Science.gov

Sample records for gene molecular cloning

  1. Gene Transfer and Molecular Cloning of the Human NGF Receptor

    NASA Astrophysics Data System (ADS)

    Chao, Moses V.; Bothwell, Mark A.; Ross, Alonzo H.; Koprowski, Hilary; Lanahan, Anthony A.; Buck, C. Randall; Sehgal, Amita

    1986-04-01

    Nerve growth factor (NGF) and its receptor are important in the development of cells derived from the neural crest. Mouse L cell transformants have been generated that stably express the human NGF receptor gene transfer with total human DNA. Affinity cross-linking, metabolic labeling and immunoprecipitation, and equilibrium binding with 125I-labeled NGF revealed that this NGF receptor had the same size and binding characteristics as the receptor from human melanoma cells and rat PC12 cells. The sequences encoding the NGF receptor were molecularly cloned using the human Alu repetitive sequence as a probe. A cosmid clone that contained the human NGF receptor gene allowed efficient transfection and expression of the receptor.

  2. Molecular cloning of gluconobacter oxydans DSM 2003 xylitol dehydrogenase gene.

    PubMed

    Sadeghi, H Mir Mohammad; Ahmadi, R; Aghaabdollahian, S; Mofid, M R; Ghaemi, Y; Abedi, D

    2011-01-01

    Due to the widespread applications of xylitol dehydrogenase, an enzyme used for the production of xylitol, the present study was designed for the cloning of xylitol dehydrogenase gene from Glcunobacter oxydans DSM 2003. After extraction of genomic DNA from this bacterium, xylitol dehydrogenase gene was replicated using polymerase chain reaction (PCR). The amplified product was entered into pTZ57R cloning vector by T/A cloning method and transformation was performed by heat shocking of the E. coli XL1-blue competent cells. Following plasmid preparation, the cloned gene was digested out and ligated into the expression vector pET-22b(+). Electrophoresis of PCR product showed a 789 bp band. Recombinant plasmid (rpTZ57R) was then constructed. This plasmid was double digested with XhoI and EcoRI resulting in 800 bp and 2900 bp bands. The obtained insert was ligated into pET-22b(+) vector and its orientation was confirmed with XhoI and BamHI restriction enzymes. In conclusion, in the present study the recombinant expression vector containing xylitol dehydrogenase gene has been constructed and can be used for the production of this enzyme in high quantities.

  3. Using "Pseudomonas Putida xylE" Gene to Teach Molecular Cloning Techniques for Undergraduates

    ERIC Educational Resources Information Center

    Dong, Xu; Xin, Yi; Ye, Li; Ma, Yufang

    2009-01-01

    We have developed and implemented a serial experiment in molecular cloning laboratory course for undergraduate students majored in biotechnology. "Pseudomonas putida xylE" gene, encoding catechol 2, 3-dioxygenase, was manipulated to learn molecular biology techniques. The integration of cloning, expression, and enzyme assay gave students…

  4. Using "Pseudomonas Putida xylE" Gene to Teach Molecular Cloning Techniques for Undergraduates

    ERIC Educational Resources Information Center

    Dong, Xu; Xin, Yi; Ye, Li; Ma, Yufang

    2009-01-01

    We have developed and implemented a serial experiment in molecular cloning laboratory course for undergraduate students majored in biotechnology. "Pseudomonas putida xylE" gene, encoding catechol 2, 3-dioxygenase, was manipulated to learn molecular biology techniques. The integration of cloning, expression, and enzyme assay gave students…

  5. Molecular cloning of the 8000-base thyroglobulin structural gene.

    PubMed

    Christophe, D; Mercken, L; Brocas, H; Pohl, V; Vassart, G

    1982-03-01

    Bovine thyroglobulin mRNA was reverse-transcribed into full-length double-stranded cDNA. The existence of three HindIII restriction endonuclease sites in the 8000-base thyroglobulin structural gene had allowed the easy cloning of the two internal HindIII fragments [Christophe et al. (1980) Eur. J. Biochem. 111, 419-423]. In the present study, the central portion of the structural gene was cloned in Escherichia coli as two individual recombinant plasmids containing 2000-base-pair and 4700-base-pair segments located respectively 5' and 3' relative to the unique BamHI site of the cDNA. BamHI linkers were added to the double-stranded cDNA and, following restriction with HindIII, selective cloning of the 5' (2600-base-pair) and 3' (1000-base-pair) terminal HindIII fragments was achieved by inserting them between the HindIII and BamHI sites of the plasmid pBR322. Partial sequencing of the 1000-base-pair 3'-terminal fragment demonstrated the presence of an A-A-U-A-A-A sequence in the mRNA 14 bases upstream from a poly(A) tract corresponding to the 3' end of the mRNA. Together, the four clones represent about 99% of the thyroglobulin structural gene and provide the starting material for the determination of thyroglobulin primary structure.

  6. A highly efficient molecular cloning platform that utilises a small bacterial toxin gene.

    PubMed

    Mok, Wendy W K; Li, Yingfu

    2013-04-15

    Molecular cloning technologies that have emerged in recent years are more efficient and simpler to use than traditional strategies, but many have the disadvantages of requiring multiple steps and expensive proprietary enzymes. We have engineered cloning vectors containing variants of IbsC, a 19-residue toxin from Escherichia coli K-12. These toxic peptides offer selectivity to minimise the background, labour, and cost associated with conventional molecular cloning. As demonstrated with the cloning of reporter genes, this "detox cloning" system consistently produced over 95 % positive clones. Purification steps between digestion and ligation are not necessary, and the total time between digestion and plating of transformants can be as little as three hours. Thus, these IbsC-based cloning vectors are as reliable and amenable to high-throughput cloning as commercially available systems, and have the advantage of being more time-efficient and cost-effective.

  7. Molecular cloning of Taenia taeniaeformis oncosphere antigen genes.

    PubMed

    Cougle, W G; Lightowlers, M W; Bogh, H O; Rickard, M D; Johnson, K S

    1991-03-01

    Infection of mice with the cestode Taenia taeniaeformis exhibits several important features common to other cestode infections, including the ability to vaccinate with crude antigen mixtures. Partial purification of the protective oncosphere antigens has been reported with a cutout from deoxycholate (DOC) acrylamide gels; this cutout was called fraction II (FII), and comprises approximately 10% of total DOC-soluble oncosphere antigen. Western blots of DOC gels probed with anti-FII antisera revealed a series of 3-5 discrete bands within the FII region. Further fractionation of the FII antigens on DOC gels was impractical due to limitations in supply of oncospheres, so a cDNA library was constructed from 150 ng of oncosphere mRNA and screened with alpha-FII antisera. Two distinct clone families were identified, oncA and oncB. Antibodies affinity-purified on either of two representative members, oncA1 and oncB1, recognised all the FII bands. Individual FII bands excised from a DOC gel resolved into an overlapping series of molecules when re-run on SDS-PAGE, indicating that each FII band consisted of several polypeptides of differing molecular weight. Immunoprecipitates resolved on SDS-PAGE revealed that alpha-FII recognised 3 major oncosphere antigens, of 62, 34 and 25 kDa; antisera against oncB precipitated both the 34- and 25-kDa antigens, whereas alpha-oncA antisera precipitated the 62-kDa antigen. We conclude that oncA and oncB encode the major antigens in the FII complex. The 62-kDa antigen encoded by oncA1 was the only common antigen precipitated by anti-FII and two other antisera raised against different protective extracts, suggesting that it may be a protective component in all three. Southern blot results indicate that oncA and oncB are distinct genes present at low copy number in the genome. Evidence is also presented suggesting that some cestode mRNAs, including oncA, may use variant polyadenylation signals.

  8. Molecular cloning of genes that specify virulence in Pseudomonas solanacearum.

    PubMed

    Xu, P L; Leong, S; Sequeira, L

    1988-02-01

    The suicide plasmid pSUP2021 was used to introduce Tn5 into the Pseudomonas solanacearum wild-type strain K60. We isolated eight avirulent mutants after screening 6,000 kanamycin-resistant transconjugants by inoculating eggplant (Solanum melongena L. cv. Black Beauty) and tobacco (Nicotiana tabacum L. cv. Bottom Special) seedlings. The Tn5-containing EcoRI fragments from the eight mutants were unique, suggesting that numerous genes specify virulence in this species. These EcoRI fragments were cloned into pBR322 or pUC12, and one of the clones, pKD810, was transformed into K60. All of the kanamycin-resistant, ampicillin-sensitive transformants were avirulent. Three randomly selected avirulent transformants were shown to carry the Tn5-containing fragment in place of the wild-type fragment and to exhibit the same hybridization pattern as the original KD810 mutant did. With pKD810 as a probe, we identified cosmids carrying the wild-type virulence genes by using a genomic library of K60 prepared in pLAFR3. Two of the homologous cosmids, pL810A and pL810C, when introduced into KD810 by transformation, restored virulence and normal growth of this mutant in tobacco. Altogether, these data indicate that the gene(s) interrupted by Tn5 insertion in KD810 is essential for the virulence of P. solanacearum. Further characterization of this gene is now being completed by subcloning, transposon mutagenesis, and complementation analysis.

  9. Molecular transformation, gene cloning, and gene expression systems for filamentous fungi

    USGS Publications Warehouse

    Gold, Scott E.; Duick, John W.; Redman, Regina S.; Rodriguez, Rusty J.

    2001-01-01

    This chapter discusses the molecular transformation, gene cloning, and gene expression systems for filamentous fungi. Molecular transformation involves the movement of discrete amounts of DNA into cells, the expression of genes on the transported DNA, and the sustainable replication of the transforming DNA. The ability to transform fungi is dependent on the stable replication and expression of genes located on the transforming DNA. Three phenomena observed in bacteria, that is, competence, plasmids, and restriction enzymes to facilitate cloning, were responsible for the development of molecular transformation in fungi. Initial transformation success with filamentous fungi, involving the complementation of auxotrophic mutants by exposure to sheared genomic DNA or RNA from wt isolates, occurred with low transformation efficiencies. In addition, it was difficult to retrieve complementing DNA fragments and isolate genes of interest. This prompted the development of transformation vectors and methods to increase efficiencies. The physiological studies performed with fungi indicated that the cell wall could be removed to generate protoplasts. It was evident that protoplasts could be transformed with significantly greater efficiencies than walled cells.

  10. Molecular cloning and functional analysis of the goose FSHβ gene.

    PubMed

    Huang, Z; Li, X; Li, Y; Liu, R; Chen, Y; Wu, N; Wang, M; Song, Y; Yuan, X; Lan, L; Xu, Q; Chen, G; Zhao, W

    2015-01-01

    The objective of this investigation was to clone goose FSHβ-subunit cDNA and to construct a FSH fusion gene to identify the function of FSHβ mRNA during stages of the breeding cycle. The FSHβ gene was obtained by reverse transcription-PCR, and the full-length FSHβ mRNA sequence was amplified by rapid-amplification of cDNA ends. FSHβ mRNA expression was detected in reproductive tissues at different stages (pre-laying, laying period, and broody period). Additionally, the expression of 4 genes known to be involved in reproduction (FSHβ, GnRH, GH, and BMP) were evaluated in COS-7 cells expressing the fusion gene (pVITRO2-FSHαβ-CTP). The results show that the FSHβ gene consists of a 16 base pair (bp) 5'-untranslated region (UTR), 396 bp open reading frame, and alternative 3'-UTRs at 518 bp and 780 bp, respectively. qPCR analyses revealed that FSHβ mRNA is highly transcribed in reproductive tissues, including the pituitary, hypothalamus, ovaries, and oviduct. FSHβ mRNA expression increased and subsequently decreased in the pituitary, ovaries, and oviduct during the reproductive stages. Stable FSH expression was confirmed using enzyme-linked immunosorbent assays after transfection with the pVITRO2-FSHαβ-CTP plasmid. FSHβ, GnRH, and BMP expression increased significantly 36 h and 48 h after transfection with the fusion gene in COS-7 cells. The results demonstrate that the FSHβ subunit functions in the goose reproductive cycle and provides a theoretical basis for future breeding work.

  11. Molecular cloning and characterization of the Candida albicans enolase gene.

    PubMed Central

    Mason, A B; Buckley, H R; Gorman, J A

    1993-01-01

    A DNA clone containing the putative Candida albicans enolase gene (ENO1) was isolated from a genomic DNA library. The sequenced insert contained a continuous open reading frame of 1,320 bp. The predicted 440-amino-acid protein is 78 and 76% identical, respectively, to Saccharomyces cerevisiae enolase proteins 1 and 2. Only one enolase gene could be detected in C. albicans genomic DNA by Southern analysis with a homologous probe. Northern (RNA) analysis detected a single, abundant C. albicans ENO1 transcript of approximately 1,600 nucleotides. When cells were grown on glucose, levels of ENO1 mRNA were markedly increased by comparison with ENO1 mRNA levels in cells grown on ethanol, a gluconeogenic carbon source. In contrast to this glucose-mediated transcriptional induction, the carbon source had no dramatic effect on the levels of enolase protein or enzyme activity in the C. albicans strains tested. These results suggest that posttranscriptional mechanisms are responsible for modulating expression of the C. albicans enolase gene. Images PMID:8478328

  12. Molecular cloning and analysis of the Catsper1 gene promoter.

    PubMed

    Mata-Rocha, Minerva; Alvarado-Cuevas, Edith; Hernández-Sánchez, Javier; Cerecedo, Doris; Felix, Ricardo; Hernández-Reyes, Adriana; Tesoro-Cruz, Emiliano; Oviedo, Norma

    2013-05-01

    CatSper channels are essential for hyperactivity of sperm flagellum, progesterone-mediated chemotaxis and oocyte fertilization. Catsper genes are exclusively expressed in the testis during spermatogenesis, but the function and regulation of the corresponding promoter regions are unknown. Here, we report the cloning and characterization of the promoter regions in the human and murine Catsper1 genes. These promoter regions were identified and isolated from genomic DNA, and transcriptional activities were tested in vitro after transfection into human embryonic kidney 293, mouse Sertoli cells 1 and GC-1spg cell lines as well as by injecting plasmids directly into mouse testes. Although the human and murine Catsper1 promoters lacked a TATA box, a well-conserved CRE site was identified. Both sequences may be considered as TATAless promoters because their transcriptional activity was not affected after deletion of TATA box-like sites. Several transcription initiation sites were revealed by RNA ligase-mediated rapid amplification of the cDNA 5'-ends. We also found that the immediate upstream region and the first exon in the human CATSPER1 gene negatively regulate transcriptional activity. In the murine Catsper1 promoter, binding sites for transcription factors SRY, SOX9 and CREB were protected by the presence of nuclear testis proteins in DNAse degradation assays. Likewise, the mouse Catsper1 promoter exhibited transcriptional activity in both orientations and displayed significant expression levels in mouse testis in vivo, whereas the suppression of transcription signals in the promoter resulted in low expression levels. This study, thus, represents the first identification of the transcriptional control regions in the genes encoding the human and murine CatSper channels.

  13. Molecular cloning.

    PubMed

    Lessard, Juliane C

    2013-01-01

    This protocol describes the basic steps involved in conventional plasmid-based cloning. The goals are to insert a DNA fragment of interest into a receiving vector plasmid, transform the plasmid into E. coli, recover the plasmid DNA, and check for correct insertion events.

  14. Molecular cloning of a gene involved in methotrexate uptake by DNA-mediated gene transfer.

    PubMed

    Underhill, T M; Williams, F M; Murray, R C; Flintoff, W F

    1992-07-01

    A methotrexate-resistant Chinese hamster ovary cell line deficient in methotrexate uptake has been complemented to methotrexate sensitivity by transfection with DNA isolated from a wild-type Chinese hamster ovary genomic cosmid library. Primary and secondary transfectants, which contain a limited number of cosmid sequences, have been shown to regain methotrexate sensitivity and to take up methotrexate. Furthermore, the DNA from three cosmid clones, isolated from a primary methotrexate-sensitive transfectant, after transfection rescued the methotrexate-resistant phenotype at a high frequency. Restriction endonuclease analysis of the DNA of these cosmid clones indicated that they overlapped extensively and shared two regions of Chinese hamster ovary DNA of 6.6 kb and 20.6 kb. These observations indicate that a gene involved in methotrexate uptake is contained in its entirety within one of these regions. This is the first report of the functional molecular cloning of a gene involved in methotrexate uptake. A general strategy is also described for screening large cosmid libraries from primary transfectants.

  15. Molecular cloning and characterization of an extracellular protease gene from Aeromonas hydrophila.

    PubMed Central

    Rivero, O; Anguita, J; Paniagua, C; Naharro, G

    1990-01-01

    A structural gene which codes for an extracellular protease in Aeromonas hydrophilia SO2/2 and D13 was cloned in Escherichia coli C600-1 by using pBR322 as a vector. The gene codes for a temperature-stable protease with a molecular mass of approximately 38,000 daltons. The protein was secreted to the periplasm of E. coli C600-1 and purified by osmotic shock. Cloned protease (P3) was identical in molecular mass and properties to the one purified from A. hydrophila SO2/2 culture supernatant as an extracellular product. Images PMID:2193924

  16. Molecular Cloning of the Human Genes(s) Directing the Synthesis of Nervous System Cholinesterases.

    DTIC Science & Technology

    1985-12-01

    AD-8163 229 MOLECULAR CLONING OF THE HUMAN GENES (S) DIRECTING THE 1/1 SYNTHESIS OF NERYOU.. (U) NEIZMANN INST OF SCIENCE REHOVOT (ISRAEL) DEPT OF...whether these forms are produced from discrete genes or by post-transcrip- tional and post-translational processing. In addition, the amino acid...brain cholinseee (aRE.) is =*rxm yet, Which leaves open several questions Of cosdeal 1. Are the various Ch foru produiced from discrete genes , or is

  17. Molecular cloning and expression of the mouse ornithine decarboxylase gene.

    PubMed Central

    McConlogue, L; Gupta, M; Wu, L; Coffino, P

    1984-01-01

    We used mRNA from a mutant S49 mouse lymphoma cell line that produces ornithine decarboxylase (OrnDCase) as its major protein product to synthesize and clone cDNA. Plasmids containing OrnDCase cDNA were identified by hybrid selection of OrnDCase mRNA and in vitro translation. The two of these with the largest inserts together span 2.05 kilobases of cDNA. Southern blot analysis of DNA from wild-type or mutant S49 cells, cleaved with EcoRI or with BamHI, revealed multiple bands homologous to OrnD-Case cDNA, only one of which was amplified in the mutant cells. RNA transfer blot analysis showed that the major OrnD-Case mRNA in the mouse lymphoma cells is 2.0 kilobases long. A similar size mRNA was found in mouse kidney and was more abundant in the kidneys of mice treated with testosterone, an inducer of OrnDCase activity in that tissue. Images PMID:6582509

  18. [Molecular cloning and expression of Nattokinase gene in Bacillus subtilis].

    PubMed

    Liu, B Y; Song, H Y

    2002-05-01

    In order to characterize biochemically the nattokinase,the nucleotide sequence of the nattokinase gene was amplified from the chromosomal DNA of B.subtilis (natto) by PCR. The expression plasmid pBL NK was constructed and was used to transform Bacillus subtilis containing a chromosomal deletion in its subtilisin gene. The supernatant of the culture was collected after 15 h culture. The target proteins were identified by SDS-PAGE. Nattokinase was purified by a method including ultrafiltration, Sephacryl S-100 gel filtration and S-Sepharose ion-exchange chromatography, and 100 mg of purified nattokinase was obtained from one liter of culture. The purity of the protein and the specific activity were 95% and 12 000 u/mg (compared to tPA), respectively.

  19. Molecular cloning of an olfactory gene from Drosophila melanogaster.

    PubMed Central

    Hasan, G

    1990-01-01

    An olfactory gene olfE, which affects response to benzaldehyde in larvae and adults of Drosophila melanogaster, has been mapped between two breakpoints on the X chromosome. The breakpoints have been shown to lie at a distance no greater than 25 kilobases (kb). A 14-kb genomic fragment from this region has been used for germ-line transformation of olfE mutant flies, and in one of three transformant lines obtained, rescue of the olfE phenotype is observed by two separate behavioral assays. Transcript analysis of the region that rescues the olfE phenotype has shown one major transcript at 5.4 kb and a minor one at 1.7 kb. Both of these transcripts are probably alternatively spliced products of the olfE gene. A developmental and tissue-specific profile of the 5.4-kb olfE message has shown that it is present at all developmental stages, suggesting that the gene may be multifunctional. Images PMID:2123349

  20. Molecular cloning and SNP association analysis of chicken PMCH gene.

    PubMed

    Sun, Guirong; Li, Ming; Li, Hong; Tian, Yadong; Chen, Qixin; Bai, Yichun; Kang, Xiangtao

    2013-08-01

    The pre-melanin-concentrating hormone (PMCH) gene is an important gene functionally concerning the regulations of body fat content, feeding behavior and energy balance. In this study, the full-length cDNA of chicken PMCH gene was amplified by SMART RACE method. The single nucleotide polymorphisms (SNPs) in the PMCH gene were screened by comparative sequence analysis. The obtained non-synonymous coding SNPs (ncSNPs) were designed for genotyping firstly. Its effects on growth, carcass characteristics and meat quality traits were investigated employing the F2 resource population of Gushi chicken crossed with Anak broiler by AluI CRS-PCR-RFLP. Our results indicated that the cDNA of chicken PMCH shared 67.25 and 66.47% homology with that of human and bovine PMCH, respectively. The deduced amino acid sequence of chicken PMCH (163 amino acids) were 52.07 and 50.89% identical to those of human and bovine PMCH, respectively. The PMCH protein sequence is predicted to have several functional domains, including pro-MCH, CSP, IL7, XPGI and some low complexity sequence. It has 8 phosphorylation sites and no signal peptide sequence. gga-miR-18a, gga-miR-18b, gga-miR-499 microRNA targeting site was predicted in the 3' untranslated region of chicken PMCH mRNA. In addition, a total of seven SNPs including an ncSNP and a synonymous coding SNP, were identified in the PMCH gene. The ncSNP c.81 A>T was found to be in moderate polymorphic state (polymorphic index=0.365), and the frequencies for genotype AA, AB and BB were 0.3648, 0.4682 and 0.1670, respectively. Significant associations between the locus and shear force of breast and leg were observed. This polymorphic site may serve as a useful target for the marker assisted selection of the growth and meat quality traits in chicken.

  1. Molecular cloning and characterization of a cotton glucuronosyltranferase gene.

    PubMed

    Wu, Yao-Ting; Liu, Jin-Yuan

    2005-05-01

    A glucuronosyltranferase gene has been isolated from cotton (Gossypium hirsutum) fiber cells using rapid amplification of the cDNA ends. The full-length cDNA, designated GhGlcAT1, is 1400 bp in length (AY346330) and contains an open reading frame of 1107 bp encoding a protein of 368 amino acids. Alignment of the GhGlcAT1 predicted amino acid sequence was shown to have high sequence similarity with animal glucuronosyltranferases. A phylogenic tree generated by the PHYLIP program package showed that GhGlcAT1 is clustered into the plant glucuronosyltranferase proteins and is distinct from those of other species. Homology modeling of the GhGlcAT1 structure using Homo sapiens native glucuronosyltranferase (1 kws and 1 fgg) structure as a template strongly suggests that the main-chain conformation and the folding patterns were similar to structural features characteristic of animal glucuronosyltranferases. Northern blot analysis showed that the transcripts of GhGlcAT1 were abundant in fiber cells, moderate in stem, but not detected in ovule, flower, seed, root and leaf. Transcripts were most abundant at 15dpa fiber. The transcription occurred at both the primary wall elongation stage and former stage of secondary cell thickening, suggesting that GhGLcAT1 may be involved in non-cellulose polysacchrides biosynthesis of the cotton cell wall.

  2. Molecular cloning, expression, and sequence of the pilin gene from nontypeable Haemophilus influenzae M37.

    PubMed Central

    Coleman, T; Grass, S; Munson, R

    1991-01-01

    Nontypeable Haemophilus influenzae M37 adheres to human buccal epithelial cells and exhibits mannose-resistant hemagglutination of human erythrocytes. An isogenic variant of this strain which was deficient in hemagglutination was isolated. A protein with an apparent molecular weight of 22,000 was present in the sodium dodecyl sulfate-polyacrylamide gel profile of sarcosyl-insoluble proteins from the hemagglutination-proficient strain but was absent from the profile of the isogenic hemagglutination-deficient variant. A monoclonal antibody which reacts with the hemagglutination-proficient isolate but not with the hemagglutination-deficient isolate has been characterized. This monoclonal antibody was employed in an affinity column for purification of the protein as well as to screen a genomic library for recombinant clones expressing the gene. Several clones which contained overlapping genomic fragments were identified by reaction with the monoclonal antibody. The gene for the 22-kDa protein was subcloned and sequenced. The gene for the type b pilin from H. influenzae type b strain MinnA was also cloned and sequenced. The DNA sequence of the strain MinnA gene was identical to that reported previously for two other type b strains. The DNA sequence of the strain M37 gene is 77% identical to that of the type b pilin gene, and the derived amino acid sequence is 68% identical to that of the type b pilin. Images PMID:1673447

  3. Molecular cloning and expression analysis of Annexin A2 gene in sika deer antler tip.

    PubMed

    Xia, Yanling; Qu, Haomiao; Lu, Binshan; Zhang, Qiang; Li, Heping

    2017-08-16

    Molecular cloning and bioinformatics analysis of Annexin A2 gene in sika deer antler tip were conducted. The role of Annexin A2 gene in the growth and development of the antler were analyzed initially. The reverse transcriptase-polymerase chain reaction (RT-PCR) was used to clone the cDNA sequence of the Anxa2 gene from antler tip of sika deer (Cervus nippon hortulorum) and the bioinformatics tools provided on the web site were applied to analyze the amino acid sequence of Anxa2 protein. The mRNA expression levels of the Anxa2 gene in different growth stages were examined by real-time RT-PCR. The nucleotide sequence analysis revealed an ORF of 1020 bp encoding 339 amino acids long protein of calculated molecular weight 38.6 kDa and pI value 6.09. Homologous sequence alignment and phylogenetic analysis indicated that the Anxa2 mature protein of sika deer had the closest genetic distance with Cervus elaphus and Bos mutus. Real-time RT-PCR results showed that the gene had differential expression levels in different growth stages, and the expression level of the Anxa2 gene was the highest at metaphase (rapid growing period). Anxa2 gene may promote the cell proliferation, and the finding suggested Anxa2 as an important candidate for regulating the growth and development of deer antler.

  4. Molecular cloning and analysis of the CRY1 gene: a yeast ribosomal protein gene.

    PubMed Central

    Larkin, J C; Woolford, J L

    1983-01-01

    Using cloned DNA from the vicinity of the yeast mating type locus (MAT) as a probe, the wild type allele of the cryptopleurine resistance gene CRY1 has been isolated by the technique of chromosome walking and has been shown to be identical to the gene for ribosomal protein 59. A recessive cryR1 allele has also been cloned, using the integration excision method. The genetic distance from MAT to CRY1 is 2.2 cM, while the physical distance is 21 kb, giving a ratio of about 10 kb/cM for this interval. The phenotypic expression of both plasmid borne alleles of the gene can be detected in vivo. The use of this gene as a hybridization probe to examine RNA processing defects in the rna 2, rna 3, rna 4, rna 8, and rna 11 mutants is also discussed. Images PMID:6338478

  5. Molecular cloning and expression of a new gene, GON-SJTU1 in the rat testis

    PubMed Central

    2010-01-01

    Background Spermatogenesis is a complex process involving cell development, differentiation and apoptosis. This process is governed by a series of genes whose expressions are highly regulated. Male infertility can be attributed to multiple genetic defects or alterations that are related to spermatogenesis. The discovery, cloning and further functional study of genes related to spermatogenesis is of great importance to the elucidation of the molecular mechanism of spermatogenesis. It is also physiologically and pathologically significant to the therapy of male infertility. Methods GON-SJTU1 was identified and cloned from rat testis by cDNA library screening and 3'-and 5'-RACE. The products of GON-SJTU1 were assessed by Northern and Western blotting. The expression of GON-SJTU1 was also examined by In situ hybridization and immunohistochemistry. Results Here we identified and cloned a new gene, GON-SJTU1, with the biological process of spermatogenesis. GON-SJTU1 is highly expressed in the testis from day 1 to 15 and then decreased, suggesting that GON-SJTU1 might be a time-related gene and involved in the early stage of spermatogenesis. And the expression of GON-SJTU1 in the testis occurred in some male germ cells, particularly in gonocytes and spermatogonial stem cells. Conclusion GON-SJTU1 may play a role in the biological process of spermatogenesis. PMID:20462432

  6. Molecular cloning and expression of a new gene, GON-SJTU1 in the rat testis.

    PubMed

    Yang, Zhao-juan; Sun, Ning; Wang, Shu-qin; Tian, Geng G; Wu, Ji

    2010-05-12

    Spermatogenesis is a complex process involving cell development, differentiation and apoptosis. This process is governed by a series of genes whose expressions are highly regulated. Male infertility can be attributed to multiple genetic defects or alterations that are related to spermatogenesis. The discovery, cloning and further functional study of genes related to spermatogenesis is of great importance to the elucidation of the molecular mechanism of spermatogenesis. It is also physiologically and pathologically significant to the therapy of male infertility. GON-SJTU1 was identified and cloned from rat testis by cDNA library screening and 3'-and 5'-RACE. The products of GON-SJTU1 were assessed by Northern and Western blotting. The expression of GON-SJTU1 was also examined by In situ hybridization and immunohistochemistry. Here we identified and cloned a new gene, GON-SJTU1, with the biological process of spermatogenesis. GON-SJTU1 is highly expressed in the testis from day 1 to 15 and then decreased, suggesting that GON-SJTU1 might be a time-related gene and involved in the early stage of spermatogenesis. And the expression of GON-SJTU1 in the testis occurred in some male germ cells, particularly in gonocytes and spermatogonial stem cells. GON-SJTU1 may play a role in the biological process of spermatogenesis.

  7. Molecular cloning and nucleotide sequence of a transforming gene detected by transfection of chicken B-cell lymphoma DNA

    NASA Astrophysics Data System (ADS)

    Goubin, Gerard; Goldman, Debra S.; Luce, Judith; Neiman, Paul E.; Cooper, Geoffrey M.

    1983-03-01

    A transforming gene detected by transfection of chicken B-cell lymphoma DNA has been isolated by molecular cloning. It is homologous to a conserved family of sequences present in normal chicken and human DNAs but is not related to transforming genes of acutely transforming retroviruses. The nucleotide sequence of the cloned transforming gene suggests that it encodes a protein that is partially homologous to the amino terminus of transferrin and related proteins although only about one tenth the size of transferrin.

  8. Cloning and molecular characterization of a putative voltage-gated sodium channel gene in the crayfish.

    PubMed

    Coskun, Cagil; Purali, Nuhan

    2016-06-01

    Voltage-gated sodium channel genes and associated proteins have been cloned and studied in many mammalian and invertebrate species. However, there is no data available about the sodium channel gene(s) in the crayfish, although the animal has frequently been used as a model to investigate various aspects of neural cellular and circuit function. In the present work, by using RNA extracts from crayfish abdominal ganglia samples, the complete open reading frame of a putative sodium channel gene has firstly been cloned and molecular properties of the associated peptide have been analyzed. The open reading frame of the gene has a length of 5793 bp that encodes for the synthesis of a peptide, with 1930 amino acids, that is 82% similar to the α-peptide of a sodium channel in a neighboring species, Cancer borealis. The transmembrane topology analysis of the crayfish peptide indicated a pattern of four folding domains with several transmembrane segments, as observed in other known voltage-gated sodium channels. Upon analysis of the obtained sequence, functional regions of the putative sodium channel responsible for the selectivity filter, inactivation gate, voltage sensor, and phosphorylation have been predicted. The expression level of the putative sodium channel gene, as defined by a qPCR method, was measured and found to be the highest in nervous tissue.

  9. Ethylene-regulated gene expression: molecular cloning of the genes encoding an endochitinase from Phaseolus vulgaris.

    PubMed Central

    Broglie, K E; Gaynor, J J; Broglie, R M

    1986-01-01

    A full-length copy of bean leaf chitinase mRNA has been cloned. The 1146-base-pair insert of pCH18 encodes the 27-residue amino-terminal signal peptide of the precursor and 301 residues of the mature protein. Utilizing pCH18 as a hybridization probe, we have shown that the increase in translatable chitinase mRNA seen upon ethylene treatment of bean seedlings is due to a 75- to 100-fold increase in steady-state mRNA levels. Southern blot analysis of bean genomic DNA revealed that chitinase is encoded by a small, multigene family consisting of approximately four members. From our nucleotide sequence analysis of five additional chitinase cDNA clones, it appears that at least two of these genes are expressed. Three of the bean chitinase genes have been isolated from a Sau3A genomic library and partially characterized. Images PMID:2428042

  10. Molecular cloning and characterization of the human beta-like globin gene cluster.

    PubMed

    Fritsch, E F; Lawn, R M; Maniatis, T

    1980-04-01

    The genes encoding human embryonic (epsilon), fetal (G gamma, A gamma) and adult (delta, beta) beta-like globin polypeptides were isolated as a set of overlapping cloned DNA fragments from bacteriophage lambda libraries of high molecular weight (15-20 kb) chromosomal DNA. The 65 kb of DNA represented in these overlapping clones contains the genes for all five beta-like polypeptides, including the embryonic epsilon-globin gene, for which the chromosomal location was previously unknown. All five genes are transcribed from the same DNA strand and are arranged in the order 5'-epsilon-(13.3 kb)-G gamma-(3.5 kb)-A gamma-(13.9 kb)-delta-(5.4 kb)-beta-3'. Thus the genes are positioned on the chromosome in the order of their expression during development. In addition to the five known beta-like globin genes, we have detected two other beta-like globin sequences which do not correspond to known polypeptides. One of these sequences has been mapped to the A gamma-delta intergenic region while the other is located 6-9 kb 5' to the epsilon gene. Cross hybridization experiments between the intergenic sequences of the gene cluster have revealed a nonglobin repeat sequence (*) which is interspersed with the globin genes in the following manner: 5'-**epsilon-*G gamma-A gamma*-**delta-beta*-3'. Fine structure mapping of the region located 5' to the delta-globin gene revealed two repeats with a maximum size of 400 bp, which are separated by approximately 700 bp of DNA not repeated within the cluster. Preliminary experiments indicate that this repeat family is also repeated many times in the human genome.

  11. Molecular cloning and characterization of the gene encoding rat submandibular gland apomucin, Mucsmg.

    PubMed

    Albone, E F; Hagen, F K; Szpirer, C; Tabak, L A

    1996-10-01

    Mucin glycoproteins are a major constituent of salivary secretions and play a primary role in the protection of the oral cavity. Rat submandibular glands (RSMG) synthesize and secrete a low molecular weight (114 kDa) mucin glycoprotein. We have isolated, partially sequenced, and characterized the gene which encodes the RSMG apomucin. The gene is encoded by three exons of 106 nt, 69 nt, and 991 nt, separated by introns of 921 nt and 12.5 kb. CAAT and TATA elements are present, at -68 and -26, respectively, in the 5' flanking sequence of the RSMG apomucin gene. The tandem repeat domain present in exon III consists of ten tandem repeats of 39 nt encoding the consensus sequence PTTDSTTPAPTTK. Sequence comparison and organization of the nucleic acid sequence encoding the tandem repeats of two alleles for this gene suggests that the apomucin gene has undergone recombinational events during its evolution. No significant sequence similarity was found with other mucin genes, or with other known salivary gland-specific genes. The gene was localized to rat chromosome 14 using somatic cell hybrids that segregate rat chromosomes. Since this, to our knowledge, represents the first RSMG mucin gene cloned, we have designated this gene Mucsmg.

  12. Molecular cloning and expression of the Leishmania tropica KMP-11 gene.

    PubMed

    Meriee, Mouayad; Soukkarieh, Chadi; Abbady, Abdul Qader A

    2014-08-01

    Kinetoplastid membrane protein-11 (KMP-11) is a small protein of 11 kDa present in all kinetoplastid protozoa studded so far. This protein which is highly expressed in all stages of the Leishmania life cycle is considered a potential candidate for a leishmaniasis vaccine against many leishmania species. KMP-11 has been recently described in Leishmania tropica. In the present study, the KMP-11 gene was extracted from L. tropica by PCR using two oligonucleotide primers designed to amplify the entire coding region of this gene. Then, the purified PCR products were successfully ligated into a high expression vector the pRSET-GFP. This expression vector provides the opportunity to clone the desired insert as a fusion protein with a GFP and a tag, polyhistidine region. The GFP use as a carrier to improve immune response and the polyhistidine tag facilitates detection of the expressed protein with anti-His antibodies and also purification of the protein using affinity purification. After wards KMP-11 coding region was sequenced and the recombinant protein was induced and purified from Escherichia coli cultures. The results of the present study will increase our knowledge about molecular cloning and expression of the L. tropica KMP-11 gene, and this may be used as an effective target for controlling cutenous leishmaniasis.

  13. Molecular cloning and characterization of a novel mannose-binding lectin gene from Amorphophallus konjac.

    PubMed

    Fei, Jiong; Liao, Zhihua; Chai, Yourong; Pang, Yongzhen; Yao, Jianhong; Sun, Xiaofen; Tang, Kexuan

    2003-09-01

    A new lectin gene was cloned from Amorphophallus konjac. The full-length cDNA of Amorphophallus konjac agglutinin (aka) was 736 bp and contained a 474 bp open reading frame encoding a 158 amino acid protein. Homology analysis revealed that the lectin from this Araceae species belonged to the superfamily of monocot mannose-binding proteins. Molecular modeling of AKA indicated that the three-dimensional structure of AKA strongly resembles that of the snowdrop lectin. Southern blot analysis of the genomic DNA revealed that aka belonged to a low-copy gene family. Northern blot analysis demonstrated that aka expression was tissue-specific with the strongest expression being found in root.

  14. Molecular cloning and characterization of two hypersensitive induced reaction genes from wheat infected by stripe rust pathogen

    USDA-ARS?s Scientific Manuscript database

    A novel gene induced during hypersensitive reaction (HIR) in wheat was identified using in silico cloning and designated as TaHIR2. The TaHIR2 gene was deduced to encode a 284-amino acid protein, whose molecular mass and isoelectric point (pI) were 31.05 kD and 5.18, respectively. Amino acid sequenc...

  15. Molecular cloning and evolutionary analysis of the GJA1 (connexin43) gene from bats (Chiroptera).

    PubMed

    Wang, Li; Li, Gang; Wang, Jinhong; Ye, Shaohui; Jones, Gareth; Zhang, Shuyi

    2009-04-01

    Gap junction protein connexin43 (Cx43), encoded by the GJA1 gene, is the most abundant connexin in the cardiovascular system and was reported as a crucial factor maintaining cardiac electrical conduction, as well as having a very important function in facilitating the recycling of potassium ions from hair cells in the cochlea back into the cochlear endolymph during auditory transduction processes. In mammals, bats are the only taxon possessing powered flight, placing exceptional demand on many organismal processes. To meet the demands of flying, the hearts of bats show many specialties. Moreover, ultrasonic echolocation allows bat species to orientate and often detect and locate food in darkness. In this study, we cloned the full-length coding region of GJA1 gene from 12 different species of bats and obtained orthologous sequences from other mammals. We used the maximum likelihood method to analyse the evolution of GJA1 gene in mammals and the lineage of bats. Our results showed this gene is much conserved in mammals, as well as in bats' lineage. Compared with other mammals, we found one private amino acid substitution shared by bats, which is located on the inner loop domain, as well as some species-specific amino acid substitutions. The evolution rate analyses showed the signature of purifying selection on not only different classification level lineages but also the different domains and amino acid residue sites of this gene. Also, we suggested that GJA1 gene could be used as a good molecular marker to do the phylogenetic reconstruction.

  16. Molecular cloning, expression pattern and comparative analysis of chitin synthase gene B in Spodoptera exigua.

    PubMed

    Kumar, N Senthil; Tang, Bin; Chen, Xiaofei; Tian, Honggang; Zhang, Wenqing

    2008-03-01

    The chitin synthase (CHS) gene B (4781 bp) of Spodoptera exigua (SeCHSB) was cloned by reverse-transcription PCR (RT-PCR) and 3'/5' RACE from the midgut. SeCHSB contains an open reading frame of 4572 nucleotides, encoding a protein of 1523 amino acids with a predicted molecular mass of approximately 174.6 kDa. Alignment of SeCHSB with class B CHSs of other insects showed a high degree of conservation in the putative catalytic domain region. The structure of the SeCHSB gene was analyzed and was found to be the same as that of Manduca sexta CHSB (MsCHSB), including 23 exons and 22 introns but without alternative exons. Southern blot analysis revealed that SeCHSB was a single copy gene and the presence of only two chitin synthase genes in S. exigua. Further investigation indicated that SeCHSB was specifically expressed in the midgut, and its transcript existed constitutively in the midgut from the 3rd instar larval stage to prepupae and reached highest expression on the 1st day of the fifth instar larval stage. These data suggest that SeCHSB is very important in midgut formation and development. Chitin synthase gene comparisons between different classes of insects using software tools revealed some interesting aspects of the similarity and divergence of the gene in the Class Insecta.

  17. Molecular cloning and characterization of beta-expansin gene related to root hair formation in barley.

    PubMed

    Kwasniewski, Miroslaw; Szarejko, Iwona

    2006-07-01

    Root hairs are specialized epidermal cells that play a role in the uptake of water and nutrients from the rhizosphere and serve as a site of interaction with soil microorganisms. The process of root hair formation is well characterized in Arabidopsis (Arabidopsis thaliana); however, there is a very little information about the genetic and molecular basis of root hair development in monocots. Here, we report on isolation and cloning of the beta-expansin (EXPB) gene HvEXPB1, tightly related to root hair initiation in barley (Hordeum vulgare). Using root transcriptome differentiation in the wild-type/root-hairless mutant system, a cDNA fragment present in roots of wild-type plants only was identified. After cloning of full-length cDNA and genomic sequences flanking the identified fragment, the subsequent bioinformatics analyses revealed homology of the protein coded by the identified gene to the EXPB family. Reverse transcription-PCR showed that expression of HvEXPB1 cosegregated with the root hair phenotype in F2 progeny of the cross between the hairless mutant rhl1.a and the wild-type Karat parent variety. Expression of the HvEXPB1 gene was root specific; it was expressed in roots of wild-type forms, but not in coleoptiles, leaves, tillers, and spikes. The identified gene was active in roots of two other analyzed root hair mutants: rhp1.a developing root hair primordia only and rhs1.a with very short root hairs. Contrary to this, a complete lack of HvEXPB1 expression was observed in roots of the spontaneous root-hairless mutant bald root barley. All these observations suggest a role of the HvEXPB1 gene in the process of root hair formation in barley.

  18. Characterization, molecular cloning, and differential expression analysis of laccase genes from the edible mushroom Lentinula edodes.

    PubMed

    Zhao, J; Kwan, H S

    1999-11-01

    The effect of different substrates and various developmental stages (mycelium growth, primordium appearance, and fruiting-body formation) on laccase production in the edible mushroom Lentinula edodes was studied. The cap of the mature mushroom showed the highest laccase activity, and laccase activity was not stimulated by some well-known laccase inducers or sawdust. For our molecular studies, two genomic DNA sequences, representing allelic variants of the L. edodes lac1 gene, were isolated, and DNA sequence analysis demonstrated that lac1 encodes a putative polypeptide of 526 amino acids which is interrupted by 13 introns. The two allelic genes differ at 95 nucleotides, which results in seven amino acid differences in the encoded protein. The copper-binding domains found in other laccase enzymes are conserved in the L. edodes Lac1 proteins. A fragment of a second laccase gene (lac2) was also isolated, and competitive PCR showed that expression of lac1 and lac2 genes was different under various conditions. Our results suggest that laccases may play a role in the morphogenesis of the mushroom. To our knowledge, this is the first report on the cloning of genes involved in lignocellulose degradation in this economically important edible fungus.

  19. Molecular cloning and analysis of the gene encoding the thermostable penicillin G acylase from Alcaligenes faecalis.

    PubMed Central

    Verhaert, R M; Riemens, A M; van der Laan, J M; van Duin, J; Quax, W J

    1997-01-01

    Alcaligenes faecalis penicillin G acylase is more stable than the Escherichia coli enzyme. The activity of the A. faecalis enzyme was not affected by incubation at 50 degrees C for 20 min, whereas more than 50% of the E. coli enzyme was irreversibly inactivated by the same treatment. To study the molecular basis of this higher stability, the A. faecalis enzyme was isolated and its gene was cloned and sequenced. The gene encodes a polypeptide that is characteristic of periplasmic penicillin G acylase (signal peptide-alpha subunit-spacer-beta subunit). Purification, N-terminal amino acid analysis, and molecular mass determination of the penicillin G acylase showed that the alpha and beta subunits have molecular masses of 23.0 and 62.7 kDa, respectively. The length of the spacer is 37 amino acids. Amino acid sequence alignment demonstrated significant homology with the penicillin G acylase from E. coli A unique feature of the A. faecalis enzyme is the presence of two cysteines that form a disulfide bridge. The stability of the A. faecalis penicillin G acylase, but not that of the E. coli enzyme, which has no cysteines, was decreased by a reductant. Thus, the improved thermostability is attributed to the presence of the disulfide bridge. PMID:9292993

  20. Molecular cloning of the Escherichia coli B L-fucose-D-arabinose gene cluster.

    PubMed Central

    Elsinghorst, E A; Mortlock, R P

    1994-01-01

    To metabolize the uncommon pentose D-arabinose, enteric bacteria often recruit the enzymes of the L-fucose pathway by a regulatory mutation. However, Escherichia coli B can grow on D-arabinose without the requirement of a mutation, using some of the L-fucose enzymes and a D-ribulokinase that is distinct from the L-fuculokinase of the L-fucose pathway. To study this naturally occurring D-arabinose pathway, we cloned and partially characterized the E. coli B L-fucose-D-arabinose gene cluster and compared it with the L-fucose gene cluster of E. coli K-12. The order of the fucA, -P, -I, and -K genes was the same in the two E. coli strains. However, the E. coli B gene cluster contained a 5.2-kb segment located between the fucA and fucP genes that was not present in E. coli K-12. This segment carried the darK gene, which encodes the D-ribulokinase needed for growth on D-arabinose by E. coli B. The darK gene was not homologous with any of the L-fucose genes or with chromosomal DNA from other D-arabinose-utilizing bacteria. D-Ribulokinase and L-fuculokinase were purified to apparent homogeneity and partially characterized. The molecular weights, substrate specificities, and kinetic parameters of these two enzymes were very dissimilar, which together with DNA hybridization analysis, suggested that these enzymes are not related. D-Arabinose metabolism by E. coli B appears to be the result of acquisitive evolution, but the source of the darK gene has not been determined. Images PMID:7961494

  1. Molecular cloning and identification of the laspartomycin biosynthetic gene cluster from Streptomyces viridochromogenes

    PubMed Central

    Wang, Yang; Chen, Ying; Shen, Qirong; Yin, Xihou

    2011-01-01

    The biosynthetic gene cluster for laspartomycins, a family of 11 amino acid peptide antibiotics, has been cloned and sequenced from Streptomyces viridochromogenes ATCC 29814. Annotation of a segment of 88912 bp of S. viridochromogenes genomic sequence revealed the putative las cluster and its flanking regions which harbor 43 open reading frames. The lpm cluster, which spans approximately 60 kb, consists of 21 open reading frames. Those include four NRPS genes (lpmA/orf18, lpmB/orf25, lpmC/orf26 and lpmD/orf27), four genes (orfs 21, 22, 24 and 29) involved in the lipid tail biosynthesis and attachment, four regulatory genes (orfs 13, 19, 32 and 33) and three putative exporters or self-resistance genes (orfs 14, 20 and 30). In addition, the gene involved in the biosynthesis of the nonproteinogenic amino acid Pip was also identified in the lpm cluster while the genes necessary for the biosynthesis of the rare residue diaminopropionic acid (Dap) were found to reside elsewhere on the chromosome. Interestingly, the dabA, dabB and dabC genes predicted to code for the biosynthesis of the unusual amino acid diaminobutyric acid (Dab) are organized into the lpm cluster even though the Dab residue was not found in the laspartomycins. Disruption of the NRPS lpmC gene completely abolished laspartomycin production in the corresponding mutant strain. These findings will allow molecular engineering and combinatorial biosynthesis approaches to expand the structural diversity of the amphomycin-group peptide antibiotics including the laspartomycins and friulimicins. PMID:21640802

  2. Expression and molecular cloning of interferon stimulated genes in buffalo (Bubalus bubalis).

    PubMed

    Thakur, Nipuna; Singh, Girjesh; Paul, A; Bharati, J; Rajesh, G; Gm, Vidyalakshmi; Chouhan, V S; Bhure, S K; Maurya, V P; Singh, G; Sarkar, M

    2017-09-15

    Buffalo, the most important livestock species in tropical India, remains to be a poor breeder mainly due to embryonic mortality (65%) occurring mostly between 16 and 18 days of pregnancy. Early and accurate diagnosis of pregnancy can thus become a boon for successful herd management in buffalo. However, most of the currently available methods allow diagnosis only after 30 days post AI. Interferon tau (IFNT), the first pregnancy recognition signal in ruminants is one such molecule, which stimulates expression of various Interferon stimulated genes (ISGs) in the peripheral blood mononuclear cells (PBMC's) concomitant with IFNT signaling which occurs around maternal recognition of pregnancy (MRP). Hence, the study was planned to demonstrate the expression dynamics of ISGs (OAS1, MX1, MX2 and ISG15) in PBMCs during peri-implantation period in buffalo and also molecular cloning and expression of suitable ISG coded protein (s) in suitable host. Blood was collected from two groups of multiparous buffaloes: Group1: (n = 10) inseminated/pregnant (Experimental) and Group2: (n = 10) anestrous/non pregnant (Control). The expression profile of ISGs was then analyzed using real time qPCR. Expression profile of most ISGs was observed to increase through day 14 to day 20 post AI and declined thereafter. On the basis of differential gene expression at day 18 post AI, OAS1 and MX2 were identified as suitable ISG candidate biomarkers for accurate pregnancy diagnosis within 18 days post AI. Molecular cloning and expression of selected ISGs in a suitable prokaryotic expression vector was done thereafter. Bulk expression of the recombinant proteins was done and purified by affinity chromatography and confirmed by Western blot using Mouse Monoclonal His-probe antibodies. To conclude, as OAS1 and MX2, showed distinct differential expression at day 18 post AI, they may serve as ideal biomarkers for detection of early pregnancy in buffalo. Copyright © 2017 Elsevier Inc. All rights

  3. Molecular cloning and characterization of a novel esophageal cancer related gene.

    PubMed

    Cui, Yongping; Bi, Meixia; Su, Tao; Liu, Hailing; Lu, Shih-Hsin

    2010-12-01

    We previously identified four novel cDNA fragments related to human esophageal cancer. One of the fragments was named esophageal cancer related gene 2 (ECRG2). We report here the molecular cloning, sequencing, and expression of the ECRG2 gene. The ECRG2 cDNA comprises a 258 bp nucleotide sequence which encodes for 85 amino acids with a predicted molecular weight of 9.2 kDa. Analysis of the protein sequence reveals the presence at the N terminus of a signal peptide followed by 56 amino acids with a significant degree of sequence similarity with the conserved Kazal domain which characterizes the serine protease inhibitor family. Pulse-chase experiments showed that ECRG2 protein was detected in both cell lysates and culture medium, indicating that the ECRG2 protein was extracellularly secreted after the post-translational cleavage. In vitro uPA/plasmin activity analysis showed the secreted ECRG2 protein inhibited the uPA/plasmin activity, indicating that ECRG2 may be a novel serine protease inhibitor. Northern blot analysis revealed the presence of the major band corresponding to a size of 569 kb throughout the fetal skin, thymus, esophagus, brain, lung, heart, stomach, liver, spleen, colon, kidney, testis, muscle, cholecyst tissues and adult esophageal mucosa, brain, thyroid tissue and mouth epithelia. However, ECRG2 gene was significantly down-regulated in primary esophageal cancer tissues. Taken together, these results indicate that ECRG2 is a novel member of the Kazal-type serine protease inhibitor family and may function as a tumor suppressor gene regulating the protease cascades during carcinogenesis and migration/invasion of esophageal cancer.

  4. Molecular cloning and chromosomal localization of human holocarboxylase synthetase, a gene responsible for biotin dependency

    SciTech Connect

    Suzuki, Y.; Aoki, Y.; Ishida, Y.

    1994-09-01

    Holocarboxylase synthetase (HCS) catalyzes biotin incorporation into various carboxylases that require biotin as a prosthetic group. They are acetyl-CoA carboxylase, a rate-limiting enzyme of fatty acid synthesis; pyruvate carboxylase, a key enzyme of gluconeogenesis; propionyl-CoA carboxylase and 3-methylcrotonyl-CoA carboxylase, enzymes involved in amino acid catabolism. HCS is therefore involved in various metabolic processes and is a key enzyme for biotin utilization by mammalian cells. Deficiency of HCS in man is known to cause biotin-responsive multiple carboxylase deficiency. Isolation of cDNA clones for the enzyme is essential to understand HCS and its deficiency at the molecular level. We purified bovine liver HCS and sequenced its proteolytic peptides. Degenerative oligonucleotide primers were synthesized from the two peptide sequences and used to amplify a putative HCS cDNA fragment from human liver by PCR. Using the amplified DNA fragment as a probe, we screened {lambda}gt10 human liver cDNA library and isolated 12 positive clones. The isolated cDNAs encoded a protein of 726 amino acids with molecular mass of 80,759. The protein contained several sequences identical or similar to those of peptides derived from the bovine liver HCS. The predicted protein had a homologous region with BirA which acts as both a biotin-[acetyl-CoA-carboxylase] ligase and a biotin repressor in E. coli, suggesting a functional relationship between the two proteins. We expressed the protein using pET3 a vector in E. coli (BL21 strain) and raised antiserum against the expressed protein. The antiserum immunoprecipitated HCS activities of human lymphoblasts and bovine liver. A one-base deletion and a missense mutation were found in cells from siblings with HCS deficiency. The human HCS gene was assigned to chromosome 21, region 21q22.1 by fluorescence in situ hybridization analysis.

  5. Molecular cloning and characterization of two genes encoding 2-Cys peroxiredoxins from Fasciola gigantica.

    PubMed

    Chaithirayanon, Kulathida; Sobhon, Prasert

    2010-06-01

    In Fasciola species, peroxiredoxin (Prx) serves as the major antioxidant enzyme to remove hydrogen peroxide that is generated from various metabolic reactions, because the parasites lack catalase, and only express glutathione peroxidases at minimal levels. We have cloned and characterized two genes, FgPrx-1 and FgPrx-2, belonging to the 2-Cys Prx family, by immunoscreening of an expressed adult stage Fasciola gigantica cDNA library using a rabbit anti-serum against its tegumental antigens. Predicted FgPrx-1 and FgPrx-2 consisted of 218 amino acids each with predicted molecular weights at 24.63 kDa and 24.57 kDa, respectively. The two predicted F. gigantica Prx proteins exhibited 98% identity to each other, and 52% identity to Prx from oxen which is the natural host. A phylogenetic analysis revealed that FgPrx-1 and FgPrx-2 appear to be closely related to those of Fasciola hepatica. The nucleotide sequences of FgPrx-2 are 654 bp, which is similar to that cloned from newly excysted juveniles of F. hepatica. The FgPrx genes were found to be constitutively expressed in all developmental stages, and with a similar pattern. In the adult parasite, FgPrx transcripts were located in the gut epithelial cells, tegument cells, and cells of reproductive organs, including prostate gland, vitelline glands, testis and ovary. In 4-week-old juveniles, a similar distribution pattern was observed. Metacercaria and newly excysted juveniles exhibited strongest signals for mRNA transcripts in the gut epithelium, and moderately in the tegumental cells. Because of their key role in protecting the parasite and specificities, these proteins may have immunodiagnostic as well as vaccine potentials. Copyright (c) 2010 Elsevier Inc. All rights reserved.

  6. Molecular Cloning and Sequencing of Hemoglobin-Beta Gene of Channel Catfish, Ictalurus Punctatus Rafinesque

    USDA-ARS?s Scientific Manuscript database

    : Hemoglobin-y gene of channel catfish , lctalurus punctatus, was cloned and sequenced . Total RNA from head kidneys was isolated, reverse transcribed and amplified . The sequence of the channel catfish hemoglobin-y gene consists of 600 nucleotides . Analysis of the nucleotide sequence reveals one o...

  7. Molecular cloning and prokaryotic expression of vp5 gene of grass carp reovirus strain GCRV096.

    PubMed

    Jian, Ji-chang; Wang, Ya; Yan, Xiu-ying; Ding, Yu; Wu, Zao-he; Lu, Yi-shan

    2013-12-01

    VP5 is an outer capsid protein of grass carp reovirus (GCRV). It is predicted to involve in helping GCRV enter the host cells. In this study, the full-length vp5 gene (accession number in GenBank: JN206664.1) was cloned from GCRV strain GCRV096, which was isolated from diseased grass carp (Ctenopharyngodon idella) in southern China by RT-PCR technique using the primers designed from the known vp5 gene sequences of other strains of GCRV published in GenBank. The ORF sequence of vp5 is composed of 1,947 nucleotides encoding a 648-residues protein with a calculated molecular mass of 68.6 kDa and an estimated isoelectric point of 6.1. Sequence analysis results showed that VP5 might serve as a penetration protein and play an important role in GCRV penetration into the host cells. A full length of vp5 gene was subcloned into the prokaryotic expression vector pET-28a (+) and the recombinant plasmid (pET/GCRV-VP5) was then transduced into Escherichia coli BL21 (DE3) cells to express VP5 in vitro. SDS-PAGE and western blotting analysis indicated that the protein expressed successfully. Results also showed that the fusion protein expressed in the form of inclusion body, and it expressed in the highest level when induced with 0.2-mM IPTG at 28 °C for 4 h. These results are important for the future study on the molecular structure, function, and immunogenicity of GCRV capsid protein.

  8. Molecular cloning of rat homologues of the Drosophila melanogaster dunce cAMP phosphodiesterase: evidence for a family of genes.

    PubMed Central

    Swinnen, J V; Joseph, D R; Conti, M

    1989-01-01

    To study the structure and function of cyclic nucleotide phosphodiesterases (PDEs) involved in mammalian gametogenesis, a rat testis cDNA library was screened at low stringency with a cDNA clone coding for the Drosophila melanogaster dunce-encoded PDE as a probe. This screening resulted in the isolation of two groups of cDNA clones, differing in their nucleotide sequences (ratPDE1 and ratPDE2). In the rat testis, RNA transcripts corresponding to both groups of clones were expressed predominantly in germ cells. Additional screenings of a Sertoli cell cDNA library with a ratPDE2 clone as a probe led to the isolation of two more groups of clones (rat-PDE3 and ratPDE4). Unlike ratPDE1 and ratPDE2, these clones hybridized to transcripts present predominantly in the Sertoli cell. In the middle of the coding region, all four groups of clones were homologous to each other. The deduced amino acid sequences of part of this region were also homologous to the D. melanogaster dunce PDE and to PDEs from bovine and yeast. These data indicate that a family of genes homologous to the D. melanogaster dunce-encoded PDE is present in the rat and that these genes are differentially expressed in somatic and germ cells of the seminiferous tubule. These findings provide a molecular basis for the observed heterogeneity of cAMP PDEs. Images PMID:2546153

  9. Molecular Cloning, Characterization, and Expression Analysis of Lignin Genes from Sugarcane Genotypes Varying in Lignin Content.

    PubMed

    Kasirajan, Lakshmi; Aruchamy, Kalaivaani; Thirugnanasambandam, Prathima P; Athiappan, Selvi

    2017-04-01

    Sugarcane (Saccharum spp.) is one of the highest biomass-producing plant and the best lignocellulosic feedstock for ethanol production. To achieve more efficient conversion of biomass to ethanol, a better understanding of the main factors affecting biomass recalcitrance is needed. Therefore, with this objective, here, we report a systematic study on lignin content, deposition, identification, and cloning of genes involved in lignin biosynthesis and their differential expression in five sugarcane clones, EC11003, EC11010, IK 76-91, IK 76-99, and Co 86032. Lignin content among the clones varied from 26.87 to 23.19 % with the highest in the clone EC11010 and the lowest in high sugar Co86032. Lignin deposition studied through phloroglucinol staining of the cell walls implied that the sclerenchyma cells of the energy canes (EC11010 and EC11003) have more lignin deposition followed by the Erianthus (IK 76-91 and IK 76-99) clones whereas Co86032 has the minimum amount of lignin deposition. We cloned partial coding regions of important genes of lignification COMT (650 bp), CCR (332 bp), and PAL (650 bp) from Erianthus, wild relative of sugarcane followed by the expression analysis through real-time PCR. Differential expression analysis showed high level of expression for the three genes in the energy cane EC11010.

  10. Molecular cloning of novel genes for polycyclic aromatic hydrocarbon degradation from Commamonas testosteroni GZ39

    SciTech Connect

    Goyal, A.K.; Zylstra, G.J.

    1996-01-01

    The mechanisms by which bacteria degrade simple polycyclic aromatic compounds have been studied for some time. The genes for the initial steps in the degradation of maphthalene have been cloned from many different Pseudomonas stains. This study was undertaken to investigate the diversity of genes involved in phenanthrene degradation and to identify novel organisms and genes for polycyclic aromatic hydrocarbon degradations. 53 refs., 5 figs., 1 tab.

  11. Molecular cloning and characterisation of the RESA gene, a marker of genetic diversity of Plasmodium falciparum.

    PubMed

    Moyano, Eva M; González, Luis Miguel; Cuevas, Laureano; Perez-Pastrana, Esperanza; Santa-Maria, Ysmael; Benito, Agustín

    2010-07-01

    To identity immunodiagnostic antigen genes, a Plasmodium falciparum (Dd2 clone) expression library was screened using human immune sera. The ring-infected erythrocyte surface antigen (RESA) was isolated: this antigen of the resistant clone presents repeat tandem sequences like the 3D7 clone, albeit in different numbers. RESA has been studied as a marker of genetic diversity, with different sizes being observed in different isolates and clones of Plasmodium falciparum. The native protein was localised in cultures by western-blot and immuno-transmission electron microscopy. The antigenicity of RESA was evaluated by ELISA, using the carboxy-terminal repeat region as antigen. The assay's sensitivity and specificity were 78.2 and 94% respectively.

  12. Molecular cloning and characterization of two novel cellulase genes from the mollusc Ampullaria crossean.

    PubMed

    Guo, Rui; Ding, Ming; Zhang, Si-Liang; Xu, Gen-Jun; Zhao, Fu-Kun

    2008-02-01

    Cellulase genes have been reported not only from fungi, bacteria and plant, but also from some invertebrate animals. Here, two cellulase (endo-beta-1,4-glucanase, EC 3.2.1.4) genes, eg27I and eg27II, were cloned from the freshwater snail Ampullaria crossean cDNA using degenerate primers. The nucleotide sequences of the two genes shared 94.5% identity. The open reading frames of both genes consisted of 588 bp, encoding 195 amino acids. Both EG27I and EG27II belong to the glycoside hydrolase family 45, and each lacks a carbohydrate-binding module. The presence of introns demonstrated a eukaryotic origin of the EG27 gene, and, in addition, successful cloning of EG27 cDNA supported endogenous production of EG27 cellulase by Ampullaria crossean. Investigation of the EG27 cDNA from A. crossean will provide further information on GHF45 cellulases.

  13. Molecular cloning and bioinformatic analysis of the Streptococcus agalactiae neuA gene isolated from tilapia.

    PubMed

    Wang, E L; Wang, K Y; Chen, D F; Geng, Y; Huang, L Y; Wang, J; He, Y

    2015-06-01

    Cytidine monophosphate (CMP) N-acetylneuraminic acid (NeuNAc) synthetase, which is encoded by the neuA gene, can catalyze the activation of sialic acid with CMP, and plays an important role in Streptococcus agalactiae infection pathogenesis. To study the structure and function of the S. agalactiae neuA gene, we isolated it from diseased tilapia, amplified it using polymerase chain reaction (PCR) with specific primers, and cloned it into a pMD19-T vector. The recombinant plasmid was confirmed by PCR and restriction enzyme digestion, and identified by sequencing. Molecular characterization analyses of the neuA nucleotide amino acid sequence were performed using bioinformatic tools and an online server. The results showed that the neuA nucleotide sequence contained a complete coding region, which comprised 1242 bp, encoding 413 amino acids (aa). The aa sequence was highly conserved and contained a Glyco_tranf_GTA_type superfamily and an SGNH_hydrolase superfamily conserved domain, which are related to sialic acid activation catalysis. The NeuA protein possessed many important sites related to post-translational modification, including 28 potential phosphorylation sites and 2 potential N-glycosylation sites, had no signal peptides or transmembrane regions, and was predicted to reside in the cytoplasm. Moreover, the protein had some B-cell epitopes, which suggests its potential in development of a vaccine against S. agalactiae infection. The codon usage frequency of neuA differed greatly in Escherichia coli and Homo sapiens genes, and neuA may be more efficiently expressed in eukaryotes (yeast). S. agalactiae neuA from tilapia maintains high structural homology and sequence identity with CMP-NeuNAc synthetases from other bacteria.

  14. Molecular cloning and structural characterization of the human histidase gene (HAL)

    SciTech Connect

    Suchi, Mariko; Sano, Hirofumi; Mizuno, Haruo; Wada, Yoshiro

    1995-09-01

    Histidase (EC 4.3.1.3) is a cytosolic enzyme that catalyzes the nonoxidative determination of histidine to urocanic acid. Histidinemia, resulting from reduced histidase activity as reported in Cambridge stock his/her mice and in humans, is the most frequent inborn metabolic error in Japan. The histidase chromosomal gene (HAL) was isolated from a {lambda}EMBL-3 human genomic library using the human histidase cDNA as a probe. Restriction mapping and Southern blot analysis of the isolated clones reveal a single-copy gene spanning approximately 25 kb and consisting of 21 exons. Exon 1 encodes only 5{prime} untranslated sequence of liver histidase mRNA, with protein coding beginning in exon 2. A rarely observed 5{prime}GC, similar to that reported in the human P-450(SCC) gene, is present in intron 20. All other splicing junctions adhere to the canonical GT/AG rule. A TATA box sequence is located 25 bp upstream of the liver histidase transcription initiation site determined by S1 nuclease protection analysis. Several liver- and epidermis-specific transcription factor binding sites, including C/EBP, NFIL6, HNF5, AP2/ KER1, MNF, and others, are also identified in the 5{prime} flanking region. Consistent with the hepatic and epidermal expression of histidase, this finding suggests that histidase transcription may be regulated by these factors. We further identify a polymorphism (A to G transition) in the histidase coding region of exon 16. The human histidase genomic structure presented here should facilitate the molecular investigation of symptomatic and asymptomatic forms of histidinemia. 69 refs., 4 figs., 1 tab.

  15. Molecular cloning and expression analysis of the sucrose transporter gene family from Theobroma cacao L.

    PubMed

    Li, Fupeng; Wu, Baoduo; Qin, Xiaowei; Yan, Lin; Hao, Chaoyun; Tan, Lehe; Lai, Jianxiong

    2014-08-10

    In this study, we performed cloning and expression analysis of six putative sucrose transporter genes, designated TcSUT1, TcSUT2, TcSUT3, TcSUT4, TcSUT5 and TcSUT6, from the cacao genotype 'TAS-R8'. The combination of cDNA and genomic DNA sequences revealed that the cacao SUT genes contained exon numbers ranging from 1 to 14. The average molecular mass of all six deduced proteins was approximately 56 kDa (range 52 to 66 kDa). All six proteins were predicted to exhibit typical features of sucrose transporters with 12 trans-membrane spanning domains. Phylogenetic analysis revealed that TcSUT2 and TcSUT4 belonged to Group 2 SUT and Group 4 SUT, respectively, and the other TcSUT proteins were belonging to Group 1 SUT. Real-time PCR was conducted to investigate the expression pattern of each member of the SUT family in cacao. Our experiment showed that TcSUT1 was expressed dominantly in pods and that, TcSUT3 and TcSUT4 were highly expressed in both pods and in bark with phloem. Within pods, TcSUT1 and TcSUT4 were expressed more in the seed coat and seed from the pod enlargement stage to the ripening stage. TcSUT5 expression sharply increased to its highest expression level in the seed coat during the ripening stage. Expression pattern analysis indicated that TcSUT genes may be associated with photoassimilate transport into developing seeds and may, therefore, have an impact on seed production. Copyright © 2014 Elsevier B.V. All rights reserved.

