Sample records for gene knockout vector

  1. A Protocol for Multiple Gene Knockout in Mouse Small Intestinal Organoids Using a CRISPR-concatemer.

    PubMed

    Merenda, Alessandra; Andersson-Rolf, Amanda; Mustata, Roxana C; Li, Taibo; Kim, Hyunki; Koo, Bon-Kyoung

    2017-07-12

    CRISPR/Cas9 technology has greatly improved the feasibility and speed of loss-of-function studies that are essential in understanding gene function. In higher eukaryotes, paralogous genes can mask a potential phenotype by compensating the loss of a gene, thus limiting the information that can be obtained from genetic studies relying on single gene knockouts. We have developed a novel, rapid cloning method for guide RNA (gRNA) concatemers in order to create multi-gene knockouts following a single round of transfection in mouse small intestinal organoids. Our strategy allows for the concatemerization of up to four individual gRNAs into a single vector by performing a single Golden Gate shuffling reaction with annealed gRNA oligos and a pre-designed retroviral vector. This allows either the simultaneous knockout of up to four different genes, or increased knockout efficiency following the targeting of one gene by multiple gRNAs. In this protocol, we show in detail how to efficiently clone multiple gRNAs into the retroviral CRISPR-concatemer vector and how to achieve highly efficient electroporation in intestinal organoids. As an example, we show that simultaneous knockout of two pairs of genes encoding negative regulators of the Wnt signaling pathway (Axin1/2 and Rnf43/Znrf3) renders intestinal organoids resistant to the withdrawal of key growth factors.

  2. An episomal vector-based CRISPR/Cas9 system for highly efficient gene knockout in human pluripotent stem cells.

    PubMed

    Xie, Yifang; Wang, Daqi; Lan, Feng; Wei, Gang; Ni, Ting; Chai, Renjie; Liu, Dong; Hu, Shijun; Li, Mingqing; Li, Dajin; Wang, Hongyan; Wang, Yongming

    2017-05-24

    Human pluripotent stem cells (hPSCs) represent a unique opportunity for understanding the molecular mechanisms underlying complex traits and diseases. CRISPR/Cas9 is a powerful tool to introduce genetic mutations into the hPSCs for loss-of-function studies. Here, we developed an episomal vector-based CRISPR/Cas9 system, which we called epiCRISPR, for highly efficient gene knockout in hPSCs. The epiCRISPR system enables generation of up to 100% Insertion/Deletion (indel) rates. In addition, the epiCRISPR system enables efficient double-gene knockout and genomic deletion. To minimize off-target cleavage, we combined the episomal vector technology with double-nicking strategy and recent developed high fidelity Cas9. Thus the epiCRISPR system offers a highly efficient platform for genetic analysis in hPSCs.

  3. Gene knockout and overexpression analysis revealed the role of N-acetylmuramidase in autolysis of Lactobacillus delbrueckii subsp. bulgaricus ljj-6.

    PubMed

    Pang, Xiao-Yang; Cui, Wen-Ming; Liu, Lu; Zhang, Shu-Wen; Lv, Jia-Ping

    2014-01-01

    Autolysis of lactic acid bacteria (LAB) plays a vital role in dairy processing. During cheese making, autolysis of LAB affects cheese flavor development through release of intracellular enzymes and restricts the proliferation of cells in yogurt fermentation and probiotics production. In order to explore the mechanism of autolysis, the gene for the autolytic enzymes of L. bulgaricus, N-acetylmuramidase (mur), was cloned and sequenced (GenBank accession number: KF157911). Mur gene overexpression and gene knockout vectors were constructed based on pMG76e and pUC19 vectors. Recombinant plasmids were transformed into L. bulgaricus ljj-6 by electroporation, then three engineered strains with pMG76e-mur vector and fifteen engineered strains with pUC19-mur::EryBII were screened. The autolysis of the mur knockout strain was significantly lower and autolysis of the mur overexpressed strain was significantly higher compared with that of the wild type strain ljj-6. This result suggested that the mur gene played an important role in autolysis of L. bulgaricus. On the other hand, autolytic activity in a low degree was still observed in the mur knockout strain, which implied that other enzymes but autolysin encoded by mur were also involved in autolysis of L. bulgaricus.

  4. Generating gene knockout rats by homologous recombination in embryonic stem cells

    PubMed Central

    Tong, Chang; Huang, Guanyi; Ashton, Charles; Li, Ping; Ying, Qi-Long

    2013-01-01

    We describe here a detailed protocol for generating gene knockout rats by homologous recombination in embryonic stem (ES) cells. This protocol comprises the following procedures: derivation and expansion of rat ES cells, construction of gene-targeting vectors, generation of gene-targeted rat ES cells and, finally, production of gene-targeted rats. The major differences between this protocol and the classical mouse gene-targeting protocol include ES cell culture methods, drug selection scheme, colony picking and screening strategies. This ES cell–based gene-targeting technique allows sophisticated genetic modifications to be performed in the rat, as many laboratories have been doing in the mouse for the past two decades. Recently we used this protocol to generate Tp53 (also known as p53) gene knockout rats. The entire process requires ~1 year to complete, from derivation of ES cells to generation of knockout rats. PMID:21637202

  5. Evaluation and Design of Genome-Wide CRISPR/SpCas9 Knockout Screens

    PubMed Central

    Hart, Traver; Tong, Amy Hin Yan; Chan, Katie; Van Leeuwen, Jolanda; Seetharaman, Ashwin; Aregger, Michael; Chandrashekhar, Megha; Hustedt, Nicole; Seth, Sahil; Noonan, Avery; Habsid, Andrea; Sizova, Olga; Nedyalkova, Lyudmila; Climie, Ryan; Tworzyanski, Leanne; Lawson, Keith; Sartori, Maria Augusta; Alibeh, Sabriyeh; Tieu, David; Masud, Sanna; Mero, Patricia; Weiss, Alexander; Brown, Kevin R.; Usaj, Matej; Billmann, Maximilian; Rahman, Mahfuzur; Costanzo, Michael; Myers, Chad L.; Andrews, Brenda J.; Boone, Charles; Durocher, Daniel; Moffat, Jason

    2017-01-01

    The adaptation of CRISPR/SpCas9 technology to mammalian cell lines is transforming the study of human functional genomics. Pooled libraries of CRISPR guide RNAs (gRNAs) targeting human protein-coding genes and encoded in viral vectors have been used to systematically create gene knockouts in a variety of human cancer and immortalized cell lines, in an effort to identify whether these knockouts cause cellular fitness defects. Previous work has shown that CRISPR screens are more sensitive and specific than pooled-library shRNA screens in similar assays, but currently there exists significant variability across CRISPR library designs and experimental protocols. In this study, we reanalyze 17 genome-scale knockout screens in human cell lines from three research groups, using three different genome-scale gRNA libraries. Using the Bayesian Analysis of Gene Essentiality algorithm to identify essential genes, we refine and expand our previously defined set of human core essential genes from 360 to 684 genes. We use this expanded set of reference core essential genes, CEG2, plus empirical data from six CRISPR knockout screens to guide the design of a sequence-optimized gRNA library, the Toronto KnockOut version 3.0 (TKOv3) library. We then demonstrate the high effectiveness of the library relative to reference sets of essential and nonessential genes, as well as other screens using similar approaches. The optimized TKOv3 library, combined with the CEG2 reference set, provide an efficient, highly optimized platform for performing and assessing gene knockout screens in human cell lines. PMID:28655737

  6. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Igarashi, Aki; Yamagata, Kousuke; Sugai, Tomokazu

    Apple latent spherical virus (ALSV) vectors were evaluated for virus-induced gene silencing (VIGS) of endogenous genes among a broad range of plant species. ALSV vectors carrying partial sequences of a subunit of magnesium chelatase (SU) and phytoene desaturase (PDS) genes induced highly uniform knockout phenotypes typical of SU and PDS inhibition on model plants such as tobacco and Arabidopsis thaliana, and economically important crops such as tomato, legume, and cucurbit species. The silencing phenotypes persisted throughout plant growth in these plants. In addition, ALSV vectors could be successfully used to silence a meristem gene, proliferating cell nuclear antigen and diseasemore » resistant N gene in tobacco and RCY1 gene in A. thaliana. As ALSV infects most host plants symptomlessly and effectively induces stable VIGS for long periods, the ALSV vector is a valuable tool to determine the functions of interested genes among a broad range of plant species.« less

  7. Long-term systemic therapy of Fabry disease in a knockout mouse by adeno-associated virus-mediated muscle-directed gene transfer

    PubMed Central

    Takahashi, Hiroshi; Hirai, Yukihiko; Migita, Makoto; Seino, Yoshihiko; Fukuda, Yuh; Sakuraba, Hitoshi; Kase, Ryoichi; Kobayashi, Toshihide; Hashimoto, Yasuhiro; Shimada, Takashi

    2002-01-01

    Fabry disease is a systemic disease caused by genetic deficiency of a lysosomal enzyme, α-galactosidase A (α-gal A), and is thought to be an important target for enzyme replacement therapy. We studied the feasibility of gene-mediated enzyme replacement for Fabry disease. The adeno-associated virus (AAV) vector containing the α-gal A gene was injected into the right quadriceps muscles of Fabry knockout mice. A time course study showed that α-gal A activity in plasma was increased to ≈25% of normal mice and that this elevated activity persisted for up to at least 30 weeks without development of anti-α-gal A antibodies. The α-gal A activity in various organs of treated Fabry mice remained 5–20% of those observed in normal mice. Accumulated globotriaosylceramide in these organs was completely cleared by 25 weeks after vector injection. Reduction of globotriaosylceramide levels was also confirmed by immunohistochemical and electronmicroscopic analyses. Echocardiographic examination of treated mice demonstrated structural improvement of cardiac hypertrophy 25 weeks after the treatment. AAV vector-mediated muscle-directed gene transfer provides an efficient and practical therapeutic approach for Fabry disease. PMID:12370426

  8. [Establishment of L-periaxin gene knock-out RSC96 cell line].

    PubMed

    Liang, Min; Peng, Tingting; Shi, Yawei

    2016-12-25

    Periaxin, a protein of noncompact myelin, is specifically expressed in the peripheral nervous system (PNS). There are two protein isoform L-periaxin and S-Periaxin by alternative splicing of periaxin gene, playing an important role in the initiation of myelin formation. So far, 18 different mutation sites in L-periaxin gene have been found to induce the peripheral demyelinating neurological charcot-marie-tooth diseases subtype 4F (CMT4F). The technique of activation of transcription activator-like effector nucleases (TALENS) was used to knock out the L-periaxin gene in RSC 96 cell line of Rattus. According to the design principle, the knock-out site of L-periaxin was assured to NLS domain of L-periaxin, which is target sequence of left and right arms of TALEN. The knock-out vectors of TALEN-L and TALEN-R were established and transfected into RSC96 cell. After puromycin screening, L-periaxin was knocked out successfully in RSC96 cell, which is confirmed by DNA sequence. The mutation efficiency is 21.6%. S-periaxin, not L-periaxin can be detected by Western blotting in L-periaxin gene knock-out RSC96 cell. The cell growth rate was decreased and the number of cells in G1 increased and decreased in S phase in L-periaxin gene knock-out RSC96 cell by flow cytometry and MTT assay.

  9. An efficient method for generation of bi-allelic null mutant mouse embryonic stem cells and its application for investigating epigenetic modifiers

    PubMed Central

    Cho, Lily Ting-yin; Andrews, Robert; Carroll, Thomas; Iyer, Vivek; Tate, Peri; Rosen, Barry; Stunnenberg, Hendrik G.; Fisher, Amanda G.; Skarnes, William C.

    2017-01-01

    Abstract Mouse embryonic stem (ES) cells are a popular model system to study biological processes, though uncovering recessive phenotypes requires inactivating both alleles. Building upon resources from the International Knockout Mouse Consortium (IKMC), we developed a targeting vector for second allele inactivation in conditional-ready IKMC ‘knockout-first’ ES cell lines. We applied our technology to several epigenetic regulators, recovering bi-allelic targeted clones with a high efficiency of 60% and used Flp recombinase to restore expression in two null cell lines to demonstrate how our system confirms causality through mutant phenotype reversion. We designed our strategy to select against re-targeting the ‘knockout-first’ allele and identify essential genes in ES cells, including the histone methyltransferase Setdb1. For confirmation, we exploited the flexibility of our system, enabling tamoxifen inducible conditional gene ablation while controlling for genetic background and tamoxifen effects. Setdb1 ablated ES cells exhibit severe growth inhibition, which is not rescued by exogenous Nanog expression or culturing in naive pluripotency ‘2i’ media, suggesting that the self-renewal defect is mediated through pluripotency network independent pathways. Our strategy to generate null mutant mouse ES cells is applicable to thousands of genes and repurposes existing IKMC Intermediate Vectors. PMID:28981838

  10. CRISPR/Cas9 -mediated gene knockout of Anopheles gambiae FREP1 suppresses malaria parasite infection

    PubMed Central

    Dong, Yuemei; Simões, Maria L.

    2018-01-01

    Plasmodium relies on numerous agonists during its journey through the mosquito vector, and these agonists represent potent targets for transmission-blocking by either inhibiting or interfering with them pre- or post-transcriptionally. The recently developed CRISPR/Cas9-based genome editing tools for Anopheles mosquitoes provide new and promising opportunities for the study of agonist function and for developing malaria control strategies through gene deletion to achieve complete agonist inactivation. Here we have established a modified CRISPR/Cas9 gene editing procedure for the malaria vector Anopheles gambiae, and studied the effect of inactivating the fibrinogen-related protein 1 (FREP1) gene on the mosquito’s susceptibility to Plasmodium and on mosquito fitness. FREP1 knockout mutants developed into adult mosquitoes that showed profound suppression of infection with both human and rodent malaria parasites at the oocyst and sporozoite stages. FREP1 inactivation, however, resulted in fitness costs including a significantly lower blood-feeding propensity, fecundity and egg hatching rate, a retarded pupation time, and reduced longevity after a blood meal. PMID:29518156

  11. Gene trap and gene inversion methods for conditional gene inactivation in the mouse

    PubMed Central

    Xin, Hong-Bo; Deng, Ke-Yu; Shui, Bo; Qu, Shimian; Sun, Qi; Lee, Jane; Greene, Kai Su; Wilson, Jason; Yu, Ying; Feldman, Morris; Kotlikoff, Michael I.

    2005-01-01

    Conditional inactivation of individual genes in mice using site-specific recombinases is an extremely powerful method for determining the complex roles of mammalian genes in developmental and tissue-specific contexts, a major goal of post-genomic research. However, the process of generating mice with recombinase recognition sequences placed at specific locations within a gene, while maintaining a functional allele, is time consuming, expensive and technically challenging. We describe a system that combines gene trap and site-specific DNA inversion to generate mouse embryonic stem (ES) cell clones for the rapid production of conditional knockout mice, and the use of this system in an initial gene trap screen. Gene trapping should allow the selection of thousands of ES cell clones with defined insertions that can be used to generate conditional knockout mice, thereby providing extensive parallelism that eliminates the time-consuming steps of targeting vector construction and homologous recombination for each gene. PMID:15659575

  12. Construction of two vectors for gene expression in Trichoderma reesei.

    PubMed

    Lv, Dandan; Wang, Wei; Wei, Dongzhi

    2012-01-01

    We report the construction of two filamentous fungi Trichoderma reesei expression vectors, pWEF31 and pWEF32. Both vectors possess the hygromycin phosphotransferase B gene expression cassette and the strong promoter and terminator of the cellobiohydrolase 1 gene (cbh1) from T. reesei. The two newly constructed vectors can be efficiently transformed into T. reesei with Agrobacterium-mediated transformation. The difference between pWEF31 and pWEF32 is that pWEF32 has two longer homologous arms. As a result, pWEF32 easily undergoes homologous recombination. On the other hand, pWEF31 undergoes random recombination. The applicability of both vectors was tested by first generating the expression vectors pWEF31-red and pWEF32-red and then detecting the expression of the DsRed2 gene in T. reesei Rut C30. Additionally, we measured the exo-1,4-β-glucanase activity of the recombinant cells. Our work provides an effective transformation system for homologous and heterologous gene expression and gene knockout in T. reesei. It also provides a method for recombination at a specific chromosomal location. Finally, both vectors will be useful for the large-scale gene expression industry. Copyright © 2011 Elsevier Inc. All rights reserved.

  13. An efficient method for generation of bi-allelic null mutant mouse embryonic stem cells and its application for investigating epigenetic modifiers.

    PubMed

    Fisher, Cynthia L; Marks, Hendrik; Cho, Lily Ting-Yin; Andrews, Robert; Wormald, Sam; Carroll, Thomas; Iyer, Vivek; Tate, Peri; Rosen, Barry; Stunnenberg, Hendrik G; Fisher, Amanda G; Skarnes, William C

    2017-12-01

    Mouse embryonic stem (ES) cells are a popular model system to study biological processes, though uncovering recessive phenotypes requires inactivating both alleles. Building upon resources from the International Knockout Mouse Consortium (IKMC), we developed a targeting vector for second allele inactivation in conditional-ready IKMC 'knockout-first' ES cell lines. We applied our technology to several epigenetic regulators, recovering bi-allelic targeted clones with a high efficiency of 60% and used Flp recombinase to restore expression in two null cell lines to demonstrate how our system confirms causality through mutant phenotype reversion. We designed our strategy to select against re-targeting the 'knockout-first' allele and identify essential genes in ES cells, including the histone methyltransferase Setdb1. For confirmation, we exploited the flexibility of our system, enabling tamoxifen inducible conditional gene ablation while controlling for genetic background and tamoxifen effects. Setdb1 ablated ES cells exhibit severe growth inhibition, which is not rescued by exogenous Nanog expression or culturing in naive pluripotency '2i' media, suggesting that the self-renewal defect is mediated through pluripotency network independent pathways. Our strategy to generate null mutant mouse ES cells is applicable to thousands of genes and repurposes existing IKMC Intermediate Vectors. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  14. Establishment of expanded and streamlined pipeline of PITCh knock-in – a web-based design tool for MMEJ-mediated gene knock-in, PITCh designer, and the variations of PITCh, PITCh-TG and PITCh-KIKO

    PubMed Central

    Nakamae, Kazuki; Nishimura, Yuki; Takenaga, Mitsumasa; Sakamoto, Naoaki; Ide, Hiroshi; Sakuma, Tetsushi; Yamamoto, Takashi

    2017-01-01

    ABSTRACT The emerging genome editing technology has enabled the creation of gene knock-in cells easily, efficiently, and rapidly, which has dramatically accelerated research in the field of mammalian functional genomics, including in humans. We recently developed a microhomology-mediated end-joining-based gene knock-in method, termed the PITCh system, and presented various examples of its application. Since the PITCh system only requires very short microhomologies (up to 40 bp) and single-guide RNA target sites on the donor vector, the targeting construct can be rapidly prepared compared with the conventional targeting vector for homologous recombination-based knock-in. Here, we established a streamlined pipeline to design and perform PITCh knock-in to further expand the availability of this method by creating web-based design software, PITCh designer (http://www.mls.sci.hiroshima-u.ac.jp/smg/PITChdesigner/index.html), as well as presenting an experimental example of versatile gene cassette knock-in. PITCh designer can automatically design not only the appropriate microhomologies but also the primers to construct locus-specific donor vectors for PITCh knock-in. By using our newly established pipeline, a reporter cell line for monitoring endogenous gene expression, and transgenesis (TG) or knock-in/knockout (KIKO) cell line can be produced systematically. Using these new variations of PITCh, an exogenous promoter-driven gene cassette expressing fluorescent protein gene and drug resistance gene can be integrated into a safe harbor or a specific gene locus to create transgenic reporter cells (PITCh-TG) or knockout cells with reporter knock-in (PITCh-KIKO), respectively. PMID:28453368

  15. Establishment of expanded and streamlined pipeline of PITCh knock-in - a web-based design tool for MMEJ-mediated gene knock-in, PITCh designer, and the variations of PITCh, PITCh-TG and PITCh-KIKO.

    PubMed

    Nakamae, Kazuki; Nishimura, Yuki; Takenaga, Mitsumasa; Nakade, Shota; Sakamoto, Naoaki; Ide, Hiroshi; Sakuma, Tetsushi; Yamamoto, Takashi

    2017-05-04

    The emerging genome editing technology has enabled the creation of gene knock-in cells easily, efficiently, and rapidly, which has dramatically accelerated research in the field of mammalian functional genomics, including in humans. We recently developed a microhomology-mediated end-joining-based gene knock-in method, termed the PITCh system, and presented various examples of its application. Since the PITCh system only requires very short microhomologies (up to 40 bp) and single-guide RNA target sites on the donor vector, the targeting construct can be rapidly prepared compared with the conventional targeting vector for homologous recombination-based knock-in. Here, we established a streamlined pipeline to design and perform PITCh knock-in to further expand the availability of this method by creating web-based design software, PITCh designer ( http://www.mls.sci.hiroshima-u.ac.jp/smg/PITChdesigner/index.html ), as well as presenting an experimental example of versatile gene cassette knock-in. PITCh designer can automatically design not only the appropriate microhomologies but also the primers to construct locus-specific donor vectors for PITCh knock-in. By using our newly established pipeline, a reporter cell line for monitoring endogenous gene expression, and transgenesis (TG) or knock-in/knockout (KIKO) cell line can be produced systematically. Using these new variations of PITCh, an exogenous promoter-driven gene cassette expressing fluorescent protein gene and drug resistance gene can be integrated into a safe harbor or a specific gene locus to create transgenic reporter cells (PITCh-TG) or knockout cells with reporter knock-in (PITCh-KIKO), respectively.

  16. Analysis of Foxo1-regulated genes using Foxo1-deficient pancreatic β cells.

    PubMed

    Miyazaki, Satsuki; Minamida, Rie; Furuyama, Tatsuo; Tashiro, Fumi; Yamato, Eiji; Inagaki, Shinobu; Miyazaki, Jun-ichi

    2012-09-01

    Several reports have suggested that Foxo1, a key regulator in differentiation, growth and metabolism, is involved in pancreatic β-cell function. However, detailed analyses have been hampered by a lack of Foxo1-deficient β cells. To elucidate Foxo1's function in β cells, we produced a β-cell line with inducible Foxo1 deletion. We generated a conditional knockout mouse line, in which Cre recombinase deletes the Foxo1 gene. We then established a β-cell line from an insulinoma induced in this knockout mouse by the β-cell-specific expression of simian virus 40 T antigen. In this cell line, designated MIN6-Foxo1flox/flox, adenovirus-mediated Cre expression ablates the Foxo1 gene, generating MIN6-Foxo1-KO cells. Using these knockout and floxed cell lines, we found that Foxo1 ablation enhanced the glucose-stimulated insulin secretion (GSIS) at high glucose concentrations and enhanced β-cell proliferation. We also conducted DNA microarray analyses of MIN6-Foxo1-KO cells infected with either an adenovirus vector expressing a constitutively active FOXO1 or a control vector and identified several Foxo1-regulated genes, including some known to be related to β-cell function. These cells should be useful for further studies on Foxo1's roles in β-cells and may lead to novel strategies for treating the impaired insulin secretion in type 2 diabetes mellitus. © 2012 The Authors Journal compilation © 2012 by the Molecular Biology Society of Japan/Wiley Publishing Ltd.

  17. Targeted genome editing in a quail cell line using a customized CRISPR/Cas9 system.

    PubMed

    Ahn, Jinsoo; Lee, Joonbum; Park, Ju Yeon; Oh, Keon Bong; Hwang, Seongsoo; Lee, Chang-Won; Lee, Kichoon

    2017-05-01

    Soon after RNA-guided Cas9 (CRISPR-associated protein 9) endonuclease opened a new era of targeted genome editing, the CRISPR/Cas9 platform began to be extensively used to modify genes in various types of cells and organisms. However, successful CRISPR/Cas9-mediated insertion/deletion (indel) mutation remains to be demonstrated in avian cell lines. The objective of this study was to design a poultry-specific CRISPR/Cas9 system to efficiently introduce targeted deletion mutation in chromosomes of the quail muscle clone 7 (QM7) cell line using a customized quail CRISPR vector. In this study, two avian-specific promoters, quail 7SK (q7SK) promoter and CBh promoter, the hybrid form of cytomegalovirus and chicken β-actin promoters, were cloned into a CRISPR vector for the expression of guide RNA and Cas9 protein, respectively. Then, guide RNA, which was designed to target 20-base pair (bp) nucleotides in the quail melanophilin (MLPH) locus, was ligated to the modified CRISPR vector and transfected to QM7 cells. Our results showed multiple indel mutations in the quail MLPH locus in nearly half of the alleles being tested, suggesting the high efficiency of the system for targeted gene modification. The new CRISPR vector developed from this study has the potential application to generate knockout avian cell lines and knockout poultry. © 2016 Poultry Science Association Inc.

  18. Orexin (hypocretin) gene transfer diminishes narcoleptic sleep behavior in mice

    PubMed Central

    Liu, Meng; Thankachan, Stephen; Kaur, Satvinder; Begum, Suraiya; Blanco-Centurion, Carlos; Sakurai, Takeshi; Yanagisawa, Masashi; Neve, Rachael; Shiromani, Priyattam J.

    2008-01-01

    Gene transfer has proven to be an effective neurobiological tool in a number of neurodegenerative diseases, but it is not known if it can correct a sleep disorder. Narcolepsy is a neurodegenerative sleep disorder linked to the loss of neurons containing the neuropeptide orexin, also known as hypocretin. Here, a replication-defective herpes simplex virus-1 amplicon-based vector was constructed to transfer the gene for mouse prepro-orexin into mice with a genetic deletion of the orexin gene. After in vitro tests confirmed successful gene transfer into cells, the gene vector was delivered to the lateral hypothalamus of orexin knockout (KO) mice where the orexin peptide was robustly expressed in the somata and processes of numerous neurons, and the peptide product was detected in the cerebrospinal fluid. During the 4-day life-span of the vector the incidence of cataplexy declined by 60%, and the levels of rapid eye movement sleep during the second half of the night were similar to levels in wild-type mice, indicating that narcoleptic sleep–wake behavior in orexin KO mice can be improved by targeted gene transfer. PMID:18973565

  19. PlasmoGEM, a database supporting a community resource for large-scale experimental genetics in malaria parasites.

    PubMed

    Schwach, Frank; Bushell, Ellen; Gomes, Ana Rita; Anar, Burcu; Girling, Gareth; Herd, Colin; Rayner, Julian C; Billker, Oliver

    2015-01-01

    The Plasmodium Genetic Modification (PlasmoGEM) database (http://plasmogem.sanger.ac.uk) provides access to a resource of modular, versatile and adaptable vectors for genome modification of Plasmodium spp. parasites. PlasmoGEM currently consists of >2000 plasmids designed to modify the genome of Plasmodium berghei, a malaria parasite of rodents, which can be requested by non-profit research organisations free of charge. PlasmoGEM vectors are designed with long homology arms for efficient genome integration and carry gene specific barcodes to identify individual mutants. They can be used for a wide array of applications, including protein localisation, gene interaction studies and high-throughput genetic screens. The vector production pipeline is supported by a custom software suite that automates both the vector design process and quality control by full-length sequencing of the finished vectors. The PlasmoGEM web interface allows users to search a database of finished knock-out and gene tagging vectors, view details of their designs, download vector sequence in different formats and view available quality control data as well as suggested genotyping strategies. We also make gDNA library clones and intermediate vectors available for researchers to produce vectors for themselves. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.

  20. Foamy Virus Vector-mediated Gene Correction of a Mouse Model of Wiskott–Aldrich Syndrome

    PubMed Central

    Uchiyama, Toru; Adriani, Marsilio; Jagadeesh, G Jayashree; Paine, Adam; Candotti, Fabio

    2012-01-01

    The Wiskott–Aldrich syndrome (WAS) is an X-linked disorder characterized by eczema, thrombocytopenia and immunodeficiency. Hematopoietic cell transplantation can cure the disease and gene therapy is being tested as an alternative treatment option. In this study, we assessed the use of foamy virus (FV) vectors as a gene transfer system for WAS, using a Was knockout (KO) mouse model. Preliminary experiments using FV vectors expressing the green fluorescent protein under the transcriptional control of the endogenous WAS promoter or a ubiquitously acting chromatin opening element allowed us to define transduction conditions resulting in high (>40%) and long-term in-vivo marking of blood cells after transplantation. In following experiments, Was KO mice were treated with FV vectors containing the human WAS complementary DNA (cDNA). Transplanted animals expressed the WAS protein (WASp) in T and B lymphocytes, as well as platelets and showed restoration of both T-cell receptor-mediated responses and B-cell migration. We also observed recovery of platelet adhesion and podosome formation in dendritic cells (DCs) of treated mice. These data demonstrate that FV vectors can be effective for hematopoietic stem cell (HSC)-directed gene correction of WAS. PMID:22215016

  1. Glutamine synthetase gene knockout-human embryonic kidney 293E cells for stable production of monoclonal antibodies.

    PubMed

    Yu, Da Young; Lee, Sang Yoon; Lee, Gyun Min

    2018-05-01

    Previously, it was inferred that a high glutamine synthetase (GS) activity in human embryonic kidney (HEK) 293E cells results in elevated resistance to methionine sulfoximine (MSX) and consequently hampers GS-mediated gene amplification and selection by MSX. To overcome this MSX resistance in HEK293E cells, a GS-knockout HEK293E cell line was generated using the CRISPR/Cas9 system to target the endogenous human GS gene. The GS-knockout in the HEK293E cell line (RK8) was confirmed by Western blot analysis of GS and by observation of glutamine-dependent growth. Unlike the wild type HEK293E cells, the RK8 cells were successfully used as host cells to generate a recombinant HEK293E cell line (rHEK293E) producing a monoclonal antibody (mAb). When the RK8 cells were transfected with the GS expression vector containing the mAb gene, rHEK293E cells producing the mAb could be selected in the absence as well as in the presence of MSX. The gene copies and mRNA expression levels of the mAb in rHEK293E cells were also quantified using qRT-PCR. Taken together, the GS-knockout HEK293E cell line can be used as host cells to generate stable rHEK293E cells producing a mAb through GS-mediated gene selection in the absence as well as in the presence of MSX. © 2018 Wiley Periodicals, Inc.

  2. Using RNA-seq and targeted nucleases to identify mechanisms of drug resistance in acute myeloid leukemia.

    PubMed

    Rathe, Susan K; Moriarity, Branden S; Stoltenberg, Christopher B; Kurata, Morito; Aumann, Natalie K; Rahrmann, Eric P; Bailey, Natashay J; Melrose, Ellen G; Beckmann, Dominic A; Liska, Chase R; Largaespada, David A

    2014-08-13

    The evolution from microarrays to transcriptome deep-sequencing (RNA-seq) and from RNA interference to gene knockouts using Clustered Regularly Interspaced Short Palindromic Repeats (CRISPRs) and Transcription Activator-Like Effector Nucleases (TALENs) has provided a new experimental partnership for identifying and quantifying the effects of gene changes on drug resistance. Here we describe the results from deep-sequencing of RNA derived from two cytarabine (Ara-C) resistance acute myeloid leukemia (AML) cell lines, and present CRISPR and TALEN based methods for accomplishing complete gene knockout (KO) in AML cells. We found protein modifying loss-of-function mutations in Dck in both Ara-C resistant cell lines. CRISPR and TALEN-based KO of Dck dramatically increased the IC₅₀ of Ara-C and introduction of a DCK overexpression vector into Dck KO clones resulted in a significant increase in Ara-C sensitivity. This effort demonstrates the power of using transcriptome analysis and CRISPR/TALEN-based KOs to identify and verify genes associated with drug resistance.

  3. Genome-wide recessive genetic screening in mammalian cells with a lentiviral CRISPR-guide RNA library.

    PubMed

    Koike-Yusa, Hiroko; Li, Yilong; Tan, E-Pien; Velasco-Herrera, Martin Del Castillo; Yusa, Kosuke

    2014-03-01

    Identification of genes influencing a phenotype of interest is frequently achieved through genetic screening by RNA interference (RNAi) or knockouts. However, RNAi may only achieve partial depletion of gene activity, and knockout-based screens are difficult in diploid mammalian cells. Here we took advantage of the efficiency and high throughput of genome editing based on type II, clustered, regularly interspaced, short palindromic repeats (CRISPR)-CRISPR-associated (Cas) systems to introduce genome-wide targeted mutations in mouse embryonic stem cells (ESCs). We designed 87,897 guide RNAs (gRNAs) targeting 19,150 mouse protein-coding genes and used a lentiviral vector to express these gRNAs in ESCs that constitutively express Cas9. Screening the resulting ESC mutant libraries for resistance to either Clostridium septicum alpha-toxin or 6-thioguanine identified 27 known and 4 previously unknown genes implicated in these phenotypes. Our results demonstrate the potential for efficient loss-of-function screening using the CRISPR-Cas9 system.

  4. [Construction of Rev-erbβ gene knockout HEK293 cell line with CRISPR/Cas9 system].

    PubMed

    Chen, Fang; Zhang, Weifeng; Zhao, Junli; Yang, Peiyan; Ma, Rui; Xia, Haibin

    2016-11-01

    Objective To prepare Rev-erbβ knockout HEK293 cells using clustered regularly interspaced short palindromic repeats/Cas 9 nuclease (CRISPR/Cas9) gene editing technology. Methods The knock-in or knockout of Rev-erbβ gene could be realized by single-guide RNA (sgRNA)-mediated Cas9 cutting of target DNA, and followed by DNA homologous recombination or non-homologous end joining-mediated DNA repair. Firstly, four sgRNAs were designed for Rev-erbβ gene. The sgRNA1 and sgRNA2 with the higher activity were respectively used to construct pCMV-hCas9-U6-Rev-erbβ sgRNA1 and pCMV-hCas9-U6-Rev-erbβ sgRNA2. Then, pCMV-hCas9-U6-Rev-erbβ sgRNA1, pCMV-hCas9-U6-Rev-erbβ sgRNA2 and pAd5-E1/hRev-erbβ donor plasmid vectors were co-transfected into HEK293 cells. Through drug screening, cloning and sequencing, the Rev-erbβ gene-knockout HEK293 (Rev-erbβ -/- ) cell lines were obtained with one chain integrated with exogenous gene fragment and the other chain for deletion mutants. Finally, the HEK293 (Rev-erbβ -/- ) cell lines (C3-6) was detected with real-time quantitative PCR and Western blotting. Results Expression of Rev-erbβ mRNA and protein was undetectable in HEK293 Rev-erbβ -/- cell line. Conclusion Using CRISPR/Cas9 technology, the HEK293 Rev-erbβ -/- cell line has been successfully constructed, which would provide an effective tool for the study on the function of Rev-erbβ.

  5. Systematic Analysis of Zn2Cys6 Transcription Factors Required for Development and Pathogenicity by High-Throughput Gene Knockout in the Rice Blast Fungus

    PubMed Central

    Huang, Pengyun; Lin, Fucheng

    2014-01-01

    Because of great challenges and workload in deleting genes on a large scale, the functions of most genes in pathogenic fungi are still unclear. In this study, we developed a high-throughput gene knockout system using a novel yeast-Escherichia-Agrobacterium shuttle vector, pKO1B, in the rice blast fungus Magnaporthe oryzae. Using this method, we deleted 104 fungal-specific Zn2Cys6 transcription factor (TF) genes in M. oryzae. We then analyzed the phenotypes of these mutants with regard to growth, asexual and infection-related development, pathogenesis, and 9 abiotic stresses. The resulting data provide new insights into how this rice pathogen of global significance regulates important traits in the infection cycle through Zn2Cys6TF genes. A large variation in biological functions of Zn2Cys6TF genes was observed under the conditions tested. Sixty-one of 104 Zn2Cys6 TF genes were found to be required for fungal development. In-depth analysis of TF genes revealed that TF genes involved in pathogenicity frequently tend to function in multiple development stages, and disclosed many highly conserved but unidentified functional TF genes of importance in the fungal kingdom. We further found that the virulence-required TF genes GPF1 and CNF2 have similar regulation mechanisms in the gene expression involved in pathogenicity. These experimental validations clearly demonstrated the value of a high-throughput gene knockout system in understanding the biological functions of genes on a genome scale in fungi, and provided a solid foundation for elucidating the gene expression network that regulates the development and pathogenicity of M. oryzae. PMID:25299517

  6. Nanoparticle-mediated rhodopsin cDNA but not intron-containing DNA delivery causes transgene silencing in a rhodopsin knockout model.

    PubMed

    Zheng, Min; Mitra, Rajendra N; Filonov, Nazar A; Han, Zongchao

    2016-03-01

    Previously, we compared the efficacy of nanoparticle (NP)-mediated intron-containing rhodopsin (sgRho) vs. intronless cDNA in ameliorating retinal disease phenotypes in a rhodopsin knockout (RKO) mouse model of retinitis pigmentosa. We showed that NP-mediated sgRho delivery achieved long-term expression and phenotypic improvement in RKO mice, but not NP housing cDNA. However, the protein level of the NP-sgRho construct was only 5-10% of wild-type at 8 mo postinjection. To have a better understanding of the reduced levels of long-term expression of the vectors, in the present study, we evaluated the epigenetic changes of subretinal delivering NP-cDNA vs. NP-sgRho in the RKO mouse eyes. Following the administration, DNA methylation and histone status of specific regions (bacteria plasmid backbone, promoter, rhodopsin gene, and scaffold/matrix attachment region) of the vectors were evaluated at various time points. We documented that epigenetic transgene silencing occurred in vector-mediated gene transfer, which were caused by the plasmid backbone and the cDNA of the transgene, but not the intron-containing transgene. No toxicity or inflammation was found in the treated eyes. Our results suggest that cDNA of the rhodopsin transgene and bacteria backbone interfered with the host defense mechanism of DNA methylation-mediated transgene silencing through heterochromatin-associated modifications. © FASEB.

  7. Current status of genome editing in vector mosquitoes: A review.

    PubMed

    Reegan, Appadurai Daniel; Ceasar, Stanislaus Antony; Paulraj, Michael Gabriel; Ignacimuthu, Savarimuthu; Al-Dhabi, Naif Abdullah

    2017-01-16

    Mosquitoes pose a major threat to human health as they spread many deadly diseases like malaria, dengue, chikungunya, filariasis, Japanese encephalitis and Zika. Identification and use of novel molecular tools are essential to combat the spread of vector borne diseases. Genome editing tools have been used for the precise alterations of the gene of interest for producing the desirable trait in mosquitoes. Deletion of functional genes or insertion of toxic genes in vector mosquitoes will produce either knock-out or knock-in mutants that will check the spread of vector-borne diseases. Presently, three types of genome editing tools viz., zinc finger nuclease (ZFN), transcription activator-like effector nucleases (TALEN) and clustered regulatory interspaced short palindromic repeats (CRISPR) and CRISPR associated protein 9 (Cas9) are widely used for the editing of the genomes of diverse organisms. These tools are also applied in vector mosquitoes to control the spread of vector-borne diseases. A few studies have been carried out on genome editing to control the diseases spread by vector mosquitoes and more studies need to be performed with the utilization of more recently invented tools like CRISPR/Cas9 to combat the spread of deadly diseases by vector mosquitoes. The high specificity and flexibility of CRISPR/Cas9 system may offer possibilities for novel genome editing for the control of important diseases spread by vector mosquitoes. In this review, we present the current status of genome editing research on vector mosquitoes and also discuss the future applications of vector mosquito genome editing to control the spread of vectorborne diseases.

  8. Gene targeting by TALEN-induced homologous recombination in goats directs production of β-lactoglobulin-free, high-human lactoferrin milk

    PubMed Central

    Cui, Chenchen; Song, Yujie; Liu, Jun; Ge, Hengtao; Li, Qian; Huang, Hui; Hu, Linyong; Zhu, Hongmei; Jin, Yaping; Zhang, Yong

    2015-01-01

    β-Lactoglobulin (BLG) is a major goat’s milk allergen that is absent in human milk. Engineered endonucleases, including transcription activator-like effector nucleases (TALENs) and zinc-finger nucleases, enable targeted genetic modification in livestock. In this study, TALEN-mediated gene knockout followed by gene knock-in were used to generate BLG knockout goats as mammary gland bioreactors for large-scale production of human lactoferrin (hLF). We introduced precise genetic modifications in the goat genome at frequencies of approximately 13.6% and 6.09% for the first and second sequential targeting, respectively, by using targeting vectors that underwent TALEN-induced homologous recombination (HR). Analysis of milk from the cloned goats revealed large-scale hLF expression or/and decreased BLG levels in milk from heterozygous goats as well as the absence of BLG in milk from homozygous goats. Furthermore, the TALEN-mediated targeting events in somatic cells can be transmitted through the germline after SCNT. Our result suggests that gene targeting via TALEN-induced HR may expedite the production of genetically engineered livestock for agriculture and biomedicine. PMID:25994151

  9. Gene targeting by TALEN-induced homologous recombination in goats directs production of β-lactoglobulin-free, high-human lactoferrin milk.

    PubMed

    Cui, Chenchen; Song, Yujie; Liu, Jun; Ge, Hengtao; Li, Qian; Huang, Hui; Hu, Linyong; Zhu, Hongmei; Jin, Yaping; Zhang, Yong

    2015-05-21

    β-Lactoglobulin (BLG) is a major goat's milk allergen that is absent in human milk. Engineered endonucleases, including transcription activator-like effector nucleases (TALENs) and zinc-finger nucleases, enable targeted genetic modification in livestock. In this study, TALEN-mediated gene knockout followed by gene knock-in were used to generate BLG knockout goats as mammary gland bioreactors for large-scale production of human lactoferrin (hLF). We introduced precise genetic modifications in the goat genome at frequencies of approximately 13.6% and 6.09% for the first and second sequential targeting, respectively, by using targeting vectors that underwent TALEN-induced homologous recombination (HR). Analysis of milk from the cloned goats revealed large-scale hLF expression or/and decreased BLG levels in milk from heterozygous goats as well as the absence of BLG in milk from homozygous goats. Furthermore, the TALEN-mediated targeting events in somatic cells can be transmitted through the germline after SCNT. Our result suggests that gene targeting via TALEN-induced HR may expedite the production of genetically engineered livestock for agriculture and biomedicine.

  10. pKAMA-ITACHI Vectors for Highly Efficient CRISPR/Cas9-Mediated Gene Knockout in Arabidopsis thaliana

    PubMed Central

    2017-01-01

    The CRISPR/Cas9 (clustered regularly interspaced short palindromic repeats/CRISPR-associated 9) system is widely used as a tool for genome engineering in various organisms. A complex consisting of Cas9 and single guide RNA (sgRNA) induces a DNA double-strand break in a sequence-specific manner, resulting in knockout. Some binary vectors for CRISPR/Cas9 in plants have been reported, but there is a problem with low efficiency. Here, we present a newly developed, highly efficient CRISPR/Cas9 vector for Arabidopsis thaliana, pKAMA-ITACHI Red (pKIR), harboring the RIBOSOMAL PROTEIN S5 A (RPS5A) promoter to drive Cas9. The RPS5A promoter maintains high constitutive expression at all developmental stages starting from the egg cell and including meristematic cells. Even in the T1 generation, pKIR induced null phenotypes in some genes: PHYTOENE DESATURASE 3 (PDS3), AGAMOUS (AG) and DUO POLLEN 1 (DUO1). Mutations induced by pKIR were carried in the germ cell line of the T1 generation. Surprisingly, in some lines, 100% of the T2 plants had the adh1 (ALCOHOL DEHYDROGENASE 1) null phenotype, indicating that pKIR strongly induced heritable mutations. Cas9-free T2 mutant plants were obtained by removing T2 seeds expressing a fluorescent marker in pKIR. Our results suggest that the pKIR system is a powerful molecular tool for genome engineering in Arabidopsis. PMID:27856772

  11. Gene therapy/bone marrow transplantation in ADA-deficient mice: roles of enzyme-replacement therapy and cytoreduction.

    PubMed

    Carbonaro, Denise A; Jin, Xiangyang; Wang, Xingchao; Yu, Xiao-Jin; Rozengurt, Nora; Kaufman, Michael L; Wang, Xiaoyan; Gjertson, David; Zhou, Yang; Blackburn, Michael R; Kohn, Donald B

    2012-11-01

    Gene therapy (GT) for adenosine deaminase-deficient severe combined immune deficiency (ADA-SCID) can provide significant long-term benefit when patients are given nonmyeloablative conditioning and ADA enzyme-replacement therapy (ERT) is withheld before autologous transplantation of γ-retroviral vector-transduced BM CD34+ cells. To determine the contributions of conditioning and discontinuation of ERT to the therapeutic effects, we analyzed these factors in Ada gene knockout mice (Ada(-/-)). Mice were transplanted with ADA-deficient marrow transduced with an ADA-expressing γ-retroviral vector without preconditioning or after 200 cGy or 900 cGy total-body irradiation and evaluated after 4 months. In all tissues analyzed, vector copy numbers (VCNs) were 100- to 1000-fold greater in mice receiving 900 cGy compared with 200 cGy (P < .05). In mice receiving 200 cGy, VCN was similar whether ERT was stopped or given for 1 or 4 months after GT. In unconditioned mice, there was decreased survival with and without ERT, and VCN was very low to undetectable. When recipients were conditioned with 200 cGy and received transduced lineage-depleted marrow, only recipients receiving ERT (1 or 4 months) had detectable vector sequences in thymocytes. In conclusion, cytoreduction is important for the engraftment of gene-transduced HSC, and short-term ERT after GT did not diminish the capacity of gene-corrected cells to engraft and persist.

  12. AAV-mediated RLBP1 gene therapy improves the rate of dark adaptation in Rlbp1 knockout mice

    PubMed Central

    Choi, Vivian W; Bigelow, Chad E; McGee, Terri L; Gujar, Akshata N; Li, Hui; Hanks, Shawn M; Vrouvlianis, Joanna; Maker, Michael; Leehy, Barrett; Zhang, Yiqin; Aranda, Jorge; Bounoutas, George; Demirs, John T; Yang, Junzheng; Ornberg, Richard; Wang, Yu; Martin, Wendy; Stout, Kelly R; Argentieri, Gregory; Grosenstein, Paul; Diaz, Danielle; Turner, Oliver; Jaffee, Bruce D; Police, Seshidhar R; Dryja, Thaddeus P

    2015-01-01

    Recessive mutations in RLBP1 cause a form of retinitis pigmentosa in which the retina, before its degeneration leads to blindness, abnormally slowly recovers sensitivity after exposure to light. To develop a potential gene therapy for this condition, we tested multiple recombinant adeno-associated vectors (rAAVs) composed of different promoters, capsid serotypes, and genome conformations. We generated rAAVs in which sequences from the promoters of the human RLBP1, RPE65, or BEST1 genes drove the expression of a reporter gene (green fluorescent protein). A promoter derived from the RLBP1 gene mediated expression in the retinal pigment epithelium and Müller cells (the intended target cell types) at qualitatively higher levels than in other retinal cell types in wild-type mice and monkeys. With this promoter upstream of the coding sequence of the human RLBP1 gene, we compared the potencies of vectors with an AAV2 versus an AAV8 capsid in transducing mouse retinas, and we compared vectors with a self-complementary versus a single-stranded genome. The optimal vector (scAAV8-pRLBP1-hRLBP1) had serotype 8 capsid and a self-complementary genome. Subretinal injection of scAAV8-pRLBP1-hRLBP1 in Rlbp1 nullizygous mice improved the rate of dark adaptation based on scotopic (rod-plus-cone) and photopic (cone) electroretinograms (ERGs). The effect was still present after 1 year. PMID:26199951

  13. Promyelocytic Leukemia Protein Is a Cell-Intrinsic Factor Inhibiting Parvovirus DNA Replication

    PubMed Central

    Mitchell, Angela M.; Hirsch, Matthew L.; Li, Chengwen

    2014-01-01

    Tripartite motif proteins are important viral restriction factors and affect processes ranging from uncoating to transcription to immune signaling. Specifically, the promyelocytic leukemia protein (TRIM19; also called PML) is a viral restriction factor inhibiting processes from uncoating to transcription to cell survival. Here we investigated PML's effect on adeno-associated virus (AAV), a parvovirus used for gene delivery. Although dependovirus (AAV) and autonomous parvovirus (minute virus of mice) replication centers can colocalize with PML, PML's functional effect on parvoviruses is unknown. Using PML knockout mice, we determined that PML knockout enhances recombinant AAV2 (rAAV2) transduction at a range of vector doses in both male and female mice. In fact, male and female PML knockout mice exhibited up to 56-fold and 28-fold increases in transduction, respectively. PML inhibited several rAAV serotypes, suggesting a conserved mechanism, and organ specificity correlated with PML expression. Mechanistically, PML inhibited rAAV second-strand DNA synthesis, precluding inhibition of self-complementary rAAV, and did not affect the prior steps in transduction. Furthermore, we confirmed the effect of human PML on rAAV transduction through small interfering RNA (siRNA)-mediated knockdown in HuH7 cells and determined that the highest level of inhibition was due to effects of PML isoform II (PMLII). Overexpression of PMLII resulted in inhibition of second-strand synthesis, vector production, and genome replication. Moreover, wild-type AAV2 production and infectivity were also inhibited by PMLII, demonstrating a PML interaction with wild-type AAV. These data have important implications for AAV-mediated gene therapy. Additionally, PMLII inhibition of AAV second-strand synthesis and replication, which are processes necessary for all parvoviruses, suggests implications for replication of other parvoviruses. PMID:24198403

  14. Promyelocytic leukemia protein is a cell-intrinsic factor inhibiting parvovirus DNA replication.

    PubMed

    Mitchell, Angela M; Hirsch, Matthew L; Li, Chengwen; Samulski, R Jude

    2014-01-01

    Tripartite motif proteins are important viral restriction factors and affect processes ranging from uncoating to transcription to immune signaling. Specifically, the promyelocytic leukemia protein (TRIM19; also called PML) is a viral restriction factor inhibiting processes from uncoating to transcription to cell survival. Here we investigated PML's effect on adeno-associated virus (AAV), a parvovirus used for gene delivery. Although dependovirus (AAV) and autonomous parvovirus (minute virus of mice) replication centers can colocalize with PML, PML's functional effect on parvoviruses is unknown. Using PML knockout mice, we determined that PML knockout enhances recombinant AAV2 (rAAV2) transduction at a range of vector doses in both male and female mice. In fact, male and female PML knockout mice exhibited up to 56-fold and 28-fold increases in transduction, respectively. PML inhibited several rAAV serotypes, suggesting a conserved mechanism, and organ specificity correlated with PML expression. Mechanistically, PML inhibited rAAV second-strand DNA synthesis, precluding inhibition of self-complementary rAAV, and did not affect the prior steps in transduction. Furthermore, we confirmed the effect of human PML on rAAV transduction through small interfering RNA (siRNA)-mediated knockdown in HuH7 cells and determined that the highest level of inhibition was due to effects of PML isoform II (PMLII). Overexpression of PMLII resulted in inhibition of second-strand synthesis, vector production, and genome replication. Moreover, wild-type AAV2 production and infectivity were also inhibited by PMLII, demonstrating a PML interaction with wild-type AAV. These data have important implications for AAV-mediated gene therapy. Additionally, PMLII inhibition of AAV second-strand synthesis and replication, which are processes necessary for all parvoviruses, suggests implications for replication of other parvoviruses.

  15. CRISPR/Cas9-Mediated Deletion of C1EIS Inhibits Chicken Embryonic Stem Cell Differentiation Into Male Germ Cells (Gallus gallus).

    PubMed

    Zuo, Qisheng; Jin, Kai; Wang, Yingjie; Song, Jiuzhou; Zhang, Yani; Li, Bichun

    2017-08-01

    We previously found that C1EIS is preferentially expressed in Chicken spermatogonial stem cells (SSCs) by RNA sequencing (RNA-seq), so our current study focused on C1EIS's role in Chicken embryonic stem cells (ESCs) differentiation into male germ cells. We constructed a CRISPR/Cas9 vector targeting C1EIS. T7 endonuclease I (T7EI) digestion method and sequencing of TA cloning were used to detect the knock-out efficiency of the Single guide RNA (sgRNA) after the cas9/gRNA vector transfected into D fibroblasts 1(DF-1), ESCs, and Chicken embryos. The results showed that CRISPR/Cas9 gene knockout efficiency is about 40%. Differentiation of the targeted ESCs into SSCs was inhibited at the embryoid body stage due to C1EIS deficiency. Immunofluorescent staining revealed that the mutagenized ESCs (RA (Retinoic Acid) with C1EIS Knock out) expressed lower levels of integrin α6 and integrin β1 compared to wild type cells. Quantitative real-time PCR (QRT-PCR) revealed Oct4 and Sox2 expression significantly increased, contrarily integrin β1 and Stra8 expression significantly decreased than RA induced group and RA with C1EIS Overexpression. During retinoic acid-induced differentiation, knockout of C1EIS in ESCs inhibited formation of SSC-like cells, suggesting C1EIS plays a vital role in promoting differentiation of avian ESCs to SSCs by regulating expression of multiple pluripotency-related genes. J. Cell. Biochem. 118: 2380-2386, 2017. © 2017 Wiley Periodicals, Inc. © 2017 Wiley Periodicals, Inc.

  16. pKAMA-ITACHI Vectors for Highly Efficient CRISPR/Cas9-Mediated Gene Knockout in Arabidopsis thaliana.

    PubMed

    Tsutsui, Hiroki; Higashiyama, Tetsuya

    2017-01-01

    The CRISPR/Cas9 (clustered regularly interspaced short palindromic repeats/CRISPR-associated 9) system is widely used as a tool for genome engineering in various organisms. A complex consisting of Cas9 and single guide RNA (sgRNA) induces a DNA double-strand break in a sequence-specific manner, resulting in knockout. Some binary vectors for CRISPR/Cas9 in plants have been reported, but there is a problem with low efficiency. Here, we present a newly developed, highly efficient CRISPR/Cas9 vector for Arabidopsis thaliana, pKAMA-ITACHI Red (pKIR), harboring the RIBOSOMAL PROTEIN S5 A (RPS5A) promoter to drive Cas9. The RPS5A promoter maintains high constitutive expression at all developmental stages starting from the egg cell and including meristematic cells. Even in the T1 generation, pKIR induced null phenotypes in some genes: PHYTOENE DESATURASE 3 (PDS3), AGAMOUS (AG) and DUO POLLEN 1 (DUO1). Mutations induced by pKIR were carried in the germ cell line of the T1 generation. Surprisingly, in some lines, 100% of the T2 plants had the adh1 (ALCOHOL DEHYDROGENASE 1) null phenotype, indicating that pKIR strongly induced heritable mutations. Cas9-free T2 mutant plants were obtained by removing T2 seeds expressing a fluorescent marker in pKIR. Our results suggest that the pKIR system is a powerful molecular tool for genome engineering in Arabidopsis. © The Author 2016. Published by Oxford University Press on behalf of Japanese Society of Plant Physiologists.

  17. Histone deacetylase inhibition rescues gene knockout levels achieved with integrase-defective lentiviral vectors encoding zinc-finger nucleases.

    PubMed

    Pelascini, Laetitia P L; Maggio, Ignazio; Liu, Jin; Holkers, Maarten; Cathomen, Toni; Gonçalves, Manuel A F V

    2013-12-01

    Zinc-finger nucleases (ZFNs) work as dimers to induce double-stranded DNA breaks (DSBs) at predefined chromosomal positions. In doing so, they constitute powerful triggers to edit and to interrogate the function of genomic sequences in higher eukaryotes. A preferred route to introduce ZFNs into somatic cells relies on their cotransduction with two integrase-defective lentiviral vectors (IDLVs) each encoding a monomer of a functional heterodimeric pair. The episomal nature of IDLVs diminishes the risk of genotoxicity and ensures the strict transient expression profile necessary to minimize deleterious effects associated with long-term ZFN activity. However, by deploying IDLVs and conventional lentiviral vectors encoding HPRT1- or eGFP-specific ZFNs, we report that DSB formation at target alleles is limited after IDLV-mediated ZFN transfer. This IDLV-specific underperformance stems, to a great extent, from the activity of chromatin-remodeling histone deacetylases (HDACs). Importantly, the prototypic and U.S. Food and Drug Administration-approved inhibitors of metal-dependent HDACs, trichostatin A and vorinostat, respectively, did not hinder illegitimate recombination-mediated repair of targeted chromosomal DSBs. This allowed rescuing IDLV-mediated site-directed mutagenesis to levels approaching those achieved by using their isogenic chromosomally integrating counterparts. Hence, HDAC inhibition constitutes an efficacious expedient to incorporate in genome-editing strategies based on transient IDLV-mediated ZFN expression. Finally, we compared two of the most commonly used readout systems to measure targeted gene knockout activities based on restriction and mismatch-sensitive endonucleases. These experiments indicate that these enzymatic assays display a similar performance.

  18. Gene therapy/bone marrow transplantation in ADA-deficient mice: roles of enzyme-replacement therapy and cytoreduction

    PubMed Central

    Jin, Xiangyang; Wang, Xingchao; Yu, Xiao-Jin; Rozengurt, Nora; Kaufman, Michael L.; Wang, Xiaoyan; Gjertson, David; Zhou, Yang; Blackburn, Michael R.; Kohn, Donald B.

    2012-01-01

    Gene therapy (GT) for adenosine deaminase–deficient severe combined immune deficiency (ADA-SCID) can provide significant long-term benefit when patients are given nonmyeloablative conditioning and ADA enzyme-replacement therapy (ERT) is withheld before autologous transplantation of γ-retroviral vector-transduced BM CD34+ cells. To determine the contributions of conditioning and discontinuation of ERT to the therapeutic effects, we analyzed these factors in Ada gene knockout mice (Ada−/−). Mice were transplanted with ADA-deficient marrow transduced with an ADA-expressing γ-retroviral vector without preconditioning or after 200 cGy or 900 cGy total-body irradiation and evaluated after 4 months. In all tissues analyzed, vector copy numbers (VCNs) were 100- to 1000-fold greater in mice receiving 900 cGy compared with 200 cGy (P < .05). In mice receiving 200 cGy, VCN was similar whether ERT was stopped or given for 1 or 4 months after GT. In unconditioned mice, there was decreased survival with and without ERT, and VCN was very low to undetectable. When recipients were conditioned with 200 cGy and received transduced lineage-depleted marrow, only recipients receiving ERT (1 or 4 months) had detectable vector sequences in thymocytes. In conclusion, cytoreduction is important for the engraftment of gene-transduced HSC, and short-term ERT after GT did not diminish the capacity of gene-corrected cells to engraft and persist. PMID:22833548

  19. Developing a de novo targeted knock-in method based on in utero electroporation into the mammalian brain.

    PubMed

    Tsunekawa, Yuji; Terhune, Raymond Kunikane; Fujita, Ikumi; Shitamukai, Atsunori; Suetsugu, Taeko; Matsuzaki, Fumio

    2016-09-01

    Genome-editing technology has revolutionized the field of biology. Here, we report a novel de novo gene-targeting method mediated by in utero electroporation into the developing mammalian brain. Electroporation of donor DNA with the CRISPR/Cas9 system vectors successfully leads to knock-in of the donor sequence, such as EGFP, to the target site via the homology-directed repair mechanism. We developed a targeting vector system optimized to prevent anomalous leaky expression of the donor gene from the plasmid, which otherwise often occurs depending on the donor sequence. The knock-in efficiency of the electroporated progenitors reached up to 40% in the early stage and 20% in the late stage of the developing mouse brain. Furthermore, we inserted different fluorescent markers into the target gene in each homologous chromosome, successfully distinguishing homozygous knock-in cells by color. We also applied this de novo gene targeting to the ferret model for the study of complex mammalian brains. Our results demonstrate that this technique is widely applicable for monitoring gene expression, visualizing protein localization, lineage analysis and gene knockout, all at the single-cell level, in developmental tissues. © 2016. Published by The Company of Biologists Ltd.

  20. Genome Editing in Mice Using TALE Nucleases.

    PubMed

    Wefers, Benedikt; Brandl, Christina; Ortiz, Oskar; Wurst, Wolfgang; Kühn, Ralf

    2016-01-01

    Gene engineering for generating targeted mouse mutants is a key technology for biomedical research. Using TALENs as sequence-specific nucleases to induce targeted double-strand breaks, the mouse genome can be directly modified in zygotes in a single step without the need for embryonic stem cells. By embryo microinjection of TALEN mRNAs and targeting vectors, knockout and knock-in alleles can be generated fast and efficiently. In this chapter we provide protocols for the application of TALENs in mouse zygotes.

  1. Prostaglandin E2 Activates YAP and a Positive-Signaling Loop to Promote Colon Regeneration After Colitis but Also Carcinogenesis in Mice.

    PubMed

    Kim, Han-Byul; Kim, Minchul; Park, Young-Soo; Park, Intae; Kim, Tackhoon; Yang, Sung-Yeun; Cho, Charles J; Hwang, DaeHee; Jung, Jin-Hak; Markowitz, Sanford D; Hwang, Sung Wook; Yang, Suk-Kyun; Lim, Dae-Sik; Myung, Seung-Jae

    2017-02-01

    Prostaglandin E 2 (PGE 2 ) is mediator of inflammation that regulates tissue regeneration, but its continual activation has been associated with carcinogenesis. Little is known about factors in the PGE 2 signaling pathway that contribute to tumor formation. We investigated whether yes-associated protein 1 (YAP1), a transcriptional co-activator in the Hippo signaling pathway, mediates PGE 2 function. DLD-1 and SW480 colon cancer cell lines were transfected with vectors expressing transgenes or small hairpin RNAs and incubated with recombinant PGE 2 , with or without pharmacologic inhibitors of signaling proteins, and analyzed by immunoblot, immunofluorescence, quantitative reverse-transcription polymerase chain reaction, transcriptional reporter, and proliferation assays. Dextran sodium sulfate (DSS) was given to induce colitis in C57/BL6 (control) mice, as well as in mice with disruption of the hydroxyprostaglandin dehydrogenase 15 gene (15-PGDH-knockout mice), Yap1 gene (YAP-knockout mice), and double-knockout mice. Some mice also were given indomethacin to block PGE 2 synthesis. 15-PGDH knockout mice were crossed with mice with intestine-specific disruption of the salvador family WW domain containing 1 gene (Sav1), which encodes an activator of Hippo signaling. We performed immunohistochemical analyses of colon biopsy samples from 26 patients with colitis-associated cancer and 51 age-and sex-matched patients with colorectal cancer (without colitis). Incubation of colon cancer cell lines with PGE 2 led to phosphorylation of cyclic adenosine monophosphate-responsive element binding protein 1 and increased levels of YAP1 messenger RNA, protein, and YAP1 transcriptional activity. This led to increased transcription of the prostaglandin-endoperoxide synthase 2 gene (PTGS2 or cyclooxygenase 2) and prostaglandin E-receptor 4 gene (PTGER4 or EP4). Incubation with PGE 2 promoted proliferation of colon cancer cell lines, but not cells with knockdown of YAP1. Control mice developed colitis after administration of DSS, but injection of PGE 2 led to colon regeneration in these mice. However, YAP-knockout mice did not regenerate colon tissues and died soon after administration of DSS. 15-PGDH-knockout mice regenerated colon tissues more rapidly than control mice after withdrawal of DSS, and had faster recovery of body weight, colon length, and colitis histology scores. These effects were reversed by injection of indomethacin. SAV1-knockout or 15-PGDH-knockout mice did not develop spontaneous tumors after colitis induction, but SAV1/15-PGDH double-knockout mice developed polyps that eventually progressed to carcinoma in situ. Administration of indomethacin to these mice prevented spontaneous tumor formation. Levels of PGE 2 correlated with those of YAP levels in human sporadic colorectal tumors and colitis-associated tumors. PGE 2 signaling increases the expression and transcriptional activities of YAP1, leading to increased expression of cyclooxygenase 2 and EP4 to activate a positive signaling loop. This pathway promotes proliferation of colon cancer cell lines and colon tissue regeneration in mice with colitis. Constitutive activation of this pathway led to formation of polyps and colon tumors in mice. Copyright © 2017 AGA Institute. Published by Elsevier Inc. All rights reserved.

  2. Pyviko: an automated Python tool to design gene knockouts in complex viruses with overlapping genes.

    PubMed

    Taylor, Louis J; Strebel, Klaus

    2017-01-07

    Gene knockouts are a common tool used to study gene function in various organisms. However, designing gene knockouts is complicated in viruses, which frequently contain sequences that code for multiple overlapping genes. Designing mutants that can be traced by the creation of new or elimination of existing restriction sites further compounds the difficulty in experimental design of knockouts of overlapping genes. While software is available to rapidly identify restriction sites in a given nucleotide sequence, no existing software addresses experimental design of mutations involving multiple overlapping amino acid sequences in generating gene knockouts. Pyviko performed well on a test set of over 240,000 gene pairs collected from viral genomes deposited in the National Center for Biotechnology Information Nucleotide database, identifying a point mutation which added a premature stop codon within the first 20 codons of the target gene in 93.2% of all tested gene-overprinted gene pairs. This shows that Pyviko can be used successfully in a wide variety of contexts to facilitate the molecular cloning and study of viral overprinted genes. Pyviko is an extensible and intuitive Python tool for designing knockouts of overlapping genes. Freely available as both a Python package and a web-based interface ( http://louiejtaylor.github.io/pyViKO/ ), Pyviko simplifies the experimental design of gene knockouts in complex viruses with overlapping genes.

  3. Lentiviral gene transfer regenerates hematopoietic stem cells in a mouse model for Mpl-deficient aplastic anemia.

    PubMed

    Heckl, Dirk; Wicke, Daniel C; Brugman, Martijn H; Meyer, Johann; Schambach, Axel; Büsche, Guntram; Ballmaier, Matthias; Baum, Christopher; Modlich, Ute

    2011-04-07

    Thpo/Mpl signaling plays an important role in the maintenance of hematopoietic stem cells (HSCs) in addition to its role in megakaryopoiesis. Patients with inactivating mutations in Mpl develop thrombocytopenia and aplastic anemia because of progressive loss of HSCs. Yet, it is unknown whether this loss of HSCs is an irreversible process. In this study, we used the Mpl knockout (Mpl(-/-)) mouse model and expressed Mpl from newly developed lentiviral vectors specifically in the physiologic Mpl target populations, namely, HSCs and megakaryocytes. After validating lineage-specific expression in vivo using lentiviral eGFP reporter vectors, we performed bone marrow transplantation of transduced Mpl(-/-) bone marrow cells into Mpl(-/-) mice. We show that restoration of Mpl expression from transcriptionally targeted vectors prevents lethal adverse reactions of ectopic Mpl expression, replenishes the HSC pool, restores stem cell properties, and corrects platelet production. In some mice, megakaryocyte counts were atypically high, accompanied by bone neo-formation and marrow fibrosis. Gene-corrected Mpl(-/-) cells had increased long-term repopulating potential, with a marked increase in lineage(-)Sca1(+)cKit(+) cells and early progenitor populations in reconstituted mice. Transcriptome analysis of lineage(-)Sca1(+)cKit(+) cells in Mpl-corrected mice showed functional adjustment of genes involved in HSC self-renewal.

  4. Conditional transgenic mouse models: from the basics to genome-wide sets of knockouts and current studies of tissue regeneration.

    PubMed

    Bockamp, Ernesto; Sprengel, Rolf; Eshkind, Leonid; Lehmann, Thomas; Braun, Jan M; Emmrich, Frank; Hengstler, Jan G

    2008-03-01

    Many mouse models are currently available, providing avenues to elucidate gene function and to recapitulate specific pathological conditions. To a large extent, successful translation of clinical evidence or analytical data into appropriate mouse models is possible through progress in transgenic or gene-targeting technology. Beginning with a review of standard mouse transgenics and conventional gene targeting, this article will move on to discussing the basics of conditional gene expression: the tetracycline (tet)-off and tet-on systems based on the transactivators tet-controlled transactivator (Tta) and reverse tet-on transactivator (rtTA) that allow downregulation or induction of gene expression; Cre or Flp recombinase-mediated modifications, including excision, inversion, insertion and interchromosomal translocation; combination of the tet and Cre systems, permitting inducible knockout, reporter gene activation or activation of point mutations; the avian retroviral system based on delivery of rtTA specifically into cells expressing the avian retroviral receptor, which enables cell type-specific, inducible gene expression; the tamoxifen system, one of the most frequently applied steroid receptor-based systems, allows rapid activation of a fusion protein between the gene of interest and a mutant domain of the estrogen receptor, whereby activation does not depend on transcription; and techniques for cell type-specific ablation. The diphtheria toxin receptor system offers the advantage that it can be combined with the 'zoo' of Cre recombinase driver mice. Having described the basics we move on to the cutting edge: generation of genome-wide sets of conditional knockout mice. To this end, large ongoing projects apply two strategies: gene trapping based on random integration of trapping vectors into introns leading to truncation of the transcript, and gene targeting, representing the directed approach using homologous recombination. It can be expected that in the near future genome-wide sets of such mice will be available. Finally, the possibilities of conditional expression systems for investigating gene function in tissue regeneration will be illustrated by examples for neurodegenerative disease, liver regeneration and wound healing of the skin.

  5. Whirlin Replacement Restores the Formation of the USH2 Protein Complex in Whirlin Knockout Photoreceptors

    PubMed Central

    Zou, Junhuang; Luo, Ling; Shen, Zuolian; Chiodo, Vince A.; Ambati, Balamurali K.; Hauswirth, William W.

    2011-01-01

    Purpose. Whirlin is the causative gene for Usher syndrome type IID (USH2D), a condition manifested as both retinitis pigmentosa and congenital deafness. Mutations in this gene cause disruption of the USH2 protein complex composed of USH2A and VLGR1 at the periciliary membrane complex (PMC) in photoreceptors. In this study, the adeno-associated virus (AAV)-mediated whirlin replacement was evaluated as a treatment option. Methods. Murine whirlin cDNA driven by the human rhodopsin kinase promoter (hRK) was packaged as an AAV2/5 vector and delivered into the whirlin knockout retina through subretinal injection. The efficiency, efficacy, and safety of this treatment were examined using immunofluorescent staining, confocal imaging, immunoelectron microscopy, Western blot analysis, histologic analysis, and electroretinogram. Results. The AAV-mediated whirlin expression started at two weeks, reached its maximum level at 10 weeks, and lasted up to six months post injection. The transgenic whirlin product had a molecular size and an expression level comparable to the wild-type. It was distributed at the PMC in both rod and cone photoreceptors from the central to peripheral retina. Importantly, the transgenic whirlin restored the cellular localization and expression level of both USH2A and VLGR1 and did not cause defects in the retinal histology and function in the whirlin knockout mouse. Conclusions. Whirlin transgene recruits USH2A and VLGR1 to the PMC and is sufficient for the formation of the USH2 protein complex in photoreceptors. The combined hRK and AAV gene delivery system could be an effective gene therapy approach to treat retinal degeneration in USH2D patients. PMID:21212183

  6. Short-term rescue of neonatal lethality in a mouse model of propionic acidemia by gene therapy.

    PubMed

    Hofherr, Sean E; Senac, Julien S; Chen, Christopher Y; Palmer, Donna J; Ng, Philip; Barry, Michael A

    2009-02-01

    Propionic acidemia (PA) is a metabolic disorder that causes mental retardation and that can be fatal if untreated. PA is inherited in an autosomal recessive fashion involving mutations in PCCA or PCCB encoding the alpha and beta subunits of propionyl-CoA carboxylase (PCC). Current treatment is based on dietary restriction of substrate amino acids, which attenuates symptoms. However, patients still experience episodes of hyperammonemia that can cause progressive neurologic damage. In this paper, we have tested gene therapy approaches to PA in a stringent mouse model of PCCA deficiency, in which homozygous knockout mice are born but die within 36 hr. In this work, we have delivered first-generation and helper-dependent adenovirus serotype 5 (Ad5) vectors expressing the human PCCA cDNA by intraperitoneal injection into newborn mice. Unmodified Ad5 vectors mediated extensive transduction of the peritoneum with weak liver transduction as determined by luciferase imaging and dsRed expression. In contrast, modification of Ad5 with polyethylene glycol detargeted the virus from the peritoneum and retargeted it for transduction in the liver. When vectors expressing PCCA were injected, significant increases in life span were observed for both the unmodified and polyethylene glycol (PEG)-modified Ad5 vectors. However, this rescue was transient. Similarly, adeno-associated virus serotype 8-mediated transduction also produced only transient rescue. These data show first proof of principle for gene therapy of PA and demonstrate the potential utility of PEG to modify viral tropism in an actual gene therapy application.

  7. Kidneys From α1,3-Galactosyltransferase Knockout/Human Heme Oxygenase-1/Human A20 Transgenic Pigs Are Protected From Rejection During Ex Vivo Perfusion With Human Blood.

    PubMed

    Ahrens, Hellen E; Petersen, Björn; Ramackers, Wolf; Petkov, Stoyan; Herrmann, Doris; Hauschild-Quintern, Janet; Lucas-Hahn, Andrea; Hassel, Petra; Ziegler, Maren; Baars, Wiebke; Bergmann, Sabine; Schwinzer, Reinhard; Winkler, Michael; Niemann, Heiner

    2015-07-01

    Multiple modifications of the porcine genome are required to prevent rejection after pig-to-primate xenotransplantation. Here, we produced pigs with a knockout of the α1,3-galactosyltransferase gene (GGTA1-KO) combined with transgenic expression of the human anti-apoptotic/anti-inflammatory molecules heme oxygenase-1 and A20, and investigated their xenoprotective properties. The GGTA1-KO/human heme oxygenase-1 (hHO-1)/human A20 (hA20) transgenic pigs were produced in a stepwise approach using zinc finger nuclease vectors targeting the GGTA1 gene and a Sleeping Beauty vector coding for hA20. Two piglets were analyzed by quantitative reverse-transcription polymerase chain reaction, flow cytometry, and sequencing. The biological function of the genetic modifications was tested in a (51)Chromium release assay and by ex vivo kidney perfusions with human blood. Disruption of the GGTA1 gene by deletion of few basepairs was demonstrated in GGTA1-KO/hHO-1/hA20 transgenic pigs. The hHO-1 and hA20 mRNA expression was confirmed by quantitative reverse-transcription polymerase chain reaction. Ex vivo perfusion of 2 transgenic kidneys was feasible for the maximum experimental time of 240 minutes without symptoms of rejection. Results indicate that GGTA1-KO/hHO-1/hA20 transgenic pigs are a promising model to alleviate rejection and ischemia-reperfusion damage in porcine xenografts and could serve as a background for further genetic modifications toward the production of a donor pig that is clinically relevant for xenotransplantation.

  8. Kidneys From α1,3-Galactosyltransferase Knockout/Human Heme Oxygenase-1/Human A20 Transgenic Pigs Are Protected From Rejection During Ex Vivo Perfusion With Human Blood

    PubMed Central

    Ahrens, Hellen E.; Petersen, Björn; Ramackers, Wolf; Petkov, Stoyan; Herrmann, Doris; Hauschild-Quintern, Janet; Lucas-Hahn, Andrea; Hassel, Petra; Ziegler, Maren; Baars, Wiebke; Bergmann, Sabine; Schwinzer, Reinhard; Winkler, Michael; Niemann, Heiner

    2015-01-01

    Background Multiple modifications of the porcine genome are required to prevent rejection after pig-to-primate xenotransplantation. Here, we produced pigs with a knockout of the α1,3-galactosyltransferase gene (GGTA1-KO) combined with transgenic expression of the human anti-apoptotic/anti-inflammatory molecules heme oxygenase-1 and A20, and investigated their xenoprotective properties. Methods The GGTA1-KO/human heme oxygenase-1 (hHO-1)/human A20 (hA20) transgenic pigs were produced in a stepwise approach using zinc finger nuclease vectors targeting the GGTA1 gene and a Sleeping Beauty vector coding for hA20. Two piglets were analyzed by quantitative reverse-transcription polymerase chain reaction, flow cytometry, and sequencing. The biological function of the genetic modifications was tested in a 51Chromium release assay and by ex vivo kidney perfusions with human blood. Results Disruption of the GGTA1 gene by deletion of few basepairs was demonstrated in GGTA1-KO/hHO-1/hA20 transgenic pigs. The hHO-1 and hA20 mRNA expression was confirmed by quantitative reverse-transcription polymerase chain reaction. Ex vivo perfusion of 2 transgenic kidneys was feasible for the maximum experimental time of 240 minutes without symptoms of rejection. Conclusions Results indicate that GGTA1-KO/hHO-1/hA20 transgenic pigs are a promising model to alleviate rejection and ischemia-reperfusion damage in porcine xenografts and could serve as a background for further genetic modifications toward the production of a donor pig that is clinically relevant for xenotransplantation. PMID:27500225

  9. Discrete change in volatile anesthetic sensitivity in mice with inactivated tandem pore potassium ion channel TRESK.

    PubMed

    Chae, Yun Jeong; Zhang, Jianan; Au, Paul; Sabbadini, Marta; Xie, Guo-Xi; Yost, C Spencer

    2010-12-01

    We investigated the role of tandem pore potassium ion channel (K2P) TRESK in neurobehavioral function and volatile anesthetic sensitivity in genetically modified mice. Exon III of the mouse TRESK gene locus was deleted by homologous recombination using a targeting vector. The genotype of bred mice (wild type, knockout, or heterozygote) was determined using polymerase chain reaction. Morphologic and behavioral evaluations of TRESK knockout mice were compared with wild-type littermates. Sensitivity of bred mice to isoflurane, halothane, sevoflurane, and desflurane were studied by determining the minimum alveolar concentration preventing movement to tail clamping in 50% of each genotype. With the exception of decreased number of inactive periods and increased thermal pain sensitivity (20% decrease in latency with hot plate test), TRESK knockout mice had healthy development and behavior. TRESK knockout mice showed a statistically significant 8% increase in isoflurane minimum alveolar concentration compared with wild-type littermates. Sensitivity to other volatile anesthetics was not significantly different. Spontaneous mortality of TRESK knockout mice after initial anesthesia testing was nearly threefold higher than that of wild-type littermates. TRESK alone is not critical for baseline central nervous system function but may contribute to the action of volatile anesthetics. The inhomogeneous change in anesthetic sensitivity corroborates findings in other K2P knockout mice and supports the theory that the mechanism of volatile anesthetic action involves multiple targets. Although it was not shown in this study, a compensatory effect by other K2P channels may also contribute to these observations.

  10. Construction of CRISPR Libraries for Functional Screening.

    PubMed

    Carstens, Carsten P; Felts, Katherine A; Johns, Sarah E

    2018-01-01

    Identification of gene function has been aided by the ability to generate targeted gene knockouts or transcriptional repression using the CRISPR/CAS9 system. Using pooled libraries of guide RNA expression vectors that direct CAS9 to a specific genomic site allows identification of genes that are either enriched or depleted in response to a selection scheme, thus linking the affected gene to the chosen phenotype. The quality of the data generated by the screening is dependent on the quality of the guide RNA delivery library with regards to error rates and especially evenness of distribution of the guides. Here, we describe a method for constructing complex plasmid libraries based on pooled designed oligomers with high representation and tight distributions. The procedure allows construction of plasmid libraries of >60,000 members with a 95th/5th percentile ratio of less than 3.5.

  11. The role of the Serratia marcescens SdeAB multidrug efflux pump and TolC homologue in fluoroquinolone resistance studied via gene-knockout mutagenesis.

    PubMed

    Begic, Sanela; Worobec, Elizabeth A

    2008-02-01

    Serratia marcescens is a prominent opportunistic nosocomial pathogen resistant to several classes of antibiotics. The major mechanism for fluoroquinolone resistance in various Gram-negative pathogens is active efflux. Our group previously identified SdeAB, a resistance-nodulation-cell division (RND) efflux pump complex, and a TolC-like outer-membrane protein (HasF), which together mediate energy-dependent fluoroquinolone efflux. In addition, a regulatory protein-encoding gene in the upstream region of sdeAB was identified (sdeR) and found to be 40 % homologous to MarA, an Escherichia coli transcriptional regulator. To provide conclusive evidence as to the role of these components in S. marcescens, sdeB, hasF and sdeR deletion mutants were constructed. Suicide vectors were created and introduced via triparental mating into S. marcescens UOC-67 (wild-type) and, for sdeB and hasF, T-861 (clinical isolate). We have analysed these genetically altered strains using minimal inhibitory concentration (MIC) assays for a wide range of compounds (fluoroquinolones, SDS, novobiocin, ethidium bromide and chloramphenicol). Intracellular accumulation of a variety of fluoroquinolones was measured fluorospectroscopically. The sdeB, hasF and sdeR knockout strains were consistently more susceptible to antibiotics than the parent strains, with the sdeB/hasF double knockout strain showing the highest susceptibility. A marked increase in fluoroquinolone (ciprofloxacin) accumulation was observed for strains deficient in either the sdeB or hasF genes when compared to the parental strains, with the highest ciprofloxacin accumulation observed for the sdeB/hasF double knockout. Antibiotic accumulation assays for the sdeB knockout mutant strains performed in the presence of carbonyl cyanide m-chlorophenylhydrazone (CCCP), a proton-motive-force inhibitor, demonstrated that SdeAB-mediated efflux is proton-motive-force dependent. Due to the comparable susceptibility of the sdeB and the hasF individual knockouts, we conclude that S. marcescens HasF is the sole outer-membrane component of the SdeAB pump. In addition, MIC data for sdeR-deficient and overexpressing strains confirm that SdeR is an activator of sdeAB and acts to enhance the overall multidrug resistance of S. marcescens.

  12. Aquaporin 5 Plays a Role in Estrogen-Induced Ectopic Implantation of Endometrial Stromal Cells in Endometriosis

    PubMed Central

    Jiang, Xiu Xiu; Fei, Xiang Wei; Zhao, Li; Ye, Xiao Lei; Xin, Liao Bin; Qu, Yang; Xu, Kai Hong; Wu, Rui Jin; Lin, Jun

    2015-01-01

    Aquaporin 5 (AQP5) participates in the migration of endometrial cells. Elucidation of the molecular mechanisms associated with AQP5-mediated, migration of endometrial cells may contribute to a better understanding of endometriosis. Our objectives included identifying the estrogen-response element (ERE) in the promoter region of the AQP5 gene, and, investigating the effects of AQP5 on ectopic implantation of endometrial cells. Luciferase reporter assays and electrophoretic mobility shift assay (EMSA) identified the ERE-like motif in the promoter region of the AQP5 gene. After blocking and up-regulating estradiol (E2) levels, we analysed the expression of AQP5 in endometrial stromal (ES) cells. After blocking E2 /or phosphatidylinositol 3 kinase(PI3K), we analysed the role of AQP5 in signaling pathways. We constructed an AQP5, shRNA, lentiviral vector to knock out the AQP5 gene in ES cells. After knock-out of the AQP5 gene, we studied the role of AQP5 in cell invasion, proliferation, and the formation of ectopic endometrial implants in female mice. We identified an estrogen-response element in the promoter region of the AQP5 gene. Estradiol (E2) increased AQP5 expression in a dose-dependent fashion, that was blocked by ICI182,780(an estrogen receptor inhibitor). E2 activated PI3K /protein kinase B(AKT) pathway (PI3K/AKT), that, in turn, increased AQP5 expression. LY294002(PI3K inhibitor) attenuated estrogen-enhanced, AQP5 expression. Knock-out of the AQP5 gene with AQP5 shRNA lentiviral vector significantly inhibited E2-enhanced invasion, proliferation of ES cells and formation of ectopic implants. Estrogen induces AQP5 expression by activating ERE in the promoter region of the AQP5gene, activates the PI3K/AKT pathway, and, promotes endometrial cell invasion and proliferation. These results provide new insights into some of the mechanisms that may underpin the development of deposits of ectopic endometrium. PMID:26679484

  13. A Review of Gene Knockout Strategies for Microbial Cells.

    PubMed

    Tang, Phooi Wah; Chua, Pooi San; Chong, Shiue Kee; Mohamad, Mohd Saberi; Choon, Yee Wen; Deris, Safaai; Omatu, Sigeru; Corchado, Juan Manuel; Chan, Weng Howe; Rahim, Raha Abdul

    2015-01-01

    Predicting the effects of genetic modification is difficult due to the complexity of metabolic net- works. Various gene knockout strategies have been utilised to deactivate specific genes in order to determine the effects of these genes on the function of microbes. Deactivation of genes can lead to deletion of certain proteins and functions. Through these strategies, the associated function of a deleted gene can be identified from the metabolic networks. The main aim of this paper is to review the available techniques in gene knockout strategies for microbial cells. The review is done in terms of their methodology, recent applications in microbial cells. In addition, the advantages and disadvantages of the techniques are compared and discuss and the related patents are also listed as well. Traditionally, gene knockout is done through wet lab (in vivo) techniques, which were conducted through laboratory experiments. However, these techniques are costly and time consuming. Hence, various dry lab (in silico) techniques, where are conducted using computational approaches, have been developed to surmount these problem. The development of numerous techniques for gene knockout in microbial cells has brought many advancements in the study of gene functions. Based on the literatures, we found that the gene knockout strategies currently used are sensibly implemented with regard to their benefits.

  14. A Multipurpose Toolkit to Enable Advanced Genome Engineering in Plants[OPEN

    PubMed Central

    Gil-Humanes, Javier; Čegan, Radim; Kono, Thomas J.Y.; Konečná, Eva; Belanto, Joseph J.; Starker, Colby G.

    2017-01-01

    We report a comprehensive toolkit that enables targeted, specific modification of monocot and dicot genomes using a variety of genome engineering approaches. Our reagents, based on transcription activator-like effector nucleases (TALENs) and the clustered regularly interspaced short palindromic repeats (CRISPR)/Cas9 system, are systematized for fast, modular cloning and accommodate diverse regulatory sequences to drive reagent expression. Vectors are optimized to create either single or multiple gene knockouts and large chromosomal deletions. Moreover, integration of geminivirus-based vectors enables precise gene editing through homologous recombination. Regulation of transcription is also possible. A Web-based tool streamlines vector selection and construction. One advantage of our platform is the use of the Csy-type (CRISPR system yersinia) ribonuclease 4 (Csy4) and tRNA processing enzymes to simultaneously express multiple guide RNAs (gRNAs). For example, we demonstrate targeted deletions in up to six genes by expressing 12 gRNAs from a single transcript. Csy4 and tRNA expression systems are almost twice as effective in inducing mutations as gRNAs expressed from individual RNA polymerase III promoters. Mutagenesis can be further enhanced 2.5-fold by incorporating the Trex2 exonuclease. Finally, we demonstrate that Cas9 nickases induce gene targeting at frequencies comparable to native Cas9 when they are delivered on geminivirus replicons. The reagents have been successfully validated in tomato (Solanum lycopersicum), tobacco (Nicotiana tabacum), Medicago truncatula, wheat (Triticum aestivum), and barley (Hordeum vulgare). PMID:28522548

  15. A multi-purpose toolkit to enable advanced genome engineering in plants

    DOE PAGES

    Cermak, Tomas; Curtin, Shaun J.; Gil-Humanes, Javier; ...

    2017-05-18

    Here, we report a comprehensive toolkit that enables targeted, specific modification of monocot and dicot genomes using a variety of genome engineering approaches. Our reagents, based on Transcription Activator-Like Effector Nucleases TALENs and the Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR)/Cas9 system, are systematized for fast, modular cloning and accommodate diverse regulatory sequences to drive reagent expression. Vectors are optimized to create either single or multiple gene knockouts and large chromosomal deletions. Moreover, integration of geminivirus-based vectors enables precise gene editing through homologous recombination. Regulation of transcription is also possible. A web-based tool streamlines vector selection and construction. One advantagemore » of our platform is the use of the Csy-type (CRISPR system yersinia) ribonuclease 4 Csy4 and tRNA processing enzymes to simultaneously express multiple guide RNAs (gRNAs). For example, we demonstrate targeted deletions in up to six genes by expressing twelve gRNAs from a single transcript. Csy4 and tRNA expression systems are almost twice as effective in inducing mutations as gRNAs expressed from individual RNA polymerase III promoters. Mutagenesis can be further enhanced 2.5-fold by incorporating the Trex2 exonuclease. Finally, we demonstrate that Cas9 nickases induce gene targeting at frequencies comparable to native Cas9 when they are delivered on geminivirus replicons. The reagents have been successfully validated in tomato (Solanum lycopersicum), tobacco (Nicotiana tabacum), Medicago truncatula, wheat (Triticum aestivum), and barley (Hordeum vulgare).« less

  16. A multi-purpose toolkit to enable advanced genome engineering in plants

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Cermak, Tomas; Curtin, Shaun J.; Gil-Humanes, Javier

    Here, we report a comprehensive toolkit that enables targeted, specific modification of monocot and dicot genomes using a variety of genome engineering approaches. Our reagents, based on Transcription Activator-Like Effector Nucleases TALENs and the Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR)/Cas9 system, are systematized for fast, modular cloning and accommodate diverse regulatory sequences to drive reagent expression. Vectors are optimized to create either single or multiple gene knockouts and large chromosomal deletions. Moreover, integration of geminivirus-based vectors enables precise gene editing through homologous recombination. Regulation of transcription is also possible. A web-based tool streamlines vector selection and construction. One advantagemore » of our platform is the use of the Csy-type (CRISPR system yersinia) ribonuclease 4 Csy4 and tRNA processing enzymes to simultaneously express multiple guide RNAs (gRNAs). For example, we demonstrate targeted deletions in up to six genes by expressing twelve gRNAs from a single transcript. Csy4 and tRNA expression systems are almost twice as effective in inducing mutations as gRNAs expressed from individual RNA polymerase III promoters. Mutagenesis can be further enhanced 2.5-fold by incorporating the Trex2 exonuclease. Finally, we demonstrate that Cas9 nickases induce gene targeting at frequencies comparable to native Cas9 when they are delivered on geminivirus replicons. The reagents have been successfully validated in tomato (Solanum lycopersicum), tobacco (Nicotiana tabacum), Medicago truncatula, wheat (Triticum aestivum), and barley (Hordeum vulgare).« less

  17. Efficacy of a Combined Intracerebral and Systemic Gene Delivery Approach for the Treatment of a Severe Lysosomal Storage Disorder

    PubMed Central

    Spampanato, Carmine; De Leonibus, Elvira; Dama, Paola; Gargiulo, Annagiusi; Fraldi, Alessandro; Sorrentino, Nicolina Cristina; Russo, Fabio; Nusco, Edoardo; Auricchio, Alberto; Surace, Enrico M; Ballabio, Andrea

    2011-01-01

    Multiple sulfatase deficiency (MSD), a severe autosomal recessive disease is caused by mutations in the sulfatase modifying factor 1 gene (Sumf1). We have previously shown that in the Sumf1 knockout mouse model (Sumf1−/−) sulfatase activities are completely absent and, similarly to MSD patients, this mouse model displays growth retardation and early mortality. The severity of the phenotype makes MSD unsuitable to be treated by enzyme replacement or bone marrow transplantation, hence the importance of testing the efficacy of novel treatment strategies. Here we show that recombinant adeno-associated virus serotype 9 (rAAV9) vector injected into the cerebral ventricles of neonatal mice resulted in efficient and widespread transduction of the brain parenchyma. In addition, we compared a combined, intracerebral ventricles and systemic, administration of an rAAV9 vector encoding SUMF1 gene to the single administrations—either directly in brain, or systemic alone —in MSD mice. The combined treatment resulted in the global activation of sulfatases, near-complete clearance of glycosaminoglycans (GAGs) and decrease of inflammation in both the central nervous system (CNS) and visceral organs. Furthermore, behavioral abilities were improved by the combined treatment. These results underscore that the “combined” mode of rAAV9 vector administration is an efficient option for the treatment of severe whole-body disorders. PMID:21326216

  18. A Versatile Transposon-Based Activation Tag Vector System for Functional Genomics in Cereals and Other Monocot Plants1[OA

    PubMed Central

    Qu, Shaohong; Desai, Aparna; Wing, Rod; Sundaresan, Venkatesan

    2008-01-01

    Transposon insertional mutagenesis is an effective alternative to T-DNA mutagenesis when transformation through tissue culture is inefficient as is the case for many crop species. When used as activation tags, transposons can be exploited to generate novel gain-of-function phenotypes without transformation and are of particular value in the study of polyploid plants where gene knockouts will not have phenotypes. We have developed an in cis-activation-tagging Ac-Ds transposon system in which a T-DNA vector carries a Dissociation (Ds) element containing 4× cauliflower mosaic virus enhancers along with the Activator (Ac) transposase gene. Stable Ds insertions were selected using green fluorescent protein and red fluorescent protein genes driven by promoters that are functional in maize (Zea mays) and rice (Oryza sativa). The system has been tested in rice, where 638 stable Ds insertions were selected from an initial set of 26 primary transformants. By analysis of 311 flanking sequences mapped to the rice genome, we could demonstrate the wide distribution of the elements over the rice chromosomes. Enhanced expression of rice genes adjacent to Ds insertions was detected in the insertion lines using semiquantitative reverse transcription-PCR method. The in cis-two-element vector system requires minimal number of primary transformants and eliminates the need for crossing, while the use of fluorescent markers instead of antibiotic or herbicide resistance increases the applicability to other plants and eliminates problems with escapes. Because Ac-Ds has been shown to transpose widely in the plant kingdom, the activation vector system developed in this study should be of utility more generally to other monocots. PMID:17993541

  19. Systemic Gene Transfer of a Hexosaminidase Variant Using an scAAV9.47 Vector Corrects GM2 Gangliosidosis in Sandhoff Mice.

    PubMed

    Osmon, Karlaina J L; Woodley, Evan; Thompson, Patrick; Ong, Katalina; Karumuthil-Melethil, Subha; Keimel, John G; Mark, Brian L; Mahuran, Don; Gray, Steven J; Walia, Jagdeep S

    2016-07-01

    GM2 gangliosidosis is a group of neurodegenerative diseases caused by β-hexosaminidase A (HexA) enzyme deficiency. There is currently no cure. HexA is composed of two similar, nonidentical subunits, α and β, which must interact with the GM2 activator protein (GM2AP), a substrate-specific cofactor, to hydrolyze GM2 ganglioside. Mutations in either subunit or the activator can result in the accumulation of GM2 ganglioside within neurons throughout the central nervous system. The resulting neuronal cell death induces the primary symptoms of the disease: motor impairment, seizures, and sensory impairments. This study assesses the long-term effects of gene transfer in a Sandhoff (β-subunit knockout) mouse model. The study utilized a modified human β-hexosaminidase α-subunit (μ-subunit) that contains critical sequences from the β-subunit that enables formation of a stable homodimer (HexM) and interaction with GM2AP to hydrolyze GM2 ganglioside. We investigated a self-complementary adeno-associated viral (scAAV) vector expressing HexM, through intravenous injections of the neonatal mice. We monitored one cohort for 8 weeks and another cohort long-term for survival benefit, behavioral, biochemical, and molecular analyses. Untreated Sandhoff disease (SD) control mice reached a humane endpoint at approximately 15 weeks, whereas treated mice had a median survival age of 40 weeks, an approximate 2.5-fold survival advantage. On behavioral tests, the treated mice outperformed their knockout age-matched controls and perform similarly to the heterozygous controls. Through the enzymatic and GM2 ganglioside analyses, we observed a significant decrease in the GM2 ganglioside level, even though the enzyme levels were not significantly increased. Molecular analyses revealed a global distribution of the vector between brain and spinal cord regions. In conclusion, the neonatal delivery of a novel viral vector expressing the human HexM enzyme is effective in ameliorating the SD mouse phenotype for long-term. Our data could have implications not only for treatment of SD but also for Tay-Sachs disease (α-subunit deficiency) and similar brain disorders.

