A Novel ‘Gene Insertion/Marker Out’ (GIMO) Method for Transgene Expression and Gene Complementation in Rodent Malaria Parasites

PubMed Central

Sajid, Mohammed; Chevalley-Maurel, Séverine; Ramesar, Jai; Klop, Onny; Franke-Fayard, Blandine M. D.; Janse, Chris J.; Khan, Shahid M.

2011-01-01

Research on the biology of malaria parasites has greatly benefited from the application of reverse genetic technologies, in particular through the analysis of gene deletion mutants and studies on transgenic parasites that express heterologous or mutated proteins. However, transfection in Plasmodium is limited by the paucity of drug-selectable markers that hampers subsequent genetic modification of the same mutant. We report the development of a novel ‘gene insertion/marker out’ (GIMO) method for two rodent malaria parasites, which uses negative selection to rapidly generate transgenic mutants ready for subsequent modifications. We have created reference mother lines for both P. berghei ANKA and P. yoelii 17XNL that serve as recipient parasites for GIMO-transfection. Compared to existing protocols GIMO-transfection greatly simplifies and speeds up the generation of mutants expressing heterologous proteins, free of drug-resistance genes, and requires far fewer laboratory animals. In addition we demonstrate that GIMO-transfection is also a simple and fast method for genetic complementation of mutants with a gene deletion or mutation. The implementation of GIMO-transfection procedures should greatly enhance Plasmodium reverse-genetic research. PMID:22216235

P and M gene junction is the optimal insertion site in Newcastle disease virus vaccine vector for foreign gene expression

USDA-ARS?s Scientific Manuscript database

Newcastle disease virus (NDV) has been developed as a vector for vaccine and gene therapy purposes. However, the optimal insertion site for foreign gene expression remained to be determined. In the present study, we inserted the green fluorescence protein (GFP) gene into five different intergenic ...

Identification of multiple sites suitable for insertion of foreign genes in herpes simplex virus genomes.

PubMed

Morimoto, Tomomi; Arii, Jun; Akashi, Hiroomi; Kawaguchi, Yasushi

2009-03-01

Information on sites in HSV genomes at which foreign gene(s) can be inserted without disrupting viral genes or affecting properties of the parental virus are important for basic research on HSV and development of HSV-based vectors for human therapy. The intergenic region between HSV-1 UL3 and UL4 genes has been reported to satisfy the requirements for such an insertion site. The UL3 and UL4 genes are oriented toward the intergenic region and, therefore, insertion of a foreign gene(s) into the region between the UL3 and UL4 polyadenylation signals should not disrupt any viral genes or transcriptional units. HSV-1 and HSV-2 each have more than 10 additional regions structurally similar to the intergenic region between UL3 and UL4. In the studies reported here, it has been demonstrated that insertion of a reporter gene expression cassette into several of the HSV-1 and HSV-2 intergenic regions has no effect on viral growth in cell culture or virulence in mice, suggesting that these multiple intergenic regions may be suitable HSV sites for insertion of foreign genes.

Seamless editing of the chloroplast genome in plants.

PubMed

Martin Avila, Elena; Gisby, Martin F; Day, Anil

2016-07-29

Gene editing technologies enable the precise insertion of favourable mutations and performance enhancing trait genes into chromosomes whilst excluding all excess DNA from modified genomes. The technology gives rise to a new class of biotech crops which is likely to have widespread applications in agriculture. Despite progress in the nucleus, the seamless insertions of point mutations and non-selectable foreign genes into the organelle genomes of crops have not been described. The chloroplast genome is an attractive target to improve photosynthesis and crop performance. Current chloroplast genome engineering technologies for introducing point mutations into native chloroplast genes leave DNA scars, such as the target sites for recombination enzymes. Seamless editing methods to modify chloroplast genes need to address reversal of site-directed point mutations by template mediated repair with the vast excess of wild type chloroplast genomes that are present early in the transformation process. Using tobacco, we developed an efficient two-step method to edit a chloroplast gene by replacing the wild type sequence with a transient intermediate. This was resolved to the final edited gene by recombination between imperfect direct repeats. Six out of 11 transplastomic plants isolated contained the desired intermediate and at the second step this was resolved to the edited chloroplast gene in five of six plants tested. Maintenance of a single base deletion mutation in an imperfect direct repeat of the native chloroplast rbcL gene showed the limited influence of biased repair back to the wild type sequence. The deletion caused a frameshift, which replaced the five C-terminal amino acids of the Rubisco large subunit with 16 alternative residues resulting in a ~30-fold reduction in its accumulation. We monitored the process in vivo by engineering an overlapping gusA gene downstream of the edited rbcL gene. Translational coupling between the overlapping rbcL and gusA genes resulted in relatively high GUS accumulation (~0.5 % of leaf protein). Editing chloroplast genomes using transient imperfect direct repeats provides an efficient method for introducing point mutations into chloroplast genes. Moreover, we describe the first synthetic operon allowing expression of a downstream overlapping gene by translational coupling in chloroplasts. Overlapping genes provide a new mechanism for co-ordinating the translation of foreign proteins in chloroplasts.

Development and applications of transgenesis in the yellow fever mosquito, Aedes aegypti.

PubMed

Adelman, Zachary N; Jasinskiene, Nijole; James, Anthony A

2002-04-30

Transgenesis technology has been developed for the yellow fever mosquito, Aedes aegypti. Successful integration of exogenous DNA into the germline of this mosquito has been achieved with the class II transposable elements, Hermes, mariner and piggyBac. A number of marker genes, including the cinnabar(+) gene of Drosophila melanogaster, and fluorescent protein genes, can be used to monitor the insertion of these elements. The availability of multiple elements and marker genes provides a powerful set of tools to investigate basic biological properties of this vector insect, as well as the materials for developing novel, genetics-based, control strategies for the transmission of disease.

A library of MiMICs allows tagging of genes and reversible, spatial and temporal knockdown of proteins in Drosophila

PubMed Central

Nagarkar-Jaiswal, Sonal; Lee, Pei-Tseng; Campbell, Megan E; Chen, Kuchuan; Anguiano-Zarate, Stephanie; Cantu Gutierrez, Manuel; Busby, Theodore; Lin, Wen-Wen; He, Yuchun; Schulze, Karen L; Booth, Benjamin W; Evans-Holm, Martha; Venken, Koen JT; Levis, Robert W; Spradling, Allan C; Hoskins, Roger A; Bellen, Hugo J

2015-01-01

Here, we document a collection of ∼7434 MiMIC (Minos Mediated Integration Cassette) insertions of which 2854 are inserted in coding introns. They allowed us to create a library of 400 GFP-tagged genes. We show that 72% of internally tagged proteins are functional, and that more than 90% can be imaged in unfixed tissues. Moreover, the tagged mRNAs can be knocked down by RNAi against GFP (iGFPi), and the tagged proteins can be efficiently knocked down by deGradFP technology. The phenotypes associated with RNA and protein knockdown typically correspond to severe loss of function or null mutant phenotypes. Finally, we demonstrate reversible, spatial, and temporal knockdown of tagged proteins in larvae and adult flies. This new strategy and collection of strains allows unprecedented in vivo manipulations in flies for many genes. These strategies will likely extend to vertebrates. DOI: http://dx.doi.org/10.7554/eLife.05338.001 PMID:25824290

Impact of a transposon insertion in phzF2 on the specialized metabolite production and interkingdom interactions of Pseudomonas aeruginosa.

PubMed

Phelan, Vanessa V; Moree, Wilna J; Aguilar, Julieta; Cornett, Dale S; Koumoutsi, Alexandra; Noble, Suzanne M; Pogliano, Kit; Guerrero, Carlos A; Dorrestein, Pieter C

2014-05-01

In microbiology, gene disruption and subsequent experiments often center on phenotypic changes caused by one class of specialized metabolites (quorum sensors, virulence factors, or natural products), disregarding global downstream metabolic effects. With the recent development of mass spectrometry-based methods and technologies for microbial metabolomics investigations, it is now possible to visualize global production of diverse classes of microbial specialized metabolites simultaneously. Using imaging mass spectrometry (IMS) applied to the analysis of microbiology experiments, we can observe the effects of mutations, knockouts, insertions, and complementation on the interactive metabolome. In this study, a combination of IMS and liquid chromatography-tandem mass spectrometry (LC-MS/MS) was used to visualize the impact on specialized metabolite production of a transposon insertion into a Pseudomonas aeruginosa phenazine biosynthetic gene, phzF2. The disruption of phenazine biosynthesis led to broad changes in specialized metabolite production, including loss of pyoverdine production. This shift in specialized metabolite production significantly alters the metabolic outcome of an interaction with Aspergillus fumigatus by influencing triacetylfusarinine production.

Impact of a Transposon Insertion in phzF2 on the Specialized Metabolite Production and Interkingdom Interactions of Pseudomonas aeruginosa

PubMed Central

Phelan, Vanessa V.; Moree, Wilna J.; Aguilar, Julieta; Cornett, Dale S.; Koumoutsi, Alexandra; Noble, Suzanne M.; Pogliano, Kit; Guerrero, Carlos A.

2014-01-01

In microbiology, gene disruption and subsequent experiments often center on phenotypic changes caused by one class of specialized metabolites (quorum sensors, virulence factors, or natural products), disregarding global downstream metabolic effects. With the recent development of mass spectrometry-based methods and technologies for microbial metabolomics investigations, it is now possible to visualize global production of diverse classes of microbial specialized metabolites simultaneously. Using imaging mass spectrometry (IMS) applied to the analysis of microbiology experiments, we can observe the effects of mutations, knockouts, insertions, and complementation on the interactive metabolome. In this study, a combination of IMS and liquid chromatography-tandem mass spectrometry (LC-MS/MS) was used to visualize the impact on specialized metabolite production of a transposon insertion into a Pseudomonas aeruginosa phenazine biosynthetic gene, phzF2. The disruption of phenazine biosynthesis led to broad changes in specialized metabolite production, including loss of pyoverdine production. This shift in specialized metabolite production significantly alters the metabolic outcome of an interaction with Aspergillus fumigatus by influencing triacetylfusarinine production. PMID:24532776

Genetically engineered livestock for agriculture: a generation after the first transgenic animal research conference.

PubMed

Murray, James D; Maga, Elizabeth A

2016-06-01

At the time of the first Transgenic Animal Research Conference, the lack of knowledge about promoter, enhancer and coding regions of genes of interest greatly hampered our efforts to create transgenes that would express appropriately in livestock. Additionally, we were limited to gene insertion by pronuclear microinjection. As predicted then, widespread genome sequencing efforts and technological advancements have profoundly altered what we can do. There have been many developments in technology to create transgenic animals since we first met at Granlibakken in 1997, including the advent of somatic cell nuclear transfer-based cloning and gene editing. We can now create new transgenes that will express when and where we want and can target precisely in the genome where we want to make a change or insert a transgene. With the large number of sequenced genomes, we have unprecedented access to sequence information including, control regions, coding regions, and known allelic variants. These technological developments have ushered in new and renewed enthusiasm for the production of transgenic animals among scientists and animal agriculturalists around the world, both for the production of more relevant biomedical research models as well as for agricultural applications. However, even though great advancements have been made in our ability to control gene expression and target genetic changes in our animals, there still are no genetically engineered animal products on the market for food. World-wide there has been a failure of the regulatory processes to effectively move forward. Estimates suggest the world will need to increase our current food production 70 % by 2050; that is we will have to produce the total amount of food each year that has been consumed by mankind over the past 500 years. The combination of transgenic animal technology and gene editing will become increasingly more important tools to help feed the world. However, to date the practical benefits of these technologies have not yet reached consumers in any country and in the absence of predictable, science-based regulatory programs it is unlikely that the benefits will be realized in the short to medium term.

Genome-scale engineering for systems and synthetic biology

PubMed Central

Esvelt, Kevin M; Wang, Harris H

2013-01-01

Genome-modification technologies enable the rational engineering and perturbation of biological systems. Historically, these methods have been limited to gene insertions or mutations at random or at a few pre-defined locations across the genome. The handful of methods capable of targeted gene editing suffered from low efficiencies, significant labor costs, or both. Recent advances have dramatically expanded our ability to engineer cells in a directed and combinatorial manner. Here, we review current technologies and methodologies for genome-scale engineering, discuss the prospects for extending efficient genome modification to new hosts, and explore the implications of continued advances toward the development of flexibly programmable chasses, novel biochemistries, and safer organismal and ecological engineering. PMID:23340847

QuickMap: a public tool for large-scale gene therapy vector insertion site mapping and analysis.

PubMed

Appelt, J-U; Giordano, F A; Ecker, M; Roeder, I; Grund, N; Hotz-Wagenblatt, A; Opelz, G; Zeller, W J; Allgayer, H; Fruehauf, S; Laufs, S

2009-07-01

Several events of insertional mutagenesis in pre-clinical and clinical gene therapy studies have created intense interest in assessing the genomic insertion profiles of gene therapy vectors. For the construction of such profiles, vector-flanking sequences detected by inverse PCR, linear amplification-mediated-PCR or ligation-mediated-PCR need to be mapped to the host cell's genome and compared to a reference set. Although remarkable progress has been achieved in mapping gene therapy vector insertion sites, public reference sets are lacking, as are the possibilities to quickly detect non-random patterns in experimental data. We developed a tool termed QuickMap, which uniformly maps and analyzes human and murine vector-flanking sequences within seconds (available at www.gtsg.org). Besides information about hits in chromosomes and fragile sites, QuickMap automatically determines insertion frequencies in +/- 250 kb adjacency to genes, cancer genes, pseudogenes, transcription factor and (post-transcriptional) miRNA binding sites, CpG islands and repetitive elements (short interspersed nuclear elements (SINE), long interspersed nuclear elements (LINE), Type II elements and LTR elements). Additionally, all experimental frequencies are compared with the data obtained from a reference set, containing 1 000 000 random integrations ('random set'). Thus, for the first time a tool allowing high-throughput profiling of gene therapy vector insertion sites is available. It provides a basis for large-scale insertion site analyses, which is now urgently needed to discover novel gene therapy vectors with 'safe' insertion profiles.

Gene replacements and insertions in rice by intron targeting using CRISPR-Cas9.

PubMed

Li, Jun; Meng, Xiangbing; Zong, Yuan; Chen, Kunling; Zhang, Huawei; Liu, Jinxing; Li, Jiayang; Gao, Caixia

2016-09-12

Sequence-specific nucleases have been exploited to create targeted gene knockouts in various plants(1), but replacing a fragment and even obtaining gene insertions at specific loci in plant genomes remain a serious challenge. Here, we report efficient intron-mediated site-specific gene replacement and insertion approaches that generate mutations using the non-homologous end joining (NHEJ) pathway using the clustered regularly interspaced short palindromic repeats (CRISPR)-CRISPR-associated protein 9 (Cas9) system. Using a pair of single guide RNAs (sgRNAs) targeting adjacent introns and a donor DNA template including the same pair of sgRNA sites, we achieved gene replacements in the rice endogenous gene 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS) at a frequency of 2.0%. We also obtained targeted gene insertions at a frequency of 2.2% using a sgRNA targeting one intron and a donor DNA template including the same sgRNA site. Rice plants harbouring the OsEPSPS gene with the intended substitutions were glyphosate-resistant. Furthermore, the site-specific gene replacements and insertions were faithfully transmitted to the next generation. These newly developed approaches can be generally used to replace targeted gene fragments and to insert exogenous DNA sequences into specific genomic sites in rice and other plants.

A Metagenome-Wide Association Study and Arrayed Mutant Library Confirm Acetobacter Lipopolysaccharide Genes Are Necessary for Association with Drosophila melanogaster.

PubMed

White, K Makay; Matthews, Melinda K; Hughes, Rachel C; Sommer, Andrew J; Griffitts, Joel S; Newell, Peter D; Chaston, John M

2018-03-28

A metagenome wide association (MGWA) study of bacterial host association determinants in Drosophila predicted that LPS biosynthesis genes are significantly associated with host colonization. We were unable to create site-directed mutants for each of the predicted genes in Acetobacter , so we created an arrayed transposon insertion library using Acetobacter fabarum DsW_054 isolated from Drosophila Creation of the A. fabarum DsW_054 gene knock-out library was performed by combinatorial mapping and Illumina sequencing of random transposon insertion mutants. Transposon insertion locations for 6,418 mutants were successfully mapped, including hits within 63% of annotated genes in the A. fabarum DsW_054 genome. For 45/45 members of the library, insertion sites were verified by arbitrary PCR and Sanger sequencing. Mutants with insertions in four different LPS biosynthesis genes were selected from the library to validate the MGWA predictions. Insertion mutations in two genes biosynthetically upstream of Lipid-A formation, lpxC and lpxB , show significant differences in host association, whereas mutations in two genes encoding LPS biosynthesis functions downstream of Lipid-A biosynthesis had no effect. These results suggest an impact of bacterial cell surface molecules on the bacterial capacity for host association. Also, the transposon insertion mutant library will be a useful resource for ongoing research on the genetic basis for Acetobacter traits. Copyright © 2018 White et al.

Ty1-copia elements reveal diverse insertion sites linked to polymorphisms among flax (Linum usitatissimum L.) accessions.

PubMed

Galindo-González, Leonardo; Mhiri, Corinne; Grandbastien, Marie-Angèle; Deyholos, Michael K

2016-12-07

Initial characterization of the flax genome showed that Ty1-copia retrotransposons are abundant, with several members being recently inserted, and in close association with genes. Recent insertions indicate a potential for ongoing transpositional activity that can create genomic diversity among accessions, cultivars or varieties. The polymorphisms generated constitute a good source of molecular markers that may be associated with phenotype if the insertions alter gene activity. Flax, where accessions are bred mainly for seed nutritional properties or for fibers, constitutes a good model for studying the relationship of transpositional activity with diversification and breeding. In this study, we estimated copy number and used a type of transposon display known as Sequence-Specific Amplification Polymorphisms (SSAPs), to characterize six families of Ty1-copia elements across 14 flax accessions. Polymorphic insertion sites were sequenced to find insertions that could potentially alter gene expression, and a preliminary test was performed with selected genes bearing transposable element (TE) insertions. Quantification of six families of Ty1-copia elements indicated different abundances among TE families and between flax accessions, which suggested diverse transpositional histories. SSAPs showed a high level of polymorphism in most of the evaluated retrotransposon families, with a trend towards higher levels of polymorphism in low-copy number families. Ty1-copia insertion polymorphisms among cultivars allowed a general distinction between oil and fiber types, and between spring and winter types, demonstrating their utility in diversity studies. Characterization of polymorphic insertions revealed an overwhelming association with genes, with insertions disrupting exons, introns or within 1 kb of coding regions. A preliminary test on the potential transcriptional disruption by TEs of four selected genes evaluated in three different tissues, showed one case of significant impact of the insertion on gene expression. We demonstrated that specific Ty1-copia families have been active since breeding commenced in flax. The retrotransposon-derived polymorphism can be used to separate flax types, and the close association of many insertions with genes defines a good source of potential mutations that could be associated with phenotypic changes, resulting in diversification processes.

Cancer gene discovery: exploiting insertional mutagenesis

PubMed Central

Ranzani, Marco; Annunziato, Stefano; Adams, David J.; Montini, Eugenio

2013-01-01

Insertional mutagenesis has been utilized as a functional forward genetics screen for the identification of novel genes involved in the pathogenesis of human cancers. Different insertional mutagens have been successfully used to reveal new cancer genes. For example, retroviruses (RVs) are integrating viruses with the capacity to induce the deregulation of genes in the neighborhood of the insertion site. RVs have been employed for more than 30 years to identify cancer genes in the hematopoietic system and mammary gland. Similarly, another tool that has revolutionized cancer gene discovery is the cut-and-paste transposons. These DNA elements have been engineered to contain strong promoters and stop cassettes that may function to perturb gene expression upon integration proximal to genes. In addition, complex mouse models characterized by tissue-restricted activity of transposons have been developed to identify oncogenes and tumor suppressor genes that control the development of a wide range of solid tumor types, extending beyond those tissues accessible using RV-based approaches. Most recently, lentiviral vectors (LVs) have appeared on the scene for use in cancer gene screens. LVs are replication defective integrating vectors that have the advantage of being able to infect non-dividing cells, in a wide range of cell types and tissues. In this review, we describe the various insertional mutagens focusing on their advantages/limitations and we discuss the new and promising tools that will improve the insertional mutagenesis screens of the future. PMID:23928056

Site-specific recombination in the chicken genome using Flipase recombinase-mediated cassette exchange.

PubMed

Lee, Hong Jo; Lee, Hyung Chul; Kim, Young Min; Hwang, Young Sun; Park, Young Hyun; Park, Tae Sub; Han, Jae Yong

2016-02-01

Targeted genome recombination has been applied in diverse research fields and has a wide range of possible applications. In particular, the discovery of specific loci in the genome that support robust and ubiquitous expression of integrated genes and the development of genome-editing technology have facilitated rapid advances in various scientific areas. In this study, we produced transgenic (TG) chickens that can induce recombinase-mediated gene cassette exchange (RMCE), one of the site-specific recombination technologies, and confirmed RMCE in TG chicken-derived cells. As a result, we established TG chicken lines that have, Flipase (Flp) recognition target (FRT) pairs in the chicken genome, mediated by piggyBac transposition. The transgene integration patterns were diverse in each TG chicken line, and the integration diversity resulted in diverse levels of expression of exogenous genes in each tissue of the TG chickens. In addition, the replaced gene cassette was expressed successfully and maintained by RMCE in the FRT predominant loci of TG chicken-derived cells. These results indicate that targeted genome recombination technology with RMCE could be adaptable to TG chicken models and that the technology would be applicable to specific gene regulation by cis-element insertion and customized expression of functional proteins at predicted levels without epigenetic influence. © FASEB.

A Comprehensive Analysis of In Vitro and In Vivo Genetic Fitness of Pseudomonas aeruginosa Using High-Throughput Sequencing of Transposon Libraries

PubMed Central

Aschard, Hugues; Cattoir, Vincent; Yoder-Himes, Deborah; Lory, Stephen; Pier, Gerald B.

2013-01-01

High-throughput sequencing of transposon (Tn) libraries created within entire genomes identifies and quantifies the contribution of individual genes and operons to the fitness of organisms in different environments. We used insertion-sequencing (INSeq) to analyze the contribution to fitness of all non-essential genes in the chromosome of Pseudomonas aeruginosa strain PA14 based on a library of ∼300,000 individual Tn insertions. In vitro growth in LB provided a baseline for comparison with the survival of the Tn insertion strains following 6 days of colonization of the murine gastrointestinal tract as well as a comparison with Tn-inserts subsequently able to systemically disseminate to the spleen following induction of neutropenia. Sequencing was performed following DNA extraction from the recovered bacteria, digestion with the MmeI restriction enzyme that hydrolyzes DNA 16 bp away from the end of the Tn insert, and fractionation into oligonucleotides of 1,200–1,500 bp that were prepared for high-throughput sequencing. Changes in frequency of Tn inserts into the P. aeruginosa genome were used to quantify in vivo fitness resulting from loss of a gene. 636 genes had <10 sequencing reads in LB, thus defined as unable to grow in this medium. During in vivo infection there were major losses of strains with Tn inserts in almost all known virulence factors, as well as respiration, energy utilization, ion pumps, nutritional genes and prophages. Many new candidates for virulence factors were also identified. There were consistent changes in the recovery of Tn inserts in genes within most operons and Tn insertions into some genes enhanced in vivo fitness. Strikingly, 90% of the non-essential genes were required for in vivo survival following systemic dissemination during neutropenia. These experiments resulted in the identification of the P. aeruginosa strain PA14 genes necessary for optimal survival in the mucosal and systemic environments of a mammalian host. PMID:24039572

Germline Transgenic Pigs by Sleeping Beauty Transposition in Porcine Zygotes and Targeted Integration in the Pig Genome

PubMed Central

Garrels, Wiebke; Mátés, Lajos; Holler, Stephanie; Dalda, Anna; Taylor, Ulrike; Petersen, Björn; Niemann, Heiner; Izsvák, Zsuzsanna; Ivics, Zoltán; Kues, Wilfried A.

2011-01-01

Genetic engineering can expand the utility of pigs for modeling human diseases, and for developing advanced therapeutic approaches. However, the inefficient production of transgenic pigs represents a technological bottleneck. Here, we assessed the hyperactive Sleeping Beauty (SB100X) transposon system for enzyme-catalyzed transgene integration into the embryonic porcine genome. The components of the transposon vector system were microinjected as circular plasmids into the cytoplasm of porcine zygotes, resulting in high frequencies of transgenic fetuses and piglets. The transgenic animals showed normal development and persistent reporter gene expression for >12 months. Molecular hallmarks of transposition were confirmed by analysis of 25 genomic insertion sites. We demonstrate germ-line transmission, segregation of individual transposons, and continued, copy number-dependent transgene expression in F1-offspring. In addition, we demonstrate target-selected gene insertion into transposon-tagged genomic loci by Cre-loxP-based cassette exchange in somatic cells followed by nuclear transfer. Transposase-catalyzed transgenesis in a large mammalian species expands the arsenal of transgenic technologies for use in domestic animals and will facilitate the development of large animal models for human diseases. PMID:21897845

A snapshot of gene therapy in Latin America.

PubMed

Linden, Rafael; Matte, Ursula

2014-03-01

Gene therapy attempts the insertion and expression of exogenous genetic material in cells for therapeutic purposes. Conceived in the 1960s, gene therapy reached its first clinical trial at the end of the 1980s and by December 2013 around 600 genuine open clinical trials of gene therapy were registered at NIH Clinical Trials Database. Here, we summarize the current efforts towards the development of gene therapy in Latin America. Our survey shows that the number of scientists involved in the development of gene therapy and DNA vaccines in Latin America is still very low. Higher levels of investment in this technology are necessary to boost the advancement of innovation and intellectual property in this field in a way that would ease both the social and financial burden of various medical conditions in Latin America.

[Construction and expression analysis of the zebrafish heart-specific transgenetic vector based on Tol2 transposable element].

PubMed

Chen, Tingfang; Luo, Na; Xie, Huaping; Wu, Xiushan; Deng, Yun

2010-02-01

In an effort to generate a desired expression construct for making heart-specific expression transgenic zebrafish, a Tol2 plasmid, which can drive EGFP reporter gene specifically expressed in the heart, was modified using subcloning technology. An IRES fragment bearing multiple cloning site (MCS) was amplified directly from pIRES2-EGFP plasmid and was inserted between the CMLC2 promoter and EGFP fragment of the pDestTol2CG vector. This recombinant expression plasmid pTol2-CMLC2-IRES-EGFP can drive any interested gene specifically expressed in the zebrafish heart along with EGFP reporter gene. To test the effectiveness of this new expression plasmid, we constructed pTol2-CMLC2-RED-IRES-EGFP plasmid by inserting another reporter gene DsRed-Monome into MCS downstream of the CMLC2 promoter and injected this transgenic recombinant plasmid into one-cell stage embryos of zebrafish. Under fluorescence microscope, both the red fluorescence and the green fluorescence produced by pTol2-CMLC2-RED-IRES-EGFP were detected specifically in the heart tissue in the same expression pattern. This novel expression construct pTol2-CMLC2-IRES-EGFP will become an important tool for our research on identifying heart development candidate genes' function using zebrafish as a model.

cea-kil operon of the ColE1 plasmid.

PubMed Central

Sabik, J F; Suit, J L; Luria, S E

1983-01-01

We isolated a series of Tn5 transposon insertion mutants and chemically induced mutants with mutations in the region of the ColE1 plasmid that includes the cea (colicin) and imm (immunity) genes. Bacterial cells harboring each of the mutant plasmids were tested for their response to the colicin-inducing agent mitomycin C. All insertion mutations within the cea gene failed to bring about cell killing after mitomycin C treatment. A cea- amber mutation exerted a polar effect on killing by mitomycin C. Two insertions beyond the cea gene but within or near the imm gene also prevented the lethal response to mitomycin C. These findings suggest the presence in the ColE1 plasmid of an operon containing the cea and kil genes whose product is needed for mitomycin C-induced lethality. Bacteria carrying ColE1 plasmids with Tn5 inserted within the cea gene produced serologically cross-reacting fragments of the colicin E1 molecule, the lengths of which were proportional to the distance between the insertion and the promoter end of the cea gene. Images PMID:6298187

Horizontally transferred genes in the genome of Pacific white shrimp, Litopenaeus vannamei

PubMed Central

2013-01-01

Background In recent years, as the development of next-generation sequencing technology, a growing number of genes have been reported as being horizontally transferred from prokaryotes to eukaryotes, most of them involving arthropods. As a member of the phylum Arthropoda, the Pacific white shrimp Litopenaeus vannamei has to adapt to the complex water environments with various symbiotic or parasitic microorganisms, which provide a platform for horizontal gene transfer (HGT). Results In this study, we analyzed the genome-wide HGT events in L. vannamei. Through homology search and phylogenetic analysis, followed by experimental PCR confirmation, 14 genes with HGT event were identified: 12 of them were transferred from bacteria and two from fungi. Structure analysis of these genes showed that the introns of the two fungi-originated genes were substituted by shrimp DNA fragment, two genes transferred from bacteria had shrimp specific introns inserted in them. Furthermore, around other three bacteria-originated genes, there were three large DNA segments inserted into the shrimp genome. One segment was a transposon that fully transferred, and the other two segments contained only coding regions of bacteria. Functional prediction of these 14 genes showed that 6 of them might be related to energy metabolism, and 4 others related to defense of the organism. Conclusions HGT events from bacteria or fungi were happened in the genome of L. vannamei, and these horizontally transferred genes can be transcribed in shrimp. This is the first time to report the existence of horizontally transferred genes in shrimp. Importantly, most of these genes are exposed to a negative selection pressure and appeared to be functional. PMID:23914989

Gene and enhancer trap tagging of vascular-expressed genes in poplar trees

Treesearch

Andrew Groover; Joseph R. Fontana; Gayle Dupper; Caiping Ma; Robert Martienssen; Steven Strauss; Richard Meilan

2004-01-01

We report a gene discovery system for poplar trees based on gene and enhancer traps. Gene and enhancer trap vectors carrying the β-glucuronidase (GUS) reporter gene were inserted into the poplar genome via Agrobacterium tumefaciens transformation, where they reveal the expression pattern of genes at or near the insertion sites. Because GUS...

Complete genome analysis of three Acinetobacter baumannii clinical isolates in China for insight into the diversification of drug resistance elements.

PubMed

Zhu, Lingxiang; Yan, Zhongqiang; Zhang, Zhaojun; Zhou, Qiming; Zhou, Jinchun; Wakeland, Edward K; Fang, Xiangdong; Xuan, Zhenyu; Shen, Dingxia; Li, Quan-Zhen

2013-01-01

The emergence and rapid spreading of multidrug-resistant Acinetobacter baumannii strains has become a major health threat worldwide. To better understand the genetic recombination related with the acquisition of drug-resistant elements during bacterial infection, we performed complete genome analysis on three newly isolated multidrug-resistant A. baumannii strains from Beijing using next-generation sequencing technology. Whole genome comparison revealed that all 3 strains share some common drug resistant elements including carbapenem-resistant bla OXA-23 and tetracycline (tet) resistance islands, but the genome structures are diversified among strains. Various genomic islands intersperse on the genome with transposons and insertions, reflecting the recombination flexibility during the acquisition of the resistant elements. The blood-isolated BJAB07104 and ascites-isolated BJAB0868 exhibit high similarity on their genome structure with most of the global clone II strains, suggesting these two strains belong to the dominant outbreak strains prevalent worldwide. A large resistance island (RI) of about 121-kb, carrying a cluster of resistance-related genes, was inserted into the ATPase gene on BJAB07104 and BJAB0868 genomes. A 78-kb insertion element carrying tra-locus and bla OXA-23 island, can be either inserted into one of the tniB gene in the 121-kb RI on the chromosome, or transformed to conjugative plasmid in the two BJAB strains. The third strains of this study, BJAB0715, which was isolated from spinal fluid, exhibit much more divergence compared with above two strains. It harbors multiple drug-resistance elements including a truncated AbaR-22-like RI on its genome. One of the unique features of this strain is that it carries both bla OXA-23 and bla OXA-58 genes on its genome. Besides, an Acinetobacter lwoffii adeABC efflux element was found inserted into the ATPase position in BJAB0715. Our comparative analysis on currently completed Acinetobacter baumannii genomes revealed extensive and dynamic genome organizations, which may facilitate the bacteria to acquire drug-resistance elements into their genomes.

A non-canonical transferred DNA insertion at the BRI1 locus in Arabidopsis thaliana.

PubMed

Zhao, Zhong; Zhu, Yan; Erhardt, Mathieu; Ruan, Ying; Shen, Wen-Hui

2009-04-01

Agrobacterium-mediated transformation is widely used in transgenic plant engineering and has been proven to be a powerful tool for insertional mutagenesis of the plant genome. The transferred DNA (T-DNA) from Agrobacterium is integrated into the plant genome through illegitimate recombination between the T-DNA and the plant DNA. Contrasting to the canonical insertion, here we report on a locus showing a complex mutation associated with T-DNA insertion at the BRI1 gene in Arabidopsis thaliana. We obtained a mutant line, named salade for its phenotype of dwarf stature and proliferating rosette. Molecular characterization of this mutant revealed that in addition to T-DNA a non-T-DNA-localized transposon from bacteria was inserted in the Arabidopsis genome and that a region of more than 11.5 kb of the Arabidopsis genome was deleted at the insertion site. The deleted region contains the brassinosteroid receptor gene BRI1 and the transcription factor gene WRKY13. Our finding reveals non-canonical T-DNA insertion, implicating horizontal gene transfer and cautioning the use of T-DNA as mutagen in transgenic research.

Frequency of a natural truncated allele of MdMLO19 in the germplasm of Malus domestica.

PubMed

Pessina, Stefano; Palmieri, Luisa; Bianco, Luca; Gassmann, Jennifer; van de Weg, Eric; Visser, Richard G F; Magnago, Pierluigi; Schouten, Henk J; Bai, Yuling; Riccardo Velasco, R; Malnoy, Mickael

2017-01-01

Podosphaera leucotricha is the causal agent of powdery mildew (PM) in apple. To reduce the amount of fungicides required to control this pathogen, the development of resistant apple cultivars should become a priority. Resistance to PM was achieved in various crops by knocking out specific members of the MLO gene family that are responsible for PM susceptibility (S-genes). In apple, the knockdown of MdMLO19 resulted in PM resistance. However, since gene silencing technologies such as RNAi are perceived unfavorably in Europe, a different approach that exploits this type of resistance is needed. This work evaluates the presence of non-functional naturally occurring alleles of MdMLO19 in apple germplasm. The screening of the re-sequencing data of 63 apple individuals led to the identification of 627 single nucleotide polymorphisms (SNPs) in five MLO genes ( MdMLO5, MdMLO7, MdMLO11, MdMLO18 , and MdMLO19 ), 127 of which were located in exons. The T-1201 insertion of a single nucleotide in MdMLO19 caused the formation of an early stop codon, resulting in a truncated protein lacking 185 amino acids, including the calmodulin-binding domain. The presence of the insertion was evaluated in 115 individuals. It was heterozygous in 64 and homozygous in 25. Twelve of the 25 individuals carrying the insertion in homozygosity were susceptible to PM. After barley, pea, cucumber, and tomato, apple would be the fifth species for which a natural non-functional mlo allele has been found.

A snapshot of gene therapy in Latin America

PubMed Central

Linden, Rafael; Matte, Ursula

2014-01-01

Gene therapy attempts the insertion and expression of exogenous genetic material in cells for therapeutic purposes. Conceived in the 1960s, gene therapy reached its first clinical trial at the end of the 1980s and by December 2013 around 600 genuine open clinical trials of gene therapy were registered at NIH Clinical Trials Database. Here, we summarize the current efforts towards the development of gene therapy in Latin America. Our survey shows that the number of scientists involved in the development of gene therapy and DNA vaccines in Latin America is still very low. Higher levels of investment in this technology are necessary to boost the advancement of innovation and intellectual property in this field in a way that would ease both the social and financial burden of various medical conditions in Latin America. PMID:24764763

Genome-Wide Spectra of Transcription Insertions and Deletions Reveal That Slippage Depends on RNA:DNA Hybrid Complementarity.

PubMed

Traverse, Charles C; Ochman, Howard

2017-08-29

Advances in sequencing technologies have enabled direct quantification of genome-wide errors that occur during RNA transcription. These errors occur at rates that are orders of magnitude higher than rates during DNA replication, but due to technical difficulties such measurements have been limited to single-base substitutions and have not yet quantified the scope of transcription insertions and deletions. Previous reporter gene assay findings suggested that transcription indels are produced exclusively by elongation complex slippage at homopolymeric runs, so we enumerated indels across the protein-coding transcriptomes of Escherichia coli and Buchnera aphidicola , which differ widely in their genomic base compositions and incidence of repeat regions. As anticipated from prior assays, transcription insertions prevailed in homopolymeric runs of A and T; however, transcription deletions arose in much more complex sequences and were rarely associated with homopolymeric runs. By reconstructing the relocated positions of the elongation complex as inferred from the sequences inserted or deleted during transcription, we show that continuation of transcription after slippage hinges on the degree of nucleotide complementarity within the RNA:DNA hybrid at the new DNA template location. IMPORTANCE The high level of mistakes generated during transcription can result in the accumulation of malfunctioning and misfolded proteins which can alter global gene regulation and in the expenditure of energy to degrade these nonfunctional proteins. The transcriptome-wide occurrence of base substitutions has been elucidated in bacteria, but information on transcription insertions and deletions-errors that potentially have more dire effects on protein function-is limited to reporter gene constructs. Here, we capture the transcriptome-wide spectrum of insertions and deletions in Escherichia coli and Buchnera aphidicola and show that they occur at rates approaching those of base substitutions. Knowledge of the full extent of sequences subject to transcription indels supports a new model of bacterial transcription slippage, one that relies on the number of complementary bases between the transcript and the DNA template to which it slipped. Copyright © 2017 Traverse and Ochman.

Adapting Strategic Aircraft Assets to a Changing World: Technology Insertion to Provide Flexibility

DTIC Science & Technology

1994-09-01

Distributed Processing ............................ 67 Unembedded Expansions ............................ 71 Concepts for, and Impacts on, Preflight...capabilities through the use of unembedded expansions to the existing avionics complex. But, before we explore these technology insertion concepts, we must... Unembedded Expansions The final hardware technology insertion area focuses on the concept of expanding the aircraft’s capabilities by inserting, or perhaps

Transposon insertion libraries for the characterization of mutants from the kiwifruit pathogen Pseudomonas syringae pv. actinidiae

PubMed Central

Mesarich, Carl H.; Rees-George, Jonathan; Gardner, Paul P.; Ghomi, Fatemeh Ashari; Gerth, Monica L.; Andersen, Mark T.; Rikkerink, Erik H. A.; Fineran, Peter C.

2017-01-01

Pseudomonas syringae pv. actinidiae (Psa), the causal agent of kiwifruit canker, is one of the most devastating plant diseases of recent times. We have generated two mini-Tn5-based random insertion libraries of Psa ICMP 18884. The first, a ‘phenotype of interest’ (POI) library, consists of 10,368 independent mutants gridded into 96-well plates. By replica plating onto selective media, the POI library was successfully screened for auxotrophic and motility mutants. Lipopolysaccharide (LPS) biosynthesis mutants with ‘Fuzzy-Spreader’-like morphologies were also identified through a visual screen. The second, a ‘mutant of interest’ (MOI) library, comprises around 96,000 independent mutants, also stored in 96-well plates, with approximately 200 individuals per well. The MOI library was sequenced on the Illumina MiSeq platform using Transposon-Directed Insertion site Sequencing (TraDIS) to map insertion sites onto the Psa genome. A grid-based PCR method was developed to recover individual mutants, and using this strategy, the MOI library was successfully screened for a putative LPS mutant not identified in the visual screen. The Psa chromosome and plasmid had 24,031 and 1,236 independent insertion events respectively, giving insertion frequencies of 3.65 and 16.6 per kb respectively. These data suggest that the MOI library is near saturation, with the theoretical probability of finding an insert in any one chromosomal gene estimated to be 97.5%. However, only 47% of chromosomal genes had insertions. This surprisingly low rate cannot be solely explained by the lack of insertions in essential genes, which would be expected to be around 5%. Strikingly, many accessory genes, including most of those encoding type III effectors, lacked insertions. In contrast, 94% of genes on the Psa plasmid had insertions, including for example, the type III effector HopAU1. These results suggest that some chromosomal sites are rendered inaccessible to transposon insertion, either by DNA-binding proteins or by the architecture of the nucleoid. PMID:28249011

The Hairless Stem Phenotype of Cotton (Gossypium barbadense) Is Linked to a Copia-Like Retrotransposon Insertion in a Homeodomain-Leucine Zipper Gene (HD1)

PubMed Central

Ding, Mingquan; Ye, Wuwei; Lin, Lifeng; He, Shae; Du, Xiongming; Chen, Aiqun; Cao, Yuefen; Qin, Yuan; Yang, Fen; Jiang, Yurong; Zhang, Hua; Wang, Xiyin; Paterson, Andrew H.; Rong, Junkang

2015-01-01

Cotton (Gossypium) stem trichomes are mostly single cells that arise from stem epidermal cells. In this study, a homeodomain-leucine zipper gene (HD1) was found to cosegregate with the dominant trichome locus previously designated as T1 and mapped to chromosome 6. Characterization of HD1 orthologs revealed that the absence of stem trichomes in modern Gossypium barbadense varieties is linked to a large retrotransposon insertion in the ninth exon, 2565 bp downstream from the initial codon in the At subgenome HD1 gene (At-GbHD1). In both the At and Dt subgenomes, reduced transcription of GbHD1 genes is caused by this insertion. The disruption of At-HD1 further affects the expression of downstream GbMYB25 and GbHOX3 genes. Analyses of primitive cultivated accessions identified another retrotransposon insertion event in the sixth exon of At-GbHD1 that might predate the previously identified retrotransposon in modern varieties. Although both retrotransposon insertions results in similar phenotypic changes, the timing of these two retrotransposon insertion events fits well with our current understanding of the history of cotton speciation and dispersal. Taken together, the results of genetics mapping, gene expression and association analyses suggest that GbHD1 is an important component that controls stem trichome development and is a promising candidate gene for the T1 locus. The interspecific phenotypic difference in stem trichome traits also may be attributable to HD1 inactivation associated with retrotransposon insertion. PMID:26133897

Advancing chimeric antigen receptor T cell therapy with CRISPR/Cas9.

PubMed

Ren, Jiangtao; Zhao, Yangbing

2017-09-01

The clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR-associated 9 (CRISPR/Cas9) system, an RNA-guided DNA targeting technology, is triggering a revolution in the field of biology. CRISPR/Cas9 has demonstrated great potential for genetic manipulation. In this review, we discuss the current development of CRISPR/Cas9 technologies for therapeutic applications, especially chimeric antigen receptor (CAR) T cell-based adoptive immunotherapy. Different methods used to facilitate efficient CRISPR delivery and gene editing in T cells are compared. The potential of genetic manipulation using CRISPR/Cas9 system to generate universal CAR T cells and potent T cells that are resistant to exhaustion and inhibition is explored. We also address the safety concerns associated with the use of CRISPR/Cas9 gene editing and provide potential solutions and future directions of CRISPR application in the field of CAR T cell immunotherapy. As an integration-free gene insertion method, CRISPR/Cas9 holds great promise as an efficient gene knock-in platform. Given the tremendous progress that has been made in the past few years, we believe that the CRISPR/Cas9 technology holds immense promise for advancing immunotherapy.

De novo insertion of an intron into the mammalian sex determining gene, SRY

PubMed Central

O’Neill, Rachel J. Waugh; Brennan, Francine E.; Delbridge, Margaret L.; Crozier, Ross H.; Graves, Jennifer A. Marshall

1998-01-01

Two theories have been proposed to explain the evolution of introns within eukaryotic genes. The introns early theory, or “exon theory of genes,” proposes that introns are ancient and that recombination within introns provided new exon structure, and thus new genes. The introns late theory, or “insertional theory of introns,” proposes that ancient genes existed as uninterrupted exons and that introns have been introduced during the course of evolution. There is still controversy as to how intron–exon structure evolved and whether the majority of introns are ancient or novel. Although there is extensive evidence in support of the introns early theory, phylogenetic comparisons of several genes indicate recent gain and loss of introns within these genes. However, no example has been shown of a protein coding gene, intronless in its ancestral form, which has acquired an intron in a derived form. The mammalian sex determining gene, SRY, is intronless in all mammals studied to date, as is the gene from which it recently evolved. However, we report here comparisons of genomic and cDNA sequences that now provide evidence of a de novo insertion of an intron into the SRY gene of dasyurid marsupials. This recently (approximately 45 million years ago) inserted sequence is not homologous with known transposable elements. Our data demonstrate that introns may be inserted as spliced units within a developmentally crucial gene without disrupting its function. PMID:9465071

CRISPR/Cas9-Mediated Knockin Application in Cell Therapy: A Non-viral Procedure for Bystander Treatment of Glioma in Mice.

PubMed

Meca-Cortés, Oscar; Guerra-Rebollo, Marta; Garrido, Cristina; Borrós, Salvador; Rubio, Nuria; Blanco, Jeronimo

2017-09-15

The use of non-viral procedures, together with CRISPR/Cas9 genome-editing technology, allows the insertion of single-copy therapeutic genes at pre-determined genomic sites, overcoming safety limitations resulting from random gene insertions of viral vectors with potential for genome damage. In this study, we demonstrate that combination of non-viral gene delivery and CRISPR/Cas9-mediated knockin via homology-directed repair can replace the use of viral vectors for the generation of genetically modified therapeutic cells. We custom-modified human adipose mesenchymal stem cells (hAMSCs), using electroporation as a transfection method and CRISPR/Cas9-mediated knockin for the introduction and stable expression of a 3 kb DNA fragment including the eGFP (selectable marker) and a variant of the herpes simplex virus 1 thymidine kinase genes (therapeutic gene), under the control of the human elongation factor 1 alpha promoter in exon 5 of the endogenous thymidine kinase 2 gene. Using a U87 glioma model in SCID mice, we show that the therapeutic capacity of the new CRISPR/Cas9-engineered hAMSCs is equivalent to that of therapeutic hAMSCs generated by introduction of the same therapeutic gene by transduction with a lentiviral vector previously published by our group. This strategy should be of general use to other applications requiring genetic modification of therapeutic cells. Copyright © 2017 The Author(s). Published by Elsevier Inc. All rights reserved.

RNA Interference in the Age of CRISPR: Will CRISPR Interfere with RNAi?

PubMed Central

Unniyampurath, Unnikrishnan; Pilankatta, Rajendra; Krishnan, Manoj N.

2016-01-01

The recent emergence of multiple technologies for modifying gene structure has revolutionized mammalian biomedical research and enhanced the promises of gene therapy. Over the past decade, RNA interference (RNAi) based technologies widely dominated various research applications involving experimental modulation of gene expression at the post-transcriptional level. Recently, a new gene editing technology, Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR) and the CRISPR-associated protein 9 (Cas9) (CRISPR/Cas9) system, has received unprecedented acceptance in the scientific community for a variety of genetic applications. Unlike RNAi, the CRISPR/Cas9 system is bestowed with the ability to introduce heritable precision insertions and deletions in the eukaryotic genome. The combination of popularity and superior capabilities of CRISPR/Cas9 system raises the possibility that this technology may occupy the roles currently served by RNAi and may even make RNAi obsolete. We performed a comparative analysis of the technical aspects and applications of the CRISPR/Cas9 system and RNAi in mammalian systems, with the purpose of charting out a predictive picture on whether the CRISPR/Cas9 system will eclipse the existence and future of RNAi. The conclusion drawn from this analysis is that RNAi will still occupy specific domains of biomedical research and clinical applications, under the current state of development of these technologies. However, further improvements in CRISPR/Cas9 based technology may ultimately enable it to dominate RNAi in the long term. PMID:26927085

RNA Interference in the Age of CRISPR: Will CRISPR Interfere with RNAi?

PubMed

Unniyampurath, Unnikrishnan; Pilankatta, Rajendra; Krishnan, Manoj N

2016-02-26

The recent emergence of multiple technologies for modifying gene structure has revolutionized mammalian biomedical research and enhanced the promises of gene therapy. Over the past decade, RNA interference (RNAi) based technologies widely dominated various research applications involving experimental modulation of gene expression at the post-transcriptional level. Recently, a new gene editing technology, Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR) and the CRISPR-associated protein 9 (Cas9) (CRISPR/Cas9) system, has received unprecedented acceptance in the scientific community for a variety of genetic applications. Unlike RNAi, the CRISPR/Cas9 system is bestowed with the ability to introduce heritable precision insertions and deletions in the eukaryotic genome. The combination of popularity and superior capabilities of CRISPR/Cas9 system raises the possibility that this technology may occupy the roles currently served by RNAi and may even make RNAi obsolete. We performed a comparative analysis of the technical aspects and applications of the CRISPR/Cas9 system and RNAi in mammalian systems, with the purpose of charting out a predictive picture on whether the CRISPR/Cas9 system will eclipse the existence and future of RNAi. The conclusion drawn from this analysis is that RNAi will still occupy specific domains of biomedical research and clinical applications, under the current state of development of these technologies. However, further improvements in CRISPR/Cas9 based technology may ultimately enable it to dominate RNAi in the long term.

Generation and validation of homozygous fluorescent knock-in cells using CRISPR-Cas9 genome editing.

PubMed

Koch, Birgit; Nijmeijer, Bianca; Kueblbeck, Moritz; Cai, Yin; Walther, Nike; Ellenberg, Jan

2018-06-01

Gene tagging with fluorescent proteins is essential for investigations of the dynamic properties of cellular proteins. CRISPR-Cas9 technology is a powerful tool for inserting fluorescent markers into all alleles of the gene of interest (GOI) and allows functionality and physiological expression of the fusion protein. It is essential to evaluate such genome-edited cell lines carefully in order to preclude off-target effects caused by (i) incorrect insertion of the fluorescent protein, (ii) perturbation of the fusion protein by the fluorescent proteins or (iii) nonspecific genomic DNA damage by CRISPR-Cas9. In this protocol, we provide a step-by-step description of our systematic pipeline to generate and validate homozygous fluorescent knock-in cell lines.We have used the paired Cas9D10A nickase approach to efficiently insert tags into specific genomic loci via homology-directed repair (HDR) with minimal off-target effects. It is time-consuming and costly to perform whole-genome sequencing of each cell clone to check for spontaneous genetic variations occurring in mammalian cell lines. Therefore, we have developed an efficient validation pipeline of the generated cell lines consisting of junction PCR, Southern blotting analysis, Sanger sequencing, microscopy, western blotting analysis and live-cell imaging for cell-cycle dynamics. This protocol takes between 6 and 9 weeks. With this protocol, up to 70% of the targeted genes can be tagged homozygously with fluorescent proteins, thus resulting in physiological levels and phenotypically functional expression of the fusion proteins.

“Agrolistic” transformation of plant cells: Integration of T-strands generated in planta

PubMed Central

Hansen, Geneviève; Chilton, Mary-Dell

1996-01-01

We describe a novel plant transformation technique, termed “agrolistic,” that combines the advantages of the Agrobacterium transformation system with the high efficiency of biolistic DNA delivery. Agrolistic transformation allows integration of the gene of interest without undesired vector sequence. The virulence genes virD1 and virD2 from Agrobacterium tumefaciens that are required in bacteria for excision of T-strands from the tumor-inducing plasmid were placed under the control of the CaMV35S promoter and codelivered with a target plasmid containing border sequences flanking the gene of interest. Transient expression assays in tobacco and in maize cells indicated that vir gene products caused strand-specific nicking in planta at the right border sequence, similar to VirD1/VirD2-catalyzed T-strand excision observed in Agrobacterium. Agrolistically transformed tobacco calli were obtained after codelivery of virD1 and virD2 genes together with a selectable marker flanked by border sequences. Some inserts exhibited right junctions with plant DNA that corresponded precisely to the sequence expected for T-DNA (portion of the tumor-inducing plasmid that is transferred to plant cells) insertion events. We designate these as “agrolistic” inserts, as distinguished from “biolistic” inserts. Both types of inserts were found in some transformed lines. The frequency of agrolistic inserts was 20% that of biolistic inserts. PMID:8962167

Designing deep sequencing experiments: detecting structural variation and estimating transcript abundance.

PubMed

Bashir, Ali; Bansal, Vikas; Bafna, Vineet

2010-06-18

Massively parallel DNA sequencing technologies have enabled the sequencing of several individual human genomes. These technologies are also being used in novel ways for mRNA expression profiling, genome-wide discovery of transcription-factor binding sites, small RNA discovery, etc. The multitude of sequencing platforms, each with their unique characteristics, pose a number of design challenges, regarding the technology to be used and the depth of sequencing required for a particular sequencing application. Here we describe a number of analytical and empirical results to address design questions for two applications: detection of structural variations from paired-end sequencing and estimating mRNA transcript abundance. For structural variation, our results provide explicit trade-offs between the detection and resolution of rearrangement breakpoints, and the optimal mix of paired-read insert lengths. Specifically, we prove that optimal detection and resolution of breakpoints is achieved using a mix of exactly two insert library lengths. Furthermore, we derive explicit formulae to determine these insert length combinations, enabling a 15% improvement in breakpoint detection at the same experimental cost. On empirical short read data, these predictions show good concordance with Illumina 200 bp and 2 Kbp insert length libraries. For transcriptome sequencing, we determine the sequencing depth needed to detect rare transcripts from a small pilot study. With only 1 Million reads, we derive corrections that enable almost perfect prediction of the underlying expression probability distribution, and use this to predict the sequencing depth required to detect low expressed genes with greater than 95% probability. Together, our results form a generic framework for many design considerations related to high-throughput sequencing. We provide software tools http://bix.ucsd.edu/projects/NGS-DesignTools to derive platform independent guidelines for designing sequencing experiments (amount of sequencing, choice of insert length, mix of libraries) for novel applications of next generation sequencing.

Metabolism and gene polymorphisms of the folate pathway in Brazilian women with history of recurrent abortion.

PubMed

Boas, Wendell Vilas; Gonçalves, Rozana Oliveira; Costa, Olívia Lúcia Nunes; Goncalves, Marilda Souza

2015-02-01

To investigate the association between polymorphisms in genes that encode enzymes involved in folate- and vitamin B12-dependent homocysteine metabolism and recurrent spontaneous abortion (RSA). We investigated the C677T and A1298C polymorphisms of the methylenetetrahydrofalate reductase gene (MTHFR), the A2756G polymorphism of the methionine synthase gene (MS) and the 844ins68 insertion of the cystathionine beta synthetase gene (CBS). The PCR technique followed by RFLP was used to assess the polymorphisms; the serum levels of homocysteine, vitamin B12 and folate were investigated by chemiluminescence. The EPI Info Software version 6.04 was used for statistical analysis. Parametric variables were compared by Student's t-test and nonparametric variables by the Wilcoxon rank sum test. The frequencies of gene polymorphisms in 89 women with a history of idiopathic recurrent miscarriage and 150 controls were 19.1 and 19.6% for the C677T, insertion, 20.8 and 26% for the A1298C insertion, 14.2 and 21.9% for the A2756G insertion, and 16.4 and 18% for the 844ins68 insertion, respectively. There were no significant differences between case and control groups in any of the gene polymorphisms investigated. However, the frequency of the 844ins68 insertion in the CBS gene was higher among women with a history of loss during the third trimester of pregnancy (p=0.003). Serum homocysteine, vitamin B12 and folate levels id not differ between the polymorphisms studied in the case and control groups. However, linear regression analysis showed a dependence of serum folate levels on the maintenance of tHcy levels. The investigated gene polymorphisms and serum homocysteine, vitamin B12 and folate levels were not associated with idiopathic recurrent miscarriage in the present study. Further investigations are needed in order to confirm the role of the CBS 844ins68 insertion in recurrent miscarriage.

MMTV insertional mutagenesis identifies genes, gene families and pathways involved in mammary cancer.

PubMed

Theodorou, Vassiliki; Kimm, Melanie A; Boer, Mandy; Wessels, Lodewyk; Theelen, Wendy; Jonkers, Jos; Hilkens, John

2007-06-01

We performed a high-throughput retroviral insertional mutagenesis screen in mouse mammary tumor virus (MMTV)-induced mammary tumors and identified 33 common insertion sites, of which 17 genes were previously not known to be associated with mammary cancer and 13 had not previously been linked to cancer in general. Although members of the Wnt and fibroblast growth factors (Fgf) families were frequently tagged, our exhaustive screening for MMTV insertion sites uncovered a new repertoire of candidate breast cancer oncogenes. We validated one of these genes, Rspo3, as an oncogene by overexpression in a p53-deficient mammary epithelial cell line. The human orthologs of the candidate oncogenes were frequently deregulated in human breast cancers and associated with several tumor parameters. Computational analysis of all MMTV-tagged genes uncovered specific gene families not previously associated with cancer and showed a significant overrepresentation of protein domains and signaling pathways mainly associated with development and growth factor signaling. Comparison of all tagged genes in MMTV and Moloney murine leukemia virus-induced malignancies showed that both viruses target mostly different genes that act predominantly in distinct pathways.

Expression of a putative dioxygenase gene adjacent to an insertion mutation is involved in the short internodes of columnar apples (Malus × domestica).

PubMed

Okada, Kazuma; Wada, Masato; Moriya, Shigeki; Katayose, Yuichi; Fujisawa, Hiroko; Wu, Jianzhong; Kanamori, Hiroyuki; Kurita, Kanako; Sasaki, Harumi; Fujii, Hiroshi; Terakami, Shingo; Iwanami, Hiroshi; Yamamoto, Toshiya; Abe, Kazuyuki

2016-11-01

Determining the molecular mechanism of fruit tree architecture is important for tree management and fruit production. An apple mutant 'McIntosh Wijcik', which was discovered as a bud mutation from 'McIntosh', exhibits a columnar growth phenotype that is controlled by a single dominant gene, Co. In this study, the mutation and the Co gene were analyzed. Fine mapping narrowed the Co region to a 101 kb region. Sequence analysis of the Co region and the original wild-type co region identified an insertion mutation of an 8202 bp long terminal repeat (LTR) retroposon in the Co region. Segregation analysis using a DNA marker based on the insertion polymorphism showed that the LTR retroposon was closely associated with the columnar growth phenotype. RNA-seq and RT-PCR analysis identified a promising Co candidate gene (91071-gene) within the Co region that is specifically expressed in 'McIntosh Wijcik' but not in 'McIntosh'. The 91071-gene was located approximately 16 kb downstream of the insertion mutation and is predicted to encode a 2-oxoglutarate-dependent dioxygenase involved in an unknown reaction. Overexpression of the 91071-gene in transgenic tobaccos and apples resulted in phenotypes with short internodes, like columnar apples. These data suggested that the 8202 bp retroposon insertion in 'McIntosh Wijcik' is associated with the short internodes of the columnar growth phenotype via upregulated expression of the adjacent 91071-gene. Furthermore, the DNA marker based on the insertion polymorphism could be useful for the marker-assisted selection of columnar apples.

Sorting genomes by reciprocal translocations, insertions, and deletions.

PubMed

Qi, Xingqin; Li, Guojun; Li, Shuguang; Xu, Ying

2010-01-01

The problem of sorting by reciprocal translocations (abbreviated as SBT) arises from the field of comparative genomics, which is to find a shortest sequence of reciprocal translocations that transforms one genome Pi into another genome Gamma, with the restriction that Pi and Gamma contain the same genes. SBT has been proved to be polynomial-time solvable, and several polynomial algorithms have been developed. In this paper, we show how to extend Bergeron's SBT algorithm to include insertions and deletions, allowing to compare genomes containing different genes. In particular, if the gene set of Pi is a subset (or superset, respectively) of the gene set of Gamma, we present an approximation algorithm for transforming Pi into Gamma by reciprocal translocations and deletions (insertions, respectively), providing a sorting sequence with length at most OPT + 2, where OPT is the minimum number of translocations and deletions (insertions, respectively) needed to transform Pi into Gamma; if Pi and Gamma have different genes but not containing each other, we give a heuristic to transform Pi into Gamma by a shortest sequence of reciprocal translocations, insertions, and deletions, with bounds for the length of the sorting sequence it outputs. At a conceptual level, there is some similarity between our algorithm and the algorithm developed by El Mabrouk which is used to sort two chromosomes with different gene contents by reversals, insertions, and deletions.

Establishment of an Arbitrary PCR for Rapid Identification of Tn917 Insertion Sites in Staphylococcus epidermidis: Characterization of Biofilm-Negative and Nonmucoid Mutants

PubMed Central

Knobloch, Johannes K.-M.; Nedelmann, Max; Kiel, Kathrin; Bartscht, Katrin; Horstkotte, Matthias A.; Dobinsky, Sabine; Rohde, Holger; Mack, Dietrich

2003-01-01

Transposon mutagenesis with the Enterococcus faecalis transposon Tn917 is a genetic approach frequently used to identify genes related with specific phenotypes in gram-positive bacteria. We established an arbitrary PCR for the rapid and easy identification of Tn917 insertion sites in Staphylococcus epidermidis with six independent, well-characterized biofilm-negative Tn917 transposon mutants, which were clustered in the icaADBC gene locus or harbor Tn917 in the regulatory gene rsbU. For all six of these mutants, short chromosomal DNA fragments flanking both transposon ends could be amplified. All fragments were sufficient to correctly identify the Tn917 insertion sites in the published S. epidermidis genomes. By using this technique, the Tn917 insertion sites of three not-yet-characterized biofilm-negative or nonmucoid mutants were identified. In the biofilm-negative and nonmucoid mutant M12, Tn917 is inserted into a gene homologous to the regulatory gene purR of Bacillus subtilis and Staphylococcus aureus. The Tn917 insertions of the nonmucoid but biofilm-positive mutants M16 and M20 are located in genes homologous to components of the phosphoenolpyruvate-sugar phosphotransferase system (PTS) of B. subtilis, S. aureus, and Staphylococcus carnosus, indicating an influence of the PTS on the mucoid phenotype in S. epidermidis. PMID:14532029

New bioinformatic tool for quick identification of functionally relevant endogenous retroviral inserts in human genome.

PubMed

Garazha, Andrew; Ivanova, Alena; Suntsova, Maria; Malakhova, Galina; Roumiantsev, Sergey; Zhavoronkov, Alex; Buzdin, Anton

2015-01-01

Endogenous retroviruses (ERVs) and LTR retrotransposons (LRs) occupy ∼8% of human genome. Deep sequencing technologies provide clues to understanding of functional relevance of individual ERVs/LRs by enabling direct identification of transcription factor binding sites (TFBS) and other landmarks of functional genomic elements. Here, we performed the genome-wide identification of human ERVs/LRs containing TFBS according to the ENCODE project. We created the first interactive ERV/LRs database that groups the individual inserts according to their familial nomenclature, number of mapped TFBS and divergence from their consensus sequence. Information on any particular element can be easily extracted by the user. We also created a genome browser tool, which enables quick mapping of any ERV/LR insert according to genomic coordinates, known human genes and TFBS. These tools can be used to easily explore functionally relevant individual ERV/LRs, and for studying their impact on the regulation of human genes. Overall, we identified ∼110,000 ERV/LR genomic elements having TFBS. We propose a hypothesis of "domestication" of ERV/LR TFBS by the genome milieu including subsequent stages of initial epigenetic repression, partial functional release, and further mutation-driven reshaping of TFBS in tight coevolution with the enclosing genomic loci.

The Ad5 [E1-, E2b-]-based vector: a new and versatile gene delivery platform

NASA Astrophysics Data System (ADS)

Jones, Frank R.; Gabitzsch, Elizabeth S.; Balint, Joseph P.

2015-05-01

Based upon advances in gene sequencing and construction, it is now possible to identify specific genes or sequences thereof for gene delivery applications. Recombinant adenovirus serotype-5 (Ad5) viral vectors have been utilized in the settings of gene therapy, vaccination, and immunotherapy but have encountered clinical challenges because they are recognized as foreign entities to the host. This recognition leads to an immunologic clearance of the vector that contains the inserted gene of interest and prevents effective immunization(s). We have reported on a new Ad5-based viral vector technology that can be utilized as an immunization modality to induce immune responses even in the presence of Ad5 vector immunity. We have reported successful immunization and immunotherapy results to infectious diseases and cancers. This improved recombinant viral platform (Ad5 [E1-, E2b-]) can now be utilized in the development of multiple vaccines and immunotherapies.

[The Russian gene pool: gene geography of Alu-insertions (ACE, APOA1, B65, PV92 TPA25)].

PubMed

Solov'eva, D S; Balanovskaia, E V; Kuznetsova, M A; Vasinskaia, O A; Frolova, S A; Pocheshkhova, E A; Evseeva, I V; Boldyreva, M N; Balanovskiĭ, O P

2010-01-01

The analysis of five Alu insertion loci (ACE, AP4OA1, B65, PV92, TPA25) has been carried out for the first time in 10 Russian populations (1088 individuals), covered all parts of historical area of the Russian ethnos. Depending on locus, Russian populations exhibit similarity with their western (European populations) or with the eastern (populations of the Ural region) neighbors. Considering frequencies of the studied Alu-insertions, Russian gene pool exhibits low variation: average difference between populations is d = 0.007, whereas on classical markers, mtDNA and Y chromosome heterogeneity of Russian gene pool is essentially higher (0.013, 0.033 and 0.142 respectively). Therefore, this set of five Alu insertions has lower variability on the intra-ethnic level. However in inter-ethnic comparisons the clear pattern was obtained: 13 Eastern European ethnic groups formed three clusters, according with their historical and geographical position--East Slavic, Caucasian and South Ural clusters. The obtained data confirms efficiency of using Alu insertions for studying genetic differentiation and history of a gene pool of the Eastern European populations.

Zinc-finger nuclease-mediated targeted insertion of reporter genes for quantitative imaging of gene expression in sea urchin embryos

PubMed Central

Ochiai, Hiroshi; Sakamoto, Naoaki; Fujita, Kazumasa; Nishikawa, Masatoshi; Suzuki, Ken-ichi; Matsuura, Shinya; Miyamoto, Tatsuo; Sakuma, Tetsushi; Shibata, Tatsuo; Yamamoto, Takashi

2012-01-01

To understand complex biological systems, such as the development of multicellular organisms, it is important to characterize the gene expression dynamics. However, there is currently no universal technique for targeted insertion of reporter genes and quantitative imaging in multicellular model systems. Recently, genome editing using zinc-finger nucleases (ZFNs) has been reported in several models. ZFNs consist of a zinc-finger DNA-binding array with the nuclease domain of the restriction enzyme FokI and facilitate targeted transgene insertion. In this study, we successfully inserted a GFP reporter cassette into the HpEts1 gene locus of the sea urchin, Hemicentrotus pulcherrimus. We achieved this insertion by injecting eggs with a pair of ZFNs for HpEts1 with a targeting donor construct that contained ∼1-kb homology arms and a 2A-histone H2B–GFP cassette. We increased the efficiency of the ZFN-mediated targeted transgene insertion by in situ linearization of the targeting donor construct and cointroduction of an mRNA for a dominant-negative form of HpLig4, which encodes the H. pulcherrimus homolog of DNA ligase IV required for error-prone nonhomologous end joining. We measured the fluorescence intensity of GFP at the single-cell level in living embryos during development and found that there was variation in HpEts1 expression among the primary mesenchyme cells. These findings demonstrate the feasibility of ZFN-mediated targeted transgene insertion to enable quantification of the expression levels of endogenous genes during development in living sea urchin embryos. PMID:22711830

RD2-MolPack-Chim3, a packaging cell line for stable production of lentiviral vectors for anti-HIV gene therapy.

PubMed

Stornaiuolo, Anna; Piovani, Bianca Maria; Bossi, Sergio; Zucchelli, Eleonora; Corna, Stefano; Salvatori, Francesca; Mavilio, Fulvio; Bordignon, Claudio; Rizzardi, Gian Paolo; Bovolenta, Chiara

2013-08-01

Over the last two decades, several attempts to generate packaging cells for lentiviral vectors (LV) have been made. Despite different technologies, no packaging clone is currently employed in clinical trials. We developed a new strategy for LV stable production based on the HEK-293T progenitor cells; the sequential insertion of the viral genes by integrating vectors; the constitutive expression of the viral components; and the RD114-TR envelope pseudotyping. We generated the intermediate clone PK-7 expressing constitutively gag/pol and rev genes and, by adding tat and rd114-tr genes, the stable packaging cell line RD2-MolPack, which can produce LV carrying any transfer vector (TV). Finally, we obtained the RD2-MolPack-Chim3 producer clone by transducing RD2-MolPack cells with the TV expressing the anti-HIV transgene Chim3. Remarkably, RD114-TR pseudovirions have much higher potency when produced by stable compared with transient technology. Most importantly, comparable transduction efficiency in hematopoietic stem cells (HSC) is obtained with 2-logs less physical particles respect to VSV-G pseudovirions produced by transient transfection. Altogether, RD2-MolPack technology should be considered a valid option for large-scale production of LV to be used in gene therapy protocols employing HSC, resulting in the possibility of downsizing the manufacturing scale by about 10-fold in respect to transient technology.

Minos-insertion mutant of the Drosophila GBA gene homologue showed abnormal phenotypes of climbing ability, sleep and life span with accumulation of hydroxy-glucocerebroside.

PubMed

Kawasaki, Haruhisa; Suzuki, Takahiro; Ito, Kumpei; Takahara, Tsubasa; Goto-Inoue, Naoko; Setou, Mitsutoshi; Sakata, Kazuki; Ishida, Norio

2017-05-30

Gaucher's disease in humans is considered a deficiency of glucocerebrosidase (GlcCerase) that result in the accumulation of its substrate, glucocerebroside (GlcCer). Although mouse models of Gaucher's disease have been reported from several laboratories, these models are limited due to the perinatal lethality of GlcCerase gene. Here, we examined phenotypes of Drosophila melanogaster homologues genes of the human Gaucher's disease gene by using Minos insertion. One of two Minos insertion mutants to unknown function gene (CG31414) accumulates the hydroxy-GlcCer in whole body of Drosophila melanogaster. This mutant showed abnormal phenotypes of climbing ability and sleep, and short lifespan. These abnormal phenotypes are very similar to that of Gaucher's disease in human. In contrast, another Minos insertion mutant (CG31148) and its RNAi line did not show such severe phenotype as observed in CG31414 gene mutation. The data suggests that Drosophila CG31414 gene mutation might be useful for unraveling the molecular mechanism of Gaucher's disease. Copyright © 2017 Elsevier B.V. All rights reserved.

Scalable human ES culture for therapeutic use: propagation, differentiation, genetic modification and regulatory issues.

PubMed

Rao, M

2008-01-01

Embryonic stem cells unlike most adult stem cell populations can replicate indefinitely while preserving genetic, epigenetic, mitochondrial and functional profiles. ESCs are therefore an excellent candidate cell type for providing a bank of cells for allogenic therapy and for introducing targeted genetic modifications for therapeutic intervention. This ability of prolonged self-renewal of stem cells and the unique advantages that this offers for gene therapy, discovery efforts, cell replacement, personalized medicine and other more direct applications requires the resolution of several important manufacturing, gene targeting and regulatory issues. In this review, we assess some of the advance made in developing scalable culture systems, improvement in vector design and gene insertion technology and the changing regulatory landscape.

Recurrence, submicroscopic complexity, and potential clinical relevance of copy gains detected by array CGH that are shown to be unbalanced insertions by FISH.

PubMed

Neill, Nicholas J; Ballif, Blake C; Lamb, Allen N; Parikh, Sumit; Ravnan, J Britt; Schultz, Roger A; Torchia, Beth S; Rosenfeld, Jill A; Shaffer, Lisa G

2011-04-01

Insertions occur when a segment of one chromosome is translocated and inserted into a new region of the same chromosome or a non-homologous chromosome. We report 71 cases with unbalanced insertions identified using array CGH and FISH in 4909 cases referred to our laboratory for array CGH and found to have copy-number abnormalities. Although the majority of insertions were non-recurrent, several recurrent unbalanced insertions were detected, including three der(Y)ins(Y;18)(q?11.2;p11.32p11.32)pat inherited from parents carrying an unbalanced insertion. The clinical significance of these recurrent rearrangements is unclear, although the small size, limited gene content, and inheritance pattern of each suggests that the phenotypic consequences may be benign. Cryptic, submicroscopic duplications were observed at or near the insertion sites in two patients, further confounding the clinical interpretation of these insertions. Using FISH, linear amplification, and array CGH, we identified a 126-kb duplicated region from 19p13.3 inserted into MECP2 at Xq28 in a patient with symptoms of Rett syndrome. Our results demonstrate that although the interpretation of most non-recurrent insertions is unclear without high-resolution insertion site characterization, the potential for an otherwise benign duplication to result in a clinically relevant outcome through the disruption of a gene necessitates the use of FISH to determine whether copy-number gains detected by array CGH represent tandem duplications or unbalanced insertions. Further follow-up testing using techniques such as linear amplification or sequencing should be used to determine gene involvement at the insertion site after FISH has identified the presence of an insertion.

Effects of insertion sites in a Newcastle disease virus vector on foreign gene expression through an internal ribosomal entry site

USDA-ARS?s Scientific Manuscript database

Newcastle disease virus (NDV), avian paramyxovirus type 1, has been developed as a vector to express foreign genes for vaccine and gene therapy purposes. The foreign genes are usually inserted into a non-coding region of the NDV genome as an independent transcription unit (ITU), which potentially a...

Retroviral insertions in the VISION database identify molecular pathways in mouse lymphoid leukemia and lymphoma

PubMed Central

Weiser, Keith C.; Liu, Bin; Hansen, Gwenn M.; Skapura, Darlene; Hentges, Kathryn E.; Yarlagadda, Sujatha; Morse III, Herbert C.

2007-01-01

AKXD recombinant inbred (RI) strains develop a variety of leukemias and lymphomas due to somatically acquired insertions of retroviral DNA into the genome of hematopoetic cells that can mutate cellular proto-oncogenes and tumor suppressor genes. We generated a new set of tumors from nine AKXD RI strains selected for their propensity to develop B-cell tumors, the most common type of human hematopoietic cancers. We employed a PCR technique called viral insertion site amplification (VISA) to rapidly isolate genomic sequence at the site of provirus insertion. Here we describe 550 VISA sequence tags (VSTs) that identify 74 common insertion sites (CISs), of which 21 have not been identified previously. Several suspected proto-oncogenes and tumor suppressor genes lie near CISs, providing supportive evidence for their roles in cancer. Furthermore, numerous previously uncharacterized genes lie near CISs, providing a pool of candidate disease genes for future research. Pathway analysis of candidate genes identified several signaling pathways as common and powerful routes to blood cancer, including Notch, E-protein, NFκB, and Ras signaling. Misregulation of several Notch signaling genes was confirmed by quantitative RT-PCR. Our data suggest that analyses of insertional mutagenesis on a single genetic background are biased toward the identification of cooperating mutations. This tumor collection represents the most comprehensive study of the genetics of B-cell leukemia and lymphoma development in mice. We have deposited the VST sequences, CISs in a genome viewer, histopathology, and molecular tumor typing data in a public web database called VISION (Viral Insertion Sites Identifying Oncogenes), which is located at http://www.mouse-genome.bcm.tmc.edu/vision. PMID:17926094

Retroviral insertions in the VISION database identify molecular pathways in mouse lymphoid leukemia and lymphoma.

PubMed

Weiser, Keith C; Liu, Bin; Hansen, Gwenn M; Skapura, Darlene; Hentges, Kathryn E; Yarlagadda, Sujatha; Morse Iii, Herbert C; Justice, Monica J

2007-10-01

AKXD recombinant inbred (RI) strains develop a variety of leukemias and lymphomas due to somatically acquired insertions of retroviral DNA into the genome of hematopoetic cells that can mutate cellular proto-oncogenes and tumor suppressor genes. We generated a new set of tumors from nine AKXD RI strains selected for their propensity to develop B-cell tumors, the most common type of human hematopoietic cancers. We employed a PCR technique called viral insertion site amplification (VISA) to rapidly isolate genomic sequence at the site of provirus insertion. Here we describe 550 VISA sequence tags (VSTs) that identify 74 common insertion sites (CISs), of which 21 have not been identified previously. Several suspected proto-oncogenes and tumor suppressor genes lie near CISs, providing supportive evidence for their roles in cancer. Furthermore, numerous previously uncharacterized genes lie near CISs, providing a pool of candidate disease genes for future research. Pathway analysis of candidate genes identified several signaling pathways as common and powerful routes to blood cancer, including Notch, E-protein, NFkappaB, and Ras signaling. Misregulation of several Notch signaling genes was confirmed by quantitative RT-PCR. Our data suggest that analyses of insertional mutagenesis on a single genetic background are biased toward the identification of cooperating mutations. This tumor collection represents the most comprehensive study of the genetics of B-cell leukemia and lymphoma development in mice. We have deposited the VST sequences, CISs in a genome viewer, histopathology, and molecular tumor typing data in a public web database called VISION (Viral Insertion Sites Identifying Oncogenes), which is located at http://www.mouse-genome.bcm.tmc.edu/vision .

IS30-related transposon mediated insertional inactivation of bile salt hydrolase (bsh1) gene of Lactobacillus plantarum strain Lp20.

PubMed

Kumar, Rajesh; Grover, Sunita; Kaushik, Jai K; Batish, Virender Kumar

2014-01-01

Lactobacillus plantarum is a flexible and versatile microorganism that inhabits a variety of niches, and its genome may express up to four bsh genes to maximize its survival in the mammalian gut. However, the ecological significance of multiple bsh genes in L. plantarum is still not clearly understood. Hence, this study demonstrated the disruption of bile salt hydrolase (bsh1) gene due to the insertion of a transposable element in L. plantarum Lp20 - a wild strain of human fecal origin. Surprisingly, L. plantarum strain Lp20 produced a ∼2.0 kb bsh1 amplicon against the normal size (∼1.0 kb) bsh1 amplicon of Bsh(+)L. plantarum Lp21. Strain Lp20 exhibited minimal Bsh activity in spite of having intact bsh2, bsh3 and bsh4 genes in its genome and hence had a Bsh(-) phenotype. Cloning and sequence characterization of Lp20 bsh1 gene predicted four individual open reading frames (ORFs) within this region. BLAST analysis of ORF1 and ORF2 revealed significant sequence similarity to the L. plantarum bsh1 gene while ORF3 and ORF4 showed high sequence homology to IS30-family transposases. Since, IS30-related transposon element was inserted within Lp20 bsh1 gene in reverse orientation (3'-5'), it introduced several stop codons and disrupted the protein reading frames of both Bsh1 and transposase. Inverted terminal repeats (GGCAGATTG) of transposon, mediated its insertion at 255-263 nt and 1301-1309 nt positions of Lp20 bsh1 gene. In conclusion, insertion of IS30 related-transposon within the bsh1 gene sequence of L. plantarum strain Lp20 demolished the integrity and functionality of Bsh1 enzyme. Additionally, this transposon DNA sequence remains active among various Lactobacillus spp. and hence harbors the potential to be explored in the development of efficient insertion mutagenesis system. Copyright © 2013 Elsevier GmbH. All rights reserved.