  16. Molecular Cloning and Differential Expression of the Maize Ferredoxin Gene Family 1

    PubMed Central

    Hase, Toshiharu; Kimata, Yoko; Yonekura, Keiko; Matsumura, Tomohiko; Sakakibara, Hitoshi

    1991-01-01

    In maize (Zea mays L.), four ferredoxin (Fd) isoproteins, Fd I to Fd IV, are differentially distributed in photosynthetic and nonphotosynthetic organs of young seedlings (Y Kimata, T Hase [1989] Plant Physiol 89: 1193-1197). To understand structural characteristics of the Fd isoproteins and molecular mechanism of the differential expression of their genes, we have cloned and characterized three different maize Fd cDNAs. DNA sequence analyses showed that two of the cDNAs encoded the entire precursor polypeptides of Fd I and Fd III, which were composed of 150 and 152 amino acid residues, respectively, and the other encoded a 135 amino acid precursor polypeptide of Fd not yet identified. High degrees of homologies were found in the deduced amino acid sequences of mature regions of these Fd isoproteins, but the transit peptide of Fd III differed considerably from those of other Fd isoproteins. Fd I and the unidentified Fd were encoded mainly with codons ending in C or G, but such strong codon bias was not seen in Fd III. Gene specific probes for each cDNA were used to probe Northern blots of RNA isolated from leaves, mesocotyls, and roots of maize seedlings. The gene transcripts for Fd I and the unidentified Fd were restricted to leaves and their levels increased markedly upon illumination of etiolated seedlings, whereas that for Fd III was detected in all organs and its accumulation was not light dependent. This organ specific accumulation of Fd mRNAs corresponds exactly to the distribution pattern of Fd isoproteins. ImagesFigure 1Figure 5Figure 6Figure 7Figure 8 PMID:16668188

  17. Molecular cloning and localization of a novel cotton annexin gene expressed preferentially during fiber development.

    PubMed

    Wang, Li Ke; Niu, Xiao Wei; Lv, Yan Hui; Zhang, Tian Zhen; Guo, Wang Zhen

    2010-10-01

    Annexins constitute a family of multifunction and structurally related proteins. These proteins are ubiquitous in the plant kingdom, and are important calcium-dependent membrane-binding proteins that participate in the polar development of different plant regions such as rhizoids, root caps, and pollen tube tips. In this study, a novel cotton annexin gene (designated as GhFAnnx) was isolated from a fiber cDNA library of cotton (Gossypium hirsutum). The full-length cDNA of GhFAnnx comprises an open reading frame of 945 bp that encodes a 314-amino acid protein with a calculated molecular mass of 35.7 kDa and an isoelectric point of 6.49. Genomic GhFAnnx sequences from different cotton species, TM-1, Hai7124 and two diploid progenitor cottons, G. herbaceum (A-genome) and G. raimondii (D-genome) showed that at least two copies of the GhFAnnx gene, each with six exons and five introns in the coding region, were identified in the allotetraploid cotton genome. The GhFAnnx gene cloned from the cDNA library in this study was mapped to the chromosome 10 of the A-subgenome of the tetraploid cotton. Sequence alignment revealed that GhFAnnx contained four repeats of 70 amino acids. Semi-quantitative reverse transcriptase-polymerase chain reaction revealed that GhFAnnx is preferentially expressed in different developmental fibers but its expression is low in roots, stems, and leaves. Subcellular localization of GhFAnnx in onion epidermal cells and cotton fibers suggests that this protein is ubiquitous in the epidermal cells of onion, but assembles at the edge and the inner side of the apex of the cotton fiber tips with brilliant spots. In summary, GhFAnnx influences fiber development and is associated with the polar expansion of the cotton fiber during elongation stages.

  18. Molecular cloning, characterization and functional analysis of a heat shock protein 70 gene in Cyclina sinensis.

    PubMed

    Ren, Yipeng; Pan, Heting; Yang, Ying; Pan, Baoping; Bu, Wenjun

    2016-11-01

    Heat shock protein 70 (HSP70) is an important member of the heat shock protein superfamily and is involved in protecting organisms against various stressors. In the present study, we used RACE to clone a full-length Cyclina sinensis HSP70 cDNA termed CsHSP70. The full length of the CsHSP70 cDNA was 2308 bp, with a 5' untranslated region (UTR) of 42 bp, a 3' UTR of 268 bp, and an open reading frame (ORF) of 1998 bp encoding a polypeptide of 655 amino acids with an estimated molecular mass of 72.75 kDa and an estimated isoelectric point of 5.48. Quantitative real-time PCR was employed to analyze the tissue distribution and temporal expression of the CsHSP70 gene after bacterial challenge and cadmium (Cd) exposure. The CsHSP70 mRNA transcript was expressed ubiquitously in five examined tissues, with the highest expression in hemocytes (P < 0.05) and with the lowest expression in the hepatopancreas. Furthermore, the expression level of CsHSP70 in hemocytes at 3 h after Vibrio anguillarum challenge was extremely significantly up-regulated (P < 0.01). Moreover, the CsHSP70 transcript was up-regulated significantly following exposure to a safe Cd concentration (0.1 mg/L). Finally, after the CsHSP70 gene was silenced by RNA interference, the expression of the CsTLR13 and CsMyD88 genes were extremely significantly decreased (P < 0.01). The results indicated that CsHSP70 could play an important role in mediating the environmental stress and immune responses, and regulating TLR signaling pathway in C. sinensis.

  19. Molecular cloning of the gene encoding the bovine brain ribonuclease and its expression in different regions of the brain.

    PubMed Central

    Sasso, M P; Carsana, A; Confalone, E; Cosi, C; Sorrentino, S; Viola, M; Palmieri, M; Russo, E; Furia, A

    1991-01-01

    In this paper we report the molecular cloning of the gene encoding the bovine brain ribonuclease. The nucleotide sequence determined in this work shows a high degree of identity to the homologous gene encoding the bovine pancreatic ribonuclease. Processing of the primary transcripts of these genes also follows a similar pathway, splicing of the unique intron in the 5' untranslated region occurs at corresponding positions. Expression of the bovine brain ribonuclease gene can be detected both at the transcriptional and translational levels in all the regions of the brain examined. Images PMID:1754384

  20. Molecular cloning and expression in Saccharomyces cerevisiae of two Aspergillus nidulans xylanase genes.

    PubMed Central

    Pérez-Gonzalez, J A; De Graaff, L H; Visser, J; Ramón, D

    1996-01-01

    Two Aspergillus nidulans genes, xlnA and xlnB, encoding the X22 and X24 xylanases from this fungus, respectively, have been cloned and sequenced. Their cDNAs have been expressed in a laboratory Saccharomyces cerevisiae strain under the control of a constitutive yeast promoter, resulting in the construction of recombinant xylanolytic yeast strains. PMID:8787417

  1. Molecular Cloning, Nucleotide Sequence, and Expression of Genes Encoding a Polycyclic Aromatic Ring Dioxygenase from Mycobacterium sp. Strain PYR-1

    PubMed Central

    Khan, Ashraf A.; Wang, Rong-Fu; Cao, Wei-Wen; Doerge, Daniel R.; Wennerstrom, David; Cerniglia, Carl E.

    2001-01-01

    Mycobacterium sp. strain PYR-1 degrades high-molecular-weight polycyclic hydrocarbons (PAHs) primarily through the introduction of both atoms of molecular oxygen by a dioxygenase. To clone the dioxygenase genes involved in PAH degradation, two-dimensional (2D) gel electrophoresis of PAH-induced proteins from cultures of Mycobacterium sp. strain PYR-1 was used to detect proteins that increased after phenanthrene, dibenzothiophene, and pyrene exposure. Comparison of proteins from induced and uninduced cultures on 2D gels indicated that at least six major proteins were expressed (105, 81, 52, 50, 43, and 13 kDa). The N-terminal sequence of the 50-kDa protein was similar to those of other dioxygenases. A digoxigenin-labeled oligonucleotide probe designed from this protein sequence was used to screen dioxygenase-positive clones from a genomic library of Mycobacterium sp. strain PYR-1. Three clones, each containing a 5,288-bp DNA insert with three genes of the dioxygenase system, were obtained. The genes in the DNA insert, from the 5′ to the 3′ direction, were a dehydrogenase, the dioxygenase small (β)-subunit, and the dioxygenase large (α)-subunit genes, arranged in a sequence different from those of genes encoding other bacterial dioxygenase systems. Phylogenetic analysis showed that the large α subunit did not cluster with most of the known α-subunit sequences but rather with three newly described α subunits of dioxygenases from Rhodococcus spp. and Nocardioides spp. The genes from Mycobacterium sp. strain PYR-1 were subcloned and overexpressed in Escherichia coli with the pBAD/ThioFusion system. The functionality of the genes for PAH degradation was confirmed in a phagemid clone containing all three genes, as well as in plasmid subclones containing the two genes encoding the dioxygenase subunits. PMID:11472934

  2. Molecular genetics of X-linked retinitis pigmentosa: Progress towards cloning the RP3 gene

    SciTech Connect

    Fujita, R.; Yan, D.; McHenry, C.

    1994-09-01

    Our goal is to identify the X-linked retinitis pigmentosa (XLRP) gene RP3. The location of RP3 is genetically delimited to a region of 1 Mb, distal to DXS140, CYBB and tctex-1-like gene and proximal to the gene OTC. It is currently thought that RP3 is within 40 kb of the proximal deletion breakpoint of a patient BB. However, a more proximal location of the gene, closer to OTC, is not ruled out. We initiated the isolation of the genomic region between DXS140 to OTC in YACs. One of the clones from DXS140 region (55B) is 460 kb and spans about 200 kb at each side of BB patient`s proximal breakpoint. It contains CYBB, tctex-1-like genes and two additional CpG islands. The 55B clone has been covered by cosmid and phage subclones. Another YAC clone from the OTC region (OTCC) spans about 1 Mb and contains at least 5 CpG islands. In situ hybridization performed with OTCC showed its location in Xp21; however, several derivative cosmids map to chromosome 7, indicating that it is a chimeric YAC. No overlap is evident between 55B and OTCC. We have isolated the YAC end-sequences and isolation of clones to close the gap is in progress. Cosmids are being used for screening eye tissue cDNA libraries, mainly from retina. Screening is done by hybridization to replica filters or by cDNA enrichment methods. Several cDNA clones have been isolated and are being characterized. Exon-amplification is also being used with the cosmids and phages. Genetic analysis is being performed to determine RP3 patients from clinically indistinguishable RP2, located in Xp11.23-p11.4, and to reduce the genetic distance of current flanking markers. For this we are analyzing a number of XLRP families with established markers in the region and with new microsatellites.

  3. Molecular cloning, genomic organization, and chromosomal localization of an additional human aldehyde dehydrogenase gene, ALDH6

    SciTech Connect

    Hsu, L.C.; Wen-Chung, Chang; Hiraoka, L.

    1994-11-15

    Aldehyde dehydrogenase isozymes have been suggested to play a major role in the detoxification of aldehydes generated by alcohol metabolism and lipid peroxidation. The authors previously cloned and characterized four human nonallelic ALDH genes encoding different isozymes. The existence of a unique ALDH isozyme in human saliva and its polymorphism has been demonstrated previously. In this paper, they describe the cloning, characterization, and chromosomal mapping of an aldehyde dehydrogenase gene (ALDH6) expressed in the human salivary gland. The cloned ALDH6 cDNA is 3457 bp in length and contains an open reading frame encoding 512 amino acid residues. The deduced amino acid sequence showed that ALDH6 is larger than the human liver ALDH1 by 11 amino acid residues at the N-terminal, and the degree of identity between the two isozymes is 70% with an alignment of 500 amino acid residues. The human ALDH6 gene spans about 37 kb and consists of 13 exons. The putative TATA and CCAAT boxes and Sp1 binding sites are found in the 5{prime} upstream region of the gene. Northern blot analysis demonstrated that the ALDH6 gene is expressed at low levels in many tissues and at higher levels in salivary gland, stomach, and kidney. The ALDH6 gene was assigned to chromosome 15q26 using fluorescence in situ hybridization. 52 refs., 6 figs., 1 tab.

  4. Molecular Cloning and Expression of a Gene Encoding Cryptosporidium parvum Glycoproteins gp40 and gp15

    PubMed Central

    Cevallos, Ana Maria; Zhang, Xiaoping; Waldor, Matthew K.; Jaison, Smitha; Zhou, Xiaoyin; Tzipori, Saul; Neutra, Marian R.; Ward, Honorine D.

    2000-01-01

    Cryptosporidium parvum is a significant cause of diarrheal disease worldwide. The specific molecules that mediate C. parvum-host cell interactions and the molecular mechanisms involved in the pathogenesis of cryptosporidiosis are unknown. In this study we have shown that gp40, a mucin-like glycoprotein, is localized to the surface and apical region of invasive stages of the parasite and is shed from its surface. gp40-specific antibodies neutralize infection in vitro, and native gp40 binds specifically to host cells, implicating this glycoprotein in C. parvum attachment to and invasion of host cells. We have cloned and sequenced a gene designated Cpgp40/15 that encodes gp40 as well as gp15, an antigenically distinct, surface glycoprotein also implicated in C. parvum-host cell interactions. Analysis of the deduced amino acid sequence of the 981-bp Cpgp40/15 revealed the presence of an N-terminal signal peptide, a polyserine domain, multiple predicted O-glycosylation sites, a single potential N-glycosylation site, and a hydrophobic region at the C terminus, a finding consistent with what is required for the addition of a GPI anchor. There is a single copy of Cpgp40/15 in the C. parvum genome, and this gene does not contain introns. Our data indicate that the two Cpgp40/15-encoded proteins, gp40 and gp15, are products of proteolytic cleavage of a 49-kDa precursor protein which is expressed in intracellular stages of the parasite. The surface localization of gp40 and gp15 and their involvement in the host-parasite interaction suggest that either or both of these glycoproteins may serve as effective targets for specific preventive or therapeutic measures for cryptosporidiosis. PMID:10858228

  5. Protein Modeling and Molecular Dynamics Simulation of Cloned Regucalcin (RGN) Gene from Bubalus bubalis.

    PubMed

    Pillai, Harikrishna; Yadav, Brijesh Singh; Chaturvedi, Navaneet; Jan, Arif Tasleem; Gupta, Girish Kumar; Baig, Mohammad Hassan; Bhure, Sanjeev Kumar

    2017-01-01

    Regucalcin (RGN), a calcium regulating protein having anti-prolific, antiapoptotic functions, plays important part in the biosynthesis of ascorbic acid. It is a highly conserved protein that has been reported from many tissue types of various vertebrate species. Employing its effect of regulating enzyme activities through reaction with sulfhydryl group (-SH) and calcium, structural level study believed to offer a better understanding of binding properties and regulatory mechanisms of RGN, was performed. Using sample from testis of Bubalus bubalis, amplification of regucalcin (RGN) gene was subjected to characterization by performing digestion using different restriction endonucleases (RE). Alongside, cDNA was cloned into pPICZαC vector and transformed in DH5α host for custom sequencing. To get a better insight of its structural characteristics, three dimensional (3D) structure of protein sequence was generated using in silico molecular modelling approach. The full trajectory analysis of structure was achieved by the Molecular Dynamics (MD) that explains the stability, flexibility and robustness of protein during simulation in a time of 50ns. Molecular docking against 1,5-anhydrosorbitol was performed for functional characterization of RGN. Preliminary screening of amplified products on Agarose gel showed expected size of ~893 bp of PCR product corresponding to RGN. Following sequencing, BLASTp search of the target sequence revealed that it shares 91% similarity score with human senescence marker protein-30 (pdb id: 3G4E). Molecular docking of 1,5-anhydrosorbitol reveals information regarding important binding site residues of RGN. 1,5-anhydrosorbitol was found to interact with binding free energy of - 6.01 Kcal/mol. RMSD calculation of subunits A, B and D-F might be responsible for functional and conserved regions of modeled protein. Three dimensional structure of RGN was generated and its interactions with 1,5- anhydrosorbitol, demonstrates the role of key

  6. Molecular cloning of chitinase 33 (chit33) gene from Trichoderma atroviride

    PubMed Central

    Matroudi, S.; Zamani, M.R.; Motallebi, M.

    2008-01-01

    In this study Trichoderma atroviride was selected as over producer of chitinase enzyme among 30 different isolates of Trichoderma sp. on the basis of chitinase specific activity. From this isolate the genomic and cDNA clones encoding chit33 have been isolated and sequenced. Comparison of genomic and cDNA sequences for defining gene structure indicates that this gene contains three short introns and also an open reading frame coding for a protein of 321 amino acids. The deduced amino acid sequence includes a 19 aa putative signal peptide. Homology between this sequence and other reported Trichoderma Chit33 proteins are discussed. The coding sequence of chit33 gene was cloned in pEt26b(+) expression vector and expressed in E. coli. PMID:24031242

  7. Identification and molecular cloning of glutamate decarboxylase gene from Lactobacillus casei

    PubMed Central

    Tavakoli, Yasaman; Esmaeili, Abolghasem; Rabbani, Mohammad

    2015-01-01

    Gamma-amino butyric acid (GABA) possesses several physiological functions such as neurotransmission, induction of hypotension, diuretic and tranquilizer effects. Production of GABA-enriched products by lactic acid bacteria has been a focus of different researches in recent years because of their safety and health-promoting specifities. In this study, glutamate decarboxylase (gad) gene of a local strains Lactobacillus casei was identified and cloned. In order to clone the gad gene from this strain, the PCR was carried out using primers designed based on conserved regions. The PCR product was purified and ligated into PGEM-T vector. Comparison of obtained sequences shows that this fragment codes the pyridoxal 5′-phosphate binding region. This strain could possibly be used for the industrial GABA production and also for development of functional fermented foods. Gad gene manipulation can also either decrease or increase the activity of enzyme in bacteria. PMID:27844008

  8. Molecular cloning and characterization of mutant and wild-type human. beta. -actin genes

    SciTech Connect

    Leavitt, J.; Gunning, P.; Porreca, P.; Ng, S.Y.; Lin, C.H.; Kedes, L.

    1984-10-01

    There are more than 20 ..beta..-actin-specific sequences in the human genome, many of which are pseudogenes. To facilitate the isolation of potentially functional ..beta..-actin genes, they used the new method of B. Seed for selecting genomic clones by homologous recombination. A derivative of the ..pi..VX miniplasmid, ..pi..AN7..beta..1, was constructed by insertion of the 600-base-pair 3' untranslated region of the ..beta..-actin mRNA expressed in human fibroblasts. Five clones containing ..beta..-actin sequences were selected from an amplified human fetal gene library by homologous recombination between library phage and the miniplasmid. One of these clones contained a complete ..beta..-actin gene with a coding sequence identical to that determined for the mRNA of human fibroblasts. A DNA fragment consisting of mostly intervening sequences from this gene was then use to identify 13 independent recombinant copies of the analogous gene from two specially constructed gene libraries, each containing one of the two types of mutant ..beta..-actin genes found in a line of neoplastic human fibroblasts. The amino acid and nucleotide sequences encoded by the unmutated gene predict that a guanine-to-adenine transition is responsible for the glycine-to-aspartic acid mutation at codon 244 and would also result in the loss of a HaeIII site. Detection of this HaeIII polymorphism among the fibroblast-derived closed verified the identity of the ..beta..-actin gene expressed in human fibroblasts.

  9. Molecular cloning and nucleotide sequence of chicken avidin-related genes 1-5.

    PubMed

    Keinänen, R A; Wallén, M J; Kristo, P A; Laukkanen, M O; Toimela, T A; Helenius, M A; Kulomaa, M S

    1994-03-01

    Using avidin cDNA as a hybridisation probe, we detected a gene family whose putative products are related to the chicken egg-white avidin. Two overlapping genomic clones were found to contain five genes (avidin-related genes 1-5, avr1-avr5), which have been cloned, characterized and sequenced. All of the genes have a four-exon structure with an overall identity with the avidin cDNA of 88-92%. The genes appear to have no pseudogenic features and, in fact, two of these genes have been shown to be transcribed. The putative proteins share a sequence identity of 68-78% with avidin. The amino acid residues responsible for the biotin-binding activity of avidin and the bacterial biotin-binding protein, streptavidin, are highly conserved. Since avidin is induced in both a progesterone-specific manner and in connection with inflammation, these genes offer a valuable tool to study complex gene regulation in vivo.

  10. Cloning, expression and molecular analysis of Iranian Brucella melitensis Omp25 gene for designing a subunit vaccine

    PubMed Central

    Yousefi, Soheil; Tahmoorespur, Mojtaba; Sekhavati, Mohammad Hadi

    2016-01-01

    Brucellosis is a well-known domestic animal infectious disease, which is caused by Brucella bacterium. The outer membrane protein 25 kDa (Omp25) gene plays an important role in simulating of TNF-α, IFN-α, macrophage, and cytokines cells. In the current study molecular cloning and expression analysis of Omp25 gene for designing a subunit vaccine against Brucella was investigated. Amplifying the full length of candidate gene was performed using specific primers. Sub-cloning of this gene conducted using pTZ57R/T vector in TOP10F strain of Escherichia coli(E.coli) as the host. Also, pET32(a)+ vector used for expression in BL21 (DE3) strain of E.coli. Omp25 gene with 642 bp size was amplified and cloned successfully. The expression results were confirmed by sequencing and sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) analyses which showed 42 kDa protein band correctly. Also, phylogenic analysis showed this gene has a near genetic relation with other Brucella strains. According to our results we can propose this gene as a candidate useful for stimulation of cell-mediated and humoral immunity system in future study. PMID:27920824

  11. Identification and cloning of molecular markers for UV-B tolerant gene in wild sugarcane (Saccharum spontaneum L.).

    PubMed

    Li, Yuan; He, Yongmei; Zu, Yanqun; Zhan, Fangdong

    2011-11-03

    Previously we have selected wild sugarcane (Saccharum spontaneum L.) sterile lines that are tolerant or susceptible to UV-B radiation based on response index (RI) in a field screening test. The RI was established according to plant height, tiller number, leaf index, total biomass and brix under enhanced ultraviolet-B (UV-B, 280-310 nm) radiation. In this experiment, molecular markers linked to the UV-B tolerant and susceptible genes were identified and cloned. RAPD (Randomly amplified polymorphic DNAs) assay using 100 arbitrary primers followed by clustering analysis separated the tolerant and susceptible lines into two groups at the genetic distance of 0.380. The UV-B tolerant and susceptible gene pools were constructed and compared using the Bulked Segregate Analysis (BSA) approach. Of the 100 arbitrary RAPD primers, primer OPR16 produced polymorphic DNA banding patterns from both gene pools. The OPR16-1200 bp DNA fragment was only amplified from the tolerant lines and the OPR16-800 bp from the susceptible ones. These two PCR fragments were cloned onto T-vector. DNA sequence alignment analysis determined that 42% homology existed between the reverse and forward sequences of the OPR16-1200 bp clone, and 36% homology between the forward sequences of the OPR16-800 bp and OPR16-1200 bp clones. The two DNA clones were determined to be linked to the UV-B tolerant and susceptible genes, and they can be used to develop molecular markers for the associated traits. Copyright © 2011 Elsevier B.V. All rights reserved.

  12. [Structural organization of the human p53 gene. I. Molecular cloning of the human p53 gene].

    PubMed

    Bukhman, V L; Ninkina, N N; Chumakov, P M; Khilenkova, M A; Samarina, O P

    1987-09-01

    Human p53 gene was cloned from the normal human placenta DNA and DNA from the strain of human kidney carcinoma transplanted into nude mice. Representative gene library from tumor strain of human kidney carcinoma and library of 15 kb EcoRI fragments of DNA from normal human placenta were constructed. Maniatis gene library was also used. Five clones were isolated from kidney carcinoma library; they covered 27 kb and included full-length p53 gene of 19.5 kb and flanking sequences. From normal placenta libraries three overlapped clones were obtained. Restriction map of cloned sequences was constructed and polarity of the p53 gene determined. The first intron of the gene is large (10.4 kb); polymorphic BglII site was observed in this intron, which allows to discriminate between allelic genes. One of these (BglII-) is ten times more abundant that the other (BglII+). Both allelic genes are able to synthesize the 2.8 kb p53 gene.

  13. Human peptidylarginine deiminase type II: molecular cloning, gene organization, and expression in human skin.

    PubMed

    Ishigami, Akihito; Ohsawa, Takako; Asaga, Hiroaki; Akiyama, Kyoichi; Kuramoto, Masashi; Maruyama, Naoki

    2002-11-01

    Peptidylarginine deiminases (PADs) are posttranslational modification enzymes that convert protein arginine to citrulline residues in a calcium ion-dependent manner. Rodents have four isoforms of PAD (types I, II, III, and IV), each of which is distinct in substrate and tissue specificity. In fact, the only tissue in which all four PAD mRNAs have been detected is the epidermis. In this study, we found PAD activity in HSC-1 human cutaneous squamous carcinoma cells in vitro, and this activity increased during cultivation. Using a homology-based strategy, we cloned a full-length cDNA encoding human PAD type II. The cDNA was 2348 bp long and encoded a 665-amino-acid sequence with a predicted molecular mass of 75 kDa. The predicted protein shared 93% identity with the rat and mouse PAD type II sequence. Alignment of the amino acid sequences from both species revealed notable conservation in the C-terminal region, suggesting the presence of a functional region such as an enzyme catalytic site and/or a calcium-binding domain. Gene organization analysis established that human PAD type II on chromosome 1p35.2-p35.21 spanned more than 50 kb and contained 16 exons and 15 introns. A recombinant PAD protein subsequently produced in Escherichia coli proved to be enzymatically active, with substrate specificities similar to those of the rat PAD type II. In an immunohistochemical study of human skin, the type II enzyme was expressed by all the living epidermal layers, suggesting that PAD type II is functionally important during terminal differentiation of epidermal keratinocytes.

  14. Molecular cloning, functional verification, and evolution of TmPm3, the powdery mildew resistance gene of Triticum monococcum L.

    PubMed

    Zhao, C Z; Li, Y H; Dong, H T; Geng, M M; Liu, W H; Li, F; Ni, Z F; Wang, X J; Xie, C J; Sun, Q X

    2016-04-26

    Powdery mildew (Pm) is one of the most harmful diseases in wheat. Three Pm-resistance genes, Pm3, Pm21, and Pm8, have been cloned but most Pm3/Pm8 alleles have lost their resistance to Pm in hexaploid wheat. In this study, a new Pm3 homolog gene (TmPm3) was isolated from Triticum monococcum L. using a homology-based cloning strategy, being the first report of a functional Pm3 homolog gene from a diploid wheat species. The transient expression of TmPm3 in leaf epidermal cells showed that over-expressed TmPm3 could significantly inhibit the penetration of Blumeria graminis f. sp tritici conidia spores and the formation of haustoria. Sequence analysis of Pm3 alleles shed new light on the evolution of Pm3 genes, providing a better understanding of the molecular basis of disease resistance. This study also suggested that homology-based cloning of resistance genes is a feasible method for the isolation of functional resistance genes from wheat germplasm.

  15. Molecular cloning of a gene encoding the histamine H2 receptor

    SciTech Connect

    Gantz, I.; Schaeffer, M.; DelValle, J.; Logsdon, C.; Campbell, V.; Uhler, M.; Yamada, Tadataka )

    1991-01-15

    The H2 subclass of histamine receptors mediates gastric acid secretion, and antagonists for this receptor have proven to be effective therapy for acid peptic disorders of the gastrointestinal tract. The physiological action of histamine has been shown to be mediated via a guanine nucleotide-binding protein linked to adenylate cyclase activation and cellular cAMP generation. The authors capitalized on the technique of polymerase chain reaction, using degenerate oligonucleotide primers based on the known homology between cellular receptors linked to guanine nucleotide-binding proteins to obtain a partial-length clone from canine gastric parietal cell cDNA. This clone was used to obtain a full-length receptor gene from a canine genomic library. Histamine increased in a dose-dependent manner cellular cAMP content in L cells permanently transfected with this gene, and preincubation of the cells with the H2-selective antagonist cimetidine shifted the dose-response curve to the right. Cimetidine inhibited the binding of the radiolabeled H2 receptor-selective ligand (methyl-{sup 3}H)tiotidine to the transfected cells in a dose-dependent fashion, but the H1-selective antagonist diphenhydramine did not. These data indicate that they have cloned a gene that encodes the H2 subclass of histamine receptors.

  16. Characterization of feline TRIM genes: molecular cloning, expression in tissues, and response to type I interferon.

    PubMed

    Koba, Ryota; Kokaji, Chika; Fujisaki, Gentoku; Oguma, Keisuke; Sentsui, Hiroshi

    2013-05-15

    Members of the tripartite motif (TRIM) protein family in mammals are responsible for various cellular processes. Previous studies have revealed that several TRIM proteins were induced by interferons (IFN) and that these proteins were involved in innate immune response against retroviral infection. Although retroviral infection is prevalent in domestic cats, the expression profiles and roles of feline TRIM genes against these viral infections are not well understood. In the present study, we examined tissue expression and IFN inducibility of nine feline TRIM genes. In addition, the complete coding sequences of six cloned TRIM genes were determined, and their structures were analyzed. Nine TRIM genes were expressed in feline tissues and five were up-regulated by type I IFN. The predicted amino acid sequence of six feline TRIM proteins showed high sequence similarities to other mammalian TRIM proteins, and suggest that feline TRIM genes are potentially involved in antiviral reactivity in IFN-mediated immune response.

  17. Molecular cloning, nucleotide sequence and expression of a Sulfolobus solfataricus gene encoding a class II fumarase.

    PubMed

    Colombo, S; Grisa, M; Tortora, P; Vanoni, M

    1994-01-03

    Fumarase catalyzes the interconversion of L-malate and fumarate. A Sulfolobus solfataricus fumarase gene (fumC) was cloned and sequenced. Typical archaebacterial regulatory sites were identified in the region flanking the fumC open reading frame. The fumC gene encodes a protein of 438 amino acids (47,899 Da) which shows several significant similarities with class II fumarases from both eubacterial and eukariotic sources as well as with aspartases. S. solfataricus fumarase expressed in Escherichia coli retains enzymatic activity and its thermostability is comparable to that of S. solfataricus purified enzyme despite a 11 amino acid C-terminal deletion.

  18. Molecular cloning and expression of the ilvGEDAY genes from Salmonella typhimurium.

    PubMed Central

    Blazey, D L; Kim, R; Burns, R O

    1981-01-01

    The ilvGEDAY genes of Salmonella typhimurium were cloned in Escherichia coli K-12 by in vitro recombination techniques. A single species of recombinant plasmid, designated pDU1, was obtained by selecting for Valr Ampr transformants of strain SK1592. pDU1 was shown to contain a 14-kilobase EcoRI partial digestion product of the S. typhimurium chromosome inserted into the EcoRI site of the pVH2124 cloning vector. The ilvGEDAY genes were found to occupy a maximum length of 7.5 kilobases. Restriction endonuclease analysis of the S. typhimurium ilv gene cluster provided another demonstration of the gene order as well as established the location of ilv Y between ilvA and ilvC. The presence of a ribosomal ribonucleic acid operon on the pDU1 insert, about 3 kilobases from the 5' end of ilvG, was shown by Southern hybridization. The expression of the ilvGEDA operon from pDU1 was found to be elevated, reflecting the increased gene dosage of the multicopy plasmid. A polarity was observed with respect to ilvEDA expression which is discussed in terms of the possible translational effects of the two internal promoter sequences, one located proximal to ilvE and the other located proximal to ilvD. Images PMID:6167564

  19. Molecular Cloning of Human Gene(s) Directing the Synthesis of Nervous System Cholinesterases

    DTIC Science & Technology

    1987-09-01

    and shed light on the unknown physiological function of these serine hydrolases in proliferating and differentiating cells. In pheochromocytoma cells...for the physiological function(s) fulfilled by the enzyme, and further suggest a common unique and ancient ancestral gene for these cDNAs. The isolated... physiological significance ..... 9 I.B. Tissue and cell type specificity in the expression of cholinesterases

  20. Molecular cloning and sequence analysis of the Zygosaccharomyces bailii HIS3 gene encoding the imidazole glycerolphosphate dehydratase.

    PubMed

    Branduardi, Paola

    2002-09-30

    Zygosaccharomyces bailii is a spoilage yeast belonging to the Zygosaccharomyces genus. In recent years these yeasts, due to their exceptional resistance to several stresses, have become more and more interesting as model organisms to study the molecular basis of the said resistance. A Z. bailii cDNA library has been built and the 672 bp nucleotide sequence coding for the HIS3 gene was cloned by complementation of a Saccharomyces cerevisiae his3 mutant strain. The deduced 223 amino acid sequence shares a high degree of homology with His3p homologues in other non-conventional yeast species. The GeneBank Accession No. is AY050224.

  1. Molecular cloning, characterization and expression of a gene encoding phosphoketolase from Termitomyces clypeatus.

    PubMed

    Sarkar, Prabuddha; Roy, Amit

    2014-05-16

    A phosphoketolase (pk) gene from the fungus Termitomyces clypeatus (TC) was cloned and partially characterized. Oligonucleotide primers specific for the phosphoketolase gene (pk) were designed from the regions of homologies found in the primary structure of the enzyme from other fungal sources related to TC, using multiple sequence alignment technique. The cDNA of partial lengths were amplified, cloned and sequenced in three parts by 3' and 5' RACE and RT-PCR using these oligonucleotide primers. The full length ds cDNA was constructed next by joining these three partial cDNA sequences having appropriate overlapping regions using Overlap Extension PCR technique. The constructed full length cDNA exhibited an open reading frame of 2487 bases and 5' and 3' UTRs. The deduced amino acid sequence, which is of 828 amino acids, when analyzed with NCBI BLAST, showed high similarities with the phosphoketolase enzyme (Pk) superfamily with expected domains. The part of the TC genomic DNA comprising of the pk gene was also amplified, cloned and sequenced and was found to contain two introns of 68 and 74 bases that interrupt the pk reading frame. The coding region of pk cDNA was subcloned in pKM260 expression vector in correct frame and the protein was expressed in Escherichia coli BL21 (DE3) transformed with this recombinant expression plasmid. The recombinant protein purified by His-tag affinity chromatography indicated the presence of a protein of the expected size. In vivo expression studies of the gene in presence of different carbon sources indicated synthesis of Pk specific mRNA, as expected. Phylogenetic studies revealed a common ancestry of the fungal and bacterial Pk. The TC is known to secrete several industrially important enzymes involved in carbohydrate metabolism. However, the presence of Pk, a key enzyme in pentose metabolism, has not been demonstrated conclusively in this organism. Cloning, sequencing and expression study of this gene establishes the functioning

  2. Molecular Cloning of Porcine SUN5 Gene and Association between a SNP with Litter Size Trait.

    PubMed

    Zhao, Zhenhua; Liu, Yonggang

    2017-03-30

    SUN domain-containing protein 5 (SUN5) is an important reproduction related gene. In this study, we cloned the full-length coding sequence of porcine SUN5 gene through RT-PCR. Sequence analysis of this gene revealed that the pig SUN5 gene encodes a protein of 383 amino acids that has high homology with the SUN5 protein of eight species: wild Bactrian camel (95%), alpaca (95%), Yangtze River dolphin (94%), sperm whale (94%), sheep (93%), black flying fox (93%), goat (92%), and horse (91%). This gene is structured into 13 exons and 12 introns as revealed by computer-assisted analysis. The prediction of transmembrane helices showed that pig SUN5 protein might be a transmembrane protein. PCR-Taq I-RFLP was established to detect the GU475008:c.138 G>A substitution of porcine SUN5 gene coding sequence and eight pig breeds displayed obvious genotype and allele frequency differences at this mutation locus. Association of this SNP with litter size traits was assessed in Large White (n = 200) and Landrace (n = 200) pig populations, and the results demonstrated that this polymorphic locus was significantly associated with the litter size of all parities in Large White and Landrace sows (P < 0.05). Therefore, the SUN5 gene could be a useful candidate gene for increasing the litter size in pigs.

  3. Molecular cloning and expression profiling of multiple Dof genes of Sorghum bicolor (L) Moench.

    PubMed

    Gupta, Shubhra; Arya, Gulab C; Malviya, Neha; Bisht, Naveen C; Yadav, Dinesh

    2016-08-01

    DNA binding with one finger (Dof) proteins represent a family of plant specific transcription factors associated with diverse biological processes, such as seed maturation and germination, phytohormone and light mediated regulation, and plant responses to biotic and abiotic stresses. In present study, a total of 21 Dof genes from Sorghum bicolor were cloned, sequenced and in silico characterized for homology search, revealing their identity to Dof like proteins. The expression profiling of SbDof genes using quantitative RT-PCR in different tissue types and also under drought and salt stresses was attempted. The SbDof genes displayed differential expression either in their transcript abundance or in their expression patterns under normal growth condition. Two of the SbDof genes namely SbDof8 and SbDof12 showed comparatively high level of transcript abundance in all the tissue types tested; whereas some of the SbDof genes showed a distinct tissue specific expression pattern. Further a total of 13 SbDof genes showed differential expression when subjected to either of the abiotic stress i.e. drought or salinity. Three of the SbDof genes namely SbDof12, SbDof19 and SbDof24 were found to be up-regulated in response to drought and salt stress. Comparative analysis of SbDof genes expression revealed existence of a complex transcriptional and functional diversity across plant growth and developmental stages.

  4. [Molecular cloning and heterologous expression of a new xylanase gene from Verticillium dahliae].

    PubMed

    Zhang, Guimin; Rao, Ben; Ye, Jian; Ma, Lixin; Zhang, Xian'en

    2008-06-01

    Fungus Verticillium dahliae caused greensickness of cotton and xylanase is necessary in this pathogenesis. Cloning xylanase gene from V. dahliae and heterologous expression might obtain new xylanase. By comparing the amino acid sequences of over 10 xylanases in 11 families from fungi through BLAST, we found 2 highly conserved regions, with a fragment of about 150 amino acids coding sequence in between. Degenerate primers complementary to the ends of these two conserved regions were designed to amplify the in-between sequence from V. dahliae. The whole xylanse gene containing intron was achieved by Genome-walking PCR method. A 63 bp intron was found through BLAST, the whole cDNA xynG was cloned by Dpn I -mediated PCR to delete intron. The cDNA was inserted into pHBM905 and expressed in Pichia pastoris GS115, xylanase-secreting transformants were selected on plate containing RBB-xylan. The transformant with the largest halos was selected for study the character of xylanase. The deduced amino acid sequence showed 72% identity with endo-beta-1, 4-xylanase from Cochliobolus carbonum and C. sativus in the GenBank, which means xynG is a new xylanase gene. The optimal pH of the purified recombinant enzyme was pH6. It remains over 50% relative activity at pH5-9. The optimal temperature was 45 degrees C. The most favorable substrate for the xylanase (XYNG) is Beechwood xylan. Mg2+ and Ca2+ improve the enzyme activity by 33.7% and 16.6%, respectively. EDTA, beta-Mercaptoethanol and NaN3 don't affect the enzyme activity. Tween-80 and DMSO activated enzyme activity by 28.4% and 12.8%. Hg+, in concentration of 5 mmol/L, also inhibited the enzyme activity. The xylanase gene xynG was firstly cloned from the fungi that caused greensickness of cotton. The xylanase genes containing one intron can be efficiently cloned from plant pathogens and white-rot fungi using strategy in this research. It is unnecessary to explore enzyme expression condition and measure enzyme activity of the

  5. Molecular cloning, tissue distribution, and daily rhythms of expression of per1 gene in European sea bass (Dicentrarchus labrax).

    PubMed

    Sánchez, Jose Antonio; Madrid, Juan Antonio; Sánchez-Vázquez, Francisco Javier

    2010-01-01

    Circadian rhythms are controlled by interlocked autoregulatory feedback loops consisting of interactions of a group of circadian clock genes and their proteins. The Period family is a group of genes that are essential components of the molecular clock. In the present study, we cloned a period gene (per1) of the European sea bass, a marine teleost of chronobiological interest. The cloned sequence encoded a protein consisting of 1436 amino acids that homology and phylogenic analyses showed to be related with fish PER1 proteins possessing very high identity with Oryzias latipes (Medaka) per1. Polymerase chain reaction screening of per1 expression showed that this gene is expressed in all the tissues analyzed (brain, heart, liver, gill, muscle, digestive tract, adipose tissue, spleen, and retina). In addition, a daily expression rhythm, with an acrophase (peak time) approximately ZT0 (lights-on), was found in the two tissue types investigated: neural (brain) and peripheral (liver and heart). In conclusion, identification and characterization of the gene encoding sea bass per1 provide valuable information for understanding the circadian mechanism at the molecular level in this species, although further research is needed to clarify the exact role that per1 plays in the circadian oscillator and the dual behavior of European sea bass.

  6. Molecular cloning and sequencing of the gene encoding the fimbrial subunit protein of Bacteroides gingivalis.

    PubMed Central

    Dickinson, D P; Kubiniec, M A; Yoshimura, F; Genco, R J

    1988-01-01

    The gene encoding the fimbrial subunit protein of Bacteroides gingivalis 381, fimbrilin, has been cloned and sequenced. The gene was present as a single copy on the bacterial chromosome, and the codon usage in the gene conformed closely to that expected for an abundant protein. The predicted size of the mature protein was 35,924 daltons, and the secretory form may have had a 10-amino-acid, hydrophilic leader sequence similar to the leader sequences of the MePhe fimbriae family. The protein sequence had no marked similarity to known fimbrial sequences, and no homologous sequences could be found in other black-pigmented Bacteroides species, suggesting that fimbrillin represents a class of fimbrial subunit protein of limited distribution. Images PMID:2895100

  7. Molecular cloning and expression analysis of a novel BCCP subunit gene from Aleurites moluccana.

    PubMed

    Xuan, W Y; Zhang, Y; Liu, Z Q; Feng, D; Luo, M Y

    2015-08-19

    Aleurites moluccana L. is grown as a roadside tree in southern China and the oil content of its seed is higher than other oil plants, such as Jatropha curcas and Camellia oleifera. A. moluccana is considered a promising energy plant because its seed oil could be used to produce biodiesel and bio-jet fuel. In addition, the bark, leaves, and kernels of A. moluccana have various medical and commercial uses. Here, a novel gene coding the biotin carboxyl carrier protein subunit (BCCP) was cloned from A. moluccana L. using the homology cloning method combined with rapid amplification of cDNA end (RACE) technology. The isolated full-length cDNA sequence (designated AM-accB) was 1188 bp, containing a 795-bp open reading frame coding for 265 amino acids. The deduced amino acid sequence of AM-accB contained a biotinylated domain located between amino acids 190 and 263. A. moluccana BCCP shows high identity at the amino acid level to its homologues in other higher plants, such as Vernicia fordii, J. curcas, and Ricinus communis (86, 77, and 70%, respectively), which all contain conserved domains for ACCase activity. The expression of the AM-accB gene during the middle stage of development and maturation in A. moluccana seeds was higher than that in early and later stages. The expression pattern of the AM-accB gene is very similar to that of the oil accumulation rate.

  8. Molecular cloning, sequencing, and expression in Escherichia coli of the potato virus Y cytoplasmic inclusion gene.

    PubMed

    Ohshima, K; Inoue, A K; Shikata, E

    1993-01-01

    Complete nucleotide sequences of cytoplasmic inclusion (CI) genes of two strains of potato virus Y (PVY) were determined from six polymerase chain reaction (PCR)-amplified cDNA clones. The size of the CI genes of both ordinary (PVY-O) and necrotic strains (PVY-T13) was 1902 nucleotides, with a sequence homology of 83.4%. Comparison of the predicted amino acid sequences showed more than 90% homology. When these were compared with those of other potyviruses, the homology ranged from 53 to 61%. cDNAs of all or a part of the PVY-O CI gene containing an additional initiation codon (ATG) at the 5' end and a stop codon at the 3' end were constructed by PCR amplification and cloned into an Escherichia coli expression vector, pKK 223-3. Complete and truncated PVY-O CI proteins were successfully produced in E. coli as judged by reactivities with PVY-O CI protein-specific antiserum. To our knowledge, this is the first report on expression of PVY CI proteins in E. coli.

  9. Molecular cloning, expression, and evolution analysis of type II CHI gene from peanut (Arachis hypogaea L.).

    PubMed

    Liu, Yu; Zhao, Shuzhen; Wang, Jiangshan; Zhao, Chuanzhi; Guan, Hongshan; Hou, Lei; Li, Changsheng; Xia, Han; Wang, Xingjun

    2015-01-01

    Chalcone isomerase (CHI) plays critical roles in plant secondary metabolism, which is important for the interaction between plants and the environment. CHI genes are widely studied in various higher plants. However, little information about CHI genes is available in peanut. Based on conservation of CHI gene family, we cloned the peanut type II CHI gene (AhCHI II) cDNA and genome sequence. The amino acid sequence of peanut CHI II was highly homologous to type II CHI from other plant species. qRT-PCR results showed that peanut CHI II is mainly expressed in roots; however, peanut CHI I is mainly expressed in tissues with high content of anthocyanin. Gene duplication and gene cluster analysis indicated that CHI II was derived from CHI I 65 million years ago approximately. Our gene structure analysis results are not in agreement with the previous hypothesis that CHI II was derived from CHI I by the insertion of an intron into the first exon. Moreover, no positive selection pressure was found in CHIs, while, 32.1 % of sites were under neutral selection, which may lead to mutation accumulation and fixation during great changes of environment.

  10. Molecular cloning and expression of heteromeric ACCase subunit genes from Jatropha curcas.

    PubMed

    Gu, Keyu; Chiam, Huihui; Tian, Dongsheng; Yin, Zhongchao

    2011-04-01

    Acetyl-CoA carboxylase (ACCase) catalyzes the biotin-dependent carboxylation of acetyl-CoA to produce malonyl-CoA, which is the essential first step in the biosynthesis of long-chain fatty acids. ACCase exists as a multi-subunit enzyme in most prokaryotes and the chloroplasts of most plants and algae, while it is present as a multi-domain enzyme in the endoplasmic reticulum of most eukaryotes. The heteromeric ACCase of higher plants consists of four subunits: an α-subunit of carboxyltransferase (α-CT, encoded by accA gene), a biotin carboxyl carrier protein (BCCP, encoded by accB gene), a biotin carboxylase (BC, encoded by accC gene) and a β-subunit of carboxyltransferase (β-CT, encoded by accD gene). In this study, we cloned and characterized the genes accA, accB1, accC and accD that encode the subunits of heteromeric ACCase in Jatropha (Jatropha curcas), a potential biofuel plant. The full-length cDNAs of the four subunit genes were isolated from a Jatropha cDNA library and by using 5' RACE, whereas the genomic clones were obtained from a Jatropha BAC library. They encode a 771 amino acid (aa) α-CT, a 286-aa BCCP1, a 537-aa BC and a 494-aa β-CT, respectively. The single-copy accA, accB1 and accC genes are nuclear genes, while the accD gene is located in chloroplast genome. Jatropha α-CT, BCCP1, BC and β-CT show high identity to their homologues in other higher plants at amino acid level and contain all conserved domains for ACCase activity. The accA, accB1, accC and accD genes are temporally and spatially expressed in the leaves and endosperm of Jatropha plants, which are regulated by plant development and environmental factors. Copyright © 2011 Elsevier Ireland Ltd. All rights reserved.

  11. Molecular cloning of allelopathy related genes and their relation to HHO in Eupatorium adenophorum.

    PubMed

    Guo, Huiming; Pei, Xixiang; Wan, Fanghao; Cheng, Hongmei

    2011-10-01

    In this study, conserved sequence regions of HMGR, DXR, and CHS (encoding 3-hydroxy-3-methylglutaryl-CoA reductase, 1-deoxyxylulose-5-phosphate reductoisomerase and chalcone synthase, respectively) were amplified by reverse transcriptase (RT)-PCR from Eupatorium adenophorum. Quantitative real-time PCR showed that the expression of CHS was related to the level of HHO, an allelochemical isolated from E. adenophorum. Semi-quantitative RT-PCR showed that there was no significant difference in expression of genes among three different tissues, except for CHS. Southern blotting indicated that at least three CHS genes are present in the E. adenophorum genome. A full-length cDNA from CHS genes (named EaCHS1, GenBank ID: FJ913888) was cloned. The 1,455 bp cDNA contained an open reading frame (1,206 bp) encoding a protein of 401 amino acids. Preliminary bioinformatics analysis of EaCHS1 revealed that EaCHS1 was a member of CHS family, the subcellular localization predicted that EaCHS1 was a cytoplasmic protein. To the best of our knowledge, this is the first report of conserved sequences of these genes and of a full-length EaCHS1 gene in E. adenophorum. The results indicated that CHS gene is related to allelopathy of E. adenophorum.

  12. Molecular cloning of a recA-like gene from the cyanobacterium Anabaena variabilis.

    PubMed Central

    Owttrim, G W; Coleman, J R

    1987-01-01

    A recA-like gene isolated from the cyanobacterium Anabaena variabilis was cloned and partially characterized. When introduced into Escherichia coli recA mutants, the 7.5-kilobase-pair plasmid-borne DNA insert restored resistance to methyl methanesulfonate and UV irradiation, as well as recombination proficiency when measured by Hfr-mediated conjugation. The cyanobacterial recA gene restored spontaneous but not mitomycin C-induced prophage production. Restriction analysis and subcloning yielded a 1.5-kilobase-pair Sau3A fragment which also restored methylmethane sulfonate resistance and coded for a 38- to 40-kilodalton polypeptide when expressed in an in vitro transcription-translation system. Images PMID:3032896

  13. Molecular cloning, expression, and regulation of the ovalbumin gene in pigeon oviduct epithelial cells.

    PubMed

    Zhang, H; Lu, L Z; Chen, L; Tao, Z R; Chen, F; Zhong, S L; Liu, Y L; Tian, Y; Yan, P S

    2014-01-10

    The full-length pigeon ovalbumin (OVA) gene cDNA was cloned and sequenced by reverse transcription-polymerase chain reaction (RT-PCR) and rapid-amplification of cDNA ends. A 386-amino acid protein was predicted for the obtained sequence, which had 67% identity with the chicken protein. Similar to chicken OVA, the pigeon OVA gene is a non-inhibitory serine protease inhibitor. Quantitative PCR analysis revealed that pigeon OVA mRNA was highly expressed in the oviduct, and trace amounts were detected in other tissues. During the reproductive cycle, pigeon oviduct OVA mRNA expression reached its peak during the egg-laying stage, decreased with brooding, and then increased again during the squab-feeding period. Moreover, the relative OVA expression level in pigeon oviduct epithelial cells could be upregulated by a constant concentration of steroid hormones.

  14. Molecular cloning of a recA-like gene from the cyanobacterium Anabaena variabilis

    SciTech Connect

    Owttrim, G.W.; Coleman, J.R.

    1987-05-01

    A recA-like gene isolated from the cyanobacterium Anabaena variabilis was cloned and partially characterized. When introduced into Escherichia coli recA mutants, the 7.5-kilobase-pair plasmid-borne DNA insert restored resistance to methyl methanesulfonate and UV irradiation, as well as recombination proficiency when measured by Hfr-mediated conjugation. The cyanobacterial recA gene restored spontaneous but not mitomycin C-induced prophage production. Restriction analysis and subcloning yielded a 1.5-kilobase-pair Sau3A fragment which also restored methylmethane sulfonate resistance and coded for a 38- to 40-kilodalton polypeptide when expressed in an in vitro transcription-translation system.

  15. Molecular cloning of a functional promoter of the human plakoglobin gene.

    PubMed

    Pötter, E; Braun, S; Lehmann, U; Brabant, G

    2001-11-01

    Plakoglobin (Pg) is the only cytoplasmic protein component common to both junctional complexes mediating cell-cell adhesion, adherens junctions and desmosomes. In these complexes Pg appears to act as a linker protein anchoring transmembrane proteins of the cadherin superfamily to the actin cytoskeleton and intermediate filament system respectively. Intercellular adhesion is frequently disturbed in skin diseases and in carcinomas, enabling tumour progression and metastasis. Whereas Pg expression is lost in some thyroid tumours and carcinoma cell lines, little information on Pg gene regulation is currently available owing to a lack of promoter studies. We have cloned and sequenced genomic DNA from a human library that resulted in 979 bp upstream of the published Pg cDNA. The transcriptional start was mapped by rapid amplification of cDNA ends. Methylation-specific PCR of bisulfite-modified cell line DNA was applied to probe the methylation status of a promoter-associated CpG island. Reporter-gene constructs of various promoter fragments were transiently transfected in thyroid carcinoma cell lines and their activities were determined by luciferase measurements. A 1 kb DNA fragment harbouring a functional promoter of the human Pg gene was cloned and characterized. The sequence lacks a canonical TATA box, but contains putative CCAAT boxes as well as various putative binding sites for transcription factors, among them SP1 and AP2, proximal to the transcriptional start. Considerable promoter activity was found in thyroid cell lines and deletion analysis indicated that a 300 bp region proximal to the 5'-untranslated region of the mRNA represents the minimal promoter of the human Pg gene. As cells lacking endogenous Pg expression were found to contain methylated CpG dinucleotides in a CpG island located around the transcriptional start site, it is suggested that epigenetic mechanisms such as DNA methylation contribute to dysregulated Pg expression.

  16. Molecular cloning and characterization of a gene regulating flowering time from Alfalfa (Medicago sativa L.).

    PubMed

    Zhang, Tiejun; Chao, Yuehui; Kang, Junmei; Ding, Wang; Yang, Qingchuan

    2013-07-01

    Genes that regulate flowering time play crucial roles in plant development and biomass formation. Based on the cDNA sequence of Medicago truncatula (accession no. AY690425), the LFY gene of alfalfa was cloned. Sequence similarity analysis revealed high homology with FLO/LFY family genes of other plants. When fused to the green fluorescent protein, MsLFY protein was localized in the nucleus of onion (Allium cepa L.) epidermal cells. The RT-qPCR analysis of MsLFY expression patterns showed that the expression of MsLFY gene was at a low level in roots, stems, leaves and pods, and the expression level in floral buds was the highest. The expression of MsLFY was induced by GA3 and long photoperiod. Plant expression vector was constructed and transformed into Arabidopsis by the agrobacterium-mediated methods. PCR amplification with the transgenic Arabidopsis genome DNA indicated that MsLFY gene had integrated in Arabidopsis genome. Overexpression of MsLFY specifically caused early flowering under long day conditions compared with non-transgenic plants. These results indicated MsLFY played roles in promoting flowering time.

  17. Molecular cloning of the perilipin gene and its association with carcass and fat traits in Chinese ducks.

    PubMed

    Zhang, H L; Fan, H J; Liu, X L; Wu, Y; Hou, S S

    2013-05-13

    The perilipin (PLIN) gene is a candidate gene of carcass and fat traits in ducks. In order to study the molecular character of the PLIN gene and its function in different breeds of Chinese ducks, samples were obtained from the Chinese Academy of Agricultural Sciences Research Center for Birds, including 95 Peking ducks of the Z2 series, 91 Peking ducks of the Z4 series, 82 hybrid systems (Z2 x Z4), and 93 Cherry Valley ducks. We used RT-PCR and 3'-RACE to clone the duck PLIN gene, detect SNPs and analyze their associations with carcass and fat traits. A 2212-bp sequence was cloned with the complete coding region and a 3'-untranslated region. We found a nucleotide mutation (C → T) in exon 2 of the PLIN gene. There were no significant correlations between the 3 genotypes (CC, CT, TT) in breast muscle weight (BMW), leg muscle weight (LMW), subcutaneous fat weight (SFW), and intramuscular fat (IMF) in the Cherry Valley duck. The CC and CT genotypes had significant differences in carcass weight (CW), carcass net weight (CNW), and percentage of abdominal fat weight (AFW); there were significant differences in AFW and percentage of SFW. In Z4, there were no significant correlations between the 3 genotypes (TT, CC, and CT) in CW, BMW, LMW, SFW, AFW, the percentage of SFW and AFW, and IMF. CNW was significantly different between TT, CC, and CT genotypes. In Z2 x Z4, there were no significant correlations between the 3 genotypes in CW, BMW, LMW, SFW, AFW, the percentage of SFW and AFW, and IMF, while the CC and CT genotypes had significant differences in CNW. In Z2, there were no significant differences between the 3 genotypes in all traits. We deduced that the PLIN gene is a potential major gene. It is linked to a major gene affecting meat quality traits. This SNP has potential as a molecular marker for marker-assisted selection.

  18. Molecular cloning and long terminal repeat sequences of human endogenous retrovirus genes related to types A and B retrovirus genes

    SciTech Connect

    Ono, M.

    1986-06-01

    By using a DNA fragment primarily encoding the reverse transcriptase (pol) region of the Syrian hamster intracisternal A particle (IAP; type A retrovirus) gene as a probe, human endogenous retrovirus genes, tentatively termed HERV-K genes, were cloned from a fetal human liver gene library. Typical HERV-K genes were 9.1 or 9.4 kilobases in length, having long terminal repeats (LTRs) of ca. 970 base pairs. Many structural features commonly observed on the retrovirus LTRs, such as the TATAA box, polyadenylation signal, and terminal inverted repeats, were present on each LTR, and a lysine (K) tRNA having a CUU anticodon was identified as a presumed primer tRNA. The HERV-K LTR, however, had little sequence homology to either the IAP LTR or other typical oncovirus LTRs. By filter hybridization, the number of HERV-K genes was estimated to be ca. 50 copies per haploid human genome. The cloned mouse mammary tumor virus (type B) gene was found to hybridize with both the HERV-K and IAP genes to essentially the same extent.

  19. Molecular cloning of copper resistance genes from Pseudomonas syringae pv. tomato

    SciTech Connect

    Bender, C.L.; Cooksey, D.A.

    1987-02-01

    A cosmid library of copper-resistant (Cu/sup r/) Psuedomonas syringe pv. tomato PT23 plasmid DNA was constructed and mobilized into the copper-sensitive recipient P. syringae pv. syringae PS61. One resultant cosmid clone, pCOP1 (46 kilobases), conferred copper resistance. The PT23 Cu/sup r/ gene(s) was located on pCOP1 by subcloning PstI restriction endonuclease fragments of pCOP1 in the broad-host-range vector pRK404. A subclone containing a 4.4-kilobase PstI fragment conferred Cu/sup r/ on PS61. The Cu/sup r/ gene(s0 was further located by insertional inactivation with Tn5. A subcloned fragment internal to the Cu/sup r/ determinant on pCOP2 was probed to plasmid and chromosomal DNA of four copper-resistant and three copper-sensitive strains of P. syringae pv. tomato. The probe hybridized to plasmids in resistant strains, but showed no detectable homology to copper-sensitive strains.

  20. Molecular cloning, tissue expression and SNP analysis in the goat nerve growth factor gene.

    PubMed

    An, Xiaopeng; Bai, Long; Hou, Jinxing; Zhao, Haibo; Peng, Jiayin; Song, Yunxuan; Wang, Jiangang; Cao, Binyun

    2013-02-01

    In this study, we cloned the full coding region of NGF gene from the caprine ovary. Result showed the caprine NGF cDNA (GenBank Accession No. JQ308184) contained a 726 bp open reading frame encoding a protein with 241 amino acid residues. Bioinformatic analysis indicated that caprine NGF amino acid sequence was 83-99 % identical to that of mouse, pig, dog, human and bovine. It was predicted that caprine NGF contained nine serine phosphorylation loci, four threonine phosphorylation loci and nine specific PKC phosphorylation loci. The NGF mRNA expression pattern showed that NGF gene was expressed highly in ovary. This work provided an important experimental basis for further research on the function of NGF in goat. A single nucleotide polymorphism (A705G) in the coding region of NGF gene was detected by PCR-RFLP and DNA sequencing in 630 goats of three breeds. The frequencies of G allele were 0.52-0.61, and frequencies of A allele were 0.48-0.39 for SN, GZ and BG breeds, respectively. The does with GG genotype had higher litter size than those with GA and AA genotypes (P < 0.05). Hence, the biochemical and physiological functions, together with the results obtained in our investigation, suggest that the NGF gene could serve as a genetic marker for litter size in goat breeding.

  1. Molecular cloning, characterization and expression of the energy homeostasis-associated gene in piglet.

    PubMed

    Wang, Sheng-ping; Gao, Yun-ling; Liu, Gang; Deng, Dun; Chen, Rong-jun; Zhang, Yu-zhe; Li, Li-li; Wen, Qing-qi; Hou, Yong-qing; Feng, Ze-meng; Guo, Zhao-hui

    2015-06-01

    The energy homeostasis-associated (Enho) gene encodes a secreted protein, adropin, which regulates the expression of hepatic lipogenic genes and adipose tissue peroxisome proliferator-activated receptor γ, a major regulator of lipogenesis. In the present study, the porcine (Sus scrofa) homologue of the Enho gene, which was named pEnho, was amplified by reverse transcriptase polymerase chain reaction (RT-PCR) using oligonucleotide primers derived from in silico sequences. The gene sequence was submitted into the GenBank of NCBI, and the access number is GQ414763. The pEnho encodes a protein of 76 amino acids which shows 75% similarity to Homo sapiens adropin. The expression profile of pEnho in tissues (liver, muscle, anterior jejunum, posterior jejunum, and ileum) was determined by quantitative real-time RT-PCR. pEnho was localized on porcine chromosome 10 and no introns were found. In conclusion, pEnho was cloned and analysed with the aim of increasing knowledge about glucose and lipid metabolism in piglets and helping to promote the health and growth of piglets through adropin regulation.

  2. Molecular cloning, characterization and expression of the energy homeostasis-associated gene in piglet*

    PubMed Central

    Wang, Sheng-ping; Gao, Yun-ling; Liu, Gang; Deng, Dun; Chen, Rong-jun; Zhang, Yu-zhe; Li, Li-li; Wen, Qing-qi; Hou, Yong-qing; Feng, Ze-meng; Guo, Zhao-hui

    2015-01-01

    The energy homeostasis-associated (Enho) gene encodes a secreted protein, adropin, which regulates the expression of hepatic lipogenic genes and adipose tissue peroxisome proliferator-activated receptor γ, a major regulator of lipogenesis. In the present study, the porcine (Sus scrofa) homologue of the Enho gene, which was named pEnho, was amplified by reverse transcriptase polymerase chain reaction (RT-PCR) using oligonucleotide primers derived from in silico sequences. The gene sequence was submitted into the GenBank of NCBI, and the access number is GQ414763. The pEnho encodes a protein of 76 amino acids which shows 75% similarity to Homo sapiens adropin. The expression profile of pEnho in tissues (liver, muscle, anterior jejunum, posterior jejunum, and ileum) was determined by quantitative real-time RT-PCR. pEnho was localized on porcine chromosome 10 and no introns were found. In conclusion, pEnho was cloned and analysed with the aim of increasing knowledge about glucose and lipid metabolism in piglets and helping to promote the health and growth of piglets through adropin regulation. PMID:26055914

  3. Molecular cloning and characterization of FGLamide allatostatin gene from the prawn, Macrobrachium rosenbergii.

    PubMed

    Yin, Guo-Li; Yang, Jin-Shu; Cao, Jun-Xia; Yang, Wei-Jun

    2006-06-01

    Allatostatins are important regulatory neuropeptides that inhibit juvenile hormone (JH) biosynthesis by the corpora allata (CA) in insects. However, to date, the structure and expression of the gene encoding allatostatins have not been reported in any species other than insects. In this study, we used a combination of a semi-nested polymerase chain reaction (PCR) and screening of a central nervous system cDNA library of Macrobrachium rosenbergii to isolate and sequence a cDNA clone (2885 bp) encoding a 701 amino acid FGLamide allatostatin precursor polypeptide. This is the first reported allatostatin gene in crustacean. The deduced precursor was conceptually split into at least 35 FGLamide allatostatins at dibasic cleavage sites (Lys and Lys/Arg), far more than reported for any other known FGLamide allatostatin precursors from insects (13-14 allatostatins). Reverse transcription-polymerase chain reaction (RT-PCR) analysis demonstrated that the gene was expressed in the brain, gut, thoracic and abdominal ganglia, but not in the heart, muscle, ovary, gill, or hepatopancreas. Furthermore, developmentally-dependent expression of the gene was observed in the brain and thoracic ganglia of the prawn by using semi-quantitative RT-PCR analysis.

  4. Molecular cloning and characterization of a glucan synthase gene from the human pathogenic fungus Paracoccidioides brasiliensis.

    PubMed

    Pereira, M; Felipe, M S; Brígido, M M; Soares, C M; Azevedo, M O

    2000-03-30

    1,3-beta-D-glucan is a fungal cell wall polymer synthesized by the multi-subunit enzyme 1,3-beta-D-glucan synthase. A subunit of this integral membrane protein was first described as the product of the FKS1 gene from Saccharomyces cerevisiae using echinocandin mutants. Other FKS1 genes were also reported for Candida albicans, Aspergillus nidulans and Cryptococcus neoformans. Here, we report the nucleotide sequence of the first homologous FKS gene cloned from the pathogenic fungus Paracoccidioides brasiliensis. An open reading frame of 5942 bp was identified in the complete sequence, interrupted by two putative introns, the first close to the 5' end and the second close to the 3' end of the gene. A promoter region is also described containing consensus sequences such as canonical TATA and CAAT boxes and, possibly, multiple sites for glucose regulation by creA protein. The deduced sequence of 1926 amino acid show more than 85% similarity to FksAp from A. nidulans, and 71% to Fks1p and Fks2p from S. cerevisiae. Computational analysis of P. brasiliensis Fks1p suggests a similar structure to transmembrane proteins, such as FksAp, with the presence of two domains composed by hydrophobic helices that limit the putative highly hydrophilic catalytic domain within the cytoplasm.

  5. Molecular cloning and characterization of the anti-obesity gene adipose in pig.

    PubMed

    Wu, Yanling; Long, Qinqiang; Feng, Bin; Zhu, Xiaoyue; Zheng, Zifeng; Gao, Sumin; Gao, Mingju; Gan, Li; Zhou, Lei; Yang, Zaiqing

    2012-11-01

    Obesity has become an epidemic health problem characterized by aberrant energy metabolism. As the major player in energy homeostasis, adipose tissue has a decisive role in the development of obesity. Many genes involved in adipogenesis are also correlated with obesity. Adipose (Adp) has been established as an anti-obesity gene to repress adipogenesis and fat accumulation in mice, which inhibits the transcriptional activity of PPARγ by forming a chromatin remodeling complex with histones and HDAC3. Here, we reported the cloning and characterization of the pig Adp gene. Pig Adp cDNA had an ORF of 2034 nucleotides and was highly conserved among various species. Genomic sequence analysis indicated that pig Adp gene contains 16 exons and 15 introns, spanning more than 60kb on chromosome 6q21-24. The expression of pig Adp was high in testis, lung, kidney and adipose tissues, and relatively low in skeletal muscle. Bioinformatic analysis of 5'-flanking region of Adp has identified several potential binding sites for pivotal transcriptional factors related to both adipocyte differentiation and inflammation, highlighting the significance of Adp in energy metabolism. We have confirmed that KLF6, a positive regulator of adipogenesis, can enhance the promoter activity of Adp and up-regulate its mRNA expression. Taken together, our results would be helpful for further study of Adp regulation in the process of fat accumulation. Copyright © 2012 Elsevier B.V. All rights reserved.

  6. Molecular cloning and expression analysis of a gene for sucrose transporter from pear (Pyrus bretschneideri Rehd.) fruit.

    PubMed

    Zhang, Huping; Zhang, Shujun; Qin, Gaihua; Wang, Lifen; Wu, Tao; Qi, Kaijie; Zhang, Shaoling

    2013-12-01

    Here we report the cloning of a sucrose transporter cDNA from pear (Pyrus bretschneideri Rehd. cv 'Yali') fruit and an analysis of the expression of the gene. A cDNA clone, designated PbSUT1 was identified as a sucrose transporter cDNA from its sequence homology at the amino acid level to sucrose transporters that have been cloned from other higher plant species. PbSUT1 potentially encoded a protein of 499 amino acid residues with a predicted molecular mass of 53.4 kDa and an isoelectric point (pI) of 9.21. Phylogenetic analysis revealed that the PbSUT1 belonged to type III SUTs and was more closely related to the MdSUT1 from apple fruit. Some major facilitator superfamily (MFS)-specific sequence motifs were found in the predicted PbSUT1 peptides, and an MFS_1 domain was located at the amino acid positions of 29-447 of the sequence. A study of gene expression along fruit development showed that PbSUT1 transcripts are present at all stages but significantly increase before fruit enlargement and during the ripening process with increasing sucrose levels. In contrast, the expression levels don't change much during the period of rapid fruit growth. This work shows that sucrose transporter may play a role in the accumulation of sugars during maturation and in maintaining the internal cellular distribution.

  7. Molecular cloning of verrucosidin-producing Penicillium polonicum genes by differential screening to obtain a DNA probe.