  20. Identification of essential genes and synthetic lethal gene combinations in Escherichia coli K-12.

    PubMed

    Mori, Hirotada; Baba, Tomoya; Yokoyama, Katsushi; Takeuchi, Rikiya; Nomura, Wataru; Makishi, Kazuichi; Otsuka, Yuta; Dose, Hitomi; Wanner, Barry L

    2015-01-01

    Here we describe the systematic identification of single genes and gene pairs, whose knockout causes lethality in Escherichia coli K-12. During construction of precise single-gene knockout library of E. coli K-12, we identified 328 essential gene candidates for growth in complex (LB) medium. Upon establishment of the Keio single-gene deletion library, we undertook the development of the ASKA single-gene deletion library carrying a different antibiotic resistance. In addition, we developed tools for identification of synthetic lethal gene combinations by systematic construction of double-gene knockout mutants. We introduce these methods herein.

  1. [RS-1 enhanced the efficiency of CRISPR-Cas9 mediated knock-in of human lactoferrin].

    PubMed

    Zhou, Wenjun; Guo, Rihong; Deng, Mingtian; Wang, Feng; Zhang, Yanli

    2017-08-25

    This study aims to knock out the goat β-lactoglobulin (BLG) gene using CRISPR-Cas9 system and knock in human lactoferrin (hLF) at the BLG locus, and further study the effect of RAD51 stimulatory compound (RS-1) on homologous recombination efficiency. First, we designed an sgRNA targeting the first exon of goat BLG gene and constructed a co-expression vector pCas9-sgBLG. This sgRNA vector was then transfected into goat ear fibroblasts (GEFs), and the target region was examined by T7EN1 assay and sequencing. Second, we constructed a targeting vector pBHA-hLF-NIE including NEO and EGFP genes based on BLG gene locus. This targeting vector together with pCas9-sgBLG expression vector was co-transfected into GEFs. Transfected cells were then treated with 0, 5, 10 and 20 μmol/L RS-1 for 72 h to analyse the EGFP expression efficiency. Next, we used 800 μg/mL G418 to screen G418-resistent cell clones, and studied hLF site-specific knock-in cell clones by PCR and sequencing. The editing efficiency of sgBLG was between 25% and 31%. The EGFP expression efficiency indicated that the gene knock-in efficiency was improved by RS-1 in a dose-dependent manner, which could reach 3.5-fold compared to the control group. The percentage of positive cells with hLF knock-in was increased to 32.61% when 10 μmol/L RS-1 was used. However, when the concentration of RS-1 increased to 20 μmol/L, the percentage of positive cells decreased to 22.22% and resulted in an increase of senescent cell clone number. These results suggested that hLF knock-in and BLG knock-out in GEFs were achieved by using CRISPR/Cas9 system, and optimum concentration of RS-1 could improve knock-in efficiency, which provides a reference for efficiently obtaining gene knock-in cells using CRISPR/Cas9 in the future.

  2. Cold Shock as a Screen for Genes Involved in Cold Acclimatization in Neurospora crassa

    PubMed Central

    Watters, Michael K.; Manzanilla, Victor; Howell, Holly; Mehreteab, Alexander; Rose, Erik; Walters, Nicole; Seitz, Nicholas; Nava, Jacob; Kekelik, Sienna; Knuth, Laura; Scivinsky, Brianna

    2018-01-01

    When subjected to rapid drops of temperature (cold shock), Neurospora responds with a temporary shift in its morphology. This report is the first to examine this response genetically. We report here the results of a screen of selected mutants from the Neurospora knockout library for alterations in their morphological response to cold shock. Three groups of knockouts were selected to be subject to this screen: genes previously suspected to be involved in hyphal development as well as knockouts resulting in morphological changes; transcription factors; and genes homologous to E. coli genes known to alter their expression in response to cold shock. A total of 344 knockout strains were subjected to cold shock. Of those, 118 strains were identified with altered responses. We report here the cold shock morphologies and GO categorizations of strains subjected to this screen. Of strains with knockouts in genes associated with hyphal growth or morphology, 33 of 131 tested (25%) showed an altered response to cold shock. Of strains with knockouts in transcription factor genes, 30 of 145 (20%) showed an altered response to cold shock. Of strains with knockouts in genes homologous to E. coli genes which display altered levels of transcription in response to cold shock, a total of 55 of 68 tested (81%) showed an altered cold shock response. This suggests that the response to cold shock in these two organisms is largely shared in common. PMID:29563189

  3. The loss-of-allele assay for ES cell screening and mouse genotyping.

    PubMed

    Frendewey, David; Chernomorsky, Rostislav; Esau, Lakeisha; Om, Jinsop; Xue, Yingzi; Murphy, Andrew J; Yancopoulos, George D; Valenzuela, David M

    2010-01-01

    Targeting vectors used to create directed mutations in mouse embryonic stem (ES) cells consist, in their simplest form, of a gene for drug selection flanked by mouse genomic sequences, the so-called homology arms that promote site-directed homologous recombination between the vector and the target gene. The VelociGene method for the creation of targeted mutations in ES cells employs targeting vectors, called BACVecs, that are based on bacterial artificial chromosomes. Compared with conventional short targeting vectors, BacVecs provide two major advantages: (1) their much larger homology arms promote high targeting efficiencies without the need for isogenicity or negative selection strategies; and (2) they enable deletions and insertions of up to 100kb in a single targeting event, making possible gene-ablating definitive null alleles and other large-scale genomic modifications. Because of their large arm sizes, however, BACVecs do not permit screening by conventional assays, such as long-range PCR or Southern blotting, that link the inserted targeting vector to the targeted locus. To exploit the advantages of BACVecs for gene targeting, we inverted the conventional screening logic in developing the loss-of-allele (LOA) assay, which quantifies the number of copies of the native locus to which the mutation was directed. In a correctly targeted ES cell clone, the LOA assay detects one of the two native alleles (for genes not on the X or Y chromosome), the other allele being disrupted by the targeted modification. We apply the same principle in reverse as a gain-of-allele assay to quantify the copy number of the inserted targeting vector. The LOA assay reveals a correctly targeted clone as having lost one copy of the native target gene and gained one copy of the drug resistance gene or other inserted marker. The combination of these quantitative assays makes LOA genotyping unequivocal and amenable to automated scoring. We use the quantitative polymerase chain reaction (qPCR) as our method of allele quantification, but any method that can reliably distinguish the difference between one and two copies of the target gene can be used to develop an LOA assay. We have designed qPCR LOA assays for deletions, insertions, point mutations, domain swaps, conditional, and humanized alleles and have used the insert assays to quantify the copy number of random insertion BAC transgenics. Because of its quantitative precision, specificity, and compatibility with high throughput robotic operations, the LOA assay eliminates bottlenecks in ES cell screening and mouse genotyping and facilitates maximal speed and throughput for knockout mouse production. Copyright (c) 2010 Elsevier Inc. All rights reserved.

  4. Conditional genomic rearrangement by designed meiotic recombination using VDE (PI-SceI) in yeast.

    PubMed

    Fukuda, Tomoyuki; Ohya, Yoshikazu; Ohta, Kunihiro

    2007-10-01

    Meiotic recombination plays critical roles in the acquisition of genetic diversity and has been utilized for conventional breeding of livestock and crops. The frequency of meiotic recombination is normally low, and is extremely low in regions called "recombination cold domains". Here, we describe a new and highly efficient method to modulate yeast meiotic gene rearrangements using VDE (PI-SceI), an intein-encoded endonuclease that causes an efficient unidirectional meiotic gene conversion at its recognition sequence (VRS). We designed universal targeting vectors, by use of which the strain that inserts the VRS at a desired site is acquired. Meiotic induction of the strains provided unidirectional gene conversions and frequent genetic rearrangements of flanking genes with little impact on cell viability. This system thus opens the way for the designed modulation of meiotic gene rearrangements, regardless of recombinational activity of chromosomal domains. Finally, the VDE-VRS system enabled us to conduct meiosis-specific conditional knockout of genes where VDE-initiated gene conversion disrupts the target gene during meiosis, serving as a novel approach to examine the functions of genes during germination of resultant spores.

  5. Broad-host-range vector system for synthetic biology and biotechnology in cyanobacteria

    PubMed Central

    Taton, Arnaud; Unglaub, Federico; Wright, Nicole E.; Zeng, Wei Yue; Paz-Yepes, Javier; Brahamsha, Bianca; Palenik, Brian; Peterson, Todd C.; Haerizadeh, Farzad; Golden, Susan S.; Golden, James W.

    2014-01-01

    Inspired by the developments of synthetic biology and the need for improved genetic tools to exploit cyanobacteria for the production of renewable bioproducts, we developed a versatile platform for the construction of broad-host-range vector systems. This platform includes the following features: (i) an efficient assembly strategy in which modules released from 3 to 4 donor plasmids or produced by polymerase chain reaction are assembled by isothermal assembly guided by short GC-rich overlap sequences. (ii) A growing library of molecular devices categorized in three major groups: (a) replication and chromosomal integration; (b) antibiotic resistance; (c) functional modules. These modules can be assembled in different combinations to construct a variety of autonomously replicating plasmids and suicide plasmids for gene knockout and knockin. (iii) A web service, the CYANO-VECTOR assembly portal, which was built to organize the various modules, facilitate the in silico construction of plasmids, and encourage the use of this system. This work also resulted in the construction of an improved broad-host-range replicon derived from RSF1010, which replicates in several phylogenetically distinct strains including a new experimental model strain Synechocystis sp. WHSyn, and the characterization of nine antibiotic cassettes, four reporter genes, four promoters, and a ribozyme-based insulator in several diverse cyanobacterial strains. PMID:25074377

  6. Baculoviral delivery of CRISPR/Cas9 facilitates efficient genome editing in human cells

    PubMed Central

    Hindriksen, Sanne; Bramer, Arne J.; Truong, My Anh; Vromans, Martijn J. M.; Post, Jasmin B.; Verlaan-Klink, Ingrid; Snippert, Hugo J.; Lens, Susanne M. A.

    2017-01-01

    The CRISPR/Cas9 system is a highly effective tool for genome editing. Key to robust genome editing is the efficient delivery of the CRISPR/Cas9 machinery. Viral delivery systems are efficient vehicles for the transduction of foreign genes but commonly used viral vectors suffer from a limited capacity in the genetic information they can carry. Baculovirus however is capable of carrying large exogenous DNA fragments. Here we investigate the use of baculoviral vectors as a delivery vehicle for CRISPR/Cas9 based genome-editing tools. We demonstrate transduction of a panel of cell lines with Cas9 and an sgRNA sequence, which results in efficient knockout of all four targeted subunits of the chromosomal passenger complex (CPC). We further show that introduction of a homology directed repair template into the same CRISPR/Cas9 baculovirus facilitates introduction of specific point mutations and endogenous gene tags. Tagging of the CPC recruitment factor Haspin with the fluorescent reporter YFP allowed us to study its native localization as well as recruitment to the cohesin subunit Pds5B. PMID:28640891

  7. One-step generation of complete gene knockout mice and monkeys by CRISPR/Cas9-mediated gene editing with multiple sgRNAs.

    PubMed

    Zuo, Erwei; Cai, Yi-Jun; Li, Kui; Wei, Yu; Wang, Bang-An; Sun, Yidi; Liu, Zhen; Liu, Jiwei; Hu, Xinde; Wei, Wei; Huo, Xiaona; Shi, Linyu; Tang, Cheng; Liang, Dan; Wang, Yan; Nie, Yan-Hong; Zhang, Chen-Chen; Yao, Xuan; Wang, Xing; Zhou, Changyang; Ying, Wenqin; Wang, Qifang; Chen, Ren-Chao; Shen, Qi; Xu, Guo-Liang; Li, Jinsong; Sun, Qiang; Xiong, Zhi-Qi; Yang, Hui

    2017-07-01

    The CRISPR/Cas9 system is an efficient gene-editing method, but the majority of gene-edited animals showed mosaicism, with editing occurring only in a portion of cells. Here we show that single gene or multiple genes can be completely knocked out in mouse and monkey embryos by zygotic injection of Cas9 mRNA and multiple adjacent single-guide RNAs (spaced 10-200 bp apart) that target only a single key exon of each gene. Phenotypic analysis of F0 mice following targeted deletion of eight genes on the Y chromosome individually demonstrated the robustness of this approach in generating knockout mice. Importantly, this approach delivers complete gene knockout at high efficiencies (100% on Arntl and 91% on Prrt2) in monkey embryos. Finally, we could generate a complete Prrt2 knockout monkey in a single step, demonstrating the usefulness of this approach in rapidly establishing gene-edited monkey models.

  8. Genome-scale CRISPR-Cas9 Knockout and Transcriptional Activation Screening

    PubMed Central

    Joung, Julia; Konermann, Silvana; Gootenberg, Jonathan S.; Abudayyeh, Omar O.; Platt, Randall J.; Brigham, Mark D.; Sanjana, Neville E.; Zhang, Feng

    2017-01-01

    Forward genetic screens are powerful tools for the unbiased discovery and functional characterization of specific genetic elements associated with a phenotype of interest. Recently, the RNA-guided endonuclease Cas9 from the microbial CRISPR (clustered regularly interspaced short palindromic repeats) immune system has been adapted for genome-scale screening by combining Cas9 with pooled guide RNA libraries. Here we describe a protocol for genome-scale knockout and transcriptional activation screening using the CRISPR-Cas9 system. Custom- or ready-made guide RNA libraries are constructed and packaged into lentiviral vectors for delivery into cells for screening. As each screen is unique, we provide guidelines for determining screening parameters and maintaining sufficient coverage. To validate candidate genes identified from the screen, we further describe strategies for confirming the screening phenotype as well as genetic perturbation through analysis of indel rate and transcriptional activation. Beginning with library design, a genome-scale screen can be completed in 9–15 weeks followed by 4–5 weeks of validation. PMID:28333914

  9. Genome-scale CRISPR-Cas9 knockout and transcriptional activation screening.

    PubMed

    Joung, Julia; Konermann, Silvana; Gootenberg, Jonathan S; Abudayyeh, Omar O; Platt, Randall J; Brigham, Mark D; Sanjana, Neville E; Zhang, Feng

    2017-04-01

    Forward genetic screens are powerful tools for the unbiased discovery and functional characterization of specific genetic elements associated with a phenotype of interest. Recently, the RNA-guided endonuclease Cas9 from the microbial CRISPR (clustered regularly interspaced short palindromic repeats) immune system has been adapted for genome-scale screening by combining Cas9 with pooled guide RNA libraries. Here we describe a protocol for genome-scale knockout and transcriptional activation screening using the CRISPR-Cas9 system. Custom- or ready-made guide RNA libraries are constructed and packaged into lentiviral vectors for delivery into cells for screening. As each screen is unique, we provide guidelines for determining screening parameters and maintaining sufficient coverage. To validate candidate genes identified by the screen, we further describe strategies for confirming the screening phenotype, as well as genetic perturbation, through analysis of indel rate and transcriptional activation. Beginning with library design, a genome-scale screen can be completed in 9-15 weeks, followed by 4-5 weeks of validation.

  10. Single-step generation of gene knockout-rescue system in pluripotent stem cells by promoter insertion with CRISPR/Cas9.

    PubMed

    Matsunaga, Taichi; Yamashita, Jun K

    2014-02-07

    Specific gene knockout and rescue experiments are powerful tools in developmental and stem cell biology. Nevertheless, the experiments require multiple steps of molecular manipulation for gene knockout and subsequent rescue procedures. Here we report an efficient and single step strategy to generate gene knockout-rescue system in pluripotent stem cells by promoter insertion with CRISPR/Cas9 genome editing technology. We inserted a tetracycline-regulated inducible gene promoter (tet-OFF/TRE-CMV) upstream of the endogenous promoter region of vascular endothelial growth factor receptor 2 (VEGFR2/Flk1) gene, an essential gene for endothelial cell (EC) differentiation, in mouse embryonic stem cells (ESCs) with homologous recombination. Both homo- and hetero-inserted clones were efficiently obtained through a simple selection with a drug-resistant gene. The insertion of TRE-CMV promoter disrupted endogenous Flk1 expression, resulting in null mutation in homo-inserted clones. When the inserted TRE-CMV promoter was activated with doxycycline (Dox) depletion, Flk1 expression was sufficiently recovered from the downstream genomic Flk1 gene. Whereas EC differentiation was almost completely perturbed in homo-inserted clones, Flk1 rescue with TRE-CMV promoter activation restored EC appearance, indicating that phenotypic changes in EC differentiation can be successfully reproduced with this knockout-rescue system. Thus, this promoter insertion strategy with CRISPR/Cas9 would be a novel attractive method for knockout-rescue experiments. Copyright © 2014 Elsevier Inc. All rights reserved.

  11. Rexin-G, a targeted genetic medicine for cancer.

    PubMed

    Gordon, Erlinda M; Hall, Frederick L

    2010-05-01

    Rexin-G, a tumor-targeted retrovector bearing a cytocidal cyclin G1 construct, is the first targeted gene therapy vector to gain fast track designation and orphan drug priorities for multiple cancer indications in the US. This review describes the major milestones in the clinical development of Rexin-G: from the molecular cloning and characterization of the human cyclin G1 proto-oncogene in 1994, to the design of the first knockout constructs and genetic engineering of the targeted delivery system from 1995 to 1997, through the initial proofs-of-concept, molecular pharmacology and toxicology studies of Rexin-G in preclinical cancer models from 1997 to 2001, to the pioneering clinical studies in humans from 2002 to 2004, which--together with the advancements in bioprocess development of high-potency clinical grade vectors circa 2005 - 2006--led to the accelerated approval of Rexin-G for all solid tumors by the Philippine FDA in 2007 and the rapid progression of clinical studies from 2007 to 2009 to the cusp of pivotal Phase III trials in the US. In recording the development of Rexin-G as a novel form of targeted biological therapy, this review also highlights important aspects of vector design engineering which served to overcome the physiological barriers to gene delivery as it addresses the key regulatory issues involved in the development of a targeted gene therapy product. Progressive clinical development of Rexin-G demonstrates the potential safety and efficacy of targeted genetic medicine, while validating the design engineering of the molecular biotechnology platform.

  12. Dopamine transporter and vesicular monoamine transporter knockout mice : implications for Parkinson's disease.

    PubMed

    Miller, G W; Wang, Y M; Gainetdinov, R R; Caron, M G

    2001-01-01

    One of the most valuable methods for understanding the function of a particular protein is the generation of animals that have had the gene encoding for the protein of interest disrupted, commonly known as a "quo;knockout"quo; or null mutant. By incorporating a sequence of DNA (typically encoding antibiotic resistance to aid in the selection of the mutant gene) into embryonic stem cells by homologous recombination, the normal transcription of the gene is effectively blocked (Fig. 1). Since a particular protein is encoded by two copies of a gene, it is necessary to have the gene on both alleles "quo;knocked out."quo; This is performed by cross-breeding animals with one affected allele (heterozygote) to generate offspring that have inherited two mutant alleles (homozygote). This procedure has been used to generate animals lacking either the plasma membrane dopamine transporter (DAT; Fig. 2) or the vesicular monoamine transporter (VMAT2; Fig. 3). Both DAT and VMAT2 are essential for dopamine homeostasis and are thought to participate in the pathogenesis of Parkinson's disease (1-5). Fig. 1. Maps of the targeting vector and the mock construct. The mouse genomic fragment (clone 11) was isolated from a Stratagene 129 SvJ library by standard colony hybridization using a PCR probe from the 5' end of rat cDNA. The restriction site abbreviations are as follows: H, HindIII; N, NotI; Sc, SacI; Sn, SnaI; X, XbaI; and Xh, XhoI. The region between HindIII and SnaI on clone 11 containing the coding sequence from transmembrane domains 3 and 4 of VMAT2 was deleted and replaced with PGK-neo. The 3' fragment of clone 11 was reserved as an external probe for Southern analysis. To facilitate PCR screening of embryonic stem cell clones, a mock construct containing the SnaI/XbaI fragment and part of the Neo cassette was generated as a positive control. pPNT and pGEM4Z were used to construct knockout and mock vectors, respectively. (Reproduced with permission from ref. 1). Fig. 2. DAT and VMAT2 expression in wild-type and DAT knockout midbrain. DAT immunoreactivity in wild-type (A) and DAT knockout midbrain (B). VMAT2 immunoreactivity in wild-type (C) and DAT knockout midbrain (D). Robust immunoreactivity was observed in the ventral tegmental area and substantia nigra pars compacta and reticulata in the wild-type brain. Note absence of DAT immunoreactivity and modest reduction of VMAT2 immunoreactivity in the DAT knockout. Fig. 3. Characterization of VMAT2 gene disruption. (A) Southern blot analysis of mouse genomic DNA. The Southern blot was prepared with 15 μg of genomic DNA per lane and probed with a 1.4-kb 3' external genomic fragment. +/+, wild type littermates; +/-, heterozygote; -/-, homozygote. (B) RT-PCR analysis of mouse brain poly(A)+ RNA. For each reverse transcription assay, 0.5 μg of poly(A)+ RNA was used. Equal volumes of cDNA templates were used for each PCR assay. The PCR primers used flank the neomycin cassette for the purpose of detecting potential readthrough of the neomycin DNA. The heterozygote has a reduced amount of transcripts compared with the wild-type littermate; the homozygote is devoid of VMAT2 transcripts. G3PDH was used as internal control. (C) Western blot analysis of wholebrain synaptic vesicles. Samples (25 μg) of vesicles were solubilized and separated by SDS-PAGE, transferred to nitrocellulose, subjected to Western blot analysis with anti-VMAT2-Ct (top) or anti-a-tubulin (bottom) antibodies, and developed with chemiluminescence. Molecular mass markers (kDa) are shown to the left. To confirm equal loading and transfer of proteins, the blots were stripped and reprobed with an antibody to α-tubulin. (Reproduced with permission from ref. 1). The importance of DAT in neuronal function is highlighted in animals in which DAT has been genetically deleted (DAT KO) (3). In the homozygote DAT KO mice, released dopamine remains in the extracellular space up to 300 times longer than normal. As expected, these animals display behaviors consistent with persistent activation of dopamine receptors, such as hyperlocomotion. Genetic deletion of VMAT2 reveals the essential role of vesicular storage and release of monoamines. Homozygote VMAT2 knockout mice survive for only a few days, whereas heterozygotes appear normal. Studies performed in homozygote pups and heterozygote adults clearly show that the level of VMAT2 expression calibrates the level of vesicular filling (1,2,bi4). With only 50% of normal VMAT2, heterozygote animals have reduced vesicular filling and release. These alterations in presynaptic monoamine function in the heterozygotes are thought to be responsible for the observed sensitization to the psychostimulants cocaine and amphetamine and to ethanol (1). Knockout animals also appear to parallel the changes that occur in reserpinized animals, suggesting that the adverse actions of this drug are mediated by VMAT2.

  13. Global Gene Expression Profiling in PAI-1 Knockout Murine Heart and Kidney: Molecular Basis of Cardiac-Selective Fibrosis

    PubMed Central

    Ghosh, Asish K.; Murphy, Sheila B.; Kishore, Raj; Vaughan, Douglas E.

    2013-01-01

    Fibrosis is defined as an abnormal matrix remodeling due to excessive synthesis and accumulation of extracellular matrix proteins in tissues during wound healing or in response to chemical, mechanical and immunological stresses. At present, there is no effective therapy for organ fibrosis. Previous studies demonstrated that aged plasminogen activator inhibitor-1(PAI-1) knockout mice develop spontaneously cardiac-selective fibrosis without affecting any other organs. We hypothesized that differential expressions of profibrotic and antifibrotic genes in PAI-1 knockout hearts and unaffected organs lead to cardiac selective fibrosis. In order to address this prediction, we have used a genome-wide gene expression profiling of transcripts derived from aged PAI-1 knockout hearts and kidneys. The variations of global gene expression profiling were compared within four groups: wildtype heart vs. knockout heart; wildtype kidney vs. knockout kidney; knockout heart vs. knockout kidney and wildtype heart vs. wildtype kidney. Analysis of illumina-based microarray data revealed that several genes involved in different biological processes such as immune system processing, response to stress, cytokine signaling, cell proliferation, adhesion, migration, matrix organization and transcriptional regulation were affected in hearts and kidneys by the absence of PAI-1, a potent inhibitor of urokinase and tissue-type plasminogen activator. Importantly, the expressions of a number of genes, involved in profibrotic pathways including Ankrd1, Pi16, Egr1, Scx, Timp1, Timp2, Klf6, Loxl1 and Klotho, were deregulated in PAI-1 knockout hearts compared to wildtype hearts and PAI-1 knockout kidneys. While the levels of Ankrd1, Pi16 and Timp1 proteins were elevated during EndMT, the level of Timp4 protein was decreased. To our knowledge, this is the first comprehensive report on the influence of PAI-1 on global gene expression profiling in the heart and kidney and its implication in fibrogenesis and several other biological processes. The significance of these observations in the light of heart-specific profibrotic signaling and fibrogenesis are discussed. PMID:23724005

  14. Trojan Horse Strategy for Non-invasive Interference of Clock Gene in the Oyster Crassostrea gigas.

    PubMed

    Payton, Laura; Perrigault, Mickael; Bourdineaud, Jean-Paul; Marcel, Anjara; Massabuau, Jean-Charles; Tran, Damien

    2017-08-01

    RNA interference is a powerful method to inhibit specific gene expression. Recently, silencing target genes by feeding has been successfully carried out in nematodes, insects, and small aquatic organisms. A non-invasive feeding-based RNA interference is reported here for the first time in a mollusk bivalve, the pacific oyster Crassostrea gigas. In this Trojan horse strategy, the unicellular alga Heterocapsa triquetra is the food supply used as a vector to feed oysters with Escherichia coli strain HT115 engineered to express the double-stranded RNA targeting gene. To test the efficacy of the method, the Clock gene, a central gene of the circadian clock, was targeted for knockout. Results demonstrated specific and systemic efficiency of the Trojan horse strategy in reducing Clock mRNA abundance. Consequences of Clock disruption were observed in Clock-related genes (Bmal, Tim1, Per, Cry1, Cry2, Rev.-erb, and Ror) and triploid oysters were more sensitive than diploid to the interference. This non-invasive approach shows an involvement of the circadian clock in oyster bioaccumulation of toxins produced by the harmful alga Alexandrium minutum.

  15. TALEN- and CRISPR/Cas9-Mediated Gene Editing in Human Pluripotent Stem Cells Using Lipid-Based Transfection.

    PubMed

    Hendriks, William T; Jiang, Xin; Daheron, Laurence; Cowan, Chad A

    2015-08-03

    Using custom-engineered nuclease-mediated genome editing, such as Transcription Activator-Like Effector Nucleases (TALENs) and Clustered Regularly Interspaced Short Palindromic Repeats (CRISPRs) RNA-guided Cas9 nucleases, human pluripotent stem cell (hPSC) lines with knockout or mutant alleles can be generated and differentiated into various cell types. This strategy of genome engineering in hPSCs will prove invaluable for studying human biology and disease. Here, we provide a detailed protocol for design and construction of TALEN and CRISPR vectors, testing of their nuclease activity, and delivery of TALEN or CRISPR vectors into hPSCs. In addition, we describe the use of single-stranded oligodeoxynucleotides (ssODNs) to introduce or repair point mutations. Next, we describe the identification of edited hPSC clones without antibiotic selection, including their clonal selection, genotyping, and expansion for downstream applications. Copyright © 2015 John Wiley & Sons, Inc.

  16. Malaria infectivity of xanthurenic acid-deficient anopheline mosquitoes produced by TALEN-mediated targeted mutagenesis.

    PubMed

    Yamamoto, Daisuke S; Sumitani, Megumi; Hatakeyama, Masatsugu; Matsuoka, Hiroyuki

    2018-02-01

    Anopheline mosquitoes are major vectors of malaria parasites. When the gametocytes of the malaria parasite are transferred from a vertebrate to mosquitoes, they differentiate into gametes, and are fertilized in the midguts of mosquitoes. Xanthurenic acid (XA), a waste product of the ommochrome synthesis pathway, has been shown to induce exflagellation during microgametogenesis in vitro; however, it currently remains unclear whether endogenous XA affects the infectivity of anopheline mosquitoes to malaria parasites in vivo due to the lack of appropriate experimental systems such as a XA-deficient line. In the present study, we produced a XA-deficient line in Anopheles stephensi using transcription activator-like effector nuclease (TALEN)-mediated gene targeting (knockout) of the kynurenine 3-monooxygenase (kmo) gene, which encodes an enzyme that participates in the ommochrome synthesis pathway. The knockout of kmo resulted in the absence of XA, and oocyst formation was inhibited in the midguts of these XA-deficient mosquitoes, which, in turn, reduced sporozoite numbers in their salivary glands. These results suggest that endogenous XA stimulates exflagellation, and enhances the infectivity of anopheline mosquitoes to malaria parasites in vivo. The XA-deficient line of the anopheline mosquito provides a useful system for analyzing and understanding the associated factors of malaria gametogenesis in the mosquito midgut.

  17. Precision-engineering the Pseudomonas aeruginosa genome with two-step allelic exchange

    PubMed Central

    Hmelo, Laura R.; Borlee, Bradley R.; Almblad, Henrik; Love, Michelle E.; Randall, Trevor E.; Tseng, Boo Shan; Lin, Chuyang; Irie, Yasuhiko; Storek, Kelly M.; Yang, Jaeun Jane; Siehnel, Richard J.; Howell, P. Lynne; Singh, Pradeep K.; Tolker-Nielsen, Tim; Parsek, Matthew R.; Schweizer, Herbert P.; Harrison, Joe J.

    2016-01-01

    Allelic exchange is an efficient method of bacterial genome engineering. This protocol describes the use of this technique to make gene knockouts and knockins, as well as single nucleotide insertions, deletions and substitutions in Pseudomonas aeruginosa. Unlike other approaches to allelic exchange, this protocol does not require heterologous recombinases to insert or excise selective markers from the target chromosome. Rather, positive and negative selection are enabled solely by suicide vector-encoded functions and host cell proteins. Here, mutant alleles, which are flanked by regions of homology to the recipient chromosome, are synthesized in vitro and then cloned into allelic exchange vectors using standard procedures. These suicide vectors are then introduced into recipient cells by conjugation. Homologous recombination then results in antibiotic resistant single-crossover mutants in which the plasmid has integrated site-specifically into the chromosome. Subsequently, unmarked double-crossover mutants are isolated directly using sucrose-mediated counter-selection. This two-step process yields seamless mutations that are precise to a single base pair of DNA. The entire procedure requires ~2 weeks. PMID:26492139

  18. [Quantitative changes of main components of erythrocyte membranes which define architectonics of cells under pttg gene knockout].

    PubMed

    Kaniuka, O P; Filiak, Ie Z; Kulachkovs'kyĭ, O R; Osyp, Iu L; Sybirna, N O

    2014-01-01

    A pttg gene knockout affects the functional state of erythron in mice which could be associated with structural changes in the structure of erythrocyte membranes. The pttg gene knockout causes a significant modification of fatty acids composition of erythrocyte membrane lipids by reducing the content of palmitic acid and increasing of polyunsaturated fatty acids amount by 18%. Analyzing the erythrocyte surface architectonics of mice under pttg gene knockout, it was found that on the background of reduction of the functionally complete biconcave discs population one could observe an increase of the number of transformed cells at different degeneration stages. Researches have shown that in mice with a pttg gene knockout compared with a control group of animals cytoskeletal protein--beta-spectrin was reduced by 17.03%. However, there is a reduction of membrane protein band 3 by 33.04%, simultaneously the content of anion transport protein band 4.5 increases by 35.2% and protein band 4.2 by 32.1%. The lectin blot analysis has helped to reveal changes in the structure of the carbohydrate determinants of erythrocyte membrane glycoproteins under conditions of directed pttg gene inactivation, accompanied by changes in the type of communication, which joins the terminal residue in carbohydrate determinant of glycoproteins. Thus, a significant redistribution of protein and fatty acids contents in erythrocyte membranes that manifested in the increase of the deformed shape of red blood cells is observed underpttg gene knockout.

  19. CRISPR-Cas9-mediated gene knockout in primary human airway epithelial cells reveals a proinflammatory role for MUC18.

    PubMed

    Chu, H W; Rios, C; Huang, C; Wesolowska-Andersen, A; Burchard, E G; O'Connor, B P; Fingerlin, T E; Nichols, D; Reynolds, S D; Seibold, M A

    2015-10-01

    Targeted knockout of genes in primary human cells using CRISPR-Cas9-mediated genome-editing represents a powerful approach to study gene function and to discern molecular mechanisms underlying complex human diseases. We used lentiviral delivery of CRISPR-Cas9 machinery and conditional reprogramming culture methods to knockout the MUC18 gene in human primary nasal airway epithelial cells (AECs). Massively parallel sequencing technology was used to confirm that the genome of essentially all cells in the edited AEC populations contained coding region insertions and deletions (indels). Correspondingly, we found mRNA expression of MUC18 was greatly reduced and protein expression was absent. Characterization of MUC18 knockout cell populations stimulated with TLR2, 3 and 4 agonists revealed that IL-8 (a proinflammatory chemokine) responses of AECs were greatly reduced in the absence of functional MUC18 protein. Our results show the feasibility of CRISPR-Cas9-mediated gene knockouts in AEC culture (both submerged and polarized), and suggest a proinflammatory role for MUC18 in airway epithelial response to bacterial and viral stimuli.

  20. A versatile modular vector system for rapid combinatorial mammalian genetics.

    PubMed

    Albers, Joachim; Danzer, Claudia; Rechsteiner, Markus; Lehmann, Holger; Brandt, Laura P; Hejhal, Tomas; Catalano, Antonella; Busenhart, Philipp; Gonçalves, Ana Filipa; Brandt, Simone; Bode, Peter K; Bode-Lesniewska, Beata; Wild, Peter J; Frew, Ian J

    2015-04-01

    Here, we describe the multiple lentiviral expression (MuLE) system that allows multiple genetic alterations to be introduced simultaneously into mammalian cells. We created a toolbox of MuLE vectors that constitute a flexible, modular system for the rapid engineering of complex polycistronic lentiviruses, allowing combinatorial gene overexpression, gene knockdown, Cre-mediated gene deletion, or CRISPR/Cas9-mediated (where CRISPR indicates clustered regularly interspaced short palindromic repeats) gene mutation, together with expression of fluorescent or enzymatic reporters for cellular assays and animal imaging. Examples of tumor engineering were used to illustrate the speed and versatility of performing combinatorial genetics using the MuLE system. By transducing cultured primary mouse cells with single MuLE lentiviruses, we engineered tumors containing up to 5 different genetic alterations, identified genetic dependencies of molecularly defined tumors, conducted genetic interaction screens, and induced the simultaneous CRISPR/Cas9-mediated knockout of 3 tumor-suppressor genes. Intramuscular injection of MuLE viruses expressing oncogenic H-RasG12V together with combinations of knockdowns of the tumor suppressors cyclin-dependent kinase inhibitor 2A (Cdkn2a), transformation-related protein 53 (Trp53), and phosphatase and tensin homolog (Pten) allowed the generation of 3 murine sarcoma models, demonstrating that genetically defined autochthonous tumors can be rapidly generated and quantitatively monitored via direct injection of polycistronic MuLE lentiviruses into mouse tissues. Together, our results demonstrate that the MuLE system provides genetic power for the systematic investigation of the molecular mechanisms that underlie human diseases.

  1. Lymphocyte signaling: beyond knockouts.

    PubMed

    Saveliev, Alexander; Tybulewicz, Victor L J

    2009-04-01

    The analysis of lymphocyte signaling was greatly enhanced by the advent of gene targeting, which allows the selective inactivation of a single gene. Although this gene 'knockout' approach is often informative, in many cases, the phenotype resulting from gene ablation might not provide a complete picture of the function of the corresponding protein. If a protein has multiple functions within a single or several signaling pathways, or stabilizes other proteins in a complex, the phenotypic consequences of a gene knockout may manifest as a combination of several different perturbations. In these cases, gene targeting to 'knock in' subtle point mutations might provide more accurate insight into protein function. However, to be informative, such mutations must be carefully based on structural and biophysical data.

  2. Gene Editing in Human Lymphoid Cells: Role for Donor DNA, Type of Genomic Nuclease and Cell Selection Method.

    PubMed

    Zotova, Anastasia; Lopatukhina, Elena; Filatov, Alexander; Khaitov, Musa; Mazurov, Dmitriy

    2017-11-02

    Programmable endonucleases introduce DNA breaks at specific sites, which are repaired by non-homologous end joining (NHEJ) or homology recombination (HDR). Genome editing in human lymphoid cells is challenging as these difficult-to-transfect cells may also inefficiently repair DNA by HDR. Here, we estimated efficiencies and dynamics of knockout (KO) and knockin (KI) generation in human T and B cell lines depending on repair template, target loci and types of genomic endonucleases. Using zinc finger nuclease (ZFN), we have engineered Jurkat and CEM cells with the 8.2 kb human immunodeficiency virus type 1 (HIV-1) ∆Env genome integrated at the adeno-associated virus integration site 1 (AAVS1) locus that stably produce virus particles and mediate infection upon transfection with helper vectors. Knockouts generated by ZFN or clustered regularly interspaced short palindromic repeats (CRISPR/Cas9) double nicking techniques were comparably efficient in lymphoid cells. However, unlike polyclonal sorted cells, gene-edited cells selected by cloning exerted tremendous deviations in functionality as estimated by replication of HIV-1 and human T cell leukemia virus type 1 (HTLV-1) in these cells. Notably, the recently reported high-fidelity eCas9 1.1 when combined to the nickase mutation displayed gene-dependent decrease in on-target activity. Thus, the balance between off-target effects and on-target efficiency of nucleases, as well as choice of the optimal method of edited cell selection should be taken into account for proper gene function validation in lymphoid cells.

  3. The Expression of TALEN before Fertilization Provides a Rapid Knock-Out Phenotype in Xenopus laevis Founder Embryos.

    PubMed

    Miyamoto, Kei; Suzuki, Ken-Ichi T; Suzuki, Miyuki; Sakane, Yuto; Sakuma, Tetsushi; Herberg, Sarah; Simeone, Angela; Simpson, David; Jullien, Jerome; Yamamoto, Takashi; Gurdon, J B

    2015-01-01

    Recent advances in genome editing using programmable nucleases have revolutionized gene targeting in various organisms. Successful gene knock-out has been shown in Xenopus, a widely used model organism, although a system enabling less mosaic knock-out in founder embryos (F0) needs to be explored in order to judge phenotypes in the F0 generation. Here, we injected modified highly active transcription activator-like effector nuclease (TALEN) mRNA to oocytes at the germinal vesicle (GV) stage, followed by in vitro maturation and intracytoplasmic sperm injection, to achieve a full knock-out in F0 embryos. Unlike conventional injection methods to fertilized embryos, the injection of TALEN mRNA into GV oocytes allows expression of nucleases before fertilization, enabling them to work from an earlier stage. Using this procedure, most of developed embryos showed full knock-out phenotypes of the pigmentation gene tyrosinase and/or embryonic lethal gene pax6 in the founder generation. In addition, our method permitted a large 1 kb deletion. Thus, we describe nearly complete gene knock-out phenotypes in Xenopus laevis F0 embryos. The presented method will help to accelerate the production of knock-out frogs since we can bypass an extra generation of about 1 year in Xenopus laevis. Meantime, our method provides a unique opportunity to rapidly test the developmental effects of disrupting those genes that do not permit growth to an adult able to reproduce. In addition, the protocol shown here is considerably less invasive than the previously used host transfer since our protocol does not require surgery. The experimental scheme presented is potentially applicable to other organisms such as mammals and fish to resolve common issues of mosaicism in founders.

  4. CompareSVM: supervised, Support Vector Machine (SVM) inference of gene regularity networks.

    PubMed

    Gillani, Zeeshan; Akash, Muhammad Sajid Hamid; Rahaman, M D Matiur; Chen, Ming

    2014-11-30

    Predication of gene regularity network (GRN) from expression data is a challenging task. There are many methods that have been developed to address this challenge ranging from supervised to unsupervised methods. Most promising methods are based on support vector machine (SVM). There is a need for comprehensive analysis on prediction accuracy of supervised method SVM using different kernels on different biological experimental conditions and network size. We developed a tool (CompareSVM) based on SVM to compare different kernel methods for inference of GRN. Using CompareSVM, we investigated and evaluated different SVM kernel methods on simulated datasets of microarray of different sizes in detail. The results obtained from CompareSVM showed that accuracy of inference method depends upon the nature of experimental condition and size of the network. For network with nodes (<200) and average (over all sizes of networks), SVM Gaussian kernel outperform on knockout, knockdown, and multifactorial datasets compared to all the other inference methods. For network with large number of nodes (~500), choice of inference method depend upon nature of experimental condition. CompareSVM is available at http://bis.zju.edu.cn/CompareSVM/ .

  5. Engineered Viruses as Genome Editing Devices.

    PubMed

    Chen, Xiaoyu; Gonçalves, Manuel A F V

    2016-03-01

    Genome editing based on sequence-specific designer nucleases, also known as programmable nucleases, seeks to modify in a targeted and precise manner the genetic information content of living cells. Delivering into cells designer nucleases alone or together with donor DNA templates, which serve as surrogate homologous recombination (HR) substrates, can result in gene knockouts or gene knock-ins, respectively. As engineered replication-defective viruses, viral vectors are having an increasingly important role as delivery vehicles for donor DNA templates and designer nucleases, namely, zinc-finger nucleases (ZFNs), transcription activator-like effector nucleases (TALENs) and clustered, regularly interspaced, short palindromic repeats (CRISPR)-associated Cas9 (CRISPR-Cas9) nucleases, also known as RNA-guided nucleases (RGNs). We review this dual role played by engineered viral particles on genome editing while focusing on their main scaffolds, consisting of lentiviruses, adeno-associated viruses, and adenoviruses. In addition, the coverage of the growing body of research on the repurposing of viral vectors as delivery systems for genome editing tools is complemented with information regarding their main characteristics, pros, and cons. Finally, this information is framed by a concise description of the chief principles, tools, and applications of the genome editing field as a whole.

  6. Engineered Viruses as Genome Editing Devices

    PubMed Central

    Chen, Xiaoyu; Gonçalves, Manuel A F V

    2016-01-01

    Genome editing based on sequence-specific designer nucleases, also known as programmable nucleases, seeks to modify in a targeted and precise manner the genetic information content of living cells. Delivering into cells designer nucleases alone or together with donor DNA templates, which serve as surrogate homologous recombination (HR) substrates, can result in gene knockouts or gene knock-ins, respectively. As engineered replication-defective viruses, viral vectors are having an increasingly important role as delivery vehicles for donor DNA templates and designer nucleases, namely, zinc-finger nucleases (ZFNs), transcription activator-like effector nucleases (TALENs) and clustered, regularly interspaced, short palindromic repeats (CRISPR)-associated Cas9 (CRISPR−Cas9) nucleases, also known as RNA-guided nucleases (RGNs). We review this dual role played by engineered viral particles on genome editing while focusing on their main scaffolds, consisting of lentiviruses, adeno-associated viruses, and adenoviruses. In addition, the coverage of the growing body of research on the repurposing of viral vectors as delivery systems for genome editing tools is complemented with information regarding their main characteristics, pros, and cons. Finally, this information is framed by a concise description of the chief principles, tools, and applications of the genome editing field as a whole. PMID:26336974

  7. Functional characterization of malaria parasites deficient in the K+ channel Kch2.

    PubMed

    Ellekvist, Peter; Mlambo, Godfree; Kumar, Nirbhay; Klaerke, Dan A

    2017-11-04

    K + channels are integral membrane proteins, which contribute to maintain vital parameters such as the cellular membrane potential and cell volume. Malaria parasites encode two K + channel homologues, Kch1 and Kch2, which are well-conserved among members of the Plasmodium genus. In the rodent malaria parasite P. berghei, the functional significance of K + channel homologue PbKch2 was studied using targeted gene knock-out. The knockout parasites were characterized in a mouse model in terms of growth-kinetics and infectivity in the mosquito vector. Furthermore, using a tracer-uptake technique with 86 Rb + as a K + congener, the K + transporting properties of the knockout parasites were assessed. Genetic disruption of Kch2 did not grossly affect the phenotype in terms of asexual replication and pathogenicity in a mouse model. In contrast to Kch1-null parasites, Kch2-null parasites were fully capable of forming oocysts in female Anopheles stephensi mosquitoes. 86 Rb + uptake in Kch2-deficient blood-stage P. berghei parasites (Kch2-null) did not differ from that of wild-type (WT) parasites. About two-thirds of the 86 Rb + uptake in WT and in Kch2-null parasites could be inhibited by K + channel blockers and could be inferred to the presence of functional Kch1 in Kch2 knockout parasites. Kch2 is therefore not required for transport of K + in P. berghei and is not essential to mosquito-stage sporogonic development of the parasite. Copyright © 2017 Elsevier Inc. All rights reserved.

  8. [BLG gene knockout and hLF gene knock-in at BLG locus in goat by TALENs].

    PubMed

    Song, Shaozheng; Zhu, Mengmin; Yuan, Yuguo; Rong, Yao; Xu, Sheng; Chen, Si; Mei, Junyan; Cheng, Yong

    2016-03-01

    To knock out β-lactoglobulin (BLG) gene and insert human lactoferrin (hLF) coding sequence at BLG locus of goat, the transcription activator-like effector nucleases (TALEN) mediated recombination was used to edit the BLG gene of goat fetal fibroblast, then as donor cells for somatic cell nuclear transfer. We designed a pair of specific plasmid TALEN-3-L/R for goat BLG exon III recognition sites, and BLC14-TK vector containing a negative selection gene HSV-TK, was used for the knock in of hLF gene. TALENs plasmids were transfected into the goat fetal fibroblast cells, and the cells were screened three days by 2 μg/mL puromycin. DNA cleavage activities of cells were verified by PCR amplification and DNA production sequencing. Then, targeting vector BLC14-TK and plasmids TALEN-3-L/R were co-transfected into goat fetal fibroblasts, both 700 μg/mL G418 and 2 μg/mL GCV were simultaneously used to screen G418-resistant cells. Detections of integration and recombination were implemented to obtain cells with hLF gene site-specific integration. We chose targeting cells as donor cells for somatic cell nuclear transfer. The mutagenicity of TALEN-3-L/R was between 25% and 30%. A total of 335 reconstructed embryos with 6 BLG-/hLF+ targeting cell lines were transferred into 16 recipient goats. There were 9 pregnancies confirmed by ultrasound on day 30 to 35 (pregnancy rate of 39.1%), and one of 50-day-old fetus with BLG-/hLF+ was achieved. These results provide the basis for hLF gene knock-in at BLG locus of goat and cultivating transgenic goat of low allergens and rich hLF in the milk.

  9. The Combinational Use of CRISPR/Cas9 and Targeted Toxin Technology Enables Efficient Isolation of Bi-Allelic Knockout Non-Human Mammalian Clones.

    PubMed

    Watanabe, Satoshi; Sakurai, Takayuki; Nakamura, Shingo; Miyoshi, Kazuchika; Sato, Masahiro

    2018-04-04

    Recent advances in genome editing systems such as clustered regularly interspaced short palindromic repeats/CRISPR-associated protein-9 nuclease (CRISPR/Cas9) have facilitated genomic modification in mammalian cells. However, most systems employ transient treatment with selective drugs such as puromycin to obtain the desired genome-edited cells, which often allows some untransfected cells to survive and decreases the efficiency of generating genome-edited cells. Here, we developed a novel targeted toxin-based drug-free selection system for the enrichment of genome-edited cells. Cells were transfected with three expression vectors, each of which carries a guide RNA (gRNA), humanized Cas9 ( hCas9 ) gene, or Clostridium perfringens -derived endo-β-galactosidase C ( EndoGalC ) gene. Once EndoGalC is expressed in a cell, it digests the cell-surface α-Gal epitope, which is specifically recognized by BS-I-B₄ lectin (IB4). Three days after transfection, these cells were treated with cytotoxin saporin-conjugated IB4 (IB4SAP) for 30 min at 37 °C prior to cultivation in a normal medium. Untransfected cells and those weakly expressing EndoGalC will die due to the internalization of saporin. Cells transiently expressing EndoGalC strongly survive, and some of these surviving clones are expected to be genome-edited bi-allelic knockout (KO) clones due to their strong co-expression of gRNA and hCas9. When porcine α-1,3-galactosyltransferase gene, which can synthesize the α-Gal epitope, was attempted to be knocked out, 16.7% and 36.7% of the surviving clones were bi-allelic and mono-allelic knockout (KO) cells, respectively, which was in contrast to the isolation of clones in the absence of IB4SAP treatment. Namely, 0% and 13.3% of the resulting clones were bi-allelic and mono-allelic KO cells, respectively. A similar tendency was seen when other target genes such as DiGeorge syndrome critical region gene 2 and transforming growth factor-β receptor type 1 gene were targeted to be knocked out. Our results indicate that a combination of the CRISPR/Cas9 system and targeted toxin technology using IB4SAP allows efficient enrichment of genome-edited clones, particularly bi-allelic KO clones.

  10. High-throughput discovery of novel developmental phenotypes.

    PubMed

    Dickinson, Mary E; Flenniken, Ann M; Ji, Xiao; Teboul, Lydia; Wong, Michael D; White, Jacqueline K; Meehan, Terrence F; Weninger, Wolfgang J; Westerberg, Henrik; Adissu, Hibret; Baker, Candice N; Bower, Lynette; Brown, James M; Caddle, L Brianna; Chiani, Francesco; Clary, Dave; Cleak, James; Daly, Mark J; Denegre, James M; Doe, Brendan; Dolan, Mary E; Edie, Sarah M; Fuchs, Helmut; Gailus-Durner, Valerie; Galli, Antonella; Gambadoro, Alessia; Gallegos, Juan; Guo, Shiying; Horner, Neil R; Hsu, Chih-Wei; Johnson, Sara J; Kalaga, Sowmya; Keith, Lance C; Lanoue, Louise; Lawson, Thomas N; Lek, Monkol; Mark, Manuel; Marschall, Susan; Mason, Jeremy; McElwee, Melissa L; Newbigging, Susan; Nutter, Lauryl M J; Peterson, Kevin A; Ramirez-Solis, Ramiro; Rowland, Douglas J; Ryder, Edward; Samocha, Kaitlin E; Seavitt, John R; Selloum, Mohammed; Szoke-Kovacs, Zsombor; Tamura, Masaru; Trainor, Amanda G; Tudose, Ilinca; Wakana, Shigeharu; Warren, Jonathan; Wendling, Olivia; West, David B; Wong, Leeyean; Yoshiki, Atsushi; MacArthur, Daniel G; Tocchini-Valentini, Glauco P; Gao, Xiang; Flicek, Paul; Bradley, Allan; Skarnes, William C; Justice, Monica J; Parkinson, Helen E; Moore, Mark; Wells, Sara; Braun, Robert E; Svenson, Karen L; de Angelis, Martin Hrabe; Herault, Yann; Mohun, Tim; Mallon, Ann-Marie; Henkelman, R Mark; Brown, Steve D M; Adams, David J; Lloyd, K C Kent; McKerlie, Colin; Beaudet, Arthur L; Bućan, Maja; Murray, Stephen A

    2016-09-22

    Approximately one-third of all mammalian genes are essential for life. Phenotypes resulting from knockouts of these genes in mice have provided tremendous insight into gene function and congenital disorders. As part of the International Mouse Phenotyping Consortium effort to generate and phenotypically characterize 5,000 knockout mouse lines, here we identify 410 lethal genes during the production of the first 1,751 unique gene knockouts. Using a standardized phenotyping platform that incorporates high-resolution 3D imaging, we identify phenotypes at multiple time points for previously uncharacterized genes and additional phenotypes for genes with previously reported mutant phenotypes. Unexpectedly, our analysis reveals that incomplete penetrance and variable expressivity are common even on a defined genetic background. In addition, we show that human disease genes are enriched for essential genes, thus providing a dataset that facilitates the prioritization and validation of mutations identified in clinical sequencing efforts.

  11. High-throughput discovery of novel developmental phenotypes

    PubMed Central

    Dickinson, Mary E.; Flenniken, Ann M.; Ji, Xiao; Teboul, Lydia; Wong, Michael D.; White, Jacqueline K.; Meehan, Terrence F.; Weninger, Wolfgang J.; Westerberg, Henrik; Adissu, Hibret; Baker, Candice N.; Bower, Lynette; Brown, James M.; Caddle, L. Brianna; Chiani, Francesco; Clary, Dave; Cleak, James; Daly, Mark J.; Denegre, James M.; Doe, Brendan; Dolan, Mary E.; Edie, Sarah M.; Fuchs, Helmut; Gailus-Durner, Valerie; Galli, Antonella; Gambadoro, Alessia; Gallegos, Juan; Guo, Shiying; Horner, Neil R.; Hsu, Chih-wei; Johnson, Sara J.; Kalaga, Sowmya; Keith, Lance C.; Lanoue, Louise; Lawson, Thomas N.; Lek, Monkol; Mark, Manuel; Marschall, Susan; Mason, Jeremy; McElwee, Melissa L.; Newbigging, Susan; Nutter, Lauryl M.J.; Peterson, Kevin A.; Ramirez-Solis, Ramiro; Rowland, Douglas J.; Ryder, Edward; Samocha, Kaitlin E.; Seavitt, John R.; Selloum, Mohammed; Szoke-Kovacs, Zsombor; Tamura, Masaru; Trainor, Amanda G; Tudose, Ilinca; Wakana, Shigeharu; Warren, Jonathan; Wendling, Olivia; West, David B.; Wong, Leeyean; Yoshiki, Atsushi; MacArthur, Daniel G.; Tocchini-Valentini, Glauco P.; Gao, Xiang; Flicek, Paul; Bradley, Allan; Skarnes, William C.; Justice, Monica J.; Parkinson, Helen E.; Moore, Mark; Wells, Sara; Braun, Robert E.; Svenson, Karen L.; de Angelis, Martin Hrabe; Herault, Yann; Mohun, Tim; Mallon, Ann-Marie; Henkelman, R. Mark; Brown, Steve D.M.; Adams, David J.; Lloyd, K.C. Kent; McKerlie, Colin; Beaudet, Arthur L.; Bucan, Maja; Murray, Stephen A.

    2016-01-01

    Approximately one third of all mammalian genes are essential for life. Phenotypes resulting from mouse knockouts of these genes have provided tremendous insight into gene function and congenital disorders. As part of the International Mouse Phenotyping Consortium effort to generate and phenotypically characterize 5000 knockout mouse lines, we have identified 410 lethal genes during the production of the first 1751 unique gene knockouts. Using a standardised phenotyping platform that incorporates high-resolution 3D imaging, we identified novel phenotypes at multiple time points for previously uncharacterized genes and additional phenotypes for genes with previously reported mutant phenotypes. Unexpectedly, our analysis reveals that incomplete penetrance and variable expressivity are common even on a defined genetic background. In addition, we show that human disease genes are enriched for essential genes identified in our screen, thus providing a novel dataset that facilitates prioritization and validation of mutations identified in clinical sequencing efforts. PMID:27626380

  12. Ultra-superovulation for the CRISPR-Cas9-mediated production of gene-knockout, single-amino-acid-substituted, and floxed mice.

    PubMed

    Nakagawa, Yoshiko; Sakuma, Tetsushi; Nishimichi, Norihisa; Yokosaki, Yasuyuki; Yanaka, Noriyuki; Takeo, Toru; Nakagata, Naomi; Yamamoto, Takashi

    2016-08-15

    Current advances in producing genetically modified mice using genome-editing technologies have indicated the need for improvement of limiting factors including zygote collection for microinjection and their cryopreservation. Recently, we developed a novel superovulation technique using inhibin antiserum and equine chorionic gonadotropin to promote follicle growth. This method enabled the increased production of fertilized oocytes via in vitro fertilization compared with the conventional superovulation method. Here, we verify that the ultra-superovulation technique can be used for the efficient generation of clustered regularly interspaced short palindromic repeats (CRISPR)-CRISPR-associated protein 9 (Cas9)-mediated knockout mice by microinjection of plasmid vector or ribonucleoprotein into zygotes. We also investigated whether single-amino-acid-substituted mice and conditional knockout mice could be generated. Founder mice bearing base substitutions were generated more efficiently by co-microinjection of Cas9 protein, a guide RNA and single-stranded oligodeoxynucleotide (ssODN) than by plasmid microinjection with ssODN. The conditional allele was successfully introduced by the one-step insertion of an ssODN designed to carry an exon flanked by two loxP sequences and homology arms using a double-cut CRISPR-Cas9 strategy. Our study presents a useful method for the CRISPR-Cas9-based generation of genetically modified mice from the viewpoints of animal welfare and work efficiency. © 2016. Published by The Company of Biologists Ltd.

  13. Impaired TFEB-mediated Lysosome Biogenesis and Autophagy Promote Chronic Ethanol-induced Liver Injury and Steatosis in Mice.

    PubMed

    Chao, Xiaojuan; Wang, Shaogui; Zhao, Katrina; Li, Yuan; Williams, Jessica A; Li, Tiangang; Chavan, Hemantkumar; Krishnamurthy, Partha; He, Xi C; Li, Linheng; Ballabio, Andrea; Ni, Hong-Min; Ding, Wen-Xing

    2018-05-18

    Defects in lysosome function and autophagy contribute to pathogenesis of alcoholic liver disease. We investigated the mechanisms by which alcohol consumption affects these processes, evaluating the functions transcription factor EB (TFEB), which regulates lysosomal biogenesis. We performed studies with GFP-LC3 mice, mice with liver-specific deletion of transcription factor EB (TFEB), mice with disruption of the transcription factor E3 gene (TFE3-knockout mice), mice with disruption of the Tefb and Tfe3 genes (TFEB, TFE3 double-knockout mice), and Tfeb flox/flox albumin cre-negative mice (controls). TFEB was overexpressed from adenoviral vectors or knocked down with small interfering RNAs in mouse livers. Mice were placed on diets of chronic ethanol feeding plus an acute binge to induce liver damage (ethanol diet); some mice were also given injections of torin1, an inhibitor of the kinase activity of the mechanistic target of rapamycin (mTOR). Liver tissues were collected and analyzed by immunohistochemistry, immunoblots, and quantitative real-time PCR to monitor lysosome biogenesis. We analyzed levels of TFEB in liver tissues from patients with alcoholic hepatitis and from healthy donors (controls) by immunohistochemistry. Liver tissues from mice on the ethanol diet had lower levels of total and nuclear TFEB, compared with control mice, and hepatocytes had reduced lysosome biogenesis and autophagy. Hepatocytes from mice on the ethanol diet had increased translocation of mTOR into lysosomes, resulting increased mTOR activation. Administration of torin1 increased liver levels of TFEB and reduced steatosis and liver injury induced by ethanol. Mice that overexpressed TFEB in liver developed less-severe ethanol-induced liver injury and had increased lysosomal biogenesis and mitochondrial bioenergetics compared to mice carrying a control vector. Mice with knockdown of TFEB, as well as TFEB, TFE3 double-knockout mice, developed more severe liver injury in response to the ethanol diet than control mice. Liver tissues from patients with alcohol-induced hepatitis had lower nuclear levels of TFEB than control tissues CONCLUSIONS: We found chronic ethanol feeding plus an acute binge to reduce hepatic expression of the transcription factor TFEB, which is required for lysosomal biogenesis and autophagy. Strategies to block mTOR activity or increase levels of TFEB might be developed to protect liver from ethanol-induced damage. Copyright © 2018 AGA Institute. Published by Elsevier Inc. All rights reserved.

  14. New insight into the role of the β3 subunit of the GABAA-R in development, behavior, body weight regulation, and anesthesia revealed by conditional gene knockout

    PubMed Central

    Ferguson, Carolyn; Hardy, Steven L; Werner, David F; Hileman, Stanley M; DeLorey, Timothy M; Homanics, Gregg E

    2007-01-01

    Background The β3 subunit of the γ-aminobutyric acid type A receptor (GABAA-R) has been reported to be important for palate formation, anesthetic action, and normal nervous system function. This subunit has also been implicated in the pathogenesis of Angelman syndrome and autism spectrum disorder. To further investigate involvement of this subunit, we previously produced mice with a global knockout of β3. However, developmental abnormalities, compensation, reduced viability, and numerous behavioral abnormalities limited the usefulness of that murine model. To overcome many of these limitations, a mouse line with a conditionally inactivated β3 gene was engineered. Results Gene targeting and embryonic stem cell technologies were used to create mice in which exon 3 of the β3 subunit was flanked by loxP sites (i.e., floxed). Crossing the floxed β3 mice to a cre general deleter mouse line reproduced the phenotype of the previously described global knockout. Pan-neuronal knockout of β3 was achieved by crossing floxed β3 mice to Synapsin I-cre transgenic mice. Palate development was normal in pan-neuronal β3 knockouts but ~61% died as neonates. Survivors were overtly normal, fertile, and were less sensitive to etomidate. Forebrain selective knockout of β3 was achieved using α CamKII-cre transgenic mice. Palate development was normal in forebrain selective β3 knockout mice. These knockouts survived the neonatal period, but ~30% died between 15–25 days of age. Survivors had reduced reproductive fitness, reduced sensitivity to etomidate, were hyperactive, and some became obese. Conclusion Conditional inactivation of the β3 gene revealed novel insight into the function of this GABAA-R subunit. The floxed β3 knockout mice described here will be very useful for conditional knockout studies to further investigate the role of the β3 subunit in development, ethanol and anesthetic action, normal physiology, and pathophysiologic processes. PMID:17927825

  15. Characterization of intravitreally delivered capsid mutant AAV2-Cre vector to induce tissue-specific mutations in murine retinal ganglion cells.

    PubMed

    Langouet-Astrie, Christophe J; Yang, Zhiyong; Polisetti, Sraavya M; Welsbie, Derek S; Hauswirth, William W; Zack, Donald J; Merbs, Shannath L; Enke, Raymond A

    2016-10-01

    Targeted expression of Cre recombinase in murine retinal ganglion cells (RGCs) by viral vector is an effective strategy for creating tissue-specific gene knockouts for investigation of genetic contribution to RGC degeneration associated with optic neuropathies. Here we characterize dosage, efficacy and toxicity for sufficient intravitreal delivery of a capsid mutant Adeno-associated virus 2 (AAV2) vector encoding Cre recombinase. Wild type and Rosa26 (R26) LacZ mice were intravitreally injected with capsid mutant AAV2 viral vectors. Murine eyes were harvested at intervals ranging from 2 weeks to 15 weeks post-injection and were assayed for viral transduction, transgene expression and RGC survival. 10(9) vector genomes (vg) were sufficient for effective in vivo targeting of murine ganglion cell layer (GCL) retinal neurons. Transgene expression was observed as early as 2 weeks post-injection of viral vectors and persisted to 11 weeks. Early expression of Cre had no significant effect on RGC survival, while significant RGC loss was detected beginning 5 weeks post-injection. Early expression of viral Cre recombinase was robust, well-tolerated and predominantly found in GCL neurons suggesting this strategy can be effective in short-term RGC-specific mutation studies in experimental glaucoma models such as optic nerve crush and transection experiments. RGC degeneration with Cre expression for more than 4 weeks suggests that Cre toxicity is a limiting factor for targeted mutation strategies in RGCs. Copyright © 2016 Elsevier Ltd. All rights reserved.

  16. Genetic manipulation of the obligate chemolithoautotrophic bacterium Thiobacillus denitrificans

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Beller, H.R.; Legler, T.C.; Kane, S.R.

    2011-07-15

    Chemolithoautotrophic bacteria can be of industrial and environmental importance, but they present a challenge for systems biology studies, as their central metabolism deviates from that of model organisms and there is a much less extensive experimental basis for their gene annotation than for typical organoheterotrophs. For microbes with sequenced genomes but unconventional metabolism, the ability to create knockout mutations can be a powerful tool for functional genomics and thereby render an organism more amenable to systems biology approaches. In this chapter, we describe a genetic system for Thiobacillus denitrificans, with which insertion mutations can be introduced by homologous recombination andmore » complemented in trans. Insertion mutations are generated by in vitro transposition, the mutated genes are amplified by the PCR, and the amplicons are introduced into T. denitrificans by electroporation. Use of a complementation vector, pTL2, based on the IncP plasmid pRR10 is also addressed.« less

  17. Microarray expression profiling identifies genes with altered expression in HDL-deficient mice

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Callow, Matthew J.; Dudoit, Sandrine; Gong, Elaine L.

    2000-05-05

    Based on the assumption that severe alterations in the expression of genes known to be involved in HDL metabolism may affect the expression of other genes we screened an array of over 5000 mouse expressed sequence tags (ESTs) for altered gene expression in the livers of two lines of mice with dramatic decreases in HDL plasma concentrations. Labeled cDNA from livers of apolipoprotein AI (apo AI) knockout mice, Scavenger Receptor BI (SR-BI) transgenic mice and control mice were co-hybridized to microarrays. Two-sample t-statistics were used to identify genes with altered expression levels in the knockout or transgenic mice compared withmore » the control mice. In the SR-BI group we found 9 array elements representing at least 5 genes to be significantly altered on the basis of an adjusted p value of less than 0.05. In the apo AI knockout group 8 array elements representing 4 genes were altered compared with the control group (p < 0.05). Several of the genes identified in the SR-BI transgenic suggest altered sterol metabolism and oxidative processes. These studies illustrate the use of multiple-testing methods for the identification of genes with altered expression in replicated microarray experiments of apo AI knockout and SR-BI transgenic mice.« less

  18. CRISPR-Cas9 Toolkit for Actinomycete Genome Editing.

    PubMed

    Tong, Yaojun; Robertsen, Helene Lunde; Blin, Kai; Weber, Tilmann; Lee, Sang Yup

    2018-01-01

    Bacteria of the order Actinomycetales are one of the most important sources of bioactive natural products, which are the source of many drugs. However, many of them still lack efficient genome editing methods, some strains even cannot be manipulated at all. This restricts systematic metabolic engineering approaches for boosting known and discovering novel natural products. In order to facilitate the genome editing for actinomycetes, we developed a CRISPR-Cas9 toolkit with high efficiency for actinomyces genome editing. This basic toolkit includes a software for spacer (sgRNA) identification, a system for in-frame gene/gene cluster knockout, a system for gene loss-of-function study, a system for generating a random size deletion library, and a system for gene knockdown. For the latter, a uracil-specific excision reagent (USER) cloning technology was adapted to simplify the CRISPR vector construction process. The application of this toolkit was successfully demonstrated by perturbation of genomes of Streptomyces coelicolor A3(2) and Streptomyces collinus Tü 365. The CRISPR-Cas9 toolkit and related protocol described here can be widely used for metabolic engineering of actinomycetes.

  19. A versatile system for rapid multiplex genome-edited CAR T cell generation

    PubMed Central

    Ren, Jiangtao; Zhang, Xuhua; Liu, Xiaojun; Fang, Chongyun; Jiang, Shuguang; June, Carl H.; Zhao, Yangbing

    2017-01-01

    The therapeutic potential of CRISPR system has already been demonstrated in many instances and begun to overlap with the rapidly expanding field of cancer immunotherapy, especially on the production of genetically modified T cell receptor or chimeric antigen receptor (CAR) T cells. Efficient genomic disruption of multiple gene loci to generate universal donor cells, as well as potent effector T cells resistant to multiple inhibitory pathways such as PD-1 and CTLA4 is an attractive strategy for cell therapy. In this study, we accomplished rapid and efficient multiplex genomic editing, and re-directing T cells with antigen specific CAR via a one-shot CRISPR protocol by incorporation of multiple gRNAs in a CAR lentiviral vector. High efficient double knockout of endogenous TCR and HLA class I could be easily achieved to generate allogeneic universal CAR T cells. We also generated Fas-resistant universal CAR T cells by triple gene disruption. Simultaneous gene editing of four gene loci using the one-shot CRISPR protocol to generate allogeneic universal T cells deficient of both PD1 and CTLA-4 was also attempted. PMID:28199983

  20. Covalent decoration of adenovirus vector capsids with the carbohydrate epitope αGal does not improve vector immunogenicity, but allows to study the in vivo fate of adenovirus immunocomplexes.

    PubMed

    Kratzer, Ramona F; Espenlaub, Sigrid; Hoffmeister, Andrea; Kron, Matthias W; Kreppel, Florian

    2017-01-01

    Adenovirus-based vectors are promising tools for genetic vaccination. However, several obstacles have to be overcome prior to a routine clinical application of adenovirus-based vectors as efficacious vectored vaccines. The linear trisaccharide epitope αGal (alpha-Gal) with the carbohydrate sequence galactose-α-1,3-galactosyl-β-1,4-N-acetylglucosamine has been described as a potent adjuvant for recombinant or attenuated vaccines. Humans and α-1,3-galactosyltransferase knockout mice do not express this epitope. Upon exposure of α-1,3-galactosyltransferase-deficient organisms to αGal in the environment, large amounts of circulating anti-Gal antibodies are produced consistently. Immunocomplexes formed between recombinant αGal-decorated vaccines and anti-Gal antibodies exhibit superior immunogenicity. We studied the effects of the trisaccharide epitope on CD8 T cell responses that are directed specifically to vector-encoded transgenic antigens. For that, covalently αGal-decorated adenovirus vectors were delivered to anti-Gal α-1,3-galactosyltransferase knockout mice. We generated replication-defective, E1-deleted adenovirus type 5 vectors that were decorated with αGal at the hexon hypervariable regions 1 or 5, at fiber knob, or at penton base. Surprisingly, none of the adenovirus immunocomplexes being formed from αGal-decorated adenovirus vectors and anti-Gal immunoglobulins improved the frequencies of CD8 T cell responses against the transgenic antigen ovalbumin. Humoral immunity directed to the adenovirus vector was neither increased. However, our data indicated that decoration of Ad vectors with the αGal epitope is a powerful tool to analyze the fate of adenovirus immunocomplexes in vivo.

  1. Adaptive bi-level programming for optimal gene knockouts for targeted overproduction under phenotypic constraints

    PubMed Central

    2013-01-01

    Background Optimization procedures to identify gene knockouts for targeted biochemical overproduction have been widely in use in modern metabolic engineering. Flux balance analysis (FBA) framework has provided conceptual simplifications for genome-scale dynamic analysis at steady states. Based on FBA, many current optimization methods for targeted bio-productions have been developed under the maximum cell growth assumption. The optimization problem to derive gene knockout strategies recently has been formulated as a bi-level programming problem in OptKnock for maximum targeted bio-productions with maximum growth rates. However, it has been shown that knockout mutants in fact reach the steady states with the minimization of metabolic adjustment (MOMA) from the corresponding wild-type strains instead of having maximal growth rates after genetic or metabolic intervention. In this work, we propose a new bi-level computational framework--MOMAKnock--which can derive robust knockout strategies under the MOMA flux distribution approximation. Methods In this new bi-level optimization framework, we aim to maximize the production of targeted chemicals by identifying candidate knockout genes or reactions under phenotypic constraints approximated by the MOMA assumption. Hence, the targeted chemical production is the primary objective of MOMAKnock while the MOMA assumption is formulated as the inner problem of constraining the knockout metabolic flux to be as close as possible to the steady-state phenotypes of wide-type strains. As this new inner problem becomes a quadratic programming problem, a novel adaptive piecewise linearization algorithm is developed in this paper to obtain the exact optimal solution to this new bi-level integer quadratic programming problem for MOMAKnock. Results Our new MOMAKnock model and the adaptive piecewise linearization solution algorithm are tested with a small E. coli core metabolic network and a large-scale iAF1260 E. coli metabolic network. The derived knockout strategies are compared with those from OptKnock. Our preliminary experimental results show that MOMAKnock can provide improved targeted productions with more robust knockout strategies. PMID:23368729

  2. Adaptive bi-level programming for optimal gene knockouts for targeted overproduction under phenotypic constraints.

    PubMed

    Ren, Shaogang; Zeng, Bo; Qian, Xiaoning

    2013-01-01

    Optimization procedures to identify gene knockouts for targeted biochemical overproduction have been widely in use in modern metabolic engineering. Flux balance analysis (FBA) framework has provided conceptual simplifications for genome-scale dynamic analysis at steady states. Based on FBA, many current optimization methods for targeted bio-productions have been developed under the maximum cell growth assumption. The optimization problem to derive gene knockout strategies recently has been formulated as a bi-level programming problem in OptKnock for maximum targeted bio-productions with maximum growth rates. However, it has been shown that knockout mutants in fact reach the steady states with the minimization of metabolic adjustment (MOMA) from the corresponding wild-type strains instead of having maximal growth rates after genetic or metabolic intervention. In this work, we propose a new bi-level computational framework--MOMAKnock--which can derive robust knockout strategies under the MOMA flux distribution approximation. In this new bi-level optimization framework, we aim to maximize the production of targeted chemicals by identifying candidate knockout genes or reactions under phenotypic constraints approximated by the MOMA assumption. Hence, the targeted chemical production is the primary objective of MOMAKnock while the MOMA assumption is formulated as the inner problem of constraining the knockout metabolic flux to be as close as possible to the steady-state phenotypes of wide-type strains. As this new inner problem becomes a quadratic programming problem, a novel adaptive piecewise linearization algorithm is developed in this paper to obtain the exact optimal solution to this new bi-level integer quadratic programming problem for MOMAKnock. Our new MOMAKnock model and the adaptive piecewise linearization solution algorithm are tested with a small E. coli core metabolic network and a large-scale iAF1260 E. coli metabolic network. The derived knockout strategies are compared with those from OptKnock. Our preliminary experimental results show that MOMAKnock can provide improved targeted productions with more robust knockout strategies.

  3. Limitations to the development of recombinant human embryonic kidney 293E cells using glutamine synthetase-mediated gene amplification: Methionine sulfoximine resistance.

    PubMed

    Yu, Da Young; Noh, Soo Min; Lee, Gyun Min

    2016-08-10

    To investigate the feasibility of glutamine synthetase (GS)-mediated gene amplification in HEK293 cells for the high-level stable production of therapeutic proteins, HEK293E cells were transfected by the GS expression vector containing antibody genes and were selected at various methionine sulfoximine (MSX) concentrations in 96-well plates. For a comparison, CHOK1 cells were transfected by the same GS expression vector and selected at various MSX concentrations. Unlike CHOK1 cells, HEK293E cells producing high levels of antibodies were not selected at all. For HEK293E cells, the number of wells with the cell pool did not decrease with an increase in the concentration of MSX up to 500μM MSX. A q-RT-PCR analysis confirmed that the antibody genes in the HEK293E cells, unlike the CHOK1 cells, were not amplified after increasing the MSX concentration. It was found that the GS activity in HEK293E cells was much higher than that in CHOK1 cells (P<0.05). In a glutamine-free medium, the GS activity of HEK293E cells was approximately 4.8 times higher than that in CHOK1 cells. Accordingly, it is inferred that high GS activity of HEK293E cells results in elevated resistance to MSX and therefore hampers GS-mediated gene amplification by MSX. Thus, in order to apply the GS-mediated gene amplification system to HEK293 cells, the endogenous GS expression level in HEK293 cells needs to be minimized by knock-out or down-regulation methods. Copyright © 2016 Elsevier B.V. All rights reserved.

  4. Development of a Markerless Knockout Method for Actinobacillus succinogenes

    PubMed Central

    Joshi, Rajasi V.; Schindler, Bryan D.; McPherson, Nikolas R.; Tiwari, Kanupriya

    2014-01-01

    Actinobacillus succinogenes is one of the best natural succinate-producing organisms, but it still needs engineering to further increase succinate yield and productivity. In this study, we developed a markerless knockout method for A. succinogenes using natural transformation or electroporation. The Escherichia coli isocitrate dehydrogenase gene with flanking flippase recognition target sites was used as the positive selection marker, making use of A. succinogenes's auxotrophy for glutamate to select for growth on isocitrate. The Saccharomyces cerevisiae flippase recombinase (Flp) was used to remove the selection marker, allowing its reuse. Finally, the plasmid expressing flp was cured using acridine orange. We demonstrate that at least two consecutive deletions can be introduced into the same strain using this approach, that no more than a total of 1 kb of DNA is needed on each side of the selection cassette to protect from exonuclease activity during transformation, and that no more than 200 bp of homologous DNA is needed on each side for efficient recombination. We also demonstrate that electroporation can be used as an alternative transformation method to obtain knockout mutants and that an enriched defined medium can be used for direct selection of knockout mutants on agar plates with high efficiency. Single-knockout mutants of the fumarate reductase and of the pyruvate formate lyase-encoding genes were obtained using this knockout strategy. Double-knockout mutants were also obtained by deleting the citrate lyase-, β-galactosidase-, and aconitase-encoding genes in the pyruvate formate lyase knockout mutant strain. PMID:24610845

  5. Development of a markerless knockout method for Actinobacillus succinogenes.

    PubMed

    Joshi, Rajasi V; Schindler, Bryan D; McPherson, Nikolas R; Tiwari, Kanupriya; Vieille, Claire

    2014-05-01

    Actinobacillus succinogenes is one of the best natural succinate-producing organisms, but it still needs engineering to further increase succinate yield and productivity. In this study, we developed a markerless knockout method for A. succinogenes using natural transformation or electroporation. The Escherichia coli isocitrate dehydrogenase gene with flanking flippase recognition target sites was used as the positive selection marker, making use of A. succinogenes's auxotrophy for glutamate to select for growth on isocitrate. The Saccharomyces cerevisiae flippase recombinase (Flp) was used to remove the selection marker, allowing its reuse. Finally, the plasmid expressing flp was cured using acridine orange. We demonstrate that at least two consecutive deletions can be introduced into the same strain using this approach, that no more than a total of 1 kb of DNA is needed on each side of the selection cassette to protect from exonuclease activity during transformation, and that no more than 200 bp of homologous DNA is needed on each side for efficient recombination. We also demonstrate that electroporation can be used as an alternative transformation method to obtain knockout mutants and that an enriched defined medium can be used for direct selection of knockout mutants on agar plates with high efficiency. Single-knockout mutants of the fumarate reductase and of the pyruvate formate lyase-encoding genes were obtained using this knockout strategy. Double-knockout mutants were also obtained by deleting the citrate lyase-, β-galactosidase-, and aconitase-encoding genes in the pyruvate formate lyase knockout mutant strain.

  6. Protein phosphatase 2ACα gene knock-out results in cortical atrophy through activating hippo cascade in neuronal progenitor cells.

    PubMed

    Liu, Bo; Sun, Li-Hua; Huang, Yan-Fei; Guo, Li-Jun; Luo, Li-Shu

    2018-02-01

    Protein phosphatase 2ACα (PP2ACα), a vital member of the protein phosphatase family, has been studied primarily as a regulator for the development, growth and protein synthesis of a lot of cell types. Dysfunction of PP2ACα protein results in neurodegenerative disease; however, this finding has not been directly confirmed in the mouse model with PP2ACα gene knock-out. Therefore, in this study presented here, we generated the PP2ACα gene knock-out mouse model by the Cre-loxP targeting gene system, with the purpose to directly observe the regulatory role of PP2ACα gene in the development of mouse's cerebral cortex. We observe that knocking-out PP2ACα gene in the central nervous system (CNS) results in cortical neuronal shrinkage, synaptic plasticity impairments, and learning/memory deficits. Further study reveals that PP2ACα gene knock-out initiates Hippo cascade in cortical neuroprogenitor cells (NPCs), which blocks YAP translocation into the nuclei of NPCs. Notably, p73, directly targeted by Hippo cascade, can bind to the promoter of glutaminase2 (GLS2) that plays a dominant role in the enzymatic regulation of glutamate/glutamine cycle. Finally, we find that PP2ACα gene knock-out inhibits the glutamine synthesis through up-regulating the activity of phosphorylated-p73 in cortical NPCs. Taken together, it concludes that PP2ACα critically supports cortical neuronal growth and cognitive function via regulating the signaling transduction of Hippo-p73 cascade. And PP2ACα indirectly modulates the glutamine synthesis of cortical NPCs through targeting p73 that plays a direct transcriptional regulatory role in the gene expression of GLS2. Copyright © 2017 Elsevier Ltd. All rights reserved.

  7. RNA interference-based functional knockdown of the voltage-gated potassium channel Kv7.2 in dorsal root ganglion neurons after in vitro and in vivo gene transfer by adeno-associated virus vectors.

    PubMed

    Valdor, Markus; Wagner, Anke; Röhrs, Viola; Berg, Johanna; Fechner, Henry; Schröder, Wolfgang; Tzschentke, Thomas M; Bahrenberg, Gregor; Christoph, Thomas; Kurreck, Jens

    2018-01-01

    Activation of the neuronal potassium channel Kv7.2 encoded by the KCNQ2 gene has recently been shown to be an attractive mechanism to inhibit nociceptive transmission. However, potent, selective, and clinically proven activators of Kv7.2/Kv7.3 currents with analgesic properties are still lacking. An important prerequisite for the development of new drugs is a model to test the selectivity of novel agonists by abrogating Kv7.2/Kv7.3 function. Since constitutive knockout mice are not viable, we developed a model based on RNA interference-mediated silencing of KCNQ2. By delivery of a KCNQ2-specific short hairpin RNA with adeno-associated virus vectors, we completely abolished the activity of the specific Kv7.2/Kv7.3-opener ICA-27243 in rat sensory neurons. Results obtained in the silencing experiments were consistent between freshly prepared and cryopreserved dorsal root ganglion neurons, as well as in dorsal root ganglion neurons dissociated and cultured after in vivo administration of the silencing vector by intrathecal injections into rats. Interestingly, the tested associated virus serotypes substantially differed with respect to their transduction capability in cultured neuronal cell lines and primary dorsal root ganglion neurons and the in vivo transfer of transgenes by intrathecal injection of associated virus vectors. However, our study provides the proof-of-concept that RNA interference-mediated silencing of KCNQ2 is a suitable approach to create an ex vivo model for testing the specificity of novel Kv7.2/Kv7.3 agonists.

  8. In Situ Gene Therapy via AAV-CRISPR-Cas9-Mediated Targeted Gene Regulation.

    PubMed

    Moreno, Ana M; Fu, Xin; Zhu, Jie; Katrekar, Dhruva; Shih, Yu-Ru V; Marlett, John; Cabotaje, Jessica; Tat, Jasmine; Naughton, John; Lisowski, Leszek; Varghese, Shyni; Zhang, Kang; Mali, Prashant

    2018-04-25

    Development of efficacious in vivo delivery platforms for CRISPR-Cas9-based epigenome engineering will be critical to enable the ability to target human diseases without permanent modification of the genome. Toward this, we utilized split-Cas9 systems to develop a modular adeno-associated viral (AAV) vector platform for CRISPR-Cas9 delivery to enable the full spectrum of targeted in situ gene regulation functionalities, demonstrating robust transcriptional repression (up to 80%) and activation (up to 6-fold) of target genes in cell culture and mice. We also applied our platform for targeted in vivo gene-repression-mediated gene therapy for retinitis pigmentosa. Specifically, we engineered targeted repression of Nrl, a master regulator of rod photoreceptor determination, and demonstrated Nrl knockdown mediates in situ reprogramming of rod cells into cone-like cells that are resistant to retinitis pigmentosa-specific mutations, with concomitant prevention of secondary cone loss. Furthermore, we benchmarked our results from Nrl knockdown with those from in vivo Nrl knockout via gene editing. Taken together, our AAV-CRISPR-Cas9 platform for in vivo epigenome engineering enables a robust approach to target disease in a genomically scarless and potentially reversible manner. Copyright © 2018 The American Society of Gene and Cell Therapy. Published by Elsevier Inc. All rights reserved.

  9. CRISPR/Cas9-mediated gene knockout is insensitive to target copy number but is dependent on guide RNA potency and Cas9/sgRNA threshold expression level

    PubMed Central

    Yuen, Garmen; Khan, Fehad J.; Gao, Shaojian; Stommel, Jayne M.; Batchelor, Eric; Wu, Xiaolin

    2017-01-01

    Abstract CRISPR/Cas9 is a powerful gene editing tool for gene knockout studies and functional genomic screens. Successful implementation of CRISPR often requires Cas9 to elicit efficient target knockout in a population of cells. In this study, we investigated the role of several key factors, including variation in target copy number, inherent potency of sgRNA guides, and expression level of Cas9 and sgRNA, in determining CRISPR knockout efficiency. Using isogenic, clonal cell lines with variable copy numbers of an EGFP transgene, we discovered that CRISPR knockout is relatively insensitive to target copy number, but is highly dependent on the potency of the sgRNA guide sequence. Kinetic analysis revealed that most target mutation occurs between 5 and 10 days following Cas9/sgRNA transduction, while sgRNAs with different potencies differ by their knockout time course and by their terminal-phase knockout efficiency. We showed that prolonged, low level expression of Cas9 and sgRNA often fails to elicit target mutation, particularly if the potency of the sgRNA is also low. Our findings provide new insights into the behavior of CRISPR/Cas9 in mammalian cells that could be used for future improvement of this platform. PMID:29036671

  10. CRISPR/Cas9-mediated gene knockout is insensitive to target copy number but is dependent on guide RNA potency and Cas9/sgRNA threshold expression level.

    PubMed

    Yuen, Garmen; Khan, Fehad J; Gao, Shaojian; Stommel, Jayne M; Batchelor, Eric; Wu, Xiaolin; Luo, Ji

    2017-11-16

    CRISPR/Cas9 is a powerful gene editing tool for gene knockout studies and functional genomic screens. Successful implementation of CRISPR often requires Cas9 to elicit efficient target knockout in a population of cells. In this study, we investigated the role of several key factors, including variation in target copy number, inherent potency of sgRNA guides, and expression level of Cas9 and sgRNA, in determining CRISPR knockout efficiency. Using isogenic, clonal cell lines with variable copy numbers of an EGFP transgene, we discovered that CRISPR knockout is relatively insensitive to target copy number, but is highly dependent on the potency of the sgRNA guide sequence. Kinetic analysis revealed that most target mutation occurs between 5 and 10 days following Cas9/sgRNA transduction, while sgRNAs with different potencies differ by their knockout time course and by their terminal-phase knockout efficiency. We showed that prolonged, low level expression of Cas9 and sgRNA often fails to elicit target mutation, particularly if the potency of the sgRNA is also low. Our findings provide new insights into the behavior of CRISPR/Cas9 in mammalian cells that could be used for future improvement of this platform. Published by Oxford University Press on behalf of Nucleic Acids Research 2017.

  11. Hormone Replacement Therapy, Iron, and Breast Cancer

    DTIC Science & Technology

    2005-10-01

    tested in cell culture model systems and in an iron loaded transgenic mouse model. Since iron slowly accumulates due to the mutation of the HFE gene ...murine HFE gene is structurally similar to the human gene . Four different HFE gene disruptions have been reported in the mouse: an exon 4 knockout...Ex3 F Hfe Ex 5 R Figure 1. HFE gene knockout. Huang, X., DAMD-17-03-1-0717 5 mice provided by Dr. Nancy Andrews of the Howard Hughes Medical

  12. Differential gene expression in Ndph-knockout mice in retinal development.

    PubMed

    Schäfer, Nikolaus F; Luhmann, Ulrich F O; Feil, Silke; Berger, Wolfgang

    2009-02-01

    Mutations in the NDP gene impair angiogenesis in the eyes of patients diagnosed with a type of blindness belonging to the group of exudative vitreoretinopathies. This study was conducted to investigate the differential gene expression caused by the absence of Norrin (the NDP protein) in the developing mouse retina and to elucidate early pathogenic events. A comparative gene expression analysis was performed on postnatal day (p)7 retinas from a knockout mouse model for Norrie disease using gene microarrays. Subsequently, results were verified by quantitative real-time PCR analyses. Immunohistochemistry was performed for the vascular permeability marker plasmalemma vesicle associated protein (Plvap). Our study identified expression differences in Ndph(y/-) versus wild-type mice retinas at p7. Gene transcription of the neutral amino acid transporter Slc38a5, apolipoprotein D (ApoD), and angiotensin II receptor-like 1 (Agtrl1) was decreased in the knockout mouse, whereas transcript levels of adrenomedullin (Adm) and of the plasmalemma vesicle associated protein (Plvap) were increased in comparison to the wild-type. In addition, ectopic expression of Plvap was found in the developing retinal vasculature of Norrin-knockout mice on the protein level. These data provide molecular evidence for a role of Norrin in the development of the retinal vasculature. Expression of two genes, Plvap and Slc38a5, is considerably altered in retinal development of Norrin-knockout mice and may reflect or contribute to the pathogenesis of the disease. In particular, ectopic expression of Plvap is consistent with hallmark disease symptoms in mice and humans.

  13. SAMHD1 knockout mice: modeling retrovirus restriction in vivo.

    PubMed

    Wu, Li

    2013-11-20

    The host dNTP hydrolase SAMHD1 acts as a viral restriction factor to inhibit the replication of several retroviruses and DNA viruses in non-cycling human immune cells. However, understanding the physiological role of mammalian SAMHD1 has been elusive due to the lack of an animal model. Two recent studies reported the generation of samhd1 knockout mouse models for investigating the restriction of HIV-1 vectors and endogenous retroviruses in vivo. Both studies suggest that SAMHD1 is important for regulating the intracellular dNTP pool and the intrinsic immunity against retroviral infection, despite different outcomes of HIV-1 vector transduction in these mouse models. Here I discuss the significance of these new findings and the future directions in studying SAMHD1-mediated retroviral restriction.

  14. Production of α1,3-galactosyltransferase and cytidine monophosphate-N-acetylneuraminic acid hydroxylase gene double-deficient pigs by CRISPR/Cas9 and handmade cloning.

    PubMed

    Gao, Hanchao; Zhao, Chengjiang; Xiang, Xi; Li, Yong; Zhao, Yanli; Li, Zesong; Pan, Dengke; Dai, Yifan; Hara, Hidetaka; Cooper, David K C; Cai, Zhiming; Mou, Lisha

    2017-02-16

    Gene-knockout pigs hold great promise as a solution to the shortage of organs from donor animals for xenotransplantation. Several groups have generated gene-knockout pigs via clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR-associated 9 (Cas9) and somatic cell nuclear transfer (SCNT). Herein, we adopted a simple and micromanipulator-free method, handmade cloning (HMC) instead of SCNT, to generate double gene-knockout pigs. First, we applied the CRISPR/Cas9 system to target α1,3-galactosyltransferase (GGTA1) and cytidine monophosphate-N-acetylneuraminic acid hydroxylase (CMAH) genes simultaneously in porcine fetal fibroblast cells (PFFs), which were derived from wild-type Chinese domestic miniature Wuzhishan pigs. Cell colonies were obtained by screening and were identified by Surveyor assay and sequencing. Next, we chose the GGTA1/CMAH double-knockout (DKO) cells for HMC to produce piglets. As a result, we obtained 11 live bi-allelic GGTA1/CMAH DKO piglets with the identical phenotype. Compared to cells from GGTA1-knockout pigs, human antibody binding and antibody-mediated complement-dependent cytotoxicity were significantly reduced in cells from GGTA1/CMAH DKO pigs, which demonstrated that our pigs would exhibit reduced humoral rejection in xenotransplantation. These data suggested that the combination of CRISPR/Cas9 and HMC technology provided an efficient and new strategy for producing pigs with multiple genetic modifications.

  15. Transgenic and gene knockout mice in gastric cancer research

    PubMed Central

    Jiang, Yannan; Yu, Yingyan

    2017-01-01

    Mouse models are useful tool for carcinogenic study. They will greatly enrich the understanding of pathogenesis and molecular mechanisms for gastric cancer. However, only few of mice could develop gastric cancer spontaneously. With the development and improvement of gene transfer technology, investigators created a variety of transgenic and knockout/knockin mouse models of gastric cancer, such as INS-GAS mice and gastrin knockout mice. Combined with helicobacter infection and carcinogens treatment, these transgenic/knockout/knockin mice developed precancerous or cancerous lesions, which are proper for gene function study or experimental therapy. Here we review the progression of genetically engineered mouse models on gastric cancer research, and emphasize the effects of chemical carcinogens or infectious factors on carcinogenesis of genetically modified mouse. We also emphasize the histological examination on mouse stomach. We expect to provide researchers with some inspirations on this field. PMID:27713138

  16. MONOAMINE OXIDASE: From Genes to Behavior

    PubMed Central

    Shih, J. C.; Chen, K.; Ridd, M. J.

    2010-01-01

    Cloning of MAO (monoamine oxidase) A and B has demonstrated unequivocally that these enzymes are made up of different polypeptides, and our understanding of MAO structure, regulation, and function has been significantly advanced by studies using their cDNA. MAO A and B genes are located on the X-chromosome (Xp11.23) and comprise 15 exons with identical intron-exon organization, which suggests that they are derived from the same ancestral gene. MAO A and B knockout mice exhibit distinct differences in neurotransmitter metabolism and behavior. MAO A knock-out mice have elevated brain levels of serotonin, norephinephrine, and dopamine and manifest aggressive behavior similar to human males with a deletion of MAO A. In contrast, MAO B knock-out mice do not exhibit aggression and only levels of phenylethylamine are increased. Mice lacking MAO B are resistant to the Parkinsongenic neurotoxin, 1-methyl-4-phenyl-1,2,3,6-tetra-hydropyridine. Both MAO A and B knock-out mice show increased reactivity to stress. These knock-out mice are valuable models for investigating the role of monoamines in psychoses and neurodegenerative and stress-related disorders. PMID:10202537

  17. CRISPR/Cas9-mediated efficient genome editing via blastospore-based transformation in entomopathogenic fungus Beauveria bassiana.

    PubMed

    Chen, Jingjing; Lai, Yiling; Wang, Lili; Zhai, Suzhen; Zou, Gen; Zhou, Zhihua; Cui, Chunlai; Wang, Sibao

    2017-04-03

    Beauveria bassiana is an environmentally friendly alternative to chemical insecticides against various agricultural insect pests and vectors of human diseases. However, its application has been limited due to slow kill and sensitivity to abiotic stresses. Understanding of the molecular pathogenesis and physiological characteristics would facilitate improvement of the fungal performance. Loss-of-function mutagenesis is the most powerful tool to characterize gene functions, but it is hampered by the low rate of homologous recombination and the limited availability of selectable markers. Here, by combining the use of uridine auxotrophy as recipient and donor DNAs harboring auxotrophic complementation gene ura5 as a selectable marker with the blastospore-based transformation system, we established a highly efficient, low false-positive background and cost-effective CRISPR/Cas9-mediated gene editing system in B. bassiana. This system has been demonstrated as a simple and powerful tool for targeted gene knock-out and/or knock-in in B. bassiana in a single gene disruption. We further demonstrated that our system allows simultaneous disruption of multiple genes via homology-directed repair in a single transformation. This technology will allow us to study functionally redundant genes and holds significant potential to greatly accelerate functional genomics studies of B. bassiana.