Development of Cre-loxP technology in zebrafish to study the regulation of fish reproduction.

PubMed

Lin, Heng-Ju; Lee, Shu-Hua; Wu, Jen-Leih; Duann, Yeh-Fang; Chen, Jyh-Yih

2013-12-01

One cannot seek permission to market transgenic fish mainly because there is no field test or any basic research on technological developments for evaluating their biosafety. Infertility is a necessary adjunct to exploiting transgenic fish unless completely secure land-locked facilities are available. In this study, we report the generation of a Cre transgenic zebrafish line using a cytomegalovirus promoter. We also produced fish carrying the Bax1 and Bax2 plasmids; these genes were separated by two loxP sites under a zona pellucida C promoter or were driven by an anti-Müllerian hormone promoter. We inserted a red fluorescent protein gene between the two loxP sites. After obtaining transgenic lines with the two transgenic fish crossed with each other (Cre transgenic zebrafish x loxP transgenic zebrafish), the floxed DNA was found to be specifically eliminated from the female or male zebrafish, and apoptosis gene expressions caused ovarian and testicular growth cessation and degeneration. Overexpression of the Bax1 and Bax2 genes caused various expression levels of apoptosis-related genes. Accordingly, this transgenic zebrafish model system provides a method to produce infertile fish and may be useful for application to genetically modified fish.

[The research advances and applications of genome editing in hereditary eye diseases].

PubMed

Cai, S W; Zhang, Y; Hou, M Z; Liu, Y; Li, X R

2017-05-11

Genome editing is a cutting-edge technology that generates DNA double strand breaks at the specific genomic DNA sequence through nuclease recognition and cleavage, and then achieves insertion, replacement, or deletion of the target gene via endogenous DNA repair mechanisms, such as non-homologous end joining, homology directed repair, and homologous recombination. So far, more than 600 human hereditary eye diseases and systemic hereditary diseases with ocular phenotypes have been found. However, most of these diseases are of incompletely elucidated pathogenesis and without effective therapies. Genome editing technology can precisely target and alter the genomes of animals, establish animal models of the hereditary diseases, and elucidate the relationship between the target gene and the disease phenotype, thereby providing a powerful approach to studying the pathogenic mechanisms underlying the hereditary eye diseases. In addition, correction of gene mutations by the genome editing brings a new hope to gene therapy for the hereditary eye diseases. This review introduces the molecular characteristics of 4 major enzymes used in the genome editing, including homing endonucleases, zinc finger nucleases, transcription activator-like effector nucleases, and clustered regularly interspaced short palindromic repeats (CRISPR)/ CRISPR-associated protein 9 (Cas9), and summarizes the current applications of this technology in investigating the pathogenic mechanisms underlying the hereditary eye diseases. (Chin J Ophthalmol, 2017, 53: 386-371 ) .

Differential effects of simple repeating DNA sequences on gene expression from the SV40 early promoter.

PubMed

Amirhaeri, S; Wohlrab, F; Wells, R D

1995-02-17

The influence of simple repeat sequences, cloned into different positions relative to the SV40 early promoter/enhancer, on the transient expression of the chloramphenicol acetyltransferase (CAT) gene was investigated. Insertion of (G)29.(C)29 in either orientation into the 5'-untranslated region of the CAT gene reduced expression in CV-1 cells 50-100 fold when compared with controls with random sequence inserts. Analysis of CAT-specific mRNA levels demonstrated that the effect was due to a reduction of CAT mRNA production rather than to posttranscriptional events. In contrast, insertion of the same insert in either orientation upstream of the promoter-enhancer or downstream of the gene stimulated gene expression 2-3-fold. These effects could be reversed by cotransfection of a competitor plasmid carrying (G)25.(C)25 sequences. The results suggest that a G.C-binding transcription factor modulates gene expression in this system and that promoter strength can be regulated by providing protein-binding sites in trans. Although constructs containing longer tracts of alternating (C-G), (T-G), or (A-T) sequences inhibited CAT expression when inserted in the 5'-untranslated region of the CAT gene, the amount of CAT mRNA was unaffected. Hence, these inhibitions must be due to posttranscriptional events, presumably at the level of translation. These effects of microsatellite sequences on gene expression are discussed with respect to recent data on related simple repeat sequences which cause several human genetic diseases.

Genome-Wide Transposon Mutagenesis in Pathogenic Leptospira Species▿ ‡

PubMed Central

Murray, Gerald L.; Morel, Viviane; Cerqueira, Gustavo M.; Croda, Julio; Srikram, Amporn; Henry, Rebekah; Ko, Albert I.; Dellagostin, Odir A.; Bulach, Dieter M.; Sermswan, Rasana W.; Adler, Ben; Picardeau, Mathieu

2009-01-01

Leptospira interrogans is the most common cause of leptospirosis in humans and animals. Genetic analysis of L. interrogans has been severely hindered by a lack of tools for genetic manipulation. Recently we developed the mariner-based transposon Himar1 to generate the first defined mutants in L. interrogans. In this study, a total of 929 independent transposon mutants were obtained and the location of insertion determined. Of these mutants, 721 were located in the protein coding regions of 551 different genes. While sequence analysis of transposon insertion sites indicated that transposition occurred in an essentially random fashion in the genome, 25 unique transposon mutants were found to exhibit insertions into genes encoding 16S or 23S rRNAs, suggesting these genes are insertional hot spots in the L. interrogans genome. In contrast, loci containing notionally essential genes involved in lipopolysaccharide and heme biosynthesis showed few transposon insertions. The effect of gene disruption on the virulence of a selected set of defined mutants was investigated using the hamster model of leptospirosis. Two attenuated mutants with disruptions in hypothetical genes were identified, thus validating the use of transposon mutagenesis for the identification of novel virulence factors in L. interrogans. This library provides a valuable resource for the study of gene function in L. interrogans. Combined with the genome sequences of L. interrogans, this provides an opportunity to investigate genes that contribute to pathogenesis and will provide a better understanding of the biology of L. interrogans. PMID:19047402

Genome-wide transposon mutagenesis in pathogenic Leptospira species.

PubMed

Murray, Gerald L; Morel, Viviane; Cerqueira, Gustavo M; Croda, Julio; Srikram, Amporn; Henry, Rebekah; Ko, Albert I; Dellagostin, Odir A; Bulach, Dieter M; Sermswan, Rasana W; Adler, Ben; Picardeau, Mathieu

2009-02-01

Leptospira interrogans is the most common cause of leptospirosis in humans and animals. Genetic analysis of L. interrogans has been severely hindered by a lack of tools for genetic manipulation. Recently we developed the mariner-based transposon Himar1 to generate the first defined mutants in L. interrogans. In this study, a total of 929 independent transposon mutants were obtained and the location of insertion determined. Of these mutants, 721 were located in the protein coding regions of 551 different genes. While sequence analysis of transposon insertion sites indicated that transposition occurred in an essentially random fashion in the genome, 25 unique transposon mutants were found to exhibit insertions into genes encoding 16S or 23S rRNAs, suggesting these genes are insertional hot spots in the L. interrogans genome. In contrast, loci containing notionally essential genes involved in lipopolysaccharide and heme biosynthesis showed few transposon insertions. The effect of gene disruption on the virulence of a selected set of defined mutants was investigated using the hamster model of leptospirosis. Two attenuated mutants with disruptions in hypothetical genes were identified, thus validating the use of transposon mutagenesis for the identification of novel virulence factors in L. interrogans. This library provides a valuable resource for the study of gene function in L. interrogans. Combined with the genome sequences of L. interrogans, this provides an opportunity to investigate genes that contribute to pathogenesis and will provide a better understanding of the biology of L. interrogans.

Successful Gene Tagging in Lettuce Using the Tnt1 Retrotransposon from Tobacco

PubMed Central

Mazier, Marianne; Botton, Emmanuel; Flamain, Fabrice; Bouchet, Jean-Paul; Courtial, Béatrice; Chupeau, Marie-Christine; Chupeau, Yves; Maisonneuve, Brigitte; Lucas, Hélène

2007-01-01

The tobacco (Nicotiana tabacum) element Tnt1 is one of the few identified active retrotransposons in plants. These elements possess unique properties that make them ideal genetic tools for gene tagging. Here, we demonstrate the feasibility of gene tagging using the retrotransposon Tnt1 in lettuce (Lactuca sativa), which is the largest genome tested for retrotransposon mutagenesis so far. Of 10 different transgenic bushes carrying a complete Tnt1 containing T-DNA, eight contained multiple transposed copies of Tnt1. The number of transposed copies of the element per plant was particularly high, the smallest number being 28. Tnt1 transposition in lettuce can be induced by a very simple in vitro culture protocol. Tnt1 insertions were stable in the progeny of the primary transformants and could be segregated genetically. Characterization of the sequences flanking some insertion sites revealed that Tnt1 often inserted into genes. The progeny of some primary transformants showed phenotypic alterations due to recessive mutations. One of these mutations was due to Tnt1 insertion in the gibberellin 3β-hydroxylase gene. Taken together, these results indicate that Tnt1 is a powerful tool for insertion mutagenesis especially in plants with a large genome. PMID:17351058

Role of RNA interference in plant improvement

NASA Astrophysics Data System (ADS)

Jagtap, Umesh Balkrishna; Gurav, Ranjit Gajanan; Bapat, Vishwas Anant

2011-06-01

Research to alter crops for their better performance involving modern technology is underway in numerous plants, and achievements in transgenic plants are impacting crop improvements in unparalleled ways. Striking progress has been made using genetic engineering technology over the past two decades in manipulating genes from diverse and exotic sources, and inserting them into crop plants for inducing desirable characteristics. RNA interference (RNAi) has recently been identified as a natural mechanism for regulation of gene expression in all higher organisms from plants to humans and promises greater accuracy and precision to plant improvement. The expression of any gene can be down-regulated in a highly explicit manner exclusive of affecting the expression of any other gene by using RNAi technologies. Additional research in this field has been focused on a number of other areas including microRNAs, hairpin RNA, and promoter methylation. Manipulating new RNAi pathways, which generate small RNA molecules to amend gene expression in crops, can produce new quality traits and having better potentiality of protection against abiotic and biotic stresses. Nutritional improvement, change in morphology, or enhanced secondary metabolite synthesis are some of the other advantages of RNAi technology. In addition to its roles in regulating gene expression, RNAi is also used as a natural defense mechanism against molecular parasites such as jumping genes and viral genetic elements that affect genome stability. Even though much advancement has been made on the field of RNAi over the preceding few years, the full prospective of RNAi for crop improvement remains to be fully realized. The intricacy of RNAi pathway, the molecular machineries, and how it relates to plant development are still to be explained.

Analysis of the 227 bp short interspersed nuclear element (SINE) insertion of the promoter of the myostatin (MSTN) gene in different horse breeds.

PubMed

Dall'Olio, Stefania; Scotti, Emilio; Fontanesi, Luca; Tassinari, Marco

2014-01-01

The myostatin (MSTN) gene encodes a protein known to be a negative regulator of muscle mass in mammalian species. Different polymorphisms of the horse (Equus caballus) MSTN gene have been identified, including single nucleotide polymorphisms and a short interspersed nuclear element (SINE) insertion of 227 bp within the promoter of the gene. The SINE insertion has been associated with performance traits in Thoroughbred racehorses and it was proposed as a predictor of optimum racing distance. The aims of this study were to perform in silico analysis to identify putative gains or abrogation of transcription-factor binding sites (TFBSs) generated by the SINE allele of the promoter and to analyse the frequency of the SINE insertion in horses used for racing (gallop and trot) and other purposes. The SINE insertion was genotyped in 227 horses from 10 breeds belonging to different morphological types (brachimorphic, mesomorphic, meso-dolichomorphic and dolichomorphic). The presence of the insertion was confirmed in the Quarter Horse (SINE allele frequency of 0.81) and in the Thoroughbred (0.51), whereas the SINE allele did not segregate in any of the other analysed breeds. As the SINE MSTN gene polymorphism may be population or breed specific, it is not a useful marker for association studies in all breeds.

Transcriptional Enhancers Induce Insertional Gene Deregulation Independently From the Vector Type and Design

PubMed Central

Maruggi, Giulietta; Porcellini, Simona; Facchini, Giulia; Perna, Serena K; Cattoglio, Claudia; Sartori, Daniela; Ambrosi, Alessandro; Schambach, Axel; Baum, Christopher; Bonini, Chiara; Bovolenta, Chiara; Mavilio, Fulvio; Recchia, Alessandra

2009-01-01

The integration characteristics of retroviral (RV) vectors increase the probability of interfering with the regulation of cellular genes, and account for a tangible risk of insertional mutagenesis in treated patients. To assess the potential genotoxic risk of conventional or self-inactivating (SIN) γ-RV and lentiviral (LV) vectors independently from the biological consequences of the insertion event, we developed a quantitative assay based on real-time reverse transcriptase—PCR on low-density arrays to evaluate alterations of gene expression in individual primary T-cell clones. We show that the Moloney leukemia virus long terminal repeat (LTR) enhancer has the strongest activity in both a γ-RV and a LV vector context, while an internal cellular promoter induces deregulation of gene expression less frequently, at a shorter range and to a lower extent in both vector types. Downregulation of gene expression was observed only in the context of LV vectors. This study indicates that insertional gene activation is determined by the characteristics of the transcriptional regulatory elements carried by the vector, and is largely independent from the vector type or design. PMID:19293778

Influence of insertion site of the avian influenza virus haemagglutinin (HA) gene within the Newcastle disease virus genome on HA expression.

PubMed

Ramp, Kristina; Skiba, Martin; Karger, Axel; Mettenleiter, Thomas C; Römer-Oberdörfer, Angela

2011-02-01

Members of the order Mononegavirales express their genes in a transcription gradient from 3' to 5'. To assess how this impacts on expression of a foreign transgene, the haemagglutinin (HA) of highly pathogenic avian influenza virus (HPAIV) A/chicken/Vietnam/P41/05 (subtype H5N1) was inserted between the phosphoprotein (P) and matrix protein (M), M and fusion protein (F), or F and haemagglutinin-neuraminidase protein (HN) genes of attenuated Newcastle disease virus (NDV) Clone 30. In addition, the gene encoding the neuraminidase of HPAIV A/duck/Vietnam/TG24-01/05 (subtype H5N1) was inserted into the NDV genome either alone or in combination with the HA gene. All recombinants replicated well in embryonated chicken eggs. The expression levels of HA-specific mRNA and protein were quantified by Northern blot analysis and mass spectrometry, with good correlation. HA expression levels differed only moderately and were highest in the recombinant carrying the HA insertion between the F and HN genes of NDV.

A Noise Trimming and Positional Significance of Transposon Insertion System to Identify Essential Genes in Yersinia pestis

NASA Astrophysics Data System (ADS)

Yang, Zheng Rong; Bullifent, Helen L.; Moore, Karen; Paszkiewicz, Konrad; Saint, Richard J.; Southern, Stephanie J.; Champion, Olivia L.; Senior, Nicola J.; Sarkar-Tyson, Mitali; Oyston, Petra C. F.; Atkins, Timothy P.; Titball, Richard W.

2017-02-01

Massively parallel sequencing technology coupled with saturation mutagenesis has provided new and global insights into gene functions and roles. At a simplistic level, the frequency of mutations within genes can indicate the degree of essentiality. However, this approach neglects to take account of the positional significance of mutations - the function of a gene is less likely to be disrupted by a mutation close to the distal ends. Therefore, a systematic bioinformatics approach to improve the reliability of essential gene identification is desirable. We report here a parametric model which introduces a novel mutation feature together with a noise trimming approach to predict the biological significance of Tn5 mutations. We show improved performance of essential gene prediction in the bacterium Yersinia pestis, the causative agent of plague. This method would have broad applicability to other organisms and to the identification of genes which are essential for competitiveness or survival under a broad range of stresses.

A Noise Trimming and Positional Significance of Transposon Insertion System to Identify Essential Genes in Yersinia pestis

PubMed Central

Yang, Zheng Rong; Bullifent, Helen L.; Moore, Karen; Paszkiewicz, Konrad; Saint, Richard J.; Southern, Stephanie J.; Champion, Olivia L.; Senior, Nicola J.; Sarkar-Tyson, Mitali; Oyston, Petra C. F.; Atkins, Timothy P.; Titball, Richard W.

2017-01-01

Massively parallel sequencing technology coupled with saturation mutagenesis has provided new and global insights into gene functions and roles. At a simplistic level, the frequency of mutations within genes can indicate the degree of essentiality. However, this approach neglects to take account of the positional significance of mutations - the function of a gene is less likely to be disrupted by a mutation close to the distal ends. Therefore, a systematic bioinformatics approach to improve the reliability of essential gene identification is desirable. We report here a parametric model which introduces a novel mutation feature together with a noise trimming approach to predict the biological significance of Tn5 mutations. We show improved performance of essential gene prediction in the bacterium Yersinia pestis, the causative agent of plague. This method would have broad applicability to other organisms and to the identification of genes which are essential for competitiveness or survival under a broad range of stresses. PMID:28165493

Lentiviral vector-based insertional mutagenesis identifies genes associated with liver cancer

PubMed Central

Ranzani, Marco; Cesana, Daniela; Bartholomae, Cynthia C.; Sanvito, Francesca; Pala, Mauro; Benedicenti, Fabrizio; Gallina, Pierangela; Sergi, Lucia Sergi; Merella, Stefania; Bulfone, Alessandro; Doglioni, Claudio; von Kalle, Christof; Kim, Yoon Jun; Schmidt, Manfred; Tonon, Giovanni; Naldini, Luigi; Montini, Eugenio

2013-01-01

Transposons and γ-retroviruses have been efficiently used as insertional mutagens in different tissues to identify molecular culprits of cancer. However, these systems are characterized by recurring integrations that accumulate in tumor cells, hampering the identification of early cancer-driving events amongst bystander and progression-related events. We developed an insertional mutagenesis platform based on lentiviral vectors (LVV) by which we could efficiently induce hepatocellular carcinoma (HCC) in 3 different mouse models. By virtue of LVV’s replication-deficient nature and broad genome-wide integration pattern, LVV-based insertional mutagenesis allowed identification of 4 new liver cancer genes from a limited number of integrations. We validated the oncogenic potential of all the identified genes in vivo, with different levels of penetrance. Our newly identified cancer genes are likely to play a role in human disease, since they are upregulated and/or amplified/deleted in human HCCs and can predict clinical outcome of patients. PMID:23314173

Genome-Wide Spectra of Transcription Insertions and Deletions Reveal That Slippage Depends on RNA:DNA Hybrid Complementarity

PubMed Central

Traverse, Charles C.

2017-01-01

ABSTRACT Advances in sequencing technologies have enabled direct quantification of genome-wide errors that occur during RNA transcription. These errors occur at rates that are orders of magnitude higher than rates during DNA replication, but due to technical difficulties such measurements have been limited to single-base substitutions and have not yet quantified the scope of transcription insertions and deletions. Previous reporter gene assay findings suggested that transcription indels are produced exclusively by elongation complex slippage at homopolymeric runs, so we enumerated indels across the protein-coding transcriptomes of Escherichia coli and Buchnera aphidicola, which differ widely in their genomic base compositions and incidence of repeat regions. As anticipated from prior assays, transcription insertions prevailed in homopolymeric runs of A and T; however, transcription deletions arose in much more complex sequences and were rarely associated with homopolymeric runs. By reconstructing the relocated positions of the elongation complex as inferred from the sequences inserted or deleted during transcription, we show that continuation of transcription after slippage hinges on the degree of nucleotide complementarity within the RNA:DNA hybrid at the new DNA template location. PMID:28851848

The clinical applications of genome editing in HIV.

PubMed

Wang, Cathy X; Cannon, Paula M

2016-05-26

HIV/AIDS has long been at the forefront of the development of gene- and cell-based therapies. Although conventional gene therapy approaches typically involve the addition of anti-HIV genes to cells using semirandomly integrating viral vectors, newer genome editing technologies based on engineered nucleases are now allowing more precise genetic manipulations. The possible outcomes of genome editing include gene disruption, which has been most notably applied to the CCR5 coreceptor gene, or the introduction of small mutations or larger whole gene cassette insertions at a targeted locus. Disruption of CCR5 using zinc finger nucleases was the first-in-human application of genome editing and remains the most clinically advanced platform, with 7 completed or ongoing clinical trials in T cells and hematopoietic stem/progenitor cells (HSPCs). Here we review the laboratory and clinical findings of CCR5 editing in T cells and HSPCs for HIV therapy and summarize other promising genome editing approaches for future clinical development. In particular, recent advances in the delivery of genome editing reagents and the demonstration of highly efficient homology-directed editing in both T cells and HSPCs are expected to spur the development of even more sophisticated applications of this technology for HIV therapy. © 2016 by The American Society of Hematology.

Allopatric integrations selectively change host transcriptomes, leading to varied expression efficiencies of exotic genes in Myxococcus xanthus.

PubMed

Zhu, Li-Ping; Yue, Xin-Jing; Han, Kui; Li, Zhi-Feng; Zheng, Lian-Shuai; Yi, Xiu-Nan; Wang, Hai-Long; Zhang, You-Ming; Li, Yue-Zhong

2015-07-22

Exotic genes, especially clustered multiple-genes for a complex pathway, are normally integrated into chromosome for heterologous expression. The influences of insertion sites on heterologous expression and allotropic expressions of exotic genes on host remain mostly unclear. We compared the integration and expression efficiencies of single and multiple exotic genes that were inserted into Myxococcus xanthus genome by transposition and attB-site-directed recombination. While the site-directed integration had a rather stable chloramphenicol acetyl transferase (CAT) activity, the transposition produced varied CAT enzyme activities. We attempted to integrate the 56-kb gene cluster for the biosynthesis of antitumor polyketides epothilones into M. xanthus genome by site-direction but failed, which was determined to be due to the insertion size limitation at the attB site. The transposition technique produced many recombinants with varied production capabilities of epothilones, which, however, were not paralleled to the transcriptional characteristics of the local sites where the genes were integrated. Comparative transcriptomics analysis demonstrated that the allopatric integrations caused selective changes of host transcriptomes, leading to varied expressions of epothilone genes in different mutants. With the increase of insertion fragment size, transposition is a more practicable integration method for the expression of exotic genes. Allopatric integrations selectively change host transcriptomes, which lead to varied expression efficiencies of exotic genes.

LINE dancing in the human genome: transposable elements and disease.

PubMed

Belancio, Victoria P; Deininger, Prescott L; Roy-Engel, Astrid M

2009-10-27

Transposable elements (TEs) have been consistently underestimated in their contribution to genetic instability and human disease. TEs can cause human disease by creating insertional mutations in genes, and also contributing to genetic instability through non-allelic homologous recombination and introduction of sequences that evolve into various cis-acting signals that alter gene expression. Other outcomes of TE activity, such as their potential to cause DNA double-strand breaks or to modulate the epigenetic state of chromosomes, are less fully characterized. The currently active human transposable elements are members of the non-LTR retroelement families, LINE-1, Alu (SINE), and SVA. The impact of germline insertional mutagenesis by TEs is well established, whereas the rate of post-insertional TE-mediated germline mutations and all forms of somatic mutations remain less well quantified. The number of human diseases discovered to be associated with non-allelic homologous recombination between TEs, and particularly between Alu elements, is growing at an unprecedented rate. Improvement in the technology for detection of such events, as well as the mounting interest in the research and medical communities in resolving the underlying causes of the human diseases with unknown etiology, explain this increase. Here, we focus on the most recent advances in understanding of the impact of the active human TEs on the stability of the human genome and its relevance to human disease.

Quantitative analysis of bristle number in Drosophila mutants identifies genes involved in neural development

NASA Technical Reports Server (NTRS)

Norga, Koenraad K.; Gurganus, Marjorie C.; Dilda, Christy L.; Yamamoto, Akihiko; Lyman, Richard F.; Patel, Prajal H.; Rubin, Gerald M.; Hoskins, Roger A.; Mackay, Trudy F.; Bellen, Hugo J.

2003-01-01

BACKGROUND: The identification of the function of all genes that contribute to specific biological processes and complex traits is one of the major challenges in the postgenomic era. One approach is to employ forward genetic screens in genetically tractable model organisms. In Drosophila melanogaster, P element-mediated insertional mutagenesis is a versatile tool for the dissection of molecular pathways, and there is an ongoing effort to tag every gene with a P element insertion. However, the vast majority of P element insertion lines are viable and fertile as homozygotes and do not exhibit obvious phenotypic defects, perhaps because of the tendency for P elements to insert 5' of transcription units. Quantitative genetic analysis of subtle effects of P element mutations that have been induced in an isogenic background may be a highly efficient method for functional genome annotation. RESULTS: Here, we have tested the efficacy of this strategy by assessing the extent to which screening for quantitative effects of P elements on sensory bristle number can identify genes affecting neural development. We find that such quantitative screens uncover an unusually large number of genes that are known to function in neural development, as well as genes with yet uncharacterized effects on neural development, and novel loci. CONCLUSIONS: Our findings establish the use of quantitative trait analysis for functional genome annotation through forward genetics. Similar analyses of quantitative effects of P element insertions will facilitate our understanding of the genes affecting many other complex traits in Drosophila.

Insertion sequence 1515 in the ply gene of a type 1 clinical isolate of Streptococcus pneumoniae abolishes pneumolysin expression.

PubMed

Garnier, Fabien; Janapatla, Rajendra Prasad; Charpentier, Emmanuelle; Masson, Geoffrey; Grélaud, Carole; Stach, Jean François; Denis, François; Ploy, Marie-Cécile

2007-07-01

A serotype 1 Streptococcus pneumoniae strain isolated by blood culture from a woman with pneumonia was found to harbor insertion sequence (IS) 1515 in the pneumolysin gene, abolishing pneumolysin expression. To our knowledge, this is the first report of an IS in the pneumolysin gene of S. pneumoniae.

Transposon Insertions of magellan-4 That Impair Social Gliding Motility in Myxococcus xanthus

PubMed Central

Youderian, Philip; Hartzell, Patricia L.

2006-01-01

Myxococcus xanthus has two different mechanisms of motility, adventurous (A) motility, which permits individual cells to glide over solid surfaces, and social (S) motility, which permits groups of cells to glide. To identify the genes involved in S-gliding motility, we mutagenized a ΔaglU (A−) strain with the defective transposon, magellan-4, and screened for S− mutants that form nonmotile colonies. Sequence analysis of the sites of the magellan-4 insertions in these mutants and the alignment of these sites with the M. xanthus genome sequence show that two-thirds of these insertions lie within 27 of the 37 nonessential genes known to be required for social motility, including those necessary for the biogenesis of type IV pili, exopolysaccharide, and lipopolysaccharide. The remaining insertions also identify 31 new, nonessential genes predicted to encode both structural and regulatory determinants of S motility. These include three tetratricopeptide repeat proteins, several regulators of transcription that may control the expression of genes involved in pilus extension and retraction, and additional enzymes involved in polysaccharide metabolism. Three insertions that abolish S motility lie within genes predicted to encode glycolytic enzymes, suggesting that the signal for pilus retraction may be a simple product of exopolysaccharide catabolism. PMID:16299386

Random insertion and gene disruption via transposon mutagenesis of Ureaplasma parvum using a mini-transposon plasmid

PubMed Central

Aboklaish, Ali F.; Dordet-Frisoni, Emilie; Citti, Christine; Toleman, Mark A; Glass, John I.; Spiller, O. Brad

2015-01-01

While transposon mutagenesis has been successfully used for Mycoplasma spp. to disrupt and determine non-essential genes, previous attempts with Ureaplasma spp. have been unsuccessful. Using a polyethylene glycol-transformation enhancing protocol, we were able to transform three separate serovars of Ureaplasma parvum with a Tn4001-based mini-transposon plasmid containing a gentamicin resistance selection marker. Despite the large degree of homology between Ureaplasma parvum and Ureaplasma urealyticum, all attempts to transform the latter in parallel failed, with the exception of a single clinical U. urealyticum isolate. PCR probing and sequencing were used to confirm transposon insertion into the bacterial genome and identify disrupted genes. Transformation of prototype serovar 3 consistently resulted in transfer only of sequence between the mini-transposon inverted repeats, but some strains showed additional sequence transfer. Transposon insertion occurred randomly in the genome resulting in unique disruption of genes UU047, UU390, UU440, UU450, UU520, UU526, UU582 for single clones from a panel of screened clones. An intergenic insertion between genes UU187 and UU188 was also characterised. Two phenotypic alterations were observed in the mutated strains: Disruption of a DEAD-box RNA helicase (UU582) altered growth kinetics, while the U. urealyticum strain lost resistance to serum attack coincident with disruption of gene UUR10_137 and loss of expression of a 41 kDa protein. Transposon mutagenesis was used successfully to insert single copies of a mini-transposon into the genome and disrupt genes leading to phenotypic changes in Ureaplasma parvum strains. This method can now be used to deliver exogenous genes for expression and determine essential genes for Ureaplasma parvum replication in culture and experimental models. PMID:25444567

Random insertion and gene disruption via transposon mutagenesis of Ureaplasma parvum using a mini-transposon plasmid.

PubMed

Aboklaish, Ali F; Dordet-Frisoni, Emilie; Citti, Christine; Toleman, Mark A; Glass, John I; Spiller, O Brad

2014-11-01

While transposon mutagenesis has been successfully used for Mycoplasma spp. to disrupt and determine non-essential genes, previous attempts with Ureaplasma spp. have been unsuccessful. Using a polyethylene glycol-transformation enhancing protocol, we were able to transform three separate serovars of Ureaplasma parvum with a Tn4001-based mini-transposon plasmid containing a gentamicin resistance selection marker. Despite the large degree of homology between Ureaplasma parvum and Ureaplasma urealyticum, all attempts to transform the latter in parallel failed, with the exception of a single clinical U. urealyticum isolate. PCR probing and sequencing were used to confirm transposon insertion into the bacterial genome and identify disrupted genes. Transformation of prototype serovar 3 consistently resulted in transfer only of sequence between the mini-transposon inverted repeats, but some strains showed additional sequence transfer. Transposon insertion occurred randomly in the genome resulting in unique disruption of genes UU047, UU390, UU440, UU450, UU520, UU526, UU582 for single clones from a panel of screened clones. An intergenic insertion between genes UU187 and UU188 was also characterised. Two phenotypic alterations were observed in the mutated strains: Disruption of a DEAD-box RNA helicase (UU582) altered growth kinetics, while the U. urealyticum strain lost resistance to serum attack coincident with disruption of gene UUR10_137 and loss of expression of a 41 kDa protein. Transposon mutagenesis was used successfully to insert single copies of a mini-transposon into the genome and disrupt genes leading to phenotypic changes in Ureaplasma parvum strains. This method can now be used to deliver exogenous genes for expression and determine essential genes for Ureaplasma parvum replication in culture and experimental models. Copyright © 2014 Elsevier GmbH. All rights reserved.

Transposable elements contribute to activation of maize genes in response to abiotic stress.

PubMed

Makarevitch, Irina; Waters, Amanda J; West, Patrick T; Stitzer, Michelle; Hirsch, Candice N; Ross-Ibarra, Jeffrey; Springer, Nathan M

2015-01-01

Transposable elements (TEs) account for a large portion of the genome in many eukaryotic species. Despite their reputation as "junk" DNA or genomic parasites deleterious for the host, TEs have complex interactions with host genes and the potential to contribute to regulatory variation in gene expression. It has been hypothesized that TEs and genes they insert near may be transcriptionally activated in response to stress conditions. The maize genome, with many different types of TEs interspersed with genes, provides an ideal system to study the genome-wide influence of TEs on gene regulation. To analyze the magnitude of the TE effect on gene expression response to environmental changes, we profiled gene and TE transcript levels in maize seedlings exposed to a number of abiotic stresses. Many genes exhibit up- or down-regulation in response to these stress conditions. The analysis of TE families inserted within upstream regions of up-regulated genes revealed that between four and nine different TE families are associated with up-regulated gene expression in each of these stress conditions, affecting up to 20% of the genes up-regulated in response to abiotic stress, and as many as 33% of genes that are only expressed in response to stress. Expression of many of these same TE families also responds to the same stress conditions. The analysis of the stress-induced transcripts and proximity of the transposon to the gene suggests that these TEs may provide local enhancer activities that stimulate stress-responsive gene expression. Our data on allelic variation for insertions of several of these TEs show strong correlation between the presence of TE insertions and stress-responsive up-regulation of gene expression. Our findings suggest that TEs provide an important source of allelic regulatory variation in gene response to abiotic stress in maize.

The Tc1/mariner transposable element family shapes genetic variation and gene expression in the protist Trichomonas vaginalis

PubMed Central

2014-01-01

Background Trichomonas vaginalis is the most prevalent non-viral sexually transmitted parasite. Although the protist is presumed to reproduce asexually, 60% of its haploid genome contains transposable elements (TEs), known contributors to genome variability. The availability of a draft genome sequence and our collection of >200 global isolates of T. vaginalis facilitate the study and analysis of TE population dynamics and their contribution to genomic variability in this protist. Results We present here a pilot study of a subset of class II Tc1/mariner TEs that belong to the T. vaginalis Tvmar1 family. We report the genetic structure of 19 Tvmar1 loci, their ability to encode a full-length transposase protein, and their insertion frequencies in 94 global isolates from seven regions of the world. While most of the Tvmar1 elements studied exhibited low insertion frequencies, two of the 19 loci (locus 1 and locus 9) show high insertion frequencies of 1.00 and 0.96, respectively. The genetic structuring of the global populations identified by principal component analysis (PCA) of the Tvmar1 loci is in general agreement with published data based on genotyping, showing that Tvmar1 polymorphisms are a robust indicator of T. vaginalis genetic history. Analysis of expression of 22 genes flanking 13 Tvmar1 loci indicated significantly altered expression of six of the genes next to five Tvmar1 insertions, suggesting that the insertions have functional implications for T. vaginalis gene expression. Conclusions Our study is the first in T. vaginalis to describe Tvmar1 population dynamics and its contribution to genetic variability of the parasite. We show that a majority of our studied Tvmar1 insertion loci exist at very low frequencies in the global population, and insertions are variable between geographical isolates. In addition, we observe that low frequency insertion is related to reduced or abolished expression of flanking genes. While low insertion frequencies might be expected, we identified two Tvmar1 insertion loci that are fixed across global populations. This observation indicates that Tvmar1 insertion may have differing impacts and fitness costs in the host genome and may play varying roles in the adaptive evolution of T. vaginalis. PMID:24834134

A Genetic Interaction Screen for Breast Cancer Progression Driver Genes

DTIC Science & Technology

2013-06-01

analysis of genetic alterations in human breast cancers has revealed that individual tumors accumulate mutations in approximately ninety different genes ...cancer. We performed a screen to test the roles of seventy breast cancer mutated genes in mouse mammary tumorigenesis using the MMTV-PyVT mouse breast...cancer model and piggyBac insertional mutation strains. We found that insertional mutations in 23 genes altered the onset of tumor formation and four

Tn5099, a xylE promoter probe transposon for Streptomyces spp.

PubMed Central

Hahn, D R; Solenberg, P J; Baltz, R H

1991-01-01

Tn5099, a promoter probe transposon for Streptomyces spp., was constructed by inserting a promoterless xylE gene and a hygromycin resistance gene into IS493. Tn5099 transposed into different sites in the Streptomyces griseofuscus genome, and the xylE reporter gene was expressed in some of the transposition mutants. Strains containing Tn5099 insertions that gave regulated expression of the xylE gene were identified. Images PMID:1653213

Cloning and expression in Escherichia coli of a hygromycin B phosphotransferase gene from Streptomyces hygroscopicus.

PubMed

Zalacain, M; Malpartida, F; Pulido, D; Jiménez, A

1987-01-15

The Streptomyces hygroscopicus hyg gene encoding a hygromycin B phosphotransferase has been introduced into different sites of both the Escherichia coli plasmid pBR322 and the Escherichia coli-Saccharomyces cerevisiae shuttle vector YRp7. When this gene was inserted into the BamHI site of pBR322 and then cloned in E. coli phosphorylating activity was not detected, indicating that the hyg gene promoter was not functional in this bacterium. However, when the hyg gene was inserted into either the unique PstI site of pBR322 or into each of the two PstI sites of YRp7, phosphotransferase activity was observed. Analysis of the translation products from these constructions by coupled in vitro transcription-translation systems suggested that in all cases transcrition was regulated by a promoter not provided by the inserted hyg gene and that the synthesized polypeptide was identical to that present in S. hygroscopicus.

[Preparation and activity validation of PP7 bacteriophage-like particles displaying PAP114-128 peptide].

PubMed

Sun, Yanli; Sun, Yanhua

2016-10-01

Objective To obtain the PP7 bacteriophage-like particles carrying the peptide of prostatic acid phosphatase PAP 114-128 , and prove that they retain the original biological activity. Methods First, the plasmid pETDuet-2PP7 was constructed as follows: the gene of PP7 coat protein dimer was amplified by gene mutation combined with overlapping PCR technology, and inserted into the vector pETDuet-1. Following that, the plasmid pETDuet-2PP7-PAP 114-128 was constructed as follows: the PP7 coat protein gene carrying the coding gene of PAP 114-128 peptide was amplified using PCR, and then inserted into the vector pETDuet-2PP7. Both pETDuet-2PP7 and pETDuet-2PP7-PAP 114-128 were transformed into E.coli and expressed. The expression product was verified by SDS-PAGE, double immunodiffusion assay and ELISA. Results The gene fragment of PP7 coat protein dimer was obtained by overlapping PCR using Ex Taq DNA polymerase, and the antigenicity of its expression product was the same as that of the coat protein of wild-type PP7 bacteriophage. Moreover, the PAP 114-128 peptide epitope that was displayed on the surface of PP7 bacteriophage was identical with the corresponding epitope of natural human PAP, and it was able to induce high levels of antibodies. Conclusion The gene of PP7 coat protein dimer with repeated sequences can be prepared by gene mutation combined with overlapping PCR. Based on this, PP7 bacteriophage-like particles carrying PAP peptide can be prepared, which not only solves the problem of the instability of the peptides, but also lays a foundation for the study on their delivery and function.

A transcription activator-like effector (TALE) induction system mediated by proteolysis.

PubMed

Copeland, Matthew F; Politz, Mark C; Johnson, Charles B; Markley, Andrew L; Pfleger, Brian F

2016-04-01

Simple and predictable trans-acting regulatory tools are needed in the fields of synthetic biology and metabolic engineering to build complex genetic circuits and optimize the levels of native and heterologous gene products. Transcription activator-like effectors (TALEs) are bacterial virulence factors that have recently gained traction in biotechnology applications owing to their customizable DNA-binding specificity. In this work we expanded the versatility of these transcription factors to create an inducible TALE system by inserting tobacco-etch virus (TEV) protease recognition sites into the TALE backbone. The resulting engineered TALEs maintain transcriptional repression of their target genes in Escherichia coli, but are degraded after induction of the TEV protease, thereby promoting expression of the previously repressed target gene of interest. This TALE-TEV technology enables both repression and induction of plasmid or chromosomal target genes in a manner analogous to traditional repressor proteins but with the added flexibility of being operator-agnostic.

A transcription activator-like effector induction system mediated by proteolysis

PubMed Central

Copeland, Matthew F.; Politz, Mark C.; Johnson, Charles B.; Markley, Andrew L.; Pfleger, Brian F.

2016-01-01

Simple and predictable trans-acting regulatory tools are needed in the fields of synthetic biology and metabolic engineering to build complex genetic circuits and optimize the levels of native and heterologous gene products. Transcription activator-like effectors (TALEs) are bacterial virulence factors that have recently gained traction in biotechnology applications due to their customizable DNA binding specificity. In this work we expand the versatility of these transcription factors to create an inducible TALE system by inserting tobacco-etch virus (TEV) protease recognition sites into the TALE backbone. The resulting engineered TALEs maintain transcriptional repression of their target genes in Escherichia coli, but are degraded following the induction of the TEV protease, thereby promoting expression of the previously repressed target gene of interest. This TALE-TEV technology enables both repression and induction of plasmid or chromosomal target genes in a manner analogous to traditional repressor proteins but with the added flexibility of being operator agnostic. PMID:26854666

Molecular analysis of a chromosome-carried erm(B) gene and its flanking insertion points in Lactobacillus johnsonii G41.

PubMed

Flórez, Ana Belén; Ammor, Mohammed Salim; Delgado, Susana; Mayo, Baltasar

2006-12-01

An erm(B) gene carried on the Lactobacillus johnsonii G41 chromosome and the upstream and downstream regions were fully sequenced. Apparently, a 1,495-bp segment of pRE25 from Enterococcus faecalis carrying the erm(B) gene became inserted, by an unknown mechanism, into the L. johnsonii chromosome.

Novel insertion mutation of ABCB1 gene in an ivermectin-sensitive Border Collie.

PubMed

Han, Jae-Ik; Son, Hyoung-Won; Park, Seung-Cheol; Na, Ki-Jeong

2010-12-01

P-glycoprotein (P-gp) is encoded by the ABCB1 gene and acts as an efflux pump for xenobiotics. In the Border Collie, a nonsense mutation caused by a 4-base pair deletion in the ABCB1 gene is associated with a premature stop to P-gp synthesis. In this study, we examined the full-length coding sequence of the ABCB1 gene in an ivermectin-sensitive Border Collie that lacked the aforementioned deletion mutation. The sequence was compared to the corresponding sequences of a wild-type Beagle and seven ivermectin-tolerant family members of the Border Collie. When compared to the wild-type Beagle sequence, that of the ivermectin-sensitive Border Collie was found to have one insertion mutation and eight single nucleotide polymorphisms (SNPs) in the coding sequence of the ABCB1 gene. While the eight SNPs were also found in the family members' sequences, the insertion mutation was found only in the ivermectin-sensitive dog. These results suggest the possibility that the SNPs are species-specific features of the ABCB1 gene in Border Collies, and that the insertion mutation may be related to ivermectin intolerance.

Novel insertion mutation of ABCB1 gene in an ivermectin-sensitive Border Collie

PubMed Central

Han, Jae-Ik; Son, Hyoung-Won; Park, Seung-Cheol

2010-01-01

P-glycoprotein (P-gp) is encoded by the ABCB1 gene and acts as an efflux pump for xenobiotics. In the Border Collie, a nonsense mutation caused by a 4-base pair deletion in the ABCB1 gene is associated with a premature stop to P-gp synthesis. In this study, we examined the full-length coding sequence of the ABCB1 gene in an ivermectin-sensitive Border Collie that lacked the aforementioned deletion mutation. The sequence was compared to the corresponding sequences of a wild-type Beagle and seven ivermectin-tolerant family members of the Border Collie. When compared to the wild-type Beagle sequence, that of the ivermectin-sensitive Border Collie was found to have one insertion mutation and eight single nucleotide polymorphisms (SNPs) in the coding sequence of the ABCB1 gene. While the eight SNPs were also found in the family members' sequences, the insertion mutation was found only in the ivermectin-sensitive dog. These results suggest the possibility that the SNPs are species-specific features of the ABCB1 gene in Border Collies, and that the insertion mutation may be related to ivermectin intolerance. PMID:21113104

[Isolation and function of genes regulating aphB expression in Vibrio cholerae].

PubMed

Chen, Haili; Zhu, Zhaoqin; Zhong, Zengtao; Zhu, Jun; Kan, Biao

2012-02-04

We identified genes that regulate the expression of aphB, the gene encoding a key virulence regulator in Vibrio cholerae O1 E1 Tor C6706(-). We constructed a transposon library in V. cholerae C6706 strain containing a P(aphB)-luxCDABE and P(aphB)-lacZ transcriptional reporter plasmids. Using a chemiluminescence imager system, we rapidly detected aphB promoter expression level at a large scale. We then sequenced the transposon insertion sites by arbitrary PCR and sequencing analysis. We obtained two candidate mutants T1 and T2 which displayed reduced aphB expression from approximately 40,000 transposon insertion mutants. Sequencing analysis shows that Tn inserted in vc1585 reading frame in the T1 mutant and Tn inserted in the end of coding sequence of vc1602 in the T2 mutant. By using a genetic screen, we identified two potential genes that may involve in regulation of the expression of the key virulence regulator AphB. This study sheds light on our further investigation to fully understand V. cholerae virulence gene regulatory cascades.

Reverse genetics of measles virus and resulting multivalent recombinant vaccines: applications of recombinant measles viruses.

PubMed

Billeter, M A; Naim, H Y; Udem, S A

2009-01-01

An overview is given on the development of technologies to allow reverse genetics of RNA viruses, i.e., the rescue of viruses from cDNA, with emphasis on nonsegmented negative-strand RNA viruses (Mononegavirales), as exemplified for measles virus (MV). Primarily, these technologies allowed site-directed mutagenesis, enabling important insights into a variety of aspects of the biology of these viruses. Concomitantly, foreign coding sequences were inserted to (a) allow localization of virus replication in vivo through marker gene expression, (b) develop candidate multivalent vaccines against measles and other pathogens, and (c) create candidate oncolytic viruses. The vector use of these viruses was experimentally encouraged by the pronounced genetic stability of the recombinants unexpected for RNA viruses, and by the high load of insertable genetic material, in excess of 6 kb. The known assets, such as the small genome size of the vector in comparison to DNA viruses proposed as vectors, the extensive clinical experience of attenuated MV as vaccine with a proven record of high safety and efficacy, and the low production cost per vaccination dose are thus favorably complemented.

P-Element Insertion Alleles of Essential Genes on the Third Chromosome of Drosophila Melanogaster: Correlation of Physical and Cytogenetic Maps in Chromosomal Region 86e-87f

PubMed Central

Deak, P.; Omar, M. M.; Saunders, RDC.; Pal, M.; Komonyi, O.; Szidonya, J.; Maroy, P.; Zhang, Y.; Ashburner, M.; Benos, P.; Savakis, C.; Siden-Kiamos, I.; Louis, C.; Bolshakov, V. N.; Kafatos, F. C.; Madueno, E.; Modolell, J.; Glover, D. M.

1997-01-01

We have established a collection of 2460 lethal or semi-lethal mutant lines using a procedure thought to insert single P elements into vital genes on the third chromosome of Drosophila melanogaster. More than 1200 randomly selected lines were examined by in situ hybridization and 90% found to contain single insertions at sites that mark 89% of all lettered subdivisions of the Bridges' map. A set of chromosomal deficiencies that collectively uncover ~25% of the euchromatin of chromosome 3 reveal lethal mutations in 468 lines corresponding to 145 complementation groups. We undertook a detailed analysis of the cytogenetic interval 86E-87F and identified 87 P-element-induced mutations falling into 38 complementation groups, 16 of which correspond to previously known genes. Twenty-one of these 38 complementation groups have at least one allele that has a P-element insertion at a position consistent with the cytogenetics of the locus. We have rescued P elements and flanking chromosomal sequences from the 86E-87F region in 35 lines with either lethal or genetically silent P insertions, and used these as probes to identify cosmids and P1 clones from the Drosophila genome projects. This has tied together the physical and genetic maps and has linked 44 previously identified cosmid contigs into seven ``supercontigs'' that span the interval. STS data for sequences flanking one side of the P-element insertions in 49 lines has identified insertions in the αγ element at 87C, two known transposable elements, and the open reading frames of seven putative single copy genes. These correspond to five known genes in this interval, and two genes identified by the homology of their predicted products to known proteins from other organisms. PMID:9409831

Transposable elements generate population-specific insertional patterns and allelic variation in genes of wild emmer wheat (Triticum turgidum ssp. dicoccoides).

PubMed

Domb, Katherine; Keidar, Danielle; Yaakov, Beery; Khasdan, Vadim; Kashkush, Khalil

2017-10-27

Natural populations of the tetraploid wild emmer wheat (genome AABB) were previously shown to demonstrate eco-geographically structured genetic and epigenetic diversity. Transposable elements (TEs) might make up a significant part of the genetic and epigenetic variation between individuals and populations because they comprise over 80% of the wild emmer wheat genome. In this study, we performed detailed analyses to assess the dynamics of transposable elements in 50 accessions of wild emmer wheat collected from 5 geographically isolated sites. The analyses included: the copy number variation of TEs among accessions in the five populations, population-unique insertional patterns, and the impact of population-unique/specific TE insertions on structure and expression of genes. We assessed the copy numbers of 12 TE families using real-time quantitative PCR, and found significant copy number variation (CNV) in the 50 wild emmer wheat accessions, in a population-specific manner. In some cases, the CNV difference reached up to 6-fold. However, the CNV was TE-specific, namely some TE families showed higher copy numbers in one or more populations, and other TE families showed lower copy numbers in the same population(s). Furthermore, we assessed the insertional patterns of 6 TE families using transposon display (TD), and observed significant population-specific insertional patterns. The polymorphism levels of TE-insertional patterns reached 92% among all wild emmer wheat accessions, in some cases. In addition, we observed population-specific/unique TE insertions, some of which were located within or close to protein-coding genes, creating allelic variations in a population-specific manner. We also showed that those genes are differentially expressed in wild emmer wheat. For the first time, this study shows that TEs proliferate in wild emmer wheat in a population-specific manner, creating new alleles of genes, which contribute to the divergent evolution of homeologous genes from the A and B subgenomes.

Gene-specific cell labeling using MiMIC transposons

PubMed Central

Gnerer, Joshua P.; Venken, Koen J. T.; Dierick, Herman A.

2015-01-01

Binary expression systems such as GAL4/UAS, LexA/LexAop and QF/QUAS have greatly enhanced the power of Drosophila as a model organism by allowing spatio-temporal manipulation of gene function as well as cell and neural circuit function. Tissue-specific expression of these heterologous transcription factors relies on random transposon integration near enhancers or promoters that drive the binary transcription factor embedded in the transposon. Alternatively, gene-specific promoter elements are directly fused to the binary factor within the transposon followed by random or site-specific integration. However, such insertions do not consistently recapitulate endogenous expression. We used Minos-Mediated Integration Cassette (MiMIC) transposons to convert host loci into reliable gene-specific binary effectors. MiMIC transposons allow recombinase-mediated cassette exchange to modify the transposon content. We developed novel exchange cassettes to convert coding intronic MiMIC insertions into gene-specific binary factor protein-traps. In addition, we expanded the set of binary factor exchange cassettes available for non-coding intronic MiMIC insertions. We show that binary factor conversions of different insertions in the same locus have indistinguishable expression patterns, suggesting that they reliably reflect endogenous gene expression. We show the efficacy and broad applicability of these new tools by dissecting the cellular expression patterns of the Drosophila serotonin receptor gene family. PMID:25712101

MiMIC: a highly versatile transposon insertion resource for engineering Drosophila melanogaster genes

PubMed Central

Venken, Koen J. T.; Schulze, Karen L.; Haelterman, Nele A.; Pan, Hongling; He, Yuchun; Evans-Holm, Martha; Carlson, Joseph W.; Levis, Robert W.; Spradling, Allan C.; Hoskins, Roger A.; Bellen, Hugo J.

2011-01-01

We demonstrate the versatility of a collection of insertions of the transposon Minos mediated integration cassette (MiMIC), in Drosophila melanogaster. MiMIC contains a gene-trap cassette and the yellow+ marker flanked by two inverted bacteriophage ΦC31 attP sites. MiMIC integrates almost at random in the genome to create sites for DNA manipulation. The attP sites allow the replacement of the intervening sequence of the transposon with any other sequence through recombinase mediated cassette exchange (RMCE). We can revert insertions that function as gene traps and cause mutant phenotypes to wild type by RMCE and modify insertions to control GAL4 or QF overexpression systems or perform lineage analysis using the Flp system. Insertions within coding introns can be exchanged with protein-tag cassettes to create fusion proteins to follow protein expression and perform biochemical experiments. The applications of MiMIC vastly extend the Drosophila melanogaster toolkit. PMID:21985007

Alu element insertion in PKLR gene as a novel cause of pyruvate kinase deficiency in Middle Eastern patients.

PubMed

Lesmana, Harry; Dyer, Lisa; Li, Xia; Denton, James; Griffiths, Jenna; Chonat, Satheesh; Seu, Katie G; Heeney, Matthew M; Zhang, Kejian; Hopkin, Robert J; Kalfa, Theodosia A

2018-03-01

Pyruvate kinase deficiency (PKD) is the most frequent red blood cell enzyme abnormality of the glycolytic pathway and the most common cause of hereditary nonspherocytic hemolytic anemia. Over 250 PKLR-gene mutations have been described, including missense/nonsense, splicing and regulatory mutations, small insertions, small and gross deletions, causing PKD and hemolytic anemia of variable severity. Alu retrotransposons are the most abundant mobile DNA sequences in the human genome, contributing to almost 11% of its mass. Alu insertions have been associated with a number of human diseases either by disrupting a coding region or a splice signal. Here, we report on two unrelated Middle Eastern patients, both born from consanguineous parents, with transfusion-dependent hemolytic anemia, where sequence analysis revealed a homozygous insertion of AluYb9 within exon 6 of the PKLR gene, causing precipitous decrease of PKLR RNA levels. This Alu element insertion consists a previously unrecognized mechanism underlying pathogenesis of PKD. © 2017 Wiley Periodicals, Inc.

Effects of a Transposable Element Insertion on Alcohol Dehydrogenase Expression in Drosophila Melanogaster

PubMed Central

Dunn, R. C.; Laurie, C. C.

1995-01-01

Variation in the DNA sequence and level of alcohol dehydrogenase (Adh) gene expression in Drosophila melanogaster have been studied to determine what types of DNA polymorphisms contribute to phenotypic variation in natural populations. The Adh gene, like many others, shows a high level of variability in both DNA sequence and quantitative level of expression. A number of transposable element insertions occur in the Adh region and one of these, a copia insertion in the 5' flanking region, is associated with unusually low Adh expression. To determine whether this insertion (called RI42) causes the low expression level, the insertion was excised from the cloned RI42 Adh gene and the effect was assessed by P-element transformation. Removal of this insertion causes a threefold increase in the level of ADH, clearly showing that it contributes to the naturally occurring variation in expression at this locus. Removal of all but one LTR also causes a threefold increase, indicating that the mechanism is not a simple sequence disruption. Furthermore, this copia insertion, which is located between the two Adh promoters and their upstream enhancer sequences, has differential effects on the levels of proximal and distal transcripts. Finally, a test for the possible modifying effects of two suppressor loci, su(w(a)) and su(f), on this insertional mutation was negative, in contrast to a previous report in the literature. PMID:7498745

Bacterio-opsin mutants of Halobacterium halobium

PubMed Central

Betlach, Mary; Pfeifer, Felicitas; Friedman, James; Boyer, Herbert W.

1983-01-01

The bacterio-opsin (bop) gene of Halobacterium halobium R1 has been cloned with about 40 kilobases of flanking genomic sequence. The 40-kilobase segment is derived from the (G+C)-rich fraction of the chromosome and is not homologous to the major (pHH1) or minor endogenous covalently closed circular DNA species of H. halobium. A 5.1-kilobase Pst I fragment containing the bop gene was subcloned in pBR322 and a partial restriction map was determined. Defined restriction fragments of this clone were used as probes to analyze the defects associated with the bop gene in 12 bacterio-opsin mutants. Eleven out of 12 of the mutants examined had inserts ranging from 350 to 3,000 base pairs either in the bop gene or up to 1,400 base pairs upstream. The positions of the inserts were localized to four regions in the 5.1-kilobase genomic fragment: within the gene (one mutant), in a region that overlaps the 5′ end of the gene (seven mutants), and in two different upstream regions (three mutants). Two revertants of the mutant with the most distal insert had an additional insert in the same region. The polar effects of these inserts are discussed in terms of inactivation of a regulatory gene or disruption of part of a coordinately expressed operon. Given the defined nature of the bop mRNA—i.e., it has a 5′ leader sequence of three ribonucleotides—these observations indicate that the bop mRNA might be processed from a large mRNA transcript. Images PMID:16593291

Rotifer rDNA-specific R9 retrotransposable elements generate an exceptionally long target site duplication upon insertion.

PubMed

Gladyshev, Eugene A; Arkhipova, Irina R

2009-12-15

Ribosomal DNA genes in many eukaryotes contain insertions of non-LTR retrotransposable elements belonging to the R2 clade. These elements persist in the host genomes by inserting site-specifically into multicopy target sites, thereby avoiding random disruption of single-copy host genes. Here we describe R9 retrotransposons from the R2 clade in the 28S RNA genes of bdelloid rotifers, small freshwater invertebrate animals best known for their long-term asexuality and for their ability to survive repeated cycles of desiccation and rehydration. While the structural organization of R9 elements is highly similar to that of other members of the R2 clade, they are characterized by two distinct features: site-specific insertion into a previously unreported target sequence within the 28S gene, and an unusually long target site duplication of 126 bp. We discuss the implications of these findings in the context of bdelloid genome organization and the mechanisms of target-primed reverse transcription.

Generation and analysis of a barcode-tagged insertion mutant library in the fission yeast Schizosaccharomyces pombe.

PubMed

Chen, Bo-Ruei; Hale, Devin C; Ciolek, Peter J; Runge, Kurt W

2012-05-03

Barcodes are unique DNA sequence tags that can be used to specifically label individual mutants. The barcode-tagged open reading frame (ORF) haploid deletion mutant collections in the budding yeast Saccharomyces cerevisiae and the fission yeast Schizosaccharomyces pombe allow for high-throughput mutant phenotyping because the relative growth of mutants in a population can be determined by monitoring the proportions of their associated barcodes. While these mutant collections have greatly facilitated genome-wide studies, mutations in essential genes are not present, and the roles of these genes are not as easily studied. To further support genome-scale research in S. pombe, we generated a barcode-tagged fission yeast insertion mutant library that has the potential of generating viable mutations in both essential and non-essential genes and can be easily analyzed using standard molecular biological techniques. An insertion vector containing a selectable ura4+ marker and a random barcode was used to generate a collection of 10,000 fission yeast insertion mutants stored individually in 384-well plates and as six pools of mixed mutants. Individual barcodes are flanked by Sfi I recognition sites and can be oligomerized in a unique orientation to facilitate barcode sequencing. Independent genetic screens on a subset of mutants suggest that this library contains a diverse collection of single insertion mutations. We present several approaches to determine insertion sites. This collection of S. pombe barcode-tagged insertion mutants is well-suited for genome-wide studies. Because insertion mutations may eliminate, reduce or alter the function of essential and non-essential genes, this library will contain strains with a wide range of phenotypes that can be assayed by their associated barcodes. The design of the barcodes in this library allows for barcode sequencing using next generation or standard benchtop cloning approaches.

Genome-Wide Mutagenesis in Borrelia burgdorferi.

PubMed

Lin, Tao; Gao, Lihui

2018-01-01

Signature-tagged mutagenesis (STM) is a functional genomics approach to identify bacterial virulence determinants and virulence factors by simultaneously screening multiple mutants in a single host animal, and has been utilized extensively for the study of bacterial pathogenesis, host-pathogen interactions, and spirochete and tick biology. The signature-tagged transposon mutagenesis has been developed to investigate virulence determinants and pathogenesis of Borrelia burgdorferi. Mutants in genes important in virulence are identified by negative selection in which the mutants fail to colonize or disseminate in the animal host and tick vector. STM procedure combined with Luminex Flex ® Map™ technology and next-generation sequencing (e.g., Tn-seq) are the powerful high-throughput tools for the determination of Borrelia burgdorferi virulence determinants. The assessment of multiple tissue sites and two DNA resources at two different time points using Luminex Flex ® Map™ technology provides a robust data set. B. burgdorferi transposon mutant screening indicates that a high proportion of genes are the novel virulence determinants that are required for mouse and tick infection. In this protocol, an effective signature-tagged Himar1-based transposon suicide vector was developed and used to generate a sequence-defined library of nearly 4800 mutants in the infectious B. burgdorferi B31 clone. In STM, signature-tagged suicide vectors are constructed by inserting unique DNA sequences (tags) into the transposable elements. The signature-tagged transposon mutants are generated when transposon suicide vectors are transformed into an infectious B. burgdorferi clone, and the transposable element is transposed into the 5'-TA-3' sequence in the B. burgdorferi genome with the signature tag. The transposon library is created and consists of many sub-libraries, each sub-library has several hundreds of mutants with same tags. A group of mice or ticks are infected with a mixed population of mutants with different tags, after recovered from different tissues of infected mice and ticks, mutants from output pool and input pool are detected using high-throughput, semi-quantitative Luminex ® FLEXMAP™ or next-generation sequencing (Tn-seq) technologies. Thus far, we have created a high-density, sequence-defined transposon library of over 6600 STM mutants for the efficient genome-wide investigation of genes and gene products required for wild-type pathogenesis, host-pathogen interactions, in vitro growth, in vivo survival, physiology, morphology, chemotaxis, motility, structure, metabolism, gene regulation, plasmid maintenance and replication, etc. The insertion sites of 4480 transposon mutants have been determined. About 800 predicted protein-encoding genes in the genome were disrupted in the STM transposon library. The infectivity and some functions of 800 mutants in 500 genes have been determined. Analysis of these transposon mutants has yielded valuable information regarding the genes and gene products important in the pathogenesis and biology of B. burgdorferi and its tick vectors.

An Integrated Approach for RNA-seq Data Normalization.

PubMed

Yang, Shengping; Mercante, Donald E; Zhang, Kun; Fang, Zhide

2016-01-01

DNA copy number alteration is common in many cancers. Studies have shown that insertion or deletion of DNA sequences can directly alter gene expression, and significant correlation exists between DNA copy number and gene expression. Data normalization is a critical step in the analysis of gene expression generated by RNA-seq technology. Successful normalization reduces/removes unwanted nonbiological variations in the data, while keeping meaningful information intact. However, as far as we know, no attempt has been made to adjust for the variation due to DNA copy number changes in RNA-seq data normalization. In this article, we propose an integrated approach for RNA-seq data normalization. Comparisons show that the proposed normalization can improve power for downstream differentially expressed gene detection and generate more biologically meaningful results in gene profiling. In addition, our findings show that due to the effects of copy number changes, some housekeeping genes are not always suitable internal controls for studying gene expression. Using information from DNA copy number, integrated approach is successful in reducing noises due to both biological and nonbiological causes in RNA-seq data, thus increasing the accuracy of gene profiling.

Generation of a Tet-On Expression System to Study Transactivation Ability of Tax-2.

PubMed

Bignami, Fabio; Sozzi, Riccardo Alessio; Pilotti, Elisabetta

2017-01-01

HTLV Tax proteins (Tax-1 and Tax-2) are known to be able to transactivate several host cellular genes involved in complex molecular pathways. Here, we describe a stable and regulated high-level expression model based on Tet-On system, to study the capacity of Tax-2 to transactivate host genes. In particular, the Jurkat Tet-On cell line suitable for evaluating the ability of Tax-2 to stimulate transactivation of a specific host gene, CCL3L1 (C-C motif chemokine ligand 3 like 1 gene), was selected. Then, a plasmid expressing tax-2 gene under control of a tetracycline-response element was constructed. To avoid the production of a fusion protein between the report gene and the inserted gene, a bidirectional plasmid was designed. Maximum expression and fast response time were achieved by using nucleofection technology as transfection method. After developing an optimized protocol for efficiently transferring tax-2 gene in Jurkat Tet-On cellular model and exposing transfected cells to Dox (doxycycline, a tetracycline derivate), a kinetics of tax-2 expression through TaqMan Real-time PCR assay was determined.

An Improved Brome mosaic virus Silencing Vector: Greater Insert Stability and More Extensive VIGS1[OPEN

PubMed Central

2018-01-01

Virus-induced gene silencing (VIGS) is used extensively for gene function studies in plants. VIGS is inexpensive and rapid compared with silencing conducted through stable transformation, but many virus-silencing vectors, especially in grasses, induce only transient silencing phenotypes. A major reason for transient phenotypes is the instability of the foreign gene fragment (insert) in the vector during VIGS. Here, we report the development of a Brome mosaic virus (BMV)-based vector that better maintains inserts through modification of the original BMV vector RNA sequence. Modification of the BMV RNA3 sequence yielded a vector, BMVCP5, that better maintained phytoene desaturase and heat shock protein70-1 (HSP70-1) inserts in Nicotiana benthamiana and maize (Zea mays). Longer maintenance of inserts was correlated with greater target gene silencing and more extensive visible silencing phenotypes displaying greater tissue penetration and involving more leaves. The modified vector accumulated similarly to the original vector in N. benthamiana after agroinfiltration, thus maintaining a high titer of virus in this intermediate host used to produce virus inoculum for grass hosts. For HSP70, silencing one family member led to a large increase in the expression of another family member, an increase likely related to the target gene knockdown and not a general effect of virus infection. The cause of the increased insert stability in the modified vector is discussed in relationship to its recombination and accumulation potential. The modified vector will improve functional genomic studies in grasses, and the conceptual methods used to improve the vector may be applied to other VIGS vectors. PMID:29127260

The Transposable Element Mariner Mediates Germline Transformation in Drosophila Melanogaster

PubMed Central

Lidholm, D. A.; Lohe, A. R.; Hartl, D. L.

1993-01-01

A vector for germline transformation in Drosophila melanogaster was constructed using the transposable element mariner. The vector, denoted pMlwB, contains a mariner element disrupted by an insertion containing the wild-type white gene from D. melanogaster, the β-galactosidase gene from Escherichia coli and sequences that enable plasmid replication and selection in E. coli. The white gene is controlled by the promoter of the D. melanogaster gene for heat-shock protein 70, and the β-galactosidase gene is flanked upstream by the promoter of the transposable element P as well as that of mariner. The MlwB element was introduced into the germline of D. melanogaster by co-injection into embryos with an active mariner element, Mos1, which codes for a functional transposase and serves as a helper. Two independent germline insertions were isolated and characterized. The results show that the MlwB element inserted into the genome in a mariner-dependent manner with the termini of the inverted repeats inserted at a TA dinucleotide. Both insertions exhibit an unexpected degree of germline and somatic stability, even in the presence of an active mariner element in the genetic background. These results demonstrate that the mariner transposable element, which is small (1286 bp) and relatively homogeneous in size among different copies, is nevertheless capable of promoting the insertion of the large (13.2 kb) MlwB element. Because of the widespread phylogenetic distribution of mariner among insects, these results suggest that mariner might provide a wide hostrange transformation vector for insects. PMID:8394264

Maize transformation technology development for commercial event generation.

PubMed

Que, Qiudeng; Elumalai, Sivamani; Li, Xianggan; Zhong, Heng; Nalapalli, Samson; Schweiner, Michael; Fei, Xiaoyin; Nuccio, Michael; Kelliher, Timothy; Gu, Weining; Chen, Zhongying; Chilton, Mary-Dell M

2014-01-01

Maize is an important food and feed crop in many countries. It is also one of the most important target crops for the application of biotechnology. Currently, there are more biotech traits available on the market in maize than in any other crop. Generation of transgenic events is a crucial step in the development of biotech traits. For commercial applications, a high throughput transformation system producing a large number of high quality events in an elite genetic background is highly desirable. There has been tremendous progress in Agrobacterium-mediated maize transformation since the publication of the Ishida et al. (1996) paper and the technology has been widely adopted for transgenic event production by many labs around the world. We will review general efforts in establishing efficient maize transformation technologies useful for transgenic event production in trait research and development. The review will also discuss transformation systems used for generating commercial maize trait events currently on the market. As the number of traits is increasing steadily and two or more modes of action are used to control key pests, new tools are needed to efficiently transform vectors containing multiple trait genes. We will review general guidelines for assembling binary vectors for commercial transformation. Approaches to increase transformation efficiency and gene expression of large gene stack vectors will be discussed. Finally, recent studies of targeted genome modification and transgene insertion using different site-directed nuclease technologies will be reviewed.

Maize transformation technology development for commercial event generation

PubMed Central

Que, Qiudeng; Elumalai, Sivamani; Li, Xianggan; Zhong, Heng; Nalapalli, Samson; Schweiner, Michael; Fei, Xiaoyin; Nuccio, Michael; Kelliher, Timothy; Gu, Weining; Chen, Zhongying; Chilton, Mary-Dell M.

2014-01-01

Maize is an important food and feed crop in many countries. It is also one of the most important target crops for the application of biotechnology. Currently, there are more biotech traits available on the market in maize than in any other crop. Generation of transgenic events is a crucial step in the development of biotech traits. For commercial applications, a high throughput transformation system producing a large number of high quality events in an elite genetic background is highly desirable. There has been tremendous progress in Agrobacterium-mediated maize transformation since the publication of the Ishida et al. (1996) paper and the technology has been widely adopted for transgenic event production by many labs around the world. We will review general efforts in establishing efficient maize transformation technologies useful for transgenic event production in trait research and development. The review will also discuss transformation systems used for generating commercial maize trait events currently on the market. As the number of traits is increasing steadily and two or more modes of action are used to control key pests, new tools are needed to efficiently transform vectors containing multiple trait genes. We will review general guidelines for assembling binary vectors for commercial transformation. Approaches to increase transformation efficiency and gene expression of large gene stack vectors will be discussed. Finally, recent studies of targeted genome modification and transgene insertion using different site-directed nuclease technologies will be reviewed. PMID:25140170

Spliceosomal Intron Insertions in Genome Compacted Ray-Finned Fishes as Evident from Phylogeny of MC Receptors, Also Supported by a Few Other GPCRs

PubMed Central

Sinha, Rahul; Goyal, Pankaj; Grapputo, Alessandro

2011-01-01

Background Insertions of spliceosomal introns are very rare events during evolution of vertebrates and the mechanisms governing creation of novel intron(s) remain obscure. Largely, gene structures of melanocortin (MC) receptors are characterized by intron-less architecture. However, recently a few exceptions have been reported in some fishes. This warrants a systematic survey of MC receptors for understanding intron insertion events during vertebrate evolution. Methodology/Principal Findings We have compiled an extended list of MC receptors from different vertebrate genomes with variations in fishes. Notably, the closely linked MC2Rs and MC5Rs from a group of ray-finned fishes have three and one intron insertion(s), respectively, with conserved positions and intron phase. In both genes, one novel insertion was in the highly conserved DRY motif at the end of helix TM3. Further, the proto-splice site MAG↑R is maintained at intron insertion sites in these two genes. However, the orthologs of these receptors from zebrafish and tetrapods are intron-less, suggesting these introns are simultaneously created in selected fishes. Surprisingly, these novel introns are traceable only in four fish genomes. We found that these fish genomes are severely compacted after the separation from zebrafish. Furthermore, we also report novel intron insertions in P2Y receptors and in CHRM3. Finally, we report ultrasmall introns in MC2R genes from selected fishes. Conclusions/Significance The current repository of MC receptors illustrates that fishes have no MC3R ortholog. MC2R, MC5R, P2Y receptors and CHRM3 have novel intron insertions only in ray-finned fishes that underwent genome compaction. These receptors share one intron at an identical position suggestive of being inserted contemporaneously. In addition to repetitive elements, genome compaction is now believed to be a new hallmark that promotes intron insertions, as it requires rapid DNA breakage and subsequent repair processes to gain back normal functionality. PMID:21850219

Cloning and expression of vgb gene in Bacillus cereus, improve phenol and p-nitrophenol biodegradation

NASA Astrophysics Data System (ADS)

Vélez-Lee, Angel Eduardo; Cordova-Lozano, Felipe; Bandala, Erick R.; Sanchez-Salas, Jose Luis

2016-02-01

In this work, the vgb gene from Vitrocilla stercoraria was used to genetically modify a Bacillus cereus strain isolated from pulp and paper wastewater effluent. The gene was cloned in a multicopy plasmid (pUB110) or uni-copy gene using a chromosome integrative vector (pTrpBG1). B. cereus and its recombinant strains were used for phenol and p-nitrophenol biodegradation using aerobic or micro-aerobic conditions and two different temperatures (i.e. 37 and 25 °C). Complete (100%) phenol degradation was obtained for the strain where the multicopy of vgb gene was present, 98% for the strain where uni-copy gene was present and 45% for wild type strain for the same experimental conditions (i.e. 37 °C and aerobic condition). For p-nitrophenol degradation at the same conditions, the strain with the multi-copy vgb gene was capable to achieve 50% of biodegradation, ˜100% biodegradation was obtained using the uni-copy strain and ˜24% for wild type strain. When the micro-aerobic condition was tested, the biodegradation yield showed a significant decreased. The biodegradation trend observed for aerobic was similar for micro-aerobic assessments: the modified strains showed higher degradation rates when compared with wild type strain. For all experimental conditions, the highest p-nitrophenol degradation was observed using the strain with uni-copy of vgb gene. Besides the increase of biodegradative capability of the strain, insertion of the vgb gene was observed able to modify other morphological characteristics such as avoiding the typical flake formation in the B. cereus culture. In both cases, the modification seems to be related with the enhancement of oxygen supply to the cells generated by the vgb gene insertion. The application of the genetically modified microorganism (GMM) to the biodegradation of pollutants in contaminated water possesses high potential as an environmentally friendly technology to facing this emergent problem.

Insertion and deletion mutagenesis of the human cytomegalovirus genome

DOE Office of Scientific and Technical Information (OSTI.GOV)

Spaete, R.R.; Mocarski, E.S.

1987-10-01

Studies on human cytomegalovirus (CMV) have been limited by a paucity of molecular genetic techniques available for manipulating the viral genome. The authors have developed methods for site-specific insertion and deletion mutagenesis of CMV utilizing a modified Escherichia coli lacZ gene as a genetic marker. The lacZ gene was placed under the control of the major ..beta.. gene regulatory signals and inserted into the viral genome by homologous recombination, disrupting one of two copies of this ..beta.. gene within the L-component repeats of CMV DNA. They observed high-level expression of ..beta..-galactosidase by the recombinant in a temporally authentic manner, withmore » levels of this enzyme approaching 1% of total protein in infected cells. Thus, CMV is an efficient vector for high-level expression of foreign gene products in human cells. Using back selection of lacZ-deficient virus in the presence of the chromogenic substrate 5-bromo-4-chloro-3-indolyl ..beta..-D-galactoside, they generated random endpoint deletion mutants. Analysis of these mutant revealed that CMV DNA sequences flanking the insert had been removed, thereby establishing this approach as a means of determining whether sequences flanking a lacZ insertion are dispensable for viral growth. In an initial test of the methods, they have shown that 7800 base pairs of one copy of L-component repeat sequences can be deleted without affecting viral growth in human fibroblasts.« less

A Guide to Computational Tools and Design Strategies for Genome Editing Experiments in Zebrafish Using CRISPR/Cas9.

PubMed

Prykhozhij, Sergey V; Rajan, Vinothkumar; Berman, Jason N

2016-02-01

The development of clustered regularly interspaced short palindromic repeats (CRISPR)/Cas9 technology for mainstream biotechnological use based on its discovery as an adaptive immune mechanism in bacteria has dramatically improved the ability of molecular biologists to modify genomes of model organisms. The zebrafish is highly amenable to applications of CRISPR/Cas9 for mutation generation and a variety of DNA insertions. Cas9 protein in complex with a guide RNA molecule recognizes where to cut the homologous DNA based on a short stretch of DNA termed the protospacer-adjacent motif (PAM). Rapid and efficient identification of target sites immediately preceding PAM sites, quantification of genomic occurrences of similar (off target) sites and predictions of cutting efficiency are some of the features where computational tools play critical roles in CRISPR/Cas9 applications. Given the rapid advent and development of this technology, it can be a challenge for researchers to remain up to date with all of the important technological developments in this field. We have contributed to the armamentarium of CRISPR/Cas9 bioinformatics tools and trained other researchers in the use of appropriate computational programs to develop suitable experimental strategies. Here we provide an in-depth guide on how to use CRISPR/Cas9 and other relevant computational tools at each step of a host of genome editing experimental strategies. We also provide detailed conceptual outlines of the steps involved in the design and execution of CRISPR/Cas9-based experimental strategies, such as generation of frameshift mutations, larger chromosomal deletions and inversions, homology-independent insertion of gene cassettes and homology-based knock-in of defined point mutations and larger gene constructs.

CRISPR-Cas9D10A Nickase-Assisted Genome Editing in Lactobacillus casei

PubMed Central

Song, Xin; Huang, He; Xiong, Zhiqiang

2017-01-01

ABSTRACT Lactobacillus casei has drawn increasing attention as a health-promoting probiotic, while effective genetic manipulation tools are often not available, e.g., the single-gene knockout in L. casei still depends on the classic homologous recombination-dependent double-crossover strategy, which is quite labor-intensive and time-consuming. In the present study, a rapid and precise genome editing plasmid, pLCNICK, was established for L. casei genome engineering based on CRISPR-Cas9D10A. In addition to the P23-Cas9D10A and Pldh-sgRNA (single guide RNA) expression cassettes, pLCNICK includes the homologous arms of the target gene as repair templates. The ability and efficiency of chromosomal engineering using pLCNICK were evaluated by in-frame deletions of four independent genes and chromosomal insertion of an enhanced green fluorescent protein (eGFP) expression cassette at the LC2W_1628 locus. The efficiencies associated with in-frame deletions and chromosomal insertion is 25 to 62%. pLCNICK has been proved to be an effective, rapid, and precise tool for genome editing in L. casei, and its potential application in other lactic acid bacteria (LAB) is also discussed in this study. IMPORTANCE The lack of efficient genetic tools has limited the investigation and biotechnological application of many LAB. The CRISPR-Cas9D10A nickase-based genome editing in Lactobacillus casei, an important food industrial microorganism, was demonstrated in this study. This genetic tool allows efficient single-gene deletion and insertion to be accomplished by one-step transformation, and the cycle time is reduced to 9 days. It facilitates a rapid and precise chromosomal manipulation in L. casei and overcomes some limitations of previous methods. This editing system can serve as a basic technological platform and offers the possibility to start a comprehensive investigation on L. casei. As a broad-host-range plasmid, pLCNICK has the potential to be adapted to other Lactobacillus species for genome editing. PMID:28864652

Fusion primer and nested integrated PCR (FPNI-PCR): a new high-efficiency strategy for rapid chromosome walking or flanking sequence cloning

PubMed Central

2011-01-01

Background The advent of genomics-based technologies has revolutionized many fields of biological enquiry. However, chromosome walking or flanking sequence cloning is still a necessary and important procedure to determining gene structure. Such methods are used to identify T-DNA insertion sites and so are especially relevant for organisms where large T-DNA insertion libraries have been created, such as rice and Arabidopsis. The currently available methods for flanking sequence cloning, including the popular TAIL-PCR technique, are relatively laborious and slow. Results Here, we report a simple and effective fusion primer and nested integrated PCR method (FPNI-PCR) for the identification and cloning of unknown genomic regions flanked known sequences. In brief, a set of universal primers was designed that consisted of various 15-16 base arbitrary degenerate oligonucleotides. These arbitrary degenerate primers were fused to the 3' end of an adaptor oligonucleotide which provided a known sequence without degenerate nucleotides, thereby forming the fusion primers (FPs). These fusion primers are employed in the first step of an integrated nested PCR strategy which defines the overall FPNI-PCR protocol. In order to demonstrate the efficacy of this novel strategy, we have successfully used it to isolate multiple genomic sequences namely, 21 orthologs of genes in various species of Rosaceace, 4 MYB genes of Rosa rugosa, 3 promoters of transcription factors of Petunia hybrida, and 4 flanking sequences of T-DNA insertion sites in transgenic tobacco lines and 6 specific genes from sequenced genome of rice and Arabidopsis. Conclusions The successful amplification of target products through FPNI-PCR verified that this novel strategy is an effective, low cost and simple procedure. Furthermore, FPNI-PCR represents a more sensitive, rapid and accurate technique than the established TAIL-PCR and hiTAIL-PCR procedures. PMID:22093809

Evidence for a Retroviral Insertion in TRPM1 as the Cause of Congenital Stationary Night Blindness and Leopard Complex Spotting in the Horse

PubMed Central

Bellone, Rebecca R.; Holl, Heather; Setaluri, Vijayasaradhi; Devi, Sulochana; Maddodi, Nityanand; Archer, Sheila; Sandmeyer, Lynne; Ludwig, Arne; Foerster, Daniel; Pruvost, Melanie; Reissmann, Monika; Bortfeldt, Ralf; Adelson, David L.; Lim, Sim Lin; Nelson, Janelle; Haase, Bianca; Engensteiner, Martina; Leeb, Tosso; Forsyth, George; Mienaltowski, Michael J.; Mahadevan, Padmanabhan; Hofreiter, Michael; Paijmans, Johanna L. A.; Gonzalez-Fortes, Gloria; Grahn, Bruce; Brooks, Samantha A.