    PubMed

    Aranda, E; Rodríguez, M; Benito, M J; Asensio, M A; Córdoba, J J

    2002-06-05

    A differential molecular screening procedure was developed to obtain DNA clones enriched for verrucosidin-related genes that could be used as DNA probes to detect verrucosidin-producing Penicillium polonicum. Permissive and nonpermissive conditions for verrucosidin production were selected to obtain differentiated poly (A)+ RNA for the cloning strategy. P. polonicum yielded the highest amount of verrucosidin when cultured in malt extract broth at 25 degrees C without shaking. These conditions were selected as verrucosidin permissive conditions. When shaking was applied to the verrucosidin permissive conditions, verrucosidin was not detected. Approximately 5000 transformants were obtained for the library of DNA fragments from verrucosidin-producing P. polonicum and hybridized with cDNA probes obtained from poly (A)+ RNA of permissive and nonpermissive conditions. A total of 120 clones hybridized only with the permissive cDNA probes. From these, eight representative DNA inserts selected on the basis of size and labelled with fluorescein-dUTP were assayed as DNA probes in the second differential screening by Northern hybridization. Probe SVr1 gave a strong hybridization signal selectively with poly (A)+ RNAs from high verrucosidin production. When this probe was assayed by dot blot hybridization with DNA of different moulds species, hybridization was detected only with DNA from the verrucosidin-producing strain. The strategy used in this work has proved to be useful to detect unknown genes related to mycotoxins. In addition, the DNA probe obtained should be considered for the detection of verrucosidin-producing moulds.

  8. Molecular cloning and expression of the IL-10 gene from guinea pigs.

    PubMed

    Dirisala, Vijaya R; Jeevan, Amminikutty; Bix, Gregory; Yoshimura, Teizo; McMurray, David N

    2012-04-25

    The Guinea pig (Cavia porcellus) is one of the most relevant small animals for modeling human tuberculosis (TB) in terms of susceptibility to low dose aerosol infection, the organization of granulomas, extrapulmonary dissemination and vaccine-induced protection. It is also considered to be a gold standard for a number of other infectious and non-infectious diseases; however, this animal model has a major disadvantage due to the lack of readily available immunological reagents. In the present study, we successfully cloned a cDNA for the critical Th2 cytokine, interleukin-10 (IL-10), from inbred Strain 2 guinea pigs using the DNA sequence information provided by the genome project. The complete open reading frame (ORF) consists of 537 base pairs which encodes a protein of 179 amino acids. This cDNA sequence exhibited 87% homology with human IL-10. Surprisingly, it showed only 84% homology with the previously published IL-10 sequence from the C4-deficient (C4D) guinea pig, leading us to clone IL-10 cDNA from the Hartley strain of guinea pig. The IL-10 gene from the Hartley strain showed 100% homology with the IL-10 sequence of Strain 2 guinea pigs. In order to validate the only published IL-10 sequence existing in Genbank reported from C4D guinea pigs, genomic DNA was isolated from tissues of C4D guinea pigs. Amplification with various sets of primers showed that the IL-10 sequence reported from C4D guinea pigs contained numerous errors. Hence the IL-10 sequence that is being reported by us replaces the earlier sequence making our IL-10 sequence to be the first one accurate from guinea pig. Recombinant guinea pig IL-10 proteins were subsequently expressed in both prokaryotic and eukaryotic cells, purified and were confirmed by N-terminal sequencing. Polyclonal anti-IL-10 antibodies were generated in rabbits using the recombinant IL-10 protein expressed in this study. Taken together, our results indicate that the DNA sequence information provided by the genome project

  9. Molecular cloning and expression analysis of WRKY transcription factor genes in Salvia miltiorrhiza.

    PubMed

    Li, Caili; Li, Dongqiao; Shao, Fenjuan; Lu, Shanfa

    2015-03-17

    WRKY proteins comprise a large family of transcription factors and play important regulatory roles in plant development and defense response. The WRKY gene family in Salvia miltiorrhiza has not been characterized. A total of 61 SmWRKYs were cloned from S. miltiorrhiza. Multiple sequence alignment showed that SmWRKYs could be classified into 3 groups and 8 subgroups. Sequence features, the WRKY domain and other motifs of SmWRKYs are largely conserved with Arabidopsis AtWRKYs. Each group of WRKY domains contains characteristic conserved sequences, and group-specific motifs might attribute to functional divergence of WRKYs. A total of 17 pairs of orthologous SmWRKY and AtWRKY genes and 21 pairs of paralogous SmWRKY genes were identified. Maximum likelihood analysis showed that SmWRKYs had undergone strong selective pressure for adaptive evolution. Functional divergence analysis suggested that the SmWRKY subgroup genes and many paralogous SmWRKY gene pairs were divergent in functions. Various critical amino acids contributed to functional divergence among subgroups were detected. Of the 61 SmWRKYs, 22, 13, 4 and 1 were predominantly expressed in roots, stems, leaves, and flowers, respectively. The other 21 were mainly expressed in at least two tissues analyzed. In S. miltiorrhiza roots treated with MeJA, significant changes of gene expression were observed for 49 SmWRKYs, of which 26 were up-regulated, 18 were down-regulated, while the other 5 were either up-regulated or down-regulated at different time-points of treatment. Analysis of published RNA-seq data showed that 42 of the 61 identified SmWRKYs were yeast extract and Ag(+)-responsive. Through a systematic analysis, SmWRKYs potentially involved in tanshinone biosynthesis were predicted. These results provide insights into functional conservation and diversification of SmWRKYs and are useful information for further elucidating SmWRKY functions.

  10. Molecular cloning of the cytochrome aa3 gene from the archaeon (Archaebacterium) Halobacterium halobium.

    PubMed

    Denda, K; Fujiwara, T; Seki, M; Yoshida, M; Fukumori, Y; Yamanaka, T

    1991-11-27

    A novel aa3-type cytochrome oxidase from the extremely halophilic archaeon, Halobacterium halobium, differs significantly from those of other prokaryotic and eukaryotic cytochrome oxidases (Fujiwara, T., Fukumori, Y., and Yamanaka, T. (1989) J. Biochem. 105, 287-292). In the present study, we cloned and sequenced the gene which encodes the cytochrome aa3 by using the polymerase chain reaction methods. The deduced amino acid sequence of subunit I of H. halobium cytochrome aa3 was more similar to that of subunit I of the eukaryotic cytochrome (44%, maize mitochondria) than that of the cytochrome from other bacteria (36%, Paracoccus denitrificans). The consensus sequence in putative metal binding residues is well-conserved also in H. halobium cytochrome aa3.

  11. Molecular cloning, characterization, and expression of the Tipula iridescent virus capsid gene.

    PubMed Central

    Tajbakhsh, S; Lee, P E; Watson, D C; Seligy, V L

    1990-01-01

    The capsid protein is the major structural component of the icosahedral Tipula iridescent virus (TIV) that replicates in cytoplasmic inclusion bodies of insect cells. TIV capsid protein purified by sodium dodecyl sulfate-polyacrylamide gel electrophoresis was digested with trypsin and fractionated by reverse-phase high-pressure liquid chromatography. A mixed oligonucleotide constructed from the amino acid sequence of a capsid tryptic peptide was used for the identification and cloning of the corresponding gene. The single-copy capsid gene, located on a 2.47-kilobase-pair HindIII TIV genomic fragment, codes for a 464-amino-acid protein (50,831 daltons) with a predicted pI of 6.34. Analysis of total RNA from infected Estigmene acrea cells indicated that the 1.8-kilobase capsid transcript was maximally produced between 14 and 24 h after infection. Transcript mapping by primer extension indicated that the RNA start site was in the A+T-rich TGCTACTAAT sequence, 19 nucleotides upstream from the first ATG codon of the capsid open reading frame. Expression of the TIV capsid protein in infected E. acrea cells was demonstrated by in vivo labeling of total proteins with [35S]methionine, using anti-capsid antiserum as the probe. Capsid protein was also expressed in Escherichia coli cells by using a pUC19 plasmid containing a lacZ-capsid gene fusion. Images PMID:2293661

  12. Molecular cloning of fused, a gene required for normal segmentation in the Drosophila melanogaster embryo.

    PubMed Central

    Mariol, M C; Preat, T; Limbourg-Bouchon, B

    1987-01-01

    Using the chromosomal walk technique, we isolated recombinant lambda bacteriophage and cosmid clones spanning 250 kilobases (kb) in the 17C-D region of the X chromosome of Drosophila melanogaster. This region was known to contain the segment polarity gene fused. Several lethal fused mutations were used to define more precisely the localization of this locus. Southern analysis of genomic DNA revealed that all of them were relatively large deficiencies, the smallest one being 40 kb long. None of the 12 viable fused mutations examined possessed detectable alterations. We isolated a cosmid containing an insertion covering the entire smallest fused deletion (40 kb). We injected this DNA into fused mutant embryos and obtained a partial phenotypic rescue of the embryonic pattern, indicating that this region contained all the sequences necessary for the embryonic expression of the fu+ gene. Within this DNA, a subclone of 14 kb codes for poly(A)+ RNAs of 3.5, 2.5, 1.6, and 1.3 kb detected in embryos from various developmental stages as well as in adults. All these transcripts showed the same developmental expression. This transcribed region was injected into fused mutant embryos, and once again we obtained a partial rescue of the embryonic phenotype, confirming that this region contained at least the fused gene. Images PMID:3118195

  13. Molecular cloning, structure, and chromosomal localization of the human inducible nitric oxide synthase gene.

    PubMed

    Chartrain, N A; Geller, D A; Koty, P P; Sitrin, N F; Nussler, A K; Hoffman, E P; Billiar, T R; Hutchinson, N I; Mudgett, J S

    1994-03-04

    Nitric oxide, a multifunctional effector molecule synthesized by nitric oxide synthase (NOS) from L-arginine, conveys signals for vasorelaxation, neurotransmission, and cytotoxicity. Three different NOS isoforms have been identified which fall into two distinct types, constitutive and inducible. The inducible NOS (iNOS) isoform is expressed in a variety of cell types and tissues in response to inflammatory agents and cytokines. The human iNOS (NOS2) gene was isolated on overlapping cosmid clones from a human genomic library using both the murine macrophage and the human hepatocyte iNOS cDNAs as probes. All isolated cosmids were part of a single genomic locus and no other genomic loci were identified or isolated. Analysis of this locus indicated that the human iNOS gene is approximately 37 kilobases in length and consists of 26 exons and 25 introns. Primer extension analysis of lipopolysaccharide and cytokine-stimulated human hepatocyte RNA mapped the transcriptional initiation site 30 base pairs downstream of a TATA sequence, and a 400-base pair 5'-flanking region was found to be structurally similar to the recently described murine iNOS promoter. Polymerase chain reaction analysis of a human/rodent genomic DNA somatic cell hybrid panel and fluorescent in situ hybridization indicated that the human iNOS gene is located on chromosome 17 at position 17cen-q11.2.

  14. Molecular cloning of a putative gene encoding isopentenyltransferase from pingyitiancha (Malus hupehensis) and characterization of its response to nitrate.

    PubMed

    Peng, Jing; Peng, Futian; Zhu, Chunfu; Wei, Shaochong

    2008-06-01

    A putative isopentenyltransferase (IPT) encoding gene was identified from a pingyitiancha (Malus hupehensis Rehd.) expressed sequence tag database, and the full-length gene was cloned by RACE. Based on expression profile and sequence alignment, the nucleotide sequence of the clone, named MhIPT3, was most similar to AtIPT3, an IPT gene in Arabidopsis. The full-length cDNA contained a 963-bp open reading frame encoding a protein of 321 amino acids with a molecular mass of 37.3 kDa. Sequence analysis of genomic DNA revealed the absence of introns in the frame. Quantitative real-time PCR analysis demonstrated that the gene was expressed in roots, stems and leaves. Application of nitrate to roots of nitrogen-deprived seedlings strongly induced expression of MhIPT3 and was accompanied by the accumulation of cytokinins, whereas MhIPT3 expression was little affected by ammonium application to roots of nitrogen-deprived seedlings. Application of nitrate to leaves also up-regulated the expression of MhIPT3 and corresponded closely with the accumulation of isopentyladenine and isopentyladenosine in leaves.

  15. Guide to molecular cloning techniques

    SciTech Connect

    Berger, S.L.; Kimmel, A.R.

    1987-01-01

    This book includes the following selections: requirements for a molecular biology laboratory; general methods for isolating and characterizing nucleic acids; enzymatic techniques and recombinant DNA technology; restriction enzymes; growth and maintenance of bacteria; genetic cloning, preparation and characterization of RNA; preparation of cDNA and the generation of cDNA libraries; selections of clones from libraries; and identification and characterization of specific clones.

  16. Molecular cloning of doublesex genes of four cladocera (water flea) species

    PubMed Central

    2013-01-01

    Background The gene doublesex (dsx) is known as a key factor regulating genetic sex determination in many organisms. We previously identified two dsx genes (DapmaDsx1 and DapmaDsx2) from a freshwater branchiopod crustacean, Daphnia magna, which are expressed in males but not in females. D. magna produces males by parthenogenesis in response to environmental cues (environmental sex determination) and we showed that DapmaDsx1 expression during embryonic stages is responsible for the male trait development. The D. magna dsx genes are thought to have arisen by a cladoceran-specific duplication; therefore, to investigate evolutionary conservation of sex specific expression of dsx genes and to further assess their functions in the environmental sex determination, we searched for dsx homologs in four closely related cladoceran species. Results We identified homologs of both dsx genes from, D. pulex, D. galeata, and Ceriodaphnia dubia, yet only a single dsx gene was found from Moina macrocopa. The deduced amino acid sequences of all 9 dsx homologs contained the DM and oligomerization domains, which are characteristic for all arthropod DSX family members. Molecular phylogenetic analysis suggested that the dsx gene duplication likely occurred prior to the divergence of these cladoceran species, because that of the giant tiger prawn Penaeus monodon is rooted ancestrally to both DSX1 and DSX2 of cladocerans. Therefore, this result also suggested that M. macrocopa lost dsx2 gene secondarily. Furthermore, all dsx genes identified in this study showed male-biased expression levels, yet only half of the putative 5’ upstream regulatory elements are preserved in D. magna and D. pulex. Conclusions The all dsx genes of five cladoceran species examined had similar amino acid structure containing highly conserved DM and oligomerization domains, and exhibited sexually dimorphic expression patterns, suggesting that these genes may have similar functions for environmental sex

  17. Molecular cloning of doublesex genes of four cladocera (water flea) species.

    PubMed

    Toyota, Kenji; Kato, Yasuhiko; Sato, Masaru; Sugiura, Naomi; Miyagawa, Shinichi; Miyakawa, Hitoshi; Watanabe, Hajime; Oda, Shigeto; Ogino, Yukiko; Hiruta, Chizue; Mizutani, Takeshi; Tatarazako, Norihisa; Paland, Susanne; Jackson, Craig; Colbourne, John K; Iguchi, Taisen

    2013-04-10

    The gene doublesex (dsx) is known as a key factor regulating genetic sex determination in many organisms. We previously identified two dsx genes (DapmaDsx1 and DapmaDsx2) from a freshwater branchiopod crustacean, Daphnia magna, which are expressed in males but not in females. D. magna produces males by parthenogenesis in response to environmental cues (environmental sex determination) and we showed that DapmaDsx1 expression during embryonic stages is responsible for the male trait development. The D. magna dsx genes are thought to have arisen by a cladoceran-specific duplication; therefore, to investigate evolutionary conservation of sex specific expression of dsx genes and to further assess their functions in the environmental sex determination, we searched for dsx homologs in four closely related cladoceran species. We identified homologs of both dsx genes from, D. pulex, D. galeata, and Ceriodaphnia dubia, yet only a single dsx gene was found from Moina macrocopa. The deduced amino acid sequences of all 9 dsx homologs contained the DM and oligomerization domains, which are characteristic for all arthropod DSX family members. Molecular phylogenetic analysis suggested that the dsx gene duplication likely occurred prior to the divergence of these cladoceran species, because that of the giant tiger prawn Penaeus monodon is rooted ancestrally to both DSX1 and DSX2 of cladocerans. Therefore, this result also suggested that M. macrocopa lost dsx2 gene secondarily. Furthermore, all dsx genes identified in this study showed male-biased expression levels, yet only half of the putative 5' upstream regulatory elements are preserved in D. magna and D. pulex. The all dsx genes of five cladoceran species examined had similar amino acid structure containing highly conserved DM and oligomerization domains, and exhibited sexually dimorphic expression patterns, suggesting that these genes may have similar functions for environmental sex determination in cladocerans.

  18. Molecular cloning, phylogenetic analysis and developmental expression of a vitellogenin (Vg) gene from the intertidal copepod Tigriopus japonicus.

    PubMed

    Lee, Kyun-Woo; Hwang, Dae-Sik; Rhee, Jae-Sung; Ki, Jang-Seu; Park, Heum Gi; Ryu, Jae-Chun; Raisuddin, Sheikh; Lee, Jae-Seong

    2008-08-01

    Vitellogenin (Vg) is the precursor of egg yolk protein vitellins, which serve as energy resource for embryonic development. Vg measurement has been used as a biomarker of exposure to endocrine-disrupting chemicals (EDCs). Therefore, Vg gene structure has been identified from several species used in environmental monitoring of EDCs. Among the copepods, except from the salmon louse, there is no report on Vg genes or their products. By using molecular cloning, we determined the full Vg gene sequence from the intertidal copepod, Tigriopus japonicus. The full cDNA sequence was of 5692 bp containing 5529 bp of open reading frame (ORF) encoding for 1842 amino acids. The phylogenetic analysis revealed that T. japonicus Vg is distinct from the other arthropods as it formed a clade with salmon louse only. The expression of Vg transcripts was negligible in nauplii; detectable only at the copepodid stage 3. Females expressed over 270 times more Vg transcripts than males. The promoter sequence of T. japonicus Vg gene revealed an estrogen receptor (ER) half site and a metal response element (MRE). When copepods were exposed to trace metals, cadmium after 96 h exposure caused significantly higher induction of Vg transcripts. Taken together, molecular analysis of T. japonicus Vg would be helpful in understanding its role in development. Previous studies have established T. japonicus as a potential model for testing of endocrine-disrupting chemicals (EDCs). The study of T. japonicus Vg will fuel momentum in using this species in comparative molecular endocrinology and biomonitoring of EDCs.

  19. Molecular cloning and characterization of wheat calreticulin (CRT) gene involved in drought-stressed responses.

    PubMed

    Jia, Xiao-Yun; Xu, Chong-Yi; Jing, Rui-Lian; Li, Run-Zhi; Mao, Xin-Guo; Wang, Ji-Ping; Chang, Xiao-Ping

    2008-01-01

    Calreticulin (CRT) is a highly conserved and ubiquitously expressed Ca(2+)-binding protein in multicellular eukaryotes. CRT plays a crucial role in many cellular processes including Ca(2+) storage and release, protein synthesis, and molecular chaperone activity. To elucidate the function of CRTs in plant responses against drought, a main abiotic stress limiting cereal crop production worldwide, a full-length cDNA encoding calreticulin protein namely TaCRT was isolated from wheat (Triticum aestivum L.). The deduced amino acid sequence of TaCRT shares high homology with other plant CRTs. Phylogenetic analysis indicates that TaCRT cDNA clone encodes a wheat CRT3 isoform. Southern analysis suggests that the wheat genome contains three copies of TaCRT. Subcellular locations of TaCRT were the cytoplasm and nucleus, evidenced by transient expression of GFP fused with TaCRT in onion epidermal cells. Enhanced accumulation of TaCRT transcript was observed in wheat seedlings in response to PEG-induced drought stress. To investigate further whether TaCRT is involved in the drought-stress response, transgenic plants were constructed. Compared to the wild-type and GFP-expressing plants, TaCRT-overexpressing tobacco (Nicotiana benthamiana) plants grew better and exhibited less wilt under the drought stress. Moreover, TaCRT-overexpressing plants exhibited enhanced drought resistance to water deficit, as shown by their capacity to maintain higher WUE (water use efficiency), WRA (water retention ability), RWC (relative water content), and lower MDR (membrane damaging ratio) (P < or = 0.01) under water-stress conditions. In conclusion, a cDNA clone encoding wheat CRT was successfully isolated and the results suggest that TaCRT is involved in the plant response to drought stress, indicating a potential in the transgenic improvements of plant water-stress.

  20. Molecular cloning, identification, and chromosomal localization of two MADS box genes in peach (Prunus persica).

    PubMed

    Zhang, Lin; Xu, Yong; Ma, Rongcai

    2008-06-01

    MADS box proteins play an important role in floral development. To find genes involved in the floral transition of Prunus species, cDNAs for two MADS box genes, PpMADS1 and PpMADS10, were cloned using degenerate primers and 5'- and 3'-RACE based on the sequence database of P. persica and P. dulcis. The full length of PpMADS1 cDNA is 1,071 bp containing an open reading frame (ORF) of 717 bp and coding for a polypeptide of 238 amino acid residues. The full length of PpMADS10 cDNA is 937 bp containing an ORF of 633 bp and coding for a polypeptide of 210 amino acid residues. Sequence comparison revealed that PpMADS1 and PpMADS10 were highly homologous to genes AP1 and PI in Arabidopsis, respectively. Phylogenetic analysis indicated that PpMADS1 belongs to the euAP1 clade of class A, and PpMADS10 is a member of GLO/PI clade of class B. RT-PCR analysis showed that PpMADS1 was expressed in sepal, petal, carpel, and fruit, which was slightly different from the expression pattern of AP1; PpMADS10 was expressed in petal and stamen, which shared the same expression pattern as PI. Using selective mapping strategy, PpMADS1 was assigned onto the Bin1:50 on the G1 linkage group between the markers MCO44 and TSA2, and PpMADS10 onto the Bin1:73 on the same linkage group between the markers Lap-1 and FGA8. Our results provided the basis for further dissection of the two MADS box gene function.

  1. Molecular cloning and functional characterization of a Δ6-fatty acid desaturase gene from Rhizopus oryzae.

    PubMed

    Zhu, Yu; Zhang, Bi-Bo

    2013-09-01

    The objective was to screen for and isolate a novel enzyme with the specific activity of a Δ6-fatty acid desaturase from Rhizopus oryzae. In this study, R. oryzae was identified as a novel fungal species that produces large amounts of γ-linolenic acid. A full-length cDNA, designated here as RoD6D, with high homology to fungal Δ6-fatty acid desaturase genes was isolated from R. oryzae by using the rapid amplification of cDNA ends method. It had an open reading frame of 1176 bp encoding a deduced polypeptide of 391 amino acids. Bioinformatics analysis characterized the putative RoD6D protein as a typical membrane-bound desaturase, including three conserved histidine-rich motifs, a hydropathy profile, and a cytochrome b5 -like domain in the N terminus. When the coding sequence was expressed in the Saccharomyces cerevisiae strain INVScl, the encoded product of RoD6D exhibited Δ6-fatty acid desaturase activity that led to the accumulation of γ-linolenic acid. The corresponding genomic sequence of RoD6D was 1565 bp in length, with five introns. This is the first report on the characterization and gene cloning of a Δ6-fatty acid desaturase of R. oryzae from Douchi.

  2. Molecular cloning and expression analysis of duplicated polyphenol oxidase genes reveal their functional differentiations in sorghum.

    PubMed

    Yan, Song; Li, Sujuan; Zhai, Guowei; Lu, Ping; Deng, Hui; Zhu, Shan; Huang, Renliang; Shao, Jianfeng; Tao, Yuezhi; Zou, Guihua

    2017-10-01

    Polyphenol oxidase (PPO) is believed to play a role in plant growth, reproduction, and resistance to pathogens and pests. PPO causes browning of grains in cereals. In this study, genetic mapping of sorghum grain for phenol color reaction (PHR) was performed using a recombinant inbred line population. Only one locus was detected between SSR markers SM06072 and Xtxp176 on chromosome 6. Two linked orthologous genes (Sb06PPO1 and Sb06PPO2) within the mapped region were discovered and cloned. Transformation experiments using Nipponbare (a PHR negative rice cultivar) showed that Sb06PPO1 from LTR108 and two Sb06PPO2 alleles from both varieties could complement Nipponbare, whereas Sb06PPO1 from 654 could not. Subsequent quantitative real-time PCR (qPCR) experiments showed that Sb06PPO1 and Sb06PPO2 functioned diversely, Sb06PPO1 was mainly expressed in young panicles before flowering. Sb06PPO2 was strongly expressed in flowering panicles, especially in hulls and branches at filling stage. Moreover, the expression of Sb06PPO1 was found to be significantly up-regulated by exogenous ABA and salt, whereas Sb06PPO2 was not changed significantly, further demonstrating functional differentiation between the two genes. Copyright © 2017 Elsevier B.V. All rights reserved.

  3. Molecular cloning, encoding sequence, and expression of vaccinia virus nucleic acid-dependent nucleoside triphosphatase gene.

    PubMed Central

    Rodriguez, J F; Kahn, J S; Esteban, M

    1986-01-01

    A rabbit poxvirus genomic library contained within the expression vector lambda gt11 was screened with polyclonal antiserum prepared against vaccinia virus nucleic acid-dependent nucleoside triphosphatase (NTPase)-I enzyme. Five positive phage clones containing from 0.72- to 2.5-kilobase-pair (kbp) inserts expressed a beta-galactosidase fusion protein that was reactive by immunoblotting with the NTPase-I antibody. Hybridization analysis allowed the location of this gene within the vaccinia HindIIID restriction fragment. From the known nucleotide sequence of the 16-kbp vaccinia HindIIID fragment, we identified a region that contains a 1896-base open reading frame coding for a 631-amino acid protein. Analysis of the complete sequence revealed a highly basic protein, with hydrophilic COOH and NH2 termini, various hydrophobic domains, and no significant homology to other known proteins. Translational studies demonstrate that NTPase-I belongs to a late class of viral genes. This protein is highly conserved among Orthopoxviruses. Images PMID:3025846

  4. Molecular cloning and characterization of alpha - galactosidase gene from Glaciozyma antarctica

    NASA Astrophysics Data System (ADS)

    Moheer, Reyad Qaed Al; Bakar, Farah Diba Abu; Murad, Abdul Munir Abdul

    2015-09-01

    Psychrophilic enzymes are proteins produced by psychrophilic organisms which recently are the limelight for industrial applications. A gene encoding α-galactosidase from a psychrophilic yeast, Glaciozyma antarctica PI12 which belongs to glycoside hydrolase family 27, was isolated and analyzed using several bioinformatic tools. The cDNA of the gene with the size of 1,404-bp encodes a protein with 467 amino acid residues. Predicted molecular weight of protein was 48.59 kDa and hence we name the gene encoding α-galactosidase as GAL48. We found that the predicted protein sequences possessed signal peptide sequence and are highly conserved among other fungal α-galactosidase.

  5. Gene cloning and molecular characterization of the Talaromyces thermophilus lipase catalyzed efficient hydrolysis and synthesis of esters.

    PubMed

    Romdhane, Ines Belhaj-Ben; Frikha, Fakher; Maalej-Achouri, Inès; Gargouri, Ali; Belghith, Hafedh

    2012-02-15

    A genomic bank from Talaromyces thermophilus fungus was constructed and screened using a previously isolated fragment lipase gene as probe. From several clones isolated, the nucleotide sequence of the lipase gene (TTL gene) was completed and sequenced. The TTL coding gene consists of an open reading frame (ORF) of 1083bp encoding a protein of 269 Aa with an estimated molecular mass of 30kDa. The TTL belongs to the same gene family as Thermomyces lanuginosus lipase (TLL, Lipolase®), a well known lipase with multiple applications. The promoter sequence of the TTL gene showed the conservation of known consensus sequences PacC, CreA, Hap2-3-4 and the existence of a particular sequence like the binding sites of Oleate Response Element (ORE) and Fatty acids Responsis Element (FARE) which are similar to that already found to be specific of lipolytic genes in Candida and Fusarium, respectively. Northern blot analysis showed that the TTL expression was much higher on wheat bran than on olive oil as sole carbon source. Compared to the Lipolase®, this enzyme was found to be more efficient for the hydrolysis and the synthesis of esters; and its synthetic efficiency even reached 91.6% from Waste Cooking Oil triglycerides.

  6. Molecular cloning and expression analysis of an arginine decarboxylase gene from peach (Prunus persica).

    PubMed

    Liu, Ji Hong; Ban, Yusuke; Wen, Xiao-Peng; Nakajima, Ikuko; Moriguchi, Takaya

    2009-01-15

    Arginine decarboxylase (ADC), one of the enzymes responsible for putrescine (Put) biosynthesis, has been shown to be implicated in stress response. In the current paper attempts were made to clone and characterize a gene encoding ADC from peach (Prunus persica (L.) Batsch, 'Akatsuki'). Rapid amplification of cDNA ends (RACE) gave rise to a full-length ADC cDNA (PpADC) with a complete open reading frame of 2178 bp, encoding a 725 amino acid polypeptide. Homology search and sequence multi-alignment demonstrated that the deduced PpADC protein sequence shared a high identity with ADCs from other plants, including several highly conservative motifs and amino acids. Southern blotting indicated that PpADC existed in peach genome as a single gene. Expression levels of PpADC in different tissues of peach (P. persica 'Akatsuki') were spatially and developmentally regulated. Treatment of peach shoots from 'Mochizuki' with exogenous 5 mM Put, an indirect product of ADC, remarkably induced accumulation of PpADC mRNA. Transcripts of PpADC in peach leaves from 'Mochizuki' were quickly induced, either transiently or continuously, in response to dehydration, high salinity (200 mM NaCl), low temperature (4 degrees C) and heavy metal (150 microM CdCl(2)), but repressed by high temperature 37 degrees C) during a 2-day treatment, which changed in an opposite direction when the stresses were otherwise removed with the exception of CdCl(2) treatment. In addition, steady-state of PpADC mRNA could be also transiently up-regulated by abscisic acid (ABA) in 'Mochizuki' leaves. All of these, taken together, suggest that PpADC is a stress-responsive gene and can be considered as a potential target that is genetically manipulated so as to create novel germplasms with enhanced stress tolerance in the future.

  7. Cloning, Characterization, and Molecular Application of a Beta-Agarase Gene from Vibrio sp. Strain V134▿

    PubMed Central

    Zhang, Wei-wei; Sun, Li

    2007-01-01

    V134, a marine isolate of the Vibrio genus, was found to produce a new beta-agarase of the GH16 family. The relevant agarase gene agaV was cloned from V134 and conditionally expressed in Escherichia coli. Enzyme activity analysis revealed that the optimum temperature and pH for the purified recombinant agarase were around 40°C and 7.0. AgaV was demonstrated to be useful in two aspects: first, as an agarolytic enzyme, the purified recombinant AgaV could be employed in the recovery of DNA from agarose gels; second, as a secretion protein, AgaV was explored at the genetic level and used as a reporter in the construction of a secretion signal trap which proved to be a simple and efficient molecular tool for the selection of genes encoding secretion proteins from both gram-positive and gram-negative bacteria. PMID:17337564

  8. Molecular cloning and gene expression analysis of Ercc6l in Sika deer (Cervus nippon hortulorum).

    PubMed

    Yin, Yupeng; Tang, Lina; Zhang, Jiabao; Tang, Bo; Li, Ziyi

    2011-01-01

    One important protein family that functions in nucleotide excision repair (NER) factors is the SNF2 family. A newly identified mouse ERCC6-like gene, Ercc6l (excision repair cross-complementing rodent repair deficiency, complementation group 6-like), has been shown to be another developmentally related member of the SNF2 family. In this study, Sika deer Ercc6l cDNA was first cloned and then sequenced. The full-length cDNA of the Sika deer Ercc6l gene is 4197 bp and contains a 3732 bp open reading frame that encodes a putative protein of 1243 amino acids. The similarity of Sika deer Ercc6l to Bos taurus Ercc6l is 94.05% at the amino acid sequence level. The similarity, however, is reduced to 68.42-82.21% when compared to Ercc6l orthologs in other mammals and to less than 50% compared to orthologs in Gallus gallus and Xenopus. Additionally, the expression of Ercc6l mRNA was investigated in the organs of fetal and adult Sika deer (FSD and ASD, respectively) by quantitative RT-PCR. The common expression level of Ercc6l mRNA in the heart, liver, spleen, lung, kidney, and stomach from six different developmental stages of 18 Sika deer were examined, though the expression levels in each organ varied among individual Sika deer. During development, there was a slight trend toward decreased Ercc61 mRNA expression. The highest Ercc6l expression levels were seen at 3 months old in every organ and showed the highest level of detection in the spleen of FSD. The lowest Ercc6l expression levels were seen at 3 years old. We are the first to successfully clone Sika deer Ercc6l mRNA. Ercc6l transcript is present in almost every organ. During Sika deer development, there is a slight trend toward decreased Ercc61 mRNA expression. It is possible that Ercc6l has other roles in embryonic development and in maintaining the growth of animals.

  9. Molecular Cloning and Gene Expression Analysis of Ercc6l in Sika Deer (Cervus nippon hortulorum)

    PubMed Central

    Zhang, Jiabao; Tang, Bo; Li, Ziyi

    2011-01-01

    Background One important protein family that functions in nucleotide excision repair (NER) factors is the SNF2 family. A newly identified mouse ERCC6-like gene, Ercc6l (excision repair cross-complementing rodent repair deficiency, complementation group 6-like), has been shown to be another developmentally related member of the SNF2 family. Methodology/Principal Findings In this study, Sika deer Ercc6l cDNA was first cloned and then sequenced. The full-length cDNA of the Sika deer Ercc6l gene is 4197 bp and contains a 3732 bp open reading frame that encodes a putative protein of 1243 amino acids. The similarity of Sika deer Ercc6l to Bos taurus Ercc6l is 94.05% at the amino acid sequence level. The similarity, however, is reduced to 68.42–82.21% when compared to Ercc6l orthologs in other mammals and to less than 50% compared to orthologs in Gallus gallus and Xenopus. Additionally, the expression of Ercc6l mRNA was investigated in the organs of fetal and adult Sika deer (FSD and ASD, respectively) by quantitative RT-PCR. The common expression level of Ercc6l mRNA in the heart, liver, spleen, lung, kidney, and stomach from six different developmental stages of 18 Sika deer were examined, though the expression levels in each organ varied among individual Sika deer. During development, there was a slight trend toward decreased Ercc61 mRNA expression. The highest Ercc6l expression levels were seen at 3 months old in every organ and showed the highest level of detection in the spleen of FSD. The lowest Ercc6l expression levels were seen at 3 years old. Conclusions/Significance We are the first to successfully clone Sika deer Ercc6l mRNA. Ercc6l transcript is present in almost every organ. During Sika deer development, there is a slight trend toward decreased Ercc61 mRNA expression. It is possible that Ercc6l has other roles in embryonic development and in maintaining the growth of animals. PMID:21695076

  10. Molecular Cloning of Adenosinediphosphoribosyl Transferase.

    DTIC Science & Technology

    1987-09-08

    AD-RIB5 458 NOLECULNA CLONING OF AOENOSINEDXPNOSPHORIBOSyL 1/1 TRNSFERASEMU CAILIFORNIA UNIV SRN FRANCISCO E KUN US SEP 8? WFOSR-TR-87-0982 SWFOSR-B5...ACCESSION NO.D,. 03261102F 2312 A~5 11. TITLE (include Securqt Classification) 0 Molecular Cloning of Adenosinediphosphoribosyl Transferase 12. PERSONAL...I’:- AFOSR.Tlt. 8 7 - 0 9 8,2 0IL * pi AFOSR- 85 -0377 PROGRESS REPORT Molecular Cloning of Adenosinediphosphoribosyl Transferase 5." Period of

  11. Molecular cloning and characterization of acrA and acrE genes of Escherichia coli.

    PubMed Central

    Ma, D; Cook, D N; Alberti, M; Pon, N G; Nikaido, H; Hearst, J E

    1993-01-01

    The DNA fragment containing the acrA locus of the Escherichia coli chromosome has been cloned by using a complementation test. The nucleotide sequence indicates the presence of two open reading frames (ORFs). Sequence analysis suggests that the first ORF encodes a 397-residue lipoprotein with a 24-amino-acid signal peptide at its N terminus. One inactive allele of acrA from strain N43 was shown to contain an IS2 element inserted into this ORF. Therefore, this ORF was designated acrA. The second downstream ORF is predicted to encode a transmembrane protein of 1,049 amino acids and is named acrE. Genes acrA and acrE are probably located on the same operon, and both of their products are likely to affect drug susceptibilities observed in wild-type cells. The cellular localizations of these polypeptides have been analyzed by making acrA::TnphoA and acrE::TnphoA fusion proteins. Interestingly, AcrA and AcrE share 65 and 77% amino acid identity with two other E. coli polypeptides, EnvC and EnvD, respectively. Drug susceptibilities in one acrA mutant (N43) and one envCD mutant (PM61) have been determined and compared. Finally, the possible functions of these proteins are discussed. Images PMID:8407802

  12. Isolation, characterization, molecular gene cloning, and sequencing of a novel phytase from Bacillus subtilis.

    PubMed

    Kerovuo, J; Lauraeus, M; Nurminen, P; Kalkkinen, N; Apajalahti, J

    1998-06-01

    The Bacillus subtilis strain VTT E-68013 was chosen for purification and characterization of its excreted phytase. Purified enzyme had maximal phytase activity at pH 7 and 55 degrees C. Isolated enzyme required calcium for its activity and/or stability and was readily inhibited by EDTA. The enzyme proved to be highly specific since, of the substrates tested, only phytate, ADP, and ATP were hydrolyzed (100, 75, and 50% of the relative activity, respectively). The phytase gene (phyC) was cloned from the B. subtilis VTT E-68013 genomic library. The deduced amino acid sequence (383 residues) showed no homology to the sequences of other phytases nor to those of any known phosphatases. PhyC did not have the conserved RHGXRXP sequence found in the active site of known phytases, and therefore PhyC appears not to be a member of the phytase subfamily of histidine acid phosphatases but a novel enzyme having phytase activity. Due to its pH profile and optimum, it could be an interesting candidate for feed applications.

  13. [Molecular cloning and characterization of a N-acetylneuraminate lyase gene from Staphylococcus hominis].

    PubMed

    Zhou, Chuanhua; Chen, Xi; Feng, Jinhui; Xiao, Dongguang; Wuz, Qiaqing; Zhu, Dunming

    2013-04-01

    A N-acetylneuraminate lyase gene (shnal) from Staphylococcus hominis was cloned into pET-28a and expressed in Escherichia coli BL21 (DE3) host cells. The recombinant enzyme was purified and characterized. It is a homotetrameric enzyme with the optimum pH at 8.0 for the cleavage direction and the optimum pH and temperature were 7.5 and 45 degrees C for the synthetic direction. The activity of ShNAL is stable when incubated at 45 degrees C for 2 h but decreased rapidly over 50 degrees C. ShNAL showed high stability in a wide range pH from 5.0 to 10.0 with the residual activity being > 70% when the enzyme was incubated in different buffers at 4 degrees C for 24 h. Its K(m) towards N-acetylneuraminic acid, pyruvate and ManNAc were (4.0 +/- 0.2) mmol/L, (35.1 +/- 3.2) mmol/L and (131.7 +/- 12.1) mmol/L, respectively. The k(cat)/K(m) value of Neu5Ac, ManNAc, and Pyr for ShNAL were 1.9 L/(mmol x s), 0.08 L/(mmol x s) and 0.08 L/(mmol x s), respectively.

  14. Molecular evolution of Hox gene regulation: cloning and transgenic analysis of the lamprey HoxQ8 gene.

    PubMed

    Carr, J L; Shashikant, C S; Bailey, W J; Ruddle, F H

    1998-01-01

    The mammalian Hox clusters arose by duplication of a primordial cluster. The duplication of Hox clusters created redundancy within cognate groups, allowing for change in function over time. The lamprey, Petromyzon marinus, occupies an intermediate position within the chordates, both in terms of morphologic complexity and possibly cluster number. To determine the extent of divergence among Hox genes after duplication events within vertebrates, we analyzed Hox genes belonging to cognate group 8. Here we report characterization of the HoxQ8 gene, which shows conservation with mammalian genes in its amino-terminal, homeobox and hexapeptide sequences, and in the position of its splice sites. A beta-galactosidase reporter gene was introduced in the HoxQ8 genomic region by targeted recombinational cloning using a yeast-bacteria shuttle vector, pClasper. These reporter gene constructs were tested for their ability to direct region-specific expression patterns in transgenic mouse embryos. Lamprey enhancers direct expression to posterior neural tube but not to mesoderm, suggesting conservation of neuronal enhancers. In the presence of the mouse heat shock promoter, lamprey enhancers could also direct expression to the posterior mesoderm suggesting that there has been some divergence in promoter function. Our results suggest that comparative studies on Hox gene structure and analysis of regulatory elements may provide insights into changes concomitant with Hox cluster duplications in the chordates.

  15. Molecular cloning and characterization of the light-harvesting chlorophyll a/b gene from the pigeon pea (Cajanus cajan).

    PubMed

    Qiao, Guang; Wen, Xiao-Peng; Zhang, Ting

    2015-12-01

    Light-harvesting chlorophyll a/b-binding proteins (LHCB) have been implicated in the stress response. In this study, a gene encoding LHCB in the pigeon pea was cloned and characterized. Based on the sequence of a previously obtained 327 bp Est, a full-length 793 bp cDNA was cloned using the rapid amplification of cDNA ends (RACE) method. It was designated CcLHCB1 and encoded a 262 amino acid protein. The calculated molecular weight of the CcLHCB1 protein was 27.89 kDa, and the theoretical isoelectric point was 5.29. Homology search and sequence multi-alignment demonstrated that the CcLHCB1 protein sequence shared a high identity with LHCB from other plants. Bioinformatics analysis revealed that CcLHCB1 was a hydrophobic protein with three transmembrane domains. By fluorescent quantitative real-time polymerase chain reaction (PCR), CcLHCB1 mRNA transcripts were detectable in different tissues (leaf, stem, and root), with the highest level found in the leaf. The expression of CcLHCB1 mRNA in the leaves was up-regulated by drought stimulation and AM inoculation. Our results provide the basis for a better understanding of the molecular organization of LCHB and might be useful for understanding the interaction between plants and microbes in the future.

  16. Immersing Undergraduate Students in the Research Experience: A Practical Laboratory Module on Molecular Cloning of Microbial Genes

    ERIC Educational Resources Information Center

    Wang, Jack T. H.; Schembri, Mark A.; Ramakrishna, Mathitha; Sagulenko, Evgeny; Fuerst, John A.

    2012-01-01

    Molecular cloning skills are an essential component of biological research, yet students often do not receive this training during their undergraduate studies. This can be attributed to the complexities of the cloning process, which may require many weeks of progressive design and experimentation. To address this issue, we incorporated an…

  17. Immersing Undergraduate Students in the Research Experience: A Practical Laboratory Module on Molecular Cloning of Microbial Genes

    ERIC Educational Resources Information Center

    Wang, Jack T. H.; Schembri, Mark A.; Ramakrishna, Mathitha; Sagulenko, Evgeny; Fuerst, John A.

    2012-01-01

    Molecular cloning skills are an essential component of biological research, yet students often do not receive this training during their undergraduate studies. This can be attributed to the complexities of the cloning process, which may require many weeks of progressive design and experimentation. To address this issue, we incorporated an…

  18. Molecular cloning, characterization and expression of the phenylalanine ammonia-lyase gene from Juglans regia.

    PubMed

    Xu, Feng; Deng, Guang; Cheng, Shuiyuan; Zhang, Weiwei; Huang, Xiaohua; Li, Linling; Cheng, Hua; Rong, Xiaofeng; Li, Jinbao

    2012-06-26

    Phenylalanine ammonia-lyase (PAL) is the first key enzyme of the phenypropanoid pathway. A full-length cDNA of PAL gene was isolated from Juglans regia for the first time, and designated as JrPAL. The full-length cDNA of the JrPAL gene contained a 1935bp open reading frame encoding a 645-amino-acid protein with a calculated molecular weight of about 70.4 kD and isoelectric point (pI) of 6.7. The deduced JrPAL protein showed high identities with other plant PALs. Molecular modeling of JrPAL showed that the 3D model of JrPAL was similar to that of PAL protein from Petroselinum crispum (PcPAL), implying that JrPAL may have similar functions with PcPAL. Phylogenetic tree analysis revealed that JrPAL shared the same evolutionary ancestor of other PALs and had a closer relationship with other angiosperm species. Transcription analysis revealed that JrPAL was expressed in all tested tissues including roots, stems, and leaves, with the highest transcription level being found in roots. Expression profiling analyses by real-time PCR revealed that JrPAL expression was induced by a variety of abiotic and biotic stresses, including UV-B, wounding, cold, abscisic acid and salicylic acid.

  19. Molecular cloning and characterization of pigeon (Columba liva) ubiquitin and ubiquitin-conjugating enzyme genes from pituitary gland library.

    PubMed

    Gao, Peng-fei; Cao, Guo-qing; Zhao, Hui-ting; Zhang, Gui-xian; Jiang, Yu-suo; Wang, Qin-de

    2009-01-01

    In the study of the regulation of incubation, broodiness and laying performance in pigeons (Columba liva), a cDNA library, which was enriched with full-length brooding-related genes, was constructed by SMART LD-PCR techniques using the pituitary glands of incubating White King pigeons. The titers of optimal primary libraries were 1.54x10(6) pfu/mL and 1.80x10(6) pfu/mL and the titers of amplified libraries were 1.89x10(8) pfu/mL and 2.32x10(9 )pfu/mL. The percentages of recombinant clones of primary libraries and amplified libraries were all over 90%. A positive clone was sequenced and named ubiquitin based on the highly similar from other species. The fragment has the four initial codons of ATG, a termination codon of TAA and a signal sequence of AATAAA for adding the poly-A tail. The open reading frame of 918bp encodes 305 amino acids (NCBI accession number is EU981283). Recombinant pigeon ubiquitin protein was efficiently expressed with the form of insoluble inclusion bodies in E. coli BL21 transformed with a pET28a(+) expression vector containing the DNA sequence encoding mature pigeon ubiquitin. The molecular weight of expressed protein is the same as predicted size of approximately 35kD. To improve the efficiency of cloning full-length cDNA, strategies of RACE combined with cDNA library were used. The length of pigeons ubiquitin-conjugating enzyme gene obtained was 1263 bp containing a complete open reading frame of 435 bp that encodes 144 aa (NCBI accession number is EU914824). The results of this study not only provide a starting point for further study of ubiquitin function in pigeon species, but also provide a starting point for investigating the brooding mechanisms of pigeons.

  20. Molecular cloning of the human eosinophil-derived neurotoxin: a member of the ribonuclease gene family.

    PubMed Central

    Rosenberg, H F; Tenen, D G; Ackerman, S J

    1989-01-01

    We have isolated a 725-base-pair cDNA clone for human eosinophil-derived neurotoxin (EDN). EDN is a distinct cationic protein of the eosinophil's large specific granule known primarily for its ability to induce ataxia, paralysis, and central nervous system cellular degeneration in experimental animals (Gordon phenomenon). The open reading frame encodes a 134-amino acid mature polypeptide with a molecular mass of 15.5 kDa and a 27-residue amino-terminal hydrophobic leader sequence. The sequence of the mature polypeptide is identical to that reported for human urinary ribonuclease [Beintema, J. J., Hofsteenge, J., Iwama, M., Morita, T., Ohgi, K., Irie, M., Sugiyama, R. H., Schieven, G. L., Dekker, C. A. & Glitz, D. G. (1988) Biochemistry 27, 4530-4538] and to the amino-terminal sequence of human liver ribonuclease [Sorrentino, S., Tucker, G. K. & Glitz, D. G. (1988) J. Biol. Chem. 263, 16125-16131]; the cDNA encodes a tryptophan in position 7, which was previously unidentified in the amino acid sequences of EDN or the urinary and liver ribonucleases. Both EDN and the related granule protein, eosinophil cationic protein, have ribonucleolytic activity; sequence similarities among EDN, eosinophil cationic protein, ribonucleases from liver, urine, and pancreas, and angiogenin define a ribonuclease multigene family. mRNA encoding EDN was detected in uninduced HL-60 cells and was up-regulated in cells induced toward eosinophilic differentiation with B-cell growth factor 2/interleukin 5 and toward neutrophilic differentiation with dimethyl sulfoxide. EDN mRNA was detected in mature neutrophils even though EDN-like neurotoxic activity is not found in neutrophil extracts. These results suggest that neutrophils contain a protein that is closely related or identical to EDN. Images PMID:2734298

  1. Molecular cloning, characterization and expression profiles of thioredoxin 1 and thioredoxin 2 genes in Mytilus galloprovincialis

    NASA Astrophysics Data System (ADS)

    Wang, Qing; Ning, Xuanxuan; Pei, Dong; Zhao, Jianmin; You, Liping; Wang, Chunyan; Wu, Huifeng

    2013-05-01

    Thioredoxin (Trx) proteins are involved in many biological processes especially the regulation of cellular redox homeostasis. In this study, two Trx cDNAs were cloned from the mussel Mytilus galloprovincialis using rapid amplifi cation of cDNA ends-polymerase chain reaction (RACE-PCR). The two cDNAs were named MgTrx1 and MgTrx2, respectively. The open reading frames of MgTrx1 and MgTrx2 were 318 and 507 base pairs (bp) and they encoded proteins of 105 and 168 amino acids with estimated molecular masses of 11.45 and 18.93 kDa, respectively. Sequence analysis revealed that both proteins possessed the conserved active site dithiol motif Cys-Gly-Pro-Cys. In addition, MgTrx2 also possessed a putative mitochondrial targeting signal suggesting that it is located in the mitochondria. Quantitative real-time polymerase chain reaction (qPCR) revealed that both MgTrx1 and MgTrx2 were constitutively expressed in all tissues examined. The MgTrx1 transcript was most abundant in hemocytes and gills, whereas the MgTrx2 transcript was most abundant in gonad, hepatopancreas, gill and hemocytes. Following Vibrio anguillarum challenge, the expression of MgTrx1 was up-regulated and reached its peak, at a value 10-fold the initial value, at 24 h. Subsequently, expression returned back to the original level. In contrast, the expression level of MgTrx2 was down-regulated following bacterial stimulation, with one fi fth of the control level evident at 12 h post challenge. These results suggest that MgTrx1 and MgTrx2 may play important roles in the response of M. galloprovincialis to bacterial challenge.

  2. Molecular cloning and sequence analysis of prion protein gene in Xiji donkey in China.

    PubMed

    Zhang, Zhuming; Wang, Renli; Xu, Lihua; Yuan, Fangzhong; Zhou, Xiangmei; Yang, Lifeng; Yin, Xiaomin; Xu, Binrui; Zhao, Deming

    2013-10-25

    Prion diseases are a group of human and animal neurodegenerative disorders caused by the deposition of an abnormal isoform prion protein (PrP(Sc)) encoded by a single copy prion protein gene (PRNP). Prion disease has been reported in many herbivores but not in Equus and the species barrier might be playing a role in resistance of these species to the disease. Therefore, analysis of genotype of prion protein (PrP) in these species may help understand the transmission of the disease. Xiji donkey is a rare species of Equus not widely reared in Ningxia, China, for service, food and medicine, but its PRNP has not been studied. Based on the reported PrP sequence in GenBank we designed primers and amplified, cloned and sequenced the PRNP of Xiji donkey. The sequence analysis showed that the Xiji donkey PRNP was consisted of an open reading frame of 768 nucleotides encoding 256 amino acids. Amino acid residues unique to donkey as compared with some Equus animals, mink, cow, sheep, human, dog, sika deer, rabbit and hamster were identified. The results showed that the amino acid sequence of Xiji donkey PrP starts with the consensus sequence MVKSH, with almost identical amino acid sequence to the PrP of other Equus species in this study. Amino acid sequence analysis showed high identity within species and close relation to the PRNP of sika deer, sheep, dog, camel, cow, mink, rabbit and hamster with 83.1-99.7% identity. The results provided the PRNP data for an additional Equus species, which should be useful to the study of the prion disease pathogenesis, resistance and cross species transmission.

  3. Molecular cloning and characterization of IKKε gene from black carp Mylopharyngodon piceus.

    PubMed

    Qu, Yixiao; Zhou, Man; Peng, Linzhi; Li, Jun; Yan, Jun; Yang, Peilin; Feng, Hao

    2015-11-01

    IKKε is an IκB kinase functioning in NF-κB signal pathway in the innate immune system of higher vertebrates. To exploit the function of IKKε of black carp (bcIKKε) in its antiviral innate immunity, the IKKε gene has been cloned from the RNA isolated from the spleen of black carp. The full-length cDNA of bcIKKε is 2537 bp, which encodes the peptide of 723 amino acids. bcIKKε contains a S-Tkc domain, a PKc domain and a UBL-TBK1-like domain and bcIKKε shares the highest amino acid sequence similarity with that of grass carp. bcIKKε was constitutively transcribed in the selected tissues of black carp including gill, kidney, heart, intestine, liver, muscle, skin and spleen; and the mRNA level of bcIKKε in these tissues varied right after SVCV or GCRV infection. bcIKKε had been well expressed in HEK293T cells and western blot assay determined that this fish kinase was around 80 KDa. The immunofluorescence assay of both NH3T3 cells and EPC cells demonstrated that bcIKKε was located in the cytosolic part of the cell. Report assay result showed that overexpression of bcIKKε in EPC cells activated the expression of both zebrafish IFN and EPC IFN. All our data suggest that bcIKKε is a novel fish kinase functioning in the innate antiviral immune response of black carp. Copyright © 2015 Elsevier Ltd. All rights reserved.

  4. Molecular cloning and characterization of SoxB2 gene from Zhikong scallop Chlamys farreri

    NASA Astrophysics Data System (ADS)

    He, Yan; Bao, Zhenmin; Guo, Huihui; Zhang, Yueyue; Zhang, Lingling; Wang, Shi; Hu, Jingjie; Hu, Xiaoli

    2013-11-01

    The Sox proteins play critical roles during the development of animals, including sex determination and central nervous system development. In this study, the SoxB2 gene was cloned from a mollusk, the Zhikong scallop ( Chlamys farreri), and characterized with respect to phylogeny and tissue distribution. The full-length cDNA and genomic DNA sequences of C. farreri SoxB2 ( Cf SoxB2) were obtained by rapid amplification of cDNA ends and genome walking, respectively, using a partial cDNA fragment from the highly conserved DNA-binding domain, i.e., the High Mobility Group (HMG) box. The full-length cDNA sequence of Cf SoxB2 was 2 048 bp and encoded 268 amino acids protein. The genomic sequence was 5 551 bp in length with only one exon. Several conserved elements, such as the TATA-box, GC-box, CAAT-box, GATA-box, and Sox/sry-sex/testis-determining and related HMG box factors, were found in the promoter region. Furthermore, real-time quantitative reverse transcription PCR assays were carried out to assess the mRNA expression of Cf SoxB 2 in different tissues. SoxB2 was highly expressed in the mantle, moderately in the digestive gland and gill, and weakly expressed in the gonad, kidney and adductor muscle. In male and female gonads at different developmental stages of reproduction, the expression levels of Cf SoxB2 were similar. Considering the specific expression and roles of SoxB 2 in other animals, in particular vertebrates, and the fact that there are many pallial nerves in the mantle, cerebral ganglia in the digestive gland and gill nerves in gill, we propose a possible essential role in nervous tissue function for Sox B 2 in C. farreri.

  5. Agouti signalling protein (ASIP) gene: molecular cloning, sequence characterisation and tissue distribution in domestic goose.

    PubMed

    Zhang, J; Wang, C; Liu, Y; Liu, J; Wang, H Y; Liu, A F; He, D Q

    2016-06-01

    Agouti signalling protein (ASIP) is an endogenous antagonist of melanocortin-1 receptor (MC1R) and is involved in the regulation of pigmentation in mammals. The objective of this study was to identify and characterise the ASIP gene in domestic goose. The goose ASIP cDNA consisted of a 44-nucleotide 5'-terminal untranslated region (UTR), a 390-nucleotide open-reading frame (ORF) and a 45-nucleotide 3'-UTR. The length of goose ASIP genomic DNA was 6176 bp, including three coding exons and two introns. Bioinformatic analysis indicated that the ORF encodes a protein of 130 amino-acid residues with a molecular weight of 14.88 kDa and an isoelectric point of 9.73. Multiple sequence alignments and phylogenetic analysis showed that the amino-acid sequence of ASIP was conserved in vertebrates, especially in the avian species. RT-qPCR showed that the goose ASIP mRNA was differentially expressed in the pigment deposition tissues, including eye, foot, feather follicle, skin of the back, as well as in skin of the abdomen. The expression level of the ASIP gene in skin of the abdomen was higher than that in skin of the back. Those findings will contribute to further understanding the functions of the ASIP gene in geese plumage colouring.

  6. Molecular Cloning and Co-Expression of Phytoene Synthase Gene from Kocuria gwangalliensis in Escherichia coli.

    PubMed

    Seo, Yong Bae; Choi, Seong-Seok; Lee, Jong Kyu; Kim, Nan-Hee; Choi, Mi Jin; Kim, Jong-Myoung; Jeong, Tae Hyug; Nam, Soo-Wan; Lim, Han Kyu; Kim, Gun-Do

    2015-11-01

    A phytoene synthase gene, crtB, was isolated from Kocuria gwangalliensis. The crtB with 1,092 bp full-length has a coding sequence of 948 bp and encodes a 316-amino-acids protein. The deduced amino acid sequence showed a 70.9% identity with a putative phytoene synthase from K. rhizophila. An expression plasmid, pCcrtB, containing the crtB gene was constructed, and E. coli cells containing this plasmid produced the recombinant protein of approximately 34 kDa , corresponding to the molecular mass of phytoene synthase. Biosynthesis of lycopene was confirmed when the plasmid pCcrtB was co-transformed into E. coli containing pRScrtEI carrying the crtE and crtI genes encoding lycopene biosynthetic pathway enzymes. The results obtained from this study will provide a base of knowledge about the phytoene synthase of K. gwangalliensis and can be applied to the production of carotenoids in a non-carotenoidproducing host.

  7. Molecular cloning and characterization of prohormone convertase 1 gene in abalone (Haliotis diversicolor supertexta).

    PubMed

    Zhou, Jin; Cai, Zhong-hua

    2010-03-01

    Prohormone convertases (PCs) are calcium-dependent serine endoproteases of the subtilisin family that play a key role in the posttranslational processing of precursors for bioactive peptides. In this study, the cDNA of PC1 from abalone (Haliotis diversicolor supertexta) was cloned and sequenced. The PC1 cDNA consisted of 2216 bp with an open reading frame of 2010 bp encoding a 670 amino acid peptide. Comparative structural analysis revealed that abalone PC1 shared high similarity and identity with most PC counterparts. The profile of deduced peptide of PC1 was composed of an N-terminal signal peptide, a prosegment domain, a catalytic domain and a P domain, which were common in many species. Sequence analysis indicated that the abalone PC1 was highly conserved in catalytic domain, including three conserved serine catalytic signatures that comprised a catalytic triad active center. Also conserved were the potential cleavage site for release of the mature peptide, a cognate integrin binding site RGD in P domain, and four cysteine residues involved in forming an intrachain disulfide bridge. To further investigate the functions of PC1 in abalone, real-time quantitative PCR was performed to determine the expression level of this gene at three different reproduction stages (i.e. pre-, during- and post-breeding). Results indicated that PC1 was expressed throughout the three stages but the expression levels varied with the timepoints and different tissues in abalone. The expression levels of PC1 in digestive gland were much higher than those of the gonad. In female abalone, the expression of PC1 was higher at pre-breeding and during-breeding stages (P<0.05), and the expression declined at the subsequent stage. Whereas, the level of PC1 in male individual did not exhibit a significant difference in various reproduction stages. Also, the natural enzyme activity of PC1 partially exhibited a similar tendency with the mRNA expression. According to the results, it can be

  8. Molecular cloning and characterization of a glycine-like receptor gene from the cattle tick Rhipicephalus (Boophilus) microplus (Acari: Ixodidae).

    PubMed

    Flores-Fernández, José Miguel; Gutiérrez-Ortega, Abel; Padilla-Camberos, Eduardo; Rosario-Cruz, Rodrigo; Hernández-Gutiérrez, Rodolfo; Martínez-Velázquez, Moisés

    2014-01-01

    The cattle tick Rhipicephalus (Boophilus) microplus is the most economically important ectoparasite affecting the cattle industry in tropical and subtropical areas around the world. The principal method of tick control has relied mainly on the use of chemical acaricides, including ivermectin; however, cattle tick populations resistant to ivermectin have recently been reported in Brazil, Mexico, and Uruguay. Currently, the molecular basis for ivermectin susceptibility and resistance are not well understood in R. microplus. This prompted us to search for potential molecular targets for ivermectin. Here, we report the cloning and molecular characterization of a R. microplus glycine-like receptor (RmGlyR) gene. The characterized mRNA encodes for a 464-amino acid polypeptide, which contains features common to ligand-gated ion channels, such as a large N-terminal extracellular domain, four transmembrane domains, a large intracellular loop and a short C-terminal extracellular domain. The deduced amino acid sequence showed around 30% identity to GlyRs from some invertebrate and vertebrate organisms. The polypeptide also contains the PAR motif, which is important for forming anion channels, and a conserved glycine residue at the third transmembrane domain, which is essential for high ivermectin sensitivity. PCR analyses showed that RmGlyR is expressed at egg, larval and adult developmental stages. Our findings suggest that the deduced receptor is an additional molecular target to ivermectin and it might be involved in ivermectin resistance in R. microplus.

  9. Molecular cloning and characterization of a glycine-like receptor gene from the cattle tick Rhipicephalus (Boophilus) microplus (Acari: Ixodidae)

    PubMed Central

    Flores-Fernández, José Miguel; Gutiérrez-Ortega, Abel; Padilla-Camberos, Eduardo; Rosario-Cruz, Rodrigo; Hernández-Gutiérrez, Rodolfo; Martínez-Velázquez, Moisés

    2014-01-01

    The cattle tick Rhipicephalus (Boophilus) microplus is the most economically important ectoparasite affecting the cattle industry in tropical and subtropical areas around the world. The principal method of tick control has relied mainly on the use of chemical acaricides, including ivermectin; however, cattle tick populations resistant to ivermectin have recently been reported in Brazil, Mexico, and Uruguay. Currently, the molecular basis for ivermectin susceptibility and resistance are not well understood in R. microplus. This prompted us to search for potential molecular targets for ivermectin. Here, we report the cloning and molecular characterization of a R. microplus glycine-like receptor (RmGlyR) gene. The characterized mRNA encodes for a 464-amino acid polypeptide, which contains features common to ligand-gated ion channels, such as a large N-terminal extracellular domain, four transmembrane domains, a large intracellular loop and a short C-terminal extracellular domain. The deduced amino acid sequence showed around 30% identity to GlyRs from some invertebrate and vertebrate organisms. The polypeptide also contains the PAR motif, which is important for forming anion channels, and a conserved glycine residue at the third transmembrane domain, which is essential for high ivermectin sensitivity. PCR analyses showed that RmGlyR is expressed at egg, larval and adult developmental stages. Our findings suggest that the deduced receptor is an additional molecular target to ivermectin and it might be involved in ivermectin resistance in R. microplus. PMID:25174962

  10. Molecular Cloning and Functional Analysis of Three FLOWERING LOCUS T (FT) Homologous Genes from Chinese Cymbidium

    PubMed Central

    Huang, Weiting; Fang, Zhongming; Zeng, Songjun; Zhang, Jianxia; Wu, Kunlin; Chen, Zhilin; Teixeira da Silva, Jaime A.; Duan, Jun

    2012-01-01

    The FLOWERING LOCUS T (FT) gene plays crucial roles in regulating the transition from the vegetative to reproductive phase. To understand the molecular mechanism of reproduction, three homologous FT genes were isolated and characterized from Cymbidium sinense “Qi Jian Bai Mo”, Cymbidium goeringii and Cymbidium ensifolium “Jin Si Ma Wei”. The three genes contained 618-bp nucleotides with a 531-bp open reading frame (ORF) of encoding 176 amino acids (AAs). Alignment of the AA sequences revealed that CsFT, CgFT and CeFT contain a conserved domain, which is characteristic of the PEBP-RKIP superfamily, and which share high identity with FT of other plants in GenBank: 94% with OnFT from Oncidium Gower Ramsey, 79% with Hd3a from Oryza sativa, and 74% with FT from Arabidopsis thaliana. qRT-PCR analysis showed a diurnal expression pattern of CsFT, CgFT and CeFT following both long day (LD, 16-h light/8-h dark) and short day (SD, 8-h light/16-h dark) treatment. While the transcripts of both CsFT and CeFT under LD were significantly higher than under SD, those of CgFT were higher under SD. Ectopic expression of CgFT in transgenic Arabidopsis plants resulted in early flowering compared to wild-type plants and significant up-regulation of APETALA1 (AP1) expression. Our data indicates that CgFT is a putative phosphatidylethanolamine-binding protein gene in Cymbidium that may regulate the vegetative to reproductive transition in flowers, similar to its Arabidopsis ortholog. PMID:23109860

  11. Cloning and molecular characterization of three novel LMW-i glutenin subunit genes from cultivated einkorn (Triticum monococcum L.).

    PubMed

    An, X; Zhang, Q; Yan, Y; Li, Q; Zhang, Y; Wang, A; Pei, Y; Tian, J; Wang, H; Hsam, S L K; Zeller, F J

    2006-08-01

    Three novel low molecular weight (LMW) glutenin subunits from cultivated einkorn (Triticum monococcum L., A(m)A(m), 2n = 2x = 14) were characterized by SDS-PAGE and molecular weights determined by MALDI-TOF-MS. Their coding genes were amplified and cloned with designed AS-PCR primers, revealing three complete gene sequences. All comprised upstream, open reading frame (ORF), downstream and no introns were present. The deduced amino acid sequences showed that all three genes, named as LMW-M1, LMW-M3 and LMW-M5, respectively, belonged to the LMW-i type subunits with the predicted molecular weight between 38.5206 and 38.7028 kDa. They showed high similarity with other LMW-i type genes from hexaploid bread wheats, but also displayed unique features. Particularly, LMW-M5 subunit contained an extra cysteine residue in the C-terminus except for eight conserved cysteines, which resulted from a single-nucleotide polymorphism (SNP) of the T-C transition, namely arginine --> cysteine substitution at position 242 from the N-terminal end. This is the first report that the LMW-i subunit contained nine cysteines residues that could result in a more highly cross-linked and more elastic glutenin suggesting that LMW-M5 gene may associates with good quality properties. In addition, a total of 25 SNPs and one insertions/deletions (InDels) were detected among three LMW-i genes, which could result in significant functional changes in polymer formation of gluten. It is anticipated that these SNPs could be used as reliable genetic markers during wheat quality improvement. The phylogenetic analysis indicated that LMW-i type genes apparently differed from LMW-m and LMW-s type genes and diverged early from the primitive LMW-GS gene family, at about 12.92 million years ago (MYA) while the differentiation of A(m) and A genomes was estimated at 3.98 MYA.

  12. Molecular cloning, expression analyses and primary evolution studies of REV- and TB1-like genes in bamboo.

    PubMed

    Peng, Hua-Zheng; Lin, Er-Pei; Sang, Qing-Liang; Yao, Sheng; Jin, Qun-Ying; Hua, Xi-Qi; Zhu, Mu-Yuan

    2007-09-01

    Most cultured bamboos are perennial woody evergreens that reproduce from rhizomes. It is unclear why some rhizome buds develop into aerial bamboo shoots instead of new rhizomes. REVOLUTA (REV)-like Class III homeodomain leucine-zipper (HD-Zip) proteins and TEOSINTE BRANCHED1 (TB1)-like transcription factors have been shown to play regulatory roles in meristem initiation and outgrowth. We cloned and analyzed the bamboo (Phyllostachys praecox C.D. Chu & C.S. Chao.) REV- (PpHB1) and TB1-like (PpTB1) gene. Gene expression was mainly detected by in situ hybridization. PpHB1 expression was detected in the tips of lateral buds, on the adaxial portion of the leaf and within the developing procambium, indicating its close correlation to rhizome bud formation and procambial development. PpTB1 expression was mainly detected on the top of buds at later developmental stages, suggesting it was more likely involved in bud outgrowth. Meristem genes might therefore serve as specific molecular markers of rhizome bud development and could be useful in studies designed to elucidate the mechanisms underlying bamboo shoot development. In addition, meristem genes such as TB1-like sequences may be useful in phylogenetic analyses of bamboo species.

  13. Molecular cloning and characterization of human WINS1 and mouse Wins2, homologous to Drosophila segment polarity gene Lines (Lin).