  18. CRISPR/Cas9-mediated efficient genome editing via blastospore-based transformation in entomopathogenic fungus Beauveria bassiana

    PubMed Central

    Chen, Jingjing; Lai, Yiling; Wang, Lili; Zhai, Suzhen; Zou, Gen; Zhou, Zhihua; Cui, Chunlai; Wang, Sibao

    2017-01-01

    Beauveria bassiana is an environmentally friendly alternative to chemical insecticides against various agricultural insect pests and vectors of human diseases. However, its application has been limited due to slow kill and sensitivity to abiotic stresses. Understanding of the molecular pathogenesis and physiological characteristics would facilitate improvement of the fungal performance. Loss-of-function mutagenesis is the most powerful tool to characterize gene functions, but it is hampered by the low rate of homologous recombination and the limited availability of selectable markers. Here, by combining the use of uridine auxotrophy as recipient and donor DNAs harboring auxotrophic complementation gene ura5 as a selectable marker with the blastospore-based transformation system, we established a highly efficient, low false-positive background and cost-effective CRISPR/Cas9-mediated gene editing system in B. bassiana. This system has been demonstrated as a simple and powerful tool for targeted gene knock-out and/or knock-in in B. bassiana in a single gene disruption. We further demonstrated that our system allows simultaneous disruption of multiple genes via homology-directed repair in a single transformation. This technology will allow us to study functionally redundant genes and holds significant potential to greatly accelerate functional genomics studies of B. bassiana. PMID:28368054

  19. Systemic correction of the muscle disorder glycogen storage disease type II after hepatic targeting of a modified adenovirus vector encoding human acid-α-glucosidase

    PubMed Central

    Amalfitano, A.; McVie-Wylie, A. J.; Hu, H.; Dawson, T. L.; Raben, N.; Plotz, P.; Chen, Y. T.

    1999-01-01

    This report demonstrates that a single intravenous administration of a gene therapy vector can potentially result in the correction of all affected muscles in a mouse model of a human genetic muscle disease. These results were achieved by capitalizing both on the positive attributes of modified adenovirus-based vectoring systems and receptor-mediated lysosomal targeting of enzymes. The muscle disease treated, glycogen storage disease type II, is a lysosomal storage disorder that manifests as a progressive myopathy, secondary to massive glycogen accumulations in the skeletal and/or cardiac muscles of affected individuals. We demonstrated that a single intravenous administration of a modified Ad vector encoding human acid α-glucosidase (GAA) resulted in efficient hepatic transduction and secretion of high levels of the precursor GAA proenzyme into the plasma of treated animals. Subsequently, systemic distribution and uptake of the proenzyme into the skeletal and cardiac muscles of the GAA-knockout mouse was confirmed. As a result, systemic decreases (and correction) of the glycogen accumulations in a variety of muscle tissues was demonstrated. This model can potentially be expanded to include the treatment of other lysosomal enzyme disorders. Lessons learned from systemic genetic therapy of muscle disorders also should have implications for other muscle diseases, such as the muscular dystrophies. PMID:10430861

  20. Modeling correction of severe urea cycle defects in the growing murine liver using a hybrid recombinant adeno-associated virus/piggyBac transposase gene delivery system.

    PubMed

    Cunningham, Sharon C; Siew, Susan M; Hallwirth, Claus V; Bolitho, Christine; Sasaki, Natsuki; Garg, Gagan; Michael, Iacovos P; Hetherington, Nicola A; Carpenter, Kevin; de Alencastro, Gustavo; Nagy, Andras; Alexander, Ian E

    2015-08-01

    Liver-targeted gene therapy based on recombinant adeno-associated viral vectors (rAAV) shows promising therapeutic efficacy in animal models and adult-focused clinical trials. This promise, however, is not directly translatable to the growing liver, where high rates of hepatocellular proliferation are accompanied by loss of episomal rAAV genomes and subsequently a loss in therapeutic efficacy. We have developed a hybrid rAAV/piggyBac transposon vector system combining the highly efficient liver-targeting properties of rAAV with stable piggyBac-mediated transposition of the transgene into the hepatocyte genome. Transposition efficiency was first tested using an enhanced green fluorescent protein expression cassette following delivery to newborn wild-type mice, with a 20-fold increase in stably gene-modified hepatocytes observed 4 weeks posttreatment compared to traditional rAAV gene delivery. We next modeled the therapeutic potential of the system in the context of severe urea cycle defects. A single treatment in the perinatal period was sufficient to confer robust and stable phenotype correction in the ornithine transcarbamylase-deficient Spf(ash) mouse and the neonatal lethal argininosuccinate synthetase knockout mouse. Finally, transposon integration patterns were analyzed, revealing 127,386 unique integration sites which conformed to previously published piggyBac data. Using a hybrid rAAV/piggyBac transposon vector system, we achieved stable therapeutic protection in two urea cycle defect mouse models; a clinically conceivable early application of this technology in the management of severe urea cycle defects could be as a bridging therapy while awaiting liver transplantation; further improvement of the system will result from the development of highly human liver-tropic capsids, the use of alternative strategies to achieve transient transposase expression, and engineered refinements in the safety profile of piggyBac transposase-mediated integration. © 2015 by the American Association for the Study of Liver Diseases.

  1. The groEL2 gene, but not groEL1, is required for biosynthesis of the secondary metabolite myxovirescin in Myxococcus xanthus DK1622.

    PubMed

    Wang, Yan; Li, Xi; Zhang, Wenyan; Zhou, Xiuwen; Li, Yue-zhong

    2014-03-01

    Myxococcus xanthus DK1622 possesses two copies of the groEL gene: groEL1, which participates in development, and groEL2, which is involved in the predatory ability of cells. In this study, we determined that the groEL2 gene is required for the biosynthesis of the secondary metabolite myxovirescin (TA), which plays essential roles in predation. The groEL2-knockout mutant strain was defective in producing a zone of inhibition and displayed decreased killing ability against Escherichia coli, while the groEL1-knockout mutant strain exhibited little difference from the wild-type strain DK1622. HPLC revealed that deletion of the groEL2 gene blocked the production of TA, which was present in the groEL1-knockout mutant. The addition of exogenous TA rescued the inhibition and killing abilities of the groEL2-knockout mutant against E. coli. Analysis of GroEL domain-swapping mutants indicated that the C-terminal equatorial domain of GroEL2 was essential for TA production, while the N-terminal equatorial or apical domains of GroEL2 were not sufficient to rescue TA production of the groEL2 knockout.

  2. The role of nuclear factor E2-Related factor 2 and uncoupling protein 2 in glutathione metabolism: Evidence from an in vivo gene knockout study.

    PubMed

    Chen, Yanyan; Xu, Yuanyuan; Zheng, Hongzhi; Fu, Jingqi; Hou, Yongyong; Wang, Huihui; Zhang, Qiang; Yamamoto, Masayuki; Pi, Jingbo

    2016-09-09

    Nuclear factor E2-related factor 2 (NRF2) and uncoupling protein 2 (UCP2) are indicated to protect from oxidative stress. They also play roles in the homeostasis of glutathione. However, the detailed mechanisms are not well understood. In the present study, we found Nrf2-knockout (Nrf2-KO) mice exhibited altered glutathione homeostasis and reduced expression of various genes involved in GSH biosynthesis, regeneration, utilization and transport in the liver. Ucp2-knockout (Ucp2-KO) mice exhibited altered glutathione homeostasis in the liver, spleen and blood, as well as increased transcript of cystic fibrosis transmembrane conductance regulator in the liver, a protein capable of mediating glutathione efflux. Nrf2-Ucp2-double knockout (DKO) mice showed characteristics of both Nrf2-KO and Ucp2-KO mice. But no significant difference was observed in DKO mice when compared with Nrf2-KO or Ucp2-KO mice, except in blood glutathione levels. These data suggest that ablation of Nrf2 and Ucp2 leads to disrupted GSH balance, which could result from altered expression of genes involved in GSH metabolism. DKO may not evoke more severe oxidative stress than the single gene knockout. Copyright © 2016 Elsevier Inc. All rights reserved.

  3. Acute multi-sgRNA knockdown of KEOPS complex genes reproduces the microcephaly phenotype of the stable knockout zebrafish model.

    PubMed

    Jobst-Schwan, Tilman; Schmidt, Johanna Magdalena; Schneider, Ronen; Hoogstraten, Charlotte A; Ullmann, Jeremy F P; Schapiro, David; Majmundar, Amar J; Kolb, Amy; Eddy, Kaitlyn; Shril, Shirlee; Braun, Daniela A; Poduri, Annapurna; Hildebrandt, Friedhelm

    2018-01-01

    Until recently, morpholino oligonucleotides have been widely employed in zebrafish as an acute and efficient loss-of-function assay. However, off-target effects and reproducibility issues when compared to stable knockout lines have compromised their further use. Here we employed an acute CRISPR/Cas approach using multiple single guide RNAs targeting simultaneously different positions in two exemplar genes (osgep or tprkb) to increase the likelihood of generating mutations on both alleles in the injected F0 generation and to achieve a similar effect as morpholinos but with the reproducibility of stable lines. This multi single guide RNA approach resulted in median likelihoods for at least one mutation on each allele of >99% and sgRNA specific insertion/deletion profiles as revealed by deep-sequencing. Immunoblot showed a significant reduction for Osgep and Tprkb proteins. For both genes, the acute multi-sgRNA knockout recapitulated the microcephaly phenotype and reduction in survival that we observed previously in stable knockout lines, though milder in the acute multi-sgRNA knockout. Finally, we quantify the degree of mutagenesis by deep sequencing, and provide a mathematical model to quantitate the chance for a biallelic loss-of-function mutation. Our findings can be generalized to acute and stable CRISPR/Cas targeting for any zebrafish gene of interest.

  4. Target sequencing and CRISPR/Cas editing reveal simultaneous loss of UTX and UTY in urothelial bladder cancer.

    PubMed

    Ahn, Jinwoo; Kim, Kwang Hyun; Park, Sanghui; Ahn, Young-Ho; Kim, Ha Young; Yoon, Hana; Lee, Ji Hyun; Bang, Duhee; Lee, Dong Hyeon

    2016-09-27

    UTX is a histone demethylase gene located on the X chromosome and is a frequently mutated gene in urothelial bladder cancer (UBC). UTY is a paralog of UTX located on the Y chromosome. We performed target capture sequencing on 128 genes in 40 non-metastatic UBC patients. UTX was the most frequently mutated gene (30%, 12/40). Of the genetic alterations identified, 75% were truncating mutations. UTY copy number loss was detected in 8 male patients (22.8%, 8/35). Of the 9 male patients with UTX mutations, 6 also had copy number loss (66.7%). To evaluate the functional roles of UTX and UTY in tumor progression, we designed UTX and UTY single knockout and UTX-UTY double knockout experiments using a CRISPR/Cas9 lentiviral system, and compared the proliferative capacities of two UBC cell lines in vitro. Single UTX or UTY knockout increased cell proliferation as compared to UTX-UTY wild-type cells. UTX-UTY double knockout cells exhibited greater proliferation than single knockout cells. These findings suggest both UTX and UTY function as dose-dependent suppressors of UBC development. While UTX escapes X chromosome inactivation in females, UTY may function as a male homologue of UTX, which could compensate for dosage imbalances.

  5. Knockdown of the bovine prion gene PRNP by RNA interference (RNAi) technology.

    PubMed

    Sutou, Shizuyo; Kunishi, Miho; Kudo, Toshiyuki; Wongsrikeao, Pimprapar; Miyagishi, Makoto; Otoi, Takeshige

    2007-07-26

    Since prion gene-knockout mice do not contract prion diseases and animals in which production of prion protein (PrP) is reduced by half are resistant to the disease, we hypothesized that bovine animals with reduced PrP would be tolerant to BSE. Hence, attempts were made to produce bovine PRNP (bPRNP) that could be knocked down by RNA interference (RNAi) technology. Before an in vivo study, optimal conditions for knocking down bPRNP were determined in cultured mammalian cell systems. Factors examined included siRNA (short interfering RNA) expression plasmid vectors, target sites of PRNP, and lengths of siRNAs. Four siRNA expression plasmid vectors were used: three harboring different cloning sites were driven by the human U6 promoter (hU6), and one by the human tRNAVal promoter. Six target sites of bovine PRNP were designed using an algorithm. From 1 (22 mer) to 9 (19, 20, 21, 22, 23, 24, 25, 27, and 29 mer) siRNA expression vectors were constructed for each target site. As targets of siRNA, the entire bPRNP coding sequence was connected to the reporter gene of the fluorescent EGFP, or of firefly luciferase or Renilla luciferase. Target plasmid DNA was co-transfected with siRNA expression vector DNA into HeLaS3 cells, and fluorescence or luminescence was measured. The activities of siRNAs varied widely depending on the target sites, length of the siRNAs, and vectors used. Longer siRNAs were less effective, and 19 mer or 21 mer was generally optimal. Although 21 mer GGGGAGAACTTCACCGAAACT expressed by a hU6-driven plasmid with a Bsp MI cloning site was best under the present experimental conditions, the corresponding tRNA promoter-driven plasmid was almost equally useful. The effectiveness of this siRNA was confirmed by immunostaining and Western blotting. Four siRNA expression plasmid vectors, six target sites of bPRNP, and various lengths of siRNAs from 19 mer to 29 mer were examined to establish optimal conditions for knocking down of bPRNP in vitro. The most effective siRNA so far tested was 21 mer GGGGAGAACTTCACCGAAACT driven either by a hU6 or tRNA promoter, a finding that provides a basis for further studies in vivo.

  6. Hepatic changes in metabolic gene expression in old ghrelin and ghrelin receptor knockout mice

    USDA-ARS?s Scientific Manuscript database

    Ghrelin knockout (GKO) and ghrelin receptor (growth hormone secretagogue receptor) knockout (GHSRKO) mice exhibit enhanced insulin sensitivity, but the mechanism is unclear. Insulin sensitivity declines with age and is inversely associated with accumulation of lipid in liver, a key glucoregulatory ...

  7. Predicting effects of structural stress in a genome-reduced model bacterial metabolism

    NASA Astrophysics Data System (ADS)

    Güell, Oriol; Sagués, Francesc; Serrano, M. Ángeles

    2012-08-01

    Mycoplasma pneumoniae is a human pathogen recently proposed as a genome-reduced model for bacterial systems biology. Here, we study the response of its metabolic network to different forms of structural stress, including removal of individual and pairs of reactions and knockout of genes and clusters of co-expressed genes. Our results reveal a network architecture as robust as that of other model bacteria regarding multiple failures, although less robust against individual reaction inactivation. Interestingly, metabolite motifs associated to reactions can predict the propagation of inactivation cascades and damage amplification effects arising in double knockouts. We also detect a significant correlation between gene essentiality and damages produced by single gene knockouts, and find that genes controlling high-damage reactions tend to be expressed independently of each other, a functional switch mechanism that, simultaneously, acts as a genetic firewall to protect metabolism. Prediction of failure propagation is crucial for metabolic engineering or disease treatment.

  8. Embryonic Lethality Due to Arrested Cardiac Development in Psip1/Hdgfrp2 Double-Deficient Mice.

    PubMed

    Wang, Hao; Shun, Ming-Chieh; Dickson, Amy K; Engelman, Alan N

    2015-01-01

    Hepatoma-derived growth factor (HDGF) related protein 2 (HRP2) and lens epithelium-derived growth factor (LEDGF)/p75 are closely related members of the HRP2 protein family. LEDGF/p75 has been implicated in numerous human pathologies including cancer, autoimmunity, and infectious disease. Knockout of the Psip1 gene, which encodes for LEDGF/p75 and the shorter LEDGF/p52 isoform, was previously shown to cause perinatal lethality in mice. The function of HRP2 was by contrast largely unknown. To learn about the role of HRP2 in development, we knocked out the Hdgfrp2 gene, which encodes for HRP2, in both normal and Psip1 knockout mice. Hdgfrp2 knockout mice developed normally and were fertile. By contrast, the double deficient mice died at approximate embryonic day (E) 13.5. Histological examination revealed ventricular septal defect (VSD) associated with E14.5 double knockout embryos. To investigate the underlying molecular mechanism(s), RNA recovered from ventricular tissue was subjected to RNA-sequencing on the Illumina platform. Bioinformatic analysis revealed several genes and biological pathways that were significantly deregulated by the Psip1 knockout and/or Psip1/Hdgfrp2 double knockout. Among the dozen genes known to encode for LEDGF/p75 binding factors, only the expression of Nova1, which encodes an RNA splicing factor, was significantly deregulated by the knockouts. However the expression of other RNA splicing factors, including the LEDGF/p52-interacting protein ASF/SF2, was not significantly altered, indicating that deregulation of global RNA splicing was not a driving factor in the pathology of the VSD. Tumor growth factor (Tgf) β-signaling, which plays a key role in cardiac morphogenesis during development, was the only pathway significantly deregulated by the double knockout as compared to control and Psip1 knockout samples. We accordingly speculate that deregulated Tgf-β signaling was a contributing factor to the VSD and prenatal lethality of Psip1/Hdgfrp2 double-deficient mice.

  9. Different Effects of sgRNA Length on CRISPR-mediated Gene Knockout Efficiency.

    PubMed

    Zhang, Jian-Ping; Li, Xiao-Lan; Neises, Amanda; Chen, Wanqiu; Hu, Lin-Ping; Ji, Guang-Zhen; Yu, Jun-Yao; Xu, Jing; Yuan, Wei-Ping; Cheng, Tao; Zhang, Xiao-Bing

    2016-06-24

    CRISPR-Cas9 is a powerful genome editing technology, yet with off-target effects. Truncated sgRNAs (17nt) have been found to decrease off-target cleavage without affecting on-target disruption in 293T cells. However, the potency of 17nt sgRNAs relative to the full-length 20nt sgRNAs in stem cells, such as human mesenchymal stem cells (MSCs) and induced pluripotent stem cells (iPSCs), has not been assessed. Using a GFP reporter system, we found that both 17nt and 20nt sgRNAs expressed by lentiviral vectors induce ~95% knockout (KO) in 293T cells, whereas the KO efficiencies are significantly lower in iPSCs (60-70%) and MSCs (65-75%). Furthermore, we observed a decrease of 10-20 percentage points in KO efficiency with 17nt sgRNAs compared to full-length sgRNAs in both iPSCs and MSCs. Off-target cleavage was observed in 17nt sgRNAs with 1-2nt but not 3-4nt mismatches; whereas 20nt sgRNAs with up to 5nt mismatches can still induce off-target mutations. Of interest, we occasionally observed off-target effects induced by the 17nt but not the 20nt sgRNAs. These results indicate the importance of balancing on-target gene cleavage potency with off-target effects: when efficacy is a major concern such as genome editing in stem cells, the use of 20nt sgRNAs is preferable.

  10. Genome and epigenome engineering CRISPR toolkit for in vivo modulation of cis-regulatory interactions and gene expression in the chicken embryo.

    PubMed

    Williams, Ruth M; Senanayake, Upeka; Artibani, Mara; Taylor, Gunes; Wells, Daniel; Ahmed, Ahmed Ashour; Sauka-Spengler, Tatjana

    2018-02-23

    CRISPR/Cas9 genome engineering has revolutionised all aspects of biological research, with epigenome engineering transforming gene regulation studies. Here, we present an optimised, adaptable toolkit enabling genome and epigenome engineering in the chicken embryo, and demonstrate its utility by probing gene regulatory interactions mediated by neural crest enhancers. First, we optimise novel efficient guide-RNA mini expression vectors utilising chick U6 promoters, provide a strategy for rapid somatic gene knockout and establish a protocol for evaluation of mutational penetrance by targeted next-generation sequencing. We show that CRISPR/Cas9-mediated disruption of transcription factors causes a reduction in their cognate enhancer-driven reporter activity. Next, we assess endogenous enhancer function using both enhancer deletion and nuclease-deficient Cas9 (dCas9) effector fusions to modulate enhancer chromatin landscape, thus providing the first report of epigenome engineering in a developing embryo. Finally, we use the synergistic activation mediator (SAM) system to activate an endogenous target promoter. The novel genome and epigenome engineering toolkit developed here enables manipulation of endogenous gene expression and enhancer activity in chicken embryos, facilitating high-resolution analysis of gene regulatory interactions in vivo . © 2018. Published by The Company of Biologists Ltd.

  11. Innate responses to gene knockouts impact overlapping gene networks and vary with respect to resistance to viral infection.

    PubMed

    Liu, Yonghong; Liu, Yuanyuan; Wu, Jiaming; Roizman, Bernard; Zhou, Grace Guoying

    2018-04-03

    Analyses of the levels of mRNAs encoding IFIT1, IFI16, RIG-1, MDA5, CXCL10, LGP2, PUM1, LSD1, STING, and IFNβ in cell lines from which the gene encoding LGP2, LSD1, PML, HDAC4, IFI16, PUM1, STING, MDA5, IRF3, or HDAC 1 had been knocked out, as well as the ability of these cell lines to support the replication of HSV-1, revealed the following: ( i ) Cell lines lacking the gene encoding LGP2, PML, or HDAC4 (cluster 1) exhibited increased levels of expression of partially overlapping gene networks. Concurrently, these cell lines produced from 5 fold to 12 fold lower yields of HSV-1 than the parental cells. ( ii ) Cell lines lacking the genes encoding STING, LSD1, MDA5, IRF3, or HDAC 1 (cluster 2) exhibited decreased levels of mRNAs of partially overlapping gene networks. Concurrently, these cell lines produced virus yields that did not differ from those produced by the parental cell line. The genes up-regulated in cell lines forming cluster 1, overlapped in part with genes down-regulated in cluster 2. The key conclusions are that gene knockouts and subsequent selection for growth causes changes in expression of multiple genes, and hence the phenotype of the cell lines cannot be ascribed to a single gene; the patterns of gene expression may be shared by multiple knockouts; and the enhanced immunity to viral replication by cluster 1 knockout cell lines but not by cluster 2 cell lines suggests that in parental cells, the expression of innate resistance to infection is specifically repressed.

  12. Survival Advantage of Neonatal CNS Gene Transfer for Late Infantile Neuronal Ceroid Lipofuscinosis

    PubMed Central

    Sondhi, Dolan; Peterson, Daniel A.; Edelstein, Andrew M.; del Fierro, Katrina; Hackett, Neil R.; Crystal, Ronald G.

    2009-01-01

    Summary Late infantile neuronal ceroid lipofuscinosis (LINCL), a fatal autosomal recessive neurodegenerative lysosomal storage disorder of childhood, is caused by mutations in the CLN2 gene, resulting in deficiency of the protein tripeptidyl peptidase I (TPP-I). We have previously shown that direct CNS administration of AAVrh.10hCLN2 to adult CLN2 knockout mice, a serotype rh.10 adeno-associated virus expressing the wild type CLN2 cDNA, will partially improve neurological function and survival. In this study, we explore the hypothesis that administration of AAVrh.10hCLN2 to the neonatal brain will significantly improve the results of AAVrh.10hCLN2 therapy. To assess this concept, AAVrh.10hCLN2 vector was administered directly to the CNS of CLN2 knockout mice at 2 days, 3 wk and 7 wk of age. While all treatment groups show a marked increase in total TPP-I activity over wild-type mice, neonatally treated mice displayed high levels of TPP-I activity in the CNS 1 yr after administration which was spread throughout the brain. Using behavioral markers, 2 day treated mice demonstrate marked improvement over 3 wk, 7 wk or untreated mice. Finally, neonatal administration of AAVrh.10hCLN2 was associated with markedly enhanced survival, with a median time of death 376 days for neonatal treated mice, 277 days for 3 wk treated mice, 168 days for 7 wk treated mice, and 121 days for untreated mice. These data suggest that neonatal treatment offers many unique advantages, and that early detection and treatment may be essential for maximal gene therapy for childhood lysosomal storage disorders affecting the CNS. PMID:18639872

  13. Highly efficient generation of GGTA1 biallelic knockout inbred mini-pigs with TALENs.

    PubMed

    Xin, Jige; Yang, Huaqiang; Fan, Nana; Zhao, Bentian; Ouyang, Zhen; Liu, Zhaoming; Zhao, Yu; Li, Xiaoping; Song, Jun; Yang, Yi; Zou, Qingjian; Yan, Quanmei; Zeng, Yangzhi; Lai, Liangxue

    2013-01-01

    Inbred mini-pigs are ideal organ donors for future human xenotransplantations because of their clear genetic background, high homozygosity, and high inbreeding endurance. In this study, we chose fibroblast cells from a highly inbred pig line called Banna mini-pig inbred line (BMI) as donor nuclei for nuclear transfer, combining with transcription activator-like effector nucleases (TALENs) and successfully generated α-1,3-galactosyltransferase (GGTA1) gene biallelic knockout (KO) pigs. To validate the efficiency of TALEN vectors, in vitro-transcribed TALEN mRNAs were microinjected into one-cell stage parthenogenetically activated porcine embryos. The efficiency of indel mutations at the GGTA1-targeting loci was as high as 73.1% (19/26) among the parthenogenetic blastocysts. TALENs were co-transfected into porcine fetal fibroblasts of BMI with a plasmid containing neomycin gene. The targeting efficiency reached 89.5% (187/209) among the survived cell clones after a 10 d selection. More remarkably 27.8% (58/209) of colonies were biallelic KO. Five fibroblast cell lines with biallelic KO were chosen as nuclear donors for somatic cell nuclear transfer (SCNT). Three miniature piglets with biallelic mutations of the GGTA1 gene were achieved. Gal epitopes on the surface of cells from all the three biallelic KO piglets were completely absent. The fibroblasts from the GGTA1 null piglets were more resistant to lysis by pooled complement-preserved normal human serum than those from wild-type pigs. These results indicate that a combination of TALENs technology with SCNT can generate biallelic KO pigs directly with high efficiency. The GGTA1 null piglets with inbred features created in this study can provide a new organ source for xenotransplantation research.

  14. Overexpression of 3β-hydroxysteroid dehydrogenases/C-4 decarboxylases causes growth defects possibly due to abnormal auxin transport in Arabidopsis.

    PubMed

    Kim, Bokyung; Kim, Gyusik; Fujioka, Shozo; Takatsuto, Suguru; Choe, Sunghwa

    2012-07-01

    Sterols play crucial roles as membrane components and precursors of steroid hormones (e.g., brassinosteroids, BR). Within membranes, sterols regulate membrane permeability and fluidity by interacting with other lipids and proteins. Sterols are frequently enriched in detergent-insoluble membranes (DIMs), which organize molecules involved in specialized signaling processes, including auxin transporters. To be fully functional, the two methyl groups at the C-4 position of cycloartenol, a precursor of plant sterols, must be removed by bifunctional 3β-hydroxysteroid dehydrogenases/C-4 decarboxylases (3βHSD/D). To understand the role of 3βHSD/D in Arabidopsis development, we analyzed the phenotypes of knock-out mutants and overexpression lines of two 3βHSD/D genes (At1g47290 and At2g26260). Neither single nor double knock-out mutants displayed a noticeable phenotype; however, overexpression consistently resulted in plants with wrinkled leaves and short inflorescence internodes. Interestingly, the internode growth defects were opportunistic; even within a plant, some stems were more severely affected than others. Endogenous levels of BRs were not altered in the overexpression lines, suggesting that the growth defect is not primarily due to a flaw in BR biosynthesis. To determine if overexpression of the sterol biosynthetic genes affects the functions of membrane-localized auxin transporters, we subjected plants to the auxin efflux carrier inhibitor, 1-N-naphthylphthalamic acid (NPA). Where-as the gravity vectors of wild-type roots became randomly scattered in response to NPA treatment, those of the overexpression lines continued to grow in the direction of gravity. Overexpression of the two Arabidopsis 3βHSD/D genes thus appears to affect auxin transporter activity, possibly by altering sterol composition in the membranes.

  15. Role of plnB gene in the regulation of bacteriocin production in Lactobacillus paraplantarum L-XM1.

    PubMed

    Zhang, Xiangmei; Shang, Nan; Zhang, Xu; Gui, Meng; Li, Pinglan

    2013-06-12

    Homologues of plnB gene have been shown to participate in regulation of bacteriocin production through quorum sensing system in other organisms, to investigate the possible role of plnB gene in Lactobacillus paraplantarum L-XM1, we cloned and insertionally inactivated the plnB gene. The plnB knockout mutant ΔplnB21 showed loss of bacteriocin production, its Bac⁺ phenotype could not be restored even after the addition of PlnA. Furthermore, reverse transcription-PCR analysis from total RNA preparations showed that the bacteriocin structural genes of the plnEF and plnJK were not transcribed in the plnB knockout mutant compared with the wild-type strain. It was therefore concluded that plnB is invovled in a quorum sensing based bacteriocin production. This is the first demonstration of a role for plnB by gene knockout in L. paraplantarum. Copyright © 2012 Elsevier GmbH. All rights reserved.

  16. Sarcocystis pantherophis, n. sp. from eastern rat snakes (Pantherophis alleghaniensis) definitive hosts and interferongamma gene knockout mice as experimental intermediate hosts

    USDA-ARS?s Scientific Manuscript database

    Here we report a new species, Sarcocystis pantherophisi with the Eastern rat snake (Pantherophis alleghaniensis) as natural definitive host and the interferon gamma gene knockout (KO) mouse as the experimental intermediate host. Sporocysts (n=15) from intestinal contents of the snake were 17.3 x 10....

  17. Acute multi-sgRNA knockdown of KEOPS complex genes reproduces the microcephaly phenotype of the stable knockout zebrafish model

    PubMed Central

    Schneider, Ronen; Hoogstraten, Charlotte A.; Schapiro, David; Majmundar, Amar J.; Kolb, Amy; Eddy, Kaitlyn; Shril, Shirlee; Braun, Daniela A.; Poduri, Annapurna

    2018-01-01

    Until recently, morpholino oligonucleotides have been widely employed in zebrafish as an acute and efficient loss-of-function assay. However, off-target effects and reproducibility issues when compared to stable knockout lines have compromised their further use. Here we employed an acute CRISPR/Cas approach using multiple single guide RNAs targeting simultaneously different positions in two exemplar genes (osgep or tprkb) to increase the likelihood of generating mutations on both alleles in the injected F0 generation and to achieve a similar effect as morpholinos but with the reproducibility of stable lines. This multi single guide RNA approach resulted in median likelihoods for at least one mutation on each allele of >99% and sgRNA specific insertion/deletion profiles as revealed by deep-sequencing. Immunoblot showed a significant reduction for Osgep and Tprkb proteins. For both genes, the acute multi-sgRNA knockout recapitulated the microcephaly phenotype and reduction in survival that we observed previously in stable knockout lines, though milder in the acute multi-sgRNA knockout. Finally, we quantify the degree of mutagenesis by deep sequencing, and provide a mathematical model to quantitate the chance for a biallelic loss-of-function mutation. Our findings can be generalized to acute and stable CRISPR/Cas targeting for any zebrafish gene of interest. PMID:29346415

  18. Rapid construction of a whole-genome transposon insertion collection for Shewanella oneidensis by Knockout Sudoku.

    PubMed

    Baym, Michael; Shaket, Lev; Anzai, Isao A; Adesina, Oluwakemi; Barstow, Buz

    2016-11-10

    Whole-genome knockout collections are invaluable for connecting gene sequence to function, yet traditionally, their construction has required an extraordinary technical effort. Here we report a method for the construction and purification of a curated whole-genome collection of single-gene transposon disruption mutants termed Knockout Sudoku. Using simple combinatorial pooling, a highly oversampled collection of mutants is condensed into a next-generation sequencing library in a single day, a 30- to 100-fold improvement over prior methods. The identities of the mutants in the collection are then solved by a probabilistic algorithm that uses internal self-consistency within the sequencing data set, followed by rapid algorithmically guided condensation to a minimal representative set of mutants, validation, and curation. Starting from a progenitor collection of 39,918 mutants, we compile a quality-controlled knockout collection of the electroactive microbe Shewanella oneidensis MR-1 containing representatives for 3,667 genes that is functionally validated by high-throughput kinetic measurements of quinone reduction.

  19. Genetic cathepsin B deficiency reduces beta-amyloid in transgenic mice expressing human wild-type amyloid precursor protein.

    PubMed

    Hook, Vivian Y H; Kindy, Mark; Reinheckel, Thomas; Peters, Christoph; Hook, Gregory

    2009-08-21

    Neurotoxic beta-amyloid (Abeta) peptides participate in Alzheimer's disease (AD); therefore, reduction of Abeta generated from APP may provide a therapeutic approach for AD. Gene knockout studies in transgenic mice producing human Abeta may identify targets for reducing Abeta. This study shows that knockout of the cathepsin B gene in mice expressing human wild-type APP (hAPPwt) results in substantial decreases in brain Abeta40 and Abeta42 by 67% and decreases in levels of the C-terminal beta-secretase fragment (CTFbeta) derived from APP. In contrast, knockout of cathepsin B in mice expressing hAPP with the rare Swedish (Swe) and Indiana (Ind) mutations had no effect on Abeta. The difference in reduction of Abeta in hAPPwt mice, but not in hAPPSwe/Ind mice, shows that the transgenic model can affect cathepsin B gene knockout results. Since most AD patients express hAPPwt, these data validate cathepsin B as a target for development of inhibitors to lower Abeta in AD.

  20. Predominant role of msr(D) over mef(A) in macrolide resistance in Streptococcus pyogenes.

    PubMed

    Zhang, Yan; Tatsuno, Ichiro; Okada, Ryo; Hata, Nanako; Matsumoto, Masakado; Isaka, Masanori; Isobe, Ken-ichi; Hasegawa, Tadao

    2016-01-01

    In Japan, the number of patients with streptococcal toxic shock syndrome is reported to be increasing. mef(A) gene-positive macrolide-resistant emm1 strains are thought to possibly contribute to the rise in the frequency of STSS. Although analyses of macrolide-resistant mechanisms, including mef(A) resistance, have been performed mainly in Streptococcus pneumoniae, the role of this gene in Streptococcus pyogenes has not been completely investigated. Therefore, to the best of our knowledge, we established the first mef(A)-knockout strain using an emm1-type S. pyogenes strain, and tested its susceptibility to erythromycin, clarithromycin and azithromycin. We found that the antimicrobial susceptibilities were almost identical to those of the parental strain. Hence, we established a knockout strain for another gene, msr(D), that is located immediately downstream of mef(A). The macrolide resistances of the resulting strain significantly decreased, and were further altered when both mef(A) and msr(D) were knocked out. The introduction of the msr(D) gene into a macrolide-sensitive strain conferred more resistance than the introduction of the mef(A) gene. The erythromycin susceptibilities of knockout strains were further dissected using two additional emm4- and emm75-type S. pyogenes strains. We found almost identical results for both strains except for the mef(A) knockout emm4 type, whose susceptibility was altered, although the change was less than that for the msr(D) knockout. These results suggest that both mef(A) and msr(D) are involved in macrolide resistance in S. pyogenes, and that the msr(D) gene plays a more predominant role in macrolide resistance than mef(A).

  1. A critical role for alternative polyadenylation factor CPSF6 in targeting HIV-1 integration to transcriptionally active chromatin

    PubMed Central

    Sowd, Gregory A.; Serrao, Erik; Wang, Hao; Wang, Weifeng; Fadel, Hind J.; Poeschla, Eric M.; Engelman, Alan N.

    2016-01-01

    Integration is vital to retroviral replication and influences the establishment of the latent HIV reservoir. HIV-1 integration favors active genes, which is in part determined by the interaction between integrase and lens epithelium-derived growth factor (LEDGF)/p75. Because gene targeting remains significantly enriched, relative to random in LEDGF/p75 deficient cells, other host factors likely contribute to gene-tropic integration. Nucleoporins 153 and 358, which bind HIV-1 capsid, play comparatively minor roles in integration targeting, but the influence of another capsid binding protein, cleavage and polyadenylation specificity factor 6 (CPSF6), has not been reported. In this study we knocked down or knocked out CPSF6 in parallel or in tandem with LEDGF/p75. CPSF6 knockout changed viral infectivity kinetics, decreased proviral formation, and preferentially decreased integration into transcriptionally active genes, spliced genes, and regions of chromatin enriched in genes and activating histone modifications. LEDGF/p75 depletion by contrast preferentially altered positional integration targeting within gene bodies. Dual factor knockout reduced integration into genes to below the levels observed with either single knockout and revealed that CPSF6 played a more dominant role than LEDGF/p75 in directing integration to euchromatin. CPSF6 complementation rescued HIV-1 integration site distribution in CPSF6 knockout cells, but complementation with a capsid binding mutant of CPSF6 did not. We conclude that integration targeting proceeds via two distinct mechanisms: capsid-CPSF6 binding directs HIV-1 to actively transcribed euchromatin, where the integrase-LEDGF/p75 interaction drives integration into gene bodies. PMID:26858452

  2. Dual gene activation and knockout screen reveals directional dependencies in genetic networks. | Office of Cancer Genomics

    Cancer.gov

    Understanding the direction of information flow is essential for characterizing how genetic networks affect phenotypes. However, methods to find genetic interactions largely fail to reveal directional dependencies. We combine two orthogonal Cas9 proteins from Streptococcus pyogenes and Staphylococcus aureus to carry out a dual screen in which one gene is activated while a second gene is deleted in the same cell. We analyze the quantitative effects of activation and knockout to calculate genetic interaction and directionality scores for each gene pair.

  3. Functional categorization of gene expression changes in the cerebellum of a Cln3-knockout mouse model for Batten disease.

    PubMed

    Brooks, Andrew I; Chattopadhyay, Subrata; Mitchison, Hannah M; Nussbaum, Robert L; Pearce, David A

    2003-01-01

    Juvenile neuronal ceroid lipofuscinosis (JNCL or Batten Disease) is the most common progressive neurodegenerative disorder of childhood. The disease is inherited in an autosomal recessive manner and is the result of mutations in the CLN3 gene. One brain region severely affected in Batten disease is the cerebellum. Using a mouse model for Batten disease which shares pathological similarities to the disease in humans we have used oligonucleotide arrays to profile approximately 19000 mRNAs in the cerebellum. We have identified reproducible changes of twofold or more in the expression of 756 gene products in the cerebellum of 10-week-old Cln3-knockout mice as compared to wild-type controls. We have subsequently divided these genes with altered expression into 14 functional categories. We report a significant alteration in expression of genes associated with neurotransmission, neuronal cell structure and development, immune response and inflammation, and lipid metabolism. An apparent shift in metabolism toward gluconeogenesis is also evident in Cln3-knockout mice. Further experimentation will be necessary to understand the contribution of these changes in expression to a disease state. Detailed analysis of the functional consequences of altered expression of genes in the cerebellum of the Cln3-knockout mice may provide valuable clues in understanding the molecular basis of the pathological mechanisms underlying Batten disease.

  4. Optimized RNP transfection for highly efficient CRISPR/Cas9-mediated gene knockout in primary T cells.

    PubMed

    Seki, Akiko; Rutz, Sascha

    2018-03-05

    CRISPR (clustered, regularly interspaced, short palindromic repeats)/Cas9 (CRISPR-associated protein 9) has become the tool of choice for generating gene knockouts across a variety of species. The ability for efficient gene editing in primary T cells not only represents a valuable research tool to study gene function but also holds great promise for T cell-based immunotherapies, such as next-generation chimeric antigen receptor (CAR) T cells. Previous attempts to apply CRIPSR/Cas9 for gene editing in primary T cells have resulted in highly variable knockout efficiency and required T cell receptor (TCR) stimulation, thus largely precluding the study of genes involved in T cell activation or differentiation. Here, we describe an optimized approach for Cas9/RNP transfection of primary mouse and human T cells without TCR stimulation that results in near complete loss of target gene expression at the population level, mitigating the need for selection. We believe that this method will greatly extend the feasibly of target gene discovery and validation in primary T cells and simplify the gene editing process for next-generation immunotherapies. © 2018 Genentech.

  5. The role of nuclear factor E2-Related factor 2 and uncoupling protein 2 in glutathione metabolism: Evidence from an in vivo gene knockout study

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Chen, Yanyan; The Hamner Institutes for Health Sciences, Research Triangle Park, NC; Xu, Yuanyuan, E-mail: yyxu@cmu.edu.cn

    Nuclear factor E2-related factor 2 (NRF2) and uncoupling protein 2 (UCP2) are indicated to protect from oxidative stress. They also play roles in the homeostasis of glutathione. However, the detailed mechanisms are not well understood. In the present study, we found Nrf2-knockout (Nrf2-KO) mice exhibited altered glutathione homeostasis and reduced expression of various genes involved in GSH biosynthesis, regeneration, utilization and transport in the liver. Ucp2-knockout (Ucp2-KO) mice exhibited altered glutathione homeostasis in the liver, spleen and blood, as well as increased transcript of cystic fibrosis transmembrane conductance regulator in the liver, a protein capable of mediating glutathione efflux. Nrf2-Ucp2-doublemore » knockout (DKO) mice showed characteristics of both Nrf2-KO and Ucp2-KO mice. But no significant difference was observed in DKO mice when compared with Nrf2-KO or Ucp2-KO mice, except in blood glutathione levels. These data suggest that ablation of Nrf2 and Ucp2 leads to disrupted GSH balance, which could result from altered expression of genes involved in GSH metabolism. DKO may not evoke more severe oxidative stress than the single gene knockout. - Highlights: • Nrf2/Ucp2 deficiency leads to alteration of glutathione homeostasis. • Nrf2 regulates expression of genes in glutathione generation and utilization. • Ucp2 affects glutathione metabolism by regulating hepatic efflux of glutathione. • Nrf2 deficiency may not aggravate oxidative stress in Ucp2-deficient mice.« less

  6. Mutagenesis and phenotyping resources in zebrafish for studying development and human disease

    PubMed Central

    Varshney, Gaurav Kumar

    2014-01-01

    The zebrafish (Danio rerio) is an important model organism for studying development and human disease. The zebrafish has an excellent reference genome and the functions of hundreds of genes have been tested using both forward and reverse genetic approaches. Recent years have seen an increasing number of large-scale mutagenesis projects and the number of mutants or gene knockouts in zebrafish has increased rapidly, including for the first time conditional knockout technologies. In addition, targeted mutagenesis techniques such as zinc finger nucleases, transcription activator-like effector nucleases and clustered regularly interspaced short sequences (CRISPR) or CRISPR-associated (Cas), have all been shown to effectively target zebrafish genes as well as the first reported germline homologous recombination, further expanding the utility and power of zebrafish genetics. Given this explosion of mutagenesis resources, it is now possible to perform systematic, high-throughput phenotype analysis of all zebrafish gene knockouts. PMID:24162064

  7. Morphological and genetic characterization of group I Clostridium botulinum type B strain 111 and the transcriptional regulator spoIIID gene knockout mutant in sporulation.

    PubMed

    Hosomi, Koji; Kuwana, Ritsuko; Takamatsu, Hiromu; Kohda, Tomoko; Kozaki, Shunji; Mukamoto, Masafumi

    2015-06-01

    Clostridium botulinum is a heat-resistant spore-forming bacterium that causes the serious paralytic illness botulism. Heat-resistant spores may cause food sanitation hazards and sporulation plays a central role in the survival of C. botulinum. We observed morphological changes and investigated the role of the transcriptional regulator SpoIIID in the sporulation of C. botulinum type B strain 111 in order to elucidate the molecular mechanism in C. botulinum. C. botulinum type B formed heat-resistant spores through successive morphological changes corresponding to those of Bacillus subtilis, a spore-forming model organism. An analysis of the spoIIID gene knockout mutant revealed that the transcriptional regulator SpoIIID contributed to heat-resistant spore formation by C. botulinum type B and activated the transcription of the sigK gene later during sporulation. Transcription of the spoIIID gene, which differed from that in B. subtilis and Clostridium difficile, was observed in the sigE gene knockout mutant of C. botulinum type B. An analysis of the sigF gene knockout mutant showed that the sporulation-specific sigma factor SigF was essential for transcription of the spoIIID gene in C. botulinum type B. These results suggest that the regulation of sporulation in C. botulinum is not similar to that in B. subtilis and other clostridia. Copyright © 2015 Elsevier Ltd. All rights reserved.

  8. EFFECTS OF HEAT AND BROMOCHLOROACETIC ACID ON MALE REPRODUCTION IN HEAT SHOCK FACTOR-1 GENE KNOCKOUT MICE

    EPA Science Inventory

    Effects of heat and bromochloroacetic acid on male reproduction in heat shock factor-1 gene knockout mice.
    Luft JC1, IJ Benjamin2, JB Garges1 and DJ Dix1. 1Reproductive Toxicology Division, USEPA, RTP, NC, 27711 and 2Dept of Internal Medicine, Univ.of Texas Southwestern Med C...

  9. Genetic background can result in a marked or minimal effect of gene knockout (GPR55 and CB2 receptor) in experimental autoimmune encephalomyelitis models of multiple sclerosis.

    PubMed

    Sisay, Sofia; Pryce, Gareth; Jackson, Samuel J; Tanner, Carolyn; Ross, Ruth A; Michael, Gregory J; Selwood, David L; Giovannoni, Gavin; Baker, David

    2013-01-01

    Endocannabinoids and some phytocannabinoids bind to CB1 and CB2 cannabinoid receptors, transient receptor potential vanilloid one (TRPV1) receptor and the orphan G protein receptor fifty-five (GPR55). Studies using C57BL/10 and C57BL/6 (Cnr2 (tm1Zim)) CB2 cannabinoid receptor knockout mice have demonstrated an immune-augmenting effect in experimental autoimmune encephalomyelitis (EAE) models of multiple sclerosis. However, other EAE studies in Biozzi ABH mice often failed to show any treatment effect of either CB2 receptor agonism or antagonism on inhibition of T cell autoimmunity. The influence of genetic background on the induction of EAE in endocannabinoid system-related gene knockout mice was examined. It was found that C57BL/6.GPR55 knockout mice developed less severe disease, notably in female mice, following active induction with myelin oligodendrocyte glycoprotein 35-55 peptide. In contrast C57BL/6.CB2 (Cnr2 (Dgen)) receptor knockout mice developed augmented severity of disease consistent with the genetically and pharmacologically-distinct, Cnr2 (tm1Zim) mice. However, when the knockout gene was bred into the ABH mouse background and EAE induced with spinal cord autoantigens the immune-enhancing effect of CB2 receptor deletion was lost. Likewise CB1 receptor and transient receptor potential vanilloid one knockout mice on the ABH background demonstrated no alteration in immune-susceptibility, in terms of disease incidence and severity of EAE, in contrast to that reported in some C57BL/6 mouse studies. Furthermore the immune-modulating influence of GPR55 was marginal on the ABH mouse background. Whilst sedative doses of tetrahydrocannabinol could induce immunosuppression, this was associated with a CB1 receptor rather than a CB2 receptor-mediated effect. These data support the fact that non-psychoactive doses of medicinal cannabis have a marginal influence on the immune response in MS. Importantly, it adds a note of caution for the translational value of some transgenic/gene knockout and other studies on low-EAE susceptibility backgrounds with inconsistent disease course and susceptibility.

  10. Genetic Background Can Result in a Marked or Minimal Effect of Gene Knockout (GPR55 and CB2 Receptor) in Experimental Autoimmune Encephalomyelitis Models of Multiple Sclerosis

    PubMed Central

    Jackson, Samuel J.; Tanner, Carolyn; Ross, Ruth A.; Michael, Gregory J.; Selwood, David L.; Giovannoni, Gavin; Baker, David

    2013-01-01

    Endocannabinoids and some phytocannabinoids bind to CB1 and CB2 cannabinoid receptors, transient receptor potential vanilloid one (TRPV1) receptor and the orphan G protein receptor fifty-five (GPR55). Studies using C57BL/10 and C57BL/6 (Cnr2 tm1Zim) CB2 cannabinoid receptor knockout mice have demonstrated an immune-augmenting effect in experimental autoimmune encephalomyelitis (EAE) models of multiple sclerosis. However, other EAE studies in Biozzi ABH mice often failed to show any treatment effect of either CB2 receptor agonism or antagonism on inhibition of T cell autoimmunity. The influence of genetic background on the induction of EAE in endocannabinoid system-related gene knockout mice was examined. It was found that C57BL/6.GPR55 knockout mice developed less severe disease, notably in female mice, following active induction with myelin oligodendrocyte glycoprotein 35-55 peptide. In contrast C57BL/6.CB2 (Cnr2 Dgen) receptor knockout mice developed augmented severity of disease consistent with the genetically and pharmacologically-distinct, Cnr2 tm1Zim mice. However, when the knockout gene was bred into the ABH mouse background and EAE induced with spinal cord autoantigens the immune-enhancing effect of CB2 receptor deletion was lost. Likewise CB1 receptor and transient receptor potential vanilloid one knockout mice on the ABH background demonstrated no alteration in immune-susceptibility, in terms of disease incidence and severity of EAE, in contrast to that reported in some C57BL/6 mouse studies. Furthermore the immune-modulating influence of GPR55 was marginal on the ABH mouse background. Whilst sedative doses of tetrahydrocannabinol could induce immunosuppression, this was associated with a CB1 receptor rather than a CB2 receptor-mediated effect. These data support the fact that non-psychoactive doses of medicinal cannabis have a marginal influence on the immune response in MS. Importantly, it adds a note of caution for the translational value of some transgenic/gene knockout and other studies on low-EAE susceptibility backgrounds with inconsistent disease course and susceptibility. PMID:24130809

  11. Dcdc2 knockout mice display exacerbated developmental disruptions following knockdown of Dcx

    PubMed Central

    Wang, Yu; Yin, Xiuyin; Rosen, Glenn; Gabel, Lisa; Guadiana, Sarah M.; Sarkisian, Matthew R; Galaburda, Albert M.; LoTurco, Joseph J.

    2011-01-01

    The dyslexia-associated gene DCDC2 is a member of the DCX family of genes known to play roles in neurogenesis, neuronal migration and differentiation. Here we report the first phenotypic analysis of a Dcdc2 knockout mouse. Comparisons between Dcdc2 knockout mice and wild type littermates revealed no significant differences in neuronal migration, neocortical lamination, neuronal cilliogenesis or dendritic differentiation. Considering previous studies showing genetic interactions and potential functional redundancy among members of the DCX family, we tested whether decreasing Dcx expression by RNAi would differentially impair neurodevelopment in Dcdc2 knockouts and wild type mice. Consistent with this hypothesis, we found that deficits in neuronal migration, and dendritic growth caused by RNAi of Dcx were more severe in Dcdc2 knockouts than in wild type mice with the same transfection. These results indicate that Dcdc2 is not required for neurogenesis, neuronal migration or differentiation in mice, but may have partial functional redundancy with Dcx. PMID:21689730

  12. Efficient PRNP deletion in bovine genome using gene-editing technologies in bovine cells

    PubMed Central

    Choi, WooJae; Kim, Eunji; Yum, Soo-Young; Lee, ChoongIl; Lee, JiHyun; Moon, JoonHo; Ramachandra, Sisitha; Malaweera, Buddika Oshadi; Cho, JongKi; Kim, Jin-Soo; Kim, SeokJoong; Jang, Goo

    2015-01-01

    abstract Even though prion (encoded by the PRNP gene) diseases like bovine spongiform encephalopathy (BSE) are fatal neurodegenerative diseases in cattle, their study via gene deletion has been limited due to the absence of cell lines or mutant models. In this study, we aim to develop an immortalized fibroblast cell line in which genome-engineering technology can be readily applied to create gene-modified clones for studies. To this end, this study is designed to 1) investigate the induction of primary fibroblasts to immortalization by introducing Bmi-1 and hTert genes; 2) investigate the disruption of the PRNP in those cells; and 3) evaluate the gene expression and embryonic development using knockout (KO) cell lines. Primary cells from a male neonate were immortalized with Bmi-1and hTert. Immortalized cells were cultured for more than 180 days without any changes in their doubling time and morphology. Furthermore, to knockout the PRNP gene, plasmids that encode transcription activator-like effector nuclease (TALEN) pairs were transfected into the cells, and transfected single cells were propagated. Mutated clonal cell lines were confirmed by T7 endonuclease I assay and sequencing. Four knockout cell lines were used for somatic cell nuclear transfer (SCNT), and the resulting embryos were developed to the blastocyst stage. The genes (CSNK2A1, FAM64A, MPG and PRND) were affected after PRNP disruption in immortalized cells. In conclusion, we established immortalized cattle fibroblasts using Bmi-1 and hTert genes, and used TALENs to knockout the PRNP gene in these immortalized cells. The efficient PRNP KO is expected to be a useful technology to develop our understanding of in vitro prion protein functions in cattle. PMID:26217959

  13. Metabolic engineering of Escherichia coli for the production of l-valine based on transcriptome analysis and in silico gene knockout simulation

    PubMed Central

    Park, Jin Hwan; Lee, Kwang Ho; Kim, Tae Yong; Lee, Sang Yup

    2007-01-01

    The l-valine production strain of Escherichia coli was constructed by rational metabolic engineering and stepwise improvement based on transcriptome analysis and gene knockout simulation of the in silico genome-scale metabolic network. Feedback inhibition of acetohydroxy acid synthase isoenzyme III by l-valine was removed by site-directed mutagenesis, and the native promoter containing the transcriptional attenuator leader regions of the ilvGMEDA and ilvBN operon was replaced with the tac promoter. The ilvA, leuA, and panB genes were deleted to make more precursors available for l-valine biosynthesis. This engineered Val strain harboring a plasmid overexpressing the ilvBN genes produced 1.31 g/liter l-valine. Comparative transcriptome profiling was performed during batch fermentation of the engineered and control strains. Among the down-regulated genes, the lrp and ygaZH genes, which encode a global regulator Lrp and l-valine exporter, respectively, were overexpressed. Amplification of the lrp, ygaZH, and lrp-ygaZH genes led to the enhanced production of l-valine by 21.6%, 47.1%, and 113%, respectively. Further improvement was achieved by using in silico gene knockout simulation, which identified the aceF, mdh, and pfkA genes as knockout targets. The VAMF strain (Val ΔaceF Δmdh ΔpfkA) overexpressing the ilvBN, ilvCED, ygaZH, and lrp genes was able to produce 7.55 g/liter l-valine from 20 g/liter glucose in batch culture, resulting in a high yield of 0.378 g of l-valine per gram of glucose. These results suggest that an industrially competitive strain can be efficiently developed by metabolic engineering based on combined rational modification, transcriptome profiling, and systems-level in silico analysis. PMID:17463081

  14. Generation of stable human cell lines with Tetracycline-inducible (Tet-on) shRNA or cDNA expression.

    PubMed

    Gomez-Martinez, Marta; Schmitz, Debora; Hergovich, Alexander

    2013-03-05

    A major approach in the field of mammalian cell biology is the manipulation of the expression of genes of interest in selected cell lines, with the aim to reveal one or several of the gene's function(s) using transient/stable overexpression or knockdown of the gene of interest. Unfortunately, for various cell biological investigations this approach is unsuitable when manipulations of gene expression result in cell growth/proliferation defects or unwanted cell differentiation. Therefore, researchers have adapted the Tetracycline repressor protein (TetR), taken from the E. coli tetracycline resistance operon(1), to generate very efficient and tight regulatory systems to express cDNAs in mammalian cells(2,3). In short, TetR has been modified to either (1) block initiation of transcription by binding to the Tet-operator (TO) in the promoter region upon addition of tetracycline (termed Tet-off system) or (2) bind to the TO in the absence of tetracycline (termed Tet-on system) (Figure 1). Given the inconvenience that the Tet-off system requires the continuous presence of tetracycline (which has a half-life of about 24 hr in tissue cell culture medium) the Tet-on system has been more extensively optimized, resulting in the development of very tight and efficient vector systems for cDNA expression as used here. Shortly after establishment of RNA interference (RNAi) for gene knockdown in mammalian cells(4), vectors expressing short-hairpin RNAs (shRNAs) were described that function very similar to siRNAs(5-11). However, these shRNA-mediated knockdown approaches have the same limitation as conventional knockout strategies, since stable depletion is not feasible when gene targets are essential for cellular survival. To overcome this limitation, van de Wetering et al.(12) modified the shRNA expression vector pSUPER(5) by inserting a TO in the promoter region, which enabled them to generate stable cell lines with tetracycline-inducible depletion of their target genes of interest. Here, we describe a method to efficiently generate stable human Tet-on cell lines that reliably drive either inducible overexpression or depletion of the gene of interest. Using this method, we have successfully generated Tet-on cell lines which significantly facilitated the analysis of the MST/hMOB/NDR cascade in centrosome(13,14) and apoptosis signaling(15,16). In this report, we describe our vectors of choice, in addition to describing the two consecutive manipulation steps that are necessary to efficiently generate human Tet-on cell lines (Figure 2). Moreover, besides outlining a protocol for the generation of human Tet-on cell lines, we will discuss critical aspects regarding the technical procedures and the characterization of Tet-on cells.

  15. Microarray analysis of retinal gene expression in Egr-1 knockout mice

    PubMed Central

    Schippert, Ruth; Schaeffel, Frank

    2009-01-01

    Purpose We found earlier that 42 day-old Egr-1 knockout mice had longer eyes and a more myopic refractive error compared to their wild-types. To identify genes that could be responsible for the temporarily enhanced axial eye growth, a microarray analysis was performed in knockout and wild-type mice at the postnatal ages of 30 and 42 days. Methods The retinas of homozygous and wild-type Egr-1 knockout mice (Taconic, Ry, Denmark) were prepared for RNA isolation (RNeasy Mini Kit, Qiagen) at the age of 30 or 42 days, respectively (n=12 each). Three retinas were pooled and labeled cRNA was made. The samples were hybridized to Affymetrix GeneChip Mouse Genome 430 2.0 Arrays. Hybridization signals were calculated using GC-RMA normalization. Genes were identified as differentially expressed if they showed a fold-change (FC) of at least 1.5 and a p-value <0.05. A false-discovery rate of 5% was applied. Ten genes with potential biologic relevance were examined further with semiquantitative real-time RT–PCR. Results Comparing mRNA expression levels between wild-type and homozygous Egr-1 knockout mice, we found 73 differentially expressed genes at the age of 30 days and 135 genes at the age of 42 days. Testing for differences in gene expression between the two ages (30 versus 42 days), 54 genes were differently expressed in wild-type mice and 215 genes in homozygous animals. Based on three networks proposed by Ingenuity pathway analysis software, nine differently expressed genes in the homozygous Egr-1 knockout mice were chosen for further validation by real-time RT–PCR, three genes in each network. In addition, the gene that was most prominently regulated in the knockout mice, compared to wild-type, at both 30 days and 42 days of age (protocadherin beta-9 [Pcdhb9]), was tested with real-time RT–PCR. Changes in four of the ten genes could be confirmed by real-time RT–PCR: nuclear prelamin A recognition factor (Narf), oxoglutarate dehydrogenase (Ogdh), selenium binding protein 1 (Selenbp1), and Pcdhb9. Except for Pcdhb9, the genes whose mRNA expression levels were validated were listed in one of the networks proposed by Ingenuity pathway analysis software. In addition to these genes, the software proposed several key-regulators which did not change in our study: retinoic acid, vascular endothelial growth factor A (VEGF-A), FBJ murine osteosarcoma viral oncogene homolog (cFos), and others. Conclusions Identification of genes that are differentially regulated during the development period between postnatal day 30 (when both homozygous and wild-type mice still have the same axial length) and day 42 (where the difference in eye length is apparent) could improve the understanding of mechanisms for the control of axial eye growth and may lead to potential targets for pharmacological intervention. With the aid of pathway-analysis software, a coarse picture of possible biochemical pathways could be generated. Although the mRNA expression levels of proteins proposed by the software, like VEGF, FOS, retinoic acid (RA) receptors, or cellular RA binding protein, did not show any changes in our experiment, these molecules have previously been implicated in the signaling cascades controlling axial eye growth. According to the pathway-analysis software, they represent links between several proteins whose mRNA expression was changed in our study. PMID:20019881

  16. Microarray analysis of retinal gene expression in Egr-1 knockout mice.

    PubMed

    Schippert, Ruth; Schaeffel, Frank; Feldkaemper, Marita Pauline

    2009-12-10

    We found earlier that 42 day-old Egr-1 knockout mice had longer eyes and a more myopic refractive error compared to their wild-types. To identify genes that could be responsible for the temporarily enhanced axial eye growth, a microarray analysis was performed in knockout and wild-type mice at the postnatal ages of 30 and 42 days. The retinas of homozygous and wild-type Egr-1 knockout mice (Taconic, Ry, Denmark) were prepared for RNA isolation (RNeasy Mini Kit, Qiagen) at the age of 30 or 42 days, respectively (n=12 each). Three retinas were pooled and labeled cRNA was made. The samples were hybridized to Affymetrix GeneChip Mouse Genome 430 2.0 Arrays. Hybridization signals were calculated using GC-RMA normalization. Genes were identified as differentially expressed if they showed a fold-change (FC) of at least 1.5 and a p-value <0.05. A false-discovery rate of 5% was applied. Ten genes with potential biologic relevance were examined further with semiquantitative real-time RT-PCR. Comparing mRNA expression levels between wild-type and homozygous Egr-1 knockout mice, we found 73 differentially expressed genes at the age of 30 days and 135 genes at the age of 42 days. Testing for differences in gene expression between the two ages (30 versus 42 days), 54 genes were differently expressed in wild-type mice and 215 genes in homozygous animals. Based on three networks proposed by Ingenuity pathway analysis software, nine differently expressed genes in the homozygous Egr-1 knockout mice were chosen for further validation by real-time RT-PCR, three genes in each network. In addition, the gene that was most prominently regulated in the knockout mice, compared to wild-type, at both 30 days and 42 days of age (protocadherin beta-9 [Pcdhb9]), was tested with real-time RT-PCR. Changes in four of the ten genes could be confirmed by real-time RT-PCR: nuclear prelamin A recognition factor (Narf), oxoglutarate dehydrogenase (Ogdh), selenium binding protein 1 (Selenbp1), and Pcdhb9. Except for Pcdhb9, the genes whose mRNA expression levels were validated were listed in one of the networks proposed by Ingenuity pathway analysis software. In addition to these genes, the software proposed several key-regulators which did not change in our study: retinoic acid, vascular endothelial growth factor A (VEGF-A), FBJ murine osteosarcoma viral oncogene homolog (cFos), and others. Identification of genes that are differentially regulated during the development period between postnatal day 30 (when both homozygous and wild-type mice still have the same axial length) and day 42 (where the difference in eye length is apparent) could improve the understanding of mechanisms for the control of axial eye growth and may lead to potential targets for pharmacological intervention. With the aid of pathway-analysis software, a coarse picture of possible biochemical pathways could be generated. Although the mRNA expression levels of proteins proposed by the software, like VEGF, FOS, retinoic acid (RA) receptors, or cellular RA binding protein, did not show any changes in our experiment, these molecules have previously been implicated in the signaling cascades controlling axial eye growth. According to the pathway-analysis software, they represent links between several proteins whose mRNA expression was changed in our study.

  17. GeneKnockout by Targeted Mutagenesis in a Hemimetabolous Insect, the Two-Spotted Cricket Gryllus bimaculatus, using TALENs.

    PubMed

    Watanabe, Takahito; Noji, Sumihare; Mito, Taro

    2016-01-01

    Hemimetabolous, or incompletely metamorphosing, insects are phylogenetically basal. These insects include many deleterious species. The cricket, Gryllus bimaculatus, is an emerging model for hemimetabolous insects, based on the success of RNA interference (RNAi)-based gene-functional analyses and transgenic technology. Taking advantage of genome-editing technologies in this species would greatly promote functional genomics studies. Genome editing using transcription activator-like effector nucleases (TALENs) has proven to be an effective method for site-specific genome manipulation in various species. TALENs are artificial nucleases that are capable of inducing DNA double-strand breaks into specified target sequences. Here, we describe a protocol for TALEN-based gene knockout in G. bimaculatus, including a mutant selection scheme via mutation detection assays, for generating homozygous knockout organisms.

  18. Genome Editing in Rats Using TALE Nucleases.

    PubMed

    Tesson, Laurent; Remy, Séverine; Ménoret, Séverine; Usal, Claire; Thinard, Reynald; Savignard, Chloé; De Cian, Anne; Giovannangeli, Carine; Concordet, Jean-Paul; Anegon, Ignacio

    2016-01-01

    The rat is an important animal model to understand gene function and model human diseases. Since recent years, the development of gene-specific nucleases has become important for generating new rat models of human diseases, to analyze the role of genes and to generate human antibodies. Transcription activator-like (TALE) nucleases efficiently create gene-specific knockout rats and lead to the possibility of gene targeting by homology-directed recombination (HDR) and generating knock-in rats. We describe a detailed protocol for generating knockout and knock-in rats via microinjection of TALE nucleases into fertilized eggs. This technology is an efficient, cost- and time-effective method for creating new rat models.

  19. Ascorbate synthesis pathway, dual role of ascorbate in bone homeostasis

    USDA-ARS?s Scientific Manuscript database

    Using mouse gene knock-out models, we identify aldehyde reductase (EC 1.1.1.2, Akr1a4 (GR)) and aldose reductase (EC 1.1.1.21, Akr1b3 (AR)) as the enzymes responsible for conversion of D-glucuronate to L-gulonate, a key step in the ascorbate (ASC) synthesis pathway in mice. The gene knock-out (KO) m...

  20. GENETIC CATHEPSIN B DEFICIENCY REDUCES β-AMYLOID IN TRANSGENIC MICE EXPRESSING HUMAN WILD-TYPE AMYLOID PRECURSOR PROTEIN

    PubMed Central

    Hook, Vivian Y. H.; Kindy, Mark; Reinheckel, Thomas; Peters, Christoph; Hook, Gregory

    2009-01-01

    Neurotoxic β-amyloid (Aβ) peptides participate in Alzheimer’s disease (AD); therefore, reduction of Aβ generated from APP may provide a therapeutic approach for AD. Gene knockout studies in transgenic mice producing human Aβ may identify targets for reducing Aβ. This study shows that knockout of the cathepsin B gene in mice expressing human wild-type APP (hAPPwt) results in substantial decrease of Aβ40 and Aβ42 by 67% in brain, and decreases levels of the C-terminal β-secretase fragment (CTFβ) derived from APP. In contrast, knockout of cathepsin B in mice expressing hAPP with the rare Swedish (Swe) and Indiana (Ind) mutations had no effect on Aβ. The difference in reduction of Aβ in hAPPwt mice, but not in hAPPSwe/Ind mice, shows that the transgenic model can affect cathepsin B gene knockout results. Since most AD patients express hAPPwt, these data validate cathepsin B as a target for development of inhibitors to lower Aβ in AD. PMID:19501042

  1. Tailoring the Immune Response via Customization of Pathogen Gene Expression.

    PubMed

    Runco, Lisa M; Stauft, Charles B; Coleman, J Robert

    2014-01-01

    The majority of studies focused on the construction and reengineering of bacterial pathogens have mainly relied on the knocking out of virulence factors or deletion/mutation of amino acid residues to then observe the microbe's phenotype and the resulting effect on the host immune response. These knockout bacterial strains have also been proposed as vaccines to combat bacterial disease. Theoretically, knockout strains would be unable to cause disease since their virulence factors have been removed, yet they could induce a protective memory response. While knockout strains have been valuable tools to discern the role of virulence factors in host immunity and bacterial pathogenesis, they have been unable to yield clinically relevant vaccines. The advent of synthetic biology and enhanced user-directed gene customization has altered this binary process of knockout, followed by observation. Recent studies have shown that a researcher can now tailor and customize a given microbe's gene expression to produce a desired immune response. In this commentary, we highlight these studies as a new avenue for controlling the inflammatory response as well as vaccine development.

  2. Tailoring the Immune Response via Customization of Pathogen Gene Expression

    PubMed Central

    Runco, Lisa M.; Stauft, Charles B.

    2014-01-01

    The majority of studies focused on the construction and reengineering of bacterial pathogens have mainly relied on the knocking out of virulence factors or deletion/mutation of amino acid residues to then observe the microbe's phenotype and the resulting effect on the host immune response. These knockout bacterial strains have also been proposed as vaccines to combat bacterial disease. Theoretically, knockout strains would be unable to cause disease since their virulence factors have been removed, yet they could induce a protective memory response. While knockout strains have been valuable tools to discern the role of virulence factors in host immunity and bacterial pathogenesis, they have been unable to yield clinically relevant vaccines. The advent of synthetic biology and enhanced user-directed gene customization has altered this binary process of knockout, followed by observation. Recent studies have shown that a researcher can now tailor and customize a given microbe's gene expression to produce a desired immune response. In this commentary, we highlight these studies as a new avenue for controlling the inflammatory response as well as vaccine development. PMID:24719769

  3. The histone demethylase Jarid1b ensures faithful mouse development by protecting developmental genes from aberrant H3K4me3.

    PubMed

    Albert, Mareike; Schmitz, Sandra U; Kooistra, Susanne M; Malatesta, Martina; Morales Torres, Cristina; Rekling, Jens C; Johansen, Jens V; Abarrategui, Iratxe; Helin, Kristian

    2013-04-01

    Embryonic development is tightly regulated by transcription factors and chromatin-associated proteins. H3K4me3 is associated with active transcription and H3K27me3 with gene repression, while the combination of both keeps genes required for development in a plastic state. Here we show that deletion of the H3K4me2/3 histone demethylase Jarid1b (Kdm5b/Plu1) results in major neonatal lethality due to respiratory failure. Jarid1b knockout embryos have several neural defects including disorganized cranial nerves, defects in eye development, and increased incidences of exencephaly. Moreover, in line with an overlap of Jarid1b and Polycomb target genes, Jarid1b knockout embryos display homeotic skeletal transformations typical for Polycomb mutants, supporting a functional interplay between Polycomb proteins and Jarid1b. To understand how Jarid1b regulates mouse development, we performed a genome-wide analysis of histone modifications, which demonstrated that normally inactive genes encoding developmental regulators acquire aberrant H3K4me3 during early embryogenesis in Jarid1b knockout embryos. H3K4me3 accumulates as embryonic development proceeds, leading to increased expression of neural master regulators like Pax6 and Otx2 in Jarid1b knockout brains. Taken together, these results suggest that Jarid1b regulates mouse development by protecting developmental genes from inappropriate acquisition of active histone modifications.

  4. The Histone Demethylase Jarid1b Ensures Faithful Mouse Development by Protecting Developmental Genes from Aberrant H3K4me3

    PubMed Central

    Kooistra, Susanne M.; Malatesta, Martina; Morales Torres, Cristina; Rekling, Jens C.; Johansen, Jens V.; Abarrategui, Iratxe; Helin, Kristian

    2013-01-01

    Embryonic development is tightly regulated by transcription factors and chromatin-associated proteins. H3K4me3 is associated with active transcription and H3K27me3 with gene repression, while the combination of both keeps genes required for development in a plastic state. Here we show that deletion of the H3K4me2/3 histone demethylase Jarid1b (Kdm5b/Plu1) results in major neonatal lethality due to respiratory failure. Jarid1b knockout embryos have several neural defects including disorganized cranial nerves, defects in eye development, and increased incidences of exencephaly. Moreover, in line with an overlap of Jarid1b and Polycomb target genes, Jarid1b knockout embryos display homeotic skeletal transformations typical for Polycomb mutants, supporting a functional interplay between Polycomb proteins and Jarid1b. To understand how Jarid1b regulates mouse development, we performed a genome-wide analysis of histone modifications, which demonstrated that normally inactive genes encoding developmental regulators acquire aberrant H3K4me3 during early embryogenesis in Jarid1b knockout embryos. H3K4me3 accumulates as embryonic development proceeds, leading to increased expression of neural master regulators like Pax6 and Otx2 in Jarid1b knockout brains. Taken together, these results suggest that Jarid1b regulates mouse development by protecting developmental genes from inappropriate acquisition of active histone modifications. PMID:23637629

  5. Generation of Newly Discovered Resistance Gene mcr-1 Knockout in Escherichia coli Using the CRISPR/Cas9 System.

    PubMed

    Sun, Lichang; He, Tao; Zhang, Lili; Pang, Maoda; Zhang, Qiaoyan; Zhou, Yan; Bao, Hongduo; Wang, Ran

    2017-07-28

    The mcr-1 gene is a new "superbug" gene discoverd in China in 2016 that makes bacteria highly resistant to the last-resort class of antibiotics. The mcr-1 gene raised serious concern about its possible global dissemination and spread. Here, we report a potential anti-resistant strategy using the CRISPR/Cas9-mediated approach that can efficiently induce mcr-1 gene knockout in Escherichia coli . Our findings suggested that using the CRISPR/Cas9 system to knock out the resistance gene mcr-1 might be a potential anti-resistant strategy. Bovine myeloid antimicrobial peptide-27 could help deliver plasmid pCas::mcr targeting specific DNA sequences of the mcr-1 gene into microbial populations.

  6. Gene knockout by targeted mutagenesis in a hemimetabolous insect, the two-spotted cricket Gryllus bimaculatus, using TALENs.

    PubMed

    Watanabe, Takahito; Noji, Sumihare; Mito, Taro

    2014-08-15

    Hemimetabolous, or incompletely metamorphosing, insects are phylogenetically basal. These insects include many deleterious species. The cricket, Gryllus bimaculatus, is an emerging model for hemimetabolous insects, based on the success of RNA interference (RNAi)-based gene-functional analyses and transgenic technology. Taking advantage of genome-editing technologies in this species would greatly promote functional genomics studies. Genome editing using transcription activator-like effector nucleases (TALENs) has proven to be an effective method for site-specific genome manipulation in various species. TALENs are artificial nucleases that are capable of inducing DNA double-strand breaks into specified target sequences. Here, we describe a protocol for TALEN-based gene knockout in G. bimaculatus, including a mutant selection scheme via mutation detection assays, for generating homozygous knockout organisms. Copyright © 2014 Elsevier Inc. All rights reserved.

  7. Global gene expression analysis in a mouse model for Norrie disease: late involvement of photoreceptor cells.

    PubMed

    Lenzner, Steffen; Prietz, Sandra; Feil, Silke; Nuber, Ulrike A; Ropers, H-Hilger; Berger, Wolfgang

    2002-09-01

    Mutations in the NDP gene give rise to a variety of eye diseases, including classic Norrie disease (ND), X-linked exudative vitreoretinopathy (EVRX), retinal telangiectasis (Coats disease), and advanced retinopathy of prematurity (ROP). The gene product is a cystine-knot-containing extracellular signaling molecule of unknown function. In the current study, gene expression was determined in a mouse model of ND, to unravel disease-associated mechanisms at the molecular level. Gene transcription in the eyes of 2-year-old Ndp knockout mice was compared with that in the eyes of age-matched wild-type control animals, by means of cDNA subtraction and microarrays. Clones (n = 3072) from the cDNA subtraction libraries were spotted onto glass slides and hybridized with fluorescently labeled RNA-derived targets. More than 230 differentially expressed clones were sequenced, and their expression patterns were verified by virtual Northern blot analysis. Numerous gene transcripts that are absent or downregulated in the eye of Ndp knockout mice are photoreceptor cell specific. In younger Ndp knockout mice (up to 1 year old), however, all these transcripts were found to be expressed at normal levels. The identification of numerous photoreceptor cell-specific transcripts with a reduced expression in 2-year-old, but not in young, Ndp knockout mice indicates that normal gene expression in these light-sensitive cells of mutant mice is established and maintained over a long period and that rods and cones are affected relatively late in the mouse model of ND. Obviously, the absence of the Ndp gene product is not compatible with long-term survival of photoreceptor cells in the mouse.

  8. Thyroid Hormone Receptor α- and β-Knockout Xenopus tropicalis Tadpoles Reveal Subtype-Specific Roles During Development.

    PubMed

    Nakajima, Keisuke; Tazawa, Ichiro; Yaoita, Yoshio

    2018-02-01

    Thyroid hormone (TH) binds TH receptor α (TRα) and β (TRβ) to induce amphibian metamorphosis. Whereas TH signaling has been well studied, functional differences between TRα and TRβ during this process have not been characterized. To understand how each TR contributes to metamorphosis, we generated TRα- and TRβ-knockout tadpoles of Xenopus tropicalis and examined developmental abnormalities, histology of the tail and intestine, and messenger RNA expression of genes encoding extracellular matrix-degrading enzymes. In TRβ-knockout tadpoles, tail regression was delayed significantly and a healthy notochord was observed even 5 days after the initiation of tail shortening (stage 62), whereas in the tails of wild-type and TRα-knockout tadpoles, the notochord disappeared after ∼1 day. The messenger RNA expression levels of genes encoding extracellular matrix-degrading enzymes (MMP2, MMP9TH, MMP13, MMP14, and FAPα) were obviously reduced in the tail tip of TRβ-knockout tadpoles, with the shortening tail. The reduction in olfactory nerve length and head narrowing by gill absorption were also affected. Hind limb growth and intestinal shortening were not compromised in TRβ-knockout tadpoles, whereas tail regression and olfactory nerve shortening appeared to proceed normally in TRα-knockout tadpoles, except for the precocious development of hind limbs. Our results demonstrated the distinct roles of TRα and TRβ in hind limb growth and tail regression, respectively. Copyright © 2018 Endocrine Society.

  9. Myxoma virus M130R is a novel virulence factor required for lethal myxomatosis in rabbits.

    PubMed

    Barrett, John W; Werden, Steven J; Wang, Fuan; McKillop, William M; Jimenez, June; Villeneuve, Danielle; McFadden, Grant; Dekaban, Gregory A

    2009-09-01

    Myxoma virus (MV) is a highly lethal, rabbit-specific poxvirus that induces a disease called myxomatosis in European rabbits. In an effort to understand the function of predicted immunomodulatory genes we have deleted various viral genes from MV and tested the ability of these knockout viruses to induce lethal myxomatosis. MV encodes a unique 15 kD cytoplasmic protein (M130R) that is expressed late (12h post infection) during infection. M130R is a non-essential gene for MV replication in rabbit, monkey or human cell lines. Construction of a targeted gene knockout virus (vMyx130KO) and infection of susceptible rabbits demonstrate that the M130R knockout virus is attenuated and that loss of M130R expression allows the rabbit host immune system to effectively respond to and control the lethal effects of MV. M130R expression is a bona fide poxviral virulence factor necessary for full and lethal development of myxomatosis.

  10. Kappa2 opioid receptor subtype binding requires the presence of the DOR-1 gene.

    PubMed

    Ansonoff, Michael A; Wen, Ting; Pintar, John E

    2010-01-01

    Over the past several years substantial evidence has documented that opioid receptor homo- and heterodimers form in cell lines expressing one or more of the opioid receptors. We used opioid receptor knockout mice to determine whether in vivo pharmacological characteristics of kappa1 and kappa2 opioid receptors changed following knockout of specific opioid receptors. Using displacement of the general opioid ligand diprenorphine, we observed that occupancy or knockout of the DOR-1 gene increases the binding density of kappa1 receptors and eliminates kappa2 receptors in crude membrane preparations while the total density of kappa opioid binding sites is unchanged. Further, the analgesic potency of U69,593 in cumulative dose response curves is enhanced in mice lacking the DOR-1 gene. These results demonstrate that the DOR-1 gene is required for the expression of the kappa2 opioid receptor subtype and are consistent with the possibility that a KOR-1/DOR-1 heterodimer mediates kappa2 pharmacology.

  11. Lymphocyte signaling : beyond knockouts

    PubMed Central

    Saveliev, Alexander; Tybulewicz, Victor L. J.

    2016-01-01

    The analysis of lymphocyte signaling was greatly enhanced by the advent of gene targeting, which allows the selective inactivation of a single gene. Whereas this gene ‘knockout’ approach is often informative, in many cases the phenotype resulting from gene ablation might not provide a complete picture of the function of the corresponding protein. If a protein has multiple functions within a single or several signaling pathways, or stabilizes other proteins in a complex, the phenotypic consequences of a gene knockout may manifest as a combination of several different perturbations. In these cases, gene targeting to ‘knockin’ subtle point mutations might provide more accurate insight into protein function. However, to be informative, such mutations must be carefully designed based on structural and biophysical data. PMID:19295633

  12. A lentivirus-free inducible CRISPR-Cas9 system for efficient targeting of human genes.

    PubMed

    Bisht, Kamlesh; Grill, Sherilyn; Graniel, Jacqueline; Nandakumar, Jayakrishnan

    2017-08-01

    CRISPR-Cas9 is a cutting-edge tool for modifying genomes. The efficacy with which Cas9 recognizes its target has revolutionized the engineering of knockouts. However this efficacy complicates the knocking out of important genes in cultured cells. Unedited cells holding a survival advantage within an edited population can confound the knockout phenotype. Here we develop a HeLa-based system that overcomes this limitation, incorporating several attractive features. First, we use Flp-recombinase to generate clones stably integrated for Cas9 and guide RNAs, eliminating the possibility of unedited cells. Second, Cas9 can be induced uniformly in the clonal cultures using doxycycline to measure the knockout phenotype. Third, two genes can be simultaneously knocked out using this approach. Finally, by not involving lentiviruses, our method is appealing to a broad research audience. Using this methodology we generated an inducible AGO2-knockout cell line showing normal RNA interference in the absence of doxycycline. Upon induction of Cas9, the AGO2 locus was cleaved, the AGO2 protein was depleted, and RNA interference was compromised. In addition to generating inducible knockouts, our technology can be adapted to improve other applications of Cas9, including transcriptional/epigenetic modulation and visualization of cellular DNA loci. Copyright © 2017 The Authors. Published by Elsevier Inc. All rights reserved.

  13. Renal Dysfunction Induced by Kidney-Specific Gene Deletion of Hsd11b2 as a Primary Cause of Salt-Dependent Hypertension.

    PubMed

    Ueda, Kohei; Nishimoto, Mitsuhiro; Hirohama, Daigoro; Ayuzawa, Nobuhiro; Kawarazaki, Wakako; Watanabe, Atsushi; Shimosawa, Tatsuo; Loffing, Johannes; Zhang, Ming-Zhi; Marumo, Takeshi; Fujita, Toshiro

    2017-07-01

    Genome-wide analysis of renal sodium-transporting system has identified specific variations of Mendelian hypertensive disorders, including HSD11B2 gene variants in apparent mineralocorticoid excess. However, these genetic variations in extrarenal tissue can be involved in developing hypertension, as demonstrated in former studies using global and brain-specific Hsd11b2 knockout rodents. To re-examine the importance of renal dysfunction on developing hypertension, we generated kidney-specific Hsd11b2 knockout mice. The knockout mice exhibited systemic hypertension, which was abolished by reducing salt intake, suggesting its salt-dependency. In addition, we detected an increase in renal membrane expressions of cleaved epithelial sodium channel-α and T53-phosphorylated Na + -Cl - cotransporter in the knockout mice. Acute intraperitoneal administration of amiloride-induced natriuresis and increased urinary sodium/potassium ratio more in the knockout mice compared with those in the wild-type control mice. Chronic administration of amiloride and high-KCl diet significantly decreased mean blood pressure in the knockout mice, which was accompanied with the correction of hypokalemia and the resultant decrease in Na + -Cl - cotransporter phosphorylation. Accordingly, a Na + -Cl - cotransporter blocker hydrochlorothiazide significantly decreased mean blood pressure in the knockout mice. Chronic administration of mineralocorticoid receptor antagonist spironolactone significantly decreased mean blood pressure of the knockout mice along with downregulation of cleaved epithelial sodium channel-α and phosphorylated Na + -Cl - cotransporter expression in the knockout kidney. Our data suggest that kidney-specific deficiency of 11β-HSD2 leads to salt-dependent hypertension, which is attributed to mineralocorticoid receptor-epithelial sodium channel-Na + -Cl - cotransporter activation in the kidney, and provides evidence that renal dysfunction is essential for developing the phenotype of apparent mineralocorticoid excess. © 2017 American Heart Association, Inc.

  14. Characterization of a Bacillus subtilis surfactin synthetase knockout and antimicrobial activity analysis.

    PubMed

    Liu, Hongxia; Qu, Xiaoxu; Gao, Ling; Zhao, Shengming; Lu, Zhaoxin; Zhang, Chong; Bie, Xiaomei

    2016-11-10

    Gene knockout is an important approach to improve the production of antimicrobial compounds. B. subtilis PB2-LS10, derived from B. subtilis PB2-L by a surfactin synthetase (srf) genes knockout, exhibits stronger inhibitory action than its parental strain against all tested pathogenic bacteria and fungi. The antimicrobial extracts produced by B. subtilis PB2-L and B. subtilis PB2-LS10 respectively were characterized by the high-resolution LC-ESI-MS. To provide further insight into the distinct antimicrobial activities, we investigated the impact of the srf genes deletion on the growth and gene transcriptional profile of the strains. The mutant strain grew quickly and reached stationary phase 2h earlier than the wild-type. Prominent expression changes in the modified strain involved genes that were essential to metabolic pathways and processes. Genes related to amino acid transport, ATP-binding cassette (ABC) transporters and protein export were up-regulated in strain PB2-LS10. However, amino acid metabolism, carbohydrate metabolism and fatty acid metabolism were repressed. Because of its excellent antimicrobial activity, strain PB2-LS10 has potential for use in food preservation. Copyright © 2016 Elsevier B.V. All rights reserved.

  15. Bm59 is an early gene, but is unessential for the propagation and assembly of Bombyx mori nucleopolyhedrovirus.

    PubMed

    Hu, Xiaolong; Shen, Yunwang; Zheng, Qin; Wang, Guobao; Wu, Xiaofeng; Gong, Chengliang

    2016-02-01

    Bombyx mori nucleopolyhedrovirus (BmNPV) is a major pathogen that specifically infects the domestic silkworm and causes serious economic loss to sericulture around the world. The function of BmNPV Bm59 gene in the viral life cycle is inconclusive. To investigate the role of Bm59 during viral infection, the transcription initiation site and temporal expression of Bm59 were analyzed, and Bm59-knockout virus was generated through homologous recombination in Escherichia coli. The results showed that Bm59 is an early transcription gene with an atypia early transcriptional start motif. Budded virion (BV) production and DNA replication in the BmN cells transfected with the Bm59-knockout virus bacmid were similar to those in the cells transfected with the wild-type virus. Electron microscopy revealed that the occlusion-derived virus can be produced in cells infected with the Bm59-knockout virus. These results indicated that Bm59 is an early gene and is not essential for viral replication or assembly of BmNPV. These findings suggested that non-essential gene (Bm59) remained in the viral genome, which may interact with other viral/host genes in a certain situation.

  16. Beta-arrestin-1 protein represses diet-induced obesity.

    PubMed

    Zhuang, Le-nan; Hu, Wen-xiang; Zhang, Ming-liang; Xin, Shun-mei; Jia, Wei-ping; Zhao, Jian; Pei, Gang

    2011-08-12

    Diet-related obesity is a major metabolic disorder. Excessive fat mass is associated with type 2 diabetes, hepatic steatosis, and arteriosclerosis. Dysregulation of lipid metabolism and adipose tissue function contributes to diet-induced obesity. Here, we report that β-arrestin-1 knock-out mice are susceptible to diet-induced obesity. Knock-out of the gene encoding β-arrestin-1 caused increased fat mass accumulation and decreased whole-body insulin sensitivity in mice fed a high-fat diet. In β-arrestin-1 knock-out mice, we observed disrupted food intake and energy expenditure and increased macrophage infiltration in white adipose tissue. At the molecular level, β-arrestin-1 deficiency affected the expression of many lipid metabolic genes and inflammatory genes in adipose tissue. Consistently, transgenic overexpression of β-arrestin-1 repressed diet-induced obesity and improved glucose tolerance and systemic insulin sensitivity. Thus, our findings reveal that β-arrestin-1 plays a role in metabolism regulation.

  17. Behavioral and genetic investigations of low exploratory behavior in Il18r1−/− mice: We can’t always blame it on the targeted gene

    PubMed Central

    Eisener-Dorman, Amy F.; Lawrence, David A.; Bolivar, Valerie J.

    2010-01-01

    The development of gene targeting technologies has enabled research with immune system-related knockout mouse strains to advance our understanding of how cytokines and their receptors interact and influence a number of body systems, including the central nervous system. A critical issue when we are interpreting phenotypic data from these knockout strains is the potential role of genes other than the targeted one. Although many of the knockout strains have been made congenic on a C57BL/6 (B6) genetic background, there remains a certain amount of genetic material from the129 substrain that was used in the development of these strains. This genetic material could result in phenotypes incorrectly attributed to the targeted gene. We recently reported low activity behavior in Il10−/− mice that was linked to this genetic material rather than the targeted gene itself. In the current study we confirm the generalizability of those earlier findings, by assessing behavior in Il18−/− and Il18r1−/− knockout mice. We identified low activity and high anxiety-like behaviors in Il18r1−/− mice, whereas Il18−/− mice displayed little anxiety-like behavior. Although Il18r1−/− mice are considered a congenic strain, we have identified substantial regions of 129P2-derived genetic material not only flanking the ablated Il18r1 on Chromosome 1, but also on Chromosomes 4, 5, 8, 10, and 14. Our studies suggest that residual 129-derived gene(s), rather than the targeted Il18r1 gene, is/are responsible for the low level of activity seen in the Il18r1−/− mice. Mapping studies are necessary to identify the gene or genes contributing to the low activity phenotype. PMID:20580925

  18. Production of heterozygous alpha 1,3-galactosyltransferase (GGTA1) knock-out transgenic miniature pigs expressing human CD39.

    PubMed

    Choi, Kimyung; Shim, Joohyun; Ko, Nayoung; Eom, Heejong; Kim, Jiho; Lee, Jeong-Woong; Jin, Dong-Il; Kim, Hyunil

    2017-04-01

    Production of transgenic pigs for use as xenotransplant donors is a solution to the severe shortage of human organs for transplantation. The first barrier to successful xenotransplantation is hyperacute rejection, a rapid, massive humoral immune response directed against the pig carbohydrate GGTA1 epitope. Platelet activation, adherence, and clumping, all major features of thrombotic microangiopathy, are inevitable results of immune-mediated transplant rejection. Human CD39 rapidly hydrolyzes ATP and ADP to AMP; AMP is hydrolyzed by ecto-5'-nucleotidase (CD73) to adenosine, an anti-thrombotic and cardiovascular protective mediator. In this study, we developed a vector-based strategy for ablation of GGTA1 function and concurrent expression of human CD39 (hCD39). An hCD39 expression cassette was constructed to target exon 4 of GGTA1. We established heterozygous GGTA1 knock-out cell lines expressing hCD39 from pig ear fibroblasts for somatic cell nuclear transfer (SCNT). We also described production of heterozygous GGTA1 knock-out piglets expressing hCD39 and analyzed expression and function of the transgene. Human CD39 was expressed in heart, kidney and aorta. Human CD39 knock-in heterozygous ear fibroblast from transgenic cloned pigs, but not in non-transgenic pig's cells. Expression of GGTA1 gene was lower in the knock-in heterozygous ear fibroblast from transgenic pigs compared to the non-transgenic pig's cell. The peripheral blood mononuclear cells (PBMC) from the transgenic pigs were more resistant to lysis by pooled complement-preserved normal human serum than that from wild type (WT) pig. Accordingly, GGTA1 mutated piglets expressing hCD39 will provide a new organ source for xenotransplantation research.

  19. Dual CRISPR-Cas9 Cleavage Mediated Gene Excision and Targeted Integration in Yarrowia lipolytica.

    PubMed

    Gao, Difeng; Smith, Spencer; Spagnuolo, Michael; Rodriguez, Gabriel; Blenner, Mark

    2018-05-29

    CRISPR-Cas9 technology has been successfully applied in Yarrowia lipolytica for targeted genomic editing including gene disruption and integration; however, disruptions by existing methods typically result from small frameshift mutations caused by indels within the coding region, which usually resulted in unnatural protein. In this study, a dual cleavage strategy directed by paired sgRNAs is developed for gene knockout. This method allows fast and robust gene excision, demonstrated on six genes of interest. The targeted regions for excision vary in length from 0.3 kb up to 3.5 kb and contain both non-coding and coding regions. The majority of the gene excisions are repaired by perfect nonhomologous end-joining without indel. Based on this dual cleavage system, two targeted markerless integration methods are developed by providing repair templates. While both strategies are effective, homology mediated end joining (HMEJ) based method are twice as efficient as homology recombination (HR) based method. In both cases, dual cleavage leads to similar or improved gene integration efficiencies compared to gene excision without integration. This dual cleavage strategy will be useful for not only generating more predictable and robust gene knockout, but also for efficient targeted markerless integration, and simultaneous knockout and integration in Y. lipolytica. © 2018 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  20. Generation and characterisation of a parkin-Pacrg knockout mouse line and a Pacrg knockout mouse line.

    PubMed

    Stephenson, Sarah E M; Aumann, Timothy D; Taylor, Juliet M; Riseley, Jessica R; Li, Ruili; Mann, Jeffrey R; Tomas, Doris; Lockhart, Paul J

    2018-05-14

    Mutations in PARK2 (parkin) can result in Parkinson's disease (PD). Parkin shares a bidirectional promoter with parkin coregulated gene (PACRG) and the transcriptional start sites are separated by only ~200 bp. Bidirectionally regulated genes have been shown to function in common biological pathways. Mice lacking parkin have largely failed to recapitulate the dopaminergic neuronal loss and movement impairments seen in individuals with parkin-mediated PD. We aimed to investigate the function of PACRG and test the hypothesis that parkin and PACRG function in a common pathway by generating and characterizing two novel knockout mouse lines harbouring loss of both parkin and Pacrg or Pacrg alone. Successful modification of the targeted allele was confirmed at the genomic, transcriptional and steady state protein levels for both genes. At 18-20 months of age, there were no significant differences in the behaviour of parental and mutant lines when assessed by openfield, rotarod and balance beam. Subsequent neuropathological examination suggested there was no gross abnormality of the dopaminergic system in the substantia nigra and no significant difference in the number of dopaminergic neurons in either knockout model compared to wildtype mice.

  1. Identification of rat Rosa26 locus enables generation of knock-in rat lines ubiquitously expressing tdTomato.

    PubMed

    Kobayashi, Toshihiro; Kato-Itoh, Megumi; Yamaguchi, Tomoyuki; Tamura, Chihiro; Sanbo, Makoto; Hirabayashi, Masumi; Nakauchi, Hiromitsu

    2012-11-01

    Recent discovery of a method for derivation and culture of germline-competent rat pluripotent stem cells (PSCs) enables generation of transgenic rats or knock-out rats via genetic modification of such PSCs. This opens the way to use rats, as is routine in mice, for analyses of gene functions or physiological features. In mouse or human, one widely used technique to express a gene of interest stably and ubiquitously is to insert that gene into the Rosa26 locus via gene targeting of PSCs. Rosa26 knock-in mice conditionally expressing a reporter or a toxin gene have contributed to tracing or ablation of specific cell lineages. We successfully identified a rat orthologue of the mouse Rosa26 locus. Insertion of tdTomato, a variant of red fluorescent protein, into the Rosa26 locus of PSCs of various rat strains allows ubiquitous expression of tdTomato. Through germline transmission of one Rosa26-tdTomato knock-in embryonic stem cell line, we also obtained tdTomato knock-in rats. These expressed tdTomato ubiquitously throughout their bodies, which indicates that the rat Rosa26 locus conserves functions of its orthologues in mouse and human. The new tools described here (targeting vectors, knock-in PSCs, and rats) should be useful for a variety of research using rats.

  2. Generation of gene edited birds in one generation using sperm transfection assisted gene editing (STAGE).

    PubMed

    Cooper, Caitlin A; Challagulla, Arjun; Jenkins, Kristie A; Wise, Terry G; O'Neil, Terri E; Morris, Kirsten R; Tizard, Mark L; Doran, Timothy J

    2017-06-01

    Generating transgenic and gene edited mammals involves in vitro manipulation of oocytes or single cell embryos. Due to the comparative inaccessibility of avian oocytes and single cell embryos, novel protocols have been developed to produce transgenic and gene edited birds. While these protocols are relatively efficient, they involve two generation intervals before reaching complete somatic and germline expressing transgenic or gene edited birds. Most of this work has been done with chickens, and many protocols require in vitro culturing of primordial germ cells (PGCs). However, for many other bird species no methodology for long term culture of PGCs exists. Developing methodologies to produce germline transgenic or gene edited birds in the first generation would save significant amounts of time and resource. Furthermore, developing protocols that can be readily adapted to a wide variety of avian species would open up new research opportunities. Here we report a method using sperm as a delivery mechanism for gene editing vectors which we call sperm transfection assisted gene editing (STAGE). We have successfully used this method to generate GFP knockout embryos and chickens, as well as generate embryos with mutations in the doublesex and mab-3 related transcription factor 1 (DMRT1) gene using the CRISPR/Cas9 system. The efficiency of the method varies from as low as 0% to as high as 26% with multiple factors such as CRISPR guide efficiency and mRNA stability likely impacting the outcome. This straightforward methodology could simplify gene editing in many bird species including those for which no methodology currently exists.