2013-01-01

Leopard complex spotting is a group of white spotting patterns in horses caused by an incompletely dominant gene (LP) where homozygotes (LP/LP) are also affected with congenital stationary night blindness. Previous studies implicated Transient Receptor Potential Cation Channel, Subfamily M, Member 1 (TRPM1) as the best candidate gene for both CSNB and LP. RNA-Seq data pinpointed a 1378 bp insertion in intron 1 of TRPM1 as the potential cause. This insertion, a long terminal repeat (LTR) of an endogenous retrovirus, was completely associated with LP, testing 511 horses (χ2=1022.00, p<<0.0005), and CSNB, testing 43 horses (χ2=43, p<<0.0005). The LTR was shown to disrupt TRPM1 transcription by premature poly-adenylation. Furthermore, while deleterious transposable element insertions should be quickly selected against the identification of this insertion in three ancient DNA samples suggests it has been maintained in the horse gene pool for at least 17,000 years. This study represents the first description of an LTR insertion being associated with both a pigmentation phenotype and an eye disorder. PMID:24167615

Evidence for a retroviral insertion in TRPM1 as the cause of congenital stationary night blindness and leopard complex spotting in the horse.

PubMed

Bellone, Rebecca R; Holl, Heather; Setaluri, Vijayasaradhi; Devi, Sulochana; Maddodi, Nityanand; Archer, Sheila; Sandmeyer, Lynne; Ludwig, Arne; Foerster, Daniel; Pruvost, Melanie; Reissmann, Monika; Bortfeldt, Ralf; Adelson, David L; Lim, Sim Lin; Nelson, Janelle; Haase, Bianca; Engensteiner, Martina; Leeb, Tosso; Forsyth, George; Mienaltowski, Michael J; Mahadevan, Padmanabhan; Hofreiter, Michael; Paijmans, Johanna L A; Gonzalez-Fortes, Gloria; Grahn, Bruce; Brooks, Samantha A

2013-01-01

Leopard complex spotting is a group of white spotting patterns in horses caused by an incompletely dominant gene (LP) where homozygotes (LP/LP) are also affected with congenital stationary night blindness. Previous studies implicated Transient Receptor Potential Cation Channel, Subfamily M, Member 1 (TRPM1) as the best candidate gene for both CSNB and LP. RNA-Seq data pinpointed a 1378 bp insertion in intron 1 of TRPM1 as the potential cause. This insertion, a long terminal repeat (LTR) of an endogenous retrovirus, was completely associated with LP, testing 511 horses (χ(2)=1022.00, p<0.0005), and CSNB, testing 43 horses (χ(2)=43, p<0.0005). The LTR was shown to disrupt TRPM1 transcription by premature poly-adenylation. Furthermore, while deleterious transposable element insertions should be quickly selected against the identification of this insertion in three ancient DNA samples suggests it has been maintained in the horse gene pool for at least 17,000 years. This study represents the first description of an LTR insertion being associated with both a pigmentation phenotype and an eye disorder.

An episomal vector-based CRISPR/Cas9 system for highly efficient gene knockout in human pluripotent stem cells.

PubMed

Xie, Yifang; Wang, Daqi; Lan, Feng; Wei, Gang; Ni, Ting; Chai, Renjie; Liu, Dong; Hu, Shijun; Li, Mingqing; Li, Dajin; Wang, Hongyan; Wang, Yongming

2017-05-24

Human pluripotent stem cells (hPSCs) represent a unique opportunity for understanding the molecular mechanisms underlying complex traits and diseases. CRISPR/Cas9 is a powerful tool to introduce genetic mutations into the hPSCs for loss-of-function studies. Here, we developed an episomal vector-based CRISPR/Cas9 system, which we called epiCRISPR, for highly efficient gene knockout in hPSCs. The epiCRISPR system enables generation of up to 100% Insertion/Deletion (indel) rates. In addition, the epiCRISPR system enables efficient double-gene knockout and genomic deletion. To minimize off-target cleavage, we combined the episomal vector technology with double-nicking strategy and recent developed high fidelity Cas9. Thus the epiCRISPR system offers a highly efficient platform for genetic analysis in hPSCs.

Application of the CRISPR/Cas9 gene editing technique to research on functional genomes of parasites.

PubMed

Cui, Yubao; Yu, Lili

2016-12-01

The clustered regularly-interspaced short palindromic repeats (CRISPR) structural family functions as an acquired immune system in prokaryotes. Gene editing techniques have co-opted CRISPR and the associated Cas nucleases to allow for the precise genetic modification of human cells, zebrafish, mice, and other eukaryotes. Indeed, this approach has been used to induce a variety of modifications including directed insertion/deletion (InDel) of bases, gene knock-in, introduction of mutations in both alleles of a target gene, and deletion of small DNA fragments. Thus, CRISPR technology offers a precise molecular tool for directed genome modification with a range of potential applications; further, its high mutation efficiency, simple process, and low cost provide additional advantages over prior editing techniques. This paper will provide an overview of the basic structure and function of the CRISPR gene editing system as well as current and potential applications to research on parasites. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

Constantly evolving safety assessment protocols for GM foods.

PubMed

Sesikeran, B; Vasanthi, Siruguri

2008-01-01

he introduction of GM foods has led to the evolution of a food safety assessment paradigm that establishes safety of the GM food relative to its conventional counterpart. The GM foods currently approved and marketed in several countries have undergone extensive safety testing under a structured safety assessment framework evolved by international organizations like FAO, WHO, Codex and OECD. The major elements of safety assessment include molecular characterization of inserted genes and stability of the trait, toxicity and allergenicity potential of the expressed substances, compositional analysis, potential for gene transfer to gut microflora and unintentional effects of the genetic modification. As more number and type of food crops are being brought under the genetic modification regime, the adequacy of existing safety assessment protocols for establishing safety of these foods has been questioned. Such crops comprise GM crops with higher agronomic vigour, nutritional or health benefit/ by modification of plant metabolic pathways and those expressing bioactive substances and pharmaceuticals. The safety assessment challenges of these foods are the potential of the methods to detect unintentional effects with higher sensitivity and rigor. Development of databases on food compositions, toxicants and allergens is currently seen as an important aid to development of safety protocols. With the changing global trends in genetic modification technology future challenge would be to develop GM crops with minimum amount of inserted foreign DNA so as to reduce the burden of complex safety assessments while ensuring safety and utility of the technology.

The carnegie protein trap library: a versatile tool for Drosophila developmental studies.

PubMed

Buszczak, Michael; Paterno, Shelley; Lighthouse, Daniel; Bachman, Julia; Planck, Jamie; Owen, Stephenie; Skora, Andrew D; Nystul, Todd G; Ohlstein, Benjamin; Allen, Anna; Wilhelm, James E; Murphy, Terence D; Levis, Robert W; Matunis, Erika; Srivali, Nahathai; Hoskins, Roger A; Spradling, Allan C

2007-03-01

Metazoan physiology depends on intricate patterns of gene expression that remain poorly known. Using transposon mutagenesis in Drosophila, we constructed a library of 7404 protein trap and enhancer trap lines, the Carnegie collection, to facilitate gene expression mapping at single-cell resolution. By sequencing the genomic insertion sites, determining splicing patterns downstream of the enhanced green fluorescent protein (EGFP) exon, and analyzing expression patterns in the ovary and salivary gland, we found that 600-900 different genes are trapped in our collection. A core set of 244 lines trapped different identifiable protein isoforms, while insertions likely to act as GFP-enhancer traps were found in 256 additional genes. At least 8 novel genes were also identified. Our results demonstrate that the Carnegie collection will be useful as a discovery tool in diverse areas of cell and developmental biology and suggest new strategies for greatly increasing the coverage of the Drosophila proteome with protein trap insertions.

Neuroprotective therapies in glaucoma: II. Genetic nanotechnology tools.

PubMed

Nafissi, Nafiseh; Foldvari, Marianna

2015-01-01

Neurotrophic factor genome engineering could have many potential applications not only in the deeper understanding of neurodegenerative disorders but also in improved therapeutics. The fields of nanomedicine, regenerative medicine, and gene/cell-based therapy have been revolutionized by the development of safer and efficient non-viral technologies for gene delivery and genome editing with modern techniques for insertion of the neurotrophic factors into clinically relevant cells for a more sustained pharmaceutical effect. It has been suggested that the long-term expression of neurotrophic factors is the ultimate approach to prevent and/or treat neurodegenerative disorders such as glaucoma in patients who do not respond to available treatments or are at the progressive stage of the disease. Recent preclinical research suggests that novel neuroprotective gene and cell therapeutics could be promising approaches for both non-invasive neuroprotection and regenerative functions in the eye. Several progenitor and retinal cell types have been investigated as potential candidates for glaucoma neurotrophin therapy either as targets for gene therapy, options for cell replacement therapy, or as vehicles for gene delivery. Therefore, in parallel with deeper understanding of the specific protective effects of different neurotrophic factors and the potential therapeutic cell candidates for glaucoma neuroprotection, the development of non-invasive and highly specific gene delivery methods with safe and effective technologies to modify cell candidates for life-long neuroprotection in the eye is essential before investing in this field.

Assessment of clinical analytical sensitivity and specificity of next-generation sequencing for detection of simple and complex mutations.

PubMed

Chin, Ephrem L H; da Silva, Cristina; Hegde, Madhuri

2013-02-19

Detecting mutations in disease genes by full gene sequence analysis is common in clinical diagnostic laboratories. Sanger dideoxy terminator sequencing allows for rapid development and implementation of sequencing assays in the clinical laboratory, but it has limited throughput, and due to cost constraints, only allows analysis of one or at most a few genes in a patient. Next-generation sequencing (NGS), on the other hand, has evolved rapidly, although to date it has mainly been used for large-scale genome sequencing projects and is beginning to be used in the clinical diagnostic testing. One advantage of NGS is that many genes can be analyzed easily at the same time, allowing for mutation detection when there are many possible causative genes for a specific phenotype. In addition, regions of a gene typically not tested for mutations, like deep intronic and promoter mutations, can also be detected. Here we use 20 previously characterized Sanger-sequenced positive controls in disease-causing genes to demonstrate the utility of NGS in a clinical setting using standard PCR based amplification to assess the analytical sensitivity and specificity of the technology for detecting all previously characterized changes (mutations and benign SNPs). The positive controls chosen for validation range from simple substitution mutations to complex deletion and insertion mutations occurring in autosomal dominant and recessive disorders. The NGS data was 100% concordant with the Sanger sequencing data identifying all 119 previously identified changes in the 20 samples. We have demonstrated that NGS technology is ready to be deployed in clinical laboratories. However, NGS and associated technologies are evolving, and clinical laboratories will need to invest significantly in staff and infrastructure to build the necessary foundation for success.

Identification of Actinobacillus pleuropneumoniae Genes Preferentially Expressed During Infection Using In Vivo-Induced Antigen Technology (IVIAT).

PubMed

Zhang, Fei; Zhang, Yangyi; Wen, Xintian; Huang, Xiaobo; Wen, Yiping; Wu, Rui; Yan, Qigui; Huang, Yong; Ma, Xiaoping; Zhao, Qin; Cao, Sanjie

2015-10-01

Porcine pleuropneumonia is an infectious disease caused by Actinobacillus pleuropneumoniae. The identification of A. pleuropneumoniae genes, specially expressed in vivo, is a useful tool to reveal the mechanism of infection. IVIAT was used in this work to identify antigens expressed in vivo during A. pleuropneumoniae infection, using sera from individuals with chronic porcine pleuropneumonia. Sequencing of DNA inserts from positive clones showed 11 open reading frames with high homology to A. pleuropneumoniae genes. Based on sequence analysis, proteins encoded by these genes were involved in metabolism, replication, transcription regulation, and signal transduction. Moreover, three function-unknown proteins were also indentified in this work. Expression analysis using quantitative real-time PCR showed that most of the genes tested were up-regulated in vivo relative to their expression levels in vitro. IVI (in vivoinduced) genes that were amplified by PCR in different A. pleuropneumoniae strains showed that these genes could be detected in almost all of the strains. It is demonstrated that the identified IVI antigen may have important roles in the infection of A. pleuropneumoniae.

Novel insertion in exon 5 of the TCOF1 gene in twin sisters with Treacher Collins syndrome.

PubMed

Marszałek-Kruk, Bożena Anna; Wójcicki, Piotr; Smigiel, Robert; Trzeciak, Wiesław H

2012-08-01

Treacher Collins syndrome (TCS) is associated with an abnormal differentiation of the first and second pharyngeal arches during fetal development. This causes mostly craniofacial deformities, which require numerous corrective surgeries. TCS is an autosomal dominant disorder and it occurs in the general population at a frequency of 1 in 50,000 live births. The syndrome is caused by mutations in the TCOF1 gene, which encodes the serine/alanine-rich protein named Treacle. Over 120 mutations of the TCOF1 gene responsible for TCS have been described. About 70% of recognized mutations are deletions, which lead to a frame shift, formation of a termination codon, and shortening of the protein product of the gene. Herewith, a new heterozygotic insertion, c.484_668ins185bp, was described in two monozygotic twin sisters suffering from TCS. This mutation was absent in their father, brother, and uncle, indicating a de novo origin. The insertion causes a shift in the reading frame and premature termination of translation at 167 aa. The novel insertion is the longest ever found in the TCOF1 gene and the only one found among monozygotic twin sisters.

IS1598 (IsPg4) distributed to abscess-forming strains of Porphyromonas gingivalis may enhance virulence through upregulation of nrdD-like gene expression.

PubMed

Sonoi, Norihiro; Maeda, Hiroshi; Murauchi, Toshimitsu; Yamamoto, Tadashi; Omori, Kazuhiro; Kokeguchi, Susumu; Naruishi, Koji; Takashiba, Shogo

2018-01-01

An insertion sequence, IS1598 (IsPg4) has been found in virulent strains of Porphyromonas gingivalis in a murine abscess model. The present study was performed to investigate the effects of genetic rearrangements by IS1598 on the phenotypic characteristics of the virulent strains. For this purpose, we searched for a common insertion site of IS1598 among the virulent strains. Through cloning and database search, a common insertion site was identified beside an nrdD-like gene in the virulent FDC 381, W83 and W50 strains. In this region, predicted promoters of the nrdD-like gene and IS1598 are located in tandem, and accumulation of nrdD-like gene mRNA was 5-fold higher in virulent strains (W83, W50, FDC 381) than avirulent strains (ATCC33277, SU63, SUNY1021, ESO59 without IS1598). The role of the nrdD-like gene in virulence of P. gingivalis was investigated by constructing a nrdD-deficient mutant. In the murine abscess model, the parental W83 strain produced necrotic abscesses, while the nrdD-deficient mutant had almost lost this ability. Insertion of IS1598 into the nrdD-like gene promoter region may be related to the phenotypic differences in virulence among P. gingivalis strains through upregulation of the expression of this gene.

Gene-specific cell labeling using MiMIC transposons.

PubMed

Gnerer, Joshua P; Venken, Koen J T; Dierick, Herman A

2015-04-30

Binary expression systems such as GAL4/UAS, LexA/LexAop and QF/QUAS have greatly enhanced the power of Drosophila as a model organism by allowing spatio-temporal manipulation of gene function as well as cell and neural circuit function. Tissue-specific expression of these heterologous transcription factors relies on random transposon integration near enhancers or promoters that drive the binary transcription factor embedded in the transposon. Alternatively, gene-specific promoter elements are directly fused to the binary factor within the transposon followed by random or site-specific integration. However, such insertions do not consistently recapitulate endogenous expression. We used Minos-Mediated Integration Cassette (MiMIC) transposons to convert host loci into reliable gene-specific binary effectors. MiMIC transposons allow recombinase-mediated cassette exchange to modify the transposon content. We developed novel exchange cassettes to convert coding intronic MiMIC insertions into gene-specific binary factor protein-traps. In addition, we expanded the set of binary factor exchange cassettes available for non-coding intronic MiMIC insertions. We show that binary factor conversions of different insertions in the same locus have indistinguishable expression patterns, suggesting that they reliably reflect endogenous gene expression. We show the efficacy and broad applicability of these new tools by dissecting the cellular expression patterns of the Drosophila serotonin receptor gene family. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

Highly efficient CRISPR/HDR-mediated knock-in for mouse embryonic stem cells and zygotes.

PubMed

Wang, Bangmei; Li, Kunyu; Wang, Amy; Reiser, Michelle; Saunders, Thom; Lockey, Richard F; Wang, Jia-Wang

2015-10-01

The clustered regularly interspaced short palindromic repeat (CRISPR) gene editing technique, based on the non-homologous end-joining (NHEJ) repair pathway, has been used to generate gene knock-outs with variable sizes of small insertion/deletions with high efficiency. More precise genome editing, either the insertion or deletion of a desired fragment, can be done by combining the homology-directed-repair (HDR) pathway with CRISPR cleavage. However, HDR-mediated gene knock-in experiments are typically inefficient, and there have been no reports of successful gene knock-in with DNA fragments larger than 4 kb. Here, we describe the targeted insertion of large DNA fragments (7.4 and 5.8 kb) into the genomes of mouse embryonic stem (ES) cells and zygotes, respectively, using the CRISPR/HDR technique without NHEJ inhibitors. Our data show that CRISPR/HDR without NHEJ inhibitors can result in highly efficient gene knock-in, equivalent to CRISPR/HDR with NHEJ inhibitors. Although NHEJ is the dominant repair pathway associated with CRISPR-mediated double-strand breaks (DSBs), and biallelic gene knock-ins are common, NHEJ and biallelic gene knock-ins were not detected. Our results demonstrate that efficient targeted insertion of large DNA fragments without NHEJ inhibitors is possible, a result that should stimulate interest in understanding the mechanisms of high efficiency CRISPR targeting in general.

Various mutations compensate for a deleterious lacZα insert in the replication enhancer of M13 bacteriophage

PubMed Central

Zygiel, Emily M.; Noren, Karen A.; Adamkiewicz, Marta A.; Aprile, Richard J.; Bowditch, Heather K.; Carroll, Christine L.; Cerezo, Maria Abigail S.; Dagher, Adelle M.; Hebert, Courtney R.; Hebert, Lauren E.; Mahame, Gloria M.; Milne, Stephanie C.; Silvestri, Kelly M.; Sutherland, Sara E.; Sylvia, Alexandria M.; Taveira, Caitlyn N.; VanValkenburgh, David J.; Noren, Christopher J.

2017-01-01

M13 and other members of the Ff class of filamentous bacteriophages have been extensively employed in myriad applications. The Ph.D. series of phage-displayed peptide libraries were constructed from the M13-based vector M13KE. As a direct descendent of M13mp19, M13KE contains the lacZα insert in the intergenic region between genes IV and II, where it interrupts the replication enhancer of the (+) strand origin. Phage carrying this 816-nucleotide insert are viable, but propagate in E. coli at a reduced rate compared to wild-type M13 phage, presumably due to a replication defect caused by the insert. We have previously reported thirteen compensatory mutations in the 5’-untranslated region of gene II, which encodes the replication initiator protein gIIp. Here we report several additional mutations in M13KE that restore a wild-type propagation rate. Several clones from constrained-loop variable peptide libraries were found to have ejected the majority of lacZα gene in order to reconstruct the replication enhancer, albeit with a small scar. In addition, new point mutations in the gene II 5’-untranslated region or the gene IV coding sequence have been spontaneously observed or synthetically engineered. Through phage propagation assays, we demonstrate that all these genetic modifications compensate for the replication defect in M13KE and restore the wild-type propagation rate. We discuss the mechanisms by which the insertion and ejection of the lacZα gene, as well as the mutations in the regulatory region of gene II, influence the efficiency of replication initiation at the (+) strand origin. We also examine the presence and relevance of fast-propagating mutants in phage-displayed peptide libraries. PMID:28445507

Various mutations compensate for a deleterious lacZα insert in the replication enhancer of M13 bacteriophage.

PubMed

Zygiel, Emily M; Noren, Karen A; Adamkiewicz, Marta A; Aprile, Richard J; Bowditch, Heather K; Carroll, Christine L; Cerezo, Maria Abigail S; Dagher, Adelle M; Hebert, Courtney R; Hebert, Lauren E; Mahame, Gloria M; Milne, Stephanie C; Silvestri, Kelly M; Sutherland, Sara E; Sylvia, Alexandria M; Taveira, Caitlyn N; VanValkenburgh, David J; Noren, Christopher J; Hall, Marilena Fitzsimons

2017-01-01

M13 and other members of the Ff class of filamentous bacteriophages have been extensively employed in myriad applications. The Ph.D. series of phage-displayed peptide libraries were constructed from the M13-based vector M13KE. As a direct descendent of M13mp19, M13KE contains the lacZα insert in the intergenic region between genes IV and II, where it interrupts the replication enhancer of the (+) strand origin. Phage carrying this 816-nucleotide insert are viable, but propagate in E. coli at a reduced rate compared to wild-type M13 phage, presumably due to a replication defect caused by the insert. We have previously reported thirteen compensatory mutations in the 5'-untranslated region of gene II, which encodes the replication initiator protein gIIp. Here we report several additional mutations in M13KE that restore a wild-type propagation rate. Several clones from constrained-loop variable peptide libraries were found to have ejected the majority of lacZα gene in order to reconstruct the replication enhancer, albeit with a small scar. In addition, new point mutations in the gene II 5'-untranslated region or the gene IV coding sequence have been spontaneously observed or synthetically engineered. Through phage propagation assays, we demonstrate that all these genetic modifications compensate for the replication defect in M13KE and restore the wild-type propagation rate. We discuss the mechanisms by which the insertion and ejection of the lacZα gene, as well as the mutations in the regulatory region of gene II, influence the efficiency of replication initiation at the (+) strand origin. We also examine the presence and relevance of fast-propagating mutants in phage-displayed peptide libraries.

Avian Paramyxovirus Type-3 as a Vaccine Vector: Identification of a Genome Location for High Level Expression of a Foreign Gene

PubMed Central

Yoshida, Asuka; Samal, Siba K.

2017-01-01

Avian paramyxovirus serotype 3 (APMV-3) causes infection in a wide variety of avian species, but it does not cause apparent diseases in chickens. On the contrary, APMV-1, also known as Newcastle disease virus (NDV), can cause severe disease in chickens. Currently, natural low virulence strains of NDV are used as live-attenuated vaccines throughout the world. NDV is also being evaluated as a vaccine vector against poultry pathogens. However, due to routine vaccination programs, chickens often possess pre-existing antibodies against NDV, which may cause the chickens to be less sensitive to recombinant NDV vaccines expressing antigens of other avian pathogens. Therefore, it may be possible for an APMV-3 vector vaccine to circumvent this issue. In this study, we determined the optimal insertion site in the genome of APMV-3 for high level expression of a foreign gene. We generated recombinant APMV-3 viruses expressing the green fluorescent protein (GFP) by inserting the GFP gene at five different intergenic regions in the genome. The levels of GFP transcription and translation were evaluated. Interestingly, the levels of GFP transcription and translation did not follow the 3′-to-5′ attenuation mechanism of non-segmented, negative-sense RNA viruses. The insertion of GFP gene into the P-M gene junction resulted in higher level of expression of GFP than when the gene was inserted into the upstream N-P gene junction. Unlike NDV, insertion of GFP did not attenuate the growth efficiency of AMPV-3. Thus, APMV-3 could be a more useful vaccine vector for avian pathogens than NDV. PMID:28473820

Avian Paramyxovirus Type-3 as a Vaccine Vector: Identification of a Genome Location for High Level Expression of a Foreign Gene.

PubMed

Yoshida, Asuka; Samal, Siba K

2017-01-01

Avian paramyxovirus serotype 3 (APMV-3) causes infection in a wide variety of avian species, but it does not cause apparent diseases in chickens. On the contrary, APMV-1, also known as Newcastle disease virus (NDV), can cause severe disease in chickens. Currently, natural low virulence strains of NDV are used as live-attenuated vaccines throughout the world. NDV is also being evaluated as a vaccine vector against poultry pathogens. However, due to routine vaccination programs, chickens often possess pre-existing antibodies against NDV, which may cause the chickens to be less sensitive to recombinant NDV vaccines expressing antigens of other avian pathogens. Therefore, it may be possible for an APMV-3 vector vaccine to circumvent this issue. In this study, we determined the optimal insertion site in the genome of APMV-3 for high level expression of a foreign gene. We generated recombinant APMV-3 viruses expressing the green fluorescent protein (GFP) by inserting the GFP gene at five different intergenic regions in the genome. The levels of GFP transcription and translation were evaluated. Interestingly, the levels of GFP transcription and translation did not follow the 3'-to-5' attenuation mechanism of non-segmented, negative-sense RNA viruses. The insertion of GFP gene into the P-M gene junction resulted in higher level of expression of GFP than when the gene was inserted into the upstream N-P gene junction. Unlike NDV, insertion of GFP did not attenuate the growth efficiency of AMPV-3. Thus, APMV-3 could be a more useful vaccine vector for avian pathogens than NDV.

A stochastic evolution model for residue Insertion-Deletion Independent from Substitution.

PubMed

Lèbre, Sophie; Michel, Christian J

2010-12-01

We develop here a new class of stochastic models of gene evolution based on residue Insertion-Deletion Independent from Substitution (IDIS). Indeed, in contrast to all existing evolution models, insertions and deletions are modeled here by a concept in population dynamics. Therefore, they are not only independent from each other, but also independent from the substitution process. After a separate stochastic analysis of the substitution and the insertion-deletion processes, we obtain a matrix differential equation combining these two processes defining the IDIS model. By deriving a general solution, we give an analytical expression of the residue occurrence probability at evolution time t as a function of a substitution rate matrix, an insertion rate vector, a deletion rate and an initial residue probability vector. Various mathematical properties of the IDIS model in relation with time t are derived: time scale, time step, time inversion and sequence length. Particular expressions of the nucleotide occurrence probability at time t are given for classical substitution rate matrices in various biological contexts: equal insertion rate, insertion-deletion only and substitution only. All these expressions can be directly used for biological evolutionary applications. The IDIS model shows a strongly different stochastic behavior from the classical substitution only model when compared on a gene dataset. Indeed, by considering three processes of residue insertion, deletion and substitution independently from each other, it allows a more realistic representation of gene evolution and opens new directions and applications in this research field. Copyright © 2010 Elsevier Ltd. All rights reserved.

Construction of Poxviruses as Cloning Vectors: Insertion of the Thymidine Kinase Gene from Herpes Simplex Virus into the DNA of Infectious Vaccinia Virus

NASA Astrophysics Data System (ADS)

Panicali, Dennis; Paoletti, Enzo

1982-08-01

We have constructed recombinant vaccinia viruses containing the thymidine kinase gene from herpes simplex virus. The gene was inserted into the genome of a variant of vaccinia virus that had undergone spontaneous deletion as well as into the 120-megadalton genome of the large prototypic vaccinia variant. This was accomplished via in vivo recombination by contransfection of eukaryotic tissue culture cells with cloned BamHI-digested thymidine kinase gene from herpes simplex virus containing flanking vaccinia virus DNA sequences and infectious rescuing vaccinia virus. Pure populations of the recombinant viruses were obtained by replica filter techniques or by growth of the recombinant virus in biochemically selective medium. The herpes simplex virus thymidine kinase gene, as an insert in vaccinia virus, is transcribed in vivo and in vitro, and the fidelity of in vivo transcription into a functional gene product was detected by the phosphorylation of 5-[125I]iodo-2'-deoxycytidine.

Response to crizotinib in a non-small-cell lung cancer patient harboring an EML4-ALK fusion with an atypical LTBP1 insertion.

PubMed

Aguado, Cristina; Gil, Maria-de-Los-Llanos; Yeste, Zaira; Giménez-Capitán, Ana; Teixidó, Cristina; Karachaliou, Niki; Viteri, Santiago; Rosell, Rafael; Molina-Vila, Miguel A

2018-01-01

Fusion of the anaplastic lymphoma receptor tyrosine kinase gene ( ALK ) with the echinoderm microtubule-associated protein 4 gene ( EML4 ) is the second most common actionable alteration in non-small-cell lung cancer, with a frequency of 5%. Here, we present a case of an EML4-ALK-positive patient with an atypical in-frame insertion from the LTBP1 gene in the canonical junction of variant 1 . The patient was a 39-year-old never-smoker female diagnosed with Stage IV lung adenocarcinoma. A core biopsy was negative for EGFR and KRAS mutations but positive for ALK immunohistochemistry and fluorescence in situ hybridization. When submitted to nCounter, the sample showed a 3'/5' imbalance indicative of an ALK rearrangement, but failed to give a positive signal for any of the variants tested. Finally, a band with a molecular weight higher than expected appeared after reverse transcriptase-polymerase chain reaction analysis. When Sanger sequencing was performed, the band revealed an atypical EML4-ALK fusion gene with an in-frame 129 bp insertion. A 115 bp segment of the insertion corresponded to an intronic region of LTBP1 , a gene located in the short arm of chromosome 2, between ALK and EML4 . The patient received crizotinib and showed a good therapeutic response that is still ongoing after 12 months. Our result suggests that short in-frame insertions of other genes in the EML4-ALK junction do not affect the sensitivity of the EML4-ALK fusion protein to crizotinib.

Activity of genes with functions in human Williams-Beuren Syndrome are impacted by mobile element insertions in the gray wolf genome.

PubMed

vonHoldt, Bridgett M; Ji, Sarah S; Aardema, Matthew L; Stahler, Daniel; Udell, Monique A R; Sinsheimer, Janet S

2018-06-01

In canines, transposon dynamics have been associated with a hyper-social behavioral syndrome, although the functional mechanism has yet to be described. We investigate the epigenetic and transcriptional consequences of these behavior-associated mobile element insertions in dogs and Yellowstone wolves. We posit that the transposons themselves may not be the causative feature; rather, their transcriptional regulation may exert the functional impact. We survey four outlier transposons associated with hyper-sociability, with the expectation that they are targeted for epigenetic silencing. We predict hyper-methylation of mobile element insertions (MEIs), suggestive that the epigenetic silencing of and not the MEIs themselves may be driving dysregulation of nearby genes. We found that transposon-derived sequences are significantly hyper-methylated, regardless of their copy number or species. Further, we have assessed transcriptome sequence data and found evidence that mobile element insertions impact the expression levels of six genes (WBSCR17, LIMK1, GTF2I, WBSCR27, BAZ1B, and BCL7B), all of which have known roles in human Williams-Beuren syndrome due to changes in copy number, typically hemizygosity. Although further evidence is needed, our results suggest that a few insertions alter local expression at multiple genes, likely through a cis-regulatory mechanism that excludes proximal methylation.

Co-expression network analysis of duplicate genes in maize (Zea mays L.) reveals no subgenome bias.

PubMed

Li, Lin; Briskine, Roman; Schaefer, Robert; Schnable, Patrick S; Myers, Chad L; Flagel, Lex E; Springer, Nathan M; Muehlbauer, Gary J

2016-11-04

Gene duplication is prevalent in many species and can result in coding and regulatory divergence. Gene duplications can be classified as whole genome duplication (WGD), tandem and inserted (non-syntenic). In maize, WGD resulted in the subgenomes maize1 and maize2, of which maize1 is considered the dominant subgenome. However, the landscape of co-expression network divergence of duplicate genes in maize is still largely uncharacterized. To address the consequence of gene duplication on co-expression network divergence, we developed a gene co-expression network from RNA-seq data derived from 64 different tissues/stages of the maize reference inbred-B73. WGD, tandem and inserted gene duplications exhibited distinct regulatory divergence. Inserted duplicate genes were more likely to be singletons in the co-expression networks, while WGD duplicate genes were likely to be co-expressed with other genes. Tandem duplicate genes were enriched in the co-expression pattern where co-expressed genes were nearly identical for the duplicates in the network. Older gene duplications exhibit more extensive co-expression variation than younger duplications. Overall, non-syntenic genes primarily from inserted duplications show more co-expression divergence. Also, such enlarged co-expression divergence is significantly related to duplication age. Moreover, subgenome dominance was not observed in the co-expression networks - maize1 and maize2 exhibit similar levels of intra subgenome correlations. Intriguingly, the level of inter subgenome co-expression was similar to the level of intra subgenome correlations, and genes from specific subgenomes were not likely to be the enriched in co-expression network modules and the hub genes were not predominantly from any specific subgenomes in maize. Our work provides a comprehensive analysis of maize co-expression network divergence for three different types of gene duplications and identifies potential relationships between duplication types, duplication ages and co-expression consequences.

The loss-of-allele assay for ES cell screening and mouse genotyping.

PubMed

Frendewey, David; Chernomorsky, Rostislav; Esau, Lakeisha; Om, Jinsop; Xue, Yingzi; Murphy, Andrew J; Yancopoulos, George D; Valenzuela, David M

2010-01-01

Targeting vectors used to create directed mutations in mouse embryonic stem (ES) cells consist, in their simplest form, of a gene for drug selection flanked by mouse genomic sequences, the so-called homology arms that promote site-directed homologous recombination between the vector and the target gene. The VelociGene method for the creation of targeted mutations in ES cells employs targeting vectors, called BACVecs, that are based on bacterial artificial chromosomes. Compared with conventional short targeting vectors, BacVecs provide two major advantages: (1) their much larger homology arms promote high targeting efficiencies without the need for isogenicity or negative selection strategies; and (2) they enable deletions and insertions of up to 100kb in a single targeting event, making possible gene-ablating definitive null alleles and other large-scale genomic modifications. Because of their large arm sizes, however, BACVecs do not permit screening by conventional assays, such as long-range PCR or Southern blotting, that link the inserted targeting vector to the targeted locus. To exploit the advantages of BACVecs for gene targeting, we inverted the conventional screening logic in developing the loss-of-allele (LOA) assay, which quantifies the number of copies of the native locus to which the mutation was directed. In a correctly targeted ES cell clone, the LOA assay detects one of the two native alleles (for genes not on the X or Y chromosome), the other allele being disrupted by the targeted modification. We apply the same principle in reverse as a gain-of-allele assay to quantify the copy number of the inserted targeting vector. The LOA assay reveals a correctly targeted clone as having lost one copy of the native target gene and gained one copy of the drug resistance gene or other inserted marker. The combination of these quantitative assays makes LOA genotyping unequivocal and amenable to automated scoring. We use the quantitative polymerase chain reaction (qPCR) as our method of allele quantification, but any method that can reliably distinguish the difference between one and two copies of the target gene can be used to develop an LOA assay. We have designed qPCR LOA assays for deletions, insertions, point mutations, domain swaps, conditional, and humanized alleles and have used the insert assays to quantify the copy number of random insertion BAC transgenics. Because of its quantitative precision, specificity, and compatibility with high throughput robotic operations, the LOA assay eliminates bottlenecks in ES cell screening and mouse genotyping and facilitates maximal speed and throughput for knockout mouse production. Copyright (c) 2010 Elsevier Inc. All rights reserved.

Efficient gene editing in Corynebacterium glutamicum using the CRISPR/Cas9 system.

PubMed

Peng, Feng; Wang, Xinyue; Sun, Yang; Dong, Guibin; Yang, Yankun; Liu, Xiuxia; Bai, Zhonghu

2017-11-14

Corynebacterium glutamicum (C. glutamicum) has traditionally been used as a microbial cell factory for the industrial production of many amino acids and other industrially important commodities. C. glutamicum has recently been established as a host for recombinant protein expression; however, some intrinsic disadvantages could be improved by genetic modification. Gene editing techniques, such as deletion, insertion, or replacement, are important tools for modifying chromosomes. In this research, we report a CRISPR/Cas9 system in C. glutamicum for rapid and efficient genome editing, including gene deletion and insertion. The system consists of two plasmids: one containing a target-specific guide RNA and a homologous sequence to a target gene, the other expressing Cas9 protein. With high efficiency (up to 100%), this system was used to disrupt the porB, mepA, clpX and Ncgl0911 genes, which affect the ability to express proteins. The porB- and mepA-deletion strains had enhanced expression of green fluorescent protein, compared with the wild-type stain. This system can also be used to engineer point mutations and gene insertions. In this study, we adapted the CRISPR/Cas9 system from S. pyogens to gene deletion, point mutations and insertion in C. glutamicum. Compared with published genome modification methods, methods based on the CRISPR/Cas9 system can rapidly and efficiently achieve genome editing. Our research provides a powerful tool for facilitating the study of gene function, metabolic pathways, and enhanced productivity in C. glutamicum.

A Novel Intergenic ETnII-β Insertion Mutation Causes Multiple Malformations in Polypodia Mice

PubMed Central

Lehoczky, Jessica A.; Thomas, Peedikayil E.; Patrie, Kevin M.; Owens, Kailey M.; Villarreal, Lisa M.; Galbraith, Kenneth; Washburn, Joe; Johnson, Craig N.; Gavino, Bryant; Borowsky, Alexander D.; Millen, Kathleen J.; Wakenight, Paul; Law, William; Van Keuren, Margaret L.; Gavrilina, Galina; Hughes, Elizabeth D.; Saunders, Thomas L.; Brihn, Lesil; Nadeau, Joseph H.; Innis, Jeffrey W.

2013-01-01

Mouse early transposon insertions are responsible for ∼10% of spontaneous mutant phenotypes. We previously reported the phenotypes and genetic mapping of Polypodia, (Ppd), a spontaneous, X-linked dominant mutation with profound effects on body plan morphogenesis. Our new data shows that mutant mice are not born in expected Mendelian ratios secondary to loss after E9.5. In addition, we refined the Ppd genetic interval and discovered a novel ETnII-β early transposon insertion between the genes for Dusp9 and Pnck. The ETn inserted 1.6 kb downstream and antisense to Dusp9 and does not disrupt polyadenylation or splicing of either gene. Knock-in mice engineered to carry the ETn display Ppd characteristic ectopic caudal limb phenotypes, showing that the ETn insertion is the Ppd molecular lesion. Early transposons are actively expressed in the early blastocyst. To explore the consequences of the ETn on the genomic landscape at an early stage of development, we compared interval gene expression between wild-type and mutant ES cells. Mutant ES cell expression analysis revealed marked upregulation of Dusp9 mRNA and protein expression. Evaluation of the 5′ LTR CpG methylation state in adult mice revealed no correlation with the occurrence or severity of Ppd phenotypes at birth. Thus, the broad range of phenotypes observed in this mutant is secondary to a novel intergenic ETn insertion whose effects include dysregulation of nearby interval gene expression at early stages of development. PMID:24339789

An Improved Brome mosaic virus Silencing Vector: Greater Insert Stability and More Extensive VIGS.

PubMed

Ding, Xin Shun; Mannas, Stephen W; Bishop, Bethany A; Rao, Xiaolan; Lecoultre, Mitchell; Kwon, Soonil; Nelson, Richard S

2018-01-01

Virus-induced gene silencing (VIGS) is used extensively for gene function studies in plants. VIGS is inexpensive and rapid compared with silencing conducted through stable transformation, but many virus-silencing vectors, especially in grasses, induce only transient silencing phenotypes. A major reason for transient phenotypes is the instability of the foreign gene fragment (insert) in the vector during VIGS. Here, we report the development of a Brome mosaic virus (BMV)-based vector that better maintains inserts through modification of the original BMV vector RNA sequence. Modification of the BMV RNA3 sequence yielded a vector, BMVCP5, that better maintained phytoene desaturase and heat shock protein70-1 ( HSP70-1 ) inserts in Nicotiana benthamiana and maize ( Zea mays ). Longer maintenance of inserts was correlated with greater target gene silencing and more extensive visible silencing phenotypes displaying greater tissue penetration and involving more leaves. The modified vector accumulated similarly to the original vector in N. benthamiana after agroinfiltration, thus maintaining a high titer of virus in this intermediate host used to produce virus inoculum for grass hosts. For HSP70 , silencing one family member led to a large increase in the expression of another family member, an increase likely related to the target gene knockdown and not a general effect of virus infection. The cause of the increased insert stability in the modified vector is discussed in relationship to its recombination and accumulation potential. The modified vector will improve functional genomic studies in grasses, and the conceptual methods used to improve the vector may be applied to other VIGS vectors. © 2018 American Society of Plant Biologists. All Rights Reserved.

A methodology for spacecraft technology insertion analysis balancing benefit, cost, and risk

NASA Astrophysics Data System (ADS)

Bearden, David Allen

Emerging technologies are changing the way space missions are developed and implemented. Technology development programs are proceeding with the goal of enhancing spacecraft performance and reducing mass and cost. However, it is often the case that technology insertion assessment activities, in the interest of maximizing performance and/or mass reduction, do not consider synergistic system-level effects. Furthermore, even though technical risks are often identified as a large cost and schedule driver, many design processes ignore effects of cost and schedule uncertainty. This research is based on the hypothesis that technology selection is a problem of balancing interrelated (and potentially competing) objectives. Current spacecraft technology selection approaches are summarized, and a Methodology for Evaluating and Ranking Insertion of Technology (MERIT) that expands on these practices to attack otherwise unsolved problems is demonstrated. MERIT combines the modern techniques of technology maturity measures, parametric models, genetic algorithms, and risk assessment (cost and schedule) in a unique manner to resolve very difficult issues including: user-generated uncertainty, relationships between cost/schedule and complexity, and technology "portfolio" management. While the methodology is sufficiently generic that it may in theory be applied to a number of technology insertion problems, this research focuses on application to the specific case of small (<500 kg) satellite design. Small satellite missions are of particular interest because they are often developed under rigid programmatic (cost and schedule) constraints and are motivated to introduce advanced technologies into the design. MERIT is demonstrated for programs procured under varying conditions and constraints such as stringent performance goals, not-to-exceed costs, or hard schedule requirements. MERIT'S contributions to the engineering community are its: unique coupling of the aspects of performance, cost, and schedule; assessment of system level impacts of technology insertion; procedures for estimating uncertainties (risks) associated with advanced technology; and application of heuristics to facilitate informed system-level technology utilization decisions earlier in the conceptual design phase. MERIT extends the state of the art in technology insertion assessment selection practice and, if adopted, may aid designers in determining the configuration of complex systems that meet essential requirements in a timely, cost-effective manner.

[Construction and expression of the targeting super-antigen EGF-SEA fusion gene].

PubMed

Xie, Yang; Peng, Shaoping; Liao, Zhiying; Liu, Jiafeng; Liu, Xuemei; Chen, Weifeng

2014-05-01

To construct expression vector for the SEA-EGF fusion gene. Clone the SEA gene and the EGF gene segment with PCR and RT-PCR independently, and connect this two genes by the bridge PCR. Insert the fusion gene EGF-SEA into the expression vector PET-44. Induced the secretion of the fusion protein SEA-EGF by the antileptic. The gene fragment encoding EGF and SEA mature peptide was successfully cloned. The fusion gene EGF-SEA was successfully constructed and was inserted into expression vector. The new recombinant expression vector for fusion gene EGF-SEA is specific for head and neck cancer, laid the foundation for the further study of fusion protein SEA-EGF targeting immune therapy in head and neck tumors.

Contribution of transposable elements in the plant's genome.

PubMed

Sahebi, Mahbod; Hanafi, Mohamed M; van Wijnen, Andre J; Rice, David; Rafii, M Y; Azizi, Parisa; Osman, Mohamad; Taheri, Sima; Bakar, Mohd Faizal Abu; Isa, Mohd Noor Mat; Noor, Yusuf Muhammad

2018-07-30

Plants maintain extensive growth flexibility under different environmental conditions, allowing them to continuously and rapidly adapt to alterations in their environment. A large portion of many plant genomes consists of transposable elements (TEs) that create new genetic variations within plant species. Different types of mutations may be created by TEs in plants. Many TEs can avoid the host's defense mechanisms and survive alterations in transposition activity, internal sequence and target site. Thus, plant genomes are expected to utilize a variety of mechanisms to tolerate TEs that are near or within genes. TEs affect the expression of not only nearby genes but also unlinked inserted genes. TEs can create new promoters, leading to novel expression patterns or alternative coding regions to generate alternate transcripts in plant species. TEs can also provide novel cis-acting regulatory elements that act as enhancers or inserts within original enhancers that are required for transcription. Thus, the regulation of plant gene expression is strongly managed by the insertion of TEs into nearby genes. TEs can also lead to chromatin modifications and thereby affect gene expression in plants. TEs are able to generate new genes and modify existing gene structures by duplicating, mobilizing and recombining gene fragments. They can also facilitate cellular functions by sharing their transposase-coding regions. Hence, TE insertions can not only act as simple mutagens but can also alter the elementary functions of the plant genome. Here, we review recent discoveries concerning the contribution of TEs to gene expression in plant genomes and discuss the different mechanisms by which TEs can affect plant gene expression and reduce host defense mechanisms. Copyright © 2018 Elsevier B.V. All rights reserved.

The development of a cisgenic apple plant.

PubMed

Vanblaere, Thalia; Szankowski, Iris; Schaart, Jan; Schouten, Henk; Flachowsky, Henryk; Broggini, Giovanni A L; Gessler, Cesare

2011-07-20

Cisgenesis represents a step toward a new generation of GM crops. The lack of selectable genes (e.g. antibiotic or herbicide resistance) in the final product and the fact that the inserted gene(s) derive from organisms sexually compatible with the target crop should rise less environmental concerns and increase consumer's acceptance. Here we report the generation of a cisgenic apple plant by inserting the endogenous apple scab resistance gene HcrVf2 under the control of its own regulatory sequences into the scab susceptible apple cultivar Gala. A previously developed method based on Agrobacterium-mediated transformation combined with a positive and negative selection system and a chemically inducible recombination machinery allowed the generation of apple cv. Gala carrying the scab resistance gene HcrVf2 under its native regulatory sequences and no foreign genes. Three cisgenic lines were chosen for detailed investigation and were shown to carry a single T-DNA insertion and express the target gene HcrVf2. This is the first report of the generation of a true cisgenic plant. Copyright © 2011 Elsevier B.V. All rights reserved.

Genes and Gene Therapy

MedlinePlus

... a child can have a genetic disorder. Gene therapy is an experimental technique that uses genes to ... prevent disease. The most common form of gene therapy involves inserting a normal gene to replace an ...

Impact of the excision of an ancient repeat insertion on Rickettsia conorii guanylate kinase activity.

PubMed

Abergel, Chantal; Blanc, Guillaume; Monchois, Vincent; Renesto, Patricia; Sigoillot, Cécile; Ogata, Hiroyuki; Raoult, Didier; Claverie, Jean-Michel

2006-11-01

The genomic sequencing of Rickettsia conorii revealed a new family of Rickettsia-specific palindromic elements (RPEs) capable of in-frame insertion in preexisting open reading frames (ORFs). Many of these altered ORFs correspond to proteins with well-characterized or essential functions in other microorganisms. Previous experiments indicated that RPE-containing genes are normally transcribed and that no excision of the repeat occurs at the mRNA level. Using mass spectrometry, we now confirmed the retention of the RPE-derived amino acid residues in 4 proteins successfully expressed in Escherichia coli, raising the general question of the consequences of this common insertion event on the fitness of Rickettsia enzymes. The predicted guanylate kinase activity of the R. conorii gmk gene product was measured both on the RPE-containing and RPE-excised recombinant proteins. We show that the 2 proteins are active but exhibit substantial differences in their affinity for adenosine triphosphate, guanosine monophosphate, and catalytic constants. The distribution of the RPEgmk insert among Rickettsia species indicates that the insertion event is ancient and occurred after the divergence of Rickettsia felis and R. conorii but before that of Rickettsia helvetica and R. conorii. We found no evidence that the gmk gene fixed adaptive changes to compensate the RPE peptide insertion. Furthermore, the analysis of the rates of divergence in 23 RPE-containing genes indicates that coding RPE repeats tend to evolve under weak selective constraint, at a rate similar to intergenic noncoding RPE sequences. Altogether, these results suggest that the insertion of RPE-encoded "selfish peptides," although respecting the original fold and activity of the host proteins, might be slightly detrimental to the enzyme efficiency within limits tolerable for slow-growing intracellular parasites such as Rickettsia.

Genome-wide analyses of late pollen-preferred genes conserved in various rice cultivars and functional identification of a gene involved in the key processes of late pollen development.

PubMed

Moon, Sunok; Oo, Moe Moe; Kim, Backki; Koh, Hee-Jong; Oh, Sung Aeong; Yi, Gihwan; An, Gynheung; Park, Soon Ki; Jung, Ki-Hong

2018-04-23

Understanding late pollen development, including the maturation and pollination process, is a key component in maintaining crop yields. Transcriptome data obtained through microarray or RNA-seq technologies can provide useful insight into those developmental processes. Six series of microarray data from a public transcriptome database, the Gene Expression Omnibus of the National Center for Biotechnology Information, are related to anther and pollen development. We performed a systematic and functional study across the rice genome of genes that are preferentially expressed in the late stages of pollen development, including maturation and germination. By comparing the transcriptomes of sporophytes and male gametes over time, we identified 627 late pollen-preferred genes that are conserved among japonica and indica rice cultivars. Functional classification analysis with a MapMan tool kit revealed a significant association between cell wall organization/metabolism and mature pollen grains. Comparative analysis of rice and Arabidopsis demonstrated that genes involved in cell wall modifications and the metabolism of major carbohydrates are unique to rice. We used the GUS reporter system to monitor the expression of eight of those genes. In addition, we evaluated the significance of our candidate genes, using T-DNA insertional mutant population and the CRISPR/Cas9 system. Mutants from T-DNA insertion and CRISPR/Cas9 systems of a rice gene encoding glycerophosphoryl diester phosphodiesterase are defective in their male gamete transfer. Through the global analyses of the late pollen-preferred genes from rice, we found several biological features of these genes. First, biological process related to cell wall organization and modification is over-represented in these genes to support rapid tube growth. Second, comparative analysis of late pollen preferred genes between rice and Arabidopsis provide a significant insight on the evolutional disparateness in cell wall biogenesis and storage reserves of pollen. In addition, these candidates might be useful targets for future examinations of late pollen development, and will be a valuable resource for accelerating the understanding of molecular mechanisms for pollen maturation and germination processes in rice.

Novel insertion sequence- and transposon-mediated genetic rearrangements in genomic island SGI1 of Salmonella enterica serovar Kentucky.

PubMed

Doublet, Benoît; Praud, Karine; Bertrand, Sophie; Collard, Jean-Marc; Weill, François-Xavier; Cloeckaert, Axel

2008-10-01

Salmonella genomic island 1 (SGI1) is an integrative mobilizable element that harbors a multidrug resistance (MDR) gene cluster. Since its identification in epidemic Salmonella enterica serovar Typhimurium DT104 strains, variant SGI1 MDR gene clusters conferring different MDR phenotypes have been identified in several S. enterica serovars and classified as SGI1-A to -O. A study was undertaken to characterize SGI1 from serovar Kentucky strains isolated from travelers returning from Africa. Several strains tested were found to contain the partially characterized variant SGI1-K, recently described in a serovar Kentucky strain isolated in Australia. This variant contained only one cassette array, aac(3)-Id-aadA7, and an adjacent mercury resistance module. Here, the uncharacterized part of SGI1-K was sequenced. Downstream of the mer module similar to that found in Tn21, a mosaic genetic structure was found, comprising (i) part of Tn1721 containing the tetracycline resistance genes tetR and tet(A); (ii) part of Tn5393 containing the streptomycin resistance genes strAB, IS1133, and a truncated tnpR gene; and (iii) a Tn3-like region containing the tnpR gene and the beta-lactamase bla(TEM-1) gene flanked by two IS26 elements in opposite orientations. The rightmost IS26 element was shown to be inserted into the S044 open reading frame of the SGI1 backbone. This variant MDR region was named SGI1-K1 according to the previously described variant SGI1-K. Other SGI1-K MDR regions due to different IS26 locations, inversion, and partial deletions were characterized and named SGI1-K2 to -K5. Two new SGI1 variants named SGI1-P1 and -P2 contained only the Tn3-like region comprising the beta-lactamase bla(TEM-1) gene flanked by the two IS26 elements inserted into the SGI1 backbone. Three other new variants harbored only one IS26 element inserted in place of the MDR region of SGI1 and were named SGI1-Q1 to -Q3. Thus, in serovar Kentucky, the SGI1 MDR region undergoes recombinational and insertional events of transposon and insertion sequences, resulting in a higher diversity of MDR gene clusters than previously reported and consequently a higher diversity of MDR phenotypes.

Generation and analysis of a barcode-tagged insertion mutant library in the fission yeast Schizosaccharomyces pombe

PubMed Central

2012-01-01

Background Barcodes are unique DNA sequence tags that can be used to specifically label individual mutants. The barcode-tagged open reading frame (ORF) haploid deletion mutant collections in the budding yeast Saccharomyces cerevisiae and the fission yeast Schizosaccharomyces pombe allow for high-throughput mutant phenotyping because the relative growth of mutants in a population can be determined by monitoring the proportions of their associated barcodes. While these mutant collections have greatly facilitated genome-wide studies, mutations in essential genes are not present, and the roles of these genes are not as easily studied. To further support genome-scale research in S. pombe, we generated a barcode-tagged fission yeast insertion mutant library that has the potential of generating viable mutations in both essential and non-essential genes and can be easily analyzed using standard molecular biological techniques. Results An insertion vector containing a selectable ura4+ marker and a random barcode was used to generate a collection of 10,000 fission yeast insertion mutants stored individually in 384-well plates and as six pools of mixed mutants. Individual barcodes are flanked by Sfi I recognition sites and can be oligomerized in a unique orientation to facilitate barcode sequencing. Independent genetic screens on a subset of mutants suggest that this library contains a diverse collection of single insertion mutations. We present several approaches to determine insertion sites. Conclusions This collection of S. pombe barcode-tagged insertion mutants is well-suited for genome-wide studies. Because insertion mutations may eliminate, reduce or alter the function of essential and non-essential genes, this library will contain strains with a wide range of phenotypes that can be assayed by their associated barcodes. The design of the barcodes in this library allows for barcode sequencing using next generation or standard benchtop cloning approaches. PMID:22554201

The ATRX cDNA is prone to bacterial IS10 element insertions that alter its structure.

PubMed

Valle-García, David; Griffiths, Lyra M; Dyer, Michael A; Bernstein, Emily; Recillas-Targa, Félix

2014-01-01

The SWI/SNF-like chromatin-remodeling protein ATRX has emerged as a key factor in the regulation of α-globin gene expression, incorporation of histone variants into the chromatin template and, more recently, as a frequently mutated gene across a wide spectrum of cancers. Therefore, the availability of a functional ATRX cDNA for expression studies is a valuable tool for the scientific community. We have identified two independent transposon insertions of a bacterial IS10 element into exon 8 of ATRX isoform 2 coding sequence in two different plasmids derived from a single source. We demonstrate that these insertion events are common and there is an insertion hotspot within the ATRX cDNA. Such IS10 insertions produce a truncated form of ATRX, which significantly compromises its nuclear localization. In turn, we describe ways to prevent IS10 insertion during propagation and cloning of ATRX-containing vectors, including optimal growth conditions, bacterial strains, and suggested sequencing strategies. Finally, we have generated an insertion-free plasmid that is available to the community for expression studies of ATRX.

Allexiviruses may have acquired inserted sequences between the CP and CRP genes to change the translation reinitiation strategy of CRP.

PubMed

Yoshida, Naoto; Shimura, Hanako; Masuta, Chikara

2018-06-01

Allexiviruses are economically important garlic viruses that are involved in garlic mosaic diseases. In this study, we characterized the allexivirus cysteine-rich protein (CRP) gene located just downstream of the coat protein (CP) gene in the viral genome. We determined the nucleotide sequences of the CP and CRP genes from numerous allexivirus isolates and performed a phylogenetic analysis. According to the resulting phylogenetic tree, we found that allexiviruses were clearly divided into two major groups (group I and group II) based on the sequences of the CP and CRP genes. In addition, the allexiviruses in group II had distinct sequences just before the CRP gene, while group I isolates did not. The inserted sequence between the CP and CRP genes was partially complementary to garlic 18S rRNA. Using a potato virus X vector, we showed that the CRPs affected viral accumulation and symptom induction in Nicotiana benthamiana, suggesting that the allexivirus CRP is a pathogenicity determinant. We assume that the inserted sequences before the CRP gene may have been generated during viral evolution to alter the termination-reinitiation mechanism for coupled translation of CP and CRP.

Insertion of GaAs MMICs into EW systems

NASA Astrophysics Data System (ADS)

Schineller, E. R.; Pospishil, A.; Grzyb, J.

1989-09-01

Development activities on a microwave/mm-wave monolithic IC (MIMIC) program are described, as well as the methodology for inserting these GaAs IC chips into several EW systems. The generic EW chip set developed on the MIMIC program consists of 23 broadband chip types, including amplifiers, oscillators, mixers, switches, variable attenuators, power dividers, and power combiners. These chips are being designed for fabrication using the multifunction self-aligned gate process. The benefits from GaAs IC insertion are quantified by a comparison of hardware units fabricated with existing MIC and digital ECL technology and the same units manufactured with monolithic technology. It is found that major improvements in cost, reliability, size, weight, and performance can be realized. Examples illustrating the methodology for technology insertion are presented.

Genome Editing in Stem Cells for Disease Therapeutics.

PubMed

Song, Minjung; Ramakrishna, Suresh

2018-04-01

Programmable nucleases including zinc finger nucleases, transcription activator-like effector nucleases, and clustered regularly interspaced short palindrome repeats (CRISPR)/CRISPR-associated protein have tremendous potential biological and therapeutic applications as novel genome editing tools. These nucleases enable precise modification of the gene of interest by disruption, insertion, or correction. The application of genome editing technology to pluripotent stem cells or hematopoietic stem cells has the potential to remarkably advance the contribution of this technology to life sciences. Specifically, disease models can be generated and effective therapeutics can be developed with great efficiency and speed. Here we review the characteristics and mechanisms of each programmable nuclease. In addition, we review the applications of these nucleases to stem cells for disease therapies and summarize key studies of interest.

Identification of a novel mutation in the human growth hormone receptor gene (GHR) in a patient with Laron syndrome.

PubMed

Gennero, Isabelle; Edouard, Thomas; Rashad, Mona; Bieth, Eric; Conte-Aurio, Françoise; Marin, Françoise; Tauber, Maithé; Salles, Jean Pierre; El Kholy, Mohamed

2007-07-01

Deletions and mutations in the growth hormone receptor (GHR) gene are the underlying etiology of Laron syndrome (LS) or growth hormone (GH) insensitivity syndrome (GHIS), an autosomal recessive disease. Most patients are distributed in or originate from Mediterranean and Middle-Eastern countries. Sixty mutations have been described so far. We report a novel mutation in the GHR gene in a patient with LS. Genomic DNA sequencing of exon 5 revealed a TT insertion at nucleotide 422 after codon 122. The insertion resulted in a frameshift introducing a premature termination codon that led to a truncated receptor. We present clinical, biochemical and molecular evidence of LS as the result of this homozygous insertion.

A High-Throughput Arabidopsis Reverse Genetics System

PubMed Central

Sessions, Allen; Burke, Ellen; Presting, Gernot; Aux, George; McElver, John; Patton, David; Dietrich, Bob; Ho, Patrick; Bacwaden, Johana; Ko, Cynthia; Clarke, Joseph D.; Cotton, David; Bullis, David; Snell, Jennifer; Miguel, Trini; Hutchison, Don; Kimmerly, Bill; Mitzel, Theresa; Katagiri, Fumiaki; Glazebrook, Jane; Law, Marc; Goff, Stephen A.

2002-01-01

A collection of Arabidopsis lines with T-DNA insertions in known sites was generated to increase the efficiency of functional genomics. A high-throughput modified thermal asymetric interlaced (TAIL)-PCR protocol was developed and used to amplify DNA fragments flanking the T-DNA left borders from ∼100,000 transformed lines. A total of 85,108 TAIL-PCR products from 52,964 T-DNA lines were sequenced and compared with the Arabidopsis genome to determine the positions of T-DNAs in each line. Predicted T-DNA insertion sites, when mapped, showed a bias against predicted coding sequences. Predicted insertion mutations in genes of interest can be identified using Arabidopsis Gene Index name searches or by BLAST (Basic Local Alignment Search Tool) search. Insertions can be confirmed by simple PCR assays on individual lines. Predicted insertions were confirmed in 257 of 340 lines tested (76%). This resource has been named SAIL (Syngenta Arabidopsis Insertion Library) and is available to the scientific community at www.tmri.org. PMID:12468722

Recombining overlapping BACs into a single larger BAC.

PubMed

Kotzamanis, George; Huxley, Clare

2004-01-06

BAC clones containing entire mammalian genes including all the transcribed region and long range controlling elements are very useful for functional analysis. Sequenced BACs are available for most of the human and mouse genomes and in many cases these contain intact genes. However, large genes often span more than one BAC, and single BACs covering the entire region of interest are not available. Here we describe a system for linking two or more overlapping BACs into a single clone by homologous recombination. The method was used to link a 61-kb insert carrying the final 5 exons of the human CFTR gene onto a 160-kb BAC carrying the first 22 exons. Two rounds of homologous recombination were carried out in the EL350 strain of bacteria which can be induced for the Red genes. In the first round, the inserts of the two overlapping BACs were subcloned into modified BAC vectors using homologous recombination. In the second round, the BAC to be added was linearised with the very rare-cutting enzyme I-PpoI and electroporated into recombination efficient EL350 bacteria carrying the other BAC. Recombined BACs were identified by antibiotic selection and PCR screening and 10% of clones contained the correctly recombined 220-kb BAC. The system can be used to link the inserts from any overlapping BAC or PAC clones. The original orientation of the inserts is not important and desired regions of the inserts can be selected. The size limit for the fragments recombined may be larger than the 61 kb used here and multiple BACs in a contig could be combined by alternating use of the two pBACLink vectors. This system should be of use to many investigators wishing to carry out functional analysis on large mammalian genes which are not available in single BAC clones.

Embedded Multiprocessor Technology for VHSIC Insertion

NASA Technical Reports Server (NTRS)

Hayes, Paul J.

1990-01-01

Viewgraphs on embedded multiprocessor technology for VHSIC insertion are presented. The objective was to develop multiprocessor system technology providing user-selectable fault tolerance, increased throughput, and ease of application representation for concurrent operation. The approach was to develop graph management mapping theory for proper performance, model multiprocessor performance, and demonstrate performance in selected hardware systems.

The Carnegie Protein Trap Library: A Versatile Tool for Drosophila Developmental Studies

PubMed Central

Buszczak, Michael; Paterno, Shelley; Lighthouse, Daniel; Bachman, Julia; Planck, Jamie; Owen, Stephenie; Skora, Andrew D.; Nystul, Todd G.; Ohlstein, Benjamin; Allen, Anna; Wilhelm, James E.; Murphy, Terence D.; Levis, Robert W.; Matunis, Erika; Srivali, Nahathai; Hoskins, Roger A.; Spradling, Allan C.

2007-01-01

Metazoan physiology depends on intricate patterns of gene expression that remain poorly known. Using transposon mutagenesis in Drosophila, we constructed a library of 7404 protein trap and enhancer trap lines, the Carnegie collection, to facilitate gene expression mapping at single-cell resolution. By sequencing the genomic insertion sites, determining splicing patterns downstream of the enhanced green fluorescent protein (EGFP) exon, and analyzing expression patterns in the ovary and salivary gland, we found that 600–900 different genes are trapped in our collection. A core set of 244 lines trapped different identifiable protein isoforms, while insertions likely to act as GFP-enhancer traps were found in 256 additional genes. At least 8 novel genes were also identified. Our results demonstrate that the Carnegie collection will be useful as a discovery tool in diverse areas of cell and developmental biology and suggest new strategies for greatly increasing the coverage of the Drosophila proteome with protein trap insertions. PMID:17194782

Negative regulatory loci coupling flagellin synthesis to flagellar assembly in Salmonella typhimurium.

PubMed Central

Gillen, K L; Hughes, K T

1991-01-01

The complex regulation of flagellin gene expression in Salmonella typhimurium was characterized in vivo by using lac transcriptional fusions to the two flagellin structural genes (fliC [H1] and fljB [H2]). Phase variation was measured as the rate of switching of flagellin gene expression. Switching frequencies varied from 1/500 per cell per generation to 1/10,000 per cell per generation depending on the particular insertion and the direction of switching. There is a 4- to 20-fold bias in favor of switching from the fljB(On) to the fljB(Off) orientation. Random Tn10dTc insertions were isolated which failed to express flagellin. While most of these insertions mapped to loci known to be required for flagellin expression, several new loci were identified. The presence of functional copies of all of the genes responsible for complete flagellar assembly, except the hook-associated proteins (flgK, flgL, and fliD gene products), were required for expression of the fliC or fljB flagellin genes. Two novel loci involved in negative regulation of fliC and fljB in fla mutant backgrounds were identified. One of these loci, designated the flgR locus, mapped to the flg operon at 23 min on the Salmonella linkage map. An flgR insertion mutation resulted in relief of repression of the fliC and fljB genes in all fla mutant backgrounds except for mutants in the positive regulatory loci (flhC, flhD, and fliA genes). PMID:1848842

A single gene mutation that increases maize seed weight

DOE Office of Scientific and Technical Information (OSTI.GOV)

Giroux, M.J.; Shaw, J.; Hannah, L.C.

1996-06-11

The maize endosperm-specific gene shrunken2 (Sh2) encodes the large subunit of the heterotetrameric starch synthetic enzyme adenosine diphosphoglucose pyrophosphorylase (AGP; EC 2.7.7.27). Here we exploit an in vivo, site-specific mutagenesis system to create short insertion mutations in a region of the gene known to be involved in the allosteric regulation of AGP. The site-specific mutagen is the transposable element dissociation (Ds). Approximately one-third (8 of 23) of the germinal revertants sequenced restored the wild-type sequence, whereas the remaining revertants contained insertions of 3 or 6 bp. All revertants retained the original reading frame 3 feet to the insertion site andmore » involved the addition of tyrosine and/or serine. Each insertion revertant reduced total AGP activity and the amount of the SH2 protein. The revertant containing additional tyrosine and serine residues increased seed weight 11-18% without increasing or decreasing the percentage of starch. Other insertion revertants lacking an additional serine reduced seed weight. Reduced sensitivity to phosphate, a long-known inhibitor of AGP, was found in the high seed-weight revertant. This alteration is likely universally important since insertion of tyrosine and serine in the potato large subunit of AGP at the comparable position and expression in Escherichia coli also led to a phosphate-insensitive enzyme. These results show that single gene mutations giving rise to increased seed weight, and therefore perhaps yield, are clearly possible in a plant with a long history of intensive and successful breeding efforts. 20 refs., 5 figs., 5 tabs.« less

Identification of a two-component signal transduction system involved in fimbriation of Porphyromonas gingivalis.

PubMed

Hayashi, J; Nishikawa, K; Hirano, R; Noguchi, T; Yoshimura, F

2000-01-01

Porphyromonas gingivalis, a periodontopathogen, is an oral anaerobic gram-negative bacterium with numerous fimbriae on the cell surface. Fimbriae have been considered to be an important virulence factor in this organism. We analyzed the genomic DNA of transposon-induced, fimbria-deficient mutants derived from ATCC 33277 and found that seven independent mutants had transposon insertions within the same restriction fragment. Cloning and sequencing of the disrupted region from one of the mutants revealed two adjacent open reading frames (ORFs) which seemed to encode a two-component signal transduction system. We also found that six of the mutants had insertions in a gene, fimS, a homologue of the genes encoding sensor kinase, and that the insertion in the remaining one disrupted the gene immediately downstream, fimR, a homologue of the response regulator genes in other bacteria. These findings suggest that this two-component regulatory system is involved in fimbriation of P. gingivalis.

Evaluating Risks of Insertional Mutagenesis by DNA Transposons in Gene Therapy

PubMed Central

Hackett, Perry B.; Largaespada, David A.; Switzer, Kirsten C.; Cooper, Laurence J.N.

2013-01-01

Investigational therapy can be successfully undertaken using viral- and non-viral-mediated ex vivo gene transfer. Indeed, recent clinical trials have established the potential for genetically modified T cells to improve and restore health. Recently the Sleeping Beauty (SB) transposon/transposase system has been applied in clinical trials to stably insert a chimeric antigen receptor (CAR) to redirect T-cell specificity. We discuss the context in which the SB system can be harnessed for gene therapy and describe the human application of SB-modified CAR+ T cells. We have focused on theoretical issues relating to insertional mutagenesis in the context of human genomes that are naturally subjected to remobilization of transposons and the experimental evidence over the last decade of employing SB transposons for defining genes that induce cancer. These findings are put into the context of the use of SB transposons in the treatment of human disease. PMID:23313630

The P gene of bovine parainfluenza virus 3 expresses all three reading frames from a single mRNA editing site.

PubMed Central

Pelet, T; Curran, J; Kolakofsky, D

1991-01-01

The P gene of bovine parainfluenza virus 3 (bPIV3) contains two downstream overlapping ORFs, called V and D. By comparison with the mRNA editing sites of other paramyxoviruses, two editing sites were predicted for bPIV3; site a to express the D protein, and site b to express the V protein. Examination of the bPIV3 mRNAs, however, indicates that site b is non-functional whereas site a operates frequently. Insertions at site a give rise to both V and D protein mRNAs, because a very broad distribution of Gs is added when insertions occur. This broad distribution is very different from the editing sites of Sendai virus or SV5, where predominantly one form of edited mRNA containing either a one or two G insertion respectively is created, to access the single overlapping ORF of these viruses. A model is proposed to explain how paramyxoviruses control the range of G insertions on that fraction of the mRNAs where insertions occur. The bPIV3 P gene is unique as far as we know, in that a sizeable portion of the gene expresses all 3 reading frames as protein. bPIV3 apparently does this from a single editing site by removing the constraints which control the number of slippage rounds which take place. Images PMID:1846805

An investigation into the association between HLA-G 14 bp insertion/deletion polymorphism and multiple sclerosis susceptibility.

PubMed

Mohammadi, Nabiallah; Adib, Minoo; Alsahebfosoul, Fereshteh; Kazemi, Mohammad; Etemadifar, Masoud

2016-01-15

Human Leukocyte Antigen G (HLA-G) gene polymorphism and expression rate have recently been suggested to have a potential role in susceptibility to Multiple Sclerosis (MS), a chronic inflammatory demyelinating and neurodegenerative disease of the central nervous system with unknown etiology. The aim of this study was to investigate the association of the frequency of HLA-G gene 14 bp insertion/deletion polymorphism and its plasma level with MS susceptibility. In this study, the HLA-G gene from 212 patients and 210 healthy individuals was amplified using real time PCR and screened for the 14 bp insertion/deletion polymorphism. In addition, HLA-G plasma levels of the patients were measured and compared to normal controls by ELISA method. Our results revealed that 14 bp insertion in HLA-G could result in lower plasma HLA-G level of the subjects, regardless of their health status and vice versa. Additionally, significant correlation of HLA-G genotype and its plasma level with MS susceptibility was observed. In conclusion, not only HLA-G 14 bp insertion/deletion polymorphism could be associated with expression rate of the HLA-G gene and its plasma level, but also could be considered as a risk factor for susceptibility to MS in our study population. Copyright © 2015 Elsevier B.V. All rights reserved.

Transposon tagging of genes for cell-cell interactions in Myxococcus xanthus.

PubMed Central

Kalos, M; Zissler, J

1990-01-01

The prokaryote Myxococcus xanthus is a model for cell interactions important in multicellular behavior. We used the transposon TnphoA to specifically identify genes for cell-surface factors involved in cell interactions. From a library of 10,700 insertions of TnphoA, we isolated 36 that produced alkaline phosphatase activity. Three TnphoA insertions tagged cell motility genes, called cgl, which control the adventurous movement of cells. The products of the tagged cgl genes could function in trans upon other cells and were localized primarily in the cell envelope and extracellular space, consistent with TnphoA tagging genes for extracellular factors controlling motility. Images PMID:2172982

Alternate approaches to repress endogenous microRNA activity in Arabidopsis thaliana

PubMed Central

Wang, Ming-Bo

2011-01-01

MicroRnAs (miRnAs) are an endogenous class of regulatory small RnA (sRnA). in plants, miRnAs are processed from short non-protein-coding messenger RnAs (mRnAs) transcribed from small miRnA genes (MIR genes). Traditionally in the model plant Arabidopsis thaliana (Arabidopsis), the functional analysis of a gene product has relied on the identification of a corresponding T-DnA insertion knockout mutant from a large, randomly-mutagenized population. However, because of the small size of MIR genes and presence of multiple, highly conserved members in most plant miRnA families, it has been extremely laborious and time consuming to obtain a corresponding single or multiple, null mutant plant line. Our recent study published in Molecular Plant1 outlines an alternate method for the functional characterization of miRnA action in Arabidopsis, termed anti-miRnA technology. Using this approach we demonstrated that the expression of individual miRnAs or entire miRnA families, can be readily and efficiently knocked-down. Our approach is in addition to two previously reported methodologies that also allow for the targeted suppression of either individual miRnAs, or all members of a MIR gene family; these include miRnA target mimicry2,3 and transcriptional gene silencing (TGS) of MIR gene promoters.4 All three methodologies rely on endogenous gene regulatory machinery and in this article we provide an overview of these technologies and discuss their strengths and weaknesses in inhibiting the activity of their targeted miRnA(s). PMID:21358288

Expression of homing endonuclease gene and insertion-like element in sea anemone mitochondrial genomes: Lesson learned from Anemonia viridis.

PubMed

Chi, Sylvia Ighem; Urbarova, Ilona; Johansen, Steinar D

2018-04-30

The mitochondrial genomes of sea anemones are dynamic in structure. Invasion by genetic elements, such as self-catalytic group I introns or insertion-like sequences, contribute to sea anemone mitochondrial genome expansion and complexity. By using next generation sequencing we investigated the complete mtDNAs and corresponding transcriptomes of the temperate sea anemone Anemonia viridis and its closer tropical relative Anemonia majano. Two versions of fused homing endonuclease gene (HEG) organization were observed among the Actiniidae sea anemones; in-frame gene fusion and pseudo-gene fusion. We provided support for the pseudo-gene fusion organization in Anemonia species, resulting in a repressed HEG from the COI-884 group I intron. orfA, a putative protein-coding gene with insertion-like features, was present in both Anemonia species. Interestingly, orfA and COI expression were significantly up-regulated upon long-term environmental stress corresponding to low seawater pH conditions. This study provides new insights to the dynamics of sea anemone mitochondrial genome structure and function. Copyright © 2018 Elsevier B.V. All rights reserved.

Application of signature-tagged mutagenesis to the study of virulence of Erwinia amylovora.

PubMed

Wang, Limei; Beer, Steven V

2006-12-01

To identify genes that contribute to the virulence of Erwinia amylovora in plants, 1892 mutants were created and screened in pools of < or =96 mutants using signature-tagged mutagenesis. Nineteen mutants were not recovered from apple shoots following inoculation, which suggested that the insertions in these mutants affected genes important for bacterial survival in planta. DNA flanking the Tn5 insertions in the 19 mutants was sequenced and analysed by blast. One mutant had a Tn5 insertion in amsE, a gene involved in the biosynthesis of exopolysaccaride (EPS). Fourteen mutants had insertions in loci that were implicated in biosynthesis or transport of particular amino acids or nucleotides, a site-specific recombinase active during cell division and several putative proteins of unknown function; the flanking DNA of the remaining four mutants lacked significant homology with any DNA in the database. When inoculated individually to hosts, 10 of the 19 mutants caused significantly less disease and multiplied less, as compared with the wild-type strain.

Effects of Hematopoietic Lineage and Precursor Age on CML Disease Progression

DTIC Science & Technology

2007-03-01

ABL gene was inserted is bi-cistronic and contains the gene encoding green fluorescence protein (GFP) in addition to BCR-ABL, we were able to assess...ribosome entry site (IRES) enhanced green fluorescent protein (EGFP) or 5’ LTR-driven IRES EGFP for 24-36 hours; We received the BCR-ABL construct...from our collaborator, Dr. Owen Witte. This gene was then inserted into a murine retrovirus. We then prepared stocks of retrovirus to be used for

Transposon integration enhances expression of stress response genes.

PubMed

Feng, Gang; Leem, Young-Eun; Levin, Henry L

2013-01-01

Transposable elements possess specific patterns of integration. The biological impact of these integration profiles is not well understood. Tf1, a long-terminal repeat retrotransposon in Schizosaccharomyces pombe, integrates into promoters with a preference for the promoters of stress response genes. To determine the biological significance of Tf1 integration, we took advantage of saturated maps of insertion activity and studied how integration at hot spots affected the expression of the adjacent genes. Our study revealed that Tf1 integration did not reduce gene expression. Importantly, the insertions activated the expression of 6 of 32 genes tested. We found that Tf1 increased gene expression by inserting enhancer activity. Interestingly, the enhancer activity of Tf1 could be limited by Abp1, a host surveillance factor that sequesters transposon sequences into structures containing histone deacetylases. We found the Tf1 promoter was activated by heat treatment and, remarkably, only genes that themselves were induced by heat could be activated by Tf1 integration, suggesting a synergy of Tf1 enhancer sequence with the stress response elements of target promoters. We propose that the integration preference of Tf1 for the promoters of stress response genes and the ability of Tf1 to enhance the expression of these genes co-evolved to promote the survival of cells under stress.

Transposon integration enhances expression of stress response genes

PubMed Central

Feng, Gang; Leem, Young-Eun; Levin, Henry L.