    PubMed

    Katoh, Masaru

    2002-08-01

    WNT signaling molecules play key roles in carcinogenesis and embryogenesis. Drosophila segment polarity gene Lines (Lin) is essential for Wnt/Wingless-dependent patterning in dorsal epidermis and also for hindgut development. With Wnt signaling, Lin accumulates in the nucleus to modulate transcription of Wnt target genes through association with beta-catenin/Armadillo and TCF/Pangolin. Here, human WINS1 and mouse Wins2, encoding proteins with Drosophila Lin homologous domain, were isolated using bioinformatics and cDNA-PCR. Human WINS1 encoded 757-amino-acid protein, and mouse Wins2 encoded 498-amino-acid protein. Human WINS1 and mouse Wins2 showed 60.0% total-amino-acid identity. Lin homologous domain of WINS1 and Wins2 showed 29.4% and 27.2% amino-acid identity with that of Drosphila Lin, respectively. In the human chromosome 15q26 region, WINS1 gene was clustered with ASB7 gene encoding ankyrin repeat and SOCS box-containing protein 7. Human WINS1 mRNA of 2.8-kb in size was expressed in adult testis, prostate, spleen, thymus, skeletal muscle, fetal kidney and brain. This is the first report on molecular cloning and initial characterization of human WINS1 and mouse Wins2

  14. Molecular cloning and characterization of two novel NAC genes from Mikania micrantha (Asteraceae).

    PubMed

    Li, D M; Wang, J H; Peng, S L; Zhu, G F; Lü, F B

    2012-12-17

    NAC proteins, which are plant-specific transcription factors, have been identified to play important roles in plant response to stresses and in plant development. The full-length cDNAs that encode 2 putative NAC proteins, designated as MmATAF1 and MmNAP, respectively, were cloned from Mikania micrantha by rapid amplification of cDNA ends. The full-length cDNAs of MmATAF1 and MmNAP were 1329 and 1072 bp, respectively, and they encoded deduced proteins of 260- and 278-amino acid residues, respectively. The proteins MmATAF1 and MmNAP had a calculated molecular mass of 29.81 and 32.55 kDa and a theoretical isoelectric point of 7.08 and 9.00, respectively. Nucleotide sequence data indicated that both MmATAF1 and MmNAP contained 2 introns and 3 exons and that they shared a conserved genomic organization. Multiple sequence alignments showed that MmATAF1 showed high sequence identity with ATAF1 of Arabidopsis thaliana (61%) and that MmNAP showed high sequence identity with NAP of A. thaliana (67%) and CitNAC of Citrus sinensis Osbeck (62%). Phylogenetic analysis showed that the predicted MmATAF1 and MmNAP proteins were classified into the ATAF and NAP subgroups, respectively. Transient expression analysis of onion epidermal cells indicated nuclear localization of both MmATAF1-GFP and MmNAP-GFP fusion proteins. Semi-quantitative reverse transcription polymerase chain reaction (RT-PCR) analysis indicated that MmATAF1 was expressed in all the tissues tested, but in varying abundance, while MmNAP was specifically expressed in stems, petioles, shoots, and leaves, but not in roots. The transcript levels of MmATAF1 and MmNAP in shoots and in infected stems were induced and strengthened by wounding, exogenous ZnSO(4), abscisic acid, salicylic acid, and Cuscuta campestris infection on the basis of semi-quantitative RT-PCR and real-time PCR analyses, respectively. Collectively, these results indicated that MmATAF1 and MmNAP, besides having roles in M. micrantha adaptation to C

  15. Molecular Cloning and Functional Analysis of the Duck TLR4 Gene

    PubMed Central

    Zhao, Wenming; Huang, Zhengyang; Chen, Yang; Zhang, Yang; Rong, Guanghui; Mu, Chunyu; Xu, Qi; Chen, Guohong

    2013-01-01

    Toll-like receptor 4 (TLR4) recognizes pathogen-associated molecular patterns in some animals and has been shown to be closely associated with several diseases such as tumors, atherosclerosis, and asthma. However, its function in ducks is not clear. Alternative splicing of the TLR4 gene has been identified in pigs, sheep, mice, and other species, but has not yet been reported in the duck. In this study, alternative splicing of the duck TLR4 gene was investigated using reverse transcription-polymerase chain reaction (RT-PCR). Duck TLR4 gene (duTLR4, accession number: KF278109) was found to consist of 3367 nucleotides of coding sequence. An alternative splice form, TLR4-b, was identified and shown by alignment to retain the intron between exons 1 and 2. Real-time quantitative polymerase chain reaction (qPCR) analyses suggested that duTLR4-a (wild-type) mRNA is widely expressed in various healthy tissues, whereas TLR4-b is expressed at only low levels. Following stimulation of normal duck embryo fibroblasts with lipopolysaccharide, the expression of both isoforms initially increased and then decreased. Expression of the wild-type isoform subsequently increased again, while that of the variant remained low. The expression levels of wild-type TLR4 were further analyzed by transient transfection of a pcDNA3.1(+)-TLR4-a overexpression vector into duck embryo fibroblasts. qRT-PCR analyses showed that after stimulation with LPS and poly(I:C) the expression levels of IL-1β, IL6, and MHC II increased with a response-efficacy relationship. Our experimental results indicate that TLR4 plays an important role in resistance to both bacterial and viral infections in the duck. PMID:24025421

  16. Molecular cloning and characterization of annexin genes in peanut (Arachis hypogaea L.).

    PubMed

    He, MeiJing; Yang, XinLei; Cui, ShunLi; Mu, GuoJun; Hou, MingYu; Chen, HuanYing; Liu, LiFeng

    2015-08-15

    Annexin, Ca(2+) or phospholipid binding proteins, with many family members are distributed throughout all tissues during plant growth and development. Annexins participate in a number of physiological processes, such as exocytosis, cell elongation, nodule formation in legumes, maturation and stress response. Six different full-length cDNAs and two partial-length cDNAs of peanut, (AnnAh1, AnnAh2, AnnAh3, AnnAh5, AnnAh6, AnnAh7, AnnAh4 and AnnAh8) encoding annexin proteins, were isolated and characterized using a RT-PCR/RACE-PCR based strategy. The predicted molecular masses of these annexins were 36.0kDa with acidic pIs of 5.97-8.81. ANNAh1, ANNAh2, ANNAh3, ANNAh5, ANNAh6 and ANNAh7 shared sequence similarity from 35.76 to 66.35% at amino acid level. Phylogenetic analysis revealed their evolutionary relationships with corresponding orthologous sequences in soybean and deduced proteins in various plant species. Real-time quantitative assays indicated that these genes were differentially expressed in various organs. Transcript level analysis for six annexin genes under stress conditions showed that these genes were regulated by drought, salinity, heavy metal stress, low temperature and hormone. Additionally, the prediction of cis-regulatory element suggested that different cis-responsive elements including stress- and hormone-responsive-related elements could respond to various stress conditions. These results indicated that members of AnnAhs family may play important roles in the adaptation of peanut to various environmental stresses. Copyright © 2015 Elsevier B.V. All rights reserved.

  17. Molecular cloning, expression and characterization of a phenylalanine ammonia-lyase gene (SmPAL1) from Salvia miltiorrhiza.

    PubMed

    Song, Jie; Wang, Zhezhi

    2009-05-01

    Phenylalanine ammonia-lyase (PAL) is one of the branch point enzymes between primary and secondary metabolism. It plays an important role during plant development and defense. A PAL gene designated as SmPAL1 was cloned from Salvia miltiorrhiza using genome walking technology. The full-length SmPAL1 was 2,827 bp in size and consisted of an intron and two extrons encoding a 711-amino-acid polypeptide. Sequence alignment revealed that SmPAL1 shared more than 80% identity with the PAL sequences reported in Arabidopsis thaliana and other plants. The 5' flanking sequence of SmPAL1 was also cloned, and a group of putative cis-acting elements such as TATA box, CAAT box, G box and TC-rich repeats were identified. Transcription pattern analysis indicated that SmPAL1 expressed in all tissues examined, but more highly in leaf. Besides, expression of SmPAL1 was found to be induced by various treatments including ABA, wounding, and dehydration. To further confirm its function, SmPAL1 was expressed in Escherichia coli strain M15 with pQE-30 vector. The recombinant protein exhibited high PAL activity and could catalyze the conversion of L: -Phe to trans-cinnamic acid. This study will enable us to further understand the role SmPAL1 plays in the synthesis of active pharmaceutical compounds in S. miltiorrhiza at molecular level.

  18. Molecular cloning and functional characterization of the anthocyanidin reductase gene from Vitis bellula.

    PubMed

    Zhu, Yue; Peng, Qing-Zhong; Li, Ke-Gang; Xie, De-Yu

    2014-08-01

    Anthocyanidin reductase (ANR) is an NADPH-/NADH-dependent enzyme that transfers two hydrides to anthocyanidins to produce three types of isomeric flavan-3-ols. This reductase forms the ANR pathway toward the biosynthesis of proanthocyanidins (PAs, which are also called condensed tannins). Here, we report cloning and functional characterization of an ANR (called VbANR) homolog from the leaves of Vitis bellula, a newly developed grape crop in southern China. The open reading frame (ORF) of VbANR is 1,017 bp in length and encodes 339 amino acids. A phylogenetic analysis and an alignment using 17 sequences revealed that VbANR is approximately 99.9 % identical to the ANR homolog from Vitis vinifera. The VbANR ORF is fused to the Trx gene containing a His-tag in the pET32a(+) vector to obtain a pET32a(+)-VbANR construct for expressing the recombinant VbANR. In vitro enzyme assays show that VbANR converts cyanidin, delphinidin, and pelargonidin to their corresponding flavan-3-ols. Enzymatic products include 2S,3R-trans- and 2R,3R-cis-flavan-3-ols isomers, such as (-)-catechin and (-)-epicatechin. In addition, the third compound that is observed from the enzymatic products is most likely a 2S,3S-cis-flavan-3-ol. To analyze the kinetics and optimize pH and temperature values, a UV spectrometry method was developed to quantify the concentrations of total enzymatic products. The optimum pH and temperature values are 4.0 and 40 °C, respectively. The K m , K cat, V max, and K cat/K m values for pelargonidin and delphinidin were similar. In comparison, VbANR exhibits a slightly lower affinity to cyanidin. VbANR uses both NADPH and NADH but prefers to employ NADPH. GFP fusion and confocal microscopy analyses revealed the cytosolic localization of VbANR. The overexpression of VbANR in ban mutants reconstructed the biosynthetic pathway of PAs in the seed coat. These data demonstrate that VbANR forms the ANR pathway, leading to the formation of three types of isomeric flavan-3-ols

  19. Molecular cloning of a gene (poIA) coding for an unusual DNA polymerase I from Treponema pallidum.

    PubMed

    Rodes, B; Liu, H; Johnson, S; George, R; Steiner, B

    2000-07-01

    The gene coding for the DNA polymerase I from Treponema pallidum, Nichols strain, was cloned and sequenced. Depending on which of the two alternative initiation codons was used, the protein was either 997 or 1015 amino acids long and the predicted protein had a molecular mass of either 112 or 114 kDa. Sequence comparisons with other polA genes showed that all three domains expected in the DNA polymerase I class of enzymes were present in the protein (5'-3' exonuclease, 3'-5' exonuclease and polymerase domains). Additionally, there were four unique insertions of 20-30 amino acids each, not seen in other DNA polymerase I enzymes. Two of the inserts were near the boundary of the two exonuclease domains and the other two interrupted the 3'-5' exonuclease domain which is involved in proofreading. The predicted amino-acid sequence had an exceptionally high content of cysteine (2.4% compared with <0.05% for most other sequenced DNA polymerase I enzymes). The polA gene was further cloned into pProEXHTa for expression and purification. The transformants expressed a protein of 115 kDa. Antibodies raised against synthetic peptide fragments of the putative DNA polymerase I recognised the 115-kda band in Western blot analysis. No DNA synthesis activity could be demonstrated on a primed single-stranded template. Although significant quantities of the protein were produced in the host Escherichia coli carrying the plasmid, it was not capable of complementing a polA(-) mutant in the replication of a polA-dependent plasmid.

  20. Molecular cloning of eucaryotic genes required for excision repair of UV-irradiated DNA: isolation and partial characterization of the RAD3 gene of Saccharomyces cerevisiae.

    PubMed Central

    Naumovski, L; Friedberg, E C

    1982-01-01

    We describe the molecular cloning of a 6-kilobase (kb) fragment of yeast chromosomal DNA containing the RAD3 gene of Saccharomyces cerevisiae. When present in the autonomously replicating yeast cloning vector YEp24, this fragment transformed two different UV-sensitive, excision repair-defective rad3 mutants of S. cerevisiae to UV resistance. The same result was obtained with a variety of other plasmids containing a 4.5-kb subclone of the 6-kb fragment. The UV sensitivity of mutants defective in the RAD1, RAD2, RAD4, and RAD14 loci was not affected by transformation with these plasmids. The 4.5-kb fragment was subcloned into the integrating yeast vector YIp5, and the resultant plasmid was used to transform the rad3-1 mutant to UV resistance. Both genetic and physical studies showed that this plasmid integrated by homologous recombination into the rad3 site uniquely. We conclude from these studies that the cloned DNA that transforms the rad3-1 mutant to UV resistance contains the yeast chromosomal RAD3 gene. The 4.5-kb fragment was mapped by restriction analysis, and studies on some of the subclones generated from this fragment indicate that the RAD3 gene is at least 1.5 kb in size. Images PMID:6749808

  1. Molecular cloning and characterization of four novel LMW glutenin subunit genes from Aegilops longissima, Triticum dicoccoides and T. zhukovskyi.

    PubMed

    Jiang, Chengxi; Pei, Yuhe; Zhang, Yanzhen; Li, Xiaohui; Yao, Danian; Yan, Yueming; Ma, Wujun; Hsam, S L K; Zeller, F J

    2008-04-01

    This paper reports cloning and characterisation of four novel low-molecular-weight glutenin subunit (LMW-GS) genes (designated as TzLMW-m2, TzLMW-m1, TdLMW-m1 and AlLMW-m2) from the genomic DNA of Triticum dicoccoides, T. zhukovskyi and Aegilops longissima. The coding regions of TzLMW-m2, TzLMW-m1, TdLMW-m1 and AlLMW-m2 were 1056 bp, 903 bp, 1056 bp and 1050 bp in length, encoding 350, 300, 350 and 348 amino acid residues, respectively. The deduced amino acid sequences showed that the four novel genes were classified as LMW-m types and the comparison results indicated that the four genes had a more similar structure and a higher level of homology with the LMW-m genes than the LMW-s and -i types genes. However, the first cysteine residue's positions of TzLMW-m2, TdLMW-m1 and AlLMW-m2 were different from the others. Moreover, AlLMW-m2, TdLMW-m1 and TzLMW-m2 all possessed a longer repetitive domain, which was considered to be associated with good quality of wheat. The secondary structure prediction revealed that the content of beta-strand in AlLMW-m2 and TdLMW-m1 exceeded the positive control, suggesting that AlLMW-m2 and TdLMW-m1 should be considered as candidate genes that may have positive effect on dough quality. In order to investigate the evolutionary relationship of the novel genes with the other LMW-GSs, a phylogenetic tree was constructed. The results lead to a speculation that AlLMW-m2, TdLMW-m1 and TzLMW-m2 may be the middle types during the evolution of LMW-m and LMW-s.

  2. The gene controlling marijuana psychoactivity: molecular cloning and heterologous expression of Delta1-tetrahydrocannabinolic acid synthase from Cannabis sativa L.

    PubMed

    Sirikantaramas, Supaart; Morimoto, Satoshi; Shoyama, Yoshinari; Ishikawa, Yu; Wada, Yoshiko; Shoyama, Yukihiro; Taura, Futoshi

    2004-09-17

    Delta(1)-tetrahydrocannabinolic acid (THCA) synthase is the enzyme that catalyzes oxidative cyclization of cannabigerolic acid into THCA, the precursor of Delta(1)-tetrahydrocannabinol. We cloned a novel cDNA (GenBank trade mark accession number AB057805) encoding THCA synthase by reverse transcription and polymerase chain reactions from rapidly expanding leaves of Cannabis sativa. This gene consists of a 1635-nucleotide open reading frame, encoding a 545-amino acid polypeptide of which the first 28 amino acid residues constitute the signal peptide. The predicted molecular weight of the 517-amino acid mature polypeptide is 58,597 Da. Interestingly, the deduced amino acid sequence exhibited high homology to berberine bridge enzyme from Eschscholtzia californica, which is involved in alkaloid biosynthesis. The liquid culture of transgenic tobacco hairy roots harboring the cDNA produced THCA upon feeding of cannabigerolic acid, demonstrating unequivocally that this gene encodes an active THCA synthase. Overexpression of the recombinant THCA synthase was achieved using a baculovirus-insect expression system. The purified recombinant enzyme contained covalently attached FAD cofactor at a molar ratio of FAD to protein of 1:1. The mutant enzyme constructed by changing His-114 of the wild-type enzyme to Ala-114 exhibited neither absorption characteristics of flavoproteins nor THCA synthase activity. Thus, we concluded that the FAD binding residue is His-114 and that the THCA synthase reaction is FAD-dependent. This is the first report on molecular characterization of an enzyme specific to cannabinoid biosynthesis.

  3. Molecular cloning of the gene for the human prostaglandin transporter hPGT: gene organization, promoter activity, and chromosomal localization.

    PubMed

    Lu, R; Schuster, V L

    1998-05-29

    Prostaglandins (PGs) play diverse and important roles in human health and disease. We recently identified the first known PG transporter cDNA in the rat (PGT) and human (hPGT). To aid in the analysis of any possible human disease caused by mutations in PGT, we have cloned and characterized the hPGT gene. The gene exists as a single copy in the human genome and is comprised of 14 exons distributed over approximately 95 kb. Two introns disrupt putative trans-membrane spans of the coding region; each of these sites is near a highly conserved charged residue. The approximately 250 bp immediately 5' to the start of exon 1 contain a TATAAA sequence (TATA box), a transcription initiation (Inr) consensus (CTCANTCT), two Sp 1 sequences (GGGCGG), and a cAMP response element (CGGCGTCA). Ligation of approximately 3.5 kb of 5' flanking sequence to a luciferase reporter yielded > 15-fold activity above background when expressed in A549 human lung epithelial cells. PCR-based monochromosomal somatic cell hybrid mapping and fluorescence in situ hybridization localized hPGT to chromosome 3q21. Three microsatellites were identified, one of which was demonstrated to be polymorphic in unrelated individuals and may be useful in evaluating PGT as a candidate gene in human disease.

  4. Molecular cloning and characterization of Crmdr1, a novel MDR-type ABC transporter gene from Catharanthus roseus.

    PubMed

    Jin, Hongbin; Liu, Donghui; Zuo, Kaijing; Gong, Yifu; Miao, Zhiqi; Chen, Yuhui; Ren, Weiwei; Sun, Xiaofen; Tang, Kexuan

    2007-08-01

    A novel gene encoding a MDR-like ABC transporter protein was cloned from Catharanthus roseus, a medicinal plant with more than 120 kinds of secondary metabolites, through rapid amplification of cDNA ends (RACE). This gene (named as Crmdr1; GenBank accession no.: DQ660356) had a total length of 4395 bp with an open reading frame of 3801 bp, and encoded a predicted polypeptide of 1266 amino acids with a molecular weight of 137.1 kDa. The CrMDR1 protein shared 59.8, 62.5, 60.0 and 58.2% identity with other MDR proteins isolated from Arabidopsis thaliana (AAD31576), Coptis japonica (CjMDR), Gossypium hirsutum (GhMDR) and Triticum aestivum (TaMDR) at amino acid level, respectively. Southern blot analysis showed that Crmdr1 was a low-copy gene. Expression pattern analysis revealed that Crmdr1 constitutively expressed in the root, stem and leaf, but with lower expression in leaf. The domains analysis showed that CrMDR1 protein possessed two transmembrane domains (TMDs) and two nucleotide binding domains (NBDs) arranging in "TMD1-NBD1-TMD2-NBD2" direction, which is consistent with other MDR transporters. Within NBDs three characteristic motifs common to all ABC transporters, "Walker A", "Walker B" and C motif, were found. These results indicate that CrMDR1 is a MDR-like ABC transporter protein that may be involved in the transport and accumulation of secondary metabolites.

  5. Cloning, sequencing, and expression of the gene encoding the high-molecular-weight cytochrome c from Desulfovibrio vulgaris Hildenborough

    SciTech Connect

    Pollock, W.B.R.; Voordouw, G. ); Loutfi, M.; Bruschi, M. ); Rapp-Giles, B.J.; Wall, J.D. )

    1991-01-01

    By using a synthetic deoxyoligonucleotide probe designed to recognize the structural gene for cytochrome cc{sub 3} from Desulfovibrio vulgaris Hildenborough, a 3.7-kb XhoI genomic DNA fragment containing the cc{sub 3} gene was isolated. The gene encodes a precursor polypeptide of 58.9 kDa, with an NH{sub 2}-terminal signal sequence of 31 residues. The mature polypeptide (55.7 kDa) has 16 heme binding sites of the form C-X-X-C-H. Covalent binding of heme to these 16 sites gives a holoprotein of 65.5 kDa with properties similar to those of the high-molecular-weight cytochrome c (Hmc) isolated from the same strain by Higuchi et al. Since the data indicate that cytochrome cc{sub 3} and Hmc are the same protein, the gene has been named hmc. The Hmc polypeptide contains 31 histidinyl residues, 16 of which are integral to heme binding sites. Thus, only 15 of the 16 hemes can have bis-histidinyl coordination. A comparison of the arrangement of heme binding sites and coordinated histidines in the amino acid sequences of cytochrome c{sub 3} and Hme from D. vulgaris Hildenborough suggest that the latter contains three cytochrome c{sub 3}-like domains. Cloning of the D. vulgaris Hildenborough hmc gene into the broad-host-range vector pJRD215 and subsequent conjugational transfer of the recombinant plasmid into D. desulfuricans G200 led to expression of a periplasmic Hmc gene produce with covalently bound hemes.

  6. Molecular cloning and heterologous expression analysis of JrVTE1 gene from walnut (Juglans regia).

    PubMed

    Wang, Cancan; Li, Chuanrong; Leslie, Charles A; Sun, Qingrong; Guo, Xianfeng; Yang, Keqiang

    Tocopherol cyclase (VTE1) plays a key role in promoting the production of γ-tocopherol and improving total tocopherol content in photosynthetic organisms. Walnut is an important source of tocopherols in the human diet, and γ-tocopherol is the major tocopherol compound in walnut kernels. In this study, a full-length cDNA of the VTE1 gene was isolated from walnut using RT-PCR and RACE, and designated as JrVTE1. The full-length cDNA of the JrVTE1 gene contained a 1353-bp open-reading frame encoding a 451-amino-acid protein with a calculated molecular weight of 49.5 kDa. The deduced JrVTE1 protein had a considerable homology with other plant VTE1s and belonged to the tocopherol cyclase family. Functional characterization of JrVTE1 by heterologous expression was carried out in E. coli BL21 (DE3) and microshoot lines of the fruit trees jujube (Zizyphus jujuba var. spinosa) and pear (Pyrus communis) cultivar 'Old Home'. JrVTE1 in E. coli expressed as a 50 kDa protein, as expected. One or two copies of the transferred JrVTE1 gene were detected in the genomes of representative transgenic lines (from the initial transgenic plants) of jujube and pear by gel blots analysis. Over-expression of JrVTE1 in jujube and pear resulted in an accumulation of tocopherol and a shift in tocopherol composition in leaf, root and stem tissues. In the transgenic jujube, the total tocopherol content increased by 29.8 μg/g in the stems of line J3, 43.7 and 22.5 μg/g in the roots and leaves of line J1, respectively, whereas in the transgenic pear it increased by 47.3 μg/g in the leaf of line P3, and 16.7 and 10.4 μg/g in roots and stems of line P9, respectively. In the examined tissues of transgenic plants, the highest accumulation rate was the γ-tocopherol. These results indicate that JrVTE1 is one of the rate-limiting enzymes for tocopherol production and could be used to improve the tocopherol content of tree crops through genetic engineering.

  7. Pseudomonas aeruginosa outer membrane lipoprotein I gene: molecular cloning, sequence, and expression in Escherichia coli.

    PubMed Central

    Duchêne, M; Barron, C; Schweizer, A; von Specht, B U; Domdey, H

    1989-01-01

    Lipoprotein I (OprI) is one of the major proteins of the outer membrane of Pseudomonas aeruginosa. Like porin protein F (OprF), it is a vaccine candidate because it antigenically cross-reacts with all serotype strains of the International Antigenic Typing Scheme. Since lipoprotein I was expressed in Escherichia coli under the control of its own promoter, we were able to isolate the gene by screening a lambda EMBL3 phage library with a mouse monoclonal antibody directed against lipoprotein I. The monocistronic OprI mRNA encodes a precursor protein of 83 amino acid residues including a signal peptide of 19 residues. The mature protein has a molecular weight of 6,950, not including bound glycerol and lipid. Although the amino acid sequences of protein I of P. aeruginosa and Braun's lipoprotein of E. coli differ considerably (only 30.1% identical amino acid residues), peptidoglycan in E. coli, are identical. Using lipoprotein I expressed in E. coli, it can now be tested whether this protein alone, without P. aeruginosa lipopolysaccharide contaminations, has a protective effect against P. aeruginosa infections. Images PMID:2502533

  8. Molecular Cloning and Characterization of Four Genes Encoding Ethylene Receptors Associated with Pineapple (Ananas comosus L.) Flowering.

    PubMed

    Li, Yun-He; Wu, Qing-Song; Huang, Xia; Liu, Sheng-Hui; Zhang, Hong-Na; Zhang, Zhi; Sun, Guang-Ming

    2016-01-01

    Exogenous ethylene, or ethephon, has been widely used to induce pineapple flowering, but the molecular mechanism behind ethephon induction is still unclear. In this study, we cloned four genes encoding ethylene receptors (designated AcERS1a, AcERS1b, AcETR2a, and AcETR2b). The 5' flanking sequences of these four genes were also cloned by self-formed adaptor PCR and SiteFinding-PCR, and a group of putative cis-acting elements was identified. Phylogenetic tree analysis indicated that AcERS1a, AcERS1b, AcETR2a, and AcETR2b belonged to the plant ERS1s and ETR2/EIN4-like groups. Quantitative real-time PCR showed that AcETR2a and AcETR2b (subfamily 2) were more sensitive to ethylene treatment compared with AcERS1a and AcERS1b (subfamily 1). The relative expression of AcERS1b, AcETR2a, and AcETR2b was significantly increased during the earlier period of pineapple inflorescence formation, especially at 1-9 days after ethylene treatment (DAET), whereas AcERS1a expression changed less than these three genes. In situ hybridization results showed that bract primordia (BP) and flower primordia (FP) appeared at 9 and 21 DAET, respectively, and flowers were formed at 37 DAET. AcERS1a, AcERS1b, AcETR2a, and AcETR2b were mainly expressed in the shoot apex at 1-4 DAET; thereafter, with the appearance of BP and FP, higher expression of these genes was found in these new structures. Finally, at 37 DAET, the expression of these genes was mainly focused in the flower but was also low in other structures. These findings indicate that these four ethylene receptor genes, especially AcERS1b, AcETR2a, and AcETR2b, play important roles during pineapple flowering induced by exogenous ethephon.

  9. Molecular Cloning and Characterization of Four Genes Encoding Ethylene Receptors Associated with Pineapple (Ananas comosus L.) Flowering

    PubMed Central

    Li, Yun-He; Wu, Qing-Song; Huang, Xia; Liu, Sheng-Hui; Zhang, Hong-Na; Zhang, Zhi; Sun, Guang-Ming

    2016-01-01

    Exogenous ethylene, or ethephon, has been widely used to induce pineapple flowering, but the molecular mechanism behind ethephon induction is still unclear. In this study, we cloned four genes encoding ethylene receptors (designated AcERS1a, AcERS1b, AcETR2a, and AcETR2b). The 5′ flanking sequences of these four genes were also cloned by self-formed adaptor PCR and SiteFinding-PCR, and a group of putative cis-acting elements was identified. Phylogenetic tree analysis indicated that AcERS1a, AcERS1b, AcETR2a, and AcETR2b belonged to the plant ERS1s and ETR2/EIN4-like groups. Quantitative real-time PCR showed that AcETR2a and AcETR2b (subfamily 2) were more sensitive to ethylene treatment compared with AcERS1a and AcERS1b (subfamily 1). The relative expression of AcERS1b, AcETR2a, and AcETR2b was significantly increased during the earlier period of pineapple inflorescence formation, especially at 1–9 days after ethylene treatment (DAET), whereas AcERS1a expression changed less than these three genes. In situ hybridization results showed that bract primordia (BP) and flower primordia (FP) appeared at 9 and 21 DAET, respectively, and flowers were formed at 37 DAET. AcERS1a, AcERS1b, AcETR2a, and AcETR2b were mainly expressed in the shoot apex at 1–4 DAET; thereafter, with the appearance of BP and FP, higher expression of these genes was found in these new structures. Finally, at 37 DAET, the expression of these genes was mainly focused in the flower but was also low in other structures. These findings indicate that these four ethylene receptor genes, especially AcERS1b, AcETR2a, and AcETR2b, play important roles during pineapple flowering induced by exogenous ethephon. PMID:27252725

  10. Nitrocellulose immunoblotting for identification and molecular gene cloning of Eimeria maxima antigens that stimulate lymphocyte proliferation.

    PubMed Central

    Bumstead, J M; Dunn, P P; Tomley, F M

    1995-01-01

    An immunoblotting technique was used to identify lymphostimulatory antigens within sized polypeptide fractions of Eimeria maxima sporozoites. Six fractions contained polypeptides that specifically stimulated the proliferation of immune lymphocytes in an in vitro assay, and polyclonal antisera were made in rabbits against these fractions. cDNA clones, isolated with antisera against a lymphostimulatory fraction of around 70 kDa, were found to encode four different antigens including a classical hsp70, a molecule homologous to an endoplasmic reticulum chaperonin (BiP/GRP), and a calcium-dependent serine/threonine protein kinase that appears homologous to a recently described molecule from Plasmodium falciparum. The protein kinase cDNA clone was overexpressed in Escherichia coli, and the recombinant antigen was found to induce both antibody and lymphoproliferative responses in chickens when administered subcutaneously. Thus, immunoblotting, in combination with in vitro lymphoproliferation assays, can be used as an initial screen for the identification of lymphostimulatory antigens from a complex pool of polypeptides, and a combination of cDNA cloning, expression, and immunization allows assessment of the lymphostimulatory activity of individual polypeptides. These studies should facilitate further evaluation of antigens that are potential candidates for inclusion in a recombinant vaccine against poultry coccidiosis. PMID:8548529

  11. Molecular cloning and gene expression analysis of cystatin C-like proteins in spinyhead croaker Collichthys lucidus.

    PubMed

    Song, W; Jiang, K J; Zhang, F Y; Zhao, M; Ma, L B

    2016-03-24

    Cystatins are natural tight-binding reversible inhibitors of cysteine proteases. In this study, a cDNA library was constructed from Collichthys lucidus using the SMART technique. A complete cDNA sequence with high identity to the conserved sequence of the cystatin C gene was cloned from the library using EST analysis and rapid amplification of cDNA ends (RACE), then subjected to further investigation. The full-length cDNA of cystatin C from C. lucidus (Clcys) was 699 bp long, including a 5'-terminal untranslated region (5'-UTR) of 52 bp, a 3'-UTR of 290 bp, and an open-reading frame of 357 bp. The gene encoded a polypeptide of 118 amino acids, constituting a predicted molecular weight of 12.875 kDa and a theoretical isoelectric point of 8.81. The amino acid sequence of Clcys possessed typical features of type II cystatins and had the highest identity with cystatin C of Pseudosciaena crocea (89%); therefore, it clustered with the cystatin C group in the UPGMA phylogenetic tree. Quantitative real-time reverse transcription analysis revealed that the highest expression was found in the kidney, followed by the liver, heart, and testis, with the lowest expression in muscle. Interestingly, Clcys had relatively low identity with cystatin C genes from other fish and mammals, and its expression pattern did not possess features of a housekeeping gene. Based on these findings, we suspect that the classification of cystatins in fish is somewhat confusing, and the identification of more cystatin gene sequences is needed before a definite conclusion can be drawn.

  12. Molecular cloning and characterization of the ABA-specific glucosyltransferase gene from bean (Phaseolus vulgaris L.).

    PubMed

    Palaniyandi, Sasikumar Arunachalam; Chung, Gyuhwa; Kim, Sang Hyon; Yang, Seung Hwan

    2015-04-15

    Levels of the plant hormone abscisic acid (ABA) are maintained in homeostasis by a balance of its biosynthesis, catabolism and conjugation. The detailed molecular and signaling events leading to strict homeostasis are not completely understood in crop plants. In this study, we obtained cDNA of an ABA-inducible, ABA-specific UDP-glucosyltransferase (ABAGT) from the bean plant (Phaseolus vulgaris L.) involved in conjugation of a glucose residue to ABA to form inactive ABA-glucose ester (ABA-GE) to examine its role during development and abiotic stress in bean. The bacterially expressed PvABAGTase enzyme showed ABA-specific glucosylation activity in vitro. A higher level of the PvABAGT transcript was observed in mature leaves, mature flowers, roots, seed coats and embryos as well as upon rehydration following a period of dehydration. Overexpression of 35S::PvABAGT in Arabidopsis showed reduced sensitivity to ABA compared with WT. The transgenic plants showed a high level of ABA-GE without significant decrease in the level of ABA compared with the wild type (WT) during dehydration stress. Upon rehydration, the levels of ABA and phaseic acid (PA) decreased in the WT and the PvABAGT-overexpressing lines with high levels of ABA-GE only in the transgenic plants. Our findings suggest that the PvABAGT gene could play a role in ABA homeostasis during development and stress responses in bean and its overexpression in Arabidopsis did not alter ABA homeostasis during dehydration stress. Copyright © 2015 Elsevier GmbH. All rights reserved.

  13. Molecular cloning and characterization of a phytochelatin synthase gene, PvPCS1, from Pteris vittata L.

    PubMed

    Dong, Ruibin; Formentin, Elide; Losseso, Carmen; Carimi, Francesco; Benedetti, Piero; Terzi, Mario; Schiavo, Fiorella Lo

    2005-12-01

    Pteris vittata L. is a staggeringly efficient arsenic hyperaccumulator that has been shown to be capable of accumulating up to 23,000 microg arsenic g(-1), and thus represents a species that may fully exploit the adaptive potential of plants to toxic metals. However, the molecular mechanisms of adaptation to toxic metal tolerance and hyperaccumulation remain unknown, and P. vittata genes related to metal detoxification have not yet been identified. Here, we report the isolation of a full-length cDNA sequence encoding a phytochelatin synthase (PCS) from P. vittata. The cDNA, designated PvPCS1, predicts a protein of 512 amino acids with a molecular weight of 56.9 kDa. Homology analysis of the PvPCS1 nucleotide sequence revealed that it has low identity with most known plant PCS genes except AyPCS1, and the homology is largely confined to two highly conserved regions near the 5'-end, where the similarity is as high as 85-95%. The amino acid sequence of PvPCS1 contains two Cys-Cys motifs and 12 single Cys, only 4 of which (Cys-56, Cys-90/91, and Cys-109) in the N-terminal half of the protein are conserved in other known PCS polypeptides. When expressed in Saccharomyces cerevisae, PvPCS1 mediated increased Cd tolerance. Cloning of the PCS gene from an arsenic hyperaccumulator may provide information that will help further our understanding of the genetic basis underlying toxic metal tolerance and hyperaccumulation.

  14. Purine nucleoside phosphorylase from Pseudoalteromonas sp. Bsi590: molecular cloning, gene expression and characterization of the recombinant protein.

    PubMed

    Li, Xiaohui; Jiang, Xinyin; Li, Huirong; Ren, Daming

    2008-05-01

    The gene encoding purine nucleoside phosphorylase (PNP) from the cold-adapted marine bacterium Pseudoalteromonas sp. Bsi590 was identified, cloned and expressed in Escherichia coli. The gene encodes a polypeptide of 233 amino acids with a calculated molecular weight of 25,018 Da. Pseudoalteromonas sp. Bsi590 PNP (PiPNP) shares 60% amino sequence identity and conservation of amino acid residues involved in catalysis with mesophilic Escherichia coli deoD-encoded purine nucleoside phosphorylase (EcPNP). N-terminal his-tagged PiPNP and EcPNP were purified to apparent homogeneity using Ni2+-chelating column. Compared with EcPNP, PiPNP possessed a lower temperature optimum and thermal stability. As for PNP enzymes in general, PiPNP and EcPNP displayed complicated kinetic properties; PiPNP possessed higher Km and catalytic efficiency (kcat/Km) compared to EcPNP at 37 degrees C. Substrate specificity results showed PiPNP catalyzed the phosphorolytic cleavage of 6-oxopurine and 6-aminopurine nucleosides (or 2-deoxynucleosides), and to a lesser extent purine arabinosides. PiPNP showed a better activity with inosine while no activity toward pyrimidine nucleosides. The protein conformation was analyzed by temperature perturbation difference spectrum. Results showed that PiPNP had lower conformation transition point temperature than EcPNP; phosphate buffer and KCl had significant influence on PiPNP protein conformation stability and thermostability.

  15. Identification, molecular cloning and expression analysis of five RNA-dependent RNA polymerase genes in Salvia miltiorrhiza.

    PubMed

    Shao, Fenjuan; Lu, Shanfa

    2014-01-01

    RNA-dependent RNA polymerases (RDRs) act as key components of the small RNA biogenesis pathways and play significant roles in post-transcriptional gene silencing (PTGS) and antiviral defense. However, there is no information about the RDR gene family in Salvia miltiorrhiza, an emerging model medicinal plant with great economic value. Through genome-wide predication and subsequent molecular cloning, five full-length S. miltiorrhiza RDR genes, termed SmRDR1-SmRDR5, were identified. The length of SmRDR cDNAs varies between 3,262 (SmRDR5) and 4,130 bp (SmRDR3). The intron number of SmRDR genes varies from 3 (SmRDR1, SmRDR3 and SmRDR4) to 17 (SmRDR5). All of the deduced SmRDR protein sequences contain the conserved RdRp domain. Moreover, SmRDR2 and SmRDR4 have an additional RRM domain. Based on the phylogenetic tree constructed with sixteen RDRs from Arabidopsis, rice and S. miltiorrhiza, plant RDRs may be divided into four groups (RDR1-RDR4). The RDR1 group contains an AtRDR and an OsRDR, while includes two SmRDRs. On the contrary, the RDR3 group contains three AtRDRs and two OsRDRs, but has only one SmRDR. SmRDRs were differentially expressed in flowers, leaves, stems and roots of S. miltiorrhiza and responsive to methyl jasmonate treatment and cucumber mosaic virus infection. The results suggest the involvement of RDRs in S. miltiorrhiza development and response to abiotic and biotic stresses. It provides a foundation for further studying the regulation and biological functions of SmRDRs and the biogenesis pathways of small RNAs in S. miltiorrhiza.

  16. Molecular cloning and functional analysis of a novel oncogene, cancer-upregulated gene 2 (CUG2)

    SciTech Connect

    Lee, Soojin . E-mail: leesoojin@cnu.ac.kr; Gang, Jingu; Jeon, Sun Bok; Jung, Jinyoung; Song, Si Young; Koh, Sang Seok . E-mail: sskoh@kribb.re.kr

    2007-08-31

    We examined genome-wide differences in gene expression between tumor biopsies and normal tissues in order to identify differentially regulated genes in tumors. Cancer-upregulated gene 2 (CUG2) was identified as an expressed sequence tag (EST) that exhibits significant differential expression in multiple human cancer types. CUG2 showed weak sequence homology with the down-regulator of transcription 1 (DR1) gene, a human transcription repressor. We found that EGFP-CUG2 fusion proteins were predominantly localized in the nucleus, suggesting their putative role in gene regulation. In addition, CUG2-overexpressing mouse fibroblast cells exhibited distinct cancer-specific phenotypes in vitro and developed into tumors in nude mice. Taken together, these findings suggest that CUG2 is a novel tumor-associated gene that is commonly activated in various human cancers and exhibits high transforming activities; it possibly belongs to a transcription regulator family that is involved in tumor biogenesis.

  17. Polysaccharide Lyase: Molecular Cloning, Sequencing, and Overexpression of the Xanthan Lyase Gene of Bacillus sp. Strain GL1

    PubMed Central

    Hashimoto, Wataru; Miki, Hikaru; Tsuchiya, Noriaki; Nankai, Hirokazu; Murata, Kousaku

    2001-01-01

    When grown on xanthan as a carbon source, the bacterium Bacillus sp. strain GL1 produces extracellular xanthan lyase (75 kDa), catalyzing the first step of xanthan depolymerization (H. Nankai, W. Hashimoto, H. Miki, S. Kawai, and K. Murata, Appl. Environ. Microbiol. 65:2520–2526, 1999). A gene for the lyase was cloned, and its nucleotide sequence was determined. The gene contained an open reading frame consisting of 2,793 bp coding for a polypeptide with a molecular weight of 99,308. The polypeptide had a signal peptide (2 kDa) consisting of 25 amino acid residues preceding the N-terminal amino acid sequence of the enzyme and exhibited significant homology with hyaluronidase of Streptomyces griseus (identity score, 37.7%). Escherichia coli transformed with the gene without the signal peptide sequence showed a xanthan lyase activity and produced intracellularly a large amount of the enzyme (400 mg/liter of culture) with a molecular mass of 97 kDa. During storage at 4°C, the purified enzyme (97 kDa) from E. coli was converted to a low-molecular-mass (75-kDa) enzyme with properties closely similar to those of the enzyme (75 kDa) from Bacillus sp. strain GL1, specifically in optimum pH and temperature for activity, substrate specificity, and mode of action. Logarithmically growing cells of Bacillus sp. strain GL1 on the medium with xanthan were also found to secrete not only xanthan lyase (75 kDa) but also a 97-kDa protein with the same N-terminal amino acid sequence as that of xanthan lyase (75 kDa). These results suggest that, in Bacillus sp. strain GL1, xanthan lyase is first synthesized as a preproform (99 kDa), secreted as a precursor (97 kDa) by a signal peptide-dependent mechanism, and then processed into a mature form (75 kDa) through excision of a C-terminal protein fragment with a molecular mass of 22 kDa. PMID:11157235

  18. Molecular cloning and expression analyses of a novel swine gene--ARF4.

    PubMed

    Liu, G Y; Xiong, Y Z

    2009-03-01

    The mRNA differential display technique was performed to investigate the differences of gene expression in the longissimus muscle tissues from Meishan and Large White pigs. One novel gene that was differentially expressed was identified through semi-quantitative RT-PCR and the cDNA complete sequence was then obtained using the rapid amplification of cDNA ends (RACE) method. The nucleotide sequence of the gene is not homologous to any of the known porcine genes. The sequence prediction analysis revealed that the open reading frame of this gene encodes a protein of 180 amino acids that contains the putative conserved domain of ADP-ribosylation factor (ARF) which has high homology with the ADP-ribosylation factor 4 (ARF4) of six species-bovine (98%), human and orangutan (96%), African clawed frog (96%), mouse and rat (98%)-so that it can be defined as swine ADP-ribosylation factor 4 (ARF4). This novel porcine gene was finally assigned to GeneID:595108. The phylogenetic tree analysis revealed that the swine ARF4 has a closer genetic relationship with the rat and mouse ARF4 than with those of human and African clawed frog. The tissue expression analysis indicated that the swine ARF4 gene is over expressed in muscle, fat, heart, spleen, liver, and ovary and moderately expressed in lung and kidney but weakly expressed in small intestine. Our experiment is the first to establish the primary foundation for further research on the swine ARF4 gene.

  19. Molecular cloning and promoter analysis of squalene synthase and squalene epoxidase genes from Betula platyphylla.

    PubMed

    Zhang, Mengyan; Wang, Siyao; Yin, Jing; Li, Chunxiao; Zhan, Yaguang; Xiao, Jialei; Liang, Tian; Li, Xin

    2016-09-01

    Betula platyphylla is a rich repository of pharmacologically active secondary metabolites known as birch triterpenoids (TBP). Here, we cloned the squalene synthase (SS) and squalene epoxidase genetic (SE) sequences from B. platyphylla that encode the key enzymes that are involved in triterpenoid biosynthesis and analyzed the conserved domains and phylogenetics of their corresponding proteins. The full-length sequence of BpSS is 1588 bp with a poly-A tail, which contained an open reading frame (ORF) of 1241 bp that encoded a protein of 413 amino acids. Additionally, the BpSE full-length sequence of 2040 bp with a poly-A tail was also obtained, which contained an ORF of 1581 bp encoding a protein of 526 amino acids. Their organ-specific expression patterns in 4-week-old tissue culture seedlings of B. platyphylla were detected by real-time PCR and showed that they were all highly expressed in leaves, as compared to stem and root tissues. Additionaly, both BpSS and BpSE were enhanced following stimulation with ethephon and MeJA. The expression of BpSS was enhanced by ABA, whereas BpSE was not. The SA treatment did not affect the BpSS and BpSE transcripts notably. Using a genome walking approach, promoter sequences of 965 and 1193 bp, respectively, for BpSS and BpSE were isolated, and they revealed several key cis-regulatory elements known to be involved in the response to phytohormone and abiotic plant stress. We also found that the BpSS protein is localized in the cytoplasm. Opening reading frames of BpSS and BpSE were ligated into yeast expression plasmid pYES2 under control of GAL1 promoter and introduced into the yeast INVScl1 strain. The transformants were cultured for 12 h, the squalene content of galactose-induced BpSS expression yeast cells was 13.2 times of control (empty vector control yeast cells) by high-performance liquid chromatography (HPLC) test method. And, the squalene epoxidase activity of induced BpSE expression yeast cell was about 11.8 times

  20. Molecular cloning and gene expression of canine apoptosis inhibitor of macrophage.

    PubMed

    Tomura, Shintaro; Uchida, Mona; Yonezawa, Tomohiro; Kobayashi, Masato; Bonkobara, Makoto; Arai, Satoko; Miyazaki, Toru; Tamahara, Satoshi; Matsuki, Naoaki

    2014-12-01

    Apoptosis inhibitor of macrophage (AIM) plays roles in survival of macrophages. In this study, we cloned canine AIM cDNA and observed its transcriptional expression levels in various tissues. The coding sequence of canine AIM was 1,023 bp encoding 340 amino acid residues, which had around 65% homology with those of the human, mouse and rat. Transcriptional expression of AIM was observed in the spleen, lung, liver and lymph node, which confirmed the expression of canine AIM in tissue macrophages. Moreover, AIM was highly expressed in one of the canine histiocytic sarcoma cell lines. CD36, the receptor of AIM, was also expressed in various tissues and these cell lines. These findings are useful to reveal the actual functions of canine AIM.

  1. Cloning and molecular evolution of the aldehyde dehydrogenase 2 gene (Aldh2) in bats (Chiroptera).

    PubMed

    Chen, Yao; Shen, Bin; Zhang, Junpeng; Jones, Gareth; He, Guimei

    2013-02-01

    Old World fruit bats (Pteropodidae) and New World fruit bats (Phyllostomidae) ingest significant quantities of ethanol while foraging. Mitochondrial aldehyde dehydrogenase (ALDH2, encoded by the Aldh2 gene) plays an important role in ethanol metabolism. To test whether the Aldh2 gene has undergone adaptive evolution in frugivorous and nectarivorous bats in relation to ethanol elimination, we sequenced part of the coding region of the gene (1,143 bp, ~73 % coverage) in 14 bat species, including three Old World fruit bats and two New World fruit bats. Our results showed that the Aldh2 coding sequences are highly conserved across all bat species we examined, and no evidence of positive selection was detected in the ancestral branches leading to Old World fruit bats and New World fruit bats. Further research is needed to determine whether other genes involved in ethanol metabolism have been the targets of positive selection in frugivorous and nectarivorous bats.

  2. Molecular cloning and sequencing of pheU, a gene for Escherichia coli tRNAPhe.

    PubMed Central

    Schwartz, I; Klotsky, R A; Elseviers, D; Gallagher, P J; Krauskopf, M; Siddiqui, M A; Wong, J F; Roe, B A

    1983-01-01

    A recombinant plasmid (designated pID2) carrying the E. coli gene for tRNAPhe has been isolated from a plasmid bank constructed by the ligation of a total EcoRI digest of E. coli K12 DNA into the EcoRI site of pACYC184 DNA. The plasmid was selected by virtue of its ability to complement a temperature-sensitive lesion in the gene (PheS) for the alpha-subunit of phenylalanyl-tRNA synthetase. Crude tRNA isolated from such transformants exhibited elevated levels of phenylalanine acceptor activity. The tRNAPhe gene has been localized within the first 300 base pairs of a 3.6 kb SalI fragment of pID2. The sequence of the gene and its flanking regions is presented. Images PMID:6306588

  3. Molecular cloning, sequence characterization and expression pattern of Rab18 gene from watermelon (Citrullus lanatus).

    PubMed

    Xinli, Xiao; Lei, Peng

    2015-03-04

    The complete mRNA sequence of watermelon Rab18 gene was amplified through the rapid amplification of cDNA ends (RACE) method. The full-length mRNA was 1010 bp containing a 645 bp open reading frame, which encodes a protein of 214 amino acids. Sequence analysis revealed that watermelon Rab18 protein shares high homology with the Rab18 of cucumber (99%), muskmelon (98%), Morus notabilis (90%), tomato (89%), wine grape (89%) and potato (88%). Phylogenetic analysis revealed that watermelon Rab18 gene has a closer genetic relationship with Rab18 gene of cucumber and muskmelon. Tissue expression profile analysis indicated that watermelon Rab18 gene was highly expressed in root, stem and leaf, moderately expressed in flower and weakly expressed in fruit.

  4. Molecular cloning and expression analysis of the STAT1 gene in the water buffalo (Bubalus bubalis).

    PubMed

    Deng, Tingxian; Pang, Chunying; Zhu, Peng; Liao, Biyun; Zhang, Ming; Yang, Bingzhuang; Liang, Xianwei

    2015-01-01

    Signal transducer and activator of transcription 1 (STAT1) is a critical component of the transcription factor complex in the interferon (IFN) signaling pathways. Of the seven STAT isoforms, STAT1 is a key mediator of type I and type III IFN signaling, but limited information is available for the STAT genes in the water buffalo. Here, we amplified and identified the complete coding sequence (CDS) of the buffalo STAT1 gene by using reverse transcription polymerase chain reaction (RT-PCR). Sequence analysis indicated that the buffalo STAT1 gene length size was 3437 bp, containing an open reading frame (ORF) of 2244 bp that encoded 747 amino acids for the first time. The buffalo STAT1 CDS showed 99, 98, 89, 93, 86, 85, and 87% identity with that of Bos taurus, Ovis aries, Homo sapiens, Sus scrofa, Rattus norvegicus, Mus musculus, and Capra hircus. The phylogenetic analyses revealed that the nearest relationship existed between the water buffalo and B. taurus. The STAT1 gene was ubiquitously expressed in 11 buffalo tissues by real-time PCR, whereas STAT1 was expressed at higher levels in the lymph. The STAT1 gene contained five targeted microRNA sequences compared with the B. taurus by the miRBase software that provide a fundamental for identifying the STAT1 gene function.

  5. Molecular cloning, characterization, and function analysis of a mevalonate pyrophosphate decarboxylase gene from Ganoderma lucidum.

    PubMed

    Shi, Liang; Qin, Lei; Xu, Yingjie; Ren, Ang; Fang, Xing; Mu, Dashuai; Tan, Qi; Zhao, Mingwen

    2012-05-01

    This study investigated the role of the mevalonate pyrophosphate decarboxylase gene in the triterpene biosynthetic pathway of Ganoderma lucidum. The mevalonate pyrophosphate decarboxylase gene (mvd) was isolated using a degenerate primer-PCR technique. An analysis of the Gl-mvd transcription profile revealed a positive correlation between the expression of the Gl-mvd gene and triterpene content changes in G. lucidum during development. Furthermore, a promoter deletion analysis was conducted in G. lucidum to investigate the promoter activity and the role of methyl jasmonate (MeJA) responsive elements in the mvd promoter under the MeJA elicitor. The overexpression of Gl-mvd increased triterpene accumulation compared with the wild-type strain and increased the expression of several genes involved in the triterpene biosynthetic pathway. The findings of this study suggest that mvd may play an important role in triterpene biosynthesis regulation. Moreover, there may be the interactions among the genes involved in the triterpene biosynthetic pathway in the G. lucidum. Additionally, this study provides an approach for improving triterpene content through the overexpression of a key gene.

  6. Molecular cloning of glycoside hydrolase family 45 cellulase genes from brackish water clam Corbicula japonica.

    PubMed

    Sakamoto, Kentaro; Toyohara, Haruhiko

    2009-04-01

    We previously reported endogenous Glycoside Hydrolase Family (GHF) 9 beta-1,4-glucanase gene, CjCel9A, from common Japanese freshwater clam Corbicula japonica. Here we identified another endogenous beta-1,4-glucanase genes which belong to GHF45 (CjCel45A, CjCel45B). Both genes encode ORF of 627 bp corresponding to 208 amino acids. CjCel45A and CjCel45B are different in 5' and 3'-untranslated regions and six nucleotides in the ORF. CjCEL45 has only one GHF45 catalytic domain without any carbohydrate binding modules as is the case with other molluskan GHF45 enzymes. Phylogenetic analysis and genomic structure of CjCel45 gene implies that this gene is likely to be acquired from fungi by common ancestor of mollusks. Reverse transcription (RT)-PCR analysis and in situ hybridization revealed that CjCel45A is likely to be expressed in the secretory cells in the digestive gland, suggesting that this cellulase is produced in the same site as CjCEL9A. CjCEL45A was successfully expressed in E. coli cells and zymographic analysis of the recombinant CjCEL45A showed that CjCEL45A is a functional beta-1,4-glucanase. The finding of multiple cellulase genes in C. japonica strongly supports our hypothesis that this species function as a cellulose decomposer in estuarine environments.

  7. Cloning and molecular characterization of phospholipase D (PLD) delta gene from longan (Dimocarpus longan Lour.).

    PubMed

    You, Xiangrong; Zhang, Yayuan; Li, Li; Li, Zhichun; Li, Mingjuan; Li, Changbao; Zhu, Jianhua; Peng, Hongxiang; Sun, Jian

    2014-07-01

    Longan (Dimocarpus longan Lour.) is a non-climacteric fruit with a short postharvest life. The regulation of phospholipase D (PLD) activity closely relates to postharvest browning and senescence of longan fruit. In this study, a novel cDNA clone of longan PLDδ (LgPLDδ) was obtained and registered in GenBank (accession No. JF791814). The deduced amino acid sequence possessed all of the three typical domains of plant PLDs, a C2 domain and two catalytic HxKxxxxD motifs. The tertiary structure of LgPLDδ was further predicted. The western blot result showed that the LgPLDδ protein was specifically recognized by PLDδ antibody. The Q-RT-PCR (real-time quantitative PCR) result showed that the level of LgPLDδ mRNA expression was higher in senescent tissues than in developing tissues, which was also high in postharvest fruit. The western-blotting result further certified the different expression of LgPLDδ. These results provided a scientific basis for further investigating the mechanism of postharvest longan fruit adapting to environmental stress.

  8. Molecular cloning and characterization of lactate dehydrogenase gene from Eimeria tenella.

    PubMed

    Dong, Hui; Wang, Yange; Zhao, Qiping; Han, Hongyu; Zhu, Shunhai; Li, Liujia; Wu, Youling; Huang, Bing

    2014-08-01

    Lactate dehydrogenase (LDH) is a key enzyme in the glycolytic pathway and is crucial for parasite survival. In this study, we cloned and expressed the LDH of Eimeria tenella (EtLDH). Real-time polymerase chain reaction and Western blot analysis revealed that the expression of EtLDH was developmentally regulated at the messenger RNA (mRNA) and protein levels. EtLDH mRNA levels were higher in second-generation merozoites than in other developmental stages (unsporulated oocysts, sporulated oocysts, and sporozoites). EtLDH protein expression levels were most prominent in second-generation merozoites, moderately expressed in unsporulated oocysts and sporulated oocysts, and weakly detected in sporozoites. Immunostaining with anti-recombinant EtLDH (rEtLDH) antibody indicated that EtLDH was mainly located in the anterior region in free sporozoites and became concentrated in the anterior region of intracellular sporozoites except for the apex after invasion into DF-1 cells. Specific staining of EtLDH protein was more intense in trophozoites and immature first-generation schizonts, but decreased in mature first-generation schizonts. Inhibition of EtLDH function using specific antibodies cannot efficiently reduce the ability of E. tenella sporozoites to invade host cells. These results suggest that EtLDH may be involved in glycolysis during the first-generation merogony stage in E. tenella and has little role in host invasion.

  9. Cloning and characterization of resistance gene candidate sequences and molecular marker development in gerbera (Gerbera hybrida)

    USDA-ARS?s Scientific Manuscript database

    Improving disease resistance has become an important breeding objective in gerbera, one of the most important floricultural crops in the world. Development and application of molecular markers are expected to assist selection of gerberas with improved disease resistance. The availability of resistan...

  10. Molecular cloning and characterization of the glyceraldehyde-3-phosphate dehydrogenase gene from Penicillium expansum PE-12.

    PubMed

    Zhang, T; Qi, Z; Yu, Q S; Tang, K X

    2013-07-15

    Penicillium expansum produces large amounts of lipase, which is widely used in laundry detergent and leather industry. We isolated the glyceraldehyde-3-phosphate dehydrogenase gene (PeGPD) from P. expansum PE-12 through reverse transcriptase PCR and 5'-3' rapid amplification of cDNA ends (RACE-PCR). The gene is 1266 bp long, including an ORF of 1014 bp, encoding a polypeptide chain of 337 amino acids. A phylogenetic tree based on GPD proteins showed that P. expansum is close to Aspergillus species, but comparatively distant from P. marneffei. Southern blot results revealed a single copy of PeGPD, and expression analysis gave evidence of high expression levels. PeGPD genes have potential for genetic engineering of P. expansum for industrial lipase production.

  11. Molecular Cloning and Expression Analysis of hyp-1 Type PR-10 Family Genes in Hypericum perforatum.

    PubMed

    Karppinen, Katja; Derzsó, Emese; Jaakola, Laura; Hohtola, Anja

    2016-01-01

    Hypericum perforatum L. is an important medicinal plant for the treatment of depression. The plant contains bioactive hypericins that accumulate in dark glands present especially in reproductive parts of the plant. In this study, pathogenesis-related class 10 (PR-10) family genes were identified in H. perforatum, including three previously unidentified members with sequence homology to hyp-1, a phenolic coupling protein that has earlier been suggested to participate in biosynthesis and binding/transportation of hypericin. The PR-10 genes showed constitutive but variable expression patterns in different H. perforatum tissues. They were all expressed at relatively high levels in leaves, variably in roots and low levels in stem and reproductive parts of the plant with no specific association with dark glands. The gene expression was up-regulated in leaves after salicylic acid, abscisic acid and wounding treatments but with variable levels. To study exact location of the gene expression, in situ hybridization of hyp-1 transcripts was performed and the accumulation of the Hyp-1 protein was examined in various tissues. The presence of Hyp-1 protein in H. perforatum tissues mostly paralleled with the mRNA levels. In situ RNA hybridization localized the hyp-1 transcripts predominantly in vascular tissues in root and stem, while in leaf the mRNA levels were high also in mesophyll cells in addition to vasculature. Our results indicate that the studied PR-10 genes are likely to contribute to the defense responses in H. perforatum. Furthermore, despite the location of the hyp-1 transcripts in vasculature, no support for the transportation of the Hyp-1 protein to dark glands was found in the current study. The present results together with earlier data question the role of the hyp-1 as a key gene responsible for the hypericin biosynthesis in dark glands of H. perforatum.

  12. Molecular Cloning and Expression Analysis of hyp-1 Type PR-10 Family Genes in Hypericum perforatum

    PubMed Central

    Karppinen, Katja; Derzsó, Emese; Jaakola, Laura; Hohtola, Anja

    2016-01-01

    Hypericum perforatum L. is an important medicinal plant for the treatment of depression. The plant contains bioactive hypericins that accumulate in dark glands present especially in reproductive parts of the plant. In this study, pathogenesis-related class 10 (PR-10) family genes were identified in H. perforatum, including three previously unidentified members with sequence homology to hyp-1, a phenolic coupling protein that has earlier been suggested to participate in biosynthesis and binding/transportation of hypericin. The PR-10 genes showed constitutive but variable expression patterns in different H. perforatum tissues. They were all expressed at relatively high levels in leaves, variably in roots and low levels in stem and reproductive parts of the plant with no specific association with dark glands. The gene expression was up-regulated in leaves after salicylic acid, abscisic acid and wounding treatments but with variable levels. To study exact location of the gene expression, in situ hybridization of hyp-1 transcripts was performed and the accumulation of the Hyp-1 protein was examined in various tissues. The presence of Hyp-1 protein in H. perforatum tissues mostly paralleled with the mRNA levels. In situ RNA hybridization localized the hyp-1 transcripts predominantly in vascular tissues in root and stem, while in leaf the mRNA levels were high also in mesophyll cells in addition to vasculature. Our results indicate that the studied PR-10 genes are likely to contribute to the defense responses in H. perforatum. Furthermore, despite the location of the hyp-1 transcripts in vasculature, no support for the transportation of the Hyp-1 protein to dark glands was found in the current study. The present results together with earlier data question the role of the hyp-1 as a key gene responsible for the hypericin biosynthesis in dark glands of H. perforatum. PMID:27148343

  13. Molecular cloning and expression analyses of RPS3a gene from mulberry under abiotic stresses and among different mulberry varieties.

    PubMed

    Qian, J; Zhou, H; Zhao, M D; Wang, H; Li, F; Wang, Y H; Fang, R J; Zhao, W G; Kim, H J

    2016-04-28

    A full-length cDNA sequence coding ribosomal protein S3a of mulberry tree, which we designated MmRPS3a (GenBank accession No. KR610331), was cloned based on mulberry expressed sequence tags. Sequence analysis showed that the MmRPS3a is 1089 bp long and contains a 80-bp 5'-UTR (untranslated region) and a 220-bp 3'-UTR. Its open reading frame consists of a 789-bp encoding 262 amino acids with a predicted molecular weight of 30.053 kDa and an isoelectric point of 9.84. Homology analysis revealed that MmRPS3a gene is highly conservative in mulberry and other species including Morus notabilis, Theobroma cacao, and Ricinus communis. Phylogenetic analysis based on MmRPS3a of other species showed that mulberry had a closer relationship with Prunus persica, Arabidopsis thaliana, Solanum tuberosum, Solanum lycopersicum, and Vitis vinifera. The results of quantitative PCR analysis showed that the transcriptional level of MmRPS3a mRNA changed significantly under the conditions of hypothermia, aridity, salt stress, and varieties of differing resistances.

  14. Molecular cloning and characterization of a nonsymbiotic hemoglobin gene (GLB1) from Malus hupehensis Rehd. with heterologous expression in tomato.

    PubMed

    Shi, Xingzheng; Wang, Xinliang; Peng, Futian; Zhao, Yu

    2012-08-01

    Nonsymbiotic hemoglobins (nsHbs) are involved in a variety of cellular processes in plants. Previous studies indicate that nsHb expression improves plant tolerance during waterlogging and hypoxia. In the present work, the nsHb class-1 coding sequence was cloned from Malus hupehensis Rehd. var. pinyiensis Jiang and subsequently named MhGLB1. The results elucidated the expressed characteristics and physiological effects of MhGLB1. The full-length cDNA contained a 477 bp open reading frame encoding a protein with a molecular mass of 17.8 KDa with 158 amino acids. Quantitative real-time PCR analysis showed that MhGLB1 expresses in roots, stems and leaves growing under normal and nitrate-induced conditions. Hypoxic stress induced accumulation of MhGLB1 within 12 h, and abscisic acid significantly induced expression of MhGLB1 in roots. The photosynthetic, transpiration and stomatal conductance rates of transgenic MhGLB1 tomato plants decreased more slowly than that of wild-type plants under waterlogging treatment. These results indicated that the MhGLB1 gene has an important role in hypoxia.

  15. Molecular cloning, recombinant gene expression, and antifungal activity of cystatin from taro (Colocasia esculenta cv. Kaosiung no. 1).

    PubMed

    Yang, A H; Yeh, K W

    2005-06-01

    A cDNA clone, designated CeCPI, encoding a novel phytocystatin was isolated from taro corms (Colocasia esculenta) using both degenerated primers/RT-PCR amplification and 5'-/3'-RACE extension. The full-length cDNA gene is 1,008 bp in size, encodes 206 amino acid residues, with a deduced molecular weight of 29 kDa. It contains a conserved reactive site motif Gln-Val-Val-Ser-Gly of cysteine protease inhibitors, and another consensus ARFAV sequence for phytocystatin. Sequence analysis revealed that CeCPI is phylogenetically closely related to Eudicots rather than to Monocots, despite taro belonging to Monocot. Recombinant GST-CeCPI fusion protein was overexpressed in Escherichia coli and its inhibitory activity against papain was identified on gelatin/SDS-PAGE. These results confirmed that recombinant CeCPI protein exhibited strong cysteine protease inhibitory activity. Investigation of its antifungal activity clearly revealed a toxic effect on the mycelium growth of phytopathogenic fungi, such as Sclerotium rolfsii Sacc. etc., at a concentration of 80 microg recombinant CeCPI/ ml. Moreover, mycelium growth was completely inhibited and the sclerotia lysed at a concentration of 150-200 microg/ml. Further studies have demonstrated that recombinant CeCPI is capable of acting against the endogenous cysteine proteinase in the fungal mycelium.

  16. Molecular cloning and characterization of pathogenesis-related protein family 10 gene from spinach (SoPR10).

    PubMed

    Bai, Xuegui; Long, Juan; He, Xiaozhao; Li, Shun; Xu, Huini

    2014-01-01

    PR10 genes encode small, intracellular proteins that respond to biotic and abiotic stresses. In this study, a cDNA clone (designated as SoPR10, GenBank Accession No. KC142174) encoding a PR10 protein from spinach (Spinacia oleracea L.) was isolated and characterized. SoPR10 encoded a 161-amino acid polypeptide with a predicted molecular mass of 19.76 kDa and a pI of 4.61. Real-time quantitative analysis indicated that SoPR10 was constitutively expressed in root and shoot. The abundance of SoPR10 in salt-resistant cultivar (Chaoji) was generally greater than in salt-sensitive cultivar (Daye) under 160 mM L(-1) NO3(-) treatment for 0.5, 3, and 6 h. The expression of SoPR10 was also induced by other abiotic stresses including polyethylene glycol, NaCl, salicylic acid, and H2O2. Our results indicated that SoPR10 might play important roles under nitrate stress and other abiotic stresses.

  17. Molecular cloning and functional analysis of the drought tolerance gene MsHSP70 from alfalfa (Medicago sativa L.).

    PubMed

    Li, Zhenyi; Long, Ruicai; Zhang, Tiejun; Wang, Zhen; Zhang, Fan; Yang, Qingchuan; Kang, Junmei; Sun, Yan

    2017-03-01

    Heat shock proteins (HSPs) are a ubiquitously expressed class of protective proteins that play a key role in plant response to stressful conditions. This study aimed to characterize and investigate the function of an HSP gene in alfalfa (Medicago sativa). MsHSP70, which contains a 2028-bp open reading frame, was identified through homology cloning. MsHSP70 shares high sequence identity (94.47%) with HSP70 from Medicago truncatula. Expression analysis of MsHSP70 in alfalfa organs revealed a relatively higher expression level in aerial organs such as flowers, stems and leaves than in roots. MsHSP70 was induced by heat shock, abscisic acid (ABA) and hydrogen peroxide. Transgenic Arabidopsis seedlings overexpressing MsHSP70 were hyposensitive to polyethylene glycol (PEG) and ABA treatments, suggesting that exogenous expression of MsHSP70 enhanced Arabidopsis tolerance to these stresses. Examination of physiological indexes related to drought and ABA stress demonstrated that in comparison with non-transgenic plants, T3 transgenic Arabidopsis plants had an increased proline content, higher superoxide dismutase (SOD) activity, and decreased malondialdehyde (MDA) content. Furthermore, higher relative water content (RWC) was detected in transgenic plants compared with non-transgenic plants under drought stress. These findings clearly indicate that molecular manipulation of MsHSP70 in plants can have substantial effects on stress tolerance.

  18. Molecular Cloning and Characterization of the Gene Coding for the Aerobic Azoreductase from Xenophilus azovorans KF46F

    PubMed Central

    Blümel, Silke; Knackmuss, Hans-Joachim; Stolz, Andreas

    2002-01-01

    The gene coding for an aerobic azoreductase was cloned from Xenophilus azovorans KF46F (formerly Pseudomonas sp. strain KF46F), which was previously shown to grow with the carboxylated azo compound 1-(4′-carboxyphenylazo)-2-naphthol (carboxy-Orange II) as the sole source of carbon and energy. The deduced amino acid sequence encoded a protein with a molecular weight of 30,278 and showed no significant homology to amino acid sequences currently deposited at the relevant data bases. A presumed NAD(P)H-binding site was identified in the amino-terminal region of the azoreductase. The enzyme was heterologously expressed in Escherichia coli and the azoreductase activities of resting cells and cell extracts were compared. The results suggested that whole cells of the recombinant E. coli strains were unable to take up sulfonated azo dyes and therefore did not show in vivo azoreductase activity. The turnover of several industrially relevant azo dyes by cell extracts from the recombinant E. coli strain was demonstrated. PMID:12147495

  19. Molecular cloning, sequence characterization, and gene expression profiling of a novel water buffalo (Bubalus bubalis) gene, AGPAT6.