  3. INDUCTION OF MAMMARY GLAND DEVELOPMENT IN ESTROGEN RECEPTOR-ALPHA KNOCKOUT MICE

    EPA Science Inventory

    Mammary glands from the estrogen receptor knockout ( ERKO) mouse do not undergo ductal morphogenesis or alveolar development. Disrupted Er signaling may result in reduced estrogen-responsive gene products in the mammary gland or reduced mammotropic hormones that contribute t...

  4. Gene targeting in mosquito cells: a demonstration of 'knockout' technology in extrachromosomal gene arrays

    PubMed Central

    Eggleston, Paul; Zhao, Yuguang

    2001-01-01

    Background Gene targeting would offer a number of advantages over current transposon-based strategies for insect transformation. These include freedom from both position effects associated with quasi-random integration and concerns over transgene instability mediated by endogenous transposases, independence from phylogenetic restrictions on transposon mobility and the ability to generate gene knockouts. Results We describe here our initial investigations of gene targeting in the mosquito. The target site was a hygromycin resistance gene, stably maintained as part of an extrachromosomal array. Using a promoter-trap strategy to enrich for targeted events, a neomycin resistance gene was integrated into the target site. This resulted in knockout of hygromycin resistance concurrent with the expression of high levels of neomycin resistance from the resident promoter. PCR amplification of the targeted site generated a product that was specific to the targeted cell line and consistent with precise integration of the neomycin resistance gene into the 5' end of the hygromycin resistance gene. Sequencing of the PCR product and Southern analysis of cellular DNA subsequently confirmed this molecular structure. Conclusions These experiments provide the first demonstration of gene targeting in mosquito tissue and show that mosquito cells possess the necessary machinery to bring about precise integration of exogenous sequences through homologous recombination. Further development of these procedures and their extension to chromosomally located targets hold much promise for the exploitation of gene targeting in a wide range of medically and economically important insect species. PMID:11513755

  5. Genetic deletion of CB1 receptors improves non-associative learning.

    PubMed

    Degroot, Aldemar; Salhoff, Craig; Davis, Richard J; Nomikos, George G

    2005-07-01

    Habituation (a form of non-associative learning) was measured by assessing locomotion in novel activity monitors in CB1 receptor knockout mice and juxtaposed to habituation measured in muscarinic M2, M4, and double M2/M4 receptor knockout mice. M2 and M2/M4, but not M4, receptor knockout mice appeared to have an impaired ability to habituate, whereas CB1 receptor knockout mice showed enhanced habituation compared to wild-type animals. We conclude that CB1 receptor gene invalidation improves habituation tentatively through an increase in cholinergic neurotransmission.

  6. Reduced extinction of hippocampal-dependent memories in CPEB knockout mice.

    PubMed

    Berger-Sweeney, Joanne; Zearfoss, N Ruth; Richter, Joel D

    2006-01-01

    CPEB is a sequence-specific RNA binding protein that regulates translation at synapses. In neurons of CPEB knockout mice, synaptic efficacy is reduced. Here, we have performed a battery of behavioral tests and find that relative to wild-type animals, CPEB knockout mice, although similar on many baseline behaviors, have reduced extinction of memories on two hippocampal-dependent tasks. A corresponding microarray analysis reveals that about 0.14% of hippocampal genes have an altered expression in the CPEB knockout mouse. These data suggest that CPEB-dependent local protein synthesis may be an important cellular mechanism underlying extinction of hippocampal-dependent memories.

  7. Deconstructing mammalian reproduction: using knockouts to define fertility pathways.

    PubMed

    Roy, Angshumoy; Matzuk, Martin M

    2006-02-01

    Reproduction is the sine qua non for the propagation of species and continuation of life. It is a complex biological process that is regulated by multiple factors during the reproductive life of an organism. Over the past decade, the molecular mechanisms regulating reproduction in mammals have been rapidly unraveled by the study of a vast number of mouse gene knockouts with impaired fertility. The use of reverse genetics to generate null mutants in mice through targeted disruption of specific genes has enabled researchers to identify essential regulators of spermatogenesis and oogenesis in vivo and model human disorders affecting reproduction. This review focuses on the merits, utility, and the variations of the knockout technology in studies of reproduction in mammals.

  8. [Construction of EZH2 Knockout Animal Model by CRISPR/Cas9 Technology].

    PubMed

    Meng, Fanrong; Zhao, Dan; Zhou, Qinghua; Liu, Zhe

    2018-05-20

    It has been proven that CRISPR/Cas9 (Clustered Regularly Interspaced Short Palindromic Repeats/CRISPR-associated 9) system was the modern gene-editing technology through the constitutive expression of nucleases Cas9 in the mammalian, which binds to the specific site in the genome mediated by single-guide RNA (sgRNA) at desired genomic loci. The aim of this study is that the animal model of EZH2 gene knockout was constructed using CRISPR/Cas9 technology. In this study, we designed two single-guide RNAs targeting the Exon3 and Exon4 of EZH2 gene. Then, their gene-targeting efficiency were detected by SURVEYOR assay. The lentivirus was perfused into the lungs of mice by using a bronchial tube and detected by immunohistochemistry and qRT-PCR. The experimental results of NIH-3T3 cells verify that the designed sgEZH2 can efficiently effect the cleavage of target DNA by Cas9 in vitro. The immunohistochemistry and qRT-PCR results showed that the EZH2 expression in experimental group was significantly decreased in the mouse lung tissue. The study successfully designed two sgRNA which can play a knock-out EZH2 function. An EZH2 knockout animal model was successfully constructed by CRISPR/Cas9 system, and it will be an effective animal model for studying the functions and mechanisms of EZH2.

  9. Targeted Disruption of the Basic Krüppel-Like Factor Gene (Klf3) Reveals a Role in Adipogenesis ▿ †

    PubMed Central

    Sue, Nancy; Jack, Briony H. A.; Eaton, Sally A.; Pearson, Richard C. M.; Funnell, Alister P. W.; Turner, Jeremy; Czolij, Robert; Denyer, Gareth; Bao, Shisan; Molero-Navajas, Juan Carlos; Perkins, Andrew; Fujiwara, Yuko; Orkin, Stuart H.; Bell-Anderson, Kim; Crossley, Merlin

    2008-01-01

    Krüppel-like factors (KLFs) recognize CACCC and GC-rich sequences in gene regulatory elements. Here, we describe the disruption of the murine basic Krüppel-like factor gene (Bklf or Klf3). Klf3 knockout mice have less white adipose tissue, and their fat pads contain smaller and fewer cells. Adipocyte differentiation is altered in murine embryonic fibroblasts from Klf3 knockouts. Klf3 expression was studied in the 3T3-L1 cellular system. Adipocyte differentiation is accompanied by a decline in Klf3 expression, and forced overexpression of Klf3 blocks 3T3-L1 differentiation. Klf3 represses transcription by recruiting C-terminal binding protein (CtBP) corepressors. CtBPs bind NADH and may function as metabolic sensors. A Klf3 mutant that does not bind CtBP cannot block adipogenesis. Other KLFs, Klf2, Klf5, and Klf15, also regulate adipogenesis, and functional CACCC elements occur in key adipogenic genes, including in the C/ebpα promoter. We find that C/ebpα is derepressed in Klf3 and Ctbp knockout fibroblasts and adipocytes from Klf3 knockout mice. Chromatin immunoprecipitations confirm that Klf3 binds the C/ebpα promoter in vivo. These results implicate Klf3 and CtBP in controlling adipogenesis. PMID:18391014

  10. Changes in the expression of neurotransmitter receptors in Parkin and DJ-1 knockout mice--A quantitative multireceptor study.

    PubMed

    Cremer, J N; Amunts, K; Schleicher, A; Palomero-Gallagher, N; Piel, M; Rösch, F; Zilles, K

    2015-12-17

    Parkinson's disease (PD) is a well-characterized neurological disorder with regard to its neuropathological and symptomatic appearance. At the genetic level, mutations of particular genes, e.g. Parkin and DJ-1, were found in human hereditary PD with early onset. Neurotransmitter receptors constitute decisive elements in neural signal transduction. Furthermore, since they are often altered in neurological and psychiatric diseases, receptors have been successful targets for pharmacological agents. However, the consequences of PD-associated gene mutations on the expression of transmitter receptors are largely unknown. Therefore, we studied the expression of 16 different receptor binding sites of the neurotransmitters glutamate, GABA, acetylcholine, adrenaline, serotonin, dopamine and adenosine by means of quantitative receptor autoradiography in Parkin and DJ-1 knockout mice. These knockout mice exhibit electrophysiological and behavioral deficits, but do not show the typical dopaminergic cell loss. We demonstrated differential changes of binding site densities in eleven brain regions. Most prominently, we found an up-regulation of GABA(B) and kainate receptor densities in numerous cortical areas of Parkin and DJ-1 knockout mice, as well as increased NMDA but decreased AMPA receptor densities in different brain regions of the Parkin knockout mice. The alterations of three different glutamate receptor types may indicate the potential relevance of the glutamatergic system in the pathogenesis of PD. Furthermore, the cholinergic M1, M2 and nicotinic receptors as well as the adrenergic α2 and the adenosine A(2A) receptors showed differentially increased densities in Parkin and DJ-1 knockout mice. Taken together, knockout of the PD-associated genes Parkin or DJ-1 results in differential changes of neurotransmitter receptor densities, highlighting a possible role of altered non-dopaminergic, and in particular of glutamatergic neurotransmission in PD pathogenesis. Copyright © 2015 IBRO. Published by Elsevier Ltd. All rights reserved.

  11. A Mutation in the Dmp1 Gene Alters Phosphate Responsiveness in Mice

    PubMed Central

    Gerard-O'Riley, Rita L.; Acton, Dena; McQueen, Amie K.; Strobel, Isabel E.; Witcher, Phillip C.; Feng, Jian Q.; Econs, Michael J.

    2017-01-01

    Mutations in the dentin matrix protein 1 (DMP1) gene cause autosomal recessive hypophosphatemic rickets (ARHR). Hypophosphatemia in ARHR results from increased circulating levels of the phosphaturic hormone, fibroblast growth factor 23 (FGF23). Similarly, elevated FGF23, caused by mutations in the PHEX gene, is responsible for the hypophosphatemia in X-linked hypophosphatemic rickets (XLH). Previously, we demonstrated that a Phex mutation in mice creates a lower set point for extracellular phosphate, where an increment in phosphorus further stimulates Fgf23 production to maintain low serum phosphorus levels. To test the presence of the similar set point defect in ARHR, we generated 4- and 12-week-old Dmp1/Galnt3 double knockout mice and controls, including Dmp1 knockout mice (a murine model of ARHR), Galnt3 knockout mice (a murine model of familial tumoral calcinosis), and phenotypically normal double heterozygous mice. Galnt3 knockout mice had increased proteolytic cleavage of Fgf23, leading to low circulating intact Fgf23 levels with consequent hyperphosphatemia. In contrast, Dmp1 knockout mice had little Fgf23 cleavage and increased femoral Fgf23 expression, resulting in hypophosphatemia and low femoral bone mineral density (BMD). However, introduction of the Galnt3 null allele to Dmp1 knockout mice resulted in a significant increase in serum phosphorus and normalization of BMD. This increased serum phosphorus was accompanied by markedly elevated Fgf23 expression and circulating Fgf23 levels, an attempt to reduce serum phosphorus in the face of improving phosphorus levels. These data indicate that a Dmp1 mutation creates a lower set point for extracellular phosphate and maintains it through the regulation of Fgf23 cleavage and expression. PMID:28005411

  12. A Mutation in the Dmp1 Gene Alters Phosphate Responsiveness in Mice.

    PubMed

    Ichikawa, Shoji; Gerard-O'Riley, Rita L; Acton, Dena; McQueen, Amie K; Strobel, Isabel E; Witcher, Phillip C; Feng, Jian Q; Econs, Michael J

    2017-03-01

    Mutations in the dentin matrix protein 1 (DMP1) gene cause autosomal recessive hypophosphatemic rickets (ARHR). Hypophosphatemia in ARHR results from increased circulating levels of the phosphaturic hormone, fibroblast growth factor 23 (FGF23). Similarly, elevated FGF23, caused by mutations in the PHEX gene, is responsible for the hypophosphatemia in X-linked hypophosphatemic rickets (XLH). Previously, we demonstrated that a Phex mutation in mice creates a lower set point for extracellular phosphate, where an increment in phosphorus further stimulates Fgf23 production to maintain low serum phosphorus levels. To test the presence of the similar set point defect in ARHR, we generated 4- and 12-week-old Dmp1/Galnt3 double knockout mice and controls, including Dmp1 knockout mice (a murine model of ARHR), Galnt3 knockout mice (a murine model of familial tumoral calcinosis), and phenotypically normal double heterozygous mice. Galnt3 knockout mice had increased proteolytic cleavage of Fgf23, leading to low circulating intact Fgf23 levels with consequent hyperphosphatemia. In contrast, Dmp1 knockout mice had little Fgf23 cleavage and increased femoral Fgf23 expression, resulting in hypophosphatemia and low femoral bone mineral density (BMD). However, introduction of the Galnt3 null allele to Dmp1 knockout mice resulted in a significant increase in serum phosphorus and normalization of BMD. This increased serum phosphorus was accompanied by markedly elevated Fgf23 expression and circulating Fgf23 levels, an attempt to reduce serum phosphorus in the face of improving phosphorus levels. These data indicate that a Dmp1 mutation creates a lower set point for extracellular phosphate and maintains it through the regulation of Fgf23 cleavage and expression. Copyright © 2017 by the Endocrine Society.

  13. Effects of HAb18G/CD147 knockout on hepatocellular carcinoma cells in vitro using a novel zinc-finger nuclease-targeted gene knockout approach.

    PubMed

    Li, Hong-Wei; Yang, Xiang-Min; Tang, Juan; Wang, Shi-Jie; Chen, Zhi-Nan; Jiang, Jian-Li

    2015-03-01

    HAb18G/CD147 belongs to the immunoglobulin superfamily and predominantly functions as an inducer of matrix metalloproteinase secretion for tumor invasion and metastasis. This study was designed to investigate the effects of HAb18G/CD147 knockout on hepatocellular carcinoma cells using zinc-finger nuclease (ZFNs)-targeted gene knockout approach. The HCC cell line SMMC-7721 was used for ZFNs-targeted cleavage of the HAb18G/CD147 gene. RT-PCR and Western blot assays were used to detect HAb18G/CD147 expression. HAb18G phenotypic changes following HAb18G/CD147 knockout in SMMC-K7721 cells were assessed using tumor cell adhesion, invasion, migration and colony formation and flow cytometric assays. These data demonstrated that tumor cell adhesion, invasion, migration, and colony formation capabilities of SMMC-K7721 were significantly reduced compared to parental cells or SMMC-7721 with re-expression of HAb18G/CD147 protein transfected with HAb18G/CD147 cDNA. Moreover, knockout of HAb18G/CD147 expression also induced SMMC-K7721 cells to undergo apoptosis compared to SMMC-7721 and SMMC-R7721 (P < 0.01). Molecularly, protein expression of p53 was induced in these cells, but re-expression of HAb18G/CD147 reduced p53 levels in SMMC-R7721 cells, possibly through inhibition of the PI3K-Akt-MDM2 signaling pathway. The findings provide a novel insight into the mechanisms underlying HAb18G/CD147-induced progression of HCC cells.

  14. A modulatory role of the Rax homeobox gene in mature pineal gland function: Investigating the photoneuroendocrine circadian system of a Rax conditional knockout mouse.

    PubMed

    Rohde, Kristian; Bering, Tenna; Furukawa, Takahisa; Rath, Martin Fredensborg

    2017-10-01

    The retinal and anterior neural fold homeobox gene (Rax) controls development of the eye and the forebrain. Postnatal expression of Rax in the brain is restricted to the pineal gland, a forebrain structure devoted to melatonin synthesis. The role of Rax in pineal function is unknown. In order to investigate the role of Rax in pineal function while circumventing forebrain abnormalities of the global Rax knockout, we generated an eye and pineal-specific Rax conditional knockout mouse. Deletion of Rax in the pineal gland did not affect morphology of the gland, suggesting that Rax is not essential for pineal gland development. In contrast, deletion of Rax in the eye generated an anophthalmic phenotype. In addition to the loss of central visual pathways, the suprachiasmatic nucleus of the hypothalamus housing the circadian clock was absent, indicating that the retinohypothalamic tract is required for the nucleus to develop. Telemetric analyses confirmed the lack of a functional circadian clock. Arylalkylamine N-acetyltransferase (Aanat) transcripts, encoding the melatonin rhythm-generating enzyme, were undetectable in the pineal gland of the Rax conditional knockout under normal conditions, whereas the paired box 6 homeobox gene, known to regulate pineal development, was up-regulated. By injecting isoproterenol, which mimics a nocturnal situation in the pineal gland, we were able to induce pineal expression of Aanat in the Rax conditional knockout mouse, but Aanat transcript levels were significantly lower than those of Rax-proficient mice. Our data suggest that Rax controls pineal gene expression and via Aanat may modulate melatonin synthesis. © 2017 International Society for Neurochemistry.

  15. The Xanthomonas oryzae pv. oryzae PhoPQ Two-Component System Is Required for AvrXA21 Activity, hrpG Expression, and Virulence▿ †

    PubMed Central

    Lee, Sang-Won; Jeong, Kyu-Sik; Han, Sang-Wook; Lee, Seung-Eun; Phee, Bong-Kwan; Hahn, Tae-Ryong; Ronald, Pamela

    2008-01-01

    The rice pathogen recognition receptor, XA21, confers resistance to Xanthomonas oryzae pv. oryzae strains producing the type one system-secreted molecule, AvrXA21. X. oryzae pv. oryzae requires a regulatory two-component system (TCS) called RaxRH to regulate expression of eight rax (required for AvrXA21 activity) genes and to sense population cell density. To identify other key components in this critical regulatory circuit, we assayed proteins expressed in a raxR gene knockout strain. This survey led to the identification of the phoP gene encoding a response regulator that is up-regulated in the raxR knockout strain. Next we generated a phoP knockout strain and found it to be impaired in X. oryzae pv. oryzae virulence and no longer able to activate the response regulator HrpG (hypersensitive reaction and pathogenicity G) in response to low levels of Ca2+. The impaired virulence of the phoP knockout strain can be partially complemented by constitutive expression of hrpG, indicating that PhoP controls a key aspect of X. oryzae pv. oryzae virulence through regulation of hrpG. A gene encoding the cognate putative histidine protein kinase, phoQ, was also isolated. Growth curve analysis revealed that AvrXA21 activity is impaired in a phoQ knockout strain as reflected by enhanced growth of this strain in rice lines carrying XA21. These results suggest that the X. oryzae pv. oryzae PhoPQ TCS functions in virulence and in the production of AvrXA21 in partnership with RaxRH. PMID:18203830

  16. Spermatogenic Cell-Specific Gene Mutation in Mice via CRISPR-Cas9.

    PubMed

    Bai, Meizhu; Liang, Dan; Wang, Yinghua; Li, Qing; Wu, Yuxuan; Li, Jinsong

    2016-05-20

    Tissue-specific knockout technology enables the analysis of the gene function in specific tissues in adult mammals. However, conventional strategy for producing tissue-specific knockout mice is a time- and labor-consuming process, restricting rapid study of the gene function in vivo. CRISPR-Cas9 system from bacteria is a simple and efficient gene-editing technique, which has enabled rapid generation of gene knockout lines in mouse by direct injection of CRISPR-Cas9 into zygotes. Here, we demonstrate CRISPR-Cas9-mediated spermatogenic cell-specific disruption of Scp3 gene in testes in one step. We first generated transgenic mice by pronuclear injection of a plasmid containing Hspa2 promoter driving Cas9 expression and showed Cas9 specific expression in spermatogenic cells. We then produced transgenic mice carrying Hspa2 promoter driven Cas9 and constitutive expressed sgRNA targeting Scp3 gene. Male founders were infertile due to developmental arrest of spermatogenic cells while female founders could produce progeny normally. Consistently, male progeny from female founders were infertile and females could transmit the transgenes to the next generation. Our study establishes a CRISPR-Cas9-based one-step strategy to analyze the gene function in adult tissues by a temporal-spatial pattern. Copyright © 2016 Institute of Genetics and Developmental Biology, Chinese Academy of Sciences, and Genetics Society of China. Published by Elsevier Ltd. All rights reserved.

  17. The combinational use of CRISPR/Cas9-based gene editing and targeted toxin technology enables efficient biallelic knockout of the α-1,3-galactosyltransferase gene in porcine embryonic fibroblasts.

    PubMed

    Sato, Masahiro; Miyoshi, Kazuchika; Nagao, Yozo; Nishi, Yohei; Ohtsuka, Masato; Nakamura, Shingo; Sakurai, Takayuki; Watanabe, Satoshi

    2014-01-01

    The recent development of the type II clustered regularly interspaced short palindromic repeats (CRISPR)/Cas9 system has enabled genome editing of mammalian genomes including those of mice and human; however, its applicability and efficiency in the pig have not been studied in depth. Here, using the CRISPR/Cas9 system, we aimed to destroy the function of the porcine α-1,3-galactosyltransferase (α-GalT) gene (GGTA1) whose product is responsible for the synthesis of the α-Gal epitope, a causative agent for hyperacute rejection upon pig-to-human xenotransplantation. Porcine embryonic fibroblasts were transfected with a Cas9 expression vector and guide RNA specifically designed to target GGTA1. At 4 days after transfection, the cells were incubated with IB4 conjugated with saporin (IB4SAP), which eliminates α-Gal epitope-expressing cells. Therefore, the cells surviving after IB4SAP treatment would be those negative for α-Gal epitope expression, which in turn indicates the generation of GGTA1 biallelic knockout (KO) cells. Of the 1.0 × 10(6) cells transfected, 10-33 colonies survived after IB4SAP treatment, and almost all colonies (approximately 90%) were negative for staining with red fluorescence-labeled IB4. Sequencing of the mutated portion of GGTA1 revealed a frameshift of the α-GalT protein. Porcine blastocysts derived from the somatic cell nuclear transfer of these α-Gal epitope-negative cells also lacked the α-Gal epitope on their surface. These results demonstrated that the CRISPR/Cas9 system can efficiently induce the biallelic conversion of GGTA1 in the resulting somatic cells and is thus a promising tool for the creation of KO cloned piglets. © 2014 John Wiley & Sons A/S.

  18. The effect of PDIA3 gene knockout on the mucosal immune function in IBS rats.

    PubMed

    Zhuang, Zhao-Meng; Wang, Xiao-Teng; Zhang, Lu; Tao, Li-Yuan; Lv, Bin

    2015-01-01

    To observe the changes of intestinal inflammation on PDIA3 gene knockout IBS rats and its effect on immune function. 36 SD rats were randomly divided into four groups: the control group (n = 8); IBS- empty virus group (IBS-GFP, which); IBS-PDIA3 knockout group (n = 12); IBS- the control group (n = 12). After modeling, colon and ileocecal tissue pathology in each group were observed separately. Changes of immune and inflammatory markers were measured. At the same time, ultrastructural changes in each group were observed by electron microscopy. Compared with the IBS control group, inflammation was reduced significantly in IBS-PDIA3 knockout group. IgE, IL-4 and IL-9 and the level of intestinal trypsin type were decreased significantly. Furthermore, mast cell degranulation and PAR 2 receptor reduced significantly. PDIA3 may play an important role in the development of IBS by mediating through immune responses of mucosal abnormalities. However, the mechanism needs to be confirmed in further study.

  19. Efficient targeted multiallelic mutagenesis in tetraploid potato (Solanum tuberosum) by transient CRISPR-Cas9 expression in protoplasts.

    PubMed

    Andersson, Mariette; Turesson, Helle; Nicolia, Alessandro; Fält, Ann-Sofie; Samuelsson, Mathias; Hofvander, Per

    2017-01-01

    Altered starch quality with full knockout of GBSS gene function in potato was achieved using CRISPR-Cas9 technology, through transient transfection and regeneration from isolated protoplasts. Site-directed mutagenesis (SDM) has shown great progress in introducing precisely targeted mutations. Engineered CRISPR-Cas9 has received increased focus compared to other SDM techniques, since the method is easily adapted to different targets. Here, we demonstrate that transient application of CRISPR-Cas9-mediated genome editing in protoplasts of tetraploid potato (Solanum tuberosum) yielded mutations in all four alleles in a single transfection, in up to 2 % of regenerated lines. Three different regions of the gene encoding granule-bound starch synthase (GBSS) were targeted under different experimental setups, resulting in mutations in at least one allele in 2-12 % of regenerated shoots, with multiple alleles mutated in up to 67 % of confirmed mutated lines. Most mutations resulted in small indels of 1-10 bp, but also vector DNA inserts of 34-236 bp were found in 10 % of analysed lines. No mutations were found in an allele diverging one bp from a used guide sequence, verifying similar results found in other plants that high homology between guide sequence and target region near the protospacer adjacent motif (PAM) site is essential. To meet the challenge of screening large numbers of lines, a PCR-based high-resolution fragment analysis method (HRFA) was used, enabling identification of multiple mutated alleles with a resolution limit of 1 bp. Full knockout of GBSS enzyme activity was confirmed in four-allele mutated lines by phenotypic studies of starch. One remaining wild-type (WT) allele was shown sufficient to maintain enough GBSS enzyme activity to produce significant amounts of amylose.

  20. Functions of Tenascin-C and Integrin alpha9beta1 in Mediating Prostate Cancer Bone Metastasis

    DTIC Science & Technology

    2017-10-01

    additional engineered cell lines for verification and we plan to also generate stable knockout cell lines using CRISPR /Cas 9 gene editing technology...addition to the proposed study, we plan to also produce VCaP cells that are null (knockout) for alpha 9 integrin using CRISPR /Cas9 gene editing protocols...We are experienced with CRISPR -Cas knockdown and have successfully engineered cells previously. We do not expect any particular difficulty in

  1. A Simple Retroelement Based Knock-Down System in Dictyostelium: Further Insights into RNA Interference Mechanisms.

    PubMed

    Friedrich, Michael; Meier, Doreen; Schuster, Isabelle; Nellen, Wolfgang

    2015-01-01

    We have previously shown that the most abundant Dictyostelium discoideum retroelement DIRS-1 is suppressed by RNAi mechanisms. Here we provide evidence that both inverted terminal repeats have strong promoter activity and that bidirectional expression apparently generates a substrate for Dicer. A cassette containing the inverted terminal repeats and a fragment of a gene of interest was sufficient to activate the RNAi response, resulting in the generation of ~21 nt siRNAs, a reduction of mRNA and protein expression of the respective endogene. Surprisingly, no transitivity was observed on the endogene. This was in contrast to previous observations, where endogenous siRNAs caused spreading on an artificial transgene. Knock-down was successful on seven target genes that we examined. In three cases a phenotypic analysis proved the efficiency of the approach. One of the target genes was apparently essential because no knock-out could be obtained; the RNAi mediated knock-down, however, resulted in a very slow growing culture indicating a still viable reduction of gene expression. ADVANTAGES OF THE DIRS-1–RNAI SYSTEM: The knock-down system required a short DNA fragment (~400 bp) of the target gene as an initial trigger. Further siRNAs were generated by RdRPs since we have shown some siRNAs with a 5'-triphosphate group. Extrachromosomal vectors facilitate the procedure and allowed for molecular and phenotypic analysis within one week. The system provides an efficient and rapid method to reduce protein levels including those of essential genes.

  2. Independent effects of apolipoprotein AV and apolipoprotein CIII on plasma triglyceride concentrations

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Baroukh, Nadine N.; Bauge, Eric; Akiyama, Jennifer

    2003-08-15

    Both the apolipoprotein A5 and C3 genes have repeatedly been shown to play an important role in determining plasma triglyceride concentrations in humans and mice. In mice, transgenic and knockout experiments indicate that plasma triglyceride levels are negatively and positively correlated with APOA5 and APOC3 expression, respectively. In humans, common polymorphisms in both genes have also been associated with plasma triglyceride concentrations. The evolutionary relationship among these two apolipoprotein genes and their close proximity on human chromosome 11q23 have largely precluded the determination of their relative contribution to altered Both the apolipoprotein A5 and C3 genes have repeatedly been shownmore » to play an important role in determining plasma triglyceride concentrations in humans and mice. In mice, transgenic and knockout experiments indicate that plasma triglyceride levels are negatively and positively correlated with APOA5 and APOC3 expression, respectively. In humans, common polymorphisms in both genes have also been associated with plasma triglyceride concentrations. The evolutionary relationship among these two apolipoprotein genes and their close proximity on human chromosome 11q23 have largely precluded the determination of their relative contribution to altered triglycerides. To overcome these confounding factors and address their relationship, we generated independent lines of mice that either over-expressed (''double transgenic'') or completely lacked (''double knockout'') both apolipoprotein genes. We report that both ''double transgenic'' and ''double knockout'' mice display intermedia tetriglyceride concentrations compared to over-expression or deletion of either gene alone. Furthermore, we find that human ApoAV plasma protein levels in the ''double transgenic'' mice are approximately 500-fold lower than human ApoCIII levels, supporting ApoAV is a potent triglyceride modulator despite its low concentration. Together, these data indicate that APOA5 and APOC3 independently influence plasma triglyceride concentrations but in an opposing manner.« less

  3. Geno- and phenotypic characteristics of a transfected babesia bovis 6-Cys-E knockout clonal line

    USDA-ARS?s Scientific Manuscript database

    Babesia bovis is an intra-erythrocytic tick transmitted apicomplexan protozoan parasite. It has a complex life style including asexual replication in the mammalian host and sexual replication occurring in the midgut of host tick vector, typically, Rhipicephalus microplus. Previous evidence showed th...

  4. Modulation of taste responsiveness by the satiation hormone peptide YY

    PubMed Central

    La Sala, Michael S.; Hurtado, Maria D.; Brown, Alicia R.; Bohórquez, Diego V.; Liddle, Rodger A.; Herzog, Herbert; Zolotukhin, Sergei; Dotson, Cedrick D.

    2013-01-01

    It has been hypothesized that the peripheral taste system may be modulated in the context of an animal's metabolic state. One purported mechanism for this phenomenon is that circulating gastrointestinal peptides modulate the functioning of the peripheral gustatory system. Recent evidence suggests endocrine signaling in the oral cavity can influence food intake (FI) and satiety. We hypothesized that these hormones may be affecting FI by influencing taste perception. We used immunohistochemistry along with genetic knockout models and the specific reconstitution of peptide YY (PYY) in saliva using gene therapy protocols to identify a role for PYY signaling in taste. We show that PYY is expressed in subsets of taste cells in murine taste buds. We also show, using brief-access testing with PYY knockouts, that PYY signaling modulates responsiveness to bitter-tasting stimuli, as well as to lipid emulsions. We show that salivary PYY augmentation, via viral vector therapy, rescues behavioral responsiveness to a lipid emulsion but not to bitter stimuli and that this response is likely mediated via activation of Y2 receptors localized apically in taste cells. Our findings suggest distinct functions for PYY produced locally in taste cells vs. that circulating systemically.—La Sala, M. S., Hurtado, M. D., Brown, A. R., Bohórquez, D. V., Liddle, R. A., Herzog, H., Zolotukhin, S., Dotson, C. D. Modulation of taste responsiveness by the satiation hormone peptide YY. PMID:24043261

  5. Random transposon mutagenesis of the Saccharopolyspora erythraea genome reveals additional genes influencing erythromycin biosynthesis

    PubMed Central

    Fedashchin, Andrij; Cernota, William H.; Gonzalez, Melissa C.; Leach, Benjamin I.; Kwan, Noelle; Wesley, Roy K.; Weber, J. Mark

    2015-01-01

    A single cycle of strain improvement was performed in Saccharopolyspora erythraea mutB and 15 genotypes influencing erythromycin production were found. Genotypes generated by transposon mutagenesis appeared in the screen at a frequency of ∼3%. Mutations affecting central metabolism and regulatory genes were found, as well as hydrolases, peptidases, glycosyl transferases and unknown genes. Only one mutant retained high erythromycin production when scaled-up from micro-agar plug fermentations to shake flasks. This mutant had a knockout of the cwh1 gene (SACE_1598), encoding a cell-wall-associated hydrolase. The cwh1 knockout produced visible growth and morphological defects on solid medium. This study demonstrated that random transposon mutagenesis uncovers strain improvement-related genes potentially useful for strain engineering. PMID:26468041

  6. The normal function of a speciation gene, Odysseus, and its hybrid sterility effect.

    PubMed

    Sun, Sha; Ting, Chau-Ti; Wu, Chung-I

    2004-07-02

    To understand how postmating isolation is connected to the normal process of species divergence and why hybrid male sterility is often the first sign of speciation, we analyzed the Odysseus (OdsH) gene of hybrid male sterility in Drosophila. We carried out expression analysis, transgenic study, and gene knockout. The combined evidence suggests that the sterility phenotype represents a novel manifestation of the gene function rather than the reduction or loss of the normal one. The gene knockout experiment identified the normal function of OdsH as a modest enhancement of sperm production in young males. The implication of a weak effect of OdsH on the normal phenotype but a strong influence on hybrid male sterility is discussed in light of Haldane's rule of postmating isolation.

  7. Co-regulation of intragenic microRNA miR-153 and its host gene Ia-2 β: identification of miR-153 target genes with functions related to IA-2β in pancreas and brain.

    PubMed

    Mandemakers, W; Abuhatzira, L; Xu, H; Caromile, L A; Hébert, S S; Snellinx, A; Morais, V A; Matta, S; Cai, T; Notkins, A L; De Strooper, B

    2013-07-01

    We analysed the genomic organisation of miR-153, a microRNA embedded in genes that encode two of the major type 1 diabetes autoantigens, islet-associated protein (IA)-2 and IA-2β. We also identified miR-153 target genes that correlated with IA-2β localisation and function. A bioinformatics approach was used to identify miR-153's genomic organisation. To analyse the co-regulation of miR-153 and IA-2β, quantitative PCR analysis of miR-153 and Ia-2β (also known as Ptprn2) was performed after a glucose stimulation assay in MIN6B cells and isolated murine pancreatic islets, and also in wild-type Ia-2 (also known as Ptprn), Ia-2β single knockout and Ia-2/Ia-2β double knockout mouse brain and pancreatic islets. Bioinformatics identification of miR-153 target genes and validation via luciferase reporter assays, western blotting and quantitative PCR were also carried out. Two copies of miR-153, miR-153-1 and miR-153-2, are localised in intron 19 of Ia-2 and Ia-2β, respectively. In rodents, only miR-153-2 is conserved. We demonstrated that expression of miR-153-2 and Ia-2β in rodents is partially co-regulated as demonstrated by a strong reduction of miR-153 expression levels in Ia-2β knockout and Ia-2/Ia-2β double knockout mice. miR-153 levels were unaffected in Ia-2 knockout mice. In addition, glucose stimulation, which increases Ia-2 and Ia-2β expression, also significantly increased expression of miR-153. Several predicted targets of miR-153 were reduced after glucose stimulation in vitro, correlating with the increase in miR-153 levels. This study suggests the involvement of miR-153, IA-2β and miR-153 target genes in a regulatory network, which is potentially relevant to insulin and neurotransmitter release.

  8. Identification of Lactobacillus sakei genes induced during meat fermentation and their role in survival and growth.

    PubMed

    Hüfner, Eric; Markieton, Tobias; Chaillou, Stéphane; Crutz-Le Coq, Anne-Marie; Zagorec, Monique; Hertel, Christian

    2007-04-01

    Lactobacillus sakei is a lactic acid bacterium that is ubiquitous in the food environment and is one of the most important constituents of commercial meat starter cultures. In this study, in vivo expression technology (IVET) was applied to investigate gene expression of L. sakei 23K during meat fermentation. The IVET vector used (pEH100) contained promoterless and transcriptionally fused reporter genes mediating beta-glucuronidase activity and erythromycin resistance. A genomic library of L. sakei 23K was established, and the clones were subjected to fermentation in a raw-sausage model. Fifteen in carne-induced fusions were identified. Several genes encoded proteins which are likely to contribute to stress-related functions. One of these genes was involved in acquisition of ammonia from amino acids, and the remaining either were part of functionally unrelated pathways or encoded hypothetical proteins. The construction and use of isogenic mutants in the sausage model suggested that four genes have an impact on the performance of L. sakei during raw-sausage fermentation. Inactivation of the heat shock regulator gene ctsR resulted in increased growth, whereas knockout of the genes asnA2, LSA1065, and LSA1194 resulted in attenuated performance compared to the wild-type strain. The results of our study are the first to provide an insight into the transcriptional response of L. sakei when growing in the meat environment. In addition, this study establishes a molecular basis which allows investigation of bacterial properties that are likely to contribute to the ecological performance of the organism and to influence the final outcome of sausage fermentation.

  9. Generation of knockout rabbits using transcription activator-like effector nucleases.

    PubMed

    Wang, Yu; Fan, Nana; Song, Jun; Zhong, Juan; Guo, Xiaogang; Tian, Weihua; Zhang, Quanjun; Cui, Fenggong; Li, Li; Newsome, Philip N; Frampton, Jon; Esteban, Miguel A; Lai, Liangxue

    2014-01-01

    Zinc-finger nucleases and transcription activator-like effector nucleases are novel gene-editing platforms contributing to redefine the boundaries of modern biological research. They are composed of a non-specific cleavage domain and a tailor made DNA-binding module, which enables a broad range of genetic modifications by inducing efficient DNA double-strand breaks at desired loci. Among other remarkable uses, these nucleases have been employed to produce gene knockouts in mid-size and large animals, such as rabbits and pigs, respectively. This approach is cost effective, relatively quick, and can produce invaluable models for human disease studies, biotechnology or agricultural purposes. Here we describe a protocol for the efficient generation of knockout rabbits using transcription activator-like effector nucleases, and a perspective of the field.

  10. A Convenient Cas9-based Conditional Knockout Strategy for Simultaneously Targeting Multiple Genes in Mouse.

    PubMed

    Chen, Jiang; Du, Yinan; He, Xueyan; Huang, Xingxu; Shi, Yun S

    2017-03-31

    The most powerful way to probe protein function is to characterize the consequence of its deletion. Compared to conventional gene knockout (KO), conditional knockout (cKO) provides an advanced gene targeting strategy with which gene deletion can be performed in a spatially and temporally restricted manner. However, for most species that are amphiploid, the widely used Cre-flox conditional KO (cKO) system would need targeting loci in both alleles to be loxP flanked, which in practice, requires time and labor consuming breeding. This is considerably significant when one is dealing with multiple genes. CRISPR/Cas9 genome modulation system is advantaged in its capability in targeting multiple sites simultaneously. Here we propose a strategy that could achieve conditional KO of multiple genes in mouse with Cre recombinase dependent Cas9 expression. By transgenic construction of loxP-stop-loxP (LSL) controlled Cas9 (LSL-Cas9) together with sgRNAs targeting EGFP, we showed that the fluorescence molecule could be eliminated in a Cre-dependent manner. We further verified the efficacy of this novel strategy to target multiple sites by deleting c-Maf and MafB simultaneously in macrophages specifically. Compared to the traditional Cre-flox cKO strategy, this sgRNAs-LSL-Cas9 cKO system is simpler and faster, and would make conditional manipulation of multiple genes feasible.

  11. Identification of genetic elements in metabolism by high-throughput mouse phenotyping.

    PubMed

    Rozman, Jan; Rathkolb, Birgit; Oestereicher, Manuela A; Schütt, Christine; Ravindranath, Aakash Chavan; Leuchtenberger, Stefanie; Sharma, Sapna; Kistler, Martin; Willershäuser, Monja; Brommage, Robert; Meehan, Terrence F; Mason, Jeremy; Haselimashhadi, Hamed; Hough, Tertius; Mallon, Ann-Marie; Wells, Sara; Santos, Luis; Lelliott, Christopher J; White, Jacqueline K; Sorg, Tania; Champy, Marie-France; Bower, Lynette R; Reynolds, Corey L; Flenniken, Ann M; Murray, Stephen A; Nutter, Lauryl M J; Svenson, Karen L; West, David; Tocchini-Valentini, Glauco P; Beaudet, Arthur L; Bosch, Fatima; Braun, Robert B; Dobbie, Michael S; Gao, Xiang; Herault, Yann; Moshiri, Ala; Moore, Bret A; Kent Lloyd, K C; McKerlie, Colin; Masuya, Hiroshi; Tanaka, Nobuhiko; Flicek, Paul; Parkinson, Helen E; Sedlacek, Radislav; Seong, Je Kyung; Wang, Chi-Kuang Leo; Moore, Mark; Brown, Steve D; Tschöp, Matthias H; Wurst, Wolfgang; Klingenspor, Martin; Wolf, Eckhard; Beckers, Johannes; Machicao, Fausto; Peter, Andreas; Staiger, Harald; Häring, Hans-Ulrich; Grallert, Harald; Campillos, Monica; Maier, Holger; Fuchs, Helmut; Gailus-Durner, Valerie; Werner, Thomas; Hrabe de Angelis, Martin

    2018-01-18

    Metabolic diseases are a worldwide problem but the underlying genetic factors and their relevance to metabolic disease remain incompletely understood. Genome-wide research is needed to characterize so-far unannotated mammalian metabolic genes. Here, we generate and analyze metabolic phenotypic data of 2016 knockout mouse strains under the aegis of the International Mouse Phenotyping Consortium (IMPC) and find 974 gene knockouts with strong metabolic phenotypes. 429 of those had no previous link to metabolism and 51 genes remain functionally completely unannotated. We compared human orthologues of these uncharacterized genes in five GWAS consortia and indeed 23 candidate genes are associated with metabolic disease. We further identify common regulatory elements in promoters of candidate genes. As each regulatory element is composed of several transcription factor binding sites, our data reveal an extensive metabolic phenotype-associated network of co-regulated genes. Our systematic mouse phenotype analysis thus paves the way for full functional annotation of the genome.

  12. Easi-CRISPR for creating knock-in and conditional knockout mouse models using long ssDNA donors.

    PubMed

    Miura, Hiromi; Quadros, Rolen M; Gurumurthy, Channabasavaiah B; Ohtsuka, Masato

    2018-01-01

    CRISPR/Cas9-based genome editing can easily generate knockout mouse models by disrupting the gene sequence, but its efficiency for creating models that require either insertion of exogenous DNA (knock-in) or replacement of genomic segments is very poor. The majority of mouse models used in research involve knock-in (reporters or recombinases) or gene replacement (e.g., conditional knockout alleles containing exons flanked by LoxP sites). A few methods for creating such models have been reported that use double-stranded DNA as donors, but their efficiency is typically 1-10% and therefore not suitable for routine use. We recently demonstrated that long single-stranded DNAs (ssDNAs) serve as very efficient donors, both for insertion and for gene replacement. We call this method efficient additions with ssDNA inserts-CRISPR (Easi-CRISPR) because it is a highly efficient technology (efficiency is typically 30-60% and reaches as high as 100% in some cases). The protocol takes ∼2 months to generate the founder mice.

  13. True-breeding targeted gene knock-out in barley using designer TALE-nuclease in haploid cells.

    PubMed

    Gurushidze, Maia; Hensel, Goetz; Hiekel, Stefan; Schedel, Sindy; Valkov, Vladimir; Kumlehn, Jochen

    2014-01-01

    Transcription activator-like effector nucleases (TALENs) are customizable fusion proteins able to cleave virtually any genomic DNA sequence of choice, and thereby to generate site-directed genetic modifications in a wide range of cells and organisms. In the present study, we expressed TALENs in pollen-derived, regenerable cells to establish the generation of instantly true-breeding mutant plants. A gfp-specific TALEN pair was expressed via Agrobacterium-mediated transformation in embryogenic pollen of transgenic barley harboring a functional copy of gfp. Thanks to the haploid nature of the target cells, knock-out mutations were readily detected, and homozygous primary mutant plants obtained following genome duplication. In all, 22% of the TALEN transgenics proved knocked out with respect to gfp, and the loss of function could be ascribed to the deletions of between four and 36 nucleotides in length. The altered gfp alleles were transmitted normally through meiosis, and the knock-out phenotype was consistently shown by the offspring of two independent mutants. Thus, here we describe the efficient production of TALEN-mediated gene knock-outs in barley that are instantaneously homozygous and non-chimeric in regard to the site-directed mutations induced. This TALEN approach has broad applicability for both elucidating gene function and tailoring the phenotype of barley and other crop species.

  14. Optimizing sgRNA structure to improve CRISPR-Cas9 knockout efficiency.

    PubMed

    Dang, Ying; Jia, Gengxiang; Choi, Jennie; Ma, Hongming; Anaya, Edgar; Ye, Chunting; Shankar, Premlata; Wu, Haoquan

    2015-12-15

    Single-guide RNA (sgRNA) is one of the two key components of the clustered regularly interspaced short palindromic repeats (CRISPR)-Cas9 genome-editing system. The current commonly used sgRNA structure has a shortened duplex compared with the native bacterial CRISPR RNA (crRNA)-transactivating crRNA (tracrRNA) duplex and contains a continuous sequence of thymines, which is the pause signal for RNA polymerase III and thus could potentially reduce transcription efficiency. Here, we systematically investigate the effect of these two elements on knockout efficiency and showed that modifying the sgRNA structure by extending the duplex length and mutating the fourth thymine of the continuous sequence of thymines to cytosine or guanine significantly, and sometimes dramatically, improves knockout efficiency in cells. In addition, the optimized sgRNA structure also significantly increases the efficiency of more challenging genome-editing procedures, such as gene deletion, which is important for inducing a loss of function in non-coding genes. By a systematic investigation of sgRNA structure we find that extending the duplex by approximately 5 bp combined with mutating the continuous sequence of thymines at position 4 to cytosine or guanine significantly increases gene knockout efficiency in CRISPR-Cas9-based genome editing experiments.

  15. Efficient mouse airway transduction following recombination between AAV vectors carrying parts of a larger gene.

    PubMed

    Halbert, Christine L; Allen, James M; Miller, A Dusty

    2002-07-01

    The small packaging capacity of adeno-associated virus (AAV) vectors limits the utility of this promising vector system for transfer of large genes. We explored the possibility that larger genes could be reconstituted following homologous recombination between AAV vectors carrying overlapping gene fragments. An alkaline phosphatase (AP) gene was split between two such AAV vectors (rec vectors) and packaged using AAV2 or AAV6 capsid proteins. Rec vectors having either capsid protein recombined to express AP in cultured cells at about 1-2% of the rate observed for an intact vector. Surprisingly, the AAV6 rec vectors transduced lung cells in mice almost as efficiently as did an intact vector, with 10% of airway epithelial cells, the target for treatment of cystic fibrosis (CF), being positive. Thus AAV rec vectors may be useful for diseases such as CF that require transfer of large genes.

  16. Contribution of chloride channel permease to fluoride resistance in Streptococcus mutans.

    PubMed

    Murata, Takatoshi; Hanada, Nobuhiro

    2016-06-01

    Genes encoding fluoride transporters have been identified in bacterial and archaeal species. The genome sequence of the cariogenic Streptococcus mutans bacteria suggests the presence of a putative fluoride transporter, which is referred to as a chloride channel permease. Two homologues of this gene (GenBank locus tags SMU_1290c and SMU_1289c) reside in tandem in the genome of S. mutans The aim of this study was to determine whether the chloride channel permeases contribute to fluoride resistance. We constructed SMU_1290c- and SMU_1289c-knockout S. mutans UA159 strains. We also constructed a double-knockout strain lacking both genes. SMU_1290c or SMU_1289c was transformed into a fluoride transporter- disrupted Escherichia coli strain. All bacterial strains were cultured under appropriate conditions with or without sodium fluoride, and fluoride resistance was evaluated. All three gene-knockout S. mutans strains showed lower resistance to sodium fluoride than did the wild-type strain. No significant changes in resistance to other sodium halides were recognized between the wild-type and double-knockout strains. Both SMU_1290c and SMU_1289c transformation rescued fluoride transporter-disrupted E. coli cell from fluoride toxicity. We conclude that the chloride channel permeases contribute to fluoride resistance in S. mutans. © FEMS 2016. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  17. Transcription factor NF-kappaB participates in regulation of epithelial cell turnover in the colon.

    PubMed

    Inan, M S; Tolmacheva, V; Wang, Q S; Rosenberg, D W; Giardina, C

    2000-12-01

    The transcription factor nuclear factor (NF)-kappaB regulates the expression of genes that can influence cell proliferation and death. Here we analyze the contribution of NF-kappaB to the regulation of epithelial cell turnover in the colon. Immunohistochemical, immunoblot, and DNA binding analyses indicate that NF-kappaB complexes change as colonocytes mature: p65-p50 complexes predominate in proliferating epithelial cells of the colon, whereas the p50-p50 dimer is prevalent in mature epithelial cells. NF-kappaB1 (p50) knockout mice were used to study the role of NF-kappaB in regulating epithelial cell turnover. Knockout animals lacked detectable NF-kappaB DNA binding activity in isolated epithelial cells and had significantly longer crypts with a more extensive proliferative zone than their wild-type counterparts (as determined by proliferating cell nuclear antigen staining and in vivo bromodeoxyuridine labeling). Gene expression profiling reveals that the NF-kappaB1 knockout mice express the potentially growth-enhancing tumor necrosis factor (TNF)-alpha and nerve growth factor-alpha genes at elevated levels, with in situ hybridization localizing some of the TNF-alpha expression to epithelial cells. TNF-alpha is NF-kappaB regulated, and its upregulation in NF-kappaB1 knockouts may result from an alleviation of p50-p50 repression. NF-kappaB complexes may therefore influence cell proliferation in the colon through their ability to selectively activate and/or repress gene expression.

  18. Improving the efficiency of CHO cell line generation using glutamine synthetase gene knockout cells.

    PubMed

    Fan, Lianchun; Kadura, Ibrahim; Krebs, Lara E; Hatfield, Christopher C; Shaw, Margaret M; Frye, Christopher C

    2012-04-01

    Although Chinese hamster ovary (CHO) cells, with their unique characteristics, have become a major workhorse for the manufacture of therapeutic recombinant proteins, one of the major challenges in CHO cell line generation (CLG) is how to efficiently identify those rare, high-producing clones among a large population of low- and non-productive clones. It is not unusual that several hundred individual clones need to be screened for the identification of a commercial clonal cell line with acceptable productivity and growth profile making the cell line appropriate for commercial application. This inefficiency makes the process of CLG both time consuming and laborious. Currently, there are two main CHO expression systems, dihydrofolate reductase (DHFR)-based methotrexate (MTX) selection and glutamine synthetase (GS)-based methionine sulfoximine (MSX) selection, that have been in wide industrial use. Since selection of recombinant cell lines in the GS-CHO system is based on the balance between the expression of the GS gene introduced by the expression plasmid and the addition of the GS inhibitor, L-MSX, the expression of GS from the endogenous GS gene in parental CHOK1SV cells will likely interfere with the selection process. To study endogenous GS expression's potential impact on selection efficiency, GS-knockout CHOK1SV cell lines were generated using the zinc finger nuclease (ZFN) technology designed to specifically target the endogenous CHO GS gene. The high efficiency (∼2%) of bi-allelic modification on the CHO GS gene supports the unique advantages of the ZFN technology, especially in CHO cells. GS enzyme function disruption was confirmed by the observation of glutamine-dependent growth of all GS-knockout cell lines. Full evaluation of the GS-knockout cell lines in a standard industrial cell culture process was performed. Bulk culture productivity improved two- to three-fold through the use of GS-knockout cells as parent cells. The selection stringency was significantly increased, as indicated by the large reduction of non-producing and low-producing cells after 25 µM L-MSX selection, and resulted in a six-fold efficiency improvement in identifying similar numbers of high-productive cell lines for a given recombinant monoclonal antibody. The potential impact of GS-knockout cells on recombinant protein quality is also discussed. Copyright © 2011 Wiley Periodicals, Inc.

  19. RNA-seq reveals transcriptome changes in goats following myostatin gene knockout

    PubMed Central

    Cai, Bei; Zhou, Shiwei; Zhu, Haijing; Qu, Lei; Wang, Xiaolong

    2017-01-01

    Myostatin (MSTN) is a powerful negative regulator of skeletal muscle mass in mammalian species that is primarily expressed in skeletal muscles, and mutations of its encoding gene can result in the double-muscling trait. In this study, the CRISPR/Cas9 technique was used to edit MSTN in Shaanbei Cashmere goats and generate knockout animals. RNA sequencing was used to determine and compare the transcriptome profiles of the muscles from three wild-type (WT) goats, three fibroblast growth factor 5 (FGF5) knockout goats (FGF5+/- group) and three goats with disrupted expression of both the FGF5 and MSTN genes (FM+/- group). The sequence reads were obtained using the Illumina HiSeq 2000 system and mapped to the Capra hircus reference genome using TopHat (v2.0.9). In total, 68.93, 62.04 and 66.26 million clean sequencing reads were obtained from the WT, FM+/- and FGF5+/- groups, respectively. There were 201 differentially expressed genes (DEGs) between the WT and FGF5+/- groups, with 86 down- and 115 up-regulated genes in the FGF5+/- group. Between the WT and FM+/- groups, 121 DEGs were identified, including 81 down- and 40 up-regulated genes in the FM+/- group. A total of 198 DEGs were detected between the FGF5+/- group and FM+/- group, with 128 down- and 70 up-regulated genes in the FM+/- group. At the transcriptome level, we found substantial changes in genes involved in fatty acid metabolism and the biosynthesis of unsaturated fatty acids, such as stearoyl-CoA dehydrogenase, 3-hydroxyacyl-CoA dehydratase 2, ELOVL fatty acid elongase 6 and fatty acid synthase, suggesting that the expression levels of these genes may be directly regulated by MSTN and that these genes are likely downstream targets of MSTN with potential roles in lipid metabolism in goats. Moreover, five randomly selected DEGs were further validated with qRT-PCR, and the results were consistent with the transcriptome analysis. The present study provides insight into the unique transcriptome profile of the MSTN knockout goat, which is a valuable resource for studying goat genomics. PMID:29228005

  20. Substrate-Induced Transcriptional Activation of the MoCel7C Cellulase Gene Is Associated with Methylation of Histone H3 at Lysine 4 in the Rice Blast Fungus Magnaporthe oryzae

    PubMed Central

    Vu, Ba Van; Pham, Kieu Thi Minh

    2013-01-01

    The mechanisms involved in substrate-dependent regulation of a Magnaporthe oryzae gene encoding a cellulase which we designate MoCel7C (MGG_14954) were investigated. The levels of MoCel7C transcript were dramatically increased more than 1,000-fold, 16 to 24 h after transfer to a medium containing 2% carboxymethylcellulose (CMC), while levels were very low or undetectable in conventional rich medium. Green fluorescent protein reporter assays showed that the MoCel7C promoter was activated by cello-oligosaccharides larger than a pentamer. CMC-induced activation of the MoCel7C promoter was suppressed by glucose and cellobiose. Chromatin immunoprecipitation assays revealed that histone H3 methylation on lysine 4 (H3K4) at the MoCel7C locus was associated with activation of the gene by CMC. Consistently, CMC-induced MoCel7C gene activation was drastically diminished in a knockout (KO) mutant of the MoSET1 gene, which encodes a histone lysine methyltransferase that catalyzes H3K4 methylation in M. oryzae. Interestingly, however, MoCel7C transcript levels under noninducing conditions were significantly increased in the MoSET1 KO mutant, suggesting that MoSET1 directly or indirectly plays a role in both activation and suppression of the MoCel7C gene in response to environmental signals. In addition, gene expression and silencing vectors using the MoCel7C promoter were constructed. PMID:23995923

  1. Morphological observation of the stria vascularis in midkine and pleiotrophin knockout mice.

    PubMed

    Sone, Michihiko; Muramatsu, Hisako; Muramatsu, Takashi; Nakashima, Tsutomu

    2011-02-01

    Midkine and Pleiotrophin are low molecular weight basic proteins with closely related structures and serve as growth/differentiation factors. They have been reported to be expressed in the cochlea during the embryonic and perinatal periods. In the present study, we focused on the roles of midkine and pleiotrophin in the stria vascularis and investigated morphological changes using mice deficient in these genes. Midkine knockout, pleiotrophin knockout, and double knockout mice were used and compared to wild-type mice. Auditory brain stem responses (ABRs) and cochlear blood flows were measured in each type of mice. Pathological changes in the stria vascularis were examined by light microscopy, including immunohistochemical staining with anti-Kir4.1 antibody, and electron microscopy. Hearing thresholds examined by ABRs were significantly higher in midkine knockout and pleiotrophin knockout mice than in wild-type mice. Double knockout mice showed higher thresholds compared to midkine knockout and pleiotrophin knockout mice. Blood flow in the lateral walls did not significantly differ and light microscopy examination showed an almost normal appearance of the stria vascularis in these knockout mice. However, the expression of Kir4.1 was weak in the knockout mice and severe vacuolar degeneration was observed by electron microscopy in the intermediate cells of the double knockout mice. The present study demonstrates that midkine and pleiotrophin play some roles for the morphological maintenance of intermediate cell in the stria vascularis. Copyright © 2010 Elsevier Ireland Ltd. All rights reserved.

  2. Inflammatory and mitochondrial gene expression data in GPER-deficient cardiomyocytes from male and female mice.

    PubMed

    Wang, Hao; Sun, Xuming; Chou, Jeff; Lin, Marina; Ferrario, Carlos M; Zapata-Sudo, Gisele; Groban, Leanne

    2017-02-01

    We previously showed that cardiomyocyte-specific G protein-coupled estrogen receptor (GPER) gene deletion leads to sex-specific adverse effects on cardiac structure and function; alterations which may be due to distinct differences in mitochondrial and inflammatory processes between sexes. Here, we provide the results of Gene Set Enrichment Analysis (GSEA) based on the DNA microarray data from GPER-knockout versus GPER-intact (intact) cardiomyocytes. This article contains complete data on the mitochondrial and inflammatory response-related gene expression changes that were significant in GPER knockout versus intact cardiomyocytes from adult male and female mice. The data are supplemental to our original research article "Cardiomyocyte-specific deletion of the G protein-coupled estrogen receptor (GPER) leads to left ventricular dysfunction and adverse remodeling: a sex-specific gene profiling" (Wang et al., 2016) [1]. Data have been deposited to the Gene Expression Omnibus (GEO) database repository with the dataset identifier GSE86843.

  3. Production of CMAH Knockout Preimplantation Embryos Derived From Immortalized Porcine Cells Via TALE Nucleases.

    PubMed

    Moon, JoonHo; Lee, Choongil; Kim, Su Jin; Choi, Ji-Yei; Lee, Byeong Chun; Kim, Jin-Soo; Jang, Goo

    2014-05-27

    Although noncancerous immortalized cell lines have been developed by introducing genes into human and murine somatic cells, such cell lines have not been available in large domesticated animals like pigs. For immortalizing porcine cells, primary porcine fetal fibroblasts were isolated and cultured using the human telomerase reverse transcriptase (hTERT) gene. After selecting cells with neomycin for 2 weeks, outgrowing colonized cells were picked up and subcultured for expansion. Immortalized cells were cultured for more than 9 months without changing their doubling time (~24 hours) or their diameter (< 20 µm) while control cells became replicatively senescent during the same period. Even a single cell expanded to confluence in 100 mm dishes. Furthermore, to knockout the CMAH gene, designed plasmids encoding a transcription activator-like effector nuclease (TALENs) pairs were transfected into the immortalized cells. Each single colony was analyzed by the mutation-sensitive T7 endonuclease I assay, fluorescent PCR, and dideoxy sequencing to obtain three independent clonal populations of cells that contained biallelic modifications. One CMAH knockout clone was chosen and used for somatic cell nuclear transfer. Cloned embryos developed to the blastocyst stage. In conclusion, we demonstrated that immortalized porcine fibroblasts were successfully established using the human hTERT gene, and the TALENs enabled biallelic gene disruptions in these immortalized cells.

  4. Production of CMAH Knockout Preimplantation Embryos Derived From Immortalized Porcine Cells Via TALE Nucleases

    PubMed Central

    Moon, JoonHo; Lee, Choongil; Kim, Su Jin; Choi, Ji-Yei; Lee, Byeong Chun; Kim, Jin-Soo; Jang, Goo

    2014-01-01

    Although noncancerous immortalized cell lines have been developed by introducing genes into human and murine somatic cells, such cell lines have not been available in large domesticated animals like pigs. For immortalizing porcine cells, primary porcine fetal fibroblasts were isolated and cultured using the human telomerase reverse transcriptase (hTERT) gene. After selecting cells with neomycin for 2 weeks, outgrowing colonized cells were picked up and subcultured for expansion. Immortalized cells were cultured for more than 9 months without changing their doubling time (~24 hours) or their diameter (< 20 µm) while control cells became replicatively senescent during the same period. Even a single cell expanded to confluence in 100 mm dishes. Furthermore, to knockout the CMAH gene, designed plasmids encoding a transcription activator-like effector nuclease (TALENs) pairs were transfected into the immortalized cells. Each single colony was analyzed by the mutation-sensitive T7 endonuclease I assay, fluorescent PCR, and dideoxy sequencing to obtain three independent clonal populations of cells that contained biallelic modifications. One CMAH knockout clone was chosen and used for somatic cell nuclear transfer. Cloned embryos developed to the blastocyst stage. In conclusion, we demonstrated that immortalized porcine fibroblasts were successfully established using the human hTERT gene, and the TALENs enabled biallelic gene disruptions in these immortalized cells. PMID:24866481

  5. Gene inactivation in the plant pathogen Glomerella cingulata: three strategies for the disruption of the pectin lyase gene pnlA.

    PubMed

    Bowen, J K; Templeton, M D; Sharrock, K R; Crowhurst, R N; Rikkerink, E H

    1995-01-20

    The feasibility of performing routine transformation-mediated mutagenesis in Glomerella cingulata was analysed by adopting three one-step gene disruption strategies targeted at the pectin lyase gene pnlA. The efficiencies of disruption following transformation with gene replacement- or gene truncation-disruption vectors were compared. To effect replacement-disruption, G. cingulata was transformed with a vector carrying DNA from the pnlA locus in which the majority of the coding sequence had been replaced by the gene for hygromycin B resistance. Two of the five transformants investigated contained an inactivated pnlA gene (pnlA-); both also contained ectopically integrated vector sequences. The efficacy of gene disruption by transformation with two gene truncation-disruption vectors was also assessed. Both vectors carried at 5' and 3' truncated copy of the pnlA coding sequence, adjacent to the gene for hygromycin B resistance. The promoter sequences controlling the selectable marker differed in the two vectors. In one vector the homologous G. cingulata gpdA promoter controlled hygromycin B phosphotransferase expression (homologous truncation vector), whereas in the second vector promoter elements were from the Aspergillus nidulans gpdA gene (heterologous truncation vector). Following transformation with the homologous truncation vector, nine transformants were analysed by Southern hybridisation; no transformants contained a disrupted pnlA gene. Of nineteen heterologous truncation vector transformants, three contained a disrupted pnlA gene; Southern analysis revealed single integrations of vector sequence at pnlA in two of these transformants. pnlA mRNA was not detected by Northern hybridisation in pnlA- transformants. pnlA- transformants failed to produce a PNLA protein with a pI identical to one normally detected in wild-type isolates by silver and activity staining of isoelectric focussing gels. Pathogenesis on Capsicum and apple was unaffected by disruption of the pnlA gene, indicating that the corresponding gene product, PNLA, is not essential for pathogenicity. Gene disruption is a feasible method for selectively mutating defined loci in G. cingulata for functional analysis of the corresponding gene products.

  6. Generation of Stable Knockout Mammalian Cells by TALEN-Mediated Locus-Specific Gene Editing.

    PubMed

    Mahata, Barun; Biswas, Kaushik

    2017-01-01

    Precise and targeted genome editing using Transcription Activator-Like Effector Endonucleases (TALENs) has been widely used and proven to be an extremely effective and specific knockout strategy in both cultured cells and animal models. The current chapter describes a protocol for the construction and generation of TALENs using serial and hierarchical digestion and ligation steps, and using the synthesized TALEN pairs to achieve locus-specific targeted gene editing in mammalian cell lines using a modified clonal selection strategy in an easy and cost-efficient manner.

  7. OAS and PKR are not Required for the Anti-viral Effect of Ad:IFN-γ Against Acute HSV-1 in Primary Trigeminal Ganglia Cultures

    PubMed Central

    Austin, Bobbie Ann; Halford, William; Silverman, Robert H.; Williams, Bryan R. G.; Carr, Daniel J. J.

    2005-01-01

    Three interferon-gamma (IFNG) induced anti-viral pathways have been reported. Involved anti-viral proteins include: Mx, RNaseL/2'-5'-OAS, and PKR. Involvement of OAS and PKR in IFNG-induced anti-HSV-1 pathways has not been previously reported, but IFNG induces OAS and PKR when other viruses invade the nervous system. The aim of the current study was to determine whether the absence of intact OAS and PKR anti-viral pathways affect the anti-viral activity of IFNG during acute HSV-1 infection within trigeminal ganglia (TG). To investigate this, primary TG cultures were established using TGs removed from C57BL/6 (Wt), RNase L knockout, and RNase L/PKR double knockout mice. Each dissociated TG was transduced with an adenoviral vector containing an IFNG transgene or vector alone. Viral titers following HSV-1 infection of primary TG cell cultures were determined. Significant differences in viral titer for Ad:Null versus Ad:IFNG tranduced TGs were found in each genotype. However, the effectiveness of Ad:IFNG was not reduced in the absence of both OAS and PKR pathways or OAS alone. Recombinant IFNG also exhibited anti-HSV-1 activity. The effectiveness of the IFNG transgene was lost in primary TG cells from IFNG receptor knockout mice. The data suggest that novel anti-HSV-1 mechanisms are induced by IFNG. PMID:16704298

  8. Porcine Knock-in Fibroblasts Expressing hDAF on α-1,3-Galactosyltransferase (GGTA1) Gene Locus.

    PubMed

    Kim, Ji Woo; Kim, Hye-Min; Lee, Sang Mi; Kang, Man-Jong

    2012-10-01

    The Galactose-α1,3-galactose (α1,3Gal) epitope is responsible for hyperacute rejection in pig-to-human xenotransplantation. Human decay-accelerating factor (hDAF) is a cell surface regulatory protein that serves as a complement inhibitor to protect self cells from complement attack. The generation of α1,3-galactosyltransferase (GGTA1) knock-out pigs expressing DAF is a necessary step for their use as organ donors for humans. In this study, we established GGTA1 knock-out cell lines expressing DAF from pig ear fibroblasts for somatic cell nuclear transfer. hDAF expression was detected in hDAF knock-in heterozygous cells, but not in normal pig cells. Expression of the GGTA1 gene was lower in the knock-in heterozygous cell line compared to the normal pig cell. Knock-in heterozygous cells afforded more effective protection against cytotoxicity with human serum than with GGTA1 knock-out heterozygous and control cells. These cell lines may be used in the production of GGTA1 knock-out and DAF expression pigs for xenotransplantation.

  9. Deficits in learning and memory in mice with a mutation of the candidate dyslexia susceptibility gene Dyx1c1.

    PubMed

    Rendall, Amanda R; Tarkar, Aarti; Contreras-Mora, Hector M; LoTurco, Joseph J; Fitch, R Holly

    2017-09-01

    Dyslexia is a learning disability characterized by difficulty learning to read and write. The underlying biological and genetic etiology remains poorly understood. One candidate gene, dyslexia susceptibility 1 candidate 1 (DYX1C1), has been shown to be associated with deficits in short-term memory in dyslexic populations. The purpose of the current study was to examine the behavioral phenotype of a mouse model with a homozygous conditional (forebrain) knockout of the rodent homolog Dyx1c1. Twelve Dyx1c1 conditional homozygous knockouts, 7 Dyx1c1 conditional heterozygous knockouts and 6 wild-type controls were behaviorally assessed. Mice with the homozygous Dyx1c1 knockout showed deficits on memory and learning, but not on auditory or motor tasks. These findings affirm existing evidence that DYX1C1 may play an underlying role in the development of neural systems important to learning and memory, and disruption of this function could contribute to the learning deficits seen in individuals with dyslexia. Copyright © 2015 Elsevier Inc. All rights reserved.

  10. Transcriptional and phenotypic comparisons of Ppara knockout and siRNA knockdown mice

    PubMed Central

    De Souza, Angus T.; Dai, Xudong; Spencer, Andrew G.; Reppen, Tom; Menzie, Ann; Roesch, Paula L.; He, Yudong; Caguyong, Michelle J.; Bloomer, Sherri; Herweijer, Hans; Wolff, Jon A.; Hagstrom, James E.; Lewis, David L.; Linsley, Peter S.; Ulrich, Roger G.

    2006-01-01

    RNA interference (RNAi) has great potential as a tool for studying gene function in mammals. However, the specificity and magnitude of the in vivo response to RNAi remains to be fully characterized. A molecular and phenotypic comparison of a genetic knockout mouse and the corresponding knockdown version would help clarify the utility of the RNAi approach. Here, we used hydrodynamic delivery of small interfering RNA (siRNA) to knockdown peroxisome proliferator activated receptor alpha (Ppara), a gene that is central to the regulation of fatty acid metabolism. We found that Ppara knockdown in the liver results in a transcript profile and metabolic phenotype that is comparable to those of Ppara−/− mice. Combining the profiles from mice treated with the PPARα agonist fenofibrate, we confirmed the specificity of the RNAi response and identified candidate genes proximal to PPARα regulation. Ppara knockdown animals developed hypoglycemia and hypertriglyceridemia, phenotypes observed in Ppara−/− mice. In contrast to Ppara−/− mice, fasting was not required to uncover these phenotypes. Together, these data validate the utility of the RNAi approach and suggest that siRNA can be used as a complement to classical knockout technology in gene function studies. PMID:16945951

  11. Rescue of Pompe disease in mice by AAV-mediated liver delivery of secretable acid α-glucosidase

    PubMed Central

    Puzzo, Francesco; Colella, Pasqualina; Biferi, Maria G.; Bali, Deeksha; Paulk, Nicole K.; Vidal, Patrice; Collaud, Fanny; Simon-Sola, Marcelo; Charles, Severine; Hardet, Romain; Leborgne, Christian; Meliani, Amine; Cohen-Tannoudji, Mathilde; Astord, Stephanie; Gjata, Bernard; Sellier, Pauline; van Wittenberghe, Laetitia; Vignaud, Alban; Boisgerault, Florence; Barkats, Martine; Laforet, Pascal; Kay, Mark A.; Koeberl, Dwight D.; Ronzitti, Giuseppe; Mingozzi, Federico

    2018-01-01

    Glycogen storage disease type II or Pompe disease is a severe neuromuscular disorder caused by mutations in the lysosomal enzyme, acid α-glucosidase (GAA), which result in pathological accumulation of glycogen throughout the body. Enzyme replacement therapy is available for Pompe disease; however, it has limited efficacy, has high immunogenicity, and fails to correct pathological glycogen accumulation in nervous tissue and skeletal muscle. Using bioinformatics analysis and protein engineering, we developed transgenes encoding GAA that could be expressed and secreted by hepatocytes. Then, we used adeno-associated virus (AAV) vectors optimized for hepatic expression to deliver the GAA transgenes to Gaa knockout (Gaa−/−) mice, a model of Pompe disease. Therapeutic gene transfer to the liver rescued glycogen accumulation in muscle and the central nervous system, and ameliorated cardiac hypertrophy as well as muscle and respiratory dysfunction in the Gaa−/− mice; mouse survival was also increased. Secretable GAA showed improved therapeutic efficacy and lower immunogenicity compared to nonengineered GAA. Scale-up to nonhuman primates, and modeling of GAA expression in primary human hepatocytes using hepatotropic AAV vectors, demonstrated the therapeutic potential of AAV vector–mediated liver expression of secretable GAA for treating pathological glycogen accumulation in multiple tissues in Pompe disease. PMID:29187643

  12. CRISPR/Cas9 knockout of HAS2 in rat chondrosarcoma chondrocytes demonstrates the requirement of hyaluronan for aggrecan retention

    PubMed Central

    Huang, Yi; Askew, Emily B.; Knudson, Cheryl B.; Knudson, Warren

    2016-01-01

    Hyaluronan (HA) plays an essential role in cartilage where it functions to retain aggrecan. Previous studies have suggested that aggrecan is anchored indirectly to the plasma membrane of chondrocytes via its binding to cell-associated HA. However, reagents used to test these observations such as hyaluronidase and HA oligosaccharides are short term and may have side activities that complicate interpretation. Using the CRISPR/Cas9 gene editing approach, a model system was developed by generating HA-deficient chondrocyte cell lines. HA synthase-2 (Has2)-specific single guide RNA was introduced into two different variant lines of rat chondrosarcoma chondrocytes; knockout clones were isolated and characterized. Two other members of the HA synthase gene family were expressed at very low relative copy number but showed no compensatory response in the Has2 knockouts. Wild type chondrocytes of both variants exhibited large pericellular matrices or coats extending from the plasma membrane. Addition of purified aggrecan monomer expanded the size of these coats as the proteoglycan became retained within the pericellular matrix. Has2 knockout chondrocytes lost all capacity to assemble a particle-excluding pericellular matrix and more importantly, no matrices formed around the knockout cells following the addition of purified aggrecan. When grown as pellet cultures so as to generate a bioengineered neocartilage tissue, the Has2 knockout chondrocytes assumed a tightly-compacted morphology as compared to the wild type cells. When knockout chondrocytes were transduced with Adeno-ZsGreen1-mycHas2, the cell-associated pericellular matrices were restored including the capacity to bind and incorporate additional exogenous aggrecan into the matrix. These results suggest that HA is essential for aggrecan retention and maintaining cell separation during tissue formation. PMID:27094859

  13. Role of cellular FKBP52 protein in intracellular trafficking of recombinant adeno-associated virus 2 vectors

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Zhao Weihong; Wu Jianqing; Zhong Li

    2006-09-30

    We have reported that tyrosine-phosphorylated forms of a cellular protein, FKBP52, inhibit the second-strand DNA synthesis of adeno-associated virus 2 (AAV), leading to inefficient transgene expression from recombinant AAV vectors. To further explore the role of FKBP52 in AAV-mediated transduction, we established murine embryo fibroblasts (MEFs) cultures from FKBP52 wild-type (WT), heterozygous (HE), and knockout (KO) mice. Conventional AAV vectors failed to transduce WT MEFs efficiently, and the transduction efficiency was not significantly increased in HE or KO MEFs. AAV vectors failed to traffic efficiently to the nucleus in these cells. Treatment with hydroxyurea (HU) increased the transduction efficiency ofmore » conventional AAV vectors by {approx}25-fold in WT MEFs, but only by {approx}4-fold in KO MEFs. The use of self-complementary AAV (scAAV) vectors, which bypass the requirement of viral second-strand DNA synthesis, revealed that HU treatment increased the transduction efficiency {approx}23-fold in WT MEFs, but only {approx}4-fold in KO MEFs, indicating that the lack of HU treatment-mediated increase in KO MEFs was not due to failure of AAV to undergo viral second-strand DNA synthesis. Following HU treatment, {approx}59% of AAV genomes were present in the nuclear fraction from WT MEFs, but only {approx}28% in KO MEFs, indicating that the pathway by which HU treatment mediates nuclear transport of AAV was impaired in KO MEFs. When KO MEFs were stably transfected with an FKBP52 expression plasmid, HU treatment-mediated increase in the transduction efficiency was restored in these cells, which correlated directly with improved intracellular trafficking. Intact AAV particles were also shown to interact with FKBP52 as well as with dynein, a known cellular protein involved in AAV trafficking. These studies suggest that FKBP52, being a cellular chaperone protein, facilitates intracellular trafficking of AAV, which has implications in the optimal use of recombinant AAV vectors in human gene therapy.« less

  14. A homozygous Keap1-knockout human embryonic stem cell line generated using CRISPR/Cas9 mediates gene targeting.

    PubMed

    Kim, So-Jung; Habib, Omer; Kim, Jin-Soo; Han, Hyo-Won; Koo, Soo Kyung; Kim, Jung-Hyun

    2017-03-01

    Kelch-like ECH-associated protein 1 (keap1) is a cysteine-rich protein that interacts with transcription factor Nrf2 in a redox-sensitive manner, leading to the degradation of Nrf2 (Kim et al., 2014a). Disruption of Keap1 results in the induction of Nrf2-related signaling pathways involving the expression of a set of anti-oxidant and anti-inflammatory genes. We generated biallelic mutants of the Keap1 gene using a CRISPR-Cas9 genome editing method in the H9 human embryonic stem cell (hESC). The Keap1 homozygous-knockout H9 cell line retained normal morphology, gene expression, and in vivo differentiation potential. Copyright © 2016 The Author(s). Published by Elsevier B.V. All rights reserved.

  15. Role of alpha-synuclein in 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine-induced parkinsonism in mice.

    PubMed

    Schlüter, O M; Fornai, F; Alessandrí, M G; Takamori, S; Geppert, M; Jahn, R; Südhof, T C

    2003-01-01

    In humans, mutations in the alpha-synuclein gene or exposure to the neurotoxin 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine (MPTP) produce Parkinson's disease with loss of dopaminergic neurons and depletion of nigrostriatal dopamine. alpha-Synuclein is a vertebrate-specific component of presynaptic nerve terminals that may function in modulating synaptic transmission. To test whether MPTP toxicity involves alpha-synuclein, we generated alpha-synuclein-deficient mice by homologous recombination, and analyzed the effect of deleting alpha-synuclein on MPTP toxicity using these knockout mice. In addition, we examined commercially available mice that contain a spontaneous loss of the alpha-synuclein gene. As described previously, deletion of alpha-synuclein had no significant effects on brain structure or composition. In particular, the levels of synaptic proteins were not altered, and the concentrations of dopamine, dopamine metabolites, and dopaminergic proteins were unchanged. Upon acute MPTP challenge, alpha-synuclein knockout mice were partly protected from chronic depletion of nigrostriatal dopamine when compared with littermates of the same genetic background, whereas mice carrying the spontaneous deletion of the alpha-synuclein gene exhibited no protection. Furthermore, alpha-synuclein knockout mice but not the mice with the alpha-synuclein gene deletion were slightly more sensitive to methamphetamine than littermate control mice. These results demonstrate that alpha-synuclein is not obligatorily coupled to MPTP sensitivity, but can influence MPTP toxicity on some genetic backgrounds, and illustrate the need for extensive controls in studies aimed at describing the effects of mouse knockouts on MPTP sensitivity.

  16. In silico experiment system for testing hypothesis on gene functions using three condition specific biological networks.

    PubMed

    Lee, Chai-Jin; Kang, Dongwon; Lee, Sangseon; Lee, Sunwon; Kang, Jaewoo; Kim, Sun

    2018-05-25

    Determining functions of a gene requires time consuming, expensive biological experiments. Scientists can speed up this experimental process if the literature information and biological networks can be adequately provided. In this paper, we present a web-based information system that can perform in silico experiments of computationally testing hypothesis on the function of a gene. A hypothesis that is specified in English by the user is converted to genes using a literature and knowledge mining system called BEST. Condition-specific TF, miRNA and PPI (protein-protein interaction) networks are automatically generated by projecting gene and miRNA expression data to template networks. Then, an in silico experiment is to test how well the target genes are connected from the knockout gene through the condition-specific networks. The test result visualizes path from the knockout gene to the target genes in the three networks. Statistical and information-theoretic scores are provided on the resulting web page to help scientists either accept or reject the hypothesis being tested. Our web-based system was extensively tested using three data sets, such as E2f1, Lrrk2, and Dicer1 knockout data sets. We were able to re-produce gene functions reported in the original research papers. In addition, we comprehensively tested with all disease names in MalaCards as hypothesis to show the effectiveness of our system. Our in silico experiment system can be very useful in suggesting biological mechanisms which can be further tested in vivo or in vitro. http://biohealth.snu.ac.kr/software/insilico/. Copyright © 2018 Elsevier Inc. All rights reserved.

  17. Targeted deletion of miR-132/-212 impairs memory and alters the hippocampal transcriptome.

    PubMed

    Hansen, Katelin F; Sakamoto, Kensuke; Aten, Sydney; Snider, Kaitlin H; Loeser, Jacob; Hesse, Andrea M; Page, Chloe E; Pelz, Carl; Arthur, J Simon C; Impey, Soren; Obrietan, Karl

    2016-02-01

    miR-132 and miR-212 are structurally related microRNAs that have been found to exert powerful modulatory effects within the central nervous system (CNS). Notably, these microRNAs are tandomly processed from the same noncoding transcript, and share a common seed sequence: thus it has been difficult to assess the distinct contribution of each microRNA to gene expression within the CNS. Here, we employed a combination of conditional knockout and transgenic mouse models to examine the contribution of the miR-132/-212 gene locus to learning and memory, and then to assess the distinct effects that each microRNA has on hippocampal gene expression. Using a conditional deletion approach, we show that miR-132/-212 double-knockout mice exhibit significant cognitive deficits in spatial memory, recognition memory, and in tests of novel object recognition. Next, we utilized transgenic miR-132 and miR-212 overexpression mouse lines and the miR-132/-212 double-knockout line to explore the distinct effects of these two miRNAs on the transcriptional profile of the hippocampus. Illumina sequencing revealed that miR-132/-212 deletion increased the expression of 1138 genes; Venn analysis showed that 96 of these genes were also downregulated in mice overexpressing miR-132. Of the 58 genes that were decreased in animals overexpressing miR-212, only four of them were also increased in the knockout line. Functional gene ontology analysis of downregulated genes revealed significant enrichment of genes related to synaptic transmission, neuronal proliferation, and morphogenesis, processes known for their roles in learning, and memory formation. These data, coupled with previous studies, firmly establish a role for the miR-132/-212 gene locus as a key regulator of cognitive capacity. Further, although miR-132 and miR-212 share a seed sequence, these data indicate that these miRNAs do not exhibit strongly overlapping mRNA targeting profiles, thus indicating that these two genes may function in a complex, nonredundant manner to shape the transcriptional profile of the CNS. The dysregulation of miR-132/-212 expression could contribute to signaling mechanisms that are involved in an array of cognitive disorders. © 2016 Hansen et al.; Published by Cold Spring Harbor Laboratory Press.

  18. Targeted deletion of miR-132/-212 impairs memory and alters the hippocampal transcriptome

    PubMed Central

    Hansen, Katelin F.; Sakamoto, Kensuke; Aten, Sydney; Snider, Kaitlin H.; Loeser, Jacob; Hesse, Andrea M.; Page, Chloe E.; Pelz, Carl; Arthur, J. Simon C.; Impey, Soren

    2016-01-01

    miR-132 and miR-212 are structurally related microRNAs that have been found to exert powerful modulatory effects within the central nervous system (CNS). Notably, these microRNAs are tandomly processed from the same noncoding transcript, and share a common seed sequence: thus it has been difficult to assess the distinct contribution of each microRNA to gene expression within the CNS. Here, we employed a combination of conditional knockout and transgenic mouse models to examine the contribution of the miR-132/-212 gene locus to learning and memory, and then to assess the distinct effects that each microRNA has on hippocampal gene expression. Using a conditional deletion approach, we show that miR-132/-212 double-knockout mice exhibit significant cognitive deficits in spatial memory, recognition memory, and in tests of novel object recognition. Next, we utilized transgenic miR-132 and miR-212 overexpression mouse lines and the miR-132/-212 double-knockout line to explore the distinct effects of these two miRNAs on the transcriptional profile of the hippocampus. Illumina sequencing revealed that miR-132/-212 deletion increased the expression of 1138 genes; Venn analysis showed that 96 of these genes were also downregulated in mice overexpressing miR-132. Of the 58 genes that were decreased in animals overexpressing miR-212, only four of them were also increased in the knockout line. Functional gene ontology analysis of downregulated genes revealed significant enrichment of genes related to synaptic transmission, neuronal proliferation, and morphogenesis, processes known for their roles in learning, and memory formation. These data, coupled with previous studies, firmly establish a role for the miR-132/-212 gene locus as a key regulator of cognitive capacity. Further, although miR-132 and miR-212 share a seed sequence, these data indicate that these miRNAs do not exhibit strongly overlapping mRNA targeting profiles, thus indicating that these two genes may function in a complex, nonredundant manner to shape the transcriptional profile of the CNS. The dysregulation of miR-132/-212 expression could contribute to signaling mechanisms that are involved in an array of cognitive disorders. PMID:26773099

  19. VEGF and VEGFB Play Balancing Roles in Adipose Differentiation, Gene Expression, and Function.

    PubMed

    Jin, Honghong; Li, Dan; Wang, Xutong; Jia, Jia; Chen, Yang; Yao, Yapeng; Zhao, Chunlan; Lu, Xiaodan; Zhang, Shujie; Togo, Jacques; Ji, Yan; Zhang, Luqing; Feng, Xuechao; Zheng, Yaowu

    2018-05-01

    Obesity is the result of abnormal adipose development and energy metabolism. Using vascular endothelial growth factor (VEGF) B-knockout and inducible VEGF downregulation mouse models, we have shown that VEGFB inactivation caused expansion of white adipose, whitening of brown adipose, an increase in fat accumulation, and a reduction in energy consumption. At the same time, expression of the white adipose-associated genes was increased and brown adipose-associated genes decreased. VEGF repression, in contrast, induced brown adipose expansion and brown adipocyte development in white adipose, increased energy expenditure, upregulated brown adipose-associated genes, and downregulated white adipose-associated genes. When VEGFB-knockout and VEGF-repressed mice are crossed together, VEGF and VEGFB can counteractively regulate large numbers of genes and efficiently reverse each other's roles. These genes, under counteractive VEGF and VEGFB regulations, include transcription factors, adhesion molecules, and metabolic enzymes. This balancing role is confirmed by morphologic and functional changes. This study reports that VEGF and VEGFB counteractively regulate adipose development and function in energy metabolism.

  20. Multiple homologous genes knockout (KO) by CRISPR/Cas9 system in rabbit.

    PubMed

    Liu, Huan; Sui, Tingting; Liu, Di; Liu, Tingjun; Chen, Mao; Deng, Jichao; Xu, Yuanyuan; Li, Zhanjun

    2018-03-20

    The CRISPR/Cas9 system is a highly efficient and convenient genome editing tool, which has been widely used for single or multiple gene mutation in a variety of organisms. Disruption of multiple homologous genes, which have similar DNA sequences and gene function, is required for the study of the desired phenotype. In this study, to test whether the CRISPR/Cas9 system works on the mutation of multiple homologous genes, a single guide RNA (sgRNA) targeting three fucosyltransferases encoding genes (FUT1, FUT2 and SEC1) was designed. As expected, triple gene mutation of FUT1, FUT2 and SEC1 could be achieved simultaneously via a sgRNA mediated CRISPR/Cas9 system. Besides, significantly reduced serum fucosyltransferases enzymes activity was also determined in those triple gene mutation rabbits. Thus, we provide the first evidence that multiple homologous genes knockout (KO) could be achieved efficiently by a sgRNA mediated CRISPR/Cas9 system in mammals, which could facilitate the genotype to phenotype studies of homologous genes in future. Copyright © 2018 Elsevier B.V. All rights reserved.

  1. INTERPRETATION OF THE CANCER RESPONSE TO POTENTIAL RENTAL CARCINOGENS IN THE TSC2 KNOCKOUT (EKER) RAT IS DEPENDENT ON LENGTH OF TREATMENT.

    EPA Science Inventory

    INTERPRETATION OF THE CANCER RESPONSE TO POTENTIAL RENAL CARCINOGENS IN THE TSC2 KNOCKOUT (EKER) RAT IS DEPENDENT ON LENGTH OF TREATMENT.

    Genetically increasing the function of oncogenes or knocking out the function of a tumor supressor gene has dramatically increased the...

  2. Knockout of exogenous EGFP gene in porcine somatic cells using zinc-finger nucleases

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Watanabe, Masahito; Department of Life Sciences, School of Agriculture, Meiji University, 1-1-1 Higashimita, Tama-ku, Kawasaki, Kanagawa 214-8571; Umeyama, Kazuhiro

    2010-11-05

    Research highlights: {yields} EGFP gene integrated in porcine somatic cells could be knocked out using the ZFN-KO system. {yields} ZFNs induced targeted mutations in porcine primary cultured cells. {yields} Complete absence of EGFP fluorescence was confirmed in ZFN-treated cells. -- Abstract: Zinc-finger nucleases (ZFNs) are expected as a powerful tool for generating gene knockouts in laboratory and domestic animals. Currently, it is unclear whether this technology can be utilized for knocking-out genes in pigs. Here, we investigated whether knockout (KO) events in which ZFNs recognize and cleave a target sequence occur in porcine primary cultured somatic cells that harbor themore » exogenous enhanced green fluorescent protein (EGFP) gene. ZFN-encoding mRNA designed to target the EGFP gene was introduced by electroporation into the cell. Using the Surveyor nuclease assay and flow cytometric analysis, we confirmed ZFN-induced cleavage of the target sequence and the disappearance of EGFP fluorescence expression in ZFN-treated cells. In addition, sequence analysis revealed that ZFN-induced mutations such as base substitution, deletion, or insertion were generated in the ZFN cleavage site of EGFP-expression negative cells that were cloned from ZFN-treated cells, thereby showing it was possible to disrupt (i.e., knock out) the function of the EGFP gene in porcine somatic cells. To our knowledge, this study provides the first evidence that the ZFN-KO system can be applied to pigs. These findings may open a new avenue to the creation of gene KO pigs using ZFN-treated cells and somatic cell nuclear transfer.« less

  3. Nonviral vectors for cancer gene therapy: prospects for integrating vectors and combination therapies.

    PubMed

    Ohlfest, John R; Freese, Andrew B; Largaespada, David A

    2005-12-01

    Gene therapy has the potential to improve the clinical outcome of many cancers by transferring therapeutic genes into tumor cells or normal host tissue. Gene transfer into tumor cells or tumor-associated stroma is being employed to induce tumor cell death, stimulate anti-tumor immune response, inhibit angiogenesis, and control tumor cell growth. Viral vectors have been used to achieve this proof of principle in animal models and, in select cases, in human clinical trials. Nevertheless, there has been considerable interest in developing nonviral vectors for cancer gene therapy. Nonviral vectors are simpler, more amenable to large-scale manufacture, and potentially safer for clinical use. Nonviral vectors were once limited by low gene transfer efficiency and transient or steadily declining gene expression. However, recent improvements in plasmid-based vectors and delivery methods are showing promise in circumventing these obstacles. This article reviews the current status of nonviral cancer gene therapy, with an emphasis on combination strategies, long-term gene transfer using transposons and bacteriophage integrases, and future directions.

  4. Knockout of the Gnrh genes in zebrafish: effects on reproduction and potential compensation by reproductive and feeding-related neuropeptides.

    PubMed

    Marvel, Miranda; Spicer, Olivia Smith; Wong, Ten-Tsao; Zmora, Nilli; Zohar, Yonathan

    2018-04-04

    Gonadotropin-releasing hormone (GnRH) is known as a pivotal upstream regulator of reproduction in vertebrates. However, reproduction is not compromised in the hypophysiotropic Gnrh3 knockout line in zebrafish (gnrh3-/-). In order to determine if Gnrh2, the only other Gnrh isoform in zebrafish brains, is compensating for the loss of Gnrh3, we generated a double Gnrh knockout zebrafish line. Surprisingly, the loss of both Gnrh isoforms resulted in no major impact on reproduction, indicating that a compensatory response, outside of the Gnrh system, was evoked. A plethora of factors acting along the reproductive hypothalamus-pituitary axis were evaluated as possible compensators based on neuroanatomical and differential gene expression studies. In addition, we also examined the involvement of feeding factors in the brain as potential compensators for Gnrh2, which has known anorexigenic effects. We found that the double knockout fish exhibited upregulation of several genes in the brain, specifically gonadotropin-inhibitory hormone (gnih), secretogranin 2 (scg2), tachykinin 3a (tac3a), and pituitary adenylate cyclase-activating peptide 1 (pacap1), and downregulation of agouti-related peptide 1 (agrp1), indicating the compensation occurs outside of Gnrh cells and therefore is a non-cell autonomous response to the loss of Gnrh. While the differential expression of gnih and agrp1 in the double knockout line was confined to the periventricular nucleus and hypothalamus, respectively, the upregulation of scg2 corresponded with a broader neuronal redistribution in the lateral hypothalamus and hindbrain. In conclusion, our results demonstrate the existence of a redundant reproductive regulatory system that comes into play when Gnrh2 and Gnrh3 are lost.

  5. Random phenotypic variation of yeast (Saccharomyces cerevisiae) single-gene knockouts fits a double pareto-lognormal distribution.

    PubMed

    Graham, John H; Robb, Daniel T; Poe, Amy R

    2012-01-01

    Distributed robustness is thought to influence the buffering of random phenotypic variation through the scale-free topology of gene regulatory, metabolic, and protein-protein interaction networks. If this hypothesis is true, then the phenotypic response to the perturbation of particular nodes in such a network should be proportional to the number of links those nodes make with neighboring nodes. This suggests a probability distribution approximating an inverse power-law of random phenotypic variation. Zero phenotypic variation, however, is impossible, because random molecular and cellular processes are essential to normal development. Consequently, a more realistic distribution should have a y-intercept close to zero in the lower tail, a mode greater than zero, and a long (fat) upper tail. The double Pareto-lognormal (DPLN) distribution is an ideal candidate distribution. It consists of a mixture of a lognormal body and upper and lower power-law tails. If our assumptions are true, the DPLN distribution should provide a better fit to random phenotypic variation in a large series of single-gene knockout lines than other skewed or symmetrical distributions. We fit a large published data set of single-gene knockout lines in Saccharomyces cerevisiae to seven different probability distributions: DPLN, right Pareto-lognormal (RPLN), left Pareto-lognormal (LPLN), normal, lognormal, exponential, and Pareto. The best model was judged by the Akaike Information Criterion (AIC). Phenotypic variation among gene knockouts in S. cerevisiae fits a double Pareto-lognormal (DPLN) distribution better than any of the alternative distributions, including the right Pareto-lognormal and lognormal distributions. A DPLN distribution is consistent with the hypothesis that developmental stability is mediated, in part, by distributed robustness, the resilience of gene regulatory, metabolic, and protein-protein interaction networks. Alternatively, multiplicative cell growth, and the mixing of lognormal distributions having different variances, may generate a DPLN distribution.