2013-01-01

Transposable elements possess specific patterns of integration. The biological impact of these integration profiles is not well understood. Tf1, a long-terminal repeat retrotransposon in Schizosaccharomyces pombe, integrates into promoters with a preference for the promoters of stress response genes. To determine the biological significance of Tf1 integration, we took advantage of saturated maps of insertion activity and studied how integration at hot spots affected the expression of the adjacent genes. Our study revealed that Tf1 integration did not reduce gene expression. Importantly, the insertions activated the expression of 6 of 32 genes tested. We found that Tf1 increased gene expression by inserting enhancer activity. Interestingly, the enhancer activity of Tf1 could be limited by Abp1, a host surveillance factor that sequesters transposon sequences into structures containing histone deacetylases. We found the Tf1 promoter was activated by heat treatment and, remarkably, only genes that themselves were induced by heat could be activated by Tf1 integration, suggesting a synergy of Tf1 enhancer sequence with the stress response elements of target promoters. We propose that the integration preference of Tf1 for the promoters of stress response genes and the ability of Tf1 to enhance the expression of these genes co-evolved to promote the survival of cells under stress. PMID:23193295

Isolation and Expression of the Lysis Genes of Actinomyces naeslundii Phage Av-1

PubMed Central

Delisle, Allan L.; Barcak, Gerard J.; Guo, Ming

2006-01-01

Like most gram-positive oral bacteria, Actinomyces naeslundii is resistant to salivary lysozyme and to most other lytic enzymes. We are interested in studying the lysins of phages of this important oral bacterium as potential diagnostic and therapeutic agents. To identify the Actinomyces phage genes encoding these species-specific enzymes in Escherichia coli, we constructed a new cloning vector, pAD330, that can be used to enrich for and isolate phage holin genes, which are located adjacent to the lysin genes in most phage genomes. Cloned holin insert sequences were used to design sequencing primers to identify nearby lysin genes by using whole phage DNA as the template. From partial digestions of A. naeslundii phage Av-1 genomic DNA we were able to clone, in independent experiments, inserts that complemented the defective λ holin in pAD330, as evidenced by extensive lysis after thermal induction. The DNA sequence of the inserts in these plasmids revealed that both contained the complete lysis region of Av-1, which is comprised of two holin-like genes, designated holA and holB, and an endolysin gene, designated lysA. We were able to subclone and express these genes and determine some of the functional properties of their gene products. PMID:16461656

Utilization of next generation sequencing for analyzing transgenic insertions in plum

USDA-ARS?s Scientific Manuscript database

When utilizing transgenic plants, it is useful to know how many copies of the genes were inserted and the locations of these insertions in the genome. This information can provide important insights for the interpretation of transgene expression and the resulting phenotype. Traditionally, these qu...

A natural allele of Nxf1/TAP supresses retrovirus insertional mutations

PubMed Central

Floyd, Jennifer A.; Gold, David A.; Concepcion, Dorothy; Poon, Tiffany H.; Wang, Xiaobo; Keithley, Elizabeth; Chen, Dan; Ward, Erica J.; Chinn, Steven B.; Friedman, Rick A.; Yu, Hon-Tsen; Moriwaki, Kazuo; Shiroishi, Toshihiko; Hamilton, Bruce A.

2009-01-01

Endogenous retroviruses have shaped the evolution of mammalian genomes. Host genes that control the effects of retrovirus insertions are therefore of great interest. The Modifier-of-vibrator-1 locus controls level of correctly processed mRNA from genes mutated by endogenous retrovirus insertions into introns, including the pitpnvb tremor mutation and the Eya1BOR model of human branchiootorenal syndrome. Positional complementation cloning identifies Mvb1 as the nuclear export factor Nxf1, providing an unexpected link between mRNA export receptor and pre-mRNA processing. Population structure of the suppressing allele in wild M. m. castaneus suggests selective advantage. A congenic Mvb1CAST allele is a useful tool for modifying gene expression from existing mutations and could be used to manipulate engineered mutations containing retroviral elements. PMID:14517553

Application of genome editing technologies to the study and treatment of hematological disease.

PubMed

Pellagatti, Andrea; Dolatshad, Hamid; Yip, Bon Ham; Valletta, Simona; Boultwood, Jacqueline

2016-01-01

Genome editing technologies have advanced significantly over the past few years, providing a fast and effective tool to precisely manipulate the genome at specific locations. The three commonly used genome editing technologies are Zinc Finger Nucleases (ZFNs), Transcription Activator-Like Effector Nucleases (TALENs), and the Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR)-associated Cas9 (CRISPR/Cas9) system. ZFNs and TALENs consist of endonucleases fused to a DNA-binding domain, while the CRISPR/Cas9 system uses guide RNAs to target the bacterial Cas9 endonuclease to the desired genomic location. The double-strand breaks made by these endonucleases are repaired in the cells either by non-homologous end joining, resulting in the introduction of insertions/deletions, or, if a repair template is provided, by homology directed repair. The ZFNs, TALENs and CRISPR/Cas9 systems take advantage of these repair mechanisms for targeted genome modification and have been successfully used to manipulate the genome in human cells. These genome editing tools can be used to investigate gene function, to discover new therapeutic targets, and to develop disease models. Moreover, these genome editing technologies have great potential in gene therapy. Here, we review the latest advances in the application of genome editing technology to the study and treatment of hematological disorders. Copyright © 2015 Elsevier Ltd. All rights reserved.

Insertion of a solo LTR retrotransposon associates with spur mutations in 'Red Delicious' apple (Malus × domestica).

PubMed

Han, Mengxue; Sun, Qibao; Zhou, Junyong; Qiu, Huarong; Guo, Jing; Lu, Lijuan; Mu, Wenlei; Sun, Jun

2017-09-01

Insertion of a solo LTR, which possesses strong bidirectional, stem-specific promoter activities, is associated with the evolution of a dwarfing apple spur mutation. Spur mutations in apple scions revolutionized global apple production. Since long terminal repeat (LTR) retrotransposons are tightly related to natural mutations, inter-retrotransposon-amplified polymorphism technique and genome walking were used to find sequences in the apple genome based on these LTRs. In 'Red Delicious' spur mutants, a novel, 2190-bp insertion was identified as a spur-specific, solo LTR (sLTR) located at the 1038th nucleotide of another sLTR, which was 1536 bp in length. This insertion-within-an-insertion was localized within a preexisting Gypsy-50 retrotransposon at position 3,762,767 on chromosome 4. The analysis of transcriptional activity of the two sLTRs (the 2190- and 1536-bp inserts) indicated that the 2190-bp sLTR is a promoter, capable of bidirectional transcription. GUS expression in the 2190-bp-sense and 2190-bp-antisense transgenic lines was prominent in stems. In contrast, no promoter activity from either the sense or the antisense strand of the 1536-bp sLTR was detected. From ~150 kb of DNA on each side of the 2190 bp, sLTR insertion site, corresponding to 300 kb of the 'Golden Delicious' genome, 23 genes were predicted. Ten genes had predicted functions that could affect shoot development. This first report, of a sLTR insertion associated with the evolution of apple spur mutation, will facilitate apple breeding, cloning of spur-related genes, and discovery of mechanisms behind dwarf habit.

The construction of recombinant industrial yeasts free of bacterial sequences by directed gene replacement into a nonessential region of the genome.

PubMed

Xiao, W; Rank, G H

1989-03-15

The yeast SMR1 gene was used as a dominant resistance-selectable marker for industrial yeast transformation and for targeting integration of an economically important gene at the homologous ILV2 locus. A MEL1 gene, which codes for alpha-galactosidase, was inserted into a dispensable upstream region of SMR1 in vitro; different treatments of the plasmid (pWX813) prior to transformation resulted in 3' end, 5' end and replacement integrations that exhibited distinct integrant structures. One-step replacement within a nonessential region of the host genome generated a stable integration of MEL1 devoid of bacterial plasmid DNA. Using this method, we have constructed several alpha-galactosidase positive industrial Saccharomyces strains. Our study provides a general method for stable gene transfer in most industrial Saccharomyces yeasts, including those used in the baking, brewing (ale and lager), distilling, wine and sake industries, with solely nucleotide sequences of interest. The absence of bacterial DNA in the integrant structure facilitates the commercial application of recombinant DNA technology in the food and beverage industry.

CRISPR-Cas9-mediated gene knockout in primary human airway epithelial cells reveals a proinflammatory role for MUC18.

PubMed

Chu, H W; Rios, C; Huang, C; Wesolowska-Andersen, A; Burchard, E G; O'Connor, B P; Fingerlin, T E; Nichols, D; Reynolds, S D; Seibold, M A

2015-10-01

Targeted knockout of genes in primary human cells using CRISPR-Cas9-mediated genome-editing represents a powerful approach to study gene function and to discern molecular mechanisms underlying complex human diseases. We used lentiviral delivery of CRISPR-Cas9 machinery and conditional reprogramming culture methods to knockout the MUC18 gene in human primary nasal airway epithelial cells (AECs). Massively parallel sequencing technology was used to confirm that the genome of essentially all cells in the edited AEC populations contained coding region insertions and deletions (indels). Correspondingly, we found mRNA expression of MUC18 was greatly reduced and protein expression was absent. Characterization of MUC18 knockout cell populations stimulated with TLR2, 3 and 4 agonists revealed that IL-8 (a proinflammatory chemokine) responses of AECs were greatly reduced in the absence of functional MUC18 protein. Our results show the feasibility of CRISPR-Cas9-mediated gene knockouts in AEC culture (both submerged and polarized), and suggest a proinflammatory role for MUC18 in airway epithelial response to bacterial and viral stimuli.

An EAV-HP Insertion in 5′ Flanking Region of SLCO1B3 Causes Blue Eggshell in the Chicken

PubMed Central

Yang, Xiaolin; Li, Guangqi; Zhang, Yuanyuan; Li, Junying; Wang, Xiaotong; Bai, Jirong; Xu, Guiyun; Deng, Xuemei; Yang, Ning; Wu, Changxin

2013-01-01

The genetic determination of eggshell coloration has not been determined in birds. Here we report that the blue eggshell is caused by an EAV-HP insertion that promotes the expression of SLCO1B3 gene in the uterus (shell gland) of the oviduct in chicken. In this study, the genetic map location of the blue eggshell gene was refined by linkage analysis in an F2 chicken population, and four candidate genes within the refined interval were subsequently tested for their expression levels in the shell gland of the uterus from blue-shelled and non-blue-shelled hens. SLCO1B3 gene was found to be the only one expressed in the uterus of blue-shelled hens but not in that of non-blue-shelled hens. Results from a pyrosequencing analysis showed that only the allele of SLCO1B3 from blue-shelled chickens was expressed in the uterus of heterozygous hens (O*LC/O*N). SLCO1B3 gene belongs to the organic anion transporting polypeptide (OATP) family; and the OATPs, functioning as membrane transporters, have been reported for the transportation of amphipathic organic compounds, including bile salt in mammals. We subsequently resequenced the whole genomic region of SLCO1B3 and discovered an EAV-HP insertion in the 5′ flanking region of SLCO1B3. The EAV-HP insertion was found closely associated with blue eggshell phenotype following complete Mendelian segregation. In situ hybridization also demonstrated that the blue eggshell is associated with ectopic expression of SLCO1B3 in shell glands of uterus. Our finding strongly suggests that the EAV-HP insertion is the causative mutation for the blue eggshell phenotype. The insertion was also found in another Chinese blue-shelled breed and an American blue-shelled breed. In addition, we found that the insertion site in the blue-shelled chickens from Araucana is different from that in Chinese breeds, which implied independent integration events in the blue-shelled chickens from the two continents, providing a parallel evolutionary example at the molecular level. PMID:23359636

Adeno-associated virus inverted terminal repeats stimulate gene editing.

PubMed

Hirsch, M L

2015-02-01

Advancements in genome editing have relied on technologies to specifically damage DNA which, in turn, stimulates DNA repair including homologous recombination (HR). As off-target concerns complicate the therapeutic translation of site-specific DNA endonucleases, an alternative strategy to stimulate gene editing based on fragile DNA was investigated. To do this, an episomal gene-editing reporter was generated by a disruptive insertion of the adeno-associated virus (AAV) inverted terminal repeat (ITR) into the egfp gene. Compared with a non-structured DNA control sequence, the ITR induced DNA damage as evidenced by increased gamma-H2AX and Mre11 foci formation. As local DNA damage stimulates HR, ITR-mediated gene editing was investigated using DNA oligonucleotides as repair substrates. The AAV ITR stimulated gene editing >1000-fold in a replication-independent manner and was not biased by the polarity of the repair oligonucleotide. Analysis of additional human DNA sequences demonstrated stimulation of gene editing to varying degrees. In particular, inverted yet not direct, Alu repeats induced gene editing, suggesting a role for DNA structure in the repair event. Collectively, the results demonstrate that inverted DNA repeats stimulate gene editing via double-strand break repair in an episomal context and allude to efficient gene editing of the human chromosome using fragile DNA sequences.

A small indel mutation in an anthocyanin transporter causes variegated colouration of peach flowers.

PubMed

Cheng, Jun; Liao, Liao; Zhou, Hui; Gu, Chao; Wang, Lu; Han, Yuepeng

2015-12-01

The ornamental peach cultivar 'Hongbaihuatao (HBH)' can simultaneously bear pink, red, and variegated flowers on a single tree. Anthocyanin content in pink flowers is extremely low, being only 10% that of a red flower. Surprisingly, the expression of anthocyanin structural and potential regulatory genes in white flowers was not significantly lower than that in both pink and red flowers. However, proteomic analysis revealed a GST encoded by a gene-regulator involved in anthocyanin transport (Riant)-which is expressed in the red flower, but almost undetectable in the variegated flower. The Riant gene contains an insertion-deletion (indel) polymorphism in exon 3. In white flowers, the Riant gene is interrupted by a 2-bp insertion in the last exon, which causes a frameshift and a premature stop codon. In contrast, both pink and red flowers that arise from bud sports are heterozygous for the Riant locus, with one functional allele due to the 2-bp deletion or a novel 1-bp insertion. Southern blot analysis indicated that the Riant gene occurs in a single copy in the peach genome and it is not interrupted by a transposon. The function of the Riant gene was confirmed by its ectopic expression in the Arabidopsis tt19 mutant, where it complements the anthocyanin phenotype, but not the proanthocyanidin pigmentation in seed coat. Collectively,these results indicate that a small indel mutation in the Riant gene, which is not the result of a transposon insertion or excision, causes variegated colouration of peach flowers. © The Author 2015. Published by Oxford University Press on behalf of the Society for Experimental Biology.

Dictyostelium mobile elements: strategies to amplify in a compact genome.

PubMed

Winckler, T; Dingermann, T; Glöckner, G

2002-12-01

Dictyostelium discoideum is a eukaryotic microorganism that is attractive for the study of fundamental biological phenomena such as cell-cell communication, formation of multicellularity, cell differentiation and morphogenesis. Large-scale sequencing of the D. discoideum genome has provided new insights into evolutionary strategies evolved by transposable elements (TEs) to settle in compact microbial genomes and to maintain active populations over evolutionary time. The high gene density (about 1 gene/2.6 kb) of the D. discoideum genome leaves limited space for selfish molecular invaders to move and amplify without causing deleterious mutations that eradicate their host. Targeting of transfer RNA (tRNA) gene loci appears to be a generally successful strategy for TEs residing in compact genomes to insert away from coding regions. In D. discoideum, tRNA gene-targeted retrotransposition has evolved independently at least three times by both non-long terminal repeat (LTR) retrotransposons and retrovirus-like LTR retrotransposons. Unlike the nonspecifically inserting D. discoideum TEs, which have a strong tendency to insert into preexisting TE copies and form large and complex clusters near the ends of chromosomes, the tRNA gene-targeted retrotransposons have managed to occupy 75% of the tRNA gene loci spread on chromosome 2 and represent 80% of the TEs recognized on the assembled central 6.5-Mb part of chromosome 2. In this review we update the available information about D. discoideum TEs which emerges both from previous work and current large-scale genome sequencing, with special emphasis on the fact that tRNA genes are principal determinants of retrotransposon insertions into the D. discoideum genome.

Biallelic insertion of a transcriptional terminator via the CRISPR/Cas9 system efficiently silences expression of protein-coding and non-coding RNA genes.

PubMed

Liu, Yangyang; Han, Xiao; Yuan, Junting; Geng, Tuoyu; Chen, Shihao; Hu, Xuming; Cui, Isabelle H; Cui, Hengmi

2017-04-07

The type II bacterial CRISPR/Cas9 system is a simple, convenient, and powerful tool for targeted gene editing. Here, we describe a CRISPR/Cas9-based approach for inserting a poly(A) transcriptional terminator into both alleles of a targeted gene to silence protein-coding and non-protein-coding genes, which often play key roles in gene regulation but are difficult to silence via insertion or deletion of short DNA fragments. The integration of 225 bp of bovine growth hormone poly(A) signals into either the first intron or the first exon or behind the promoter of target genes caused efficient termination of expression of PPP1R12C , NSUN2 (protein-coding genes), and MALAT1 (non-protein-coding gene). Both NeoR and PuroR were used as markers in the selection of clonal cell lines with biallelic integration of a poly(A) signal. Genotyping analysis indicated that the cell lines displayed the desired biallelic silencing after a brief selection period. These combined results indicate that this CRISPR/Cas9-based approach offers an easy, convenient, and efficient novel technique for gene silencing in cell lines, especially for those in which gene integration is difficult because of a low efficiency of homology-directed repair. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

A recombinant rabies virus carrying GFP between N and P affects viral transcription in vitro.

PubMed

Luo, Jun; Zhao, Jing; Tian, Qin; Mo, Weiyu; Wang, Yifei; Chen, Hao; Guo, Xiaofeng

2016-06-01

Several studies have demonstrated the rabies virus to be a perfect potential vaccine vector to insert foreign genes into the target genome. For this study, a green fluorescent protein (GFP) gene was cloned into the rabies virus (RABV) genome between the N and P gene. CT dinucleotide was inserted as intergenic region. The recombinant high egg passage Flury strain (HEP-Flury) of RABV, carrying GFP (rHEP-NP-GFP), was generated in BHK-21 cells using reverse genetics. According to the viral growth kinetics assay, the addition of GFP between N and P gene has little effect on the viral growth compared to the parental strain HEP-Flury. Quantitative real-time PCR (qPCR) indicated that rHEP-NP-GFP showed different viral gene transcription, especially for G gene, compared to HEP-Flury. The same is true for one other recombinant RABV carrying GFP between G and L gene in NA cells. In addition, parent HEP-Flury showed more expression of innate immune-related molecules in NA cells. Compared to HEP-Flury, Western blotting (WB) indicated that insertion of a foreign gene following N gene enhanced the expression of M and G proteins. According to the qPCR and WB, GFP expression levels of rHEP-NP-GFP were significantly higher than rHEP-GFP. This study indicates HEP-Flury as valid vector to express exogenous genes between N and P.

Unusual Properties of Regulatory DNA from the Drosophila Engrailed Gene: Three ``pairing-Sensitive'' Sites within a 1.6-Kb Region

PubMed Central

Kassis, J. A.

1994-01-01

We have previously shown that a 2-kb fragment of engrailed DNA can suppress expression of a linked marker gene, white, in the P element vector CaSpeR. This suppression is dependent on the presence of two copies of engrailed DNA-containing P elements (P[en]) in proximity in the Drosophila genome (either in cis or in trans). In this study, the 2-kb fragment was dissected and found to contain three fragments of DNA which could mediate white suppression [called ``pairing-sensitive sites'' (PS)]. A PS site was also identified in regulatory DNA from the Drosophila escargot gene. The eye colors of six different P[en] insertions in the escargot gene suggest an interaction between P[en]-encoded and genome-encoded PS sites. I hypothesize that white gene expression from P[en] is repressed by the formation of a protein complex which is initiated at the engrailed PS sites and also requires interactions with flanking genomic DNA. Genes were sought which influence the function of PS sites. Mutations in some Polycomb and trithorax group genes were found to affect the eye color from some P[en] insertion sites. However, different mutations affected expression from different P[en] insertion sites and no one mutation was found to affect expression from all P[en] insertion sites examined. These results suggest that white expression from P[en] is not directly regulated by members of the Polycomb and trithorax group genes, but in some cases can be influenced by them. I propose that engrailed PS sites normally act to promote interactions between distantly located engrailed regulatory sites and the engrailed promoter. PMID:8005412

Electron-Beam Vapor Deposition of Mold Inserts Final Report CRADA No. TSB-777-94

DOE Office of Scientific and Technical Information (OSTI.GOV)

Shepp, T.; Feeley, T.

Lawrence Livermore National Laboratory and H.G.G. Laser Fare, Inc. studied the application of electron-beam vapor deposition technology to the production of mold inserts for use in an injection molding machine by Laser Fare. Laser Fare provided LLNL with the requirements of the mold inserts as well as sample inserts. LLNL replicated the mold insert(s) to Laser Fare for testing by Laser Fare.

Gene conversion as a mechanism for divergence of a chloroplast tRNA gene inserted in the mitochondrial genome of Brassica oleracea.

PubMed Central

Dron, M; Hartmann, C; Rode, A; Sevignac, M

1985-01-01

We have characterized a 1.7 kb sequence, containing a tRNA Leu2 gene shared by the ct and mt genomes of Brassica oleracea. The two sequences are completely homologous except in two short regions where two distinct gene conversion events have occurred between two sets of direct repeats leading to the insertion of 5 bp in the T loop of the mt copy of the ct gene. This is the first evidence that gene conversion represents the initial evolutionary step in inactivation of transferred ct genes in the mt genome. We also indicate that organelle DNA transfer by organelle fusion is an ongoing process which could be useful in genetic engineering. PMID:4080548

Knock-in/Knock-out (KIKO) vectors for rapid integration of large DNA sequences, including whole metabolic pathways, onto the Escherichia coli chromosome at well-characterised loci.

PubMed

Sabri, Suriana; Steen, Jennifer A; Bongers, Mareike; Nielsen, Lars K; Vickers, Claudia E

2013-06-24

Metabolic engineering projects often require integration of multiple genes in order to control the desired phenotype. However, this often requires iterative rounds of engineering because many current insertion approaches are limited by the size of the DNA that can be transferred onto the chromosome. Consequently, construction of highly engineered strains is very time-consuming. A lack of well-characterised insertion loci is also problematic. A series of knock-in/knock-out (KIKO) vectors was constructed for integration of large DNA sequences onto the E. coli chromosome at well-defined loci. The KIKO plasmids target three nonessential genes/operons as insertion sites: arsB (an arsenite transporter); lacZ (β-galactosidase); and rbsA-rbsR (a ribose metabolism operon). Two homologous 'arms' target each insertion locus; insertion is mediated by λ Red recombinase through these arms. Between the arms is a multiple cloning site for the introduction of exogenous sequences and an antibiotic resistance marker (either chloramphenicol or kanamycin) for selection of positive recombinants. The resistance marker can subsequently be removed by flippase-mediated recombination. The insertion cassette is flanked by hairpin loops to isolate it from the effects of external transcription at the integration locus. To characterize each target locus, a xylanase reporter gene (xynA) was integrated onto the chromosomes of E. coli strains W and K-12 using the KIKO vectors. Expression levels varied between loci, with the arsB locus consistently showing the highest level of expression. To demonstrate the simultaneous use of all three loci in one strain, xynA, green fluorescent protein (gfp) and a sucrose catabolic operon (cscAKB) were introduced into lacZ, arsB and rbsAR respectively, and shown to be functional. The KIKO plasmids are a useful tool for efficient integration of large DNA fragments (including multiple genes and pathways) into E. coli. Chromosomal insertion provides stable expression without the need for continuous antibiotic selection. Three non-essential loci have been characterised as insertion loci; combinatorial insertion at all three loci can be performed in one strain. The largest insertion at a single site described here was 5.4 kb; we have used this method in other studies to insert a total of 7.3 kb at one locus and 11.3 kb across two loci. These vectors are particularly useful for integration of multigene cassettes for metabolic engineering applications.

A Look to Future Directions in Gene Therapy Research for Monogenic Diseases

PubMed Central

Porteus, Matthew H; Connelly, Jon P; Pruett, Shondra M

2006-01-01

The concept of gene therapy has long appealed to biomedical researchers and clinicians because it promised to treat certain diseases at their origins. In the last several years, there have been several trials in which patients have benefited from gene therapy protocols. This progress, however, has revealed important problems, including the problem of insertional oncogenesis. In this review, which focuses on monogenic diseases, we discuss the problem of insertional oncogenesis and identify areas for future research, such as developing more quantitative assays for risk and efficacy, and ways of minimizing the genotoxic effects of gene therapy protocols, which will be important if gene therapy is to fulfill its conceptual promise. PMID:17009872

Identification of the novel lincosamide resistance gene lnu(E) truncated by ISEnfa5-cfr-ISEnfa5 insertion in Streptococcus suis: de novo synthesis and confirmation of functional activity in Staphylococcus aureus.

PubMed

Zhao, Qin; Wendlandt, Sarah; Li, Hui; Li, Jun; Wu, Congming; Shen, Jianzhong; Schwarz, Stefan; Wang, Yang

2014-01-01

The novel lincosamide resistance gene lnu(E), truncated by insertion of an ISEnfa5-cfr-ISEnfa5 segment, was identified in Streptococcus suis. The gene lnu(E) encodes a 173-amino-acid protein with ≤69.4% identity to other lincosamide nucleotidyltransferases. The lnu(E) gene and its promoter region were de novo synthesized, and Staphylococcus aureus RN4220 carrying a shuttle vector with the cloned lnu(E) gene showed a 16-fold increase in the lincomycin MIC. Mass spectrometry experiments demonstrated that Lnu(E) catalyzed the nucleotidylation of lincomycin.

Identification of the Novel Lincosamide Resistance Gene lnu(E) Truncated by ISEnfa5-cfr-ISEnfa5 Insertion in Streptococcus suis: De Novo Synthesis and Confirmation of Functional Activity in Staphylococcus aureus

PubMed Central

Zhao, Qin; Wendlandt, Sarah; Li, Hui; Li, Jun; Wu, Congming; Shen, Jianzhong

2014-01-01

The novel lincosamide resistance gene lnu(E), truncated by insertion of an ISEnfa5-cfr-ISEnfa5 segment, was identified in Streptococcus suis. The gene lnu(E) encodes a 173-amino-acid protein with ≤69.4% identity to other lincosamide nucleotidyltransferases. The lnu(E) gene and its promoter region were de novo synthesized, and Staphylococcus aureus RN4220 carrying a shuttle vector with the cloned lnu(E) gene showed a 16-fold increase in the lincomycin MIC. Mass spectrometry experiments demonstrated that Lnu(E) catalyzed the nucleotidylation of lincomycin. PMID:24366733

Inserting new technology into small missions

NASA Technical Reports Server (NTRS)

Deutsch, L. J.

2001-01-01

Part of what makes small missions small is that they have less money. Executing missions at low cost implies extensive use of cost sharing with other missions or use of existing solutions. However, in order to create many small missions, new technology must be developed, applied, and assimilated. Luckily, there are methods for creating new technology and inserting it into faster-better-cheaper (FBC) missions.

Analysis of the K1 capsule biosynthesis genes of Escherichia coli: definition of three functional regions for capsule production.

PubMed

Boulnois, G J; Roberts, I S; Hodge, R; Hardy, K R; Jann, K B; Timmis, K N

1987-06-01

Transposon and deletion analysis of the cloned K1 capsule biosynthesis genes of Escherichia coli revealed that approximately 17 kb of DNA, split into three functional regions, is required for capsule production. One block (region 1) is required for translocation of polysaccharide to the cell surface and mutations in this region result in the intracellular appearance of polymer indistinguishable on immunoelectrophoresis to that found on the surface of K1 encapsulated bacteria. This material was released from the cell by osmotic shock indicating that the polysaccharide was probably present in the periplasmic space. Insertions in a second block (region 2) completely abolished polymer production and this second region is believed to encode the enzymes for the biosynthesis and polymerisation of the K1 antigen. Addition of exogenous N-acetylneuraminic acid to one insertion mutant in this region restored its ability to express surface polymer as judged by K1 phage sensitivity. This insertion probably defines genes involved in biosynthesis of N-acetylneuraminic acid. Insertions in a third block (region 3) result in the intracellular appearance of polysaccharide with a very low electrophoretic mobility. The presence of the cloned K1 capsule biosynthesis genes on a multicopy plasmid in an E. coli K-12 strain did not increase the yields of capsular polysaccharide produced compared to the K1+ isolate from which the genes were cloned.

An experimental system for the evaluation of retroviral vector design to diminish the risk for proto-oncogene activation

PubMed Central

Ryu, Byoung Y.; Evans-Galea, Marguerite V.; Gray, John T.; Bodine, David M.; Persons, Derek A.

2008-01-01

Pathogenic activation of the LMO2 proto-oncogene by an oncoretroviral vector insertion in a clinical trial for X-linked severe combined immunodeficiency (X-SCID) has prompted safety concerns. We used an adeno-associated virus vector to achieve targeted insertion of a γ-retroviral long terminal repeat (LTR) driving a GFP expression cassette with flanking loxP sites in a human T-cell line at the precise location of vector integration in one of the patients with X-SCID. The LTR-GFP cassette was inserted into the first intron of the LMO2 gene, resulting in strong activation of LMO2. Cre-mediated cassette exchange was used to replace the original LTR-GFP cassette with one flanked by insulator elements leading to a several fold reduction in LMO2 expression. The LTR-GFP cassette was also replaced with a globin gene regulatory cassette that failed to activate the LMO2 gene in lymphoid cells. A γ-retroviral vector with 2 intact LTRs resulted in activation of the LMO2 gene when inserted into the first intron, but a self-inactivating lentiviral vector with an internal cellular promoter and flanking insulator elements did not activate the LMO2 gene. Thus, this system is useful for comparing the safety profiles of vector cassettes with various regulatory elements for their potential for proto-oncogene activation. PMID:17991809

Natural mutagenesis of human genomes by endogenous retrotransposons.

PubMed

Iskow, Rebecca C; McCabe, Michael T; Mills, Ryan E; Torene, Spencer; Pittard, W Stephen; Neuwald, Andrew F; Van Meir, Erwin G; Vertino, Paula M; Devine, Scott E

2010-06-25

Two abundant classes of mobile elements, namely Alu and L1 elements, continue to generate new retrotransposon insertions in human genomes. Estimates suggest that these elements have generated millions of new germline insertions in individual human genomes worldwide. Unfortunately, current technologies are not capable of detecting most of these young insertions, and the true extent of germline mutagenesis by endogenous human retrotransposons has been difficult to examine. Here, we describe technologies for detecting these young retrotransposon insertions and demonstrate that such insertions indeed are abundant in human populations. We also found that new somatic L1 insertions occur at high frequencies in human lung cancer genomes. Genome-wide analysis suggests that altered DNA methylation may be responsible for the high levels of L1 mobilization observed in these tumors. Our data indicate that transposon-mediated mutagenesis is extensive in human genomes and is likely to have a major impact on human biology and diseases.

Comparison of large-insert, small-insert and pyrosequencing libraries for metagenomic analysis.

PubMed

Danhorn, Thomas; Young, Curtis R; DeLong, Edward F

2012-11-01

The development of DNA sequencing methods for characterizing microbial communities has evolved rapidly over the past decades. To evaluate more traditional, as well as newer methodologies for DNA library preparation and sequencing, we compared fosmid, short-insert shotgun and 454 pyrosequencing libraries prepared from the same metagenomic DNA samples. GC content was elevated in all fosmid libraries, compared with shotgun and 454 libraries. Taxonomic composition of the different libraries suggested that this was caused by a relative underrepresentation of dominant taxonomic groups with low GC content, notably Prochlorales and the SAR11 cluster, in fosmid libraries. While these abundant taxa had a large impact on library representation, we also observed a positive correlation between taxon GC content and fosmid library representation in other low-GC taxa, suggesting a general trend. Analysis of gene category representation in different libraries indicated that the functional composition of a library was largely a reflection of its taxonomic composition, and no additional systematic biases against particular functional categories were detected at the level of sequencing depth in our samples. Another important but less predictable factor influencing the apparent taxonomic and functional library composition was the read length afforded by the different sequencing technologies. Our comparisons and analyses provide a detailed perspective on the influence of library type on the recovery of microbial taxa in metagenomic libraries and underscore the different uses and utilities of more traditional, as well as contemporary 'next-generation' DNA library construction and sequencing technologies for exploring the genomics of the natural microbial world.

A Medicago truncatula Tobacco Retrotransposon Insertion Mutant Collection with Defects in Nodule Development and Symbiotic Nitrogen Fixation1[W][OA

PubMed Central

Pislariu, Catalina I.; D. Murray, Jeremy; Wen, JiangQi; Cosson, Viviane; Muni, RajaSekhara Reddy Duvvuru; Wang, Mingyi; A. Benedito, Vagner; Andriankaja, Andry; Cheng, Xiaofei; Jerez, Ivone Torres; Mondy, Samuel; Zhang, Shulan; Taylor, Mark E.; Tadege, Million; Ratet, Pascal; Mysore, Kirankumar S.; Chen, Rujin; Udvardi, Michael K.

2012-01-01

A Tnt1-insertion mutant population of Medicago truncatula ecotype R108 was screened for defects in nodulation and symbiotic nitrogen fixation. Primary screening of 9,300 mutant lines yielded 317 lines with putative defects in nodule development and/or nitrogen fixation. Of these, 230 lines were rescreened, and 156 lines were confirmed with defective symbiotic nitrogen fixation. Mutants were sorted into six distinct phenotypic categories: 72 nonnodulating mutants (Nod−), 51 mutants with totally ineffective nodules (Nod+ Fix−), 17 mutants with partially ineffective nodules (Nod+ Fix+/−), 27 mutants defective in nodule emergence, elongation, and nitrogen fixation (Nod+/− Fix−), one mutant with delayed and reduced nodulation but effective in nitrogen fixation (dNod+/− Fix+), and 11 supernodulating mutants (Nod++Fix+/−). A total of 2,801 flanking sequence tags were generated from the 156 symbiotic mutant lines. Analysis of flanking sequence tags revealed 14 insertion alleles of the following known symbiotic genes: NODULE INCEPTION (NIN), DOESN’T MAKE INFECTIONS3 (DMI3/CCaMK), ERF REQUIRED FOR NODULATION, and SUPERNUMERARY NODULES (SUNN). In parallel, a polymerase chain reaction-based strategy was used to identify Tnt1 insertions in known symbiotic genes, which revealed 25 additional insertion alleles in the following genes: DMI1, DMI2, DMI3, NIN, NODULATION SIGNALING PATHWAY1 (NSP1), NSP2, SUNN, and SICKLE. Thirty-nine Nod− lines were also screened for arbuscular mycorrhizal symbiosis phenotypes, and 30 mutants exhibited defects in arbuscular mycorrhizal symbiosis. Morphological and developmental features of several new symbiotic mutants are reported. The collection of mutants described here is a source of novel alleles of known symbiotic genes and a resource for cloning novel symbiotic genes via Tnt1 tagging. PMID:22679222

A Medicago truncatula tobacco retrotransposon insertion mutant collection with defects in nodule development and symbiotic nitrogen fixation.

PubMed

Pislariu, Catalina I; Murray, Jeremy D; Wen, JiangQi; Cosson, Viviane; Muni, RajaSekhara Reddy Duvvuru; Wang, Mingyi; Benedito, Vagner A; Andriankaja, Andry; Cheng, Xiaofei; Jerez, Ivone Torres; Mondy, Samuel; Zhang, Shulan; Taylor, Mark E; Tadege, Million; Ratet, Pascal; Mysore, Kirankumar S; Chen, Rujin; Udvardi, Michael K

2012-08-01

A Tnt1-insertion mutant population of Medicago truncatula ecotype R108 was screened for defects in nodulation and symbiotic nitrogen fixation. Primary screening of 9,300 mutant lines yielded 317 lines with putative defects in nodule development and/or nitrogen fixation. Of these, 230 lines were rescreened, and 156 lines were confirmed with defective symbiotic nitrogen fixation. Mutants were sorted into six distinct phenotypic categories: 72 nonnodulating mutants (Nod-), 51 mutants with totally ineffective nodules (Nod+ Fix-), 17 mutants with partially ineffective nodules (Nod+ Fix+/-), 27 mutants defective in nodule emergence, elongation, and nitrogen fixation (Nod+/- Fix-), one mutant with delayed and reduced nodulation but effective in nitrogen fixation (dNod+/- Fix+), and 11 supernodulating mutants (Nod++Fix+/-). A total of 2,801 flanking sequence tags were generated from the 156 symbiotic mutant lines. Analysis of flanking sequence tags revealed 14 insertion alleles of the following known symbiotic genes: NODULE INCEPTION (NIN), DOESN'T MAKE INFECTIONS3 (DMI3/CCaMK), ERF REQUIRED FOR NODULATION, and SUPERNUMERARY NODULES (SUNN). In parallel, a polymerase chain reaction-based strategy was used to identify Tnt1 insertions in known symbiotic genes, which revealed 25 additional insertion alleles in the following genes: DMI1, DMI2, DMI3, NIN, NODULATION SIGNALING PATHWAY1 (NSP1), NSP2, SUNN, and SICKLE. Thirty-nine Nod- lines were also screened for arbuscular mycorrhizal symbiosis phenotypes, and 30 mutants exhibited defects in arbuscular mycorrhizal symbiosis. Morphological and developmental features of several new symbiotic mutants are reported. The collection of mutants described here is a source of novel alleles of known symbiotic genes and a resource for cloning novel symbiotic genes via Tnt1 tagging.

Reverse genetics in high throughput: rapid generation of complete negative strand RNA virus cDNA clones and recombinant viruses thereof.

PubMed

Nolden, T; Pfaff, F; Nemitz, S; Freuling, C M; Höper, D; Müller, T; Finke, Stefan

2016-04-05

Reverse genetics approaches are indispensable tools for proof of concepts in virus replication and pathogenesis. For negative strand RNA viruses (NSVs) the limited number of infectious cDNA clones represents a bottleneck as clones are often generated from cell culture adapted or attenuated viruses, with limited potential for pathogenesis research. We developed a system in which cDNA copies of complete NSV genomes were directly cloned into reverse genetics vectors by linear-to-linear RedE/T recombination. Rapid cloning of multiple rabies virus (RABV) full length genomes and identification of clones identical to field virus consensus sequence confirmed the approache's reliability. Recombinant viruses were recovered from field virus cDNA clones. Similar growth kinetics of parental and recombinant viruses, preservation of field virus characters in cell type specific replication and virulence in the mouse model were confirmed. Reduced titers after reporter gene insertion indicated that the low level of field virus replication is affected by gene insertions. The flexibility of the strategy was demonstrated by cloning multiple copies of an orthobunyavirus L genome segment. This important step in reverse genetics technology development opens novel avenues for the analysis of virus variability combined with phenotypical characterization of recombinant viruses at a clonal level.

Construction of Pseudomolecule Sequences of the aus Rice Cultivar Kasalath for Comparative Genomics of Asian Cultivated Rice

PubMed Central

Sakai, Hiroaki; Kanamori, Hiroyuki; Arai-Kichise, Yuko; Shibata-Hatta, Mari; Ebana, Kaworu; Oono, Youko; Kurita, Kanako; Fujisawa, Hiroko; Katagiri, Satoshi; Mukai, Yoshiyuki; Hamada, Masao; Itoh, Takeshi; Matsumoto, Takashi; Katayose, Yuichi; Wakasa, Kyo; Yano, Masahiro; Wu, Jianzhong

2014-01-01

Having a deep genetic structure evolved during its domestication and adaptation, the Asian cultivated rice (Oryza sativa) displays considerable physiological and morphological variations. Here, we describe deep whole-genome sequencing of the aus rice cultivar Kasalath by using the advanced next-generation sequencing (NGS) technologies to gain a better understanding of the sequence and structural changes among highly differentiated cultivars. The de novo assembled Kasalath sequences represented 91.1% (330.55 Mb) of the genome and contained 35 139 expressed loci annotated by RNA-Seq analysis. We detected 2 787 250 single-nucleotide polymorphisms (SNPs) and 7393 large insertion/deletion (indel) sites (>100 bp) between Kasalath and Nipponbare, and 2 216 251 SNPs and 3780 large indels between Kasalath and 93-11. Extensive comparison of the gene contents among these cultivars revealed similar rates of gene gain and loss. We detected at least 7.39 Mb of inserted sequences and 40.75 Mb of unmapped sequences in the Kasalath genome in comparison with the Nipponbare reference genome. Mapping of the publicly available NGS short reads from 50 rice accessions proved the necessity and the value of using the Kasalath whole-genome sequence as an additional reference to capture the sequence polymorphisms that cannot be discovered by using the Nipponbare sequence alone. PMID:24578372

Structure and expression of the attacin genes in Hyalophora cecropia.

PubMed

Sun, S C; Lindström, I; Lee, J Y; Faye, I

1991-02-26

To study the regulation of the immune genes in insects, we have cloned and sequenced the attacin gene locus of the giant silk moth Hyalophora cecropia. The locus contains one acidic and one basic attacin gene as well as two pseudogenes, which are remnants of basic attacin genes. A small insertion element was found within the locus. The two functional attacin genes are transcribed in opposite directions and have two introns inserted at homologous positions. A common sequence, GGGGATTCCT, is found at nucleotide position -48 in the acidic gene and at nucleotide position -58 in the basic gene. Interestingly, this decanucleotide is similar to the consensus of the NF-k B-binding site. Expression studies revealed that both attacins are strongly induced by phorbol 12-myristate 13-acetate, lipopolysaccharide and bacteria. However, only the acidic attacin gene showed a clear response to injury.

[Observation on gene polymorphism of Rh blood group in Chinese Han nationality].

PubMed

Lan, Jiong-Cai; Wang, Cong-Rong; Wei, Ya-Ming; Zhou, Hua-You; Cao, Qiong; Zhang, Yin-Ze; Jiang, KuReXi; Wu, Da-Lin; Liu, Zhong

2003-12-01

To observe the gene polymorphism of Rh blood group in unrelated random individuals and families for Chinese Han nationality, polymerase chain reaction-sequence specific primer (PCR-SSP) was used to amplify the Rh C/E gene, RhD gene, exons, intron 2 and 10, insert and Rh Box in 160 blood samples of RhD positive unrelated individuals and 71 samples of RhD negative unrelated individuals and 7 samples of families whose probands were RhD-negative. The results showed that RhD genes of RhD-negative individuals with C antigens were polymorphism, three forms were found for D exon including intact, partial deletion and complete deletion exons. Insert fragments and Rh Box were found in most cases of families whose probands were RhD-negative and its inheritance accorded with the Mendel's Law, and it did not affect the expression of RhD gene. "Normal" RhD exon 4 amplifying product was not found in all of the samples. It was concluded that gene structure of the RhD-negative in Chinese was polymorphism, intact, partial deletion and complete deletion exons were found in the individuals with C antigen and probably existed specific D (nf) Ce haplotype. The function of insert was uncertain. The Rh gene sequences of Chinese Han nationality are different from those of Caucasian and the Rh gene library based on Han nationality should be established.

Construction of Signature-tagged Mutant Library in Mesorhizobium loti as a Powerful Tool for Functional Genomics

PubMed Central

Shimoda, Yoshikazu; Mitsui, Hisayuki; Kamimatsuse, Hiroko; Minamisawa, Kiwamu; Nishiyama, Eri; Ohtsubo, Yoshiyuki; Nagata, Yuji; Tsuda, Masataka; Shinpo, Sayaka; Watanabe, Akiko; Kohara, Mitsuyo; Yamada, Manabu; Nakamura, Yasukazu; Tabata, Satoshi; Sato, Shusei

2008-01-01

Rhizobia are nitrogen-fixing soil bacteria that establish endosymbiosis with some leguminous plants. The completion of several rhizobial genome sequences provides opportunities for genome-wide functional studies of the physiological roles of many rhizobial genes. In order to carry out genome-wide phenotypic screenings, we have constructed a large mutant library of the nitrogen-fixing symbiotic bacterium, Mesorhizobium loti, by transposon mutagenesis. Transposon insertion mutants were generated using the signature-tagged mutagenesis (STM) technique and a total of 29 330 independent mutants were obtained. Along with the collection of transposon mutants, we have determined the transposon insertion sites for 7892 clones, and confirmed insertions in 3680 non-redundant M. loti genes (50.5% of the total number of M. loti genes). Transposon insertions were randomly distributed throughout the M. loti genome without any bias toward G+C contents of insertion target sites and transposon plasmids used for the mutagenesis. We also show the utility of STM mutants by examining the specificity of signature tags and test screenings for growth- and nodulation-deficient mutants. This defined mutant library allows for genome-wide forward- and reverse-genetic functional studies of M. loti and will serve as an invaluable resource for researchers to further our understanding of rhizobial biology. PMID:18658183

Inserting new technology into small missions

NASA Technical Reports Server (NTRS)

Deutsch, L. J.

2001-01-01

Part of what makes small missions small is that they have less money. Executing missions at low cost implies extensive use of cost sharing with other missions or use of existing solutions. Luckily, there are methods for creating new technology and inserting it into faster-better-cheaper missions.

Familial retinoblastoma due to intronic LINE-1 insertion causes aberrant and noncanonical mRNA splicing of the RB1 gene.

PubMed

Rodríguez-Martín, Carlos; Cidre, Florencia; Fernández-Teijeiro, Ana; Gómez-Mariano, Gema; de la Vega, Leticia; Ramos, Patricia; Zaballos, Ángel; Monzón, Sara; Alonso, Javier

2016-05-01

Retinoblastoma (RB, MIM 180200) is the paradigm of hereditary cancer. Individuals harboring a constitutional mutation in one allele of the RB1 gene have a high predisposition to develop RB. Here, we present the first case of familial RB caused by a de novo insertion of a full-length long interspersed element-1 (LINE-1) into intron 14 of the RB1 gene that caused a highly heterogeneous splicing pattern of RB1 mRNA. LINE-1 insertion was inferred by mRNA studies and full-length sequenced by massive parallel sequencing. Some of the aberrant mRNAs were produced by noncanonical acceptor splice sites, a new finding that up to date has not been described to occur upon LINE-1 retrotransposition. Our results clearly show that RNA-based strategies have the potential to detect disease-causing transposon insertions. It also confirms that the incorporation of new genetic approaches, such as massive parallel sequencing, contributes to characterize at the sequence level these unique and exceptional genetic alterations.

Developing a de novo targeted knock-in method based on in utero electroporation into the mammalian brain.

PubMed

Tsunekawa, Yuji; Terhune, Raymond Kunikane; Fujita, Ikumi; Shitamukai, Atsunori; Suetsugu, Taeko; Matsuzaki, Fumio

2016-09-01

Genome-editing technology has revolutionized the field of biology. Here, we report a novel de novo gene-targeting method mediated by in utero electroporation into the developing mammalian brain. Electroporation of donor DNA with the CRISPR/Cas9 system vectors successfully leads to knock-in of the donor sequence, such as EGFP, to the target site via the homology-directed repair mechanism. We developed a targeting vector system optimized to prevent anomalous leaky expression of the donor gene from the plasmid, which otherwise often occurs depending on the donor sequence. The knock-in efficiency of the electroporated progenitors reached up to 40% in the early stage and 20% in the late stage of the developing mouse brain. Furthermore, we inserted different fluorescent markers into the target gene in each homologous chromosome, successfully distinguishing homozygous knock-in cells by color. We also applied this de novo gene targeting to the ferret model for the study of complex mammalian brains. Our results demonstrate that this technique is widely applicable for monitoring gene expression, visualizing protein localization, lineage analysis and gene knockout, all at the single-cell level, in developmental tissues. © 2016. Published by The Company of Biologists Ltd.

[Mutants of bacterium Azospirillum brasilense Sp245 with Omegon insertion in mmsB or fabG genes of lipid metabolism are defective in motility and flagellation].

PubMed

Kovtunov, E A; Shelud'ko, A V; Chernyshova, M P; Petrova, L P; Katsy, E I

2013-11-01

Bacteria Azospirillum brasilense have mixed flagellation: in addition to the polar flagellum, numerous lateral flagella are formed in their cells on medium with increased density. Flagella determine the active swimming and swarming capacities of azospirilla. Using A. brasilense Sp245 as an example, we showed that the Omegon-Km artificial transposon insertion into the chromosomal gene for 3-hydroxyisobutyrate dehydrogenase (mmsB) was concurrent with the appearance of significant defects in the formation of polar flagella and with the paralysis of lateral flagella. The Sp245 mutant with the Omegon insertion into the plasmid AZOBR_p1-borne gene for 3-oxoacyl-[acyl-carrier protein]-reductase (fabG) showed the complete loss of flagella and the swarming capacity, as well as significant defects in polar flagellar assembly (though some cells are still motile in liquid medium). The viability of the A. brasilense Sp245 mutants with the Omegon insertion into the mmsB or fabG gene was not reduced. No considerable differences in the fatty acid composition of whole cell lipid extracts were found for the A. brasilense Sp245 strain and its mmsB and fabG mutants.

Construction and characterization of a recombinant invertebrate iridovirus.

PubMed

Ozgen, Arzu; Muratoglu, Hacer; Demirbag, Zihni; Vlak, Just M; van Oers, Monique M; Nalcacioglu, Remziye

2014-08-30

Chilo iridescent virus (CIV), officially named Insect iridescent virus 6 (IIV6), is the type species of the genus Iridovirus (family Iridoviridae). In this paper we constructed a recombinant CIV, encoding the green fluorescent protein (GFP). This recombinant can be used to investigate viral replication dynamics. We showed that homologous recombination is a valid method to make CIV gene knockouts and to insert foreign genes. The CIV 157L gene, putatively encoding a non-functional inhibitor of apoptosis (IAP), was chosen as target for foreign gene insertion. The gfp open reading frame preceded by the viral mcp promoter was inserted into the 157L locus by homologous recombination in Anthonomus grandis BRL-AG-3A cells. Recombinant virus (rCIV-Δ157L-gfp) was purified by successive rounds of plaque purification. All plaques produced by the purified recombinant virus emitted green fluorescence due to the presence of GFP. One-step growth curves for recombinant and wild-type CIV were similar and the recombinant was fully infectious in vivo. Hence, CIV157L can be inactivated without altering the replication kinetics of the virus. Consequently, the CIV 157L locus can be used as a site for insertion of foreign DNA, e.g. to modify viral properties for insect biocontrol. Copyright © 2014 Elsevier B.V. All rights reserved.

[Analysis of Alu-insertion polymorphism in three subethnic groups of Kalmyks].

PubMed

Khusainova, R I; Balinova, N V; Kutuev, I A; Spitsina, N Kh; Akhmetova, V L; Valiev, R R; Spitsyn, V A; Khusnutdinova, E K

2009-03-01

Eight Alu insertions at the NBC27, TPA25, NBC148, NBC123, ACE, APOA1, NBC51, and PV92 locus were examined in three subethnic groups of Kalmyks (Torgouds, Derbets, and Buzava). In general, the pattern of allele frequencies in Kalmyks was consistent with that in Asian populations of the world, and was similar to the Alu insertion frequencies pattern in Turkic populations of the Volga--Ural region and Central Asia. Pairwise comparisons of three subpopulations of Kalmyks with respect to the frequency distributions of eight Alu insertions revealed the differences between the groups examined. The coefficient of gene differentiation, F(st), constituted 1.37%, pointing to the common origin of the groups of interest, as well as to the uniformity of the gene pools of subethnic groups of Kalmyks examined.

Inherited Creutzfeldt-Jakob disease in a British family associated with a novel 144 base pair insertion of the prion protein gene.

PubMed Central

Nicholl, D; Windl, O; de Silva, R; Sawcer, S; Dempster, M; Ironside, J W; Estibeiro, J P; Yuill, G M; Lathe, R; Will, R G

1995-01-01

A case of familial Creutzfeldt-Jakob disease associated with a 144 base pair insertion in the open reading frame of the prion protein gene is described. Sequencing of the mutated allele showed an arrangement of six octapeptide repeats, distinct from that of a recently described British family with an insertion of similar size. Thirteen years previously the brother of the proband had died from "Huntington's disease", but re-examination of his neuropathology revealed spongiform encephalopathy and anti-prion protein immunocytochemistry gave a positive result. The independent evolution of at least two distinct pathological 144 base pair insertions in Britain is proposed. The importance of maintaining a high index of suspicion of inherited Creutzfeldt-Jakob disease in cases of familial neurodegenerative disease is stressed. Images PMID:7823070

Vector for IS element entrapment and functional characterization based on turning on expression of distal promoterless genes.

PubMed

Szeverényi, I; Hodel, A; Arber, W; Olasz, F

1996-09-26

We constructed and characterized a novel trap vector for rapid isolation of insertion sequences. The strategy used for the isolation of IS elements is based on the ability of many IS elements to turn on the expression of otherwise silent genes distal to some sites of insertion. The simple transposition of an IS element can sometimes cause the constitutive expression of promoterless antibiotic resistance genes resulting in selectable phenotypes. The trap vector pAW1326 is based on a pBR322 replicon, it carries ampicillin and streptomycin resistance genes, and also silenced genes that confer chloramphenicol and kanamycin resistance once activated. The trap vector pAW1326 proved to be efficient and 85 percent of all isolated mutations were insertions. The majority of IS elements resident in the studied Escherichia coli strains tested became trapped, namely IS2, IS3, IS5, IS150, IS186 and Tn1000. We also encountered an insertion sequence, called IS10L/R-2, which is a hybrid of the two IS variants IS10L and IS10R. IS10L/R-2 is absent from most E. coli strains, but it is detectable in some strains such as JM109 which had been submitted to Tn10 mutagenesis. The distribution of the insertion sequences within the trap region was not random. Rather, the integration of chromosomal mobile genetic elements into the offered target sequence occurred in element-specific clusters. This is explained both by the target specificity and by the specific requirements for the activation of gene transcription by the DNA rearrangement. The employed trap vector pAW1326 proved to be useful for the isolation of mobile genetic elements, for a demonstration of their transposition activity as well as for the further characterization of some of the functional parameters of transposition.

NGS Catalog: A Database of Next Generation Sequencing Studies in Humans

PubMed Central

Xia, Junfeng; Wang, Qingguo; Jia, Peilin; Wang, Bing; Pao, William; Zhao, Zhongming

2015-01-01

Next generation sequencing (NGS) technologies have been rapidly applied in biomedical and biological research since its advent only a few years ago, and they are expected to advance at an unprecedented pace in the following years. To provide the research community with a comprehensive NGS resource, we have developed the database Next Generation Sequencing Catalog (NGS Catalog, http://bioinfo.mc.vanderbilt.edu/NGS/index.html), a continually updated database that collects, curates and manages available human NGS data obtained from published literature. NGS Catalog deposits publication information of NGS studies and their mutation characteristics (SNVs, small insertions/deletions, copy number variations, and structural variants), as well as mutated genes and gene fusions detected by NGS. Other functions include user data upload, NGS general analysis pipelines, and NGS software. NGS Catalog is particularly useful for investigators who are new to NGS but would like to take advantage of these powerful technologies for their own research. Finally, based on the data deposited in NGS Catalog, we summarized features and findings from whole exome sequencing, whole genome sequencing, and transcriptome sequencing studies for human diseases or traits. PMID:22517761

Antibody phage display: overview of a powerful technology that has quickly translated to the clinic.

PubMed

Kotlan, Beatrix; Glassy, Mark C

2009-01-01

Antibody-based immunologic reagents are useful for identifying, isolating, or eliminating cells with particular characteristics related to different diseases. Phage display is a highly valuable technique for antibody selection related to this purpose. In brief, a diverse group of antibody genes prepared from a patient or generated in vitro are inserted into a phagemid vector or the phage genome so that when the protein is expressed, it becomes anchored on the surface of the phage by fusion to a coat protein. A diverse library of recombinant antibodies is generated in this way and can then be exposed or panned on the antigen of interest, typically, this being a molecule associated with a particular pathological condition. Phage that carry proteins or peptides bind preferentially to the target and can thus be isolated from the library. The viruses that are recovered in this way also carry the gene for the binding moiety facilitating its over-expression or manipulation. Recent reviews highlight key milestones in the development of antibody libraries and their screening by phage display, and the impact of these technologies on drug discovery seems assured.

Identification of Novel Virulence Determinants in Mycobacterium paratuberculosis by Screening a Library of Insertional Mutants†

PubMed Central

Shin, Sung Jae; Wu, Chia-wei; Steinberg, Howard; Talaat, Adel M.

2006-01-01

Johne's disease, caused by Mycobacterium paratuberculosis infection, is a worldwide problem for the dairy industry and has a possible involvement in Crohn's disease in humans. To identify virulence determinants of this economically important pathogen, a library of 5,060 transposon mutants was constructed using Tn5367 insertion mutagenesis, followed by large-scale sequencing to identify disrupted genes. In this report, 1,150 mutants were analyzed and 970 unique insertion sites were identified. Sequence analysis of the disrupted genes indicated that the insertion of Tn5367 was more prevalent in genomic regions with G+C content (50.5 to 60.5%) lower than the average G+C content (69.3%) of the rest of the genome. Phenotypic screening of the library identified disruptions of genes involved in iron, tryptophan, or mycolic acid metabolic pathways that displayed unique growth characteristics. Bioinformatic analysis of disrupted genes identified a list of potential virulence determinants for further testing with animals. Mouse infection studies showed a significant decrease in tissue colonization by mutants with a disruption in the gcpE, pstA, kdpC, papA2, impA, umaA1, or fabG2_2 gene. Attenuation phenotypes were tissue specific (e.g., for the umaA1 mutant) as well as time specific (e.g., for the impA mutant), suggesting that those genes may be involved in different virulence mechanisms. The identified potential virulence determinants represent novel functional classes that could be necessary for mycobacterial survival during infection and could provide suitable targets for vaccine and drug development against Johne's and Crohn's diseases. PMID:16790754

A small indel mutation in an anthocyanin transporter causes variegated colouration of peach flowers

PubMed Central

Cheng, Jun; Liao, Liao; Zhou, Hui; Gu, Chao; Wang, Lu; Han, Yuepeng

2015-01-01

The ornamental peach cultivar ‘Hongbaihuatao (HBH)’ can simultaneously bear pink, red, and variegated flowers on a single tree. Anthocyanin content in pink flowers is extremely low, being only 10% that of a red flower. Surprisingly, the expression of anthocyanin structural and potential regulatory genes in white flowers was not significantly lower than that in both pink and red flowers. However, proteomic analysis revealed a GST encoded by a gene—regulator involved in anthocyanin transport (Riant)—which is expressed in the red flower, but almost undetectable in the variegated flower. The Riant gene contains an insertion-deletion (indel) polymorphism in exon 3. In white flowers, the Riant gene is interrupted by a 2-bp insertion in the last exon, which causes a frameshift and a premature stop codon. In contrast, both pink and red flowers that arise from bud sports are heterozygous for the Riant locus, with one functional allele due to the 2-bp deletion or a novel 1-bp insertion. Southern blot analysis indicated that the Riant gene occurs in a single copy in the peach genome and it is not interrupted by a transposon. The function of the Riant gene was confirmed by its ectopic expression in the Arabidopsis tt19 mutant, where it complements the anthocyanin phenotype, but not the proanthocyanidin pigmentation in seed coat. Collectively,these results indicate that a small indel mutation in the Riant gene, which is not the result of a transposon insertion or excision, causes variegated colouration of peach flowers. PMID:26357885

BAC Modification through Serial or Simultaneous Use of CRE/Lox Technology

PubMed Central

Parrish, Mark; Unruh, Jay; Krumlauf, Robb

2011-01-01

Bacterial Artificial Chromosomes (BACs) are vital tools in mouse genomic analyses because of their ability to propagate large inserts. The size of these constructs, however, prevents the use of conventional molecular biology techniques for modification and manipulation. Techniques such as recombineering and Cre/Lox methodologies have thus become heavily relied upon for such purposes. In this work, we investigate the applicability of Lox variant sites for serial and/or simultaneous manipulations of BACs. We show that Lox spacer mutants are very specific, and inverted repeat variants reduce Lox reaction rates through reducing the affinity of Cre for the site, while retaining some functionality. Employing these methods, we produced serial modifications encompassing four independent changes which generated a mouse HoxB BAC with fluorescent reporter proteins inserted into four adjacent Hox genes. We also generated specific, simultaneous deletions using combinations of spacer variants and inverted repeat variants. These techniques will facilitate BAC manipulations and open a new repertoire of methods for BAC and genome manipulation. PMID:21197414

A Rapid, High-Quality, Cost-Effective, Comprehensive and Expandable Targeted Next-Generation Sequencing Assay for Inherited Heart Diseases.

PubMed

Wilson, Kitchener D; Shen, Peidong; Fung, Eula; Karakikes, Ioannis; Zhang, Angela; InanlooRahatloo, Kolsoum; Odegaard, Justin; Sallam, Karim; Davis, Ronald W; Lui, George K; Ashley, Euan A; Scharfe, Curt; Wu, Joseph C

2015-09-11

Thousands of mutations across >50 genes have been implicated in inherited cardiomyopathies. However, options for sequencing this rapidly evolving gene set are limited because many sequencing services and off-the-shelf kits suffer from slow turnaround, inefficient capture of genomic DNA, and high cost. Furthermore, customization of these assays to cover emerging targets that suit individual needs is often expensive and time consuming. We sought to develop a custom high throughput, clinical-grade next-generation sequencing assay for detecting cardiac disease gene mutations with improved accuracy, flexibility, turnaround, and cost. We used double-stranded probes (complementary long padlock probes), an inexpensive and customizable capture technology, to efficiently capture and amplify the entire coding region and flanking intronic and regulatory sequences of 88 genes and 40 microRNAs associated with inherited cardiomyopathies, congenital heart disease, and cardiac development. Multiplexing 11 samples per sequencing run resulted in a mean base pair coverage of 420, of which 97% had >20× coverage and >99% were concordant with known heterozygous single nucleotide polymorphisms. The assay correctly detected germline variants in 24 individuals and revealed several polymorphic regions in miR-499. Total run time was 3 days at an approximate cost of $100 per sample. Accurate, high-throughput detection of mutations across numerous cardiac genes is achievable with complementary long padlock probe technology. Moreover, this format allows facile insertion of additional probes as more cardiomyopathy and congenital heart disease genes are discovered, giving researchers a powerful new tool for DNA mutation detection and discovery. © 2015 American Heart Association, Inc.

Identification of immune protective genes of Eimeria maxima through cDNA expression library screening.

PubMed

Yang, XinChao; Li, MengHui; Liu, JianHua; Ji, YiHong; Li, XiangRui; Xu, LiXin; Yan, RuoFeng; Song, XiaoKai

2017-02-16

Eimeria maxima is one of the most prevalent Eimeria species causing avian coccidiosis, and results in huge economic loss to the global poultry industry. Current control strategies, such as anti-coccidial medication and live vaccines have been limited because of their drawbacks. The third generation anticoccidial vaccines including the recombinant vaccines as well as DNA vaccines have been suggested as a promising alternative strategy. To date, only a few protective antigens of E. maxima have been reported. Hence, there is an urgent need to identify novel protective antigens of E. maxima for the development of neotype anticoccidial vaccines. With the aim of identifying novel protective genes of E. maxima, a cDNA expression library of E. maxima sporozoites was constructed using Gateway technology. Subsequently, the cDNA expression library was divided into 15 sub-libraries for cDNA expression library immunization (cDELI) using parasite challenged model in chickens. Protective sub-libraries were selected for the next round of screening until individual protective clones were obtained, which were further sequenced and analyzed. Adopting the Gateway technology, a high-quality entry library was constructed, containing 9.2 × 10 6 clones with an average inserted fragments length of 1.63 kb. The expression library capacity was 2.32 × 10 7 colony-forming units (cfu) with an average inserted fragments length of 1.64 Kb. The expression library was screened using parasite challenged model in chickens. The screening yielded 6 immune protective genes including four novel protective genes of EmJS-1, EmRP, EmHP-1 and EmHP-2, and two known protective genes of EmSAG and EmCKRS. EmJS-1 is the selR domain-containing protein of E. maxima whose function is unknown. EmHP-1 and EmHP-2 are the hypothetical proteins of E. maxima. EmRP and EmSAG are rhomboid-like protein and surface antigen glycoproteins of E. maxima respectively, and involved in invasion of the parasite. Our results provide a cDNA expression library for further screening of T cell stimulating or inhibiting antigens of E. maxima. Moreover, our results provide six candidate protective antigens for developing new vaccines against E. maxima.

Advances in CRISPR-Cas9 genome engineering: lessons learned from RNA interference

PubMed Central

Barrangou, Rodolphe; Birmingham, Amanda; Wiemann, Stefan; Beijersbergen, Roderick L.; Hornung, Veit; Smith, Anja van Brabant

2015-01-01

The discovery that the machinery of the Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR)-Cas9 bacterial immune system can be re-purposed to easily create deletions, insertions and replacements in the mammalian genome has revolutionized the field of genome engineering and re-invigorated the field of gene therapy. Many parallels have been drawn between the newly discovered CRISPR-Cas9 system and the RNA interference (RNAi) pathway in terms of their utility for understanding and interrogating gene function in mammalian cells. Given this similarity, the CRISPR-Cas9 field stands to benefit immensely from lessons learned during the development of RNAi technology. We examine how the history of RNAi can inform today's challenges in CRISPR-Cas9 genome engineering such as efficiency, specificity, high-throughput screening and delivery for in vivo and therapeutic applications. PMID:25800748

Characterization of Novel Hepatitis B Virus PreS/S-Gene Mutations in a Patient with Occult Hepatitis B Virus Infection

PubMed Central

Xu, Zhihui; Chen, Rongjuan; Si, Lanlan; Lu, Shanshan; Li, Xiaodong; Wang, Shuai; Zhang, Kai; Li, Jin; Han, Juqiang; Xu, Dongping

2016-01-01

Objective The impact of hepatitis B virus (HBV) preS/S-gene mutations on occult HBV infection (OBI) is not fully understood. This study characterized multiple novel HBV preS/S-gene mutants obtained from an OBI patient. Methods PreS/S-gene mutants were analyzed by clonal sequencing. Viral replication and expression were analyzed by transfecting HBV genomic recombinants into HepG2 cells. Results Twenty-one preS/S-gene mutants were cloned from four sequential serum samples, including 13 mutants that were not previously documented: (1) sI/T126V+sG145R; (2) preS1 nt 3014−3198 deletion; (3) preS1 nt 3046−3177 deletion; (4) preS1 nt 3046−3177 deletion+s115−116 “INGTST” insertion; (5) preS1 nt 3046−3177 deletion+s115−116 “INGTST” insertion+sG145R; (6) preS1 nt 3115−3123 deletion+sQ129N; (7) preS1 nt 3115−3123 deletion+s126−127 “RPCMNCTI” insertion; (8) s115−116 “INGTST” insertion; (9) s115−116 “INGTST” insertion+sG145R; (10) s126−127 “RPCMNCTI” insertion; (11) preS1 nt 2848−2862 deletion+preS2 initiation codon M→I; (12) s122−123 “KSTGLCK” insertion+sQ129N; and (13) preS2 initiation codon M→I+s131−133TSM→NST. The proportion of preS1 nt 3046−3177 deletion and preS2 initiation codon M→I+s131−133TSM→NST mutants increased in the viral pool with prolonged disease. The 13 novel OBI-related mutants showed a 51.2−99.9% decrease in HBsAg levels compared with that of the wild type. Additional N-glycosylation-associated mutations, sQ129N and s131−133TSM→NST, but not s126−127 “RPCMNCTI,” greatly attenuated anti-HBs binding to HBsAg. Compared with the wild type, replication and surface antigen promoter II activity of the preS1 nt 3046−3177 deletion mutant decreased by 43.3% and 97.0%, respectively. Conclusion PreS/S-gene mutations may play coordinated roles in the presentation of OBI and might be associated with disease progression. This has implications for HBV diagnosis and vaccine improvement. PMID:27182775

Transcriptome-wide effects of inverted SINEs on gene expression and their impact on RNA polymerase II activity.

PubMed

Tajaddod, Mansoureh; Tanzer, Andrea; Licht, Konstantin; Wolfinger, Michael T; Badelt, Stefan; Huber, Florian; Pusch, Oliver; Schopoff, Sandy; Janisiw, Michael; Hofacker, Ivo; Jantsch, Michael F

2016-10-25

Short interspersed elements (SINEs) represent the most abundant group of non-long-terminal repeat transposable elements in mammalian genomes. In primates, Alu elements are the most prominent and homogenous representatives of SINEs. Due to their frequent insertion within or close to coding regions, SINEs have been suggested to play a crucial role during genome evolution. Moreover, Alu elements within mRNAs have also been reported to control gene expression at different levels. Here, we undertake a genome-wide analysis of insertion patterns of human Alus within transcribed portions of the genome. Multiple, nearby insertions of SINEs within one transcript are more abundant in tandem orientation than in inverted orientation. Indeed, analysis of transcriptome-wide expression levels of 15 ENCODE cell lines suggests a cis-repressive effect of inverted Alu elements on gene expression. Using reporter assays, we show that the negative effect of inverted SINEs on gene expression is independent of known sensors of double-stranded RNAs. Instead, transcriptional elongation seems impaired, leading to reduced mRNA levels. Our study suggests that there is a bias against multiple SINE insertions that can promote intramolecular base pairing within a transcript. Moreover, at a genome-wide level, mRNAs harboring inverted SINEs are less expressed than mRNAs harboring single or tandemly arranged SINEs. Finally, we demonstrate a novel mechanism by which inverted SINEs can impact on gene expression by interfering with RNA polymerase II.

Alterations in the 5 'untranslated region of the EPSPS gene influence EPSPS overexpression in glyphosate-resistant Eleusine indica.

PubMed

Zhang, Chun; Feng, Li; Tian, Xing-Shan

2018-04-26

The herbicide glyphosate inhibits the enzyme 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS). Overexpression of the EPSPS gene is one of the molecular mechanisms conferring glyphosate resistance in weeds, but the transcriptional regulation of this gene is poorly understood. The EPSPS gene was found to be significantly up-regulated following glyphosate treatment in a glyphosate- resistant Eleusine indica population from South China. To further investigate the regulation of EPSPS overexpression, the promoter of the EPSPS gene from this E. indica population was cloned and analyzed. Two upstream regulatory sequences, Epro-S (862 bp) and Epro-R (877 bp) of EPSPS were obtained from glyphosate-susceptible (S) and -resistant (R) E. indica plants respectively by HiTAIL-PCR. The Epro-S and Epro-R sequences were 99% homologous, except for the two insertions (3 bp and12 bp) in the R sequence. The 12-base insertion of the Epro-R sequence was located in the 5'-UTR-Py-rich stretch element. The promoter activity tests showed that the 12-base insertion resulted in significant enhancement of the Epro-R promoter activity, whereas the 3-base insertion had little effect on Epro-R promoter activity. Alterations in the 5'-UTR-Py-rich stretch element of EPSPS are responsible for glyphosate induced EPSPS overexpression. Therefore, EPSPS transcriptional regulation confers glyphosate resistance in this E. indica population. This article is protected by copyright. All rights reserved.

Structure of Exogenous Gene Integration and Event-Specific Detection in the Glyphosate-Tolerant Transgenic Cotton Line BG2-7.

PubMed

Zhang, Xiaobing; Tang, Qiaoling; Wang, Xujing; Wang, Zhixing

2016-01-01

In this study, the flanking sequence of an inserted fragment conferring glyphosate tolerance on transgenic cotton line BG2-7 was analyzed by thermal asymmetric interlaced polymerase chain reaction (TAIL-PCR) and standard PCR. The results showed apparent insertion of the exogenous gene into chromosome D10 of the Gossypium hirsutum L. genome, as the left and right borders of the inserted fragment are nucleotides 61,962,952 and 61,962,921 of chromosome D10, respectively. In addition, a 31-bp cotton microsatellite sequence was noted between the genome sequence and the 5' end of the exogenous gene. In total, 84 and 298 bp were deleted from the left and right borders of the exogenous gene, respectively, with 30 bp deleted from the cotton chromosome at the insertion site. According to the flanking sequence obtained, several pairs of event-specific detection primers were designed to amplify sequence between the 5' end of the exogenous gene and the cotton genome junction region as well as between the 3' end and the cotton genome junction region. Based on screening tests, the 5'-end primers GTCATAACGTGACTCCCTTAATTCTCC/CCTATTACACGGCTATGC and 3'-end primers TCCTTTCGCTTTCTTCCCTT/ACACTTACATGGCGTCTTCT were used to detect the respective BG2-7 event-specific primers. The limit of detection of the former primers reached 44 copies, and that of the latter primers reached 88 copies. The results of this study provide useful data for assessment of BG2-7 safety and for accelerating its industrialization.

Model-based assist feature insertion for sub-40nm memory device

NASA Astrophysics Data System (ADS)

Suh, Sungsoo; Lee, Suk-joo; Choi, Seong-woon; Lee, Sung-Woo; Park, Chan-hoon

2009-04-01

Many issues need to be resolved for a production-worthy model based assist feature insertion flow for single and double exposure patterning process to extend low k1 process at 193 nm immersion technology. Model based assist feature insertion is not trivial to implement either for single and double exposure patterning compared to rule based methods. As shown in Fig. 1, pixel based mask inversion technology in itself has difficulties in mask writing and inspection although it presents as one of key technology to extend single exposure for contact layer. Thus far, inversion technology is tried as a cooptimization of target mask to simultaneously generate optimized main and sub-resolution assists features for a desired process window. Alternatively, its technology can also be used to optimize for a target feature after an assist feature types are inserted in order to simplify the mask complexity. Simplification of inversion mask is one of major issue with applying inversion technology to device development even if a smaller mask feature can be fabricated since the mask writing time is also a major factor. As shown in Figure 2, mask writing time may be a limiting factor in determining whether or not an inversion solution is viable. It can be reasoned that increased number of shot counts relates to increase in margin for inversion methodology. On the other hand, there is a limit on how complex a mask can be in order to be production worthy. There is also source and mask co-optimization which influences the final mask patterns and assist feature sizes and positions for a given target. In this study, we will discuss assist feature insertion methods for sub 40-nm technology.

Gene leopard nuclei (len P103) participating in control of disjunction and coiling of chromosomes in Drosophila

DOE Office of Scientific and Technical Information (OSTI.GOV)

Omel`yanchuk, L.V.

1995-12-01

A lethal insertion of an element P[lArB], which caused nondisjunction and structural abnormalities in chromosomes in the neuroblasts of homozygous larvae, was found. The insertion was mapped to region 57B1-12 of the polytene map of chromosome 2 of Drosophila. The expression of the corresponding gene was found in testes, ovaries, and neural ganglia. 8 refs., 6 figs.

The pht4;1-3 mutant line contains a loss of function allele in the Fatty Acid Desaturase 7 gene caused by a remnant inactivated selection marker-a cautionary tale.

PubMed

Nilsson, Anders K; Andersson, Mats X

2017-01-01

A striking and unexpected biochemical phenotype was found in an insertion mutant line in the model plant Arabidopsis thaliana . One of two investigated insertion mutant lines in the gene encoding the phosphate transporter PHT4;1 demonstrated a prominent loss of trienoic fatty acids, whereas the other insertion line was indistinguishable from wild type in this aspect. We demonstrate that the loss of trienoic fatty acids was due to a remnant inactive negative selection marker gene in this particular transposon tagged line, pht4;1-3 . This constitutes a cautionary tale that warns of the importance to confirm the loss of this type of selection markers and the importance of verifying the relationship between a phenotype and genotype by more than one independent mutant line or alternatively genetic complementation.

Distribution of Classical and Nonclassical Virulence Genes in Enterotoxigenic Escherichia coli Isolates from Chilean Children and tRNA Gene Screening for Putative Insertion Sites for Genomic Islands▿†

PubMed Central

Del Canto, Felipe; Valenzuela, Patricio; Cantero, Lidia; Bronstein, Jonathan; Blanco, Jesús E.; Blanco, Jorge; Prado, Valeria; Levine, Myron; Nataro, James; Sommerfelt, Halvor; Vidal, Roberto

2011-01-01

Enterotoxigenic Escherichia coli (ETEC) is an important cause of diarrhea. Three adhesins (Tia, TibA, EtpA), an iron acquisition system (Irp1, Irp2, and FyuA), a GTPase (LeoA), and an autotransporter (EatA) are ETEC virulence-related proteins that, in contrast to the classical virulence factors (enterotoxins and fimbrial colonization factors) have not heretofore been targets in characterizing isolates from epidemiological studies. Here, we determined the occurrence of these nonclassical virulence genes in 103 ETEC isolates from Chilean children with diarrhea and described their association with O serogroups and classical virulence determinants. Because tia, leoA, irp2, and fyuA are harbored by pathogenicity islands inserted into the selC and asnT tRNA genes (tDNAs), we analyzed the regions flanking these loci. Ten additional tDNAs were also screened to identify hot spots for genetic insertions. Associations between the most frequent serogroups and classical colonization factor (CF)-toxin profiles included O6/LT-STh/CS1-CS3-CS21 (i.e., O6 serogroup, heat-labile [LT] and human heat-stable [STh] enterotoxins, and CFs CS1, -3 and -21), O6/LT-STh/CS2-CS3-CS21, and O104-O127/STh/CFAI-CS21. The eatA and etpA genes were detected in more than 70% of the collection, including diverse serogroups and virulence profiles. Sixteen percent of the ETEC strains were negative for classical and nonclassical adhesins, suggesting the presence of unknown determinants of adhesion. The leuX, thrW, and asnT tDNAs were disrupted in more than 65% of strains, suggesting they are hot spots for the insertion of mobile elements. Sequences similar to integrase genes were identified next to the thrW, asnT, pheV, and selC tDNAs. We propose that the eatA and etpA genes should be included in characterizations of ETEC isolates in future epidemiological studies to determine their prevalence in other geographical regions. Sequencing of tDNA-associated genetic insertions might identify new ETEC virulence determinants. PMID:21775541

DOE final report 100608.doc

DOE Office of Scientific and Technical Information (OSTI.GOV)

Golden, Susan S

2008-10-16

The aim of this project was to inactivate each locus of the genome of the cyanobacterium Synechococcus elongatus PCC 7942 and screen resulting mutants for altered circadian phenotypes. The immediate goal was to identify all open reading frames (ORFs) that contribute to circadian timing. An additional result was to create a complete archived set of mutagenesis templates, of great utility for the wider research community, that will allow inactivation of any given locus in the genome of S. elongatus. Clones that carry segments of the S. elongatus genome were saturated with transposon insertions in vitro. We completed saturation mutagenesis ofmore » the chromosome (~2800 ORFs). The positions of insertions were sequenced for 17,767 mutagenized clones. Each individual insertion into the S. elongatus DNA in a cosmid or plasmid is a substrate for mutagenesis of the genome via homologous recombination. Because the complete insertion mutation clone set is 5-7 fold redundant, we produced a streamlined set of clones that contains one insertion mutation per locus in the genome, a unigene set. All clones are archived as Escherichia coli stocks frozen in glycerol in 96-well plates at -85ºC and as replicas of these plates on Whatman CloneSaver cards. Each of the mutagenesis substrates from the unigene set has been recombined into the chromosome of wild-type S. elongatus and these cyanobacterial mutants have been archived at -85ºC as well. S. elongatus insertion mutants defective for than 1400 independent genes have screened in luciferase reporter gene backgrounds to evaluate the effect of each mutation on circadian rhythms of gene expression. For the first 700 genes tested, mutagenesis of 71 different ORFs resulted in circadian phenotypes. The mutagenesis project also created insertion mutations in the endogenous large plasmid of S. elongatus, pANL. The sequence of pANL revealed two potential addiction cassettes that appear to account for selection for plasmid persistence. Genetic experiments confirmed that these regions are present on all sub-sets of the plasmid that can replace wild-type pANL. Analysis of mutants defective in each of the remaining ~1400 genes for defects in circadian rhythms will be completed with support from another agency as part of a larger project on circadian rhythms in this cyanobacterium.« less

Efficient gene knockin in axolotl and its use to test the role of satellite cells in limb regeneration.