    PubMed

    Song, S; Huo, J L; Li, D L; Yuan, Y Y; Yuan, F; Miao, Y W

    2013-10-01

    Several 1-acylglycerol-3-phosphate-O-acyltransferases (AGPATs) can acylate lysophosphatidic acid to produce phosphatidic acid. Of the eight AGPAT isoforms, AGPAT6 is a crucial enzyme for glycerolipids and triacylglycerol biosynthesis in some mammalian tissues. We amplified and identified the complete coding sequence (CDS) of the water buffalo AGPAT6 gene by using the reverse transcription-polymerase chain reaction, based on the conversed sequence information of the cattle or expressed sequence tags of other Bovidae species. This novel gene was deposited in the NCBI database (accession No. JX518941). Sequence analysis revealed that the CDS of this AGPAT6 encodes a 456-amino acid enzyme (molecular mass = 52 kDa; pI = 9.34). Water buffalo AGPAT6 contains three hydrophobic transmembrane regions and a signal 37-amino acid peptide, localized in the cytoplasm. The deduced amino acid sequences share 99, 98, 98, 97, 98, 98, 97 and 95% identity with their homologous sequences from cattle, horse, human, mouse, orangutan, pig, rat, and chicken, respectively. The phylogenetic tree analysis based on the AGPAT6 CDS showed that water buffalo has a closer genetic relationship with cattle than with other species. Tissue expression profile analysis shows that this gene is highly expressed in the mammary gland, moderately expressed in the heart, muscle, liver, and brain; weakly expressed in the pituitary gland, spleen, and lung; and almost silently expressed in the small intestine, skin, kidney, and adipose tissues. Four predicted microRNA target sites are found in the water buffalo AGPAT6 CDS. These results will establish a foundation for further insights into this novel water buffalo gene.

  20. Molecular cloning and functional analysis of an ethylene receptor gene from sugarcane (Saccharum spp.) by hormone and environmental stresses

    USDA-ARS?s Scientific Manuscript database

    Ethylene receptor (ethylene response sensor, ERS) is the primary component involving in the ethylene biosynthesis and ethylene signal transduction pathway. In the present study, a GZ-ERS gene encoding ERS was cloned from a sugarcane cv. YL17 (Saccharum spp.) using RT-PCR and ligation-mediated PCR wi...

  1. Toward the molecular cloning of the Septoria nodorum blotch susceptibility gene Snn2 in wheat

    USDA-ARS?s Scientific Manuscript database

    Septoria nodorum blotch is a disease of wheat caused by the necrotrophic fungus Parastagonospora nodorum. In the wheat-P. nodorum pathosystem, recognition of pathogen-produced necrotrophic effectors (NEs) by dominant host genes leads to host cell death, which allows the pathogen to gain nutrients an...

  2. Molecular cloning and expression analysis of multiple polyphenol oxidase genes in developing wheat (Triticum aestivum) kernels

    USDA-ARS?s Scientific Manuscript database

    Polyphenol oxidase (PPO, EC 1.10.31) is a major cause of discoloring in raw dough containing wheat flour. Minimization of PPO activity has proven difficult because bread wheat is genetically complex, composed of the genomes of three grass species. The PPO-A1 and PPO-D1 genes, on chromosomes 2A and...

  3. Molecular cloning and expression profile analysis of three sunflower (Helianthus annuus) diterpene synthase genes.

    PubMed

    Pugliesi, Claudio; Fambrini, Marco; Salvini, Mariangela

    2011-02-01

    ent-Kaurene, a key precursor of gibberellins, is formed by the action of two diterpene synthases (diTPSs), ent-copalyl diphosphate synthase (CPS), and ent-kaurene synthase (KS). The full-length cDNAs of CPS- (HaCPS1L) and KS-like (HaKS2L and HaKS3L) genes were isolated from sunflower. The amino acid sequences of HaCPS1L, HaKS2L, and HaKS3L exhibit structural features and homology to diTPSs of several plant species involved in gibberellin biosynthesis. RT-PCR analysis indicates that the expression of all genes (HaCPS1L, HaKS2L, and HaKS3L) is highly regulated during growth and development. All three diTPSs are preferentially expressed in rapidly growing tissues. HaKS2L is expressed at a much lower level than the other two diTPS genes. During seed development, the high level of both HaCPS1L and HaKS3L transcripts correlated with the period of rapid growth of the embryo. The three diTPS genes are not subjected to feedback regulation by gibberellin activity.

  4. Molecular cloning of a human gene that is a member of the nerve growth factor family

    SciTech Connect

    Jones, K.R.; Reichardt, L.F. )

    1990-10-01

    Cell death within the developing vertebrate nervous system is regulated in part by interactions between neurons and their innervation targets that are mediated by neurotrophic factors. These factors also appear to have a role in the maintenance of the adult nervous system. Two neurotrophic factors, nerve growth factor and brain-derived neurotrophic factor, share substantial amino acid sequence identity. The authors have used a screen that combines polymerase chain reaction amplification of genomic DNA and low-stringency hybridization with degenerate oligonucleotides to isolate human BDNF and a human gene, neurotrophin-3, that is closely related to both nerve growth factor and brain-derived neurotrophic factor. mRNA products of the brain-derived neurotrophic factor and neurotrophin-3 genes were detected in the adult human brain, suggesting that these proteins are involved in the maintenance of the adult nervous system. Neurotrophin-3 is also expected to function in embryonic neural development.

  5. Molecular cloning, characterization and expression analysis of a CC chemokine gene from miiuy croaker (Miichthys miiuy).

    PubMed

    Cheng, Yuanzhi; Sun, Yuena; Shi, Ge; Wang, Rixin; Xu, Tianjun

    2012-12-01

    Chemokines are a family of structurally related chemotactic cytokines that regulate the migration of leukocytes, under both physiological and inflammatory conditions. A partial cDNA of CC chemokine gene designed as Mimi-CC3 was isolated from miiuy croaker (Miichthys miiuy) spleen cDNA library. Unknown 3' part of the cDNA was amplified by 3'-RACE. The complete cDNA of Mimi-CC3 contains an 89-nt 5'-UTR, a 303-nt open reading frame and a 441-nt 3'-UTR. Three exons and two introns were identified in Mimi-CC3. The deduced Mimi-CC3 protein sequences contain a 22 amino acids signal peptide and a 78 amino acids mature polypeptide, which possesses the typical arrangement of four cysteines as found in other known CC chemokines. It shares low amino acid sequence identities with most other fish and mammalian CC chemokines (less than 54.1 %), but shares very high identities with large yellow croaker CC chemokine (94.6 %). Phylogenetic analysis showed that Mimi-CC3 gene may have an orthologous relationship with mammalian/amphibian CCL25 gene. Tissue expression distributed analysis showed that Mimi-CC3 gene was constitutively expressed in all nine tissues examined, although at different levels. Upon stimulated with Vibrio anguillarum, the time-course analysis using a real-time PCR showed that Mimi-CC3 transcript in kidney and liver was obviously up-regulated and reached the peak levels, followed by a recovery. Mimi-CC3 expression in kidney was more strongly increased than in liver. However, down-regulation was observed in spleen. These results indicated that Mimi-CC3 plays important roles in miiuy croaker immune response as well as in homeostatic mechanisms.

  6. Molecular cloning, characterization and expression of the heat shock protein 60 gene from the human pathogenic fungus Paracoccidioides brasiliensis.

    PubMed

    Izacc, S M; Gomez, F J; Jesuino, R S; Fonseca, C A; Felipe, M S; Deepe, G S; Soares, C M

    2001-10-01

    A gene encoding the heat shock protein (HSP) 60 from Paracoccidioides brasiliensis (Pb) was cloned and characterized. The hsp60 gene is composed of three exons divided by two introns. Structural analysis of the promoter detected canonical sequences characteristic of regulatory regions from eukaryotic genes. The deduced amino acid sequence of the Pb hsp60 gene and the respective cloned cDNA consists of 592 residues highly homologous to other fungal HSP60 proteins. The hsp60 gene is present as a single copy in the genome, as shown by Southern blot analysis. The HSP60 protein was isolated from Pb yeast cellular extracts. N-terminal amino acid sequencing of HSP60 confirmed that the cloned hsp60 gene correlated to the predicted protein in Pb. HSP60 expression appeared to be regulated during form transition in Pb, as different levels of expression were detected in in vitro labeling of cells and northern blot analysis. The complete coding region of Pb hsp60 was fused with plasmid pGEX-4T-3 and expressed in Escherichia coli as a glutathione S-transferase-tagged recombinant protein. The protein reacted with a mouse monoclonal antibody raised to a human recombinant HSP60. Western immunoblot experiments demonstrated that the recombinant protein and the native HSP60 were recognized by sera from humans with paracoccidioidomycosis (PCM).

  7. Molecular cloning, characterization and expression analysis of TGF-β and receptor genes in the woodchuck model.

    PubMed

    Wang, Lu; Wang, Junzhong; Liu, Yana; Wang, Baoju; Yang, Shangqing; Yu, Qing; Roggendorf, Michael; Lu, Mengji; Liu, Jia; Yang, Dongliang

    2016-12-20

    Transforming growth factor beta (TGF-β) is an important cytokine with pleiotropic regulatory functions in the immune system and in the responses against viral infections. TGF-β acts on a variety of immune cells through the cell surface TGF-β receptor (University of Duisburg-EssenTGFBR). The woodchuck has been used as a biomedical model for studies of obesity and energy balance, endocrine and metabolic function, cardiovascular, cerebrovascular and neoplastic disease. Woodchucks infected with woodchuck hepatitis virus (WHV) represent an informative animal model to study hepatitis B virus (HBV) infection. In this study, the cDNA sequences of woodchuck TGF-β1, TGF-β2, TGFBR1 and TGFBR2 were cloned, sequenced and characterized. The full-length TGFBR1 cDNA sequence consisted of 1305bp coding sequence (CDS) that encoded 434 amino acids with a molecular weight of 48.9kDa. The phylogenetic tree analysis revealed that the woodchuck TGF-β family genes had a closer genetic relationship with Ictidomys tridecemlineatus. One antibody with cross-reactivity to woodchuck TGFBR1 was identified by flow cytometry. Moreover, the expression of these genes were analyzed at the transcriptional level. The quantitative PCR analysis showed that the TGF-β family transcripts were constitutively expressed in many tissues tested. Altered expression levels of the TGF-β family transcripts in the liver of WHV infected woodchucks were observed. These results serve as a foundation for further insight into the role of the TGF-β family in viral hepatitis in woodchuck model. Our work also possesses the potential value for characterizing the TGF-β family in other related diseases, such as obesity-related diseases, metabolic disorder, cardiovascular disease and cancer.

  8. Molecular cloning of L-methylmalonyl-CoA mutase: Gene transfer and analysis of mut cell lines

    SciTech Connect

    Ledley, F.D.; Lumetta, M.; Nguyen, P.N.; Kolhouse, J.F.; Allen, R.H. )

    1988-05-01

    L-Methylmalonyl-CoA mutase (MCM, EC 5.4.99.2) is a mitochondrial adenosylcobalamin-requiring enzyme that catalyzes the isomerization of L-methylmalonyl-CoA to succinyl-CoA. This enzyme is deficient in methylmalonic acidemia, an often fatal disorder of organic acid metabolism. Antibody against human placental MCM was used to screen human placenta and liver cDNA expression libraries for MCM cDNA clones. One clone expressed epitopes that could affinity-purify antibodies against MCM. A cDNA corresponding in length to the mRNA was obtained and introduced into COS cells by DNA-mediated gene transfer. Cells transformed with this clone expressed increased levels of MCM enzymatic activity. RNA blot analysis of cells genetically deficient in MCM indicates that several deficient cell lines have a specific decrease in the amount of hybridizable mRNA. These data confirm the authenticity of the MCM cDNA clone, establish the feasibility of constituting MCM activity by gene transfer for biochemical analysis and gene therapy, and provide a preliminary picture of the genotypic spectrum underlying MCM deficiency.

  9. Molecular cloning and functional characterization of beta-N-acetylglucosaminidase genes from Sf9 cells.

    PubMed

    Aumiller, Jared J; Hollister, Jason R; Jarvis, Donald L

    2006-06-01

    Sf9, a cell line derived from the lepidopteran insect, Spodoptera frugiperda, is widely used as a host for recombinant glycoprotein expression and purification by baculovirus vectors. Previous studies have shown that this cell line has one or more beta-N-acetylglucosaminidase activities that may be involved in the degradation and/or processing of N-glycoprotein glycans. However, these enzymes and their functions remain poorly characterized. Therefore, the goal of this study was to isolate beta-N-acetylglucosaminidase genes from Sf9 cells, over-express the gene products, and characterize their enzymatic activities. A degenerate PCR approach yielded three Sf9 cDNAs, which appeared to encode two distinct beta-N-acetylglucosaminidases, according to bioinformatic analyses. Baculovirus-mediated expression of these two cDNA products induced membrane-associated beta-N-acetylglucosaminidase activities in Sf9 cells, which cleaved terminal N-acetylglucosamine residues from the alpha-3 and -6 branches of a biantennary N-glycan substrate with acidic pH optima and completely hydrolyzed chitotriose to its constituent N-acetylglucosamine monomers. GFP-tagged forms of both enzymes exhibited punctate cytoplasmic fluorescence, which did not overlap with either lysosomal or Golgi-specific dyes. Together, these results indicated that the two new Sf9 genes identified in this study encode broad-spectrum beta-N-acetylglucosaminidases that appear to have unusual intracellular distributions. Their relative lack of substrate specificity and acidic pH optima are consistent with a functional role for these enzymes in glycoprotein glycan and chitin degradation, but not with a role in N-glycoprotein glycan processing.

  10. Molecular cloning and developmental expression of the caveolin gene family in the amphibian Xenopus laevis.

    PubMed

    Razani, Babak; Park, David S; Miyanaga, Yuko; Ghatpande, Ashwini; Cohen, Justin; Wang, Xiao Bo; Scherer, Philipp E; Evans, Todd; Lisanti, Michael P

    2002-06-25

    Caveolae are approximately 50-100 nm invaginations of the plasma membrane thought to form as a result of a local accumulation of cholesterol, sphingolipids, and a unique family of three proteins known as the caveolins: Cav-1, -2, and -3. Here, we report the identification, sequence, and developmental expression of the three caveolin genes in the amphibian Xenopus laevis. Sequence comparisons show that Xenopus Cav-1, -2, and -3 are approximately 80, 64, and 45% identical, respectively, to their counterparts in humans. Furthermore, Northern blotting experiments demonstrate that the Xenopus caveolins have tissue-specific expression profiles consistent with those previously reported in adult mammals. In the adult frog, Xenopus Cav-1 and Cav-2 are most abundantly expressed in the fat body and the lungs, while Xenopus Cav-3 is primarily expressed in muscle tissue types (heart and skeletal muscle). However, our temporal and spatial analyses of these expression patterns during embryogenesis reveal several novel features, with possible relevance to developmental signaling. Transcripts encoding Xenopus Cav-1 and -2 first appear in the notochord of neurula stage embryos, which represents a key signaling tissue. In contrast, Xenopus Cav-3 shows a highly specific punctate expression pattern in the embryonic epidermis, similar to previous patterns implicated in Notch signaling. These findings are in striking contrast to their steady-state expression patterns in the adult frog. Taken together, our results show that the Xenopus caveolin gene family is present and differentially expressed in both embryonic and adult tissues. This report is the first detailed study of caveolin gene expression in a developing embryo.

  11. Molecular cloning, characteristics and low temperature response of raffinose synthase gene in Cucumis sativus L.

    PubMed

    Sui, Xiao-lei; Meng, Fan-zhen; Wang, Hong-yun; Wei, Yu-xia; Li, Rui-fu; Wang, Zhen-yu; Hu, Li-ping; Wang, Shao-hui; Zhang, Zhen-xian

    2012-12-15

    Raffinose synthase (RS, EC2.4.1.82) is one of the key enzymes that channels sucrose into the raffinose family oligosaccharides (RFOs) biosynthetic pathway. However, the gene encoding RS is poorly characterized in cucumber (Cucumis sativus L.), which is a typical RFOs-translocating plant species. Here we isolated the gene encoding RS (CsRS) from the leaves of cucumber plants. The complete cDNA of CsRS consisted of 2552 nucleotides with an open reading frame encoding a polypeptide of 784 amino acid residues. Reverse transcription-polymerase chain reaction and RNA hybridization analysis revealed that expression of CsRS was the highest in leaves followed by roots, fruits, and stems. The RS activity was up-regulated and the raffinose content was high in the leaves of transgenic tobacco with over-expression of CsRS, while both the RS activity and the raffinose content decreased in the transgenic cucumber plants with anti-sense expression of CsRS. The expression of CsRS could be induced by low temperature and exogenous phytohormone abscisic acid (ABA). In cucumber growing under low temperature stress, CsRS expression, RS activity and raffinose content increased gradually in the leaves, the fruits, the stems and the roots. The most notable increase was observed in the leaves. Similarly, the expression of CsRS was induced in cucumber leaves and fruits with 200 μM and 150 μM ABA treatments, respectively.

  12. Molecular cloning, expression profiles, and characterization of a novel polyphenol oxidase (PPO) gene in Hevea brasiliensis.

    PubMed

    Li, Dejun; Deng, Zhi; Liu, Changren; Zhao, Manman; Guo, Huina; Xia, Zhihui; Liu, Hui

    2014-01-01

    The polyphenol oxidase (PPO) is involved in undesirable browning in many plant foods. Although the PPOs have been studied by several researchers, the isolation and expression profiles of PPO gene were not reported in rubber tree. In this study, a new PPO gene, HbPPO, was isolated from Hevea brasiliensis. The sequence alignment showed that HbPPO indicated high identities to plant PPOs and belonged to dicot branch. The cis-acting regulatory elements related to stress/hormone responses were predicted in the promoter region of HbPPO. Real-time RT-PCR analyses showed that HbPPO expression varied widely depending on different tissues and developmental stages of leaves. Besides being associated with tapping panel dryness, the HbPPO transcripts were regulated by ethrel, wounding, H2O2, and methyl jasmonate treatments. Moreover, the correlation between latex coagulation rate and PPO activity was further confirmed in this study. Our results lay the foundation for further analyzing the function of HbPPO in rubber tree.

  13. Molecular Cloning and Expression Analysis of a Catalase Gene (NnCAT) from Nelumbo nucifera.

    PubMed

    Dong, Chen; Zheng, Xingfei; Diao, Ying; Wang, Youwei; Zhou, Mingquan; Hu, Zhongli

    2015-11-01

    Rapid amplification cDNA end (RACE) assay was established to achieve the complete cDNA sequence of a catalase gene (NnCAT) from Nelumbo nucifera. The obtained full-length cDNA was 1666 bp in size and contained a 1476-bp open reading frame. The 3D structural model of NnCAT was constructed by homology modeling. The putative NnCAT possessed all the main characteristic amino acid residues and motifs of catalase (CAT) protein family, and the phylogenetic analysis revealed that NnCAT grouped together with high plants. Moreover, recombinant NnCAT showed the CAT activity (758 U/mg) at room temperature, holding high activity during temperature range of 20-50 °C, then the optimal pH of recombinant protein was assessed from pH 4 to pH 11. Additionally, real-time PCR assay demonstrated that NnCAT mRNA was expressed in various tissues of N. nucifera, with the highest expression in young leaf and lowest level in the root, and mRNA level of NnCAT was significantly augmented in response to short-time mechanical wounding. Different expression pattern of NnCAT gene suggested that NnCAT probably played a defensive role in the initial stages of oxidative stress, regulating the level of reactive oxygen species (ROS) by extracellular stimuli such as short-time mechanical wounding.

  14. Molecular cloning and functional characterization of a mouse gene upregulated by lipopolysaccharide treatment reveals alternative splicing

    SciTech Connect

    Du, Kejun; Chen, Yaoming; Dai, Zongming; Bi, Yuan; Cai, Tongjian; Hou, Lichao; Chai, Yubo; Song, Qinghe; Chen, Sumin; Luo, Wenjing; Chen, Jingyuan

    2010-01-01

    Treatment of mouse cells with lipopolysaccharide (LPS) potently initiates an inflammatory response, but the underlying mechanisms are unclear. We therefore sought to characterize cDNA sequences of a new mouse LPS-responsive gene, and to evaluate the effects of MLrg. Full-length cDNAs were obtained from LPS-treated NIH3T3 cells. We report that the MLrg gene produces two alternative splice products (GenBank Accession Nos. (DQ316984) and (DQ320011)), respectively, encoding MLrgW and MLrgS polypeptides. Both proteins contain zinc finger and leucine zipper domains and are thus potential regulators of transcription. Expression of MLrgW and MLrgS were robustly upregulated following LPS treatment, and the proteins were localized predominantly in the nuclear membrane and cytoplasm. In stable transfectants over-expressing MLrgW the proportion of cells in G1 phase was significantly reduced, while in cells over-expressing MLrgS the proportion of cells in G2 was significantly increased; both proteins are thus potential regulators of cell cycle progression. Upregulation of MLrgW and MLrgS may be an important component of the LPS inflammatory pathway and of the host response to infection with GNB.

  15. Molecular cloning and characterisation of sea bass (Dicentrarchus labrax L.) caspase-3 gene.

    PubMed

    Reis, Marta I R; Nascimento, Diana S; do Vale, Ana; Silva, Manuel T; dos Santos, Nuno M S

    2007-02-01

    Caspase-3 is one of the major caspases operating in apoptosis, cleaving and inactivating a number of molecules and largely contributing to the apoptotic phenotype and the dismantling of the apoptoting cell. The opening reading frame of sea bass (Dicentrarchus labrax L.) caspase-3 has 281 amino acids. The complete sequence of caspase-3 shows a very close homology to the correspondent sequence from other vertebrates, in particularly with that of Takifugu rubripes and Oryzias latipes, with 87.7 and 87.9% of similarity, respectively. Furthermore, the sea bass caspase-3 sequence retains the motifs that are functionally important, such as the pentapeptide active-site motif (QACRG) and the putative cleavage sites at the aspartic acids. In the sea bass genome, the caspase-3 gene exists as a single copy gene and is organised in six exons and five introns. A very low expression of caspase-3 was detected by RT-PCR in various organs of non-stimulated sea bass, with slightly higher levels in thymus and heart and was increased in head kidneys of Photobacterium damselae ssp. piscicida infected sea bass. This increased expression was accompanied by the occurrence of high numbers of apoptoting cells with activated caspase-3.

  16. Molecular cloning and characterization of Escherichia coli K12 ygjG gene

    PubMed Central

    Samsonova, Natalya N; Smirnov, Sergey V; Altman, Irina B; Ptitsyn, Leonid R

    2003-01-01

    Background Putrescine is the intermediate product of arginine decarboxylase pathway in Escherichia coli which can be used as an alternative nitrogen source. Transaminase and dehydrogenase enzymes seem to be implicated in the degradative pathway of putrescine, in which this compound is converted into γ-aminobutyrate. But genes coding for these enzymes have not been identified so far. Results The 1.8-kbp DNA fragment containing E. coli K12 ygjG gene with aer-ygjG intergenic region was examined. It was found that the fragment contains σ54-depended open reading frame (ORF) of 1,380 nucleotides encoding a 459-amino acid polypeptide of approximately 49.6 kDa. The cytidine (C) residue localized 10 bp downstream of the σ54 promoter sequence was identified as the first mRNA base. The UUG translation initiation codon is situated 36 nucleotides downstream of the mRNA start. The YgjG was expressed as a his6-tag fused protein and purified to homogeneity. The protein catalyzed putrescine:2-oxoglutaric acid (2-OG) aminotransferase reaction (PATase, EC 2.6.1.29). The Km values for putrescine and 2-OG were found to be 9.2 mM and 19.0 mM, respectively. The recombinant enzyme also was able to transaminate cadaverine and, in lower extent, spermidine, and gave maximum activity at pH 9.0. Conclusion Expression of E. coli K12 ygjG coding region revealed σ54-depended ORF which encodes a 459-amino acid protein with putrescine:2-OG aminotransferase activity. The enzyme also was able to transaminate cadaverine and, in lower extent, spermidine. PMID:12617754

  17. Molecular cloning and characterization of genes involved in rosmarinic acid biosynthesis from Prunella vulgaris.

    PubMed

    Kim, Yeon Bok; Shin, YouJin; Tuan, Pham Anh; Li, Xiaohua; Park, Yunji; Park, Nam-il; Park, Sang Un

    2014-01-01

    Prunella vulgaris L., commonly known as "self-heal" or "heal-all," is a perennial herb with a long history of medicinal use. Phenylalanine ammonia-lyase (PAL), cinnamate 4-hydroxylase (C4H), and 4-coumarate:coenzyme-A (CoA) ligase (4CL) are important enzymes in the phenylpropanoid pathway and in the accumulation of rosmarinic acid (RA), which is a major secondary metabolite in P. vulgaris. In this study, we isolated cDNAs encoding PvPAL, PvC4H, and Pv4CL from P. vulgaris using rapid amplification of cDNA ends polymerase chain reaction (PCR). The amino acid sequence alignments of PvPAL, PvC4H, and Pv4CL showed high sequence identity to those of other plants. Quantitative real-time PCR analysis was used to determine the transcript levels of genes involved in RA biosynthesis in the flowers, leaves, stems, and roots of P. vulgaris. The transcript levels of PvPAL, PvC4H, and Pv4CL1 were the highest in flowers, whereas Pv4CL2 was the highest in roots. High-performance liquid chromatography analysis also showed the highest RA content in the flowers (3.71 mg/g dry weight). We suggest that the expression of the PvPAL, PvC4H, and Pv4CL1 genes is correlated with the accumulation of RA. Our results revealed that P. vulgaris flowers are appropriate for medicinal usage, and our findings provide support for increasing RA production in this plant.

  18. Molecular cloning of ADIR, a novel interferon responsive gene encoding a protein related to the torsins.

    PubMed

    Dron, Michel; Meritet, Jean François; Dandoy-Dron, Françoise; Meyniel, Jean-Philippe; Maury, Chantal; Tovey, Michael G

    2002-03-01

    The expression of the previously uncharacterized gene Adir (for ATP dependent interferon responsive gene) was increased by 5- to 15-fold in tissue of the oral cavity or in spleen and liver of mice treated orally or intraperitoneally with IFN-alpha, and in mouse cells treated in vitro with IFN-alpha or IFN-gamma. The level of Adir mRNA was also increased 20- to 40-fold in the brains of animals infected with encephalomyocarditis virus. Adir is expressed ubiquitously in mouse tissues as 1.9-, 2.4-, and 3.5-kb mRNA transcripts encoding a 385-amino-acid protein with a conserved ATP binding domain containing typical nucleotide and Mg(2+) binding sites. We also characterized the human ortholog, ADIR, which is located on chromosome 1q25-q31 and contains six exons encoding a 397-amino-acid protein with 80% homology to the mouse protein. A single 2.3-kb mRNA was detected in all human tissues examined, except for placenta, which also contained a 1.25-kb tissue-specific transcript generated by alternative splicing and encoding a putative 336-amino-acid protein. Although ADIR exhibits low homology to DYT1 and TOR1B, the deduced ADIR protein sequences are highly homologous to torsin A and torsin B and more distantly related to members of the Clp/HSP100 family of proteins, suggesting that ADIR, like torsins, is related to the AAA chaperone-like family of ATPases. An ADIR-EGFP fusion protein expressed in HeLa cells was shown to be associated with the endoplasmic reticulum.

  19. Molecular cloning of a Brassica napus thiohydroximate S-glucosyltransferase gene and its expression in Escherichia coli.

    PubMed

    Marillia, Elizabeth-France; MacPherson, Jim M.; Tsang, Edward W. T.; Van Audenhove, Katrien; Keller, Wilf A.; GrootWassink, Jan W. D.

    2001-10-01

    A genomic clone encoding a thiohydroximate S-glucosyltransferase (S-GT) was isolated from Brassica napus by library screening with probes generated by PCR using degenerated primers. Its corresponding cDNA was amplified by rapid amplification of cDNA ends (RACE) PCR and also cloned by cDNA library screening. The genomic clone was 5 896 bp long and contained a 173-bp intron. At least two copies of the S-GT gene were present in B. napus. The full-length cDNA clone was 1.5 kb long and contained an open reading frame encoding a 51-kDa polypeptide. The deduced amino acid sequence shared a significant degree of homology with other glucosyltransferases characterized in other species, including a highly conserved motif within this family of enzymes corresponding to the glucose-binding domain. The recombinant protein was expressed in Escherichia coli, and the enzyme activity was tested by a biochemical assay based on the measure of glucose incorporation. The high thiohydroximate S-GT activity detected from the recombinant protein confirmed that this clone was indeed a S-glucosyltransferase.

  20. Molecular Cloning and Characterization of Novel Phytocystatin Gene from Turmeric, Curcuma longa

    PubMed Central

    Chan, Seow-Neng; Abu Bakar, Norliza; Mahmood, Maziah; Ho, Chai-Ling

    2014-01-01

    Phytocystatin, a type of protease inhibitor (PI), plays major roles in plant defense mechanisms and has been reported to show antipathogenic properties and plant stress tolerance. Recombinant plant PIs are gaining popularity as potential candidates in engineering of crop protection and in synthesizing medicine. It is therefore crucial to identify PI from novel sources like Curcuma longa as it is more effective in combating against pathogens due to its novelty. In this study, a novel cDNA fragment encoding phytocystatin was isolated using degenerate PCR primers, designed from consensus regions of phytocystatin from other plant species. A full-length cDNA of the phytocystatin gene, designated CypCl, was acquired using 5′/3′ rapid amplification of cDNA ends method and it has been deposited in NCBI database (accession number KF545954.1). It has a 687 bp long open reading frame (ORF) which encodes 228 amino acids. BLAST result indicated that CypCl is similar to cystatin protease inhibitor from Cucumis sativus with 74% max identity. Sequence analysis showed that CypCl contains most of the motifs found in a cystatin, including a G residue, LARFAV-, QxVxG sequence, PW dipeptide, and SNSL sequence at C-terminal extension. Phylogenetic studies also showed that CypCl is related to phytocystatin from Elaeis guineensis. PMID:25853138

  1. Molecular cloning and functional characterization of the apple sucrose transporter gene MdSUT2.

    PubMed

    Ma, Qi-Jun; Sun, Mei-Hong; Liu, Ya-Jing; Lu, Jing; Hu, Da-Gang; Hao, Yu-Jin

    2016-12-01

    Sucrose is not only the primary photosynthetic product but also the major component translocated in the phloem of economically important plant species. Sucrose transporters or carriers (SUTs or SUCs), function as sucrose/H(+) symporters and play a crucial role in determining the cell-to-cell distribution of sucrose throughout the entire plant. However, whether such genes are involved in responses to abiotic stress and other biological processes is largely unknown. Here, we report that MdSUT2 in apple is a homolog of the Arabidopsis vacuolar sucrose transporter AtSUT2. Ectopic expression of MdSUT2 in Arabidopsis decreased sucrose sensitivity in germination and seeding stage and increased sucrose transport activity. In addition, our results showed that MdSUT2 impacted on plant growth by accelerating vegetative growth and promoting early flowering in Arabidopsis. Overexpression of MdSUT2 significantly improved abiotic stress tolerance including NaCl, ABA, and mannitol in apple calli and Arabidopsis. Together, these findings provide evidence that the apple sucrose transporter MdSUT2 is involved in abiotic stress resistance and the regulation of plant growth and development. Copyright © 2016 Elsevier Masson SAS. All rights reserved.

  2. Molecular cloning, expression analysis and cellular localization of an LFRFamide gene in the cuttlefish Sepiella japonica.

    PubMed

    Cao, Zi-Hao; Sun, Lian-Lian; Chi, Chang-Feng; Liu, Hui-Hui; Zhou, Li-Qing; Lv, Zhen-Ming; Wu, Chang-Wen

    2016-06-01

    Neuropeptides are important regulators of physiological processes in metazoans, such as feeding, reproduction, and heart activities. In this study, an LFRFamide gene was identified from the cuttlefish Sepiella japonica (designated as SjLFRFamide). The full-length sequence of SjLFRFamide cDNA has 841bp, and the open reading frame contains 567bp encoding 188 amino acids, which shared high similarity with precursor SOFaRP2 from Sepia officinalis. The deduced SjLFRFamdie precursor protein contains a signal peptide and four different FLPs (FMRFamide-like peptides): one pentapeptide (TIFRFamide), two hexapeptides (NSLFRFamide and GNLFRFamide) and one heptapeptide (PHTPFRFamide). Multiple sequence alignment showed that SjLFRFamide contains rather conserved mature peptides, which all ended in FRF. The phylogenetic analysis suggests that SjLFRFamide belongs to the LFRFamide subfamily. The tissue distribution analysis through quantitative real-time PCR method showed that SjLFRFamide mRNA is significantly expressed in the brain, and slight trace are detected in female nidamental gland and accessory nidamental gland. In situ hybridization assay of the brain indicated that SjLFRFamide is transcribed in several different functional lobes, suggesting SjLFRFamide might associate with multiple physiological regulations, such as feeding, chromatophore regulation and reproduction. This is the first study describing LFRFamide in S. japonica, which might have great importance for cuttlefish artificial breeding. Copyright © 2015 Elsevier Inc. All rights reserved.

  3. Molecular Cloning and Characterization of Two Genes Encoding Dihydroflavonol-4-Reductase from Populus trichocarpa

    PubMed Central

    Jia, Zhichun; Yang, Li; Sun, Yimin; Xiao, Xunyan; Song, Feng; Luo, Keming

    2012-01-01

    Dihydroflavonol 4-reductase (DFR, EC 1.1.1.219) is a rate-limited enzyme in the biosynthesis of anthocyanins and condensed tannins (proanthocyanidins) that catalyzes the reduction of dihydroflavonols to leucoanthocyanins. In this study, two full-length transcripts encoding for PtrDFR1 and PtrDFR2 were isolated from Populus trichocarpa. Sequence alignment of the two PtrDFRs with other known DFRs reveals the homology of these genes. The expression profile of PtrDFRs was investigated in various tissues of P. trichocarpa. To determine their functions, two PtrDFRs were overexpressed in tobacco (Nicotiana tabacum) via Agrobacterium-mediated transformation. The associated color change in the flowers was observed in all 35S:PtrDFR1 lines, but not in 35S:PtrDFR2 lines. Compared to the wild-type control, a significantly higher accumulation of anthocyanins was detected in transgenic plants harboring the PtrDFR1. Furthermore, overexpressing PtrDFR1 in Chinese white poplar (P. tomentosa Carr.) resulted in a higher accumulation of both anthocyanins and condensed tannins, whereas constitutively expressing PtrDFR2 only improved condensed tannin accumulation, indicating the potential regulation of condensed tannins by PtrDFR2 in the biosynthetic pathway in poplars. PMID:22363429

  4. Molecular cloning and characterization of novel phytocystatin gene from turmeric, Curcuma longa.

    PubMed

    Chan, Seow-Neng; Abu Bakar, Norliza; Mahmood, Maziah; Ho, Chai-Ling; Shaharuddin, Noor Azmi

    2014-01-01

    Phytocystatin, a type of protease inhibitor (PI), plays major roles in plant defense mechanisms and has been reported to show antipathogenic properties and plant stress tolerance. Recombinant plant PIs are gaining popularity as potential candidates in engineering of crop protection and in synthesizing medicine. It is therefore crucial to identify PI from novel sources like Curcuma longa as it is more effective in combating against pathogens due to its novelty. In this study, a novel cDNA fragment encoding phytocystatin was isolated using degenerate PCR primers, designed from consensus regions of phytocystatin from other plant species. A full-length cDNA of the phytocystatin gene, designated CypCl, was acquired using 5'/3' rapid amplification of cDNA ends method and it has been deposited in NCBI database (accession number KF545954.1). It has a 687 bp long open reading frame (ORF) which encodes 228 amino acids. BLAST result indicated that CypCl is similar to cystatin protease inhibitor from Cucumis sativus with 74% max identity. Sequence analysis showed that CypCl contains most of the motifs found in a cystatin, including a G residue, LARFAV-, QxVxG sequence, PW dipeptide, and SNSL sequence at C-terminal extension. Phylogenetic studies also showed that CypCl is related to phytocystatin from Elaeis guineensis.

  5. Molecular cloning of the yeast mitochondrial aconitase gene (ACO1) and evidence of a synergistic regulation of expression by glucose plus glutamate.

    PubMed Central

    Gangloff, S P; Marguet, D; Lauquin, G J

    1990-01-01

    We have isolated genomic clones complementing the aconitase-deficient strain (glu1-1) of Saccharomyces cerevisiae. Identification of the aconitase gene was established by enzymatic assays and molecular analyses. The corresponding mRNA has been characterized, and its direction of transcription has been determined. The complete nucleotide sequence revealed strong amino acid homologies with the sequences of some peptides isolated from the mammalian protein. Disruption of the gene by deletion-insertion led to glutamate auxotrophy. Expression of the aconitase gene was sensitive to glucose repression and was synergistically down regulated by glucose and glutamate. Images PMID:1972545

  6. Designing and Cloning Molecular Constructs to Knock Out N-Acetylglucosamine Phosphatidylinositol De-N-Acetylase (GPI12) Gene in Leishmania major (MRHO/IR/75/ER)

    PubMed Central

    GHASEMI NEJAD ALMANI, Pooya; SHARIFI, Iraj; KAZEMI, Bahram; BABAEI, Zahra; BANDEHPOUR, Mojgan; SALARI, Samira; SAEDI DEZAKI, Ebrahim

    2016-01-01

    Background: Leishmaniasis represents a major public health concern in tropical and sub-tropical countries. At present, there is no efficacious vaccine against the disease and new control methods are needed. One way to access this important goal is to knock out genes of specific macromolecules to evaluate the effect of deletion on the growth, multiplication, pathogenesis and immunity of the parasite. The aim of this study was to design and clone molecular constructs to knock out N-acetylglucosamine phosphatidylinositol de-N-acetylase (GPI12) gene in Leishmania major. Methods: For designing and making molecular constructs, we used pLEXSY-neo2 and pLEXSY-hyg2 vectors. The molecular constructs were cloned in E. coli strain Top10. The molecular constructs were transfected by electroporation into L. major in two stages. Results: The molecular constructs were confirmed by Colony PCR and sequencing. The recombinant strains were isolated by selective antibiotics, after which they were confirmed by PCR, Southern and Western blots. Conclusion: Recombinant parasites were created and examined for subsequent study. With the use of molecular constructs, it was possible to remove and study gene GPI12 and to achieve a live recombinant Leishmania parasite that maintained the original form of the antigenic parasites. This achievement can be used as an experimental model for vaccine development studies. Further investigations are essential to check this model in a suitable host. PMID:28127356

  7. The ura5 gene of the ascomycete Sordaria macrospora: molecular cloning, characterization and expression in Escherichia coli.

    PubMed

    Le Chevanton, L; Leblon, G

    1989-04-15

    We cloned the ura5 gene coding for the orotate phosphoribosyl transferase from the ascomycete Sordaria macrospora by heterologous probing of a Sordaria genomic DNA library with the corresponding Podospora anserina sequence. The Sordaria gene was expressed in an Escherichia coli pyrE mutant strain defective for the same enzyme, and expression was shown to be promoted by plasmid sequences. The nucleotide sequence of the 1246-bp DNA fragment encompassing the region of homology with the Podospora gene has been determined. This sequence contains an open reading frame of 699 nucleotides. The deduced amino acid sequence shows 72% similarity with the corresponding Podospora protein.

  8. Molecular cloning and characterization of the genes encoding the proteins of Zika virus.

    PubMed

    Hou, Wangheng; Cruz-Cosme, Ruth; Armstrong, Najealicka; Obwolo, Lilian Akello; Wen, Fayuan; Hu, Wenhui; Luo, Min-Hua; Tang, Qiyi

    2017-09-10

    Zika virus (ZIKV) encodes a precursor protein (also called polyprotein) of about 3424 amino acids that is processed by proteases to generate 10 mature proteins and a small peptide. In the present study, we characterized the chemical features, suborganelle distribution and potential function of each protein using Flag-tagged protein expression system. Western blot analysis revealed the molecular weight of the proteins and the polymerization of E, NS1, and NS3 proteins. In addition, we performed multi-labeled fluorescent immunocytochemistry and subcellular fractionation to determine the subcellular localization of these proteins in host cells. We found that 1) the capsid protein colocalizes with 3 different cellular organelles: nucleoli, Golgi apparatus, and lipid droplet; NS2b and NS4a are associated with the Golgi apparatus; 2) the capsid and NS1proteins distribute in both cytoplasm and nucleus, NS5 is a nuclear protein; 3) NS3 protein colocalizes with tubulin and affects Lamin A; 4) Envelope, PrM, and NS2a proteins co-localize with the endoplasmic reticulum; 5) NS1 is associated with autophagosomes and NS4b is related to early endosome; 6) NS5 forms punctate structures in the nucleus that associate with splicing compartments shown by SC35, leading to reduction of SC35 protein level and trafficking of SC35 from the nucleus to the cytoplasm. These data suggest that ZIKV generates 10 functional viral proteins that exhibit distinctive subcellular distribution in host cells. Copyright © 2017 Elsevier B.V. All rights reserved.

  9. Molecular cloning and characterization of a flavanone 3-Hydroxylase gene from Artemisia annua L.

    PubMed

    Xiong, Shuo; Tian, Na; Long, Jinhua; Chen, Yuhong; Qin, Yu; Feng, Jinyu; Xiao, Wenjun; Liu, Shuoqian

    2016-08-01

    Flavonoids were found to synergize anti-malaria and anti-cancer compounds in Artemisia annua, a very important economic crop in China. In order to discover the regulation mechanism of flavonoids in Artemisia annua, the full length cDNA of flavanone 3-hydroxylase (F3H) were isolated from Artemisia annua for the first time by using RACE (rapid amplification of cDNA ends). The completed open read frame of AaF3H was 1095 bp and it encoded a 364-amino acid protein with a predicted molecular mass of 41.18 kDa and a pI of 5.67. The recombinant protein of AaF3H was expressed in E. coli BL21(DE3) as His-tagged protein, purified by Ni-NTA agrose affinity chromatography, and functionally characterized in vitro. The results showed that the His-tagged protein (AaF3H) catalyzed naringenin to dihydrokaempferol in the present of Fe(2+). The Km for naringenin was 218.03 μM. The optimum pH for AaF3H reaction was determined to be pH 8.5, and the optimum temperature was determined to be 35 °C. The AaF3H transcripts were found to be accumulated in the cultivar with higher level of flavonoids than that with lower level of flavonoids, which implied that AaF3H was a potential target for regulation of flavonoids biosynthesis in Artemisia annua through metabolic engineering. Copyright © 2016 Elsevier Masson SAS. All rights reserved.

  10. Molecular cloning and expression analysis of a gene for a sucrose transporter in maize (Zea mays L.).

    PubMed

    Aoki, N; Hirose, T; Takahashi, S; Ono, K; Ishimaru, K; Ohsugi, R

    1999-10-01

    Here we report the cloning of a sucrose transporter cDNA from maize (Zea mays L.) and an analysis of the expression of the gene. A cDNA clone (ZmSUT1) was identified as a sucrose transporter cDNA from its sequence homology at the amino acid level to sucrose transporters that have been cloned from other higher plant species. Based on the results of genomic Southern hybridization, ZmSUT1 appears to be a single copy gene. A Northern blot analysis of seedlings and leaf blades suggests that the sucrose transporter is involved in the export of accumulated carbohydrates from source leaf blades. From the measurements of transcript levels and carbohydrate contents in mature leaf blades, we propose that the expression of the gene for the maize sucrose transporter is positively regulated by the amounts of soluble sugars such as sucrose and glucose in source leaves of maize. In addition, based on the tissue specificity of the expression of the gene in maize plants at the reproductive stage, it is possible that the sucrose transporter acts in sink tissues such as pedicles as well as in source tissues such as leaf blades.

  11. Molecular cloning of a mouse DNA repair gene that complements the defect of group-A xeroderma pigmentosum.

    PubMed Central

    Tanaka, K; Satokata, I; Ogita, Z; Uchida, T; Okada, Y

    1989-01-01

    For isolation of the gene responsible for xeroderma pigmentosum (XP) complementation group A, plasmid pSV2gpt and genomic DNA from a mouse embryo were cotransfected into XP2OSSV cells, a group-A XP cell line. Two primary UV-resistant XP transfectants were isolated from about 1.6 X 10(5) pSV2gpt-transformed XP colonies. pSV2gpt and genomic DNA from the primary transfectants were again cotransfected into XP2OSSV cells and a secondary UV-resistant XP transfectant was obtained by screening about 4.8 X 10(5) pSV2gpt-transformed XP colonies. The secondary transfectant retained fewer mouse repetitive sequences. A mouse gene that complements the defect of XP2OSSV cells was cloned into an EMBL3 vector from the genome of a secondary transfectant. Transfections of the cloned DNA also conferred UV resistance on another group-A XP cell line but not on XP cell lines of group C, D, F, or G. Northern blot analysis of poly(A)+ RNA with a subfragment of cloned mouse DNA repair gene as the probe revealed that an approximately 1.0 kilobase mRNA was transcribed in the donor mouse embryo and secondary transfectant, and approximately 1.0- and approximately 1.3-kilobase mRNAs were transcribed in normal human cells, but none of these mRNAs was detected in three strains of group-A XP cells. These results suggest that the cloned DNA repair gene is specific for group-A XP and may be the mouse homologue of the group-A XP human gene. Images PMID:2748601

  12. Molecular cloning of a mouse DNA repair gene that complements the defect of group-A xeroderma pigmentosum

    SciTech Connect

    Tanaka, K.; Satokata, I.; Ogita, Z.; Uchida, T.; Okada, Y.

    1989-07-01

    For isolation of the gene responsible for xeroderma pigmentosum (XP) complementation group A, plasmid pSV2gpt and genomic DNA from a mouse embryo were cotransfected into XP2OSSV cells, a group-A XP cell line. Two primary UV-resistant XP transfectants were isolated from about 1.6 X 10(5) pSV2gpt-transformed XP colonies. pSV2gpt and genomic DNA from the primary transfectants were again cotransfected into XP2OSSV cells and a secondary UV-resistant XP transfectant was obtained by screening about 4.8 X 10(5) pSV2gpt-transformed XP colonies. The secondary transfectant retained fewer mouse repetitive sequences. A mouse gene that complements the defect of XP2OSSV cells was cloned into an EMBL3 vector from the genome of a secondary transfectant. Transfections of the cloned DNA also conferred UV resistance on another group-A XP cell line but not on XP cell lines of group C, D, F, or G. Northern blot analysis of poly(A)+ RNA with a subfragment of cloned mouse DNA repair gene as the probe revealed that an approximately 1.0 kilobase mRNA was transcribed in the donor mouse embryo and secondary transfectant, and approximately 1.0- and approximately 1.3-kilobase mRNAs were transcribed in normal human cells, but none of these mRNAs was detected in three strains of group-A XP cells. These results suggest that the cloned DNA repair gene is specific for group-A XP and may be the mouse homologue of the group-A XP human gene.

  13. Molecular cloning, regulation, and functional analysis of two GHS-R genes in zebrafish.

    PubMed

    Eom, Ji; Hong, Areum; Kang, Young-Ho; Yoo, Han-Ju; Chang, Eun-Ju; Kang, Sang-Wook; Yoon, Seung-Yong; Kim, Sang-Yeob; Song, Youngsup

    2014-08-01

    Mammalian ghrelin is derived from stomach and regulates growth hormone release and appetite by modulating GHS-R (Growth hormone secretagogue receptor) activity. Zebrafish has been developed as a forward genetic screening model system and previous screening identified a number of genes involved in multiple signaling pathways. In this system, ghrelin has been identified and its function and regulation have been shown to be highly conserved to that of mammals. Here, we identified three isoforms of zGHS-R1 and one of zGHS-R2 (zGHS-R2a), and characterized their expression, regulation and function. Three isoforms of zGHS-R1, which we named zGHS-R1a, zGHS-R1b, and zGHS-R1c, are generated by alternative splicing. The expression of zGHS-R1 is highly enriched in brain, intestine tissue, and skin tissues. Compared to zGHS-R1, the expression pattern of zGHS-R2a is rather evenly distributed. A 15 day fasting elevated expression of zGHS-R1 and zGHS-R2 transcripts in anterior intestine tissues, but not in brain. Whereas zGHS-R1a, zGHS-R1c, and zGHS-R2a appear to be presented on the plasma membrane, the localization of zGHS-R1b seems to be restricted in the intracellular region. Treatment of ghrelin agonist, L692,585 or goldfish ghrelin peptides but not rat ghrelin, elevated intracellular Ca(2+) level and phosphorylation of ERK in HEK-293 cells expressing zGHS-R1a, but not zGHS-R1b, zGHS-R1c, or zGHS-R2a. It appears that besides core ghrelin peptide sequence of GS/TSF additional amino acids are required for the activation of zGHS-R1a, as rat ghrelin induces neither intracellular Ca(2+) mobilization nor ERK phosphrylation. These results suggest that ghrelin system in zebrafish is highly conserved to that of mammals, and thus is an ideal in vivo model for dissecting ghrelin system.

  14. Molecular cloning and differential expression analysis of a squalene synthase gene from Dioscorea zingiberensis, an important pharmaceutical plant.

    PubMed

    Ye, Yun; Wang, Runfa; Jin, Liang; Shen, Junhao; Li, Xiaotong; Yang, Ting; Zhou, Mengzhuo; Yang, Zhifan; Chen, Yongqin

    2014-09-01

    Diosgenin is a steroid derived from cholesterol in plants and used as a typical initial intermediate for synthesis of numerous steroidal drugs in the world. Commercially, this compound is extracted mainly from the rhizomes or tubers of some Dioscorea species. Squalene synthase (SQS: EC 2.5.1.21) catalyzes the condensation of two molecules of farnesyl diphosphate to form squalene, the first committed step for biosynthesis of plant sterols including cholesterol, and is thought to play an important role in diosgenin biosynthesis. A full-length cDNA of a putative squalene synthase gene was cloned from D. zingiberensis and designated as DzSQS (Genbank Accession Number KC960673). DzSQS was contained an open reading frame of 1,230 bp encoding a polypeptide of 409 amino acids with a predicted molecular weight of 46 kDa and an isoelectric point of 6.2. The deduced amino acid sequence of DzSQS shared over 70 % sequence identity with those of SQSs from other plants. The truncated DzSQS in which 24 amino acids were deleted from the carboxy terminus was expressed in Escherichia coli, and the resultant bacterial crude extract was incubated with farnesyl diphosphate and NADPH. GC-MS analysis showed that squalene was detected in the in vitro reaction mixture. Quantitative real-time PCR analysis revealed that DzSQS was expressed from highest to lowest order in mature leaves, newly-formed rhizomes, young leaves, young stems, and two-year-old rhizomes of D. zingiberensis.

  15. Molecular cloning and functional analysis of the clock genes, Clock and cycle, in the firebrat Thermobia domestica.

    PubMed

    Kamae, Yuichi; Tanaka, Fukuto; Tomioka, Kenji

    2010-09-01

    Comparative molecular analysis reveals a wide variation of clock mechanisms among insects. In this study, the clock gene homologues of Clock (Td'Clk) and cycle (Td'cyc) were cloned from an apterygote insect, Thermobia domestica. Structural analysis showed that Td'CLK includes bHLH, PAS-A, PAS-B domains but lacks a polyglutamine repeat in the C terminal region that is implicated for transcriptional activity in Drosophila CLK. Td'CYC contains a BCTR domain in its C terminal in addition to the common domains found in Drosophila CYC, i.e. bHLH, PAS-A, PAS-B domains. Unlike in Drosophila, Td'Clk mRNA levels showed no significant daily fluctuation, while Td'cyc exhibited rhythmic expression. A single injection of double-stranded RNA (dsRNA) of Td'Clk or Td'cyc into the abdomen of adult firebrats effectively knocked down respective mRNA levels and abolished the rhythmic expression of Td'cyc. Most Td'Clk or Td'cyc dsRNA-injected firebrats lost their circadian locomotor rhythm in constant darkness up to 30 days after injection, whereas those injected with DsRed2 dsRNA as a negative control clearly maintained it. From these results, it is likely that Td'Clk and Td'cyc are involved in the circadian clock machinery in the firebrat. However, the structure and expression profile of Td'Clk and Td'cyc more closely resembles those of mammals than Drosophila.

  16. In silico analysis, molecular cloning, expression and characterization of l-asparaginase gene from Lactobacillus reuteri DSM 20016.

    PubMed

    Susan Aishwarya, Suresh; Iyappan, Sellamuthu; Vijaya Lakshmi, Kamepali; Rajnish, Kandathil Narayanan

    2017-10-01

    l-Asparaginase is employed in leukaemic treatment and in processing starchy foods. The in silico analysis of Lactobacillus reuteri DSM 20016 reveals the presence of an l-asparaginase gene with theoretical pI value of 4.99. 3D structure prediction was carried out and one model was selected based on the validation scores of 86.293 for ERRAT, 92.10% for VERIFY 3D and Ramachandran plot. Multiple sequence alignment of the protein sequences of l-asparaginases I and II of Escherichia coli, Erwinia chrysanthemum and Homo sapiens shows their sequence similarity. The ORF LREU_RS09880 from L. reuteri DSM 20016 genome was cloned and expressed in E. coli. The recombinant protein was purified to homogeneity using Ni-NTA chromatography and showed higher substrate specificity for l-asparagine. Kinetic parameters like Km and Vmax of recombinant l-asparaginase were calculated as 0.3332 mM, 14.06 mM/min, respectively. Temperature and pH profile of recombinant l-asparaginase were analysed and maximum activity was found between 30 and 40 °C and at pH 6. The recombinant enzyme was thermally stable up to 24 h at 28 °C. Recombinant l-asparaginase has a recovery percentage of 92 and 10.5 fold purification. HPLC-MS-MS and SDS-PAGE analysis of the purified protein indicated a molecular weight of 35 kDa as a monomer.

  17. Molecular cloning and regulatory analysis of the cuticle-degrading-protease structural gene from the entomopathogenic fungus Metarhizium anisopliae.

    PubMed

    St Leger, R J; Frank, D C; Roberts, D W; Staples, R C

    1992-03-15

    The proteinaceous insect cuticle is an effective barrier against most microbes, but entomopathogenic fungi can breach it using extracellular proteases. We report here the isolation and characterization of a cDNA clone of the cuticle-degrading protease (Pr1) of Metarhizium anisopliae. The cDNA sequence revealed that Pr1 is synthesized as a large precursor (40.3 kDa) containing a signal peptide, a propeptide and the mature protein predicted to have a molecular mass of 28.6 kDa. The primary structure of Pr1 has extensive similarity with enzymes of the subtilisin subclass of serine endopeptidases and the serine, histidine and aspartate components of the active site in subtilisins are preserved. Proteinase K demonstrated the closest sequence similarity to Pr1 (61%) but Pr1 was twofold more effective than proteinase K at degrading isolated cuticles of Manduca sexta and 33-fold more effective at degrading structural proteins bound to the cuticle by covalent bonds. We postulate that the additional positively charged residues on the surface of the Pr1 molecule, as determined using proteinase K, may facilitate electrostatic binding to cuticle proteins which is a prerequisite for activity. Northern-blot analysis of RNA and nuclear run-on assays demonstrated transcriptional control of the expression of Pr1 during nutrient deprivation and during the formation of infection structures. Southern-blot analysis demonstrated that genes with significant homologies to Metarhizium Pr1 were present in the entomopathogens Aspergillus flavus and Verticillium lecanii but not Zoophthora (= Erynia) radicans.

  18. Molecular Cloning and Expression Analysis of Eight PgWRKY Genes in Panax ginseng Responsive to Salt and Hormones.

    PubMed

    Xiu, Hao; Nuruzzaman, Mohammed; Guo, Xiangqian; Cao, Hongzhe; Huang, Jingjia; Chen, Xianghui; Wu, Kunlu; Zhang, Ru; Huang, Yuzhao; Luo, Junli; Luo, Zhiyong

    2016-03-04

    Despite the importance of WRKY genes in plant physiological processes, little is known about their roles in Panax ginseng C.A. Meyer. Forty-eight unigenes on this species were previously reported as WRKY transcripts using the next-generation sequencing (NGS) technology. Subsequently, one gene that encodes PgWRKY1 protein belonging to subgroup II-d was cloned and functionally characterized. In this study, eight WRKY genes from the NGS-based transcriptome sequencing dataset designated as PgWRKY2-9 have been cloned and characterized. The genes encoding WRKY proteins were assigned to WRKY Group II (one subgroup II-c, four subgroup II-d, and three subgroup II-e) based on phylogenetic analysis. The cDNAs of the cloned PgWRKYs encode putative proteins ranging from 194 to 358 amino acid residues, each of which includes one WRKYGQK sequence motif and one C₂H₂-type zinc-finger motif. Quantitative real-time PCR (qRT-PCR) analysis demonstrated that the eight analyzed PgWRKY genes were expressed at different levels in various organs including leaves, roots, adventitious roots, stems, and seeds. Importantly, the transcription responses of these PgWRKYs to methyl jasmonate (MeJA) showed that PgWRKY2, PgWRKY3, PgWRKY4, PgWRKY5, PgWRKY6, and PgWRKY7 were downregulated by MeJA treatment, while PgWRKY8 and PgWRKY9 were upregulated to varying degrees. Moreover, the PgWRKY genes increased or decreased by salicylic acid (SA), abscisic acid (ABA), and NaCl treatments. The results suggest that the PgWRKYs may be multiple stress-inducible genes responding to both salt and hormones.

  19. Molecular Cloning and Expression Analysis of Eight PgWRKY Genes in Panax ginseng Responsive to Salt and Hormones

    PubMed Central

    Xiu, Hao; Nuruzzaman, Mohammed; Guo, Xiangqian; Cao, Hongzhe; Huang, Jingjia; Chen, Xianghui; Wu, Kunlu; Zhang, Ru; Huang, Yuzhao; Luo, Junli; Luo, Zhiyong

    2016-01-01

    Despite the importance of WRKY genes in plant physiological processes, little is known about their roles in Panax ginseng C.A. Meyer. Forty-eight unigenes on this species were previously reported as WRKY transcripts using the next-generation sequencing (NGS) technology. Subsequently, one gene that encodes PgWRKY1 protein belonging to subgroup II-d was cloned and functionally characterized. In this study, eight WRKY genes from the NGS-based transcriptome sequencing dataset designated as PgWRKY2-9 have been cloned and characterized. The genes encoding WRKY proteins were assigned to WRKY Group II (one subgroup II-c, four subgroup II-d, and three subgroup II-e) based on phylogenetic analysis. The cDNAs of the cloned PgWRKYs encode putative proteins ranging from 194 to 358 amino acid residues, each of which includes one WRKYGQK sequence motif and one C2H2-type zinc-finger motif. Quantitative real-time PCR (qRT-PCR) analysis demonstrated that the eight analyzed PgWRKY genes were expressed at different levels in various organs including leaves, roots, adventitious roots, stems, and seeds. Importantly, the transcription responses of these PgWRKYs to methyl jasmonate (MeJA) showed that PgWRKY2, PgWRKY3, PgWRKY4, PgWRKY5, PgWRKY6, and PgWRKY7 were downregulated by MeJA treatment, while PgWRKY8 and PgWRKY9 were upregulated to varying degrees. Moreover, the PgWRKY genes increased or decreased by salicylic acid (SA), abscisic acid (ABA), and NaCl treatments. The results suggest that the PgWRKYs may be multiple stress–inducible genes responding to both salt and hormones. PMID:26959011

  20. Molecular cloning and sequence analysis of Zygosaccharomyces rouxii ADE2 gene encoding a phosphoribosyl-aminoimidazole carboxylase.

    PubMed

    Sychrova, H; Braun, V; Souciet, J L

    1999-09-30

    The nucleotide sequence of a 2.8 kb fragment containing the ADE2 gene of the osmotolerant yeast Zygosaccharomyces rouxii has been determined. The gene was cloned from a Z. rouxii genomic DNA library by complementation of the Saccharomyces cerevisae ade2 mutant strain. The sequenced DNA fragment contains a 1710 bp open reading frame predicting a protein of 570 amino acids. The deduced amino acid sequence shares a high degree of homology with Ade2p homologues in five other yeast species. Copyright 1999 John Wiley & Sons, Ltd.

  1. Molecular cloning and expression analysis of small ubiquitin-like modifier (SUMO) genes from grouper (Epinephelus coioides).

    PubMed

    Xu, Meng; Wei, Jingguang; Chen, Xiuli; Gao, Pin; Zhou, Yongcan; Qin, Qiwei

    2016-01-01

    Small ubiquitin-like modifier (SUMO) is a group of proteins binding to lysine residues of target proteins and thereby modifying their stability, activity and subcellular localization. In the present study, two SUMO homolog genes (EcSUMO1 and EcSUMO2) from grouper (Epinephelus coioides) were cloned and characterized. The full-length sequence of EcSUMO1 was 749 bp in length and contained a predicted open reading frame of 306 bp encoding 101 amino acids with a molecular mass of 11.34 kDa. The full-length sequence of EcSUMO2 was 822 bp in length and contained a predicted open reading frame of 291 bp encoding 96 amino acids with a molecular mass of 10.88 kDa EcSUMO1 shares 44.55% identity with EcSUMO2. EcSUMO1 shares 99%, 90%, and 88% identity with those from Oreochromis niloticus, Danio rerio, and Homo sapiens, respectively. EcSUMO2 shares 98%, 93%, and 96% identity with those from Anoplopoma fimbria, D.rerio, and H. sapiens, respectively. Quantitative real-time PCR analysis indicated that EcSUMO1 and EcSUMO2 were constitutively expressed in all of the analyzed tissues in healthy grouper, but the expression of EcSUMO2 was higher than that of EcSUMO1. EcSUMO1 and EcSUMO2 were identified as a remarkably (P < 0.01) up-regulated responding to poly(I:C) and Singapore grouper iridovirus (SGIV) stimulation in head kidney of groupers. EcSUMO1 and EcSUMO2 were distributed in both cytoplasm and nucleus in GS cells. Over-expressed EcSUMO1 and EcSUMO2 enhanced SGIV and Red-spotted grouper nervous necrosis virus (RGNNV) replication during viral infection in vitro. Our study was an important attempt to understand the SUMO pathway in fish, which may provide insights into the regulatory mechanism of viral infection in E.coioides under farmed conditions.

  2. Expressed sequence tags and molecular cloning and characterization of gene encoding pinoresinol/lariciresinol reductase from Podophyllum hexandrum.

    PubMed

    Wankhede, Dhammaprakash Pandhari; Biswas, Dipul Kumar; Rajkumar, Subramani; Sinha, Alok Krishna

    2013-12-01

    Podophyllotoxin, an aryltetralin lignan, is the source of important anticancer drugs etoposide, teniposide, and etopophos. Roots/rhizome of Podophyllum hexandrum form one of the most important sources of podophyllotoxin. In order to understand genes involved in podophyllotoxin biosynthesis, two suppression subtractive hybridization libraries were synthesized, one each from root/rhizome and leaves using high and low podophyllotoxin-producing plants of P. hexandrum. Sequencing of clones identified a total of 1,141 Expressed Sequence Tags (ESTs) resulting in 354 unique ESTs. Several unique ESTs showed sequence similarity to the genes involved in metabolism, stress/defense responses, and signalling pathways. A few ESTs also showed high sequence similarity with genes which were shown to be involved in podophyllotoxin biosynthesis in other plant species such as pinoresinol/lariciresinol reductase. A full length coding sequence of pinoresinol/lariciresinol reductase (PLR) has been cloned from P. hexandrum which was found to encode protein with 311 amino acids and show sequence similarity with PLR from Forsythia intermedia and Linum spp. Spatial and stress-inducible expression pattern of PhPLR and other known genes of podophyllotoxin biosynthesis, secoisolariciresinol dehydrogenase (PhSDH), and dirigent protein oxidase (PhDPO) have been studied. All the three genes showed wounding and methyl jasmonate-inducible expression pattern. The present work would form a basis for further studies to understand genomics of podophyllotoxin biosynthesis in P. hexandrum.

  3. Molecular Cloning and Expression Analysis of the Rhodobacter capsulatus sodB Gene, Encoding an Iron Superoxide Dismutase

    PubMed Central

    Cortez, Néstor; Carrillo, Néstor; Pasternak, Cécile; Balzer, Angelika; Klug, Gabriele

    1998-01-01

    Genetic complementation of a sodA sodB Escherichia coli mutant strain was used to clone Rhodobacter capsulatus genes involved in detoxification of superoxide radicals. After sequence analysis, 1 of the 16 identical clones obtained by this selection procedure was shown to contain an open reading frame with sequence similarity to that coding for Fe-containing superoxide dismutases (SodB). The R. capsulatus sodB gene was expressed in E. coli, and the nature of the metal ligand was confirmed by inhibitor sensitivity assays with lysates from both bacterial species. Activity staining of cleared Rhodobacter lysates resolved by polyacrylamide gel electrophoresis indicated that SodB was the only superoxide dismutase present in this phototrophic organism. The sodB gene was expressed at low levels in R. capsulatus cells grown under anaerobic or semiaerobic conditions, but expression was strongly induced upon exposure of the bacteria to air or to methyl viologen. Attempts to construct a sodB mutant in this organism by allelic exchange of the chromosomal copy of the gene with a suicide plasmid containing a mutated sodB gene were unsuccessful, strongly suggesting that the encoded superoxide dismutase is essential for viability of R. capsulatus in aerobic cultures. PMID:9765573

  4. Three slow skeletal muscle troponin genes in small-tailed Han sheep (Ovis aries): molecular cloning, characterization and expression analysis.

    PubMed

    Sun, Yan; Wang, Guizhi; Ji, Zhibin; Chao, Tianle; Liu, Zhaohua; Wang, Xiaolong; Liu, Guanqing; Wu, Changhao; Wang, Jianmin

    2016-09-01

    To explore the basic characteristics and expressing profile of the three slow skeletal muscle troponin genes TNNC1 (Troponin C type 1), TNNI1 (troponin I type 1) and TNNT1 (troponin T type 1). Three purebred Dorper sheep and another three purebred small-tailed Han sheep were selected. The sequence of the genes from the small-tailed Han sheep was cloned using rapid amplification of cDNA ends and reverse transcription-polymerase chain reaction; The characteristics of the predicted amino acids sequences were analyzed using bioinformatics analysis software; Gene expression analyses were performed using quantitative reverse transcription PCR. The full-length cDNA sequences of the genes were 707, 898, and 1001 bp, respectively, and were submitted to GenBank under accession numbers KR153938, KT218688 and KT218690. The three predicted proteins were predicted to be hydrophilic, non-secretory proteins and contain several phosphorylation sites. Multiple alignments and phylogenetic tree analyses showed that the predicted proteins were relatively conserved in mammals. The expression results of the three genes in eight tissues of Dorper and small-tailed Han sheep revealed that the three genes had a similar mRNA expression pattern, whereas distinct differences were observed among the eight tissues of the two sheep species. We cloned the full-length cDNA of the three genes, analyzed the amino acid sequences, and determined the expression levels of the genes. These results might play important roles in facilitating the future research of the three genes.

  5. Molecular cloning and characterization of the obg gene of Streptomyces griseus in relation to the onset of morphological differentiation.

    PubMed Central

    Okamoto, S; Itoh, M; Ochi, K

    1997-01-01

    Morphological differentiation in microorganisms is usually accompanied by a decrease in intracellular GTP pool size, as has been demonstrated in bacillaceae, streptomycetaceae, and yeasts. The obg gene, which codes for a GTP-binding protein belonging to the GTPase superfamily of proteins, was cloned from Streptomyces griseus IFO13189. The gene is located just downstream of the genes for ribosomal proteins L21 and L27, encoded a protein of 478 amino acids (51 kDa), and possessed three consensus motifs which confer GTP-binding ability; Obg protein expressed in Escherichia coli bound GTP, as demonstrated using a UV cross-linking method. Introduction of multiple copies of obg into wild-type S. griseus suppressed aerial mycelium development in cells on solid media. However, no effect on streptomycin production was detected, indicating that Obg is involved in the regulation of the onset of morphological but not physiological differentiation. Multiple copies of obg also suppressed submerged spore formation in liquid culture. Southern hybridization studies indicated that genes homologous to obg exist widely in streptomycetes, and an obg homolog was successfully cloned from S. coelicolor A3(2). We propose that by monitoring the intracellular GTP pool size, the Obg protein is involved in sensing changes in the nutritional environment leading ultimately to morphological differentiation. PMID:8981995

  6. Molecular cloning and regulation of expression of the genes for initiation factor 3 and two aminoacyl-tRNA synthetases.