  6. Generating double knockout mice to model genetic intervention for diabetic cardiomyopathy in humans.

    PubMed

    Chavali, Vishalakshi; Nandi, Shyam Sundar; Singh, Shree Ram; Mishra, Paras Kumar

    2014-01-01

    Diabetes is a rapidly increasing disease that enhances the chances of heart failure twofold to fourfold (as compared to age and sex matched nondiabetics) and becomes a leading cause of morbidity and mortality. There are two broad classifications of diabetes: type1 diabetes (T1D) and type2 diabetes (T2D). Several mice models mimic both T1D and T2D in humans. However, the genetic intervention to ameliorate diabetic cardiomyopathy in these mice often requires creating double knockout (DKO). In order to assess the therapeutic potential of a gene, that specific gene is either overexpressed (transgenic expression) or abrogated (knockout) in the diabetic mice. If the genetic mice model for diabetes is used, it is necessary to create DKO with transgenic/knockout of the target gene to investigate the specific role of that gene in pathological cardiac remodeling in diabetics. One of the important genes involved in extracellular matrix (ECM) remodeling in diabetes is matrix metalloproteinase-9 (Mmp9). Mmp9 is a collagenase that remains latent in healthy hearts but induced in diabetic hearts. Activated Mmp9 degrades extracellular matrix (ECM) and increases matrix turnover causing cardiac fibrosis that leads to heart failure. Insulin2 mutant (Ins2+/-) Akita is a genetic model for T1D that becomes diabetic spontaneously at the age of 3-4 weeks and show robust hyperglycemia at the age of 10-12 weeks. It is a chronic model of T1D. In Ins2+/- Akita, Mmp9 is induced. To investigate the specific role of Mmp9 in diabetic hearts, it is necessary to create diabetic mice where Mmp9 gene is deleted. Here, we describe the method to generate Ins2+/-/Mmp9-/- (DKO) mice to determine whether the abrogation of Mmp9 ameliorates diabetic cardiomyopathy.

  7. Functional analysis of chloroplast early light inducible proteins (ELIPs)

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Wetzel, Carolyn M

    The objectives of this project were to characterize gene expression patterns of early light inducible protein (ELIP) genes in Arabidopsis thaliana and in Lycopersicon esculentum, to identify knock mutants of the 2 ELIP genes in Arabidopsis, and to characterize the effects of the knockouts. Expression in Arabidopsis was studied in response to thylakoid electron transport chain (PETC) capacity, where it was found that there is a signal for expression associated with reduction of the PETC. Expression in response to salt was also studied, with different responses of the two gene copies. Knockout lines for ELIP1 and ELIP2 have been identifiedmore » and are being characterized. In tomato, it was found that the single-copy ELIP gene is highly expressed in ripening fruit during the chloroplast-to-chromoplast transition. Studies of expression in tomato ripening mutants are ongoing.« less

  8. Analysis of mammalian gene function through broad based phenotypic screens across a consortium of mouse clinics

    PubMed Central

    Adams, David J; Adams, Niels C; Adler, Thure; Aguilar-Pimentel, Antonio; Ali-Hadji, Dalila; Amann, Gregory; André, Philippe; Atkins, Sarah; Auburtin, Aurelie; Ayadi, Abdel; Becker, Julien; Becker, Lore; Bedu, Elodie; Bekeredjian, Raffi; Birling, Marie-Christine; Blake, Andrew; Bottomley, Joanna; Bowl, Mike; Brault, Véronique; Busch, Dirk H; Bussell, James N; Calzada-Wack, Julia; Cater, Heather; Champy, Marie-France; Charles, Philippe; Chevalier, Claire; Chiani, Francesco; Codner, Gemma F; Combe, Roy; Cox, Roger; Dalloneau, Emilie; Dierich, André; Di Fenza, Armida; Doe, Brendan; Duchon, Arnaud; Eickelberg, Oliver; Esapa, Chris T; El Fertak, Lahcen; Feigel, Tanja; Emelyanova, Irina; Estabel, Jeanne; Favor, Jack; Flenniken, Ann; Gambadoro, Alessia; Garrett, Lilian; Gates, Hilary; Gerdin, Anna-Karin; Gkoutos, George; Greenaway, Simon; Glasl, Lisa; Goetz, Patrice; Da Cruz, Isabelle Goncalves; Götz, Alexander; Graw, Jochen; Guimond, Alain; Hans, Wolfgang; Hicks, Geoff; Hölter, Sabine M; Höfler, Heinz; Hancock, John M; Hoehndorf, Robert; Hough, Tertius; Houghton, Richard; Hurt, Anja; Ivandic, Boris; Jacobs, Hughes; Jacquot, Sylvie; Jones, Nora; Karp, Natasha A; Katus, Hugo A; Kitchen, Sharon; Klein-Rodewald, Tanja; Klingenspor, Martin; Klopstock, Thomas; Lalanne, Valerie; Leblanc, Sophie; Lengger, Christoph; le Marchand, Elise; Ludwig, Tonia; Lux, Aline; McKerlie, Colin; Maier, Holger; Mandel, Jean-Louis; Marschall, Susan; Mark, Manuel; Melvin, David G; Meziane, Hamid; Micklich, Kateryna; Mittelhauser, Christophe; Monassier, Laurent; Moulaert, David; Muller, Stéphanie; Naton, Beatrix; Neff, Frauke; Nolan, Patrick M; Nutter, Lauryl MJ; Ollert, Markus; Pavlovic, Guillaume; Pellegata, Natalia S; Peter, Emilie; Petit-Demoulière, Benoit; Pickard, Amanda; Podrini, Christine; Potter, Paul; Pouilly, Laurent; Puk, Oliver; Richardson, David; Rousseau, Stephane; Quintanilla-Fend, Leticia; Quwailid, Mohamed M; Racz, Ildiko; Rathkolb, Birgit; Riet, Fabrice; Rossant, Janet; Roux, Michel; Rozman, Jan; Ryder, Ed; Salisbury, Jennifer; Santos, Luis; Schäble, Karl-Heinz; Schiller, Evelyn; Schrewe, Anja; Schulz, Holger; Steinkamp, Ralf; Simon, Michelle; Stewart, Michelle; Stöger, Claudia; Stöger, Tobias; Sun, Minxuan; Sunter, David; Teboul, Lydia; Tilly, Isabelle; Tocchini-Valentini, Glauco P; Tost, Monica; Treise, Irina; Vasseur, Laurent; Velot, Emilie; Vogt-Weisenhorn, Daniela; Wagner, Christelle; Walling, Alison; Weber, Bruno; Wendling, Olivia; Westerberg, Henrik; Willershäuser, Monja; Wolf, Eckhard; Wolter, Anne; Wood, Joe; Wurst, Wolfgang; Yildirim, Ali Önder; Zeh, Ramona; Zimmer, Andreas; Zimprich, Annemarie

    2015-01-01

    The function of the majority of genes in the mouse and human genomes remains unknown. The mouse ES cell knockout resource provides a basis for characterisation of relationships between gene and phenotype. The EUMODIC consortium developed and validated robust methodologies for broad-based phenotyping of knockouts through a pipeline comprising 20 disease-orientated platforms. We developed novel statistical methods for pipeline design and data analysis aimed at detecting reproducible phenotypes with high power. We acquired phenotype data from 449 mutant alleles, representing 320 unique genes, of which half had no prior functional annotation. We captured data from over 27,000 mice finding that 83% of the mutant lines are phenodeviant, with 65% demonstrating pleiotropy. Surprisingly, we found significant differences in phenotype annotation according to zygosity. Novel phenotypes were uncovered for many genes with unknown function providing a powerful basis for hypothesis generation and further investigation in diverse systems. PMID:26214591

  9. Vaccination with recombinant adenoviruses expressing Ebola virus glycoprotein elicits protection in the interferon alpha/beta receptor knock-out mouse.

    PubMed

    O'Brien, Lyn M; Stokes, Margaret G; Lonsdale, Stephen G; Maslowski, David R; Smither, Sophie J; Lever, Mark S; Laws, Thomas R; Perkins, Stuart D

    2014-03-01

    The resistance of adult immunocompetent mice to infection with ebolaviruses has led to the development of alternative small animal models that utilise immunodeficient mice, for example the interferon α/β receptor knock-out mouse (IFNR(-/-)). IFNR(-/-) mice have been shown to be susceptible to infection with ebolaviruses by multiple routes but it is not known if this murine model is suitable for testing therapeutics that rely on the generation of an immune response for efficacy. We have tested recombinant adenovirus vectors for their ability to protect IFNR(-/-) mice from challenge with Ebola virus and have analysed the humoral response generated after immunisation. The recombinant vaccines elicited good levels of protection in the knock-out mouse and the antibody response in IFNR(-/-) mice was similar to that observed in vaccinated wild-type mice. These results indicate that the IFNR(-/-) mouse is a relevant small animal model for studying ebolavirus-specific therapeutics. Copyright © 2014. Published by Elsevier Inc.

  10. Characterization of the first knock-out aldh7a1 zebrafish model for pyridoxine-dependent epilepsy using CRISPR-Cas9 technology

    PubMed Central

    Zabinyakov, Nikita; Bullivant, Garrett; Cao, Feng; Fernandez Ojeda, Matilde; Jia, Zheng Ping; Wen, Xiao-Yan; Dowling, James J.; Salomons, Gajja S.

    2017-01-01

    Pyridoxine dependent epilepsy (PDE) is caused by likely pathogenic variants in ALDH7A1 (PDE-ALDH7A1) and inherited autosomal recessively. Neurotoxic alpha-amino adipic semialdehyde (alpha-AASA), piperideine 6-carboxylate and pipecolic acid accumulate in body fluids. Neonatal or infantile onset seizures refractory to anti-epileptic medications are clinical features. Treatment with pyridoxine, arginine and lysine-restricted diet does not normalize neurodevelopmental outcome or accumulation of neurotoxic metabolites. There is no animal model for high throughput drug screening. For this reason, we developed and characterized the first knock-out aldh7a1 zebrafish model using CRISPR-Cas9 technology. Zebrafish aldh7a1 mutants were generated by using a vector free method of CRISPR-Cas9 mutagenesis. Genotype analysis of aldh7a1 knock-out zebrafish was performed by high resolution melt analysis, direct sequencing and QIAxcel system. Electroencephalogram was performed. Alpha-AASA, piperideine 6-carboxylate and pipecolic acid, were measured by liquid chromatography-tandem mass spectrometry. Our knock-out aldh7a1 zebrafish has homozygous 5 base pair (bp) mutation in ALDH7A1. Knock-out aldh7a1 embryos have spontaneous rapid increase in locomotion and a rapid circling swim behavior earliest 8-day post fertilization (dpf). Electroencephalogram revealed large amplitude spike discharges compared to wild type. Knock-out aldh7a1 embryos have elevated alpha-AASA, piperideine 6-carboxylate and pipecolic acid compared to wild type embryos at 3 dpf. Knock-out aldh7a1 embryos showed no aldh7a1 protein by western blot compared to wild type. Our knock-out aldh7a1 zebrafish is a well characterized model for large-scale drug screening using behavioral and biochemical features and accurately recapitulates the human PDE-ALDH7A1 disease. PMID:29053735

  11. Characterization of the first knock-out aldh7a1 zebrafish model for pyridoxine-dependent epilepsy using CRISPR-Cas9 technology.

    PubMed

    Zabinyakov, Nikita; Bullivant, Garrett; Cao, Feng; Fernandez Ojeda, Matilde; Jia, Zheng Ping; Wen, Xiao-Yan; Dowling, James J; Salomons, Gajja S; Mercimek-Andrews, Saadet

    2017-01-01

    Pyridoxine dependent epilepsy (PDE) is caused by likely pathogenic variants in ALDH7A1 (PDE-ALDH7A1) and inherited autosomal recessively. Neurotoxic alpha-amino adipic semialdehyde (alpha-AASA), piperideine 6-carboxylate and pipecolic acid accumulate in body fluids. Neonatal or infantile onset seizures refractory to anti-epileptic medications are clinical features. Treatment with pyridoxine, arginine and lysine-restricted diet does not normalize neurodevelopmental outcome or accumulation of neurotoxic metabolites. There is no animal model for high throughput drug screening. For this reason, we developed and characterized the first knock-out aldh7a1 zebrafish model using CRISPR-Cas9 technology. Zebrafish aldh7a1 mutants were generated by using a vector free method of CRISPR-Cas9 mutagenesis. Genotype analysis of aldh7a1 knock-out zebrafish was performed by high resolution melt analysis, direct sequencing and QIAxcel system. Electroencephalogram was performed. Alpha-AASA, piperideine 6-carboxylate and pipecolic acid, were measured by liquid chromatography-tandem mass spectrometry. Our knock-out aldh7a1 zebrafish has homozygous 5 base pair (bp) mutation in ALDH7A1. Knock-out aldh7a1 embryos have spontaneous rapid increase in locomotion and a rapid circling swim behavior earliest 8-day post fertilization (dpf). Electroencephalogram revealed large amplitude spike discharges compared to wild type. Knock-out aldh7a1 embryos have elevated alpha-AASA, piperideine 6-carboxylate and pipecolic acid compared to wild type embryos at 3 dpf. Knock-out aldh7a1 embryos showed no aldh7a1 protein by western blot compared to wild type. Our knock-out aldh7a1 zebrafish is a well characterized model for large-scale drug screening using behavioral and biochemical features and accurately recapitulates the human PDE-ALDH7A1 disease.

  12. Vector systems for prenatal gene therapy: principles of retrovirus vector design and production.

    PubMed

    Howe, Steven J; Chandrashekran, Anil

    2012-01-01

    Vectors derived from the Retroviridae family have several attributes required for successful gene delivery. Retroviral vectors have an adequate payload size for the coding regions of most genes; they are safe to handle and simple to produce. These vectors can be manipulated to target different cell types with low immunogenicity and can permanently insert genetic information into the host cells' genome. Retroviral vectors have been used in gene therapy clinical trials and successfully applied experimentally in vitro, in vivo, and in utero.

  13. Generation of gene-targeted mice using embryonic stem cells derived from a transgenic mouse model of Alzheimer's disease.

    PubMed

    Yamamoto, Satoshi; Ooshima, Yuki; Nakata, Mitsugu; Yano, Takashi; Matsuoka, Kunio; Watanabe, Sayuri; Maeda, Ryouta; Takahashi, Hideki; Takeyama, Michiyasu; Matsumoto, Yoshio; Hashimoto, Tadatoshi

    2013-06-01

    Gene-targeting technology using mouse embryonic stem (ES) cells has become the "gold standard" for analyzing gene functions and producing disease models. Recently, genetically modified mice with multiple mutations have increasingly been produced to study the interaction between proteins and polygenic diseases. However, introduction of an additional mutation into mice already harboring several mutations by conventional natural crossbreeding is an extremely time- and labor-intensive process. Moreover, to do so in mice with a complex genetic background, several years may be required if the genetic background is to be retained. Establishing ES cells from multiple-mutant mice, or disease-model mice with a complex genetic background, would offer a possible solution. Here, we report the establishment and characterization of novel ES cell lines from a mouse model of Alzheimer's disease (3xTg-AD mouse, Oddo et al. in Neuron 39:409-421, 2003) harboring 3 mutated genes (APPswe, TauP301L, and PS1M146V) and a complex genetic background. Thirty blastocysts were cultured and 15 stable ES cell lines (male: 11; female: 4) obtained. By injecting these ES cells into diploid or tetraploid blastocysts, we generated germline-competent chimeras. Subsequently, we confirmed that F1 mice derived from these animals showed similar biochemical and behavioral characteristics to the original 3xTg-AD mice. Furthermore, we introduced a gene-targeting vector into the ES cells and successfully obtained gene-targeted ES cells, which were then used to generate knockout mice for the targeted gene. These results suggest that the present methodology is effective for introducing an additional mutation into mice already harboring multiple mutated genes and/or a complex genetic background.

  14. An Efficient Method Using Gluconacetobacter europaeus To Reduce an Unfavorable Flavor Compound, Acetoin, in Rice Vinegar Production

    PubMed Central

    Akasaka, Naoki; Sakoda, Hisao; Hidese, Ryota; Ishii, Yuri

    2013-01-01

    Gluconacetobacter europaeus, one of the microorganisms most commonly used for vinegar production, produces the unfavorable flavor compound acetoin. Since acetoin reduction is important for rice vinegar production, a genetic approach was attempted to reduce acetoin produced by G. europaeus KGMA0119 using specific gene knockout without introducing exogenous antibiotic resistance genes. A uracil-auxotrophic mutant with deletion of the orotate phosphoribosyltransferase gene (pyrE) was first isolated by positive selection using 5-fluoroorotic acid. The pyrE disruptant designated KGMA0704 (ΔpyrE) showed 5-fluoroorotic acid resistance. KGMA0704 and the pyrE gene were used for further gene disruption experiments as a host cell and a selectable marker, respectively. Targeted disruption of aldC or als, which encodes α-acetolactate decarboxylase or α-acetolactate synthase, was attempted in KGMA0704. The disruption of these genes was expected to result in a decrease in acetoin levels. A disruption vector harboring the pyrE marker within the targeted gene was constructed for double-crossover recombination. The cells of KGMA0704 were transformed with the exogenous DNA using electroporation, and genotypic analyses of the transformants revealed the unique occurrence of targeted aldC or als gene disruption. The aldC disruptant KGMA4004 and the als disruptant KGMA5315 were cultivated, and the amount of acetoin was monitored. The acetoin level in KGMA4004 culture was significantly reduced to 0.009% (wt/vol) compared with KGMA0119 (0.042% [wt/vol]), whereas that of KGMA5315 was not affected (0.037% [wt/vol]). This indicates that aldC disruption is critical for acetoin reduction. G. europaeus KGMA4004 has clear application potential in the production of rice vinegar with less unfavorable flavor. PMID:24056455

  15. Impaired eye-blink conditioning in waggler, a mutant mouse with cerebellar BDNF deficiency.

    PubMed

    Bao, S; Chen, L; Qiao, X; Knusel, B; Thompson, R F

    1998-01-01

    In addition to their trophic functions, neurotrophins are also implicated in synaptic modulation and learning and memory. Although gene knockout techniques have been used widely in studying the roles of neurotrophins at molecular and cellular levels, behavioral studies using neurotrophin knockouts are limited by the early-onset lethality and various sensory deficits associated with the gene knockout mice. In the present study, we found that in a spontaneous mutant mouse, waggler, the expression of brain-derived neurotrophic factor (BDNF) was selectively absent in the cerebellar granule cells. The cytoarchitecture of the waggler cerebellum appeared to be normal at the light microscope level. The mutant mice exhibited no sensory deficits to auditory stimuli or heat-induced pain. However, they were massively impaired in classic eye-blink conditioning. These results suggest that BDNF may have a role in normal cerebellar neuronal function, which, in turn, is essential for classic eye-blink conditioning.

  16. Of Men and Mice: Modeling the Fragile X Syndrome

    PubMed Central

    Dahlhaus, Regina

    2018-01-01

    The Fragile X Syndrome (FXS) is one of the most common forms of inherited intellectual disability in all human societies. Caused by the transcriptional silencing of a single gene, the fragile x mental retardation gene FMR1, FXS is characterized by a variety of symptoms, which range from mental disabilities to autism and epilepsy. More than 20 years ago, a first animal model was described, the Fmr1 knock-out mouse. Several other models have been developed since then, including conditional knock-out mice, knock-out rats, a zebrafish and a drosophila model. Using these model systems, various targets for potential pharmaceutical treatments have been identified and many treatments have been shown to be efficient in preclinical studies. However, all attempts to turn these findings into a therapy for patients have failed thus far. In this review, I will discuss underlying difficulties and address potential alternatives for our future research. PMID:29599705

  17. Altered sleep and affect in the neurotensin receptor 1 knockout mouse.

    PubMed

    Fitzpatrick, Karrie; Winrow, Christopher J; Gotter, Anthony L; Millstein, Joshua; Arbuzova, Janna; Brunner, Joseph; Kasarskis, Andrew; Vitaterna, Martha H; Renger, John J; Turek, Fred W

    2012-07-01

    Sleep and mood disorders have long been understood to have strong genetic components, and there is considerable comorbidity of sleep abnormalities and mood disorders, suggesting the involvement of common genetic pathways. Here, we examine a candidate gene implicated in the regulation of both sleep and affective behavior using a knockout mouse model. Previously, we identified a quantitative trait locus (QTL) for REM sleep amount, REM sleep bout number, and wake amount in a genetically segregating population of mice. Here, we show that traits mapping to this QTL correlated with an expression QTL for neurotensin receptor 1 (Ntsr1), a receptor for neurotensin, a ligand known to be involved in several psychiatric disorders. We examined sleep as well as behaviors indicative of anxiety and depression in the NTSR1 knockout mouse. NTSR1 knockouts had a lower percentage of sleep time spent in REM sleep in the dark phase and a larger diurnal variation in REM sleep duration than wild types under baseline conditions. Following sleep deprivation, NTSR1 knockouts exhibited more wake and less NREM rebound sleep. NTSR1 knockouts also showed increased anxious and despair behaviors. Here we illustrate a link between expression of the Ntsr1 gene and sleep traits previously associated with a particular QTL. We also demonstrate a relationship between Ntsr1 and anxiety and despair behaviors. Given the considerable evidence that anxiety and depression are closely linked with abnormalities in sleep, the data presented here provide further evidence that neurotensin and Ntsr1 may be a component of a pathway involved in both sleep and mood disorders.

  18. Genetic disruption of oncogenic Kras sensitizes lung cancer cells to Fas receptor-mediated apoptosis.

    PubMed

    Mou, Haiwei; Moore, Jill; Malonia, Sunil K; Li, Yingxiang; Ozata, Deniz M; Hough, Soren; Song, Chun-Qing; Smith, Jordan L; Fischer, Andrew; Weng, Zhiping; Green, Michael R; Xue, Wen

    2017-04-04

    Genetic lesions that activate KRAS account for ∼30% of the 1.6 million annual cases of lung cancer. Despite clinical need, KRAS is still undruggable using traditional small-molecule drugs/inhibitors. When oncogenic Kras is suppressed by RNA interference, tumors initially regress but eventually recur and proliferate despite suppression of Kras Here, we show that tumor cells can survive knockout of oncogenic Kras , indicating the existence of Kras -independent survival pathways. Thus, even if clinical KRAS inhibitors were available, resistance would remain an obstacle to treatment. Kras -independent cancer cells exhibit decreased colony formation in vitro but retain the ability to form tumors in mice. Comparing the transcriptomes of oncogenic Kras cells and Kras knockout cells, we identified 603 genes that were specifically up-regulated in Kras knockout cells, including the Fas gene, which encodes a cell surface death receptor involved in physiological regulation of apoptosis. Antibodies recognizing Fas receptor efficiently induced apoptosis of Kras knockout cells but not oncogenic Kras -expressing cells. Increased Fas expression in Kras knockout cells was attributed to decreased association of repressive epigenetic marks at the Fas promoter. Concordant with this observation, treating oncogenic Kras cells with histone deacetylase inhibitor and Fas-activating antibody efficiently induced apoptosis, thus bypassing the need to inhibit Kras. Our results suggest that activation of Fas could be exploited as an Achilles' heel in tumors initiated by oncogenic Kras.

  19. Genetic disruption of oncogenic Kras sensitizes lung cancer cells to Fas receptor-mediated apoptosis

    PubMed Central

    Mou, Haiwei; Moore, Jill; Malonia, Sunil K.; Li, Yingxiang; Ozata, Deniz M.; Hough, Soren; Song, Chun-Qing; Smith, Jordan L.; Fischer, Andrew; Weng, Zhiping; Xue, Wen

    2017-01-01

    Genetic lesions that activate KRAS account for ∼30% of the 1.6 million annual cases of lung cancer. Despite clinical need, KRAS is still undruggable using traditional small-molecule drugs/inhibitors. When oncogenic Kras is suppressed by RNA interference, tumors initially regress but eventually recur and proliferate despite suppression of Kras. Here, we show that tumor cells can survive knockout of oncogenic Kras, indicating the existence of Kras-independent survival pathways. Thus, even if clinical KRAS inhibitors were available, resistance would remain an obstacle to treatment. Kras-independent cancer cells exhibit decreased colony formation in vitro but retain the ability to form tumors in mice. Comparing the transcriptomes of oncogenic Kras cells and Kras knockout cells, we identified 603 genes that were specifically up-regulated in Kras knockout cells, including the Fas gene, which encodes a cell surface death receptor involved in physiological regulation of apoptosis. Antibodies recognizing Fas receptor efficiently induced apoptosis of Kras knockout cells but not oncogenic Kras-expressing cells. Increased Fas expression in Kras knockout cells was attributed to decreased association of repressive epigenetic marks at the Fas promoter. Concordant with this observation, treating oncogenic Kras cells with histone deacetylase inhibitor and Fas-activating antibody efficiently induced apoptosis, thus bypassing the need to inhibit Kras. Our results suggest that activation of Fas could be exploited as an Achilles’ heel in tumors initiated by oncogenic Kras. PMID:28320962

  20. Genotoxicity of retroviral hematopoietic stem cell gene therapy

    PubMed Central

    Trobridge, Grant D

    2012-01-01

    Introduction Retroviral vectors have been developed for hematopoietic stem cell (HSC) gene therapy and have successfully cured X-linked severe combined immunodeficiency (SCID-X1), adenosine deaminase deficiency (ADA-SCID), adrenoleukodystrophy, and Wiskott-Aldrich syndrome. However, in HSC gene therapy clinical trials, genotoxicity mediated by integrated vector proviruses has led to clonal expansion, and in some cases frank leukemia. Numerous studies have been performed to understand the molecular basis of vector-mediated genotoxicity with the aim of developing safer vectors and safer gene therapy protocols. These genotoxicity studies are critical to advancing HSC gene therapy. Areas covered This review provides an introduction to the mechanisms of retroviral vector genotoxicity. It also covers advances over the last 20 years in designing safer gene therapy vectors, and in integration site analysis in clinical trials and large animal models. Mechanisms of retroviral-mediated genotoxicity, and the risk factors that contribute to clonal expansion and leukemia in HSC gene therapy are introduced. Expert opinion Continued research on virus–host interactions and next-generation vectors should further improve the safety of future HSC gene therapy vectors and protocols. PMID:21375467

  1. A complementation assay for in vivo protein structure/function analysis in Physcomitrella patens (Funariaceae)

    DOE PAGES

    Scavuzzo-Duggan, Tess R.; Chaves, Arielle M.; Roberts, Alison W.

    2015-07-14

    Here, a method for rapid in vivo functional analysis of engineered proteins was developed using Physcomitrella patens. A complementation assay was designed for testing structure/function relationships in cellulose synthase (CESA) proteins. The components of the assay include (1) construction of test vectors that drive expression of epitope-tagged PpCESA5 carrying engineered mutations, (2) transformation of a ppcesa5 knockout line that fails to produce gametophores with test and control vectors, (3) scoring the stable transformants for gametophore production, (4) statistical analysis comparing complementation rates for test vectors to positive and negative control vectors, and (5) analysis of transgenic protein expression by Westernmore » blotting. The assay distinguished mutations that generate fully functional, nonfunctional, and partially functional proteins. In conclusion, compared with existing methods for in vivo testing of protein function, this complementation assay provides a rapid method for investigating protein structure/function relationships in plants.« less

  2. Transcription factor genes essential for cell proliferation and replicative lifespan in budding yeast

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kamei, Yuka; Tai, Akiko; Dakeyama, Shota

    Many of the lifespan-related genes have been identified in eukaryotes ranging from the yeast to human. However, there is limited information available on the longevity genes that are essential for cell proliferation. Here, we investigated whether the essential genes encoding DNA-binding transcription factors modulated the replicative lifespan of Saccharomyces cerevisiae. Heterozygous diploid knockout strains for FHL1, RAP1, REB1, and MCM1 genes showed significantly short lifespan. {sup 1}H-nuclear magnetic resonance analysis indicated a characteristic metabolic profile in the Δfhl1/FHL1 mutant. These results strongly suggest that FHL1 regulates the transcription of lifespan related metabolic genes. Thus, heterozygous knockout strains could be themore » potential materials for discovering further novel lifespan genes. - Highlights: • Involvement of yeast TF genes essential for cell growth in lifespan was evaluated. • The essential TF genes, FHL1, RAP1, REB1, and MCM1, regulate replicative lifespan. • Heterozygous deletion of FHL1 changes cellular metabolism related to lifespan.« less

  3. Vitamin D receptor pathway is required for probiotic protection in colitis.

    PubMed

    Wu, Shaoping; Yoon, Sonia; Zhang, Yong-Guo; Lu, Rong; Xia, Yinglin; Wan, Jiandi; Petrof, Elaine O; Claud, Erika C; Chen, Di; Sun, Jun

    2015-09-01

    Low expression of vitamin D receptor (VDR) and dysfunction of vitamin D/VDR signaling are reported in patients with inflammatory bowel disease (IBD); therefore, restoration of VDR function to control inflammation in IBD is desirable. Probiotics have been used in the treatment of IBD. However, the role of probiotics in the modulation of VDR signaling to effectively reduce inflammation is unknown. We identified a novel role of probiotics in activating VDR activity, thus inhibiting inflammation, using cell models and VDR knockout mice. We found that the probiotics Lactobacillus rhamnosus strain GG (LGG) and Lactobacillus plantarum (LP) increased VDR protein expression in both mouse and human intestinal epithelial cells. Using the VDR luciferase reporter vector, we detected increased transcriptional activity of VDR after probiotic treatment. Probiotics increased the expression of the VDR target genes, such as antimicrobial peptide cathelicidin, at the transcriptional level. Furthermore, the role of probiotics in regulating VDR signaling was tested in vivo using a Salmonella-colitis model in VDR knockout mice. Probiotic treatment conferred physiological and histologic protection from Salmonella-induced colitis in VDR(+/+) mice, whereas probiotics had no effects in the VDR(-/-) mice. Probiotic treatment also enhanced numbers of Paneth cells, which secrete AMPs for host defense. These data indicate that the VDR pathway is required for probiotic protection in colitis. Understanding how probiotics enhance VDR signaling and inhibit inflammation will allow probiotics to be used effectively, resulting in innovative approaches to the prevention and treatment of chronic inflammation. Copyright © 2015 the American Physiological Society.

  4. AtWRKY22 promotes susceptibility to aphids and modulates salicylic acid and jasmonic acid signalling

    PubMed Central

    Kloth, Karen J.; Wiegers, Gerrie L.; Busscher-Lange, Jacqueline; van Haarst, Jan C.; Kruijer, Willem; Bouwmeester, Harro J.; Dicke, Marcel; Jongsma, Maarten A.

    2016-01-01

    Aphids induce many transcriptional perturbations in their host plants, but the signalling cascades responsible and the effects on plant resistance are largely unknown. Through a genome-wide association (GWA) mapping study in Arabidopsis thaliana, we identified WRKY22 as a candidate gene associated with feeding behaviour of the green peach aphid, Myzus persicae. The transcription factor WRKY22 is known to be involved in pathogen-triggered immunity, and WRKY22 gene expression has been shown to be induced by aphids. Assessment of aphid population development and feeding behaviour on knockout mutants and overexpression lines showed that WRKY22 increases susceptibility to M. persicae via a mesophyll-located mechanism. mRNA sequencing analysis of aphid-infested wrky22 knockout plants revealed the up-regulation of genes involved in salicylic acid (SA) signalling and down-regulation of genes involved in plant growth and cell-wall loosening. In addition, mechanostimulation of knockout plants by clip cages up-regulated jasmonic acid (JA)-responsive genes, resulting in substantial negative JA–SA crosstalk. Based on this and previous studies, WRKY22 is considered to modulate the interplay between the SA and JA pathways in response to a wide range of biotic and abiotic stimuli. Its induction by aphids and its role in suppressing SA and JA signalling make WRKY22 a potential target for aphids to manipulate host plant defences. PMID:27107291

  5. Eliminating Xenoantigen Expression on Swine RBC.

    PubMed

    Wang, Zheng-Yu; Martens, Gregory R; Blankenship, Ross L; Sidner, Richard A; Li, Ping; Estrada, Jose L; Tector, Matthew; Tector, A Joseph

    2017-03-01

    The rapidly improving tools of genetic engineering may make it possible to overcome the humoral immune barrier that prevents xenotransplantation. We hypothesize that levels of human antibody binding to donor tissues from swine must approximate the antibody binding occurring in allotransplantation. It is uncertain if this is an attainable goal. Here we perform an initial analysis of this issue by comparing human antibody binding to red blood cells (RBC) isolated from knockout swine and to allogeneic or autologous human RBC. Human sera were incubated with RBC isolated from various genetically engineered swine or from humans. The level of IgG and IgM binding to these cells were compared using either flow cytometry or a novel mass spectrometric assay. Mass spectroscopic quantitation of human antibody binding demonstrated that as few as 3 gene inactivations can reduce the levels human antibody binding to swine RBC that is as low as autologous human RBC. Flow cytometry showed that RBC from 2-gene knockout swine exhibited less human antibody binding than human blood group O allogeneic RBC in 22% of tested sera. Deletion of a third gene from pigs resulted in 30% of human samples having less IgG and IgM RBC xenoreactivity than alloreactivity. Xenoantigenicity of swine RBC can be eliminated via gene disruption. These results suggest that the gene knockout approach may be able reduce antigenicity in other pig tissues to levels that enable the xenotransplantation humoral barrier to be overcome.

  6. Progresses towards safe and efficient gene therapy vectors.

    PubMed

    Chira, Sergiu; Jackson, Carlo S; Oprea, Iulian; Ozturk, Ferhat; Pepper, Michael S; Diaconu, Iulia; Braicu, Cornelia; Raduly, Lajos-Zsolt; Calin, George A; Berindan-Neagoe, Ioana

    2015-10-13

    The emergence of genetic engineering at the beginning of the 1970's opened the era of biomedical technologies, which aims to improve human health using genetic manipulation techniques in a clinical context. Gene therapy represents an innovating and appealing strategy for treatment of human diseases, which utilizes vehicles or vectors for delivering therapeutic genes into the patients' body. However, a few past unsuccessful events that negatively marked the beginning of gene therapy resulted in the need for further studies regarding the design and biology of gene therapy vectors, so that this innovating treatment approach can successfully move from bench to bedside. In this paper, we review the major gene delivery vectors and recent improvements made in their design meant to overcome the issues that commonly arise with the use of gene therapy vectors. At the end of the manuscript, we summarized the main advantages and disadvantages of common gene therapy vectors and we discuss possible future directions for potential therapeutic vectors.

  7. Progresses towards safe and efficient gene therapy vectors

    PubMed Central

    Chira, Sergiu; Jackson, Carlo S.; Oprea, Iulian; Ozturk, Ferhat; Pepper, Michael S.; Diaconu, Iulia; Braicu, Cornelia; Raduly, Lajos-Zsolt; Calin, George A.; Berindan-Neagoe, Ioana

    2015-01-01

    The emergence of genetic engineering at the beginning of the 1970′s opened the era of biomedical technologies, which aims to improve human health using genetic manipulation techniques in a clinical context. Gene therapy represents an innovating and appealing strategy for treatment of human diseases, which utilizes vehicles or vectors for delivering therapeutic genes into the patients' body. However, a few past unsuccessful events that negatively marked the beginning of gene therapy resulted in the need for further studies regarding the design and biology of gene therapy vectors, so that this innovating treatment approach can successfully move from bench to bedside. In this paper, we review the major gene delivery vectors and recent improvements made in their design meant to overcome the issues that commonly arise with the use of gene therapy vectors. At the end of the manuscript, we summarized the main advantages and disadvantages of common gene therapy vectors and we discuss possible future directions for potential therapeutic vectors. PMID:26362400

  8. [Influence of tissue-specific superoxide dismutase genes expression in brain cells on Drosophila melanogaster sensitivity to oxidative stress and viability].

    PubMed

    Vitushynska, M V; Matiytsiv, N P; Chernyk, Y

    2015-01-01

    The study has shown that both functional gene knockout Sodl and Sod2 and their overexpression in neurons and glial tissue increase the sensitivity of Drosophila melanogaster to oxidative stress (OS) conditions. The lowest survival rate was only 20.5% in insects with Sod2 knockout in neurons. Comparative analysis of the survival curves showed that adults with altered tissue-specific expression of the studied genes had reduced average and maximum life span. Under OS conditions induced by 5% hydrogen peroxide the life spans of wild type Oregon R and transgenic insects were significantly reduced. Altered Sod gene expression in glial tissue leads to degenerative changes in Drosophila brain at the young age. During the aging of insects and the action of pro-oxidants increasing of neurodegenerative phenotype is observed.

  9. PLAG1 deficiency impairs spermatogenesis and sperm motility in mice.

    PubMed

    Juma, Almas R; Grommen, Sylvia V H; O'Bryan, Moira K; O'Connor, Anne E; Merriner, D Jo; Hall, Nathan E; Doyle, Stephen R; Damdimopoulou, Pauliina E; Barriga, Daniel; Hart, Adam H; Van de Ven, Wim J M; De Groef, Bert

    2017-07-13

    Deficiency in pleomorphic adenoma gene 1 (PLAG1) leads to reduced fertility in male mice, but the mechanism by which PLAG1 contributes to reproduction is unknown. To investigate the involvement of PLAG1 in testicular function, we determined (i) the spatial distribution of PLAG1 in the testis using X-gal staining; (ii) transcriptomic consequences of PLAG1 deficiency in knock-out and heterozygous mice compared to wild-type mice using RNA-seq; and (iii) morphological and functional consequences of PLAG1 deficiency by determining testicular histology, daily sperm production and sperm motility in knock-out and wild-type mice. PLAG1 was sparsely expressed in germ cells and in Sertoli cells. Genes known to be involved in spermatogenesis were downregulated in the testes of knock-out mice, as well as Hsd17b3, which encodes a key enzyme in androgen biosynthesis. In the absence of Plag1, a number of genes involved in immune processes and epididymis-specific genes were upregulated in the testes. Finally, loss of PLAG1 resulted in significantly lowered daily sperm production, in reduced sperm motility, and in several animals, in sloughing of the germinal epithelium. Our results demonstrate that the subfertility seen in male PLAG1-deficient mice is, at least in part, the result of significantly reduced sperm output and sperm motility.

  10. Random Splicing of Several Exons Caused by a Single Base Change in the Target Exon of CRISPR/Cas9 Mediated Gene Knockout.

    PubMed

    Kapahnke, Marcel; Banning, Antje; Tikkanen, Ritva

    2016-12-14

    The clustered regularly interspaced short palindromic repeats (CRISPR)-associated sequence 9 (CRISPR/Cas9) system is widely used for genome editing purposes as it facilitates an efficient knockout of a specific gene in, e.g. cultured cells. Targeted double-strand breaks are introduced to the target sequence of the guide RNAs, which activates the cellular DNA repair mechanism for non-homologous-end-joining, resulting in unprecise repair and introduction of small deletions or insertions. Due to this, sequence alterations in the coding region of the target gene frequently cause frame-shift mutations, facilitating degradation of the mRNA. We here show that such CRISPR/Cas9-mediated alterations in the target exon may also result in altered splicing of the respective pre-mRNA, most likely due to mutations of splice-regulatory sequences. Using the human FLOT-1 gene as an example, we demonstrate that such altered splicing products also give rise to aberrant protein products. These may potentially function as dominant-negative proteins and thus interfere with the interpretation of the data generated with these cell lines. Since most researchers only control the consequences of CRISPR knockout at genomic and protein level, our data should encourage to also check the alterations at the mRNA level.

  11. Brief Report: Altered Social Behavior in Isolation-Reared "Fmr1" Knockout Mice

    ERIC Educational Resources Information Center

    Heitzer, Andrew M.; Roth, Alexandra K.; Nawrocki, Lauren; Wrenn, Craige C.; Valdovinos, Maria G.

    2013-01-01

    Social behavior abnormalities in Fragile X syndrome (FXS) are characterized by social withdrawal, anxiety, and deficits in social cognition. To assess these deficits, a model of FXS, the "Fmr1" knockout mouse ("Fmr1" KO), has been utilized. This mouse model has a null mutation in the fragile X mental retardation 1 gene ("Fmr1") and displays…

  12. Genome-scale CRISPR-Cas9 knockout screening in human cells.

    PubMed

    Shalem, Ophir; Sanjana, Neville E; Hartenian, Ella; Shi, Xi; Scott, David A; Mikkelson, Tarjei; Heckl, Dirk; Ebert, Benjamin L; Root, David E; Doench, John G; Zhang, Feng

    2014-01-03

    The simplicity of programming the CRISPR (clustered regularly interspaced short palindromic repeats)-associated nuclease Cas9 to modify specific genomic loci suggests a new way to interrogate gene function on a genome-wide scale. We show that lentiviral delivery of a genome-scale CRISPR-Cas9 knockout (GeCKO) library targeting 18,080 genes with 64,751 unique guide sequences enables both negative and positive selection screening in human cells. First, we used the GeCKO library to identify genes essential for cell viability in cancer and pluripotent stem cells. Next, in a melanoma model, we screened for genes whose loss is involved in resistance to vemurafenib, a therapeutic RAF inhibitor. Our highest-ranking candidates include previously validated genes NF1 and MED12, as well as novel hits NF2, CUL3, TADA2B, and TADA1. We observe a high level of consistency between independent guide RNAs targeting the same gene and a high rate of hit confirmation, demonstrating the promise of genome-scale screening with Cas9.

  13. Self-focusing therapeutic gene delivery with intelligent gene vector swarms: intra-swarm signalling through receptor transgene expression in targeted cells.

    PubMed

    Tolmachov, Oleg E

    2015-01-01

    Gene delivery in vivo that is tightly focused on the intended target cells is essential to maximize the benefits of gene therapy and to reduce unwanted side-effects. Cell surface markers are immediately available for probing by therapeutic gene vectors and are often used to direct gene transfer with these vectors to specific target cell populations. However, it is not unusual for the choice of available extra-cellular markers to be too scarce to provide a reliable definition of the desired therapeutically relevant set of target cells. Therefore, interrogation of intra-cellular determinants of cell-specificity, such as tissue-specific transcription factors, can be vital in order to provide detailed cell-guiding information to gene vector particles. An important improvement in cell-specific gene delivery can be achieved through auto-buildup in vector homing efficiency using intelligent 'self-focusing' of swarms of vector particles on target cells. Vector self-focusing was previously suggested to rely on the release of diffusible chemo-attractants after a successful target-specific hit by 'scout' vector particles. I hypothesize that intelligent self-focusing behaviour of swarms of cell-targeted therapeutic gene vectors can be accomplished without the employment of difficult-to-use diffusible chemo-attractants, instead relying on the intra-swarm signalling through cells expressing a non-diffusible extra-cellular receptor for the gene vectors. In the proposed model, cell-guiding information is gathered by the 'scout' gene vector particles, which: (1) attach to a variety of cells via a weakly binding (low affinity) receptor; (2) successfully facilitate gene transfer into these cells; (3) query intra-cellular determinants of cell-specificity with their transgene expression control elements and (4) direct the cell-specific biosynthesis of a vector-encoded strongly binding (high affinity) cell-surface receptor. Free members of the vector swarm loaded with therapeutic cargo are then attracted to and internalized into the intended target cells via the expressed cognate strongly binding extra-cellular receptor, causing escalation of gene transfer into these cells and increasing the copy number of the therapeutic gene expression modules. Such self-focusing swarms of gene vectors can be either homogeneous, with 'scout' and 'therapeutic' members of the swarm being structurally identical, or, alternatively, heterogeneous (split), with 'scout' and 'therapeutic' members of the swarm being structurally specialized. It is hoped that the proposed self-focusing cell-targeted gene vector swarms with receptor-mediated intra-swarm signalling could be particularly effective in 'top-up' gene delivery scenarios, achieving high-level and sustained expression of therapeutic transgenes that are prone to shut-down through degradation and silencing. Crucially, in contrast to low-precision 'general location' vector guidance by diffusible chemo-attractants, ear-marking non-diffusible receptors can provide high-accuracy targeting of therapeutic vector particles to the specific cell, which has undergone a 'successful cell-specific hit' by a 'scout' vector particle. Opportunities for cell targeting could be expanded, since in the proposed model of self-focusing it could be possible to probe a broad selection of intra-cellular determinants of cell-specificity and not just to rely exclusively on extra-cellular markers of cell-specificity. By employing such self-focusing gene vectors for the improvement of cell-targeted delivery of therapeutic genes, e.g., in cancer therapy or gene addition therapy of recessive genetic diseases, it could be possible to broaden a leeway for the reduction of the vector load and, consequently, to minimize undesired vector cytotoxicity, immune reactions, and the risk of inadvertent genetic modification of germline cells in genetic treatment in vivo. Copyright © 2014 Elsevier B.V. All rights reserved.

  14. Gene therapy using retrovirus vectors: vector development and biosafety at clinical trials.

    PubMed

    Doi, Knayo; Takeuchi, Yasuhiro

    2015-01-01

    Retrovirus vectors (gammaretroviral and lentiviral vectors) have been considered as promising tools to transfer therapeutic genes into patient cells because they can permanently integrate into host cellular genome. To treat monogenic, inherited diseases, retroviral vectors have been used to add correct genes into patient cells. Conventional gammaretroviral vectors achieved successful results in clinical trials: treated patients had therapeutic gene expression in target cells and had improved symptoms of diseases. However, serious side-effects of leukemia occurred, caused by retroviral insertional mutagenesis (IM). These incidences stressed the importance of monitoring vector integration sites in patient cells as well as of re-consideration on safer vectors. More recently lentiviral vectors which can deliver genes into non-dividing cells started to be used in clinical trials including neurological disorders, showing their efficacy. Vector integration site analysis revealed that lentiviruses integrate less likely to near promoter regions of oncogenes than gammaretroviruses and no adverse events have been reported in lentiviral vector-mediated gene therapy clinical trials. Therefore lentiviral vectors have promises to be applied to a wide range of common diseases in near future. For example, T cells from cancer patients were transduced to express chimeric T cell receptors recognizing their tumour cells enhancing patients' anti-cancer immunity.

  15. Problem-Solving Test: Targeted Gene Disruption

    ERIC Educational Resources Information Center

    Szeberenyi, Jozsef

    2008-01-01

    Mutational inactivation of a specific gene is the most powerful technique to analyze the biological function of the gene. This approach has been used for a long time in viruses, bacteria, yeast, and fruit fly, but looked quite hopeless in more complex organisms. Targeted inactivation of specific genes (also known as knock-out mutation) in mice is…

  16. AAV Vectorization of DSB-mediated Gene Editing Technologies.

    PubMed

    Moser, Rachel J; Hirsch, Matthew L

    2016-01-01

    Recent work both at the bench and the bedside demonstrate zinc-finger nucleases (ZFNs), CRISPR/Cas9, and other programmable site-specific endonuclease technologies are being successfully utilized within and alongside AAV vectors to induce therapeutically relevant levels of directed gene editing within the human chromosome. Studies from past decades acknowledge that AAV vector genomes are enhanced substrates for homology-directed repair in the presence or absence of targeted DNA damage within the host genome. Additionally, AAV vectors are currently the most efficient format for in vivo gene delivery with no vector related complications in >100 clinical trials for diverse diseases. At the same time, advancements in the design of custom-engineered site-specific endonucleases and the utilization of elucidated endonuclease formats have resulted in efficient and facile genetic engineering for basic science and for clinical therapies. AAV vectors and gene editing technologies are an obvious marriage, using AAV for the delivery of repair substrate and/or a gene encoding a designer endonuclease; however, while efficient delivery and enhanced gene targeting by vector genomes are advantageous, other attributes of AAV vectors are less desirable for gene editing technologies. This review summarizes the various roles that AAV vectors play in gene editing technologies and provides insight into its trending applications for the treatment of genetic diseases.

  17. Genetically Engineering Entomopathogenic Fungi.

    PubMed

    Zhao, H; Lovett, B; Fang, W

    2016-01-01

    Entomopathogenic fungi have been developed as environmentally friendly alternatives to chemical insecticides in biocontrol programs for agricultural pests and vectors of disease. However, mycoinsecticides currently have a small market share due to low virulence and inconsistencies in their performance. Genetic engineering has made it possible to significantly improve the virulence of fungi and their tolerance to adverse conditions. Virulence enhancement has been achieved by engineering fungi to express insect proteins and insecticidal proteins/peptides from insect predators and other insect pathogens, or by overexpressing the pathogen's own genes. Importantly, protein engineering can be used to mix and match functional domains from diverse genes sourced from entomopathogenic fungi and other organisms, producing insecticidal proteins with novel characteristics. Fungal tolerance to abiotic stresses, especially UV radiation, has been greatly improved by introducing into entomopathogens a photoreactivation system from an archaean and pigment synthesis pathways from nonentomopathogenic fungi. Conversely, gene knockout strategies have produced strains with reduced ecological fitness as recipients for genetic engineering to improve virulence; the resulting strains are hypervirulent, but will not persist in the environment. Coupled with their natural insect specificity, safety concerns can also be mitigated by using safe effector proteins with selection marker genes removed after transformation. With the increasing public concern over the continued use of synthetic chemical insecticides and growing public acceptance of genetically modified organisms, new types of biological insecticides produced by genetic engineering offer a range of environmentally friendly options for cost-effective control of insect pests. Copyright © 2016 Elsevier Inc. All rights reserved.

  18. Enhanced rhamnolipid production in Burkholderia thailandensis transposon knockout strains deficient in polyhydroxyalkanoate (PHA) synthesis.

    PubMed

    Funston, Scott J; Tsaousi, Konstantina; Smyth, Thomas J; Twigg, Matthew S; Marchant, Roger; Banat, Ibrahim M

    2017-12-01

    Microbially produced rhamnolipids have significant commercial potential; however, the main bacterial producer, Pseudomonas aeruginosa, is an opportunistic human pathogen, which limits biotechnological exploitation. The non-pathogenic species Burkholderia thailandensis produces rhamnolipids; however, yield is relatively low. The aim of this study was to determine whether rhamnolipid production could be increased in Burkholderia thailandensis through mutation of genes responsible for the synthesis of the storage material polyhydroxyalkanoate (PHA), thereby increasing cellular resources for the production of rhamnolipids. Potential PHA target genes were identified in B. thailandensis through comparison with known function genes in Pseudomonas aeruginosa. Multiple knockout strains for the phbA, phbB and phbC genes were obtained and their growth characteristics and rhamnolipid and PHA production determined. The wild-type strain and an rhamnolipid (RL)-deficient strain were used as controls. Three knockout strains (ΔphbA1, ΔphbB1 and ΔphbC1) with the best enhancement of rhamnolipid production were selected for detailed study. ΔphbB1 produced the highest level of purified RL (3.78 g l -1 ) compared to the wild-type strain (1.28 g l -1 ). In ΔphbB1, the proportion of mono-rhamnolipid was also increased compared to the wild-type strain. The production of PHA was reduced by at least 80% in all three phb mutant strains, although never completely eliminated. These results suggest that, in contrast to Pseudomonas aeruginosa, knockout of the PHA synthesis pathway in Burkholderia thailandensis could be used to increase rhamnolipid production. The evidence of residual PHA production in the phb mutant strains suggests B. thailandensis possesses a secondary unelucidated PHA synthesis pathway.

  19. Reduced osteoblast activity in the mice lacking TR4 nuclear receptor leads to osteoporosis.

    PubMed

    Lin, Shin-Jen; Ho, Hsin-Chiu; Lee, Yi-Fen; Liu, Ning-Chun; Liu, Su; Li, Gonghui; Shyr, Chih-Rong; Chang, Chawnshang

    2012-06-07

    Early studies suggested that TR4 nuclear receptor might play important roles in the skeletal development, yet its detailed mechanism remains unclear. We generated TR4 knockout mice and compared skeletal development with their wild type littermates. Primary bone marrow cells were cultured and we assayed bone differentiation by alkaline phosphatase and alizarin red staining. Primary calvaria were cultured and osteoblastic marker genes were detected by quantitative PCR. Luciferase reporter assays, chromatin immunoprecipitation (ChIP) assays, and electrophoretic mobility shift assays (EMSA) were performed to demonstrate TR4 can directly regulate bone differentiation marker osteocalcin. We first found mice lacking TR4 might develop osteoporosis. We then found that osteoblast progenitor cells isolated from bone marrow of TR4 knockout mice displayed reduced osteoblast differentiation capacity and calcification. Osteoblast primary cultures from TR4 knockout mice calvaria also showed higher proliferation rates indicating lower osteoblast differentiation ability in mice after loss of TR4. Mechanism dissection found the expression of osteoblast markers genes, such as ALP, type I collagen alpha 1, osteocalcin, PTH, and PTHR was dramatically reduced in osteoblasts from TR4 knockout mice as compared to those from TR4 wild type mice. In vitro cell line studies with luciferase reporter assay, ChIP assay, and EMSA further demonstrated TR4 could bind directly to the promoter region of osteocalcin gene and induce its gene expression at the transcriptional level in a dose dependent manner. Together, these results demonstrate TR4 may function as a novel transcriptional factor to play pathophysiological roles in maintaining normal osteoblast activity during the bone development and remodeling, and disruption of TR4 function may result in multiple skeletal abnormalities.

  20. Normal radial migration and lamination are maintained in dyslexia-susceptibility candidate gene homolog Kiaa0319 knockout mice.

    PubMed

    Martinez-Garay, Isabel; Guidi, Luiz G; Holloway, Zoe G; Bailey, Melissa A G; Lyngholm, Daniel; Schneider, Tomasz; Donnison, Timothy; Butt, Simon J B; Monaco, Anthony P; Molnár, Zoltán; Velayos-Baeza, Antonio

    2017-04-01

    Developmental dyslexia is a common disorder with a strong genetic component, but the underlying molecular mechanisms are still unknown. Several candidate dyslexia-susceptibility genes, including KIAA0319, DYX1C1, and DCDC2, have been identified in humans. RNA interference experiments targeting these genes in rat embryos have shown impairments in neuronal migration, suggesting that defects in radial cortical migration could be involved in the disease mechanism of dyslexia. Here we present the first characterisation of a Kiaa0319 knockout mouse line. Animals lacking KIAA0319 protein do not show anatomical abnormalities in any of the layered structures of the brain. Neurogenesis and radial migration of cortical projection neurons are not altered, and the intrinsic electrophysiological properties of Kiaa0319-deficient neurons do not differ from those of wild-type neurons. Kiaa0319 overexpression in cortex delays radial migration, but does not affect final neuronal position. However, knockout animals show subtle differences suggesting possible alterations in anxiety-related behaviour and in sensorimotor gating. Our results do not reveal a migration disorder in the mouse model, adding to the body of evidence available for Dcdc2 and Dyx1c1 that, unlike in the rat in utero knockdown models, the dyslexia-susceptibility candidate mouse homolog genes do not play an evident role in neuronal migration. However, KIAA0319 protein expression seems to be restricted to the brain, not only in early developmental stages but also in adult mice, indicative of a role of this protein in brain function. The constitutive and conditional knockout lines reported here will be useful tools for further functional analyses of Kiaa0319.

  1. Bloomsbury report on mouse embryo phenotyping: recommendations from the IMPC workshop on embryonic lethal screening.

    PubMed

    Adams, David; Baldock, Richard; Bhattacharya, Shoumo; Copp, Andrew J; Dickinson, Mary; Greene, Nicholas D E; Henkelman, Mark; Justice, Monica; Mohun, Timothy; Murray, Stephen A; Pauws, Erwin; Raess, Michael; Rossant, Janet; Weaver, Tom; West, David

    2013-05-01

    Identifying genes that are important for embryo development is a crucial first step towards understanding their many functions in driving the ordered growth, differentiation and organogenesis of embryos. It can also shed light on the origins of developmental disease and congenital abnormalities. Current international efforts to examine gene function in the mouse provide a unique opportunity to pinpoint genes that are involved in embryogenesis, owing to the emergence of embryonic lethal knockout mutants. Through internationally coordinated efforts, the International Knockout Mouse Consortium (IKMC) has generated a public resource of mouse knockout strains and, in April 2012, the International Mouse Phenotyping Consortium (IMPC), supported by the EU InfraCoMP programme, convened a workshop to discuss developing a phenotyping pipeline for the investigation of embryonic lethal knockout lines. This workshop brought together over 100 scientists, from 13 countries, who are working in the academic and commercial research sectors, including experts and opinion leaders in the fields of embryology, animal imaging, data capture, quality control and annotation, high-throughput mouse production, phenotyping, and reporter gene analysis. This article summarises the outcome of the workshop, including (1) the vital scientific importance of phenotyping embryonic lethal mouse strains for basic and translational research; (2) a common framework to harmonise international efforts within this context; (3) the types of phenotyping that are likely to be most appropriate for systematic use, with a focus on 3D embryo imaging; (4) the importance of centralising data in a standardised form to facilitate data mining; and (5) the development of online tools to allow open access to and dissemination of the phenotyping data.

  2. Gene silencing in Escherichia coli using antisense RNAs expressed from doxycycline-inducible vectors.

    PubMed

    Nakashima, N; Tamura, T

    2013-06-01

    Here, we report on the construction of doxycycline (tetracycline analogue)-inducible vectors that express antisense RNAs in Escherichia coli. Using these vectors, the expression of genes of interest can be silenced conditionally. The expression of antisense RNAs from the vectors was more tightly regulated than the previously constructed isopropyl-β-D-galactopyranoside-inducible vectors. Furthermore, expression levels of antisense RNAs were enhanced by combining the doxycycline-inducible promoter with the T7 promoter-T7 RNA polymerase system; the T7 RNA polymerase gene, under control of the doxycycline-inducible promoter, was integrated into the lacZ locus of the genome without leaving any antibiotic marker. These vectors are useful for investigating gene functions or altering cell phenotypes for biotechnological and industrial applications. A gene silencing method using antisense RNAs in Escherichia coli is described, which facilitates the investigation of bacterial gene function. In particular, the method is suitable for comprehensive analyses or phenotypic analyses of genes essential for growth. Here, we describe expansion of vector variations for expressing antisense RNAs, allowing choice of a vector appropriate for the target genes or experimental purpose. © 2013 The Society for Applied Microbiology.

  3. Low molecular weight polyethylenimine cross-linked by 2-hydroxypropyl-gamma-cyclodextrin coupled to peptide targeting HER2 as a gene delivery vector.

    PubMed

    Huang, Hongliang; Yu, Hai; Tang, Guping; Wang, Qingqing; Li, Jun

    2010-03-01

    Gene delivery is one of the critical steps for gene therapy. Non-viral vectors have many advantages but suffered from low gene transfection efficiency. Here, in order to develop new polymeric gene vectors with low cytotoxicity and high gene transfection efficiency, we synthesized a cationic polymer composed of low molecular weight polyethylenimine (PEI) of molecular weight of 600 Da cross-linked by 2-hydroxypropyl-gamma-cyclodextrin (HP gamma-CD) and then coupled to MC-10 oligopeptide containing a sequence of Met-Ala-Arg-Ala-Lys-Glu. The oligopeptide can target to HER2, the human epidermal growth factor receptor 2, which is often over expressed in many breast and ovary cancers. The new gene vector was expected to be able to target delivery of genes to HER2 positive cancer cells for gene therapy. The new gene vector was composed of chemically bonded HP gamma-CD, PEI (600 Da), and MC-10 peptide at a molar ratio of 1:3.3:1.2. The gene vector could condense plasmid DNA at an N/P ratio of 6 or above. The particle size of HP gamma-CD-PEI-P/DNA complexes at N/P ratios 40 was around 170-200 nm, with zeta potential of about 20 mV. The gene vector showed very low cytotoxicity, strong targeting specificity to HER2 receptor, and high efficiency of delivering DNA to target cells in vitro and in vivo with the reporter genes. The delivery of therapeutic IFN-alpha gene mediated by the new gene vector and the therapeutic efficiency were also studied in mice animal model. The animal study results showed that the new gene vector HP gamma-CD-PEI-P significantly enhanced the anti-tumor effect on tumor-bearing nude mice as compared to PEI (25 kDa), HP gamma-CD-PEI, and other controls, indicating that this new polymeric gene vector is a potential candidate for cancer gene therapy. (c) 2009 Elsevier Ltd. All rights reserved.

  4. Development and trial of vaccines against Brucella.

    PubMed

    Lalsiamthara, Jonathan; Lee, John Hwa

    2017-08-31

    The search for ideal brucellosis vaccines remains active today. Currently, no licensed human or canine anti-brucellosis vaccines are available. In bovines, the most successful vaccine (S19) is only used in calves, as adult vaccination results in orchitis in male, prolonged infection, and possible abortion complications in pregnant female cattle. Another widely deployed vaccine (RB51) has a low protective efficacy. An ideal vaccine should exhibit a safe profile as well as enhance protective efficacy. However, currently available vaccines exhibit one or more major drawbacks. Smooth live attenuated vaccines suffer shortcomings such as residual virulence and serodiagnostic interference. Inactivated vaccines, in general, confer relatively low levels of protection. Recent developments to improve brucellosis vaccines include generation of knockout mutants by targeting genes involved in metabolism, virulence, and the lipopolysaccharide synthesis pathway, as well as generation of DNA vaccines, mucosal vaccines, and live vectored vaccines, have all produced varying degrees of success. Herein, we briefly review the bacteriology, pathogenesis, immunological implications, candidate vaccines, vaccinations, and models related to Brucella .

  5. Development and trial of vaccines against Brucella

    PubMed Central

    Lalsiamthara, Jonathan

    2017-01-01

    The search for ideal brucellosis vaccines remains active today. Currently, no licensed human or canine anti-brucellosis vaccines are available. In bovines, the most successful vaccine (S19) is only used in calves, as adult vaccination results in orchitis in male, prolonged infection, and possible abortion complications in pregnant female cattle. Another widely deployed vaccine (RB51) has a low protective efficacy. An ideal vaccine should exhibit a safe profile as well as enhance protective efficacy. However, currently available vaccines exhibit one or more major drawbacks. Smooth live attenuated vaccines suffer shortcomings such as residual virulence and serodiagnostic interference. Inactivated vaccines, in general, confer relatively low levels of protection. Recent developments to improve brucellosis vaccines include generation of knockout mutants by targeting genes involved in metabolism, virulence, and the lipopolysaccharide synthesis pathway, as well as generation of DNA vaccines, mucosal vaccines, and live vectored vaccines, have all produced varying degrees of success. Herein, we briefly review the bacteriology, pathogenesis, immunological implications, candidate vaccines, vaccinations, and models related to Brucella. PMID:28859268

  6. Efficient generation of P53 biallelic knockout Diannan miniature pigs via TALENs and somatic cell nuclear transfer.

    PubMed

    Shen, Youfeng; Xu, Kaixiang; Yuan, Zaimei; Guo, Jianxiong; Zhao, Heng; Zhang, Xuezeng; Zhao, Lu; Qing, Yubo; Li, Honghui; Pan, Weirong; Jia, Baoyu; Zhao, Hong-Ye; Wei, Hong-Jiang

    2017-11-03

    Pigs have many features that make them attractive as biomedical models for various diseases, including cancer. P53 is an important tumor suppressor gene that exerts a central role in protecting cells from oncogenic transformation and is mutated in a large number of human cancers. P53 mutations occur in almost every type of tumor and in over 50% of all tumors. In a recent publication, pigs with a mutated P53 gene were generated that resulted in lymphoma and renal and osteogenic tumors. However, approximately 80% of human tumors have dysfunctional P53. A P53-deficient pig model is still required to elucidate. Transcription activator-like effector nucleases (TALENs) were designed to target porcine P53 exon 4. The targeting activity was evaluated using a luciferase SSA recombination assay. P53 biallelic knockout (KO) cell lines were established from single-cell colonies of fetal fibroblasts derived from Diannan miniature pigs followed by electroporation with TALENs plasmids. One cell line was selected as the donor cell line for somatic cell nuclear transfer (SCNT) for the generation of P53 KO pigs. P53 KO stillborn fetuses and living piglets were obtained. Gene typing of the collected cloned individuals was performed by T7EI assay and sequencing. Fibroblast cells from Diannan miniature piglets with a P53 biallelic knockout or wild type were analyzed for the P53 response to doxorubicin treatment by confocal microscopy and western blotting. The luciferase SSA recombination assay revealed that the targeting activities of the designed TALENs were 55.35-fold higher than those of the control. Eight cell lines (8/19) were mutated for P53, and five of them were biallelic knockouts. One of the biallelic knockout cell lines was selected as nuclear donor cells for SCNT. The cloned embryos were transferred into five recipient gilts, three of them becoming pregnant. Five live fetuses were obtained from one surrogate by caesarean section after 38 days of gestation for genotyping. Finally, six live piglets and one stillborn piglet were collected from two recipients by caesarean section. Sequencing analyses of the target site confirmed the P53 biallelic knockout in all fetuses and piglets, consistent with the genotype of the donor cells. The qPCR analysis showed that the expression of the P53 mRNA had significant reduction in various tissues of the knockout piglets. Furthermore, confocal microscopy and western blotting analyses demonstrated that the fibroblast cells of Diannan miniature piglets with a P53 biallelic knockout were defective in mediating DNA damage when incubated with doxorubicin. TALENs combined with SCNT was successfully used to generate P53 KO Diannan miniature pigs. Although these genetically engineered Diannan miniature pigs had no tumorigenic signs, the P53 gene was dysfunctional. We believe that these pigs will provide powerful new resources for preclinical oncology and basic cancer research.

  7. NCKX3 was compensated by calcium transporting genes and bone resorption in a NCKX3 KO mouse model.

    PubMed

    Yang, Hyun; Ahn, Changhwan; Shin, Eun-Kyeong; Lee, Ji-Sun; An, Beum-Soo; Jeung, Eui-Bae

    2017-10-15

    Gene knockout is the most powerful tool for determination of gene function or permanent modification of the phenotypic characteristics of an animal. Existing methods for gene disruption are limited by their efficiency, time required for completion and potential for confounding off-target effects. In this study, a rapid single-step approach to knockout of a targeted gene in mice using zinc-finger nucleases (ZFNs) was demonstrated for generation of mutant (knockout; KO) alleles. Specifically, ZFNs to target the sodium/calcium/potassium exchanger3 (NCKX3) gene in C57bl/6j were designed using the concept of this approach. NCKX3 KO mice were generated and the phenotypic characterization and molecular regulation of active calcium transporting genes was assessed when mice were fed different calcium diets during growth. General phenotypes such as body weight and plasma ion level showed no distinct abnormalities. Thus, the potassium/sodium/calcium exchanger of NCKX3 KO mice proceeded normally in this study. As a result, the compensatory molecular regulation of this mechanism was elucidated. Renal TRPV5 mRNA of NCKX3 KO mice increased in both male and female mice. Expression of TRPV6 mRNA was only down-regulated in the duodenum of male KO mice. Renal- and duodenal expression of PTHR and VDR were not changed; however, GR mRNA expression was increased in the kidney of NCKX3 KO mice. Depletion of the NCKX3 gene in a KO mouse model showed loss of bone mineral contents and increased plasma parathyroid hormone, suggesting that NCKX3 may play a role in regulating calcium homeostasis. Copyright © 2017 Elsevier B.V. All rights reserved.

  8. Adenovirus-Mediated Gene Delivery: Potential Applications for Gene and Cell-Based Therapies in the New Era of Personalized Medicine

    PubMed Central

    Lee, Cody S.; Bishop, Elliot S.; Zhang, Ruyi; Yu, Xinyi; Farina, Evan M.; Yan, Shujuan; Zhao, Chen; Zheng, Zongyue; Shu, Yi; Wu, Xingye; Lei, Jiayan; Li, Yasha; Zhang, Wenwen; Yang, Chao; Wu, Ke; Wu, Ying; Ho, Sherwin; Athiviraham, Aravind; Lee, Michael J.; Wolf, Jennifer Moriatis; Reid, Russell R.; He, Tong-Chuan

    2017-01-01

    With rapid advances in understanding molecular pathogenesis of human diseases in the era of genome sciences and systems biology, it is anticipated that increasing numbers of therapeutic genes or targets will become available for targeted therapies. Despite numerous setbacks, efficacious gene and/or cell-based therapies still hold the great promise to revolutionize the clinical management of human diseases. It is wildly recognized that poor gene delivery is the limiting factor for most in vivo gene therapies. There has been a long-lasting interest in using viral vectors, especially adenoviral vectors, to deliver therapeutic genes for the past two decades. Among all currently available viral vectors, adenovirus is the most efficient gene delivery system in a broad range of cell and tissue types. The applications of adenoviral vectors in gene delivery have greatly increased in number and efficiency since their initial development. In fact, among over 2,000 gene therapy clinical trials approved worldwide since 1989, a significant portion of the trials have utilized adenoviral vectors. This review aims to provide a comprehensive overview on the characteristics of adenoviral vectors, including adenoviral biology, approaches to engineering adenoviral vectors, and their applications in clinical and pre-clinical studies with an emphasis in the areas of cancer treatment, vaccination and regenerative medicine. Current challenges and future directions regarding the use of adenoviral vectors are also discussed. It is expected that the continued improvements in adenoviral vectors should provide great opportunities for cell and gene therapies to live up to its enormous potential in personalized medicine. PMID:28944281

  9. Gravity Persistent Signal 1 (GPS1) reveals novel cytochrome P450s involved in gravitropism.

    PubMed

    Withers, John C; Shipp, Matthew J; Rupasinghe, Sanjeewa G; Sukumar, Poornima; Schuler, Mary A; Muday, Gloria K; Wyatt, Sarah E

    2013-01-01

    Gravity is an important environmental factor that affects growth and development of plants. In response to changes in gravity, directional growth occurs along the major axes and lateral branches of both shoots and roots. The gravity persistent signal (gps) mutants of Arabidopsis thaliana were previously identified as having an altered response to gravity when reoriented relative to the gravity vector in the cold, with the gps1 mutant exhibiting a complete loss of tropic response under these conditions. Thermal asymmetric interlaced (TAIL) PCR was used to identify the gene defective in gps1. Gene expression data, molecular modeling and computational substrate dockings, quantitative RT-PCR analyses, reporter gene fusions, and physiological analyses of knockout mutants were used to characterize the genes identified. Cloning of the gene defective in gps1 and genetic complementation revealed that GPS1 encodes CYP705A22, a cytochrome P450 monooxygenase (P450). CYP705A5, a closely related family member, was identified as expressed specifically in roots in response to gravistimulation, and a mutation affecting its expression resulted in a delayed gravity response, increased flavonol levels, and decreased basipetal auxin transport. Molecular modeling coupled with in silico substrate docking and diphenylboric acid 2-aminoethyl ester (DBPA) staining indicated that these P450s are involved in biosynthesis of flavonoids potentially involved in auxin transport. The characterization of two novel P450s (CYP705A22 and CYP705A5) and their role in the gravity response has offered new insights into the regulation of the genetic and physiological controls of plant gravitropism.

  10. Identifying Cancer Driver Genes Using Replication-Incompetent Retroviral Vectors

    PubMed Central

    Bii, Victor M.; Trobridge, Grant D.

    2016-01-01

    Identifying novel genes that drive tumor metastasis and drug resistance has significant potential to improve patient outcomes. High-throughput sequencing approaches have identified cancer genes, but distinguishing driver genes from passengers remains challenging. Insertional mutagenesis screens using replication-incompetent retroviral vectors have emerged as a powerful tool to identify cancer genes. Unlike replicating retroviruses and transposons, replication-incompetent retroviral vectors lack additional mutagenesis events that can complicate the identification of driver mutations from passenger mutations. They can also be used for almost any human cancer due to the broad tropism of the vectors. Replication-incompetent retroviral vectors have the ability to dysregulate nearby cancer genes via several mechanisms including enhancer-mediated activation of gene promoters. The integrated provirus acts as a unique molecular tag for nearby candidate driver genes which can be rapidly identified using well established methods that utilize next generation sequencing and bioinformatics programs. Recently, retroviral vector screens have been used to efficiently identify candidate driver genes in prostate, breast, liver and pancreatic cancers. Validated driver genes can be potential therapeutic targets and biomarkers. In this review, we describe the emergence of retroviral insertional mutagenesis screens using replication-incompetent retroviral vectors as a novel tool to identify cancer driver genes in different cancer types. PMID:27792127

  11. Chromosome preference of disease genes and vectorization for the prediction of non-coding disease genes.

    PubMed

    Peng, Hui; Lan, Chaowang; Liu, Yuansheng; Liu, Tao; Blumenstein, Michael; Li, Jinyan

    2017-10-03

    Disease-related protein-coding genes have been widely studied, but disease-related non-coding genes remain largely unknown. This work introduces a new vector to represent diseases, and applies the newly vectorized data for a positive-unlabeled learning algorithm to predict and rank disease-related long non-coding RNA (lncRNA) genes. This novel vector representation for diseases consists of two sub-vectors, one is composed of 45 elements, characterizing the information entropies of the disease genes distribution over 45 chromosome substructures. This idea is supported by our observation that some substructures (e.g., the chromosome 6 p-arm) are highly preferred by disease-related protein coding genes, while some (e.g., the 21 p-arm) are not favored at all. The second sub-vector is 30-dimensional, characterizing the distribution of disease gene enriched KEGG pathways in comparison with our manually created pathway groups. The second sub-vector complements with the first one to differentiate between various diseases. Our prediction method outperforms the state-of-the-art methods on benchmark datasets for prioritizing disease related lncRNA genes. The method also works well when only the sequence information of an lncRNA gene is known, or even when a given disease has no currently recognized long non-coding genes.

  12. Chromosome preference of disease genes and vectorization for the prediction of non-coding disease genes

    PubMed Central

    Peng, Hui; Lan, Chaowang; Liu, Yuansheng; Liu, Tao; Blumenstein, Michael; Li, Jinyan

    2017-01-01

    Disease-related protein-coding genes have been widely studied, but disease-related non-coding genes remain largely unknown. This work introduces a new vector to represent diseases, and applies the newly vectorized data for a positive-unlabeled learning algorithm to predict and rank disease-related long non-coding RNA (lncRNA) genes. This novel vector representation for diseases consists of two sub-vectors, one is composed of 45 elements, characterizing the information entropies of the disease genes distribution over 45 chromosome substructures. This idea is supported by our observation that some substructures (e.g., the chromosome 6 p-arm) are highly preferred by disease-related protein coding genes, while some (e.g., the 21 p-arm) are not favored at all. The second sub-vector is 30-dimensional, characterizing the distribution of disease gene enriched KEGG pathways in comparison with our manually created pathway groups. The second sub-vector complements with the first one to differentiate between various diseases. Our prediction method outperforms the state-of-the-art methods on benchmark datasets for prioritizing disease related lncRNA genes. The method also works well when only the sequence information of an lncRNA gene is known, or even when a given disease has no currently recognized long non-coding genes. PMID:29108274

  13. Protein arginine methyltransferase 1 modulates innate immune responses through regulation of peroxisome proliferator-activated receptor γ-dependent macrophage differentiation.

    PubMed

    Tikhanovich, Irina; Zhao, Jie; Olson, Jody; Adams, Abby; Taylor, Ryan; Bridges, Brian; Marshall, Laurie; Roberts, Benjamin; Weinman, Steven A

    2017-04-28

    Arginine methylation is a common posttranslational modification that has been shown to regulate both gene expression and extranuclear signaling events. We recently reported defects in protein arginine methyltransferase 1 (PRMT1) activity and arginine methylation in the livers of cirrhosis patients with a history of recurrent infections. To examine the role of PRMT1 in innate immune responses in vivo , we created a cell type-specific knock-out mouse model. We showed that myeloid-specific PRMT1 knock-out mice demonstrate higher proinflammatory cytokine production and a lower survival rate after cecal ligation and puncture. We found that this defect is because of defective peroxisome proliferator-activated receptor γ (PPARγ)-dependent M2 macrophage differentiation. PPARγ is one of the key transcription factors regulating macrophage polarization toward a more anti-inflammatory and pro-resolving phenotype. We found that PRMT1 knock-out macrophages failed to up-regulate PPARγ expression in response to IL4 treatment resulting in 4-fold lower PPARγ expression in knock-out cells than in wild-type cells. Detailed study of the mechanism revealed that PRMT1 regulates PPARγ gene expression through histone H4R3me2a methylation at the PPARγ promoter. Supplementing with PPARγ agonists rosiglitazone and GW1929 was sufficient to restore M2 differentiation in vivo and in vitro and abrogated the difference in survival between wild-type and PRMT1 knock-out mice. Taken together these data suggest that PRMT1-dependent regulation of macrophage PPARγ expression contributes to the infection susceptibility in PRMT1 knock-out mice. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

  14. Disrupting the male germ line to find infertility and contraception targets.

    PubMed

    Archambeault, Denise R; Matzuk, Martin M

    2014-05-01

    Genetically-manipulated mouse models have become indispensible for broadening our understanding of genes and pathways related to male germ cell development. Until suitable in vitro systems for studying spermatogenesis are perfected, in vivo models will remain the gold standard for inquiry into testicular function. Here, we discuss exciting advances that are allowing researchers faster, easier, and more customizable access to their mouse models of interest. Specifically, the trans-NIH Knockout Mouse Project (KOMP) is working to generate knockout mouse models of every gene in the mouse genome. The related Knockout Mouse Phenotyping Program (KOMP2) is performing systematic phenotypic analysis of this genome-wide collection of knockout mice, including fertility screening. Together, these programs will not only uncover new genes involved in male germ cell development but also provide the research community with the mouse models necessary for further investigations. In addition to KOMP/KOMP2, another promising development in the field of mouse models is the advent of CRISPR (clustered regularly interspaced short palindromic repeat)-Cas technology. Utilizing 20 nucleotide guide sequences, CRISPR/Cas has the potential to introduce sequence-specific insertions, deletions, and point mutations to produce null, conditional, activated, or reporter-tagged alleles. CRISPR/Cas can also successfully target multiple genes in a single experimental step, forgoing the multiple generations of breeding traditionally required to produce mouse models with deletions, insertions, or mutations in multiple genes. In addition, CRISPR/Cas can be used to create mouse models carrying variants identical to those identified in infertile human patients, providing the opportunity to explore the effects of such mutations in an in vivo system. Both the KOMP/KOMP2 projects and the CRISPR/Cas system provide powerful, accessible genetic approaches to the study of male germ cell development in the mouse. A more complete understanding of male germ cell biology is critical for the identification of novel targets for potential non-hormonal contraceptive intervention. Copyright © 2014. Published by Elsevier Masson SAS.

  15. Human knockouts and phenotypic analysis in a cohort with a high rate of consanguinity.

    PubMed

    Saleheen, Danish; Natarajan, Pradeep; Armean, Irina M; Zhao, Wei; Rasheed, Asif; Khetarpal, Sumeet A; Won, Hong-Hee; Karczewski, Konrad J; O'Donnell-Luria, Anne H; Samocha, Kaitlin E; Weisburd, Benjamin; Gupta, Namrata; Zaidi, Mozzam; Samuel, Maria; Imran, Atif; Abbas, Shahid; Majeed, Faisal; Ishaq, Madiha; Akhtar, Saba; Trindade, Kevin; Mucksavage, Megan; Qamar, Nadeem; Zaman, Khan Shah; Yaqoob, Zia; Saghir, Tahir; Rizvi, Syed Nadeem Hasan; Memon, Anis; Hayyat Mallick, Nadeem; Ishaq, Mohammad; Rasheed, Syed Zahed; Memon, Fazal-Ur-Rehman; Mahmood, Khalid; Ahmed, Naveeduddin; Do, Ron; Krauss, Ronald M; MacArthur, Daniel G; Gabriel, Stacey; Lander, Eric S; Daly, Mark J; Frossard, Philippe; Danesh, John; Rader, Daniel J; Kathiresan, Sekar

    2017-04-12

    A major goal of biomedicine is to understand the function of every gene in the human genome. Loss-of-function mutations can disrupt both copies of a given gene in humans and phenotypic analysis of such 'human knockouts' can provide insight into gene function. Consanguineous unions are more likely to result in offspring carrying homozygous loss-of-function mutations. In Pakistan, consanguinity rates are notably high. Here we sequence the protein-coding regions of 10,503 adult participants in the Pakistan Risk of Myocardial Infarction Study (PROMIS), designed to understand the determinants of cardiometabolic diseases in individuals from South Asia. We identified individuals carrying homozygous predicted loss-of-function (pLoF) mutations, and performed phenotypic analysis involving more than 200 biochemical and disease traits. We enumerated 49,138 rare (<1% minor allele frequency) pLoF mutations. These pLoF mutations are estimated to knock out 1,317 genes, each in at least one participant. Homozygosity for pLoF mutations at PLA2G7 was associated with absent enzymatic activity of soluble lipoprotein-associated phospholipase A2; at CYP2F1, with higher plasma interleukin-8 concentrations; at TREH, with lower concentrations of apoB-containing lipoprotein subfractions; at either A3GALT2 or NRG4, with markedly reduced plasma insulin C-peptide concentrations; and at SLC9A3R1, with mediators of calcium and phosphate signalling. Heterozygous deficiency of APOC3 has been shown to protect against coronary heart disease; we identified APOC3 homozygous pLoF carriers in our cohort. We recruited these human knockouts and challenged them with an oral fat load. Compared with family members lacking the mutation, individuals with APOC3 knocked out displayed marked blunting of the usual post-prandial rise in plasma triglycerides. Overall, these observations provide a roadmap for a 'human knockout project', a systematic effort to understand the phenotypic consequences of complete disruption of genes in humans.

  16. Production and characterization of murine models of classic and intermediate maple syrup urine disease

    PubMed Central

    Homanics, Gregg E; Skvorak, Kristen; Ferguson, Carolyn; Watkins, Simon; Paul, Harbhajan S

    2006-01-01

    Background Maple Syrup Urine Disease (MSUD) is an inborn error of metabolism caused by a deficiency of branched-chain keto acid dehydrogenase. MSUD has several clinical phenotypes depending on the degree of enzyme deficiency. Current treatments are not satisfactory and require new approaches to combat this disease. A major hurdle in developing new treatments has been the lack of a suitable animal model. Methods To create a murine model of classic MSUD, we used gene targeting and embryonic stem cell technologies to create a mouse line that lacked a functional E2 subunit gene of branched-chain keto acid dehydrogenase. To create a murine model of intermediate MSUD, we used transgenic technology to express a human E2 cDNA on the knockout background. Mice of both models were characterized at the molecular, biochemical, and whole animal levels. Results By disrupting the E2 subunit gene of branched-chain keto acid dehydrogenase, we created a gene knockout mouse model of classic MSUD. The homozygous knockout mice lacked branched-chain keto acid dehydrogenase activity, E2 immunoreactivity, and had a 3-fold increase in circulating branched-chain amino acids. These metabolic derangements resulted in neonatal lethality. Transgenic expression of a human E2 cDNA in the liver of the E2 knockout animals produced a model of intermediate MSUD. Branched-chain keto acid dehydrogenase activity was 5–6% of normal and was sufficient to allow survival, but was insufficient to normalize circulating branched-chain amino acids levels, which were intermediate between wildtype and the classic MSUD mouse model. Conclusion These mice represent important animal models that closely approximate the phenotype of humans with the classic and intermediate forms of MSUD. These animals provide useful models to further characterize the pathogenesis of MSUD, as well as models to test novel therapeutic strategies, such as gene and cellular therapies, to treat this devastating metabolic disease. PMID:16579849

  17. Long non-coding RNAs regulate effects of β-crystallin B2 on mouse ovary development.

    PubMed

    Gao, Qian; Ren, Hanxiao; Chen, Mingkun; Niu, Ziguang; Tao, Haibo; Jia, Yin; Zhang, Jianrong; Li, Wenjie

    2016-11-01

    β-crystallin B2 (CRYBB2) knockout mice exhibit morphological and functional abnormalities in the ovary. Long non‑coding RNAs (lncRNAs) regulate gene transcription and translation, and epigenetic modification of genomic DNA. The present study investigated the role of lncRNAs in mediating the effects of CRYBB2 in the regulation of ovary development in mice. In the current study, ovary tissues from wild‑type (WT) and CRYBB2 knockout mice were subjected to lncRNA and mRNA microarray profiling. Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) analyses were performed to group the differentially expressed lncRNAs into regulated gene pathways and functions. The correlation matrix method was used to establish a network of lncRNA and mRNA co‑expression. Quantitative reverse transcription-polymerase chain reaction (RT‑qPCR) was used to verify expression of a number of these differentially expressed lncRNAs and mRNAs. There were 157 differentially expressed lncRNAs and 1,085 differentially expressed mRNAs between ovary tissues from WT and CRYBB2 knockout mice. The GO and KEGG analyses indicated that these differentially expressed lncRNAs and mRNAs were important in Ca2+ signaling and ligand and receptor interactions. The correlation matrix method established an lncRNA and mRNA co‑expression network, consisting of 53 lncRNAs and 45 mRNAs with 98 nodes and 75 connections. RT‑qPCR confirmed downregulation of lncRNA A‑30‑P01019163 expression, which further downregulated its downstream gene purinergic receptor P2X, ligand‑gated ion channel, 7 (P2rx7) expression in ovary tissues from CRYBB2 knockout mice. In conclusion, CRYBB2 regulates expression of different lncRNAs to influence ovary development. lncRNA A‑30‑P01019163 may affect ovarian cell cycle and proliferation by regulating P2rx7 expression in the ovary.

  18. Efficient genome editing of wild strawberry genes, vector development and validation.

    PubMed

    Zhou, Junhui; Wang, Guoming; Liu, Zhongchi

    2018-03-25

    The clustered regularly interspaced short palindromic repeats (CRISPR)-Cas9 system is an effective genome editing tool for plant and animal genomes. However, there are still few reports on the successful application of CRISPR-Cas9 to horticultural plants, especially with regard to germ-line transmission of targeted mutations. Here, we report high-efficiency genome editing in the wild strawberry Fragaria vesca and its successful application to mutate the auxin biosynthesis gene TAA1 and auxin response factor 8 (ARF8). In our CRISPR system, the Arabidopsis U6 promoter AtU6-26 and the wild strawberry U6 promoter FveU6-2 were each used to drive the expression of sgRNA, and both promoters were shown to lead to high-efficiency genome editing in strawberry. To test germ-line transmission of the edited mutations and new mutations induced in the next generation, the progeny of the primary (T0) transgenic plants carrying the CRISPR construct was analysed. New mutations were detected in the progeny plants at a high efficiency, including large deletions between the two PAM sites. Further, T1 plants harbouring arf8 homozygous knockout mutations grew considerably faster than wild-type plants. The results indicate that our CRISPR vectors can be used to edit the wild strawberry genome at a high efficiency and that both sgRNA design and appropriate U6 promoters contribute to the success of genomic editing. Our results open up exciting opportunities for engineering strawberry and related horticultural crops to improve traits of economic importance. © 2018 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.

  19. Altered Sleep and Affect in the Neurotensin Receptor 1 Knockout Mouse

    PubMed Central

    Fitzpatrick, Karrie; Winrow, Christopher J.; Gotter, Anthony L.; Millstein, Joshua; Arbuzova, Janna; Brunner, Joseph; Kasarskis, Andrew; Vitaterna, Martha H.; Renger, John J.; Turek, Fred W.

    2012-01-01

    Study Objective: Sleep and mood disorders have long been understood to have strong genetic components, and there is considerable comorbidity of sleep abnormalities and mood disorders, suggesting the involvement of common genetic pathways. Here, we examine a candidate gene implicated in the regulation of both sleep and affective behavior using a knockout mouse model. Design: Previously, we identified a quantitative trait locus (QTL) for REM sleep amount, REM sleep bout number, and wake amount in a genetically segregating population of mice. Here, we show that traits mapping to this QTL correlated with an expression QTL for neurotensin receptor 1 (Ntsr1), a receptor for neurotensin, a ligand known to be involved in several psychiatric disorders. We examined sleep as well as behaviors indicative of anxiety and depression in the NTSR1 knockout mouse. Measurements and Results: NTSR1 knockouts had a lower percentage of sleep time spent in REM sleep in the dark phase and a larger diurnal variation in REM sleep duration than wild types under baseline conditions. Following sleep deprivation, NTSR1 knockouts exhibited more wake and less NREM rebound sleep. NTSR1 knockouts also showed increased anxious and despair behaviors. Conclusions: Here we illustrate a link between expression of the Ntsr1 gene and sleep traits previously associated with a particular QTL. We also demonstrate a relationship between Ntsr1 and anxiety and despair behaviors. Given the considerable evidence that anxiety and depression are closely linked with abnormalities in sleep, the data presented here provide further evidence that neurotensin and Ntsr1 may be a component of a pathway involved in both sleep and mood disorders. Citation: Fitzpatrick K; Winrow CJ; Gotter AL; Millstein J; Arbuzova J; Brunner J; Kasarskis A; Vitaterna MH; Renger JJ; Turek FW. Altered sleep and affect in the neurotensin receptor 1 knockout mouse. SLEEP 2012;35(7):949-956. PMID:22754041

  20. Knockout of Foxp2 disrupts vocal development in mice.

    PubMed

    Castellucci, Gregg A; McGinley, Matthew J; McCormick, David A

    2016-03-16

    The FOXP2 gene is important for the development of proper speech motor control in humans. However, the role of the gene in general vocal behavior in other mammals, including mice, is unclear. Here, we track the vocal development of Foxp2 heterozygous knockout (Foxp2+/-) mice and their wildtype (WT) littermates from juvenile to adult ages, and observe severe abnormalities in the courtship song of Foxp2+/- mice. In comparison to their WT littermates, Foxp2+/- mice vocalized less, produced shorter syllable sequences, and possessed an abnormal syllable inventory. In addition, Foxp2+/- song also exhibited irregular rhythmic structure, and its development did not follow the consistent trajectories observed in WT vocalizations. These results demonstrate that the Foxp2 gene is critical for normal vocal behavior in juvenile and adult mice, and that Foxp2 mutant mice may provide a tractable model system for the study of the gene's role in general vocal motor control.

  1. Translating human genetics into mouse: the impact of ultra-rapid in vivo genome editing.

    PubMed

    Aida, Tomomi; Imahashi, Risa; Tanaka, Kohichi

    2014-01-01

    Gene-targeted mutant animals, such as knockout or knockin mice, have dramatically improved our understanding of the functions of genes in vivo and the genetic diversity that characterizes health and disease. However, the generation of targeted mice relies on gene targeting in embryonic stem (ES) cells, which is a time-consuming, laborious, and expensive process. The recent groundbreaking development of several genome editing technologies has enabled the targeted alteration of almost any sequence in any cell or organism. These technologies have now been applied to mouse zygotes (in vivo genome editing), thereby providing new avenues for simple, convenient, and ultra-rapid production of knockout or knockin mice without the need for ES cells. Here, we review recent achievements in the production of gene-targeted mice by in vivo genome editing. © 2013 The Authors Development, Growth & Differentiation © 2013 Japanese Society of Developmental Biologists.

  2. [Escherichia coli heat-labile enterotoxin B subunit enhances the immune response against canine parvovirus VP2 in mice immunized by VP2 DNA vaccine].

    PubMed

    Han, Dongmei; Zhong, Fei; Li, Xiujin; Wang, Wei; Wang, Xingxing; Pan, Sumin

    2011-01-01

    To investigate the effect of Escherichia coli heat-labile enterotoxin (LT) B subunit (LTB) gene on canine parvovirus (CPV) VP2 gene vaccine. The LTB gene was amplified by PCR from genomic DNA of E. coli 44815 strain. The VP2-70 fragment (210 bp) encoding major epitope of VP2 (70 amino acids) was amplified by PCR from a plasmid encoding VP2 gene. VP2-70 and LTB genes were inserted into the eukaryotic vector to construct VP2-70 gene,LTB gene and VP2-70-LTB fused gene vectors. The mice were immunized with VP2-70 vector, VP2-70-LTB fused vector, or VP2-70 vector plus LTB vector, respectively. The antibody titers at the different time were measured by using ELISA method. The spleen lymphocyte proliferation activity was analyzed by 3-(4, 5-Dimethylthiazol-2-yl)-2, 5-diphenyltetrazolium bromide (MTT) assay. The sequence of VP2-70 and LTB genes was identified. The recombinant VP2-70 and LTB proteins could be expressed in HEK293T cells in a secretory manner. The mice immunized with VP2-70 vector, VP2-70-LTB vector or VP2-70 vector plus LTB vector could generate the specific antibody against VP2 protein. The antibody titer immunized with VP2-70-LTB vector reached 1:5120 at 35 d post immunization, significantly higher than that of other two groups (P < 0.01). For antibody isotype analysis, the IgG1 isotype antibody titers in all test groups were significantly higher than of IgG2a (P < 0.01). The high-level spleen lymphocyte stimulation index was observed in the three test groups under the stimulation with Con A, higher than that in control groups (P < 0.01). LTB gene could enhance the humoral immune response of CPV VP2 gene vaccine in mice.

  3. A CRISPR-Based Screen Identifies Genes Essential for West-Nile-Virus-Induced Cell Death.

    PubMed

    Ma, Hongming; Dang, Ying; Wu, Yonggan; Jia, Gengxiang; Anaya, Edgar; Zhang, Junli; Abraham, Sojan; Choi, Jang-Gi; Shi, Guojun; Qi, Ling; Manjunath, N; Wu, Haoquan

    2015-07-28

    West Nile virus (WNV) causes an acute neurological infection attended by massive neuronal cell death. However, the mechanism(s) behind the virus-induced cell death is poorly understood. Using a library containing 77,406 sgRNAs targeting 20,121 genes, we performed a genome-wide screen followed by a second screen with a sub-library. Among the genes identified, seven genes, EMC2, EMC3, SEL1L, DERL2, UBE2G2, UBE2J1, and HRD1, stood out as having the strongest phenotype, whose knockout conferred strong protection against WNV-induced cell death with two different WNV strains and in three cell lines. Interestingly, knockout of these genes did not block WNV replication. Thus, these appear to be essential genes that link WNV replication to downstream cell death pathway(s). In addition, the fact that all of these genes belong to the ER-associated protein degradation (ERAD) pathway suggests that this might be the primary driver of WNV-induced cell death. Copyright © 2015 The Authors. Published by Elsevier Inc. All rights reserved.

  4. Efficient CRISPR/Cas9-Mediated Versatile, Predictable, and Donor-Free Gene Knockout in Human Pluripotent Stem Cells.

    PubMed

    Liu, Zhongliang; Hui, Yi; Shi, Lei; Chen, Zhenyu; Xu, Xiangjie; Chi, Liankai; Fan, Beibei; Fang, Yujiang; Liu, Yang; Ma, Lin; Wang, Yiran; Xiao, Lei; Zhang, Quanbin; Jin, Guohua; Liu, Ling; Zhang, Xiaoqing

    2016-09-13

    Loss-of-function studies in human pluripotent stem cells (hPSCs) require efficient methodologies for lesion of genes of interest. Here, we introduce a donor-free paired gRNA-guided CRISPR/Cas9 knockout strategy (paired-KO) for efficient and rapid gene ablation in hPSCs. Through paired-KO, we succeeded in targeting all genes of interest with high biallelic targeting efficiencies. More importantly, during paired-KO, the cleaved DNA was repaired mostly through direct end joining without insertions/deletions (precise ligation), and thus makes the lesion product predictable. The paired-KO remained highly efficient for one-step targeting of multiple genes and was also efficient for targeting of microRNA, while for long non-coding RNA over 8 kb, cleavage of a short fragment of the core promoter region was sufficient to eradicate downstream gene transcription. This work suggests that the paired-KO strategy is a simple and robust system for loss-of-function studies for both coding and non-coding genes in hPSCs. Copyright © 2016 The Author(s). Published by Elsevier Inc. All rights reserved.

  5. Autozygome Sequencing Expands the Horizon of Human Knockout Research and Provides Novel Insights into Human Phenotypic Variation

    PubMed Central

    Anazi, Shamsa; Alshamekh, Shomoukh; Alkuraya, Fowzan S.