PubMed

Fei, Ji-Feng; Schuez, Maritta; Knapp, Dunja; Taniguchi, Yuka; Drechsel, David N; Tanaka, Elly M

2017-11-21

Salamanders exhibit extensive regenerative capacities and serve as a unique model in regeneration research. However, due to the lack of targeted gene knockin approaches, it has been difficult to label and manipulate some of the cell populations that are crucial for understanding the mechanisms underlying regeneration. Here we have established highly efficient gene knockin approaches in the axolotl ( Ambystoma mexicanum ) based on the CRISPR/Cas9 technology. Using a homology-independent method, we successfully inserted both the Cherry reporter gene and a larger membrane-tagged Cherry-ER T2 -Cre-ER T2 (∼5-kb) cassette into axolotl Sox2 and Pax7 genomic loci. Depending on the size of the DNA fragments for integration, 5-15% of the F0 transgenic axolotl are positive for the transgene. Using these techniques, we have labeled and traced the PAX7-positive satellite cells as a major source contributing to myogenesis during axolotl limb regeneration. Our work brings a key genetic tool to molecular and cellular studies of axolotl regeneration.

Application of CRISPR/Cas9 genome editing to the study and treatment of disease.

PubMed

Pellagatti, Andrea; Dolatshad, Hamid; Valletta, Simona; Boultwood, Jacqueline

2015-07-01

CRISPR/Cas is a microbial adaptive immune system that uses RNA-guided nucleases to cleave foreign genetic elements. The CRISPR/Cas9 method has been engineered from the type II prokaryotic CRISPR system and uses a single-guide RNA to target the Cas9 nuclease to a specific genomic sequence. Cas9 induces double-stranded DNA breaks which are repaired either by imperfect non-homologous end joining to generate insertions or deletions (indels) or, if a repair template is provided, by homology-directed repair. Due to its specificity, simplicity and versatility, the CRISPR/Cas9 system has recently emerged as a powerful tool for genome engineering in various species. This technology can be used to investigate the function of a gene of interest or to correct gene mutations in cells via genome editing, paving the way for future gene therapy approaches. Improvements to the efficiency of CRISPR repair, in particular to increase the rate of gene correction and to reduce undesired off-target effects, and the development of more effective delivery methods will be required for its broad therapeutic application.

Clostridium perfringens type A–E toxin plasmids

PubMed Central

Freedman, John C.; Theoret, James R.; Wisniewski, Jessica A.; Uzal, Francisco A.; Rood, Julian I.; McClane, Bruce A.

2014-01-01

Clostridium perfringens relies upon plasmid-encoded toxin genes to cause intestinal infections. These toxin genes are associated with insertion sequences that may facilitate their mobilization and transfer, giving rise to new toxin plasmids with common backbones. Most toxin plasmids carry a transfer of clostridial plasmids locus mediating conjugation, which likely explains the presence of similar toxin plasmids in otherwise unrelated C. perfringens strains. The association of many toxin genes with insertion sequences and conjugative plasmids provides virulence flexibility when causing intestinal infections. However, incompatibility issues apparently limit the number of toxin plasmids maintained by a single cell. PMID:25283728

A virus vector based on Canine Herpesvirus for vaccine applications in canids.

PubMed

Strive, T; Hardy, C M; Wright, J; Reubel, G H

2007-01-31

Canine Herpesvirus (CHV) is being developed as a virus vector for the vaccination of European red foxes. However, initial studies using recombinant CHV vaccines in foxes revealed viral attenuation and lack of antibody response to inserted foreign antigens. These findings were attributed both to inactivation of the thymidine kinase (TK) gene and excess foreign genetic material in the recombinant viral genome. In this study, we report an improved CHV-bacterial artificial chromosome (BAC) vector system designed to overcome attenuation in foxes. A non-essential region was identified in the CHV genome as an alternative insertion site for foreign genes. Replacement of a guanine/cytosine (GC)-rich intergenic region between UL21 and UL22 of CHV with a marker gene did not change growth behaviour in vitro, showing that this region is not essential for virus growth in cell culture. We subsequently produced a CHV-BAC vector with an intact TK gene in which the bacterial genes and the antigen expression cassette were inserted into this GC-rich locus. Unlike earlier constructs, the new CHV-BAC allowed self-excision of the bacterial genes via homologous recombination after transfection of BACs into cell culture. The BAC-CHV system was used to produce a recombinant virus that constitutively expressed porcine zona pellucida subunit C protein between the UL21 and UL22 genes of CHV. Complete self-excision of the bacterial genes from CHV was achieved within one round of replication whilst retaining antigen gene expression.

In situ genetic correction of the sickle cell anemia mutation in human induced pluripotent stem cells using engineered zinc finger nucleases.

PubMed

Sebastiano, Vittorio; Maeder, Morgan L; Angstman, James F; Haddad, Bahareh; Khayter, Cyd; Yeo, Dana T; Goodwin, Mathew J; Hawkins, John S; Ramirez, Cherie L; Batista, Luis F Z; Artandi, Steven E; Wernig, Marius; Joung, J Keith

2011-11-01

The combination of induced pluripotent stem cell (iPSC) technology and targeted gene modification by homologous recombination (HR) represents a promising new approach to generate genetically corrected, patient-derived cells that could be used for autologous transplantation therapies. This strategy has several potential advantages over conventional gene therapy including eliminating the need for immunosuppression, avoiding the risk of insertional mutagenesis by therapeutic vectors, and maintaining expression of the corrected gene by endogenous control elements rather than a constitutive promoter. However, gene targeting in human pluripotent cells has remained challenging and inefficient. Recently, engineered zinc finger nucleases (ZFNs) have been shown to substantially increase HR frequencies in human iPSCs, raising the prospect of using this technology to correct disease causing mutations. Here, we describe the generation of iPSC lines from sickle cell anemia patients and in situ correction of the disease causing mutation using three ZFN pairs made by the publicly available oligomerized pool engineering method (OPEN). Gene-corrected cells retained full pluripotency and a normal karyotype following removal of reprogramming factor and drug-resistance genes. By testing various conditions, we also demonstrated that HR events in human iPSCs can occur as far as 82 bps from a ZFN-induced break. Our approach delineates a roadmap for using ZFNs made by an open-source method to achieve efficient, transgene-free correction of monogenic disease mutations in patient-derived iPSCs. Our results provide an important proof of principle that ZFNs can be used to produce gene-corrected human iPSCs that could be used for therapeutic applications. Copyright © 2011 AlphaMed Press.

Genome engineering via homologous recombination in mouse embryonic stem (ES) cells: an amazingly versatile tool for the study of mammalian biology.

PubMed

Babinet, C; Cohen-Tannoudji, M

2001-09-01

The ability to introduce genetic modifications in the germ line of complex organisms has been a long-standing goal of those who study developmental biology. In this regard, the mouse, a favorite model for the study of the mammals, is unique: indeed not only is it possible since the late seventies, to add genes to the mouse genome like in several other complex organisms but also to perform gene replacement and modification. This has been made possible via two technological breakthroughs: 1) the isolation and culture of embryonic stem cells (ES), which have the unique ability to colonize all the tissues of an host embryo including its germ line; 2) the development of methods allowing homologous recombination between an incoming DNA and its cognate chromosomal sequence (gene "targeting"). As a result, it has become possible to create mice bearing null mutations in any cloned gene (knock-out mice). Such a possibility has revolutionized the genetic approach of almost all aspects of the biology of the mouse. In recent years, the scope of gene targeting has been widened even more, due to the refinement of the knock-out technology: other types of genetic modifications may now be created, including subtle mutations (point mutations, micro deletions or insertions, etc.) and chromosomal rearrangements such as large deletions, duplications and translocations. Finally, methods have been devised which permit the creation of conditional mutations, allowing the study of gene function throughout the life of an animal, when gene inactivation entails embryonic lethality. In this paper, we present an overview of the methods and scenarios used for the programmed modification of mouse genome, and we underline their enormous interest for the study of mammalian biology.

Additive Manufacturing for Highly Efficient Window Inserts CRADA Report

DOE Office of Scientific and Technical Information (OSTI.GOV)

Roschli, Alex C.; Chesser, Phillip C.; Love, Lonnie J.

ORNL partnered with the Mackinac Technology Company to demonstrate how additive manufacturing can be used to create highly energy efficient window inserts for retrofit in pre-existing buildings. Many early iterations of the window inserts were fabricated using carbon fiber reinforced thermoplastics and polycarbonate films as a stand in for the low-e coated films produced by the Mackinac Technology Company. After demonstration of the proof of concept, i.e. custom window inserts with tensioned film, the materials used for the manufacture of the frames was more closely examined. Hollow particle-filled syntactic foam and low-density polymer composites formed by expandable microspheres were exploredmore » as the materials used to additively manufacture the frames of the inserts. It was concluded that low-cost retrofit window inserts in custom sizes could be easily fabricated using large scale additive manufacturing. Furthermore, the syntactic and expanded foams developed and tested satisfy the mechanical performance requirements for the application.« less

Reconstitutional Mutagenesis of the Maize P Gene by Short-Range Ac Transpositions

PubMed Central

Moreno, M. A.; Chen, J.; Greenblatt, I.; Dellaporta, S. L.

1992-01-01

The tendency for Ac to transpose over short intervals has been utilized to develop insertional mutagenesis and fine structure genetic mapping strategies in maize. We recovered excisions of Ac from the P gene and insertions into nearby chromosomal sites. These closely linked Ac elements reinserted into the P gene, reconstituting over 250 unstable variegated alleles. Reconstituted alleles condition a variety of variegation patterns that reflect the position and orientation of Ac within the P gene. Molecular mapping and DNA sequence analyses have shown that reinsertion sites are dispersed throughout a 12.3-kb chromosomal region in the promoter, exons and introns of the P gene, but in some regions insertions sites were clustered in a nonrandom fashion. Transposition profiles and target site sequence data obtained from these studies have revealed several features of Ac transposition including its preference for certain target sites. These results clearly demonstrate the tendency of Ac to transpose to nearby sites in both proximal and distal directions from the donor site. With minor modifications, reconstitutional mutagenesis should be applicable to many Ac-induced mutations in maize and in other plant species and can possibly be extended to other eukaryotic transposon systems as well. PMID:1325389

Problems associated with gene transfer and opportunities for microgravity environments

NASA Astrophysics Data System (ADS)

Tennessen, Daniel J.

1997-01-01

The method of crop improvement by gene transfer is becoming increasingly routine with transgenic foods and ornamental crops now being marketed to consumers. However, biological processes of plants, and the physical barriers of current protocols continue to limit the application of gene transfer in many commercial crops. The goal of this paper is to outline the current limitations of gene transfer and to hypothesize possible opportunities for use of microgravity to overcome such limitations. The limitations detailed in this paper include host-range specificity of Agrobacterium mediated transformation, probability of gene insertion, position effects of the inserted genes, gene copy number, stability of foreign gene expression in host plants, and regeneration of recalcitrant plant species. Microgravity offers an opportunity for gene transfer where cell growth kinetics, DNA synthesis, and genetic recombination rates can be altered. Such biological conditions may enhance the ability for recombination of reporter genes and other genes of interest to agriculture. Proposed studies would be useful for understanding instability of foreign gene expression and may lead to stable transformed plants. Other aspects of gene transfer in microgravity are discussed.

Enhanced green fluorescent protein (egfp) gene expression in Tetraselmis subcordiformis chloroplast with endogenous regulators.

PubMed

Cui, Yulin; Zhao, Jialin; Hou, Shichang; Qin, Song

2016-05-01

On the basis of fundamental genetic transformation technologies, the goal of this study was to optimize Tetraselmis subcordiformis chloroplast transformation through the use of endogenous regulators. The genes rrn16S, rbcL, psbA, and psbC are commonly highly expressed in chloroplasts, and the regulators of these genes are often used in chloroplast transformation. For lack of a known chloroplast genome sequence, the genome-walking method was used here to obtain full sequences of T. subcordiformis endogenous regulators. The resulting regulators, including three promoters, two terminators, and a ribosome combination sequence, were inserted into the previously constructed plasmid pPSC-R, with the egfp gene included as a reporter gene, and five chloroplast expression vectors prepared. These vectors were successfully transformed into T. subcordiformis by particle bombardment and the efficiency of each vector tested by assessing EGFP fluorescence via microscopy. The results showed that these vectors exhibited higher efficiency than the former vector pPSC-G carrying exogenous regulators, and the vector pRFA with Prrn, psbA-5'RE, and TpsbA showed the highest efficiency. This research provides a set of effective endogenous regulators for T. subcordiformis and will facilitate future fundamental studies of this alga.

Retrotransposons of the Tnt1B family are mobile in Nicotiana plumbaginifolia and can induce alternative splicing of the host gene upon insertion.

PubMed

Leprinc, A S; Grandbastien, M A; Christian, M

2001-11-01

Active retrotransposons have been identified in Nicotiana plumbaginifolia by their ability to disrupt the nitrate reductase gene in chlorate-resistant mutants selected from protoplast-derived cultures. In mutants E23 and F97, two independent insertions of Tnp2, a new retrotransposon closely related to the tobacco Tnt1 elements, were detected in the nitrate reductase gene. These two Tnp2 elements are members of the Tnt1B subfamily which shows that Tnt1B elements can be active and mutagenic in the N. plumbaginifolia genome. Furthermore, these results suggest that Tnt1B is the most active family of Tntl elements in N. plumbaginifolia, whereas in tobacco only members of the Tnt1A subfamily were found inserted in the nitrate reductase gene. The transcriptional regulations of Tnp2 and Tnt1A elements are most probably different due to non-conserved U3 regions. Our results thus support the hypothesis that different Nicotiana species contain different active Tntl subfamilies and that only one active Tntl subfamily might be maintained in each of these species. The Tnp2 insertion found in the F97 mutant was found to be spliced out of the nitrate reductase mRNA by activation of cryptic donor and acceptor sites in the nitrate reductase and the Tnp2 sequences respectively.

Characterization of three active transposable elements recently inserted in three independent DFR-A alleles and one high-copy DNA transposon isolated from the Pink allele of the ANS gene in onion (Allium cepa L.).

PubMed

Kim, Sunggil; Park, Jee Young; Yang, Tae-Jin

2015-06-01

Intact retrotransposon and DNA transposons inserted in a single gene were characterized in onions (Allium cepa) and their transcription and copy numbers were estimated in this study. While analyzing diverse onion germplasm, large insertions in the DFR-A gene encoding dihydroflavonol 4-reductase (DFR) involved in the anthocyanin biosynthesis pathway were found in two accessions. A 5,070-bp long terminal repeat (LTR) retrotransposon inserted in the active DFR-A (R4) allele was identified from one of the large insertions and designated AcCOPIA1. An intact ORF encoded typical domains of copia-like LTR retrotransposons. However, AcCOPIA1 contained atypical 'TG' and 'TA' dinucleotides at the ends of the LTRs. A 4,615-bp DNA transposon was identified in the other large insertion. This DNA transposon, designated AcCACTA1, contained an ORF coding for a transposase showing homology with the CACTA superfamily transposable elements (TEs). Another 5,073-bp DNA transposon was identified from the DFR-A (TRN) allele. This DNA transposon, designated AchAT1, belonged to the hAT superfamily with short 4-bp terminal inverted repeats (TIRs). Finally, a 6,258-bp non-autonomous DNA transposon, designated AcPINK, was identified in the ANS-p allele encoding anthocyanidin synthase, the next downstream enzyme to DFR in the anthocyanin biosynthesis pathway. AcPINK also possessed very short 3-bp TIRs. Active transcription of AcCOPIA1, AcCACTA1, and AchAT1 was observed through RNA-Seq analysis and RT-PCR. The copy numbers of AcPINK estimated by mapping the genomic DNA reads produced by NextSeq 500 were predominantly high compared with the other TEs. A series of evidence indicated that these TEs might have transposed in these onion genes very recently, providing a stepping stone for elucidation of enormously large-sized onion genome structure.

Evolutionary genomics: transdomain gene transfers.

PubMed

Bordenstein, Seth R

2007-11-06

Biologists have until now conceded that bacterial gene transfer to multicellular animals is relatively uncommon in Nature. A new study showing promiscuous insertions of bacterial endosymbiont genes into invertebrate genomes ushers in a shift in this paradigm.

Genome-Wide Identification by Transposon Insertion Sequencing of Escherichia coli K1 Genes Essential for In Vitro Growth, Gastrointestinal Colonizing Capacity, and Survival in Serum.

PubMed

McCarthy, Alex J; Stabler, Richard A; Taylor, Peter W

2018-04-01

Escherichia coli K1 strains are major causative agents of invasive disease of newborn infants. The age dependency of infection can be reproduced in neonatal rats. Colonization of the small intestine following oral administration of K1 bacteria leads rapidly to invasion of the blood circulation; bacteria that avoid capture by the mesenteric lymphatic system and evade antibacterial mechanisms in the blood may disseminate to cause organ-specific infections such as meningitis. Some E. coli K1 surface constituents, in particular the polysialic acid capsule, are known to contribute to invasive potential, but a comprehensive picture of the factors that determine the fully virulent phenotype has not emerged so far. We constructed a library and constituent sublibraries of ∼775,000 Tn 5 transposon mutants of E. coli K1 strain A192PP and employed transposon-directed insertion site sequencing (TraDIS) to identify genes required for fitness for infection of 2-day-old rats. Transposon insertions were lacking in 357 genes following recovery on selective agar; these genes were considered essential for growth in nutrient-replete medium. Colonization of the midsection of the small intestine was facilitated by 167 E. coli K1 gene products. Restricted bacterial translocation across epithelial barriers precluded TraDIS analysis of gut-to-blood and blood-to-brain transits; 97 genes were required for survival in human serum. This study revealed that a large number of bacterial genes, many of which were not previously associated with systemic E. coli K1 infection, are required to realize full invasive potential. IMPORTANCE Escherichia coli K1 strains cause life-threatening infections in newborn infants. They are acquired from the mother at birth and colonize the small intestine, from where they invade the blood and central nervous system. It is difficult to obtain information from acutely ill patients that sheds light on physiological and bacterial factors determining invasive disease. Key aspects of naturally occurring age-dependent human infection can be reproduced in neonatal rats. Here, we employ transposon-directed insertion site sequencing to identify genes essential for the in vitro growth of E. coli K1 and genes that contribute to the colonization of susceptible rats. The presence of bottlenecks to invasion of the blood and cerebrospinal compartments precluded insertion site sequencing analysis, but we identified genes for survival in serum. Copyright © 2018 McCarthy et al.

Genome-Wide Identification by Transposon Insertion Sequencing of Escherichia coli K1 Genes Essential for In Vitro Growth, Gastrointestinal Colonizing Capacity, and Survival in Serum

PubMed Central

McCarthy, Alex J.

2018-01-01

ABSTRACT Escherichia coli K1 strains are major causative agents of invasive disease of newborn infants. The age dependency of infection can be reproduced in neonatal rats. Colonization of the small intestine following oral administration of K1 bacteria leads rapidly to invasion of the blood circulation; bacteria that avoid capture by the mesenteric lymphatic system and evade antibacterial mechanisms in the blood may disseminate to cause organ-specific infections such as meningitis. Some E. coli K1 surface constituents, in particular the polysialic acid capsule, are known to contribute to invasive potential, but a comprehensive picture of the factors that determine the fully virulent phenotype has not emerged so far. We constructed a library and constituent sublibraries of ∼775,000 Tn5 transposon mutants of E. coli K1 strain A192PP and employed transposon-directed insertion site sequencing (TraDIS) to identify genes required for fitness for infection of 2-day-old rats. Transposon insertions were lacking in 357 genes following recovery on selective agar; these genes were considered essential for growth in nutrient-replete medium. Colonization of the midsection of the small intestine was facilitated by 167 E. coli K1 gene products. Restricted bacterial translocation across epithelial barriers precluded TraDIS analysis of gut-to-blood and blood-to-brain transits; 97 genes were required for survival in human serum. This study revealed that a large number of bacterial genes, many of which were not previously associated with systemic E. coli K1 infection, are required to realize full invasive potential. IMPORTANCE Escherichia coli K1 strains cause life-threatening infections in newborn infants. They are acquired from the mother at birth and colonize the small intestine, from where they invade the blood and central nervous system. It is difficult to obtain information from acutely ill patients that sheds light on physiological and bacterial factors determining invasive disease. Key aspects of naturally occurring age-dependent human infection can be reproduced in neonatal rats. Here, we employ transposon-directed insertion site sequencing to identify genes essential for the in vitro growth of E. coli K1 and genes that contribute to the colonization of susceptible rats. The presence of bottlenecks to invasion of the blood and cerebrospinal compartments precluded insertion site sequencing analysis, but we identified genes for survival in serum. PMID:29339415

Characterization of a new high copy Stowaway family MITE, BRAMI-1 in Brassica genome

PubMed Central

2013-01-01

Background Miniature inverted-repeat transposable elements (MITEs) are expected to play important roles in evolution of genes and genome in plants, especially in the highly duplicated plant genomes. Various MITE families and their roles in plants have been characterized. However, there have been fewer studies of MITE families and their potential roles in evolution of the recently triplicated Brassica genome. Results We identified a new MITE family, BRAMI-1, belonging to the Stowaway super-family in the Brassica genome. In silico mapping revealed that 697 members are dispersed throughout the euchromatic regions of the B. rapa pseudo-chromosomes. Among them, 548 members (78.6%) are located in gene-rich regions, less than 3 kb from genes. In addition, we identified 516 and 15 members in the 470 Mb and 15 Mb genomic shotgun sequences currently available for B. oleracea and B. napus, respectively. The resulting estimated copy numbers for the entire genomes were 1440, 1464 and 2490 in B. rapa, B. oleracea and B. napus, respectively. Concurrently, only 70 members of the related Arabidopsis ATTIRTA-1 MITE family were identified in the Arabidopsis genome. Phylogenetic analysis revealed that BRAMI-1 elements proliferated in the Brassica genus after divergence from the Arabidopsis lineage. MITE insertion polymorphism (MIP) was inspected for 50 BRAMI-1 members, revealing high levels of insertion polymorphism between and within species of Brassica that clarify BRAMI-1 activation periods up to the present. Comparative analysis of the 71 genes harbouring the BRAMI-1 elements with their non-insertion paralogs (NIPs) showed that the BRAMI-1 insertions mainly reside in non-coding sequences and that the expression levels of genes with the elements differ from those of their NIPs. Conclusion A Stowaway family MITE, named as BRAMI-1, was gradually amplified and remained present in over than 1400 copies in each of three Brassica species. Overall, 78% of the members were identified in gene-rich regions, and it is assumed that they may contribute to the evolution of duplicated genes in the highly duplicated Brassica genome. The resulting MIPs can serve as a good source of DNA markers for Brassica crops because the insertions are highly dispersed in the gene-rich euchromatin region and are polymorphic between or within species. PMID:23547712

Cloning of a CACTA transposon-like insertion in intron I of tomato invertase Lin5 gene and identification of transposase-like sequences of Solanaceae species.

PubMed

Proels, Reinhard K; Roitsch, Thomas

2006-03-01

Very few CACTA transposon-like sequences have been described in Solanaceae species. Sequence information has been restricted to partial transposase (TPase)-like fragments, and no target gene of CACTA-like transposon insertion has been described in tomato to date. In this manuscript, we report on a CACTA transposon-like insertion in intron I of tomato (Lycopersicon esculentum) invertase gene Lin5 and TPase-like sequences of several Solanaceae species. Consensus primers deduced from the TPase region of the tomato CACTA transposon-like element allowed the amplification of similar sequences from various Solanaceae species of different subfamilies including Solaneae (Solanum tuberosum), Cestreae (Nicotiana tabacum) and Datureae (Datura stramonium). This demonstrates the ubiquitous presence of CACTA-like elements in Solanaceae genomes. The obtained partial sequences are highly conserved, and allow further detection and detailed analysis of CACTA-like transposons throughout Solanaceae species. CACTA-like transposon sequences make possible the evaluation of their use for genome analysis, functional studies of genes and the evolutionary relationships between plant species.

Construction of a large-scale Burkholderia cenocepacia J2315 transposon mutant library

NASA Astrophysics Data System (ADS)

Wong, Yee-Chin; Pain, Arnab; Nathan, Sheila

2014-09-01

Burkholderia cenocepacia, a pathogenic member of the Burkholderia cepacia complex (Bcc), has emerged as a significant threat towards cystic fibrosis patients, where infection often leads to the fatal clinical manifestation known as cepacia syndrome. Many studies have investigated the pathogenicity of B. cenocepacia as well as its ability to become highly resistant towards many of the antibiotics currently in use. In addition, studies have also been undertaken to understand the pathogen's capacity to adapt and survive in a broad range of environments. Transposon based mutagenesis has been widely used in creating insertional knock-out mutants and coupled with recent advances in sequencing technology, robust tools to study gene function in a genome-wide manner have been developed based on the assembly of saturated transposon mutant libraries. In this study, we describe the construction of a large-scale library of B. cenocepacia transposon mutants. To create transposon mutants of B. cenocepacia strain J2315, electrocompetent bacteria were electrotransformed with the EZ-Tn5 transposome. Tetracyline resistant colonies were harvested off selective agar and pooled. Mutants were generated in multiple batches with each batch consisting of ˜20,000 to 40,000 mutants. Transposon insertion was validated by PCR amplification of the transposon region. In conclusion, a saturated B. cenocepacia J2315 transposon mutant library with an estimated total number of 500,000 mutants was successfully constructed. This mutant library can now be further exploited as a genetic tool to assess the function of every gene in the genome, facilitating the discovery of genes important for bacterial survival and adaptation, as well as virulence.

Tnt1 Retrotransposon Mutagenesis: A Tool for Soybean Functional Genomics1[W][OA

PubMed Central

Cui, Yaya; Barampuram, Shyam; Stacey, Minviluz G.; Hancock, C. Nathan; Findley, Seth; Mathieu, Melanie; Zhang, Zhanyuan; Parrott, Wayne A.; Stacey, Gary

2013-01-01

Insertional mutagenesis is a powerful tool for determining gene function in both model and crop plant species. Tnt1, the transposable element of tobacco (Nicotiana tabacum) cell type 1, is a retrotransposon that replicates via an RNA copy that is reverse transcribed and integrated elsewhere in the plant genome. Based on studies in a variety of plants, Tnt1 appears to be inactive in normal plant tissue but can be reactivated by tissue culture. Our goal was to evaluate the utility of the Tnt1 retrotransposon as a mutagenesis strategy in soybean (Glycine max). Experiments showed that the Tnt1 element was stably transformed into soybean plants by Agrobacterium tumefaciens-mediated transformation. Twenty-seven independent transgenic lines carrying Tnt1 insertions were generated. Southern-blot analysis revealed that the copy number of transposed Tnt1 elements ranged from four to 19 insertions, with an average of approximately eight copies per line. These insertions showed Mendelian segregation and did not transpose under normal growth conditions. Analysis of 99 Tnt1 flanking sequences revealed insertions into 62 (62%) annotated genes, indicating that the element preferentially inserts into protein-coding regions. Tnt1 insertions were found in all 20 soybean chromosomes, indicating that Tnt1 transposed throughout the soybean genome. Furthermore, fluorescence in situ hybridization experiments validated that Tnt1 inserted into multiple chromosomes. Passage of transgenic lines through two different tissue culture treatments resulted in Tnt1 transposition, significantly increasing the number of insertions per line. Thus, our data demonstrate the Tnt1 retrotransposon to be a powerful system that can be used for effective large-scale insertional mutagenesis in soybean. PMID:23124322

DOE Office of Scientific and Technical Information (OSTI.GOV)

Otani, Sanae; Department of Pediatrics, Graduate School of Medicine, Osaka City University, Osaka; Ayata, Minoru, E-mail: maverick@med.osaka-cu.ac.jp

Measles virus (MV) is the causative agent of measles and its neurological complications, subacute sclerosing panencephalitis (SSPE) and measles inclusion body encephalitis (MIBE). Biased hypermutation in the M gene is a characteristic feature of SSPE and MIBE. To determine whether the M gene is the preferred target of hypermutation, an additional transcriptional unit containing a humanized Renilla reniformis green fluorescent protein (hrGFP) gene was introduced into the IC323 MV genome, and nude mice were inoculated intracerebrally with the virus. Biased hypermutation occurred in the M gene and also in the hrGFP gene when it was inserted between the leader andmore » the N gene, but not between the H and L gene. These results indicate that biased hypermutation is usually found in a gene whose function is not essential for viral proliferation in the brain and that the location of a gene in the MV genome can affect its mutational frequency. - Highlights: • Wild-type MV can cause persistent infections in nude mice. • Biased hypermutation occurred in the M gene. • Biased hypermutation occurred in an inessential gene inserted between the leader and the N gene.« less

Disrupting the male germ line to find infertility and contraception targets.

PubMed

Archambeault, Denise R; Matzuk, Martin M

2014-05-01

Genetically-manipulated mouse models have become indispensible for broadening our understanding of genes and pathways related to male germ cell development. Until suitable in vitro systems for studying spermatogenesis are perfected, in vivo models will remain the gold standard for inquiry into testicular function. Here, we discuss exciting advances that are allowing researchers faster, easier, and more customizable access to their mouse models of interest. Specifically, the trans-NIH Knockout Mouse Project (KOMP) is working to generate knockout mouse models of every gene in the mouse genome. The related Knockout Mouse Phenotyping Program (KOMP2) is performing systematic phenotypic analysis of this genome-wide collection of knockout mice, including fertility screening. Together, these programs will not only uncover new genes involved in male germ cell development but also provide the research community with the mouse models necessary for further investigations. In addition to KOMP/KOMP2, another promising development in the field of mouse models is the advent of CRISPR (clustered regularly interspaced short palindromic repeat)-Cas technology. Utilizing 20 nucleotide guide sequences, CRISPR/Cas has the potential to introduce sequence-specific insertions, deletions, and point mutations to produce null, conditional, activated, or reporter-tagged alleles. CRISPR/Cas can also successfully target multiple genes in a single experimental step, forgoing the multiple generations of breeding traditionally required to produce mouse models with deletions, insertions, or mutations in multiple genes. In addition, CRISPR/Cas can be used to create mouse models carrying variants identical to those identified in infertile human patients, providing the opportunity to explore the effects of such mutations in an in vivo system. Both the KOMP/KOMP2 projects and the CRISPR/Cas system provide powerful, accessible genetic approaches to the study of male germ cell development in the mouse. A more complete understanding of male germ cell biology is critical for the identification of novel targets for potential non-hormonal contraceptive intervention. Copyright © 2014. Published by Elsevier Masson SAS.

Translations on USSR Science and Technology, Physical Sciences and Technology, Number 24

DTIC Science & Technology

1977-11-30

8217 UPMVLYAYUSHCHIYE SISTEM I MA.SHIWY’ No 3, 1977 (UPMVLYAYUSHCHIYE SISTEMI I MA.SHIEY, May/jun 77)... 6k CYBERNETICS, COMPUTERS MD AUTOMATION TECHNOLOGY...insert pp 5-8) [Five articles from the insert] [Text] The organizing of the scientific and production complexes in the "Svetlana" association has...documentation and issuing copies to the corresponding subdivisions of the NPK [scientific and produc- tion complex ], work got underway on a broad

Determination of the Optimal Chromosomal Location(s) for a DNA Element in Escherichia coli Using a Novel Transposon-mediated Approach.

PubMed

Frimodt-Møller, Jakob; Charbon, Godefroid; Krogfelt, Karen A; Løbner-Olesen, Anders

2017-09-11

The optimal chromosomal position(s) of a given DNA element was/were determined by transposon-mediated random insertion followed by fitness selection. In bacteria, the impact of the genetic context on the function of a genetic element can be difficult to assess. Several mechanisms, including topological effects, transcriptional interference from neighboring genes, and/or replication-associated gene dosage, may affect the function of a given genetic element. Here, we describe a method that permits the random integration of a DNA element into the chromosome of Escherichia coli and select the most favorable locations using a simple growth competition experiment. The method takes advantage of a well-described transposon-based system of random insertion, coupled with a selection of the fittest clone(s) by growth advantage, a procedure that is easily adjustable to experimental needs. The nature of the fittest clone(s) can be determined by whole-genome sequencing on a complex multi-clonal population or by easy gene walking for the rapid identification of selected clones. Here, the non-coding DNA region DARS2, which controls the initiation of chromosome replication in E. coli, was used as an example. The function of DARS2 is known to be affected by replication-associated gene dosage; the closer DARS2 gets to the origin of DNA replication, the more active it becomes. DARS2 was randomly inserted into the chromosome of a DARS2-deleted strain. The resultant clones containing individual insertions were pooled and competed against one another for hundreds of generations. Finally, the fittest clones were characterized and found to contain DARS2 inserted in close proximity to the original DARS2 location.

A Versatile Transposon-Based Activation Tag Vector System for Functional Genomics in Cereals and Other Monocot Plants1[OA

PubMed Central

Qu, Shaohong; Desai, Aparna; Wing, Rod; Sundaresan, Venkatesan

2008-01-01

Transposon insertional mutagenesis is an effective alternative to T-DNA mutagenesis when transformation through tissue culture is inefficient as is the case for many crop species. When used as activation tags, transposons can be exploited to generate novel gain-of-function phenotypes without transformation and are of particular value in the study of polyploid plants where gene knockouts will not have phenotypes. We have developed an in cis-activation-tagging Ac-Ds transposon system in which a T-DNA vector carries a Dissociation (Ds) element containing 4× cauliflower mosaic virus enhancers along with the Activator (Ac) transposase gene. Stable Ds insertions were selected using green fluorescent protein and red fluorescent protein genes driven by promoters that are functional in maize (Zea mays) and rice (Oryza sativa). The system has been tested in rice, where 638 stable Ds insertions were selected from an initial set of 26 primary transformants. By analysis of 311 flanking sequences mapped to the rice genome, we could demonstrate the wide distribution of the elements over the rice chromosomes. Enhanced expression of rice genes adjacent to Ds insertions was detected in the insertion lines using semiquantitative reverse transcription-PCR method. The in cis-two-element vector system requires minimal number of primary transformants and eliminates the need for crossing, while the use of fluorescent markers instead of antibiotic or herbicide resistance increases the applicability to other plants and eliminates problems with escapes. Because Ac-Ds has been shown to transpose widely in the plant kingdom, the activation vector system developed in this study should be of utility more generally to other monocots. PMID:17993541

Comparison of Insertional RNA Editing in Myxomycetes

PubMed Central

Chen, Cai; Frankhouser, David; Bundschuh, Ralf

2012-01-01

RNA editing describes the process in which individual or short stretches of nucleotides in a messenger or structural RNA are inserted, deleted, or substituted. A high level of RNA editing has been observed in the mitochondrial genome of Physarum polycephalum. The most frequent editing type in Physarum is the insertion of individual Cs. RNA editing is extremely accurate in Physarum; however, little is known about its mechanism. Here, we demonstrate how analyzing two organisms from the Myxomycetes, namely Physarum polycephalum and Didymium iridis, allows us to test hypotheses about the editing mechanism that can not be tested from a single organism alone. First, we show that using the recently determined full transcriptome information of Physarum dramatically improves the accuracy of computational editing site prediction in Didymium. We use this approach to predict genes in the mitochondrial genome of Didymium and identify six new edited genes as well as one new gene that appears unedited. Next we investigate sequence conservation in the vicinity of editing sites between the two organisms in order to identify sites that harbor the information for the location of editing sites based on increased conservation. Our results imply that the information contained within only nine or ten nucleotides on either side of the editing site (a distance previously suggested through experiments) is not enough to locate the editing sites. Finally, we show that the codon position bias in C insertional RNA editing of these two organisms is correlated with the selection pressure on the respective genes thereby directly testing an evolutionary theory on the origin of this codon bias. Beyond revealing interesting properties of insertional RNA editing in Myxomycetes, our work suggests possible approaches to be used when finding sequence motifs for any biological process fails. PMID:22383871

A Genetic Screen for Pathogenicity Genes in the Hemibiotrophic Fungus Colletotrichum higginsianum Identifies the Plasma Membrane Proton Pump Pma2 Required for Host Penetration

PubMed Central

Dahl, Marlis; Müller, Susanne; Voll, Lars M.; Koch, Christian

2015-01-01

We used insertional mutagenesis by Agrobacterium tumefaciens mediated transformation (ATMT) to isolate pathogenicity mutants of Colletotrichum higginsianum. From a collection of 7200 insertion mutants we isolated 75 mutants with reduced symptoms. 19 of these were affected in host penetration, while 17 were affected in later stages of infection, like switching to necrotrophic growth. For 16 mutants the location of T-DNA insertions could be identified by PCR. A potential plasma membrane H+-ATPase Pma2 was targeted in five independent insertion mutants. We genetically inactivated the Ku80 component of the non-homologous end-joining pathway in C. higginsianum to establish an efficient gene knockout protocol. Chpma2 deletion mutants generated by homologous recombination in the ΔChku80 background form fully melanized appressoria but entirely fail to penetrate the host tissue and are non-pathogenic. The ChPMA2 gene is induced upon appressoria formation and infection of A. thaliana. Pma2 activity is not important for vegetative growth of saprophytically growing mycelium, since the mutant shows no growth penalty under these conditions. Colletotrichum higginsianum codes for a closely related gene (ChPMA1), which is highly expressed under most growth conditions. ChPMA1 is more similar to the homologous yeast genes for plasma membrane pumps. We propose that expression of a specific proton pump early during infection may be common to many appressoria forming fungal pathogens as we found ChPMA2 orthologs in several plant pathogenic fungi. PMID:25992547

Construction of insertion and deletion mxa mutants of Methylobacterium extorquens AM1 by electroporation.

PubMed

Toyama, H; Anthony, C; Lidstrom, M E

1998-09-01

Methylobacterium extorquens AM1 is a pink-pigmented facultative methylotroph which is widely used for analyzing pathways of C1 metabolism with biochemical and molecular biological techniques. To facilitate this approach, we have applied a new method to construct insertion or disruption mutants with drug resistance genes by electroporation. By using this method, mutants were obtained in four genes present in the mxa methylotrophy gene cluster for which the functions were unknown, mxaR, mxaS, mxaC and mxaD. These mutants were unable to grow on methanol except the mutant of mxaD, which showed reduced growth on methanol.

Ethical issues of CRISPR technology and gene editing through the lens of solidarity.

PubMed

Mulvihill, John J; Capps, Benjamin; Joly, Yann; Lysaght, Tamra; Zwart, Hub A E; Chadwick, Ruth

2017-06-01

The avalanche of commentaries on CRISPR-Cas9 technology, a bacterial immune system modified to recognize any short DNA sequence, cut it out, and insert a new one, has rekindled hopes for gene therapy and other applications and raised criticisms of engineering genes in future generations. This discussion draws on articles that emphasize ethics, identified partly through PubMed and Google, 2014-2016. CRISPR-Cas9 has taken the pace and prospects for genetic discovery and applications to a high level, stoking anticipation for somatic gene engineering to help patients. We support a moratorium on germ line manipulation. We place increased emphasis on the principle of solidarity and the public good. The genetic bases of some diseases are not thoroughly addressable with CRISPR-Cas9. We see no new ethical issues, compared with gene therapy and genetic engineering in general, apart from the explosive rate of findings. Other controversies include eugenics, patentability and unrealistic expectations of professionals and the public. Biggest issues are the void of research on human germ cell biology, the appropriate routes for oversight and transparency, and the scientific and ethical areas of reproductive medicine. The principle of genomic solidarity and priority on public good should be a lens for bringing clarity to CRISPR debates. The valid claim of genetic exceptionalism supports restraint on experimentation in human germ cells, given the trans-generational dangers and the knowledge gap in germ cell biology. © The Author 2017. Published by Oxford University Press. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com

Molecular Characteristics of the Mycobacterium tuberculosis LAM-RUS Family Prevalent in Central Russia▿ †

PubMed Central

Dubiley, Svetlana; Kirillov, Eugene; Ignatova, Anna; Stepanshina, Valentina; Shemyakin, Igor

2007-01-01

We analyzed IS6110-associated polymorphisms in the phospholipase C genes of 107 isolates of Mycobacterium tuberculosis selected to be representative of isolates circulating in central Russia. We found that the majority of Latin American-Mediterranean family strains contained an insertion in a unique position in the plcA gene, suggesting a common ancestor. This insertion can serve as a specific genetic marker for this group, which we designate the LAM-RUS family. PMID:17942651

A 3D-Engineered Conformal Implant Releases DNA Nanocomplexs for Eradicating the Postsurgery Residual Glioblastoma.

PubMed

Yang, Yuan; Du, Ting; Zhang, Jiumeng; Kang, Tianyi; Luo, Li; Tao, Jie; Gou, Zhiyuan; Chen, Shaochen; Du, Yanan; He, Jiankang; Jiang, Shu; Mao, Qing; Gou, Maling

2017-08-01

Gene therapy has great promise for glioblastoma treatment; however, it remains a great challenge to efficiently deliver genes to the brain. The incomplete resection of glioblastoma always leads to poor prognosis. Here, a 3D-engineered conformal implant for eradicating the postsurgery residual glioblastoma is designed. This implant is constructed by 3D-printing technology to match the tumor cavity and release an oncolytic virus-inspired DNA nanocomplex to kill glioblastoma cells through apoptosis induction. Meanwhile, a 3D-engineered subcutaneous glioblastoma xenograft is built to mimic the resection tumor cavity in mice. Insertion of the implant into the glioblastoma resection cavity efficiently delays tumor recurrence and significantly prolongs overall survival. This study provides a proof-of-concept of glioblastoma therapy using a conformal implant that releases oncolytic DNA nanocomplexs. This strategy can lead to the development of future precision therapy for eradicating postsurgery residual tumors.

ASTROCULTURE(tm) Commercial Plant Growth Unit and Glove Box Insert

NASA Technical Reports Server (NTRS)

Zhou, Wei-Jia; Lambing, Steve (Technical Monitor)

2002-01-01

Two commercial plant investigations will be conducted during the STS-107 mission: living flower essential oil production and gene transfer. The research will be done using the ASTROCULTURE (trademark) hardware, which builds on similar experiments flown in the past on the space shuttle. This research will investigate how microgravity might affect the formation of the volatile chemical compounds - the essential oils - produced by two different types of living flowers. The flowers will be cultured in the ASTROCULTURE (trademark) plant chamber, which provides an enclosed and controlled environment. As the flowers bloom in space, they will produce essential oils, and these volatile compounds will be collected using International Flavors and Fragrance's proprietary Solid Phase Micro Extraction (SPME) technology. The gene transfer experiment examines a newly developed transformation system to see if it operates efficiently in the microgravity environment. This research is important for the development of genetically engineered crops, also known as transgenic crops.

[Genome editing of industrial microorganism].

PubMed

Zhu, Linjiang; Li, Qi

2015-03-01

Genome editing is defined as highly-effective and precise modification of cellular genome in a large scale. In recent years, such genome-editing methods have been rapidly developed in the field of industrial strain improvement. The quickly-updating methods thoroughly change the old mode of inefficient genetic modification, which is "one modification, one selection marker, and one target site". Highly-effective modification mode in genome editing have been developed including simultaneous modification of multiplex genes, highly-effective insertion, replacement, and deletion of target genes in the genome scale, cut-paste of a large DNA fragment. These new tools for microbial genome editing will certainly be applied widely, and increase the efficiency of industrial strain improvement, and promote the revolution of traditional fermentation industry and rapid development of novel industrial biotechnology like production of biofuel and biomaterial. The technological principle of these genome-editing methods and their applications were summarized in this review, which can benefit engineering and construction of industrial microorganism.

A general insert label for peptide display on chimeric filamentous bacteriophages.

PubMed

Kaplan, Gilad; Gershoni, Jonathan M

2012-01-01

The foreign insert intended to be displayed via recombinant phage proteins can have a negative effect on protein expression and phage assembly. A typical example is the case of display of peptides longer than 6 amino acid residues on the major coat protein, protein VIII of the filamentous bacteriophages M13 and fd. A solution to this problem has been the use of "two-gene systems" generating chimeric phages that concomitantly express wild-type protein VIII along with recombinant protein VIII. Although the two-gene systems are much more permissive in regard to insert length and composition, some cases can still adversely affect phage assembly. Although these phages genotypically contain the desired DNA of the insert, they appear to be phenotypically wild type. To avoid false-negative results when using chimeric phages in binding studies, it is necessary to confirm that the observed lack of phage recognition is not due to faulty assembly and display of the intended insert. Here we describe a strategy for generating antibodies that specifically recognize recombinant protein VIII regardless of the nature of its foreign insert. These antibodies can be used as a general monitor of the display of recombinant protein VIII into phage particles. Copyright © 2011 Elsevier Inc. All rights reserved.

Integrated genome-wide Alu methylation and transcriptome profiling analyses reveal novel epigenetic regulatory networks associated with autism spectrum disorder.

PubMed

Saeliw, Thanit; Tangsuwansri, Chayanin; Thongkorn, Surangrat; Chonchaiya, Weerasak; Suphapeetiporn, Kanya; Mutirangura, Apiwat; Tencomnao, Tewin; Hu, Valerie W; Sarachana, Tewarit

2018-01-01

Alu elements are a group of repetitive elements that can influence gene expression through CpG residues and transcription factor binding. Altered gene expression and methylation profiles have been reported in various tissues and cell lines from individuals with autism spectrum disorder (ASD). However, the role of Alu elements in ASD remains unclear. We thus investigated whether Alu elements are associated with altered gene expression profiles in ASD. We obtained five blood-based gene expression profiles from the Gene Expression Omnibus database and human Alu-inserted gene lists from the TranspoGene database. Differentially expressed genes (DEGs) in ASD were identified from each study and overlapped with the human Alu-inserted genes. The biological functions and networks of Alu-inserted DEGs were then predicted by Ingenuity Pathway Analysis (IPA). A combined bisulfite restriction analysis of lymphoblastoid cell lines (LCLs) derived from 36 ASD and 20 sex- and age-matched unaffected individuals was performed to assess the global DNA methylation levels within Alu elements, and the Alu expression levels were determined by quantitative RT-PCR. In ASD blood or blood-derived cells, 320 Alu-inserted genes were reproducibly differentially expressed. Biological function and pathway analysis showed that these genes were significantly associated with neurodevelopmental disorders and neurological functions involved in ASD etiology. Interestingly, estrogen receptor and androgen signaling pathways implicated in the sex bias of ASD, as well as IL-6 signaling and neuroinflammation signaling pathways, were also highlighted. Alu methylation was not significantly different between the ASD and sex- and age-matched control groups. However, significantly altered Alu methylation patterns were observed in ASD cases sub-grouped based on Autism Diagnostic Interview-Revised scores compared with matched controls. Quantitative RT-PCR analysis of Alu expression also showed significant differences between ASD subgroups. Interestingly, Alu expression was correlated with methylation status in one phenotypic ASD subgroup. Alu methylation and expression were altered in LCLs from ASD subgroups. Our findings highlight the association of Alu elements with gene dysregulation in ASD blood samples and warrant further investigation. Moreover, the classification of ASD individuals into subgroups based on phenotypes may be beneficial and could provide insights into the still unknown etiology and the underlying mechanisms of ASD.

Biased hypermutation occurred frequently in a gene inserted into the IC323 recombinant measles virus during its persistence in the brains of nude mice.

PubMed

Otani, Sanae; Ayata, Minoru; Takeuchi, Kaoru; Takeda, Makoto; Shintaku, Haruo; Ogura, Hisashi

2014-08-01

Measles virus (MV) is the causative agent of measles and its neurological complications, subacute sclerosing panencephalitis (SSPE) and measles inclusion body encephalitis (MIBE). Biased hypermutation in the M gene is a characteristic feature of SSPE and MIBE. To determine whether the M gene is the preferred target of hypermutation, an additional transcriptional unit containing a humanized Renilla reniformis green fluorescent protein (hrGFP) gene was introduced into the IC323 MV genome, and nude mice were inoculated intracerebrally with the virus. Biased hypermutation occurred in the M gene and also in the hrGFP gene when it was inserted between the leader and the N gene, but not between the H and L gene. These results indicate that biased hypermutation is usually found in a gene whose function is not essential for viral proliferation in the brain and that the location of a gene in the MV genome can affect its mutational frequency. Copyright © 2014 Elsevier Inc. All rights reserved.

Insertional Mutagenesis by CRISPR/Cas9 Ribonucleoprotein Gene Editing in Cells Targeted for Point Mutation Repair Directed by Short Single-Stranded DNA Oligonucleotides.

PubMed

Rivera-Torres, Natalia; Banas, Kelly; Bialk, Pawel; Bloh, Kevin M; Kmiec, Eric B

2017-01-01

CRISPR/Cas9 and single-stranded DNA oligonucleotides (ssODNs) have been used to direct the repair of a single base mutation in human genes. Here, we examine a method designed to increase the precision of RNA guided genome editing in human cells by utilizing a CRISPR/Cas9 ribonucleoprotein (RNP) complex to initiate DNA cleavage. The RNP is assembled in vitro and induces a double stranded break at a specific site surrounding the mutant base designated for correction by the ssODN. We use an integrated mutant eGFP gene, bearing a single base change rendering the expressed protein nonfunctional, as a single copy target in HCT 116 cells. We observe significant gene correction activity of the mutant base, promoted by the RNP and single-stranded DNA oligonucleotide with validation through genotypic and phenotypic readout. We demonstrate that all individual components must be present to obtain successful gene editing. Importantly, we examine the genotype of individually sorted corrected and uncorrected clonally expanded cell populations for the mutagenic footprint left by the action of these gene editing tools. While the DNA sequence of the corrected population is exact with no adjacent sequence modification, the uncorrected population exhibits heterogeneous mutagenicity with a wide variety of deletions and insertions surrounding the target site. We designate this type of DNA aberration as on-site mutagenicity. Analyses of two clonal populations bearing specific DNA insertions surrounding the target site, indicate that point mutation repair has occurred at the level of the gene. The phenotype, however, is not rescued because a section of the single-stranded oligonucleotide has been inserted altering the reading frame and generating truncated proteins. These data illustrate the importance of analysing mutagenicity in uncorrected cells. Our results also form the basis of a simple model for point mutation repair directed by a short single-stranded DNA oligonucleotides and CRISPR/Cas9 ribonucleoprotein complex.

Insertional Mutagenesis by CRISPR/Cas9 Ribonucleoprotein Gene Editing in Cells Targeted for Point Mutation Repair Directed by Short Single-Stranded DNA Oligonucleotides

PubMed Central

Rivera-Torres, Natalia; Bialk, Pawel; Bloh, Kevin M.; Kmiec, Eric B.

2017-01-01

CRISPR/Cas9 and single-stranded DNA oligonucleotides (ssODNs) have been used to direct the repair of a single base mutation in human genes. Here, we examine a method designed to increase the precision of RNA guided genome editing in human cells by utilizing a CRISPR/Cas9 ribonucleoprotein (RNP) complex to initiate DNA cleavage. The RNP is assembled in vitro and induces a double stranded break at a specific site surrounding the mutant base designated for correction by the ssODN. We use an integrated mutant eGFP gene, bearing a single base change rendering the expressed protein nonfunctional, as a single copy target in HCT 116 cells. We observe significant gene correction activity of the mutant base, promoted by the RNP and single-stranded DNA oligonucleotide with validation through genotypic and phenotypic readout. We demonstrate that all individual components must be present to obtain successful gene editing. Importantly, we examine the genotype of individually sorted corrected and uncorrected clonally expanded cell populations for the mutagenic footprint left by the action of these gene editing tools. While the DNA sequence of the corrected population is exact with no adjacent sequence modification, the uncorrected population exhibits heterogeneous mutagenicity with a wide variety of deletions and insertions surrounding the target site. We designate this type of DNA aberration as on-site mutagenicity. Analyses of two clonal populations bearing specific DNA insertions surrounding the target site, indicate that point mutation repair has occurred at the level of the gene. The phenotype, however, is not rescued because a section of the single-stranded oligonucleotide has been inserted altering the reading frame and generating truncated proteins. These data illustrate the importance of analysing mutagenicity in uncorrected cells. Our results also form the basis of a simple model for point mutation repair directed by a short single-stranded DNA oligonucleotides and CRISPR/Cas9 ribonucleoprotein complex. PMID:28052104

Evolutionary force of AT-rich repeats to trap genomic and episomal DNAs into the rice genome: lessons from endogenous pararetrovirus.

PubMed

Liu, Ruifang; Koyanagi, Kanako O; Chen, Sunlu; Kishima, Yuji

2012-12-01

In plant genomes, the incorporation of DNA segments is not a common method of artificial gene transfer. Nevertheless, various segments of pararetroviruses have been found in plant genomes in recent decades. The rice genome contains a number of segments of endogenous rice tungro bacilliform virus-like sequences (ERTBVs), many of which are present between AT dinucleotide repeats (ATrs). Comparison of genomic sequences between two closely related rice subspecies, japonica and indica, allowed us to verify the preferential insertion of ERTBVs into ATrs. In addition to ERTBVs, the comparative analyses showed that ATrs occasionally incorporate repeat sequences including transposable elements, and a wide range of other sequences. Besides the known genomic sequences, the insertion sequences also represented DNAs of unclear origins together with ERTBVs, suggesting that ATrs have integrated episomal DNAs that would have been suspended in the nucleus. Such insertion DNAs might be trapped by ATrs in the genome in a host-dependent manner. Conversely, other simple mono- and dinucleotide sequence repeats (SSR) were less frequently involved in insertion events relative to ATrs. Therefore, ATrs could be regarded as hot spots of double-strand breaks that induce non-homologous end joining. The insertions within ATrs occasionally generated new gene-related sequences or involved structural modifications of existing genes. Likewise, in a comparison between Arabidopsis thaliana and Arabidopsis lyrata, the insertions preferred ATrs to other SSRs. Therefore ATrs in plant genomes could be considered as genomic dumping sites that have trapped various DNA molecules and may have exerted a powerful evolutionary force. © 2012 The Authors. The Plant Journal © 2012 Blackwell Publishing Ltd.

Insertional inactivation of oprD in carbapenem-resistant Pseudomonas aeruginosa strains isolated from burn patients in Tehran, Iran.

PubMed

Shariati, A; Azimi, T; Ardebili, A; Chirani, A S; Bahramian, A; Pormohammad, A; Sadredinamin, M; Erfanimanesh, S; Bostanghadiri, N; Shams, S; Hashemi, A

2018-01-01

In this study, we report the insertion sequence IS Ppu 21 in the opr D porin gene of carbapenem-resistant Pseudomonas aeruginosa isolates from burn patients in Tehran, Iran. Antibiotic susceptibility tests for P. aeruginosa isolates were determined. Production of metallo-β-lactamases (MBLs) and carbapenemase was evaluated and the β-lactamase-encoding and aminoglycoside-modifying enzyme genes were investigated by PCR and sequencing methods. The mRNA transcription level of oprD and mex efflux pump genes were evaluated by real-time PCR. The outer membrane protein profile was determined by SDS-PAGE. The genetic relationship between the P. aeruginosa isolates was assessed by random amplified polymorphic DNA PCR. In all, 10.52% (10/95) of clinical isolates of P. aeruginosa harboured the IS Ppu 21 insertion element in the opr D gene. The extended-spectrum β-lactamase-encoding gene in IS Ppu 21-carrying isolates was bla TEM . PCR assays targeting MBL and carbapenemase-encoding genes were also negative in all ten isolates. The rmt A, aad A, aad B and arm A genes were positive in all IS Ppu 21 harbouring isolates. The relative expression levels of the mex X, mex B, mex T and mex D genes in ten isolates ranged from 0.1- to 1.4-fold, 1.1- to 3.68-fold, 0.3- to 8.22-fold and 1.7- to 35.17-fold, respectively. The relative expression levels of the oprD in ten isolates ranged from 0.57- to 35.01-fold, which was much higher than those in the control strain P. aeruginosa PAO1. Evaluation of the outer membrane protein by SDS-PAGE suggested that opr D was produced at very low levels by all isolates. Using random amplified polymorphic DNA PCR genotyping, eight of the ten isolates containing IS Ppu 21 were shown to be clonally related. The present study describes a novel molecular mechanism, IS Ppu 21 insertion of the opr D gene, associated with carbapenem resistance in clinical P. aeruginosa isolates.

The development of the conditionally replication-competent adenovirus: replacement of E4 orf1-4 region by exogenous gene.

PubMed

Nam, Jae-Kook; Lee, Mi-Hyang; Seo, Hae-Hyun; Kim, Seok-Ki; Lee, Kang-Huyn; Kim, In-Hoo; Lee, Sang-Jin

2010-05-01

Tumor or tissue specific replicative adenovirus armed with a therapeutic gene has shown a promising anti-cancer therapeutic modality. However, because the genomic packaging capacity is constrained, only a few places inside it are available for transgene insertion. In the present study, we introduce a novel strategy utilizing the early E4 region for the insertion of therapeutic gene(s). We constructed the conditionally replication-competent adenovirus (CRAd), Ad5E4(mRFP) by: (i) replacing the E4/E1a promoter by the prostate-specific enhancer element; (ii) inserting mRFP inside the E4orf1-4 deletion region; and (iii) sub-cloning enhanced green fluorescent protein controlled by cytomegalovirus promoter in the left end of the viral genome. Subsequently, we evaluated its replication abilities and killing activities in vitro, as well as its in vivo anti-tumor efficacy in CWR22rv xenografts. When infected with Ad5E4(mRFP), the number and intensity of the mRFP gene products increased in a prostate cancer cell-specific manner as designed, suggesting that the mRFP gene and E4orfs other than E4orf1-4 were well synthesized from one transcript via alternative splicing as the recombinant adenovirus replicated. As expected from the confirmed virus replication capability, Ad5E4(mRFP) induced cell lysis as potent as the wild-type adenovirus and effectively suppressed tumor growth when tested in the CWR22rv xenografts in nude mice. Furthermore, Ad5E4(endo/angio) harboring an endostatin-angiostatin gene in E4orf1-4 was able to enhance CRAd by replacing mRFP with a therapeutic gene. The approach employed in the present study for the insertion of a therapeutic transgene in CRAd should facilitate the construction of CRAd containing multiple therapeutic genes in the viral genome that may have the potential to serve as highly potent cancer therapeutic reagents. Copyright (c) 2010 John Wiley & Sons, Ltd.

The Wnt-1 (int-1) oncogene promoter and its mechanism of activation by insertion of proviral DNA of the mouse mammary tumor virus.

PubMed Central

Nusse, R; Theunissen, H; Wagenaar, E; Rijsewijk, F; Gennissen, A; Otte, A; Schuuring, E; van Ooyen, A

1990-01-01

Wnt-1 (int-1) is a cellular oncogene often activated by insertion of proviral DNA of the mouse mammary tumor virus. We have mapped the 5' end and the promoter area of the Wnt-1 gene by nuclease protection and primer extension assays. In differentiating P19 embryonal carcinoma cells, in which Wnt-1 is naturally expressed, two start sites of transcription were found, one preceded by two TATA boxes and one preceded by several GC boxes. In P19 cells, a 1-kilobase upstream sequence of Wnt-1 was able to confer differentiation-specific expression on a heterologous gene. We have investigated how Wnt-1 transcription was affected by mouse mammary tumor virus proviral integrations in various configurations near the promoters of the gene. One provirus has been inserted in the 5' nontranslated part of Wnt-1, in the same transcriptional orientation, and has functionally replaced the Wnt-1 promoters. Wnt-1 transcription in this tumor starts in the right long terminal repeat of the provirus, with considerable readthrough transcription from the left long terminal repeat. Another provirus has been inserted in the orientation opposite that of Wnt-1 into a GC box, disrupting the first Wnt-1 transcription start site but not the downstream start site. Most insertions have not structurally altered the Wnt-1 transcripts and have enhanced the activity of the normal two promoters. Images PMID:1695322

A transposable element in a NAC gene is associated with drought tolerance in maize seedlings

PubMed Central

Mao, Hude; Wang, Hongwei; Liu, Shengxue; Li, Zhigang; Yang, Xiaohong; Yan, Jianbing; Li, Jiansheng; Tran, Lam-Son Phan; Qin, Feng

2015-01-01

Drought represents a major constraint on maize production worldwide. Understanding the genetic basis for natural variation in drought tolerance of maize may facilitate efforts to improve this trait in cultivated germplasm. Here, using a genome-wide association study, we show that a miniature inverted-repeat transposable element (MITE) inserted in the promoter of a NAC gene (ZmNAC111) is significantly associated with natural variation in maize drought tolerance. The 82-bp MITE represses ZmNAC111 expression via RNA-directed DNA methylation and H3K9 dimethylation when heterologously expressed in Arabidopsis. Increasing ZmNAC111 expression in transgenic maize enhances drought tolerance at the seedling stage, improves water-use efficiency and induces upregulation of drought-responsive genes under water stress. The MITE insertion in the ZmNAC111 promoter appears to have occurred after maize domestication and spread among temperate germplasm. The identification of this MITE insertion provides insight into the genetic basis for natural variation in maize drought tolerance. PMID:26387805

Effective oligonucleotide-mediated gene disruption in ES cells lacking the mismatch repair protein MSH3.

PubMed

Dekker, M; Brouwers, C; Aarts, M; van der Torre, J; de Vries, S; van de Vrugt, H; te Riele, H

2006-04-01

We have previously demonstrated that site-specific insertion, deletion or substitution of one or two nucleotides in mouse embryonic stem cells (ES cells) by single-stranded deoxyribo-oligonucleotides is several hundred-fold suppressed by DNA mismatch repair (MMR) activity. Here, we have investigated whether compound mismatches and larger insertions escape detection by the MMR machinery and can be effectively introduced in MMR-proficient cells. We identified several compound mismatches that escaped detection by the MMR machinery to some extent, but could not define general rules predicting the efficacy of complex base-pair substitutions. In contrast, we found that four-nucleotide insertions were largely subject to suppression by the MSH2/MSH3 branch of MMR and could be effectively introduced in Msh3-deficient cells. As these cells have no overt mutator phenotype and Msh3-deficient mice do not develop cancer, Msh3-deficient ES cells can be used for oligonucleotide-mediated gene disruption. As an example, we present disruption of the Fanconi anemia gene Fancf.

Determinism and randomness in the evolution of introns and sine inserts in mouse and human mitochondrial solute carrier and cytokine receptor genes.

PubMed

Cianciulli, Antonia; Calvello, Rosa; Panaro, Maria A

2015-04-01

In the homologous genes studied, the exons and introns alternated in the same order in mouse and human. We studied, in both species: corresponding short segments of introns, whole corresponding introns and complete homologous genes. We considered the total number of nucleotides and the number and orientation of the SINE inserts. Comparisons of mouse and human data series showed that at the level of individual relatively short segments of intronic sequences the stochastic variability prevails in the local structuring, but at higher levels of organization a deterministic component emerges, conserved in mouse and human during the divergent evolution, despite the ample re-editing of the intronic sequences and the fact that processes such as SINE spread had taken place in an independent way in the two species. Intron conservation is negatively correlated with the SINE occupancy, suggesting that virus inserts interfere with the conservation of the sequences inherited from the common ancestor. Copyright © 2015 Elsevier Ltd. All rights reserved.

Gtl2lacZ, an insertional mutation on mouse chromosome 12 with parental origin-dependent phenotype.

PubMed

Schuster-Gossler, K; Simon-Chazottes, D; Guenet, J L; Zachgo, J; Gossler, A

1996-01-01

We have produced a transgenic mouse line, Gtl2lacZ (Gene trap locus 2), that carries an insertional mutation with a dominant modified pattern of inheritance:heterozygous Gtl2lacZ mice that inherited the transgene from the father show a proportionate dwarfism phenotype, whereas the penetrance and expressivity of the phenotype is strongly reduced in Gtl2lacZ mice that inherited the transgene from the mother. On a mixed genetic background this pattern of inheritance was reversible upon transmission of the transgene through the germ line of the opposite sex. On a predominantly 129/Sv genetic background, however, transgene passage through the female germ line modified the transgene effect, such that the penetrance of the mutation was drastically reduced and the phenotype was no longer obvious after subsequent male germ line transmission. Expression of the transgene, however, was neither affected by genetic background nor by parental legacy. Gtl2lacZ maps to mouse Chromosome 12 in a region that displays imprinting effects associated with maternal and paternal disomy. Our results suggest that the transgene insertion in Gtl2lacZ mice affects an endogenous gene(s) required for fetal and postnatal growth and that this gene(s) is predominantly paternally expressed.

Development of a duplex real-time RT-qPCR assay to monitor genome replication, gene expression and gene insert stability during in vivo replication of a prototype live attenuated canine distemper virus vector encoding SIV gag.

PubMed

Coleman, John W; Wright, Kevin J; Wallace, Olivia L; Sharma, Palka; Arendt, Heather; Martinez, Jennifer; DeStefano, Joanne; Zamb, Timothy P; Zhang, Xinsheng; Parks, Christopher L

2015-03-01

Advancement of new vaccines based on live viral vectors requires sensitive assays to analyze in vivo replication, gene expression and genetic stability. In this study, attenuated canine distemper virus (CDV) was used as a vaccine delivery vector and duplex 2-step quantitative real-time RT-PCR (RT-qPCR) assays specific for genomic RNA (gRNA) or mRNA have been developed that concurrently quantify coding sequences for the CDV nucleocapsid protein (N) and a foreign vaccine antigen (SIV Gag). These amplicons, which had detection limits of about 10 copies per PCR reaction, were used to show that abdominal cavity lymphoid tissues were a primary site of CDV vector replication in infected ferrets, and importantly, CDV gRNA or mRNA was undetectable in brain tissue. In addition, the gRNA duplex assay was adapted for monitoring foreign gene insert genetic stability during in vivo replication by analyzing the ratio of CDV N and SIV gag genomic RNA copies over the course of vector infection. This measurement was found to be a sensitive probe for assessing the in vivo genetic stability of the foreign gene insert. Copyright © 2014 Elsevier B.V. All rights reserved.

Ribosomal Binding Site Switching: An Effective Strategy for High-Throughput Cloning Constructions

PubMed Central

Li, Yunlong; Zhang, Yong; Lu, Pei; Rayner, Simon; Chen, Shiyun

2012-01-01

Direct cloning of PCR fragments by TA cloning or blunt end ligation are two simple methods which would greatly benefit high-throughput (HTP) cloning constructions if the efficiency can be improved. In this study, we have developed a ribosomal binding site (RBS) switching strategy for direct cloning of PCR fragments. RBS is an A/G rich region upstream of the translational start codon and is essential for gene expression. Change from A/G to T/C in the RBS blocks its activity and thereby abolishes gene expression. Based on this property, we introduced an inactive RBS upstream of a selectable marker gene, and designed a fragment insertion site within this inactive RBS. Forward and reverse insertions of specifically tailed fragments will respectively form an active and inactive RBS, thus all background from vector self-ligation and fragment reverse insertions will be eliminated due to the non-expression of the marker gene. The effectiveness of our strategy for TA cloning and blunt end ligation are confirmed. Application of this strategy to gene over-expression, a bacterial two-hybrid system, a bacterial one-hybrid system, and promoter bank construction are also verified. The advantages of this simple procedure, together with its low cost and high efficiency, makes our strategy extremely useful in HTP cloning constructions. PMID:23185557

A functional 12T-insertion polymorphism in the ATP1A1 promoter confers decreased susceptibility to hypertension in a male Sardinian population.

PubMed

Herrera, Victoria L; Pasion, Khristine A; Moran, Ann Marie; Zaninello, Roberta; Ortu, Maria Francesca; Fresu, Giovanni; Piras, Daniela Antonella; Argiolas, Giuseppe; Troffa, Chiara; Glorioso, Valeria; Masala, Wanda; Glorioso, Nicola; Ruiz-Opazo, Nelson

2015-01-01

Identification of susceptibility genes for essential hypertension in humans has been a challenge due to its multifactorial pathogenesis complicated by gene-gene and gene-environment interactions, developmental programing and sex specific differences. These concurrent features make identification of causal hypertension susceptibility genes with a single approach difficult, thus requiring multiple lines of evidence involving genetic, biochemical and biological experimentation to establish causal functional mutations. Here we report experimental evidence encompassing genetic, biochemical and in vivo modeling that altogether support ATP1A1 as a hypertension susceptibility gene in males in Sardinia, Italy. ATP1A1 encodes the α1Na,K-ATPase isoform, the sole sodium pump in vascular endothelial and renal tubular epithelial cells. DNA-sequencing detected a 12-nucleotide long thymidine (12T) insertion(ins)/deletion(del) polymorphism within a poly-T sequence (38T vs 26T) in the ATP1A1 5'-regulatory region associated with hypertension in a male Sardinian population. The 12T-insertion allele confers decreased susceptibility to hypertension (P = 0.035; OR = 0.50 [0.28-0.93]) accounting for 12.1 mmHg decrease in systolic BP (P = 0.02) and 6.6 mmHg in diastolic BP (P = 0.046). The ATP1A1 promoter containing the 12T-insertion exhibited decreased transcriptional activity in in vitro reporter-assay systems, indicating decreased α1Na,K-ATPase expression with the 12T-insertion, compared with the 12T-deletion ATP1A1 promoter. To test the effects of decreased α1Na,K-ATPase expression on blood pressure, we measured blood pressure by radiotelemetry in three month-old, highly inbred heterozygous knockout ATP1A1+/- male mice with resultant 58% reduction in ATP1A1 protein levels. Male ATP1A1+/- mice showed significantly lower blood pressure (P < 0.03) than age-matched male wild-type littermate controls. Concordantly, lower ATP1A1 expression is expected to lower Na-reabsorption in the kidney thereby decreasing sodium-associated risk for hypertension and sodium-induced endothelial stiffness and dysfunction. Altogether, data support ATP1A1 as a hypertension susceptibility gene in a male Sardinian population, and mandate further investigation of its involvement in hypertension in the general population.

A Functional 12T-Insertion Polymorphism in the ATP1A1 Promoter Confers Decreased Susceptibility to Hypertension in a Male Sardinian Population

PubMed Central

Herrera, Victoria L.; Pasion, Khristine A.; Moran, Ann Marie; Zaninello, Roberta; Ortu, Maria Francesca; Fresu, Giovanni; Piras, Daniela Antonella; Argiolas, Giuseppe; Troffa, Chiara; Glorioso, Valeria; Masala, Wanda; Glorioso, Nicola; Ruiz-Opazo, Nelson

2015-01-01

Identification of susceptibility genes for essential hypertension in humans has been a challenge due to its multifactorial pathogenesis complicated by gene-gene and gene-environment interactions, developmental programing and sex specific differences. These concurrent features make identification of causal hypertension susceptibility genes with a single approach difficult, thus requiring multiple lines of evidence involving genetic, biochemical and biological experimentation to establish causal functional mutations. Here we report experimental evidence encompassing genetic, biochemical and in vivo modeling that altogether support ATP1A1 as a hypertension susceptibility gene in males in Sardinia, Italy. ATP1A1 encodes the α1Na,K-ATPase isoform, the sole sodium pump in vascular endothelial and renal tubular epithelial cells. DNA-sequencing detected a 12-nucleotide long thymidine (12T) insertion(ins)/deletion(del) polymorphism within a poly-T sequence (38T vs 26T) in the ATP1A1 5’-regulatory region associated with hypertension in a male Sardinian population. The 12T-insertion allele confers decreased susceptibility to hypertension (P = 0.035; OR = 0.50 [0.28–0.93]) accounting for 12.1 mmHg decrease in systolic BP (P = 0.02) and 6.6 mmHg in diastolic BP (P = 0.046). The ATP1A1 promoter containing the 12T-insertion exhibited decreased transcriptional activity in in vitro reporter-assay systems, indicating decreased α1Na,K-ATPase expression with the 12T-insertion, compared with the 12T-deletion ATP1A1 promoter. To test the effects of decreased α1Na,K-ATPase expression on blood pressure, we measured blood pressure by radiotelemetry in three month-old, highly inbred heterozygous knockout ATP1A1+/− male mice with resultant 58% reduction in ATP1A1 protein levels. Male ATP1A1+/− mice showed significantly lower blood pressure (P < 0.03) than age-matched male wild-type littermate controls. Concordantly, lower ATP1A1 expression is expected to lower Na-reabsorption in the kidney thereby decreasing sodium-associated risk for hypertension and sodium-induced endothelial stiffness and dysfunction. Altogether, data support ATP1A1 as a hypertension susceptibility gene in a male Sardinian population, and mandate further investigation of its involvement in hypertension in the general population. PMID:25615575

Diversity of Shiga Toxin-Producing Escherichia coli (STEC) O26:H11 Strains Examined via stx Subtypes and Insertion Sites of Stx and EspK Bacteriophages

PubMed Central

Bonanno, Ludivine; Loukiadis, Estelle; Mariani-Kurkdjian, Patricia; Oswald, Eric; Garnier, Lucille; Michel, Valérie

2015-01-01

Shiga toxin-producing Escherichia coli (STEC) is a food-borne pathogen that may be responsible for severe human infections. Only a limited number of serotypes, including O26:H11, are involved in the majority of serious cases and outbreaks. The main virulence factors, Shiga toxins (Stx), are encoded by bacteriophages. Seventy-four STEC O26:H11 strains of various origins (including human, dairy, and cattle) were characterized for their stx subtypes and Stx phage chromosomal insertion sites. The majority of food and cattle strains possessed the stx1a subtype, while human strains carried mainly stx1a or stx2a. The wrbA and yehV genes were the main Stx phage insertion sites in STEC O26:H11, followed distantly by yecE and sbcB. Interestingly, the occurrence of Stx phages inserted in the yecE gene was low in dairy strains. In most of the 29 stx-negative E. coli O26:H11 strains also studied here, these bacterial insertion sites were vacant. Multilocus sequence typing of 20 stx-positive or stx-negative E. coli O26:H11 strains showed that they were distributed into two phylogenetic groups defined by sequence type 21 (ST21) and ST29. Finally, an EspK-carrying phage was found inserted in the ssrA gene in the majority of the STEC O26:H11 strains but in only a minority of the stx-negative E. coli O26:H11 strains. The differences in the stx subtypes and Stx phage insertion sites observed in STEC O26:H11 according to their origin might reflect that strains circulating in cattle and foods are clonally distinct from those isolated from human patients. PMID:25819955

Regulation and Adaptive Evolution of Lactose Operon Expression in Lactobacillus delbrueckii

PubMed Central

Lapierre, Luciane; Mollet, Beat; Germond, Jacques-Edouard

2002-01-01

Lactobacillus delbrueckii subsp. bulgaricus and L. delbrueckii subsp. lactis are both used in the dairy industry as homofermentative lactic acid bacteria in the production of fermented milk products. After selective pressure for the fast fermentation of milk in the manufacture of yogurts, L. delbrueckii subsp. bulgaricus loses its ability to regulate lac operon expression. A series of mutations led to the constitutive expression of the lac genes. A complex of insertion sequence (IS) elements (ISL4 inside ISL5), inserted at the border of the lac promoter, induced the loss of the palindromic structure of one of the operators likely involved in the binding of regulatory factors. A lac repressor gene was discovered downstream of the β-galactosidase gene of L. delbrueckii subsp. lactis and was shown to be inactivated by several mutations in L. delbrueckii subsp. bulgaricus. Regulatory mechanisms of the lac gene expression of L. delbrueckii subsp. bulgaricus and L. delbrueckii subsp. lactis were compared by heterologous expression in Lactococcus lactis of the two lac promoters in front of a reporter gene (β-glucuronidase) in the presence or absence of the lac repressor gene. Insertion of the complex of IS elements in the lac promoter of L. delbrueckii subsp. bulgaricus increased the promoter's activity but did not prevent repressor binding; rather, it increased the affinity of the repressor for the promoter. Inactivation of the lac repressor by mutations was then necessary to induce the constitutive expression of the lac genes in L. delbrueckii subsp. bulgaricus. PMID:11807052

Transposon based functional characterization of soybean genes

USDA-ARS?s Scientific Manuscript database

Type II transposable elements that use cut and paste mechanism for jumping from one genomic region to another is ideal in tagging and cloning genes. Precise excision from an insertion site in a mutant gene leads to regaining the wild-type function. Thus, function of a gene can be established based o...

Expansion of genetic testing in the division of functional genomics, research center for bioscience and technology, tottori university from 2000 to 2013.

PubMed

Adachi, Kaori

2014-03-01

At the Division of Functional Genomics, Research Center for Bioscience and Technology, Tottori University, we have been making an effort to establish a genetic testing facility that can provide the same screening procedures conducted worldwide. Direct Sequencing of PCR products is the main method to detect point mutations, small deletions and insertions. Multiplex Ligation-dependent Probe Amplification (MLPA) was used to detect large deletions or insertions. Expansion of the repeat was analyzed for triplet repeat diseases. Original primers were constructed for 41 diseases when the reported primers failed to amplify the gene. Prediction of functional effects of human nsSNPs (PolyPhen) was used for evaluation of novel mutations. From January 2000 to September 2013, a total of 1,006 DNA samples were subjected to genetic testing in the Division of Functional Genomics, Research Center for Bioscience and Technology, Tottori University. The hospitals that requested genetic testing were located in 43 prefectures in Japan and in 11 foreign countries. The genetic testing covered 62 diseases, and mutations were detected in 287 out of 1,006 with an average mutation detection rate of 24.7%. There were 77 samples for prenatal diagnosis. The number of samples has rapidly increased since 2010. In 2013, the next-generation sequencers were introduced in our facility and are expected to provide more comprehensive genetic testing in the near future. Nowadays, genetic testing is a popular and powerful tool for diagnosis of many genetic diseases. Our genetic testing should be further expanded in the future.