    PubMed Central

    Elseviers, D; Gallagher, P; Hoffman, A; Weinberg, B; Schwartz, I

    1982-01-01

    A 22-kilobase fragment of the Escherichia coli chromosome which contains the genes for translation initiation factor 3, phenylalanyl-tRNA synthetase, and threonyl-tRNA synthetase was cloned into plasmid pACYC184. The hybrid plasmid (designated pID1) complements a temperature-sensitive pheS lesion in E. coli NP37. pID1-transformed NP37 overproduce initiation factor 3 and phenylalanyl-tRNA synthetase. Gene expression from pID1 was studied in vitro in a coupled transcription-translation system and in minicells. The results suggest that the genes for initiation factor 3 and phenylalanyl- and threonyl-tRNA synthetase are regulated by different mechanisms. Images PMID:6749810

  7. Molecular cloning and regulation of expression of the genes for initiation factor 3 and two aminoacyl-tRNA synthetases.

    PubMed

    Elseviers, D; Gallagher, P; Hoffman, A; Weinberg, B; Schwartz, I

    1982-10-01

    A 22-kilobase fragment of the Escherichia coli chromosome which contains the genes for translation initiation factor 3, phenylalanyl-tRNA synthetase, and threonyl-tRNA synthetase was cloned into plasmid pACYC184. The hybrid plasmid (designated pID1) complements a temperature-sensitive pheS lesion in E. coli NP37. pID1-transformed NP37 overproduce initiation factor 3 and phenylalanyl-tRNA synthetase. Gene expression from pID1 was studied in vitro in a coupled transcription-translation system and in minicells. The results suggest that the genes for initiation factor 3 and phenylalanyl- and threonyl-tRNA synthetase are regulated by different mechanisms.

  8. Molecular cloning and expression of genes encoding a novel dioxygenase involved in low- and high-molecular-weight polycyclic aromatic hydrocarbon degradation in Mycobacterium vanbaalenii PYR-1.

    PubMed

    Kim, Seong-Jae; Kweon, Ohgew; Freeman, James P; Jones, Richard C; Adjei, Michael D; Jhoo, Jin-Woo; Edmondson, Ricky D; Cerniglia, Carl E

    2006-02-01

    Mycobacterium vanbaalenii PYR-1 is able to metabolize a wide range of low- and high-molecular-weight (HMW) polycyclic aromatic hydrocarbons (PAHs). A 20-kDa protein was upregulated in PAH-metabolizing M. vanbaalenii PYR-1 cells compared to control cultures. The differentially expressed protein was identified as a beta subunit of the terminal dioxygenase using mass spectrometry. PCR with degenerate primers designed based on de novo sequenced peptides and a series of plaque hybridizations were done to screen the M. vanbaalenii PYR-1 genomic library. The genes, designated nidA3B3, encoding the alpha and beta subunits of terminal dioxygenase, were subsequently cloned and sequenced. The deduced enzyme revealed close similarities to the corresponding PAH ring-hydroxylating dioxygenases from Mycobacterium and Rhodococcus spp. but had the highest similarity, 61.9%, to the alpha subunit from Nocardioides sp. strain KP7. The alpha subunit also showed 52% sequence homology with the previously reported NidA from M. vanbaalenii PYR-1. The genes nidA3B3 were subcloned into the expression vector pET-17b, and the enzyme activity in Escherichia coli cells was reconstituted through coexpression with the ferredoxin (PhdC) and ferredoxin reductase (PhdD) genes of the phenanthrene dioxygenase from Nocardioides sp. strain KP7. The recombinant PAH dioxygenase appeared to favor the HMW PAH substrates fluoranthene, pyrene, and phenanthrene. Several other PAHs, including naphthalene, anthracene, and benz[a]anthracene, were also converted to their corresponding cis-dihydrodiols. The recombinant E. coli, however, did not show any dioxygenation activity for phthalate and biphenyl. The upregulation of nidA3B3 in M. vanbaalenii PYR-1 induced by PAHs was confirmed by reverse transcription-PCR analysis.

  9. Molecular cloning and expression analysis of the cell-wall invertase gene family in rice (Oryza sativa L.).

    PubMed

    Cho, Jung-Il; Lee, Sang-Kyu; Ko, Seho; Kim, He-Kyung; Jun, Sung-Hoon; Lee, Youn-Hyung; Bhoo, Seong Hee; Lee, Kwang-Woong; An, Gynheung; Hahn, Tae-Ryong; Jeon, Jong-Seong

    2005-06-01

    Cell-wall invertase (CIN) catalyzes the hydrolysis of sucrose into glucose and fructose for the supply of carbohydrates to sink organs via an apoplastic pathway. To study the CIN genes in rice (Oryza sativa L.), we isolated cDNA clones showing amino acid similarity to the plant cell wall invertase proteins from a search of rice sequence databases. Profile analyses revealed that the cloned genes are expressed in unique patterns in various organs. For example, transcripts of OsCIN1, OsCIN2, OsCIN4, and OsCIN7 were detected in immature seeds whereas OsCIN3 gene expression was flower-specific. Further transcript analysis of these genes expressed in developing seeds indicated that OsCIN1, OsCIN2, and OsCIN7 might play an important role involving sucrose partitioning to the embryo and endosperm. Sucrose, a substrate of CINs, induced the accumulation of OsCIN1 transcripts in excised leaves and OsCIN2 in immature seeds, while the level of OsCIN5 was significantly down-regulated in excised leaves treated with sucrose. Infecting the tissues with rice blast (Magnaporthe grisea) as a biotic stressor increased the expression of OsCIN1, OsCIN4, and OsCIN5, suggesting that these genes may participate in a switch in metabolism to resist pathogen invasion. These results demonstrate that OsCIN genes play diverse roles involving the regulation of metabolism, growth, development, and stress responses.

  10. Molecular cloning and in situ localization of the human contactin gene (CNTN1) on chromosome 12q11-q12

    SciTech Connect

    Berglund, E.O.; Ranscht, B.

    1994-06-01

    Chick contactin/F11 (also known as F3 in mouse) is a neuronal cell adhesion molecule of the immunoglobulin (Ig) gene family that is implicated in playing a role in the formation of axon connections in the developing nervous system. In human brain, contactin was first identified by amino terminal and peptide sequencing of the lentil-lectin-binding glycoprotein Gp135. The authors now report the isolation and characterization of cDNA clones encoding human contactin. Human contactin is composed of six C2 Ig-domains and four fibronectin type III (FNIII) repeats and is anchored to the membrane via a glycosyl phosphatidylinositol moiety, as shown by PI-PLC treatment of cells transfected with contactin cDNA and metabolic labeling with [{sup 3}H]-ethanolamine. At the amino acid level, h-contactin is 78% identical to chick contactin/F11 and 94% to mouse F3. Independent cDNAs encoding two putative contactin 1 cDNA encodes a protein with the amino-terminal sequence of purified Gp135, while the putative h-contactin 2 gene has a deletion of 33 nucleotides that predicts a protein with a shortened amino terminus. Northern analysis with a probe common for both isoforms detects one mRNA species of approximately 6.6 kb in adult human brain. Fluorescence in situ hybridization maps the gene for human contactin to human chromosome 12q11-q12. The h-contactin gene locus is thus in close proximity to homeobox 3, integrin subunit {alpha}5, several proto-oncogene genes, a chromosomal breakpoint associated with various tumors, and the gene locus for Stickler syndrome. The cloning of human contactin now permits the study of its role in disorder of the human nervous system. 56 refs., 6 figs., 1 tab.

  11. Molecular cloning of functional genes for high growth-temperature and salt tolerance of the basidiomycete Fomitopsis pinicola isolated in a mangrove forest in Micronesia.

    PubMed

    Miyazaki, Yasumasa; Hiraide, Masakazu; Shibuya, Hajime

    2007-01-01

    Several functional genes encoding putative proteins, heat shock protein 70, sphingosine phosphate lyase, and Na+/H+ antiporter, were cloned from the basidiomycete Fomitopsis pinicola, a wood-rotting fungus isolated in the tropical mangrove forest of Pohnpei Island of the Federated States of Micronesia. The deduced amino acid sequences of the obtained genes involved in heat shock resistance, lipid synthesis, and salt tolerance showed diverse similarities to other homologous proteins. Molecular phylogenetic trees of these proteins suggested that encoded proteins of the cloned genes of F. pinicola differed remarkably from other homologs in various organisms, even fungal proteins. Putative candidates for other genes related to several cellular metabolisms were also amplified, implying the possible existence of those genes in F. pinicola. This is the first report of possibly functional genes derived from a basidiomycetous mushroom growing in tropical islands such as Micronesia. The genes found in this study might play important roles in the cellular survival of the basidiomycete F. pinicola under severe environmental conditions.

  12. Molecular cloning of the Pseudomonas carboxypeptidase G2 gene and its expression in Escherichia coli and Pseudomonas putida.

    PubMed Central

    Minton, N P; Atkinson, T; Sherwood, R F

    1983-01-01

    The gene coding for carboxypeptidase G2 was cloned from Pseudomonas sp. strain RS-16 into Escherichia coli W5445 by inserting Sau3A-generated DNA fragments into the BamHI site of pBR322. The plasmid isolated, pNM1, was restriction mapped, and the position of the gene on the 5.8-megadalton insert was pinpointed by subcloning. The expression of carboxypeptidase in E. coli was 100-fold lower than in the Pseudomonas sp. strain. When the cloned gene was subcloned into the Pseudomonas vector pKT230 and introduced into Pseudomonas putida 2440, a 30-fold increase in expression over that obtained in E. coli was observed. High expression (up to 5% soluble protein) was obtained in E. coli by subcloning a 3.1-megadalton Bg/II fragment into the BamHI site of pAT153. The increased expression was orientation dependent and is presumed to be due to transcriptional readthrough from the Tc promoter of the vector. Production of carboxypeptidase was shown to be induced (two-fold) by the presence of folic acid, and the mature protein was shown to be located in the periplasmic space of E. coli. Images PMID:6358192

  13. Molecular progress on the mapping and cloning of functional genes for blast disease in rice (Oryza sativa L.): current status and future considerations.

    PubMed

    Ashkani, S; Rafii, M Y; Shabanimofrad, M; Ghasemzadeh, A; Ravanfar, S A; Latif, M A

    2016-01-01

    Rice blast disease, which is caused by the fungal pathogen Magnaporthe oryzae, is a recurring problem in all rice-growing regions of the world. The use of resistance (R) genes in rice improvement breeding programmes has been considered to be one of the best options for crop protection and blast management. Alternatively, quantitative resistance conferred by quantitative trait loci (QTLs) is also a valuable resource for the improvement of rice disease resistance. In the past, intensive efforts have been made to identify major R-genes as well as QTLs for blast disease using molecular techniques. A review of bibliographic references shows over 100 blast resistance genes and a larger number of QTLs (∼500) that were mapped to the rice genome. Of the blast resistance genes, identified in different genotypes of rice, ∼22 have been cloned and characterized at the molecular level. In this review, we have summarized the reported rice blast resistance genes and QTLs for utilization in future molecular breeding programmes to introgress high-degree resistance or to pyramid R-genes in commercial cultivars that are susceptible to M. oryzae. The goal of this review is to provide an overview of the significant studies in order to update our understanding of the molecular progress on rice and M. oryzae. This information will assist rice breeders to improve the resistance to rice blast using marker-assisted selection which continues to be a priority for rice-breeding programmes.

  14. Molecular cloning, nucleotide sequence, and expression of a carboxypeptidase-encoding gene from the archaebacterium Sulfolobus solfataricus.

    PubMed Central

    Colombo, S; Toietta, G; Zecca, L; Vanoni, M; Tortora, P

    1995-01-01

    Mammalian metallocarboxypeptidases play key roles in major biological processes, such as digestive-protein degradation and specific proteolytic processing. A Sulfolobus solfataricus gene (cpsA) encoding a recently described zinc carboxypeptidase with an unusually broad substrate specificity was cloned, sequenced, and expressed in Escherichia coli. Despite the lack of overall sequence homology with known carboxypeptidases, seven homology blocks, including the Zn-coordinating and catalytic residues, were identified by multiple alignment with carboxypeptidases A, B, and T. S. solfataricus carboxypeptidase expressed in E. coli was found to be enzymatically active, and both its substrate specificity and thermostability were comparable to those of the purified S. solfataricus enzyme. PMID:7559343

  15. Molecular cloning, nucleotide sequence, and expression of a carboxypeptidase-encoding gene from the archaebacterium Sulfolobus solfataricus.

    PubMed

    Colombo, S; Toietta, G; Zecca, L; Vanoni, M; Tortora, P

    1995-10-01

    Mammalian metallocarboxypeptidases play key roles in major biological processes, such as digestive-protein degradation and specific proteolytic processing. A Sulfolobus solfataricus gene (cpsA) encoding a recently described zinc carboxypeptidase with an unusually broad substrate specificity was cloned, sequenced, and expressed in Escherichia coli. Despite the lack of overall sequence homology with known carboxypeptidases, seven homology blocks, including the Zn-coordinating and catalytic residues, were identified by multiple alignment with carboxypeptidases A, B, and T. S. solfataricus carboxypeptidase expressed in E. coli was found to be enzymatically active, and both its substrate specificity and thermostability were comparable to those of the purified S. solfataricus enzyme.

  16. Molecular cloning, nucleotide sequence, and expression in Escherichia coli of a hemolytic toxin (aerolysin) gene from Aeromonas trota

    SciTech Connect

    Khan, A.A.; Kim, E.; Cerniglia, C.E.

    1998-07-01

    Aeromonas trota AK2, which was derived from ATCC 49659 and produces the extracellular pore-forming hemolytic toxin aerolysin, was mutagenized with the transposon mini-Tn5Km1 to generate a hemolysin-deficient mutant, designated strain AK253. Southern blotting data indicated that an 8.7-kb NotI fragment of the genomic DNA of strain AK253 contained the kanamycin resistance gene of mini-Tn5Km1. The 8.7-kb NotI DNA fragment was cloned into the vector pGEM5Zf({minus}) by selecting for kanamycin resistance, and the resultant clone, pAK71, showed aerolysin activity in Escherichia coli JM109. The nucleotide sequence of the aerA gene, located on the 1.8-kb ApaI-EcoRI fragment, was determined to consist of 1,479 bp and to have an ATG initiation codon and a TAA termination codon. An in vitro coupled transcription-translation analysis of the 1.8-kb region suggested that the aerA gene codes for a 54-kDa protein, in agreement with nucleotide sequence data. The deduced amino acid sequence of the aerA gene product of A. trota exhibited 99% homology with the amino acid sequence of the aerA product of Aeromonas sobria AB3 and 57% homology with the amino acid sequences of the products of the aerA genes of Aeromonas salmonicida 17-2 and A. sobria 33.

  17. Molecular cloning and characterization of the human mitochondrial NADH:ubiquinone oxidoreductase 24-kDa gene

    SciTech Connect

    Coo, J. de; Buddiger, P.; Kessel, A.G. van

    1994-09-01

    The mitochondrial NADH:ubiquinone oxidoreductase (complex I) of the respiratory chain is composed of at least 41 individual proteins. Seven are encoded for by the mitochondrial genome and 34 are of nuclear origin. Mutations in the mitochondrial encoded subunits have been observed in a number of different mitochondrial encephalomyopathies. In order to investigate the contribution of mutations in the nuclearly encoded subunits, we started to characterize the human gene for the 24 kDa flavoprotein fragment, one of the three key subunits of complex I. Two gene loci were detected with a human cDNA as a probe using somatic cell hybrids, one on chromosome 18 and one on chromosome 19. Cosmid clones were isolated containing the two genes. Using FISH analysis the map position was further refined to 18p11.2-18p11.31 and 19qter, respectively. RNA studies showed that only the chromosome 18 gene was expressed. This gene spans approximately 20 kb and consists of 8 exons. Exon and flanking intron sequences were characterized. The pseudogene differs from the intact cDNA by the lack of the methionine initiator codon. Currently, we are testing patients with complex I deficiencies for mutations in their 24 kDa gene.

  18. Molecular Cloning, Expression, and Identification of Bre Genes Involved in Glycosphingolipids Synthesis in Helicoverpa armigera (Lepidoptera: Noctuidae).

    PubMed

    Zhang, Dandan; Xiao, Yutao; Hussain Dhiloo, Khalid; Soberon, Mario; Bravo, Alejandra; Wu, Kongming

    2016-05-17

    Glycosphingolipids (GSLs) play important roles in the cellular biology of vertebrate and invertebrate organisms, such as cell differentiation, tumor metastasis, and cell coordination. GSLs also serve as receptors for different bacterial toxins. For example, in the nematode Caenorhabditis elegans, GSLs function as receptors of the insecticidal Cry toxins produced by Bacillus thuringiensis (Bt), and mutations in bre genes involved in GSLs synthesis resulted in resistance to Cry5 toxin in this organism. However, the information of GSLs function in insects is still limited. In this study, three genes for glycosyltransferases, bre2, bre3, and bre4, from Helicoverpa armigera were identified and cloned. The previously reported bre5 gene from H. armigera was also analyzed. Protein sequence alignments revealed that proteins codified by H. armigera Bre shared high identity with homologous proteins from other organisms. Expression profile analysis revealed that the expressions of bre genes varied in the different tissues and also in the different developmental stages of H. armigera. Finally, the heterologous expression of bre genes in Trichoplusia ni Hi5 cell line showed that the corresponding translated proteins were localized in the cytoplasm of Hi5 cells. These results provide the bases for further functional studies of bre genes and analyzing potential roles of GSLs in mode of action of Cry1A toxin in H. armigera.

  19. Molecular cloning and characterization of CFT1, a developmentally regulated avian alpha(1,3)-fucosyltransferase gene.

    PubMed

    Lee, K P; Carlson, L M; Woodcock, J B; Ramachandra, N; Schultz, T L; Davis, T A; Lowe, J B; Thompson, C B; Larsen, R D

    1996-12-20

    Although coordinate expression of carbohydrate epitopes during development is well described, mechanisms which regulate this expression remain largely unknown. In this study we demonstrate that developing chicken B cells express the LewisX terminal oligosaccharide structure in a stage-specific manner. To examine regulation of this expression, we have cloned and expressed the chicken alpha(1,3)-fucosyltransferase gene involved in LewisX biosynthesis, naming it chicken fucosyltransferase 1 (CFT1). CFT1 is characterized by a single long open reading frame of 356 amino acids encoding a type II transmembrane glycoprotein. The domain structure and predicted amino acid sequence are highly conserved between CFT1 and mammalian FucTIV genes (52.8% and 46.3% identity to mouse and human respectively). In vitro CFT1 fucosyltransferase activity utilizes LacNAc > 3'sialyl-LacNAc acceptors with almost no utilization of other neutral type II (lactose, 2-fucosyllactose), or type I (lacto-N-biose I) acceptors. CFT1-transfected cells make cell surface LewisX (COS-7) and LewisX + VIM-2 structures (Chinese hamster ovary). CFT1 gene expression is tissue-specific and includes embryonic thymus and bursa. Furthermore, expression of the CFT1 gene and cell surface LewisX structures are closely linked during B cell development. These findings reveal the evolutionary conservation between nonmammalian and mammalian alpha(1,3)-fucosyltransferase genes and demonstrate a role for fucosyltransferase gene regulation in the developmental expression of oligosaccharide structures.

  20. Molecular cloning of the Clostridium botulinum structural gene encoding the type B neurotoxin and determination of its entire nucleotide sequence.

    PubMed Central

    Whelan, S M; Elmore, M J; Bodsworth, N J; Brehm, J K; Atkinson, T; Minton, N P

    1992-01-01

    DNA fragments derived from the Clostridium botulinum type A neurotoxin (BoNT/A) gene (botA) were used in DNA-DNA hybridization reactions to derive a restriction map of the region of the C. botulinum type B strain Danish chromosome encoding botB. As the one probe encoded part of the BoNT/A heavy (H) chain and the other encoded part of the light (L) chain, the position and orientation of botB relative to this map were established. The temperature at which hybridization occurred indicated that a higher degree of DNA homology occurred between the two genes in the H-chain-encoding region. By using the derived restriction map data, a 2.1-kb BglII-XbaI fragment encoding the entire BoNT/B L chain and 108 amino acids of the H chain was cloned and characterized by nucleotide sequencing. A contiguous 1.8-kb XbaI fragment encoding a further 623 amino acids of the H chain was also cloned. The 3' end of the gene was obtained by cloning a 1.6-kb fragment amplified from genomic DNA by inverse polymerase chain reaction. Translation of the nucleotide sequence derived from all three clones demonstrated that BoNT/B was composed of 1,291 amino acids. Comparative alignment of its sequence with all currently characterized BoNTs (A, C, D, and E) and tetanus toxin (TeTx) showed that a wide variation in percent homology occurred dependent on which component of the dichain was compared. Thus, the L chain of BoNT/B exhibits the greatest degree of homology (50% identity) with the TeTx L chain, whereas its H chain is most homologous (48% identity) with the BoNT/A H chain. Overall, the six neurotoxins were shown to be composed of highly conserved amino acid domains interceded with amino acid tracts exhibiting little overall similarity. In total, 68 amino acids of an average of 442 are absolutely conserved between L chains and 110 of 845 amino acids are conserved between H chains. Conservation of Trp residues (one in the L chain and nine in the H chain) was particularly striking. The most

  1. Molecular cloning and expression of squalene synthase and 2,3-oxidosqualene cyclase genes in persimmon (Diospyros kaki L.) fruits.

    PubMed

    Zhou, Chunhua; Zhao, Daqiu; Sheng, Yanle; Liang, Guohua; Tao, Jun

    2012-02-01

    Oleanolic acid (OA) and ursolic acid (UA) are the main triterpene acids in persimmon fruit, and squalene synthase and 2,3-oxidosqualene cyclases are important enzymes in pentacyclic triterpene biosynthesis. In order to study their relationship, DkSQS and DkOSC were cloned from persimmon fruits in the present study. The full-length cDNA of DkSQS was 1647 bp, containing an open reading frame (ORF) of 1245 bp that encoded a peptide of 415 amino acids (AA). The 3'-end of DkOSC cDNA fragment contained 522 bp, including a partial ORF of 298 bp, a full poly A tail that encoded 98 AA. Two cultivars of persimmon, i.e. cv. Nishimurawase and cv. Niuxinshi, were used to study the content of OA and UA and the related gene expression. Results showed that OA and UA contents changed in both cultivars during fruit development, the difference in cv. Nishimurawase was greater than that in cv. Niuxinshi. The expression of DkSQS and DkOSC had no obvious correlation with the biosynthesis of OA and UA in the flesh. There may be two main reasons. Firstly, different enzymes involved in the biosynthesis of triterpenes and mutual adjustment were existed in different gene expressions. Secondly, it was not clear that the DkOSC cloned in this research belonged to which subfamily. Therefore, the real relationship between triterpenes and DkSQS and DkOSC in persimmon fruits is still to be revealed.

  2. Molecular cloning, sequencing and expression in Escherichia coli of the bean yellow mosaic virus coat protein gene.

    PubMed

    Hammond, J; Hammond, R W

    1989-08-01

    The sequence of 1015 nucleotides from the 3' poly(A) tract of the potyvirus bean yellow mosaic virus (BYMV) RNA has been determined from two cDNA clones. This sequence contained a single long open reading frame (ORF) starting upstream of the cloned region. The ORF was expressed as a fusion protein in Escherichia coli, and the product was detected by antibodies specific for the coat protein of BYMV. The predicted length of the coat protein gene was 822 nucleotides, corresponding to a 273 amino acid coat protein of Mr 30910. The deduced amino acid sequence of the BYMV coat protein was compared to the chemically determined amino acid composition of purified virion protein, and of protein prepared from trypsin-treated virions. The nucleotide and deduced amino acid sequences were compared to the sequences of the coat protein genes of other potyviruses. The BYMV coat protein gene was found to be 50 to 61% homologous to those of other potyviruses at both the nucleotide and amino acid levels; the greatest variation was between the 5'-proximal one-fifth of the genes. Amino acid sequences and hydrophilicity plots of the different potyvirus coat proteins showed similarities which indicated that the structure of the coat protein is highly conserved; a non-terminal region of variability was predicted to be exposed on the exterior of the virion. A putative cleavage site at a glutamine-serine dipeptide was identified by similarity in context to the cleavage sites of tobacco etch virus and tobacco vein mottling virus coat proteins from the viral polyproteins. The BYMV 3'-terminal non-coding region of 166 nucleotides is followed by a poly(A) tract.

  3. Molecular cloning, characterization and differential expression of novel phytocystatin gene during tropospheric ozone stress in maize (Zea mays) leaves.

    PubMed

    Ahmad, Rafiq; Zuily-Fodil, Yasmine; Passaquet, Chantal; Ali Khan, Sabaz; Repellin, Anne

    2015-03-01

    In this study, a full-length cDNA encoding a novel phytocystatin gene, designated CC14, was identified in maize leaves. The CC14 gene sequence reported in this study has been deposited in the GenBank database (accession number JF290478). The CC14 gene was cloned into an expression vector pET30 EK/LIC and was then transformed into Escherichia coli strain BL21 (DE3) pLysS to produce a recombinant CC14 protein. The recombinant protein was purified by nickel nitrilotriacetic acid affinity chromatography after induction with 1 mM IPTG. The purified CC14 protein was electrophoresed on SDS-PAGE and a protein 25 kDa in size was observed. Antiprotease activities of the purified recombinant CC14 protein against cysteine proteases and commercially available papain were tested. The results showed that CC14 purified protein suppressed 100% activity of papain and 57-86% plant cysteine protease activity. Moreover, an upregulation of CC14 gene expression was observed after 20 days of ozone stress in maize leaves. Together, these observations concurred to conclude that CC14 gene could potentially be used as a basis for the development of transgenic crops and natural pesticides that resist biotic and abiotic stresses.

  4. Molecular cloning and characterization of a cellulase gene from a symbiotic protist of the lower termite, Coptotermes formosanus.

    PubMed

    Inoue, Tetsushi; Moriya, Shigeharu; Ohkuma, Moriya; Kudo, Toshiaki

    2005-04-11

    The endo-beta-1,4-glucanase gene was cloned from a cDNA library constructed from the mixed population of symbiotic protists in the hindgut of the lower termite, Coptotermes formosanus, using the lambda ZAP II vector. The recombinant phage library was screened for cellulolytic activity by the Congo red staining procedure. The nucleotide sequence comprised 941 nucleotides including a polyA tail sequence and showed high sequence similarity with endoglucanase genes belonging to glycosyl hydrolase family 5. Determination of the 5' end of the cellulase gene using the 5'RACE method showed that the full-length cDNA comprised a 921-bp ORF, encoding a putative 33,620 Da protein. The organismal source of this cellulase gene was identified using PCR with gene-specific primers and whole-cell in situ hybridization as the smallest symbiotic hypermastigote protist, Spirotrichonympha leidyi. The optimal pH and temperature of the cellulase heterologously expressed in Escherichia coli were 5.8-6.0 and 70 degrees C, respectively. The Km and Vmax values on carboxymethyl cellulose (CMC) substrate were 1.90 mg/ml and 148.2 units/mg protein, respectively.

  5. Molecular cloning and characterization of a mammalian excision repair gene that partially restores UV resistance to xeroderma pigmentosum complementation group D cells

    SciTech Connect

    Arrand, J.E.; Bone, N.M.; Johnson, R.T. )

    1989-09-01

    A hamster DNA repair gene has been isolated by cosmid rescue after two rounds of transfection of an immortalized xeroderma pigmentosum (XP) complementation group D cell line with neomycin-resistance gene (neo)-tagged normal hamster DNA and selection with G418 and ultraviolet irradiation. The functional length of the sequence has been defined as 11.5 kilobase pairs by measurement of the region of overlap between two hamster DNA-containing cosmids, cloned by selection for the integrated neo gene, that are able to confer an increase in resistance to ultraviolet irradiation on two XP-D cell line but not on an XP-A line. Detailed molecular characterization of the hamster repair gene has revealed no obvious similarities to two human excision repair genes (ERCC1 and ERCC2) that correct repair-defective hamster cells but have no effect on XP cells. Hybridization analyses of normal human and XP cell genomic DNAs and mRNAs, using a cosmid-clone probe from which repeated sequences have been removed, show that homologues are present and expressed in all cases.

  6. Molecular cloning and expression analysis of KIN10 and cold-acclimation related genes in wild banana 'Huanxi' (Musa itinerans).

    PubMed

    Liu, Weihua; Cheng, Chunzhen; Lai, Gongti; Lin, Yuling; Lai, Zhongxiong

    2015-01-01

    Banana cultivars may experience chilling or freezing injury in some of their cultivated regions, where wild banana can still grow very well. The clarification of the cold-resistant mechanism of wild banana is vital for cold-resistant banana breeding. In this study, the central stress integrator gene KIN10 and some cold-acclimation related genes (HOS1 and ICE1s) from the cold-resistant wild banana 'Huanxi' (Musa itinerans) were cloned and their expression patterns under different temperature treatments were analyzed. Thirteen full-length cDNA transcripts including 6 KIN10s, 1 HOS1 and 6 ICE1s were successfully cloned. Quantitative real-time PCR (qRT-PCR) results showed that all these genes had the highest expression levels at the critical temperature of banana (13 °C). Under chilling temperature (4 °C), the expression level of KIN10 reduced significantly but the expression of HOS1 was still higher than that at the optimal temperature (28 °C, control). Both KIN10 and HOS1 showed the lowest expression levels at 0 °C, the expression level of ICE1, however, was higher than control. As sucrose plays role in plant cold-acclimation and in regulation of KIN10 and HOS1 bioactivities, the sucrose contents of wild banana under different temperatures were detected. Results showed that the sucrose content increased as temperature lowered. Our result suggested that KIN10 may participate in cold stress response via regulating sucrose biosynthesis, which is helpful in regulating cold acclimation pathway in wild banana.

  7. Molecular cloning and characterization of cDNAs of the superoxide dismutase gene family in the resurrection plant Haberlea rhodopensis.

    PubMed

    Apostolova, Elena; Rashkova, Maya; Anachkov, Nikolay; Denev, Iliya; Toneva, Valentina; Minkov, Ivan; Yahubyan, Galina

    2012-06-01

    Resurrection plants can tolerate almost complete water loss in their vegetative parts. The superoxide dismutases (SODs) are essential enzymes of defense against the oxidative damage caused by water stress. Here, we cloned and characterized cDNAs of the SOD gene family in the resurrection plant Haberlea rhodopensis. Seven full-length cDNAs, and their partial genomic clones, were obtained by combination of degenerate PCR, RT-PCR and RACE. The derived amino acid sequences exhibited a very high degree of similarity to cytosolic Cu,Zn-SODs (HrCSD2, HrCSD3), chloroplastic Cu,Zn-SODs (HrCSD5), other Cu,Zn-SODs (HrCSD4), Mn-SODs (HrMSD) and Fe-SODs (HrFSD). One cDNA turned out to be a pseudogene (HrCSD1). All identified SOD genes were found expressed at transcriptional level--the HrCSD2, HrCSD5, HrMSD and HrFSD were constitutively expressed in all organs, while the HrCSD3 and HrCSD4 were organ-specific. The transcripts of the housekeeping SOD genes were detected at significant levels even in air-dry leaves. The multigene SOD family of H. rhodopensis is the first studied SOD family amongst resurrection plant species. Our finding of well expressed SOD transcripts in fully dehydrated leaves correlates with retention of SOD activity, and with the ability of H. rhodopensis to revive upon rehydration. Because of the endemic relict nature of that species, our findings may help to further elucidate the evolutionary relationships among different SOD isoforms from distinct plant species. Copyright © 2012 Elsevier Masson SAS. All rights reserved.

  8. Molecular cloning of the human leukotriene C4 synthase gene and assignment to chromosome 5q35.

    PubMed Central

    Bigby, T. D.; Hodulik, C. R.; Arden, K. C.; Fu, L.

    1996-01-01

    BACKGROUND: Cysteinyl leukotrienes (LT) are mediators involved in inflammatory and allergic disorders LTC4 synthase catalyzes the first committed step in the synthesis of these inflammatory mediators, and its cellular distribution appears to be unique. MATERIALS AND METHODS: A human genomic library was screened by polymerase chain reaction (PCR) with primers that were designed based on the reported cDNA sequence for the LTC4 synthase gene. The gene was identified in one clone by Southern blotting of restriction enzyme digests, subcloning of fragments containing regions of interest, and DNA sequencing of these subclones. The transcription initiation site was determined by primer extension analysis. Chromosome location was determined by fluorescent in situ hybridization and screening of somatic cell hybrids by PCR. RESULTS: The LTC4 synthase gene is approximately 2.5 kb in length, consisting of five exons (136, 100, 71, 82, and 257 bp, respectively) and four introns (1,447, 102, 84, and 230 bp, respectively). Transcription initiation occurs at a single site 78 bp upstream of the coding region. The 5'-flanking region contains neither a TATA nor a CAAT box. The first 1 kb of the 5'-flanking region, however, contains putative DNA binding motifs for SP-1, AP-1, AP-2, ets factors, and CREB/ATF. A STAT binding motif is present in the first intron. The LTC4 synthase gene is located in the distal region of the long arm of chromosome 5 in 5q35. CONCLUSIONS: The LTC4 synthase gene does not contain elements of a typical regulated gene and may therefore contain novel regulatory elements. This gene is also located in a region on chromosome 5 that appears to play a role in allergic and inflammatory disorders, such as asthma. Images FIG. 1 FIG. 5 FIG. 4 FIG. 6 PMID:8898379

  9. Molecular cloning and expression of key gene encoding hypothetical DNA polymerase from B. mori parvo-like virus

    PubMed Central

    2010-01-01

    BmPLV-Z is the abbreviation for Bombyx mori parvo-like virus (China isolate). This is a novel virus with two single-stranded linear DNA molecules, viz., VD1 (6543 bp) and VD2 (6022 bp), which are encapsidated respectively into separate virions. Analysis of the deduced amino acid sequence of VD1-ORF4 indicated the existence of a putative DNA-polymerase with exonuclease activity, possibly involved in the replication of BmPLV-Z. In the present study, a recombinant baculovirus was constructed to express the full length of the protein encoded by the VD1-ORF4 gene (3318 bp). In addition, a 2163-bp fragment amplified from the very same gene was cloned into prokaryotic expression vector pET-30a and expressed in E.coli Rosetta 2 (DE3) pLysS. The expressed fusion protein was employed to immunize New Zealand white rabbits for the production of an antiserum, afterwards used for examining the expression of the protein encoded by VD1-ORF4 gene in Sf-9 cells infected with recombinant baculovirus. Western blot analysis of extracts from thus cells infected revealed a specific band of about 120 kDa, thereby indicating that the full length protein encoded by the VD1-ORF4 gene had been successfully and stably expressed in Sf-9 cells. PMID:21637584

  10. Molecular cloning and expression of key gene encoding hypothetical DNA polymerase from B. mori parvo-like virus.

    PubMed

    Zhang, Junhong; Li, Guohui; Chen, Huiqing; Li, Xiaogang; Lv, Meng; Chen, Keping; Yao, Qin

    2010-10-01

    BmPLV-Z is the abbreviation for Bombyx mori parvo-like virus (China isolate). This is a novel virus with two single-stranded linear DNA molecules, viz., VD1 (6543 bp) and VD2 (6022 bp), which are encapsidated respectively into separate virions. Analysis of the deduced amino acid sequence of VD1-ORF4 indicated the existence of a putative DNA-polymerase with exonuclease activity, possibly involved in the replication of BmPLV-Z. In the present study, a recombinant baculovirus was constructed to express the full length of the protein encoded by the VD1-ORF4 gene (3318 bp). In addition, a 2163-bp fragment amplified from the very same gene was cloned into prokaryotic expression vector pET-30a and expressed in E.coli Rosetta 2 (DE3) pLysS. The expressed fusion protein was employed to immunize New Zealand white rabbits for the production of an antiserum, afterwards used for examining the expression of the protein encoded by VD1-ORF4 gene in Sf-9 cells infected with recombinant baculovirus. Western blot analysis of extracts from thus cells infected revealed a specific band of about 120 kDa, thereby indicating that the full length protein encoded by the VD1-ORF4 gene had been successfully and stably expressed in Sf-9 cells.

  11. Molecular cloning and functional analysis of the FSH receptor gene promoter from the volcano mouse (Neotomodon alstoni alstoni).

    PubMed

    Pérez-Solis, Marco Allán; Macías, Héctor; Acosta-MontesdeOca, Adriana; Pasapera, Ana María; Fierro, Reyna; Ulloa-Aguirre, Alfredo; Gutiérrez-Sagal, Rubén

    2010-02-01

    To gain further insights on the genetic divergence and the species-specific characteristics of the follicle-stimulating hormone receptor (FSHR), we cloned 946 bp of the 5'-flanking region of the FSHR gene from the volcano mouse (Neotomodon alstoni alstoni), and compared its features with those from other mammalian species. The sequence of neotomodon FSHR (nFSHR) gene from the translation initiation site to -946 is 74, 71, 64, and 59% homologous to rat, mouse (129/J), human, and sheep, respectively. The nFSHR 5'-flanking region exhibits new interesting putative cis-regulatory elements including those for the SRY transcription factor, which had not been previously related to the FSHR gene. The transcriptional regulation properties of nFSHR gene were studied in mouse Sertoli (MSC-1) and non-Sertoli (H441) cell lines, and compared with those obtained with similar 129/J constructs. All constructs tested were more active in H441 than in MSC-1 cells. The low transcription levels detected in MSC-1 cells probably reflect the recruitment of Sertoli cells-specific nuclear factors that repress transcription of the FSHR gene. In H441 cells, 129/J constructs were more active than their neotomodon counterparts, indicating important species-specific differences in their transcription pattern. Functional analysis of a series of progressive 5'-deletion mutants identified regions involved in positive and negative transcriptional regulation as well as the strongest minimal promoter spanning 260 bp upstream the translation initiation site. The identification of inhibitory nuclear transcription factors, which are apparently expressed in MSC-1 cells, may contribute to a better understanding of the transcriptional regulation of the FSHR gene.

  12. Starch-branching enzyme I gene (IbSBEI) from sweet potato (Ipomoea batatas); molecular cloning and expression analysis.

    PubMed

    Hamada, Tatsuro; Kim, Sun-Hyung; Shimada, Takiko

    2006-08-01

    The cDNA of the starch-branching enzyme I gene (IbSBEI) in the sweet potato (Ipomoea batatas) has been cloned and sequenced. The IbSBEI amino acid sequence was 81% identical to that of potato StSBEI. DNA gel-blot analyses demonstrated that at least two copies of IbSBEI are present in the sweet potato genome. IbSBEI was strongly expressed in tuberous roots. Transcript levels in the roots of single leaf cuttings were extremely low during the first 15-40 d after planting and continuously increased up to 50 d, by which time the tuberous roots had almost completely developed. This indicates that IbSBEI may work in concert with the AGPase large subunit during the primary phase of starch granule formation.

  13. Molecular Cloning and Gene Expression Analysis of the Leptin Receptor in the Chinese Mitten Crab Eriocheir sinensis

    PubMed Central

    Jiang, Hui; Ren, Fei; Sun, Jiangling; He, Lin; Li, Weiwei; Xie, Yannan; Wang, Qun

    2010-01-01

    Background Leptin is an adipocyte-derived hormone with multiple functions that regulates energy homeostasis and reproductive functions. Increased knowledge of leptin receptor function will enhance our understanding of the physiological roles of leptin in animals. Methodology/Principal Findings In the present study, a full-length leptin receptor (lepr) cDNA, consisting of 1,353 nucleotides, was cloned from Chinese mitten crab (Eriocheir sinensis) using rapid amplification of cDNA ends (RACE) following the identification of a single expressed sequence tag (EST) clone in a cDNA library. The lepr cDNA consisted of a 22-nucleotide 5′-untranslated region (5′ UTR), a 402-nucleotide open reading frame (ORF) and a 929-nucleotide 3′ UTR. Multiple sequence alignments revealed that Chinese mitten crab lepr shared a conserved vacuolar protein sorting 55 (Vps55) domain with other species. Chinese mitten crab lepr expression was determined in various tissues and at three different reproductive stages using quantitative real-time RT-PCR. Lepr expression was highest in the intestine, thoracic ganglia, gonad, and accessory gonad, moderate in hepatopancreas and cranial ganglia, and low in muscle, gill, heart, haemocytes, and stomach. Furthermore, lepr expression was significantly higher in the intestine, gonad and thoracic ganglia in immature crabs relative to precocious and mature crabs. In contrast, lepr expression was significantly lower in the hepatopancreas of immature crabs relative to mature crabs. Conclusions/Significance We are the first to identify the lepr gene and to determine its gene expression patterns in various tissues and at three different reproductive stages in Chinese mitten crab. Taken together, our results suggest that lepr may be involved in the nutritional regulation of metabolism and reproduction in Chinese mitten crabs. PMID:20567508

  14. Molecular Cloning and Characterization of Full-Length cDNA of Calmodulin Gene from Pacific Oyster Crassostrea gigas.

    PubMed

    Li, Xing-Xia; Yu, Wen-Chao; Cai, Zhong-Qiang; He, Cheng; Wei, Na; Wang, Xiao-Tong; Yue, Xi-Qing

    2016-01-01

    The shell of the pearl oyster (Pinctada fucata) mainly comprises aragonite whereas that of the Pacific oyster (Crassostrea gigas) is mainly calcite, thereby suggesting the different mechanisms of shell formation between above two mollusks. Calmodulin (CaM) is an important gene for regulating the uptake, transport, and secretion of calcium during the process of shell formation in pearl oyster. It is interesting to characterize the CaM in oysters, which could facilitate the understanding of the different shell formation mechanisms among mollusks. We cloned the full-length cDNA of Pacific oyster CaM (cgCaM) and found that the cgCaM ORF encoded a peptide of 113 amino acids containing three EF-hand calcium-binding domains, its expression level was highest in the mantle, hinting that the cgCaM gene is probably involved in shell formation of Pacific oyster, and the common ancestor of Gastropoda and Bivalvia may possess at least three CaM genes. We also found that the numbers of some EF hand family members in highly calcified species were higher than those in lowly calcified species and the numbers of these motifs in oyster genome were the highest among the mollusk species with whole genome sequence, further hinting the correlation between CaM and biomineralization.

  15. Molecular Cloning and Characterization of the Helicobacter pylori fliD Gene, an Essential Factor in Flagellar Structure and Motility

    PubMed Central

    Seong Kim, Jang; Hoon Chang, Ji; Il Chung, Soo; Sun Yum, Jung

    1999-01-01

    Helicobacter pylori colonizes the human stomach and can cause gastroduodenal disease. Flagellar motility is regarded as a major factor in the colonizing ability of H. pylori. The functional roles of flagellar structural proteins other than FlaA, FlaB, and FlgE are not well understood. The fliD operon of H. pylori consists of flaG, fliD, and fliS genes, in the order stated, under the control of a ς28-dependent promoter. In an effort to elucidate the function of the FliD protein, a hook-associated protein 2 homologue, in flagellar morphogenesis and motility, the fliD gene (2,058 bp) was cloned and isogenic mutants were constructed by disruption of the fliD gene with a kanamycin resistance cassette and electroporation-mediated allelic-exchange mutagenesis. In the fliD mutant, morphologically abnormal flagellar appendages in which very little filament elongation was apparent were observed. The fliD mutant strain was completely nonmotile, indicating that these abnormal flagella were functionally defective. Furthermore, the isogenic fliD mutant of H. pylori SS1, a mouse-adapted strain, was not able to colonize the gastric mucosae of host mice. These results suggest that H. pylori FliD is an essential element in the assembly of the functional flagella that are required for colonization of the gastric mucosa. PMID:10559162

  16. Molecular cloning and chromosomal assignment of the human brain-type phosphodiesterase I/nucleotide pyrophosphatase gene (PDNP2)

    SciTech Connect

    Kawagoe, Hiroyuki; Soma, Osamu; Goji, Junko

    1995-11-20

    Phosphodiesterase I/nucleotide pyrophosphatase is a widely expressed membrane-bound enzyme that cleaves diester bonds of a variety of substrates. We have cloned brain-type cDNA for this enzyme from rat brain and designated it PD-I{alpha}. In this study we have isolated cDNA and genomic DNA encoding human PD-I{alpha}. Human PD-I{alpha} cDNA, designated PDNP2 in HGMW nomenclature, has a 2589-nucleotide open reading frame encoding a polypeptide of 863 amino acids with a calculated M{sub r} of 99,034. Northern blot analysis revealed that human PD-I{alpha} transcript was present in brain, lung, placenta, and kidney. The database analysis showed that human PD-I{alpha} was identical with human autotaxin (ATX), a novel tumor motility-stimulating factor, except that human PD-I{alpha} lacks 156 nucleotides and 52 amino acids of human ATX. Human PD-I{alpha} and human ATX are likely to be alternative splicing products from the same gene. The 5{prime} region of the human PDNP2 gene contains four putative binding sites of transcription factor Sp1 without typical TATA or CAAT boxes, and there is a potential octamer binding motif in intron 2. From the results of fluorescence in situ hybridization, the human PDNP2 gene is located at chromosome 8q24.1. 17 refs., 3 figs.

  17. Molecular cloning and functional characterization of Catharanthus roseus hydroxymethylbutenyl 4-diphosphate synthase gene promoter from the methyl erythritol phosphate pathway.

    PubMed

    Ginis, Olivia; Courdavault, Vincent; Melin, Céline; Lanoue, Arnaud; Giglioli-Guivarc'h, Nathalie; St-Pierre, Benoit; Courtois, Martine; Oudin, Audrey

    2012-05-01

    The Madagascar periwinkle produces monoterpenoid indole alkaloids (MIA) of high interest due to their therapeutical values. The terpenoid moiety of MIA is derived from the methyl erythritol phosphate (MEP) and seco-iridoid pathways. These pathways are regarded as the limiting branch for MIA biosynthesis in C. roseus cell and tissue cultures. In previous studies, we demonstrated a coordinated regulation at the transcriptional and spatial levels of genes from both pathways. We report here on the isolation of the 5'-flanking region (1,049 bp) of the hydroxymethylbutenyl 4-diphosphate synthase (HDS) gene from the MEP pathway. To investigate promoter transcriptional activities, the HDS promoter was fused to GUS reporter gene. Agrobacterium-mediated transformation of young tobacco leaves revealed that the cloned HDS promoter displays a tissue-specific GUS staining restricted to the vascular region of the leaves and limited to a part of the vein that encompasses the phloem in agreement with the previous localization of HDS transcripts in C. roseus aerial organs. Further functional characterizations in stably or transiently transformed C. roseus cells allowed us to identify the region that can be consider as the minimal promoter and to demonstrate the induction of HDS promoter by several hormonal signals (auxin, cytokinin, methyljasmonate and ethylene) leading to MIA production. These results, and the bioinformatic analysis of the HDS 5'-region, suggest that the HDS promoter harbours a number of cis-elements binding specific transcription factors that would regulate the flux of terpenoid precursors involved in MIA biosynthesis.

  18. Molecular Cloning and Characterization of DXS and DXR Genes in the Terpenoid Biosynthetic Pathway of Tripterygium wilfordii

    PubMed Central

    Tong, Yuru; Su, Ping; Zhao, Yujun; Zhang, Meng; Wang, Xiujuan; Liu, Yujia; Zhang, Xianan; Gao, Wei; Huang, Luqi

    2015-01-01

    1-Deoxy-d-xylulose-5-phosphate synthase (DXS) and 1-deoxy-d-xylulose-5-phosphate reductoisomerase (DXR) genes are the key enzyme genes of terpenoid biosynthesis but still unknown in Tripterygium wilfordii Hook. f. Here, three full-length cDNA encoding DXS1, DXS2 and DXR were cloned from suspension cells of T. wilfordii with ORF sizes of 2154 bp (TwDXS1, GenBank accession no.KM879187), 2148 bp (TwDXS2, GenBank accession no.KM879186), 1410 bp (TwDXR, GenBank accession no.KM879185). And, the TwDXS1, TwDXS2 and TwDXR were characterized by color complementation in lycopene accumulating strains of Escherichia coli, which indicated that they encoded functional proteins and promoted lycopene pathway flux. TwDXS1 and TwDXS2 are constitutively expressed in the roots, stems and leaves and the expression level showed an order of roots > stems > leaves. After the suspension cells were induced by methyl jasmonate, the mRNA expression level of TwDXS1, TwDXS2, and TwDXR increased, and triptophenolide was rapidly accumulated to 149.52 µg·g−1, a 5.88-fold increase compared with the control. So the TwDXS1, TwDXS2, and TwDXR could be important genes involved in terpenoid biosynthesis in Tripterygium wilfordii Hook. f. PMID:26512659

  19. Molecular cloning and sequencing of metallothionein in squamates: new insights into the evolution of the metallothionein genes in vertebrates.

    PubMed

    Trinchella, Francesca; Riggio, Marilisa; Filosa, Silvana; Parisi, Elio; Scudiero, Rosaria

    2008-10-15

    Metallothioneins are cysteine-rich, metal-binding proteins ubiquitously expressed in living organisms. In the last past years, a plethora of vertebrate metallothionein sequences have become available, but so far there has been an almost absolute lack of data about sequences of metallothionein of non-avian diapsida. In the framework of the investigations on structural and functional properties of non-mammalian metallothioneins, we have cloned and sequenced the cDNAs encoding for metallothioneins of 10 squamate reptiles, belonging to 5 different infraorders. These sequences have been used to gain insight into the evolutionary history of metallothioneins in reptiles. Phylogenetic analysis shows that reptilian metallothionein phylogeny is inconsistent with the species phylogeny. Such findings allow us to hypothesize that the identified metallothionein in each squamate species used for this study might be considered a paralogous gene derived from more events of gene duplication and losses occurred during the diversification of the squamate species. Finally, through vertebrate metallothionein comparisons and phylogenetic analysis, we also add a novel contribution to the understanding of the evolution of metallothionein genes along the major vertebrate lineages.

  20. Molecular Cloning and Characterization of Full-Length cDNA of Calmodulin Gene from Pacific Oyster Crassostrea gigas

    PubMed Central

    Li, Xing-Xia; Yu, Wen-Chao; Cai, Zhong-Qiang; He, Cheng; Wei, Na

    2016-01-01

    The shell of the pearl oyster (Pinctada fucata) mainly comprises aragonite whereas that of the Pacific oyster (Crassostrea gigas) is mainly calcite, thereby suggesting the different mechanisms of shell formation between above two mollusks. Calmodulin (CaM) is an important gene for regulating the uptake, transport, and secretion of calcium during the process of shell formation in pearl oyster. It is interesting to characterize the CaM in oysters, which could facilitate the understanding of the different shell formation mechanisms among mollusks. We cloned the full-length cDNA of Pacific oyster CaM (cgCaM) and found that the cgCaM ORF encoded a peptide of 113 amino acids containing three EF-hand calcium-binding domains, its expression level was highest in the mantle, hinting that the cgCaM gene is probably involved in shell formation of Pacific oyster, and the common ancestor of Gastropoda and Bivalvia may possess at least three CaM genes. We also found that the numbers of some EF hand family members in highly calcified species were higher than those in lowly calcified species and the numbers of these motifs in oyster genome were the highest among the mollusk species with whole genome sequence, further hinting the correlation between CaM and biomineralization. PMID:27703977

  1. Subtilisin Sendai from alkalophilic Bacillus sp.: molecular and enzymatic properties of the enzyme and molecular cloning and characterization of the gene, aprS.

    PubMed

    Yamagata, Y; Isshiki, K; Ichishima, E

    1995-07-01

    We purified a new extracellular serine proteinase (designated subtilisin Sendai) from the culture broth of alkalophilic Bacillus sp. G-825-6, and its properties were characterized. Its optimum pH was at 10.0, when succinyl-L-leucyl-L-leucyl-L-valyl-L-tyrosyl-4-methylcoumaryl-7-amide (Suc-Leu-Leu-Val-Tyr-MCA) was used as a substrate. The substrate specificity of subtilisin Sendai was determined with oxidized insulin B-chain and fluorogenic peptidyl-MCA substrates. The isoelectric point of subtilisin Sendai was over 11.0. The molecular mass of the enzyme was estimated as 28,000 using sodium dodecyl sulfate-polyacrylamide gel electrophoresis. The circular dichroism spectrum of the enzyme was measured, and we discuss the relationship between the secondary structure of the enzyme and alkaline stability at pH 12 in comparison with that of subtilisin NAT. The structural gene (aprS) was cloned and sequenced. The deduced amino acid sequence for the mature protein (269 amino acids) was preceded by a putative signal sequence of 27 residues and a putative pro-sequence of 86 amino acids. The homology of the primary structure for 13 subtilisins was compared. The catalytic triad (Asp32, His64, and Ser221 with the numbering of subtilisin BPN') and the amino acid sequences near these amino acid residues were well conserved. As a special feature, it was observed that there was an extensive number of negatively charged amino acids in the pro-region of subtilisin Sendai and alkaline subtilisins. This was different from those of subtilisin from neutrophiles.

  2. Molecular cloning and expression of chitin deacetylase 1 gene from the gills of Penaeus monodon (black tiger shrimp).

    PubMed

    Sarmiento, Katreena P; Panes, Vivian A; Santos, Mudjekeewis D

    2016-08-01

    Chitin deacetylases have been identified and studied in several fungi and insects but not in crustaceans. These glycoproteins function in catalyzing the conversion of chitin to chitosan by the hydrolysis of N-acetamido bonds of chitin. Here, for the first time, the full length cDNA of chitin deacetylase (CDA) gene from crustaceans was fully cloned using a partial fragment obtained from a transcriptome database of the gills of black tiger shrimp Penaeus monodon that survived White Spot Syndrome Virus (WSSV) infection employing Rapid Amplification of cDNA Ends (RACE) PCR. The shrimp CDA, named PmCDA1, was further characterized by in silico analysis, and its constitutive expression determined in apparently healthy shrimp through reverse transcription PCR (RT-PCR). Results revealed that the P. monodon chitin deacetylase (PmCDA1) is 2176 bp-long gene with an open reading frame (ORF) of 1596 bp encoding for 532 amino acids. Phylogenetic analysis revealed that PmCDA1 belongs to Group I CDAs together with CDA1 and CDA2 proteins found in insects. Moreover, PmCDA1 is composed of a conserved chitin-binding peritrophin-A domain (CBD), a low-density lipoprotein receptor class A domain (LDL-A) and a catalytic domain that is part of CE4 superfamily, all found in group I CDAs, which are known to serve critical immune function against WSSV. Finally, high expression of PmCDA1 gene in the gills of apparently healthy P. monodon was observed suggesting important basal function of the gene in this tissue. Taken together, this is a first report of the full chitin deacetylase 1 (CDA1) gene in crustaceans particularly in shrimp that exhibits putative immune function against WSSV and is distinctly highly expressed in the gills of shrimp.

  3. Molecular cloning, expression, and chromosomal localization of the gene encoding a human myeloid membrane antigen (gp150).

    PubMed Central

    Look, A T; Peiper, S C; Rebentisch, M B; Ashmun, R A; Roussel, M F; Lemons, R S; Le Beau, M M; Rubin, C M; Sherr, C J

    1986-01-01

    DNA from a tertiary mouse cell transformant containing amplified human sequences encoding a human myeloid membrane glycoprotein, gp150, was used to construct a bacteriophage lambda library. A single recombinant phage containing 12 kilobases (kb) of human DNA was isolated, and molecular subclones were then used to isolate the complete gp150 gene from a human placental genomic DNA library. The intact gp150 gene, assembled from three recombinant phages, proved to be biologically active when transfected into NIH 3T3 cells. Molecular probes from the gp150 locus annealed with a 4.0-kb polyadenylated RNA transcript derived from human myeloid cell lines and from tertiary mouse cell transformants. The gp150 gene was assigned to human chromosome 15, and was subchromosomally localized to bands q25-26 by in situ hybridization. The chromosomal location of the gp150 gene coincides cytogenetically with the region assigned to the c-fes proto-oncogene, another human gene specifically expressed by myeloid cells. Images PMID:2428842

  4. Molecular diversity of Bacteroides spp. in human fecal microbiota as determined by group-specific 16S rRNA gene clone library analysis.

    PubMed

    Li, Min; Zhou, Haokui; Hua, Weiying; Wang, Baohong; Wang, Shengyue; Zhao, Guoping; Li, Lanjuan; Zhao, Liping; Pang, Xiaoyan

    2009-05-01

    Bacteroides spp. represent a prominent bacterial group in human intestinal microbiota with roles in symbiosis and pathogenicity; however, the detailed composition of this group in human feces has yet to be comprehensively characterized. In this study, the molecular diversity of Bacteroides spp. in human fecal microbiota was analyzed from a seven-member, four-generation Chinese family using Bacteroides spp. group-specific 16S rRNA gene clone library analysis. A total of 549 partial 16S rRNA sequences amplified by Bacteroides spp.-specific primers were classified into 52 operational taxonomic units (OTUs) with a 99% sequence identity cut-off. Twenty-three OTUs, representing 83% of all clones, were related to 11 validly described Bacteroides species, dominated by Bacteroides coprocola, B. uniformis, and B. vulgatus. Most of the OTUs did not correspond to known species and represented hitherto uncharacterized bacteria. Relative to 16S rRNA gene universal libraries, the diversity of Bacteroides spp. detected by the group-specific libraries was much higher than previously described. Remarkable inter-individual differences were also observed in the composition of Bacteroides spp. in this family cohort. The comprehensive observation of molecular diversity of Bacteroides spp. provides new insights into potential contributions of various species in this group to human health and disease.

  5. Molecular cloning and characterization of the putative Halloween gene Phantom from the small brown planthopper Laodelphax striatellus.

    PubMed

    Jia, Shuang; Wan, Pin-Jun; Li, Guo-Qing

    2015-12-01

    Ecdysteroid hormone 20-hydroxyecdysone plays fundamental roles in insect postembryonic development and reproduction. Several cytochrome P450 mono-oxygenases (CYPs), encoded by the Halloween genes, have been documented to be involved in ecdysteroidogenesis in representative insects in Diptera, Lepidoptera and Orthoptera. Here the putative Halloween gene Phantom (Phm, cyp306a1) from a hemipteran insect species, the small brown planthopper Laodelphax striatellus, was cloned. LsPHM shows five insect conserved P450 motifs, that is, Helix-C, Helix-I, Helix-K, PERF and heme-binding motifs. Temporal and spatial expression patterns of LsPhm were evaluated by quantitative polymerase chain reaction. Through the fourth-instar and the early fifth-instar stages, LsPhm showed two expression peaks in day 2 and days 4-5 fourth-instar nymphs, and three troughs in day 1 and 3 fourth instars and day 1 fifth instars. On day 5 of the fourth-instar nymphs, LsPhm clearly had a high transcript level in the thorax where the prothoracic glands were located. Dietary introduction of double-stranded RNA (dsRNA) of LsPhm at the nymph stage successfully knocked down the target gene, decreased expression level of ecdysone receptor (LsEcR) gene and caused a higher nymphal mortality rate and delayed development. Ingestion of 20-hydroxyecdysone on LsPhm-dsRNA-exposed nymphs did not increase LsPhm expression level, but almost completely rescued the LsEcR mRNA level, and relieved the negative effects on survival and development. Thus, our data suggest that the putative LsPhm encodes a functional 25-hydroxylase that catalyzes the biosynthesis of ecdysteroids in L. striatellus. © 2014 Institute of Zoology, Chinese Academy of Sciences.

  6. Molecular Cloning, Bioinformatic Analysis, and Expression of Bombyx mori Lebocin 5 Gene Related to Beauveria bassiana Infection

    PubMed Central

    Lü, Dingding; Hou, Chengxiang; Qin, Guangxing; Gao, Kun; Chen, Tian

    2017-01-01

    A full-length cDNA of lebocin 5 (BmLeb5) was first cloned from silkworm, Bombyx mori, by rapid amplification of cDNA ends. The BmLeb5 gene is 808 bp in length and the open reading frame encodes a 179-amino acid hydroxyproline-rich peptide. Bioinformatic analysis results showed that BmLeb5 owns an O-glycosylation site and four RXXR motifs as other lebocins. Sequence similarity and phylogenic analysis results indicated that lebocins form a multiple gene family in silkworm as cecropins. Quantitative real-time PCR analysis revealed that BmLeb5 was highest expressed in the fat body. In the silkworm larvae infected by Beauveria bassiana, the expression level of BmLeb5 was upregulated in the fat body and hemolymph which are the most important immune tissues in silkworm. The recombinant protein of BmLeb5 was for the first time successfully expressed with prokaryotic expression system and purified. There are no reports so far that the expression of lebocins could be induced by entomopathogenic fungus. Our study suggested that BmLeb5 might play an important role in the immune response of silkworm to defend B. bassiana infection. The results also provided helpful information for further studying the lebocin family functioned in antifungal immune response in the silkworm. PMID:28194425

  7. Molecular cloning and expression analysis of a novel gene DGCR8 located in the DiGeorge syndrome chromosomal region.

    PubMed

    Shiohama, Aiko; Sasaki, Takashi; Noda, Setsuko; Minoshima, Shinsei; Shimizu, Nobuyoshi

    2003-04-25

    We have identified and cloned a novel gene (DGCR8) from the human chromosome 22q11.2. This gene is located in the DiGeorge syndrome chromosomal region (DGCR). It consists of 14 exons spanning over 35kb and produces transcripts with ORF of 2322bp, encoding a protein of 773 amino acids. We also isolated a mouse ortholog Dgcr8 and found it has 95.3% identity with human DGCR8 at the amino acid sequence level. Northern blot analysis of human and mouse tissues from adult and fetus showed rather ubiquitous expression. However, the in situ hybridization of mouse embryos revealed that mouse Dgcr8 transcripts are localized in neuroepithelium of primary brain, limb bud, vessels, thymus, and around the palate during the developmental stages of embryos. The expression profile of Dgcr8 in developing mouse embryos is consistent with the clinical phenotypes including congenital heart defects and palate clefts associated with DiGeorge syndrome (DGS)/conotruncal anomaly face syndrome (CAFS)/velocardiofacial syndrome (VCFS), which are caused by monoallelic microdeletion of chromosome 22q11.2.

  8. Molecular Cloning, Expression Pattern and Genotypic Effects on Glucoraphanin Biosynthetic Related Genes in Chinese Kale (Brassica oleracea var. alboglabra Bailey).

    PubMed

    Yin, Ling; Chen, Changming; Chen, Guoju; Cao, Bihao; Lei, Jianjun

    2015-11-11

    Glucoraphanin is a plant secondary metabolite that is involved in plant defense and imparts health-promoting properties to cruciferous vegetables. In this study, three genes involved in glucoraphanin metabolism, branched-chain aminotransferase 4 (BCAT4), methylthioalkylmalate synthase 1 (MAM1) and dihomomethionine N-hydroxylase (CYP79F1), were cloned from Chinese kale (Brassica oleracea var. alboglabra Bailey). Sequence homology and phylogenetic analysis identified these genes and confirmed the evolutionary status of Chinese kale. The transcript levels of BCAT4, MAM1 and CYP79F1 were higher in cotyledon, leaf and stem compared with flower and silique. BCAT4, MAM1 and CYP79F1 were expressed throughout leaf development with lower transcript levels during the younger stages. Glucoraphanin content varied extensively among different varieties, which ranged from 0.25 to 2.73 µmol·g(-1) DW (dry weight). Expression levels of BCAT4 and MAM1 were high at vegetative-reproductive transition phase, while CYP79F1 was expressed high at reproductive phase. BCAT4, MAM1 and CYP79F1 were expressed significantly high in genotypes with high glucoraphanin content. All the results provided a better understanding of the roles of BCAT4, MAM1 and CYP79F1 in the glucoraphanin biosynthesis of Chinese kale.

  9. Molecular cloning and functional identification of a novel phenylacetyl-CoA ligase gene from Penicillium chrysogenum.

    PubMed

    Wang, Fu-Qiang; Liu, Jing; Dai, Meng; Ren, Zhi-Hong; Su, Cai-Yun; He, Jian-Gong

    2007-08-24

    A novel phenylacetyl-CoA ligase gene, designated phlB, was cloned and identified from the penicillin producing strain Penicillium chrysogenum based on subtractive suppression hybridization approach. The phlB gene contains a 1686-bp open-reading frame and encodes a protein of approximately 62.6 kDa. The deduced amino acid sequence shows about 35% identity to the characterized P. chrysogenum phenylacetyl-CoA ligase Phl and has a peroxisomal targeting signal on its C-terminal. Recombinant PhlB protein was overexpressed in Escherichia coli and purified by nickel affinity chromatography. Enzymatic assay confirmed that recombinant PhlB can catalyze the reaction of phenylacetic acid (PAA) with CoA to yield phenylacetyl-CoA. The expression level of phlB in the penicillin producing medium supplemented with PAA, the side chain precursor of penicillin G, was about 2.5-fold higher than that in medium without PAA. The study suggested that PhlB might participate in the activation of PAA during penicillin biosynthesis in P. chrysogenum.

  10. Molecular cloning and functional expression analysis of a new gene encoding geranylgeranyl diphosphate synthase from hazel (Corylus avellana L. Gasaway).

    PubMed

    Wang, Yechun; Miao, Zhiqi; Tang, Kexuan

    2010-10-01

    Geranylgeranyl diphosphate synthase (GGPPS) [EC 2.5.1.29] catalyzes the biosynthesis of geranylgeranyl diphosphate (GGPP), which is a key precursor for diterpenes such as taxol. Herein, a full-length cDNA encoding GGPPS (designated as CgGGPPS) was cloned and characterized from hazel (Corylus avellana L. Gasaway), a taxol-producing angiosperms. The full-length cDNA of CgGGPPS was 1515 bp with a 1122 bp open reading frame (ORF) encoding a 373 amino acid polypeptide. The CgGGPPS genomic DNA sequence was also obtained, revealing CgGGPPS gene was not interrupted by an intron. Southern blot analysis indicated that CgGGPPS belonged to a small gene family. Tissue expression pattern analysis indicated that CgGGPPS expressed the highest in leaves. RT-PCR analysis indicated that CgGGPPS expression could be induced by exogenous methyl jasmonate acid. Furthermore, carotenoid accumulation was observed in Escherichia coli carrying pACCAR25ΔcrtE plasmid carrying CgGGPPS. The result revealed that cDNA encoded a functional GGPP synthase.

  11. Molecular Cloning, Bioinformatic Analysis, and Expression of Bombyx mori Lebocin 5 Gene Related to Beauveria bassiana Infection.

    PubMed

    Lü, Dingding; Hou, Chengxiang; Qin, Guangxing; Gao, Kun; Chen, Tian; Guo, Xijie

    2017-01-01

    A full-length cDNA of lebocin 5 (BmLeb5) was first cloned from silkworm, Bombyx mori, by rapid amplification of cDNA ends. The BmLeb5 gene is 808 bp in length and the open reading frame encodes a 179-amino acid hydroxyproline-rich peptide. Bioinformatic analysis results showed that BmLeb5 owns an O-glycosylation site and four RXXR motifs as other lebocins. Sequence similarity and phylogenic analysis results indicated that lebocins form a multiple gene family in silkworm as cecropins. Quantitative real-time PCR analysis revealed that BmLeb5 was highest expressed in the fat body. In the silkworm larvae infected by Beauveria bassiana, the expression level of BmLeb5 was upregulated in the fat body and hemolymph which are the most important immune tissues in silkworm. The recombinant protein of BmLeb5 was for the first time successfully expressed with prokaryotic expression system and purified. There are no reports so far that the expression of lebocins could be induced by entomopathogenic fungus. Our study suggested that BmLeb5 might play an important role in the immune response of silkworm to defend B. bassiana infection. The results also provided helpful information for further studying the lebocin family functioned in antifungal immune response in the silkworm.

  12. Molecular cloning of bovine lymphocyte activation gene-3 and its expression characteristics in bovine leukemia virus-infected cattle.

    PubMed

    Shirai, Tatsuya; Konnai, Satoru; Ikebuchi, Ryoyo; Okagawa, Tomohiro; Suzuki, Saori; Sunden, Yuji; Onuma, Misao; Murata, Shiro; Ohashi, Kazuhiko

    2011-12-15

    Lymphocyte activation gene-3 (LAG-3), a major histocompatibility complex (MHC) class II binding CD4 homologue has recently been shown as one of the mechanisms for down-regulating immune responses during chronic disease progression. For the first time, we cloned LAG-3 from two breeds of cattle (Holstein and Japanese Black), and analyzed its expression levels in cattle infected with bovine leukemia virus (BLV), a chronic viral infection that leads to immuno-suppression. The cloned cDNA of bovine LAG-3 have an open reading frame of 1551 nucleotides, encoding a polypeptide of 515 amino acids in length. Similar to the swine LAG-3, the bovine LAG-3 protein sequence consisted of four extracellular domains, a transmembrane domain and an inhibitory motif, KTGELE. We found that the bovine LAG-3 mRNA transcripts were expressed predominantly on T-cells such as CD4(+) and CD8(+) cells, among peripheral blood mononuclear cells. In subsequent expression analysis, LAG-3 mRNA expression on CD4(+) T-cells from BLV-infected cattle was upregulated compared to that in normal cattle. Comparable results were obtained with CD8(+) T-cells from cattle infected with BLV. We further observed strong upregualtion of MHC class II molecule, the ligand for LAG-3 in BLV-infected cattle. These findings indicate an important role for inhibitory receptor molecules such as LAG-3 in chronic bovine infections and future studies will elucidate the specific role of LAG-3 in bovine diseases. Copyright © 2011 Elsevier B.V. All rights reserved.