    2013-01-01

    The use of autozygosity as a mapping tool in the search for autosomal recessive disease genes is well established. We hypothesized that autozygosity not only unmasks the recessiveness of disease causing variants, but can also reveal natural knockouts of genes with less obvious phenotypic consequences. To test this hypothesis, we exome sequenced 77 well phenotyped individuals born to first cousin parents in search of genes that are biallelically inactivated. Using a very conservative estimate, we show that each of these individuals carries biallelic inactivation of 22.8 genes on average. For many of the 169 genes that appear to be biallelically inactivated, available data support involvement in modulating metabolism, immunity, perception, external appearance and other phenotypic aspects, and appear therefore to contribute to human phenotypic variation. Other genes with biallelic inactivation may contribute in yet unknown mechanisms or may be on their way to conversion into pseudogenes due to true recent dispensability. We conclude that sequencing the autozygome is an efficient way to map the contribution of genes to human phenotypic variation that goes beyond the classical definition of disease. PMID:24367280

  6. Efficient CRISPR/Cas9-based gene knockout in watermelon.

    PubMed

    Tian, Shouwei; Jiang, Linjian; Gao, Qiang; Zhang, Jie; Zong, Mei; Zhang, Haiying; Ren, Yi; Guo, Shaogui; Gong, Guoyi; Liu, Fan; Xu, Yong

    2017-03-01

    CRISPR/Cas9 system can precisely edit genomic sequence and effectively create knockout mutations in T0 generation watermelon plants. Genome editing offers great advantage to reveal gene function and generate agronomically important mutations to crops. Recently, RNA-guided genome editing system using the type II clustered regularly interspaced short palindromic repeats (CRISPR)-associated protein 9 (Cas9) has been applied to several plant species, achieving successful targeted mutagenesis. Here, we report the genome of watermelon, an important fruit crop, can also be precisely edited by CRISPR/Cas9 system. ClPDS, phytoene desaturase in watermelon, was selected as the target gene because its mutant bears evident albino phenotype. CRISPR/Cas9 system performed genome editing, such as insertions or deletions at the expected position, in transfected watermelon protoplast cells. More importantly, all transgenic watermelon plants harbored ClPDS mutations and showed clear or mosaic albino phenotype, indicating that CRISPR/Cas9 system has technically 100% of genome editing efficiency in transgenic watermelon lines. Furthermore, there were very likely no off-target mutations, indicated by examining regions that were highly homologous to sgRNA sequences. Our results show that CRISPR/Cas9 system is a powerful tool to effectively create knockout mutations in watermelon.

  7. AtSIG6 and other members of the sigma gene family jointly but differentially determine plastid target gene expression in Arabidopsis thaliana

    PubMed Central

    Bock, Sylvia; Ortelt, Jennifer; Link, Gerhard

    2014-01-01

    Plants contain a nuclear gene family for plastid sigma factors, i.e., proteins that associate with the “bacterial-type” organellar RNA polymerase and confer the ability for correct promoter binding and transcription initiation. Questions that are still unresolved relate to the “division of labor” among members of the sigma family, both in terms of their range of target genes and their temporal and spatial activity during development. Clues to the in vivo role of individual sigma genes have mainly come from studies of sigma knockout lines. Despite its obvious strengths, however, this strategy does not necessarily trace-down causal relationships between mutant phenotype and a single sigma gene, if other family members act in a redundant and/or compensatory manner. We made efforts to reduce the complexity by genetic crosses of Arabidopsis single mutants (with focus on a chlorophyll-deficient sig6 line) to generate double knockout lines. The latter typically had a similar visible phenotype as the parental lines, but tended to be more strongly affected in the transcript patterns of both plastid and sigma genes. Because triple mutants were lethal under our growth conditions, we exploited a strategy of transformation of single and double mutants with RNAi constructs that contained sequences from the unconserved sigma region (UCR). These RNAi/knockout lines phenotypically resembled their parental lines, but were even more strongly affected in their plastid transcript patterns. Expression patterns of sigma genes revealed both similarities and differences compared to the parental lines, with transcripts at reduced or unchanged amounts and others that were found to be present in higher (perhaps compensatory) amounts. Together, our results reveal considerable flexibility of gene activity at the levels of both sigma and plastid gene expression. A (still viable) “basal state” seems to be reached, if 2–3 of the 6 Arabidopsis sigma genes are functionally compromised. PMID:25505479

  8. CRISPR-Mediated Triple Knockout of SLAMF1, SLAMF5 and SLAMF6 Supports Positive Signaling Roles in NKT Cell Development.

    PubMed

    Huang, Bonnie; Gomez-Rodriguez, Julio; Preite, Silvia; Garrett, Lisa J; Harper, Ursula L; Schwartzberg, Pamela L

    2016-01-01

    The SLAM family receptors contribute to diverse aspects of lymphocyte biology and signal via the small adaptor molecule SAP. Mutations affecting SAP lead to X-linked lymphoproliferative syndrome Type 1, a severe immunodysregulation characterized by fulminant mononucleosis, dysgammaglobulinemia, and lymphoproliferation/lymphomas. Patients and mice having mutations affecting SAP also lack germinal centers due to a defect in T:B cell interactions and are devoid of invariant NKT (iNKT) cells. However, which and how SLAM family members contribute to these phenotypes remains uncertain. Three SLAM family members: SLAMF1, SLAMF5 and SLAMF6, are highly expressed on T follicular helper cells and germinal center B cells. SLAMF1 and SLAMF6 are also implicated in iNKT development. Although individual receptor knockout mice have limited iNKT and germinal center phenotypes compared to SAP knockout mice, the generation of multi-receptor knockout mice has been challenging, due to the genomic linkage of the genes encoding SLAM family members. Here, we used Cas9/CRISPR-based mutagenesis to generate mutations simultaneously in Slamf1, Slamf5 and Slamf6. Genetic disruption of all three receptors in triple-knockout mice (TKO) did not grossly affect conventional T or B cell development and led to mild defects in germinal center formation post-immunization. However, the TKO worsened defects in iNKT cells development seen in SLAMF6 single gene-targeted mice, supporting data on positive signaling and potential redundancy between these receptors.

  9. Pseudotyped Lentiviral Vectors for Retrograde Gene Delivery into Target Brain Regions

    PubMed Central

    Kobayashi, Kenta; Inoue, Ken-ichi; Tanabe, Soshi; Kato, Shigeki; Takada, Masahiko; Kobayashi, Kazuto

    2017-01-01

    Gene transfer through retrograde axonal transport of viral vectors offers a substantial advantage for analyzing roles of specific neuronal pathways or cell types forming complex neural networks. This genetic approach may also be useful in gene therapy trials by enabling delivery of transgenes into a target brain region distant from the injection site of the vectors. Pseudotyping of a lentiviral vector based on human immunodeficiency virus type 1 (HIV-1) with various fusion envelope glycoproteins composed of different combinations of rabies virus glycoprotein (RV-G) and vesicular stomatitis virus glycoprotein (VSV-G) enhances the efficiency of retrograde gene transfer in both rodent and nonhuman primate brains. The most recently developed lentiviral vector is a pseudotype with fusion glycoprotein type E (FuG-E), which demonstrates highly efficient retrograde gene transfer in the brain. The FuG-E–pseudotyped vector permits powerful experimental strategies for more precisely investigating the mechanisms underlying various brain functions. It also contributes to the development of new gene therapy approaches for neurodegenerative disorders, such as Parkinson’s disease, by delivering genes required for survival and protection into specific neuronal populations. In this review article, we report the properties of the FuG-E–pseudotyped vector, and we describe the application of the vector to neural circuit analysis and the potential use of the FuG-E vector in gene therapy for Parkinson’s disease. PMID:28824385

  10. Zinc Finger Nuclease Mediated Knockout of ADP-Dependent Glucokinase in Cancer Cell Lines: Effects on Cell Survival and Mitochondrial Oxidative Metabolism

    PubMed Central

    Richter, Susan; Morrison, Shona; Connor, Tim; Su, Jiechuang; Print, Cristin G.; Ronimus, Ron S.; McGee, Sean L.; Wilson, William R.

    2013-01-01

    Zinc finger nucleases (ZFN) are powerful tools for editing genes in cells. Here we use ZFNs to interrogate the biological function of ADPGK, which encodes an ADP-dependent glucokinase (ADPGK), in human tumour cell lines. The hypothesis we tested is that ADPGK utilises ADP to phosphorylate glucose under conditions where ATP becomes limiting, such as hypoxia. We characterised two ZFN knockout clones in each of two lines (H460 and HCT116). All four clones had frameshift mutations in all alleles at the target site in exon 1 of ADPGK, and were ADPGK-null by immunoblotting. ADPGK knockout had little or no effect on cell proliferation, but compromised the ability of H460 cells to survive siRNA silencing of hexokinase-2 under oxic conditions, with clonogenic survival falling from 21±3% for the parental line to 6.4±0.8% (p = 0.002) and 4.3±0.8% (p = 0.001) for the two knockouts. A similar increased sensitivity to clonogenic cell killing was observed under anoxia. No such changes were found when ADPGK was knocked out in HCT116 cells, for which the parental line was less sensitive than H460 to anoxia and to hexokinase-2 silencing. While knockout of ADPGK in HCT116 cells caused few changes in global gene expression, knockout of ADPGK in H460 cells caused notable up-regulation of mRNAs encoding cell adhesion proteins. Surprisingly, we could discern no consistent effect on glycolysis as measured by glucose consumption or lactate formation under anoxia, or extracellular acidification rate (Seahorse XF analyser) under oxic conditions in a variety of media. However, oxygen consumption rates were generally lower in the ADPGK knockouts, in some cases markedly so. Collectively, the results demonstrate that ADPGK can contribute to tumour cell survival under conditions of high glycolytic dependence, but the phenotype resulting from knockout of ADPGK is cell line dependent and appears to be unrelated to priming of glycolysis in these lines. PMID:23799003

  11. Cytoprotective role of autophagy against BH3 mimetic gossypol in ATG5 knockout cells generated by CRISPR-Cas9 endonuclease.

    PubMed

    Kim, Na-Yeon; Han, Byeal-I; Lee, Michael

    2016-01-01

    Previously, we demonstrated the association between autophagy and gossypol-induced growth inhibition of mutant BRAF melanoma cells. Here, we investigate the role of autophagy in ATG5 knockout cell lines generated by the Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR)/Cas-mediated genome editing. The MTT assay revealed that the inhibitory effect of gossypol was weaker on ATG5 knockout cells than that on the wild type (WT) cells. The conversion of non-autophagic LC3-I to autophagic LC3-II and RT-PCR confirmed the functional gene knockout. However, Cyto-ID autophagy assay revealed that gossypol induced ATG5- and LC3-independent autophagy in ATG5 knockout cells. Moreover, gossypol acts as an autophagy inducer in ATG5 knockout cells while blocking the later stages of the autophagy process in WT cells, which was determined by measuring autophagic flux after co-treatment of gossypol with chloroquine (late-stage autophagy inhibitor). On the other hand, inhibition of autophagy with 3-MA or Beclin-1 siRNA caused a partial increase in the sensitivity to gossypol in ATG5 knockout cells, but not in the WT cells. Together, our findings suggest that the resistance to gossypol in ATG5 knockout cells is associated with increased cytoprotective autophagy, independent of ATG5. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

  12. Development of Sendai Virus Vectors and their Potential Applications in Gene Therapy and Regenerative Medicine

    PubMed Central

    Nakanishi, Mahito; Otsu, Makoto

    2012-01-01

    Gene delivery/expression vectors have been used as fundamental technologies in gene therapy since the 1980s. These technologies are also being applied in regenerative medicine as tools to reprogram cell genomes to a pluripotent state and to other cell lineages. Rapid progress in these new research areas and expectations for their translation into clinical applications have facilitated the development of more sophisticated gene delivery/expression technologies. Since its isolation in 1953 in Japan, Sendai virus (SeV) has been widely used as a research tool in cell biology and in industry, but the application of SeV as a recombinant viral vector has been investigated only recently. Recombinant SeV vectors have various unique characteristics, such as low pathogenicity, powerful capacity for gene expression and a wide host range. In addition, the cytoplasmic gene expression mediated by this vector is advantageous for applications, in that chromosomal integration of exogenous genes can be undesirable. In this review, we introduce a brief historical background on the development of recombinant SeV vectors and describe their current applications in gene therapy. We also describe the application of SeV vectors in advanced nuclear reprogramming and introduce a defective and persistent SeV vector (SeVdp) optimized for such reprogramming. PMID:22920683

  13. [Use of a novel baculovirus vector to express nucleoprotein gene of Crimean-Congo hemorrhagic fever virus in both insect and mammalian cells].

    PubMed

    Ma, Benjiang; Hang, Changshou; Zhao, Yun; Wang, Shiwen; Xie, Yanxiang

    2002-09-01

    To construct a novel baculovirus vector which is capable of promoting the high-yield expression of foreign gene in mammalian cells and to express by this vector the nucleoprotein (NP) gene of Crimean-Congo hemorrhagic fever virus (CCHFV) Chinese isolate (Xinjiang hemorrhagic fever virus, XHFV) BA88166 in insect and Vero cells. Human cytomegalovirus (CMV) immediate early (IE) promoter was ligated to the baculovirus vector pFastBac1 downstream of the polyhedrin promoter to give rise to the novel vector pCB1. XHFV NP gene was cloned to this vector and was well expressed in COS-7 cells and Vero cells by means of recombinant plasmid transfection and baculovirus infection. The XHFV NP gene in vector pCB1 could be well expressed in mammalian cells. Vero cells infected with recombinant baculovirus harboring NP gene could be employed as antigens to detect XHF serum specimens whose results were in good correlation with those of ELISA and in parallel with clinical diagnoses. This novel baculovirus vector is able to express the foreign gene efficiently in both insect and mammalian cells, which provides not only the convenient diagnostic antigens but also the potential for developing recombinant virus vaccines and gene therapies.

  14. Evolving phage vectors for cell targeted gene delivery.

    PubMed

    Larocca, David; Burg, Michael A; Jensen-Pergakes, Kristen; Ravey, Edward Prenn; Gonzalez, Ana Maria; Baird, Andrew

    2002-03-01

    We adapted filamentous phage vectors for targeted gene delivery to mammalian cells by inserting a mammalian reporter gene expression cassette (GFP) into the vector backbone and fusing the pIII coat protein to a cell targeting ligand (i.e. FGF2, EGF). Like transfection with animal viral vectors, targeted phage gene delivery is concentration, time, and ligand dependent. Importantly, targeted phage particles are specific for the appropriate target cell surface receptor. Phage have distinct advantages over existing gene therapy vectors because they are simple, economical to produce at high titer, have no intrinsic tropism for mammalian cells, and are relatively simple to genetically modify and evolve. Initially transduction by targeted phage particles was low resulting in foreign gene expression in 1-2% of transfected cells. We increased transduction efficiency by modifying both the transfection protocol and vector design. For example, we stabilized the display of the targeting ligand to create multivalent phagemid-based vectors with transduction efficiencies of up to 45% in certain cell lines when combined with genotoxic treatment. Taken together, these studies establish that the efficiency of phage-mediated gene transfer can be significantly improved through genetic modification. We are currently evolving phage vectors with enhanced cell targeting, increased stability, reduced immunogenicity and other properties suitable for gene therapy.

  15. Arabidopsis serotonin N-acetyltransferase knockout mutant plants exhibit decreased melatonin and salicylic acid levels resulting in susceptibility to an avirulent pathogen.

    PubMed

    Lee, Hyoung Yool; Byeon, Yeong; Tan, Dun-Xian; Reiter, Russel J; Back, Kyoungwhan

    2015-04-01

    Serotonin N-acetyltransferase (SNAT) is the penultimate enzyme in the melatonin biosynthesis pathway in plants. We examined the effects of SNAT gene inactivation in two Arabidopsis T-DNA insertion mutant lines. After inoculation with the avirulent pathogen Pseudomonas syringe pv. tomato DC3000 harboring the elicitor avrRpt2 (Pst-avrRpt2), melatonin levels in the snat knockout mutant lines were 50% less than in wild-type Arabidopsis Col-0 plants. The snat knockout mutant lines exhibited susceptibility to pathogen infection that coincided with decreased induction of defense genes including PR1, ICS1, and PDF1.2. Because melatonin acts upstream of salicylic acid (SA) synthesis, the reduced melatonin levels in the snat mutant lines led to decreased SA levels compared to wild-type, suggesting that the increased pathogen susceptibility of the snat mutant lines could be attributed to decreased SA levels and subsequent attenuation of defense gene induction. Exogenous melatonin treatment failed to induce defense gene expression in nahG Arabidopsis plants, but restored the induction of defense gene expression in the snat mutant lines. In addition, melatonin caused translocation of NPR1 (nonexpressor of PR1) protein from the cytoplasm into the nucleus indicating that melatonin-elicited pathogen resistance in response to avirulent pathogen attack is SA-dependent in Arabidopsis. © 2015 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  16. AtWRKY22 promotes susceptibility to aphids and modulates salicylic acid and jasmonic acid signalling.

    PubMed

    Kloth, Karen J; Wiegers, Gerrie L; Busscher-Lange, Jacqueline; van Haarst, Jan C; Kruijer, Willem; Bouwmeester, Harro J; Dicke, Marcel; Jongsma, Maarten A

    2016-05-01

    Aphids induce many transcriptional perturbations in their host plants, but the signalling cascades responsible and the effects on plant resistance are largely unknown. Through a genome-wide association (GWA) mapping study in Arabidopsis thaliana, we identified WRKY22 as a candidate gene associated with feeding behaviour of the green peach aphid, Myzus persicae The transcription factor WRKY22 is known to be involved in pathogen-triggered immunity, and WRKY22 gene expression has been shown to be induced by aphids. Assessment of aphid population development and feeding behaviour on knockout mutants and overexpression lines showed that WRKY22 increases susceptibility to M. persicae via a mesophyll-located mechanism. mRNA sequencing analysis of aphid-infested wrky22 knockout plants revealed the up-regulation of genes involved in salicylic acid (SA) signalling and down-regulation of genes involved in plant growth and cell-wall loosening. In addition, mechanostimulation of knockout plants by clip cages up-regulated jasmonic acid (JA)-responsive genes, resulting in substantial negative JA-SA crosstalk. Based on this and previous studies, WRKY22 is considered to modulate the interplay between the SA and JA pathways in response to a wide range of biotic and abiotic stimuli. Its induction by aphids and its role in suppressing SA and JA signalling make WRKY22 a potential target for aphids to manipulate host plant defences. © The Author 2016. Published by Oxford University Press on behalf of the Society for Experimental Biology.

  17. High-capacity 'gutless' adenoviral vectors.

    PubMed

    Kochanek, S; Schiedner, G; Volpers, C

    2001-10-01

    Adenoviral vectors are promising gene transfer vehicles for different gene therapy applications. High-capacity adenoviral (HC-Ad) vectors address some of the problems that have been observed with replication-defective, E1-deleted first-generation adenoviral vectors: toxicity and immunogenicity due to viral gene expression and 7 to 8 kb capacity limit for the transport of therapeutic DNA. This review summarizes HC-Ad vector-related publications from the past 18 months that are mainly concerned with vector design/production and in vivo applications in different murine models.

  18. Disease Model Discovery from 3,328 Gene Knockouts by The International Mouse Phenotyping Consortium

    PubMed Central

    Meehan, Terrence F.; Conte, Nathalie; West, David B.; Jacobsen, Julius O.; Mason, Jeremy; Warren, Jonathan; Chen, Chao-Kung; Tudose, Ilinca; Relac, Mike; Matthews, Peter; Karp, Natasha; Santos, Luis; Fiegel, Tanja; Ring, Natalie; Westerberg, Henrik; Greenaway, Simon; Sneddon, Duncan; Morgan, Hugh; Codner, Gemma F; Stewart, Michelle E; Brown, James; Horner, Neil; Haendel, Melissa; Washington, Nicole; Mungall, Christopher J.; Reynolds, Corey L; Gallegos, Juan; Gailus-Durner, Valerie; Sorg, Tania; Pavlovic, Guillaume; Bower, Lynette R; Moore, Mark; Morse, Iva; Gao, Xiang; Tocchini-Valentini, Glauco P; Obata, Yuichi; Cho, Soo Young; Seong, Je Kyung; Seavitt, John; Beaudet, Arthur L.; Dickinson, Mary E.; Herault, Yann; Wurst, Wolfgang; de Angelis, Martin Hrabe; Lloyd, K.C. Kent; Flenniken, Ann M; Nutter, Lauryl MJ; Newbigging, Susan; McKerlie, Colin; Justice, Monica J.; Murray, Stephen A.; Svenson, Karen L.; Braun, Robert E.; White, Jacqueline K.; Bradley, Allan; Flicek, Paul; Wells, Sara; Skarnes, William C.; Adams, David J.; Parkinson, Helen; Mallon, Ann-Marie; Brown, Steve D.M.; Smedley, Damian

    2017-01-01

    Although next generation sequencing has revolutionised the ability to associate variants with human diseases, diagnostic rates and development of new therapies are still limited by our lack of knowledge of function and pathobiological mechanism for most genes. To address this challenge, the International Mouse Phenotyping Consortium (IMPC) is creating a genome- and phenome-wide catalogue of gene function by characterizing new knockout mouse strains across diverse biological systems through a broad set of standardised phenotyping tests, with all mice made readily available to the biomedical community. Analysing the first 3328 genes reveals models for 360 diseases including the first for type C Bernard-Soulier, Bardet-Biedl-5 and Gordon Holmes syndromes. 90% of our phenotype annotations are novel, providing the first functional evidence for 1092 genes and candidates in unsolved diseases such as Arrhythmogenic Right Ventricular Dysplasia 3. Finally, we describe our role in variant functional validation with the 100,000 Genomes and other projects. PMID:28650483

  19. Single master regulatory gene coordinates the evolution and development of butterfly color and iridescence

    PubMed Central

    Zhang, Linlin

    2017-01-01

    The optix gene has been implicated in butterfly wing pattern adaptation by genetic association, mapping, and expression studies. The actual developmental function of this gene has remained unclear, however. Here we used CRISPR/Cas9 genome editing to show that optix plays a fundamental role in nymphalid butterfly wing pattern development, where it is required for determination of all chromatic coloration. optix knockouts in four species show complete replacement of color pigments with melanins, with corresponding changes in pigment-related gene expression, resulting in black and gray butterflies. We also show that optix simultaneously acts as a switch gene for blue structural iridescence in some butterflies, demonstrating simple regulatory coordination of structural and pigmentary coloration. Remarkably, these optix knockouts phenocopy the recurring “black and blue” wing pattern archetype that has arisen on many independent occasions in butterflies. Here we demonstrate a simple genetic basis for structural coloration, and show that optix plays a deeply conserved role in butterfly wing pattern development. PMID:28923944

  20. Single master regulatory gene coordinates the evolution and development of butterfly color and iridescence.

    PubMed

    Zhang, Linlin; Mazo-Vargas, Anyi; Reed, Robert D

    2017-10-03

    The optix gene has been implicated in butterfly wing pattern adaptation by genetic association, mapping, and expression studies. The actual developmental function of this gene has remained unclear, however. Here we used CRISPR/Cas9 genome editing to show that optix plays a fundamental role in nymphalid butterfly wing pattern development, where it is required for determination of all chromatic coloration. optix knockouts in four species show complete replacement of color pigments with melanins, with corresponding changes in pigment-related gene expression, resulting in black and gray butterflies. We also show that optix simultaneously acts as a switch gene for blue structural iridescence in some butterflies, demonstrating simple regulatory coordination of structural and pigmentary coloration. Remarkably, these optix knockouts phenocopy the recurring "black and blue" wing pattern archetype that has arisen on many independent occasions in butterflies. Here we demonstrate a simple genetic basis for structural coloration, and show that optix plays a deeply conserved role in butterfly wing pattern development.

  1. Analysis of mammalian gene function through broad-based phenotypic screens across a consortium of mouse clinics.

    PubMed

    de Angelis, Martin Hrabě; Nicholson, George; Selloum, Mohammed; White, Jacqui; Morgan, Hugh; Ramirez-Solis, Ramiro; Sorg, Tania; Wells, Sara; Fuchs, Helmut; Fray, Martin; Adams, David J; Adams, Niels C; Adler, Thure; Aguilar-Pimentel, Antonio; Ali-Hadji, Dalila; Amann, Gregory; André, Philippe; Atkins, Sarah; Auburtin, Aurelie; Ayadi, Abdel; Becker, Julien; Becker, Lore; Bedu, Elodie; Bekeredjian, Raffi; Birling, Marie-Christine; Blake, Andrew; Bottomley, Joanna; Bowl, Mike; Brault, Véronique; Busch, Dirk H; Bussell, James N; Calzada-Wack, Julia; Cater, Heather; Champy, Marie-France; Charles, Philippe; Chevalier, Claire; Chiani, Francesco; Codner, Gemma F; Combe, Roy; Cox, Roger; Dalloneau, Emilie; Dierich, André; Di Fenza, Armida; Doe, Brendan; Duchon, Arnaud; Eickelberg, Oliver; Esapa, Chris T; El Fertak, Lahcen; Feigel, Tanja; Emelyanova, Irina; Estabel, Jeanne; Favor, Jack; Flenniken, Ann; Gambadoro, Alessia; Garrett, Lilian; Gates, Hilary; Gerdin, Anna-Karin; Gkoutos, George; Greenaway, Simon; Glasl, Lisa; Goetz, Patrice; Da Cruz, Isabelle Goncalves; Götz, Alexander; Graw, Jochen; Guimond, Alain; Hans, Wolfgang; Hicks, Geoff; Hölter, Sabine M; Höfler, Heinz; Hancock, John M; Hoehndorf, Robert; Hough, Tertius; Houghton, Richard; Hurt, Anja; Ivandic, Boris; Jacobs, Hughes; Jacquot, Sylvie; Jones, Nora; Karp, Natasha A; Katus, Hugo A; Kitchen, Sharon; Klein-Rodewald, Tanja; Klingenspor, Martin; Klopstock, Thomas; Lalanne, Valerie; Leblanc, Sophie; Lengger, Christoph; le Marchand, Elise; Ludwig, Tonia; Lux, Aline; McKerlie, Colin; Maier, Holger; Mandel, Jean-Louis; Marschall, Susan; Mark, Manuel; Melvin, David G; Meziane, Hamid; Micklich, Kateryna; Mittelhauser, Christophe; Monassier, Laurent; Moulaert, David; Muller, Stéphanie; Naton, Beatrix; Neff, Frauke; Nolan, Patrick M; Nutter, Lauryl Mj; Ollert, Markus; Pavlovic, Guillaume; Pellegata, Natalia S; Peter, Emilie; Petit-Demoulière, Benoit; Pickard, Amanda; Podrini, Christine; Potter, Paul; Pouilly, Laurent; Puk, Oliver; Richardson, David; Rousseau, Stephane; Quintanilla-Fend, Leticia; Quwailid, Mohamed M; Racz, Ildiko; Rathkolb, Birgit; Riet, Fabrice; Rossant, Janet; Roux, Michel; Rozman, Jan; Ryder, Ed; Salisbury, Jennifer; Santos, Luis; Schäble, Karl-Heinz; Schiller, Evelyn; Schrewe, Anja; Schulz, Holger; Steinkamp, Ralf; Simon, Michelle; Stewart, Michelle; Stöger, Claudia; Stöger, Tobias; Sun, Minxuan; Sunter, David; Teboul, Lydia; Tilly, Isabelle; Tocchini-Valentini, Glauco P; Tost, Monica; Treise, Irina; Vasseur, Laurent; Velot, Emilie; Vogt-Weisenhorn, Daniela; Wagner, Christelle; Walling, Alison; Weber, Bruno; Wendling, Olivia; Westerberg, Henrik; Willershäuser, Monja; Wolf, Eckhard; Wolter, Anne; Wood, Joe; Wurst, Wolfgang; Yildirim, Ali Önder; Zeh, Ramona; Zimmer, Andreas; Zimprich, Annemarie; Holmes, Chris; Steel, Karen P; Herault, Yann; Gailus-Durner, Valérie; Mallon, Ann-Marie; Brown, Steve Dm

    2015-09-01

    The function of the majority of genes in the mouse and human genomes remains unknown. The mouse embryonic stem cell knockout resource provides a basis for the characterization of relationships between genes and phenotypes. The EUMODIC consortium developed and validated robust methodologies for the broad-based phenotyping of knockouts through a pipeline comprising 20 disease-oriented platforms. We developed new statistical methods for pipeline design and data analysis aimed at detecting reproducible phenotypes with high power. We acquired phenotype data from 449 mutant alleles, representing 320 unique genes, of which half had no previous functional annotation. We captured data from over 27,000 mice, finding that 83% of the mutant lines are phenodeviant, with 65% demonstrating pleiotropy. Surprisingly, we found significant differences in phenotype annotation according to zygosity. New phenotypes were uncovered for many genes with previously unknown function, providing a powerful basis for hypothesis generation and further investigation in diverse systems.

  2. Comparison of the editing patterns and editing efficiencies of TALEN and CRISPR-Cas9 when targeting the human CCR5 gene.

    PubMed

    Nerys-Junior, Arildo; Braga-Dias, Luciene P; Pezzuto, Paula; Cotta-de-Almeida, Vinícius; Tanuri, Amilcar

    2018-01-01

    The human C-C chemokine receptor type-5 (CCR5) is the major transmembrane co-receptor that mediates HIV-1 entry into target CD4+ cells. Gene therapy to knock-out the CCR5 gene has shown encouraging results in providing a functional cure for HIV-1 infection. In gene therapy strategies, the initial region of the CCR5 gene is a hotspot for producing functional gene knock-out. Such target gene editing can be done using programmable endonucleases such as transcription activator-like effector nucleases (TALEN) or clustered regularly interspaced short palindromic repeats (CRISPR-Cas9). These two gene editing approaches are the most modern and effective tools for precise gene modification. However, little is known of potential differences in the efficiencies of TALEN and CRISPR-Cas9 for editing the beginning of the CCR5 gene. To examine which of these two methods is best for gene therapy, we compared the patterns and amount of editing at the beginning of the CCR5 gene using TALEN and CRISPR-Cas9 followed by DNA sequencing. This comparison revealed that CRISPR-Cas9 mediated the sorting of cells that contained 4.8 times more gene editing than TALEN+ transfected cells.

  3. Comparison of the editing patterns and editing efficiencies of TALEN and CRISPR-Cas9 when targeting the human CCR5 gene

    PubMed Central

    Nerys-Junior, Arildo; Braga-Dias, Luciene P.; Pezzuto, Paula; Cotta-de-Almeida, Vinícius; Tanuri, Amilcar

    2018-01-01

    Abstract The human C-C chemokine receptor type-5 (CCR5) is the major transmembrane co-receptor that mediates HIV-1 entry into target CD4+ cells. Gene therapy to knock-out the CCR5 gene has shown encouraging results in providing a functional cure for HIV-1 infection. In gene therapy strategies, the initial region of the CCR5 gene is a hotspot for producing functional gene knock-out. Such target gene editing can be done using programmable endonucleases such as transcription activator-like effector nucleases (TALEN) or clustered regularly interspaced short palindromic repeats (CRISPR-Cas9). These two gene editing approaches are the most modern and effective tools for precise gene modification. However, little is known of potential differences in the efficiencies of TALEN and CRISPR-Cas9 for editing the beginning of the CCR5 gene. To examine which of these two methods is best for gene therapy, we compared the patterns and amount of editing at the beginning of the CCR5 gene using TALEN and CRISPR-Cas9 followed by DNA sequencing. This comparison revealed that CRISPR-Cas9 mediated the sorting of cells that contained 4.8 times more gene editing than TALEN+ transfected cells. PMID:29583154

  4. Transcriptional Enhancers Induce Insertional Gene Deregulation Independently From the Vector Type and Design

    PubMed Central

    Maruggi, Giulietta; Porcellini, Simona; Facchini, Giulia; Perna, Serena K; Cattoglio, Claudia; Sartori, Daniela; Ambrosi, Alessandro; Schambach, Axel; Baum, Christopher; Bonini, Chiara; Bovolenta, Chiara; Mavilio, Fulvio; Recchia, Alessandra

    2009-01-01

    The integration characteristics of retroviral (RV) vectors increase the probability of interfering with the regulation of cellular genes, and account for a tangible risk of insertional mutagenesis in treated patients. To assess the potential genotoxic risk of conventional or self-inactivating (SIN) γ-RV and lentiviral (LV) vectors independently from the biological consequences of the insertion event, we developed a quantitative assay based on real-time reverse transcriptase—PCR on low-density arrays to evaluate alterations of gene expression in individual primary T-cell clones. We show that the Moloney leukemia virus long terminal repeat (LTR) enhancer has the strongest activity in both a γ-RV and a LV vector context, while an internal cellular promoter induces deregulation of gene expression less frequently, at a shorter range and to a lower extent in both vector types. Downregulation of gene expression was observed only in the context of LV vectors. This study indicates that insertional gene activation is determined by the characteristics of the transcriptional regulatory elements carried by the vector, and is largely independent from the vector type or design. PMID:19293778

  5. Viral Vectors for Gene Delivery to the Central Nervous System

    PubMed Central

    Lentz, Thomas B.; Gray, Steven J.; Samulski, R. Jude

    2011-01-01

    The potential benefits of gene therapy for neurological diseases such as Parkinson’s, Amyotrophic Lateral Sclerosis (ALS), Epilepsy, and Alzheimer’s are enormous. Even a delay in the onset of severe symptoms would be invaluable to patients suffering from these and other diseases. Significant effort has been placed in developing vectors capable of delivering therapeutic genes to the CNS in order to treat neurological disorders. At the forefront of potential vectors, viral systems have evolved to efficiently deliver their genetic material to a cell. The biology of different viruses offers unique solutions to the challenges of gene therapy, such as cell targeting, transgene expression and vector production. It is important to consider the natural biology of a vector when deciding whether it will be the most effective for a specific therapeutic function. In this review, we outline desired features of the ideal vector for gene delivery to the CNS and discuss how well available viral vectors compare to this model. Adeno-associated virus, retrovirus, adenovirus and herpesvirus vectors are covered. Focus is placed on features of the natural biology that have made these viruses effective tools for gene delivery with emphasis on their application in the CNS. Our goal is to provide insight into features of the optimal vector and which viral vectors can provide these features. PMID:22001604

  6. An Improved Single-Step Cloning Strategy Simplifies the Agrobacterium tumefaciens-Mediated Transformation (ATMT)-Based Gene-Disruption Method for Verticillium dahliae.

    PubMed

    Wang, Sheng; Xing, Haiying; Hua, Chenlei; Guo, Hui-Shan; Zhang, Jie

    2016-06-01

    The soilborne fungal pathogen Verticillium dahliae infects a broad range of plant species to cause severe diseases. The availability of Verticillium genome sequences has provided opportunities for large-scale investigations of individual gene function in Verticillium strains using Agrobacterium tumefaciens-mediated transformation (ATMT)-based gene-disruption strategies. Traditional ATMT vectors require multiple cloning steps and elaborate characterization procedures to achieve successful gene replacement; thus, these vectors are not suitable for high-throughput ATMT-based gene deletion. Several advancements have been made that either involve simplification of the steps required for gene-deletion vector construction or increase the efficiency of the technique for rapid recombinant characterization. However, an ATMT binary vector that is both simple and efficient is still lacking. Here, we generated a USER-ATMT dual-selection (DS) binary vector, which combines both the advantages of the USER single-step cloning technique and the efficiency of the herpes simplex virus thymidine kinase negative-selection marker. Highly efficient deletion of three different genes in V. dahliae using the USER-ATMT-DS vector enabled verification that this newly-generated vector not only facilitates the cloning process but also simplifies the subsequent identification of fungal homologous recombinants. The results suggest that the USER-ATMT-DS vector is applicable for efficient gene deletion and suitable for large-scale gene deletion in V. dahliae.

  7. Novel Nonreplicating Vaccinia Virus Vector Enhances Expression of Heterologous Genes and Suppresses Synthesis of Endogenous Viral Proteins.

    PubMed

    Wyatt, Linda S; Xiao, Wei; Americo, Jeffrey L; Earl, Patricia L; Moss, Bernard

    2017-06-06

    Viruses are used as expression vectors for protein synthesis, immunology research, vaccines, and therapeutics. Advantages of poxvirus vectors include the accommodation of large amounts of heterologous DNA, the presence of a cytoplasmic site of transcription, and high expression levels. On the other hand, competition of approximately 200 viral genes with the target gene for expression and immune recognition may be disadvantageous. We describe a vaccinia virus (VACV) vector that uses an early promoter to express the bacteriophage T7 RNA polymerase; has the A23R intermediate transcription factor gene deleted, thereby restricting virus replication to complementing cells; and has a heterologous gene regulated by a T7 promoter. In noncomplementing cells, viral early gene expression and DNA replication occurred normally but synthesis of intermediate and late proteins was prevented. Nevertheless, the progeny viral DNA provided templates for abundant expression of heterologous genes regulated by a T7 promoter. Selective expression of the Escherichia coli lac repressor gene from an intermediate promoter reduced transcription of the heterologous gene specifically in complementing cells, where large amounts might adversely impact VACV replication. Expression of heterologous proteins mediated by the A23R deletion vector equaled that of a replicating VACV, was higher than that of a nonreplicating modified vaccinia virus Ankara (MVA) vector used for candidate vaccines in vitro and in vivo , and was similarly immunogenic in mice. Unlike the MVA vector, the A23R deletion vector still expresses numerous early genes that can restrict immunogenicity as demonstrated here by the failure of the prototype vector to induce interferon alpha. By deleting immunomodulatory genes, we anticipate further improvements in the system. IMPORTANCE Vaccines provide an efficient and effective way of preventing infectious diseases. Nevertheless, new and better vaccines are needed. Vaccinia virus, which was used successfully as a live vaccine to eradicate smallpox, has been further attenuated and adapted as a recombinant vector for immunization against other pathogens. However, since the initial description of this vector system, only incremental improvements largely related to safety have been implemented. Here we described novel modifications of the platform that increased expression of the heterologous target gene and decreased expression of endogenous vaccinia virus genes while providing safety by preventing replication of the candidate vaccine except in complementing cells used for vector propagation. Copyright © 2017 Wyatt et al.

  8. Role of melanopsin in circadian responses to light.

    PubMed

    Ruby, Norman F; Brennan, Thomas J; Xie, Xinmin; Cao, Vinh; Franken, Paul; Heller, H Craig; O'Hara, Bruce F

    2002-12-13

    Melanopsin has been proposed as an important photoreceptive molecule for the mammalian circadian system. Its importance in this role was tested in melanopsin knockout mice. These mice entrained to a light/dark cycle, phase-shifted after a light pulse, and increased circadian period when light intensity increased. Induction of the immediate-early gene c-fos was observed after a nighttime light pulse in both wild-type and knockout mice. However, the magnitude of these behavioral responses in knockout mice was 40% lower than in wild-type mice. Although melanopsin is not essential for the circadian clock to receive photic input, it contributes significantly to the magnitude of photic responses.

  9. Loss of Sip1 leads to migration defects and retention of ectodermal markers during lens development.

    PubMed

    Manthey, Abby L; Lachke, Salil A; FitzGerald, Paul G; Mason, Robert W; Scheiblin, David A; McDonald, John H; Duncan, Melinda K

    2014-02-01

    SIP1 encodes a DNA-binding transcription factor that regulates multiple developmental processes, as highlighted by the pleiotropic defects observed in Mowat-Wilson syndrome, which results from mutations in this gene. Further, in adults, dysregulated SIP1 expression has been implicated in both cancer and fibrotic diseases, where it functionally links TGFβ signaling to the loss of epithelial cell characteristics and gene expression. In the ocular lens, an epithelial tissue important for vision, Sip1 is co-expressed with epithelial markers, such as E-cadherin, and is required for the complete separation of the lens vesicle from the head ectoderm during early ocular morphogenesis. However, the function of Sip1 after early lens morphogenesis is still unknown. Here, we conditionally deleted Sip1 from the developing mouse lens shortly after lens vesicle closure, leading to defects in coordinated fiber cell tip migration, defective suture formation, and cataract. Interestingly, RNA-Sequencing analysis on Sip1 knockout lenses identified 190 differentially expressed genes, all of which are distinct from previously described Sip1 target genes. Furthermore, 34% of the genes with increased expression in the Sip1 knockout lenses are normally downregulated as the lens transitions from the lens vesicle to early lens, while 49% of the genes with decreased expression in the Sip1 knockout lenses are normally upregulated during early lens development. Overall, these data imply that Sip1 plays a major role in reprogramming the lens vesicle away from a surface ectoderm cell fate towards that necessary for the development of a transparent lens and demonstrate that Sip1 regulates distinctly different sets of genes in different cellular contexts. Copyright © 2013 Elsevier Ireland Ltd. All rights reserved.

  10. Loss of Sip1 leads to migration defects and retention of ectodermal markers during lens development

    PubMed Central

    Manthey, Abby L.; Lachke, Salil A.; FitzGerald, Paul G.; Mason, Robert W.; Scheiblin, David A.; McDonald, John H.; Duncan, Melinda K.

    2014-01-01

    SIP1 encodes a DNA-binding transcription factor that regulates multiple developmental processes, as highlighted by the pleiotropic defects observed in Mowat-Wilson Syndrome, which results from mutations in this gene. Further, in adults, dysregulated SIP1 expression has been implicated in both cancer and fibrotic diseases, where it functionally links TGFβ signaling to the loss of epithelial cell characteristics and gene expression. In the ocular lens, an epithelial tissue important for vision, Sip1 is co-expressed with epithelial markers, such as E-cadherin, and is required for the complete separation of the lens vesicle from the head ectoderm during early ocular morphogenesis. However, the function of Sip1 after early lens morphogenesis is still unknown. Here, we conditionally deleted Sip1 from the developing mouse lens shortly after lens vesicle closure, leading to defects in coordinated fiber cell tip migration, defective suture formation, and cataract. Interestingly, RNA-Sequencing analysis on Sip1 knockout lenses identified 190 differentially expressed genes, all of which are distinct from previously described Sip1 target genes. Furthermore, 34% of the genes with increased expression in the Sip1 knockout lenses are normally downregulated as the lens transitions from the lens vesicle to early lens, while 49% of the genes with decreased expression in the Sip1 knockout lenses are normally upregulated during early lens development. Overall, these data imply that Sip1 plays a major role in reprogramming the lens vesicle away from a surface ectoderm cell fate towards that necessary for the development of a transparent lens and demonstrate that Sip1 regulates distinctly different sets of genes in different cellular contexts. PMID:24161570

  11. A Negative Regulator of Cellulose Biosynthesis, bcsR, Affects Biofilm Formation, and Adhesion/Invasion Ability of Cronobacter sakazakii.

    PubMed

    Gao, Jian-Xin; Li, Ping; Du, Xin-Jun; Han, Zhong-Hui; Xue, Rui; Liang, Bin; Wang, Shuo

    2017-01-01

    Cronobacter sakazakii is an important foodborne pathogen that causes neonatal meningitis and sepsis, with high mortality in neonates. However, very little information is available regarding the pathogenesis of C. sakazakii at the genetic level. In our previous study, a cellulose biosynthesis-related gene ( bcsR ) was shown to be involved in C. sakazakii adhesion/invasion into epithelial cells. In this study, the detailed functions of this gene were investigated using a gene knockout technique. A bcsR knockout mutant (Δ bcsR ) of C. sakazakii ATCC BAA-894 showed decreased adhesion/invasion (3.9-fold) in human epithelial cell line HCT-8. Biofilm formation by the mutant was reduced to 50% of that exhibited by the wild-type (WT) strain. Raman spectrometry was used to detect variations in biofilm components caused by bcsR knockout, and certain components, including carotenoids, fatty acids, and amides, were significantly reduced. However, another biofilm component, cellulose, was increased in Δ bcsR , suggesting that bcsR negatively affects cellulose biosynthesis. This result was also verified via RT-PCR, which demonstrated up-regulation of five crucial cellulose synthesis genes ( bcsA, B, C, E, Q ) in Δ bcsR . Furthermore, the expression of other virulence or biofilm-related genes, including flagellar assembly genes ( fliA, C, D ) and toxicity-related genes ( ompA, ompX, hfq ), was studied. The expression of fliC and ompA in the Δ bcsR mutant was found to be remarkably reduced compared with that in the wild-type and the others were also affected excepted ompX . In summary, bcsR is a negative regulator of cellulose biosynthesis but positively regulates biofilm formation and the adhesion/invasion ability of C. sakazakii .

  12. Generation and CRISPR/Cas9 editing of transformed progenitor B cells as a pseudo-physiological system to study DNA repair gene function in V(D)J recombination.

    PubMed

    Lenden Hasse, Hélène; Lescale, Chloé; Bianchi, Joy J; Yu, Wei; Bedora-Faure, Marie; Deriano, Ludovic

    2017-12-01

    Antigen receptor gene assembly is accomplished in developing lymphocytes by the V(D)J recombination reaction, which can be separated into two steps: DNA cleavage by the recombination-activating gene (RAG) nuclease and joining of DNA double strand breaks (DSBs) by components of the nonhomologous end joining (NHEJ) pathway. Deficiencies for NHEJ factors can result in immunodeficiency and a propensity to accumulate genomic instability, thus highlighting the importance of identifying all players in this process and deciphering their functions. Bcl2 transgenic v-Abl kinase-transformed pro-B cells provide a pseudo-physiological cellular system to study V(D)J recombination. Treatment of v-Abl/Bcl2 pro-B cells with the Abl kinase inhibitor Imatinib leads to G1 cell cycle arrest, the rapid induction of Rag1/2 gene expression and V(D)J recombination. In this system, the Bcl2 transgene alleviates Imatinib-induced apoptosis enabling the analysis of induced V(D)J recombination. Although powerful, the use of mouse models carrying the Bcl2 transgene for the generation of v-Abl pro-B cell lines is time and money consuming. Here, we describe a method for generating v-Abl/Bcl2 pro-B cell lines from wild type mice and for performing gene knock-out using episomal CRISPR/Cas9 targeting vectors. Using this approach, we generated distinct NHEJ-deficient pro-B cell lines and quantified V(D)J recombination levels in these cells. Furthermore, this methodology can be adapted to generate pro-B cell lines deficient for any gene suspected to play a role in V(D)J recombination, and more generally DSB repair. Copyright © 2017 The Authors. Published by Elsevier B.V. All rights reserved.

  13. Characterizing the roles of Cryphonectria parasitica RNA-dependent RNA polymerase-like genes in antiviral defense, viral recombination and transposon transcript accumulation.

    PubMed

    Zhang, Dong-Xiu; Spiering, Martin J; Nuss, Donald L

    2014-01-01

    An inducible RNA-silencing pathway, involving a single Dicer protein, DCL2, and a single Argonaute protein, AGL2, was recently shown to serve as an effective antiviral defense response in the chestnut blight fungus Cryphonectria parasitica. Eukaryotic RNA-dependent RNA polymerases (RdRPs) are frequently involved in transcriptional and posttranscriptional gene silencing and antiviral defense. We report here the identification and characterization of four RdRP genes (rdr1-4) in the C. parasitica genome. Sequence relationships with other eukaryotic RdRPs indicated that RDR1 and RDR2 were closely related to QDE-1, an RdRP involved in RNA silencing ("quelling") in Neurospora crassa, whereas RDR3 was more closely related to the meiotic silencing gene SAD-1 in N. crassa. The RdRP domain of RDR4, related to N. crassa RRP-3 of unknown function, was truncated and showed evidence of alternative splicing. Similar to reports for dcl2 and agl2, the expression levels for rdr3 and rdr4 increased after hypovirus CHV-1/EP713 infection, while expression levels of rdr1 and rdr2 were unchanged. The virus-responsive induction patterns for rdr3 and rdr4 were altered in the Δdcl2 and Δagl2 strains, suggesting some level of interaction between rdr3 and rdr4 and the dcl2/agl2 silencing pathway. Single rdr gene knockouts Δrdr1-4, double knockouts Δrdr1/2, Δrdr2/3, Δrdr1/3, and a triple knockout, Δrdr1/2/3, were generated and evaluated for effects on fungal phenotype, the antiviral defense response, viral RNA recombination activity and transposon expression. None of the single or multiple rdr knockout strains displayed any phenotypic differences from the parental strains with or without viral infection or any significant changes in viral RNA accumulation or recombination activity or transposon RNA accumulation, indicating no detectable contribution by the C. parasitica rdr genes to these processes.

  14. Human knockouts and phenotypic analysis in a cohort with a high rate of consanguinity

    PubMed Central

    Saleheen, Danish; Natarajan, Pradeep; Armean, Irina M.; Zhao, Wei; Rasheed, Asif; Khetarpal, Sumeet; Won, Hong-Hee; Karczewski, Konrad J.; O’Donnell-Luria, Anne H.; Samocha, Kaitlin E.; Weisburd, Benjamin; Gupta, Namrata; Zaidi, Mozzam; Samuel, Maria; Imran, Atif; Abbas, Shahid; Majeed, Faisal; Ishaq, Madiha; Akhtar, Saba; Trindade, Kevin; Mucksavage, Megan; Qamar, Nadeem; Zaman, Khan Shah; Yaqoob, Zia; Saghir, Tahir; Rizvi, Syed Nadeem Hasan; Memon, Anis; Mallick, Nadeem Hayyat; Ishaq, Mohammad; Rasheed, Syed Zahed; Memon, Fazal-ur-Rehman; Mahmood, Khalid; Ahmed, Naveeduddin; Do, Ron; Krauss, Ronald M.; MacArthur, Daniel G.; Gabriel, Stacey; Lander, Eric S.; Daly, Mark J.; Frossard, Philippe; Danesh, John; Rader, Daniel J.; Kathiresan, Sekar

    2017-01-01

    A major goal of biomedicine is to understand the function of every gene in the human genome.1 Loss-of-function (LoF) mutations can disrupt both copies of a given gene in humans and phenotypic analysis of such ‘human knockouts’ can provide insight into gene function. Consanguineous unions are more likely to result in offspring who carry LoF mutations in a homozygous state. In Pakistan, consanguinity rates are notably high.2 Here, we sequenced the protein-coding regions of 10,503 adult participants in the Pakistan Risk of Myocardial Infarction Study (PROMIS) designed to understand the determinants of cardiometabolic diseases in South Asians.3 We identified individuals carrying predicted LoF (pLoF) mutations in the homozygous state, and performed phenotypic analysis involving >200 biochemical and disease traits. We enumerated 49,138 rare (<1 % minor allele frequency) pLoF mutations. These pLoF mutations are predicted to knock out 1,317 genes in at least one participant. Homozygosity for pLoF mutations at PLAG27 was associated with absent enzymatic activity of soluble lipoprotein-associated phospholipase A2; at CYP2F1, with higher plasma interleukin-8 concentrations; at TREH, with lower concentrations of apoB-containing lipoprotein subfractions; at either A3GALT2 or NRG4, with markedly reduced plasma insulin C-peptide concentrations; and at SLC9A3R1, with mediators of calcium and phosphate signaling. Finally, APOC3 is a gene which retards clearance of plasma triglyceride-rich lipoproteins and where heterozygous deficiency confers protection against coronary heart disease.4,5 In Pakistan, we now observe APOC3 homozygous pLoF carriers; we recalled these knockout humans and challenged with an oral fat load. Compared with wild-type family members, APOC3 knockouts displayed marked blunting of the usual post-prandial rise in plasma triglycerides. Overall, these observations provide a roadmap for a ‘human knockout project’, a systematic effort to understand the phenotypic consequences of complete disruption of genes in humans. PMID:28406212

  15. Regulation of gene expression by dietary Ca2+ in kidneys of 25-hydroxyvitamin D3-1 alpha-hydroxylase knockout mice.

    PubMed

    Hoenderop, Joost G J; Chon, Helena; Gkika, Dimitra; Bluyssen, Hans A R; Holstege, Frank C P; St-Arnaud, Rene; Braam, Branko; Bindels, Rene J M

    2004-02-01

    Pseudovitamin D deficiency rickets (PDDR) is an autosomal disease, characterized by undetectable levels of 1,25-dihydroxyvitamin D3 (1,25(OH)2D3), rickets and secondary hyperparathyroidism. Mice in which the 25-hydroxyvitamin D3-1 alpha-hydroxylase (1 alpha-OHase) gene was inactivated, presented the same clinical phenotype as patients with PDDR. cDNA Microarray technology was used on kidneys of 1 alpha-OHase knockout mice to study the expression profile of renal genes in this Ca2+-related disorder. Genome wide molecular events that occur during the rescue of these mice by high dietary Ca2+ intake were studied by the use of 15K cDNA microarray chips. 1 alpha-OHase knockout mice fed a normal Ca2+ diet developed severe hypocalcemia, rickets and died with an average life span of 12 +/- 2 weeks. Intriguingly, 1 alpha-OHase-/- mice supplemented with an enriched Ca2+ diet were normocalcemic and not significantly different from wild-type mice. Inactivation of the 1 alpha-OHase gene resulted in a significant regulation of +/- 1000 genes, whereas dietary Ca2+ supplementation of the 1 alpha-OHase-/- mice revealed +/- 2000 controlled genes. Interestingly, 557 transcripts were regulated in both situations implicating the involvement in the dietary Ca2+-mediated rescue mechanism of the 1 alpha-OHase-/- mice. Conspicuous regulated genes encoded for signaling molecules like the PDZ-domain containing protein channel interacting protein, FK binding protein type 4, kinases, and importantly Ca2+ transporting proteins including the Na+-Ca2+ exchanger, calbindin-D28K and the Ca2+ sensor calmodulin. Dietary Ca2+ intake normalized disturbances in the Ca2+ homeostasis due to vitamin D deficiency that were accompanied by the regulation of a subset of renal genes, including well-known renal Ca2+ transport protein genes, but also genes not previously identified as playing a role in renal Ca2+ handling.

  16. Conditional knockout of retinal determination genes in differentiating cells in Drosophila.

    PubMed

    Jin, Meng; Eblimit, Aiden; Pulikkathara, Merlyn; Corr, Stuart; Chen, Rui; Mardon, Graeme

    2016-08-01

    Conditional gene knockout in postmitotic cells is a valuable technique which allows the study of gene function with spatiotemporal control. Surprisingly, in contrast to its long-term and extensive use in mouse studies, this technology is lacking in Drosophila. Here, we use a novel method for generating complete loss of eyes absent (eya) or sine oculis (so) function in postmitotic cells posterior to the morphogenetic furrow (MF). Specifically, genomic rescue constructs with flippase recognition target (FRT) sequences flanking essential exons are used to generate conditional null alleles. By removing gene function in differentiating cells, we show that eya and so are dispensable for larval photoreceptor differentiation, but are required for differentiation during pupal development. Both eya and so are necessary for photoreceptor survival and the apoptosis caused by loss of eya or so function is likely a secondary consequence of inappropriate differentiation. We also confirm their requirement for cone cell development and reveal a novel role in interommatidial bristle (IOB) formation. In addition, so is required for normal eye disc morphology. This is the first report of a knockout method to study eya and so function in postmitotic cells. This technology will open the door to a large array of new functional studies in virtually any tissue and at any stage of development or in adults. © 2016 Federation of European Biochemical Societies.

  17. Retinoid-related orphan receptor γ (RORγ) adult induced knockout mice develop lymphoblastic lymphoma.

    PubMed

    Liljevald, Maria; Rehnberg, Maria; Söderberg, Magnus; Ramnegård, Marie; Börjesson, Jenny; Luciani, Donatella; Krutrök, Nina; Brändén, Lena; Johansson, Camilla; Xu, Xiufeng; Bjursell, Mikael; Sjögren, Anna-Karin; Hornberg, Jorrit; Andersson, Ulf; Keeling, David; Jirholt, Johan

    2016-11-01

    RORγ is a nuclear hormone receptor which controls polarization of naive CD4 + T-cells into proinflammatory Th17 cells. Pharmacological antagonism of RORγ has therapeutic potential for autoimmune diseases; however, this mechanism may potentially carry target-related safety risks, as mice deficient in Rorc, the gene encoding RORγ, develop T-cell lymphoma with 50% frequency. Due to the requirement of RORγ during development, the Rorc knockout (KO) animals lack secondary lymphoid organs and have a dysregulation in the generation of CD4+ and CD8+ T cells. We wanted to extend the evaluation of RORγ deficiency to address the question whether lymphomas, similar to those observed in the Rorc KO, would develop in an animal with an otherwise intact adult immune system. Accordingly, we designed a conditional RORγ knockout mouse (Rorc CKO) where the Rorc locus could be deleted in adult animals. Based on these studies we can confirm that these animals also develop lymphoma in a similar time frame as embryonic Rorc knockouts. This study also suggests that in animals where the gene deletion is incomplete, the thymus undergoes a rapid selection process replacing Rorc deficient cells with remnant thymocytes carrying a functional Rorc locus and that subsequently, these animals do not develop lymphoblastic lymphoma. Copyright © 2016 Elsevier B.V. All rights reserved.

  18. Tightly-wound miniknot vectors for gene therapy: a potential improvement over supercoiled minicircle DNA.

    PubMed

    Tolmachov, Oleg E

    2010-04-01

    Minimized derivatives of bacterial plasmids with removed bacterial backbones are promising vectors for the efficient delivery and for the long-term expression of therapeutic genes. The absence of the bacterial plasmid backbone, a known inducer of innate immune response and a known silencer of transgene expression, provides a partial explanation for the high efficiency of gene transfer using minimized DNA vectors. Supercoiled minicircle DNA is a type of minimized DNA vector obtained via intra-plasmid recombination in bacteria. Minicircle vectors seem to get an additional advantage from their physical compactness, which reduces DNA damage due to the mechanical stress during gene delivery. An independent topological means for DNA compression is knotting, with some knotted DNA isoforms offering superior compactness. I propose that, firstly, knotted DNA can be a suitable compact DNA form for the efficient transfection of a range of human cells with therapeutic genes, and, secondly, that knotted minimized DNA vectors without bacterial backbones ("miniknot" vectors) can surpass supercoiled minicircle DNA vectors in the efficiency of therapeutic gene delivery. Crucially, while the introduction of a single nick to a supercoiled DNA molecule leads to the loss of the compact supercoiled status, the introduction of nicks to knotted DNA does not change knotting. Tight miniknot vectors can be readily produced by the direct action of highly concentrated type II DNA topoisomerase on minicircle DNA or, alternatively, by annealing of the 19-base cohesive ends of the minimized vectors confined within the capsids of Escherichia coli bacteriophage P2 or its satellite bacteriophage P4. After reaching the nucleoplasm of the target cell, the knotted DNA is expected to be unknotted through type II topoisomerase activity and thus to become available for transcription, chromosomal integration or episomal maintenance. The hypothesis can be tested by comparing the gene transfer efficiency achieved with the proposed miniknot vectors, the minicircle vectors described previously, knotted plasmid vectors and standard plasmid vectors. Tightly-wound miniknots can be particularly useful in the gene administration procedures involving considerable forces acting on vector DNA: aerosol inhalation, jet-injection, electroporation, particle bombardment and ultrasound DNA transfer. (c) 2009 Elsevier Ltd. All rights reserved.

  19. [Construction and expression of the targeting super-antigen EGF-SEA fusion gene].

    PubMed

    Xie, Yang; Peng, Shaoping; Liao, Zhiying; Liu, Jiafeng; Liu, Xuemei; Chen, Weifeng

    2014-05-01

    To construct expression vector for the SEA-EGF fusion gene. Clone the SEA gene and the EGF gene segment with PCR and RT-PCR independently, and connect this two genes by the bridge PCR. Insert the fusion gene EGF-SEA into the expression vector PET-44. Induced the secretion of the fusion protein SEA-EGF by the antileptic. The gene fragment encoding EGF and SEA mature peptide was successfully cloned. The fusion gene EGF-SEA was successfully constructed and was inserted into expression vector. The new recombinant expression vector for fusion gene EGF-SEA is specific for head and neck cancer, laid the foundation for the further study of fusion protein SEA-EGF targeting immune therapy in head and neck tumors.

  20. Retroviral vectors encoding ADA regulatory locus control region provide enhanced T-cell-specific transgene expression.

    PubMed

    Trinh, Alice T; Ball, Bret G; Weber, Erin; Gallaher, Timothy K; Gluzman-Poltorak, Zoya; Anderson, French; Basile, Lena A

    2009-12-30

    Murine retroviral vectors have been used in several hundred gene therapy clinical trials, but have fallen out of favor for a number of reasons. One issue is that gene expression from viral or internal promoters is highly variable and essentially unregulated. Moreover, with retroviral vectors, gene expression is usually silenced over time. Mammalian genes, in contrast, are characterized by highly regulated, precise levels of expression in both a temporal and a cell-specific manner. To ascertain if recapitulation of endogenous adenosine deaminase (ADA) expression can be achieved in a vector construct we created a new series of Moloney murine leukemia virus (MuLV) based retroviral vector that carry human regulatory elements including combinations of the ADA promoter, the ADA locus control region (LCR), ADA introns and human polyadenylation sequences in a self-inactivating vector backbone. A MuLV-based retroviral vector with a self-inactivating (SIN) backbone, the phosphoglycerate kinase promoter (PGK) and the enhanced green fluorescent protein (eGFP), as a reporter gene, was generated. Subsequent vectors were constructed from this basic vector by deletion or addition of certain elements. The added elements that were assessed are the human ADA promoter, human ADA locus control region (LCR), introns 7, 8, and 11 from the human ADA gene, and human growth hormone polyadenylation signal. Retroviral vector particles were produced by transient three-plasmid transfection of 293T cells. Retroviral vectors encoding eGFP were titered by transducing 293A cells, and then the proportion of GFP-positive cells was determined using fluorescence-activated cell sorting (FACS). Non T-cell and T-cell lines were transduced at a multiplicity of infection (MOI) of 0.1 and the yield of eGFP transgene expression was evaluated by FACS analysis using mean fluorescent intensity (MFI) detection. Vectors that contained the ADA LCR were preferentially expressed in T-cell lines. Further improvements in T-cell specific gene expression were observed with the incorporation of additional cis-regulatory elements, such as a human polyadenylation signal and intron 7 from the human ADA gene. These studies suggest that the combination of an authentically regulated ADA gene in a murine retroviral vector, together with additional locus-specific regulatory refinements, will yield a vector with a safer profile and greater efficacy in terms of high-level, therapeutic, regulated gene expression for the treatment of ADA-deficient severe combined immunodeficiency.

  1. The evolution of heart gene delivery vectors.

    PubMed

    Wasala, Nalinda B; Shin, Jin-Hong; Duan, Dongsheng

    2011-10-01

    Gene therapy holds promise for treating numerous heart diseases. A key premise for the success of cardiac gene therapy is the development of powerful gene transfer vehicles that can achieve highly efficient and persistent gene transfer specifically in the heart. Other features of an ideal vector include negligible toxicity, minimal immunogenicity and easy manufacturing. Rapid progress in the fields of molecular biology and virology has offered great opportunities to engineer various genetic materials for heart gene delivery. Several nonviral vectors (e.g. naked plasmids, plasmid lipid/polymer complexes and oligonucleotides) have been tested. Commonly used viral vectors include lentivirus, adenovirus and adeno-associated virus. Among these, adeno-associated virus has shown many attractive features for pre-clinical experimentation in animal models of heart diseases. We review the history and evolution of these vectors for heart gene transfer. Copyright © 2011 John Wiley & Sons, Ltd.

  2. The evolution of heart gene delivery vectors

    PubMed Central

    Wasala, Nalinda B.; Shin, Jin-Hong; Duan, Dongsheng

    2012-01-01

    Gene therapy holds promise for treating numerous heart diseases. A key premise for the success of cardiac gene therapy is the development of powerful gene transfer vehicles that can achieve highly efficient and persistent gene transfer specifically in the heart. Other features of an ideal vector include negligible toxicity, minimal immunogenicity and easy manufacturing. Rapid progress in the fields of molecular biology and virology has offered great opportunities to engineer various genetic materials for heart gene delivery. Several nonviral vectors (e.g. naked plasmids, plasmid lipid/polymer complexes and oligonucleotides) have been tested. Commonly used viral vectors include lentivirus, adenovirus and adeno-associated virus. Among these, adeno-associated virus has shown many attractive features for pre-clinical experimentation in animal models of heart diseases. We review the history and evolution of these vectors for heart gene transfer. PMID:21837689

  3. Immune Recognition of Gene Transfer Vectors: Focus on Adenovirus as a Paradigm

    PubMed Central

    Aldhamen, Yasser Ali; Seregin, Sergey S.; Amalfitano, Andrea

    2011-01-01

    Recombinant Adenovirus (Ad) based vectors have been utilized extensively as a gene transfer platform in multiple pre-clinical and clinical applications. These applications are numerous, and inclusive of both gene therapy and vaccine based approaches to human or animal diseases. The widespread utilization of these vectors in both animal models, as well as numerous human clinical trials (Ad-based vectors surpass all other gene transfer vectors relative to numbers of patients treated, as well as number of clinical trials overall), has shed light on how this virus vector interacts with both the innate and adaptive immune systems. The ability to generate and administer large amounts of this vector likely contributes not only to their ability to allow for highly efficient gene transfer, but also their elicitation of host immune responses to the vector and/or the transgene the vector expresses in vivo. These facts, coupled with utilization of several models that allow for full detection of these responses has predicted several observations made in human trials, an important point as lack of similar capabilities by other vector systems may prevent detection of such responses until only after human trials are initiated. Finally, induction of innate or adaptive immune responses by Ad vectors may be detrimental in one setting (i.e., gene therapy) and be entirely beneficial in another (i.e., prophylactic or therapeutic vaccine based applications). Herein, we review the current understanding of innate and adaptive immune responses to Ad vectors, as well some recent advances that attempt to capitalize on this understanding so as to further broaden the safe and efficient use of Ad-based gene transfer therapies in general. PMID:22566830

  4. Thyroid Hormone Receptor α Controls Developmental Timing and Regulates the Rate and Coordination of Tissue-Specific Metamorphosis in Xenopus tropicalis.

    PubMed

    Wen, Luan; Shibata, Yuki; Su, Dan; Fu, Liezhen; Luu, Nga; Shi, Yun-Bo

    2017-06-01

    Thyroid hormone (T3) receptors (TRs) mediate the effects of T3 on organ metabolism and animal development. There are two TR genes, TRα and TRβ, in all vertebrates. During animal development, TRα expression is activated earlier than zygotic T3 synthesis and secretion into the plasma, implicating a developmental role of TRα both in the presence and absence of T3. Using T3-dependent amphibian metamorphosis as a model, we previously proposed a dual-function model for TRs, in particular TRα, during development. That is, unliganded TR represses the expression of T3-inducible genes during premetamorphosis to ensure proper animal growth and prevent premature metamorphosis, whereas during metamorphosis, liganded TR activates target gene transcription to promote the transformation of the tadpole into a frog. To determine if TRα has such a dual function, we generated homozygous TRα-knockout animal lines. We show that, indeed, TRα knockout affects both premetamorphic animal development and metamorphosis. Surprisingly, we observed that TRα is not essential for amphibian metamorphosis, given that homozygous knockout animals complete metamorphosis within a similar time period after fertilization as their wild-type siblings. On the other hand, the timing of metamorphosis for different organs is altered by the knockout; limb metamorphosis occurs earlier, whereas intestinal metamorphosis is completed later than in wild-type siblings. Thus, our studies have demonstrated a critical role of endogenous TRα, not only in regulating both the timing and rate of metamorphosis, but also in coordinating temporal metamorphosis of different organs.

  5. Fabp4-Cre-mediated Sirt6 deletion impairs adipose tissue function and metabolic homeostasis in mice.

    PubMed

    Xiong, Xiwen; Zhang, Cuicui; Zhang, Yang; Fan, Rui; Qian, Xinlai; Dong, X Charlie

    2017-06-01

    SIRT6 is a member of sirtuin family of deacetylases involved in diverse processes including genome stability, metabolic homeostasis and anti-inflammation. However, its function in the adipose tissue is not well understood. To examine the metabolic function of SIRT6 in the adipose tissue, we generated two mouse models that are deficient in Sirt6 using the Cre-lox approach. Two commonly used Cre lines that are driven by either the mouse Fabp4 or Adipoq gene promoter were chosen for this study. The Sirt6- knockout mice generated by the Fabp4-Cre line ( Sirt6 f/f : Fabp4-Cre) had a significant increase in both body weight and fat mass and exhibited glucose intolerance and insulin resistance as compared with the control wild-type mice. At the molecular levels, the Sirt6 f/f :Fabp4-Cre-knockout mice had increased expression of inflammatory genes including F4/80, TNFα, IL-6 and MCP-1 in both white and brown adipose tissues. Moreover, the knockout mice showed decreased expression of the adiponectin gene in the white adipose tissue and UCP1 in the brown adipose tissue, respectively. In contrast, the Sirt6 knockout mice generated by the Adipoq-Cre line ( Sirt6 f/f :Adipoq-Cre) only had modest insulin resistance. In conclusion, our data suggest that the function of SIRT6 in the Fabp4-Cre-expressing cells in addition to mature adipocytes plays a critical role in body weight maintenance and metabolic homeostasis. © 2017 Society for Endocrinology.

  6. Bacteriophage-Derived Vectors for Targeted Cancer Gene Therapy

    PubMed Central

    Pranjol, Md Zahidul Islam; Hajitou, Amin

    2015-01-01

    Cancer gene therapy expanded and reached its pinnacle in research in the last decade. Both viral and non-viral vectors have entered clinical trials, and significant successes have been achieved. However, a systemic administration of a vector, illustrating safe, efficient, and targeted gene delivery to solid tumors has proven to be a major challenge. In this review, we summarize the current progress and challenges in the targeted gene therapy of cancer. Moreover, we highlight the recent developments of bacteriophage-derived vectors and their contributions in targeting cancer with therapeutic genes following systemic administration. PMID:25606974

  7. Bacteriophage-derived vectors for targeted cancer gene therapy.

    PubMed

    Pranjol, Md Zahidul Islam; Hajitou, Amin

    2015-01-19

    Cancer gene therapy expanded and reached its pinnacle in research in the last decade. Both viral and non-viral vectors have entered clinical trials, and significant successes have been achieved. However, a systemic administration of a vector, illustrating safe, efficient, and targeted gene delivery to solid tumors has proven to be a major challenge. In this review, we summarize the current progress and challenges in the targeted gene therapy of cancer. Moreover, we highlight the recent developments of bacteriophage-derived vectors and their contributions in targeting cancer with therapeutic genes following systemic administration.

  8. Production of non viral DNA vectors.

    PubMed

    Schleef, Martin; Blaesen, Markus; Schmeer, Marco; Baier, Ruth; Marie, Corinne; Dickson, George; Scherman, Daniel

    2010-12-01

    After some decades of research, development and first clinical approaches to use DNA vectors in gene therapy, cell therapy and DNA vaccination, the requirements for the pharmaceutical manufacturing of gene vectors has improved significantly step by step. Even the expression level and specificity of non viral DNA vectors were significantly modified and followed the success of viral vectors. The strict separation of "viral" and "non viral" gene transfer are historic borders between scientist and we will show that both fields together are able to allow the next step towards successful prevention and therapy. Here we summarize the features of producing and modifying these non-viral gene vectors to ensure the required quality to modify cells and to treat human and animals.

  9. Microfluidic measurement of effects of ACF7/MACF1 gene on the mechanics of primary cortical neurons

    NASA Astrophysics Data System (ADS)

    Lee, Donghee; Ka, Minhan; Kim, Woo-Yang; Ryu, Sangjin

    2014-03-01

    Actin filaments and microtubules play important roles in determining the mechanics of cells, and ACF7/MACF1 (Actin Crosslinking Family 7/Microtubule And Actin Crosslinking Factor 1) gene seems to be closely related to connections between actin filaments and microtubules. To identify such roles of the ACF7/MACF1 gene of primary cortical neurons, we isolated neuronal cells from the cerebral cortex of the embryonic mouse brain, which is important in memory, language and perception. We exerted viscous shear flow to normal neuronal cells and ACF7/MACF1 gene knockout neuronal cells using rectangular microfluidic channels. While changing viscous shear stress on the cells, we recorded changes in the morphology of the two cell types using video microscopy. Having analyzed the deformation of the cells, we could quantitatively correlate differences in the morphological change between the both normal and ACF7/MACF1 gene knockout neuronal cells to the applied shear force, which will contribute toward identifying cell mechanical roles of the ACF7/MACF1 gene.

  10. Genome Editing of Monkey.

    PubMed

    Liu, Zhen; Cai, Yijun; Sun, Qiang

    2017-01-01

    Gene-modified monkey models would be particularly valuable in biomedical and neuroscience research. Virus-based transgenic and programmable nucleases-based site-specific gene editing methods (TALEN, CRISPR-cas9) enable the generation of gene-modified monkeys with gain or loss of function of specific genes. Here, we describe the generation of transgenic and knock-out (KO) monkeys with high efficiency by lentivirus and programmable nucleases.

  11. [Construction of Corynebacterium crenatum AS 1.542 δ argR and analysis of transcriptional levels of the related genes of arginine biosynthetic pathway].

    PubMed

    Chen, Xuelan; Tang, Li; Jiao, Haitao; Xu, Feng; Xiong, Yonghua

    2013-01-04

    ArgR, coded by the argR gene from Corynebacterium crenatum AS 1.542, acts as a negative regulator in arginine biosynthetic pathway. However, the effect of argR on transcriptional levels of the related biosynthetic genes has not been reported. Here, we constructed a deletion mutant of argR gene: C. crenatum AS 1.542 Delta argR using marker-less knockout technology, and compared the changes of transcriptional levels of the arginine biosynthetic genes between the mutant strain and the wild-type strain. We used marker-less knockout technology to construct C. crenatum AS 1.542 Delta argR and analyzed the changes of the relate genes at the transcriptional level using real-time fluorescence quantitative PCR. C. crenatum AS 1.542 Delta argR was successfully obtained and the transcriptional level of arginine biosynthetic genes in this mutant increased significantly with an average of about 162.1 folds. The arginine biosynthetic genes in C. crenatum are clearly controlled by the negative regulator ArgR. However, the deletion of this regulator does not result in a clear change in arginine production in the bacteria.

  12. A novel polyketide biosynthesis gene cluster is involved in fruiting body morphogenesis in the filamentous fungi Sordaria macrospora and Neurospora crassa.

    PubMed

    Nowrousian, Minou

    2009-04-01

    During fungal fruiting body development, hyphae aggregate to form multicellular structures that protect and disperse the sexual spores. Analysis of microarray data revealed a gene cluster strongly upregulated during fruiting body development in the ascomycete Sordaria macrospora. Real time PCR analysis showed that the genes from the orthologous cluster in Neurospora crassa are also upregulated during development. The cluster encodes putative polyketide biosynthesis enzymes, including a reducing polyketide synthase. Analysis of knockout strains of a predicted dehydrogenase gene from the cluster showed that mutants in N. crassa and S. macrospora are delayed in fruiting body formation. In addition to the upregulated cluster, the N. crassa genome comprises another cluster containing a polyketide synthase gene, and five additional reducing polyketide synthase (rpks) genes that are not part of clusters. To study the role of these genes in sexual development, expression of the predicted rpks genes in S. macrospora (five genes) and N. crassa (six genes) was analyzed; all but one are upregulated during sexual development. Analysis of knockout strains for the N. crassa rpks genes showed that one of them is essential for fruiting body formation. These data indicate that polyketides produced by RPKSs are involved in sexual development in filamentous ascomycetes.

  13. Activated ERK1/2 increases CD44 in glomerular parietal epithelial cells leading to matrix expansion

    PubMed Central

    Roeder, Sebastian S.; Barnes, Taylor J.; Lee, Jonathan S.; Kato, India; Eng, Diana G.; Kaverina, Natalya V.; Sunseri, Maria W.; Daniel, Christoph; Amann, Kerstin; Pippin, Jeffrey W.; Shankland, Stuart J.

    2017-01-01

    The glycoprotein CD44 is barely detected in normal mouse and human glomeruli, but is increased in glomerular parietal epithelial cells following podocyte injury in focal segmental glomerulosclerosis (FSGS). To determine the biological role and regulation of CD44 in these cells, we employed an in vivo and in vitro approach. Experimental FSGS was induced in CD44 knockout and wildtype mice with a cytotoxic podocyte antibody. Albuminuria, focal and global glomerulosclerosis (periodic acid-Schiff stain) and collagen IV staining were lower in CD44 knockout compared with wild type mice with FSGS. Parietal epithelial cells had lower migration from Bowman’s capsule to the glomerular tuft in CD44 knockout mice with disease compared with wild type mice. In cultured murine parietal epithelial cells, overexpressing CD44 with a retroviral vector encoding CD44 was accompanied by significantly increased collagen IV expression and parietal epithelial cells migration. Because our results showed de novo co-staining for activated ERK1/2 (pERK) in parietal epithelial cells in experimental FSGS, and also in biopsies from patients with FSGS, two in vitro strategies were employed to prove that pERK regulated CD44 levels. First, mouse parietal epithelial cells were infected with a retroviral vector for the upstream kinase MEK-DD to increase pERK, which was accompanied by increased CD44 levels. Second, in CD44 overexpressing parietal epithelial cells, decreasing pERK with U0126 was accompanied by reduced CD44. Finally, parietal epithelial cell migration was higher in cells with increased and reduced in cells with decreased pERK. Thus, pERK is a regulator of CD44 expression and increased CD44 expression leads to a pro-sclerotic and migratory parietal epithelial cells phenotype. PMID:27998643

  14. Re-engineering adenovirus vector systems to enable high-throughput analyses of gene function.

    PubMed

    Stanton, Richard J; McSharry, Brian P; Armstrong, Melanie; Tomasec, Peter; Wilkinson, Gavin W G

    2008-12-01

    With the enhanced capacity of bioinformatics to interrogate extensive banks of sequence data, more efficient technologies are needed to test gene function predictions. Replication-deficient recombinant adenovirus (Ad) vectors are widely used in expression analysis since they provide for extremely efficient expression of transgenes in a wide range of cell types. To facilitate rapid, high-throughput generation of recombinant viruses, we have re-engineered an adenovirus vector (designated AdZ) to allow single-step, directional gene insertion using recombineering technology. Recombineering allows for direct insertion into the Ad vector of PCR products, synthesized sequences, or oligonucleotides encoding shRNAs without requirement for a transfer vector Vectors were optimized for high-throughput applications by making them "self-excising" through incorporating the I-SceI homing endonuclease into the vector removing the need to linearize vectors prior to transfection into packaging cells. AdZ vectors allow genes to be expressed in their native form or with strep, V5, or GFP tags. Insertion of tetracycline operators downstream of the human cytomegalovirus major immediate early (HCMV MIE) promoter permits silencing of transgenes in helper cells expressing the tet repressor thus making the vector compatible with the cloning of toxic gene products. The AdZ vector system is robust, straightforward, and suited to both sporadic and high-throughput applications.

  15. Evidence of reactive astrocytes but not peripheral immune system activation in a mouse model of Fragile X Syndrome

    PubMed Central

    Yuskaitis, Christopher J.; Beurel, Eleonore; Jope, Richard S.

    2010-01-01

    Fragile X syndrome (FXS) is the most common form of inherited mental retardation and is one of the few known genetic causes of autism. FXS results from the loss of Fmr1 gene function, thus Fmr1 knockout mice provide a model to study impairments associated with FXS and autism and to test potential therapeutic interventions. The inhibitory serine-phosphorylation of glycogen synthase kinase-3 (GSK3) is lower in brain regions of Fmr1 knockout mice than wild-type mice and the GSK3 inhibitor lithium rescues several behavioral impairments in Fmr1 knockout mice. Therefore, we examined if the serine-phosphorylation of GSK3 in Fmr1 knockout mice also was altered outside the brain and if administration of lithium ameliorated the macroorchidism phenotype. Additionally, since GSK3 regulates numerous functions of the immune system and immune alterations have been associated with autism, we tested if immune function is altered in Fmr1 knockout mice. The inhibitory serine-phosphorylation of GSK3 was significantly lower in the testis and liver of Fmr1 knockout mice than wild-type mice, and chronic lithium treatment reduced macroorchidism in Fmr1 knockout mice. No alterations in peripheral immune function were identified in Fmr1 knockout mice. However, examination of glia, the immune cells of the brain, revealed reactive astrocytes in several brain regions of Fmr1 knockout mice and treatment with lithium reduced this in the striatum and cerebellum. These results provide further evidence of the involvement of dysregulated GSK3 in FXS, and demonstrate that lithium administration reduces macroorchidism and reactive astrocytes in Fmr1 knockout mice. PMID:20600866

  16. Advances in genetic engineering of the avian genome: "Realising the promise".

    PubMed

    Doran, Timothy J; Cooper, Caitlin A; Jenkins, Kristie A; Tizard, Mark L V

    2016-06-01

    This review provides an historic perspective of the key steps from those reported at the 1st Transgenic Animal Research Conference in 1997 through to the very latest developments in avian transgenesis. Eighteen years later, on the occasion of the 10th conference in this series, we have seen breakthrough advances in the use of viral vectors and transposons to transform the germline via the direct manipulation of the chicken embryo, through to the establishment of PGC cultures allowing in vitro modification, expansion into populations to analyse the genetic modifications and then injection of these cells into embryos to create germline chimeras. We have now reached an unprecedented time in the history of chicken transgenic research where we have the technology to introduce precise, targeted modifications into the chicken genome, ranging from; new transgenes that provide improved phenotypes such as increased resilience to economically important diseases; the targeted disruption of immunoglobulin genes and replacement with human sequences to generate transgenic chickens that express "humanised" antibodies for biopharming; and the deletion of specific nucleotides to generate targeted gene knockout chickens for functional genomics. The impact of these advances is set to be realised through applications in chickens, and other bird species as models in scientific research, for novel biotechnology and to protect and improve agricultural productivity.

  17. Independent degeneration of photoreceptors and retinal pigment epithelium in conditional knockout mouse models of choroideremia

    PubMed Central

    Tolmachova, Tanya; Anders, Ross; Abrink, Magnus; Bugeon, Laurence; Dallman, Margaret J.; Futter, Clare E.; Ramalho, José S.; Tonagel, Felix; Tanimoto, Naoyuki; Seeliger, Mathias W.; Huxley, Clare; Seabra, Miguel C.

    2006-01-01

    Choroideremia (CHM) is an X-linked degeneration of the retinal pigment epithelium (RPE), photoreceptors, and choroid, caused by loss of function of the CHM/REP1 gene. REP1 is involved in lipid modification (prenylation) of Rab GTPases, key regulators of intracellular vesicular transport and organelle dynamics. To study the pathogenesis of CHM and to develop a model for assessing gene therapy, we have created a conditional mouse knockout of the Chm gene. Heterozygous-null females exhibit characteristic hallmarks of CHM: progressive degeneration of the photoreceptors, patchy depigmentation of the RPE, and Rab prenylation defects. Using tamoxifen-inducible and tissue-specific Cre expression in combination with floxed Chm alleles, we show that CHM pathogenesis involves independently triggered degeneration of photoreceptors and the RPE, associated with different subsets of defective Rabs. PMID:16410831

  18. The preproghrelin gene is required for the normal integration of thermoregulation and sleep in mice

    PubMed Central

    Szentirmai, Éva; Kapás, Levente; Sun, Yuxiang; Smith, Roy G.; Krueger, James M.

    2009-01-01

    Peptidergic mechanisms controlling feeding, metabolism, thermoregulation, and sleep overlap in the hypothalamus. Low ambient temperatures and food restriction induce hypothermic (torpor) bouts and characteristic metabolic and sleep changes in mice. We report that mice lacking the preproghrelin gene, but not those lacking the ghrelin receptor, have impaired abilities to manifest and integrate normal sleep and thermoregulatory responses to metabolic challenges. In response to fasting at 17 °C (a subthermoneutral ambient temperature), preproghrelin knockout mice enter hypothermic bouts associated with reduced sleep, culminating in a marked drop in body temperature to near-ambient levels. Prior treatment with obestatin, another preproghrelin gene product, attenuates the hypothermic response of preproghrelin knockout mice. Results suggest that obestatin is a component in the coordinated regulation of metabolism and sleep during torpor. PMID:19666521

  19. Advances in Non-Viral DNA Vectors for Gene Therapy

    PubMed Central

    Hardee, Cinnamon L.; Arévalo-Soliz, Lirio Milenka; Hornstein, Benjamin D.; Zechiedrich, Lynn

    2017-01-01

    Uses of viral vectors have thus far eclipsed uses of non-viral vectors for gene therapy delivery in the clinic. Viral vectors, however, have certain issues involving genome integration, the inability to be delivered repeatedly, and possible host rejection. Fortunately, development of non-viral DNA vectors has progressed steadily, especially in plasmid vector length reduction, now allowing these tools to fill in specifically where viral or other non-viral vectors may not be the best options. In this review, we examine the improvements made to non-viral DNA gene therapy vectors, highlight opportunities for their further development, address therapeutic needs for which their use is the logical choice, and discuss their future expansion into the clinic. PMID:28208635

  20. Genetic modification of hematopoietic cells using retroviral and lentiviral vectors: safety considerations for vector design and delivery into target cells.

    PubMed

    Dropulic, Boro

    2005-07-01

    The recent development of leukemia in three patients following retroviral vector gene transfer in hematopoietic stem cells, resulting in the death of one patient, has raised safety concerns for the use of integrating gene transfer vectors for human gene therapy. This review discusses these serious adverse events from the perspective of whether restrictions on vector design and vector-modified target cells are warranted at this time. A case is made against presently establishing specific restrictions for vector design and transduced cells; rather, their safety should be ascertained by empiric evaluation in appropriate preclinical models on a case-by-case basis. Such preclinical data, coupled with proper informed patient consent and a risk-benefit ratio analysis, provide the best available prospective evaluation of gene transfer vectors prior to their translation into the clinic.

  1. In Vivo Zinc Finger Nuclease-mediated Targeted Integration of a Glucose-6-phosphatase Transgene Promotes Survival in Mice With Glycogen Storage Disease Type IA

    PubMed Central

    Landau, Dustin J; Brooks, Elizabeth Drake; Perez-Pinera, Pablo; Amarasekara, Hiruni; Mefferd, Adam; Li, Songtao; Bird, Andrew; Gersbach, Charles A; Koeberl, Dwight D

    2016-01-01

    Glycogen storage disease type Ia (GSD Ia) is caused by glucose-6-phosphatase (G6Pase) deficiency in association with severe, life-threatening hypoglycemia that necessitates lifelong dietary therapy. Here we show that use of a zinc-finger nuclease (ZFN) targeted to the ROSA26 safe harbor locus and a ROSA26-targeting vector containing a G6PC donor transgene, both delivered with adeno-associated virus (AAV) vectors, markedly improved survival of G6Pase knockout (G6Pase-KO) mice compared with mice receiving the donor vector alone (P < 0.04). Furthermore, transgene integration has been confirmed by sequencing in the majority of the mice treated with both vectors. Targeted alleles were 4.6-fold more common in livers of mice with GSD Ia, as compared with normal littermates, at 8 months following vector administration (P < 0.02). This suggests a selective advantage for vector-transduced hepatocytes following ZFN-mediated integration of the G6Pase vector. A short-term experiment also showed that 3-month-old mice receiving the ZFN had significantly-improved biochemical correction, in comparison with mice that received the donor vector alone. These data suggest that the use of ZFNs to drive integration of G6Pase at a safe harbor locus might improve vector persistence and efficacy, and lower mortality in GSD Ia. PMID:26865405

  2. Characterization of the Serratia marcescens SdeCDE multidrug efflux pump studied via gene knockout mutagenesis.

    PubMed

    Begic, Sanela; Worobec, Elizabeth A

    2008-05-01

    Serratia marcescens is an important nosocomial agent having high antibiotic resistance. A major mechanism for S. marcescens antibiotic resistance is active efflux. To ascertain the substrate specificity of the S. marcescens SdeCDE efflux pump, we constructed pump gene deletion mutants. sdeCDE knockout strains showed no change in antibiotic susceptibility in comparison with the parental strains for any of the substrates, with the exception of novobiocin. In addition, novobiocin was the only antibiotic to be accumulated by sdeCDE-deficient strains. Based on the substrates used in our study, we conclude that SdeCDE is a Resistance-Nodulation-Cell Division family pump with limited substrate specificity.

  3. Targeted systemic gene therapy and molecular imaging of cancer contribution of the vascular-targeted AAVP vector.

    PubMed

    Hajitou, Amin

    2010-01-01

    Gene therapy and molecular-genetic imaging have faced a major problem: the lack of an efficient systemic gene delivery vector. Unquestionably, eukaryotic viruses have been the vectors of choice for gene delivery to mammalian cells; however, they have had limited success in systemic gene therapy. This is mainly due to undesired uptake by the liver and reticuloendothelial system, broad tropism for mammalian cells causing toxicity, and their immunogenicity. On the other hand, prokaryotic viruses such as bacteriophage (phage) have no tropism for mammalian cells, but can be engineered to deliver genes to these cells. However, phage-based vectors have inherently been considered poor vectors for mammalian cells. We have reported a new generation of vascular-targeted systemic hybrid prokaryotic-eukaryotic vectors as chimeras between an adeno-associated virus (AAV) and targeted bacteriophage (termed AAV/phage; AAVP). In this hybrid vector, the targeted bacteriophage serves as a shuttle to deliver the AAV transgene cassette inserted in an intergenomic region of the phage DNA genome. As a proof of concept, we assessed the in vivo efficacy of vector in animal models of cancer by displaying on the phage capsid the cyclic Arg-Gly-Asp (RGD-4C) ligand that binds to alphav integrin receptors specifically expressed on the angiogenic blood vessels of tumors. The ligand-directed vector was able to specifically deliver imaging and therapeutic transgenes to tumors in mice, rats, and dogs while sparing the normal organs. This chapter reviews some gene transfer strategies and the potential of the vascular-targeted AAVP vector for enhancing the effectiveness of existing systemic gene delivery and genetic-imaging technologies. Copyright (c) 2010 Elsevier Inc. All rights reserved.

  4. Gene targeting in embryonic stem cells, II: conditional technologies

    USDA-ARS?s Scientific Manuscript database

    Genome modification via transgenesis has allowed researchers to link genotype and phenotype as an alternative approach to the characterization of random mutations through evolution. The synergy of technologies from the fields of embryonic stem (ES) cells, gene knockouts, and protein-mediated recombi...

  5. Site-specific selfish genes as tools for the control and genetic engineering of natural populations.

    PubMed

    Burt, Austin

    2003-05-07

    Site-specific selfish genes exploit host functions to copy themselves into a defined target DNA sequence, and include homing endonuclease genes, group II introns and some LINE-like transposable elements. If such genes can be engineered to target new host sequences, then they can be used to manipulate natural populations, even if the number of individuals released is a small fraction of the entire population. For example, a genetic load sufficient to eradicate a population can be imposed in fewer than 20 generations, if the target is an essential host gene, the knockout is recessive and the selfish gene has an appropriate promoter. There will be selection for resistance, but several strategies are available for reducing the likelihood of it evolving. These genes may also be used to genetically engineer natural populations, by means of population-wide gene knockouts, gene replacements and genetic transformations. By targeting sex-linked loci just prior to meiosis one may skew the population sex ratio, and by changing the promoter one may limit the spread of the gene to neighbouring populations. The proposed constructs are evolutionarily stable in the face of the mutations most likely to arise during their spread, and strategies are also available for reversing the manipulations.

  6. Genetic modification of adeno-associated viral vector type 2 capsid enhances gene transfer efficiency in polarized human airway epithelial cells.

    PubMed

    White, April F; Mazur, Marina; Sorscher, Eric J; Zinn, Kurt R; Ponnazhagan, Selvarangan

    2008-12-01

    Cystic fibrosis (CF) is a common genetic disease characterized by defects in the expression of the CF transmembrane conductance regulator (CFTR) gene. Gene therapy offers better hope for the treatment of CF. Adeno-associated viral (AAV) vectors are capable of stable expression with low immunogenicity. Despite their potential in CF gene therapy, gene transfer efficiency by AAV is limited because of pathophysiological barriers in these patients. Although a few AAV serotypes have shown better transduction compared with the AAV2-based vectors, gene transfer efficiency in human airway epithelium has still not reached therapeutic levels. To engineer better AAV vectors for enhanced gene delivery in human airway epithelium, we developed and characterized mutant AAV vectors by genetic capsid modification, modeling the well-characterized AAV2 serotype. We genetically incorporated putative high-affinity peptide ligands to human airway epithelium on the GH loop region of AAV2 capsid protein. Six independent mutant AAV were constructed, containing peptide ligands previously reported to bind with high affinity for known and unknown receptors on human airway epithelial cells. The vectors were tested on nonairway cells and nonpolarized and polarized human airway epithelial cells for enhanced infectivity. One of the mutant vectors, with the peptide sequence THALWHT, not only showed the highest transduction in undifferentiated human airway epithelial cells but also indicated significant transduction in polarized cells. Interestingly, this modified vector was also able to infect cells independently of the heparan sulfate proteoglycan receptor. Incorporation of this ligand on other AAV serotypes, which have shown improved gene transfer efficiency in the human airway epithelium, may enhance the application of AAV vectors in CF gene therapy.

  7. Sleeping Beauty-baculovirus hybrid vectors for long-term gene expression in the eye.

    PubMed

    Turunen, Tytteli Anni Kaarina; Laakkonen, Johanna Päivikki; Alasaarela, Laura; Airenne, Kari Juhani; Ylä-Herttuala, Seppo

    2014-01-01

    A baculovirus vector is capable of efficiently transducing many nondiving and diving cell types. However, the potential of baculovirus is restricted for many gene delivery applications as a result of the transient gene expression that it mediates. The plasmid-based Sleeping Beauty (SB) transposon system integrates transgenes into target cell genome efficiently with a genomic integration pattern that is generally considered safer than the integration of many other integrating vectors; yet efficient delivery of therapeutic genes into cells of target tissues in vivo is a major challenge for nonviral gene therapy. In the present study, SB was introduced into baculovirus to obtain novel hybrid vectors that would combine the best features of the two vector systems (i.e. effective gene delivery and efficient integration into the genome), thus circumventing the major limitations of these vectors. We constructed and optimized SB-baculovirus hybrid vectors that bear either SB100x transposase or SB transposon in the forward or reverse orientations with respect to the viral backbone The functionality of the novel hybrid vectors was investigated in cell cultures and in a proof-of-concept study in the mouse eye. The hybrid vectors showed high and sustained transgene expression that remained stable and demonstrated no signs of decline during the 2 months follow-up in vitro. These results were verified in the mouse eye where persistent transgene expression was detected two months after intravitreal injection. Our results confirm that (i) SB-baculovirus hybrid vectors mediate long-term gene expression in vitro and in vivo, and (ii) the hybrid vectors are potential new tools for the treatment of ocular diseases. Copyright © 2014 John Wiley & Sons, Ltd.

  8. Developing a Mouse Model of Sensory and Cognitive Deficits for Multiple Sclerosis

    DTIC Science & Technology

    2012-07-01

    ABRs and otoacoustic emissions. More sophisticates measures, such as neural processing of binaural responses are typically performed in rats, guinea...ears we are able to calculate the binaural component of the EEGs for comparison of wild type and Claudin 11 knockout responses. We are awaiting the...knockout of the Claudin 11 gene. 2. Development of a novel anesthesia protocol to measure binaural auditory signals in the superior olivary complex of

  9. Targeted adenoviral vectors

    NASA Astrophysics Data System (ADS)

    Douglas, Joanne T.

    The practical implementation of gene therapy in the clinical setting mandates gene delivery vehicles, or vectors, capable of efficient gene delivery selectively to the target disease cells. The utility of adenoviral vectors for gene therapy is restricted by their dependence on the native adenoviral primary cellular receptor for cell entry. Therefore, a number of strategies have been developed to allow CAR-independent infection of specific cell types, including the use of bispecific conjugates and genetic modifications to the adenoviral capsid proteins, in particular the fibre protein. These targeted adenoviral vectors have demonstrated efficient gene transfer in vitro , correlating with a therapeutic benefit in preclinical animal models. Such vectors are predicted to possess enhanced efficacy in human clinical studies, although anatomical barriers to their use must be circumvented.