Liver-Directed Lentiviral Gene Therapy in a Dog Model of Hemophilia B

PubMed Central

Bartholomae, Cynthia C.; Volpin, Monica; Della Valle, Patrizia; Sanvito, Francesca; Sergi Sergi, Lucia; Gallina, Pierangela; Benedicenti, Fabrizio; Bellinger, Dwight; Raymer, Robin; Merricks, Elizabeth; Bellintani, Francesca; Martin, Samia; Doglioni, Claudio; D’Angelo, Armando; VandenDriessche, Thierry; Chuah, Marinee K.; Schmidt, Manfred; Nichols, Timothy; Montini, Eugenio; Naldini, Luigi

2017-01-01

We investigated the safety and efficacy of liver-directed gene therapy using lentiviral vectors in a large animal model of hemophilia B, and evaluated the risk of insertional mutagenesis in tumor-prone mouse models. We show that gene therapy using lentiviral vectors targeting expression of a canine factor IX transgene to hepatocytes was well-tolerated and provided stable long-term production of coagulation factor IX in dogs with hemophilia B. By exploiting three different mouse models designed to amplify the consequences of insertional mutagenesis, we show that no genotoxicity was detected with these lentiviral vectors. Our findings suggest that lentiviral vectors may be an attractive candidate for gene therapy targeted to the liver and may be useful for the treatment of hemophilia. PMID:25739762

Genetically Modified Food: Knowledge and Attitude of Teachers and Students

NASA Astrophysics Data System (ADS)

Mohapatra, Animesh K.; Priyadarshini, Deepika; Biswas, Antara

2010-10-01

The concepts behind the technology of genetic modification of organisms and its applications are complex. A diverse range of opinions, public concern and considerable media interest accompanies the subject. This study explores the knowledge and attitudes of science teachers and senior secondary biology students about the application of a rapidly expanding technology, genetic engineering, to food production. The results indicated significant difference in understanding of concepts related with genetically engineered food stuffs between teachers and students. The most common ideas about genetically modified food were that cross bred plants and genetically modified plants are not same, GM organisms are produced by inserting a foreign gene into a plant or animal and are high yielding. More teachers thought that genetically engineered food stuffs were unsafe for the environment. Both teachers and students showed number of misconceptions, for example, the pesticidal proteins produced by GM organisms have indirect effects through bioaccumulation, induces production of allergic proteins, genetic engineering is production of new genes, GM plants are leaky sieves and that transgenes are more likely to introgress into wild species than mutated species. In general, more students saw benefits while teachers were cautious about the advantages of genetically engineered food stuffs.

Disease resistance breeding in rose: current status and potential of biotechnological tools.

PubMed

Debener, Thomas; Byrne, David H

2014-11-01

The cultivated rose is a multispecies complex for which a high level of disease protection is needed due to the low tolerance of blemishes in ornamental plants. The most important fungal diseases are black spot, powdery mildew, botrytis and downy mildew. Rose rosette, a lethal viral pathogen, is emerging as a devastating disease in North America. Currently rose breeders use a recurrent phenotypic selection approach and perform selection for disease resistance for most pathogen issues in a 2-3 year field trial. Marker assisted selection could accelerate this breeding process. Thus far markers have been identified for resistance to black spot (Rdrs) and powdery mildew and with the ability of genotyping by sequencing to generate 1000s of markers our ability to identify markers useful in plant improvement should increase exponentially. Transgenic rose lines with various fungal resistance genes inserted have shown limited success and RNAi technology has potential to provide virus resistance. Roses, as do other plants, have sequences homologous to characterized R-genes in their genomes, some which have been related to specific disease resistance. With improving next generation sequencing technology, our ability to do genomic and transcriptomic studies of the resistance related genes in both the rose and the pathogens to reveal novel gene targets to develop resistant roses will accelerate. Finally, the development of designer nucleases opens up a potentially non-GMO approach to directly modify a rose's DNA to create a disease resistant rose. Although there is much potential, at present rose breeders are not using marker assisted breeding primarily because a good suite of marker/trait associations (MTA) that would ensure a path to stable disease resistance is not available. As our genomic analytical tools improve, so will our ability to identify useful genes and linked markers. Once these MTAs are available, it will be the cost savings, both in time and money, that will convince the breeders to use the technology. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

[Chromosomal large fragment deletion induced by CRISPR/Cas9 gene editing system].

PubMed

Cheng, L H; Liu, Y; Niu, T

2017-05-14

Objective: Using CRISPR-Cas9 gene editing technology to achieve a number of genes co-deletion on the same chromosome. Methods: CRISPR-Cas9 lentiviral plasmid that could induce deletion of Aloxe3-Alox12b-Alox8 cluster genes located on mouse 11B3 chromosome was constructed via molecular clone. HEK293T cells were transfected to package lentivirus of CRISPR or Cas9 cDNA, then mouse NIH3T3 cells were infected by lentivirus and genomic DNA of these cells was extracted. The deleted fragment was amplified by PCR, TA clone, Sanger sequencing and other techniques were used to confirm the deletion of Aloxe3-Alox12b-Alox8 cluster genes. Results: The CRISPR-Cas9 lentiviral plasmid, which could induce deletion of Aloxe3-Alox12b-Alox8 cluster genes, was successfully constructed. Deletion of target chromosome fragment (Aloxe3-Alox12b-Alox8 cluster genes) was verified by PCR. The deletion of Aloxe3-Alox12b-Alox8 cluster genes was affirmed by TA clone, Sanger sequencing, and the breakpoint junctions of the CRISPR-Cas9 system mediate cutting events were accurately recombined, insertion mutation did not occur between two cleavage sites at all. Conclusion: Large fragment deletion of Aloxe3-Alox12b-Alox8 cluster genes located on mouse chromosome 11B3 was successfully induced by CRISPR-Cas9 gene editing system.

Cloning and expression of 130-kd mosquito-larvicidal delta-endotoxin gene of Bacillus thuringiensis var. Israelensis in Escherichia coli.

PubMed

Angsuthanasombat, C; Chungjatupornchai, W; Kertbundit, S; Luxananil, P; Settasatian, C; Wilairat, P; Panyim, S

1987-07-01

Five recombinant E. coli clones exhibiting toxicity to Aedes aegypti larvae were obtained from a library of 800 clones containing XbaI DNA fragments of 110 kb plasmid from B. thuringiensis var. israelensis. All the five clones (pMU 14/258/303/388/679) had the same 3.8-kb insert and encoded a major protein of 130 kDa which was highly toxic to A. aegypti larvae. Three clones (pMU 258/303/388) transcribed the 130 kD a gene in the same direction as that of lac Z promoter of pUC12 vector whereas the transcription of the other two (pMU 14/679) was in the opposite direction. A 1.9-kb fragment of the 3.8 kb insert coded for a protein of 65 kDa. Partial DNA sequence of the 3.8 kb insert, corresponding to the 5'-terminal of the 130 kDa gene, revealed a continuous reading frame, a Shine-Dalgarno sequence and a tentative 5'-regulatory region. These results demonstrated that the 3.8 kb insert is a minimal DNA fragment containing a regulatory region plus the coding sequence of the 130 kDa protein that is highly toxic to mosquito larvae.

Comprehensive identification of Vibrio vulnificus genes required for growth in human serum.

PubMed

Carda-Diéguez, M; Silva-Hernández, F X; Hubbard, T P; Chao, M C; Waldor, M K; Amaro, C

2018-12-31

Vibrio vulnificus can be a highly invasive pathogen capable of spreading from an infection site to the bloodstream, causing sepsis and death. To survive and proliferate in blood, the pathogen requires mechanisms to overcome the innate immune defenses and metabolic limitations of this host niche. We created a high-density transposon mutant library in YJ016, a strain representative of the most virulent V. vulnificus lineage (or phylogroup) and used transposon insertion sequencing (TIS) screens to identify loci that enable the pathogen to survive and proliferate in human serum. Initially, genes underrepresented for insertions were used to estimate the V. vulnificus essential gene set; comparisons of these genes with similar TIS-based classification of underrepresented genes in other vibrios enabled the compilation of a common Vibrio essential gene set. Analysis of the relative abundance of insertion mutants in the library after exposure to serum suggested that genes involved in capsule biogenesis are critical for YJ016 complement resistance. Notably, homologues of two genes required for YJ016 serum-resistance and capsule biogenesis were not previously linked to capsule biogenesis and are largely absent from other V. vulnificus strains. The relative abundance of mutants after exposure to heat inactivated serum was compared with the findings from the serum screen. These comparisons suggest that in both conditions the pathogen relies on its Na + transporting NADH-ubiquinone reductase (NQR) complex and type II secretion system to survive/proliferate within the metabolic constraints of serum. Collectively, our findings reveal the potency of comparative TIS screens to provide knowledge of how a pathogen overcomes the diverse limitations to growth imposed by serum.

Technology Insertion for Recapitalization of Legacy Systems

DTIC Science & Technology

2015-09-30

peened, and 4) an Abcite coating will be flame sprayed on the component. The ALCM program (B) has 1) evaluated data provided, 2) gathered questions...Report Technology Insertion for the Recapitalization of Legacy Systems Laser sintering, thermal spray and cold spray are additive manufacturing methods... coatings Need an experienced operator Requires a special spray booth to limit overspray and protect operator Requires primer or surface treatment

The Major Cold Shock Gene, cspA, Is Involved in the Susceptibility of Staphylococcus aureus to an Antimicrobial Peptide of Human Cathepsin G

PubMed Central

Katzif, Samuel; Danavall, Damien; Bowers, Samera; Balthazar, Jacqueline T.; Shafer, William M.

2003-01-01

A Tn551 insertional library of Staphylococcus aureus strain ISP479 was challenged with an antimicrobial peptide (CG 117-136) derived from human neutrophil cathepsin G (CG). After repeated selection and screening of surviving colonies, a mutant was identified that expressed increased resistance to CG 117-136. Southern hybridization analysis revealed that the Tn551 insert in this mutant (SK1) was carried on a 10.6-kb EcoRI chromosomal DNA fragment. Subsequent physical mapping of this Tn551 insert revealed that it was positioned between a putative promoter sequence and the translational start codon of the cspA gene, which encodes a protein (CspA) highly similar to the major cold shock proteins CspA and CspB of Escherichia coli and Bacillus subtilis, respectively. This Tn551 insertion as well as a separate deletion-insertion mutation in cspA decreased the capacity of S. aureus to respond to the stress of cold shock and increased resistance to CG 117-136. The results indicate for the first time that a physiologic link exists between bacterial susceptibility to an antimicrobial peptide and a stress response system. PMID:12874306

The major cold shock gene, cspA, is involved in the susceptibility of Staphylococcus aureus to an antimicrobial peptide of human cathepsin G.

PubMed

Katzif, Samuel; Danavall, Damien; Bowers, Samera; Balthazar, Jacqueline T; Shafer, William M

2003-08-01

A Tn551 insertional library of Staphylococcus aureus strain ISP479 was challenged with an antimicrobial peptide (CG 117-136) derived from human neutrophil cathepsin G (CG). After repeated selection and screening of surviving colonies, a mutant was identified that expressed increased resistance to CG 117-136. Southern hybridization analysis revealed that the Tn551 insert in this mutant (SK1) was carried on a 10.6-kb EcoRI chromosomal DNA fragment. Subsequent physical mapping of this Tn551 insert revealed that it was positioned between a putative promoter sequence and the translational start codon of the cspA gene, which encodes a protein (CspA) highly similar to the major cold shock proteins CspA and CspB of Escherichia coli and Bacillus subtilis, respectively. This Tn551 insertion as well as a separate deletion-insertion mutation in cspA decreased the capacity of S. aureus to respond to the stress of cold shock and increased resistance to CG 117-136. The results indicate for the first time that a physiologic link exists between bacterial susceptibility to an antimicrobial peptide and a stress response system.

Isolation of Erwinia chrysanthemi kduD mutants altered in pectin degradation.

PubMed Central

Condemine, G; Hugouvieux-Cotte-Pattat, N; Robert-Baudouy, J

1986-01-01

Mutants of Erwinia chrysanthemi impaired in pectin degradation were isolated by chemical and Mu d(Ap lac) insertion mutagenesis. A mutation in the kduD gene coding for 2-keto-3-deoxygluconate oxidoreductase prevented the growth of the bacteria on polygalacturonate as the sole carbon source. Analysis of the kduD::Mu d(Ap lac) insertions indicated that kduD is either an isolated gene or the last gene of a polycistronic operon. Some of the Mu d(Ap lac) insertions were kduD-lac fusions in which beta-galactosidase synthesis reflected kduD gene expression. In all these fusions, beta-galactosidase activity was shown to be sensitive to catabolite repression by glucose and to be inducible by polygalacturonate, galacturonate, and other intermediates of polygalacturonate catabolism. Galacturonate-mediated induction was prevented by a mutation which blocked its metabolism to 2-keto-3-deoxygluconate. 2-Keto-3-deoxygluconate appeared to be the true inducer of kduD expression resulting from galacturonate degradation. 5-Keto-4-deoxyuronate or 2,5-diketo-3-deoxygluconate were the true inducers, originating from polygalacturonate cleavage. These three intermediates also appeared to induce pectate lyases, oligogalacturonate lyase, and 5-keto-4-deoxyuronate isomerase synthesis. PMID:3949717

Perturbation of nuclear architecture by long-distance chromosome interactions.

PubMed

Dernburg, A F; Broman, K W; Fung, J C; Marshall, W F; Philips, J; Agard, D A; Sedat, J W

1996-05-31

Position-effect variegation (PEV) describes the stochastic transcriptional silencing of a gene positioned adjacent to heterochromatin. Using FISH, we have tested whether variegated expression of the eye-color gene brown in Drosophila is influenced by its nuclear localization. In embryonic nuclei, a heterochromatic insertion at the brown locus is always spatially isolated from other heterochromatin. However, during larval development this insertion physically associates with other heterochromatic regions on the same chromosome in a stochastic manner. These observations indicate that the brown gene is silenced by specific contact with centromeric heterochromatin. Moreover, they provide direct evidence for long-range chromosome interactions and their impact on three-dimensional nuclear architecture, while providing a cohesive explanation for the phenomenon of PEV.

Ancient DNA analysis reveals woolly rhino evolutionary relationships.

PubMed

Orlando, Ludovic; Leonard, Jennifer A; Thenot, Aurélie; Laudet, Vincent; Guerin, Claude; Hänni, Catherine

2003-09-01

With ancient DNA technology, DNA sequences have been added to the list of characters available to infer the phyletic position of extinct species in evolutionary trees. We have sequenced the entire 12S rRNA and partial cytochrome b (cyt b) genes of one 60-70,000-year-old sample, and partial 12S rRNA and cyt b sequences of two 40-45,000-year-old samples of the extinct woolly rhinoceros (Coelodonta antiquitatis). Based on these two mitochondrial markers, phylogenetic analyses show that C. antiquitatis is most closely related to one of the three extant Asian rhinoceros species, Dicerorhinus sumatrensis. Calculations based on a molecular clock suggest that the lineage leading to C. antiquitatis and D. sumatrensis diverged in the Oligocene, 21-26 MYA. Both results agree with morphological models deduced from palaeontological data. Nuclear inserts of mitochondrial DNA were identified in the ancient specimens. These data should encourage the use of nuclear DNA in future ancient DNA studies. It also further establishes that the degraded nature of ancient DNA does not completely protect ancient DNA studies based on mitochondrial data from the problems associated with nuclear inserts.

Efficient CRISPR/Cas9-assisted gene targeting enables rapid and precise genetic manipulation of mammalian neural stem cells

PubMed Central

Bressan, Raul Bardini; Dewari, Pooran Singh; Kalantzaki, Maria; Gangoso, Ester; Matjusaitis, Mantas; Garcia-Diaz, Claudia; Blin, Carla; Grant, Vivien; Bulstrode, Harry; Gogolok, Sabine; Skarnes, William C.

2017-01-01

Mammalian neural stem cell (NSC) lines provide a tractable model for discovery across stem cell and developmental biology, regenerative medicine and neuroscience. They can be derived from foetal or adult germinal tissues and continuously propagated in vitro as adherent monolayers. NSCs are clonally expandable, genetically stable, and easily transfectable – experimental attributes compatible with targeted genetic manipulations. However, gene targeting, which is crucial for functional studies of embryonic stem cells, has not been exploited to date in NSC lines. Here, we deploy CRISPR/Cas9 technology to demonstrate a variety of sophisticated genetic modifications via gene targeting in both mouse and human NSC lines, including: (1) efficient targeted transgene insertion at safe harbour loci (Rosa26 and AAVS1); (2) biallelic knockout of neurodevelopmental transcription factor genes; (3) simple knock-in of epitope tags and fluorescent reporters (e.g. Sox2-V5 and Sox2-mCherry); and (4) engineering of glioma mutations (TP53 deletion; H3F3A point mutations). These resources and optimised methods enable facile and scalable genome editing in mammalian NSCs, providing significant new opportunities for functional genetic analysis. PMID:28096221

DEAF-1 regulates immunity gene expression in Drosophila.

PubMed

Reed, Darien E; Huang, Xinhua M; Wohlschlegel, James A; Levine, Michael S; Senger, Kate

2008-06-17

Immunity genes are activated in the Drosophila fat body by Rel and GATA transcription factors. Here, we present evidence that an additional regulatory factor, deformed epidermal autoregulatory factor-1 (DEAF-1), also contributes to the immune response and is specifically important for the induction of two genes encoding antimicrobial peptides, Metchnikowin (Mtk) and Drosomycin (Drs). The systematic mutagenesis of a minimal Mtk 5' enhancer identified a sequence motif essential for both a response to LPS preparations in S2 cells and activation in the larval fat body in response to bacterial infection. Using affinity chromatography coupled to multidimensional protein identification technology (MudPIT), we identified DEAF-1 as a candidate regulator. DEAF-1 activates the expression of Mtk and Drs promoter-luciferase fusion genes in S2 cells. SELEX assays and footprinting data indicate that DEAF-1 binds to and activates Mtk and Drs regulatory DNAs via a TTCGGBT motif. The insertion of this motif into the Diptericin (Dpt) regulatory region confers DEAF-1 responsiveness to this normally DEAF-1-independent enhancer. The coexpression of DEAF-1 with Dorsal, Dif, and Relish results in the synergistic activation of transcription. We propose that DEAF-1 is a regulator of Drosophila immunity.

Systems Biology-Based Investigation of Cellular Antiviral Drug Targets Identified by Gene-Trap Insertional Mutagenesis.

PubMed

Cheng, Feixiong; Murray, James L; Zhao, Junfei; Sheng, Jinsong; Zhao, Zhongming; Rubin, Donald H

2016-09-01

Viruses require host cellular factors for successful replication. A comprehensive systems-level investigation of the virus-host interactome is critical for understanding the roles of host factors with the end goal of discovering new druggable antiviral targets. Gene-trap insertional mutagenesis is a high-throughput forward genetics approach to randomly disrupt (trap) host genes and discover host genes that are essential for viral replication, but not for host cell survival. In this study, we used libraries of randomly mutagenized cells to discover cellular genes that are essential for the replication of 10 distinct cytotoxic mammalian viruses, 1 gram-negative bacterium, and 5 toxins. We herein reported 712 candidate cellular genes, characterizing distinct topological network and evolutionary signatures, and occupying central hubs in the human interactome. Cell cycle phase-specific network analysis showed that host cell cycle programs played critical roles during viral replication (e.g. MYC and TAF4 regulating G0/1 phase). Moreover, the viral perturbation of host cellular networks reflected disease etiology in that host genes (e.g. CTCF, RHOA, and CDKN1B) identified were frequently essential and significantly associated with Mendelian and orphan diseases, or somatic mutations in cancer. Computational drug repositioning framework via incorporating drug-gene signatures from the Connectivity Map into the virus-host interactome identified 110 putative druggable antiviral targets and prioritized several existing drugs (e.g. ajmaline) that may be potential for antiviral indication (e.g. anti-Ebola). In summary, this work provides a powerful methodology with a tight integration of gene-trap insertional mutagenesis testing and systems biology to identify new antiviral targets and drugs for the development of broadly acting and targeted clinical antiviral therapeutics.

Genome Engineering in Bacillus anthracis Using Cre Recombinase

PubMed Central

Pomerantsev, Andrei P.; Sitaraman, Ramakrishnan; Galloway, Craig R.; Kivovich, Violetta; Leppla, Stephen H.

2006-01-01

Genome engineering is a powerful method for the study of bacterial virulence. With the availability of the complete genomic sequence of Bacillus anthracis, it is now possible to inactivate or delete selected genes of interest. However, many current methods for disrupting or deleting more than one gene require use of multiple antibiotic resistance determinants. In this report we used an approach that temporarily inserts an antibiotic resistance marker into a selected region of the genome and subsequently removes it, leaving the target region (a single gene or a larger genomic segment) permanently mutated. For this purpose, a spectinomycin resistance cassette flanked by bacteriophage P1 loxP sites oriented as direct repeats was inserted within a selected gene. After identification of strains having the spectinomycin cassette inserted by a double-crossover event, a thermo-sensitive plasmid expressing Cre recombinase was introduced at the permissive temperature. Cre recombinase action at the loxP sites excised the spectinomycin marker, leaving a single loxP site within the targeted gene or genomic segment. The Cre-expressing plasmid was then removed by growth at the restrictive temperature. The procedure could then be repeated to mutate additional genes. In this way, we sequentially mutated two pairs of genes: pepM and spo0A, and mcrB and mrr. Furthermore, loxP sites introduced at distant genes could be recombined by Cre recombinase to cause deletion of large intervening regions. In this way, we deleted the capBCAD region of the pXO2 plasmid and the entire 30 kb of chromosomal DNA between the mcrB and mrr genes, and in the latter case we found that the 32 intervening open reading frames were not essential to growth. PMID:16369025

Widespread and evolutionary analysis of a MITE family Monkey King in Brassicaceae.

PubMed

Dai, Shutao; Hou, Jinna; Long, Yan; Wang, Jing; Li, Cong; Xiao, Qinqin; Jiang, Xiaoxue; Zou, Xiaoxiao; Zou, Jun; Meng, Jinling

2015-06-19

Miniature inverted repeat transposable elements (MITEs) are important components of eukaryotic genomes, with hundreds of families and many copies, which may play important roles in gene regulation and genome evolution. However, few studies have investigated the molecular mechanisms involved. In our previous study, a Tourist-like MITE, Monkey King, was identified from the promoter region of a flowering time gene, BnFLC.A10, in Brassica napus. Based on this MITE, the characteristics and potential roles on gene regulation of the MITE family were analyzed in Brassicaceae. The characteristics of the Tourist-like MITE family Monkey King in Brassicaceae, including its distribution, copies and insertion sites in the genomes of major Brassicaceae species were analyzed in this study. Monkey King was actively amplified in Brassica after divergence from Arabidopsis, which was indicated by the prompt increase in copy number and by phylogenetic analysis. The genomic variations caused by Monkey King insertions, both intra- and inter-species in Brassica, were traced by PCR amplification. Genomic sequence analysis showed that most complete Monkey King elements are located in gene-rich regions, less than 3kb from genes, in both the B. rapa and A. thaliana genomes. Sixty-seven Brassica expressed sequence tags carrying Monkey King fragments were also identified from the NCBI database. Bisulfite sequencing identified specific DNA methylation of cytosine residues in the Monkey King sequence. A fragment containing putative TATA-box motifs in the MITE sequence could bind with nuclear protein(s) extracted from leaves of B. napus plants. A Monkey King-related microRNA, bna-miR6031, was identified in the microRNA database. In transgenic A. thaliana, when the Monkey King element was inserted upstream of 35S promoter, the promoter activity was weakened. Monkey King, a Brassicaceae Tourist-like MITE family, has amplified relatively recently and has induced intra- and inter-species genomic variations in Brassica. Monkey King elements are most abundant in the vicinity of genes and may have a substantial effect on genome-wide gene regulation in Brassicaceae. Monkey King insertions potentially regulate gene expression and genome evolution through epigenetic modification and new regulatory motif production.

Angiotensin-converting enzyme (ACE) gene insertion/deletion polymorphism is not a risk factor for hypertension in SLE nephritis.

PubMed

Negi, Vir S; Devaraju, Panneer; Gulati, Reena

2015-09-01

SLE is a systemic autoimmune disease with high prevalence of hypertension. Around 40-75 % of SLE patients develop nephritis, a major cause of hypertension and mortality. Angiotensin-converting enzyme (ACE) maintains the blood pressure and blood volume homeostasis. An insertion/deletion (I/D) polymorphism in intron 16 of ACE gene was reported to influence the development of hypertension, nephritis, and cardiovascular diseases in different ethnic populations. Despite compelling evidence for the high prevalence of hypertension in individuals with SLE, underlying factors for its development are not well studied. With this background, we analyzed the influence of ACE insertion/deletion polymorphism on susceptibility to SLE, development of nephritis and hypertension, other clinical features and autoantibody phenotype in South Indian SLE patients. Three hundred patients with SLE and 460 age and sex similar ethnicity matched individuals were included as patients and healthy controls, respectively. The ACE gene insertion/deletion polymorphism was analyzed by PCR. Insertion (I) and deletion (D) alleles were observed to be equally distributed among patients (57 and 43 %) and controls (59 and 41 %), respectively. The mutant (D) allele did not confer significant risk for SLE (II vs. ID: p = 0.4, OR 1.15, 95 % CI 0.8-1.6; II vs. DD: p = 0.34, OR 1.22, 95 % CI 0.8-1.85). There was no association of the ACE genotype or the allele with development of lupus nephritis (II vs. ID: p = 0.19, OR 1.41, 95 % CI 0.84-2.36; II vs. DD: p = 0.41, OR 0.74, 95 % CI 0.38-1.41) or hypertension (II vs. ID: p = 0.85, OR 0.9, 95 % CI 0.43-1.8; II vs. DD: p = 0.66, OR 1.217, 95 % CI 0.5-2.8). The presence of mutant allele (D) was not found to influence any clinical features or autoantibody phenotype. The insertion/deletion polymorphism of the ACE gene is not a genetic risk factor for SLE and does not influence development of hypertension or lupus nephritis in South Indian Tamils.

Secretion Trap Tagging of Secreted and Membrane-Spanning Proteins Using Arabidopsis Gene Traps

Treesearch

Andrew T. Groover; Joseph R. Fontana; Juana M. Arroyo; Cristina Yordan; W. Richard McCombie; Robert A. Martienssen

2003-01-01

Secreted and membrane-spanning proteins play fundamental roles in plant development but pose challenges for genetic identification and characterization. We describe a "secretion trap" screen for gene trap insertions in genes encoding proteins routed through the secretory pathway. The gene trap transposon encodes a ß-glucuronidase reporter enzyme...

What makes up plant genomes: The vanishing line between transposable elements and genes.

PubMed

Zhao, Dongyan; Ferguson, Ann A; Jiang, Ning

2016-02-01

The ultimate source of evolution is mutation. As the largest component in plant genomes, transposable elements (TEs) create numerous types of mutations that cannot be mimicked by other genetic mechanisms. When TEs insert into genomic sequences, they influence the expression of nearby genes as well as genes unlinked to the insertion. TEs can duplicate, mobilize, and recombine normal genes or gene fragments, with the potential to generate new genes or modify the structure of existing genes. TEs also donate their transposase coding regions for cellular functions in a process called TE domestication. Despite the host defense against TE activity, a subset of TEs survived and thrived through discreet selection of transposition activity, target site, element size, and the internal sequence. Finally, TEs have established strategies to reduce the efficacy of host defense system by increasing the cost of silencing TEs. This review discusses the recent progress in the area of plant TEs with a focus on the interaction between TEs and genes. Copyright © 2015 Elsevier B.V. All rights reserved.

Active Transposition in Genomes

PubMed Central

Huang, Cheng Ran Lisa; Burns, Kathleen H.; Boeke, Jef D.

2013-01-01

Transposons are DNA sequences capable of moving in genomes. Early evidence showed their accumulation in many species and suggested their continued activity in at least isolated organisms. In the past decade, with the development of various genomic technologies, it has become abundantly clear that ongoing activity is the rule rather than the exception. Active transposons of various classes are observed throughout plants and animals, including humans. They continue to create new insertions, have an enormous variety of structural and functional impact on genes and genomes, and play important roles in genome evolution. Transposon activities have been identified and measured by employing various strategies. Here, we summarize evidence of current transposon activity in various plant and animal genomes. PMID:23145912

High resolution melting: improvements in the genetic diagnosis of hypertrophic cardiomyopathy in a Portuguese cohort

PubMed Central

2012-01-01

Background Hypertrophic Cardiomyopathy (HCM) is a complex myocardial disorder with a recognized genetic heterogeneity. The elevated number of genes and mutations involved in HCM limits a gene-based diagnosis that should be considered of most importance for basic research and clinical medicine. Methodology In this report, we evaluated High Resolution Melting (HRM) robustness, regarding HCM genetic testing, by means of analyzing 28 HCM-associated genes, including the most frequent 4 HCM-associated sarcomere genes, as well as 24 genes with lower reported HCM-phenotype association. We analyzed 80 Portuguese individuals with clinical phenotype of HCM allowing simultaneously a better characterization of this disease in the Portuguese population. Results HRM technology allowed us to identify 60 mutated alleles in 72 HCM patients: 49 missense mutations, 3 nonsense mutations, one 1-bp deletion, one 5-bp deletion, one in frame 3-bp deletion, one insertion/deletion, 3 splice mutations, one 5'UTR mutation in MYH7, MYBPC3, TNNT2, TNNI3, CSRP3, MYH6 and MYL2 genes. Significantly 22 are novel gene mutations. Conclusions HRM was proven to be a technique with high sensitivity and a low false positive ratio allowing a rapid, innovative and low cost genotyping of HCM. In a short return, HRM as a gene scanning technique could be a cost-effective gene-based diagnosis for an accurate HCM genetic diagnosis and hopefully providing new insights into genotype/phenotype correlations. PMID:22429680

Applications of CRISPR/Cas System to Bacterial Metabolic Engineering.

PubMed

Cho, Suhyung; Shin, Jongoh; Cho, Byung-Kwan

2018-04-05

The clustered regularly interspaced short palindromic repeats/CRISPR-associated (CRISPR/Cas) adaptive immune system has been extensively used for gene editing, including gene deletion, insertion, and replacement in bacterial and eukaryotic cells owing to its simple, rapid, and efficient activities in unprecedented resolution. Furthermore, the CRISPR interference (CRISPRi) system including deactivated Cas9 (dCas9) with inactivated endonuclease activity has been further investigated for regulation of the target gene transiently or constitutively, avoiding cell death by disruption of genome. This review discusses the applications of CRISPR/Cas for genome editing in various bacterial systems and their applications. In particular, CRISPR technology has been used for the production of metabolites of high industrial significance, including biochemical, biofuel, and pharmaceutical products/precursors in bacteria. Here, we focus on methods to increase the productivity and yield/titer scan by controlling metabolic flux through individual or combinatorial use of CRISPR/Cas and CRISPRi systems with introduction of synthetic pathway in industrially common bacteria including Escherichia coli . Further, we discuss additional useful applications of the CRISPR/Cas system, including its use in functional genomics.

Functional genomics of lipid metabolism in the oleaginous yeast Rhodosporidium toruloides

DOE Office of Scientific and Technical Information (OSTI.GOV)

Coradetti, Samuel T.; Pinel, Dominic; Geiselman, Gina M.

The basidiomycete yeast Rhodosporidium toruloides (also known as Rhodotorula toruloides) accumulates high concentrations of lipids and carotenoids from diverse carbon sources. It has great potential as a model for the cellular biology of lipid droplets and for sustainable chemical production. We developed a method for high-throughput genetics (RB-TDNAseq), using sequence-barcoded Agrobacterium tumefaciens T-DNA insertions. We identified 1,337 putative essential genes with low T-DNA insertion rates. We functionally profiled genes required for fatty acid catabolism and lipid accumulation, validating results with 35 targeted deletion strains. We identified a high-confidence set of 150 genes affecting lipid accumulation, including genes with predicted functionmore » in signaling cascades, gene expression, protein modification and vesicular trafficking, autophagy, amino acid synthesis and tRNA modification, and genes of unknown function. Lastly, these results greatly advance our understanding of lipid metabolism in this oleaginous species and demonstrate a general approach for barcoded mutagenesis that should enable functional genomics in diverse fungi.« less

Functional genomics of lipid metabolism in the oleaginous yeast Rhodosporidium toruloides

PubMed Central

Geiselman, Gina M; Ito, Masakazu; Mondo, Stephen J; Reilly, Morgann C; Cheng, Ya-Fang; Bauer, Stefan; Grigoriev, Igor V; Gladden, John M; Simmons, Blake A; Brem, Rachel B

2018-01-01

The basidiomycete yeast Rhodosporidium toruloides (also known as Rhodotorula toruloides) accumulates high concentrations of lipids and carotenoids from diverse carbon sources. It has great potential as a model for the cellular biology of lipid droplets and for sustainable chemical production. We developed a method for high-throughput genetics (RB-TDNAseq), using sequence-barcoded Agrobacterium tumefaciens T-DNA insertions. We identified 1,337 putative essential genes with low T-DNA insertion rates. We functionally profiled genes required for fatty acid catabolism and lipid accumulation, validating results with 35 targeted deletion strains. We identified a high-confidence set of 150 genes affecting lipid accumulation, including genes with predicted function in signaling cascades, gene expression, protein modification and vesicular trafficking, autophagy, amino acid synthesis and tRNA modification, and genes of unknown function. These results greatly advance our understanding of lipid metabolism in this oleaginous species and demonstrate a general approach for barcoded mutagenesis that should enable functional genomics in diverse fungi. PMID:29521624

Functional genomics of lipid metabolism in the oleaginous yeast Rhodosporidium toruloides

DOE PAGES

Coradetti, Samuel T.; Pinel, Dominic; Geiselman, Gina M.; ...

2018-03-09

The basidiomycete yeast Rhodosporidium toruloides (also known as Rhodotorula toruloides) accumulates high concentrations of lipids and carotenoids from diverse carbon sources. It has great potential as a model for the cellular biology of lipid droplets and for sustainable chemical production. We developed a method for high-throughput genetics (RB-TDNAseq), using sequence-barcoded Agrobacterium tumefaciens T-DNA insertions. We identified 1,337 putative essential genes with low T-DNA insertion rates. We functionally profiled genes required for fatty acid catabolism and lipid accumulation, validating results with 35 targeted deletion strains. We identified a high-confidence set of 150 genes affecting lipid accumulation, including genes with predicted functionmore » in signaling cascades, gene expression, protein modification and vesicular trafficking, autophagy, amino acid synthesis and tRNA modification, and genes of unknown function. Lastly, these results greatly advance our understanding of lipid metabolism in this oleaginous species and demonstrate a general approach for barcoded mutagenesis that should enable functional genomics in diverse fungi.« less

Drug- and Gene-eluting Stents for Preventing Coronary Restenosis

PubMed Central

Lekshmi, Kamali Manickavasagam; Che, Hui-Lian; Cho, Chong-Su

2017-01-01

Coronary artery disease (CAD) has been reported to be a major cause of death worldwide. Current treatment methods include atherectomy, coronary angioplasty (as a percutaneous coronary intervention), and coronary artery bypass. Among them, the insertion of stents into the coronary artery is one of the commonly used methods for CAD, although the formation of in-stent restenosis (ISR) is a major drawback, demanding improvement in stent technology. Stents can be improved using the delivery of DNA, siRNA, and miRNA rather than anti-inflammatory/anti-thrombotic drugs. In particular, genes that could interfere with the development of plaque around infected regions are conjugated on the stent surface to inhibit neointimal formation. Despite their potential benefits, it is necessary to explore the various properties of gene-eluting stents. Furthermore, multifunctional electronic stents that can be used as a biosensor and deliver drug- or gene-based on physiological condition will be a very promising way to the successful treatment of ISR. In this review, we have discussed the molecular mechanism of restenosis, the use of drug- and gene-eluting stents, and the possible roles that these stents have in the prevention and treatment of coronary restenosis. Further, we have explained how multifunctional electronic stents could be used as a biosensor and deliver drugs based on physiological conditions. PMID:28184335

The Sequences of 1504 Mutants in the Model Rice Variety Kitaake Facilitate Rapid Functional Genomic Studies

PubMed Central

Pham, Nikki T.; Wei, Tong; Schackwitz, Wendy S.; Lipzen, Anna M.; Duong, Phat Q.; Jones, Kyle C.; Ruan, Deling; Bauer, Diane; Peng, Yi; Schmutz, Jeremy

2017-01-01

The availability of a whole-genome sequenced mutant population and the cataloging of mutations of each line at a single-nucleotide resolution facilitate functional genomic analysis. To this end, we generated and sequenced a fast-neutron-induced mutant population in the model rice cultivar Kitaake (Oryza sativa ssp japonica), which completes its life cycle in 9 weeks. We sequenced 1504 mutant lines at 45-fold coverage and identified 91,513 mutations affecting 32,307 genes, i.e., 58% of all rice genes. We detected an average of 61 mutations per line. Mutation types include single-base substitutions, deletions, insertions, inversions, translocations, and tandem duplications. We observed a high proportion of loss-of-function mutations. We identified an inversion affecting a single gene as the causative mutation for the short-grain phenotype in one mutant line. This result reveals the usefulness of the resource for efficient, cost-effective identification of genes conferring specific phenotypes. To facilitate public access to this genetic resource, we established an open access database called KitBase that provides access to sequence data and seed stocks. This population complements other available mutant collections and gene-editing technologies. This work demonstrates how inexpensive next-generation sequencing can be applied to generate a high-density catalog of mutations. PMID:28576844

DOE Office of Scientific and Technical Information (OSTI.GOV)

Li, Guotian; Jain, Rashmi; Chern, Mawsheng

The availability of a whole-genome sequenced mutant population and the cataloging of mutations of each line at a single-nucleotide resolution facilitate functional genomic analysis. To this end, we generated and sequenced a fast-neutron-induced mutant population in the model rice cultivar Kitaake (Oryza sativa ssp japonica), which completes its life cycle in 9 weeks. We sequenced 1504 mutant lines at 45-fold coverage and identified 91,513 mutations affecting 32,307 genes, i.e., 58% of all rice genes. We detected an average of 61 mutations per line. Mutation types include single-base substitutions, deletions, insertions, inversions, translocations, and tandem duplications. We observed a high proportionmore » of loss-of-function mutations. We identified an inversion affecting a single gene as the causative mutation for the short-grain phenotype in one mutant line. This result reveals the usefulness of the resource for efficient, cost-effective identification of genes conferring specific phenotypes. To facilitate public access to this genetic resource, we established an open access database called KitBase that provides access to sequence data and seed stocks. This population complements other available mutant collections and gene-editing technologies. In conclusion, this work demonstrates how inexpensive next-generation sequencing can be applied to generate a high-density catalog of mutations.« less

Insertion/Deletion Within the KDM6A Gene Is Significantly Associated With Litter Size in Goat

PubMed Central

Cui, Yang; Yan, Hailong; Wang, Ke; Xu, Han; Zhang, Xuelian; Zhu, Haijing; Liu, Jinwang; Qu, Lei; Lan, Xianyong; Pan, Chuanying

2018-01-01

A previous whole-genome association analysis identified lysine demethylase 6A (KDM6A), which encodes a type of histone demethylase, as a candidate gene associated to goat fecundity. KDM6A gene knockout mouse disrupts gametophyte development, suggesting that it has a critical role in reproduction. In this study, goat KDM6A mRNA expression profiles were determined, insertion/deletion (indel) variants in the gene identified, indel variants effect on KDM6A gene expression assessed, and their association with first-born litter size analyzed in 2326 healthy female Shaanbei white cashmere goats. KDM6A mRNA was expressed in all tissues tested (heart, liver, spleen, lung, kidney, muscle, brain, skin and testis); the expression levels in testes at different developmental stages [1-week-old (wk), 2, 3 wk, 1-month-old (mo), 1.5 and 2 mo] indicated a potential association with the mitosis-to-meiosis transition, implying that KDM6A may have an essential role in goat fertility. Meanwhile, two novel intronic indels of 16 bp and 5 bp were identified. Statistical analysis revealed that only the 16 bp indel was associated with first-born litter size (P < 0.01), and the average first-born litter size of individuals with an insertion/insertion genotype higher than that of those with the deletion/deletion genotype (P < 0.05). There was also a significant difference in genotype distributions of the 16 bp indel between mothers of single-lamb and multi-lamb litters in the studied goat population (P = 0.001). Consistently, the 16 bp indel also had a significant effect on KDM6A gene expression. Additionally, there was no significant linkage disequilibrium (LD) between these two indel loci, consistent with the association analysis results. Together, these findings suggest that the 16 bp indel in KDM6A may be useful for marker-assisted selection (MAS) of goats. PMID:29616081

Transposable elements are enriched within or in close proximity to xenobiotic-metabolizing cytochrome P450 genes

PubMed Central

Chen, Song; Li, Xianchun

2007-01-01

Background Transposons, i.e. transposable elements (TEs), are the major internal spontaneous mutation agents for the variability of eukaryotic genomes. To address the general issue of whether transposons mediate genomic changes in environment-adaptation genes, we scanned two alleles per each of the six xenobiotic-metabolizing Helicoverpa zea cytochrome P450 loci, including CYP6B8, CYP6B27, CYP321A1, CYP321A2, CYP9A12v3 and CYP9A14, for the presence of transposon insertions by genome walking and sequence analysis. We also scanned thirteen Drosophila melanogaster P450s genes for TE insertions by in silico mapping and literature search. Results Twelve novel transposons, including LINEs (long interspersed nuclear elements), SINEs (short interspersed nuclear elements), MITEs (miniature inverted-repeat transposable elements), one full-length transib-like transposon, and one full-length Tcl-like DNA transpson, are identified from the alleles of the six H. zea P450 genes. The twelve transposons are inserted into the 5'flanking region, 3'flanking region, exon, or intron of the six environment-adaptation P450 genes. In D. melanogaster, seven out of the eight Drosophila P450s (CYP4E2, CYP6A2, CYP6A8, CYP6A9, CYP6G1, CYP6W1, CYP12A4, CYP12D1) implicated in insecticide resistance are associated with a variety of transposons. By contrast, all the five Drosophila P450s (CYP302A1, CYP306A1, CYP307A1, CYP314A1 and CYP315A1) involved in ecdysone biosynthesis and developmental regulation are free of TE insertions. Conclusion These results indicate that TEs are selectively retained within or in close proximity to xenobiotic-metabolizing P450 genes. PMID:17381843

A "White" Anthocyanin-less Pomegranate (Punica granatum L.) Caused by an Insertion in the Coding Region of the Leucoanthocyanidin Dioxygenase (LDOX; ANS) Gene.

PubMed

Ben-Simhon, Zohar; Judeinstein, Sylvie; Trainin, Taly; Harel-Beja, Rotem; Bar-Ya'akov, Irit; Borochov-Neori, Hamutal; Holland, Doron

2015-01-01

Color is an important determinant of pomegranate fruit quality and commercial value. To understand the genetic factors controlling color in pomegranate, chemical, molecular and genetic characterization of a "white" pomegranate was performed. This unique accession is lacking the typical pomegranate color rendered by anthocyanins in all tissues of the plant, including flowers, fruit (skin and arils) and leaves. Steady-state gene-expression analysis indicated that none of the analyzed "white" pomegranate tissues are able to synthesize mRNA corresponding to the PgLDOX gene (leucoanthocyanidin dioxygenase, also called ANS, anthocyanidin synthase), which is one of the central structural genes in the anthocyanin-biosynthesis pathway. HPLC analysis revealed that none of the "white" pomegranate tissues accumulate anthocyanins, whereas other flavonoids, corresponding to biochemical reactions upstream of LDOX, were present. Molecular analysis of the "white" pomegranate revealed the presence of an insertion and an SNP within the coding region of PgLDOX. It was found that the SNP does not change amino acid sequence and is not fully linked with the "white" phenotype in all pomegranate accessions from the collection. On the other hand, genotyping of pomegranate accessions from the collection and segregating populations for the "white" phenotype demonstrated its complete linkage with the insertion, inherited as a recessive single-gene trait. Taken together, the results indicate that the insertion in PgLDOX is responsible for the "white" anthocyanin-less phenotype. These data provide the first direct molecular, genetic and chemical evidence for the effect of a natural modification in the LDOX gene on color accumulation in a fruit-bearing woody perennial deciduous tree. This modification can be further utilized to elucidate the physiological role of anthocyanins in protecting the tree organs from harmful environmental conditions, such as temperature and UV radiation.

A "White" Anthocyanin-less Pomegranate (Punica granatum L.) Caused by an Insertion in the Coding Region of the Leucoanthocyanidin Dioxygenase (LDOX; ANS) Gene

PubMed Central

Ben-Simhon, Zohar; Judeinstein, Sylvie; Trainin, Taly; Harel-Beja, Rotem; Bar-Ya'akov, Irit; Borochov-Neori, Hamutal; Holland, Doron

2015-01-01

Color is an important determinant of pomegranate fruit quality and commercial value. To understand the genetic factors controlling color in pomegranate, chemical, molecular and genetic characterization of a "white" pomegranate was performed. This unique accession is lacking the typical pomegranate color rendered by anthocyanins in all tissues of the plant, including flowers, fruit (skin and arils) and leaves. Steady-state gene-expression analysis indicated that none of the analyzed "white" pomegranate tissues are able to synthesize mRNA corresponding to the PgLDOX gene (leucoanthocyanidin dioxygenase, also called ANS, anthocyanidin synthase), which is one of the central structural genes in the anthocyanin-biosynthesis pathway. HPLC analysis revealed that none of the "white" pomegranate tissues accumulate anthocyanins, whereas other flavonoids, corresponding to biochemical reactions upstream of LDOX, were present. Molecular analysis of the "white" pomegranate revealed the presence of an insertion and an SNP within the coding region of PgLDOX. It was found that the SNP does not change amino acid sequence and is not fully linked with the "white" phenotype in all pomegranate accessions from the collection. On the other hand, genotyping of pomegranate accessions from the collection and segregating populations for the "white" phenotype demonstrated its complete linkage with the insertion, inherited as a recessive single-gene trait. Taken together, the results indicate that the insertion in PgLDOX is responsible for the "white" anthocyanin-less phenotype. These data provide the first direct molecular, genetic and chemical evidence for the effect of a natural modification in the LDOX gene on color accumulation in a fruit-bearing woody perennial deciduous tree. This modification can be further utilized to elucidate the physiological role of anthocyanins in protecting the tree organs from harmful environmental conditions, such as temperature and UV radiation. PMID:26581077

EUVL back-insertion layout optimization

NASA Astrophysics Data System (ADS)

Civay, D.; Laffosse, E.; Chesneau, A.

2018-03-01

Extreme ultraviolet lithography (EUVL) is targeted for front-up insertion at advanced technology nodes but will be evaluated for back insertion at more mature nodes. EUVL can put two or more mask levels back on one mask, depending upon what level(s) in the process insertion occurs. In this paper, layout optimization methods are discussed that can be implemented when EUVL back insertion is implemented. The layout optimizations can be focused on improving yield, reliability or density, depending upon the design needs. The proposed methodology modifies the original two or more colored layers and generates an optimized single color EUVL layout design.

A gene-trap strategy identifies quiescence-induced genes in synchronized myoblasts.

PubMed

Sambasivan, Ramkumar; Pavlath, Grace K; Dhawan, Jyotsna

2008-03-01

Cellular quiescence is characterized not only by reduced mitotic and metabolic activity but also by altered gene expression. Growing evidence suggests that quiescence is not merely a basal state but is regulated by active mechanisms. To understand the molecular programme that governs reversible cell cycle exit, we focused on quiescence-related gene expression in a culture model of myogenic cell arrest and activation. Here we report the identification of quiescence-induced genes using a gene-trap strategy. Using a retroviral vector, we generated a library of gene traps in C2C12 myoblasts that were screened for arrest-induced insertions by live cell sorting (FACS-gal). Several independent gene- trap lines revealed arrest-dependent induction of betagal activity, confirming the efficacy of the FACS screen. The locus of integration was identified in 15 lines. In three lines,insertion occurred in genes previously implicated in the control of quiescence, i.e. EMSY - a BRCA2--interacting protein, p8/com1 - a p300HAT -- binding protein and MLL5 - a SET domain protein. Our results demonstrate that expression of chromatin modulatory genes is induced in G0, providing support to the notion that this reversibly arrested state is actively regulated.

The Essential Genome of Escherichia coli K-12

PubMed Central

2018-01-01

ABSTRACT Transposon-directed insertion site sequencing (TraDIS) is a high-throughput method coupling transposon mutagenesis with short-fragment DNA sequencing. It is commonly used to identify essential genes. Single gene deletion libraries are considered the gold standard for identifying essential genes. Currently, the TraDIS method has not been benchmarked against such libraries, and therefore, it remains unclear whether the two methodologies are comparable. To address this, a high-density transposon library was constructed in Escherichia coli K-12. Essential genes predicted from sequencing of this library were compared to existing essential gene databases. To decrease false-positive identification of essential genes, statistical data analysis included corrections for both gene length and genome length. Through this analysis, new essential genes and genes previously incorrectly designated essential were identified. We show that manual analysis of TraDIS data reveals novel features that would not have been detected by statistical analysis alone. Examples include short essential regions within genes, orientation-dependent effects, and fine-resolution identification of genome and protein features. Recognition of these insertion profiles in transposon mutagenesis data sets will assist genome annotation of less well characterized genomes and provides new insights into bacterial physiology and biochemistry. PMID:29463657

Liver-directed lentiviral gene therapy in a dog model of hemophilia B.

PubMed

Cantore, Alessio; Ranzani, Marco; Bartholomae, Cynthia C; Volpin, Monica; Valle, Patrizia Della; Sanvito, Francesca; Sergi, Lucia Sergi; Gallina, Pierangela; Benedicenti, Fabrizio; Bellinger, Dwight; Raymer, Robin; Merricks, Elizabeth; Bellintani, Francesca; Martin, Samia; Doglioni, Claudio; D'Angelo, Armando; VandenDriessche, Thierry; Chuah, Marinee K; Schmidt, Manfred; Nichols, Timothy; Montini, Eugenio; Naldini, Luigi

2015-03-04

We investigated the efficacy of liver-directed gene therapy using lentiviral vectors in a large animal model of hemophilia B and evaluated the risk of insertional mutagenesis in tumor-prone mouse models. We showed that gene therapy using lentiviral vectors targeting the expression of a canine factor IX transgene in hepatocytes was well tolerated and provided a stable long-term production of coagulation factor IX in dogs with hemophilia B. By exploiting three different mouse models designed to amplify the consequences of insertional mutagenesis, we showed that no genotoxicity was detected with these lentiviral vectors. Our findings suggest that lentiviral vectors may be an attractive candidate for gene therapy targeted to the liver and may be potentially useful for the treatment of hemophilia. Copyright © 2015, American Association for the Advancement of Science.

Crispr-mediated Gene Targeting of Human Induced Pluripotent Stem Cells.

PubMed

Byrne, Susan M; Church, George M

2015-01-01

CRISPR/Cas9 nuclease systems can create double-stranded DNA breaks at specific sequences to efficiently and precisely disrupt, excise, mutate, insert, or replace genes. However, human embryonic stem or induced pluripotent stem cells (iPSCs) are more difficult to transfect and less resilient to DNA damage than immortalized tumor cell lines. Here, we describe an optimized protocol for genome engineering of human iPSCs using a simple transient transfection of plasmids and/or single-stranded oligonucleotides. With this protocol, we achieve transfection efficiencies greater than 60%, with gene disruption efficiencies from 1-25% and gene insertion/replacement efficiencies from 0.5-10% without any further selection or enrichment steps. We also describe how to design and assess optimal sgRNA target sites and donor targeting vectors; cloning individual iPSC by single cell FACS sorting, and genotyping successfully edited cells.

Unstable transpositions of his4 in yeast.

PubMed Central

Greer, H; Fink, G R

1979-01-01

Unstable transpositions in yeast have been selected in which the his4C gene from chromosome III is inserted into chromosome XII. This event is associated with the generation of a recessive lethal mutation, resulting from the integration of his4C into an essential gene. Strains with these transpositions are viable as diploids or aneuploids for chromosome XII. The event that generates the transpositions does not lead reciprocally to a deletion on chromosome III, implying that synthesis of a new copy of his4C and subsequent transposition may have occurred. The his4C transpositions are unstable and give rise to C- segregants at a high frequency, as a result of either precise excision of the his4C gene (restoring function of the gene into which insertion had occurred) or chromosome loss. PMID:386353

High Inter-Individual Diversity of Point Mutations, Insertions, and Deletions in Human Influenza Virus Nucleoprotein-Specific Memory B Cells

PubMed Central

Bussmann, Bianca M.; Horn, Susanne; Sieg, Michael; Jassoy, Christian

2015-01-01

The diversity of virus-specific antibodies and of B cells among different individuals is unknown. Using single-cell cloning of antibody genes, we generated recombinant human monoclonal antibodies from influenza nucleoprotein-specific memory B cells in four adult humans with and without preceding influenza vaccination. We examined the diversity of the antibody repertoires and found that NP-specific B cells used numerous immunoglobulin genes. The heavy chains (HCs) originated from 26 and the kappa light chains (LCs) from 19 different germ line genes. Matching HC and LC chains gave rise to 43 genetically distinct antibodies that bound influenza NP. The median lengths of the CDR3 of the HC, kappa and lambda LC were 14, 9 and 11 amino acids, respectively. We identified changes at 13.6% of the amino acid positions in the V gene of the antibody heavy chain, at 8.4 % in the kappa and at 10.6 % in the lambda V gene. We identified somatic insertions or deletions in 8.1% of the variable genes. We also found several small groups of clonal relatives that were highly diversified. Our findings demonstrate broadly diverse memory B cell repertoires for the influenza nucleoprotein. We found extensive variation within individuals with a high number of point mutations, insertions, and deletions, and extensive clonal diversification. Thus, structurally conserved proteins can elicit broadly diverse and highly mutated B-cell responses. PMID:26086076

Construction of a recombinant duck enteritis virus vaccine expressing hemagglutinin of H9N2 avian influenza virus and evaluation of its efficacy in ducks.

PubMed

Sun, Ying; Yang, Chenghuai; Li, Junping; Li, Ling; Cao, Minghui; Li, Qihong; Li, Huijiao

2017-01-01

H9 subtype avian influenza viruses (AIVs) remain a significant burden in the poultry industry and are considered to be one of the most likely causes of any new influenza pandemic in humans. As ducks play an important role in the maintenance of H9 viruses in nature, successful control of the spread of H9 AIVs in ducks will have significant beneficial effects on public health. Duck enteritis virus (DEV) may be a promising candidate viral vector for aquatic poultry vaccination. In this study, we constructed a recombinant DEV, rDEV-∆UL2-HA, inserting the hemagglutinin (HA) gene from duck-origin H9N2 AIV into the UL2 gene by homologous recombination. One-step growth analyses showed that the HA gene insertion had no effect on viral replication and suggested that the UL2 gene was nonessential for virus growth in vitro. In vivo tests further showed that the insertion of the HA gene in place of the UL2 gene did not affect the immunogenicity of the virus. Moreover, a single dose of 10 3 TCID 50 of rDEV-∆UL2-HA induced solid protection against lethal DEV challenge and completely prevented H9N2 AIV viral shedding. To our knowledge, this is the first report of a DEV-vectored vaccine providing robust protection against both DEV and H9N2 AIV virus infections in ducks.

Genetic diagnosis of Duchenne and Becker muscular dystrophy using next-generation sequencing technology: comprehensive mutational search in a single platform.

PubMed

Lim, Byung Chan; Lee, Seungbok; Shin, Jong-Yeon; Kim, Jong-Il; Hwang, Hee; Kim, Ki Joong; Hwang, Yong Seung; Seo, Jeong-Sun; Chae, Jong Hee

2011-11-01

Duchenne muscular dystrophy or Becker muscular dystrophy might be a suitable candidate disease for application of next-generation sequencing in the genetic diagnosis because the complex mutational spectrum and the large size of the dystrophin gene require two or more analytical methods and have a high cost. The authors tested whether large deletions/duplications or small mutations, such as point mutations or short insertions/deletions of the dystrophin gene, could be predicted accurately in a single platform using next-generation sequencing technology. A custom solution-based target enrichment kit was designed to capture whole genomic regions of the dystrophin gene and other muscular-dystrophy-related genes. A multiplexing strategy, wherein four differently bar-coded samples were captured and sequenced together in a single lane of the Illumina Genome Analyser, was applied. The study subjects were 25 16 with deficient dystrophin expression without a large deletion/duplication and 9 with a known large deletion/duplication. Nearly 100% of the exonic region of the dystrophin gene was covered by at least eight reads with a mean read depth of 107. Pathogenic small mutations were identified in 15 of the 16 patients without a large deletion/duplication. Using these 16 patients as the standard, the authors' method accurately predicted the deleted or duplicated exons in the 9 patients with known mutations. Inclusion of non-coding regions and paired-end sequence analysis enabled accurate identification by increasing the read depth and providing information about the breakpoint junction. The current method has an advantage for the genetic diagnosis of Duchenne muscular dystrophy and Becker muscular dystrophy wherein a comprehensive mutational search may be feasible using a single platform.

Gene-breaking: A new paradigm for human retrotransposon-mediated gene evolution

PubMed Central

Wheelan, Sarah J.; Aizawa, Yasunori; Han, Jeffrey S.; Boeke, Jef D.

2005-01-01

The L1 retrotransposon is the most highly successful autonomous retrotransposon in mammals. This prolific genome parasite may on occasion benefit its host through genome rearrangements or adjustments of host gene expression. In examining possible effects of L1 elements on host gene expression, we investigated whether a full-length L1 element inserted in the antisense orientation into an intron of a cellular gene may actually split the gene's transcript into two smaller transcripts: (1) a transcript containing the upstream exons and terminating in the major antisense polyadenylation site (MAPS) of the L1, and (2) a transcript derived from the L1 antisense promoter (ASP) that includes the downstream exons of the gene. Bioinformatic analysis and experimental follow-up provide evidence for this L1 “gene-breaking” hypothesis. We identified three human genes apparently “broken” by L1 elements, as well as 12 more candidate genes. Most of the inserted L1 elements in our 15 candidate genes predate the human/chimp divergence. If indeed split, the transcripts of these genes may in at least one case encode potentially interacting proteins, and in another case may encode novel proteins. Gene-breaking represents a new mechanism through which L1 elements remodel mammalian genomes. PMID:16024818

Genomic characterization of two large Alu-mediated rearrangements of the BRCA1 gene.

PubMed

Peixoto, Ana; Pinheiro, Manuela; Massena, Lígia; Santos, Catarina; Pinto, Pedro; Rocha, Patrícia; Pinto, Carla; Teixeira, Manuel R

2013-02-01

To determine whether a large genomic rearrangement is actually novel and to gain insight about the mutational mechanism responsible for its occurrence, molecular characterization with breakpoint identification is mandatory. We here report the characterization of two large deletions involving the BRCA1 gene. The first rearrangement harbored a 89,664-bp deletion comprising exon 7 of the BRCA1 gene to exon 11 of the NBR1 gene (c.441+1724_oNBR1:c.1073+480del). Two highly homologous Alu elements were found in the genomic sequences flanking the deletion breakpoints. Furthermore, a 20-bp overlapping sequence at the breakpoint junction was observed, suggesting that the most likely mechanism for the occurrence of this rearrangement was nonallelic homologous recombination. The second rearrangement fully characterized at the nucleotide level was a BRCA1 exons 11-15 deletion (c.671-319_4677-578delinsAlu). The case harbored a 23,363-bp deletion with an Alu element inserted at the breakpoints of the deleted region. As the Alu element inserted belongs to a still active AluY family, the observed rearrangement could be due to an insertion-mediated deletion mechanism caused by Alu retrotransposition. To conclude, we describe the breakpoints of two novel large deletions involving the BRCA1 gene and analysis of their genomic context allowed us to gain insight about the respective mutational mechanism.

Lentiviral-Mediated Gene Therapy in Fanconi Anemia-A Mice Reveals Long-Term Engraftment and Continuous Turnover of Corrected HSCs.

PubMed

Molina-Estevez, F Javier; Nowrouzi, Ali; Lozano, M Luz; Galy, Anne; Charrier, Sabine; von Kalle, Christof; Guenechea, Guillermo; Bueren, Juan A; Schmidt, Manfred

2015-01-01

Fanconi anemia is a DNA repair-deficiency syndrome mainly characterized by cancer predisposition and bone marrow failure. Trying to restore the hematopoietic function in these patients, lentiviral vector-mediated gene therapy trials have recently been proposed. However, because no insertional oncogenesis studies have been conducted so far in DNA repair-deficiency syndromes such as Fanconi anemia, we have carried out a genome-wide screening of lentiviral insertion sites after the gene correction of Fanca(-/-) hematopoietic stem cells (HSCs), using LAM-PCR and 454-pyrosequencing. Our studies first demonstrated that transduction of Fanca(-/-) HSCs with a lentiviral vector designed for clinical application efficiently corrects the phenotype of Fanconi anemia repopulating cells without any sign of toxicity. The identification of more than 6,500 insertion sites in primary and secondary recipients showed a polyclonal pattern of reconstitution, as well as a continuous turnover of corrected Fanca(-/-) HSC clones, without evidences of selection towards specific common integration sites. Taken together our data show, for the first time in a DNA repair-deficiency syndrome, that lentiviral vector-mediated gene therapy efficiently corrects the phenotype of affected HSCs and promotes a healthy pattern of clonal turnover in vivo. These studies will have a particular impact in the development of new gene therapy trials in patients affected by DNA repair syndromes, particularly in Fanconi anemia.

Identification of Salmonella typhimurium Genes Required for Colonization of the Chicken Alimentary Tract and for Virulence in Newly Hatched Chicks

PubMed Central

Turner, Arthur K.; Lovell, Margaret A.; Hulme, Scott D.; Zhang-Barber, Li; Barrow, Paul A.

1998-01-01

From a collection of 2,800 Tn5-TC1 transposon mutants of Salmonella typhimurium F98, 18 that showed reduced intestinal colonization of 3-week-old chicks were identified. The sites of transposon insertion were determined for most of the mutants and included insertions in the lipopolysaccharide biosynthesis genes rfaK, rfaY, rfbK, and rfbB and the genes dksA, clpB, hupA, and sipC. In addition, identification was made of an insertion into a novel gene that encodes a protein showing similarity to the IIC component of the mannose class of phosphoenolpyruvate-carbohydrate phosphotransferase systems, which we putatively called ptsC. Transduction of most of the transposon mutations to a fresh S. typhimurium F98 genetic background and construction of defined mutations in the rfbK, dksA, hupA, sipC, and ptsC genes of S. typhimurium F98 supported the role in colonization of all but the pts locus. The virulence of the rfbK, dksA, hupA, sipC, and ptsC defined mutants and clpB and rfaY transductants in 1-day-old chicks was tested. All but the ptsC and rfaY mutants were attenuated for virulence. A number of other phenotypes associated with some of the mutations are described. PMID:9573095

Rapid construction of a Bacterial Artificial Chromosomal (BAC) expression vector using designer DNA fragments.

PubMed

Chen, Chao; Zhao, Xinqing; Jin, Yingyu; Zhao, Zongbao Kent; Suh, Joo-Won

2014-11-01

Bacterial artificial chromosomal (BAC) vectors are increasingly being used in cloning large DNA fragments containing complex biosynthetic pathways to facilitate heterologous production of microbial metabolites for drug development. To express inserted genes using Streptomyces species as the production hosts, an integration expression cassette is required to be inserted into the BAC vector, which includes genetic elements encoding a phage-specific attachment site, an integrase, an origin of transfer, a selection marker and a promoter. Due to the large sizes of DNA inserted into the BAC vectors, it is normally inefficient and time-consuming to assemble these fragments by routine PCR amplifications and restriction-ligations. Here we present a rapid method to insert fragments to construct BAC-based expression vectors. A DNA fragment of about 130 bp was designed, which contains upstream and downstream homologous sequences of both BAC vector and pIB139 plasmid carrying the whole integration expression cassette. In-Fusion cloning was performed using the designer DNA fragment to modify pIB139, followed by λ-RED-mediated recombination to obtain the BAC-based expression vector. We demonstrated the effectiveness of this method by rapid construction of a BAC-based expression vector with an insert of about 120 kb that contains the entire gene cluster for biosynthesis of immunosuppressant FK506. The empty BAC-based expression vector constructed in this study can be conveniently used for construction of BAC libraries using either microbial pure culture or environmental DNA, and the selected BAC clones can be directly used for heterologous expression. Alternatively, if a BAC library has already been constructed using a commercial BAC vector, the selected BAC vectors can be manipulated using the method described here to get the BAC-based expression vectors with desired gene clusters for heterologous expression. The rapid construction of a BAC-based expression vector facilitates heterologous expression of large gene clusters for drug discovery. Copyright © 2014 Elsevier Inc. All rights reserved.

Evolutionary transgenomics: prospects and challenges.

PubMed

Correa, Raul; Baum, David A

2015-01-01

Many advances in our understanding of the genetic basis of species differences have arisen from transformation experiments, which allow us to study the effect of genes from one species (the donor) when placed in the genetic background of another species (the recipient). Such interspecies transformation experiments are usually focused on candidate genes - genes that, based on work in model systems, are suspected to be responsible for certain phenotypic differences between the donor and recipient species. We suggest that the high efficiency of transformation in a few plant species, most notably Arabidopsis thaliana, combined with the small size of typical plant genes and their cis-regulatory regions allow implementation of a screening strategy that does not depend upon a priori candidate gene identification. This approach, transgenomics, entails moving many large genomic inserts of a donor species into the wild type background of a recipient species and then screening for dominant phenotypic effects. As a proof of concept, we recently conducted a transgenomic screen that analyzed more than 1100 random, large genomic inserts of the Alabama gladecress Leavenworthia alabamica for dominant phenotypic effects in the A. thaliana background. This screen identified one insert that shortens fruit and decreases A. thaliana fertility. In this paper we discuss the principles of transgenomic screens and suggest methods to help minimize the frequencies of false positive and false negative results. We argue that, because transgenomics avoids committing in advance to candidate genes it has the potential to help us identify truly novel genes or cryptic functions of known genes. Given the valuable knowledge that is likely to be gained, we believe the time is ripe for the plant evolutionary community to invest in transgenomic screens, at least in the mustard family Brassicaceae where many species are amenable to efficient transformation.

Study of Gene Trafficking between Acanthamoeba and Giant Viruses Suggests an Undiscovered Family of Amoeba-Infecting Viruses.

PubMed

Maumus, Florian; Blanc, Guillaume

2016-12-14

The nucleocytoplasmic large DNA viruses (NCLDV) are a group of extremely complex double-stranded DNA viruses, which are major parasites of a variety of eukaryotes. Recent studies showed that certain unicellular eukaryotes contain fragments of NCLDV DNA integrated in their genome, when surprisingly many of these organisms were not previously shown to be infected by NCLDVs. These findings prompted us to search the genome of Acanthamoeba castellanii strain Neff (Neff), one of the most prolific hosts in the discovery of giant NCLDVs, for possible DNA inserts of viral origin. We report the identification of 267 markers of lateral gene transfer with viruses, approximately half of which are clustered in Neff genome regions of viral origins, transcriptionally inactive or exhibit nucleotide-composition signatures suggestive of a foreign origin. The integrated viral genes had diverse origin among relatives of viruses that infect Neff, including Mollivirus, Pandoravirus, Marseillevirus, Pithovirus, and Mimivirus However, phylogenetic analysis suggests the existence of a yet-undiscovered family of amoeba-infecting NCLDV in addition to the five already characterized. The active transcription of some apparently anciently integrated virus-like genes suggests that some viral genes might have been domesticated during the amoeba evolution. These insights confirm that genomic insertion of NCLDV DNA is a common theme in eukaryotes. This gene flow contributed fertilizing the eukaryotic gene repertoire and participated in the occurrence of orphan genes, a long standing issue in genomics. Search for viral inserts in eukaryotic genomes followed by environmental screening of the original viruses should be used to isolate radically new NCLDVs. © The Author(s) 2016. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

Population and clinical genetics of human transposable elements in the (post) genomic era

PubMed Central

Rishishwar, Lavanya; Wang, Lu; Clayton, Evan A.; Mariño-Ramírez, Leonardo; McDonald, John F.; Jordan, I. King

2017-01-01

ABSTRACT Recent technological developments—in genomics, bioinformatics and high-throughput experimental techniques—are providing opportunities to study ongoing human transposable element (TE) activity at an unprecedented level of detail. It is now possible to characterize genome-wide collections of TE insertion sites for multiple human individuals, within and between populations, and for a variety of tissue types. Comparison of TE insertion site profiles between individuals captures the germline activity of TEs and reveals insertion site variants that segregate as polymorphisms among human populations, whereas comparison among tissue types ascertains somatic TE activity that generates cellular heterogeneity. In this review, we provide an overview of these new technologies and explore their implications for population and clinical genetic studies of human TEs. We cover both recent published results on human TE insertion activity as well as the prospects for future TE studies related to human evolution and health. PMID:28228978

Insertional engineering of chromosomes with Sleeping Beauty transposition: an overview.

PubMed

Grabundzija, Ivana; Izsvák, Zsuzsanna; Ivics, Zoltán

2011-01-01

Novel genetic tools and mutagenesis strategies based on the Sleeping Beauty (SB) transposable element are currently under development with a vision to link primary DNA sequence information to gene functions in vertebrate models. By virtue of its inherent capacity to insert into DNA, the SB transposon can be developed into powerful tools for chromosomal manipulations. Mutagenesis screens based on SB have numerous advantages including high throughput and easy identification of mutated alleles. Forward genetic approaches based on insertional mutagenesis by engineered SB transposons have the advantage of providing insight into genetic networks and pathways based on phenotype. Indeed, the SB transposon has become a highly instrumental tool to induce tumors in experimental animals in a tissue-specific -manner with the aim of uncovering the genetic basis of diverse cancers. Here, we describe a battery of mutagenic cassettes that can be applied in conjunction with SB transposon vectors to mutagenize genes, and highlight versatile experimental strategies for the generation of engineered chromosomes for loss-of-function as well as gain-of-function mutagenesis for functional gene annotation in vertebrate models.

Structure and Expression of Hybrid Dysgenesis-Induced Alleles of the Ovarian Tumor (Otu) Gene in Drosophila Melanogaster

PubMed Central

Sass, G. L.; Mohler, J. D.; Walsh, R. C.; Kalfayan, L. J.; Searles, L. L.

1993-01-01

Mutations at the ovarian tumor (otu) gene of Drosophila melanogaster cause female sterility and generate a range of ovarian phenotypes. Quiescent (QUI) mutants exhibit reduced germ cell proliferation; in oncogenic (ONC) mutants germ cells undergo uncontrolled proliferation generating excessive numbers of undifferentiated cells; the egg chambers of differentiated (DIF) mutants differentiate to variable degrees but fail to complete oogenesis. We have examined mutations caused by insertion and deletion of P elements at the otu gene. The P element insertion sites are upstream of the major otu transcription start sites. In deletion derivatives, the P element, regulatory regions and/or protein coding sequences have been removed. In both insertion and deletion mutants, the level of otu expression correlates directly with the severity of the phenotype: the absence of otu function produces the most severe QUI phenotype while the ONC mutants express lower levels of otu than those which are DIF. The results of this study demonstrate that the diverse mutant phenotypes of otu are the consequence of different levels of otu function. PMID:8436274

Identification of atypical ATRNL1 insertion to EML4-ALK fusion gene in NSCLC.

PubMed

Robesova, Blanka; Bajerova, Monika; Hausnerova, Jitka; Skrickova, Jana; Tomiskova, Marcela; Dvorakova, Dana

2015-03-01

We herein present a rare case of an EML4-ALK positive patient. A 61-year-old man was diagnosed with locoregional non-small cell lung cancer (NSCLC). No EGFR mutations were detected, and therefore the ALK rearrangement was evaluated using immunohistochemistry (IHC), fluorescence in situ hybridization (FISH) and the reverse transcription PCR (RT-PCR) method for EML4-ALK. All methods showed a positive result and, therefore, the patient was treated with crizotinib with a good therapeutic response. However, a detailed RT-PCR analysis and sequencing revealed an unexpected 138 bp insertion of attractin-like 1 (ATRNL1) gene into the EML4-ALK fusion gene. In our case, the positive therapeutic response suggests that ATRNL1 insertion does not affect EML4-ALK's sensitivity to crizotinib. This case shows great EML4-ALK heterogeneity and also that basic detection methods (IHC, FISH) cannot fully specify ALK rearrangement but in many cases a full specification seems to be important for an effective TKI indication, and sequencing ALK variants might contribute to optimized patient selection. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

Prevalence of Ambler class A β-lactamases and ampC expression in cephalosporin-resistant isolates of Acinetobacter baumannii.

PubMed

Rezaee, Mohammad Ahangarzadeh; Pajand, Omid; Nahaei, Mohammad Reza; Mahdian, Reza; Aghazadeh, Mohammad; Ghojazadeh, Morteza; Hojabri, Zoya

2013-07-01

We examined the prevalence of various cephalosporins' resistance mechanisms in Acinetobacter baumannii clinical isolates. Phenotypic and molecular detection of Ambler classes A, B and D β-lactamases was performed on 75 isolates. Clonal relatedness was defined using Repetitive Extragenic Palindromic PCR. PCR mapping was used to examine the linkage of insertion sequences and the ampC gene, and ampC expression was analyzed by TaqMan reverse transcriptase-PCR. Twenty-six (37%) isolates carried at least one of the blaPER-1 or blaTEM-1. Sixty-nine (98.5%) out of 70 cephalosporin-resistant isolates had insertions upstream of the ampC gene, of which 48 (69%) and 6 (8%) were identified as ISAba1and ISAba125, respectively. Higher level of expression was obtained in resistant isolates lacking ISAba1/ampC combination in comparison with that in positive ones. The ability to up-regulate the expression of ampC gene in association with different insertion elements has become an important factor in A. baumannii resistance to cephalosporins. Copyright © 2013 Elsevier Inc. All rights reserved.

An ATP-driven efflux pump is a novel pathogenicity factor in rice blast disease.

PubMed Central

Urban, M; Bhargava, T; Hamer, J E

1999-01-01

Cells tolerate exposure to cytotoxic compounds through the action of ATP-driven efflux pumps belonging to the ATP-binding cassette (ABC) superfamily of membrane transporters. Phytopathogenic fungi encounter toxic environments during plant invasion as a result of the plant defense response. Here we demonstrate the requirement for an ABC transporter during host infection by the fungal plant pathogen Magnaporthe grisea. The ABC1 gene was identified in an insertional mutagenesis screen for pathogenicity mutants. The ABC1 insertional mutant and a gene-replacement mutant arrest growth and die shortly after penetrating either rice or barley epidermal cells. The ABC1-encoded protein is similar to yeast ABC transporters implicated in multidrug resistance, and ABC1 gene transcripts are inducible by toxic drugs and a rice phytoalexin. However, abc1 mutants are not hypersensitive to antifungal compounds. The non-pathogenic, insertional mutation in ABC1 occurs in the promoter region and dramatically reduces transcript induction by metabolic poisons. These data strongly suggest that M.grisea requires the up-regulation of specific ABC transporters for pathogenesis; most likely to protect itself against plant defense mechanisms. PMID:9927411

In vivo modification of a maize engineered minichromosome.

PubMed

Gaeta, Robert T; Masonbrink, Rick E; Zhao, Changzeng; Sanyal, Abhijit; Krishnaswamy, Lakshminarasimhan; Birchler, James A

2013-06-01

Engineered minichromosomes provide efficient platforms for stacking transgenes in crop plants. Methods for modifying these chromosomes in vivo are essential for the development of customizable systems for the removal of selection genes or other sequences and for the addition of new genes. Previous studies have demonstrated that Cre, a site-specific recombinase, could be used to modify lox sites on transgenes on maize minichromosomes; however, these studies demonstrated somatic recombination only, and modified minichromosomes could not be recovered. We describe the recovery of an engineered chromosome composed of little more than a centromere plus transgene that was derived by telomere-mediated truncation. We used the fiber fluorescence in situ hybridization technique and detected a transgene on the minichromosome inserted among stretches of CentC centromere repeats, and this insertion was large enough to suggest a tandem insertion. By crossing the minichromosome to a plant expressing Cre-recombinase, the Bar selection gene was removed, leaving behind a single loxP site. This study demonstrates that engineered chromosomes can be modified in vivo using site-specific recombinases, a demonstration essential to the development of amendable chromosome platforms in plants.

[Determination of genetic bases of auxotrophy in Yersinia pestis ssp. caucasica strains].

PubMed

Odinokov, G N; Eroshenko, G A; Kukleva, L M; Shavina, N Iu; Krasnov, Ia M; Kutyrev, V V

2012-04-01

Based on the results of computer analysis of nucleotide sequences in strains Yersinia pestis and Y. pseudotuberculosis recorded in the files of NCBI GenBank database, differences between genes argA, aroG, aroF, thiH, and thiG of strain Pestoides F (subspecies caucasica) were found, compared to other strains of plaque agent and pseudotuberculosis microbe. Using PCR with calculated primers and the method of sequence analysis, the structure of variable regions of these genes was studied in 96 natural Y. pestis and Y. pseudotuberculosis strains. It was shown that all examined strains of subspecies caucasica, unlike strains of plague-causing agent of other subspecies and pseudotubercolosis microbe, had identical mutations in genes argA (integration of the insertion sequence IS100), aroG (insertion of ten nucleotides), aroF (inserion of IS100), thiH (insertion of nucleotide T), and thiG (deletion of 13 nucleotides). These mutations are the reason for the absence in strains belonging to this subspecies of the ability to synthesize arginine, phenylalanine, tyrosine, and vitamin B1 (thiamine), and cause their auxotrophy for these growth factors.

Single gene insertion drives bioalcohol production by a thermophilic archaeon

PubMed Central

Basen, Mirko; Schut, Gerrit J.; Nguyen, Diep M.; Lipscomb, Gina L.; Benn, Robert A.; Prybol, Cameron J.; Vaccaro, Brian J.; Poole, Farris L.; Kelly, Robert M.; Adams, Michael W. W.

2014-01-01

Bioethanol production is achieved by only two metabolic pathways and only at moderate temperatures. Herein a fundamentally different synthetic pathway for bioalcohol production at 70 °C was constructed by insertion of the gene for bacterial alcohol dehydrogenase (AdhA) into the archaeon Pyrococcus furiosus. The engineered strain converted glucose to ethanol via acetate and acetaldehyde, catalyzed by the host-encoded aldehyde ferredoxin oxidoreductase (AOR) and heterologously expressed AdhA, in an energy-conserving, redox-balanced pathway. Furthermore, the AOR/AdhA pathway also converted exogenously added aliphatic and aromatic carboxylic acids to the corresponding alcohol using glucose, pyruvate, and/or hydrogen as the source of reductant. By heterologous coexpression of a membrane-bound carbon monoxide dehydrogenase, CO was used as a reductant for converting carboxylic acids to alcohols. Redirecting the fermentative metabolism of P. furiosus through strategic insertion of foreign genes creates unprecedented opportunities for thermophilic bioalcohol production. Moreover, the AOR/AdhA pathway is a potentially game-changing strategy for syngas fermentation, especially in combination with carbon chain elongation pathways. PMID:25368184

Single gene insertion drives bioalcohol production by a thermophilic archaeon

DOE Office of Scientific and Technical Information (OSTI.GOV)

Basen, M; Schut, GJ; Nguyen, DM

2014-12-09

Bioethanol production is achieved by only two metabolic pathways and only at moderate temperatures. Herein a fundamentally different synthetic pathway for bioalcohol production at 70 degrees C was constructed by insertion of the gene for bacterial alcohol dehydrogenase (AdhA) into the archaeon Pyrococcus furiosus. The engineered strain converted glucose to ethanol via acetate and acetaldehyde, catalyzed by the host-encoded aldehyde ferredoxin oxidoreductase (AOR) and heterologously expressed AdhA, in an energy-conserving, redox-balanced pathway. Furthermore, the AOR/AdhA pathway also converted exogenously added aliphatic and aromatic carboxylic acids to the corresponding alcohol using glucose, pyruvate, and/or hydrogen as the source of reductant. Bymore » heterologous coexpression of a membrane-bound carbon monoxide dehydrogenase, CO was used as a reductant for converting carboxylic acids to alcohols. Redirecting the fermentative metabolism of P. furiosus through strategic insertion of foreign genes creates unprecedented opportunities for thermophilic bioalcohol production. Moreover, the AOR/AdhA pathway is a potentially game-changing strategy for syngas fermentation, especially in combination with carbon chain elongation pathways.« less

Papaya (Carica papaya L.).