  13. Molecular cloning, characterization and expression analysis of 3-hydroxy-3-methylglutaryl coenzyme A reductase gene from Centella asiatica L.

    PubMed

    Kalita, Ratna; Patar, Lochana; Shasany, Ajit Kumar; Modi, Mahendra K; Sen, Priyabrata

    2015-09-01

    3-Hydroxy-3-methylglutaryl-CoA reductases (HMGR) plays an important role in catalyzing the first committed step of isoprenoid biosynthesis in the mevelonic (MVA) pathway (catalyzes the conversion of HMG-CoA to MVA) in plants. The present manuscript reports the full length cDNA cloning of HMGR (CaHMGR, GenBank accession number: KJ939450.2) and its characterization from Centella asiatica. Sequence analysis indicated that the cDNA was of 1965 bp, which had an open reading frame of 1617 bp and encoded a protein containing 539 amino-acids with a mol wt of 57.9 kDa. A BLASTp search against non-redundant (nr) protein sequence showed that C. asiatica HMGR (CaHMGR) has 65-81% identity with HMGRs from different plant species and multi-alignment comparison analysis showed the presence of two motif each corresponding to HMG-CoA-binding and NADP(H)-binding. The Conserved Domain Database analysis predicted that CaHMGR belongs to Class I hydroxymethylglutaryl-coenzyme A (HMG-CoA) reductase. Three-dimensional modeling confirmed the novelty of CaHMGR with a spatial structure similar to Homo sapiens (PDB id: 1IDQ8_A). Tissue Expression analysis indicates that CaHMGR is ubiquitous albeit differentially expressed among different tissues analysed, Strong expression was recorded in the nodes and leaves and low in the roots. The present investigation confirmed that nodes are vital to terpenoid synthesis in C. asiatica. Thus, the cloning of full length CDS, characterization and structure-function analysis of HMGR gene in Centella facilitate to understand the HMGR's functions and regulatory mechanisms involved in mevalonate pathway in C. asiatica at genetic level.

  14. Molecular cloning of the 130-kilodalton mosquitocidal delta-endotoxin gene of Bacillus thuringiensis subsp. israelensis in Bacillus sphaericus.

    PubMed Central

    Trisrisook, M; Pantuwatana, S; Bhumiratana, A; Panbangred, W

    1990-01-01

    A 3.7-kilobase (kb) XbaI fragment harboring the cryIVB gene (L. Thorne, F. Garduno, T. Thompson, D. Decker, M. A. Zounes, M. Wild, A. M. Walfield, and T. J. Pollock, J. Bacteriol. 166:801-811, 1986) which encoded a 130-kilodalton (kDa) mosquitocidal toxin from a 110-kb plasmid of Bacillus thuringiensis subsp. israelensis 4Q2-72 was cloned into pUC12 and transformed into Escherichia coli. The clone with a recombinant plasmid (designated pBT8) was toxic to Aedes aegypti larvae. The fragment (3.7 kb) was ligated into pBC16 (tetracycline resistant [Tcr]) and transformed by the method of protoplast transformation into Bacillus sphaericus 1593 and 2362, which were highly toxic to Anopheles and Culex mosquito larvae but less toxic to Aedes larvae. After cell regeneration on regeneration medium, the Tcr plasmids from transformants (pBTC1) of both strains of B. sphaericus were prepared and analyzed. The 3.7-kb XbaI fragment from the B. thuringiensis subsp. israelensis plasmid was shown to be present by agarose gel electrophoresis and Southern blot hybridization. In addition, B. sphaericus transformants produced a 130-kDa mosquitocidal toxin which was detected by Western (immuno-) blot analysis with antibody prepared against B. thuringiensis subsp. israelensis 130-kDa mosquitocidal toxin. The 50% lethal concentrations of the transformants of strains 1593 and 2362 against A. aegypti larvae were 2.7 X 10(2) and 5.7 X 10(2) cells per ml, respectively. This level of toxicity was comparable to the 50% lethal concentration of B. thuringiensis subsp. israelensis but much higher than that of B. sphaericus 1593 and 2362 (4.7 X 10(4) cells per ml) against A. aegypti larvae.(ABSTRACT TRUNCATED AT 250 WORDS) Images PMID:2200339

  15. Molecular Cloning and Characterization of the Ehrlichia chaffeensis Variable-Length PCR Target: an Antigen-Expressing Gene That Exhibits Interstrain Variation

    PubMed Central

    Sumner, John W.; Childs, James E.; Paddock, Christopher D.

    1999-01-01

    A clone expressing an immunoreactive protein with an apparent molecular mass of 44 kDa was selected from an Ehrlichia chaffeensis Arkansas genomic library by probing with anti-E. chaffeensis hyperimmune mouse ascitic fluid. Nucleotide sequencing revealed an open reading frame (ORF) capable of encoding a 198-amino-acid polypeptide. The ORF contained four imperfect, direct, tandem 90-bp repeats. The nucleotide and deduced amino acid sequences did not show close homologies to entries in the molecular databases. PCR with primers whose sequences matched the sequences flanking the ORF was performed with DNA samples extracted from cell cultures infected with nine different isolates of E. chaffeensis, blood samples from seven patients with monocytic ehrlichiosis, and Amblyomma americanum ticks collected in four different states. The resulting amplicons varied in length, containing three to six repeat units. This gene, designated the variable-length PCR target, is useful for PCR detection of E. chaffeensis and differentiation of isolates. PMID:10203503

  16. Molecular cloning and characterization of the Ehrlichia chaffeensis variable-length PCR target: an antigen-expressing gene that exhibits interstrain variation.

    PubMed

    Sumner, J W; Childs, J E; Paddock, C D

    1999-05-01

    A clone expressing an immunoreactive protein with an apparent molecular mass of 44 kDa was selected from an Ehrlichia chaffeensis Arkansas genomic library by probing with anti-E. chaffeensis hyperimmune mouse ascitic fluid. Nucleotide sequencing revealed an open reading frame (ORF) capable of encoding a 198-amino-acid polypeptide. The ORF contained four imperfect, direct, tandem 90-bp repeats. The nucleotide and deduced amino acid sequences did not show close homologies to entries in the molecular databases. PCR with primers whose sequences matched the sequences flanking the ORF was performed with DNA samples extracted from cell cultures infected with nine different isolates of E. chaffeensis, blood samples from seven patients with monocytic ehrlichiosis, and Amblyomma americanum ticks collected in four different states. The resulting amplicons varied in length, containing three to six repeat units. This gene, designated the variable-length PCR target, is useful for PCR detection of E. chaffeensis and differentiation of isolates.

  17. Cloning of the rice seed alpha-globulin-encoding gene: sequence similarity of the 5'-flanking region to those of the genes encoding wheat high-molecular-weight glutenin and barley D hordein.

    PubMed

    Nakase, M; Hotta, H; Adachi, T; Aoki, N; Nakamura, R; Masumura, T; Tanaka, K; Matsuda, T

    1996-05-08

    A genomic clone encoding the rice endosperm major globulin (alpha-globulin) with an apparent molecular mass of 26 kDa was isolated, and its nucleotide (nt) sequence and transcription start point (tsp) were determined. The tsp was identical to that of the gene encoding the wheat high-molecular-weight (HMW) glutenin subunit. The consensus '-300 element' and an A + T-rich sequence exist upstream from the TATA box in the 5'-flanking region. A nt sequence of about 130 bp in the 5'-flanking region was found to be markedly homologous to those of the genes encoding the wheat HMW glutenin subunit and barley D hordein.

  18. Molecular cloning and characterization of a heme oxygenase1 gene from sunflower and its expression profiles in salinity acclimation.

    PubMed

    Zhu, Kaikai; Jin, Qijiang; Samma, Muhammad Kaleem; Lin, Guoqing; Shen, Wenbiao

    2014-06-01

    Heme oxygenase1 (HO1) is involved in protecting plants from environmental stimuli. In this study, a sunflower (Helianthus annuus L.) HO1 gene (HaHO1) was cloned and sequenced. It was confirmed that HaHO1 encodes a precursor protein of 32.93 kDa with an N-terminal plastid transit peptide which was validated by subcellular localization. The amino acid sequence of HaHO1 shared high homology with other plant HO1s. The predicted three-dimensional structure showed a high degree of structural conservation as compared to the known HO1 crystal structures. Phylogenetic analysis revealed that HaHO1 clearly grouped with the plant HO1-like sequences. Moreover, the purified recombinant mature HaHO1 expressed in Escherichia coli exhibits HO activity. Thus, it was concluded that HaHO1 encodes a functional HO1 in sunflower. Additionally, HaHO1 gene was ubiquitously expressed in all tested tissues, and induced differentially during different growth stages after germination, and could be differentially induced by several stresses and hemin treatment. For example, a pretreatment with a low concentration of NaCl (25 mM) could lead to the induction of HaHO1 gene expression and thereafter a salinity acclamatory response. Above cytoprotective effect could be impaired by the potent HO1 inhibitor zinc protoporphyrin IX (ZnPPIX), which was further rescued by the addition of 50% carbon monoxide aqueous solution (in particular) or bilirubin, two catalytic by-products of HO1, respectively. Similarly, a HO1 inducer, hemin, could mimic the salinity acclamatory response. Together, these findings strongly suggested that the up-regulation of HaHO1 might be required for the observed salinity acclimation in sunflower plants.

  19. Cloning of canine myocilin cDNA and molecular analysis of the myocilin gene in Shiba Inu dogs.

    PubMed

    Kato, Kumiko; Sasaki, Nobuo; Matsunaga, Satoru; Nishimura, Ryohei; Ogawa, Hiroyuki

    2007-01-01

    To identify canine myocilin cDNA and compare its sequence in glaucomatous and nonglaucomatous Shiba Inu dogs with closed and open iridocorneal angles (ICAs). Total RNA was extracted from the ciliary body of the eyes of a healthy Beagle, and the canine myocilin gene was cloned and sequenced. Of the Shiba Inu dogs tested, five were glaucomatous with closed ICA, three were nonglaucomatous with open ICA, and two were nonglaucomatous with closed ICA. The genomic DNA of these dogs was extracted from peripheral blood leukocytes. The exons of the canine myocilin gene were amplified using the polymerase chain reaction (PCR), and sequenced. The frequency of mutation in canine myocilin DNA was verified in these dogs by using the myocilin cDNA of a Beagle. The canine myocilin cDNA was 1452 bp long and contained the entire open reading frame encoding 483 amino acids. A leucine zipper-like motif and olfactomedin-like domain were conserved in the amino acid residues. The presence of sequence variants in the genomic DNA of Shiba Inu dogs was independent of the occurrence of glaucoma and ICA grading. Myocilin RNA was detected in the ciliary body and trabecular meshwork (TM) of a Beagle. The myocilin sequence of Shiba Inu dogs suggests that myocilin mutations are unlikely to play a significant role in the pathogenesis of primary closed-angle glaucoma in this breed. However, several mutations in the myocilin gene in exon 1 of Shiba Inu dogs may predispose them to an obstruction in the anterior aqueous outflow.

  20. Molecular cloning and characterization of genes required for ribose transport and utilization in Escherichia coli K-12.

    PubMed Central

    Iida, A; Harayama, S; Iino, T; Hazelbauer, G L

    1984-01-01

    We isolated spontaneous and transposon insertion mutants of Escherichia coli K-12 that were specifically defective in utilization or in high-affinity transport of D-ribose (or in both). Cotransduction studies located all of the mutations near ilv, at the same position as previously identified mutations causing defects in ribokinase ( rbsK ) or ribose transport ( rbsP ). Plasmids that complemented the rbs mutations were isolated from the collection of ColE1 hybrid plasmids constructed by Clarke and Carbon. Analysis of those plasmids as well as of fragments cloned into pBR322 and pACYC184 allowed definition of the rbs region. Products of rbs genes were identified by examination of the proteins produced in minicells containing various rbs plasmids. We identified four rbs genes: rbsB , which codes for the 29-kilodalton ribose-binding protein; rbsK , which codes for the 34-kilodalton ribokinase ; rbsA , which codes for a 50-kilodalton protein required for high-affinity transport; and rbsC , which codes for a 27-kilodalton protein likely to be a transport system component. Our studies showed that these genes are transcribed from a common promoter in the order rbsA rbsC rbsB rbsK . It appears that the high-affinity transport system for ribose consists of the three components, ribose-binding protein, the 50-kilodalton RbsA protein, and the 27-kilodalton RbsC protein, although a fourth, unidentified component could exist. Mutants defective in this transport system, but normal for ribokinase , are able to grow normally on high concentrations of the sugar, indicating that there is at least a second, low-affinity transport system for ribose in E. coli K-12. Images PMID:6327617

  1. Cloning

    MedlinePlus

    Cloning describes the processes used to create an exact genetic replica of another cell, tissue or organism. ... named Dolly. There are three different types of cloning: Gene cloning, which creates copies of genes or ...

  2. Molecular cloning and expression analysis of the ethylene insensitive3 (EIN3) gene in cucumber (Cucumis sativus).

    PubMed

    Bie, B B; Pan, J S; He, H L; Yang, X Q; Zhao, J L; Cai, R

    2013-10-07

    The plant gaseous hormone ethylene regulates many aspects of plant growth, development, and responses to the environment. Ethylene insensitive3 (EIN3) is a key transcription factor involved in the ethylene signal transduction pathway. To gain a better understanding of this particular pathway in cucumber, the full-length cDNA encoding EIN3 (designated as CsEIN3) was cloned from cucumber for the first time by rapid amplification of cDNA ends. The full length of CsEIN3 was 2560 bp, with an open reading frame of 1908 bp encoding 635 amino acids. Sequence alignment and phylogenetic analyses revealed that CsEIN3 has high homology with other plant EIN3/EIL proteins that were derived from a common ancestor during evolution, and CsEIN3 was grouped into a cluster along with melon. Homology modeling demonstrated that CsEIN3 has a highly similar structure to the specific DNA-binding domain contained in EIN3/EIL proteins. Based on quantitative reverse transcription-polymerase chain reaction analysis, we found that CsEIN3 was constitutively expressed in all organs examined, and was increased during flower development and maturation in both male and female flowers. Our results suggest that CsEIN3 is involved in processes of flower development. In conclusion, this study will provide the basis for further study on the role of EIN3 in relevant biological processes of cucumber and on the molecular mechanism of the cucumber ethylene signaling pathway.

  3. Molecular cloning of the heat shock protein 20 gene from Paphia textile and its expression in response to heat shock

    NASA Astrophysics Data System (ADS)

    Li, Jiakai; Wu, Xiangwei; Tan, Jing; Zhao, Ruixiang; Deng, Lingwei; Liu, Xiande

    2015-07-01

    P. textile is an important aquaculture species in China and is mainly distributed in Fujian, Guangdong, and Guangxi Provinces. In this study, an HSP20 cDNA designated PtHSP20 was cloned from P. textile. The full-length cDNA of PtHSP20 is 1 090 bp long and contains a 5' untranslated region (UTR) of 93 bp, a 3' UTR of 475 bp, and an open reading frame (ORF) of 522 bp. The PtHSP20 cDNA encodes 173 amino acid residues and has a molecular mass of 20.22 kDa and an isoelectric point of 6.2. Its predicted amino acid sequence shows that PtHSP20 contains a typical α-crystallin domain (residues 77-171) and three polyadenylation signal-sequences at the C-terminus. According to an amino acid sequence alignment, PtHSP20 shows moderate homology to other mollusk sHSPs. PtHSP20 mRNA was present in all of the test tissues including the heart, digestive gland, adductor muscle, gonad, gill, and mantle, with the highest concentration found in the gonad. Under the stress of high temperature, the expression of PtHSP20 mRNA was down-regulated in all of the tissues except the adductor muscle and gonad.

  4. Molecular biology of channel catfish gonadotropin receptors: 1. Cloning of a functional luteinizing hormone receptor and preovulatory induction of gene expression.

    PubMed

    Kumar, R S; Ijiri, S; Trant, J M

    2001-03-01

    There is little known about the molecular biology of piscine gonadotropin receptors, and information about gene expression during reproductive development is particularly lacking. We have cloned the LH receptor (LHR) in the channel catfish (cc), and examined its gene expression throughout a reproductive cycle. A cDNA encoding the receptor was isolated from the testis using reverse transcription-polymerase chain reaction (RT-PCR) and rapid amplification of cDNA ends procedures. It encoded a 696-amino acid protein that showed the greatest homology (46-50% identity) with the known LHRs and lesser similarity with FSH receptors and thyroid-stimulating hormone receptors (44-47% and 42-44% identity, respectively). In addition, two characteristics unique to the LHRs were conserved in the cloned receptor and the encoding gene: presence of an intron corresponding to intron 10 in mammals and turkey and occurrence of a double cysteine residue in the cytoplasmic tail for potential palmitoylation. The ccLHR gene was well expressed in the gonads and kidney and merely detectable in the gills, muscle, and spleen. The isolated cDNA encoded an active ccLHR protein, as the recombinant receptor expressed in COS7 cells activated a cAMP response element-driven reporter gene (luciferase) upon exposure to hCG in a dose-dependent manner. Seasonal changes in the ovarian expression of the ccLHR gene, as examined by measuring the transcript abundance by quantitative real-time RT-PCR, remained rather low during most of the reproductive cycle but was acutely induced around the time of spawning. This pattern of expression correlates well with the reported expression of its ligand (LH) in fishes and concurs with the notion that LH is a key regulator of the periovulatory maturational events.

  5. Molecular cloning and expression profile of an abiotic stress and hormone responsive MYB transcription factor gene from Panax ginseng.

    PubMed

    Afrin, Sadia; Zhu, Jie; Cao, Hongzhe; Huang, Jingjia; Xiu, Hao; Luo, Tiao; Luo, Zhiyong

    2015-04-01

    The v-myb avian myeloblastosis viral oncogene homolog (MYB) family constitutes one of the most abundant groups of transcription factors and plays vital roles in developmental processes and defense responses in plants. A ginseng (Panax ginseng C.A. Meyer) MYB gene was cloned and designated as PgMYB1. The cDNA of PgMYB1 is 762 base pairs long and encodes the R2R3-type protein consisting 238 amino acids. Subcellular localization showed that PgMYB1-mGFP5 fusion protein was specifically localized in the nucleus. To understand the functional roles of PgMYB1, we investigated the expression patterns of PgMYB1 in different tissues and under various conditions. Quantitative real-time polymerase chain reaction and western blot analysis showed that PgMYB1 was expressed at higher level in roots, leaves, and lateral roots than in stems and seeds. The expression of PgMYB1 was up-regulated by abscisic acid, salicylic acid, NaCl, and cold (chilling), and down-regulated by methyl jasmonate. These results suggest that PgMYB1 might be involved in responding to environmental stresses and hormones.

  6. Molecular cloning and sequence of the thdF gene involved in the thiophene and furan oxidation by Escherichia coli

    SciTech Connect

    Alam, K.Y.; Clark, D.P.

    1990-01-01

    Since sulfur dioxide emission from burning high sulfur coals is a major contributor to acid rain, it is important to develop bacteria which are capable of efficiently removing the sulfur from coal before combustion. Inorganic sulfur can be removed from coal by certain strains of Thiobacillus or Sulfolobus; however the organic sulfur remains intransigent. Since high sulfur Illinois coals typically contain 60% to 70% of their sulfur in the form of the heterocyclic thiophene ring we have started to investigate the biodegradation of derivatives of thiophene and the corresponding oxygen heterocycle, furan. Our previous work resulted in the isolation of a triple mutant, NAR30, capable of oxidizing a range of furan and thiophene derivatives. However, NAR30 does not completely degrade thiophenes or furans and its oxidation of these compounds is slow and inefficient. We decided to clone the thd genes both in order to increase the efficiency of degradation and to investigate the nature of the reactions involved. 37 refs., 4 figs., 3 tabs.

  7. Cloning, Molecular Analysis, and Expression of the Polyhydroxyalkanoic Acid Synthase (phaC) Gene from Chromobacterium violaceum

    PubMed Central

    Kolibachuk, Dana; Miller, Andrea; Dennis, Douglas

    1999-01-01

    The polyhydroxyalkanoic acid synthase gene from Chromobacterium violaceum (phaCCv) was cloned and characterized. A 6.3-kb BamHI fragment was found to contain both phaCCv and the polyhydroxyalkanoic acid (PHA)-specific 3-ketothiolase (phaACv). Escherichia coli strains harboring this fragment produced significant levels of PHA synthase and 3-ketothiolase, as judged by their activities. While C. violaceum accumulated poly(3-hydroxybutyrate) or poly(3-hydroxybutyrate-co-3-hydroxyvalerate) when grown on a fatty acid carbon source, Klebsiella aerogenes and Ralstonia eutropha (formerly Alcaligenes eutrophus), harboring phaCCv, accumulated the above-mentioned polymers and, additionally, poly(3-hydroxybutyrate-co-3-hydroxyhexanoate) when even-chain-length fatty acids were utilized as the carbon source. This finding suggests that the metabolic environments of these organisms are sufficiently different to alter the product range of the C. violaceum PHA synthase. Neither recombinant E. coli nor recombinant Pseudomonas putida harboring phaCCv accumulated significant levels of PHA. Sequence analysis of the phaCCv product shows homology with several PHA synthases, most notably a 48% identity with that of Alcaligenes latus (GenBank accession no. AAD10274). PMID:10427049

  8. Molecular cloning and tissue distribution of the phosphotyrosine interaction domain containing 1 (PID1) gene in Tianfu goat.

    PubMed

    Xu, Honggang; Xu, Gangyi; Wang, Daihua; Zheng, Chengli; Wan, Lu

    2013-02-15

    Phosphotyrosine interaction domain containing 1 (PID1) is an important mediator in the development of obesity-related insulin resistance in humans and animals. For a better understanding of the structure and function of the PID1 gene and to study its effect in caprine, the cDNA of the PID1 gene from the abdominal muscle of Tianfu goat was cloned and sequenced. The structure of PID1 was analyzed using bioinformatics tools. The results showed that the full sequence of the caprine PID1 cDNA was 896 bp long and contained a 654 bp long coding region that encoded a 217 amino acid sequence. Fifteen phosphorylation sites were predicted in the translated PID1 protein. The protein had a phosphotyrosine-binding domain between Arg(53) and Ile(199). A phylogenic tree based on the PID1 proteins from other species revealed that the caprine protein was closely related to cattle PID1. Fluorescence quantitative PCR analyses revealed that PID1 was expressed in the heart, liver, spleen, lung, kidney, leg muscle, abdominal muscle and longissimus dorsi muscle of goats. In particular, high expression levels of PID1 were detected in liver and abdominal muscle, and low expression levels were seen in lung. Furthermore, the PID1 mRNA expression levels in the longissimus dorsi muscles increased gradually with the age of the goats (P<0.05). Western blotting results detected the PID1 protein in six of the tissues in which PID1 was shown to be expressed; the two exceptions were liver and spleen. Copyright © 2012 Elsevier B.V. All rights reserved.

  9. Molecular cloning and characterization of the MsHSP17.7 gene from Medicago sativa L.

    PubMed

    Li, Zhen-Yi; Long, Rui-Cai; Zhang, Tie-Jun; Yang, Qing-Chuan; Kang, Jun-Mei

    2016-08-01

    Heat shock proteins (HSPs) are ubiquitous protective proteins that play crucial roles in plant development and adaptation to stress, and the aim of this study is to characterize the HSP gene in alfalfa. Here we isolated a small heat shock protein gene (MsHSP17.7) from alfalfa by homology-based cloning. MsHSP17.7 contains a 477-bp open reading frame and encodes a protein of 17.70-kDa. The amino acid sequence shares high identity with MtHSP (93.98 %), PsHSP17.1 (83.13 %), GmHSP17.9 (74.10 %) and SlHSP17.6 (79.25 %). Phylogenetic analysis revealed that MsHSP17.7 belongs to the group of cytosolic class II small heat shock proteins (sHSP), and likely localizes to the cytoplasm. Quantitative RT-PCR indicated that MsHSP17.7 was induced by heat shock, high salinity, peroxide and drought stress. Prokaryotic expression indicated that the salt and peroxide tolerance of Escherichia coli was remarkably enhanced. Transgenic Arabidopsis plants overexpressing MsHSP17.7 exhibited increased root length of transgenic Arabidopsis lines under salt stress compared to the wild-type line. The malondialdehyde (MDA) levels in the transgenic lines were significantly lower than in wild-type, although proline levels were similar between transgenic and wild-type lines. MsHSP17.7 was induced by heat shock, high salinity, oxidative stress and drought stress. Overexpression analysis suggests that MsHSP17.7 might play a key role in response to high salinity stress.

  10. Molecular cloning, tissue expression of gene Muc2 in blunt snout bream Megalobrama amblycephala and regulation after re-feeding

    NASA Astrophysics Data System (ADS)

    Xue, Chunyu; Xi, Bingwen; Ren, Mingchun; Dong, Jingjing; Xie, Jun; Xu, Pao

    2015-03-01

    Mucins are important components of mucus, which form a natural, physical, biochemical and semipermeable mucosal layer on the epidermis of fish gills, skin, and the gastrointestinal tract. As the first step towards characterizing the function of Muc2, we cloned a partial Megalobrama amblycephala Muc2 cDNA of 2 175 bp, and analyzed its tissue-specific expression pattern by quantitative real-time PCR (qPCR). The obtained sequence comprised 41 bp 5'-untranslated region (5'-UTR), 2 134 bp open reading frame encoding a protein of 711 amino acids. BLAST searching and phylogenetic analysis showed that the predicted protein contained several common secreted mucin-module domains (VWD-C8-TIL-VWD-C8) and had high homology with mucins from other vertebrates. Among four candidate reference genes ( β- Actin, RPI13α, RPII, 18S) for the qPCR, RPII was chosen as an appropriate reference gene because of its lowest variation in different tissues. M. amblycephala Muc2 was mainly expressed in the intestine, in the order (highest to lowest) middle-intestine > fore-intestine > hind-intestine. Muc2 was expressed relatively poorly in other organs (brain, liver, kidney, spleen, skin and gill). Furthermore, after 20-days of starvation, M. amblycephala Muc2 expressions after refeeding for 0 h, 3 h, 16 h, 3 d, and 10 d were significantly decreased in the three intestinal segments ( P<0.05) at 16 h, and were then upregulated to near the initial level at 10 d.

  11. Molecular cloning and characterization of Siamese crocodile (Crocodylus siamensis) copper, zinc superoxide dismutase (CSI-Cu,Zn-SOD) gene.

    PubMed

    Sujiwattanarat, Penporn; Pongsanarakul, Parinya; Temsiripong, Yosapong; Temsiripong, Theeranan; Thawornkuno, Charin; Uno, Yoshinobu; Unajak, Sasimanas; Matsuda, Yoichi; Choowongkomon, Kiattawee; Srikulnath, Kornsorn

    2016-01-01

    Superoxide dismutase (SOD, EC 1.15.1.1) is an antioxidant enzyme found in all living cells. It regulates oxidative stress by breaking down superoxide radicals to oxygen and hydrogen peroxide. A gene coding for Cu,Zn-SOD was cloned and characterized from Siamese crocodile (Crocodylus siamensis; CSI). The full-length expressed sequence tag (EST) of this Cu,Zn-SOD gene (designated as CSI-Cu,Zn-SOD) contained 462bp encoding a protein of 154 amino acids without signal peptides, indicated as intracellular CSI-Cu,Zn-SOD. This agreed with the results from the phylogenetic tree, which indicated that CSI-Cu,Zn-SOD belonged to the intracellular Cu,Zn-SOD. Chromosomal location determined that the CSI-Cu,Zn-SOD was localized to the proximal region of the Siamese crocodile chromosome 1p. Several highly conserved motifs, two conserved signature sequences (GFHVHEFGDNT and GNAGGRLACGVI), and conserved amino acid residues for binding copper and zinc (His(47), His(49), His(64), His(72), His(81), Asp(84), and His(120)) were also identified in CSI-Cu,Zn-SOD. Real-time PCR analysis showed that CSI-Cu,Zn-SOD mRNA was expressed in all the tissues examined (liver, pancreas, lung, kidney, heart, and whole blood), which suggests a constitutively expressed gene in these tissues. Expression of the gene in Escherichia coli cells followed by purification yielded a recombinant CSI-Cu,Zn-SOD, with Km and Vmax values of 6.075mM xanthine and 1.4×10(-3)mmolmin(-1)mg(-1), respectively. This Vmax value was 40 times lower than native Cu,Zn-SOD (56×10(-3)mmolmin(-1)mg(-1)), extracted from crocodile erythrocytes. This suggests that cofactors, protein folding properties, or post-translational modifications were lost during the protein purification process, leading to a reduction in the rate of enzyme activity in bacterial expression of CSI-Cu,Zn-SOD. Copyright © 2015 Elsevier Inc. All rights reserved.

  12. Molecular cloning, phylogenetic analysis, and expression profiling of endoplasmic reticulum molecular chaperone BiP genes from bread wheat (Triticum aestivum L.).

    PubMed

    Zhu, Jiantang; Hao, Pengchao; Chen, Guanxing; Han, Caixia; Li, Xiaohui; Zeller, Friedrich J; Hsam, Sai L K; Hu, Yingkao; Yan, Yueming

    2014-10-01

    The endoplasmic reticulum chaperone binding protein (BiP) is an important functional protein, which is involved in protein synthesis, folding assembly, and secretion. In order to study the role of BiP in the process of wheat seed development, we cloned three BiP homologous cDNA sequences in bread wheat (Triticum aestivum), completed by rapid amplification of cDNA ends (RACE), and examined the expression of wheat BiP in wheat tissues, particularly the relationship between BiP expression and the subunit types of HMW-GS using near-isogenic lines (NILs) of HMW-GS silencing, and under abiotic stress. Sequence analysis demonstrated that all BiPs contained three highly conserved domains present in plants, animals, and microorganisms, indicating their evolutionary conservation among different biological species. Quantitative reverse transcription-polymerase chain reaction (qRT-PCR) revealed that TaBiP (Triticum aestivum BiP) expression was not organ-specific, but was predominantly localized to seed endosperm. Furthermore, immunolocalization confirmed that TaBiP was primarily located within the protein bodies (PBs) in wheat endosperm. Three TaBiP genes exhibited significantly down-regulated expression following high molecular weight-glutenin subunit (HMW-GS) silencing. Drought stress induced significantly up-regulated expression of TaBiPs in wheat roots, leaves, and developing grains. The high conservation of BiP sequences suggests that BiP plays the same role, or has common mechanisms, in the folding and assembly of nascent polypeptides and protein synthesis across species. The expression of TaBiPs in different wheat tissue and under abiotic stress indicated that TaBiP is most abundant in tissues with high secretory activity and with high proportions of cells undergoing division, and that the expression level of BiP is associated with the subunit types of HMW-GS and synthesis. The expression of TaBiPs is developmentally regulated during seed development and early seedling

  13. Molecular cloning and characterization of a novel soybean gene encoding a leucine-zipper-like protein induced to salt stress.

    PubMed

    Aoki, Ayako; Kanegami, Akemi; Mihara, Michiko; Kojima, Toshio; Shiraiwa, Masakazu; Takahara, Hidenari

    2005-08-15

    To understand molecular responses to salt stress in soybean (Glycine max [L.] Merr.), we identified 106 salt-inducible soybean genes that expressed differentially at 72 h after 100 mM NaCl treatment using the cDNA-amplified fragment length polymorphism (AFLP) method. The genes were designated as G. max Transcript-Derived Fragments (GmTDFs). Among these genes, we characterized a soybean gene GmTDF-5 that encoded an unknown protein of 367 amino acids. The GmTDF-5 protein was a putative cytosolic protein with two leucine-zipper motifs at the N-terminal and was calculated as 40.7 kDa. Southern blot analysis indicated that GmTDF-5 presents as an intron-less single gene on soybean genome and possibly distributes narrowly throughout the higher plants. By 100 mM NaCl treatment, the gene expression of GmTDF-5 was induced in the stem and lower-expanded leaf, and the amount of mRNA increased 5.1- and 2.0-fold up to 72 h, respectively. Interestingly, GmTDF-5 expression in the upper-leaf appeared dramatically with 10.0-fold increase at 72 h after the salt stress, but not until 48 h. Hyperosmotic pressure (mannitol treatment) and dehydration also caused the increases similar to NaCl treatment in the levels of GmTDF-5 expression. These results suggest that GmTDF-5 might be a novel cytosolic leucine-zipper-like protein functioning in mature organs of soybean shoot against water-potential changes.

  14. Molecular cloning and characterization of GhNPR1, a gene implicated in pathogen responses from cotton (Gossypium hirsutum L.).

    PubMed

    Zhang, Ying; Wang, Xia; Cheng, Cheng; Gao, Qiuqiang; Liu, Jingyun; Guo, Xingqi

    2008-02-01

    A novel gene, designated as GhNPR1 (Gossypium hirsutum non-expressor of pathogenesis-related genes 1), was isolated from G. hirsutum (cotton) by RT-PCR (reverse transcription-PCR) and RACE (rapid amplification of cDNA ends). The full-length cDNA was 2108 bp long and had an ORF (open reading frame) that putatively encoded a polypeptide of 592 amino acids, with a predicted molecular mass of 66 kDa. Comparison of this protein sequence with that of Arabidopsis thaliana, Brassica juncea and Nicotiana tabacum showed that the amino-acid homology was 52.98, 52.32 and 54.98% respectively. Analysis of the exon-intron structure of the GhNPR1 gene showed that GhNPR1 consisted of four exons and three introns. Southern-blot analysis revealed that the GhNPR1 was a single-copy gene in cotton. Northern-blot analysis indicated that GhNPR1 was constitutively expressed in all tested tissues, including roots, stems and leaves, with the high expression in stems and leaves. In addition, GhNPR1 was also found to be induced by signalling molecules for plant defence responses, such as methyl jasmonate, salicylic acid and ethylene, as well as attack by pathogens, such as Fusarium oxysporum and Xanthomonas campestris. These results suggest that GhNPR1 may play an important role in the response to pathogen infections in cotton plants.

  15. Molecular cloning and functional analysis of the gene encoding 3-hydroxy-3-methylglutaryl coenzyme A reductase from hazel (Corylus avellana L. Gasaway).

    PubMed

    Wang, Yechun; Guo, Binhui; Zhang, Fei; Yao, Hongyan; Miao, Zhiqi; Tang, Kexuan

    2007-11-30

    The enzyme 3-hydroxy-3-methylglutaryl-CoA reductase (HMGR; EC1.1.1.34) catalyzes the first committed step of isoprenoids biosynthesis in MVA pathway. Here we report for the first time the cloning and characterization of a full-length cDNA encoding HMGR (designated as CgHMGR, GenBank accession number EF206343) from hazel (Corylus avellana L. Gasaway), a taxol-producing plant species. The full-length cDNA of CgHMGR was 2064 bp containing a 1704-bp ORF encoding 567 amino acids. Bioinformatic analyses revealed that the deduced CgHMGR had extensive homology with other plant HMGRs and contained two transmembrane domains and a catalytic domain. The predicted 3-D model of CgHMGR had a typical spatial structure of HMGRs. Southern blot analysis indicated that CgHMGR belonged to a small gene family. Expression analysis revealed that CgHMGR expressed high in roots, and low in leaves and stems, and the expression of CgHMGR could be up-regulated by methyl jasmonate (MeJA). The functional color assay in Escherichia coli showed that CgHMGR could accelerate the biosynthesis of beta-carotene, indicating that CgHMGR encoded a functional protein. The cloning, characterization and functional analysis of CgHMGR gene will enable us to further understand the role of CgHMGR involved in taxol biosynthetic pathway in C. avellana at molecular level.

  16. Molecular cloning, computational analysis and expression pattern of forkhead box l2 (Foxl2) gene in catfish.

    PubMed

    Bhat, Irfan Ahmad; Rather, Mohd Ashraf; Dar, Jaffer Yousuf; Sharma, Rupam

    2016-10-01

    Foxl2 belongs to forkhead/HNF-3-related family of transcription factors which is involved in ovarian differentiation and development. In present study, the Foxl2 mRNA was cloned from ovary of C. batrachus. The full length cDNA sequence of the Foxl2 was 1056bp which consists of 5' (41bp) and 3' (106bp) non-coding regions, as well as a 909bp of open reading frame (ORF) that encodes 302 amino acids. The putative protein was having the theoretical molecular weight (MW) of 34.018kD and a calculated isoelectric point (pI) of 9.38. There were 11 serine (Ser), 5 threonine (Thr), and 5 tyrosine (Tyr) phosphorylation sites and 2 putative N-glycosylation sites on the predicted protein. The ligand binding sites were predicted to be present on amino acids 42, 49, 50, 91, 92 and 95 respectively. The signal peptide analysis predicted that C. batrachus Foxl2 is a non-secretory protein. The hydropathy profile of Foxl2 protein revealed that this protein is hydrophilic in nature. Protein-protein interaction demonstrated that Foxl2 protein chiefly interacts with cytochrome P450 protein family. The mRNA transcript analysis of various tissues indicated that the C. batrachus Foxl2 mRNA was more expressed in the brain, pituitary and ovary in female while, the former two tissues and testis showed low expression in male. This study provides a basis for further structural and functional exploration of the Foxl2 from C. batrachus, including its deduced protein and its signal transduction function. Copyright © 2016 Elsevier Ltd. All rights reserved.

  17. First molecular cloning and gene expression analysis of teleost CD42 (glycoprotein Ib beta chain) GPIb-IX-V subunit from rock bream, Oplegnathus fasciatus.

    PubMed

    Jeong, Ji-Min; Kim, Ju-Won; Kim, Do-Hyung; Park, Chan-Il

    2015-04-01

    CD42 is a platelet membrane glycoprotein Ib that plays a key role in haemostasis and thrombin-induced platelet activation. Here, we report the molecular cloning and sequence analysis of the CD42c gene from rock bream (Oplegnathus fasciatus). Rock bream CD42 (RbCD42c) gene expression profiles were determined after infection with Streptococcus iniae, Edwardsiella tarda and red seabream iridovirus (RSIV). The full-length RbCD42c cDNA contained an open reading frame of 624 bp encoding 207 amino acids. The deduced amino acid sequences of the leucine-rich repeat (LRR)-N terminal and LRR-C terminal were conserved between fish and mammals. RbCD42c was highly expressed in red blood cells, spleen, gill, liver and kidney of healthy rock bream. The RbCD42c gene was not significantly up- or downregulated after E. tarda exposure. However, RbCD42c gene expression was upregulated in kidney, spleen and gill after S. iniae infection. RbCD42c was upregulated in spleen, liver and gill, but downregulated in kidney 24 and 48 h after RSIV infection. These results suggest that RbCD42c has different expression patterns after infection with bacterial or viral pathogens. This gene may be directly involved in haemostasis.

  18. Molecular Cloning and Characterization of Three Genes Encoding Dihydroflavonol-4-Reductase from Ginkgo biloba in Anthocyanin Biosynthetic Pathway

    PubMed Central

    Hua, Cheng; Linling, Li; Shuiyuan, Cheng; Fuliang, Cao; Feng, Xu; Honghui, Yuan; Conghua, Wu

    2013-01-01

    Dihydroflavonol-4-reductase (DFR, EC1.1.1.219) catalyzes a key step late in the biosynthesis of anthocyanins, condensed tannins (proanthocyanidins), and other flavonoids important to plant survival and human nutrition. Three DFR cDNA clones (designated GbDFRs) were isolated from the gymnosperm Ginkgo biloba. The deduced GbDFR proteins showed high identities to other plant DFRs, which form three distinct DFR families. Southern blot analysis showed that the three GbDFRs each belong to a different DFR family. Phylogenetic tree analysis revealed that the GbDFRs share the same ancestor as other DFRs. The expression of the three recombinant GbDFRs in Escherichia coli showed that their actual protein sizes were in agreement with predictions from the cDNA sequences. The recombinant proteins were purified and their activity was analyzed; both GbDFR1 and GbDFR3 could catalyze dihydroquercetin conversion to leucocyanidin, while GbDFR2 catalyzed dihydrokaempferol conversion to leucopelargonidin. qRT-PCR showed that the GbDFRs were expressed in a tissue-specific manner, and transcript accumulation for the three genes was highest in young leaves and stamens. These transcription patterns were in good agreement with the pattern of anthocyanin accumulation in G.biloba. The expression profiles suggested that GbDFR1 and GbDFR2 are mainly involved in responses to plant hormones, environmental stress and damage. During the annual growth cycle, the GbDFRs were significantly correlated with anthocyanin accumulation in leaves. A fitted linear curve showed the best model for relating GbDFR2 and GbDFR3 with anthocyanin accumulation in leaves. GbDFR1 appears to be involved in environmental stress response, while GbDFR3 likely has primary functions in the synthesis of anthocyanins. These data revealed unexpected properties and differences in three DFR proteins from a single species. PMID:23991027

  19. Molecular cloning of novel antimicrobial peptide genes from the skin of the Chinese brown frog, Rana chensinensis.

    PubMed

    Zhao, Jie; Sun, Yan; Li, Zhi; Su, Qi

    2011-02-01

    One species of the Chinese brown frog, Rana chensinensis, is widely distributed in north-central China. In this study, a cDNA library was constructed to clone the antimicrobial peptides' genes from the skin of R. chensinensis. Twenty-three prepropeptide cDNA sequences encoding twelve novel mature antimicrobial peptides were isolated and characterized. Six peptides belonged to three known families previously identified from other Ranid frogs: temporin (4 peptides), brevinin-2 (1 peptide), and palustrin-2 (1 peptide). The other six peptides showed little similarity to known antimicrobial peptides. According to the amino acid sequences, with or without α-helix structure, and either hydrophilic or hydrophobic, these were organized into four new families: chensinin-1 (3 peptides), chensinin-2 (1 peptide), chensinin-3 (1 peptide), and chensinin-4 (1 peptide). Five peptides from different families were chemically synthesized, and their antimicrobial, cytolytic, and hemolytic activities were evaluated. Of these, brevinin-2CE showed strongest antimicrobial activities against both the Gram-positive and Gram-negative bacteria with a slight hemolysis. Temporin-1CEe and palustrin-2CE also displayed a slight hemolysis, but they had different activities to prokaryotic cells. Temporin-1CEe showed higher antimicrobial activity against Gram-positive bacteria than Gram-negative bacteria, whereas it was contrary to palustrin-2CE. Chensinin-1 CEb and chensinin-3CE only had moderate antimicrobial activity against microorganisms. In addition, the brevinin-2 peptides from different brown frogs were analyzed to reveal the taxonomy and phylogenetic relationships of R. chensinensis.

  20. Molecular cloning and expression of a gene that controls the high-temperature regulon of Escherichia coli.

    PubMed Central

    Neidhardt, F C; VanBogelen, R A; Lau, E T

    1983-01-01

    The high-temperature production (HTP) regulon of Escherichia coli consists of a set of operons that are induced coordinately by a shift to a high temperature under the control of a single chromosomal gene called htpR or hin. To identify more components of this regulon, the rates of synthesis of many polypeptides resolved on two-dimensional polyacrylamide gels were measured in various strains by pulse-labeling after a temperature shift-up. A total of 13 polypeptides were found to be heat inducible only in cells bearing a normal htpR gene on the chromosome or on a plasmid; on this basis these polypeptides were designated products of the HTP regulon. Several hybrid plasmids that contain segments of the E. coli chromosome in the 75-min region were found to carry the htpR gene. A restriction map of this region was constructed, and selected fragments were subcloned and tested for the ability to complement an htpR mutant. The polypeptides encoded by these fragments were detected by permitting expression in maxicells, minicells, and chloramphenicol-treated cells. Complementation was accompanied by production of a polypeptide having a molecular weight of approximately 33,000. This polypeptide, designated F33.4, was markedly reduced in amount in an htpR mutant expected to contain very little htpR gene product. Polypeptide F33.4 is postulated to be the product of htpR and to be an effector that controls heat induction of the HTP regulon. Images PMID:6337122

  1. Molecular Cloning, Expression, and Characterization of the Genes Encoding the Two Essential Protein Components of Micrococcus luteus B-P 26 Hexaprenyl Diphosphate Synthase

    PubMed Central

    Shimizu, Naoto; Koyama, Tanetoshi; Ogura, Kyozo

    1998-01-01

    The structural genes encoding the two essential components A and B of hexaprenyl diphosphate synthase, which produce the precursor of the prenyl side chain of menaquinone-6, were cloned from Micrococcus luteus B-P 26. PMID:9515931

  2. Molecular cloning of the Matrix Gla Protein gene from Xenopus laevis. Functional analysis of the promoter identifies a calcium sensitive region required for basal activity.

    PubMed

    Conceição, Natércia; Henriques, Nuno M; Ohresser, Marc C P; Hublitz, Philip; Schüle, Roland; Cancela, M Leonor

    2002-04-01

    To analyze the regulation of Matrix Gla Protein (MGP) gene expression in Xenopus laevis, we cloned the xMGP gene and its 5' region, determined their molecular organization, and characterized the transcriptional properties of the core promoter. The Xenopus MGP (xMGP) gene is organized into five exons, one more as its mammalian counterparts. The first two exons in the Xenopus gene encode the DNA sequence that corresponds to the first exon in mammals whereas the last three exons show homologous organization in the Xenopus MGP gene and in the mammalian orthologs. We characterized the transcriptional regulation of the xMGP gene in transient transfections using Xenopus A6 cells. In our assay system the identified promoter was shown to be transcriptionally active, resulting in a 12-fold induction of reporter gene expression. Deletional analysis of the 5' end of the xMGP promoter revealed a minimal activating element in the sequence from -70 to -36 bp. Synthetic reporter constructs containing three copies of the defined regulatory element delivered 400-fold superactivation, demonstrating its potential for the recruitment of transcriptional activators. In gel mobility shift assays we demonstrate binding of X. laevis nuclear factors to an extended regulatory element from -180 to -36, the specificity of the interaction was proven in competition experiments using different fragments of the xMGP promoter. By this approach the major site of factor binding was demonstrated to be included in the minimal activating promoter fragment from -70 to -36 bp. In addition, in transient transfection experiments we could show that this element mediates calcium dependent transcription and increasing concentrations of extracellular calcium lead to a significant dose dependent activation of reporter gene expression.

  3. Molecular cloning and expression of a mammalian homologue of a translationally controlled tumor protein (TCTP) gene from Penaeus monodon shrimp.

    PubMed

    Bangrak, Phuwadol; Graidist, Potchanapond; Chotigeat, Wilaiwan; Phongdara, Amornrat

    2004-03-18

    White spot syndrome, caused by white spot syndrome virus (WSSV), is a deadly disease of shrimps, causing a catastrophic loss in shrimp industries worldwide. In order to investigate molecular response of shrimp haemocyte to WSSV infection, we performed subtraction hybridization of mRNAs from healthy and WSSV-infected haemocyte. One of the genes that were severely down-regulated in moribund WSSV-infected-haemocyte was translationally controlled tumor protein (TCTP) (or fortilin). Strikingly, while there was a slight difference in the amount of TCTP message between normal and early WSSV-infected shrimps, shrimps that exhibited severe symptoms uniformly had very little TCTP in their haemocyte. Taken together with the fact that TCTP functions as an anti-apoptotic protein in mammals, our data suggest that TCTP in shrimp protects WSSV-infected shrimps from death.

  4. Molecular cloning and characterization of multidomain xylanase from manure library

    USDA-ARS?s Scientific Manuscript database

    The gene (manf-x10) encoding xylanase from an environmental genomic DNA library was cloned and expressed in Escherichia coli. The encoded enzyme was predicted to be 467 amino acids with a molecular mass of 50.3 kD. The recombinant ManF-X10 was purified by HisTrap affinity column and showed activit...

  5. Molecular cloning and characterization of a gene encoding RING zinc finger ankyrin protein from drought-tolerant Artemisia desertorum.

    PubMed

    Yang, Xiuhong; Sun, Chao; Hu, Yuanlei; Lin, Zhongping

    2008-03-01

    A RING zinc finger ankyrin protein gene,designated AdZFP1, was isolated from drought-tolerant Artemisia desertorum Spreng by mRNA differential display and RACE. Its cDNA was 1723 bp and encoded a putative protein of 445 amino acids with a predicted molecular mass of 47.9 kDa and an isoelectric point (pI) of 7.49. A typical C3HC4- type RING finger domain was found at the C-terminal region of the AdZFP1 protein,and several groups of ankyrin repeats were found at the N-terminal region. Alignments of amino acid sequence showed that AdZFP1 was 66% identical to the Arabidopsis thaliana putative RING zinc finger ankyrin protein AAN31869. Transcriptional analysis showed that AdZFP1 was inducible under drought stress in root,stem and leaf of the plant.Semi-quantitative reverse- transcriptase-polymerase chain reaction (RT-PCR) analysis showed that the transcript of AdZFP1 was strongly induced by exogenous abscisic acid (ABA) and also by salinity,cold and heat to some extent. Overexpression of the AdZFP1 gene in transgenic tobacco enhanced their tolerance to drought stress.

  6. Molecular cloning and evolutionary analysis of captive forest musk deer bitter taste receptor gene T2R16.

    PubMed

    Zhao, G J; Wu, N; Li, D Y; Zeng, D J; Chen, Q; Lu, L; Feng, X L; Zhang, C L; Zheng, C L; Jie, H

    2015-12-08

    Sensing bitter tastes is crucial for most animals because it can prevent them from ingesting harmful food. This process is mainly mediated by the bitter taste receptors (T2R) that are largely expressed in the taste buds. Previous studies have identified some T2R gene repertoires. Marked variation in repertoire size has been noted among species. However, research on T2Rs is still limited and the mechanisms underlying the evolution of vertebrate T2Rs remain poorly understood. In the present study, we analyzed the structure and features of the protein encoded by the forest musk deer (Moschus berezovskii) T2R16 and submitted the gene sequence to NCBI GenBank. The results showed that the full coding DNA sequence (CDS) of musk deer T2R16 (GenBank accession No. KP677279) was 906 bp, encoding 301 amino acids, which contained ATG start codon and TGA stop codon, with a calculated molecular weight of 35.03 kDa and an isoelectric point of 9.56. The T2R16 protein receptor had seven conserved transmembrane regions. Hydrophobicity analysis showed that most amino acid residues in T2R16 protein were hydrophobic, and the grand average of hydrophobicity (GRAVY) was 0.657. Phylogenetic analysis based on this gene revealed that forest musk deer had the closest association with sheep (Ovis aries), as compared to cow (Bos taurus), Tursiops truncatus, and other species, whereas it was genetically farthest from humans (Homo sapiens). We hope these results would complement the existing data on T2R16 and encourage further research in this respect.

  7. Molecular cloning and transcriptional activity of a new Petunia calreticulin gene involved in pistil transmitting tract maturation, progamic phase, and double fertilization.

    PubMed

    Lenartowski, Robert; Suwińska, Anna; Prusińska, Justyna; Gumowski, Krzysztof; Lenartowska, Marta

    2014-02-01

    Calreticulin (CRT) is a highly conserved and ubiquitously expressed Ca²⁺-binding protein in multicellular eukaryotes. As an endoplasmic reticulum-resident protein, CRT plays a key role in many cellular processes including Ca²⁺ storage and release, protein synthesis, and molecular chaperoning in both animals and plants. CRT has long been suggested to play a role in plant sexual reproduction. To begin to address this possibility, we cloned and characterized the full-length cDNA of a new CRT gene (PhCRT) from Petunia. The deduced amino acid sequence of PhCRT shares homology with other known plant CRTs, and phylogenetic analysis indicates that the PhCRT cDNA clone belongs to the CRT1/CRT2 subclass. Northern blot analysis and fluorescent in situ hybridization were used to assess PhCRT gene expression in different parts of the pistil before pollination, during subsequent stages of the progamic phase, and at fertilization. The highest level of PhCRT mRNA was detected in the stigma-style part of the unpollinated pistil 1 day before anthesis and during the early stage of the progamic phase, when pollen is germinated and tubes outgrow on the stigma. In the ovary, PhCRT mRNA was most abundant after pollination and reached maximum at the late stage of the progamic phase, when pollen tubes grow into the ovules and fertilization occurs. PhCRT mRNA transcripts were seen to accumulate predominantly in transmitting tract cells of maturing and receptive stigma, in germinated pollen/growing tubes, and at the micropylar region of the ovule, where the female gametophyte is located. From these results, we suggest that PhCRT gene expression is up-regulated during secretory activity of the pistil transmitting tract cells, pollen germination and outgrowth of the tubes, and then during gamete fusion and early embryogenesis.

  8. Analysis of the ergosterol biosynthesis pathway cloning, molecular characterization and phylogeny of lanosterol 14 α-demethylase (ERG11) gene of Moniliophthora perniciosa

    PubMed Central

    de Oliveira Ceita, Geruza; Vilas-Boas, Laurival Antônio; Castilho, Marcelo Santos; Carazzolle, Marcelo Falsarella; Pirovani, Carlos Priminho; Selbach-Schnadelbach, Alessandra; Gramacho, Karina Peres; Ramos, Pablo Ivan Pereira; Barbosa, Luciana Veiga; Pereira, Gonçalo Amarante Guimarães; Góes-Neto, Aristóteles

    2014-01-01

    The phytopathogenic fungus Moniliophthora perniciosa (Stahel) Aime & Philips-Mora, causal agent of witches’ broom disease of cocoa, causes countless damage to cocoa production in Brazil. Molecular studies have attempted to identify genes that play important roles in fungal survival and virulence. In this study, sequences deposited in the M. perniciosa Genome Sequencing Project database were analyzed to identify potential biological targets. For the first time, the ergosterol biosynthetic pathway in M. perniciosa was studied and the lanosterol 14α-demethylase gene (ERG11) that encodes the main enzyme of this pathway and is a target for fungicides was cloned, characterized molecularly and its phylogeny analyzed. ERG11 genomic DNA and cDNA were characterized and sequence analysis of the ERG11 protein identified highly conserved domains typical of this enzyme, such as SRS1, SRS4, EXXR and the heme-binding region (HBR). Comparison of the protein sequences and phylogenetic analysis revealed that the M. perniciosa enzyme was most closely related to that of Coprinopsis cinerea. PMID:25505843

  9. Molecular cloning and characterization of a human cDNA and gene encoding a novel acid ceramidase-like protein.

    PubMed

    Hong, S B; Li, C M; Rhee, H J; Park, J H; He, X; Levy, B; Yoo, O J; Schuchman, E H

    1999-12-01

    Computer-assisted database analysis of sequences homologous to human acid ceramidase (ASAH) revealed a 1233-bp cDNA (previously designated cPj-LTR) whose 266-amino-acid open reading frame had approximately 36% identity with the ASAH polypeptide. Based on this high degree of homology, we undertook further molecular characterization of cPj-LTR and now report the full-length cDNA sequence, complete gene structure (renamed human ASAHL since it is a human acid ceramidase-like sequence), chromosomal location, primer extension and promoter analysis, and transient expression results. The full-length human ASAHL cDNA was 1825 bp and contained an open-reading frame encoding a 359-amino-acid polypeptide that was 33% identical and 69% similar to the ASAH polypeptide over its entire length. Numerous short regions of complete identity were observed between these two sequences and two sequences obtained from the Caenorhabditis elegans genome database. The 30-kb human ASAHL genomic sequence contained 11 exons, which ranged in size from 26 to 671 bp, and 10 introns, which ranged from 150 bp to 6.4 kb. The gene was localized to the chromosomal region 4q21.1 by fluorescence in situ hybridization analysis. Northern blotting experiments revealed a major 2.0-kb ASAHL transcript that was expressed at high levels in the liver and kidney, but at relatively low levels in other tissues such as the lung, heart, and brain. Sequence analysis of the 5'-flanking region of the human ASAHL gene revealed a putative promoter region that lacked a TATA box and was GC rich, typical features of a housekeeping gene promoter, as well as several tissue-specific and/or hormone-induced transcription regulatory sites. 5'-Deletion analysis localized the promoter activity to a 1. 1-kb fragment within this region. A major transcription start site also was located 72 bp upstream from the ATG translation initiation site by primer extension analysis. Expression analysis of a green fluorescence protein/ASAHL fusion

  10. Molecular cloning of the human UMP synthase gene and characterization of point mutations in two hereditary orotic aciduria families.

    PubMed Central

    Suchi, M; Mizuno, H; Kawai, Y; Tsuboi, T; Sumi, S; Okajima, K; Hodgson, M E; Ogawa, H; Wada, Y

    1997-01-01

    Uridine monophosphate (UMP) synthase is a bifunctional enzyme catalyzing the last two steps of de novo pyrimidine biosynthesis, orotate phosphoribosyltransferase (OPRT) and orotidine-5'-monophosphate decarboxylase (ODC). Loss of either enzymatic activity results in hereditary orotic aciduria, a rare autosomal recessive disorder characterized by retarded growth, anemia, and excessive urinary excretion of orotic acid. We have isolated the UMP synthase chromosomal gene from a lambdaEMBL-3 human genomic library and report a single-copy gene spanning approximately 15 kb. The UMP synthase genomic structure encodes six exons ranging in size from 115 bp to 672 bp, and all splicing junctions adhere to the canonical GT/AG rule. Cognate promoter elements implicated in glucocorticoid- and cAMP-mediated regulation as well as in liver-, myeloid-, and lymphocyte-specific expression are located within the 5' flanking sequence. Molecular investigation of UMP synthase deficiency in a Japanese orotic aciduria patient revealed mutations R96G (A-to-G transition; nt 286) and G429R (G-to-C transversion; nt 1285) in one allele and V109G (T-to-G transversion; nt 326) in the other allele. Expression of human UMP synthase cDNAs containing these mutations in pyrimidine auxotrophic Escherichia coli and in recombinant baculovirus-infected Sf21 cells demonstrates impaired activity presumably associated with the urinary orotic acid substrate accumulations observed in vivo. We further establish the identity of two polymorphisms, G213A (v = .26) and 440Gpoly (v = .27) located in exons 3 and 6, respectively, which did not significantly compromise either OPRT or ODC function. Images Figure 1 Figure 4 Figure 5 PMID:9042911

  11. Molecular Cloning, Sequencing, and Expression in Escherichia coli of the Gene Encoding a Novel 5-Oxoprolinase without ATP-Hydrolyzing Activity from Alcaligenes faecalis N-38A

    PubMed Central

    Nishimura, Atsuhisa; Oyama, Hiroshi; Hamada, Takatoshi; Nobuoka, Katsunori; Shin, Takashi; Murao, Sawao; Oda, Kohei

    2000-01-01

    The gene encoding a novel 5-oxoprolinase without ATP-hydrolyzing activity from Alcaligenes faecalis N-38A was cloned and characterized. The coding region of this gene is 1,299 bp long. The predicted primary protein is composed of 433 amino acid residues, with a 31-amino-acid signal peptide. The mature protein is composed of 402 amino acid residues with a molecular mass of 46,163 Da. The derived amino acid sequence of the enzyme showed no significant sequence similarity to any other proteins reported so far. The 5-oxoprolinase gene was expressed in Escherichia coli by using a regulatory expression system with an isopropyl-β-d-thiogalactopyranoside-inducible tac promoter, and its expression level was approximately 16 mg per liter. The purified enzyme has the same characteristics as the authentic enzyme, except for the amino terminus, which has three additional amino acids. The enzyme was markedly inhibited by p-chloromercuribenzoic acid, EDTA, o-phenanthroline, HgCl2, and CuSO4. The EDTA-inactivated enzyme was completely restored by the addition of Zn2+ or Co2+. In addition, the enzyme was found to contain 1 g-atom of zinc per mol of protein. These results suggest that the 5-oxoprolinase produced by A. faecalis N-38A is a zinc metalloenzyme. PMID:10919770

  12. Molecular cloning and characterization of amh, dax1 and cyp19a1a genes and their response to 17α-methyltestosterone in Pengze crucian carp.

    PubMed

    Li, Meng; Wang, Lihong; Wang, Houpeng; Liang, Hongwei; Zheng, Yao; Qin, Fang; Liu, Shaozhen; Zhang, Yingying; Wang, Zaizhao

    2013-05-01

    The proteins encoded by amh, dax1 and cyp19a1a play important roles in gonad differentiation. Their functions have been far less studied in teleosts. In this study, the full-length cDNAs of amh, dax1 and cyp19a1a were cloned and characterized in a triploid gynogenic fish, the Pengze crucian carp. Their expression profilings in juvenile development, adult tissues and juveniles exposed to 100 ng/L 17α-methyltestosterone (MT) were investigated. Results showed that their putative proteins shared high identities to their counterparts in cyprinid fish species, respectively. The tissue distribution results indicated that amh and cyp19a1a were predominantly expressed in the ovary and dax1 was dominantly expressed in the liver. Gene profiling in the developmental stages showed that all the three target genes had a consistent highest expression at 48 days post hatching (dph). The period of 48 dph appeared to be a key time during the process of the gonad development of Pengze crucian carp. 100 ng/L MT significantly increased the mRNA expression of amh at 2- and 4-week exposures and enhanced dax1 and cyp19a1a at 6-week exposure. The present study indicated that MT could influence the gonad development in Pengze crucian carp by disturbing sex-differentiation associated gene expression. Furthermore, the present study will be of great significance to broaden the understanding of molecular mechanisms of the physiological processes of reproduction in fish.

  13. Cloning of rat homeobox genes

    SciTech Connect

    Sakoyama, Yasuhiko; Mizuta, Ikuko; Ogasawara, Naotake

    1994-10-01

    We report the isolation of nine rat cognates of mouse homeoboxes within the four Hox gene clusters and a rat homologue of mouse IPF1 homeobox, RHbox No. 13A. The sequences of nine cloned homeoboxes are highly similar to those of the mouse and human homeoboxes in the Hox clusters. The restriction enzyme sites and map distances between each of the homeoboxes on the rat genome are nearly identical to those of mouse and human. Thus, we conclude that the isolated homeoboxes are the rat homologues of mouse homeoboxes within the four Hox clusters. A novel homeobox RHbox No. 13A is different from the Drosophila Antennapedia (Antp) sequence but is highly similar to the XlHbox8 (Xenopus laevis) and HtrA2 (Helobdella triserialis) homeoboxes. Forty-two amino acids of the last two-thirds of the RHbox No. 13A, XlHbox8, and mouse IPF1 homeodomains completely matched. In addition, these four homeodomains contain a unique His residue in the recognition helix of a helix-turn-helix DNA-binding motif. This His residue is not found in any of the previously published mammalian homeodomain sequences except mouse IPF1. 24 refs., 4 figs.

  14. Molecular cloning, nucleotide sequencing, and expression of genes encoding alcohol dehydrogenases from the thermophile Thermoanaerobacter brockii and the mesophile Clostridium beijerinckii.

    PubMed

    Peretz, M; Bogin, O; Tel-Or, S; Cohen, A; Li, G; Chen, J S; Burstein, Y

    1997-08-01

    Proteins play a pivotal role in thermophily. Comparing the molecular properties of homologous proteins from thermophilic and mesophilic bacteria is important for understanding the mechanisms of microbial adaptation to extreme environments. The thermophile Thermoanaerobacter (Thermoanaerobium) brockii and the mesophile Clostridium beijerinckii contain an NADP(H)-linked, zinc-containing secondary alcohol dehydrogenase (TBADH and CBADH) showing a similarly broad substrate range. The structural genes encoding the TBADH and the CBADH were cloned, sequenced, and highly expressed in Escherichia coli. The coding sequences of the TB adh and the CB adh genes are, respectively, 1056 and 1053 nucleotides long. The TB adh gene encoded an amino acid sequence identical to that of the purified TBADH. Alignment of the deduced amino acid sequences of the TB and CB adh genes showed a 76% identity and a 86% similarity, and the two genes had a similar preference for codons with A or T in the third position. Multiple sequence alignment of ADHs from different sources revealed that two (Cys-46 and His-67) of the three ligands for the catalytic Zn atom of the horse-liver ADH are preserved in TBADH and CBADH. Both the TBADH and CBADH were homotetramers. The substrate specificities and thermostabilities of the TBADH and CBADH expressed inE. coli were identical to those of the enzymes isolated from T. brockii and C. beijerinckii, respectively. A comparison of the amino acid composition of the two ADHs suggests that the presence of eight additional proline residues in TBADH than in CBADH and the exchange of hydrophilic and large hydrophobic residues in CBADH for the small hydrophobic amino acids Pro, Ala, and Val in TBADH might contribute to the higher thermostability of the T. brockii enzyme.

  15. Molecular Cloning, Characterization, and Expression of MiSOC1: A Homolog of the Flowering Gene SUPPRESSOR OF OVEREXPRESSION OF CONSTANS1 from Mango (Mangifera indica L).

    PubMed

    Wei, Junya; Liu, Debing; Liu, Guoyin; Tang, Jie; Chen, Yeyuan

    2016-01-01

    MADS-box transcription factor plays a crucial role in plant development, especially controlling the formation and development of floral organs. Mango (Mangifera indica L) is an economically important fruit crop, but its molecular control of flowering is largely unknown. To better understand the molecular basis of flowering regulation in mango, we isolated and characterized the MiSOC1, a putative mango orthologs for the Arabidopsis SUPPRESSOR OF OVEREXPRESSION OF CONSTANS1/AGAMOUS-LIKE 20 (SOC1/AGL20) with homology-based cloning and RACE. The full-length cDNA (GenBank accession No.: KP404094) is 945 bp in length including a 74 bp long 5' UTR and a 189 bp long 3' UTR and the open reading frame was 733 bps, encoding 223 amino acids with molecular weight 25.6 kD. Both sequence alignment and phylogenetic analysis all indicated that deduced protein contained a conservative MADS-box and semi-conservative K domain and belonged to the SOC1/TM3 subfamily of the MADS-box family. Quantitative real-time PCR was performed to investigate the expression profiles of MiSOC1 gene in different tissues/organs including root, stem, leaves, flower bud, and flower. The result indicated MiSOC1 was widely expressed at different levels in both vegetative and reproductive tissues/organs with the highest expression level in the stems' leaves and inflorescences, low expression in roots and flowers. The expression of MiSOC1 in different flower developmental stages was different while same tissue -specific pattern among different varieties. In addition, MiSOC1 gene expression was affect by ethephon while high concentration ethephon inhibit the expression of MiSOC1. Overexpression of MiSOC1 resulted in early flowering in Arabidopsis. In conclusion, these results suggest that MiSOC1 may act as induce flower function in mango.

  16. Molecular Cloning, Characterization, and Expression of MiSOC1: A Homolog of the Flowering Gene SUPPRESSOR OF OVEREXPRESSION OF CONSTANS1 from Mango (Mangifera indica L)

    PubMed Central

    Wei, Junya; Liu, Debing; Liu, Guoyin; Tang, Jie; Chen, Yeyuan

    2016-01-01

    MADS-box transcription factor plays a crucial role in plant development, especially controlling the formation and development of floral organs. Mango (Mangifera indica L) is an economically important fruit crop, but its molecular control of flowering is largely unknown. To better understand the molecular basis of flowering regulation in mango, we isolated and characterized the MiSOC1, a putative mango orthologs for the Arabidopsis SUPPRESSOR OF OVEREXPRESSION OF CONSTANS1/AGAMOUS-LIKE 20 (SOC1/AGL20) with homology-based cloning and RACE. The full-length cDNA (GenBank accession No.: KP404094) is 945 bp in length including a 74 bp long 5′ UTR and a 189 bp long 3′ UTR and the open reading frame was 733 bps, encoding 223 amino acids with molecular weight 25.6 kD. Both sequence alignment and phylogenetic analysis all indicated that deduced protein contained a conservative MADS-box and semi-conservative K domain and belonged to the SOC1/TM3 subfamily of the MADS-box family. Quantitative real-time PCR was performed to investigate the expression profiles of MiSOC1 gene in different tissues/organs including root, stem, leaves, flower bud, and flower. The result indicated MiSOC1 was widely expressed at different levels in both vegetative and reproductive tissues/organs with the highest expression level in the stems’ leaves and inflorescences, low expression in roots and flowers. The expression of MiSOC1 in different flower developmental stages was different while same tissue –specific pattern among different varieties. In addition, MiSOC1 gene expression was affect by ethephon while high concentration ethephon inhibit the expression of MiSOC1. Overexpression of MiSOC1 resulted in early flowering in Arabidopsis. In conclusion, these results suggest that MiSOC1 may act as induce flower function in mango. PMID:27965680

  17. Molecular cloning and characterization of two novel genes from hexaploid wheat that encode double PR-1 domains coupled with a receptor-like protein kinase

    USDA-ARS?s Scientific Manuscript database

    Hexaploid wheat (Triticum aestivum L.) contains at least 23 TaPr-1 genes encoding the group 1 pathogenesis-related (PR-1) proteins as identified in our previous work. Here we report the cloning and characterization of TaPr-1-rk1 and TaPr-1-rk2, two novel genes closely related to the wheat PR-1 famil...