  10. The Function of Herpes Simplex Virus Genes: A Primer for Genetic Engineering of Novel Vectors

    NASA Astrophysics Data System (ADS)

    Roizman, Bernard

    1996-10-01

    Herpes simplex virus vectors are being developed for delivery and expression of human genes to the central nervous system, selective destruction of cancer cells, and as carriers for genes encoding antigens that induce protective immunity against infectious agents. Vectors constructed to meet these objectives must differ from wild-type virus with respect to host range, reactivation from latency, and expression of viral genes. The vectors currently being developed are (i) helper free amplicons, (ii) replication defective viruses, and (iii) genetically engineered replication competent viruses with restricted host range. Whereas the former two types of vectors require stable, continuous cell lines expressing viral genes for their replication, the replication competent viruses will replicate on approved primary human cell strains.

  11. CRISPR/Cas9-mediated gene knockout of NANOG and NANOGP8 decreases the malignant potential of prostate cancer cells.

    PubMed

    Kawamura, Norihiko; Nimura, Keisuke; Nagano, Hiromichi; Yamaguchi, Sohei; Nonomura, Norio; Kaneda, Yasufumi

    2015-09-08

    NANOG expression in prostate cancer is highly correlated with cancer stem cell characteristics and resistance to androgen deprivation. However, it is not clear whether NANOG or its pseudogenes contribute to the malignant potential of cancer. We established NANOG- and NANOGP8-knockout DU145 prostate cancer cell lines using the CRISPR/Cas9 system. Knockouts of NANOG and NANOGP8 significantly attenuated malignant potential, including sphere formation, anchorage-independent growth, migration capability, and drug resistance, compared to parental DU145 cells. NANOG and NANOGP8 knockout did not inhibit in vitro cell proliferation, but in vivo tumorigenic potential decreased significantly. These phenotypes were recovered in NANOG- and NANOGP8-rescued cell lines. These results indicate that NANOG and NANOGP8 proteins are expressed in prostate cancer cell lines, and NANOG and NANOGP8 equally contribute to the high malignant potential of prostate cancer.

  12. Immunization of knock-out α/β interferon receptor mice against lethal bluetongue infection with a BoHV-4-based vector expressing BTV-8 VP2 antigen.

    PubMed

    Franceschi, Valentina; Capocefalo, Antonio; Calvo-Pinilla, Eva; Redaelli, Marco; Mucignat-Caretta, Carla; Mertens, Peter; Ortego, Javier; Donofrio, Gaetano

    2011-04-05

    New effective tools for vaccine strategies are necessary to limit the spread of bluetongue, an insect-transmitted viral disease of domestic and wild ruminants. In the present study, BoHV-4-based vector cloned as a bacterial artificial chromosome (BAC) was engineered to express the bluetongue virus (BTV) immune-dominant glycoprotein VP2 provided of a heterologous signal peptide to its amino terminal and a trans-membrane domain to its carboxyl terminal (IgK-VP2gDtm), to allow the VP2 expression targeting to the cell membrane fraction. Based on adult α/β interferon receptor knockout (IFNAR(-/-)) mice, a newly generated bluetongue laboratory animal model, a pre-challenge experiment was performed to test BoHV-4 safety on such immune-compromised animal. BoHV-4 infected IFNAR(-/-) mice did not show clinical signs even following the inoculation of BoHV-4 intra-cerebrally, although many areas of the brain got transduced. IFNAR(-/-) mice intraperitoneally inoculated twice with BoHV-4-A-IgK-VP2gDtm at different time points developed serum neutralizing antibodies against BTV and showed a strongly reduced viremia and a longer survival time when challenged with a lethal dose of BTV-8. The data acquired in this pilot study validate BoHV-4-based vector as a safe and effective heterologous antigen carrier/producer for the formulation of enhanced recombinant immunogens for the vaccination against lethal bluetongue. Copyright © 2011 Elsevier Ltd. All rights reserved.

  13. Enhanced hexose fermentation by Saccharomyces cerevisiae through integration of stoichiometric modeling and genetic screening.

    PubMed

    Quarterman, Josh; Kim, Soo Rin; Kim, Pan-Jun; Jin, Yong-Su

    2015-01-20

    In order to determine beneficial gene deletions for ethanol production by the yeast Saccharomyces cerevisiae, we performed an in silico gene deletion experiment based on a genome-scale metabolic model. Genes coding for two oxidative phosphorylation reactions (cytochrome c oxidase and ubiquinol cytochrome c reductase) were identified by the model-based simulation as potential deletion targets for enhancing ethanol production and maintaining acceptable overall growth rate in oxygen-limited conditions. Since the two target enzymes are composed of multiple subunits, we conducted a genetic screening study to evaluate the in silico results and compare the effect of deleting various portions of the respiratory enzyme complexes. Over two-thirds of the knockout mutants identified by the in silico study did exhibit experimental behavior in qualitative agreement with model predictions, but the exceptions illustrate the limitation of using a purely stoichiometric model-based approach. Furthermore, there was a substantial quantitative variation in phenotype among the various respiration-deficient mutants that were screened in this study, and three genes encoding respiratory enzyme subunits were identified as the best knockout targets for improving hexose fermentation in microaerobic conditions. Specifically, deletion of either COX9 or QCR9 resulted in higher ethanol production rates than the parental strain by 37% and 27%, respectively, with slight growth disadvantages. Also, deletion of QCR6 led to improved ethanol production rate by 24% with no growth disadvantage. The beneficial effects of these gene deletions were consistently demonstrated in different strain backgrounds and with four common hexoses. The combination of stoichiometric modeling and genetic screening using a systematic knockout collection was useful for narrowing a large set of gene targets and identifying targets of interest. Copyright © 2014 Elsevier B.V. All rights reserved.

  14. Urea transporter knockout mice and their renal phenotypes.

    PubMed

    Fenton, Robert A; Yang, Baoxue

    2014-01-01

    Urea transporter gene knockout mice have been created for the study of the urine-concentrating mechanism. The major findings in studies of the renal phenotype of these mice are as follows: (1) Urea accumulation in the inner medullary interstitium is dependent on intrarenal urea recycling mediated by urea transporters; (2) urea transporters are essential for preventing urea-induced osmotic diuresis and thus for water conservation; (3) NaCl concentration in the inner medullary interstitium is not significantly affected by the absence of IMCD, descending limb of Henle and descending vasa recta urea transporters. Studies in urea transporter knockout mouse models have highlighted the essential role of urea for producing maximally concentrated urine.

  15. Gene delivery with viral vectors for cerebrovascular diseases

    PubMed Central

    Gan, Yu; Jing, Zheng; Stetler, R. Anne; Cao, Guodong

    2017-01-01

    Recent achievements in the understanding of molecular events involved in the pathogenesis of central nervous system (CNS) injury have made gene transfer a promising approach for various neurological disorders, including cerebrovascular diseases. However, special obstacles, including the post-mitotic nature of neurons and the blood-brain barrier (BBB), constitute key challenges for gene delivery to the CNS. Despite the various limitations in current gene delivery systems, a spectrum of viral vectors has been successfully used to deliver genes to the CNS. Furthermore, recent advancements in vector engineering have improved the safety and delivery of viral vectors. Numerous viral vector-based clinical trials for neurological disorders have been initiated. This review will summarize the current implementation of viral gene delivery in the context of cerebrovascular diseases including ischemic stroke, hemorrhagic stroke and subarachnoid hemorrhage (SAH). In particular, we will discuss the potentially feasible ways in which viral vectors can be manipulated and exploited for use in neural delivery and therapy. PMID:23276981

  16. Mitochondrial pyruvate carrier function determines cell stemness and metabolic reprogramming in cancer cells

    PubMed Central

    Li, Xiaoran; Kan, Quancheng; Fan, Zhirui; Li, Yaqing; Ji, Yasai; Zhao, Jing; Zhang, Mingzhi; Grigalavicius, Mantas; Berge, Viktor; Goscinski, Mariusz Adam; M. Nesland, Jahn; Suo, Zhenhe

    2017-01-01

    One of the remarkable features of cancer cells is aerobic glycolysis, a phenomenon known as the “Warburg Effect”, in which cells rely preferentially on glycolysis instead of oxidative phosphorylation (OXPHOS) as the main energy source even in the presence of high oxygen tension. Cells with dysfunctional mitochondria are unable to generate sufficient ATP from mitochondrial OXPHOS, and then are forced to rely on glycolysis for ATP generation. Here we report our results in a prostate cancer cell line in which the mitochondrial pyruvate carrier 1 (MPC1) gene was knockout. It was discovered that the MPC1 gene knockout cells revealed a metabolism reprogramming to aerobic glycolysis with reduced ATP production, and the cells became more migratory and resistant to both chemotherapy and radiotherapy. In addition, the MPC1 knockout cells expressed significantly higher levels of the stemness markers Nanog, Hif1α, Notch1, CD44 and ALDH. To further verify the correlation of MPC gene function and cell stemness/metabolic reprogramming, MPC inhibitor UK5099 was applied in two ovarian cancer cell lines and similar results were obtained. Taken together, our results reveal that functional MPC may determine the fate of metabolic program and the stemness status of cancer cells in vitro. PMID:28624784

  17. Alternative polyadenylation drives genome-to-phenome information detours in the AMPKα1 and AMPKα2 knockout mice.

    PubMed

    Zhang, Shuwen; Zhang, Yangzi; Zhou, Xiang; Fu, Xing; Michal, Jennifer J; Ji, Guoli; Du, Min; Davis, Jon F; Jiang, Zhihua

    2018-04-24

    Currently available mouse knockout (KO) lines remain largely uncharacterized for genome-to-phenome (G2P) information flows. Here we test our hypothesis that altered myogenesis seen in AMPKα1- and AMPKα2-KO mice is caused by use of alternative polyadenylation sites (APSs). AMPKα1 and AMPKα2 are two α subunits of adenosine monophosphate-activated protein kinase (AMPK), which serves as a cellular sensor in regulation of many biological events. A total of 56,483 APSs were derived from gastrocnemius muscles. The differentially expressed APSs (DE-APSs) that were down-regulated tended to be distal. The DE-APSs that were related to reduced and increased muscle mass were down-regulated in AMPKα1-KO mice, but up-regulated in AMPKα2-KO mice, respectively. Five genes: Car3 (carbonic anhydrase 3), Mylk4 (myosin light chain kinase family, member 4), Neb (nebulin), Obscn (obscurin) and Pfkm (phosphofructokinase, muscle) utilized different APSs with potentially antagonistic effects on muscle function. Overall, gene knockout triggers genome plasticity via use of APSs, completing the G2P processes. However, gene-based analysis failed to reach such a resolution. Therefore, we propose that alternative transcripts are minimal functional units in genomes and the traditional central dogma concept should be now examined under a systems biology approach.

  18. Vector platforms for gene therapy of inherited retinopathies

    PubMed Central

    Trapani, Ivana; Puppo, Agostina; Auricchio, Alberto

    2014-01-01

    Inherited retinopathies (IR) are common untreatable blinding conditions. Most of them are inherited as monogenic disorders, due to mutations in genes expressed in retinal photoreceptors (PR) and in retinal pigment epithelium (RPE). The retina’s compatibility with gene transfer has made transduction of different retinal cell layers in small and large animal models via viral and non-viral vectors possible. The ongoing identification of novel viruses as well as modifications of existing ones based either on rational design or directed evolution have generated vector variants with improved transduction properties. Dozens of promising proofs of concept have been obtained in IR animal models with both viral and non-viral vectors, and some of them have been relayed to clinical trials. To date, recombinant vectors based on the adeno-associated virus (AAV) represent the most promising tool for retinal gene therapy, given their ability to efficiently deliver therapeutic genes to both PR and RPE and their excellent safety and efficacy profiles in humans. However, AAVs’ limited cargo capacity has prevented application of the viral vector to treatments requiring transfer of genes with a coding sequence larger than 5 kb. Vectors with larger capacity, i.e. nanoparticles, adenoviral and lentiviral vectors are being exploited for gene transfer to the retina in animal models and, more recently, in humans. This review focuses on the available platforms for retinal gene therapy to fight inherited blindness, highlights their main strengths and examines the efforts to overcome some of their limitations. PMID:25124745

  19. Retroviral vectors encoding ADA regulatory locus control region provide enhanced T-cell-specific transgene expression

    PubMed Central

    2009-01-01

    Background Murine retroviral vectors have been used in several hundred gene therapy clinical trials, but have fallen out of favor for a number of reasons. One issue is that gene expression from viral or internal promoters is highly variable and essentially unregulated. Moreover, with retroviral vectors, gene expression is usually silenced over time. Mammalian genes, in contrast, are characterized by highly regulated, precise levels of expression in both a temporal and a cell-specific manner. To ascertain if recapitulation of endogenous adenosine deaminase (ADA) expression can be achieved in a vector construct we created a new series of Moloney murine leukemia virus (MuLV) based retroviral vector that carry human regulatory elements including combinations of the ADA promoter, the ADA locus control region (LCR), ADA introns and human polyadenylation sequences in a self-inactivating vector backbone. Methods A MuLV-based retroviral vector with a self-inactivating (SIN) backbone, the phosphoglycerate kinase promoter (PGK) and the enhanced green fluorescent protein (eGFP), as a reporter gene, was generated. Subsequent vectors were constructed from this basic vector by deletion or addition of certain elements. The added elements that were assessed are the human ADA promoter, human ADA locus control region (LCR), introns 7, 8, and 11 from the human ADA gene, and human growth hormone polyadenylation signal. Retroviral vector particles were produced by transient three-plasmid transfection of 293T cells. Retroviral vectors encoding eGFP were titered by transducing 293A cells, and then the proportion of GFP-positive cells was determined using fluorescence-activated cell sorting (FACS). Non T-cell and T-cell lines were transduced at a multiplicity of infection (MOI) of 0.1 and the yield of eGFP transgene expression was evaluated by FACS analysis using mean fluorescent intensity (MFI) detection. Results Vectors that contained the ADA LCR were preferentially expressed in T-cell lines. Further improvements in T-cell specific gene expression were observed with the incorporation of additional cis-regulatory elements, such as a human polyadenylation signal and intron 7 from the human ADA gene. Conclusion These studies suggest that the combination of an authentically regulated ADA gene in a murine retroviral vector, together with additional locus-specific regulatory refinements, will yield a vector with a safer profile and greater efficacy in terms of high-level, therapeutic, regulated gene expression for the treatment of ADA-deficient severe combined immunodeficiency. PMID:20042112

  20. Intracellular trafficking of hybrid gene delivery vectors.

    PubMed

    Keswani, Rahul K; Lazebnik, Mihael; Pack, Daniel W

    2015-06-10

    Viral and non-viral gene delivery vectors are in development for human gene therapy, but both exhibit disadvantages such as inadequate efficiency, lack of cell-specific targeting or safety concerns. We have recently reported the design of hybrid delivery vectors combining retrovirus-like particles with synthetic polymers or lipids that are efficient, provide sustained gene expression and are more stable compared to native retroviruses. To guide further development of this promising class of gene delivery vectors, we have investigated their mechanisms of intracellular trafficking. Moloney murine leukemia virus-like particles (M-VLPs) were complexed with chitosan (Chi) or liposomes (Lip) comprising DOTAP, DOPE and cholesterol to form the hybrid vectors (Chi/M-VLPs and Lip/M-VLPs, respectively). Transfection efficiency and cellular internalization of the vectors were quantified in the presence of a panel of inhibitors of various endocytic pathways. Intracellular transport and trafficking kinetics of the hybrid vectors were dependent on the synthetic component and used a combination of clathrin- and caveolar-dependent endocytosis and macropinocytosis. Chi/M-VLPs were slower to transfect compared to Lip/M-VLPs due to the delayed detachment of the synthetic component. The synthetic component of hybrid gene delivery vectors plays a significant role in their cellular interactions and processing and is a key parameter for the design of more efficient gene delivery vehicles. Copyright © 2015 Elsevier B.V. All rights reserved.

  1. Development of novel types of plastid transformation vectors and evaluation of factors controlling expression.

    PubMed

    Herz, Stefan; Füssl, Monika; Steiger, Sandra; Koop, Hans-Ulrich

    2005-12-01

    Two new vector types for plastid transformation were developed and uidA reporter gene expression was compared to standard transformation vectors. The first vector type does not contain any plastid promoter, instead it relies on extension of existing plastid operons and was therefore named "operon-extension" vector. When a strongly expressed plastid operon like psbA was extended by the reporter gene with this vector type, the expression level was superior to that of a standard vector under control of the 16S rRNA promoter. Different insertion sites, promoters and 5'-UTRs were analysed for their effect on reporter gene expression with standard and operon-extension vectors. The 5'-UTR of phage 7 gene 10 in combination with a modified N-terminus was found to yield the highest expression levels. Expression levels were also strongly dependent on external factors like plant or leaf age or light intensity. In the second vector type, named "split" plastid transformation vector, modules of the expression cassette were distributed on two separate vectors. Upon co-transformation of plastids with these vectors, the complete expression cassette became inserted into the plastome. This result can be explained by successive co-integration of the split vectors and final loop-out recombination of the duplicated sequences. The split vector concept was validated with different vector pairs.

  2. TimesVector: a vectorized clustering approach to the analysis of time series transcriptome data from multiple phenotypes.

    PubMed

    Jung, Inuk; Jo, Kyuri; Kang, Hyejin; Ahn, Hongryul; Yu, Youngjae; Kim, Sun

    2017-12-01

    Identifying biologically meaningful gene expression patterns from time series gene expression data is important to understand the underlying biological mechanisms. To identify significantly perturbed gene sets between different phenotypes, analysis of time series transcriptome data requires consideration of time and sample dimensions. Thus, the analysis of such time series data seeks to search gene sets that exhibit similar or different expression patterns between two or more sample conditions, constituting the three-dimensional data, i.e. gene-time-condition. Computational complexity for analyzing such data is very high, compared to the already difficult NP-hard two dimensional biclustering algorithms. Because of this challenge, traditional time series clustering algorithms are designed to capture co-expressed genes with similar expression pattern in two sample conditions. We present a triclustering algorithm, TimesVector, specifically designed for clustering three-dimensional time series data to capture distinctively similar or different gene expression patterns between two or more sample conditions. TimesVector identifies clusters with distinctive expression patterns in three steps: (i) dimension reduction and clustering of time-condition concatenated vectors, (ii) post-processing clusters for detecting similar and distinct expression patterns and (iii) rescuing genes from unclassified clusters. Using four sets of time series gene expression data, generated by both microarray and high throughput sequencing platforms, we demonstrated that TimesVector successfully detected biologically meaningful clusters of high quality. TimesVector improved the clustering quality compared to existing triclustering tools and only TimesVector detected clusters with differential expression patterns across conditions successfully. The TimesVector software is available at http://biohealth.snu.ac.kr/software/TimesVector/. sunkim.bioinfo@snu.ac.kr. Supplementary data are available at Bioinformatics online. © The Author 2017. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com

  3. Syngeneic AAV pseudo-particles potentiate gene transduction of AAV vectors

    USDA-ARS?s Scientific Manuscript database

    Gene delivery vectors based on adeno-associated virus (AAV) have emerged as safe and efficient therapeutic platform for numerous diseases. Excessive empty particles were generated as impurities during AAV vector production, but their effects on clinical outcome of AAV gene therapy are unclear. Here,...

  4. A multicolor panel of novel lentiviral "gene ontology" (LeGO) vectors for functional gene analysis.

    PubMed

    Weber, Kristoffer; Bartsch, Udo; Stocking, Carol; Fehse, Boris

    2008-04-01

    Functional gene analysis requires the possibility of overexpression, as well as downregulation of one, or ideally several, potentially interacting genes. Lentiviral vectors are well suited for this purpose as they ensure stable expression of complementary DNAs (cDNAs), as well as short-hairpin RNAs (shRNAs), and can efficiently transduce a wide spectrum of cell targets when packaged within the coat proteins of other viruses. Here we introduce a multicolor panel of novel lentiviral "gene ontology" (LeGO) vectors designed according to the "building blocks" principle. Using a wide spectrum of different fluorescent markers, including drug-selectable enhanced green fluorescent protein (eGFP)- and dTomato-blasticidin-S resistance fusion proteins, LeGO vectors allow simultaneous analysis of multiple genes and shRNAs of interest within single, easily identifiable cells. Furthermore, each functional module is flanked by unique cloning sites, ensuring flexibility and individual optimization. The efficacy of these vectors for analyzing multiple genes in a single cell was demonstrated in several different cell types, including hematopoietic, endothelial, and neural stem and progenitor cells, as well as hepatocytes. LeGO vectors thus represent a valuable tool for investigating gene networks using conditional ectopic expression and knock-down approaches simultaneously.

  5. Genetic Locus for Streptolysin S Production by Group A Streptococcus

    PubMed Central

    Nizet, Victor; Beall, Bernard; Bast, Darrin J.; Datta, Vivekananda; Kilburn, Laurie; Low, Donald E.; De Azavedo, Joyce C. S.

    2000-01-01

    Group A streptococcus (GAS) is an important human pathogen that causes pharyngitis and invasive infections, including necrotizing fasciitis. Streptolysin S (SLS) is the cytolytic factor that creates the zone of beta-hemolysis surrounding GAS colonies grown on blood agar. We recently reported the discovery of a potential genetic determinant involved in SLS production, sagA, encoding a small peptide of 53 amino acids (S. D. Betschel, S. M. Borgia, N. L. Barg, D. E. Low, and J. C. De Azavedo, Infect. Immun. 66:1671–1679, 1998). Using transposon mutagenesis, chromosomal walking steps, and data from the GAS genome sequencing project (www.genome.ou.edu/strep.html), we have now identified a contiguous nine-gene locus (sagA to sagI) involved in SLS production. The sag locus is conserved among GAS strains regardless of M protein type. Targeted plasmid integrational mutagenesis of each gene in the sag operon resulted in an SLS-negative phenotype. Targeted integrations (i) upstream of the sagA promoter and (ii) downstream of a terminator sequence after sagI did not affect SLS production, establishing the functional boundaries of the operon. A rho-independent terminator sequence between sagA and sagB appears to regulate the amount of sagA transcript produced versus transcript for the entire operon. Reintroduction of the nine-gene sag locus on a plasmid vector restored SLS activity to the nonhemolytic sagA knockout mutant. Finally, heterologous expression of the intact sag operon conferred the SLS beta-hemolytic phenotype to the nonhemolytic Lactococcus lactis. We conclude that gene products of the GAS sag operon are both necessary and sufficient for SLS production. Sequence homologies of sag operon gene products suggest that SLS is related to the bacteriocin family of microbial toxins. PMID:10858242

  6. Efficient CRISPR/Cas9-based genome editing in carrot cells.

    PubMed

    Klimek-Chodacka, Magdalena; Oleszkiewicz, Tomasz; Lowder, Levi G; Qi, Yiping; Baranski, Rafal

    2018-04-01

    The first report presenting successful and efficient carrot genome editing using CRISPR/Cas9 system. Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR)/CRISPR-associated (Cas9) is a powerful genome editing tool that has been widely adopted in model organisms recently, but has not been used in carrot-a model species for in vitro culture studies and an important health-promoting crop grown worldwide. In this study, for the first time, we report application of the CRISPR/Cas9 system for efficient targeted mutagenesis of the carrot genome. Multiplexing CRISPR/Cas9 vectors expressing two single-guide RNA (gRNAs) targeting the carrot flavanone-3-hydroxylase (F3H) gene were tested for blockage of the anthocyanin biosynthesis in a model purple-colored callus using Agrobacterium-mediated genetic transformation. This approach allowed fast and visual comparison of three codon-optimized Cas9 genes and revealed that the most efficient one in generating F3H mutants was the Arabidopsis codon-optimized AteCas9 gene with up to 90% efficiency. Knockout of F3H gene resulted in the discoloration of calli, validating the functional role of this gene in the anthocyanin biosynthesis in carrot as well as providing a visual marker for screening successfully edited events. Most resulting mutations were small Indels, but long chromosome fragment deletions of 116-119 nt were also generated with simultaneous cleavage mediated by two gRNAs. The results demonstrate successful site-directed mutagenesis in carrot with CRISPR/Cas9 and the usefulness of a model callus culture to validate genome editing systems. Given that the carrot genome has been sequenced recently, our timely study sheds light on the promising application of genome editing tools for boosting basic and translational research in this important vegetable crop.

  7. Overexpressing the Multiple-Stress Responsive Gene At1g74450 Reduces Plant Height and Male Fertility in Arabidopsis thaliana

    PubMed Central

    Visscher, Anne M.; Belfield, Eric J.; Vlad, Daniela; Irani, Niloufer; Moore, Ian; Harberd, Nicholas P.

    2015-01-01

    A subset of genes in Arabidopsis thaliana is known to be up-regulated in response to a wide range of different environmental stress factors. However, not all of these genes are characterized as yet with respect to their functions. In this study, we used transgenic knockout, overexpression and reporter gene approaches to try to elucidate the biological roles of five unknown multiple-stress responsive genes in Arabidopsis. The selected genes have the following locus identifiers: At1g18740, At1g74450, At4g27652, At4g29780 and At5g12010. Firstly, T-DNA insertion knockout lines were identified for each locus and screened for altered phenotypes. None of the lines were found to be visually different from wildtype Col-0. Secondly, 35S-driven overexpression lines were generated for each open reading frame. Analysis of these transgenic lines showed altered phenotypes for lines overexpressing the At1g74450 ORF. Plants overexpressing the multiple-stress responsive gene At1g74450 are stunted in height and have reduced male fertility. Alexander staining of anthers from flowers at developmental stage 12–13 showed either an absence or a reduction in viable pollen compared to wildtype Col-0 and At1g74450 knockout lines. Interestingly, the effects of stress on crop productivity are most severe at developmental stages such as male gametophyte development. However, the molecular factors and regulatory networks underlying environmental stress-induced male gametophytic alterations are still largely unknown. Our results indicate that the At1g74450 gene provides a potential link between multiple environmental stresses, plant height and pollen development. In addition, ruthenium red staining analysis showed that At1g74450 may affect the composition of the inner seed coat mucilage layer. Finally, C-terminal GFP fusion proteins for At1g74450 were shown to localise to the cytosol. PMID:26485022

  8. Inference of gene regulatory networks from genome-wide knockout fitness data

    PubMed Central

    Wang, Liming; Wang, Xiaodong; Arkin, Adam P.; Samoilov, Michael S.

    2013-01-01

    Motivation: Genome-wide fitness is an emerging type of high-throughput biological data generated for individual organisms by creating libraries of knockouts, subjecting them to broad ranges of environmental conditions, and measuring the resulting clone-specific fitnesses. Since fitness is an organism-scale measure of gene regulatory network behaviour, it may offer certain advantages when insights into such phenotypical and functional features are of primary interest over individual gene expression. Previous works have shown that genome-wide fitness data can be used to uncover novel gene regulatory interactions, when compared with results of more conventional gene expression analysis. Yet, to date, few algorithms have been proposed for systematically using genome-wide mutant fitness data for gene regulatory network inference. Results: In this article, we describe a model and propose an inference algorithm for using fitness data from knockout libraries to identify underlying gene regulatory networks. Unlike most prior methods, the presented approach captures not only structural, but also dynamical and non-linear nature of biomolecular systems involved. A state–space model with non-linear basis is used for dynamically describing gene regulatory networks. Network structure is then elucidated by estimating unknown model parameters. Unscented Kalman filter is used to cope with the non-linearities introduced in the model, which also enables the algorithm to run in on-line mode for practical use. Here, we demonstrate that the algorithm provides satisfying results for both synthetic data as well as empirical measurements of GAL network in yeast Saccharomyces cerevisiae and TyrR–LiuR network in bacteria Shewanella oneidensis. Availability: MATLAB code and datasets are available to download at http://www.duke.edu/∼lw174/Fitness.zip and http://genomics.lbl.gov/supplemental/fitness-bioinf/ Contact: wangx@ee.columbia.edu or mssamoilov@lbl.gov Supplementary information: Supplementary data are available at Bioinformatics online PMID:23271269

  9. Altering the selection capabilities of common cloning vectors via restriction enzyme mediated gene disruption

    PubMed Central

    2013-01-01

    Background The cloning of gene sequences forms the basis for many molecular biological studies. One important step in the cloning process is the isolation of bacterial transformants carrying vector DNA. This involves a vector-encoded selectable marker gene, which in most cases, confers resistance to an antibiotic. However, there are a number of circumstances in which a different selectable marker is required or may be preferable. Such situations can include restrictions to host strain choice, two phase cloning experiments and mutagenesis experiments, issues that result in additional unnecessary cloning steps, in which the DNA needs to be subcloned into a vector with a suitable selectable marker. Results We have used restriction enzyme mediated gene disruption to modify the selectable marker gene of a given vector by cloning a different selectable marker gene into the original marker present in that vector. Cloning a new selectable marker into a pre-existing marker was found to change the selection phenotype conferred by that vector, which we were able to demonstrate using multiple commonly used vectors and multiple resistance markers. This methodology was also successfully applied not only to cloning vectors, but also to expression vectors while keeping the expression characteristics of the vector unaltered. Conclusions Changing the selectable marker of a given vector has a number of advantages and applications. This rapid and efficient method could be used for co-expression of recombinant proteins, optimisation of two phase cloning procedures, as well as multiple genetic manipulations within the same host strain without the need to remove a pre-existing selectable marker in a previously genetically modified strain. PMID:23497512

  10. Assessing the potential for AAV vector genotoxicity in a murine model

    PubMed Central

    Li, Hojun; Malani, Nirav; Hamilton, Shari R.; Schlachterman, Alexander; Bussadori, Giulio; Edmonson, Shyrie E.; Shah, Rachel; Arruda, Valder R.; Mingozzi, Federico; Fraser Wright, J.; Bushman, Frederic D.

    2011-01-01

    Gene transfer using adeno-associated virus (AAV) vectors has great potential for treating human disease. Recently, questions have arisen about the safety of AAV vectors, specifically, whether integration of vector DNA in transduced cell genomes promotes tumor formation. This study addresses these questions with high-dose liver-directed AAV-mediated gene transfer in the adult mouse as a model (80 AAV-injected mice and 52 controls). After 18 months of follow-up, AAV-injected mice did not show a significantly higher rate of hepatocellular carcinoma compared with controls. Tumors in mice treated with AAV vectors did not have significantly different amounts of vector DNA compared with adjacent normal tissue. A novel high-throughput method for identifying AAV vector integration sites was developed and used to clone 1029 integrants. Integration patterns in tumor tissue and adjacent normal tissue were similar to each other, showing preferences for active genes, cytosine-phosphate-guanosine islands, and guanosine/cysteine-rich regions. Gene expression data showed that genes near integration sites did not show significant changes in expression patterns compared with genes more distal to integration sites. No integration events were identified as causing increased oncogene expression. Thus, we did not find evidence that AAV vectors cause insertional activation of oncogenes and subsequent tumor formation. PMID:21106988

  11. Extended Minus-Strand DNA as Template for R-U5-Mediated Second-Strand Transfer in Recombinational Rescue of Primer Binding Site-Modified Retroviral Vectors

    PubMed Central

    Mikkelsen, Jacob Giehm; Lund, Anders H.; Dybkær, Karen; Duch, Mogens; Pedersen, Finn Skou

    1998-01-01

    We have previously demonstrated recombinational rescue of primer binding site (PBS)-impaired Akv murine leukemia virus-based vectors involving initial priming on endogenous viral sequences and template switching during cDNA synthesis to obtain PBS complementarity in second-strand transfer of reverse transcription (Mikkelsen et al., J. Virol. 70:1439–1447, 1996). By use of the same forced recombination system, we have now found recombinant proviruses of different structures, suggesting that PBS knockout vectors may be rescued through initial priming on endogenous virus RNA, read-through of the mutated PBS during minus-strand synthesis, and subsequent second-strand transfer mediated by the R-U5 complementarity of the plus strand and the extended minus-strand DNA acceptor template. Mechanisms for R-U5-mediated second-strand transfer and its possible role in retrovirus replication and evolution are discussed. PMID:9499117

  12. Evolving lessons on nanomaterial-coated viral vectors for local and systemic gene therapy

    PubMed Central

    Kasala, Dayananda; Yoon, A-Rum; Hong, Jinwoo; Kim, Sung Wan; Yun, Chae-Ok

    2016-01-01

    Viral vectors are promising gene carriers for cancer therapy. However, virus-mediated gene therapies have demonstrated insufficient therapeutic efficacy in clinical trials due to rapid dissemination to nontarget tissues and to the immunogenicity of viral vectors, resulting in poor retention at the disease locus and induction of adverse inflammatory responses in patients. Further, the limited tropism of viral vectors prevents efficient gene delivery to target tissues. In this regard, modification of the viral surface with nanomaterials is a promising strategy to augment vector accumulation at the target tissue, circumvent the host immune response, and avoid nonspecific interactions with the reticuloendothelial system or serum complement. In the present review, we discuss various chemical modification strategies to enhance the therapeutic efficacy of viral vectors delivered either locally or systemically. We conclude by highlighting the salient features of various nanomaterial-coated viral vectors and their prospects and directions for future research. PMID:27348247

  13. Augmenting the Genetic Toolbox for Sulfolobus islandicus with a Stringent Positive Selectable Marker for Agmatine Prototrophy

    PubMed Central

    Cooper, Tara E.; Krause, David J.

    2013-01-01

    Sulfolobus species have become the model organisms for studying the unique biology of the crenarchaeal division of the archaeal domain. In particular, Sulfolobus islandicus provides a powerful opportunity to explore natural variation via experimental functional genomics. To support these efforts, we further expanded genetic tools for S. islandicus by developing a stringent positive selection for agmatine prototrophs in strains in which the argD gene, encoding arginine decarboxylase, has been deleted. Strains with deletions in argD were shown to be auxotrophic for agmatine even in nutrient-rich medium, but growth could be restored by either supplementation of exogenous agmatine or reintroduction of a functional copy of the argD gene from S. solfataricus P2 into the ΔargD host. Using this stringent selection, a robust targeted gene knockout system was established via an improved next generation of the MID (marker insertion and unmarked target gene deletion) method. Application of this novel system was validated by targeted knockout of the upsEF genes involved in UV-inducible cell aggregation formation. PMID:23835176

  14. Expression of interferon-induced antiviral genes is delayed in a STAT1 knockout mouse model of Crimean-Congo hemorrhagic fever.

    PubMed

    Bowick, Gavin C; Airo, Adriana M; Bente, Dennis A

    2012-06-19

    Crimean Congo hemorrhagic fever (CCHF) is a tick-borne hemorrhagic zoonosis associated with high mortality. Pathogenesis studies and the development of vaccines and antivirals against CCHF have been severely hampered by the lack of suitable animal model. We recently developed and characterized a mature mouse model for CCHF using mice carrying STAT1 knockout (KO). Given the importance of interferons in controlling viral infections, we investigated the expression of interferon pathway-associated genes in KO and wild-type (WT) mice challenged with CCHF virus. We expected that the absence of the STAT1 protein would result in minimal expression of IFN-related genes. Surprisingly, the KO mice showed high levels of IFN-stimulated gene expression, beginning on day 2 post-infection, while in WT mice challenged with virus the same genes were expressed at similar levels on day 1. We conclude that CCHF virus induces similar type I IFN responses in STAT1 KO and WT mice, but the delayed response in the KO mice permits rapid viral dissemination and fatal illness.

  15. Current status of non-viral gene therapy for CNS disorders

    PubMed Central

    Jayant, Rahul Dev; Sosa, Daniela; Kaushik, Ajeet; Atluri, Venkata; Vashist, Arti; Tomitaka, Asahi; Nair, Madhavan

    2017-01-01

    Introduction Viral and non-viral vectors have been used as methods of delivery in gene therapy for many CNS diseases. Currently, viral vectors such as adeno-associated viruses (AAV), retroviruses, lentiviruses, adenoviruses and herpes simplex viruses (HHV) are being used as successful vectors in gene therapy at clinical trial levels. However, many disadvantages have risen from their usage. Non-viral vectors like cationic polymers, cationic lipids, engineered polymers, nanoparticles, and naked DNA offer a much safer option and can therefore be explored for therapeutic purposes. Areas covered This review discusses different types of viral and non-viral vectors for gene therapy and explores clinical trials for CNS diseases that have used these types of vectors for gene delivery. Highlights include non-viral gene delivery and its challenges, possible strategies to improve transfection, regulatory issues concerning vector usage, and future prospects for clinical applications. Expert opinion Transfection efficiency of cationic lipids and polymers can be improved through manipulation of molecules used. Efficacy of cationic lipids is dependent on cationic charge, saturation levels, and stability of linkers. Factors determining efficacy of cationic polymers are total charge density, molecular weights, and complexity of molecule. All of the above mentioned parameters must be taken care for efficient gene delivery. PMID:27249310

  16. IFNAR2-dependent gene expression profile induced by IFN-α in Pteropus alecto bat cells and impact of IFNAR2 knockout on virus infection.

    PubMed

    Zhang, Qian; Zeng, Lei-Ping; Zhou, Peng; Irving, Aaron T; Li, Shang; Shi, Zheng-Li; Wang, Lin-Fa

    2017-01-01

    Bats are important reservoirs of many viruses, which are capable of infecting the host without inducing obvious clinical diseases. Interferon and the downstream interferon regulated genes (IRGs) are known to act as the first line of defense against viral infections. Little is known about the transcriptional profile of genes being induced by interferon in bats and their role in controlling virus infection. In this study, we constructed IFNAR2 knockout bat cell lines using CRISPR technology and further characterized gene expression profiles induced by the most abundant IFN-α (IFN-α3). Firstly, we demonstrated that the CRISPR/Cas9 system is applicable for bat cells as this represents the first CRIPSR knockout cell line for bats. Our results showed the pleiotropic effect of IFN-α3 on the bat kidney cell line, PaKiT03. As expected, we confirmed that IFNAR2 is indispensable for IFN-a signaling pathway and plays an important role in antiviral immunity. Unexpectedly, we also identified novel IFNAR2-dependent IRGs which are enriched in pathways related to cancer. To our knowledge, this seems to be bat-specific as no such observation has been reported for other mammalian species. This study expands our knowledge about bat immunology and the cell line established can provide a powerful tool for future study into virus-bat interaction and cancer biology.

  17. Effects of SIRT1 gene knock-out via activation of SREBP2 protein-mediated PI3K/AKT signaling on osteoarthritis in mice.

    PubMed

    Yu, Fei; Zeng, Hui; Lei, Ming; Xiao, De-Ming; Li, Wei; Yuan, Hao; Lin, Jian-Jing

    2016-10-01

    This study investigated the effects of SIRT1 gene knock-out on osteoarthritis in mice, and the possible roles of SREBP2 protein and the PI3K/AKT signaling pathway in the effects. Mice were randomly divided into a normal group and a SIRT1 gene knock-out group (6 mice in each group). In these groups, one side of the knee anterior cruciate ligament was traversed, and the ipsilateral medial meniscus was cut to establish an osteoarthritis model of knee joint. The countralateral synovial bursa was cut out, serving as controls. The knee joint specimens were then divided into four groups: SIRT1 +/+ control group (group A, n=6); SIRT1 +/+ osteoarthritis group (group B, n=6); SIRT1 -/- control group (group C, n=6); SIRT1 -/- osteoarthritis group (group D, n=6). HE staining, Masson staining, Safranin O-Fast Green staining and Van Gieson staining were used to observe the morphological changes in the articular cartilage of the knee. Immunohistochemical staining was employed to detect the expression of SIRT1, SREBP2, VEGF, AKT, HMGCR and type II collagen proteins. SA-β-gal staining was utilized to evaluate chondrocyte aging. The results showed clear knee joint cartilage destruction and degeneration in the SIRT1 -/- osteoarthritis group. The tidal line was twisted and displaced anteriorly. Type II collagen was destroyed and distributed unevenly. Compared with the SIRT1 +/+ osteoarthritis group and SIRT1 -/- control group, SIRT1 protein expression was not obviously changed in the SIRT1 -/- osteoarthritis group (P>0.05), while the expression levels of the SREBP2, VEGF and HMGCR proteins were significantly increased (P<0.05) and the levels of AKT and type II collagen proteins were significantly decreased (P<0.05). SIRT1 gene knock-out may aggravate cartilage degeneration in osteoarthritis by activating the SREBP2 protein-mediated PI3K/AKT signalling pathway, suggesting that SIRT1 gene may play a protective role against osteoarthritis.

  18. Hybrid biosynthetic gene therapy vector development and dual engineering capacity.

    PubMed

    Jones, Charles H; Ravikrishnan, Anitha; Chen, Mingfu; Reddinger, Ryan; Kamal Ahmadi, Mahmoud; Rane, Snehal; Hakansson, Anders P; Pfeifer, Blaine A

    2014-08-26

    Genetic vaccines offer a treatment opportunity based upon successful gene delivery to specific immune cell modulators. Driving the process is the vector chosen for gene cargo packaging and subsequent delivery to antigen-presenting cells (APCs) capable of triggering an immune cascade. As such, the delivery process must successfully navigate a series of requirements and obstacles associated with the chosen vector and target cell. In this work, we present the development and assessment of a hybrid gene delivery vector containing biological and biomaterial components. Each component was chosen to design and engineer gene delivery separately in a complimentary and fundamentally distinct fashion. A bacterial (Escherichia coli) inner core and a biomaterial [poly(beta-amino ester)]-coated outer surface allowed the simultaneous application of molecular biology and polymer chemistry to address barriers associated with APC gene delivery, which include cellular uptake and internalization, phagosomal escape, and intracellular cargo concentration. The approach combined and synergized normally disparate vector properties and tools, resulting in increased in vitro gene delivery beyond individual vector components or commercially available transfection agents. Furthermore, the hybrid device demonstrated a strong, efficient, and safe in vivo humoral immune response compared with traditional forms of antigen delivery. In summary, the flexibility, diversity, and potential of the hybrid design were developed and featured in this work as a platform for multivariate engineering at the vector and cellular scales for new applications in gene delivery immunotherapy.

  19. Construction and applications of exon-trapping gene-targeting vectors with a novel strategy for negative selection.

    PubMed

    Saito, Shinta; Ura, Kiyoe; Kodama, Miho; Adachi, Noritaka

    2015-06-30

    Targeted gene modification by homologous recombination provides a powerful tool for studying gene function in cells and animals. In higher eukaryotes, non-homologous integration of targeting vectors occurs several orders of magnitude more frequently than does targeted integration, making the gene-targeting technology highly inefficient. For this reason, negative-selection strategies have been employed to reduce the number of drug-resistant clones associated with non-homologous vector integration, particularly when artificial nucleases to introduce a DNA break at the target site are unavailable or undesirable. As such, an exon-trap strategy using a promoterless drug-resistance marker gene provides an effective way to counterselect non-homologous integrants. However, constructing exon-trapping targeting vectors has been a time-consuming and complicated process. By virtue of highly efficient att-mediated recombination, we successfully developed a simple and rapid method to construct plasmid-based vectors that allow for exon-trapping gene targeting. These exon-trap vectors were useful in obtaining correctly targeted clones in mouse embryonic stem cells and human HT1080 cells. Most importantly, with the use of a conditionally cytotoxic gene, we further developed a novel strategy for negative selection, thereby enhancing the efficiency of counterselection for non-homologous integration of exon-trap vectors. Our methods will greatly facilitate exon-trapping gene-targeting technologies in mammalian cells, particularly when combined with the novel negative selection strategy.

  20. The Ad5 [E1-, E2b-]-based vector: a new and versatile gene delivery platform

    NASA Astrophysics Data System (ADS)

    Jones, Frank R.; Gabitzsch, Elizabeth S.; Balint, Joseph P.

    2015-05-01

    Based upon advances in gene sequencing and construction, it is now possible to identify specific genes or sequences thereof for gene delivery applications. Recombinant adenovirus serotype-5 (Ad5) viral vectors have been utilized in the settings of gene therapy, vaccination, and immunotherapy but have encountered clinical challenges because they are recognized as foreign entities to the host. This recognition leads to an immunologic clearance of the vector that contains the inserted gene of interest and prevents effective immunization(s). We have reported on a new Ad5-based viral vector technology that can be utilized as an immunization modality to induce immune responses even in the presence of Ad5 vector immunity. We have reported successful immunization and immunotherapy results to infectious diseases and cancers. This improved recombinant viral platform (Ad5 [E1-, E2b-]) can now be utilized in the development of multiple vaccines and immunotherapies.

  1. Towards β-globin gene-targeting with integrase-defective lentiviral vectors.

    PubMed

    Inanlou, Davoud Nouri; Yakhchali, Bagher; Khanahmad, Hossein; Gardaneh, Mossa; Movassagh, Hesam; Cohan, Reza Ahangari; Ardestani, Mehdi Shafiee; Mahdian, Reza; Zeinali, Sirous

    2010-11-01

    We have developed an integrase-defective lentiviral (LV) vector in combination with a gene-targeting approach for gene therapy of β-thalassemia. The β-globin gene-targeting construct has two homologous stems including sequence upstream and downstream of the β-globin gene, a β-globin gene positioned between hygromycin and neomycin resistant genes and a herpes simplex virus type 1 thymidine kinase (HSVtk) suicide gene. Utilization of integrase-defective LV as a vector for the β-globin gene increased the number of selected clones relative to non-viral methods. This method represents an important step toward the ultimate goal of a clinical gene therapy for β-thalassemia.

  2. Role of thin descending limb urea transport in renal urea handling and the urine concentrating mechanism

    PubMed Central

    Lei, Tianluo; Zhou, Lei; Layton, Anita T.; Zhou, Hong; Zhao, Xuejian; Bankir, Lise

    2011-01-01

    Urea transporters UT-A2 and UT-B are expressed in epithelia of thin descending limb of Henle's loop and in descending vasa recta, respectively. To study their role and possible interaction in the context of the urine concentration mechanism, a UT-A2 and UT-B double knockout (UT-A2/B knockout) mouse model was generated by targeted deletion of the UT-A2 promoter in embryonic stem cells with UT-B gene knockout. The UT-A2/B knockout mice lacked detectable UT-A2 and UT-B transcripts and proteins and showed normal survival and growth. Daily urine output was significantly higher in UT-A2/B knockout mice than that in wild-type mice and lower than that in UT-B knockout mice. Urine osmolality in UT-A2/B knockout mice was intermediate between that in UT-B knockout and wild-type mice. The changes in urine osmolality and flow rate, plasma and urine urea concentration, as well as non-urea solute concentration after an acute urea load or chronic changes in protein intake suggested that UT-A2 plays a role in the progressive accumulation of urea in the inner medulla. These results suggest that in wild-type mice UT-A2 facilitates urea absorption by urea efflux from the thin descending limb of short loops of Henle. Moreover, UT-A2 deletion in UT-B knockout mice partially remedies the urine concentrating defect caused by UT-B deletion, by reducing urea loss from the descending limbs to the peripheral circulation; instead, urea is returned to the inner medulla through the loops of Henle and the collecting ducts. PMID:21849488

  3. Role of thin descending limb urea transport in renal urea handling and the urine concentrating mechanism.

    PubMed

    Lei, Tianluo; Zhou, Lei; Layton, Anita T; Zhou, Hong; Zhao, Xuejian; Bankir, Lise; Yang, Baoxue

    2011-12-01

    Urea transporters UT-A2 and UT-B are expressed in epithelia of thin descending limb of Henle's loop and in descending vasa recta, respectively. To study their role and possible interaction in the context of the urine concentration mechanism, a UT-A2 and UT-B double knockout (UT-A2/B knockout) mouse model was generated by targeted deletion of the UT-A2 promoter in embryonic stem cells with UT-B gene knockout. The UT-A2/B knockout mice lacked detectable UT-A2 and UT-B transcripts and proteins and showed normal survival and growth. Daily urine output was significantly higher in UT-A2/B knockout mice than that in wild-type mice and lower than that in UT-B knockout mice. Urine osmolality in UT-A2/B knockout mice was intermediate between that in UT-B knockout and wild-type mice. The changes in urine osmolality and flow rate, plasma and urine urea concentration, as well as non-urea solute concentration after an acute urea load or chronic changes in protein intake suggested that UT-A2 plays a role in the progressive accumulation of urea in the inner medulla. These results suggest that in wild-type mice UT-A2 facilitates urea absorption by urea efflux from the thin descending limb of short loops of Henle. Moreover, UT-A2 deletion in UT-B knockout mice partially remedies the urine concentrating defect caused by UT-B deletion, by reducing urea loss from the descending limbs to the peripheral circulation; instead, urea is returned to the inner medulla through the loops of Henle and the collecting ducts.

  4. CCN3 Protein Participates in Bone Regeneration as an Inhibitory Factor*

    PubMed Central

    Matsushita, Yuki; Sakamoto, Kei; Tamamura, Yoshihiro; Shibata, Yasuaki; Minamizato, Tokutaro; Kihara, Tasuku; Ito, Masako; Katsube, Ken-ichi; Hiraoka, Shuichi; Koseki, Haruhiko; Harada, Kiyoshi; Yamaguchi, Akira

    2013-01-01

    CCN3, a member of the CCN protein family, inhibits osteoblast differentiation in vitro. However, the role of CCN3 in bone regeneration has not been well elucidated. In this study, we investigated the role of CCN3 in bone regeneration. We identified the Ccn3 gene by microarray analysis as a highly expressed gene at the early phase of bone regeneration in a mouse bone regeneration model. We confirmed the up-regulation of Ccn3 at the early phase of bone regeneration by RT-PCR, Western blot, and immunofluorescence analyses. Ccn3 transgenic mice, in which Ccn3 expression was driven by 2.3-kb Col1a1 promoter, showed osteopenia compared with wild-type mice, but Ccn3 knock-out mice showed no skeletal changes compared with wild-type mice. We analyzed the bone regeneration process in Ccn3 transgenic mice and Ccn3 knock-out mice by microcomputed tomography and histological analyses. Bone regeneration in Ccn3 knock-out mice was accelerated compared with that in wild-type mice. The mRNA expression levels of osteoblast-related genes (Runx2, Sp7, Col1a1, Alpl, and Bglap) in Ccn3 knock-out mice were up-regulated earlier than those in wild-type mice, as demonstrated by RT-PCR. Bone regeneration in Ccn3 transgenic mice showed no significant changes compared with that in wild-type mice. Phosphorylation of Smad1/5 was highly up-regulated at bone regeneration sites in Ccn3 KO mice compared with wild-type mice. These results indicate that CCN3 is up-regulated in the early phase of bone regeneration and acts as a negative regulator for bone regeneration. This study may contribute to the development of new strategies for bone regeneration therapy. PMID:23653360

  5. ANTXR2 Knock-Out Does Not Result in the Development of Hypertension in Rats.

    PubMed

    Liu, Xiaoyan; Yuan, Wen; Li, Jing; Yang, Lei; Cai, Jun

    2017-02-01

    Our recent genetic study as well as robust evidences reported by previous genome-wide association studies (GWASs) have indicated that the single nucleotide polymorphism rs16998073, located near gene anthrax toxin receptor 2 (ANTXR2), was significantly associated with hypertension in Asians and Europeans. The aim of the present study was to determine whether ANTXR2 is the causal gene of hypertension at the 4q21 locus using an ANTXR2 knock-out model. Relative expression of ANTXR2 in Wistar-Kyoto rats (WKYs) and spontaneously hypertensive rats (SHRs) were determined by real-time quantitative polymerase chain reaction and western blot analysis. ANTXR2 knock-out rats were created using CRISPR/Cas9-mediated genome editing and blood pressure values were measured in ANTXR2 -/- and wild type (WT) rats by tail-cuff method and carotid arterial catheterization method. Neither the mRNA nor protein levels of ANTXR2 were significantly different between tissues from SHRs and WKYs. To create ANTXR2 -/- rats, 67 base pairs were deleted in exon 1 of ANTXR2 using CRISPR/Cas9-mediated genome editing. ANTXR2 protein decreased significantly in aortas of ANTXR2 -/- rats, suggesting sufficient efficiency of ANTXR2 knock-out in this model. However, ANTXR2 -/- rats exhibited nearly the same blood pressure as WT rats at baseline conditions as well as during Angiotensin II (400ng/kg/min) infusion or high-salt diet treatment. These findings suggest that ANTXR2 might not be associated with hypertension and thus further functional analysis is warranted to identify the causal gene at this locus. © American Journal of Hypertension, Ltd 2016. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  6. Morphologic and Histologic Comparison of Hypertrophic Scar in Nude Mice, T-Cell Receptor, and Recombination Activating Gene Knockout Mice.

    PubMed

    Momtazi, Moein; Ding, Jie; Kwan, Peter; Anderson, Colin C; Honardoust, Dariush; Goekjian, Serge; Tredget, Edward E

    2015-12-01

    Proliferative scars in nude mice have demonstrated morphologic and histologic similarities to human hypertrophic scar. Gene knockout technology provides the opportunity to study the effect of deleting immune cells in various disease processes. The authors' objective was to test whether grafting human skin onto T-cell receptor (TCR) αβ-/-γδ-/-, recombination activating gene (RAG)-1-/-, and RAG-2γ-/-c-/- mice results in proliferative scars consistent with human hypertrophic scar and to characterize the morphologic, histologic, and cellular changes that occur after removing immune cells. Nude TCRαβ-/-γδ-/-, RAG-1-/-, and RAG-2-/-γc-/- mice (n = 20 per strain) were grafted with human skin and euthanized at 30, 60, 120, and 180 days. Controls (n = 5 per strain) were autografted with mouse skin. Scars and normal skin were harvested at each time point. Sections were stained with hematoxylin and eosin, Masson's trichrome, and immunohistochemistry for anti-human leukocyte antigen-ABC, α-smooth muscle actin, decorin, and biglycan. TCRαβ-/-γδ-/-, RAG-1-/-, and RAG-2-/-γc-/- mice grafted with human skin developed firm, elevated scars with histologic and immunohistochemical similarities to human hypertrophic scar. Autografted controls showed no evidence of pathologic scarring. Knockout animals demonstrated a capacity for scar remodeling not observed in nude mice where reductions in α-smooth muscle actin staining pattern and scar thickness occurred over time. Human skin transplanted onto TCRαβ-/-γδ-/-, RAG-1-/-, and RAG-2-/-γc-/- mice results in proliferative scars with morphologic and histologic features of human hypertrophic scar. Remodeling of proliferative scars generated in knockout animals is analogous to changes in human hypertrophic scar. These animal models may better represent the natural history of human hypertrophic scar.

  7. Generation of human endometrial knockout cell lines with the CRISPR/Cas9 system confirms the prostaglandin F2α synthase activity of aldo-ketoreductase 1B1.

    PubMed

    Lacroix Pépin, Nicolas; Chapdelaine, Pierre; Rodriguez, Yoima; Tremblay, Jacques-P; Fortier, Michel A

    2014-07-01

    Prostaglandins (PGs) are important regulators of female reproductive function. The primary PGs produced in the endometrium are PGE2 and PGF2α. Relatively little is known about the biosynthetic pathways leading to the formation of PGF2α. We have described the role of aldo-ketoreductase (AKR)1B1 in increased PGF2α production by human endometrial cells following stimulation with interleukin-1β (IL-1β). However, alternate PGF synthases are expressed concurrently in endometrial cells. A definite proof of the role of AKR1B1 would require gene knockout; unfortunately, this gene has no direct equivalent in the mouse. Recently, an efficient genome-editing technology using RNA-guided DNase Cas9 and the clustered regularly interspaced short palindromic repeats (CRISPR) system has been developed. We have adapted this approach to knockout AKR1B1 gene expression in human endometrial cell lines. One clone (16-2) of stromal origin generated by the CRISPR/Cas9 system exhibited a complete loss of AKR1B1 protein and mRNA expression, whereas other clones presented with partial edition. The present report focuses on the characterization of clone 16-2 exhibiting deletion of 68 and 2 nucleotides, respectively, on each of the alleles. Cells from this clone lost their ability to produce PGF2α but maintained their original stromal cell (human endometrial stromal cells-2) phenotype including the capacity to decidualize in the presence of progesterone (medroxyprogesterone acetate) and 8-bromo-cAMP. Knockout cells also maintained their ability to increase PGE2 production in response to IL-1β. In summary, we demonstrate that the new genome editing CRISPR/Cas9 system can be used in human cells to generate stable knockout cell line models. Our results suggest that genome editing of human cell lines can be used to complement mouse KO models to validate the function of genes in differentiated tissues and cells. Our results also confirm that AKR1B1 is involved in the synthesis of PGF2α. © The Author 2014. Published by Oxford University Press on behalf of the European Society of Human Reproduction and Embryology. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  8. STAT1 is essential for the inhibition of hepatitis C virus replication by interferon-λ but not by interferon-α.

    PubMed

    Yamauchi, Shota; Takeuchi, Kenji; Chihara, Kazuyasu; Honjoh, Chisato; Kato, Yuji; Yoshiki, Hatsumi; Hotta, Hak; Sada, Kiyonao

    2016-12-08

    Interferon-α (IFN-α) and IFN-λ are structurally distinct cytokines that bind to different receptors, but induce expression of similar sets of genes through Janus kinase (JAK)-signal transducers and activators of transcription (STAT) pathways. The difference between IFN-α and IFN-λ signaling remains poorly understood. Here, using the CRISPR/Cas9 system, we examine the role of STAT1 and STAT2 in the inhibition of hepatitis C virus (HCV) replication by IFN-α and IFN-λ. Treatment with IFN-α increases expression of IFN-stimulated genes (ISGs) such as double-stranded RNA-activated protein kinase (PKR) and decreases viral RNA and protein levels in HCV-infected Huh-7.5 human hepatoma cells. These responses are only partially attenuated by knockout of STAT1 but are abolished by knockout of STAT2. In contrast, the inhibition of HCV replication by IFN-λ is abolished by knockout of STAT1 or STAT2. Microarray analysis reveals that IFN-α but not IFN-λ can induce expression of the majority of ISGs in STAT1 knockout cells. These findings suggest that IFN-α can inhibit HCV replication through a STAT2-dependent but STAT1-independent pathway, whereas IFN-λ induces ISG expression and inhibits HCV replication exclusively through a STAT1- and STAT2-dependent pathway.

  9. STAT1 is essential for the inhibition of hepatitis C virus replication by interferon-λ but not by interferon-α

    PubMed Central

    Yamauchi, Shota; Takeuchi, Kenji; Chihara, Kazuyasu; Honjoh, Chisato; Kato, Yuji; Yoshiki, Hatsumi; Hotta, Hak; Sada, Kiyonao

    2016-01-01

    Interferon-α (IFN-α) and IFN-λ are structurally distinct cytokines that bind to different receptors, but induce expression of similar sets of genes through Janus kinase (JAK)-signal transducers and activators of transcription (STAT) pathways. The difference between IFN-α and IFN-λ signaling remains poorly understood. Here, using the CRISPR/Cas9 system, we examine the role of STAT1 and STAT2 in the inhibition of hepatitis C virus (HCV) replication by IFN-α and IFN-λ. Treatment with IFN-α increases expression of IFN-stimulated genes (ISGs) such as double-stranded RNA-activated protein kinase (PKR) and decreases viral RNA and protein levels in HCV-infected Huh-7.5 human hepatoma cells. These responses are only partially attenuated by knockout of STAT1 but are abolished by knockout of STAT2. In contrast, the inhibition of HCV replication by IFN-λ is abolished by knockout of STAT1 or STAT2. Microarray analysis reveals that IFN-α but not IFN-λ can induce expression of the majority of ISGs in STAT1 knockout cells. These findings suggest that IFN-α can inhibit HCV replication through a STAT2-dependent but STAT1-independent pathway, whereas IFN-λ induces ISG expression and inhibits HCV replication exclusively through a STAT1- and STAT2-dependent pathway. PMID:27929099

  10. Engineering zucchini yellow mosaic potyvirus as a non-pathogenic vector for expression of heterologous proteins in cucurbits.

    PubMed

    Arazi, T; Slutsky, S G; Shiboleth, Y M; Wang, Y; Rubinstein, M; Barak, S; Yang, J; Gal-On, A

    2001-04-27

    Plant virus vectors provide an attractive biotechnological tool for the transient expression of foreign genes in whole plants. As yet there has been no use of recombinant viruses for the improvement of commercial crops. This is mainly because the viruses used to create vectors usually cause significant yield loss and can be transmitted in the field. A novel attenuated zucchini yellow mosaic potyvirus (AG) was used for the development of an environmentally safe non-pathogenic virus vector. The suitability of AG as an expression vector in plants was tested by analysis of two infectious viral constructs, each containing a distinct gene insertion site. Introduction of a foreign viral coat protein gene into AG genome between the P1 and HC-Pro genes, resulted in no expression in planta. In contrast, the same gene was stably expressed when inserted between NIb and CP genes, suggesting that this site is more suitable for a gene vector. Virus-mediated expression of reporter genes was observed in squash and cucumber leaves, stems, roots and edible fruit. Furthermore, AG stably expressed human interferon-alpha 2, an important human anti-viral drug, without affecting plant development and yield. Interferon biological activity was measured in cucumber and squash fruit. Together, these data corroborate a biotechnological utility of AG as a non-pathogenic vector for the expression of a foreign gene, as a benefit trait, in cucurbits and their edible fruit.

  11. Fmr1 and Nlgn3 knockout rats: novel tools for investigating autism spectrum disorders.

    PubMed

    Hamilton, Shannon M; Green, Jennie R; Veeraragavan, Surabi; Yuva, Lisa; McCoy, Aaron; Wu, Yumei; Warren, Joe; Little, Lara; Ji, Diana; Cui, Xiaoxia; Weinstein, Edward; Paylor, Richard

    2014-04-01

    Animal models are critical for gaining insights into autism spectrum disorder (ASD). Despite their apparent advantages to mice for neural studies, rats have not been widely used for disorders of the human CNS, such as ASD, for the lack of convenient genome manipulation tools. Here we describe two of the first transgenic rat models for ASD, developed using zinc-finger nuclease (ZFN) methodologies, and their initial behavioral assessment using a rapid juvenile test battery. A syndromic and nonsyndromic rat model for ASD were created as two separate knockout rat lines with heritable disruptions in the genes encoding Fragile X mental retardation protein (FMRP) and Neuroligin3 (NLGN3). FMRP, a protein with numerous proposed functions including regulation of mRNA and synaptic protein synthesis, and NLGN3, a member of the neuroligin synaptic cell-adhesion protein family, have been implicated in human ASD. Juvenile subjects from both knockout rat lines exhibited abnormalities in ASD-relevant phenotypes including juvenile play, perseverative behaviors, and sensorimotor gating. These data provide important first evidence regarding the utility of rats as genetic models for investigating ASD-relevant genes.

  12. Lipid-lowering effects of anti-angiopoietin-like 4 antibody recapitulate the lipid phenotype found in angiopoietin-like 4 knockout mice

    PubMed Central

    Desai, Urvi; Lee, E-Chiang; Chung, Kyu; Gao, Cuihua; Gay, Jason; Key, Billie; Hansen, Gwenn; Machajewski, Dennis; Platt, Kenneth A.; Sands, Arthur T.; Schneider, Matthias; Van Sligtenhorst, Isaac; Suwanichkul, Adisak; Vogel, Peter; Wilganowski, Nat; Wingert, June; Zambrowicz, Brian P.; Landes, Greg; Powell, David R.

    2007-01-01

    We used gene knockout mice to explore the role of Angiopoietin-like-4 (Angptl4) in lipid metabolism as well as to generate anti-Angptl4 mAbs with pharmacological activity. Angptl4 −/− mice had lower triglyceride (TG) levels resulting both from increased very low-density lipoprotein (VLDL) clearance and decreased VLDL production and had modestly lower cholesterol levels. Also, both Angptl4 −/− suckling mice and adult mice fed a high-fat diet showed reduced viability associated with lipogranulomatous lesions of the intestines and their draining lymphatics and mesenteric lymph nodes. Treating C57BL/6J, ApoE −/−, LDLr −/−, and db/db mice with the anti-Angptl4 mAb 14D12 recapitulated the lipid and histopathologic phenotypes noted in Angptl4 −/− mice. This demonstrates that the knockout phenotype reflects not only the physiologic function of the Angptl4 gene but also predicts the pharmacologic consequences of Angptl4 protein inhibition with a neutralizing antibody in relevant models of human disease. PMID:17609370

  13. Problem-Solving Test: Conditional Gene Targeting Using the Cre/loxP Recombination System

    ERIC Educational Resources Information Center

    Szeberényi, József

    2013-01-01

    Terms to be familiar with before you start to solve the test: gene targeting, knock-out mutation, bacteriophage, complementary base-pairing, homologous recombination, deletion, transgenic organisms, promoter, polyadenylation element, transgene, DNA replication, RNA polymerase, Shine-Dalgarno sequence, restriction endonuclease, polymerase chain…

  14. Assessing somatic hypermutation in Ramos B cells after overexpression or knockdown of specific genes.

    PubMed

    Upton, Dana C; Unniraman, Shyam

    2011-11-01

    B cells start their life with low affinity antibodies generated by V(D)J recombination. However, upon detecting a pathogen, the variable (V) region of an immunoglobulin (Ig) gene is mutated approximately 100,000-fold more than the rest of the genome through somatic hypermutation (SHM), resulting in high affinity antibodies. In addition, class switch recombination (CSR) produces antibodies with different effector functions depending on the kind of immune response that is needed for a particular pathogen. Both CSR and SHM are initiated by activation-induced cytidine deaminase (AID), which deaminates cytosine residues in DNA to produce uracils. These uracils are processed by error-prone forms of repair pathways, eventually leading to mutations and recombination. Our current understanding of the molecular details of SHM and CSR come from a combination of studies in mice, primary cells, cell lines, and cell-free experiments. Mouse models remain the gold standard with genetic knockouts showing critical roles for many repair factors (e.g. Ung, Msh2, Msh6, Exo1, and polymerase η). However, not all genes are amenable for knockout studies. For example, knockouts of several double-strand break repair proteins are embryonically lethal or impair B-cell development. Moreover, sometimes the specific function of a protein in SHM or CSR may be masked by more global defects caused by the knockout. In addition, since experiments in mice can be lengthy, altering expression of individual genes in cell lines has become an increasingly popular first step to identifying and characterizing candidate genes. Ramos - a Burkitt lymphoma cell line that constitutively undergoes SHM - has been a popular cell-line model to study SHM. One advantage of Ramos cells is that they have a built-in convenient semi-quantitative measure of SHM. Wild type cells express IgM and, as they pick up mutations, some of the mutations knock out IgM expression. Therefore, assaying IgM loss by fluorescence-activated cell scanning (FACS) provides a quick read-out for the level of SHM. A more quantitative measurement of SHM can be obtained by directly sequencing the antibody genes. Since Ramos cells are difficult to transfect, we produce stable derivatives that have increased or lowered expression of an individual gene by infecting cells with retroviral or lentiviral constructs that contain either an overexpression cassette or a short hairpin RNA (shRNA), respectively. Here, we describe how we infect Ramos cells and then use these cells to investigate the role of specific genes on SHM (Figure 1).

  15. Host structural carbohydrate induces vector transmission of a bacterial plant pathogen.

    PubMed

    Killiny, Nabil; Almeida, Rodrigo P P

    2009-12-29

    Many insect-borne pathogens have complex life histories because they must colonize both hosts and vectors for successful dissemination. In addition, the transition from host to vector environments may require changes in gene expression before the pathogen's departure from the host. Xylella fastidiosa is a xylem-limited plant-pathogenic bacterium transmitted by leafhopper vectors that causes diseases in a number of economically important plants. We hypothesized that factors of host origin, such as plant structural polysaccharides, are important in regulating X. fastidiosa gene expression and mediating vector transmission of this pathogen. The addition of pectin and glucan to a simple defined medium resulted in dramatic changes in X. fastidiosa's phenotype and gene-expression profile. Cells grown in the presence of pectin became more adhesive than in other media tested. In addition, the presence of pectin and glucan in media resulted in significant changes in the expression of several genes previously identified as important for X. fastidiosa's pathogenicity in plants. Furthermore, vector transmission of X. fastidiosa was induced in the presence of both polysaccharides. Our data show that host structural polysaccharides mediate gene regulation in X. fastidiosa, which results in phenotypic changes required for vector transmission. A better understanding of how vector-borne pathogens transition from host to vector, and vice versa, may lead to previously undiscovered disease-control strategies.

  16. Methods for Gene Transfer to the Central Nervous System

    PubMed Central

    Kantor, Boris; Bailey, Rachel M.; Wimberly, Keon; Kalburgi, Sahana N.; Gray, Steven J.

    2015-01-01

    Gene transfer is an increasingly utilized approach for research and clinical applications involving the central nervous system (CNS). Vectors for gene transfer can be as simple as an unmodified plasmid, but more commonly involve complex modifications to viruses to make them suitable gene delivery vehicles. This chapter will explain how tools for CNS gene transfer have been derived from naturally occurring viruses. The current capabilities of plasmid, retroviral, adeno-associated virus, adenovirus, and herpes simplex virus vectors for CNS gene delivery will be described. These include both focal and global CNS gene transfer strategies, with short- or long-term gene expression. As is described in this chapter, an important aspect of any vector is the cis-acting regulatory elements incorporated into the vector genome that control when, where, and how the transgene is expressed. PMID:25311922

  17. Alterations of amino acids and monoamine metabolism in male Fmr1 knockout mice: a putative animal model of the human fragile X mental retardation syndrome.

    PubMed

    Gruss, M; Braun, K

    2001-01-01

    The Fragile X syndrome, a common form of mental retardation in humans, is caused by silencing the fragile X mental retardation (FMR1) gene leading to the absence of the encoded fragile X mental retardation protein 1 (FMRP). We describe morphological and behavioral abnormalities for both affected humans and Fmr1 knockout mice, a putative animal model for the human Fragile X syndrome. The aim of the present study was to identify possible neurochemical abnormalities in Fmr1 knockout mice, with particular focus on neurotransmission. Significant region-specific differences of basal neurotransmitter and metabolite levels were found between wildtype and Fmr1 knockout animals, predominantly in juveniles (post-natal days 28 to 31). Adults (postnatal days 209 to 221) showed only few abnormalities as compared with the wildtype. In juvenile knockout mice, aspartate and taurine were especially increased in cortical regions, striatum, hippocampus, cerebellum, and brainstem. In addition, juveniles showed an altered balance between excitatory and inhibitory amino acids in the caudal cortex, hippocampus, and brainstem. We detected very few differences in monoamine turnover in both age stages. The results presented here provide the first evidence that lack of FMRP expression in FMRP knockout mice is accompanied by age-dependent, region-specific alterations in neurotransmission.

  18. Efficient gene knock-out and knock-in with transgenic Cas9 in Drosophila.

    PubMed

    Xue, Zhaoyu; Ren, Mengda; Wu, Menghua; Dai, Junbiao; Rong, Yikang S; Gao, Guanjun

    2014-03-21

    Bacterial Cas9 nuclease induces site-specific DNA breaks using small gRNA as guides. Cas9 has been successfully introduced into Drosophila for genome editing. Here, we improve the versatility of this method by developing a transgenic system that expresses Cas9 in the Drosophila germline. Using this system, we induced inheritable knock-out mutations by injecting only the gRNA into embryos, achieved highly efficient mutagenesis by expressing gRNA from the promoter of a novel non-coding RNA gene, and recovered homologous recombination-based knock-in of a fluorescent marker at a rate of 4.5% by co-injecting gRNA with a circular DNA donor. Copyright © 2014 Xue et al.

  19. Characterization of Bombyx mori nucleopolyhedrovirus with a knockout of Bm17.

    PubMed

    Shen, Hongxing; Zhou, Yang; Zhang, Wen; Nin, Bin; Wang, Hua; Wang, Xiaochun; Shao, Shihe; Chen, Huiqing; Guo, Zhongjian; Liu, Xiaoyong; Yao, Qin; Chen, Keping

    2012-12-01

    Open reading frame 17 (Bm17) gene of Bombyx mori nucleopolyhedrovirus is a highly conserved gene in lepidopteran nucleopolyhedroviruses, but its function remains unknown. In this report, transient-expression and superinfection assays indicated that BM17 localized in the nucleus and cytoplasm of infected BmN cells. To determine the role of Bm17 in baculovirus life cycle, we constructed a Bm17 knockout virus and characterized its properties in cells. Analysis of the production and infection of budded virions, the level of viral DNA replication revealed showed that there was no significant difference among the mutant, the control, and the Bm17 repaired virus strains. These results suggest that BM17 is not essential for virus replication in cultured cells.

  20. “Stealth” Adenoviruses Blunt Cell-Mediated and Humoral Immune Responses against the Virus and Allow for Significant Gene Expression upon Readministration in the Lung

    PubMed Central

    Croyle, Maria A.; Chirmule, Narendra; Zhang, Yi; Wilson, James M.

    2001-01-01

    Most of the early gene therapy trials for cystic fibrosis have been with adenovirus vectors. First-generation viruses with E1a and E1b deleted are limited by transient expression of the transgene and substantial inflammatory responses. Gene transfer is also significantly curtailed following a second dose of virus. In an effort to reduce adenovirus-associated inflammation, capsids of first-generation vectors were modified with various activated monomethoxypolyethylene glycols. Cytotoxic T-lymphocyte production was significantly reduced in C57BL/6 mice after a single intratracheal administration of modified vectors, and length of gene expression was extended from 4 to 42 days. T-cell subsets from mice exposed to the conjugated vectors demonstrated a marked decrease in Th1 responses and slight enhancement of Th2 responses compared to animals dosed with native virus. Neutralizing antibodies (NAB) against adenovirus capsid proteins were reduced in serum and bronchoalveolar lavage fluid of animals after a single dose of modified virus, allowing significant levels of gene expression upon rechallenge with native adenovirus. Modification with polyethylene glycol (PEG) also allowed substantial gene expression from the new vectors in animals previously immunized with unmodified virus. However, gene expression was significantly reduced after two doses of the same PEG-conjugated vector. Alternating the activation group of PEG between doses did produce significant gene expression upon readministration. This technology in combination with second-generation or helper-dependent adenovirus could produce dosing strategies which promote successful readministration of vector in clinical trials and marked expression in patients with significant anti-adenovirus NAB levels and reduce the possibility of immune reactions against viral vectors for gene therapy. PMID:11312351

  1. Genetic resources offer efficient tools for rice functional genomics research.

    PubMed

    Lo, Shuen-Fang; Fan, Ming-Jen; Hsing, Yue-Ie; Chen, Liang-Jwu; Chen, Shu; Wen, Ien-Chie; Liu, Yi-Lun; Chen, Ku-Ting; Jiang, Mirng-Jier; Lin, Ming-Kuang; Rao, Meng-Yen; Yu, Lin-Chih; Ho, Tuan-Hua David; Yu, Su-May

    2016-05-01

    Rice is an important crop and major model plant for monocot functional genomics studies. With the establishment of various genetic resources for rice genomics, the next challenge is to systematically assign functions to predicted genes in the rice genome. Compared with the robustness of genome sequencing and bioinformatics techniques, progress in understanding the function of rice genes has lagged, hampering the utilization of rice genes for cereal crop improvement. The use of transfer DNA (T-DNA) insertional mutagenesis offers the advantage of uniform distribution throughout the rice genome, but preferentially in gene-rich regions, resulting in direct gene knockout or activation of genes within 20-30 kb up- and downstream of the T-DNA insertion site and high gene tagging efficiency. Here, we summarize the recent progress in functional genomics using the T-DNA-tagged rice mutant population. We also discuss important features of T-DNA activation- and knockout-tagging and promoter-trapping of the rice genome in relation to mutant and candidate gene characterizations and how to more efficiently utilize rice mutant populations and datasets for high-throughput functional genomics and phenomics studies by forward and reverse genetics approaches. These studies may facilitate the translation of rice functional genomics research to improvements of rice and other cereal crops. © 2015 John Wiley & Sons Ltd.

  2. Microinjection of CRISPR/Cas9 Protein into Channel Catfish, Ictalurus punctatus, Embryos for Gene Editing.

    PubMed

    Elaswad, Ahmed; Khalil, Karim; Cline, David; Page-McCaw, Patrick; Chen, Wenbiao; Michel, Maximilian; Cone, Roger; Dunham, Rex

    2018-01-20

    The complete genome of the channel catfish, Ictalurus punctatus, has been sequenced, leading to greater opportunities for studying channel catfish gene function. Gene knockout has been used to study these gene functions in vivo. The clustered regularly interspaced short palindromic repeats/CRISPR associated protein 9 (CRISPR/Cas9) system is a powerful tool used to edit genomic DNA sequences to alter gene function. While the traditional approach has been to introduce CRISPR/Cas9 mRNA into the single cell embryos through microinjection, this can be a slow and inefficient process in catfish. Here, a detailed protocol for microinjection of channel catfish embryos with CRISPR/Cas9 protein is described. Briefly, eggs and sperm were collected and then artificial fertilization performed. Fertilized eggs were transferred to a Petri dish containing Holtfreter's solution. Injection volume was calibrated and then guide RNAs/Cas9 targeting the toll/interleukin 1 receptor domain-containing adapter molecule (TICAM 1) gene and rhamnose binding lectin (RBL) gene were microinjected into the yolk of one-cell embryos. The gene knockout was successful as indels were confirmed by DNA sequencing. The predicted protein sequence alterations due to these mutations included frameshift and truncated protein due to premature stop codons.

  3. Describing the role of Drosophila melanogaster ABC transporters in insecticide biology using CRISPR-Cas9 knockouts.

    PubMed

    Denecke, Shane; Fusetto, Roberto; Batterham, Philip

    2017-12-01

    ABC transporters have a well-established role in drug resistance, effluxing xenobiotics from cells and tissues within the organism. More recently, research has been dedicated to understanding the role insect ABC transporters play in insecticide toxicity, but progress in understanding the contribution of specific transporters has been hampered by the lack of functional genetic tools. Here, we report knockouts of three Drosophila melanogaster ABC transporter genes, Mdr49, Mdr50, and Mdr65, that are homologous to the well-studied mammalian ABCB1 (P-glycoprotein). Each knockout mutant was created in the same wild type background and tested against a panel of insecticides representing different chemical classes. Mdr65 knockouts were more susceptible to all neuroactive insecticides tested, but Mdr49 and Mdr50 knockouts showed increased susceptibility or resistance depending on the insecticide used. Mdr65 was chosen for further analysis. Calculation of LC 50 values for the Mdr65 knockout allowed the substrate specificity of this transporter to be examined. No obvious distinguishing structural features were shared among MDR65 substrates. A role for Mdr65 in insecticide transport was confirmed by testing the capacity of the knockout to synergize with the ABC inhibitor verapamil and by measuring the levels of insecticide retained in the body of knockout flies. These data unambiguously establish the influence of ABC transporters on the capacity of wild type D. melanogaster to tolerate insecticide exposure and suggest that both tissue and substrate specificity underpin this capacity. Copyright © 2017 Elsevier Ltd. All rights reserved.

  4. Chromosomal integration of adenoviral vector DNA in vivo.

    PubMed

    Stephen, Sam Laurel; Montini, Eugenio; Sivanandam, Vijayshankar Ganesh; Al-Dhalimy, Muhseen; Kestler, Hans A; Finegold, Milton; Grompe, Markus; Kochanek, Stefan

    2010-10-01

    So far there has been no report of any clinical or preclinical evidence for chromosomal vector integration following adenovirus (Ad) vector-mediated gene transfer in vivo. We used liver gene transfer with high-capacity Ad vectors in the FAH(Deltaexon5) mouse model to analyze homologous and heterologous recombination events between vector and chromosomal DNA. Intravenous injection of Ad vectors either expressing a fumarylacetoacetate hydrolase (FAH) cDNA or carrying part of the FAH genomic locus resulted in liver nodules of FAH-expressing hepatocytes, demonstrating chromosomal vector integration. Analysis of junctions between vector and chromosomal DNA following heterologous recombination indicated integration of the vector genome through its termini. Heterologous recombination occurred with a median frequency of 6.72 x 10(-5) per transduced hepatocyte, while homologous recombination occurred more rarely with a median frequency of 3.88 x 10(-7). This study has established quantitative and qualitative data on recombination of adenoviral vector DNA with genomic DNA in vivo, contributing to a risk-benefit assessment of the biosafety of Ad vector-mediated gene transfer.

  5. The immune response induced by DNA vaccine expressing nfa1 gene against Naegleria fowleri.

    PubMed

    Kim, Jong-Hyun; Lee, Sang-Hee; Sohn, Hae-Jin; Lee, Jinyoung; Chwae, Yong-Joon; Park, Sun; Kim, Kyongmin; Shin, Ho-Joon

    2012-12-01

    The pathogenic free-living amoeba, Naegleria fowleri, causes fatal primary amoebic meningoencephalitis in experimental animals and in humans. The nfa1 gene that was cloned from N. fowleri is located on pseudopodia, especially amoebic food cups and plays an important role in the pathogenesis of N. fowleri. In this study, we constructed and characterized retroviral vector and lentiviral vector systems for nfa1 DNA vaccination in mice. We constructed the retroviral vector (pQCXIN) and the lentiviral vector (pCDH) cloned with the egfp-nfa1 gene. The expression of nfa1 gene in Chinese hamster ovary cell and human primary nasal epithelial cell transfected with the pQCXIN/egfp-nfa1 vector or pCDH/egfp-nfa1 vector was observed by fluorescent microscopy and Western blotting analysis. Our viral vector systems effectively delivered the nfa1 gene to the target cells and expressed the Nfa1 protein within the target cells. To evaluate immune responses of nfa1-vaccinated mice, BALB/c mice were intranasally vaccinated with viral particles of each retro- or lentiviral vector expressing nfa1 gene. DNA vaccination using viral vectors expressing nfa1 significantly stimulated the production of Nfa1-specific IgG subclass, as well as IgG levels. In particular, both levels of IgG2a (Th1) and IgG1 (Th2) were significantly increased in mice vaccinated with viral vectors. These results show the nfa1-vaccination induce efficiently Th1 type, as well as Th2 type immune responses. This is the first report to construct viral vector systems and to evaluate immune responses as DNA vaccination in N. fowleri infection. Furthermore, these results suggest that nfal vaccination may be an effective method for treatment of N. fowleri infection.

  6. Large Animal Models for Foamy Virus Vector Gene Therapy

    PubMed Central

    Trobridge, Grant D.; Horn, Peter A.; Beard, Brian C.; Kiem, Hans-Peter

    2012-01-01

    Foamy virus (FV) vectors have shown great promise for hematopoietic stem cell (HSC) gene therapy. Their ability to efficiently deliver transgenes to multi-lineage long-term repopulating cells in large animal models suggests they will be effective for several human hematopoietic diseases. Here, we review FV vector studies in large animal models, including the use of FV vectors with the mutant O6-methylguanine-DNA methyltransferase, MGMTP140K to increase the number of genetically modified cells after transplantation. In these studies, FV vectors have mediated efficient gene transfer to polyclonal repopulating cells using short ex vivo transduction protocols designed to minimize the negative effects of ex vivo culture on stem cell engraftment. In this regard, FV vectors appear superior to gammaretroviral vectors, which require longer ex vivo culture to effect efficient transduction. FV vectors have also compared favorably with lentiviral vectors when directly compared in the dog model. FV vectors have corrected leukocyte adhesion deficiency and pyruvate kinase deficiency in the dog large animal model. FV vectors also appear safer than gammaretroviral vectors based on a reduced frequency of integrants near promoters and also near proto-oncogenes in canine repopulating cells. Together, these studies suggest that FV vectors should be highly effective for several human hematopoietic diseases, including those that will require relatively high percentages of gene-modified cells to achieve clinical benefit. PMID:23223198

  7. Robust Lentiviral Gene Delivery But Limited Transduction Capacity of Commonly Used Adeno-Associated Viral Serotypes in Xenotransplanted Human Skin.

    PubMed

    Jakobsen, Maria; Askou, Anne Louise; Stenderup, Karin; Rosada, Cecilia; Dagnæs-Hansen, Frederik; Jensen, Thomas G; Corydon, Thomas J; Mikkelsen, Jacob Giehm; Aagaard, Lars

    2015-08-01

    Skin is an easily accessible organ, and therapeutic gene transfer to skin remains an attractive alternative for the treatment of skin diseases. Although we have previously documented potent lentiviral gene delivery to human skin, vectors based on adeno-associated virus (AAV) rank among the most promising gene delivery tools for in vivo purposes. Thus, we compared the potential usefulness of various serotypes of recombinant AAV vectors and lentiviral vectors for gene transfer to human skin in a xenotransplanted mouse model. Vector constructs encoding firefly luciferase were packaged in AAV capsids of serotype 1, 2, 5, 6, 8, and 9 and separately administered by intradermal injection in human skin transplants. For all serotypes, live bioimaging demonstrated low levels of transgene expression in the human skin graft, and firefly luciferase expression was observed primarily in neighboring tissue outside of the graft. In contrast, gene delivery by intradermally injected lentiviral vectors was efficient and led to extensive and persistent firefly luciferase expression within the human skin graft only. The study demonstrates the limited capacity of single-stranded AAV vectors of six commonly used serotypes for gene delivery to human skin in vivo.

  8. Robust Lentiviral Gene Delivery But Limited Transduction Capacity of Commonly Used Adeno-Associated Viral Serotypes in Xenotransplanted Human Skin

    PubMed Central

    Jakobsen, Maria; Askou, Anne Louise; Stenderup, Karin; Rosada, Cecilia; Dagnæs-Hansen, Frederik; Jensen, Thomas G.; Corydon, Thomas J.; Mikkelsen, Jacob Giehm; Aagaard, Lars

    2015-01-01

    Skin is an easily accessible organ, and therapeutic gene transfer to skin remains an attractive alternative for the treatment of skin diseases. Although we have previously documented potent lentiviral gene delivery to human skin, vectors based on adeno-associated virus (AAV) rank among the most promising gene delivery tools for in vivo purposes. Thus, we compared the potential usefulness of various serotypes of recombinant AAV vectors and lentiviral vectors for gene transfer to human skin in a xenotransplanted mouse model. Vector constructs encoding firefly luciferase were packaged in AAV capsids of serotype 1, 2, 5, 6, 8, and 9 and separately administered by intradermal injection in human skin transplants. For all serotypes, live bioimaging demonstrated low levels of transgene expression in the human skin graft, and firefly luciferase expression was observed primarily in neighboring tissue outside of the graft. In contrast, gene delivery by intradermally injected lentiviral vectors was efficient and led to extensive and persistent firefly luciferase expression within the human skin graft only. The study demonstrates the limited capacity of single-stranded AAV vectors of six commonly used serotypes for gene delivery to human skin in vivo. PMID:26204415

  9. Method: low-cost delivery of the cotton leaf crumple virus-induced gene silencing system

    PubMed Central

    2012-01-01

    Background We previously developed a virus-induced gene silencing (VIGS) vector for cotton from the bipartite geminivirusCotton leaf crumple virus (CLCrV). The original CLCrV VIGS vector was designed for biolistic delivery by a gene gun. This prerequisite limited the use of the system to labs with access to biolistic equipment. Here we describe the adaptation of this system for delivery by Agrobacterium (Agrobacterium tumefaciens). We also describe the construction of two low-cost particle inflow guns. Results The biolistic CLCrV vector was transferred into two Agrobacterium binary plasmids. Agroinoculation of the binary plasmids into cotton resulted in silencing and GFP expression comparable to the biolistic vector. Two homemade low-cost gene guns were used to successfully inoculate cotton (G. hirsutum) and N. benthamiana with either the CLCrV VIGS vector or the Tomato golden mosaic virus (TGMV) VIGS vector respectively. Conclusions These innovations extend the versatility of CLCrV-based VIGS for analyzing gene function in cotton. The two low-cost gene guns make VIGS experiments affordable for both research and teaching labs by providing a working alternative to expensive commercial gene guns. PMID:22853641

  10. Tightly regulated, high-level expression from controlled copy number vectors based on the replicon of temperate phage N15.

    PubMed

    Mardanov, Andrey V; Strakhova, Taisia S; Smagin, Vladimir A; Ravin, Nikolai V

    2007-06-15

    A new Escherichia coli host/vector system has been developed to allow a dual regulation of both the plasmid copy number and gene expression. The new pN15E vectors are low copy number plasmids based on the replicon of temperate phage N15, comprising the repA replicase gene and cB repressor gene, controlling the plasmid copy number. Regulation of pN15E copy number is achieved through arabinose-inducible expression of phage N15 antirepressor protein, AntA, whose gene was integrated into the chromosome of the host strain under control of the PBAD promoter. The host strain also carried phage N15 partition operon, sop, allowing stable inheritance of pN15E vectors in the absence of selection pressure. In the first vector, pN15E4, the same PBAD promoter controls expression of a cloned gene. The second vector, pN15E6, carries the phage T5 promoter with a double lac operator repression module thus allowing independent regulation of promoter activity and copy number. Using the lacZ gene to monitor expression in these vectors, we show that the ratio of induction/repression can be about 7600-fold for pN15E4 and more than 15,000-fold for pN15E6. The low copy number of these vectors ensures very low basal level of expression allowing cloning genes encoding toxic products that was demonstrated by the stable maintenance of a gene encoding a restriction endonuclease in pN15E4. The tight control of transcription and the potential to regulate gene activities quantitatively over wide ranges will open up new approaches in the study of gene function in vivo and controlled expression of heterologous genes.

  11. Slc25a12 disruption alters myelination and neurofilaments: a model for a hypomyelination syndrome and childhood neurodevelopmental disorders.

    PubMed

    Sakurai, Takeshi; Ramoz, Nicolas; Barreto, Marta; Gazdoiu, Mihaela; Takahashi, Nagahide; Gertner, Michael; Dorr, Nathan; Gama Sosa, Miguel A; De Gasperi, Rita; Perez, Gissel; Schmeidler, James; Mitropoulou, Vivian; Le, H Carl; Lupu, Mihaela; Hof, Patrick R; Elder, Gregory A; Buxbaum, Joseph D

    2010-05-01

    SLC25A12, a susceptibility gene for autism spectrum disorders that is mutated in a neurodevelopmental syndrome, encodes a mitochondrial aspartate-glutamate carrier (aspartate-glutamate carrier isoform 1 [AGC1]). AGC1 is an important component of the malate/aspartate shuttle, a crucial system supporting oxidative phosphorylation and adenosine triphosphate production. We characterized mice with a disruption of the Slc25a12 gene, followed by confirmatory in vitro studies. Slc25a12-knockout mice, which showed no AGC1 by immunoblotting, were born normally but displayed delayed development and died around 3 weeks after birth. In postnatal day 13 to 14 knockout brains, the brains were smaller with no obvious alteration in gross structure. However, we found a reduction in myelin basic protein (MBP)-positive fibers, consistent with a previous report. Furthermore, the neocortex of knockout mice contained abnormal neurofilamentous accumulations in neurons, suggesting defective axonal transport and/or neurodegeneration. Slice cultures prepared from knockout mice also showed a myelination defect, and reduction of Slc25a12 in rat primary oligodendrocytes led to a cell-autonomous reduction in MBP expression. Myelin deficits in slice cultures from knockout mice could be reversed by administration of pyruvate, indicating that reduction in AGC1 activity leads to reduced production of aspartate/N-acetylaspartate and/or alterations in the dihydronicotinamide adenine dinucleotide/nicotinamide adenine dinucleotide(+) ratio, resulting in myelin defects. Our data implicate AGC1 activity in myelination and in neuronal structure and indicate that while loss of AGC1 leads to hypomyelination and neuronal changes, subtle alterations in AGC1 expression could affect brain development, contributing to increased autism susceptibility. Copyright 2010 Society of Biological Psychiatry. Published by Elsevier Inc. All rights reserved.

  12. An Improved Brome mosaic virus Silencing Vector: Greater Insert Stability and More Extensive VIGS1[OPEN

    PubMed Central

    2018-01-01

    Virus-induced gene silencing (VIGS) is used extensively for gene function studies in plants. VIGS is inexpensive and rapid compared with silencing conducted through stable transformation, but many virus-silencing vectors, especially in grasses, induce only transient silencing phenotypes. A major reason for transient phenotypes is the instability of the foreign gene fragment (insert) in the vector during VIGS. Here, we report the development of a Brome mosaic virus (BMV)-based vector that better maintains inserts through modification of the original BMV vector RNA sequence. Modification of the BMV RNA3 sequence yielded a vector, BMVCP5, that better maintained phytoene desaturase and heat shock protein70-1 (HSP70-1) inserts in Nicotiana benthamiana and maize (Zea mays). Longer maintenance of inserts was correlated with greater target gene silencing and more extensive visible silencing phenotypes displaying greater tissue penetration and involving more leaves. The modified vector accumulated similarly to the original vector in N. benthamiana after agroinfiltration, thus maintaining a high titer of virus in this intermediate host used to produce virus inoculum for grass hosts. For HSP70, silencing one family member led to a large increase in the expression of another family member, an increase likely related to the target gene knockdown and not a general effect of virus infection. The cause of the increased insert stability in the modified vector is discussed in relationship to its recombination and accumulation potential. The modified vector will improve functional genomic studies in grasses, and the conceptual methods used to improve the vector may be applied to other VIGS vectors. PMID:29127260

  13. Stable and Efficient Gene Transfer into the Retina Using an HIV-Based Lentiviral Vector

    NASA Astrophysics Data System (ADS)

    Miyoshi, Hiroyuki; Takahashi, Masayo; Gage, Fred H.; Verma, Inder M.

    1997-09-01

    The development of methods for efficient gene transfer to terminally differentiated retinal cells is important to study the function of the retina as well as for gene therapy of retinal diseases. We have developed a lentiviral vector system based on the HIV that can transduce terminally differentiated neurons of the brain in vivo. In this study, we have evaluated the ability of HIV vectors to transfer genes into retinal cells. An HIV vector containing a gene encoding the green fluorescent protein (GFP) was injected into the subretinal space of rat eyes. The GFP gene under the control of the cytomegalovirus promoter was efficiently expressed in both photoreceptor cells and retinal pigment epithelium. However, the use of the rhodopsin promoter resulted in expression predominantly in photoreceptor cells. Most successfully transduced eyes showed that photoreceptor cells in >80% of the area of whole retina expressed the GFP. The GFP expression persisted for at least 12 weeks with no apparent decrease. The efficient gene transfer into photoreceptor cells by HIV vectors will be useful for gene therapy of retinal diseases such as retinitis pigmentosa.

  14. [Effects of canine IL-2 and IL-7 genes on enhancing immunogenicity of canine parvovirus VP2 gene vaccine in mice].

    PubMed

    Chen, Huihui; Zhong, Fei; Li, Xiujin; Wang, Lu; Sun, Yan; Neng, Changai; Zhang, Kao; Li, Wenyan; Wen, Jiexia

    2012-11-04

    To investigate the effects of canine interleukin-2 (cIL-2) and cIL-7 genes on enhancing the immunogenicity of canine parvovirus (CPV) VP2 DNA vaccine. The bicistronic vectors of cIL-2 and cIL-7 genes were constructed using the eukaryotic expression vector containing internal ribosome entry site (IRES). The cIL-2/ cIL-7 dicistronic vector plus previously constructed vectors, including CPV VP2 DNA vaccine vector, cIL-2 vector and cIL-7 vector, were used to co-immunize mice with different combinations, consisting of VP2 alone, VP2 + cIL-2, VP2 + cIL-7 and VP2 + cIL-2/cIL-7. The VP2-specific antibody levels in immunized mice were measured by ELISA at different time post-immunization. The proliferation indices and interferon-gamma expression were measured by lymphocyte proliferation assay and ELISA, respectively. The cIL-2/cIL-7 bicistronic vector was correct and could mediate cIL-2 and cIL-7 gene expression in eukaryotic cells. Immunization results revealed that the antibody titers and the neutralizing antibody levels of the mice co-immunized with VP2 + cIL-7/cIL-2 vectors were significantly higher than that with either VP2 + cIL-2 vectors or VP2 + cIL-7 vectors (P < 0.05). The lymphocyte proliferation indices of VP2 + cIL-7/cIL-2 vector-immunized mice were also higher than that of other two groups although not statistically significant. However, the IFN-gamma expression levels of VP2 + cIL-7/cIL-2 vector-immunized mice were significantly higher than other immunized mice (P < 0.05). The cIL-2 and cIL-7 genes showed the significant synergic effects on enhancing the immunogenecity of CPV VP2 DNA vaccine.