PubMed

Zhu, Yun J; Fitch, Maureen M M; Moore, Paul H

2006-01-01

Transgenic papaya plants were initially obtained using particle bombardment, a method having poor efficiency in producing intact, single-copy insertion of transgenes. Single-copy gene insertion was improved using Agrobacterium tumefaciens. With progress being made in genome sequencing and gene discovery, there is a need for more efficient methods of transformation in order to study the function of these genes. We describe a protocol for Agrobacterium-mediated transformation using carborundum-wounded papaya embryogenic calli. This method should lead to high-throughput transformation, which on average produced at least one plant that was positive in polymerase chain reaction (PCR), histochemical staining, or by Southern blot hybridization from 10 to 20% of the callus clusters that had been co-cultivated with Agrobacterium. Plants regenerated from the callus clusters in 9 to 13 mo.

Using Phage Display to Create Recombinant Antibodies.

PubMed

Dasch, James R; Dasch, Amy L

2017-09-01

A variety of phage display technologies have been developed since the approach was first described for antibodies. The most widely used approaches incorporate antibody sequences into the minor coat protein pIII of the nonlytic filamentous phage fd or M13. Libraries of variable gene sequences, encoding either scFv or Fab fragments, are made by incorporating sequences into phagemid vectors. The phagemid is packaged into phage particles with the assistance of a helper phage to produce the antibody display phage. This protocol describes a method for creating a phagemid library. The multiple cloning site (MCS) of the pBluescript KS(-) phagemid vector is replaced by digestion with the restriction enzyme BssHII, followed by the insertion of four overlapping oligonucleotides to create a new MCS within the vector. Next, the 3' portion of gene III (from M13mp18) is amplified and combined with an antibody sequence using overlap extension PCR. This product is inserted into the phagemid vector to create pPDS. Two helper plasmids are also created from the modified pBluescript vector: pLINK provides the linker between the heavy and light chains, and pFABC provides the CH1 domain of the heavy chain. An antibody cDNA library is constructed from the RNA of interest and ligated into pPDS. The phagemid library is electroporated into Escherichia coli cells along with the VCS-M13 helper phage. © 2017 Cold Spring Harbor Laboratory Press.

Whole-Genome Sequences of DA and F344 Rats with Different Susceptibilities to Arthritis, Autoimmunity, Inflammation and Cancer

PubMed Central

Guo, Xiaosen; Brenner, Max; Zhang, Xuemei; Laragione, Teresina; Tai, Shuaishuai; Li, Yanhong; Bu, Junjie; Yin, Ye; Shah, Anish A.; Kwan, Kevin; Li, Yingrui; Jun, Wang; Gulko, Pércio S.

2013-01-01

DA (D-blood group of Palm and Agouti, also known as Dark Agouti) and F344 (Fischer) are two inbred rat strains with differences in several phenotypes, including susceptibility to autoimmune disease models and inflammatory responses. While these strains have been extensively studied, little information is available about the DA and F344 genomes, as only the Brown Norway (BN) and spontaneously hypertensive rat strains have been sequenced to date. Here we report the sequencing of the DA and F344 genomes using next-generation Illumina paired-end read technology and the first de novo assembly of a rat genome. DA and F344 were sequenced with an average depth of 32-fold, covered 98.9% of the BN reference genome, and included 97.97% of known rat ESTs. New sequences could be assigned to 59 million positions with previously unknown data in the BN reference genome. Differences between DA, F344, and BN included 19 million positions in novel scaffolds, 4.09 million single nucleotide polymorphisms (SNPs) (including 1.37 million new SNPs), 458,224 short insertions and deletions, and 58,174 structural variants. Genetic differences between DA, F344, and BN, including high-impact SNPs and short insertions and deletions affecting >2500 genes, are likely to account for most of the phenotypic variation between these strains. The new DA and F344 genome sequencing data should facilitate gene discovery efforts in rat models of human disease. PMID:23695301

Whole-genome sequences of DA and F344 rats with different susceptibilities to arthritis, autoimmunity, inflammation and cancer.

PubMed

Guo, Xiaosen; Brenner, Max; Zhang, Xuemei; Laragione, Teresina; Tai, Shuaishuai; Li, Yanhong; Bu, Junjie; Yin, Ye; Shah, Anish A; Kwan, Kevin; Li, Yingrui; Jun, Wang; Gulko, Pércio S

2013-08-01

DA (D-blood group of Palm and Agouti, also known as Dark Agouti) and F344 (Fischer) are two inbred rat strains with differences in several phenotypes, including susceptibility to autoimmune disease models and inflammatory responses. While these strains have been extensively studied, little information is available about the DA and F344 genomes, as only the Brown Norway (BN) and spontaneously hypertensive rat strains have been sequenced to date. Here we report the sequencing of the DA and F344 genomes using next-generation Illumina paired-end read technology and the first de novo assembly of a rat genome. DA and F344 were sequenced with an average depth of 32-fold, covered 98.9% of the BN reference genome, and included 97.97% of known rat ESTs. New sequences could be assigned to 59 million positions with previously unknown data in the BN reference genome. Differences between DA, F344, and BN included 19 million positions in novel scaffolds, 4.09 million single nucleotide polymorphisms (SNPs) (including 1.37 million new SNPs), 458,224 short insertions and deletions, and 58,174 structural variants. Genetic differences between DA, F344, and BN, including high-impact SNPs and short insertions and deletions affecting >2500 genes, are likely to account for most of the phenotypic variation between these strains. The new DA and F344 genome sequencing data should facilitate gene discovery efforts in rat models of human disease.

Genome editing for crop improvement: Challenges and opportunities

PubMed Central

Abdallah, Naglaa A; Prakash, Channapatna S; McHughen, Alan G

2015-01-01

ABSTRACT Genome or gene editing includes several new techniques to help scientists precisely modify genome sequences. The techniques also enables us to alter the regulation of gene expression patterns in a pre-determined region and facilitates novel insights into the functional genomics of an organism. Emergence of genome editing has brought considerable excitement especially among agricultural scientists because of its simplicity, precision and power as it offers new opportunities to develop improved crop varieties with clear-cut addition of valuable traits or removal of undesirable traits. Research is underway to improve crop varieties with higher yields, strengthen stress tolerance, disease and pest resistance, decrease input costs, and increase nutritional value. Genome editing encompasses a wide variety of tools using either a site-specific recombinase (SSR) or a site-specific nuclease (SSN) system. Both systems require recognition of a known sequence. The SSN system generates single or double strand DNA breaks and activates endogenous DNA repair pathways. SSR technology, such as Cre/loxP and Flp/FRT mediated systems, are able to knockdown or knock-in genes in the genome of eukaryotes, depending on the orientation of the specific sites (loxP, FLP, etc.) flanking the target site. There are 4 main classes of SSN developed to cleave genomic sequences, mega-nucleases (homing endonuclease), zinc finger nucleases (ZFNs), transcriptional activator-like effector nucleases (TALENs), and the CRISPR/Cas nuclease system (clustered regularly interspaced short palindromic repeat/CRISPR-associated protein). The recombinase mediated genome engineering depends on recombinase (sub-) family and target-site and induces high frequencies of homologous recombination. Improving crops with gene editing provides a range of options: by altering only a few nucleotides from billions found in the genomes of living cells, altering the full allele or by inserting a new gene in a targeted region of the genome. Due to its precision, gene editing is more precise than either conventional crop breeding methods or standard genetic engineering methods. Thus this technology is a very powerful tool that can be used toward securing the world's food supply. In addition to improving the nutritional value of crops, it is the most effective way to produce crops that can resist pests and thrive in tough climates. There are 3 types of modifications produced by genome editing; Type I includes altering a few nucleotides, Type II involves replacing an allele with a pre-existing one and Type III allows for the insertion of new gene(s) in predetermined regions in the genome. Because most genome-editing techniques can leave behind traces of DNA alterations evident in a small number of nucleotides, crops created through gene editing could avoid the stringent regulation procedures commonly associated with GM crop development. For this reason many scientists believe plants improved with the more precise gene editing techniques will be more acceptable to the public than transgenic plants. With genome editing comes the promise of new crops being developed more rapidly with a very low risk of off-target effects. It can be performed in any laboratory with any crop, even those that have complex genomes and are not easily bred using conventional methods. PMID:26930114

Transposon Mutagenesis Identified Chromosomal and Plasmid Genes Essential for Adaptation of the Marine Bacterium Dinoroseobacter shibae to Anaerobic Conditions

PubMed Central

Ebert, Matthias; Laaß, Sebastian; Burghartz, Melanie; Petersen, Jörn; Koßmehl, Sebastian; Wöhlbrand, Lars; Rabus, Ralf; Wittmann, Christoph; Jahn, Dieter

2013-01-01

Anaerobic growth and survival are integral parts of the life cycle of many marine bacteria. To identify genes essential for the anoxic life of Dinoroseobacter shibae, a transposon library was screened for strains impaired in anaerobic denitrifying growth. Transposon insertions in 35 chromosomal and 18 plasmid genes were detected. The essential contribution of plasmid genes to anaerobic growth was confirmed with plasmid-cured D. shibae strains. A combined transcriptome and proteome approach identified oxygen tension-regulated genes. Transposon insertion sites of a total of 1,527 mutants without an anaerobic growth phenotype were determined to identify anaerobically induced but not essential genes. A surprisingly small overlap of only three genes (napA, phaA, and the Na+/Pi antiporter gene Dshi_0543) between anaerobically essential and induced genes was found. Interestingly, transposon mutations in genes involved in dissimilatory and assimilatory nitrate reduction (napA, nasA) and corresponding cofactor biosynthesis (genomic moaB, moeB, and dsbC and plasmid-carried dsbD and ccmH) were found to cause anaerobic growth defects. In contrast, mutation of anaerobically induced genes encoding proteins required for the later denitrification steps (nirS, nirJ, nosD), dimethyl sulfoxide reduction (dmsA1), and fermentation (pdhB1, arcA, aceE, pta, acs) did not result in decreased anaerobic growth under the conditions tested. Additional essential components (ferredoxin, cccA) of the anaerobic electron transfer chain and central metabolism (pdhB) were identified. Another surprise was the importance of sodium gradient-dependent membrane processes and genomic rearrangements via viruses, transposons, and insertion sequence elements for anaerobic growth. These processes and the observed contributions of cell envelope restructuring (lysM, mipA, fadK), C4-dicarboxylate transport (dctM1, dctM3), and protease functions to anaerobic growth require further investigation to unravel the novel underlying adaptation strategies. PMID:23974024

Expressing genes do not forget their LINEs: transposable elements and gene expression

PubMed Central

Kines, Kristine J.; Belancio, Victoria P.

2012-01-01

1. ABSTRACT Historically the accumulated mass of mammalian transposable elements (TEs), particularly those located within gene boundaries, was viewed as a genetic burden potentially detrimental to the genomic landscape. This notion has been strengthened by the discovery that transposable sequences can alter the architecture of the transcriptome, not only through insertion, but also long after the integration process is completed. Insertions previously considered harmless are now known to impact the expression of host genes via modification of the transcript quality or quantity, transcriptional interference, or by the control of pathways that affect the mRNA life-cycle. Conversely, several examples of the evolutionary advantageous impact of TEs on the host gene structure that diversified the cellular transcriptome are reported. TE-induced changes in gene expression can be tissue-or disease-specific, raising the possibility that the impact of TE sequences may vary during development, among normal cell types, and between normal and disease-affected tissues. The understanding of the rules and abundance of TE-interference with gene expression is in its infancy, and its contribution to human disease and/or evolution remains largely unexplored. PMID:22201807

J85 Rejuvenation Through Technology Insertion

DTIC Science & Technology

2000-10-01

and Sabre 75 business addition to military production, the J85 was jets . Number Model Produced Aircraft Type(s) Engine Type Thrust (lbs) J85-GE-4 740...REJUVENATION THROUGH TECHNOLOGY INSERTION T.A. Brisken, P.N. Howell, A.C. Ewing Military Engines Operation GE Aircraft Engines 1 Neumann Way Cincinnati...OH 45215, USA Summary thrust to weight ratio turbojet engines with potential application to early cruise missiles and drones. The history of the

Sequence variations of the partially dominant DELLA gene Rht-B1c in wheat and their functional impacts

PubMed Central

Ma, Zhengqiang

2013-01-01

Rht-B1c, allelic to the DELLA protein-encoding gene Rht-B1a, is a natural mutation documented in common wheat (Triticum aestivum). It confers variation to a number of traits related to cell and plant morphology, seed dormancy, and photosynthesis. The present study was conducted to examine the sequence variations of Rht-B1c and their functional impacts. The results showed that Rht-B1c was partially dominant or co-dominant for plant height, and exhibited an increased dwarfing effect. At the sequence level, Rht-B1c differed from Rht-B1a by one 2kb Veju retrotransposon insertion, three coding region single nucleotide polymorphisms (SNPs), one 197bp insertion, and four SNPs in the 1kb upstream sequence. Haplotype investigations, association analyses, transient expression assays, and expression profiling showed that the Veju insertion was primarily responsible for the extreme dwarfing effect. It was found that the Veju insertion changed processing of the Rht-B1c transcripts and resulted in DELLA motif primary structure disruption. Expression assays showed that Rht-B1c caused reduction of total Rht-1 transcript levels, and up-regulation of GATA-like transcription factors and genes positively regulated by these factors, suggesting that one way in which Rht-1 proteins affect plant growth and development is through GATA-like transcription factor regulation. PMID:23918966

The Tgm9-induced indexed insertional mutant collection to conduct community-based reverse genetics studies in soybean

USDA-ARS?s Scientific Manuscript database

Until now, functional analyses of soybean genes have been very arduous because of the lack of a rapid transformation procedure. Recently identified the active endogenous type II transposable element, Tgm9, excises from insertion sites and restores wild-type phenotypes. Thus, this element provides a ...

Facial asymmetry and clinical manifestations in patients with novel insertion of the TCOF1 gene.

PubMed

Su, P-H; Liu, Y-F; Yu, J-S; Chen, J-Y; Chen, S-J; Lai, Y-J

2012-11-01

This study explored the role of TCOF1 insertion mutations in Taiwanese patients with craniofacial anomalies. Twelve patients with single or multiple, asymmetrical congenital craniofacial anomalies were enrolled. Genomic DNA was prepared from leukocytes; the coding regions of TCOF1 were analyzed by polymerase chain reaction and direct sequencing. Clinical manifestations were correlated to the TCOF1 mutation. Six of 12 patients diagnosed with hemifacial microsomia exhibited a novel insertion mutation 4127 ins G (frameshift) in exon 24 in the TCOF1 gene. All six patients were diagnosed with anomalies on the left side. In addition, four of these six patients had hearing impairment; three had other major anomalies; and two had developmental delay. The insertion caused a frameshift, an early truncation, the loss of two putative nuclear localization signals (residues 1404-1420 and 1424-1440), and the loss of coiled coil domain (1406-1426) in treacle protein. These findings support the existence of two regulators of growth of the mandibular condyles. © 2011 John Wiley & Sons A/S.

Nicotinamide dependence of uropathogenic Escherichia coli UTI89 and application of nadB as a neutral insertion site.

PubMed

Li, Zhaoli; Bouckaert, Julie; Deboeck, Francine; De Greve, Henri; Hernalsteens, Jean-Pierre

2012-03-01

NAD and NADP are ubiquitous in the metabolism of Escherichia coli K-12. NAD auxotrophy can be rendered by mutation in any of the three genes nadB, nadA and nadC. The nadB and nadA genes were defined as antivirulence loci in Shigella spp., as a mutation (mainly in nadB) disrupting the synthesis of quinolinate is required for virulence. Uropathogenic E. coli (UPEC) isolates from acute cystitis patients, exhibiting nicotinamide auxotrophy, were of serotype O18 : K1 : H7. E. coli UTI89, the model uropathogenic and O18 : K1 : H7 strain, requires nicotinamide or quinolinate for growth. A mutation in the nadB gene, encoding L-aspartate oxidase, was shown to be responsible for the nicotinamide requirement of UTI89. This was further confirmed by complementation of UTI89 with a recombinant plasmid harbouring the nadB gene of E. coli K-12. An Ala28Val point mutant of the recombinant plasmid failed to support the growth of UTI89 in minimal medium. This proves that the Ala28Val mutation in the NadB gene of UTI89 completely impedes de novo synthesis of nicotinamide. In spontaneous prototrophic revertants of UTI89, the nadB gene has a Val28Ala mutation. Both analyses implicate that the nicotinamide auxotrophy of UTI89 is caused by a single Ala28Val mutation in NadB. We showed that the same mutation is also present in other NAD auxotrophic E. coli O18 strains. No significant differences were observed between the virulence of isogenic NAD auxotrophic and prototrophic strains in the murine ascending urinary tract infection model. Considering these data, we applied the nadB locus as a neutral site for DNA insertions in the bacterial chromosome. We successfully restored the parental phenotype of a fimH mutant by inserting fimH, with a synthetic em7 promoter, into the nadB gene. This neutral insertion site is of significance for further research on the pathogenicity of UPEC.

A Truncated AdeS Kinase Protein Generated by ISAba1 Insertion Correlates with Tigecycline Resistance in Acinetobacter baumannii

PubMed Central

Sun, Jun-Ren; Perng, Cherng-Lih; Chan, Ming-Chin; Morita, Yuji; Lin, Jung-Chung; Su, Chih-Mao; Wang, Wei-Yao; Chang, Tein-Yao; Chiueh, Tzong-Shi

2012-01-01

Over-expression of AdeABC efflux pump stimulated continuously by the mutated AdeRS two component system has been found to result in antimicrobial resistance, even tigecycline (TGC) resistance, in multidrug-resistant Acinetobacter baumannii (MRAB). Although the insertion sequence, ISAba1, contributes to one of the AdeRS mutations, the detail mechanism remains unclear. In the present study we collected 130 TGC-resistant isolates from 317 carbapenem resistant MRAB (MRAB-C) isolates, and 38 of them were characterized with ISAba1 insertion in the adeS gene. The relationship between the expression of AdeABC efflux pump and TGC resistant was verified indirectly by successfully reducing TGC resistance with NMP, an efflux pump inhibitor. Further analysis showed that the remaining gene following the ISAba1 insertion was still transcribed to generate a truncated AdeS protein by the Pout promoter on ISAba1 instead of frame shift or pre-termination. Through introducing a series of recombinant adeRS constructs into a adeRS knockout strain, we demonstrated the truncated AdeS protein was constitutively produced and stimulating the expression of AdeABC efflux pump via interaction with AdeR. Our findings suggest a mechanism of antimicrobial resistance induced by an aberrant cytoplasmic sensor derived from an insertion element. PMID:23166700

Generation of mariner-based transposon insertion mutant library of Bacillus sphaericus 2297 and investigation of genes involved in sporulation and mosquito-larvicidal crystal protein synthesis.

PubMed

Wu, Yiming; Hu, Xiaomin; Ge, Yong; Zheng, Dasheng; Yuan, Zhiming

2012-05-01

Bacillus sphaericus has been used with great success in mosquito control programs worldwide. Under conditions of nutrient limitation, it undergoes sporulation via a series of well defined morphological stages. However, only a small number of genes involved in sporulation have been identified. To identify genes associated with sporulation, and to understand the relationship between sporulation and crystal protein synthesis, a random mariner-based transposon insertion mutant library of B. sphaericus strain 2297 was constructed and seven sporulation-defective mutants were selected. Sequencing of the DNA flanking of the transposon insertion identified several genes involved in sporulation. The morphologies of mutants were determined by electron microscopy and synthesis of crystal proteins was analyzed by SDS-PAGE and Western blot. Four mutants blocked at early stages of sporulation failed to produce crystal proteins and had lower larvicidal activity. However, the other three mutants were blocked at later stages and were able to form crystal proteins, and the larvicidal activity was similar to wild type. These results indicated that crystal protein synthesis in B. sphaericus is dependent on sporulation initiation. © 2012 Federation of European Microbiological Societies. Published by Blackwell Publishing Ltd. All rights reserved.

A potyvirus-based gene vector allows producing active human S-COMT and animal GFP, but not human sorcin, in vector-infected plants.

PubMed

Kelloniemi, Jani; Mäkinen, Kristiina; Valkonen, Jari P T

2006-05-01

Potato virus A (PVA), a potyvirus with a (+)ssRNA genome translated to a large polyprotein, was engineered and used as a gene vector for expression of heterologous proteins in plants. Foreign genes including jellyfish GFP (Aequorea victoria) encoding the green fluorescent protein (GFP, 27 kDa) and the genes of human origin (Homo sapiens) encoding a soluble resistance-related calcium-binding protein (sorcin, 22 kDa) and the catechol-O-methyltransferase (S-COMT; 25 kDa) were cloned between the cistrons for the viral replicase and coat protein (CP). The inserts caused no adverse effects on viral infectivity and virulence, and the inserted sequences remained intact in progeny viruses in the systemically infected leaves. The heterologous proteins were released from the viral polyprotein following cleavage by the main viral proteinase, NIa, at engineered proteolytic processing sites flanking the insert. Active GFP, as indicated by green fluorescence, and S-COMT with high levels of enzymatic activity were produced. In contrast, no sorcin was detected despite the expected equimolar amounts of the foreign and viral proteins being expressed as a polyprotein. These data reveal inherent differences between heterologous proteins in their suitability for production in plants.

Efficient conditional and promoter-specific in vivo expression of cDNAs of choice by taking advantage of recombinase-mediated cassette exchange using FlEx gene traps

PubMed Central

Schebelle, Laura; Wolf, Claudia; Stribl, Carola; Javaheri, Tahereh; Schnütgen, Frank; Ettinger, Andreas; Ivics, Zoltán; Hansen, Jens; Ruiz, Patricia; von Melchner, Harald; Wurst, Wolfgang; Floss, Thomas

2010-01-01

Recombinase-mediated cassette exchange (RMCE) exploits the possibility to unidirectionally exchange any genetic material flanked by heterotypic recombinase recognition sites (RRS) with target sites in the genome. Due to a limited number of available pre-fabricated target sites, RMCE in mouse embryonic stem (ES) cells has not been tapped to its full potential to date. Here, we introduce a universal system, which allows the targeted insertion of any given transcriptional unit into 85 742 previously annotated retroviral conditional gene trap insertions, representing 7013 independent genes in mouse ES cells, by RMCE. This system can be used to express any given cDNA under the control of endogenous trapped promoters in vivo, as well as for the generation of transposon ‘launch pads’ for chromosomal region-specific ‘Sleeping Beauty’ insertional mutagenesis. Moreover, transcription of the gene-of-interest is only activated upon Cre-recombinase activity, a feature that adds conditionality to this expression system, which is demonstrated in vivo. The use of the RMCE system presented in this work requires one single-cloning step followed by one overnight gateway clonase reaction and subsequent cassette exchange in ES cells with efficiencies of 40% in average. PMID:20139417

Construction and Cloning of Reporter-Tagged Replicon cDNA for an In Vitro Replication Study of Murine Norovirus-1 (MNV-1).

PubMed

Ahmad, Muhammad Khairi; Tabana, Yasser M; Ahmed, Mowaffaq Adam; Sandai, Doblin Anak; Mohamed, Rafeezul; Ismail, Ida Shazrina; Zulkiflie, Nurulisa; Yunus, Muhammad Amir

2017-12-01

A norovirus maintains its viability, infectivity and virulence by its ability to replicate. However, the biological mechanisms of the process remain to be explored. In this work, the NanoLuc™ Luciferase gene was used to develop a reporter-tagged replicon system to study norovirus replication. The NanoLuc™ Luciferase reporter protein was engineered to be expressed as a fusion protein for MNV-1 minor capsid protein, VP2. The foot-and-mouth disease virus 2A (FMDV2A) sequence was inserted between the 3'end of the reporter gene and the VP2 start sequence to allow co-translational 'cleavage' of fusion proteins during intracellular transcript expression. Amplification of the fusion gene was performed using a series of standard and overlapping polymerase chain reactions. The resulting amplicon was then cloned into three readily available backbones of MNV-1 cDNA clones. Restriction enzyme analysis indicated that the NanoLucTM Luciferase gene was successfully inserted into the parental MNV-1 cDNA clone. The insertion was further confirmed by using DNA sequencing. NanoLuc™ Luciferase-tagged MNV-1 cDNA clones were successfully engineered. Such clones can be exploited to develop robust experimental assays for in vitro assessments of viral RNA replication.

[Genetic diversity and relationships of northern eurasia populations for polymorphic Alu-insertions].

PubMed

Khitrinskaia, I Iu; Khar'kov, V N; Voevoda, M I; Stepanova, V A

2014-01-01

We for the first time have examined the autosomal gene pool of the Siberia, Central Asian and the Far East populations (27 populations of 12 ethnic groups) using a set of polymorphic Alu insertions in the human genome. The results of the analysis testify (i) to a significant level of genetic diversity in the Northern Eurasian populations and (ii) to a considerable differentiation of gene pool in the population of this region. It has been shown that at the CD4 locus, the frequency of Alu (-) is inversely related to the Mongoloid component of the population, the lowest and highest frequencies of the Alu deletion at locus CD4 were recorded respectively in Eskimo (0.012) and Russian and Ukrainian (0.35). The analysis of gene flow proved Caucasoid populations (Russian, Tajik and Uzbek), as well as those of Turkic ethnic groups from the Southern Siberia (Altaians and Tuvinians) and Khanty and Mansy populations to be the recipients of a considerable gene flow from the outside of the concerned population system, as compared with the East Siberian and the Far East ethnic groups. The results of the correlation analysis received with use polymorphic Alu insertion testify to the greatest correlation of genetic distances with anthropological characteristics of populations.

The wheat cytochrome oxidase subunit II gene has an intron insert and three radical amino acid changes relative to maize

PubMed Central

Bonen, Linda; Boer, Poppo H.; Gray, Michael W.

1984-01-01

We have determined the sequence of the wheat mitochondrial gene for cytochrome oxidase subunit II (COII) and find that its derived protein sequence differs from that of maize at only three amino acid positions. Unexpectedly, all three replacements are non-conservative ones. The wheat COII gene has a highly-conserved intron at the same position as in maize, but the wheat intron is 1.5 times longer because of an insert relative to its maize counterpart. Hybridization analysis of mitochondrial DNA from rye, pea, broad bean and cucumber indicates strong sequence conservation of COII coding sequences among all these higher plants. However, only rye and maize mitochondrial DNA show homology with wheat COII intron sequences and rye alone with intron-insert sequences. We find that a sequence identical to the region of the 5' exon corresponding to the transmembrane domain of the COII protein is present at a second genomic location in wheat mitochondria. These variations in COII gene structure and size, as well as the presence of repeated COII sequences, illustrate at the DNA sequence level, factors which contribute to higher plant mitochondrial DNA diversity and complexity. ImagesFig. 3.Fig. 4.Fig. 5. PMID:16453565

Selfish DNA in protein-coding genes of Rickettsia.

PubMed

Ogata, H; Audic, S; Barbe, V; Artiguenave, F; Fournier, P E; Raoult, D; Claverie, J M

2000-10-13

Rickettsia conorii, the aetiological agent of Mediterranean spotted fever, is an intracellular bacterium transmitted by ticks. Preliminary analyses of the nearly complete genome sequence of R. conorii have revealed 44 occurrences of a previously undescribed palindromic repeat (150 base pairs long) throughout the genome. Unexpectedly, this repeat was found inserted in-frame within 19 different R. conorii open reading frames likely to encode functional proteins. We found the same repeat in proteins of other Rickettsia species. The finding of a mobile element inserted in many unrelated genes suggests the potential role of selfish DNA in the creation of new protein sequences.

Disruption of tetR type regulator adeN by mobile genetic element confers elevated virulence in Acinetobacter baumannii.

PubMed

Saranathan, Rajagopalan; Pagal, Sudhakar; Sawant, Ajit R; Tomar, Archana; Madhangi, M; Sah, Suresh; Satti, Annapurna; Arunkumar, K P; Prashanth, K

2017-10-03

Acinetobacter baumannii is an important human pathogen and considered as a major threat due to its extreme drug resistance. In this study, the genome of a hyper-virulent MDR strain PKAB07 of A. baumannii isolated from an Indian patient was sequenced and analyzed to understand its mechanisms of virulence, resistance and evolution. Comparative genome analysis of PKAB07 revealed virulence and resistance related genes scattered throughout the genome, instead of being organized as an island, indicating the highly mosaic nature of the genome. Many intermittent horizontal gene transfer events, insertion sequence (IS) element insertions identified were augmenting resistance machinery and elevating the SNP densities in A. baumannii eventually aiding in their swift evolution. ISAba1, the most widely distributed insertion sequence in A. baumannii was found in multiple sites in PKAB07. Out of many ISAba1 insertions, we identified novel insertions in 9 different genes wherein insertional inactivation of adeN (tetR type regulator) was significant. To assess the significance of this disruption in A. baumannii, adeN mutant and complement strains were constructed in A. baumannii ATCC 17978 strain and studied. Biofilm levels were abrogated in the adeN knockout when compared with the wild type and complemented strain of adeN knockout. Virulence of the adeN knockout mutant strain was observed to be high, which was validated by in vitro experiments and Galleria mellonella infection model. The overexpression of adeJ, a major component of AdeIJK efflux pump observed in adeN knockout strain could be the possible reason for the elevated virulence in adeN mutant and PKB07 strain. Knocking out of adeN in ATCC strain led to increased resistance and virulence at par with the PKAB07. Disruption of tetR type regulator adeN by ISAba1 consequently has led to elevated virulence in this pathogen.

Pressure redistribution by molded inserts in diabetic footwear: a pilot study.

PubMed

Lord, M; Hosein, R

1994-08-01

A small-scale trial is described to demonstrate and evaluate the redistribution of plantar pressure resulting from the use of custom-molded inserts in the orthopedic shoes of diabetic patients at risk of plantar ulceration. A pressure-measuring insole based on force-sensitive resistor technology enabled the load distribution to be compared using molded inserts and flat inserts fitted into the same shoes. An analysis of the 12 peaks of pressure that could be identified under a discrete metatarsal head of six subjects in the trial showed that the pressure was significantly reduced with the use of molded inserts (flat inserts: 305 +/- 79 kPa; molded inserts: 216 +/- 70 kPa; n = 6 p < 0.005). Technical limitations of the equipment and the difficult choice of match of flat insert to molded for comparison suggest that further studies are required for a definitive result.

Identifying Cancer Driver Genes Using Replication-Incompetent Retroviral Vectors

PubMed Central

Bii, Victor M.; Trobridge, Grant D.

2016-01-01

Identifying novel genes that drive tumor metastasis and drug resistance has significant potential to improve patient outcomes. High-throughput sequencing approaches have identified cancer genes, but distinguishing driver genes from passengers remains challenging. Insertional mutagenesis screens using replication-incompetent retroviral vectors have emerged as a powerful tool to identify cancer genes. Unlike replicating retroviruses and transposons, replication-incompetent retroviral vectors lack additional mutagenesis events that can complicate the identification of driver mutations from passenger mutations. They can also be used for almost any human cancer due to the broad tropism of the vectors. Replication-incompetent retroviral vectors have the ability to dysregulate nearby cancer genes via several mechanisms including enhancer-mediated activation of gene promoters. The integrated provirus acts as a unique molecular tag for nearby candidate driver genes which can be rapidly identified using well established methods that utilize next generation sequencing and bioinformatics programs. Recently, retroviral vector screens have been used to efficiently identify candidate driver genes in prostate, breast, liver and pancreatic cancers. Validated driver genes can be potential therapeutic targets and biomarkers. In this review, we describe the emergence of retroviral insertional mutagenesis screens using replication-incompetent retroviral vectors as a novel tool to identify cancer driver genes in different cancer types. PMID:27792127

Software technology insertion: A study of success factors

NASA Technical Reports Server (NTRS)

Lydon, Tom

1990-01-01

Managing software development in large organizations has become increasingly difficult due to increasing technical complexity, stricter government standards, a shortage of experienced software engineers, competitive pressure for improved productivity and quality, the need to co-develop hardware and software together, and the rapid changes in both hardware and software technology. The 'software factory' approach to software development minimizes risks while maximizing productivity and quality through standardization, automation, and training. However, in practice, this approach is relatively inflexible when adopting new software technologies. The methods that a large multi-project software engineering organization can use to increase the likelihood of successful software technology insertion (STI), especially in a standardized engineering environment, are described.

The NASA Electronic Parts and Packaging (NEPP) Program: Insertion of New Electronics Technologies

NASA Technical Reports Server (NTRS)

LaBel, Kenneth A.; Sampson, Michael J.

2007-01-01

This viewgraph presentation gives an overview of NASA Electronic Parts and Packaging (NEPP) Program's new electronics technology trends. The topics include: 1) The Changing World of Radiation Testing of Memories; 2) Even Application-Specific Tests are Costly!; 3) Hypothetical New Technology Part Qualification Cost; 4) Where we are; 5) Approaching FPGAs as a More Than a "Part" for Reliability; 6) FPGAs Beget Novel Radiation Test Setups; 7) Understanding the Complex Radiation Data; 8) Tracking Packaging Complexity and Reliability for FPGAs; 9) Devices Supporting the FPGA Need to be Considered; 10) Summary of the New Electronic Technologies and Insertion into Flight Programs Workshop; and 11) Highlights of Panel Notes and Comments

The dam replacing gene product enhances Neisseria gonorrhoeae FA1090 viability and biofilm formation

PubMed Central

Kwiatek, Agnieszka; Bacal, Pawel; Wasiluk, Adrian; Trybunko, Anastasiya; Adamczyk-Poplawska, Monika

2014-01-01

Many Neisseriaceae do not exhibit Dam methyltransferase activity and, instead of the dam gene, possess drg (dam replacing gene) inserted in the leuS/dam locus. The drg locus in Neisseria gonorrhoeae FA1090 has a lower GC-pairs content (40.5%) compared to the whole genome of N. gonorrhoeae FA1090 (52%). The gonococcal drg gene encodes a DNA endonuclease Drg, with GmeATC specificity. Disruption of drg or insertion of the dam gene in gonococcal genome changes the level of expression of genes as shown by transcriptome analysis. For the drg-deficient N. gonorrhoeae mutant, a total of 195 (8.94% of the total gene pool) genes exhibited an altered expression compared to the wt strain by at least 1.5 fold. In dam-expressing N. gonorrhoeae mutant, the expression of 240 genes (11% of total genes) was deregulated. Most of these deregulated genes were involved in translation, DNA repair, membrane biogenesis and energy production as shown by cluster of orthologous group analysis. In vivo, the inactivation of drg gene causes the decrease of the number of live neisserial cells and long lag phase of growth. The insertion of dam gene instead of drg locus restores cell viability. We have also shown that presence of the drg gene product is important for N. gonorrhoeae FA1090 in adhesion, including human epithelial cells, and biofilm formation. Biofilm produced by drg-deficient strain is formed by more dispersed cells, compared to this one formed by parental strain as shown by scanning electron and confocal microscopy. Also adherence assays show a significantly smaller biomass of formed biofilm (OD570 = 0.242 ± 0.038) for drg-deficient strain, compared to wild-type strain (OD570 = 0.378 ± 0.057). Dam-expressing gonococcal cells produce slightly weaker biofilm with cells embedded in an extracellular matrix. This strain has also a five times reduced ability for adhesion to human epithelial cells. In this context, the presence of Drg is more advantageous for N. gonorrhoeae biology than Dam presence. PMID:25566225

SETA Support for the DARPA Microelectronics Technology Insertion Program of the Microelectronics Technology Office

DTIC Science & Technology

1992-08-17

Conclusions. Key personnel planned and administered the 193-nm lithography SBIR workshop on May 7, 1992 as well as planned the GaAs Insertion...converters can use Josephson junctions (JJ) to improve performance. Superconductive quantum interference devices (SQUIDs), such as JJs, are used to form...forward control of a lithography stepper. Mark Conner at Booz-Allen has copies of the charts. You should take a few minutes to review them. I asked Costos

A rapid and cost-effective method for sequencing pooled cDNA clones by using a combination of transposon insertion and Gateway technology.

PubMed

Morozumi, Takeya; Toki, Daisuke; Eguchi-Ogawa, Tomoko; Uenishi, Hirohide

2011-09-01

Large-scale cDNA-sequencing projects require an efficient strategy for mass sequencing. Here we describe a method for sequencing pooled cDNA clones using a combination of transposon insertion and Gateway technology. Our method reduces the number of shotgun clones that are unsuitable for reconstruction of cDNA sequences, and has the advantage of reducing the total costs of the sequencing project.

A Novel Retrotransposon Inserted in the Dominant Vrn-B1 Allele Confers Spring Growth Habit in Tetraploid Wheat (Triticum turgidum L.).

PubMed

Chu, C-G; Tan, C T; Yu, G-T; Zhong, S; Xu, S S; Yan, L

2011-12-01

Vernalization genes determine winter/spring growth habit in temperate cereals and play important roles in plant development and environmental adaptation. In wheat (Triticum L. sp.), it was previously shown that allelic variation in the vernalization gene VRN1 was due to deletions or insertions either in the promoter or in the first intron. Here, we report a novel Vrn-B1 allele that has a retrotransposon in its promoter conferring spring growth habit. The VRN-B1 gene was mapped in a doubled haploid population that segregated for winter-spring growth habit but was derived from two spring tetraploid wheat genotypes, the durum wheat (T. turgidum subsp. durum) variety 'Lebsock' and T. turgidum subsp. carthlicum accession PI 94749. Genetic analysis revealed that Lebsock carried the dominant Vrn-A1 and recessive vrn-B1 alleles, whereas PI 94749 had the recessive vrn-A1 and dominant Vrn-B1 alleles. The Vrn-A1 allele in Lebsock was the same as the Vrn-A1c allele previously reported in hexaploid wheat. No differences existed between the vrn-B1 and Vrn-B1 alleles, except that a 5463-bp insertion was detected in the 5'-UTR region of the Vrn-B1 allele. This insertion was a novel retrotransposon (designated as retrotrans_VRN), which was flanked by a 5-bp target site duplication and contained primer binding site and polypurine tract motifs, a 325-bp long terminal repeat, and an open reading frame encoding 1231 amino acids. The insertion of retrotrans_VRN resulted in expression of Vrn-B1 without vernalization. Retrotrans_VRN is prevalent among T. turgidum subsp. carthlicum accessions, less prevalent among T. turgidum subsp. dicoccum accessions, and rarely found in other tetraploid wheat subspecies.

Phenotypic characterization of xpr, a global regulator of extracellular virulence factors in Staphylococcus aureus

NASA Technical Reports Server (NTRS)

Smeltzer, M. S.; Hart, M. E.; Iandolo, J. J.; Spooner, B. S. (Principal Investigator)

1993-01-01

We recently described a Tn551 insertion in the chromosome of Staphylococcus aureus S6C that resulted in drastically reduced expression of extracellular lipase (M. S. Smeltzer, S. R. Gill, and J. J. Iandolo, J. Bacteriol. 174:4000-4006, 1992). The insertion was localized to a chromosomal site (designated omega 1058) distinct from the lipase structural gene (geh) and the accessory gene regulator (agr), both of which were structurally intact in the lipase-negative (Lip-) mutants. In this report, we describe a phenotypic comparison between strains S6C, a hyperproducer of enterotoxin B; KSI9051, a derivative of S6C carrying the Tn551 insertion at omega 1058; ISP546, an 8325-4 strain that carries a Tn551 insertion in the agr locus; and ISP479C, the parent strain of ISP546 cured of the Tn551 delivery plasmid pI258repA36. Compared with their respective parent strains, ISP546 and KSI9051 produced greatly reduced amounts of lipase, alpha-toxin, delta-toxin, protease, and nuclease. KSI9051 also produced reduced amounts of staphylococcal enterotoxin B. Coagulase production was increased in ISP546 but not in KSI9051. Using a mouse model, we also demonstrated that ISP546 and KSI9051 were far less virulent than ISP479C and S6C. We have designated the genetic element defined by the Tn551 insertion at omega 1058 xpr to denote its role as a regulator of extracellular protein synthesis. We conclude that xpr and agr are similar and possibly interactive regulatory genes that play an important role in pathogenesis of staphylococcal disease.

A putative regulatory genetic locus modulates virulence in the pathogen Leptospira interrogans.

PubMed

Eshghi, Azad; Becam, Jérôme; Lambert, Ambroise; Sismeiro, Odile; Dillies, Marie-Agnès; Jagla, Bernd; Wunder, Elsio A; Ko, Albert I; Coppee, Jean-Yves; Goarant, Cyrille; Picardeau, Mathieu

2014-06-01

Limited research has been conducted on the role of transcriptional regulators in relation to virulence in Leptospira interrogans, the etiological agent of leptospirosis. Here, we identify an L. interrogans locus that encodes a sensor protein, an anti-sigma factor antagonist, and two genes encoding proteins of unknown function. Transposon insertion into the gene encoding the sensor protein led to dampened transcription of the other 3 genes in this locus. This lb139 insertion mutant (the lb139(-) mutant) displayed attenuated virulence in the hamster model of infection and reduced motility in vitro. Whole-transcriptome analyses using RNA sequencing revealed the downregulation of 115 genes and the upregulation of 28 genes, with an overrepresentation of gene products functioning in motility and signal transduction and numerous gene products with unknown functions, predicted to be localized to the extracellular space. Another significant finding encompassed suppressed expression of the majority of the genes previously demonstrated to be upregulated at physiological osmolarity, including the sphingomyelinase C precursor Sph2 and LigB. We provide insight into a possible requirement for transcriptional regulation as it relates to leptospiral virulence and suggest various biological processes that are affected due to the loss of native expression of this genetic locus.

Risk Management of New Microelectronics for NASA: Radiation Knowledge-base

NASA Technical Reports Server (NTRS)

LaBel, Kenneth A.

2004-01-01

Contents include the following: NASA Missions - implications to reliability and radiation constraints. Approach to Insertion of New Technologies Technology Knowledge-base development. Technology model/tool development and validation. Summary comments.

Paucity and preferential suppression of transgenes in late replication domains of the D. melanogaster genome.

PubMed

Babenko, Vladimir N; Makunin, Igor V; Brusentsova, Irina V; Belyaeva, Elena S; Maksimov, Daniil A; Belyakin, Stepan N; Maroy, Peter; Vasil'eva, Lyubov A; Zhimulev, Igor F

2010-05-21

Eukaryotic genomes are organized in extended domains with distinct features intimately linking genome structure, replication pattern and chromatin state. Recently we identified a set of long late replicating euchromatic regions that are underreplicated in salivary gland polytene chromosomes of D. melanogaster. Here we demonstrate that these underreplicated regions (URs) have a low density of P-element and piggyBac insertions compared to the genome average or neighboring regions. In contrast, Minos-based transposons show no paucity in URs but have a strong bias to testis-specific genes. We estimated the suppression level in 2,852 stocks carrying a single P-element by analysis of eye color determined by the mini-white marker gene and demonstrate that the proportion of suppressed transgenes in URs is more than three times higher than in the flanking regions or the genomic average. The suppressed transgenes reside in intergenic, genic or promoter regions of the annotated genes. We speculate that the low insertion frequency of P-elements and piggyBacs in URs partially results from suppression of transgenes that potentially could prevent identification of transgenes due to complete suppression of the marker gene. In a similar manner, the proportion of suppressed transgenes is higher in loci replicating late or very late in Kc cells and these loci have a lower density of P-elements and piggyBac insertions. In transgenes with two marker genes suppression of mini-white gene in eye coincides with suppression of yellow gene in bristles. Our results suggest that the late replication domains have a high inactivation potential apparently linked to the silenced or closed chromatin state in these regions, and that such inactivation potential is largely maintained in different tissues.

Biodegradation of the Organic Disulfide 4,4′-Dithiodibutyric Acid by Rhodococcus spp.

PubMed Central

Khairy, Heba; Wübbeler, Jan Hendrik

2015-01-01

Four Rhodococcus spp. exhibited the ability to use 4,4′-dithiodibutyric acid (DTDB) as a sole carbon source for growth. The most important step for the production of a novel polythioester (PTE) using DTDB as a precursor substrate is the initial cleavage of DTDB. Thus, identification of the enzyme responsible for this step was mandatory. Because Rhodococcus erythropolis strain MI2 serves as a model organism for elucidation of the biodegradation of DTDB, it was used to identify the genes encoding the enzymes involved in DTDB utilization. To identify these genes, transposon mutagenesis of R. erythropolis MI2 was carried out using transposon pTNR-TA. Among 3,261 mutants screened, 8 showed no growth with DTDB as the sole carbon source. In five mutants, the insertion locus was mapped either within a gene coding for a polysaccharide deacetyltransferase, a putative ATPase, or an acetyl coenzyme A transferase, 1 bp upstream of a gene coding for a putative methylase, or 176 bp downstream of a gene coding for a putative kinase. In another mutant, the insertion was localized between genes encoding a putative transcriptional regulator of the TetR family (noxR) and an NADH:flavin oxidoreductase (nox). Moreover, in two other mutants, the insertion loci were mapped within a gene encoding a hypothetical protein in the vicinity of noxR and nox. The interruption mutant generated, R. erythropolis MI2 noxΩtsr, was unable to grow with DTDB as the sole carbon source. Subsequently, nox was overexpressed and purified, and its activity with DTDB was measured. The specific enzyme activity of Nox amounted to 1.2 ± 0.15 U/mg. Therefore, we propose that Nox is responsible for the initial cleavage of DTDB into 2 molecules of 4-mercaptobutyric acid (4MB). PMID:26407888

Long-term health and germline transmission in transgenic cattle following transposon-mediated gene transfer.

PubMed

Yum, Soo-Young; Lee, Song-Jeon; Park, Sin-Gi; Shin, In-Gang; Hahn, Sang-Eun; Choi, Woo-Jae; Kim, Hee-Soo; Kim, Hyeong-Jong; Bae, Seong-Hun; Lee, Je-Hyeong; Moon, Joo-Yeong; Lee, Woo-Sung; Lee, Ji-Hyun; Lee, Choong-Il; Kim, Seong-Jin; Jang, Goo

2018-05-23

Transposon-mediated, non-viral gene delivery is a powerful tool for generating stable cell lines and transgenic animals. However, as multi-copy insertion is the preferred integration pattern, there is the potential for uncontrolled changes in endogenous gene expression and detrimental effects in cells or animals. Our group has previously reported on the generation of several transgenic cattle by using microinjection of the Sleeping Beauty (SB) and PiggyBac (PB) transposons and seeks to explore the long-term effects of this technology on cattle. Transgenic cattle, one female (SNU-SB-1) and one male (SNU-PB-1), reached over 36 months of age with no significant health issues and normal blood parameters. The detection of transgene integration and fluorescent signal in oocytes and sperm suggested the capacity for germline transmission in both of the founder animals. After natural breeding, the founder transgenic cow delivered a male calf and secreted milk containing fluorescent transgenic proteins. The calf expressed green fluorescent protein in primary cells from ear skin, with no significant change in overall genomic stability and blood parameters. Three sites of transgene integration were identified by next-generation sequencing of the calf's genome. Overall, these data demonstrate that transposon-mediated transgenesis can be applied to cattle without being detrimental to their long-term genomic stability or general health. We further suggest that this technology may be usefully applied in other fields, such as the generation of transgenic animal models.

Progress of targeted genome modification approaches in higher plants.

PubMed

Cardi, Teodoro; Neal Stewart, C

2016-07-01

Transgene integration in plants is based on illegitimate recombination between non-homologous sequences. The low control of integration site and number of (trans/cis)gene copies might have negative consequences on the expression of transferred genes and their insertion within endogenous coding sequences. The first experiments conducted to use precise homologous recombination for gene integration commenced soon after the first demonstration that transgenic plants could be produced. Modern transgene targeting categories used in plant biology are: (a) homologous recombination-dependent gene targeting; (b) recombinase-mediated site-specific gene integration; (c) oligonucleotide-directed mutagenesis; (d) nuclease-mediated site-specific genome modifications. New tools enable precise gene replacement or stacking with exogenous sequences and targeted mutagenesis of endogeneous sequences. The possibility to engineer chimeric designer nucleases, which are able to target virtually any genomic site, and use them for inducing double-strand breaks in host DNA create new opportunities for both applied plant breeding and functional genomics. CRISPR is the most recent technology available for precise genome editing. Its rapid adoption in biological research is based on its inherent simplicity and efficacy. Its utilization, however, depends on available sequence information, especially for genome-wide analysis. We will review the approaches used for genome modification, specifically those for affecting gene integration and modification in higher plants. For each approach, the advantages and limitations will be noted. We also will speculate on how their actual commercial development and implementation in plant breeding will be affected by governmental regulations.

Methods and compositions for controlling gene expression by RNA processing

DOEpatents

Doudna, Jennifer A.; Qi, Lei S.; Haurwitz, Rachel E.; Arkin, Adam P.

2017-08-29

The present disclosure provides nucleic acids encoding an RNA recognition sequence positioned proximal to an insertion site for the insertion of a sequence of interest; and host cells genetically modified with the nucleic acids. The present disclosure also provides methods of modifying the activity of a target RNA, and kits and compositions for carrying out the methods.

Biochemical and genetic analyses of acetoin catabolism in Alcaligenes eutrophus.

PubMed Central

Fründ, C; Priefert, H; Steinbüchel, A; Schlegel, H G

1989-01-01

In genetic studies on the catabolism of acetoin in Alcaligenes eutrophus, we used Tn5::mob-induced mutants which were impaired in the utilization of acetoin as the sole carbon source for growth. The transposon-harboring EcoRI restriction fragments from 17 acetoin-negative and slow-growing mutants (class 2a) and from six pleiotropic mutants of A. eutorphus, which were acetoin-negative and did not grow chemolithoautotrophically (class 2b), were cloned from pHC79 gene banks. The insertions of Tn5 were mapped on four different chromosomal EcoRI restriction fragments (A, C, D, and E) in class 2a mutants. The native DNA fragments were cloned from a lambda L47 or from a cosmid gene bank. Evidence is provided that fragments A (21 kilobase pairs [kb]) and C (7.7 kb) are closely linked in the genome; the insertions of Tn5 covered a region of approximately 5 kb. Physiological experiments revealed that this region encodes for acetoin:dichlorophenol-indophenol oxidoreductase, a fast-migrating protein, and probably for one additional protein that is as yet unknown. In mutants which were not completely impaired in growth on acetoin but which grew much slower and after a prolonged lag phase, fragments D (7.2 kb) and E (8.1 kb) were inactivated by insertion of Tn5::mob. No structural gene could be assigned to the D or E fragments. In class 2b mutants, insertions of Tn5 were mapped on fragment B (11.3 kb). This fragment complemented pleiotropic hno mutants in trans; these mutants were impaired in the formation of a rpoN-like protein. The expression of the gene cluster on fragments A and C seemed to be rpoN dependent. PMID:2556366

A novel (A)γδβ(0)-thalassemia caused by DNA deletion-inversion-insertion of the β-globin gene cluster and five olfactory receptor genes: Genetic interactions, hematological phenotypes and molecular characterization.

PubMed

Singha, Kritsada; Fucharoen, Goonnapa; Hama, Abdulloh; Fucharoen, Supan

2015-07-01

To report the phenotypes and genetic basis of a novel (A)γδβ(0)-thalassemia found in Thai individuals with several forms of thalassemia. An initial study was done in an adult Thai woman who had hypochromic microcytic red cells with unusually 100% Hb F. Extended study was carried out on her parents and another 17 unrelated individuals with elevated Hb F. Hb analysis was performed by capillary electrophoresis and DNA analysis was done using PCR. A novel diagnostic method based on multiplex PCR assays was developed. DNA analysis of the proband revealed the homozygosity for a novel deletion of 118.3 kb, removing the entire (A)γ, ψβ, δ-, β-globin and five olfactory receptor (OR) genes with an insertion of a 179 bp inverted DNA sequence located behind the OR52A5 gene located downstream and an insertion of 7 orphan nucleotides. Her parents were both carriers of this mutation. Further screening in suspected cases in our series unexpectedly led to identification of an additional 17 cases with this mutation in different genotypes including plain heterozygote, homozygote, compound heterozygote with Hb E, and double heterozygote with several forms of α-thalassemia. Hematological features associated with these genetic interactions are presented. Haplotype analysis indicated a single origin of this novel deletion-inversion-insertion (A)γδβ(0)-thalassemia in the Thai population. Differentiation of this mutation and other high Hb F determinants documented previously could be done by using a developed multiplex PCR assay. Copyright © 2015 The Canadian Society of Clinical Chemists. Published by Elsevier Inc. All rights reserved.

[Analysis of ethnogeographic groups of Kazakhs based on nuclear genome DNA polymorphism].

PubMed

Salimova, A Z; Kutuev, I A; Khusainova, R I; Akhmetova, V L; Sviatova, G S; Berezina, G M; Khusnutdinova, E K

2005-07-01

Eight nuclear DNA loci, including six Alu insertions (ACE, APOA1, PV92, TPA25, Ya5NBC27, and Ya5NBC148), 32-bp deletion in the CCR5 gene, and VNTR locus at the eNOS gene, were examined in three ethnogeographic groups of Kazakhs (342 individuals). The individuals examined lived in southeastern, central, and southwestern regions of Kazakhstan, and according to their tribal attribution, belonged to the Senior, Middle, and Junior Zhuzes. The Alu insertions appeared to be polymorphic in all populations examined: the insertion frequency varied from 0.264 in the populations of the Senior and Middle Zhuzes at the Ya5NBC27 and Ya5NBC148 loci, to 0.827 in Kazakhs of the Middle Zhuz at the APOA1 locus. In Kazakh groups examined only two alleles of the eNOS VNTR locus were detected with the number of repeats constituting four (A) and five (B) copies. The highest frequency of A allele was found in Kazakhs from the Junior Zhuz (0.113), while the highest frequency of B allele was detected in population of the Senior Zhuz (0.893). The frequency of the 32-bp deletion in the chemokine receptor CCR5 gene varied from 0.027 in the Junior Zhuz to 0.045 in the Senior Zhuz. Kazakhs showed high genetic diversity (Hex = 0.376). In general, in three ethnogeographic groups of Kazakhs, the coefficient of gene differentiation (G(ST)) over eight diallelic markers of nuclear genome constituted 1.1%. The differences in the Alu insertions made the highest contribution to the among-population diversity (G(ST) = 1.2%).

The insertion of the non-heme FeB cofactor into nitric oxide reductase from P. denitrificans depends on NorQ and NorD accessory proteins.

PubMed

Kahle, Maximilian; Ter Beek, Josy; Hosler, Jonathan P; Ädelroth, Pia

2018-06-03

Bacterial NO reductases (NOR) catalyze the reduction of NO into N 2 O, either as a step in denitrification or as a detoxification mechanism. cNOR from Paracoccus (P.) denitrificans is expressed from the norCBQDEF operon, but only the NorB and NorC proteins are found in the purified NOR complex. Here, we established a new purification method for the P. denitrificans cNOR via a His-tag using heterologous expression in E. coli. The His-tagged enzyme is both structurally and functionally very similar to non-tagged cNOR. We were also able to express and purify cNOR from the structural genes norCB only, in absence of the accessory genes norQDEF. The produced protein is a stable NorCB complex containing all hemes and it can bind gaseous ligands (CO) to heme b 3 , but it is catalytically inactive. We show that this deficient cNOR lacks the non-heme iron cofactor Fe B . Mutational analysis of the nor gene cluster revealed that it is the norQ and norD genes that are essential to form functional cNOR. NorQ belongs to the family of MoxR P-loop AAA+ ATPases, which are in general considered to facilitate enzyme activation processes often involving metal insertion. Our data indicates that NorQ and NorD work together in order to facilitate non-heme Fe insertion. This is noteworthy since in many cases Fe cofactor binding occurs spontaneously. We further suggest a model for NorQ/D-facilitated metal insertion into cNOR. Copyright © 2018 Elsevier B.V. All rights reserved.

Reverse genetics of Newcastle disease virus

USDA-ARS?s Scientific Manuscript database

Reverse genetics allows the generation of recombinant viruses or vectors used in functional studies, vaccine development, and gene therapy. This technique allows genetic manipulation and cloning of viral genomes, mutation through site-directed mutagenesis, and gene insertion or deletion, among othe...

Factor IX[sub Madrid 2]: A deletion/insertion in Facotr IX gene which abolishes the sequence of the donor junction at the exon IV-intron d splice site

DOE Office of Scientific and Technical Information (OSTI.GOV)

Solera, J.; Magallon, M.; Martin-Villar, J.

1992-02-01

DNA from a patient with severe hemophilia B was evaluated by RFLP analysis, producing results which suggested the existence of a partial deletion within the factor IX gene. The deletion was further localized and characterized by PCR amplification and sequencing. The altered allele has a 4,442-bp deletion which removes both the donor splice site located at the 5[prime] end of intron d and the two last coding nucleotides located at the 3[prime] end of exon IV in the normal factor IX gene; this fragment has been inserted in inverted orientation. Two homologous sequences have been discovered at the ends ofmore » the deleted DNA fragment.« less

Physiological impact of transposable elements encoding DDE transposases in the environmental adaptation of Streptococcus agalactiae.

PubMed

Fléchard, Maud; Gilot, Philippe

2014-07-01

We have referenced and described Streptococcus agalactiae transposable elements encoding DDE transposases. These elements belonged to nine families of insertion sequences (ISs) and to a family of conjugative transposons (TnGBSs). An overview of the physiological impact of the insertion of all these elements is provided. DDE-transposable elements affect S. agalactiae in a number of aspects of its capability to adapt to various environments and modulate the expression of several virulence genes, the scpB-lmB genomic region and the genes involved in capsule expression and haemolysin transport being the targets of several different mobile elements. The referenced mobile elements modify S. agalactiae behaviour by transferring new gene(s) to its genome, by modifying the expression of neighbouring genes at the integration site or by promoting genomic rearrangements. Transposition of some of these elements occurs in vivo, suggesting that by dynamically regulating some adaptation and/or virulence genes, they improve the ability of S. agalactiae to reach different niches within its host and ensure the 'success' of the infectious process. © 2014 The Authors.

Effect of the Molecular Nature of Mutation on the Efficiency of Intrachromosomal Gene Conversion in Mouse Cells

PubMed Central

Letsou, Anthea; Liskay, R. Michael

1987-01-01

With the intent of further exploring the nature of gene conversion in mammalian cells, we systematically addressed the effects of the molecular nature of mutation on the efficiency of intrachromosomal gene conversion in cultured mouse cells. Comparison of conversion rates revealed that all mutations studied were suitable substrates for gene conversion; however, we observed that the rates at which different mutations converted to wild-type could differ by two orders of magnitude. Differences in conversion rates were correlated with the molecular nature of the mutations. In general, rates of conversion decreased with increasing size of the molecular lesions. In comparisons of conversion rates for single base pair insertions and deletions we detected a genotype-directed path for conversion, by which an insertion was converted to wild-type three to four times more efficiently than was a deletion which maps to the same site. The data are discussed in relation to current theories of gene conversion, and are consistent with the idea that gene conversion in mammalian cells can result from repair of heteroduplex DNA (hDNA) intermediates. PMID:2828159

Angiotensin-converting enzyme gene insertion/deletion polymorphism studies in Asian Indian pregnant women biochemically identifies gestational diabetes mellitus.

PubMed

Khan, Imran A; Jahan, Parveen; Hasan, Qurratulain; Rao, Pragna

2014-12-01

Gestational diabetes mellitus (GDM) is defined as glucose intolerance first recognized during pregnancy. Insertion/deletion (I/D) polymorphism of a 287 bp Alu repetitive sequence in intron 16 of the angiotensin-converting enzyme (ACE) gene has been widely investigated in Asian Indian populations with different ethnic origins. The present study examined possible association between I/D polymorphism of the ACE gene and GDM in Asian Indian pregnant women. A total of 200 pregnant women (100 GDM and 100 non-GDM) were recruited in this study and I/D polymorphism of a 287 bp Alu1 element inside intron 16 of the ACE gene was examined by polymerase chain reaction (PCR)-based gel electrophoresis. The distribution of the variants like II, ID, and DD genotypes of ACE gene showed differences between normal GDM versus non-GDM subjects, and the frequency of the ID+ DD Vs II genotype was significant (p=0.0002) in the GDM group. ACE gene polymorphism was associated with GDM in Asian Indian pregnant women. © The Author(s) 2013.

Unexpected allelic heterogeneity and spectrum of mutations in Fowler syndrome revealed by next-generation exome sequencing.

PubMed

Lalonde, Emilie; Albrecht, Steffen; Ha, Kevin C H; Jacob, Karine; Bolduc, Nathalie; Polychronakos, Constantin; Dechelotte, Pierre; Majewski, Jacek; Jabado, Nada

2010-08-01

Protein coding genes constitute approximately 1% of the human genome but harbor 85% of the mutations with large effects on disease-related traits. Therefore, efficient strategies for selectively sequencing complete coding regions (i.e., "whole exome") have the potential to contribute our understanding of human diseases. We used a method for whole-exome sequencing coupling Agilent whole-exome capture to the Illumina DNA-sequencing platform, and investigated two unrelated fetuses from nonconsanguineous families with Fowler Syndrome (FS), a stereotyped phenotype lethal disease. We report novel germline mutations in feline leukemia virus subgroup C cellular-receptor-family member 2, FLVCR2, which has recently been shown to cause FS. Using this technology, we identified three types of genetic abnormalities: point-mutations, insertions-deletions, and intronic splice-site changes (first pathogenic report using this technology), in the fetuses who both were compound heterozygotes for the disease. Although revealing a high level of allelic heterogeneity and mutational spectrum in FS, this study further illustrates the successful application of whole-exome sequencing to uncover genetic defects in rare Mendelian disorders. Of importance, we show that we can identify genes underlying rare, monogenic and recessive diseases using a limited number of patients (n=2), in the absence of shared genetic heritage and in the presence of allelic heterogeneity.

Cloning of a promoter-like soybean DNA sequence responding to IAA induction in Escherichia coli K12.

PubMed

Kline, E L; Chiang, S J; Lattora, D; Chaung, W

1992-02-01

We have constructed a soybean genomic DNA library in Escherichia coli K12 strain KC13 using plasmid pPV33, which consists of a promoter-less tetracycline resistance (Tcr) gene. A recombinant clone, KC13(pAU-SB1)+, was obtained by selecting for resistance to tetracycline in the presence of indole-3-acetic acid (IAA). Restriction enzyme cleavage and Southern hybridization analysis revealed that the pAU-SB1 plasmid has a 250 bp soybean DNA insert fused with the Tcr gene. In the presence of a selected group of auxins, induction of the Tcr phenotype and mRNA synthesis of the Tcr gene are observed only in KC13(pAU-SB1)+ cultures. On the other hand, induction of the Tcr phenotype and mRNA synthesis of the Tcr gene are absent in cells harboring the cloning vector pPV33 or a recombinant plasmid containing the 250 bp insert in the reverse orientation, pAU-SB1ro. This demonstrated a need for the insertion of the 250 bp soybean DNA and the specificity of its orientation in response to IAA induction. The start point of mRNA transcription in response to IAA, IBA, IPA, 2,4,5-T, and a-NAP is at base pair -96 or -95 upstream of the translational start site of the Tcr gene and base pair -98 with 2,4-D.

Pantropic retroviruses as a transduction tool for sea urchin embryos

PubMed Central

Core, Amanda B.; Reyna, Arlene E.; Conaway, Evan A.; Bradham, Cynthia A.

2012-01-01

Sea urchins are an important model for experiments at the intersection of development and systems biology, and technical innovations that enhance the utility of this model are of great value. This study explores pantropic retroviruses as a transduction tool for sea urchin embryos, and demonstrates that pantropic retroviruses infect sea urchin embryos with high efficiency and genomically integrate at a copy number of one per cell. We successfully used a self-inactivation strategy to both insert a sea urchin-specific enhancer and disrupt the endogenous viral enhancer. The resulting self-inactivating viruses drive global and persistent gene expression, consistent with genomic integration during the first cell cycle. Together, these data provide substantial proof of principle for transduction technology in sea urchin embryos. PMID:22431628

Recombinant Parainfluenza Virus 5 Expressing Hemagglutinin of Influenza A Virus H5N1 Protected Mice against Lethal Highly Pathogenic Avian Influenza Virus H5N1 Challenge

PubMed Central

Li, Zhuo; Mooney, Alaina J.; Gabbard, Jon D.; Gao, Xiudan; Xu, Pei; Place, Ryan J.; Hogan, Robert J.; Tompkins, S. Mark

2013-01-01

A safe and effective vaccine is the best way to prevent large-scale highly pathogenic avian influenza virus (HPAI) H5N1 outbreaks in the human population. The current FDA-approved H5N1 vaccine has serious limitations. A more efficacious H5N1 vaccine is urgently needed. Parainfluenza virus 5 (PIV5), a paramyxovirus, is not known to cause any illness in humans. PIV5 is an attractive vaccine vector. In our studies, a single dose of a live recombinant PIV5 expressing a hemagglutinin (HA) gene of H5N1 (rPIV5-H5) from the H5N1 subtype provided sterilizing immunity against lethal doses of HPAI H5N1 infection in mice. Furthermore, we have examined the effect of insertion of H5N1 HA at different locations within the PIV5 genome on the efficacy of a PIV5-based vaccine. Interestingly, insertion of H5N1 HA between the leader sequence, the de facto promoter of PIV5, and the first viral gene, nucleoprotein (NP), did not lead to a viable virus. Insertion of H5N1 HA between NP and the next gene, V/phosphorprotein (V/P), led to a virus that was defective in growth. We have found that insertion of H5N1 HA at the junction between the small hydrophobic (SH) gene and the hemagglutinin-neuraminidase (HN) gene gave the best immunity against HPAI H5N1 challenge: a dose as low as 1,000 PFU was sufficient to protect against lethal HPAI H5N1 challenge in mice. The work suggests that recombinant PIV5 expressing H5N1 HA has great potential as an HPAI H5N1 vaccine. PMID:23077314

A Forward Genetic Screening for Prostate Cancer Progression Genes

DTIC Science & Technology

2012-10-01

sequence  reads. For verifying  the  prevalence of insertions in tumors, PCR was  performed on  genomic  DNA corresponding to 15 insertional mutations using...and has been utilized with great effect in many organisms, from the bacterium to the fruit fly Drosophila melanogaster [1,2]. The Sleeping Beauty (SB...TX SL JC TN. References 1. Cooley L, Kelley R, Spradling A (1988) Insertional mutagenesis of the Drosophila genome with single P elements. Science

Fertility comparison between wild type and transgenic mice by in vitro fertilization.

PubMed

Vasudevan, Kuzhalini; Raber, James; Sztein, Jorge

2010-08-01

Transgenic mice are increasingly used as animal models for studies of gene function and regulation of mammalian genes. Although there has been continuous and remarkable progress in the development of transgenic technology over several decades, many aspects of the resulting transgenic model's phenotype cannot be completely predicted. For example, it is well known that as a consequence of the random insertion of the injected DNA construct, several founder mice of the new line need to be analyzed for possible differences in phenotype secondary to different insertion sites. The Knock out technique for transgenic production disrupts a specific gene by insertion or homologous recombination creating a null expression or replacement of the gene with a marker to localize it expression. This modification could result in pleiotropic phenotype if the gene is also expressed in tissues other than the target organs. Although the future breeding performance of the newly created model is critical to many studies, it is rarely anticipated that the new integrations could modify the reproductive profile of the new transgenic line. To date, few studies have demonstrated the difference between the parent strain's reproductive performance and the newly developed transgenic model. This study was designed to determine whether a genetic modification, knock out (KO) or transgenics, not anticipated to affect reproductive performance could affect the resulting reproductive profile of the newly developed transgenic mouse. More specifically, this study is designed to study the impact of the genetic modification on the ability of gametes to be fertilized in vitro. We analyzed the reproductive performance of mice with different background strains: FVB/N, C57BL/6 (129Sv/J x C57Bl/6)F1 and outbred CD1((R)) and compared them to mice of the same strain carrying a transgene or KO which was not anticipated to affect fertility. In vitro Fertilization was used to analyze the fertility of the mice. Oocytes from superovulated females were inseminated with sperm of same background. Fertility rate was considered as the percentage of two cell embryos scored 24 h after insemination. The data collected from this study shows that the fertilization rate is affected (reduced to half fold) in some of the transgenic mice compared to the respective Wild Type (WT) mice. For the WT the average fertility rate ranged from 80% (C57BL/6), 90% (FVB/N), 45% (129Sv/J x C57Bl/6)F1 and 43% (CD1). For transgenic mice it was 52% (C57BL/6), 65% (FVB/N), 22% (129Sv/J x C57Bl/6)F1 and 25% (CD1).

Variation in use of technology among vascular access specialists: an analysis of the PICC1 survey.

PubMed

Chopra, Vineet; Kuhn, Latoya; Ratz, David; Winter, Suzanne; Carr, Peter J; Paje, David; Krein, Sarah L

2017-05-15

While the use of technologies such as ultrasound and electrocardiographic (ECG) guidance systems to place peripherally inserted central catheters (PICCs) has grown, little is known about the clinicians who use these tools or their work settings. Using data from a national survey of vascular access specialists, we identified technology users as PICC inserters that: (a) use ultrasound to find a suitable vein for catheter placement; (b) measure catheter-to-vein ratio; and (c) use ECG for PICC placement. Individual and organizational-level characteristics between technology users versus non-users were assessed. Bivariable comparisons were made using Chi-squared or Fisher's exact tests; two-sided alpha with p<0.05 was considered statistically significant. Of the 2762 PICC inserters who accessed the survey, 1518 (55%) provided information regarding technology use. Technology users reported greater experience than non-technology users, with a higher percentage stating they had placed >1000 PICCs (55% vs. 45%, p<0.001). A significantly greater percentage of technology users also reported being certified in vascular access by an external agency than non-technology users (75% vs. 63%, p<0.001). Technology users were more often part of vascular access teams with ≥10 members compared to non-technology users (35% vs. 22%, p<0.001). Some practices also varied between the two groups: for example, use of certain securement devices and dressings differed between technology users and non-users (p<0.001). Technology use by vascular access clinicians while placing PICCs is associated with clinician characteristics, work setting and practice factors. Understanding whether such differences influence clinical care or patient outcomes appears necessary.

Targeted transgene insertion into the CHO cell genome using Cre recombinase-incorporating integrase-defective retroviral vectors.

PubMed

Kawabe, Yoshinori; Shimomura, Takuya; Huang, Shuohao; Imanishi, Suguru; Ito, Akira; Kamihira, Masamichi

2016-07-01

Retroviral vectors have served as efficient gene delivery tools in various biotechnology fields. However, viral DNA is randomly inserted into the genome, which can cause problems, such as insertional mutagenesis and gene silencing. Previously, we reported a site-specific gene integration system, in which a transgene is integrated into a predetermined chromosomal locus of Chinese hamster ovary (CHO) cells using integrase-defective retroviral vectors (IDRVs) and Cre recombinase. In this system, a Cre expression plasmid is transfected into founder cells before retroviral transduction. In practical applications of site-specific gene modification such as for hard-to-transfect cells or for in vivo gene delivery, both the transgene and the Cre protein into retroviral virions should be encapsulate. Here, we generated novel hybrid IDRVs in which viral genome and enzymatically active Cre can be delivered (Cre-IDRVs). Cre-IDRVs encoding marker genes, neomycin resistance and enhanced green fluorescent protein (EGFP), flanked by wild-type and mutated loxP sites were produced using an expression plasmid for a chimeric protein of Cre and retroviral gag-pol. After analyzing the incorporation of the Cre protein into retroviral virions by Western blotting, the Cre-IDRV was infected into founder CHO cells, in which marker genes (hygromycin resistance and red fluorescent protein) flanked with corresponding loxP sites are introduced into the genome. G418-resistant colonies expressing GFP appeared and the site-specific integration of the transgene into the expected chromosomal site was confirmed by PCR and sequencing of amplicons. Moreover, when Cre-IDRV carried a gene expression unit for a recombinant antibody, the recombinant cells in which the antibody expression cassette was integrated in a site-specific manner were generated and the cells produced the recombinant antibody. This method may provide a promising tool to perform site-specific gene modification according to Cre-based cell engineering. Biotechnol. Bioeng. 2016;113: 1600-1610. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

Complete genome of Cobetia marina JCM 21022T and phylogenomic analysis of the family Halomonadaceae

NASA Astrophysics Data System (ADS)

Tang, Xianghai; Xu, Kuipeng; Han, Xiaojuan; Mo, Zhaolan; Mao, Yunxiang

2018-03-01

Cobetia marina is a model proteobacteria in researches on marine biofouling. Its taxonomic nomenclature has been revised many times over the past few decades. To better understand the role of the surface-associated lifestyle of C. marina and the phylogeny of the family Halomonadaceae, we sequenced the entire genome of C. marina JCM 21022T using single molecule real-time sequencing technology (SMRT) and performed comparative genomics and phylogenomics analyses. The circular chromosome was 4 176 300 bp with an average GC content of 62.44% and contained 3 611 predicted coding sequences, 72 tRNA genes, and 21 rRNA genes. The C. marina JCM 21022T genome contained a set of crucial genes involved in surface colonization processes. The comparative genome analysis indicated the significant differences between C. marina JCM 21022T and Cobetia amphilecti KMM 296 (formerly named C. marina KMM 296) resulted from sequence insertions or deletions and chromosomal recombination. Despite these differences, pan and core genome analysis showed similar gene functions between the two strains. The phylogenomic study of the family Halomonadaceae is reported here for the first time. We found that the relationships were well resolved among every genera tested, including Chromohalobacter, Halomonas, Cobetia, Kushneria, Zymobacter, and Halotalea.

Complete genome of Cobetia marina JCM 21022T and phylogenomic analysis of the family Halomonadaceae

NASA Astrophysics Data System (ADS)

Tang, Xianghai; Xu, Kuipeng; Han, Xiaojuan; Mo, Zhaolan; Mao, Yunxiang

2016-09-01

Cobetia marina is a model proteobacteria in researches on marine biofouling. Its taxonomic nomenclature has been revised many times over the past few decades. To better understand the role of the surface-associated lifestyle of C. marina and the phylogeny of the family Halomonadaceae, we sequenced the entire genome of C. marina JCM 21022T using single molecule real-time sequencing technology (SMRT) and performed comparative genomics and phylogenomics analyses. The circular chromosome was 4 176 300 bp with an average GC content of 62.44% and contained 3 611 predicted coding sequences, 72 tRNA genes, and 21 rRNA genes. The C. marina JCM 21022T genome contained a set of crucial genes involved in surface colonization processes. The comparative genome analysis indicated the significant diff erences between C. marina JCM 21022T and Cobetia amphilecti KMM 296 (formerly named C. marina KMM 296) resulted from sequence insertions or deletions and chromosomal recombination. Despite these diff erences, pan and core genome analysis showed similar gene functions between the two strains. The phylogenomic study of the family Halomonadaceae is reported here for the first time. We found that the relationships were well resolved among every genera tested, including Chromohalobacter, Halomonas, Cobetia, Kushneria, Zymobacter, and Halotalea.

Development of a Newcastle disease virus vector expressing a foreign gene through an internal ribosomal entry site provides direct proof for a sequential transcription mechanism

USDA-ARS?s Scientific Manuscript database

Objectives: Newcastle disease virus (NDV), a member of the Paramxoviridae family, has been developed as a vector to express foreign genes for vaccine and gene therapy purposes. The foreign genes are usually inserted into a non-coding region of the NDV genome as an independent transcription unit (ITU...

Mechanism for DNA transposons to generate introns on genomic scales

PubMed Central

Huff, Jason T.; Zilberman, Daniel; Roy, Scott W.

2017-01-01

Discovered four decades ago, the existence of introns was one of the most unexpected findings in molecular biology1. Introns are sequences interrupting genes that must be removed as part of mRNA production. Genome sequencing projects have documented that most eukaryotic genes contain at least one and frequently many introns2,3. Comparison of these genomes reveals a history of long evolutionary periods with little intron gain punctuated by episodes of rapid, extensive gain2,3. However, no detailed mechanism for such episodic intron generation has been empirically supported on a sufficient scale, despite several proposals4–8. Here we show how short non-autonomous DNA transposons independently generated hundreds to thousands of introns in the prasinophyte Micromonas pusilla and the pelagophyte Aureococcus anophagefferens. Each transposon carries one splice site. The other splice site is co-opted from gene sequence duplicated upon transposon insertion, allowing perfect splicing out of RNA. The distributions of sequences that can be co-opted are biased with respect to codons, and phasing of transposon-generated introns is similarly biased. These transposons insert between preexisting nucleosomes, so that multiple nearby insertions generate nucleosome-sized intervening segments. Thus, transposon insertion and sequence co-option may explain the intron phase biases2 and prevalence of nucleosome-sized exons9 observed in eukaryotes. Overall, the two independent examples of proliferating elements illustrate a general DNA transposon mechanism plausibly accounting for episodes of rapid, extensive intron gain during eukaryotic evolution2,3. PMID:27760113

Endogenous Retroviruses: With Us and Against Us

NASA Astrophysics Data System (ADS)

Meyer, Thomas J.; Rosenkrantz, Jimi L.; Carbone, Lucia; Chavez, Shawn L.

2017-04-01

Mammalian genomes are scattered with thousands of copies of endogenous retroviruses (ERVs), mobile genetic elements that are relics of ancient retroviral infections. After inserting copies into the germ line of a host, most ERVs accumulate mutations that prevent the normal assembly of infectious viral particles, becoming trapped in host genomes and unable to leave to infect other cells. While most copies of ERVs are inactive, some are transcribed and encode the proteins needed to generate new insertions at novel loci. In some cases, old copies are removed via recombination and other mechanisms. This creates a shifting landscape of ERV copies within host genomes. New insertions can disrupt normal expression of nearby genes via directly inserting into key regulatory elements or by containing regulatory motifs within their sequences. Further, the transcriptional silencing of ERVs via epigenetic modification may result in changes to the epigenetic regulation of adjacent genes. In these ways, ERVs can be potent sources of regulatory disruption as well as genetic innovation. Here, we provide a brief review of the association between ERVs and gene expression, especially as observed in pre-implantation development and placentation. Moreover, we will describe the roles ERVs may play in somatic tissues, mostly in the context of human disease, including cancer, neurodegenerative disorders, and schizophrenia. Lastly, we discuss the recent discovery that some ERVs may have been pressed into the service of their host genomes to aid in the innate immune response to exogenous viral infections.

Complete genome sequence and the expression pattern of plasmids of the model ethanologen Zymomonas mobilis ZM4 and its xylose-utilizing derivatives 8b and 2032.

PubMed

Yang, Shihui; Vera, Jessica M; Grass, Jeff; Savvakis, Giannis; Moskvin, Oleg V; Yang, Yongfu; McIlwain, Sean J; Lyu, Yucai; Zinonos, Irene; Hebert, Alexander S; Coon, Joshua J; Bates, Donna M; Sato, Trey K; Brown, Steven D; Himmel, Michael E; Zhang, Min; Landick, Robert; Pappas, Katherine M; Zhang, Yaoping

2018-01-01

Zymomonas mobilis is a natural ethanologen being developed and deployed as an industrial biofuel producer. To date, eight Z. mobilis strains have been completely sequenced and found to contain 2-8 native plasmids. However, systematic verification of predicted Z. mobilis plasmid genes and their contribution to cell fitness has not been hitherto addressed. Moreover, the precise number and identities of plasmids in Z. mobilis model strain ZM4 have been unclear. The lack of functional information about plasmid genes in ZM4 impedes ongoing studies for this model biofuel-producing strain. In this study, we determined the complete chromosome and plasmid sequences of ZM4 and its engineered xylose-utilizing derivatives 2032 and 8b. Compared to previously published and revised ZM4 chromosome sequences, the ZM4 chromosome sequence reported here contains 65 nucleotide sequence variations as well as a 2400-bp insertion. Four plasmids were identified in all three strains, with 150 plasmid genes predicted in strain ZM4 and 2032, and 153 plasmid genes predicted in strain 8b due to the insertion of heterologous DNA for expanded substrate utilization. Plasmid genes were then annotated using Blast2GO, InterProScan, and systems biology data analyses, and most genes were found to have apparent orthologs in other organisms or identifiable conserved domains. To verify plasmid gene prediction, RNA-Seq was used to map transcripts and also compare relative gene expression under various growth conditions, including anaerobic and aerobic conditions, or growth in different concentrations of biomass hydrolysates. Overall, plasmid genes were more responsive to varying hydrolysate concentrations than to oxygen availability. Additionally, our results indicated that although all plasmids were present in low copy number (about 1-2 per cell), the copy number of some plasmids varied under specific growth conditions or due to heterologous gene insertion. The complete genome of ZM4 and two xylose-utilizing derivatives is reported in this study, with an emphasis on identifying and characterizing plasmid genes. Plasmid gene annotation, validation, expression levels at growth conditions of interest, and contribution to host fitness are reported for the first time.

Cell Cycle Status of CD34+ Hemopoietic Stem Cells Determines Lentiviral Integration in Actively Transcribed and Development-related Genes

PubMed Central

Papanikolaou, Eleni; Paruzynski, Anna; Kasampalidis, Ioannis; Deichmann, Annette; Stamateris, Evangelos; Schmidt, Manfred; von Kalle, Christof; Anagnou, Nicholas P

2015-01-01

Gene therapy utilizing lentiviral-vectors (LVs) is postulated as a dynamic therapeutic alternative for monogenic diseases. However, retroviral gene transfer may cause insertional mutagenesis. Although, such risks had been originally estimated as extremely low, several reports of leukemias or clonal dominance, have led to a re-evaluation of the mechanisms operating in insertional mutagenesis. Therefore, unraveling the mechanism of retroviral integration is mandatory toward safer gene therapy applications. In the present study, we undertook an experimental approach which enabled direct correlation of the cell cycle stage of the target cell with the integration profile of LVs. CD34+ cells arrested at different stages of cell cycle, were transduced with a GFP-LV. LAM-PCR was employed for integration site detection, followed by microarray analysis to correlate transcribed genes with integration sites. The results indicate that ~10% of integration events occurred in actively transcribed genes and that the cell cycle stage of target cells affects integration pattern. Specifically, use of thymine promoted a safer profile, since it significantly reduced integration within cell cycle-related genes, while we observed increased possibility for integration into genes related to development, and decreased possibility for integration within cell cycle and cancer-related genes, when transduction occurs during mitosis. PMID:25523760

Insertional Mutagenesis for Genes involved in Otic/Vestibular Development and Function in Xenopus Tropicalis

NASA Technical Reports Server (NTRS)

Torrejon, Marcela; Li, Erica; Nguyen, Minh; Winfree, Seth; Wang, Esther; Reinsch, Sigrid; Dalton, Bonnie (Technical Monitor)

2002-01-01

Sensitivity to gravity is essential for spatial orientation. Consequently, the gravity receptor system is one of the phylogenetically oldest sensory systems, and the special adaptations that enhance sensitivity to gravity are highly conserved. The main goal of this project is to use Xenopus (frog) to identify genes expressed during vestibular and auditory development. These studies will lead a better understanding of the molecular mechanisms involved in vestibular and auditory development and function. We are using a gene-trap approach in Xenopus tropicalis with the green fluorescent protein (GFP) gene as the transgene reporter. GFP expression occurs only when the GFP gene is correctly integrated in actively transcribed genes. Using the GFP as a tag we can easily identify and clone the mutated gene. In addition, we can study the function of the mutated gene by analyzing the defects generated by insertion of the GFP transgene. To date we have tissue specific GFP expression in X. tropicalis including expression in ear, neural tube, kidney, muscle, eyes and nose. Our transgenic animals will soon reach maturity so that we can outcross them and analyze their progeny. Our next goal is to isolate RNA from our transgenics and clone the tagged genes using RACE-PCR. Currently we are optimizing the RACE-PCR method using transgenics with crystallin GFP expression.

Evaluation of dowel bar inserter practices in PCC pavements with magnetic tomography technology : final report.

DOT National Transportation Integrated Search

2016-12-01

Dowel Bar Inserters (DBI) are automated mechanical equipment that position dowel bars in Portland Cement Concrete (PCC) after concrete is placed. Compared to the alternative approach, which is using dowel baskets, DBIs offer advantages in cost and sp...

A VNTR element associated with steroid sulfatase gene deletions stimulates recombination in cultured cells

DOE Office of Scientific and Technical Information (OSTI.GOV)

Gong, Y.; Li, X.M.; Shapiro, L.J.

1994-09-01

Steroid sulfatase deficiency is a common genetic disorder, with a prevalence of approximately one in every 3500 males world wide. About 90% of these patients have complete gene deletions, which appear to result from recombination between members of a low-copy repeat family (CRI-232 is the prototype) that flank the gene. RU1 and RU2 are two VNTR elements found within each of these family members. RU1 consists of 30 bp repeating units and its length shows minimal variation among individuals. The RU2 element consists of repeating sequences which are highly asymmetric, with about 90% purines and no C`s on one strand,more » and range from 0.6 kb to over 23 kb among different individuals. We conducted a study to determine if the RU1 or RU2 elements can promote recombination in an in vivo test system. We inserted these elements adjacent to the neo gene in each of two pSV2neo derivatives, one of which has a deletion in the 5{prime} portion of the neo gene and the other having a deletion in the 3{prime} portion. These plasmids were combined and used to transfect EJ cells. Survival of cells in G418 indicates restoration of a functional neo gene by recombination between two deletion constructs. Thus counting G418 resistant colonies gives a quantitative measure of the enhancement of recombination by the inserted VNTR elements. The results showed no effect on recombination by the inserted RU1 element (compared to the insertion of a nonspecific sequence), while the RU2 element stimulated recombination by 3.5-fold (P<0.01). A separate set of constructs placed RU1 or RU2 within the intron of an exon trapping vector. Following tranfection of cells, recombination events were monitored by a PCR assay that detected the approximation of primer binding sites (as a result of recombination). These studies showed that, as in the first set of experiments, the highly variable RU2 element is capable of stimulating somatic recombination in mammalian cells.« less

The Sequences of 1504 Mutants in the Model Rice Variety Kitaake Facilitate Rapid Functional Genomic Studies.

PubMed

Li, Guotian; Jain, Rashmi; Chern, Mawsheng; Pham, Nikki T; Martin, Joel A; Wei, Tong; Schackwitz, Wendy S; Lipzen, Anna M; Duong, Phat Q; Jones, Kyle C; Jiang, Liangrong; Ruan, Deling; Bauer, Diane; Peng, Yi; Barry, Kerrie W; Schmutz, Jeremy; Ronald, Pamela C

2017-06-01

The availability of a whole-genome sequenced mutant population and the cataloging of mutations of each line at a single-nucleotide resolution facilitate functional genomic analysis. To this end, we generated and sequenced a fast-neutron-induced mutant population in the model rice cultivar Kitaake ( Oryza sativa ssp japonica ), which completes its life cycle in 9 weeks. We sequenced 1504 mutant lines at 45-fold coverage and identified 91,513 mutations affecting 32,307 genes, i.e., 58% of all rice genes. We detected an average of 61 mutations per line. Mutation types include single-base substitutions, deletions, insertions, inversions, translocations, and tandem duplications. We observed a high proportion of loss-of-function mutations. We identified an inversion affecting a single gene as the causative mutation for the short-grain phenotype in one mutant line. This result reveals the usefulness of the resource for efficient, cost-effective identification of genes conferring specific phenotypes. To facilitate public access to this genetic resource, we established an open access database called KitBase that provides access to sequence data and seed stocks. This population complements other available mutant collections and gene-editing technologies. This work demonstrates how inexpensive next-generation sequencing can be applied to generate a high-density catalog of mutations. © 2017 American Society of Plant Biologists. All rights reserved.

The Sequences of 1,504 Mutants in the Model Rice Variety Kitaake Facilitate Rapid Functional Genomic Studies

DOE PAGES

Li, Guotian; Jain, Rashmi; Chern, Mawsheng; ...

2017-06-02

The availability of a whole-genome sequenced mutant population and the cataloging of mutations of each line at a single-nucleotide resolution facilitate functional genomic analysis. To this end, we generated and sequenced a fast-neutron-induced mutant population in the model rice cultivar Kitaake (Oryza sativa ssp japonica), which completes its life cycle in 9 weeks. We sequenced 1504 mutant lines at 45-fold coverage and identified 91,513 mutations affecting 32,307 genes, i.e., 58% of all rice genes. We detected an average of 61 mutations per line. Mutation types include single-base substitutions, deletions, insertions, inversions, translocations, and tandem duplications. We observed a high proportionmore » of loss-of-function mutations. We identified an inversion affecting a single gene as the causative mutation for the short-grain phenotype in one mutant line. This result reveals the usefulness of the resource for efficient, cost-effective identification of genes conferring specific phenotypes. To facilitate public access to this genetic resource, we established an open access database called KitBase that provides access to sequence data and seed stocks. This population complements other available mutant collections and gene-editing technologies. In conclusion, this work demonstrates how inexpensive next-generation sequencing can be applied to generate a high-density catalog of mutations.« less

Complementary DNA cloning of the pear 1-aminocyclopropane-1-carboxylic acid oxidase gene and agrobacterium-mediated anti-sense genetic transformation.

PubMed

Qi, Jing; Dong, Zhen; Zhang, Yu-Xing

2015-12-01

The aim of the present study was to genetically modify plantlets of the Chinese yali pear to reduce their expression of ripening-associated 1-aminocyclopropane-1-carboxylic acid oxidase (ACO) and therefore increase the shelf-life of the fruit. Primers were designed with selectivity for the conserved regions of published ACO gene sequences, and yali complementary DNA (cDNA) cloning was performed by reverse transcription quantitative polymerase chain reaction (PCR). The obtained cDNA fragment contained 831 base pairs, encoding 276 amino acid residues, and shared no less than 94% nucleotide sequence identity with other published ACO genes. The cDNA fragment was inversely inserted into a pBI121 expression vector, between the cauliflower mosaic virus 35S promoter and the nopaline synthase terminator, in order to construct the anti‑sense expression vector of the ACO gene; it was transfected into cultured yali plants using Agrobacterium LBA4404. Four independent transgenic lines of pear plantlets were obtained and validated by PCR analysis. A Southern blot assay revealed that there were three transgenic lines containing a single copy of exogenous gene and one line with double copies. The present study provided germplasm resources for the cultivation of novel storage varieties of pears, therefore providing a reference for further applications of anti‑sense RNA technology in the genetic improvement of pears and other fruit.

Efficient transformation and expression of gfp gene in Valsa mali var. mali.

PubMed

Chen, Liang; Sun, Gengwu; Wu, Shujing; Liu, Huixiang; Wang, Hongkai

2015-01-01

Valsa mali var. mali, the causal agent of valsa canker of apple, causes great loss of apple production in apple producing regions. The pathogenic mechanism of the pathogen has not been studied extensively, thus a suitable gene marker for pathogenic invasion analysis and a random insertion of T-DNA for mutants are desirable. In this paper, we reported the construction of a binary vector pKO1-HPH containing a positive selective gene hygromycin phosphotransferase (hph), a reporter gene gfp conferring green fluorescent protein, and an efficient protocol for V. mali var. mali transformation mediated by Agrobacterium tumefaciens. A transformation efficiency up to about 75 transformants per 10(5) conidia was achieved when co-cultivation of V. mali var. mali and A. tumefaciens for 48 h in A. tumefaciens inductive medium agar plates. The insertions of hph gene and gfp gene into V. mali var. mali genome verified by polymerase chain reaction and southern blot analysis showed that 10 randomly-selected transformants exhibited a single, unique hybridization pattern. This is the first report of A. tumefaciens-mediated transformation of V. mali var mali carrying a 'reporter' gfp gene that stably and efficiently expressed in the transformed V. mali var. mali species.

The Identification and Differentiation between Burkholderia mallei and Burkholderia pseudomallei Using One Gene Pyrosequencing.

PubMed

Gilling, Damian H; Luna, Vicki Ann; Pflugradt, Cori

2014-01-01

The etiologic agents for melioidosis and glanders, Burkholderia mallei and Burkholderia pseudomallei respectively, are genetically similar making identification and differentiation from other Burkholderia species and each other challenging. We used pyrosequencing to determine the presence or absence of an insertion sequence IS407A within the flagellin P (fliP) gene and to exploit the difference in orientation of this gene in the two species. Oligonucleotide primers were designed to selectively target the IS407A-fliP interface in B. mallei and the fliP gene specifically at the insertion point in B. pseudomallei. We then examined DNA from ten B. mallei, ten B. pseudomallei, 14 B. cepacia, eight other Burkholderia spp., and 17 other bacteria. Resultant pyrograms encompassed the target sequence that contained either the fliP gene with the IS407A interruption or the fully intact fliP gene with 100% sensitivity and 100% specificity. These pyrosequencing assays based upon a single gene enable investigators to reliably identify the two species. The information obtained by these assays provides more knowledge of the genomic reduction that created the new species B. mallei from B. pseudomallei and may point to new targets that can be exploited in the future.

PIMMS (Pragmatic Insertional Mutation Mapping System) Laboratory Methodology a Readily Accessible Tool for Identification of Essential Genes in Streptococcus

PubMed Central

Blanchard, Adam M.; Egan, Sharon A.; Emes, Richard D.; Warry, Andrew; Leigh, James A.

2016-01-01

The Pragmatic Insertional Mutation Mapping (PIMMS) laboratory protocol was developed alongside various bioinformatics packages (Blanchard et al., 2015) to enable detection of essential and conditionally essential genes in Streptococcus and related bacteria. This extended the methodology commonly used to locate insertional mutations in individual mutants to the analysis of mutations in populations of bacteria. In Streptococcus uberis, a pyogenic Streptococcus associated with intramammary infection and mastitis in ruminants, the mutagen pGhost9:ISS1 was shown to integrate across the entire genome. Analysis of >80,000 mutations revealed 196 coding sequences, which were not be mutated and a further 67 where mutation only occurred beyond the 90th percentile of the coding sequence. These sequences showed good concordance with sequences within the database of essential genes and typically matched sequences known to be associated with basic cellular functions. Due to the broad utility of this mutagen and the simplicity of the methodology it is anticipated that PIMMS will be of value to a wide range of laboratories in functional genomic analysis of a wide range of Gram positive bacteria (Streptococcus, Enterococcus, and Lactococcus) of medical, veterinary, and industrial significance. PMID:27826289

Evaluation of Measles Vaccine Virus as a Vector to Deliver Respiratory Syncytial Virus Fusion Protein or Epstein-Barr Virus Glycoprotein gp350

PubMed Central

Mok, Hoyin; Cheng, Xing; Xu, Qi; Zengel, James R; Parhy, Bandita; Zhao, Jackie; Wang, C. Kathy; Jin, Hong

2012-01-01

Live attenuated recombinant measles vaccine virus (MV) Edmonston-Zagreb (EZ) strain was evaluated as a viral vector to express the ectodomains of fusion protein of respiratory syncytial virus (RSV F) or glycoprotein 350 of Epstein-Barr virus (EBV gp350) as candidate vaccines for prophylaxis of RSV and EBV. The glycoprotein gene was inserted at the 1st or the 3rd position of the measles virus genome and the recombinant viruses were generated. Insertion of the foreign gene at the 3rd position had a minimal impact on viral replication in vitro. RSV F or EBV gp350 protein was secreted from infected cells. In cotton rats, EZ-RSV F and EZ-EBV gp350 induced MV- and insert-specific antibody responses. In addition, both vaccines also induced insert specific interferon gamma (IFN-γ) secreting T cell response. EZ-RSV F protected cotton rats from pulmonary replication of RSV A2 challenge infection. In rhesus macaques, although both EZ-RSV F and EZ-EBV gp350 induced MV specific neutralizing antibody responses, only RSV F specific antibody response was detected. Thus, the immunogenicity of the foreign antigens delivered by measles vaccine virus is dependent on the nature of the insert and the animal models used for vaccine evaluation. PMID:22383906

48 CFR 1852.227-70 - New technology.

Code of Federal Regulations, 2010 CFR

2010-10-01

... 48 Federal Acquisition Regulations System 6 2010-10-01 2010-10-01 true New technology. 1852.227-70... New technology. As prescribed in 1827.303-70(b), insert the following clause: New Technology (NOV 1998... administration of this New Technology clause within six months of conception and/or first actual reduction to...

Structure and transcriptional impact of divergent repetitive elements inserted within Phanerochaete chrysosporium strain RP-78 genes

Treesearch

Luis F. Larrondo; Paulo Canessa; Rafael Vicuna; Philip Stewart; Amber Vanden Wymelenberg; Dan Cullen

2007-01-01

We describe the structure, organization, and transcriptional impact of repetitive elements within the lignin-degrading basidiomycete, Phanerochaete chrysosporium. Searches of the P. chrysosporium genome revealed five copies of pce1, a 1,750-nt non-autonomous, class II element. Alleles encoding a putative glucosyltransferase and a cytochrome P450 harbor pce insertions...

Stx1 prophage excision in Escherichia coli strain PA20 confers strong curli and biofilm formation by restoring native mlrA

USDA-ARS?s Scientific Manuscript database

Prophage insertions in Escherichia coli O157:H7 mlrA contribute to the low expression of curli fimbriae and biofilm observed in many clinical isolates. Varying levels of CsgD-dependent curli/biofilm expression are restored to strains bearing prophage insertions in mlrA by mutation of regulatory gene...

Origin of mitochondria by intracellular enslavement of a photosynthetic purple bacterium

PubMed Central

Cavalier-Smith, Thomas

2006-01-01

Mitochondria originated by permanent enslavement of purple non-sulphur bacteria. These endosymbionts became organelles through the origin of complex protein-import machinery and insertion into their inner membranes of protein carriers for extracting energy for the host. A chicken-and-egg problem exists: selective advantages for evolving import machinery were absent until inner membrane carriers were present, but this very machinery is now required for carrier insertion. I argue here that this problem was probably circumvented by conversion of the symbiont protein-export machinery into protein-import machinery, in three phases. I suggest that the first carrier entered the periplasmic space via pre-existing β-barrel proteins in the bacterial outer membrane that later became Tom40, and inserted into the inner membrane probably helped by a pre-existing inner membrane protein, thereby immediately providing the protoeukaryote host with photosynthesate. This would have created a powerful selective advantage for evolving more efficient carrier import by inserting Tom70 receptors. Massive gene transfer to the nucleus inevitably occurred by mutation pressure. Finally, pressure from harmful, non-selected gene transfer to the nucleus probably caused evolution of the presequence mechanism, and photosynthesis was lost. PMID:16822756

Transposable elements and insecticide resistance.

PubMed

Rostant, Wayne G; Wedell, Nina; Hosken, David J

2012-01-01

Transposable elements (TEs) are mobile DNA sequences that are able to copy themselves within a host genome. They were initially characterized as selfish genes because of documented or presumed costs to host fitness, but it has become increasingly clear that not all TEs reduce host fitness. A good example of TEs benefiting hosts is seen with insecticide resistance, where in a number of cases, TE insertions near specific genes confer resistance to these man-made products. This is particularly true of Accord and associated TEs in Drosophila melanogaster and Doc insertions in Drosophila simulans. The first of these insertions also has sexually antagonistic fitness effects in the absence of insecticides, and although the magnitude of this effect depends on the genetic background in which Accord finds itself, this represents an excellent example of intralocus sexual conflict where the precise allele involved is well characterized. We discuss this finding and the role of TEs in insecticide resistance. We also highlight areas for further research, including the need for surveys of the prevalence and fitness consequences of the Doc insertion and how Drosophila can be used as models to investigate resistance in pest species. Copyright © 2012 Elsevier Inc. All rights reserved.

Construction and Cloning of Reporter-Tagged Replicon cDNA for an In Vitro Replication Study of Murine Norovirus-1 (MNV-1)

PubMed Central

Ahmad, Muhammad Khairi; Tabana, Yasser M; Ahmed, Mowaffaq Adam; Sandai, Doblin Anak; Mohamed, Rafeezul; Ismail, Ida Shazrina; Zulkiflie, Nurulisa; Yunus, Muhammad Amir

2017-01-01

Background A norovirus maintains its viability, infectivity and virulence by its ability to replicate. However, the biological mechanisms of the process remain to be explored. In this work, the NanoLuc™ Luciferase gene was used to develop a reporter-tagged replicon system to study norovirus replication. Methods The NanoLuc™ Luciferase reporter protein was engineered to be expressed as a fusion protein for MNV-1 minor capsid protein, VP2. The foot-and-mouth disease virus 2A (FMDV2A) sequence was inserted between the 3′end of the reporter gene and the VP2 start sequence to allow co-translational ‘cleavage’ of fusion proteins during intracellular transcript expression. Amplification of the fusion gene was performed using a series of standard and overlapping polymerase chain reactions. The resulting amplicon was then cloned into three readily available backbones of MNV-1 cDNA clones. Results Restriction enzyme analysis indicated that the NanoLucTM Luciferase gene was successfully inserted into the parental MNV-1 cDNA clone. The insertion was further confirmed by using DNA sequencing. Conclusion NanoLuc™ Luciferase-tagged MNV-1 cDNA clones were successfully engineered. Such clones can be exploited to develop robust experimental assays for in vitro assessments of viral RNA replication. PMID:29379384

A Genome-Wide Functional Investigation into the Roles of Receptor-Like Proteins in Arabidopsis1[W][OA

PubMed Central

Wang, Guodong; Ellendorff, Ursula; Kemp, Ben; Mansfield, John W.; Forsyth, Alec; Mitchell, Kathy; Bastas, Kubilay; Liu, Chun-Ming; Woods-Tör, Alison; Zipfel, Cyril; de Wit, Pierre J.G.M.; Jones, Jonathan D.G.; Tör, Mahmut; Thomma, Bart P.H.J.

2008-01-01

Receptor-like proteins (RLPs) are cell surface receptors that typically consist of an extracellular leucine-rich repeat domain, a transmembrane domain, and a short cytoplasmatic tail. In several plant species, RLPs have been found to play a role in disease resistance, such as the tomato (Solanum lycopersicum) Cf and Ve proteins and the apple (Malus domestica) HcrVf2 protein that mediate resistance against the fungal pathogens Cladosporium fulvum, Verticillium spp., and Venturia inaequalis, respectively. In addition, RLPs play a role in plant development; Arabidopsis (Arabidopsis thaliana) TOO MANY MOUTHS (TMM) regulates stomatal distribution, while Arabidopsis CLAVATA2 (CLV2) and its functional maize (Zea mays) ortholog FASCINATED EAR2 regulate meristem maintenance. In total, 57 RLP genes have been identified in the Arabidopsis genome and a genome-wide collection of T-DNA insertion lines was assembled. This collection was functionally analyzed with respect to plant growth and development and sensitivity to various stress responses, including susceptibility toward pathogens. A number of novel developmental phenotypes were revealed for our CLV2 and TMM insertion mutants. In addition, one AtRLP gene was found to mediate abscisic acid sensitivity and another AtRLP gene was found to influence nonhost resistance toward Pseudomonas syringae pv phaseolicola. This genome-wide collection of Arabidopsis RLP gene T-DNA insertion mutants provides a tool for future investigations into the biological roles of RLPs. PMID:18434605

A Pseudomonas putida double mutant deficient in butanol assimilation: a promising step for engineering a biological biofuel production platform.

PubMed

Cuenca, María Del Sol; Molina-Santiago, Carlos; Gómez-García, María R; Ramos, Juan L

2016-03-01

Biological production in heterologous hosts is of interest for the production of the C4 alcohol (butanol) and other chemicals. However, some hurdles need to be overcome in order to achieve an economically viable process; these include avoiding the consumption of butanol and maintaining tolerance to this solvent during production. Pseudomonas putida is a potential host for solvent production; in order to further adapt P. putida to this role, we generated mini-Tn5 mutant libraries in strain BIRD-1 that do not consume butanol. We analyzed the insertion site of the mini-Tn5 in a mutant that was deficient in assimilation of butanol using arbitrary PCR followed by Sanger sequencing and found that the transposon was inserted in the malate synthase B gene. Here, we show that in a second round of mutagenesis a double mutant unable to take up butanol had an insertion in a gene coding for a multisensor hybrid histidine kinase. The genetic context of the histidine kinase sensor revealed the presence of a set of genes potentially involved in butanol assimilation; qRT-PCR analysis showed induction of this set of genes in the wild type and the malate synthase mutant but not in the double mutant. © FEMS 2016. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

A genome-wide inducible phenotypic screen identifies antisense RNA constructs silencing Escherichia coli essential genes

PubMed Central

Meng, Jia; Kanzaki, Gregory; Meas, Diane; Lam, Christopher K.; Crummer, Heather; Tain, Justina; Xu, H. Howard

2013-01-01

Regulated antisense RNA (asRNA) expression has been employed successfully in Gram-positive bacteria for genome-wide essential gene identification and drug target determination. However, there have been no published reports describing the application of asRNA gene silencing for comprehensive analyses of essential genes in Gram-negative bacteria. In this study, we report the first genome-wide identification of asRNA constructs for essential genes in Escherichia coli. We screened 250,000 library transformants for conditional growth-inhibitory recombinant clones from two shot-gun genomic libraries of E. coli using a paired-termini expression vector (pHN678). After sequencing plasmid inserts of 675 confirmed inducer-sensitive cell clones, we identified 152 separate asRNA constructs of which 134 inserts came from essential genes while 18 originated from non-essential genes (but share operons with essential genes). Among the 79 individual essential genes silenced by these asRNA constructs, 61 genes (77%) engage in processes related to protein synthesis. The cell-based assays of an asRNA clone targeting fusA (encoding elongation factor G) showed that the induced cells were sensitized 12 fold to fusidic acid, a known specific inhibitor. Our results demonstrate the utility of the paired-termini expression vector and feasibility of large-scale gene silencing in E. coli using regulated asRNA expression. PMID:22268863

CRISPR-mediated direct mutation of cancer genes in the mouse liver

PubMed Central

Xue, Wen; Chen, Sidi; Yin, Hao; Tammela, Tuomas; Papagiannakopoulos, Thales; Joshi, Nikhil S.; Cai, Wenxin; Yang, Gillian; Bronson, Roderick; Crowley, Denise G.; Zhang, Feng; Anderson, Daniel G.; Sharp, Phillip A.; Jacks, Tyler

2014-01-01

The study of cancer genes in mouse models has traditionally relied on genetically-engineered strains made via transgenesis or gene targeting in embryonic stem (ES) cells1. Here we describe a new method of cancer model generation using the CRISPR/Cas system in vivo in wild-type mice. We have used hydrodynamic injection to deliver a CRISPR plasmid DNA expressing Cas9 and single guide RNAs (sgRNAs)2–4 to the liver and directly target the tumor suppressor genes Pten5 and p536, alone and in combination. CRISPR-mediated Pten mutation led to elevated Akt phosphorylation and lipid accumulation in hepatocytes, phenocopying the effects of deletion of the gene using Cre-LoxP technology7, 8. Simultaneous targeting of Pten and p53 induced liver tumors that mimicked those caused by Cre-loxP-mediated deletion of Pten and p53. DNA sequencing of liver and tumor tissue revealed insertion or deletion (indel) mutations of the tumor suppressor genes, including bi-allelic mutations of both Pten and p53 in tumors. Furthermore, co-injection of Cas9 plasmids harboring sgRNAs targeting the β-Catenin gene (Ctnnb1) and a single-stranded DNA (ssDNA) oligonucleotide donor carrying activating point mutations led to the generation of hepatocytes with nuclear localization of β-Catenin. This study demonstrates the feasibility of direct mutation of tumor suppressor genes and oncogenes in the liver using the CRISPR/Cas system, which presents a new avenue for rapid development of liver cancer models and functional genomics. PMID:25119044

Safety of gene therapy: new insights to a puzzling case.

PubMed

Rothe, Michael; Schambach, Axel; Biasco, Luca

2014-01-01

Over the last few years, the transfer of therapeutic genes via gammaretro- or lentiviral vector systems has proven its virtue as an alternative treatment for a series of genetic disorders. The number of approved phase I/II clinical trials, especially for rare diseases, is steadily increasing, but the overall hurdles to become a broadly acceptable therapy remain numerous. The efforts by clinicians and basic scientists have tremendously improved the knowledge available about feasibility and biosafety of gene therapy. Nonetheless, despite the generation of a plethora of clinical and preclinical safety data, we still lack sufficiently powerful assays to predictively assess the exact levels of toxicity that might be observed in any given clinical gene therapy. Insertional mutagenesis is one of the major concerns when using integrating vectors for permanent cell modification, and the occurrence of adverse events related to genotoxicity, in early gene therapy trials, has refrained the field of gene therapy from emerging further. In this review, we provided a comprehensive overview on the basic principles and potential co-factors concurring in the generation of adverse events reported in gene therapy clinical trials using integrating vectors. Additionally, we summarized the available systems to assess genotoxicity at the preclinical level and we shed light on the issues affecting the predictive value of these assays when translating their results into the clinical arena. In the last section of the review we briefly touched on the future trends and how they could increase the safety of gene therapy employing integrating vector technology to take it to the next level.

CRISPR-mediated direct mutation of cancer genes in the mouse liver.

PubMed

Xue, Wen; Chen, Sidi; Yin, Hao; Tammela, Tuomas; Papagiannakopoulos, Thales; Joshi, Nikhil S; Cai, Wenxin; Yang, Gillian; Bronson, Roderick; Crowley, Denise G; Zhang, Feng; Anderson, Daniel G; Sharp, Phillip A; Jacks, Tyler

2014-10-16

The study of cancer genes in mouse models has traditionally relied on genetically-engineered strains made via transgenesis or gene targeting in embryonic stem cells. Here we describe a new method of cancer model generation using the CRISPR/Cas (clustered regularly interspaced short palindromic repeats/CRISPR-associated proteins) system in vivo in wild-type mice. We used hydrodynamic injection to deliver a CRISPR plasmid DNA expressing Cas9 and single guide RNAs (sgRNAs) to the liver that directly target the tumour suppressor genes Pten (ref. 5) and p53 (also known as TP53 and Trp53) (ref. 6), alone and in combination. CRISPR-mediated Pten mutation led to elevated Akt phosphorylation and lipid accumulation in hepatocytes, phenocopying the effects of deletion of the gene using Cre-LoxP technology. Simultaneous targeting of Pten and p53 induced liver tumours that mimicked those caused by Cre-loxP-mediated deletion of Pten and p53. DNA sequencing of liver and tumour tissue revealed insertion or deletion mutations of the tumour suppressor genes, including bi-allelic mutations of both Pten and p53 in tumours. Furthermore, co-injection of Cas9 plasmids harbouring sgRNAs targeting the β-catenin gene and a single-stranded DNA oligonucleotide donor carrying activating point mutations led to the generation of hepatocytes with nuclear localization of β-catenin. This study demonstrates the feasibility of direct mutation of tumour suppressor genes and oncogenes in the liver using the CRISPR/Cas system, which presents a new avenue for rapid development of liver cancer models and functional genomics.

Knockout of exogenous EGFP gene in porcine somatic cells using zinc-finger nucleases

DOE Office of Scientific and Technical Information (OSTI.GOV)

Watanabe, Masahito; Department of Life Sciences, School of Agriculture, Meiji University, 1-1-1 Higashimita, Tama-ku, Kawasaki, Kanagawa 214-8571; Umeyama, Kazuhiro

2010-11-05

Research highlights: {yields} EGFP gene integrated in porcine somatic cells could be knocked out using the ZFN-KO system. {yields} ZFNs induced targeted mutations in porcine primary cultured cells. {yields} Complete absence of EGFP fluorescence was confirmed in ZFN-treated cells. -- Abstract: Zinc-finger nucleases (ZFNs) are expected as a powerful tool for generating gene knockouts in laboratory and domestic animals. Currently, it is unclear whether this technology can be utilized for knocking-out genes in pigs. Here, we investigated whether knockout (KO) events in which ZFNs recognize and cleave a target sequence occur in porcine primary cultured somatic cells that harbor themore » exogenous enhanced green fluorescent protein (EGFP) gene. ZFN-encoding mRNA designed to target the EGFP gene was introduced by electroporation into the cell. Using the Surveyor nuclease assay and flow cytometric analysis, we confirmed ZFN-induced cleavage of the target sequence and the disappearance of EGFP fluorescence expression in ZFN-treated cells. In addition, sequence analysis revealed that ZFN-induced mutations such as base substitution, deletion, or insertion were generated in the ZFN cleavage site of EGFP-expression negative cells that were cloned from ZFN-treated cells, thereby showing it was possible to disrupt (i.e., knock out) the function of the EGFP gene in porcine somatic cells. To our knowledge, this study provides the first evidence that the ZFN-KO system can be applied to pigs. These findings may open a new avenue to the creation of gene KO pigs using ZFN-treated cells and somatic cell nuclear transfer.« less

Cercosporin-deficient mutants by plasmid tagging in the asexual fungus Cercospora nicotianae.

PubMed

Chung, K-R; Ehrenshaft, M; Wetzel, D K; Daub, M E

2003-11-01

We have successfully adapted plasmid insertion and restriction enzyme-mediated integration (REMI) to produce cercosporin toxin-deficient mutants in the asexual phytopathogenic fungus Cercospora nicotianae. The use of pre-linearized plasmid or restriction enzymes in the transformation procedure significantly decreased the transformation frequency, but promoted a complicated and undefined mode of plasmid integration that leads to mutations in the C. nicotianae genome. Vector DNA generally integrated in multiple copies, and no increase in single-copy insertion was observed when enzymes were added to the transformation mixture. Out of 1873 transformants tested, 39 putative cercosporin toxin biosynthesis ( ctb) mutants were recovered that showed altered levels of cercosporin production. Seven ctb mutants were recovered using pre-linearized plasmids without the addition of enzymes, and these were considered to be non-REMI mutants. The correlation between a specific insertion and a mutant phenotype was confirmed using rescued plasmids as gene disruption vectors in the wild-type strain. Six out of fifteen rescued plasmids tested yielded cercosporin-deficient transformants when re-introduced into the wild-type strain, suggesting a link between the insertion site and the cercosporin-deficient phenotype. Sequence analysis of a fragment flanking the insert site recovered from one insertion mutant showed it to be disrupted in sequences with high homology to the acyl transferase domain of polyketide synthases from other fungi. Disruption of this polyketide synthase gene ( CTB1) using a rescued plasmid resulted in mutants that were defective in cercosporin production. Thus, we provide the first molecular evidence that cercosporin is synthesized via a polyketide pathway as previously hypothesized.

48 CFR 1352.239-72 - Security requirements for information technology resources.

Code of Federal Regulations, 2011 CFR

2011-10-01

... information technology resources. 1352.239-72 Section 1352.239-72 Federal Acquisition Regulations System... Clauses 1352.239-72 Security requirements for information technology resources. As prescribed in 48 CFR 1339.270(b), insert the following clause: Security Requirements for Information Technology Resources...

48 CFR 1352.239-71 - Electronic and information technology.

Code of Federal Regulations, 2014 CFR

2014-10-01

... Electronic and information technology. As prescribed in 48 CFR 1339.270(a), insert the following provision: Electronic and Information Technology (APR 2010) (a) To be considered eligible for award, offerors must propose electronic and information technology (EIT) that meet the applicable Access Board accessibility...

48 CFR 1352.239-71 - Electronic and information technology.

Code of Federal Regulations, 2012 CFR

2012-10-01

... Electronic and information technology. As prescribed in 48 CFR 1339.270(a), insert the following provision: Electronic and Information Technology (APR 2010) (a) To be considered eligible for award, offerors must propose electronic and information technology (EIT) that meet the applicable Access Board accessibility...

48 CFR 1352.239-71 - Electronic and information technology.

Code of Federal Regulations, 2011 CFR

2011-10-01

... Electronic and information technology. As prescribed in 48 CFR 1339.270(a), insert the following provision: Electronic and Information Technology (APR 2010) (a) To be considered eligible for award, offerors must propose electronic and information technology (EIT) that meet the applicable Access Board accessibility...

48 CFR 1352.239-71 - Electronic and information technology.

Code of Federal Regulations, 2013 CFR

2013-10-01

... Electronic and information technology. As prescribed in 48 CFR 1339.270(a), insert the following provision: Electronic and Information Technology (APR 2010) (a) To be considered eligible for award, offerors must propose electronic and information technology (EIT) that meet the applicable Access Board accessibility...

48 CFR 1352.239-72 - Security requirements for information technology resources.

Code of Federal Regulations, 2013 CFR

2013-10-01

... information technology resources. 1352.239-72 Section 1352.239-72 Federal Acquisition Regulations System... Clauses 1352.239-72 Security requirements for information technology resources. As prescribed in 48 CFR 1339.270(b), insert the following clause: Security Requirements for Information Technology Resources...

48 CFR 1352.239-72 - Security requirements for information technology resources.

Code of Federal Regulations, 2012 CFR

2012-10-01

... information technology resources. 1352.239-72 Section 1352.239-72 Federal Acquisition Regulations System... Clauses 1352.239-72 Security requirements for information technology resources. As prescribed in 48 CFR 1339.270(b), insert the following clause: Security Requirements for Information Technology Resources...

48 CFR 1352.239-72 - Security requirements for information technology resources.

Code of Federal Regulations, 2014 CFR

2014-10-01

... information technology resources. 1352.239-72 Section 1352.239-72 Federal Acquisition Regulations System... Clauses 1352.239-72 Security requirements for information technology resources. As prescribed in 48 CFR 1339.270(b), insert the following clause: Security Requirements for Information Technology Resources...

48 CFR 1352.239-72 - Security requirements for information technology resources.

Code of Federal Regulations, 2010 CFR

2010-10-01

... information technology resources. 1352.239-72 Section 1352.239-72 Federal Acquisition Regulations System... Clauses 1352.239-72 Security requirements for information technology resources. As prescribed in 48 CFR 1339.270(b), insert the following clause: Security Requirements for Information Technology Resources...

Challenges for Insertion of Structural Nanomaterials in Aerospace Applications

NASA Technical Reports Server (NTRS)

Sochi, Emilie J.

2012-01-01

In the two decades since Iijima's report on carbon nanotubes (CNT), there has been great interest in realizing the benefits of mechanical properties observed at the nanoscale in large-scale structures. The weight savings possible due to dramatic improvements in mechanical properties relative to state-of-the-art material systems can be game changing for applications like aerospace vehicles. While there has been significant progress in commercial production of CNTs, major aerospace applications that take advantage of properties offered by this material have yet to be realized. This paper provides a perspective on the technical challenges and barriers for insertion of CNTs as an emerging material technology in aerospace applications and proposes approaches that may reduce the typical timeframe for technology maturation and insertion into aerospace structures.

Molecular biology. Mothers setting boundaries.

PubMed

Thorvaldsen, J L; Bartolomei, M S

2000-06-23

Certain genes are only expressed at one allele, a phenomenon called imprinting. Although it is well established that one allele of certain imprinted genes is silenced through methylation, this does not appear to be the case for all imprinted genes. In a thoughtful Perspective, Thorvaldsen and Bartolomei discuss new findings showing that insertion of insulator elements (boundary regions) between the promoter of a gene and its enhancer (a sequence that boosts gene expression) may be another way in which genes are silenced during imprinting.

hisT is part of a multigene operon in Escherichia coli K-12.

PubMed Central

Marvel, C C; Arps, P J; Rubin, B C; Kammen, H O; Penhoet, E E; Winkler, M E

1985-01-01

The Escherichia coli K-12 hisT gene has been cloned, and its organization and expression have been analyzed on multicopy plasmids. The hisT gene, which encodes tRNA pseudouridine synthase I (PSUI), was isolated on a Clarke-Carbon plasmid known to contain the purF gene. The presence of the hisT gene on this plasmid was suggested by its ability to restore both production of PSUI enzymatic activity and suppression of amber mutations in a hisT mutant strain. A 2.3-kilobase HindIII-ClaI restriction fragment containing the hisT gene was subcloned into plasmid pBR322, and the resulting plasmid (designated psi 300) was mapped with restriction enzymes. Complementation analysis with different kinds of hisT mutations and tRNA structural analysis confirmed that plasmid psi 300 contained the hisT structural gene. Enzyme assays showed that plasmid psi 300 overproduced PSUI activity by ca. 20-fold compared with the wild-type level. Subclones containing restriction fragments from plasmid psi 300 inserted downstream from the lac promoter established that the hisT gene is oriented from the HindIII site toward the ClaI site. Other subclones and derivatives of plasmid psi 300 containing insertion or deletion mutations were constructed and assayed for production of PSUI activity and production of proteins in minicells. These experiments showed that: (i) the proximal 1.3-kilobase HindIII-BssHII restriction fragment contains a promoter for the hisT gene and encodes a 45,000-dalton polypeptide that is not PSUI; (ii) the distal 1.0-kilobase BssHII-ClaI restriction fragment encodes the 31,000-dalton PSUI polypeptide; (iii) the 45,000-dalton polypeptide is synthesized in an approximately eightfold excess compared with PSUI; and (iv) synthesis of the two polypeptides is coupled, suggesting that the two genes are part of an operon. Insertion of mini-Mu d1 (lac Km) phage into plasmid psi 300 confirmed that the hisT gene is the downstream gene in the operon. Images PMID:2981810

Short and long-term genome stability analysis of prokaryotic genomes.

PubMed

Brilli, Matteo; Liò, Pietro; Lacroix, Vincent; Sagot, Marie-France

2013-05-08

Gene organization dynamics is actively studied because it provides useful evolutionary information, makes functional annotation easier and often enables to characterize pathogens. There is therefore a strong interest in understanding the variability of this trait and the possible correlations with life-style. Two kinds of events affect genome organization: on one hand translocations and recombinations change the relative position of genes shared by two genomes (i.e. the backbone gene order); on the other, insertions and deletions leave the backbone gene order unchanged but they alter the gene neighborhoods by breaking the syntenic regions. A complete picture about genome organization evolution therefore requires to account for both kinds of events. We developed an approach where we model chromosomes as graphs on which we compute different stability estimators; we consider genome rearrangements as well as the effect of gene insertions and deletions. In a first part of the paper, we fit a measure of backbone gene order conservation (hereinafter called backbone stability) against phylogenetic distance for over 3000 genome comparisons, improving existing models for the divergence in time of backbone stability. Intra- and inter-specific comparisons were treated separately to focus on different time-scales. The use of multiple genomes of a same species allowed to identify genomes with diverging gene order with respect to their conspecific. The inter-species analysis indicates that pathogens are more often unstable with respect to non-pathogens. In a second part of the text, we show that in pathogens, gene content dynamics (insertions and deletions) have a much more dramatic effect on genome organization stability than backbone rearrangements. In this work, we studied genome organization divergence taking into account the contribution of both genome order rearrangements and genome content dynamics. By studying species with multiple sequenced genomes available, we were able to explore genome organization stability at different time-scales and to find significant differences for pathogen and non-pathogen species. The output of our framework also allows to identify the conserved gene clusters and/or partial occurrences thereof, making possible to explore how gene clusters assembled during evolution.

Novel mutants of Erwinia carotovora subsp. carotovora defective in the production of plant cell wall degrading enzymes generated by Mu transpososome-mediated insertion mutagenesis.

PubMed

Laasik, Eve; Ojarand, Merli; Pajunen, Maria; Savilahti, Harri; Mäe, Andres

2005-02-01

As in Erwinia carotovora subsp. carotovora the regulation details of the main virulence factors, encoding extracellular enzymes that degrade the plant cell wall, is only rudimentally understood, we performed a genetic screen to identify novel candidate genes involved in the process. Initially, we used Mu transpososome-mediated mutagenesis approach to generate a comprehensive transposon insertion mutant library of ca. 10000 clones and screened the clones for the loss of extracellular enzyme production. Extracellular enzymes production was abolished by mutations in the chromosomal helEcc, trkAEcc yheLEcc, glsEcc, igaAEcc and cysQEcc genes. The findings reported here demonstrate that we have isolated six new representatives that belong to the pool of genes modulating the production of virulence factors in E. carotovora.

A novel suicide shuttle plasmid for Streptococcus suis serotype 2 and Streptococcus equi ssp. zooepidemicus gene mutation

PubMed Central

Liu, Rui; Zhang, Ping; Su, Yiqi; Lin, Huixing; Zhang, Hui; Yu, Lei; Ma, Zhe; Fan, Hongjie

2016-01-01

The mariner-based Himar1 system has been utilized for creating mutant libraries of many Gram-positive bacteria. Streptococcus suis serotype 2 (SS2) and Streptococcus equi ssp. zooepidemicus (SEZ) are primary pathogens of swine that threaten the swine industry in China. To provide a forward-genetics technology for finding virulent phenotype-related genes in these two pathogens, we constructed a novel temperature-sensitive suicide shuttle plasmid, pMar4s, which contains the Himar1 system transposon, TnYLB-1, and the Himar1 C9 transposase from pMarA and the repTAs temperature-sensitive fragment from pSET4s. The kanamycin (Kan) resistance gene was in the TnYLB-1 transposon. Temperature sensitivity and Kan resistance allowed the selection of mutant strains and construction of the mutant library. The SS2 and SEZ mutant libraries were successfully constructed using the pMar4s plasmid. Inverse-Polymerase Chain Reaction (Inverse-PCR) results revealed large variability in transposon insertion sites and that the library could be used for phenotype alteration screening. The thiamine biosynthesis gene apbE was screened for its influence on SS2 anti-phagocytosis; likewise, the sagF gene was identified to be a hemolytic activity-related gene in SEZ. pMar4s was suitable for mutant library construction, providing more information regarding SS2 and SEZ virulence factors and illustrating the pathogenesis of swine streptococcosis. PMID:27256117

[Target gene sequence capture and next generation sequencing technology to diagnose four children with Alagille syndrome].

PubMed

Gao, M L; Zhong, X M; Ma, X; Ning, H J; Zhu, D; Zou, J Z

2016-06-02

To make genetic diagnosis of Alagille syndrome (ALGS) patients using target gene sequence capture and next generation sequencing technology. Target gene sequence capture and next generation sequencing were used to detect ALGS gene of 4 patients. They were hospitalized at the Affiliated Hospital, Capital Institute of Pediatrics between January 2014 and December 2015, referred to clinical diagnosis of ALGS typical and atypical respectively in 2 cases. Blood samples were collected from patients and their parents and genomic DNA was extracted from lymphocytes. Target gene sequence capture and next generation sequencing was detected. Sanger sequencing was used to confirm the results of the patients and their parents. Cholestasis, heart defects, inverted triangular face and butterfly vertebrae were presented as main clinical features in 4 male patients. The first hospital visiting ages ranged from 3 months and 14 days to 3 years and 1 month. The age of onset ranged from 3 days to 42 days (median 23 days). According to the clinical diagnostic criteria of ALGS, patient 1 and patient 2 were considered as typical ALGS. The other 2 patients were considered as atypical ALGS. Four Jagged 1(JAG1) pathogenic mutations were detected. Three different missense mutations were detected in patient 1 to patient 3 with ALGS(c.839C>T(p.W280X), c. 703G>A(p.R235X), c. 1720C>T(p.V574M)). The JAG1 mutation of patient 3 was first reported. Patient 4 had one novel insertion mutation (c.1779_1780insA(p.Ile594AsnfsTer23)). Parental analysis verified that the JAG1 missense mutation of 3 patients were de novo. The results of sanger sequencing was consistent with the results of the next generation sequencing. Target gene sequence capture combined with next generation sequencing can detect two pathogenic genes in ALGS and test genes of other related diseases in infantile cholestatic diseases simultaneously and presents a high throughput, high efficiency and low cost. It may provide molecular diagnosis and treatment for clinicians with good clinical application prospects.

Insulation of Enhancer-Promoter Communication by a Gypsy Transposon Insert in the Drosophila cut Gene: Cooperation between Suppressor of Hairy-wing and Modifier of mdg4 Proteins

PubMed Central

Gause, Maria; Morcillo, Patrick; Dorsett, Dale

2001-01-01

The Drosophila mod(mdg4) gene products counteract heterochromatin-mediated silencing of the white gene and help activate genes of the bithorax complex. They also regulate the insulator activity of the gypsy transposon when gypsy inserts between an enhancer and promoter. The Su(Hw) protein is required for gypsy-mediated insulation, and the Mod(mdg4)-67.2 protein binds to Su(Hw). The aim of this study was to determine whether Mod(mdg4)-67.2 is a coinsulator that helps Su(Hw) block enhancers or a facilitator of activation that is inhibited by Su(Hw). Here we provide evidence that Mod(mdg4)-67.2 acts as a coinsulator by showing that some loss-of-function mod(mdg4) mutations decrease enhancer blocking by a gypsy insert in the cut gene. We find that the C terminus of Mod(mdg4)-67.2 binds in vitro to a region of Su(Hw) that is required for insulation, while the N terminus mediates self-association. The N terminus of Mod(mdg4)-67.2 also interacts with the Chip protein, which facilitates activation of cut. Mod(mdg4)-67.2 truncated in the C terminus interferes in a dominant-negative fashion with insulation in cut but does not significantly affect heterochromatin-mediated silencing of white. We infer that multiple contacts between Su(Hw) and a Mod(mdg4)-67.2 multimer are required for insulation. We theorize that Mod(mdg4)-67.2 usually aids gene activation but can also act as a coinsulator by helping Su(Hw) trap facilitators of activation, such as the Chip protein. PMID:11416154

[Construction of a plant effective expression vector containing the gene of hepatitis B virus surface antigen].

PubMed

Lin, Bing-Ying; Jin, Zhi-Qiang; Li, Mei

2006-11-01

To construct a plant effective expression vector driven by a fruit specific promoter for the expression of hepatitis B virus surface antigen (HBsAg), to further improve the expression of exogenous gene in plant, and to prepare for the development of an effective anti-hepatitis vaccine. Tomato fruit-specific promoters' gene 2A12 and E8 were respectively introduced to pBPFOmega7 to form pB2A12 and pBE8. The DNA fragment containing HBsAg-s gene from plasmid YEP-HBs was inserted respectively into pB2A12 and pBE8 to form pB2A12-HBs and pBE8-HBs. The fragment containing "p35S+2A12+Omega+HBsAg-s+Tnos" of the pB2A12-HBs was sub-cloned into plasmid pCAMBIA1301 to yield the reconstructed plant binary expression plasmid pCAM2A12-HBs, and the fragment containing "p35S+E8+Omega+HBsAg-s+Tnos" of the pBE8-HBs was sub-cloned into plasmid pCAMBIA1301 to yield the plasmid pCAME8-HBs. The inserted gene HBsAg and fruit-specific promoters in the reconstructed plant binary expression vectors were confirmed by sequencing. Then, pCAM2A12-HBs and pCAME8-HBs were directly introduced into Agrobacterium tumefaciens strain EHA105. Digestion with restriction enzymes proved that all recombinant vectors had the inserts with expected length of the target fragments, and the sequencing results were confirmed correct. In this study, plant expression vector containing HBsAg gene driven by fruit specific promoter and CaMV35s promoter was successfully constructed.

Optimizing and benchmarking de novo transcriptome sequencing: from library preparation to assembly evaluation.

PubMed

Hara, Yuichiro; Tatsumi, Kaori; Yoshida, Michio; Kajikawa, Eriko; Kiyonari, Hiroshi; Kuraku, Shigehiro

2015-11-18

RNA-seq enables gene expression profiling in selected spatiotemporal windows and yields massive sequence information with relatively low cost and time investment, even for non-model species. However, there remains a large room for optimizing its workflow, in order to take full advantage of continuously developing sequencing capacity. Transcriptome sequencing for three embryonic stages of Madagascar ground gecko (Paroedura picta) was performed with the Illumina platform. The output reads were assembled de novo for reconstructing transcript sequences. In order to evaluate the completeness of transcriptome assemblies, we prepared a reference gene set consisting of vertebrate one-to-one orthologs. To take advantage of increased read length of >150 nt, we demonstrated shortened RNA fragmentation time, which resulted in a dramatic shift of insert size distribution. To evaluate products of multiple de novo assembly runs incorporating reads with different RNA sources, read lengths, and insert sizes, we introduce a new reference gene set, core vertebrate genes (CVG), consisting of 233 genes that are shared as one-to-one orthologs by all vertebrate genomes examined (29 species)., The completeness assessment performed by the computational pipelines CEGMA and BUSCO referring to CVG, demonstrated higher accuracy and resolution than with the gene set previously established for this purpose. As a result of the assessment with CVG, we have derived the most comprehensive transcript sequence set of the Madagascar ground gecko by means of assembling individual libraries followed by clustering the assembled sequences based on their overall similarities. Our results provide several insights into optimizing de novo RNA-seq workflow, including the coordination between library insert size and read length, which manifested in improved connectivity of assemblies. The approach and assembly assessment with CVG demonstrated here would be applicable to transcriptome analysis of other species as well as whole genome analyses.

Identification of genes associated with asexual reproduction in Phyllosticta citricarpa mutants obtained through Agrobacterium tumefaciens transformation.

PubMed

Goulin, Eduardo Henrique; Savi, Daiani Cristina; Petters, Desirrê Alexia Lourenço; Kava, Vanessa; Galli-Terasawa, Lygia; Silva, Geraldo José; Glienke, Chirlei

2016-11-01

Phyllosticta citricarpa is the epidemiological agent of Citrus Black Spot (CBS) disease, which is responsible for large economic losses worldwide. CBS is characterized by the presence of spores (pycnidiospores) in dark lesions of fruit, which are also responsible for short distance dispersal of the disease. The identification of genes involved in asexual reproduction of P. citricarpa can be an alternative for directional disease control. We analyzed a library of mutants obtained through Agrobacterium tumefaciens transformation system, looking for alterations in growth and reproductive structure formation. Two mutant strains were found to have lost the ability to form pycnidia. The flanking T-DNA insertion regions were identified on P. citricarpa genome by using blast analysis and further gene prediction. The predicted genes containing the T-DNA insertions were identified as Spindle Poison Sensitivity Scp3, Ion Transport protein, and Cullin Binding proteins. The Ion Transport and Cullin Binding proteins are known to be correlated with sexual and asexual reproduction in fungi; however, the exact mechanism by which these proteins act on spore formation in P. citricarpa needs to be better characterized. The Scp3 proteins are suggested here for the first time as being associated with asexual reproduction in fungus. This protein is associated with microtubule formation, and as microtubules play an essential role as spindle machinery for chromosome segregation and cytokinesis, insertions in this gene can lead to abnormal formations, such as that observed here in P. citricarpa. We suggest these genes as new targets for fungicide development and CBS disease control, by iRNA. Copyright © 2016 Elsevier GmbH. All rights reserved.

Insulated hsp70B' promoter: stringent heat-inducible activity in replication-deficient, but not replication-competent adenoviruses.

PubMed

Rohmer, Stanimira; Mainka, Astrid; Knippertz, Ilka; Hesse, Andrea; Nettelbeck, Dirk M

2008-04-01

Key to the realization of gene therapy is the development of efficient and targeted gene transfer vectors. Therapeutic gene transfer by replication-deficient or more recently by conditionally replication-competent/oncolytic adenoviruses has shown much promise. For specific applications, however, it will be advantageous to provide vectors that allow for external control of gene expression. The efficient cellular heat shock system in combination with available technology for focused and controlled hyperthermia suggests heat-regulated transcription control as a promising tool for this purpose. We investigated the feasibility of a short fragment of the human hsp70B' promoter, with and without upstream insulator elements, for the regulation of transgene expression by replication-deficient or oncolytic adenoviruses. Two novel adenoviral vectors with an insulated hsp70B' promoter were developed and showed stringent heat-inducible gene expression with induction ratios up to 8000-fold. In contrast, regulation of gene expression from the hsp70B' promoter without insulation was suboptimal. In replication-competent/oncolytic adenoviruses regulation of the hsp70B' promoter was lost specifically during late replication in permissive cells and could not be restored by the insulators. We developed novel adenovirus gene transfer vectors that feature improved and stringent regulation of transgene expression from the hsp70B' promoter using promoter insulation. These vectors have potential for gene therapy applications that benefit from external modulation of therapeutic gene expression or for combination therapy with hyperthermia. Furthermore, our study reveals that vector replication can deregulate inserted cellular promoters, an observation which is of relevance for the development of replication-competent/oncolytic gene transfer vectors. (c) 2008 John Wiley & Sons, Ltd.

Implementation of a new blood cooler insert and tracking technology with educational initiatives and its effect on reducing red blood cell wastage.

PubMed

Fadeyi, Emmanuel A; Emery, Wanda; Simmons, Julie H; Jones, Mary Rose; Pomper, Gregory J

2017-10-01

The objective was to report a successful implementation of a blood cooler insert and tracking technology with educational initiatives and its effect on reducing red blood cell (RBC) wastage. The blood bank database was used to quantify and categorize total RBC units issued in blood coolers from January 2010 to December 2015 with and without the new inserts throughout the hospital. Radiofrequency identification tags were used with special software to monitor blood cooler tracking. An educational policy on how to handle the coolers was initiated. Data were gathered from the software that provided a real-time location monitoring of the blood coolers with inserts throughout the institution. The implementation of the blood cooler with inserts and tracking device reduced mean yearly RBC wastage by fourfold from 0.64% to 0.17% between 2010 and 2015. The conserved RBCs corresponded to a total cost savings of $167,844 during the 3-year postimplementation period. The implementation of new blood cooler inserts, tracking system, and educational initiatives substantially reduced the mean annual total RBC wastage. The cost to implement this initiative may be small if there is an existing institutional infrastructure to monitor and track hospital equipment into which the blood bank intervention can be adapted when compared to the cost of blood wastage. © 2017 AABB.

Essential Genes for In Vitro Growth of the Endophyte Herbaspirillum seropedicae SmR1 as Revealed by Transposon Insertion Site Sequencing

PubMed Central

Rosconi, Federico; de Vries, Stefan P. W.; Baig, Abiyad; Fabiano, Elena

2016-01-01

ABSTRACT The interior of plants contains microorganisms (referred to as endophytes) that are distinct from those present at the root surface or in the surrounding soil. Herbaspirillum seropedicae strain SmR1, belonging to the betaproteobacteria, is an endophyte that colonizes crops, including rice, maize, sugarcane, and sorghum. Different approaches have revealed genes and pathways regulated during the interactions of H. seropedicae with its plant hosts. However, functional genomic analysis of transposon (Tn) mutants has been hampered by the lack of genetic tools. Here we successfully employed a combination of in vivo high-density mariner Tn mutagenesis and targeted Tn insertion site sequencing (Tn-seq) in H. seropedicae SmR1. The analysis of multiple gene-saturating Tn libraries revealed that 395 genes are essential for the growth of H. seropedicae SmR1 in tryptone-yeast extract medium. A comparative analysis with the Database of Essential Genes (DEG) showed that 25 genes are uniquely essential in H. seropedicae SmR1. The Tn mutagenesis protocol developed and the gene-saturating Tn libraries generated will facilitate elucidation of the genetic mechanisms of the H. seropedicae endophytic lifestyle. IMPORTANCE A focal point in the study of endophytes is the development of effective biofertilizers that could help to reduce the input of agrochemicals in croplands. Besides the ability to promote plant growth, a good biofertilizer should be successful in colonizing its host and competing against the native microbiota. By using a systematic Tn-based gene-inactivation strategy and massively parallel sequencing of Tn insertion sites (Tn-seq), it is possible to study the fitness of thousands of Tn mutants in a single experiment. We have applied the combination of these techniques to the plant-growth-promoting endophyte Herbaspirillum seropedicae SmR1. The Tn mutant libraries generated will enable studies into the genetic mechanisms of H. seropedicae-plant interactions. The approach that we have taken is applicable to other plant-interacting bacteria. PMID:27590816

Human Alu insertion polymorphisms in North African populations.

PubMed

Cherni, Loth; Frigi, Sabeh; Ennafaa, Hajer; Mtiraoui, Nabil; Mahjoub, Touhami; Benammar-Elgaaied, Amel

2011-10-01

Several features make Alu insertions a powerful tool used in population genetic studies: the polymorphic nature of many Alu insertions, the stability of an Alu insertion event and, furthermore, the ancestral state of an Alu insertion is known to be the absence of the Alu element at a particular locus and the presence of an Alu insertion at the site that forward mutational change. This study analyses seven Alu insertion polymorphisms in a sample of 297 individuals from the autochthonous population of Tunisia (Thala, Smar, Zarzis, and Bou Salem) and Libya with the aim of studying their genetic structure with respect to the populations of North Africa, Western, Eastern and Central Europe. The comparative analyses carried out using the MDS and AMOVA methods reveal the existence of spatial heterogeneity, and identify four population groups. Study populations (Libya, Smar, Zarzis, and Bou Salem) are closest to North African populations whereas Thala is isolated and is closest to Western European populations. In conclusion, Results of the present study support the important role that migratory movements have played in the North African gene pool, at least since the Neolithic period.

A major insertion accounts for a significant proportion of mutations underlying human lipoprotein lipase deficiency

DOE Office of Scientific and Technical Information (OSTI.GOV)

Langlois, S.; Kastelein, J.J.; Hayden, M.R.

1989-02-01

Lipoprotein lipase is an important enzyme involved in triacylglycerol metabolism. Primary LPL deficiency is a genetic disorder that is usually manifested by a severe elevation in triacylglycerol levels. The authors have used a recently isolated LPL cDNA clone to study 15 probands from 11 families with this inherited disorder. Surprisingly, 7 of the probands from 4 families, of different ancestries, had a similar insertion in their LPL gene. In contrast to other human genetic disorders, where insertions are rare causes of mutation, this insertion accounts for a significant proportion of the alleles causing LPL deficiency. Detailed restriction mapping of themore » insertion revealed that it was unlikely to be a duplication of neighboring DNA and that it was not similar to the consensus sequence of human L1 repetitive elements. This suggests that there must be other mechanisms of insertional mutagenesis in human genetic disease besides transposition of mobile L1 repetitive elements.« less

Insertion of an SVA element, a nonautonomous retrotransposon, in PMS2 intron 7 as a novel cause of Lynch syndrome.

PubMed

van der Klift, Heleen M; Tops, Carli M; Hes, Frederik J; Devilee, Peter; Wijnen, Juul T

2012-07-01

Heterozygous germline mutations in the mismatch repair gene PMS2 predispose carriers for Lynch syndrome, an autosomal dominant predisposition to cancer. Here, we present a LINE-1-mediated retrotranspositional insertion in PMS2 as a novel mutation type for Lynch syndrome. This insertion, detected with Southern blot analysis in the genomic DNA of the patient, is characterized as a 2.2 kb long 5' truncated SVA_F element. The insertion is not detectable by current diagnostic testing limited to MLPA and direct Sanger sequencing on genomic DNA. The molecular nature of this insertion could only be resolved in RNA from cultured lymphocytes in which nonsense-mediated RNA decay was inhibited. Our report illustrates the technical problems encountered in the detection of this mutation type. Especially large heterozygous insertions will remain unnoticed because of preferential amplification of the smaller wild-type allele in genomic DNA, and are probably underreported in the mutation spectra of autosomal dominant disorders. © 2012 Wiley Periodicals, Inc.

Resources for Biological Annotation of the Drosophila Genome

DOE Office of Scientific and Technical Information (OSTI.GOV)

Gerald M. Rubin

2005-08-08

This project supported seed money for the development of cDNA and genetic resources to support studies of the Drosophila melanogaster genome. Key publications supported by this work that provide additional detail: (1) ''The Drosophila gene collection: identification of putative full-length cDNAs for 70% of D. melanogaster genes''; and (2) ''The Berkeley Drosophila Genome Project gene disruption project: Single P-element insertions mutating 25% of vital Drosophila genes''.

Genetic resources offer efficient tools for rice functional genomics research.

PubMed

Lo, Shuen-Fang; Fan, Ming-Jen; Hsing, Yue-Ie; Chen, Liang-Jwu; Chen, Shu; Wen, Ien-Chie; Liu, Yi-Lun; Chen, Ku-Ting; Jiang, Mirng-Jier; Lin, Ming-Kuang; Rao, Meng-Yen; Yu, Lin-Chih; Ho, Tuan-Hua David; Yu, Su-May

2016-05-01

Rice is an important crop and major model plant for monocot functional genomics studies. With the establishment of various genetic resources for rice genomics, the next challenge is to systematically assign functions to predicted genes in the rice genome. Compared with the robustness of genome sequencing and bioinformatics techniques, progress in understanding the function of rice genes has lagged, hampering the utilization of rice genes for cereal crop improvement. The use of transfer DNA (T-DNA) insertional mutagenesis offers the advantage of uniform distribution throughout the rice genome, but preferentially in gene-rich regions, resulting in direct gene knockout or activation of genes within 20-30 kb up- and downstream of the T-DNA insertion site and high gene tagging efficiency. Here, we summarize the recent progress in functional genomics using the T-DNA-tagged rice mutant population. We also discuss important features of T-DNA activation- and knockout-tagging and promoter-trapping of the rice genome in relation to mutant and candidate gene characterizations and how to more efficiently utilize rice mutant populations and datasets for high-throughput functional genomics and phenomics studies by forward and reverse genetics approaches. These studies may facilitate the translation of rice functional genomics research to improvements of rice and other cereal crops. © 2015 John Wiley & Sons Ltd.

Phylogenetic Evidence for Lateral Gene Transfer in the Intestine of Marine Iguanas

PubMed Central

Nelson, David M.; Cann, Isaac K. O.; Altermann, Eric; Mackie, Roderick I.

2010-01-01

Background Lateral gene transfer (LGT) appears to promote genotypic and phenotypic variation in microbial communities in a range of environments, including the mammalian intestine. However, the extent and mechanisms of LGT in intestinal microbial communities of non-mammalian hosts remains poorly understood. Methodology/Principal Findings We sequenced two fosmid inserts obtained from a genomic DNA library derived from an agar-degrading enrichment culture of marine iguana fecal material. The inserts harbored 16S rRNA genes that place the organism from which they originated within Clostridium cluster IV, a well documented group that habitats the mammalian intestinal tract. However, sequence analysis indicates that 52% of the protein-coding genes on the fosmids have top BLASTX hits to bacterial species that are not members of Clostridium cluster IV, and phylogenetic analysis suggests that at least 10 of 44 coding genes on the fosmids may have been transferred from Clostridium cluster XIVa to cluster IV. The fosmids encoded four transposase-encoding genes and an integrase-encoding gene, suggesting their involvement in LGT. In addition, several coding genes likely involved in sugar transport were probably acquired through LGT. Conclusion Our phylogenetic evidence suggests that LGT may be common among phylogenetically distinct members of the phylum Firmicutes inhabiting the intestinal tract of marine iguanas. PMID:20520734

48 CFR 1852.204-76 - Security requirements for unclassified information technology resources.

Code of Federal Regulations, 2011 CFR

2011-10-01

... unclassified information technology resources. 1852.204-76 Section 1852.204-76 Federal Acquisition Regulations... information technology resources. As prescribed in 1804.470-4(a), insert the following clause: SECURITY REQUIREMENTS FOR UNCLASSIFIED INFORMATION TECHNOLOGY RESOURCES (MONTH YEAR) (a) The contractor shall protect...

48 CFR 2452.239-71 - Information Technology Virus Security.

Code of Federal Regulations, 2014 CFR

2014-10-01

... 48 Federal Acquisition Regulations System 6 2014-10-01 2014-10-01 false Information Technology... Provisions and Clauses 2452.239-71 Information Technology Virus Security. As prescribed in 2439.107(b), insert the following clause: Information Technology Virus Security (FEB 2006) (a) The contractor hereby...

48 CFR 2452.239-71 - Information Technology Virus Security.

Code of Federal Regulations, 2013 CFR

2013-10-01

... 48 Federal Acquisition Regulations System 6 2013-10-01 2013-10-01 false Information Technology... Provisions and Clauses 2452.239-71 Information Technology Virus Security. As prescribed in 2439.107(b), insert the following clause: Information Technology Virus Security (FEB 2006) (a) The contractor hereby...

48 CFR 2452.239-71 - Information Technology Virus Security.

Code of Federal Regulations, 2012 CFR

2012-10-01

... 48 Federal Acquisition Regulations System 6 2012-10-01 2012-10-01 false Information Technology... Provisions and Clauses 2452.239-71 Information Technology Virus Security. As prescribed in 2439.107(b), insert the following clause: Information Technology Virus Security (FEB 2006) (a) The contractor hereby...

48 CFR 552.239-70 - Information Technology Security Plan and Security Authorization.

Code of Federal Regulations, 2011 CFR

2011-10-01

... 48 Federal Acquisition Regulations System 4 2011-10-01 2011-10-01 false Information Technology... Text of Provisions and Clauses 552.239-70 Information Technology Security Plan and Security Authorization. As prescribed in 539.7002(a), insert the following provision: Information Technology Security...

48 CFR 1252.239-71 - Information technology security plan and accreditation.

Code of Federal Regulations, 2014 CFR

2014-10-01

... 48 Federal Acquisition Regulations System 5 2014-10-01 2014-10-01 false Information technology... Provisions and Clauses 1252.239-71 Information technology security plan and accreditation. As prescribed in (TAR) 48 CFR 1239.70, insert the following provision: Information Technology Security Plan and...

48 CFR 3052.204-70 - Security requirements for unclassified information technology resources.

Code of Federal Regulations, 2011 CFR

2011-10-01

... unclassified information technology resources. 3052.204-70 Section 3052.204-70 Federal Acquisition Regulations... for unclassified information technology resources. As prescribed in (HSAR) 48 CFR 3004.470-3, insert a clause substantially the same as follows: Security Requirements for Unclassified Information Technology...

48 CFR 1252.239-71 - Information technology security plan and accreditation.

Code of Federal Regulations, 2013 CFR

2013-10-01

... 48 Federal Acquisition Regulations System 5 2013-10-01 2013-10-01 false Information technology... Provisions and Clauses 1252.239-71 Information technology security plan and accreditation. As prescribed in (TAR) 48 CFR 1239.70, insert the following provision: Information Technology Security Plan and...

48 CFR 552.239-70 - Information Technology Security Plan and Security Authorization.

Code of Federal Regulations, 2014 CFR

2014-10-01

... 48 Federal Acquisition Regulations System 4 2014-10-01 2014-10-01 false Information Technology... Text of Provisions and Clauses 552.239-70 Information Technology Security Plan and Security Authorization. As prescribed in 539.7002(a), insert the following provision: Information Technology Security...

48 CFR 1252.239-71 - Information technology security plan and accreditation.

Code of Federal Regulations, 2011 CFR

2011-10-01

... 48 Federal Acquisition Regulations System 5 2011-10-01 2011-10-01 false Information technology... Provisions and Clauses 1252.239-71 Information technology security plan and accreditation. As prescribed in (TAR) 48 CFR 1239.70, insert the following provision: Information Technology Security Plan and...

48 CFR 552.239-70 - Information Technology Security Plan and Security Authorization.

Code of Federal Regulations, 2012 CFR

2012-10-01

... 48 Federal Acquisition Regulations System 4 2012-10-01 2012-10-01 false Information Technology... Text of Provisions and Clauses 552.239-70 Information Technology Security Plan and Security Authorization. As prescribed in 539.7002(a), insert the following provision: Information Technology Security...

48 CFR 552.239-70 - Information Technology Security Plan and Security Authorization.

Code of Federal Regulations, 2013 CFR

2013-10-01

... 48 Federal Acquisition Regulations System 4 2013-10-01 2013-10-01 false Information Technology... Text of Provisions and Clauses 552.239-70 Information Technology Security Plan and Security Authorization. As prescribed in 539.7002(a), insert the following provision: Information Technology Security...

48 CFR 2452.239-71 - Information Technology Virus Security.

Code of Federal Regulations, 2011 CFR

2011-10-01

... 48 Federal Acquisition Regulations System 6 2011-10-01 2011-10-01 false Information Technology... Provisions and Clauses 2452.239-71 Information Technology Virus Security. As prescribed in 2439.107(b), insert the following clause: Information Technology Virus Security (FEB 2006) (a) The contractor hereby...

48 CFR 1252.239-71 - Information technology security plan and accreditation.

Code of Federal Regulations, 2012 CFR

2012-10-01

... 48 Federal Acquisition Regulations System 5 2012-10-01 2012-10-01 false Information technology... Provisions and Clauses 1252.239-71 Information technology security plan and accreditation. As prescribed in (TAR) 48 CFR 1239.70, insert the following provision: Information Technology Security Plan and...

48 CFR 3052.204-70 - Security requirements for unclassified information technology resources.

Code of Federal Regulations, 2012 CFR

2012-10-01

... unclassified information technology resources. 3052.204-70 Section 3052.204-70 Federal Acquisition Regulations... for unclassified information technology resources. As prescribed in (HSAR) 48 CFR 3004.470-3, insert a clause substantially the same as follows: Security Requirements for Unclassified Information Technology...

48 CFR 352.239-73 - Electronic information and technology accessibility.

Code of Federal Regulations, 2013 CFR

2013-10-01

... technology accessibility. 352.239-73 Section 352.239-73 Federal Acquisition Regulations System HEALTH AND... Clauses 352.239-73 Electronic information and technology accessibility. (a) As prescribed in 339.201-70(a), the Contracting Officer shall insert the following provision: Electronic and Information Technology...

48 CFR 352.239-73 - Electronic information and technology accessibility.

Code of Federal Regulations, 2012 CFR

2012-10-01

... technology accessibility. 352.239-73 Section 352.239-73 Federal Acquisition Regulations System HEALTH AND... Clauses 352.239-73 Electronic information and technology accessibility. (a) As prescribed in 339.201-70(a), the Contracting Officer shall insert the following provision: Electronic and Information Technology...

48 CFR 352.239-73 - Electronic information and technology accessibility.

Code of Federal Regulations, 2014 CFR

2014-10-01

... technology accessibility. 352.239-73 Section 352.239-73 Federal Acquisition Regulations System HEALTH AND... Clauses 352.239-73 Electronic information and technology accessibility. (a) As prescribed in 339.201-70(a), the Contracting Officer shall insert the following provision: Electronic and Information Technology...

48 CFR 352.239-73 - Electronic information and technology accessibility.

Code of Federal Regulations, 2011 CFR

2011-10-01

... technology accessibility. 352.239-73 Section 352.239-73 Federal Acquisition Regulations System HEALTH AND... Clauses 352.239-73 Electronic information and technology accessibility. (a) As prescribed in 339.201-70(a), the Contracting Officer shall insert the following provision: Electronic and Information Technology...

48 CFR 1852.204-76 - Security requirements for unclassified information technology resources.

Code of Federal Regulations, 2012 CFR

2012-10-01

... unclassified information technology resources. 1852.204-76 Section 1852.204-76 Federal Acquisition Regulations... information technology resources. As prescribed in 1804.470-4(a), insert the following clause: Security Requirements for Unclassified Information Technology Resources (MONTH YEAR) (a) The contractor shall protect...

48 CFR 1852.204-76 - Security requirements for unclassified information technology resources.

Code of Federal Regulations, 2013 CFR

2013-10-01

... unclassified information technology resources. 1852.204-76 Section 1852.204-76 Federal Acquisition Regulations... information technology resources. As prescribed in 1804.470-4(a), insert the following clause: Security Requirements for Unclassified Information Technology Resources (MONTH YEAR) (a) The contractor shall protect...

48 CFR 1852.204-76 - Security requirements for unclassified information technology resources.

Code of Federal Regulations, 2014 CFR

2014-10-01

... unclassified information technology resources. 1852.204-76 Section 1852.204-76 Federal Acquisition Regulations... information technology resources. As prescribed in 1804.470-4(a), insert the following clause: Security Requirements for Unclassified Information Technology Resources (MONTH YEAR) (a) The contractor shall protect...

48 CFR 1252.239-71 - Information technology security plan and accreditation.

Code of Federal Regulations, 2010 CFR

2010-10-01

... 48 Federal Acquisition Regulations System 5 2010-10-01 2010-10-01 false Information technology... Provisions and Clauses 1252.239-71 Information technology security plan and accreditation. As prescribed in (TAR) 48 CFR 1239.70, insert the following provision: Information Technology Security Plan and...

48 CFR 3052.204-70 - Security requirements for unclassified information technology resources.

Code of Federal Regulations, 2010 CFR

2010-10-01

... unclassified information technology resources. 3052.204-70 Section 3052.204-70 Federal Acquisition Regulations... for unclassified information technology resources. As prescribed in (HSAR) 48 CFR 3004.470-3, insert a clause substantially the same as follows: Security Requirements for Unclassified Information Technology...

48 CFR 2452.239-71 - Information Technology Virus Security.

Code of Federal Regulations, 2010 CFR

2010-10-01

... 48 Federal Acquisition Regulations System 6 2010-10-01 2010-10-01 true Information Technology... Provisions and Clauses 2452.239-71 Information Technology Virus Security. As prescribed in 2439.107(b), insert the following clause: Information Technology Virus Security (FEB 2006) (a) The contractor hereby...

48 CFR 1352.239-71 - Electronic and information technology.

Code of Federal Regulations, 2010 CFR

2010-10-01

... technology. 1352.239-71 Section 1352.239-71 Federal Acquisition Regulations System DEPARTMENT OF COMMERCE... Electronic and information technology. As prescribed in 48 CFR 1339.270(a), insert the following provision: Electronic and Information Technology (APR 2010) (a) To be considered eligible for award, offerors must...

48 CFR 352.239-73 - Electronic information and technology accessibility.

Code of Federal Regulations, 2010 CFR

2010-10-01

... technology accessibility. 352.239-73 Section 352.239-73 Federal Acquisition Regulations System HEALTH AND... Clauses 352.239-73 Electronic information and technology accessibility. (a) As prescribed in 339.201-70(a), the Contracting Officer shall insert the following provision: Electronic and Information Technology...