  15. Cereal transformation through particle bombardment

    NASA Technical Reports Server (NTRS)

    Casas, A. M.; Kononowicz, A. K.; Bressan, R. A.; Hasegawa, P. M.; Mitchell, C. A. (Principal Investigator)

    1995-01-01

    The review focuses on experiments that lead to stable transformation in cereals using microprojectile bombardment. The discussion of biological factors that affect transformation examines target tissues and vector systems for gene transfer. The vector systems include reporter genes, selectable markers, genes of agronomic interest, and vector constructions. Other topics include physical parameters that affect DNA delivery, selection of stably transformed cells and plant regeneration, and analysis of gene expression and transmission to the progeny.

  16. Tailor-made gene silencing of Staphylococcus aureus clinical isolates by CRISPR interference

    PubMed Central

    Sato’o, Yusuke; Hisatsune, Junzo; Yu, Liansheng; Sakuma, Tetsushi; Yamamoto, Takashi

    2018-01-01

    Preparing the genetically modified organisms have required much time and labor, making it the rate-limiting step but CRISPR/Cas9 technology appearance has changed this difficulty. Although reports on CRISPR/Cas9 technology such as genome editing and CRISPR interference (CRISPRi) in eukaryotes increased, those in prokaryotes especially in Staphylococci were limited. Thus, its potential in the bacteriology remains unexplored. This is attributed to ecological difference between eukaryotes and prokaryotes. Here, we constructed a novel CRISPRi plasmid vector, pBACi for Staphylococcus aureus. The transformation efficiency of S. aureus was ~104 CFU/μg DNA using a vector extracted from dcm negative, which encoded one of DNA modification genes, E. coli. Further, pBACi was introduced into various clinical isolates including that not accepting the conventional temperature-sensitive vector. dcas9 in the vector was expressed throughout the growth phases of S. aureus and this vector decreased various gene mRNA expressions based on the crRNA targeting sequences and altered the knockdown strains’ phenotypes. The targeted genes included various virulence and antibiotic resistant genes. Bioinformatics suggest this vector can be introduced into wide range of low-GC Gram-positive bacteria. Because this new CRISPR/Cas9-based vector can easily prepare knockdown strains, we believe the novel vector will facilitate the characterization of the function of genes from S. aureus and other Gram-positive bacteria. PMID:29377933

  17. Recombination–deletion between homologous cassettes in retrovirus is suppressed via a strategy of degenerate codon substitution

    PubMed Central

    Im, Eung Jun; Bais, Anthony J; Yang, Wen; Ma, Qiangzhong; Guo, Xiuyang; Sepe, Steven M; Junghans, Richard P

    2014-01-01

    Transduction and expression procedures in gene therapy protocols may optimally transfer more than a single gene to correct a defect and/or transmit new functions to recipient cells or organisms. This may be accomplished by transduction with two (or more) vectors, or, more efficiently, in a single vector. Occasionally, it may be useful to coexpress homologous genes or chimeric proteins with regions of shared homology. Retroviridae include the dominant vector systems for gene transfer (e.g., gamma-retro and lentiviruses) and are capable of such multigene expression. However, these same viruses are known for efficient recombination–deletion when domains are duplicated within the viral genome. This problem can be averted by resorting to two-vector strategies (two-chain two-vector), but at a penalty to cost, convenience, and efficiency. Employing a chimeric antigen receptor system as an example, we confirm that coexpression of two genes with homologous domains in a single gamma-retroviral vector (two-chain single-vector) leads to recombination–deletion between repeated sequences, excising the equivalent of one of the chimeric antigen receptors. Here, we show that a degenerate codon substitution strategy in the two-chain single-vector format efficiently suppressed intravector deletional loss with rescue of balanced gene coexpression by minimizing sequence homology between repeated domains and preserving the final protein sequence. PMID:25419532

  18. The effects of Capn1 gene inactivation on the differential expression of genes in skeletal muscle

    USDA-ARS?s Scientific Manuscript database

    Protein turnover is required for muscle growth and regeneration and several proteolytic enzymes, including the calpains, degrade myofibrillar proteins during this process. In a previous experiment, phenotypic differences were observed between µ-calpain knockout (KO) and wild type (WT) mice, includin...

  19. Simple cloning strategy using GFPuv gene as positive/negative indicator.

    PubMed

    Miura, Hiromi; Inoko, Hidetoshi; Inoue, Ituro; Tanaka, Masafumi; Sato, Masahiro; Ohtsuka, Masato

    2011-09-15

    Because construction of expression vectors is the first requisite in the functional analysis of genes, development of simple cloning systems is a major requirement during the postgenomic era. In the current study, we developed cloning vectors for gain- or loss-of-function studies by using the GFPuv gene as a positive/negative indicator of cloning. These vectors allow us to easily detect correct clones and obtain expression vectors from a simple procedure by means of the combined use of the GFPuv gene and a type IIS restriction enzyme. Copyright © 2011 Elsevier Inc. All rights reserved.

  20. The Role of Lymphangiogenesis in Orthotopic Prostatic Tumor-Environment on Regional and Systemic Metastasis

    DTIC Science & Technology

    2008-01-01

    expressing Renilla luciferase and VEGF-C shRNA or irrelevant firefly luciferase shRNA (Ctrl) were implanted orthotopically as before. To determine the...on metastasis in Pten knockout model (Month 10-24): a) Generate Ubc/sVEGFR-3 and Ubc/ Renilla luciferase (RL) lentiviral vectors by subcloning...progression (month 10-12) c) Monitor efficiency of Ubc/lentiviral transduction and expression in Pten (-/-) prostate using optical imaging of Renilla

  1. Historical Perspective on the Current Renaissance for Hematopoietic Stem Cell Gene Therapy.

    PubMed

    Kohn, Donald B

    2017-10-01

    Gene therapy using hematopoietic stem cells (HSC) has developed over the past 3 decades, with progressive improvements in the efficacy and safety. Autologous transplantation of HSC modified with murine gammaretroviral vectors first showed clinical benefits for patients with several primary immune deficiencies, but some of these patients suffered complications from vector-related genotoxicity. Lentiviral vectors have been used recently for gene addition to HSC and have yielded clinical benefits for primary immune deficiencies, metabolic diseases, and hemoglobinopathies, without vector-related complications. Gene editing using site-specific endonucleases is emerging as a promising technology for gene therapy and is moving into clinical trials. Copyright © 2017 Elsevier Inc. All rights reserved.

  2. A gene cassette for adapting Escherichia coli strains as hosts for att-Int-mediated rearrangement and pL expression vectors.

    PubMed

    Balakrishnan, R; Bolten, B; Backman, K C

    1994-01-28

    A cassette of genes from bacteriophage lambda, when carried on a derivative of bacteriophage Mu, renders strains of Escherichia coli (and in principle other Mu-sensitive bacteria) capable of supporting lambda-based expression vectors, such as rearrangement vectors and pL vectors. The gene cassette contains a temperature-sensitive allele of the repressor gene, cIts857, and a shortened leftward operon comprising, oLpL, N, xis and int. Transfection and lysogenization of this cassette into various host bacteria is mediated by phage Mu functions. Examples of regulated expression of the gene encoding T4 DNA ligase are presented.

  3. The magnetofection method: using magnetic force to enhance gene delivery.

    PubMed

    Plank, Christian; Schillinger, Ulrike; Scherer, Franz; Bergemann, Christian; Rémy, Jean-Serge; Krötz, Florian; Anton, Martina; Lausier, Jim; Rosenecker, Joseph

    2003-05-01

    In order to enhance and target gene delivery we have previously established a novel method, termed magnetofection, which uses magnetic force acting on gene vectors that are associated with magnetic particles. Here we review the benefits, the mechanism and the potential of the method with regard to overcoming physical limitations to gene delivery. Magnetic particle chemistry and physics are discussed, followed by a detailed presentation of vector formulation and optimization work. While magnetofection does not necessarily improve the overall performance of any given standard gene transfer method in vitro, its major potential lies in the extraordinarily rapid and efficient transfection at low vector doses and the possibility of remotely controlled vector targeting in vivo.

  4. Cardiac Gene Therapy: Optimization of Gene Delivery Techniques In Vivo

    PubMed Central

    Katz, Michael G.; Swain, JaBaris D.; White, Jennifer D.; Low, David; Stedman, Hansell

    2010-01-01

    Abstract Vector-mediated cardiac gene therapy holds tremendous promise as a translatable platform technology for treating many cardiovascular diseases. The ideal technique is one that is efficient and practical, allowing for global cardiac gene expression, while minimizing collateral expression in other organs. Here we survey the available in vivo vector-mediated cardiac gene delivery methods—including transcutaneous, intravascular, intramuscular, and cardiopulmonary bypass techniques—with consideration of the relative merits and deficiencies of each. Review of available techniques suggests that an optimal method for vector-mediated gene delivery to the large animal myocardium would ideally employ retrograde and/or anterograde transcoronary gene delivery,extended vector residence time in the coronary circulation, an increased myocardial transcapillary gradient using physical methods, increased endothelial permeability with pharmacological agents, minimal collateral gene expression by isolation of the cardiac circulation from the systemic, and have low immunogenicity. PMID:19947886

  5. Gene Therapy with the Sleeping Beauty Transposon System.

    PubMed

    Kebriaei, Partow; Izsvák, Zsuzsanna; Narayanavari, Suneel A; Singh, Harjeet; Ivics, Zoltán

    2017-11-01

    The widespread clinical implementation of gene therapy requires the ability to stably integrate genetic information through gene transfer vectors in a safe, effective, and economical manner. The latest generation of Sleeping Beauty (SB) transposon vectors fulfills these requirements, and may overcome limitations associated with viral gene transfer vectors and transient nonviral gene delivery approaches that are prevalent in ongoing clinical trials. The SB system enables high-level stable gene transfer and sustained transgene expression in multiple primary human somatic cell types, thereby representing a highly attractive gene transfer strategy for clinical use. Here, we review the most important aspects of using SB for gene therapy, including vectorization as well as genomic integration features. We also illustrate the path to successful clinical implementation by highlighting the application of chimeric antigen receptor (CAR)-modified T cells in cancer immunotherapy. Copyright © 2017 Elsevier Ltd. All rights reserved.

  6. QuickMap: a public tool for large-scale gene therapy vector insertion site mapping and analysis.

    PubMed

    Appelt, J-U; Giordano, F A; Ecker, M; Roeder, I; Grund, N; Hotz-Wagenblatt, A; Opelz, G; Zeller, W J; Allgayer, H; Fruehauf, S; Laufs, S

    2009-07-01

    Several events of insertional mutagenesis in pre-clinical and clinical gene therapy studies have created intense interest in assessing the genomic insertion profiles of gene therapy vectors. For the construction of such profiles, vector-flanking sequences detected by inverse PCR, linear amplification-mediated-PCR or ligation-mediated-PCR need to be mapped to the host cell's genome and compared to a reference set. Although remarkable progress has been achieved in mapping gene therapy vector insertion sites, public reference sets are lacking, as are the possibilities to quickly detect non-random patterns in experimental data. We developed a tool termed QuickMap, which uniformly maps and analyzes human and murine vector-flanking sequences within seconds (available at www.gtsg.org). Besides information about hits in chromosomes and fragile sites, QuickMap automatically determines insertion frequencies in +/- 250 kb adjacency to genes, cancer genes, pseudogenes, transcription factor and (post-transcriptional) miRNA binding sites, CpG islands and repetitive elements (short interspersed nuclear elements (SINE), long interspersed nuclear elements (LINE), Type II elements and LTR elements). Additionally, all experimental frequencies are compared with the data obtained from a reference set, containing 1 000 000 random integrations ('random set'). Thus, for the first time a tool allowing high-throughput profiling of gene therapy vector insertion sites is available. It provides a basis for large-scale insertion site analyses, which is now urgently needed to discover novel gene therapy vectors with 'safe' insertion profiles.

  7. Lentiviral gene ontology (LeGO) vectors equipped with novel drug-selectable fluorescent proteins: new building blocks for cell marking and multi-gene analysis.

    PubMed

    Weber, K; Mock, U; Petrowitz, B; Bartsch, U; Fehse, B

    2010-04-01

    Vector-encoded fluorescent proteins (FPs) facilitate unambiguous identification or sorting of gene-modified cells by fluorescence-activated cell sorting (FACS). Exploiting this feature, we have recently developed lentiviral gene ontology (LeGO) vectors (www.LentiGO-Vectors.de) for multi-gene analysis in different target cells. In this study, we extend the LeGO principle by introducing 10 different drug-selectable FPs created by fusing one of the five selection marker (protecting against blasticidin, hygromycin, neomycin, puromycin and zeocin) and one of the five FP genes (Cerulean, eGFP, Venus, dTomato and mCherry). All tested fusion proteins allowed both fluorescence-mediated detection and drug-mediated selection of LeGO-transduced cells. Newly generated codon-optimized hygromycin- and neomycin-resistance genes showed improved expression as compared with their ancestors. New LeGO constructs were produced at titers >10(6) per ml (for non-concentrated supernatants). We show efficient combinatorial marking and selection of various cells, including mesenchymal stem cells, simultaneously transduced with different LeGO constructs. Inclusion of the cytomegalovirus early enhancer/chicken beta-actin promoter into LeGO vectors facilitated robust transgene expression in and selection of neural stem cells and their differentiated progeny. We suppose that the new drug-selectable markers combining advantages of FACS and drug selection are well suited for numerous applications and vector systems. Their inclusion into LeGO vectors opens new possibilities for (stem) cell tracking and functional multi-gene analysis.

  8. Xylella fastidiosa Afimbrial Adhesins Mediate Cell Transmission to Plants by Leafhopper Vectors▿

    PubMed Central

    Killiny, Nabil; Almeida, Rodrigo P. P.

    2009-01-01

    The interactions between the economically important plant-pathogenic bacterium Xylella fastidiosa and its leafhopper vectors are poorly characterized. We used different approaches to determine how X. fastidiosa cells interact with the cuticular surface of the foreguts of vectors. We demonstrate that X. fastidiosa binds to different polysaccharides with various affinities and that these interactions are mediated by cell surface carbohydrate-binding proteins. In addition, competition assays showed that N-acetylglucosamine inhibits bacterial adhesion to vector foregut extracts and intact wings, demonstrating that attachment to leafhopper surfaces is affected in the presence of specific polysaccharides. In vitro experiments with several X. fastidiosa knockout mutants indicated that hemagglutinin-like proteins are associated with cell adhesion to polysaccharides. These results were confirmed with biological experiments in which hemagglutinin-like protein mutants were transmitted to plants by vectors at lower rates than that of the wild type. Furthermore, although these mutants were defective in adhesion to the cuticle of vectors, their growth rate once attached to leafhoppers was similar to that of the wild type, suggesting that these proteins are important for initial adhesion of X. fastidiosa to leafhoppers. We propose that X. fastidiosa colonization of leafhopper vectors is a complex, stepwise process similar to the formation of biofilms on surfaces. PMID:19011051

  9. Genomic Profiling of Tumor Necrosis Factor Alpha (TNF-α) Receptor and Interleukin-1 Receptor Knockout Mice Reveals a Link between TNF-α Signaling and Increased Severity of 1918 Pandemic Influenza Virus Infection▿ †

    PubMed Central

    Belisle, Sarah E.; Tisoncik, Jennifer R.; Korth, Marcus J.; Carter, Victoria S.; Proll, Sean C.; Swayne, David E.; Pantin-Jackwood, Mary; Tumpey, Terrence M.; Katze, Michael G.

    2010-01-01

    The influenza pandemic of 1918 to 1919 was one of the worst global pandemics in recent history. The highly pathogenic nature of the 1918 virus is thought to be mediated in part by a dysregulation of the host response, including an exacerbated proinflammatory cytokine response. In the present study, we compared the host transcriptional response to infection with the reconstructed 1918 virus in wild-type, tumor necrosis factor (TNF) receptor-1 knockout (TNFRKO), and interleukin-1 (IL-1) receptor-1 knockout (IL1RKO) mice as a means of further understanding the role of proinflammatory cytokine signaling during the acute response to infection. Despite reported redundancy in the functions of IL-1β and TNF-α, we observed that reducing the signaling capacity of each of these molecules by genetic disruption of their key receptor genes had very different effects on the host response to infection. In TNFRKO mice, we found delayed or decreased expression of genes associated with antiviral and innate immune signaling, complement, coagulation, and negative acute-phase response. In contrast, in IL1RKO mice numerous genes were differentially expressed at 1 day postinoculation, including an increase in the expression of genes that contribute to dendritic and natural killer cell processes and cellular movement, and gene expression profiles remained relatively constant at later time points. We also observed a compensatory increase in TNF-α expression in virus-infected IL1RKO mice. Our data suggest that signaling through the IL-1 receptor is protective, whereas signaling through the TNF-α receptor increases the severity of 1918 virus infection. These findings suggest that manipulation of these pathways may have therapeutic benefit. PMID:20926563

  10. Genetic basis of HDL variation in 129/SvImJ and C57BL/6J mice: importance of testing candidate genes in targeted mutant mice.

    PubMed

    Su, Zhiguang; Wang, Xiaosong; Tsaih, Shirng-Wern; Zhang, Aihong; Cox, Allison; Sheehan, Susan; Paigen, Beverly

    2009-01-01

    To evaluate the effect of genetic background on high-density lipoprotein cholesterol (HDL) levels in Soat1(-/-) mice, we backcrossed sterol O-acyltransferase 1 (Soat1)(-/-) mice, originally reported to have elevated HDL levels, to C57BL/6 mice and constructed a congenic strain with only a small region (3.3Mb) of 129 alleles, specifically excluding the nearby apolipoprotein A-II (Apoa2) gene from 129. HDL levels in these Soat1(-/-) mice were no different from C57BL/6, indicating that the passenger gene Apoa2 caused the previously reported elevation of HDL in these Soat1(-/-) mice. Because many knockouts are made in strain 129 and then subsequently backcrossed into C57BL/6, it is important to identify quantitative trait loci (QTL) that differ between 129 and C57BL/6 so that one can guard against effects ascribed to a knockout but really caused by a passenger gene from 129. To provide such data, we generated 528 F(2) progeny from an intercross of 129S1/SvImJ and C57BL/6 and measured HDL concentrations in F(2) animals first fed chow and then atherogenic diet. A genome wide scan using 508 single-nucleotide polymorphisms (SNPs) identified 19 QTL, 2 of which were male specific and 2 were female specific. Using comparative genomics and haplotype analysis, we narrowed QTL on chromosomes 3, 5, 8, 17, and 18 to 0.5, 6.3, 2.6, 1.1, and 0.6 Mb, respectively. These data will serve as a reference for any effort to test the impact of candidate genes on HDL using a knockout strategy.

  11. Efficient disruption of Zebrafish genes using a Gal4-containing gene trap

    PubMed Central

    2013-01-01

    Background External development and optical transparency of embryos make zebrafish exceptionally suitable for in vivo insertional mutagenesis using fluorescent proteins to visualize expression patterns of mutated genes. Recently developed Gene Breaking Transposon (GBT) vectors greatly improve the fidelity and mutagenicity of transposon-based gene trap vectors. Results We constructed and tested a bipartite GBT vector with Gal4-VP16 as the primary gene trap reporter. Our vector also contains a UAS:eGFP cassette for direct detection of gene trap events by fluorescence. To confirm gene trap events, we generated a UAS:mRFP tester line. We screened 270 potential founders and established 41 gene trap lines. Three of our gene trap alleles display homozygous lethal phenotypes ranging from embryonic to late larval: nsf tpl6, atp1a3atpl10 and flrtpl19. Our gene trap cassette is flanked by direct loxP sites, which enabled us to successfully revert nsf tpl6, atp1a3atpl10 and flrtpl19 gene trap alleles by injection of Cre mRNA. The UAS:eGFP cassette is flanked by direct FRT sites. It can be readily removed by injection of Flp mRNA for use of our gene trap alleles with other tissue-specific GFP-marked lines. The Gal4-VP16 component of our vector provides two important advantages over other GBT vectors. The first is increased sensitivity, which enabled us to detect previously unnoticed expression of nsf in the pancreas. The second advantage is that all our gene trap lines, including integrations into non-essential genes, can be used as highly specific Gal4 drivers for expression of other transgenes under the control of Gal4 UAS. Conclusions The Gal4-containing bipartite Gene Breaking Transposon vector presented here retains high specificity for integrations into genes, high mutagenicity and revertibility by Cre. These features, together with utility as highly specific Gal4 drivers, make gene trap mutants presented here especially useful to the research community. PMID:24034702

  12. Optimized AAV rh.10 Vectors That Partially Evade Neutralizing Antibodies during Hepatic Gene Transfer

    PubMed Central

    Selot, Ruchita; Arumugam, Sathyathithan; Mary, Bertin; Cheemadan, Sabna; Jayandharan, Giridhara R.

    2017-01-01

    Of the 12 common serotypes used for gene delivery applications, Adeno-associated virus (AAV)rh.10 serotype has shown sustained hepatic transduction and has the lowest seropositivity in humans. We have evaluated if further modifications to AAVrh.10 at its phosphodegron like regions or predicted immunogenic epitopes could improve its hepatic gene transfer and immune evasion potential. Mutant AAVrh.10 vectors were generated by site directed mutagenesis of the predicted targets. These mutant vectors were first tested for their transduction efficiency in HeLa and HEK293T cells. The optimal vector was further evaluated for their cellular uptake, entry, and intracellular trafficking by quantitative PCR and time-lapse confocal microscopy. To evaluate their potential during hepatic gene therapy, C57BL/6 mice were administered with wild-type or optimal mutant AAVrh.10 and the luciferase transgene expression was documented by serial bioluminescence imaging at 14, 30, 45, and 72 days post-gene transfer. Their hepatic transduction was further verified by a quantitative PCR analysis of AAV copy number in the liver tissue. The optimal AAVrh.10 vector was further evaluated for their immune escape potential, in animals pre-immunized with human intravenous immunoglobulin. Our results demonstrate that a modified AAVrh.10 S671A vector had enhanced cellular entry (3.6 fold), migrate rapidly to the perinuclear region (1 vs. >2 h for wild type vectors) in vitro, which further translates to modest increase in hepatic gene transfer efficiency in vivo. More importantly, the mutant AAVrh.10 vector was able to partially evade neutralizing antibodies (~27–64 fold) in pre-immunized animals. The development of an AAV vector system that can escape the circulating neutralizing antibodies in the host will substantially widen the scope of gene therapy applications in humans. PMID:28769791

  13. Viral Vectors for in Vivo Gene Transfer

    NASA Astrophysics Data System (ADS)

    Thévenot, E.; Dufour, N.; Déglon, N.

    The transfer of DNA into the nucleus of a eukaryotic cell (gene transfer) is a central theme of modern biology. The transfer is said to be somatic when it refers to non-germline organs of a developed individual, and germline when it concerns gametes or the fertilised egg of an animal, with the aim of transmitting the relevant genetic modification to its descendents [1]. The efficient introduction of genetic material into a somatic or germline cell and the control of its expression over time have led to major advances in understanding how genes work in vivo, i.e., in living organisms (functional genomics), but also to the development of innovative therapeutic methods (gene therapy). The efficiency of gene transfer is conditioned by the vehicle used, called the vector. Desirable features for a vector are as follows: Easy to produce high titer stocks of the vector in a reproducible way. Absence of toxicity related to transduction (transfer of genetic material into the target cell, and its expression there) and no immune reaction of the organism against the vector and/or therapeutic protein. Stability in the expression of the relevant gene over time, and the possibility of regulation, e.g., to control expression of the therapeutic protein on the physiological level, or to end expression at the end of treatment. Transduction of quiescent cells should be as efficient as transduction of dividing cells. Vectors currently used fall into two categories: non-viral and viral vectors. In non-viral vectors, the DNA is complexed with polymers, lipids, or cationic detergents (described in Chap. 3). These vectors have a low risk of toxicity and immune reaction. However, they are less efficient in vivo than viral vectors when it comes to the number of cells transduced and long-term transgene expression. (Naked DNA transfer or electroporation is rather inefficient in the organism. This type of gene transfer will not be discussed here, and the interested reader is referred to the review [2].) For this reason, it is mainly viral vectors that are used for gene transfer in animals and humans.

  14. CD25 Preselective Anti-HIV Vectors for Improved HIV Gene Therapy

    PubMed Central

    Kalomoiris, Stefanos; Lawson, Je'Tai; Chen, Rachel X.; Bauer, Gerhard; Nolta, Jan A.

    2012-01-01

    Abstract As HIV continues to be a global public health problem with no effective vaccine available, new and innovative therapies, including HIV gene therapies, need to be developed. Due to low transduction efficiencies that lead to low in vivo gene marking, therapeutically relevant efficacy of HIV gene therapy has been difficult to achieve in a clinical setting. Methods to improve the transplantation of enriched populations of anti-HIV vector-transduced cells may greatly increase the in vivo efficacy of HIV gene therapies. Here we describe the development of preselective anti-HIV lentiviral vectors that allow for the purification of vector-transduced cells to achieve an enriched population of HIV-resistant cells. A selectable protein, human CD25, not normally found on CD34+ hematopoietic progenitor cells (HPCs), was incorporated into a triple combination anti-HIV lentiviral vector. Upon purification of cells transduced with the preselective anti-HIV vector, safety was demonstrated in CD34+ HPCs and in HPC-derived macrophages in vitro. Upon challenge with HIV-1, improved efficacy was observed in purified preselective anti-HIV vector-transduced macrophages compared to unpurified cells. These proof-of-concept results highlight the potential use of this method to improve HIV stem cell gene therapy for future clinical applications. PMID:23216020

  15. Biosafety challenges for use of lentiviral vectors in gene therapy.

    PubMed

    Rothe, Michael; Modlich, Ute; Schambach, Axel

    2013-12-01

    Lentiviral vectors are promising tools for the genetic modification of cells in biomedical research and gene therapy. Their use in recent clinical trials for the treatment of adrenoleukodystrophy, β-thalassemia, Wiskott-Aldrich- Syndrome and metachromatic leukodystrophy underlined their efficacy for therapies especially in case of hereditary diseases. In comparison to gammaretroviral LTR-driven vectors, which were employed in the first clinical trials, lentiviral vectors present with some favorable features like the ability to transduce also non-dividing cells and a potentially safer insertion profile. However, genetic modification with viral vectors in general and stable integration of the therapeutic gene into the host cell genome bear concerns with respect to different levels of personal or environmental safety. Among them, insertional mutagenesis by enhancer mediated dysregulation of neighboring genes or aberrant splicing is still the biggest concern. However, also risks like immunogenicity of vector particles, the phenotoxicity of the transgene and potential vertical or horizontal transmission by replication competent retroviruses need to be taken into account. This review will give an overview on biosafety aspects that are relevant to the use of lentiviral vectors for genetic modification and gene therapy. Furthermore, assay systems aiming at evaluating biosafety in preclinical settings and recent promising clinical trials including efforts of monitoring of patients after gene therapy will be discussed.

  16. Herpes simplex virus type 1 (HSV-1)-derived recombinant vectors for gene transfer and gene therapy.

    PubMed

    Marconi, Peggy; Fraefel, Cornel; Epstein, Alberto L

    2015-01-01

    Herpes simplex virus type 1 (HSV-1 ) is a human pathogen whose lifestyle is based on a long-term dual interaction with the infected host, being able to establish both lytic and latent infections. The virus genome is a 153-kilobase pair (kbp) double-stranded DNA molecule encoding more than 80 genes. The interest of HSV-1 as gene transfer vector stems from its ability to infect many different cell types, both quiescent and proliferating cells, the very high packaging capacity of the virus capsid, the outstanding neurotropic adaptations that this virus has evolved, and the fact that it never integrates into the cellular chromosomes, thus avoiding the risk of insertional mutagenesis. Two types of vectors can be derived from HSV-1, recombinant vectors and amplicon vectors, and different methodologies have been developed to prepare large stocks of each type of vector. This chapter summarizes the approach most commonly used to prepare recombinant HSV-1 vectors through homologous recombination, either in eukaryotic cells or in bacteria.

  17. Insulated hsp70B' promoter: stringent heat-inducible activity in replication-deficient, but not replication-competent adenoviruses.

    PubMed

    Rohmer, Stanimira; Mainka, Astrid; Knippertz, Ilka; Hesse, Andrea; Nettelbeck, Dirk M

    2008-04-01

    Key to the realization of gene therapy is the development of efficient and targeted gene transfer vectors. Therapeutic gene transfer by replication-deficient or more recently by conditionally replication-competent/oncolytic adenoviruses has shown much promise. For specific applications, however, it will be advantageous to provide vectors that allow for external control of gene expression. The efficient cellular heat shock system in combination with available technology for focused and controlled hyperthermia suggests heat-regulated transcription control as a promising tool for this purpose. We investigated the feasibility of a short fragment of the human hsp70B' promoter, with and without upstream insulator elements, for the regulation of transgene expression by replication-deficient or oncolytic adenoviruses. Two novel adenoviral vectors with an insulated hsp70B' promoter were developed and showed stringent heat-inducible gene expression with induction ratios up to 8000-fold. In contrast, regulation of gene expression from the hsp70B' promoter without insulation was suboptimal. In replication-competent/oncolytic adenoviruses regulation of the hsp70B' promoter was lost specifically during late replication in permissive cells and could not be restored by the insulators. We developed novel adenovirus gene transfer vectors that feature improved and stringent regulation of transgene expression from the hsp70B' promoter using promoter insulation. These vectors have potential for gene therapy applications that benefit from external modulation of therapeutic gene expression or for combination therapy with hyperthermia. Furthermore, our study reveals that vector replication can deregulate inserted cellular promoters, an observation which is of relevance for the development of replication-competent/oncolytic gene transfer vectors. (c) 2008 John Wiley & Sons, Ltd.

  18. Gene Suppression of Mouse Testis In Vivo Using Small Interfering RNA Derived from Plasmid Vectors

    PubMed Central

    Takizawa, Takami; Ishikawa, Tomoko; Kosuge, Takuji; Mizuguchi, Yoshiaki; Sato, Yoko; Koji, Takehiko; Araki, Yoshihiko; Takizawa, Toshihiro

    2012-01-01

    We evaluated whether inhibiting gene expression by small interfering RNA (siRNA) can be used for an in vivo model using a germ cell-specific gene (Tex101) as a model target in mouse testis. We generated plasmid-based expression vectors of siRNA targeting the Tex101 gene and transfected them into postnatal day 10 mouse testes by in vivo electroporation. After optimizing the electroporation conditions using a vector transfected into the mouse testis, a combination of high- and low-voltage pulses showed excellent transfection efficiency for the vectors with minimal tissue damage, but gene suppression was transient. Gene suppression by in vivo electroporation may be helpful as an alternative approach when designing experiments to unravel the basic role of testicular molecules. PMID:22489107

  19. Simultaneous Knockout of CXCR4 and CCR5 Genes in CD4+ T Cells via CRISPR/Cas9 Confers Resistance to Both X4- and R5-Tropic Human Immunodeficiency Virus Type 1 Infection.

    PubMed

    Yu, Songlin; Yao, Yongchao; Xiao, Hongkui; Li, Jiaojiao; Liu, Quan; Yang, Yijun; Adah, Dickson; Lu, Junnan; Zhao, Siting; Qin, Li; Chen, Xiaoping

    2018-01-01

    Previous research has proven that disruption of either the CCR5 or the CXCR4 gene confers resistance to R5-tropic or X4-tropic human immunodeficiency virus type 1 (HIV-1) infection, respectively. However, the urgent need to ablate both of the co-receptors in individual post-thymic CD4+ T cells for dual protection remains. This study ablated the CCR5 and CXCR4 genes in human CD4+ cell lines and primary CD4+ T cells simultaneously using clustered regularly interspaced short palindromic repeats (CRISPR)/Cas9, a well-developed, highly efficient genetic engineering tool. The efficiency of gene modification is as high as 55% for CCR5 and 36% for CXCR4 in CD4+ cell lines through infection of a single lentiviral vector (LV-X4R5), which were markedly protected from both HIV-1 NL4-3 (X4-using strain) and HIV-1 YU-2 (R5-using strain) infection. Importantly, approximately 9% of the modified GHOST (3) CXCR4+CCR5+ cells harbor four bi-allelic gene disruptions in both the CXCR4 and CCR5 loci. Moreover, co-delivery of two single-guide RNAs loaded with Cas9: ribonucleoprotein (sgX4&R5 Cas9RNP) disrupted >12% of CCR5 and 10% of CXCR4 in primary human CD4+ T cells, which were rendered resistant to HIV-1 NL4-3 and HIV-1 YU-2 in vitro. Further, the modified cells do not show discernible mutagenesis in top-ranked off-target genes by the Surveyor assay and Sanger sequencing analysis. The results demonstrate the safety and efficacy of CRISPR/Cas9 in multiplex gene modification on peripherally circulating CD4+ T cells, which may promote a functional cure for HIV-1 infection.

  20. Advanced Design of Dumbbell-shaped Genetic Minimal Vectors Improves Non-coding and Coding RNA Expression.

    PubMed

    Jiang, Xiaoou; Yu, Han; Teo, Cui Rong; Tan, Genim Siu Xian; Goh, Sok Chin; Patel, Parasvi; Chua, Yiqiang Kevin; Hameed, Nasirah Banu Sahul; Bertoletti, Antonio; Patzel, Volker

    2016-09-01

    Dumbbell-shaped DNA minimal vectors lacking nontherapeutic genes and bacterial sequences are considered a stable, safe alternative to viral, nonviral, and naked plasmid-based gene-transfer systems. We investigated novel molecular features of dumbbell vectors aiming to reduce vector size and to improve the expression of noncoding or coding RNA. We minimized small hairpin RNA (shRNA) or microRNA (miRNA) expressing dumbbell vectors in size down to 130 bp generating the smallest genetic expression vectors reported. This was achieved by using a minimal H1 promoter with integrated transcriptional terminator transcribing the RNA hairpin structure around the dumbbell loop. Such vectors were generated with high conversion yields using a novel protocol. Minimized shRNA-expressing dumbbells showed accelerated kinetics of delivery and transcription leading to enhanced gene silencing in human tissue culture cells. In primary human T cells, minimized miRNA-expressing dumbbells revealed higher stability and triggered stronger target gene suppression as compared with plasmids and miRNA mimics. Dumbbell-driven gene expression was enhanced up to 56- or 160-fold by implementation of an intron and the SV40 enhancer compared with control dumbbells or plasmids. Advanced dumbbell vectors may represent one option to close the gap between durable expression that is achievable with integrating viral vectors and short-term effects triggered by naked RNA.

  1. Magnetic concentration of a retroviral vector using magnetite cationic liposomes.

    PubMed

    Ito, Akira; Takahashi, Tetsuya; Kameyama, Yujiro; Kawabe, Yoshinori; Kamihira, Masamichi

    2009-03-01

    For tissue engineering purposes, retroviral vectors represent an efficient method of delivering exogenous genes such as growth factors to injured tissues because gene-transduced cells can produce stable and constant levels of the gene product. However, retroviral vector technology suffers from low yields. In the present study, we used magnetite nanoparticles and magnetic force to concentrate the retroviral vectors to enhance the transduction efficiency and to enable their magnetic manipulation. Magnetite nanoparticles modified with cationic liposomes were added to a solution containing a retroviral vector pseudotyped with vesicular stomatitis virus glycoprotein. The magnetic particles that captured the viral vectors were collected using a magnetic force and seeded into mouse neuroblastoma Neuro2a cells. The viral titer was up to 55 times greater (up to 3 x 10(8) infectious units/mL). Additionally, the magnetically labeled retroviral vectors can be directed to the desired regions for infection by applying magnetic fields, and micro-patterns of gene-transduced cell regions could be created on a cellular monolayer using micro-patterned magnetic concentrators. These results suggest that this technique provides a promising approach to capturing and concentrating viral vectors, thus achieving high transduction efficiency and the ability to deliver genes to a specific injured site by applying a magnetic field.

  2. TALEN mediated targeted editing of GM2/GD2-synthase gene modulates anchorage independent growth by reducing anoikis resistance in mouse tumor cells

    PubMed Central

    Mahata, Barun; Banerjee, Avisek; Kundu, Manjari; Bandyopadhyay, Uday; Biswas, Kaushik

    2015-01-01

    Complex ganglioside expression is highly deregulated in several tumors which is further dependent on specific ganglioside synthase genes. Here, we designed and constructed a pair of highly specific transcription-activator like effector endonuclease (TALENs) to disrupt a particular genomic locus of mouse GM2-synthase, a region conserved in coding sequence of all four transcript variants of mouse GM2-synthase. Our designed TALENs effectively work in different mouse cell lines and TALEN induced mutation rate is over 45%. Clonal selection strategy is undertaken to generate stable GM2-synthase knockout cell line. We have also demonstrated non-homologous end joining (NHEJ) mediated integration of neomycin cassette into the TALEN targeted GM2-synthase locus. Functionally, clonally selected GM2-synthase knockout clones show reduced anchorage-independent growth (AIG), reduction in tumor growth and higher cellular adhesion as compared to wild type Renca-v cells. Insight into the mechanism shows that, reduced AIG is due to loss in anoikis resistance, as both knockout clones show increased sensitivity to detachment induced apoptosis. Therefore, TALEN mediated precise genome editing at GM2-synthase locus not only helps us in understanding the function of GM2-synthase gene and complex gangliosides in tumorigenicity but also holds tremendous potential to use TALENs in translational cancer research and therapeutics. PMID:25762467

  3. TALEN mediated targeted editing of GM2/GD2-synthase gene modulates anchorage independent growth by reducing anoikis resistance in mouse tumor cells.

    PubMed

    Mahata, Barun; Banerjee, Avisek; Kundu, Manjari; Bandyopadhyay, Uday; Biswas, Kaushik

    2015-03-12

    Complex ganglioside expression is highly deregulated in several tumors which is further dependent on specific ganglioside synthase genes. Here, we designed and constructed a pair of highly specific transcription-activator like effector endonuclease (TALENs) to disrupt a particular genomic locus of mouse GM2-synthase, a region conserved in coding sequence of all four transcript variants of mouse GM2-synthase. Our designed TALENs effectively work in different mouse cell lines and TALEN induced mutation rate is over 45%. Clonal selection strategy is undertaken to generate stable GM2-synthase knockout cell line. We have also demonstrated non-homologous end joining (NHEJ) mediated integration of neomycin cassette into the TALEN targeted GM2-synthase locus. Functionally, clonally selected GM2-synthase knockout clones show reduced anchorage-independent growth (AIG), reduction in tumor growth and higher cellular adhesion as compared to wild type Renca-v cells. Insight into the mechanism shows that, reduced AIG is due to loss in anoikis resistance, as both knockout clones show increased sensitivity to detachment induced apoptosis. Therefore, TALEN mediated precise genome editing at GM2-synthase locus not only helps us in understanding the function of GM2-synthase gene and complex gangliosides in tumorigenicity but also holds tremendous potential to use TALENs in translational cancer research and therapeutics.

  4. Comprehensive characterization of glutamine synthetase-mediated selection for the establishment of recombinant CHO cells producing monoclonal antibodies.

    PubMed

    Noh, Soo Min; Shin, Seunghyeon; Lee, Gyun Min

    2018-03-29

    To characterize a glutamine synthetase (GS)-based selection system, monoclonal antibody (mAb) producing recombinant CHO cell clones were generated by a single round of selection at various methionine sulfoximine (MSX) concentrations (0, 25, and 50 μM) using two different host cell lines (CHO-K1 and GS-knockout CHO). Regardless of the host cell lines used, the clones selected at 50 μM MSX had the lowest average specific growth rate and the highest average specific production rates of toxic metabolic wastes, lactate and ammonia. Unlike CHO-K1, high producing clones could be generated in the absence of MSX using GS-knockout CHO with an improved selection stringency. Regardless of the host cell lines used, the clones selected at various MSX concentrations showed no significant difference in the GS, heavy chain, and light chain gene copies (P > 0.05). Furthermore, there was no correlation between the specific mAb productivity and these three gene copies (R 2  ≤ 0.012). Taken together, GS-mediated gene amplification does not occur in a single round of selection at a MSX concentration up to 50 μM. The use of the GS-knockout CHO host cell line facilitates the rapid generation of high producing clones with reduced production of lactate and ammonia in the absence of MSX.

  5. Inhalation of Nebulized Perfluorochemical Enhances Recombinant Adenovirus and Adeno-Associated Virus-Mediated Gene Expression in Lung Epithelium

    PubMed Central

    Beckett, Travis; Bonneau, Laura; Howard, Alan; Blanchard, James; Borda, Juan; Weiner, Daniel J.; Wang, Lili; Gao, Guang Ping; Kolls, Jay K.; Bohm, Rudolf; Liggitt, Denny

    2012-01-01

    Abstract Use of perfluorochemical liquids during intratracheal vector administration enhances recombinant adenovirus and adeno-associated virus (AAV)-mediated lung epithelial gene expression. We hypothesized that inhalation of nebulized perfluorochemical vapor would also enhance epithelial gene expression after subsequent intratracheal vector administration. Freely breathing adult C57BL/6 mice were exposed for selected times to nebulized perflubron or sterile saline in a sealed Plexiglas chamber. Recombinant adenoviral vector was administered by transtracheal puncture at selected times afterward and mice were killed 3 days after vector administration to assess transgene expression. Mice tolerated the nebulized perflubron without obvious ill effects. Vector administration 6 hr after nebulized perflubron exposure resulted in an average 540% increase in gene expression in airway and alveolar epithelium, compared with that with vector alone or saline plus vector control (p<0.05). However, vector administration 1 hr, 1 day, or 3 days after perflubron exposure was not different from either nebulized saline with vector or vector alone and a 60-min exposure to nebulized perflubron is required. In parallel pilot studies in macaques, inhalation of nebulized perflubron enhanced recombinant AAV2/5 vector expression throughout the lung. Serial chest radiographs, bronchoalveolar lavages, and results of complete blood counts and serum biochemistries demonstrated no obvious adverse effects of nebulized perflubron. Further, one macaque receiving nebulized perflubron only was monitored for 1 year with no obvious adverse effects of exposure. These results demonstrate that inhalation of nebulized perflubron, a simple, clinically more feasible technique than intratracheal administration of liquid perflubron, safely enhances lung gene expression. PMID:22568624

  6. A limited innate immune response is induced by a replication-defective herpes simplex virus vector following delivery to the murine central nervous system

    PubMed Central

    Zeier, Zane; Aguilar, J Santiago; Lopez, Cecilia M; Devi-Rao, G B; Watson, Zachary L; Baker, Henry V; Wagner, Edward K; Bloom, David C

    2010-01-01

    Herpes simplex virus type 1 (HSV-1)–based vectors readily transduce neurons and have a large payload capacity, making them particularly amenable to gene therapy applications within the central nervous system (CNS). Because aspects of the host responses to HSV-1 vectors in the CNS are largely unknown, we compared the host response of a nonreplicating HSV-1 vector to that of a replication-competent HSV-1 virus using microarray analysis. In parallel, HSV-1 gene expression was tracked using HSV-specific oligonucleotide-based arrays in order to correlate viral gene expression with observed changes in host response. Microarray analysis was performed following stereotactic injection into the right hippocampal formation of mice with either a replication-competent HSV-1 or a nonreplicating recombinant of HSV-1, lacking the ICP4 gene (ICP4−). Genes that demonstrated a significant change (P < .001) in expression in response to the replicating HSV-1 outnumbered those that changed in response to mock or nonreplicating vector by approximately 3-fold. Pathway analysis revealed that both the replicating and nonreplicating vectors induced robust antigen presentation but only mild interferon, chemokine, and cytokine signaling responses. The ICP4− vector was restricted in several of the Toll-like receptor-signaling pathways, indicating reduced stimulation of the innate immune response. These array analyses suggest that although the nonreplicating vector induces detectable activation of immune response pathways, the number and magnitude of the induced response is dramatically restricted compared to the replicating vector, and with the exception of antigen presentation, host gene expression induced by the non-replicating vector largely resembles mock infection. PMID:20095947

  7. Association between the SPRY1 gene polymorphism and obesity-related traits and osteoporosis in Korean women.

    PubMed

    Jin, Hyun-Seok; Kim, Bo-Young; Kim, Jeonghyun; Hong, Kyung-Won; Jung, Suk-Yul; Lee, Yun-Seok; Huh, Dam; Oh, Bermseok; Chung, Yoon-Sok; Jeong, Seon-Yong

    2013-01-01

    Emerging evidence has revealed a close relationship between obesity and osteoporosis. It was reported recently that conditional knockout of the Spry1 gene in mice adipocytes causes an increase in body fat and a decrease in bone mass, and that these phenotypes are rescued by Spry1 overexpression in adipose tissue. In this study, we investigated whether genetic variation in the human SPRY1 gene is associated with obesity-related phenotypes and/or osteoporosis in humans. We performed a candidate gene association analysis between the four single nucleotide polymorphisms (SNPs) and 14 imputed SNPs in the SPRY1 gene and obesity-related traits and osteoporosis in a Korean women cohort (3013 subjects). All four SPRY1 gene SNPs were significantly associated with either obesity-related traits or osteoporosis. The TGCC haplotype in the SRPY1 gene showed simultaneous association with an increased risk for obesity-related traits, percentage body fat (p=0.0087) and percentage abdominal fat (p=0.047), and osteoporosis (odds ratio=1.50; p=0.025) in the recessive genetic model. Our results support a previous finding in conditional Spry1 gene knockout mice and suggest that the SPRY1 gene is an important genetic factor for determining the risk of both obesity and osteoporosis in humans. Copyright © 2012 Elsevier Inc. All rights reserved.

  8. Engineering HSV-1 vectors for gene therapy.

    PubMed

    Goins, William F; Huang, Shaohua; Cohen, Justus B; Glorioso, Joseph C

    2014-01-01

    Virus vectors have been employed as gene transfer vehicles for various preclinical and clinical gene therapy applications, and with the approval of Glybera (alipogene tiparvovec) as the first gene therapy product as a standard medical treatment (Yla-Herttuala, Mol Ther 20: 1831-1832, 2013), gene therapy has reached the status of being a part of standard patient care. Replication-competent herpes simplex virus (HSV) vectors that replicate specifically in actively dividing tumor cells have been used in Phase I-III human trials in patients with glioblastoma multiforme, a fatal form of brain cancer, and in malignant melanoma. In fact, T-VEC (talimogene laherparepvec, formerly known as OncoVex GM-CSF) displayed efficacy in a recent Phase III trial when compared to standard GM-CSF treatment alone (Andtbacka et al. J Clin Oncol 31: sLBA9008, 2013) and may soon become the second FDA-approved gene therapy product used in standard patient care. In addition to the replication-competent oncolytic HSV vectors like T-VEC, replication-defective HSV vectors have been employed in Phase I-II human trials and have been explored as delivery vehicles for disorders such as pain, neuropathy, and other neurodegenerative conditions. Research during the last decade on the development of HSV vectors has resulted in the engineering of recombinant vectors that are totally replication defective, nontoxic, and capable of long-term transgene expression in neurons. This chapter describes methods for the construction of recombinant genomic HSV vectors based on the HSV-1 replication-defective vector backbones, steps in their purification, and their small-scale production for use in cell culture experiments as well as preclinical animal studies.

  9. An Improved Brome mosaic virus Silencing Vector: Greater Insert Stability and More Extensive VIGS.

    PubMed

    Ding, Xin Shun; Mannas, Stephen W; Bishop, Bethany A; Rao, Xiaolan; Lecoultre, Mitchell; Kwon, Soonil; Nelson, Richard S

    2018-01-01

    Virus-induced gene silencing (VIGS) is used extensively for gene function studies in plants. VIGS is inexpensive and rapid compared with silencing conducted through stable transformation, but many virus-silencing vectors, especially in grasses, induce only transient silencing phenotypes. A major reason for transient phenotypes is the instability of the foreign gene fragment (insert) in the vector during VIGS. Here, we report the development of a Brome mosaic virus (BMV)-based vector that better maintains inserts through modification of the original BMV vector RNA sequence. Modification of the BMV RNA3 sequence yielded a vector, BMVCP5, that better maintained phytoene desaturase and heat shock protein70-1 ( HSP70-1 ) inserts in Nicotiana benthamiana and maize ( Zea mays ). Longer maintenance of inserts was correlated with greater target gene silencing and more extensive visible silencing phenotypes displaying greater tissue penetration and involving more leaves. The modified vector accumulated similarly to the original vector in N. benthamiana after agroinfiltration, thus maintaining a high titer of virus in this intermediate host used to produce virus inoculum for grass hosts. For HSP70 , silencing one family member led to a large increase in the expression of another family member, an increase likely related to the target gene knockdown and not a general effect of virus infection. The cause of the increased insert stability in the modified vector is discussed in relationship to its recombination and accumulation potential. The modified vector will improve functional genomic studies in grasses, and the conceptual methods used to improve the vector may be applied to other VIGS vectors. © 2018 American Society of Plant Biologists. All Rights Reserved.

  10. Effective delivery of large genes to the retina by dual AAV vectors

    PubMed Central

    Trapani, Ivana; Colella, Pasqualina; Sommella, Andrea; Iodice, Carolina; Cesi, Giulia; de Simone, Sonia; Marrocco, Elena; Rossi, Settimio; Giunti, Massimo; Palfi, Arpad; Farrar, Gwyneth J; Polishchuk, Roman; Auricchio, Alberto

    2014-01-01

    Retinal gene therapy with adeno-associated viral (AAV) vectors is safe and effective in humans. However, AAV's limited cargo capacity prevents its application to therapies of inherited retinal diseases due to mutations of genes over 5 kb, like Stargardt's disease (STGD) and Usher syndrome type IB (USH1B). Previous methods based on ‘forced’ packaging of large genes into AAV capsids may not be easily translated to the clinic due to the generation of genomes of heterogeneous size which raise safety concerns. Taking advantage of AAV's ability to concatemerize, we generated dual AAV vectors which reconstitute a large gene by either splicing (trans-splicing), homologous recombination (overlapping), or a combination of the two (hybrid). We found that dual trans-splicing and hybrid vectors transduce efficiently mouse and pig photoreceptors to levels that, albeit lower than those achieved with a single AAV, resulted in significant improvement of the retinal phenotype of mouse models of STGD and USH1B. Thus, dual AAV trans-splicing or hybrid vectors are an attractive strategy for gene therapy of retinal diseases that require delivery of large genes. PMID:24150896

  11. Adenovirus Vectors Target Several Cell Subtypes of Mammalian Inner Ear In Vivo

    PubMed Central

    Li, Wenyan; Shen, Jun

    2016-01-01

    Mammalian inner ear harbors diverse cell types that are essential for hearing and balance. Adenovirus is one of the major vectors to deliver genes into the inner ear for functional studies and hair cell regeneration. To identify adenovirus vectors that target specific cell subtypes in the inner ear, we studied three adenovirus vectors, carrying a reporter gene encoding green fluorescent protein (GFP) from two vendors or with a genome editing gene Cre recombinase (Cre), by injection into postnatal days 0 (P0) and 4 (P4) mouse cochlea through scala media by cochleostomy in vivo. We found three adenovirus vectors transduced mouse inner ear cells with different specificities and expression levels, depending on the type of adenoviral vectors and the age of mice. The most frequently targeted region was the cochlear sensory epithelium, including auditory hair cells and supporting cells. Adenovirus with GFP transduced utricular supporting cells as well. This study shows that adenovirus vectors are capable of efficiently and specifically transducing different cell types in the mammalian inner ear and provides useful tools to study inner ear gene function and to evaluate gene therapy to treat hearing loss and vestibular dysfunction. PMID:28116172

  12. Highly Efficient Genome Editing via CRISPR/Cas9 to Create Clock Gene Knockout Cells.

    PubMed

    Korge, Sandra; Grudziecki, Astrid; Kramer, Achim

    2015-10-01

    Targeted genome editing using CRISPR/Cas9 is a relatively new, revolutionary technology allowing for efficient and directed alterations of the genome. It has been widely used for loss-of-function studies in animals and cell lines but has not yet been used to study circadian rhythms. Here, we describe the application of CRISPR/Cas9 genome editing for the generation of an F-box and leucine-rich repeat protein 3 (Fbxl3) knockout in a human cell line. Genomic alterations at the Fbxl3 locus occurred with very high efficiency (70%-100%) and specificity at both alleles, resulting in insertions and deletions that led to premature stop codons and hence FBXL3 knockout. Fbxl3 knockout cells displayed low amplitude and long period oscillations of Bmal1-luciferase reporter activity as well as increased CRY1 protein stability in line with previously published phenotypes for Fbxl3 knockout in mice. Thus, CRISPR/Cas9 genome editing should be highly valuable for studying circadian rhythms not only in human cells but also in classic model systems as well as nonmodel organisms. © 2015 The Author(s).

  13. Sequence determinants of improved CRISPR sgRNA design.

    PubMed

    Xu, Han; Xiao, Tengfei; Chen, Chen-Hao; Li, Wei; Meyer, Clifford A; Wu, Qiu; Wu, Di; Cong, Le; Zhang, Feng; Liu, Jun S; Brown, Myles; Liu, X Shirley

    2015-08-01

    The CRISPR/Cas9 system has revolutionized mammalian somatic cell genetics. Genome-wide functional screens using CRISPR/Cas9-mediated knockout or dCas9 fusion-mediated inhibition/activation (CRISPRi/a) are powerful techniques for discovering phenotype-associated gene function. We systematically assessed the DNA sequence features that contribute to single guide RNA (sgRNA) efficiency in CRISPR-based screens. Leveraging the information from multiple designs, we derived a new sequence model for predicting sgRNA efficiency in CRISPR/Cas9 knockout experiments. Our model confirmed known features and suggested new features including a preference for cytosine at the cleavage site. The model was experimentally validated for sgRNA-mediated mutation rate and protein knockout efficiency. Tested on independent data sets, the model achieved significant results in both positive and negative selection conditions and outperformed existing models. We also found that the sequence preference for CRISPRi/a is substantially different from that for CRISPR/Cas9 knockout and propose a new model for predicting sgRNA efficiency in CRISPRi/a experiments. These results facilitate the genome-wide design of improved sgRNA for both knockout and CRISPRi/a studies. © 2015 Xu et al.; Published by Cold Spring Harbor Laboratory Press.

  14. Mitochondrial DNA: An Endogenous Trigger for Immune Paralysis.

    PubMed

    Schäfer, Simon T; Franken, Lars; Adamzik, Michael; Schumak, Beatrix; Scherag, André; Engler, Andrea; Schönborn, Niels; Walden, Jennifer; Koch, Susanne; Baba, Hideo A; Steinmann, Jörg; Westendorf, Astrid M; Fandrey, Joachim; Bieber, Thomas; Kurts, Christian; Frede, Stilla; Peters, Jürgen; Limmer, Andreas

    2016-04-01

    Critically ill patients are at high risk to suffer from sepsis, even in the absence of an initial infectious source, but the molecular mechanisms for their increased sepsis susceptibility, including a suppressed immune system, remain unclear. Although microbes and pathogen-associated molecular pattern are accepted inducers of sepsis and septic immunosuppression, the role of endogenous Toll-like receptor (TLR) ligands, such as mitochondrial DNA (mtDNA), in altering the immune response is unknown. Mitochondrial DNA serum concentrations of the mitochondrial genes D-Loop and adenosine triphosphatase 6 were determined (quantitative polymerase chain reaction) in 165 septic patients and 50 healthy volunteers. Furthermore, cytotoxic T-cell activity was analyzed in wild-type and TLR9 knockout mice, with/without previous mtDNA administration, followed by injection of an ovalbumin-expressing adenoviral vector. Mitochondrial DNA serum concentrations were increased in septic patients (adenosine triphosphatase 6, 123-fold; D-Loop, 76-fold, P < 0.0001) compared with volunteers. Furthermore, a single mtDNA injection caused profound, TLR9-dependent immunosuppression of adaptive T-cell cytotoxicity in wild-type but not in TLR9 knockout mice and evoked various immunosuppressive mechanisms including the destruction of the splenic microstructure, deletion of cross-presenting dendritic cells, and up-regulation of programmed cell death ligand 1 and indoleamine 2,3-dioxygenase. Several of these findings in mice were mirrored in septic patients, and mtDNA concentrations were associated with an increased 30-day mortality. The findings of this study imply that mtDNA, an endogenous danger associated molecular pattern, is a hitherto unknown inducer of septic immunoparalysis and one possible link between initial inflammation and subsequent immunosuppression in critically ill patients.

  15. Transducing Airway Basal Cells with a Helper-Dependent Adenoviral Vector for Lung Gene Therapy.

    PubMed

    Cao, Huibi; Ouyang, Hong; Grasemann, Hartmut; Bartlett, Claire; Du, Kai; Duan, Rongqi; Shi, Fushan; Estrada, Marvin; Seigel, Kyle E; Coates, Allan L; Yeger, Herman; Bear, Christine E; Gonska, Tanja; Moraes, Theo J; Hu, Jim

    2018-06-01

    A major challenge in developing gene-based therapies for airway diseases such as cystic fibrosis (CF) is sustaining therapeutic levels of transgene expression over time. This is largely due to airway epithelial cell turnover and the host immunogenicity to gene delivery vectors. Modern gene editing tools and delivery vehicles hold great potential for overcoming this challenge. There is currently not much known about how to deliver genes into airway stem cells, of which basal cells are the major type in human airways. In this study, helper-dependent adenoviral (HD-Ad) vectors were delivered to mouse and pig airways via intranasal delivery, and direct bronchoscopic instillation, respectively. Vector transduction was assessed by immunostaining of lung tissue sections, which revealed that airway basal cells of mice and pigs can be targeted in vivo. In addition, efficient transduction of primary human airway basal cells was verified with an HD-Ad vector expressing green fluorescent protein. Furthermore, we successfully delivered the human CFTR gene to airway basal cells from CF patients, and demonstrated restoration of CFTR channel activity following cell differentiation in air-liquid interface culture. Our results provide a strong rationale for utilizing HD-Ad vectors to target airway basal cells for permanent gene correction of genetic airway diseases.

  16. Ultrasonic vocalizations in mouse models for speech and socio-cognitive disorders: insights into the evolution of vocal communication

    PubMed Central

    Fischer, J; Hammerschmidt, K

    2011-01-01

    Comparative analyses used to reconstruct the evolution of traits associated with the human language faculty, including its socio-cognitive underpinnings, highlight the importance of evolutionary constraints limiting vocal learning in non-human primates. After a brief overview of this field of research and the neural basis of primate vocalizations, we review studies that have addressed the genetic basis of usage and structure of ultrasonic communication in mice, with a focus on the gene FOXP2 involved in specific language impairments and neuroligin genes (NL-3 and NL-4) involved in autism spectrum disorders. Knockout of FoxP2 leads to reduced vocal behavior and eventually premature death. Introducing the human variant of FoxP2 protein into mice, in contrast, results in shifts in frequency and modulation of pup ultrasonic vocalizations. Knockout of NL-3 and NL-4 in mice diminishes social behavior and vocalizations. Although such studies may provide insights into the molecular and neural basis of social and communicative behavior, the structure of mouse vocalizations is largely innate, limiting the suitability of the mouse model to study human speech, a learned mode of production. Although knockout or replacement of single genes has perceptible effects on behavior, these genes are part of larger networks whose functions remain poorly understood. In humans, for instance, deficiencies in NL-4 can lead to a broad spectrum of disorders, suggesting that further factors (experiential and/or genetic) contribute to the variation in clinical symptoms. The precise nature as well as the interaction of these factors is yet to be determined. PMID:20579107

  17. A Knock-in Mouse Model of Human PHD2 Gene-associated Erythrocytosis Establishes a Haploinsufficiency Mechanism*

    PubMed Central

    Arsenault, Patrick R.; Pei, Fei; Lee, Rebecca; Kerestes, Heddy; Percy, Melanie J.; Keith, Brian; Simon, M. Celeste; Lappin, Terence R. J.; Khurana, Tejvir S.; Lee, Frank S.

    2013-01-01

    The central pathway for controlling red cell mass is the PHD (prolyl hydroxylase domain protein):hypoxia-inducible factor (HIF) pathway. HIF, which is negatively regulated by PHD, activates numerous genes, including ones involved in erythropoiesis, such as the ERYTHROPOIETIN (EPO) gene. Recent studies have implicated PHD2 as the key PHD isoform regulating red cell mass. Studies of humans have identified erythrocytosis-associated, heterozygous point mutations in the PHD2 gene. A key question concerns the mechanism by which human mutations lead to phenotypes. In the present report, we generated and characterized a mouse line in which a P294R knock-in mutation has been introduced into the mouse Phd2 locus to model the first reported human PHD2 mutation (P317R). Phd2P294R/+ mice display a degree of erythrocytosis equivalent to that seen in Phd2+/− mice. The Phd2P294R/+-associated erythrocytosis is reversed in a Hif2a+/−, but not a Hif1a+/− background. Additional studies using various conditional knock-outs of Phd2 reveal that erythrocytosis can be induced by homozygous and heterozygous knock-out of Phd2 in renal cortical interstitial cells using a Pax3-Cre transgene or by homozygous knock-out of Phd2 in hematopoietic progenitors driven by a Vav1-Cre transgene. These studies formally prove that a missense mutation in PHD2 is the cause of the erythrocytosis, show that this occurs through haploinsufficiency, and point to multifactorial control of red cell mass by PHD2. PMID:24121508

  18. Design and construction of functional AAV vectors.

    PubMed

    Gray, John T; Zolotukhin, Serge

    2011-01-01

    Using the basic principles of molecular biology and laboratory techniques presented in this chapter, researchers should be able to create a wide variety of AAV vectors for both clinical and basic research applications. Basic vector design concepts are covered for both protein coding gene expression and small non-coding RNA gene expression cassettes. AAV plasmid vector backbones (available via AddGene) are described, along with critical sequence details for a variety of modular expression components that can be inserted as needed for specific applications. Protocols are provided for assembling the various DNA components into AAV vector plasmids in Escherichia coli, as well as for transferring these vector sequences into baculovirus genomes for large-scale production of AAV in the insect cell production system.

  19. A microRNA embedded AAV alpha-synuclein gene silencing vector for dopaminergic neurons

    PubMed Central

    Han, Ye; Khodr, Christina E.; Sapru, Mohan K.; Pedapati, Jyothi; Bohn, Martha C.

    2011-01-01

    Alpha-synuclein (SNCA), an abundantly expressed presynaptic protein, is implicated in Parkinson disease (PD). Since over-expression of human SNCA (hSNCA) leads to death of dopaminergic (DA) neurons in human, rodent and fly brain, hSNCA gene silencing may reduce levels of toxic forms of SNCA and ameliorate degeneration of DA neurons in PD. To begin to develop a gene therapy for PD based on hSNCA gene silencing, two AAV gene silencing vectors were designed, and tested for efficiency and specificity of silencing, as well as toxicity in vitro. The same hSNCA silencing sequence (shRNA) was used in both vectors, but in one vector, the shRNA was embedded in a microRNA backbone and driven by a pol II promoter, and in the other the shRNA was not embedded in a microRNA and was driven by a pol III promoter. Both vectors silenced hSNCA to the same extent in 293T cells transfected with hSNCA. In DA PC12 cells, neither vector decreased expression of rat SNCA, tyrosine hydroxylase (TH), dopamine transporter (DAT) or the vesicular monoamine transporter (VMAT). However, the mir30 embedded vector was significantly less toxic to both PC12 and SH-SY5Y cells. Our in vitro data suggest that this miRNA-embedded silencing vector may be ideal for chronic in vivo SNCA gene silencing in DA neurons. PMID:21338582

  20. A minor role of WNK3 in regulating phosphorylation of renal NKCC2 and NCC co-transporters in vivo.

    PubMed

    Oi, Katsuyuki; Sohara, Eisei; Rai, Tatemitsu; Misawa, Moko; Chiga, Motoko; Alessi, Dario R; Sasaki, Sei; Uchida, Shinichi

    2012-02-15

    Mutations in WNK1 and WNK4 kinase genes have been shown to cause a human hereditary hypertensive disease, pseudohypoaldosteronism type II (PHAII). We previously discovered that WNK kinases phosphorylate and activate OSR1/SPAK kinases that regulate renal SLC12A family transporters such as NKCC2 and NCC, and clarified that the constitutive activation of this cascade causes PHAII. WNK3, another member of the WNK kinase family, was reported to be a strong activator of NCC/NKCC2 when assayed in Xenopus oocytes, suggesting that WNK3 also plays a major role in regulating blood pressure and sodium reabsorption in the kidney. However, it remains to be determined whether WNK3 is in fact involved in the regulation of these transporters in vivo. To clarify this issue, we generated and analyzed WNK3 knockout mice. Surprisingly, phosphorylation and expression of OSR1, SPAK, NKCC2 and NCC did not decrease in knockout mouse kidney under normal and low-salt diets. Similarly, expression of epithelial Na channel and Na/H exchanger 3 were not affected in knockout mice. Na(+) and K(+) excretion in urine in WNK3 knockout mice was not affected under different salt diets. Blood pressure in WNK3 knockout mice was not lower under normal diet. However, lower blood pressure was observed in WNK3 knockout mice fed low-salt diet. WNK4 and WNK1 expression was slightly elevated in the knockout mice under low-salt diet, suggesting compensation for WNK3 knockout by these WNKs. Thus, WNK3 may have some role in the WNK-OSR1/SPAK-NCC/NKCC2 signal cascade in the kidney, but its contribution to total WNK kinase activity may be minimal.

  1. Myostatin knockout using zinc-finger nucleases promotes proliferation of ovine primary satellite cells in vitro.

    PubMed

    Salabi, Fatemeh; Nazari, Mahmood; Chen, Qing; Nimal, Jonathan; Tong, Jianming; Cao, Wen G

    2014-12-20

    Myostatin (MSTN) has previously been shown to negatively regulate the proliferation and differentiation of skeletal muscle cells. Satellite cells are quiescent muscle stem cells that promote muscle growth and repair. Because the mechanism of MSTN in the biology of satellite cells is not well understood, this study was conducted to generate MSTN mono-allelic knockout satellite cells using the zinc-finger nuclease mRNA (MSTN-KO ZFN mRNA) and also to investigate the effect of this disruption on the proliferation and differentiation of sheep primary satellite cells (PSCs). Nineteen biallelic and four mono-allelic knockout cell clones were obtained after sequence analysis. The homologous mono-allelic knockout cells with 5-bp deletion were used to further evaluations. The results demonstrated that mono-allelic knockout of MSTN gene leads to translation inhibition. Real-time quantitative PCR results indicated that knockout of MSTN contributed to an increase in CDK2 and follistatin and a decrease in p21 at the transcript level in proliferation conditions. Moreover, MSTN knockout significantly increased the proliferation of mutant clones (P < 0.01). Consistent with the observed increase in CDK2 and decrease in p21 in cells lacking MSTN, cell cycle analysis showed that MSTN negatively regulated the G1 to S progression. In addition, knockout of myostatin resulted in a remarkable increase in MyoD and MyoG expression under differentiating conditions but had no effect on Myf5 expression. These results expanded our understanding of the regulation mechanism of MSTN. Furthermore, the MSTN-KO ZFN mRNA system in PSCs could be used to generate transgenic sheep in the future.

  2. Distinct Roles of Opioid and Dopamine Systems in Lateral Hypothalamic Intracranial Self-Stimulation.

    PubMed

    Ide, Soichiro; Takahashi, Takehiro; Takamatsu, Yukio; Uhl, George R; Niki, Hiroaki; Sora, Ichiro; Ikeda, Kazutaka

    2017-05-01

    Opioid and dopamine systems play crucial roles in reward. Similarities and differences in the neural mechanisms of reward that are mediated by these 2 systems have remained largely unknown. Thus, in the present study, we investigated the differences in reward function in both µ-opioid receptor knockout mice and dopamine transporter knockout mice, important molecules in the opioid and dopamine systems. Mice were implanted with electrodes into the right lateral hypothalamus (l hour). Mice were then trained to put their muzzle into the hole in the head-dipping chamber for intracranial electrical stimulation, and the influences of gene knockout were assessed. Significant differences are observed between opioid and dopamine systems in reward function. µ-Opioid receptor knockout mice exhibited enhanced intracranial electrical stimulation, which induced dopamine release. They also exhibited greater motility under conditions of "despair" in both the tail suspension test and water wheel test. In contrast, dopamine transporter knockout mice maintained intracranial electrical stimulation responding even when more active efforts were required to obtain the reward. The absence of µ-opioid receptor or dopamine transporter did not lead to the absence of intracranial electrical stimulation responsiveness but rather differentially altered it. The present results in µ-opioid receptor knockout mice are consistent with the suppressive involvement of µ-opioid receptors in both positive incentive motivation associated with intracranial electrical stimulation and negative incentive motivation associated with depressive states. In contrast, the results in dopamine transporter knockout mice are consistent with the involvement of dopamine transporters in positive incentive motivation, especially its persistence. Differences in intracranial electrical stimulation in µ-opioid receptor and dopamine transporter knockout mice underscore the multidimensional nature of reward. © The Author 2016. Published by Oxford University Press on behalf of CINP.

  3. Helper-dependent adenoviral vectors for liver-directed gene therapy

    PubMed Central

    Brunetti-Pierri, Nicola; Ng, Philip

    2011-01-01

    Helper-dependent adenoviral (HDAd) vectors devoid of all viral-coding sequences are promising non-integrating vectors for liver-directed gene therapy because they have a large cloning capacity, can efficiently transduce a wide variety of cell types from various species independent of the cell cycle and can result in long-term transgene expression without chronic toxicity. The main obstacle preventing clinical applications of HDAd for liver-directed gene therapy is the host innate inflammatory response against the vector capsid proteins that occurs shortly after intravascular vector administration resulting in acute toxicity, the severity of which is dependent on vector dose. Intense efforts have been focused on elucidating the factors involved in this acute response and various strategies have been investigated to improve the therapeutic index of HDAd vectors. These strategies have yielded encouraging results with the potential for clinical translation. PMID:21470977

  4. Knocking-out matrix metalloproteinase-13 exacerbates rotator cuff muscle fatty infiltration.

    PubMed

    Liu, Xuhui; Ravishankar, Bharat; Ning, Anne; Liu, Mengyao; Kim, Hubert T; Feeley, Brian T

    2017-01-01

    Rotator cuff (RC) tears are common tendon injuries. Clinically, both muscle atrophy and fatty infiltration have generally been attributed to poor functional outcomes. Matrix metalloproteinase-13 plays a crucial role in extracellular matrix remodeling in many physiological and pathological processes. Nevertheless, its role in rotator cuff muscle atrophy and fatty infiltration remains unknown. The purpose of this study is to define the functional role of MMP-13 in rotator cuff muscle atrophy and fatty infiltration using a mouse RC tears model. Unilateral complete supraspinatus and infraspinatus tendon transection and suprascapular nerve transection was performed on nine of MMP-13 (-/-) knockout and nine of MMP-13 (+/+) wildtype mice at 3 months old. Mice were sacrificed 6 weeks after surgery. Supraspinatus (SS) and infraspinatus (IS) muscles were harvested for histology and gene expression analysis with RT-PCR. Six weeks after RC surgery, no significant difference in muscle atrophy and fibrosis between MMP-13 knockout and wild type mice was observed. However, there was a significant increase in the amount of fatty infiltration in MMP-13 knockout mice compared to the wild types. Muscles from MMP-13 knockout mice have significantly higher expression of fatty infiltration related genes. Results from this study suggest that MMP-13 plays a crucial role in rotator cuff muscle fatty degeneration. This novel finding suggests a new molecular mechanism that governs RC muscle FI and MMP-13 may serve as a target for therapeutics to treat muscle FI after RC tears.

  5. Gadd45b knockout mice exhibit selective deficits in hippocampus-dependent long-term memory

    PubMed Central

    Leach, Prescott T.; Poplawski, Shane G.; Kenney, Justin W.; Hoffman, Barbara; Liebermann, Dan A.; Abel, Ted; Gould, Thomas J.

    2012-01-01

    Growth arrest and DNA damage-inducible β (Gadd45b) has been shown to be involved in DNA demethylation and may be important for cognitive processes. Gadd45b is abnormally expressed in subjects with autism and psychosis, two disorders associated with cognitive deficits. Furthermore, several high-throughput screens have identified Gadd45b as a candidate plasticity-related gene. However, a direct demonstration of a link between Gadd45b and memory has not been established. The current studies first determined whether expression of the Gadd45 family of genes was affected by contextual fear conditioning. Gadd45b, and to a lesser extent Gadd45g, were up-regulated in the hippocampus following contextual fear conditioning, whereas Gadd45a was not. Next, Gadd45b knockout mice were tested for contextual and cued fear conditioning. Gadd45b knockout mice exhibited a significant deficit in long-term contextual fear conditioning; however, they displayed normal levels of short-term contextual fear conditioning. No differences between Gadd45b knockout and wild-type mice were observed in cued fear conditioning. Because cued fear conditioning is hippocampus independent, while contextual fear conditioning is hippocampus dependent, the current studies suggest that Gadd45b may be important for long-term hippocampus-dependent memory storage. Therefore, Gadd45b may be a novel therapeutic target for the cognitive deficits associated with many neurodevelopmental, neurological, and psychiatric disorders. PMID:22802593

  6. The Chromatin Remodeler BPTF Activates a Stemness Gene-Expression Program Essential for the Maintenance of Adult Hematopoietic Stem Cells.

    PubMed

    Xu, Bowen; Cai, Ling; Butler, Jason M; Chen, Dongliang; Lu, Xiongdong; Allison, David F; Lu, Rui; Rafii, Shahin; Parker, Joel S; Zheng, Deyou; Wang, Gang Greg

    2018-03-13

    Self-renewal and differentiation of adult stem cells are tightly regulated partly through configuration of chromatin structure by chromatin remodelers. Using knockout mice, we here demonstrate that bromodomain PHD finger transcription factor (BPTF), a component of the nucleosome remodeling factor (NURF) chromatin-remodeling complex, is essential for maintaining the population size of hematopoietic stem/progenitor cells (HSPCs), including long-term hematopoietic stem cells (HSCs). Bptf-deficient HSCs are defective in reconstituted hematopoiesis, and hematopoietic-specific knockout of Bptf caused profound defects including bone marrow failure and anemia. Genome-wide transcriptome profiling revealed that BPTF loss caused downregulation of HSC-specific gene-expression programs, which contain several master transcription factors (Meis1, Pbx1, Mn1, and Lmo2) required for HSC maintenance and self-renewal. Furthermore, we show that BPTF potentiates the chromatin accessibility of key HSC "stemness" genes. These results demonstrate an essential requirement of the chromatin remodeler BPTF and NURF for activation of "stemness" gene-expression programs and proper function of adult HSCs. Copyright © 2018 The Author(s). Published by Elsevier Inc. All rights reserved.

  7. Generation and Characterization of Transgenic Mice Expressing Mouse Ins1 Promoter for Pancreatic β-Cell-Specific Gene Overexpression and Knockout.

    PubMed

    Cheng, Yulong; Su, Yutong; Shan, Aijing; Jiang, Xiuli; Ma, Qinyun; Wang, Weiqing; Ning, Guang; Cao, Yanan

    2015-07-01

    The technologies for pancreatic β-cell-specific gene overexpression or knockout are fundamental for investigations of functional genes in vivo. Here we generated the Ins1-Cre-Dsred and Ins1-rtTA mouse models, which expressed the Cre recombinase or reverse tetracycline regulatable transactivator (rtTA) without hGH minigene under the control of mouse Ins1 promoter. Our data showed that the Cre-mediated recombination and rtTA-mediated activation could be efficiently detected at embryonic day 13.5 when these models were crossed with the reporter mice (ROSA(mT/mG) or tetO-HIST1H2BJ/GFP). The Cre and rtTA expression was restricted to β-cells without leakage in the brain and other tissues. Moreover, both the transgenic lines showed normal glucose tolerance and insulin secretion. These results suggested that the Ins1-Cre-Dsred and Ins1-rtTA mice could be used to knock out or overexpress target genes in embryos and adults to facilitate β-cell researches.

  8. Production of alpha 1,3-galactosyltransferase gene-deficient pigs by somatic cell nuclear transfer: a novel selection method for gal alpha 1,3-Gal antigen-deficient cells.

    PubMed

    Fujimura, Tatsuya; Takahagi, Yoichi; Shigehisa, Tamotsu; Nagashima, Hiroshi; Miyagawa, Shuji; Shirakura, Ryota; Murakami, Hiroshi

    2008-09-01

    The objective of the present study was to isolate alpha 1,3-galactosyltransferase (GalGT)-gene double knockout (DKO) cells using a novel simple method of cell selection method. To obtain GalGT-DKO cells, GalGT-gene single knockout (SKO) fetal fibroblast cells were cultured for three to nine passages and GalGT-null cells were separated using a biotin-labeled IB4 lectin attached to streptavidin-coated magnetic beads. After 15-17 days of additional cultivation, seven GalGT-DKO cell colonies were obtained from a total of 2.5 x 10(7) GalGT-SKO cells. A total of 926 somatic nuclear transferred embryos reconstructed with the DKO cells were transferred into eight recipient pigs, producing four farrowed, three liveborns, and six stillborns. Absence of GalGT gene in the cloned pigs was confirmed by PCR and Southern blotting. Flow cytometric analysis revealed that alphaGal antigens were not present in the cells of the cloned DKO pigs.

  9. Improved methods of AAV-mediated gene targeting for human cell lines using ribosome-skipping 2A peptide

    PubMed Central

    Karnan, Sivasundaram; Ota, Akinobu; Konishi, Yuko; Wahiduzzaman, Md; Hosokawa, Yoshitaka; Konishi, Hiroyuki

    2016-01-01

    The adeno-associated virus (AAV)-based targeting vector has been one of the tools commonly used for genome modification in human cell lines. It allows for relatively efficient gene targeting associated with 1–4-log higher ratios of homologous-to-random integration of targeting vectors (H/R ratios) than plasmid-based targeting vectors, without actively introducing DNA double-strand breaks. In this study, we sought to improve the efficiency of AAV-mediated gene targeting by introducing a 2A-based promoter-trap system into targeting constructs. We generated three distinct AAV-based targeting vectors carrying 2A for promoter trapping, each targeting a GFP-based reporter module incorporated into the genome, PIGA exon 6 or PIGA intron 5. The absolute gene targeting efficiencies and H/R ratios attained using these vectors were assessed in multiple human cell lines and compared with those attained using targeting vectors carrying internal ribosome entry site (IRES) for promoter trapping. We found that the use of 2A for promoter trapping increased absolute gene targeting efficiencies by 3.4–28-fold and H/R ratios by 2–5-fold compared to values obtained with IRES. In CRISPR-Cas9-assisted gene targeting using plasmid-based targeting vectors, the use of 2A did not enhance the H/R ratios but did upregulate the absolute gene targeting efficiencies compared to the use of IRES. PMID:26657635

  10. A mental retardation gene, motopsin/neurotrypsin/prss12, modulates hippocampal function and social interaction

    PubMed Central

    Mitsui, Shinichi; Osako, Yoji; Yokoi, Fumiaki; Dang, Mai T.; Yuri, Kazunari; Li, Yuqing; Yamaguchi, Nozomi

    2010-01-01

    Motopsin is a mosaic serine protease secreted from neuronal cells in various brain regions including the hippocampus. The loss of motopsin function causes nonsyndromic mental retardation in humans and impairs long-term memory formation in Drosophila. To understand motopsin’s function in the mammalian brain, motopsin knockout mice were generated. Motopsin knockout mice did not have significant deficit in memory formation, as was tested using in the Morris water maze, passive avoidance, and Y-maze tests. A social recognition test showed that the motopsin knockout mice had the ability to recognize two stimulator mice, suggesting normal social memory. In a social novelty test, motopsin knockout mice spent a longer time investigating a familiar mouse than wild-type mice did. In a resident-intruder test, motopsin knockout mice showed prolonged social interaction compared to wild-type mice. Consistent with the behavioral deficit, spine density was significantly decreased on apical dendrites, but not on basal dendrites, of hippocampal pyramidal neurons of motopsin knockout mice. In contrast, pyramidal neurons at the cingulate cortex showed normal spine density. Spatial learning and social interaction induced the phosphorylation of cAMP responsive element binding protein (CREB) in hippocampal neurons of wild-type mice, whereas the phosphorylation of CREB was markedly decreased in mutant mouse brains. Our results indicate that an extracellular protease, motopsin, preferentially affects social behaviors, and modulates the functions of hippocampal neurons. PMID:20092579

  11. [Construction, identification and expression of three kinds of shuttle plasmids of adenovirus expression vector of hepatitis C virus structure gene].

    PubMed

    Cao, Yi-zhan; Hao, Chun-qiu; Feng, Zhi-hua; Zhou, Yong-xing; Li, Jin-ge; Jia, Zhan-sheng; Wang, Ping-zhong

    2003-02-01

    To construct three recombinant shuttle plasmids of adenovirus expression vector which can express hepatitis C virus(HCV) different structure genes(C, C+E1, C+E1+E2) in order to pack adenovirus expression vectors which can express HCV different structure gene effectively. The different HCV structure genes derived from the plasmid pBRTM/HCV1-3011 by using polymerase chain reaction (PCR) were inserted into the backward position of cytomegalovirus(CMV) immediate early promotor element of shuttle plasmid(pAd.CMV-Link.1) of adenovirus expression vector respectively, then the three recombinant plasmids (pAd.HCV-C, pAd.HCV-CE1, pAd.HCV-S) were obtained. The recombinant plasmids were identified by endonuclease, PCR and sequencing. HCV structure genes were expressed transiently with Lipofectamine 2000 coated in HepG2 cells which were confirmed by immunofluorescence and Western-Blot. Insert DNAs of the three recombinant plasmids' were confirmed to be HCV different structure genes by endonuclease, PCR and sequencing. The three recombinant plasmids can express HCV structure gene (C, C+E1, C+E1+E2) transiently in HepG2 cells which were confirmed by immunofluorescence and Western-Blot. The three recombinant shuttle plasmids of adenovirus expression vector can express HCV structure gene(C, C+E1, C+E1+E2) transiently. This should be useful to pack adenovirus expression vector which can express HCV structure genes.

  12. Evaluation of the specificity and sensitivity of ferritin as an MRI reporter gene in the mouse brain using lentiviral and adeno-associated viral vectors.

    PubMed

    Vande Velde, G; Rangarajan, J R; Toelen, J; Dresselaers, T; Ibrahimi, A; Krylychkina, O; Vreys, R; Van der Linden, A; Maes, F; Debyser, Z; Himmelreich, U; Baekelandt, V

    2011-06-01

    The development of in vivo imaging protocols to reliably track transplanted cells or to report on gene expression is critical for treatment monitoring in (pre)clinical cell and gene therapy protocols. Therefore, we evaluated the potential of lentiviral vectors (LVs) and adeno-associated viral vectors (AAVs) to express the magnetic resonance imaging (MRI) reporter gene ferritin in the rodent brain. First, we compared the induction of background MRI contrast for both vector systems in immune-deficient and immune-competent mice. LV injection resulted in hypointense (that is, dark) changes of T(2)/T(2)(*) (spin-spin relaxation time)-weighted MRI contrast at the injection site, which can be partially explained by an inflammatory response against the vector injection. In contrast to LVs, AAV injection resulted in reduced background contrast. Moreover, AAV-mediated ferritin overexpression resulted in significantly enhanced contrast to background on T(2)(*)-weighted MRI. Although sensitivity associated with the ferritin reporter remains modest, AAVs seem to be the most promising vector system for in vivo MRI reporter gene imaging.

  13. Combination Gene Therapy for Liver Metastasis of Colon Carcinoma in vivo

    NASA Astrophysics Data System (ADS)

    Chen, Shu-Hsai; Chen, X. H. Li; Wang, Yibin; Kosai, Ken-Ichiro; Finegold, Milton J.; Rich, Susan S.

    1995-03-01

    The efficacy of combination therapy with a "suicide gene" and a cytokine gene to treat metastatic colon carcinoma in the liver was investigated. Tumor in the liver was generated by intrahepatic injection of a colon carcinoma cell line (MCA-26) in syngeneic BALB/c mice. Recombinant adenoviral vectors containing various control and therapeutic genes were injected directly into the solid tumors, followed by treatment with ganciclovir. While the tumors continued to grow in all animals treated with a control vector or a mouse interleukin 2 vector, those treated with a herpes simplex virus thymidine kinase vector, with or without the coadministration of the mouse interleukin 2 vector, exhibited dramatic necrosis and regression. However, only animals treated with both vectors developed an effective systemic antitumoral immunity against challenges of tumorigenic doses of parental tumor cells inoculated at distant sites. The antitumoral immunity was associated with the presence of MCA-26 tumor-specific cytolytic CD8^+ T lymphocytes. The results suggest that combination suicide and cytokine gene therapy in vivo can be a powerful approach for treatment of metastatic colon carcinoma in the liver.

  14. Reporter gene expression in fish following cutaneous infection with pantropic retroviral vectors.

    PubMed

    Paul, T A; Burns, J C; Shike, H; Getchell, R; Bowser, P R; Whitlock, K E; Casey, J W

    2001-06-01

    A central issue in gene delivery systems is choosing promoters that will direct defined and sustainable levels of gene expression. Pantropic retroviral vectors provide a means to insert genes into either somatic or germline cells. In this study, we focused on somatic cell infection by evaluating the activity of 3 promoters inserted by vectors into fish cell lines and fish skin using pantropic retroviruses. In bluegill and zebrafish cell lines, the highest levels of luciferase expression were observed from the 5' murine leukemia virus long terminal repeat of the retroviral vector. The Rous sarcoma virus long terminal repeat and cytomegalovirus early promoter, as internal promoters, generated lower levels of luciferase. Luciferase reporter vectors infected zebrafish skin, as measured by the presence of viral DNA, and expressed luciferase. We infected developing walleye dermal sarcomas with retroviral vectors to provide an environment with enhanced cell proliferation, a condition necessary for integration of the provirus into the host genome. We demonstrated a 4-fold to 7-fold increase in luciferase gene expression in tumor tissue over infections in normal walleye skin.

  15. Deletion of CXCR4 in cardiomyocytes exacerbates cardiac dysfunction following isoproterenol administration

    PubMed Central

    Wang, ER; Jarrah, AA; Benard, L; Chen, J; Schwarzkopf, M; Hadri, L; Tarzami, ST

    2014-01-01

    Altered alpha- and beta-adrenergic receptor signaling is associated with cardiac hypertrophy and failure. Stromal cell-derived factor-1α (SDF-1α) and its cognate receptor CXCR4 have been reported to mediate cardioprotection after injury through the mobilization of stem cells into injured tissue. However, little is known regarding whether SDF-1/CXCR4 induces acute protection following pathological hypertrophy and if so, by what molecular mechanism. We have previously reported that CXCR4 physically interacts with the beta-2 adrenergic receptor and modulates its down stream signaling. Here we have shown that CXCR4 expression prevents beta-adrenergic receptor induced hypertrophy. Cardiac beta-adrenergic receptors were stimulated with the implantation of a subcutaneous osmotic pump administrating isoproterenol and CXCR4 expression was selectively abrogated in cardiomyocytes using Cre-loxP-mediated gene recombination. CXCR4 knockout mice showed worsened fractional shortening and ejection fraction. CXCR4 ablation increased susceptibility to isoproterenol-induced heart failure, by upregulating apoptotic markers and reducing mitochondrial function; cardiac function decreases while fibrosis increases. Additionally, CXCR4 expression was rescued with the use of cardiotropic Adeno-associated viral-9 (AAV9) vectors. CXCR4 gene transfer reduced cardiac apoptotic signaling, improved mitochondrial function and resulted in a recovered cardiac function. Our results represent the first evidence that SDF-1/CXCR4 signaling mediates acute cardioprotection through modulating beta-adrenergic receptor signaling in vivo. PMID:24646609

  16. Transcriptional activation of PPARalpha by phenobarbital in the absence of CAR and PXR.

    PubMed

    Tamasi, Viola; Juvan, Peter; Beer, Markus; Rozman, Damjana; Meyer, Urs A

    2009-01-01

    The nuclear receptors CAR (constitutive androstane receptor) and PXR (pregnane X receptor) mediate the effects of phenobarbital on gene transcription. To investigate the relative contribution of these nuclear receptors to the expression of specific genes we studied the effect of phenobarbital in livers of wild type, CAR(-/-), PXR(-/-) and CAR/PXR(-/-) knockout mice. Spotted Steroltalk v1 cDNA arrays were applied containing probes for genes involved in drug metabolism, sterol biosynthesis, steroid synthesis/transport and heme synthesis. In the absence of CAR and PXR, phenobarbital unexpectedly induced mRNAs of several nuclear receptors, including PPARalpha and its target genes Cyp4a10 and Cyp4a14. Interestingly, in primary cultures of hepatocytes isolated from CAR/PXR(-/-) knockout mice, phenobarbital increased HNF-4alpha levels. In further experiments in these hepatocyte cultures we provide evidence that phenobarbital directly induces transcription of the PPARalpha gene via its HNF-4alpha response element, and indirectly by lack of inhibitory crosstalk of AMPK, CAR and PXR with HNF-4alpha. Our results provide further insight into CAR and PXR-independent effects of phenobarbital and the crosstalk between different nuclear receptor signaling pathways.

  17. Bacterial and Pneumocystis Infections in the Lungs of Gene-Knockout Rabbits with Severe Combined Immunodeficiency

    PubMed Central

    Song, Jun; Wang, Guoshun; Hoenerhoff, Mark J.; Ruan, Jinxue; Yang, Dongshan; Zhang, Jifeng; Yang, Jibing; Lester, Patrick A.; Sigler, Robert; Bradley, Michael; Eckley, Samantha; Cornelius, Kelsey; Chen, Kong; Kolls, Jay K.; Peng, Li; Ma, Liang; Chen, Yuqing Eugene; Sun, Fei; Xu, Jie

    2018-01-01

    Using the CRISPR/Cas9 gene-editing technology, we recently produced a number of rabbits with mutations in immune function genes, including FOXN1, PRKDC, RAG1, RAG2, and IL2RG. Seven founder knockout rabbits (F0) and three male IL2RG null (−/y) F1 animals demonstrated severe combined immunodeficiency (SCID), characterized by absence or pronounced hypoplasia of the thymus and splenic white pulp, and absence of immature and mature T and B-lymphocytes in peripheral blood. Complete blood count analysis showed severe leukopenia and lymphocytopenia accompanied by severe neutrophilia. Without prophylactic antibiotics, the SCID rabbits universally succumbed to lung infections following weaning. Pathology examination revealed severe heterophilic bronchopneumonia caused by Bordetella bronchiseptica in several animals, but a consistent feature of lung lesions in all animals was a severe interstitial pneumonia caused by Pneumocystis oryctolagi, as confirmed by histological examination and PCR analysis of Pneumocystis genes. The results of this study suggest that these SCID rabbits could serve as a useful model for human SCID to investigate the disease pathogenesis and the development of gene and drug therapies. PMID:29593714

  18. Genetic Basis of Melanin Pigmentation in Butterfly Wings

    PubMed Central

    Zhang, Linlin; Martin, Arnaud; Perry, Michael W.; van der Burg, Karin R. L.; Matsuoka, Yuji; Monteiro, Antónia; Reed, Robert D.

    2017-01-01

    Despite the variety, prominence, and adaptive significance of butterfly wing patterns, surprisingly little is known about the genetic basis of wing color diversity. Even though there is intense interest in wing pattern evolution and development, the technical challenge of genetically manipulating butterflies has slowed efforts to functionally characterize color pattern development genes. To identify candidate wing pigmentation genes, we used RNA sequencing to characterize transcription across multiple stages of butterfly wing development, and between different color pattern elements, in the painted lady butterfly Vanessa cardui. This allowed us to pinpoint genes specifically associated with red and black pigment patterns. To test the functions of a subset of genes associated with presumptive melanin pigmentation, we used clustered regularly interspaced short palindromic repeats (CRISPR)/Cas9 genome editing in four different butterfly genera. pale, Ddc, and yellow knockouts displayed reduction of melanin pigmentation, consistent with previous findings in other insects. Interestingly, however, yellow-d, ebony, and black knockouts revealed that these genes have localized effects on tuning the color of red, brown, and ochre pattern elements. These results point to previously undescribed mechanisms for modulating the color of specific wing pattern elements in butterflies, and provide an expanded portrait of the insect melanin pathway. PMID:28193726

  19. Development of a one-step gene knock-out and knock-in method for metabolic engineering of Aureobasidium pullulans.

    PubMed

    Guo, Jian; Wang, Yuanhua; Li, Baozhong; Huang, Siyao; Chen, Yefu; Guo, Xuewu; Xiao, Dongguang

    2017-06-10

    Aureobasidium pullulans is an increasingly attractive host for bio-production of pullulan, heavy oil, polymalic acid, and a large spectrum of extracellular enzymes. To date, genetic manipulation of A. pullulans mainly relies on time-consuming conventional restriction enzyme digestion and ligation methods. In this study, we present a one-step homologous recombination-based method for rapid genetic manipulation in A. pullulans. Overlaps measuring >40bp length and 10μg DNA segments for homologous recombination provided maximum benefits to transformation of A. pullulans. This optimized method was successfully applied to PKSIII gene (encodes polyketide synthase) knock-out and gltP gene (encodes glycolipid transfer protein) knock-in. After disruption of PKSIII gene, secretion of melanin decreased slightly. The melanin purified from disruptant showed lower reducing capacity compared with that of the parent strain, leading to a decrease in exopolysaccharide production. Knock-in of gltP gene resulted in at least 4.68-fold increase in heavy oil production depending on the carbon source used, indicating that gltP can regulate heavy oil synthesis in A. pullulans. Copyright © 2017 Elsevier B.V. All rights reserved.

  20. A Knockout Screen of ApiAP2 Genes Reveals Networks of Interacting Transcriptional Regulators Controlling the Plasmodium Life Cycle.

    PubMed

    Modrzynska, Katarzyna; Pfander, Claudia; Chappell, Lia; Yu, Lu; Suarez, Catherine; Dundas, Kirsten; Gomes, Ana Rita; Goulding, David; Rayner, Julian C; Choudhary, Jyoti; Billker, Oliver

    2017-01-11

    A family of apicomplexa-specific proteins containing AP2 DNA-binding domains (ApiAP2s) was identified in malaria parasites. This family includes sequence-specific transcription factors that are key regulators of development. However, functions for the majority of ApiAP2 genes remain unknown. Here, a systematic knockout screen in Plasmodium berghei identified ten ApiAP2 genes that were essential for mosquito transmission: four were critical for the formation of infectious ookinetes, and three were required for sporogony. We describe non-essential functions for AP2-O and AP2-SP proteins in blood stages, and identify AP2-G2 as a repressor active in both asexual and sexual stages. Comparative transcriptomics across mutants and developmental stages revealed clusters of co-regulated genes with shared cis promoter elements, whose expression can be controlled positively or negatively by different ApiAP2 factors. We propose that stage-specific interactions between ApiAP2 proteins on partly overlapping sets of target genes generate the complex transcriptional network that controls the Plasmodium life cycle. Copyright © 2017 The Author(s). Published by Elsevier Inc. All rights reserved.

Top