  18. Molecular cloning and expression analysis of a cytosolic Hsp70 gene from Antarctic ice algae Chlamydomonas sp. ICE-L.

    PubMed

    Liu, Shenghao; Zhang, Pengying; Cong, Bailin; Liu, Chenlin; Lin, Xuezheng; Shen, Jihong; Huang, Xiaohang

    2010-05-01

    A cDNA encoding heat shock protein 70 of Antarctic ice algae Chlamydomonas sp. ICE-L (designated as CiHsp70) was identified by RT-PCR and rapid amplification of cDNA ends approaches. The full-length cDNA of CiHsp70 was 2,232 bp, consisting of a 5'-terminal untranslated region (UTR) of 76 bp, a 3'-terminal UTR of 203 bp with a poly (A) tail, and an open reading frame of 1,953 bp. The CiHsp70 cDNA encoded a polypeptide of 651 amino acids with an ATPase domain of 388 amino acids, the substrate peptide binding domain of 246 amino acids and a C-terminus domain of 17 amino acids. The inducible CiHsp70 cDNA was highly homologous to other plant cytosolic Hsp70 genes and clustered together with green algae and higher plant rather than brown algae, diatom and Cryptophyta. Antarctic ice algae were treated with different stress conditions and messenger RNA (mRNA) expression levels of CiHsp70 were quantified by quantitative RT-PCR. The results showed that both cold and heat shock treatments could stimulate CiHsp70 mRNA expression. Meanwhile, CiHsp70 mRNA expression level increased 2.9-fold in response to UV-B radiation for 6 h, while the expression levels of CiHsp70 were remarkably increased after removing the UV-B radiation and immediately providing additional 6 h visible light. Furthermore, treating with 62 or 93 per thousand NaCl for 2 h, CiHsp70 mRNA expression level increased 3.0- and 2.1-fold, respectively. Together, our observations revealed that CiHsp70 as a molecular chaperone might play an important role in Antarctic ice algae Chlamydomonas sp. ICE-L acclimatizing to polar environment.

  19. Molecular cloning and characterization of the human interleukin-11 receptor {alpha}-chain gene, IL11RA, located on chromosome 9p13

    SciTech Connect

    Van Leuven, F.; Stas, L.; Hilliker, C.

    1996-01-01

    The human gene coding for the interleukin-11 receptor (IL11RA) was cloned and its structure analyzed. The gene is composed of 13 exons comprising nearly 10 kb of DNA that was completely sequenced. The intron-exon boundaries were determined based on the mouse Etl2 and interleukin-11 receptor cDNAs that were recently cloned. The protein sequence predicted by the human gene was over 83% identical with its murine counterpart, with very strict conservation of functionally important domains and signatures. Fluorescence in situ hybridization showed the gene to be located on human chromosome 9p13, syntenic with the mouse etl2 gene on chromosome 4. The coding exons of the interleukin-11 gene were sequenced in a patient with the cartilage-hair hypoplasia syndrome, which has been linked to a gene on chromosome 9, but no functional mutations were detected. 26 refs., 4 figs., 2 tabs.

  20. Molecular cloning, sequencing analysis, and chromosomal localization of the human protease inhibitor 4 (Kallistatin) gene (P14)

    SciTech Connect

    Chai, K.X.; Chao, J.; Chao, L.; Ward, D.C.

    1994-09-15

    The gene encoding human protease inhibitor 4 (kallistatin; gene symbol PI4), a novel serine proteinase inhibitor (serpin), has been isolated and completely sequenced. The kallistatin gene is 9618 bp in length and contains five exons and four introns. The structure and organization of the kallistatin gene are similar to those of the genes encoding {alpha}{sub 1}-antichymotrypsin. The kallistatin gene is also similar to the genes encoding rat and mouse kallikrein-binding proteins. The first exon of the kallistatin gene is a noncoding 89-bp fragment, as determined by primer extension. The fifth exon, which contains 308 bp of noncoding sequence, encodes the reactive center of kallistatin. In the 5`-flanking region of the kallistatin gene, 1125 bp have been sequenced and a consensus promoter segment with potential transcription regulatory sites, including CAAT and TATA boxes, an AP-2 binding site, a GC-rich region, a cAMP response element, and an AP-1 binding site, has been identified within this region. The kallistatin gene was localized by in situ hybridization to human chromosome 14q31-132.1, close to the serpin genes encoding {alpha}{sub 1}-antichymotrypsin, protein C inhibitor, {alpha}{sub 1}-antitrypsin, and corticosteroid-binding globulin. In a genomic DNA Southern blot, kallistatin-related genes were identified in monkey, mouse, rat, bovine, dog, cat, and a ground mole. The patterns of hybridization revealed clues of human serpin evolution. 34 refs., 6 figs.

  1. Molecular cloning and functional analysis of GbRVd, a gene in Gossypium barbadense that plays an important role in conferring resistance to Verticillium wilt.

    PubMed

    Yang, Jun; Ma, Qing; Zhang, Yan; Wang, Xingfen; Zhang, Guiyin; Ma, Zhiying

    2016-01-10

    Most of the disease resistance genes already characterized in plants encode nucleotide-binding site-leucine rich repeat (NBS-LRR) proteins that have key roles in resistance to Verticillium dahliae. Using a cDNA library and RACE protocols, we cloned a coiled-coil (CC)-NBS-LRR-type gene, GbRVd, from a resistant tetraploid cotton species, Gossypium barbadense (RVd=Resistance to V. dahliae). We also applied RT-qPCR and VIGS technologies to analyze how expression of GbRVd was induced upon attack by V. dahliae. Its 2862-bp ORF encodes a predicted protein containing 953 amino acid residues, with a predicted molecular weight of 110.17kDa and an isoelectric point of 5.87. GbRVd has three domains - CC, NBS, and LRR - and is most closely related to Gossypium raimondii RVd (88% amino acid identity). Profiling demonstrated that GbRVd is constitutively expressed in all tested tissues, and transcript levels are especially high in the leaves. In plants inoculated with V. dahliae, GbRVd was significantly up-regulated when compared with the control, with expression peaking at 48h post-inoculation. Silencing of GbRVd in cotton through VIGS dramatically down-regulated SA, NO, and H2O2 production, resulting in greater susceptibility to V. dahliae. Taken together, these results suggest that GbRVd has an important role in protecting G. barbadense against infection by V. dahliae.

  2. Molecular cloning and characterization of a novel adenylyl cyclase gene, HpAC1, involved in stress signaling in Hippeastrum x hybridum.

    PubMed

    Swieżawska, Brygida; Jaworski, Krzysztof; Pawełek, Agnieszka; Grzegorzewska, Weronika; Szewczuk, Piotr; Szmidt-Jaworska, Adriana

    2014-07-01

    Adenylyl cyclases (ACs) are enzymes that generate cyclic AMP, which is involved in different physiological and developmental processes in a number of organisms. Here, we report the cloning and characterization of a new plant adenylyl cyclases (AC) gene, designated HpAC1, from Hippeastrum x hybridum. This gene encodes a protein of 206 amino acids with a calculated molecular mass of 23 kD and an isoelectric point of 5.07. The predicted amino acid sequence contains all the typical features of and shows high identity with putative plant ACs. The purified, recombinant HpAC1 is able to convert ATP to cAMP. The complementation test that was performed to analyze the ability of HpAC1 to compensate for the AC deficiency in the Escherichia coli SP850 strain revealed that HpAC1 functions as an adenylyl cyclase and produces cyclic AMP. Moreover, it was shown that the transcript level of HpAC1 and cyclic AMP concentration changed during certain stress conditions. Both mechanical damage and Phoma narcissi infection lead to two sharp increases in HpAC1 mRNA levels during a 72-h test cycle. Changes in intracellular cAMP level were also observed. These results may indicate the participation of a cAMP-dependent pathway both in rapid and systemic reactions induced after disruption of symplast and apoplast continuity.

  3. Cloning and molecular characterization of a glycerol-3-phosphate O-acyltransferase (GPAT) gene from Echium (Boraginaceae) involved in the biosynthesis of cutin polyesters.

    PubMed

    Mañas-Fernández, Aurora; Li-Beisson, Yonghua; Alonso, Diego López; García-Maroto, Federico

    2010-09-01

    The glycerol-based lipid polyester called cutin is a main component of cuticle, the protective interface of aerial plant organs also controlling compound exchange with the environment. Though recent progress towards understanding of cutin biosynthesis has been made in Arabidopsis thaliana, little is known in other plants. One key step in this process is the acyl transfer reaction to the glycerol backbone. Here we report the cloning and molecular characterization of EpGPAT1, a gene encoding a glycerol-3-phosphate O-acyltransferase (GPAT) from Echium pitardii (Boraginaceae) with high similarity to the AtGPAT4/AtGPAT8 of Arabidopsis. Quantitative analysis by qRT-PCR showed highest expression of EpGPAT1 in seeds, roots, young leaves and flowers. Acyltransferase activity of EpGPAT1 was evidenced by heterologous expression in yeast. Ectopic expression in leaves of tobacco plants lead to an increase of C16 and C18 hydroxyacids and alpha,omega-diacids in the cell wall fraction, indicating a role in the biosynthesis of polyesters. Analysis of the genomic organization in Echium revealed the presence of EpGPAT2, a closely related gene which was found to be mostly expressed in developing leaves and flowers. The presence of a conserved HAD-like domain at the N-terminal moiety of GPATs from Echium, Arabidopsis and other plant species suggests a possible phosphohydrolase activity in addition to the reported acyltransferase activity. Evolutive implications of this finding are discussed.

  4. Identification, molecular cloning, and transcription analysis of the Choristoneura fumiferana nuclear polyhedrosis virus spindle-like protein gene.

    PubMed

    Liu, J J; Carstens, E B

    1996-09-15

    The Choristoneura fumiferana nuclear polyhedrosis virus spindle-like protein (slp) gene has been identified and localized immediately downstream and in the same orientation as the CfMNPV DNA polymerase gene. The slp gene is 1101 bp long, predicted to code for a 366 amino acid (42.1 kDa) polypeptide. Transcriptional analysis revealed that the CfMNPV slp gene is expressed at late times postinfection, beginning at 24 hr postinfection and is most abundantly expressed after 36 hr. Transcription initiates within a single baculovirus consensus late start site sequence (GTAAG) at position -18 relative to the translation start codon. Based on amino acid comparisons, the CfMNPV gene is closely related to other similar baculovirus genes and distantly but recognizably related to the fusolin proteins of two entomopoxviruses. The conservation of amino acid sequence, glycosylation signals and specific domains throughout the protein suggest that this gene product may play an important role in insect DNA virus replication.

  5. Molecular cloning and expression of α-globin and β-globin genes from crocodile (Crocodylus siamensis).

    PubMed

    Anwised, Preeyanan; Kabbua, Thai; Temsiripong, Theeranan; Dhiravisit, Apisak; Jitrapakdee, Sarawut; Araki, Tomohiro; Yoneda, Kazunari; Thammasirirak, Sompong

    2013-03-01

    The first report of complete nucleotide sequences for α- and β-globin chains from the Siamese hemoglobin (Crocodylus siamensis) is given in this study. The cDNAs encoding α- and β-globins were cloned by RT-PCR using the degenerate primers and by the rapid amplification of cDNA ends method. The full-length α-globin cDNA contains an open reading frame of 423 nucleotides encoding 141 amino acid residues, whereas the β-globin cDNA contains an open reading frame of 438 nucleotides encoding 146 amino acid residues. The authenticity of both α- and β-globin cDNA clones were also confirmed by the heterologous expression in Escherichia coli (E. coli). This is the first time that the recombinant C. siamensis globins were produced in prokaryotic system. Additionally, the heme group was inserted into the recombinant proteins and purified heme-bound proteins were performed by affinity chromatography using Co(2+)-charged Talon resins. The heme-bound proteins appeared to have a maximum absorbance at 415 nm, indicated that the recombinant proteins bound to oxygen and formed active oxyhemoglobin (HbO2). The results indicated that recombinant C. siamensis globins were successfully expressed in prokaryotic system and possessed an activity as ligand binding protein.

  6. Restoration of Chinese hamster cell radiation resistance by the human repair gene ERCC-5 and progress in molecular cloning of this gene

    SciTech Connect

    Strniste, G.F.; Chen, D.J.; deBruin, D.; McCoy, L.S.; Luke, J.A.; Mudgett, J.S.; Nickols, J.W.; Okinaka, R.T.; Tesmer, J.G.; MacInnes, M.A.

    1988-01-01

    The uv-sensitive Chinese hamster cell uv-135 is being used to identify and isolate the human gene, ERCC-5, which corrects nucleotide excision repair in this incision-defective mutant. A cosmid library, constructed from a 3/sup 0/ transformant of uv-135, has been screened for transfected gpt and human Alu family sequences. An ordered physical map of overlapping positives cosmids has been determined. Molecular evidence suggests a region of this map of <40 Kbp contains the ERCC-5 gene. 10 refs., 2 figs.

  7. Advances and applications of molecular cloning in clinical microbiology.

    PubMed

    Sharma, Kamal; Mishra, Ajay Kumar; Mehraj, Vikram; Duraisamy, Ganesh Selvaraj

    2014-10-01

    Molecular cloning is based on isolation of a DNA sequence of interest to obtain multiple copies of it in vitro. Application of this technique has become an increasingly important tool in clinical microbiology due to its simplicity, cost effectiveness, rapidity, and reliability. This review entails the recent advances in molecular cloning and its application in the clinical microbiology in the context of polymicrobial infections, recombinant antigens, recombinant vaccines, diagnostic probes, antimicrobial peptides, and recombinant cytokines. Culture-based methods in polymicrobial infection have many limitation, which has been overcome by cloning techniques and provide gold standard technique. Recombinant antigens produced by cloning technique are now being used for screening of HIV, HCV, HBV, CMV, Treponema pallidum, and other clinical infectious agents. Recombinant vaccines for hepatitis B, cholera, influenza A, and other diseases also use recombinant antigens which have replaced the use of live vaccines and thus reduce the risk for adverse effects. Gene probes developed by gene cloning have many applications including in early diagnosis of hereditary diseases, forensic investigations, and routine diagnosis. Industrial application of this technology produces new antibiotics in the form of antimicrobial peptides and recombinant cytokines that can be used as therapeutic agents.

  8. Molecular cloning, reconstruction and expression of the gene encoding the alpha-chain of the bovine CD8--definition of three peptide regions conserved across species.

    PubMed

    Lalor, P; Bucci, C; Fornaro, M; Rattazzi, M C; Nakauchi, H; Herzenberg, L A; Alberti, S

    1992-05-01

    We report the cloning of a cDNA encoding the alpha-chain of the bovine CD8 (BoCD8 alpha). A bovine thymus cDNA library was hybridized at low stringency with a human CD8 alpha cDNA clone. The first round of screening of 5 x 10(4) independent colonies yielded 12 clones containing incomplete BoCD8 alpha genes. Two further rounds of colony hybridization were conducted, each using as a probe the 5' fragment from the longest BoCD8 alpha clone previously isolated. The final screening yielded a clone containing a 2 kilobase (kb) insert. We mapped and sequenced the 2 kb BoCD8 alpha clone and compared it with the published sequences of the genes encoding the human, mouse and rat CD8 alpha. Sequence analysis confirmed that the clone under study encoded the BoCD8 alpha. The overall similarity of the BoCD8 alpha coding region with the human CD8 alpha coding sequence is 74.7% at the nucleotide level and 62.1% at the protein level. Lower levels of similarity are found with the mouse and rat CD8 alpha. Interestingly, three separate highly homologous regions are clearly defined at the peptide level in bovine versus human and mouse versus rat comparisons. Two of the regions are highly conserved among all species analysed, while the most 5' region is not. We speculate that the latter region may contain the binding site of CD8 alpha to the alpha 3 domain of major histocompatibility complex (MHC) class I molecules. Sequence analysis showed that the 2 kb BoCD8 alpha clone contains an incomplete coding region, i.e. lacks six bases corresponding to the first two amino acids of the leader region. To allow efficient translation and processing of the BoCD8 alpha gene, we constructed a chimeric gene containing the coding sequence of the BoCD8 alpha clone and synthetic sequences corresponding to the first two amino acids of the human CD8 alpha leader sequence. The chimeric gene was subcloned in the pKSV10 expression vector. The pKSV10-BoCD8 alpha construct is efficiently expressed both

  9. [Molecular cloning, sequence analysis and stress-related changes of the heat shock protein 60 gene in Neobenedenia melleni].

    PubMed

    Wang, Fang; Chen, Jiong; Shi, Yu-Hong; Lu, Xin-Jiang; Li, Ming-Yun

    2012-12-01

    Heat shock protein 60 is an essential chaperone that can maintain the natural structure and function of mitochondrial proteins. Here, we successfully cloned the full length cDNA of HSP60 from Neobenedenia melleni, designated as NmHSP60. Real-time quantitative PCR and Western blot were used to analyze the expression change of NmHSP60 under different temperature and salinity. Compared with the typical 25 Degrees Celsius, expressions decreased dramatically in eggs and adults at 18 Degrees Celsius. Conversely, at 32 Degrees Celsius, expression increase dramatically in adults. Compared with salinity 24, expressions were significantly down-regulated in adults at salinity 18, and up-regulated in eggs at salinity 30. Experimental results suggest that NmHSP60 may play an significant role in N. melleni's adaptation to adverse environmental conditions.

  10. Molecular cloning and characterization of genes for antibodies generated by orbital tissue-infiltrating B-cells in Graves` ophthalmopathy

    SciTech Connect

    Jaume, J.C.; Portolano, S.; Prummel, M.F.; McLachlan, S.M.; Rapoport, B.

    1994-02-01

    Graves` ophthalmopathy is a distressing autoimmune disease of unknown etiology. Analysis of the genes for antibodies secreted by orbital tissue-infiltrating plasma cells might provide insight into the pathogenesis of this disease. The authors, therefore, constructed an immunoglobulin heavy (H) chain and an immunoglobulin k light (L) chain cDNA library from the orbital tissue of a patient with active Graves` ophthalmopathy. Analysis of 15 H (IgG1) and 15 L (k) chains revealed a restricted spectrum of variable region genes. Fourteen of 15 variable k genes were about 94% homologous to the closest known germline gene, KL012. Thirteen of 15 H chain genes were 91% and 90% homologous to the closest germline genes, DP10 and hv1263, respectively. Remarkably, these germline genes also code for other autoantibodies to striated muscle (KL012) and thyroid peridase (KL012 and hv1263). These studies raise the possibility that particular germline genes may be associated with autoimmunity in humans. Further, the present study opens the way to identifying ocular autoantigens that may be the target of an humoral immune response. 29 refs., 4 figs., 1 tab.

  11. Identification and molecular cloning of three Halloween genes in the varroa mite, Varroa destructor (Anderson & Trueman) (Acari: Varroidae)

    USDA-ARS?s Scientific Manuscript database

    Biosynthesis of 20-hydroxyecdysone (20E) in insects involves the action of five cytochrome P450s collectively known as Halloween genes. The complete transcripts of 3 Halloween genes [spook (Vdspo), disembodied (Vddib) and shade (Vdshd)] from the varroa mite were identified, sequenced and mapped to t...

  12. Molecular Cloning, Characterization, and Anti-avian Pathogenic Escherichia coli Innate Immune Response of the Cherry Valley Duck CIITA Gene.

    PubMed

    Li, Rong; Guo, Mengjiao; Lin, Jing; Chai, Tongjie; Wei, Liangmeng

    2017-01-01

    Class II major histocompatibility complex (MHC-II) transactivator (CIITA) is a member of the pattern recognition receptor in cytoplasm, which is involved in host innate immune responses. In this study, the full-length cDNA of Cherry Valley duck CIITA (duCIITA) was cloned from the spleen of healthy Cherry Valley ducks for the first time. The CDs of duCIITA have 3648 bp and encode 1215 amino acids. The homology analysis of CIITAs amino acid sequence showed that the duCIITA has the highest identity with the Anas platyrhynchos (94.9%), followed by Gallus gallus and Meleagris gallopavo. Quantitative real-time PCR analysis indicated that duCIITA mRNA has a broad expression level in healthy Cherry Valley duck tissues. It was highly expressed in the lung and cerebellum, and lowly expressed in the rectum and esophagus. After the avian pathogenic Escherichia coli (APEC) O1K1 infection, the ducks exhibited the typical clinical symptoms, and a severe fibrinous exudate in the heart and liver surface was observed. Meanwhile, a significant up-regulation of duCIITA was detected in the infected liver. The inflammatory cytokines IL-1β, IL-6, and IL-8 have a significant up-regulation in the infected liver, spleen and brain. In addition, knockdown of the duCIITA reduces antibacterial activity and inflammatory cytokine production of the duck embryo fibroblast cells. Our research is the first study of the cloning, tissue distribution, and antibacterial immune responses of duCIITA, and these findings imply that duCIITA was an important receptor, which was involved in the early stage of the antibacterial innate immune response to APEC O1K1 infection of Cherry Valley duck.

  13. Molecular cloning and expression of five glutathione S-transferase (GST) genes from Banana (Musa acuminata L. AAA group, cv. Cavendish).

    PubMed

    Wang, Zhuo; Huang, Suzhen; Jia, Caihong; Liu, Juhua; Zhang, Jianbin; Xu, Biyu; Jin, Zhiqiang

    2013-09-01

    Three tau class MaGSTs responded to abiotic stress, MaGSTF1 and MaGSTL1 responded to signaling molecules, they may play an important role in the growth of banana plantlet. Glutathione S-transferases (GST) are multifunctional detoxification enzymes that participate in a variety of cellular processes, including stress responses. In this study, we report the molecular characteristics of five GST genes (MaGSTU1, MaGSTU2, MaGSTU3, MaGSTF1 and MaGSTL1) cloned from banana (Musa acuminate L. AAA group, cv. Cavendish) using a RACE-PCR-based strategy. The predicted molecular masses of these GSTs range from 23.4 to 27.7 kDa and their pIs are acidic. At the amino acid level, they share high sequence similarity with GSTs in the banana DH-Pahang (AA group) genome. Phylogenetic analysis showed that the deduced amino acid sequences of MaGSTs also have high similarity to GSTs of other plant species. Expression analysis by semi-quantitative RT-PCR revealed that these genes are differentially expressed in various tissues. In addition, their expression is regulated by various stress conditions, including exposure to signaling molecules, cold, salinity, drought and Fusarium oxysporum f specialis(f. Sp) cubense Tropical Race 4 (Foc TR4) infection. The expression of the tau class MaGSTs (MaGSTU1, MaGSTU2 and MaGSTU3) mainly responded to cold, salinity and drought while MaGSTF1 and MaGSTL1 expressions were upregulated by signaling molecules. Our findings suggest that MaGSTs play a key role in both development and abiotic stress responses.

  14. Molecular cloning of the canine fragile histidine triad (FHIT) gene and Fhit protein expression in canine peripheral blood mononuclear cells.

    PubMed

    Hiraoka, Hiroko; Minami, Koji; Kaneko, Naoki; Shimokawa Miyama, Takako; Mizuno, Takuya; Okuda, Masaru

    2009-05-01

    A fragile histidine triad (FHIT) gene has been studied as a tumor-associated gene in humans. The aberrant FHIT gene and its protein expression have been reported in many types of human cancers. The present study explored the canine FHIT gene structure and its protein expression in the peripheral blood mononuclear cells of healthy dogs by RT-PCR, RACE and immunoblot analysis. The obtained canine FHIT gene contained nine small exons and was located on canine chromosome 20. Furthermore, we identified an alternative splicing form of the FHIT transcript. The deduced amino acid sequence was well conserved between species, and anti-human Fhit antibody could be used to detect the canine Fhit protein. These findings will be useful for future research.

  15. Molecular cloning of alcohol dehydrogenase genes of the yeast Pichia stipitis and identification of the fermentative ADH.

    PubMed

    Passoth, V; Schäfer, B; Liebel, B; Weierstall, T; Klinner, U

    1998-10-01

    Two Pichia stipitis ADH genes (PsADH1 and PsADH2) were isolated by complementation of a Saccharomyces cerevisiae Adh(-)-mutant. The genes enabled the transformants to grow in the presence of antimycin A on glucose, to use ethanol as sole carbon source and made them sensitive to allylalcohol. The sequences of the genes showed similarities of 70-77% to sequences of ADH genes of Candida albicans, Kluyveromyces lactis, K. marxianus, and S. cerevisiae and about 60% homology to those of Schizosaccharomyces pombe and Aspergillus flavus. Southern hybridization experiments suggested that P. stipitis has only these two ADH genes. Both genes are located on the largest chromosome of P. stipitis. PsADH2 encodes for the ADH activity that is responsible for ethanol formation at oxygen limitation. The gene is regulated at the transcriptional level. Moreover, also in cells grown on ethanol, only PsADH2 transcript was found. PsADH1 transcript was detected under aerobic conditions on fermentable carbon sources.

  16. Molecular cloning, sequence identification and tissue expression profile of three novel sheep (Ovis aries) genes - BCKDHA, NAGA and HEXA.

    PubMed

    Liu, G Y; Gao, S Z

    2009-01-01

    The complete coding sequences of three sheep genes- BCKDHA, NAGA and HEXA were amplified using the reverse transcriptase polymerase chain reaction (RT-PCR), based on the conserved sequence information of the mouse or other mammals. The nucleotide sequences of these three genes revealed that the sheep BCKDHA gene encodes a protein of 313 amino acids which has high homology with the BCKDHA gene that encodes a protein of 447 amino acids that has high homology with the Branched chain keto acid dehydrogenase El, alpha polypeptide (BCKDHA) of five species chimpanzee (93%), human (96%), crab-eating macaque (93%), bovine (98%) and mouse (91%). The sheep NAGA gene encodes a protein of 411 amino acids that has high homology with the alpha-N-acetylgalactosaminidase (NAGA) of five species human (85%), bovine (94%), mouse (91%), rat (83%) and chicken (74%). The sheep HEXA gene encodes a protein of 529 amino acids that has high homology with the hexosaminidase A(HEXA) of five species bovine (98%), human (84%), Bornean orangután (84%), rat (80%) and mouse (81%). Finally these three novel sheep genes were assigned to GenelDs: 100145857, 100145858 and 100145856. The phylogenetic tree analysis revealed that the sheep BCKDHA, NAGA, and HEXA all have closer genetic relationships to the BCKDHA, NAGA, and HEXA of bovine. Tissue expression profile analysis was also carried out and results revealed that sheep BCKDHA, NAGA and HEXA genes were differentially expressed in tissues including muscle, heart, liver, fat, kidney, lung, small and large intestine. Our experiment is the first to establish the primary foundation for further research on these three sheep genes.

  17. Molecular population genetic evidence of horizontal spread of two alleles of the pyrogenic exotoxin C gene (speC) among pathogenic clones of Streptococcus pyogenes.

    PubMed Central

    Kapur, V; Nelson, K; Schlievert, P M; Selander, R K; Musser, J M

    1992-01-01

    It has recently been demonstrated that the bacteriophage-borne gene (speC) encoding pyrogenic exotoxin C is harbored by phylogenetic lineages representing virtually the entire breadth of genomic differentiation present in the species Streptococcus pyogenes (J. M. Musser, A. R. Hauser, M. H. Kim, P. M. Schlievert, K. Nelson, and R. K. Selander, Proc. Natl. Acad. Sci. USA 88:2668-2672, 1991). To determine whether the speC genes occurring in association with divergent chromosomal genotypes (clones) are identical or represent a group of allelic variants, we sequenced speC from 23 S. pyogenes strains representing 15 clones identified by multilocus enzyme electrophoresis. Two alleles of speC are present in natural populations, and each allele occurs in clones that are well differentiated in overall chromosomal character; in one case, isolates of a single clone had different speC alleles. We interpret these patterns of toxin allele-clone distribution as evidence of occasional episodes of speC horizontal dissemination, presumably by bacteriophage-mediated gene transfer and recombination. Images PMID:1500157

  18. Molecular approach to annelid regeneration: cDNA subtraction cloning reveals various novel genes that are upregulated during the large-scale regeneration of the oligochaete, Enchytraeus japonensis.

    PubMed

    Myohara, Maroko; Niva, Cintia Carla; Lee, Jae Min

    2006-08-01

    To identify genes specifically activated during annelid regeneration, suppression subtractive hybridization was performed with cDNAs from regenerating and intact Enchytraeus japonensis, a terrestrial oligochaete that can regenerate a complete organism from small body fragments within 4-5 days. Filter array screening subsequently revealed that about 38% of the forward-subtracted cDNA clones contained genes that were upregulated during regeneration. Two hundred seventy-nine of these clones were sequenced and found to contain 165 different sequences (79 known and 86 unknown). Nine clones were fully sequenced and four of these sequences were matched to known genes for glutamine synthetase, glucosidase 1, retinal protein 4, and phosphoribosylaminoimidazole carboxylase, respectively. The remaining five clones encoded an unknown open-reading frame. The expression levels of these genes were highest during blastema formation. Our present results, therefore, demonstrate the great potential of annelids as a new experimental subject for the exploration of unknown genes that play critical roles in animal regeneration.

  19. Molecular cloning and functional characterization of the lycopene ε-cyclase gene via virus-induced gene silencing and its expression pattern in Nicotiana tabacum.

    PubMed

    Shi, Yanmei; Wang, Ran; Luo, Zhaopeng; Jin, Lifeng; Liu, Pingping; Chen, Qiansi; Li, Zefeng; Li, Feng; Wei, Chunyang; Wu, Mingzhu; Wei, Pan; Xie, He; Qu, Lingbo; Lin, Fucheng; Yang, Jun

    2014-08-22

    Lycopene ε-cyclase (ε-LCY) is a key enzyme that catalyzes the synthesis of α-branch carotenoids through the cyclization of lycopene. Two cDNA molecules encoding ε-LCY (designated Ntε-LCY1 and Ntε-LCY2) were cloned from Nicotiana tabacum. Ntε-LCY1 and Ntε-LCY2 are encoded by two distinct genes with different evolutionary origins, one originating from the tobacco progenitor, Nicotiana sylvestris, and the other originating from Nicotiana tomentosiformis. The two coding regions are 97% identical at the nucleotide level and 95% identical at the amino acid level. Transcripts of Ntε-LCY were detectable in both vegetative and reproductive organs, with a relatively higher level of expression in leaves than in other tissues. Subcellular localization experiments using an Ntε-LCY1-GFP fusion protein demonstrated that mature Ntε-LCY1 protein is localized within the chloroplast in Bright Yellow 2 suspension cells. Under low-temperature and low-irradiation stress, Ntε-LCY transcript levels substantially increased relative to control plants. Tobacco rattle virus (TRV)-mediated silencing of ε-LCY in Nicotiana benthamiana resulted in an increase of β-branch carotenoids and a reduction in the levels of α-branch carotenoids. Meanwhile, transcripts of related genes in the carotenoid biosynthetic pathway observably increased, with the exception of β-OHase in the TRV-ε-lcy line. Suppression of ε-LCY expression was also found to alleviate photoinhibition of Potosystem II in virus-induced gene silencing (VIGS) plants under low-temperature and low-irradiation stress. Our results provide insight into the regulatory role of ε-LCY in plant carotenoid biosynthesis and suggest a role for ε-LCY in positively modulating low temperature stress responses.

  20. Molecular Cloning and Functional Characterization of the Lycopene ε-Cyclase Gene via Virus-Induced Gene Silencing and Its Expression Pattern in Nicotiana tabacum

    PubMed Central

    Shi, Yanmei; Wang, Ran; Luo, Zhaopeng; Jin, Lifeng; Liu, Pingping; Chen, Qiansi; Li, Zefeng; Li, Feng; Wei, Chunyang; Wu, Mingzhu; Wei, Pan; Xie, He; Qu, Lingbo; Lin, Fucheng; Yang, Jun

    2014-01-01

    Lycopene ε-cyclase (ε-LCY) is a key enzyme that catalyzes the synthesis of α-branch carotenoids through the cyclization of lycopene. Two cDNA molecules encoding ε-LCY (designated Ntε-LCY1 and Ntε-LCY2) were cloned from Nicotiana tabacum. Ntε-LCY1 and Ntε-LCY2 are encoded by two distinct genes with different evolutionary origins, one originating from the tobacco progenitor, Nicotiana sylvestris, and the other originating from Nicotiana tomentosiformis. The two coding regions are 97% identical at the nucleotide level and 95% identical at the amino acid level. Transcripts of Ntε-LCY were detectable in both vegetative and reproductive organs, with a relatively higher level of expression in leaves than in other tissues. Subcellular localization experiments using an Ntε-LCY1-GFP fusion protein demonstrated that mature Ntε-LCY1 protein is localized within the chloroplast in Bright Yellow 2 suspension cells. Under low-temperature and low-irradiation stress, Ntε-LCY transcript levels substantially increased relative to control plants. Tobacco rattle virus (TRV)-mediated silencing of ε-LCY in Nicotiana benthamiana resulted in an increase of β-branch carotenoids and a reduction in the levels of α-branch carotenoids. Meanwhile, transcripts of related genes in the carotenoid biosynthetic pathway observably increased, with the exception of β-OHase in the TRV-ε-lcy line. Suppression of ε-LCY expression was also found to alleviate photoinhibition of Potosystem II in virus-induced gene silencing (VIGS) plants under low-temperature and low-irradiation stress. Our results provide insight into the regulatory role of ε-LCY in plant carotenoid biosynthesis and suggest a role for ε-LCY in positively modulating low temperature stress responses. PMID:25153631

  1. Molecular cloning and evolutionary analysis of the HOG-signaling pathway genes from Saccharomyces cerevisiae rice wine isolates.

    PubMed

    Li, Yudong; Chen, Wei; Shi, Yugang; Liang, Xinle

    2013-04-01

    The high osmolarity glycerol (HOG) signaling pathway is crucial for yeast to cope with high osmolarity. Here, we showed that Saccharomyces cerevisiae rice wine isolates exhibited higher tolerance to osmotic stress, which was associated with the evolution of HOG pathway genes. Phylogenetic analysis of HOG genes revealed that Chinese rice wine strains were closely related to sake strains, indicating a common origin of rice wine strains. The DNA sequence diversity analysis showed that higher levels of polymorphism tended to accumulate on the osmosensor genes (MSB2 and SLN1), suggesting that most changes in a signaling transduction pathway were concentrated in the receptors. Moreover, the rapid evolution of osmosensors (Sln1/Msb2) and transcription factor (Msn4) might experience positive selection. Our results imply that the evolution of HOG pathway genes in S. cerevisiae rice wine strains is associated with their adaptation to high osmotic environments.

  2. Molecular cloning of a coiled-coil-nucleotide-binding-site-leucine-rich repeat gene from pearl millet and its expression pattern in response to the downy mildew pathogen.

    PubMed

    Veena, Mariswamy; Melvin, Prasad; Prabhu, Sreedhara Ashok; Shailasree, Sekhar; Shetty, Hunthrike Shekar; Kini, Kukkundoor Ramachandra

    2016-03-01

    Downy mildew caused by Sclerospora graminicola is a devastating disease of pearl millet. Based on candidate gene approach, a set of 22 resistance gene analogues were identified. The clone RGPM 301 (AY117410) containing a partial sequence shared 83% similarity to rice R-proteins. A full-length R-gene RGA RGPM 301 of 3552 bp with 2979 bp open reading frame encoding 992 amino acids was isolated by the degenerate primers and rapid amplification of cDNA ends polymerase chain reaction (RACE-PCR) approach. It had a molecular mass of 113.96 kDa and isoelectric point (pI) of 8.71. The sequence alignment and phylogenetic analysis grouped it to a non-TIR NBS LRR group. The quantitative real-time PCR (qRT-PCR) analysis revealed higher accumulation of the transcripts following inoculation with S. graminicola in the resistant cultivar (IP18296) compared to susceptible cultivar (7042S). Further, significant induction in the transcript levels were observed when treated with abiotic elicitor β-aminobutyric acid (BABA) and biotic elicitor Pseudomonas fluorescens. Exogenous application of phytohormones jasmonic acid or salicylic acid also up-regulated the expression levels of RGA RGPM 301. The treatment of cultivar IP18296 with mitogen-activated protein kinase (MPK) inhibitors (PD98059 and U0126) suppressed the levels of RGA RGPM 301. A 3.5 kb RGA RGPM 301 which is a non-TIR NBS-LRR protein was isolated from pearl millet and its up-regulation during downy mildew interaction was demonstrated by qRT-PCR. These studies indicate a role for this RGA in pearl millet downy mildew interaction.

  3. Molecular cloning of a CC-NBS-LRR gene from Vitis quinquangularis and its expression pattern in response to downy mildew pathogen infection.

    PubMed

    Zhang, Shuwei; Ding, Feng; Peng, Hongxiang; Huang, Yu; Lu, Jiang

    2017-09-01

    Downy mildew, caused by Plasmopara viticola, can result in a substantial decrease in grapevine productivity. Vitis vinifera is a widely cultivated grapevine species, which is susceptible to this disease. Repeated pesticide applications are harmful for both the environment and human health. Thus, it is essential to develop varieties/cultivars that are resistant to downy mildew and other diseases. In our previous studies, we investigated the natural resistance of the Chinese wild grapevine V. quinquangularis accession 'PS' against P. viticola and obtained several candidate resistance (R) genes that may play important roles in plant disease resistance. In the present study, we isolated a CC-NBS-LRR-type R gene from 'PS' and designated it VqCN. Its open reading frame is 2676 bp which encodes a protein of 891 amino acids with a predicted molecular mass of 102.12 kDa and predicted isoelectric point of 6.53. Multiple alignments with other disease resistant (R) proteins revealed a conserved phosphate-binding loop (P-loop), resistance nucleotide binding site, a hydrophobic domain (GLPL) and methionine-histidine-aspartate (MHD) motifs, which are typical components of nucleotide-binding site leucine-rich repeat proteins, as well as a coiled-coil region in the N-terminus. Quantitative real-time polymerase chain reaction analysis showed that the transcript of VqCN was rapidly and highly induced after infection with P. viticola in 'PS'. Moreover, the leaves of susceptible 'Cabernet Sauvignon' transiently expressing VqCN manifested increased resistance to P. viticola. The results indicated that VqCN might play a positive role in protecting grapevine against infection with P. viticola. Cloning and functional analysis of a putative resistance gene provide a basis for disease-resistance breeding.

  4. Two beta-glycanase genes are clustered in Bacillus polymyxa: molecular cloning, expression, and sequence analysis of genes encoding a xylanase and an endo-beta-(1,3)-(1,4)-glucanase.

    PubMed

    Gosalbes, M J; Pérez-González, J A; González, R; Navarro, A

    1991-12-01

    Two genes, xynD and gluB, encoding a xylanase and an endo-beta-(1,3)-(1,4)-glucanase (lichenase) from Bacillus polymyxa have been cloned and expressed in Escherichia coli and Bacillus subtilis. A sequenced DNA fragment of 4,466 bp contains both genes, which are separated by 155 bp. The xynD and gluB genes encode proteins of 67.8 kDa (XYND) and 27 kDa (GLUB). Two peptides with molecular masses of 62 and 53 kDa appear in cell extracts of E. coli and culture supernatants of B. subtilis clones containing the xynD gene. Both peptides show xylanase activity in zymogram analysis. The XYND enzyme also shows alpha-L-arabinofuranosidase activity. The XYND peptide and the xylanase XYNZ from Clostridium thermocellum (O. Grépinet, M. C. Chebrou, and P. Béguin, J. Bacteriol. 170:4582-4588, 1988) show 64% homology in a stretch of about 280 amino acids.

  5. Two beta-glycanase genes are clustered in Bacillus polymyxa: molecular cloning, expression, and sequence analysis of genes encoding a xylanase and an endo-beta-(1,3)-(1,4)-glucanase.

    PubMed Central

    Gosalbes, M J; Pérez-González, J A; González, R; Navarro, A

    1991-01-01

    Two genes, xynD and gluB, encoding a xylanase and an endo-beta-(1,3)-(1,4)-glucanase (lichenase) from Bacillus polymyxa have been cloned and expressed in Escherichia coli and Bacillus subtilis. A sequenced DNA fragment of 4,466 bp contains both genes, which are separated by 155 bp. The xynD and gluB genes encode proteins of 67.8 kDa (XYND) and 27 kDa (GLUB). Two peptides with molecular masses of 62 and 53 kDa appear in cell extracts of E. coli and culture supernatants of B. subtilis clones containing the xynD gene. Both peptides show xylanase activity in zymogram analysis. The XYND enzyme also shows alpha-L-arabinofuranosidase activity. The XYND peptide and the xylanase XYNZ from Clostridium thermocellum (O. Grépinet, M. C. Chebrou, and P. Béguin, J. Bacteriol. 170:4582-4588, 1988) show 64% homology in a stretch of about 280 amino acids. Images FIG. 3 PMID:1938968

  6. ERCC2: cDNA cloning and molecular characterization of a human nucleotide excision repair gene with high homology to yeast RAD3.

    PubMed Central

    Weber, C A; Salazar, E P; Stewart, S A; Thompson, L H

    1990-01-01

    Human ERCC2 genomic clones give efficient, stable correction of the nucleotide excision repair defect in UV5 Chinese hamster ovary cells. One clone having a breakpoint just 5' of classical promoter elements corrects only transiently, implicating further flanking sequences in stable gene expression. The nucleotide sequences of a cDNA clone and genomic flanking regions were determined. The ERCC2 translated amino acid sequence has 52% identity (73% homology) with the yeast nucleotide excision repair protein RAD3. RAD3 is essential for cell viability and encodes a protein that is a single-stranded DNA dependent ATPase and an ATP dependent helicase. The similarity of ERCC2 and RAD3 suggests a role for ERCC2 in both cell viability and DNA repair and provides the first insight into the biochemical function of a mammalian nucleotide excision repair gene. Images Fig. 5. PMID:2184031

  7. [Molecular cloning, structural analysis, and expression of zona pellucida glycoprotein ZP3 gene from Chinese zokor, Myospalax fontanierii].

    PubMed

    Sui, D D; Wu, J L; Zhang, H; Li, H; Zhou, Z M; Zhang, D H; Han, C X

    2014-01-01

    The zona pellucida 3 (ZP3) plays a crucial role in reproductive immunology. We obtained a full-length cDNA encoding Chinese Zokor zp3, using rapid amplification of cDNA ends-polymerase chain reaction (RACE-PCR). The cDNA contains an open reading frame of 1269 nucleotides encoding a polypeptide of 422 amino acid residues. The amino acid sequence has a high degree of homology with hamster (78%), mouse (76%), and rat (74%). XhoI and SacI sites restricted 1158 bp fragment of zokor ZP3 cDNA, excluding the signal sequence and transmembrane-like domain was cloned under the phage T7 promoterlac operator control in the pET-28a(+) vector. Recombinant pET-zokorZP3 (r-ZP3) was expressed as a poly-histidine fusion protein in E. coli strain BL21 (DE3). Optimum expression of r-ZP3 was observed at 28 degrees C, 1 mM IPTG and 2 h of inducing. The purified protein was tested by Western blot.

  8. Molecular cloning and functional analysis of the duck TIR domain-containing adaptor inducing IFN-β (TRIF) gene.

    PubMed

    Wei, Xiaoqin; Qian, Wei; Sizhu, Suolang; Shi, Lijuan; Jin, Meilin; Zhou, Hongbo

    2016-12-01

    Toll-like receptors (TLRs) trigger the innate immune response by responding to specific components of microorganisms. The TIR domain-containing adaptor inducing IFN-β (TRIF) plays an essential role in mammalian TLR-mediated signaling. The role of TRIF in ducks (duTRIF) remains poorly understood. In this study, we cloned and characterized the full-length coding sequence of duTRIF from duck embryo fibroblasts (DEFs). In healthy ducks, duTRIF transcripts were broadly expressed in different tissues, with higher expression levels in the spleen and liver. Using quantitative real-time PCR (qRT-PCR), we demonstrated the upregulation of duTRIF in DEFs infected with AIV or DTMUV, and DEFs treated with Poly I:C or LPS. Overexpression of duTRIF was able to induce the NF-κB and IFN-β expression. Furthermore, the IFN induction function of duTRIF was impaired when Ala517 was mutated to Pro or His. Taken together, these results suggested that duTRIF regulated duck innate immune responses.

  9. Molecular cloning, expression, function and immunoreactivities of members of a gene family of sphingomyelinases from Loxosceles venom glands.

    PubMed

    Tambourgi, Denise V; de F Fernandes Pedrosa, Matheus; van den Berg, Carmen W; Gonçalves-de-Andrade, Rute M; Ferracini, Matheus; Paixão-Cavalcante, Danielle; Morgan, B Paul; Rushmere, Neil K

    2004-07-01

    Loxoscelism is the clinical condition produced by the venom of spiders belonging to the genus Loxosceles, which can be observed as two well-defined clinical variants: cutaneous loxoscelism and systemic or viscerocutaneous loxoscelism. We have recently identified, purified and characterised the toxins (sphingomyelinases) from Loxosceles intermedia venom that are responsible for all the local (dermonecrosis) and systemic effects (complement dependent haemolysis) induced by whole venom. In the present study, we have cloned and expressed the two functional sphingomyelinases isoforms, P1 and P2, and shown that the recombinant proteins display all the functional characteristics of whole L. intermedia venom, e.g., dermonecrotic and complement-dependent hemolytic activities and ability of hydrolyzing sphingomyelin. We have also compared the cross-reactivities of antisera raised against the toxins from different Loxosceles species and show here that the cross-reactivity is high when toxins are from the same species (P1 and P2 from L. intermedia) but low when the toxins are from different species (L. intermedia versus L. laeta). These data suggest that in order to obtain a suitable comprehensive neutralizing antiserum using the recombinant toxin as an immunogen, a mixture of the recombinant toxins from the different species has to be used. The use of anti-recombinant toxin antisera may have clinical benefits to those individuals displaying acute loxoscelic lesions. Copyright 2004 Elsevier Ltd.

  10. Mismatch Repair in Schizosaccharomyces Pombe Requires the Mutl Homologous Gene Pms1: Molecular Cloning and Functional Analysis

    PubMed Central

    Schar, P.; Baur, M.; Schneider, C.; Kohli, J.

    1997-01-01

    Homologues of the bacterial mutS and mutL genes involved in DNA mismatch repair have been found in organisms from bacteria to humans. Here, we describe the structure and function of a newly identified Schizosaccharomyces pombe gene that encodes a predicted amino acid sequence of 794 residues with a high degree of homology to MutL related proteins. On the basis of its closer relationship to the eukaryotic ``PMS'' genes than to the ``MLH'' genes, we have designated the S. pombe homologue pms1. Disruption of the pms1 gene causes a significant increase of spontaneous mutagenesis as documented by reversion rate measurements. Tetrad analyses of crosses homozygous for the pms1 mutation reveal a reduction of spore viability from >92% to 80% associated with a low proportion (~50%) of meioses producing four viable spores and a significant, allele-dependent increase of the level of post-meiotic segregation of genetic marker allele pairs. The mutant phenotypes are consistent with a general function of pms1 in correction of mismatched base pairs arising as a consequence of DNA polymerase errors during DNA synthesis, or of hybrid DNA formation between homologous but not perfectly complementary DNA strands during meiotic recombination. PMID:9258673

  11. Light and auxin responsive cytochrome P450s from Withania somnifera Dunal: cloning, expression and molecular modelling of two pairs of homologue genes with differential regulation.

    PubMed

    Srivastava, Sudhakar; Sangwan, Rajender Singh; Tripathi, Sandhya; Mishra, Bhawana; Narnoliya, L K; Misra, L N; Sangwan, Neelam S

    2015-11-01

    Cytochrome P450s (CYPs) catalyse a wide variety of oxygenation/hydroxylation reactions that facilitate diverse metabolic functions in plants. Specific CYP families are essential for the biosynthesis of species-specialized metabolites. Therefore, we investigated the role of different CYPs related to secondary metabolism in Withania somnifera, a medicinally important plant of the Indian subcontinent. In this study, complete complementary DNAs (cDNAs) of four different CYP genes were isolated and christened as WSCYP93Id, WSCYP93Sm, WSCYP734B and WSCYP734R. These cDNAs encoded polypeptides comprising of 498, 496, 522 and 550 amino acid residues with their deduced molecular mass of 56.7, 56.9, 59.4 and 62.2 kDa, respectively. Phylogenetic study and molecular modelling analysis of the four cloned WSCYPs revealed their categorization into two CYP families (CYP83B1 and CYP734A1) belonging to CYP71 and CYP72 clans, respectively. BLASTp searches showed similarity of 75 and 56 %, respectively, between the two CYP members of CYP83B1 and CYP734A1 with major variances exhibited in their N-terminal regions. The two pairs of homologues exhibited differential expression profiles in the leaf tissues of selected chemotypes of W. somnifera as well as in response to treatments such as methyl jasmonate, wounding, light and auxin. Light and auxin regulated two pairs of WSCYP homologues in a developing seedling in an interesting differential manner. Their lesser resemblance and homology with other CYP sequences suggested these genes to be more specialized and distinct ones. The results on chemotype-specific expression patterns of the four genes strongly suggested their key/specialized involvement of the CYPs in the biosynthesis of chemotype-specific metabolites, though their further biochemical characterization would reveal the specificity in more detail. It is revealed that WSCYP93Id and WSCYP93Sm may be broadly involved in the oxygenation reactions in the plant and, thereby, control

  12. Molecular Cloning, Characterization and mRNA Expression of a Chitin Synthase 2 Gene from the Oriental Fruit Fly, Bactrocera dorsalis (Diptera: Tephritidae)

    PubMed Central

    Chen, Li; Yang, Wen-Jia; Cong, Lin; Xu, Kang-Kang; Wang, Jin-Jun

    2013-01-01

    Chitin synthase (CHS), a potential target for eco-friendly insecticides, plays an essential role in chitin formation in insects. In this study, a full-length cDNA encoding chitin synthase 2 (BdCHS2) was cloned and characterized in the oriental fruit fly, Bactrocera dorsalis. The BdCHS2 cDNA had 4417 nucleotides, containing an open reading frame of 4122 nucleotides, which encoded 1373 amino acid residues with a predicted molecular weight of 158.5 kDa. Phylogenetic analysis with other insect CHSs suggested that BdCHS2 belongs to insect CHS2. The BdCHS2 transcript was predominately found in midgut but was detected at low levels in fat body, Malpighian tubules, integument, and trachea. Moreover, BdCHS2 was expressed in all developmental stages, and highly expressed in the feeding stages. There was a positive relationship between BdCHS2 expression and total chitin content during development. Furthermore, both the gene expression and chitin content in midgut decreased when the insect was fed for 24 h, then starved for 24 h, while they increased dramatically and rapidly under the condition of starvation for 24 h then feeding for 24 h. These results suggest that BdCHS2 may play an important role in regulating chitin content of the midgut, and subsequently affect the growth and development of B. dorsalis. PMID:23965972

  13. Molecular cloning and functional characterization of the sex-determination gene doublesex in the sexually dimorphic broad-horned beetle Gnatocerus cornutus (Coleoptera, Tenebrionidae)

    PubMed Central

    Gotoh, Hiroki; Ishiguro, Mai; Nishikawa, Hideto; Morita, Shinichi; Okada, Kensuke; Miyatake, Takahisa; Yaginuma, Toshinobu; Niimi, Teruyuki

    2016-01-01

    Various types of weapon traits found in insect order Coleoptera are known as outstanding examples of sexually selected exaggerated characters. It is known that the sex determination gene doublesex (dsx) plays a significant role in sex-specific expression of weapon traits in various beetles belonging to the superfamily Scarabaeoidea. Although sex-specific weapon traits have evolved independently in various Coleopteran groups, developmental mechanisms of sex-specific expression have not been studied outside of the Scarabaeoidea. In order to test the hypothesis that dsx-dependent sex-specific expression of weapon traits is a general mechanism among the Coleoptera, we have characterized the dsx in the sexually dimorphic broad-horned beetle Gnatocerus cornutus (Tenebrionidea, Tenebirionidae). By using molecular cloning, we identified five splicing variants of Gnatocerus cornutus dsx (Gcdsx), which are predicted to code four different isoforms. We found one male-specific variant (GcDsx-M), two female-specific variants (GcDsx-FL and GcDsx-FS) and two non-sex-specific variants (correspond to a single isoform, GcDsx-C). Knockdown of all Dsx isoforms resulted in intersex phenotype both in male and female. Also, knockdown of all female-specific isoforms transformed females to intersex phenotype, while did not affect male phenotype. Our results clearly illustrate the important function of Gcdsx in determining sex-specific trait expression in both sexes. PMID:27404087

  14. Molecular cloning, sequencing, expression, and site-directed mutagenesis of the 1H-3-hydroxy-4-oxoquinaldine 2,4-dioxygenase gene from Arthrobacter spec. Rü61a.

    PubMed

    Betz, A; Facey, S J; Hauer, B; Tshisuaka, B; Lingens, F

    2000-01-01

    The ring cleaving enzyme 1H-3-hydroxy-4-oxoquinaldine 2,4-dioxygenase (HOD)) of Arthrobacter spec. Rü61a is part of the quinaldine degradation pathway. Carbon monoxide and N-acetyl-anthranilate are the products formed by dioxygenolytic cleavage of two C-C bonds in the substrate's pyridine ring. The gene coding for HOD was cloned and sequenced. An isoelectric point of pH 5.40 and a molecular mass of 31,838 Da was deduced from the sequence. HOD is shown to be remarkably similar to 1H-3-hydroxy-4-oxoquinoline 2,4-dioxygenase (QDO) of Pseudomonas putida 33/1, but not to other dioxygenases described so far. Consensus regions indicative for any chromophoric cofactor or any catalytically relevant metal were not detected. Sequence comparisons and secondary structure predictions revealed HOD as a new member of the alpha/beta hydrolase fold family. Expression in E. coli yielded recombinant catalytically active His-tagged HOD. S101A and D233A, two mutants of HOD, were obtained by site-directed mutagenesis. Since their residual activity is 43.1% and 62.6%, respectively, they probably are of no catalytic relevance although they might play a role in the interaction between enzyme and substrate.

  15. Molecular cloning, characterization and mRNA expression of a chitin synthase 2 gene from the oriental fruit fly, Bactrocera dorsalis (Diptera: Tephritidae).

    PubMed

    Chen, Li; Yang, Wen-Jia; Cong, Lin; Xu, Kang-Kang; Wang, Jin-Jun

    2013-08-19

    Chitin synthase (CHS), a potential target for eco-friendly insecticides, plays an essential role in chitin formation in insects. In this study, a full-length cDNA encoding chitin synthase 2 (BdCHS2) was cloned and characterized in the oriental fruit fly, Bactrocera dorsalis. The BdCHS2 cDNA had 4417 nucleotides, containing an open reading frame of 4122 nucleotides, which encoded 1373 amino acid residues with a predicted molecular weight of 158.5 kDa. Phylogenetic analysis with other insect CHSs suggested that BdCHS2 belongs to insect CHS2. The BdCHS2 transcript was predominately found in midgut but was detected at low levels in fat body, Malpighian tubules, integument, and trachea. Moreover, BdCHS2 was expressed in all developmental stages, and highly expressed in the feeding stages. There was a positive relationship between BdCHS2 expression and total chitin content during development. Furthermore, both the gene expression and chitin content in midgut decreased when the insect was fed for 24 h, then starved for 24 h, while they increased dramatically and rapidly under the condition of starvation for 24 h then feeding for 24 h. These results suggest that BdCHS2 may play an important role in regulating chitin content of the midgut, and subsequently affect the growth and development of B. dorsalis.

  16. Molecular cloning and functional characterization of the sex-determination gene doublesex in the sexually dimorphic broad-horned beetle Gnatocerus cornutus (Coleoptera, Tenebrionidae).

    PubMed

    Gotoh, Hiroki; Ishiguro, Mai; Nishikawa, Hideto; Morita, Shinichi; Okada, Kensuke; Miyatake, Takahisa; Yaginuma, Toshinobu; Niimi, Teruyuki

    2016-07-11

    Various types of weapon traits found in insect order Coleoptera are known as outstanding examples of sexually selected exaggerated characters. It is known that the sex determination gene doublesex (dsx) plays a significant role in sex-specific expression of weapon traits in various beetles belonging to the superfamily Scarabaeoidea. Although sex-specific weapon traits have evolved independently in various Coleopteran groups, developmental mechanisms of sex-specific expression have not been studied outside of the Scarabaeoidea. In order to test the hypothesis that dsx-dependent sex-specific expression of weapon traits is a general mechanism among the Coleoptera, we have characterized the dsx in the sexually dimorphic broad-horned beetle Gnatocerus cornutus (Tenebrionidea, Tenebirionidae). By using molecular cloning, we identified five splicing variants of Gnatocerus cornutus dsx (Gcdsx), which are predicted to code four different isoforms. We found one male-specific variant (GcDsx-M), two female-specific variants (GcDsx-FL and GcDsx-FS) and two non-sex-specific variants (correspond to a single isoform, GcDsx-C). Knockdown of all Dsx isoforms resulted in intersex phenotype both in male and female. Also, knockdown of all female-specific isoforms transformed females to intersex phenotype, while did not affect male phenotype. Our results clearly illustrate the important function of Gcdsx in determining sex-specific trait expression in both sexes.

  17. Molecular cloning, mRNA expression and tissue distribution analysis of Slc7a11 gene in alpaca (Lama paco) skins associated with different coat colors.

    PubMed

    Tian, Xue; Meng, Xiaolin; Wang, Liangyan; Song, Yunfei; Zhang, Danli; Ji, Yuankai; Li, Xuejun; Dong, Changsheng

    2015-01-25

    Slc7a11 encoding solute carrier family 7 member 11 (amionic amino acid transporter light chain, xCT), has been identified to be a critical genetic regulator of pheomelanin synthesis in hair and melanocytes. To better understand the molecular characterization of Slc7a11 and the expression patterns in skin of white versus brown alpaca (lama paco), we cloned the full length coding sequence (CDS) of alpaca Slc7a11 gene and analyzed the expression patterns using Real Time PCR, Western blotting and immunohistochemistry. The full length CDS of 1512bp encodes a 503 amino acid polypeptide. Sequence analysis showed that alpaca xCT contains 12 transmembrane regions consistent with the highly conserved amino acid permease (AA_permease_2) domain similar to other vertebrates. Sequence alignment and phylogenetic analysis revealed that alpaca xCT had the highest identity and shared the same branch with Camelus ferus. Real Time PCR and Western blotting suggested that xCT was expressed at significantly high levels in brown alpaca skin, and transcripts and protein possessed the same expression pattern in white and brown alpaca skins. Additionally, immunohistochemical analysis further demonstrated that xCT staining was robustly increased in the matrix and root sheath of brown alpaca skin compared with that of white. These results suggest that Slc7a11 functions in alpaca coat color regulation and offer essential information for further exploration on the role of Slc7a11 in melanogenesis.

  18. Molecular cloning and characterization of interferon. alpha. /. beta. response element binding factors of the murine (2 prime -5 prime )oligoadenylate synthetase ME-12 gene

    SciTech Connect

    Yan, Cong; Tamm, Igor )

    1991-01-01

    Seven clones encoding interferon response element binding factors have been isolated from a mouse fibroblast {lambda}gt11 cDNA library by using a {sup 32}P end-labeled tandem trimer of the mouse (2{prime}-5{prime})oligoadenylate synthetase gene interferon response element as a probe. Clone 16 shares strong similarity (95%) at both DNA and amino acid level with YB-1, a human major histocompatibility complex class II Y-box DNA-binding protein, and with dbpB, a human epidermal growth factor receptor gene enhancer region binding protein. The product of the gene represented by clone 16 may represent a factor that regulates multiple genes by binding to a variety of 5{prime} regulatory elements. Clone 25 is a 2407-base-pair-long cDNA and contains a putative 311-amino acid open reading frame corresponding to an estimated mass of 35.5 kDa. This putative protein, designated as interferon resonse element binding factor 1 (IREBF-1), contains an acidic domain, three heptad repeat leucine arrays, and a region that shares similarity with the yeast transcriptional factor CAL4 DNA-binding domain. Furthermore, the C terminus of IREBF-1 shows an unusual amphipathic property: within a 79-amino acid range, one side of the {alpha}-helical region contains a preponderance of hydrophobic amino acids and the other side contains hydrophilic amino acids. This type of structure provides a strong hydrophobic force for protein-protein interaction.

  19. Molecular cloning and characterization of a ToxA-like gene from the maize pathogen Cochliobolus heterostrophus

    USDA-ARS?s Scientific Manuscript database

    ToxA, the first discovered fungal proteinaceous host-selective toxin, was originally identified from the tan spot fungus Pyrenophora tritici-repentis (Ptr). Homologues of the PtrToxA gene have not been identified from any other ascomycetes except the leaf/glume blotch fungus Stagonospora nodorum, w...

  20. Molecular cloning and characterization of the mouse carboxyl ester lipase gene and evidence for expression in the lactating mammary gland

    SciTech Connect

    Lidmer, A.S.; Lundberg, L.; Kannius, M.; Bjursell, G.

    1995-09-01

    DNA hybridization was used to isolate a 2.04-kb cDNA encoding carboxyl ester lipase (CEL) from a mouse lactating mammary gland, {lambda}gt10 cDNA library. The cDNA sequence translated into a protein of 599 amino acids, including 20 amino acids of a putative signal peptide. Comparison of the deduced amino acid sequence of the mouse CEL with CEL from five other species revealed that there is a high degree of a homology between the different species. The mouse CEL gene was also isolated and found to span approximately 7.2 kb and to include 11 exons. This organization is similar to those of the recently reported human and rat CEL genes. We have also analyzed expression of the CEL gene in the mammary glands from other species by performing a Northern blot analysis with RNA from goat and cow. The results show that the gene is expressed in both species. 36 refs., 6 figs., 1 tab.

  1. Molecular cloning, characterization and expression profiles of multiple leptin genes and a leptin receptor gene in orange-spotted grouper (Epinephelus coioides).

    PubMed

    Zhang, Huixian; Chen, Huapu; Zhang, Yong; Li, Shuisheng; Lu, Danqi; Zhang, Haifa; Meng, Zining; Liu, Xiaochun; Lin, Haoran

    2013-01-15

    Leptin plays key roles in body weight regulation, energy metabolism, food intake, reproduction and immunity in mammals. However, its function in teleosts is still unclear. In the present study, two leptin genes (gLepA and gLepB) and one leptin receptor gene (gLepR) were cloned and characterized in orange-spotted grouper (Epinephelus coioides). The cDNAs of gLepA and gLepB were 671 bp and 684 bp in length, encoding for proteins of 161 amino acid (aa) and 158 aa, respectively. The three-dimensional (3D) structures modeling of gLepA and gLepB showed strong conservation of tertiary structure with that of other vertebrates. The total length of gLepR cDNA was 4242 bp, encoding a protein of 1169 aa which contained all functionally important domains conserved among vertebrate LEPR. Tissue distribution analysis showed that gLepA was highly expressed in cerebellum, liver and ovary, while gLepB mRNA abundantly in the brain regions, as well as in the ovary with some extend. The gLepR was mainly expressed in kidney, head kidney and most of brain regions. Analysis of expression profiles of gLep and gLepR genes during the embryonic stages showed that high expression of gLepR was observed in the brain vesicle stage, while neither gLepA nor gLepB mRNA was detected during different embryonic stages. Finally, fasting and refeeding experiments were carried out to investigate the possible function of leptin genes in food intake and energy metabolism, and the results showed that a significant increase of gLepA expression in the liver was induced by food deprivation in both short-term (7 days) and long-term (3 weeks) fasting and gLepA mRNA upregulation was eliminated after refeeding, while gLepB wasn't detected in the liver of grouper during fasting. No significant differences in hypothalamic leptin and leptin receptor expression were found during short-term fasting and refeeding. Hepatic expression of gLepA mRNA increased significantly 9h after a single meal. These results suggested g

  2. Cloning, expression, and molecular characterization of the gene encoding an extremely thermostable [4Fe-4S] ferredoxin from the hyperthermophilic archaeon Pyrococcus furiosus.

    PubMed Central

    Heltzel, A; Smith, E T; Zhou, Z H; Blamey, J M; Adams, M W

    1994-01-01

    The gene for ferredoxin from the hyperthermophilic archaeon Pyrococcus furiosus was cloned, sequenced, and expressed in Escherichia coli. The coding region confirmed the determined amino acid sequence. Putative archaeon-type transcriptional regulatory elements were identified. The fdxA gene appears to be an independent transcriptional unit. Recombinant ferredoxin was indistinguishable from the protein purified from P. furiosus in its thermal stability and in the potentiometric and spectroscopic properties of its [4Fe-4S] cluster. PMID:8045914

  3. Molecular cloning of a putative receptor protein kinase gene encoded at the self-incompatibility locus of Brassica oleracea

    SciTech Connect

    Stein, J.C.; Howlett, B.; Boyes, D.C.; Nasrallah, M.E.; Nasrallah, J.B. )

    1991-10-01

    Self-recognition between pollen and stigma during pollination in Brassica oleracea is genetically controlled by the multiallelic self-incompatibility locus (S). The authors describe the S receptor kinase (SRK) gene, a previously uncharacterized gene that residues at the S locus. The nucleotide sequences of genomic DNA and of cDNAs corresponding to SRK predict a putative transmembrane receptor having serine/threonine-specific protein kinase activity. Its extracellular domain exhibits striking homology to the secreted product of the S-locus genotypes are highly polymorphic and have apparently evolved in unison with genetically linked alleles of SLG. SRK directs the synthesis of several alternative transcripts, which potentially encode different protein products, and these transcripts were detected exclusively in reproductive organs. The identification of SRK may provide new perspectives into the signal transduction mechanism underlying pollen recognition.

  4. Molecular cloning, expression profile, polymorphism and the genetic effects of the dopamine D1 receptor gene on duck reproductive traits.

    PubMed

    Wang, Cui; Li, Shijun; Li, Chuang; Feng, Yanping; Peng, Xiuli; Gong, Yanzhang

    2012-09-01

    The dopamine D1 receptor (DRD1), a member of the dopamine receptor (DR) gene family, participates in the regulation of reproductive behaviors in birds. In this study, a 1,390 bp fragment covering the complete coding region (CDS) of duck DRD1 gene was obtained. The cDNA (GenBank: JQ346726) contains a 1,353 bp CDS and a 37 bp 3'- UTR including a TGA termination codon (nucleotides 1,354-1,356 bp). The duck DRD1 shares about 76-96 % nucleic acid identity and 82-98 % amino acid identity with their counterparts in other species. A phylogenetic tree based on amino acid sequences displays that duck DRD1 protein is closely related with those of chicken and zebra finch. The quantitative real-time PCR analysis indicates that the DRD1 mRNA is widely expressed in all examined tissues. Five single nucleotide polymorphisms (SNPs) (c.189A > T, c.507C > T, c.681C > T, c.765A > T, c.1044A > G) in the CDS of duck DRD1 gene were indentified, c.681C > T and c.765A > T were genotyped and analyzed in a two generations duck population by using of PCR-RFLP. Association analysis demonstrated that the c.681C > T genotypes were significantly associated with body weight at sexual maturity (when laying their first egg) (P < 0.01), egg production within 360 days (P < 0.05) and 420 days (P < 0.01); the c.765A > T genotypes were significantly associated with egg shape index and egg shell strength (P < 0.05). Those results suggest that the DRD1 gene may be a potential genetic marker to improve some reproductive traits in ducks.

  5. Molecular cloning of two molluscan caspases and gene functional analysis during Crassostrea angulata (Fujian oyster) larval metamorphosis.

    PubMed

    Yang, Bingye; Li, Lingling; Pu, Fei; You, Weiwei; Huang, Heqing; Ke, Caihuan

    2015-05-01

    Caspases have been demonstrated to possess important functions in apoptosis and immune system in vertebrate. But there is less information reported on the oyster larval development. In the present work, two full-length molluscan caspase genes, named Cacaspase-2 and Cacaspase-3, were characterized for the first time from Fujian oyster, Crassostrea angulata. Which respectively encode two predicted proteins both containing two caspase domains of p20 and p10 including the cysteine active site pentapeptide "QACRG" and the histidine active site signature. Otherwise Cacaspase-2 also contains a caspase recruitment domain. Homology and phylogenetic analysis showed that Cacaspase-2 shared high similarity with initiator caspase-2 groups, but Cacaspase-3 clustered together with executioner caspase-3 groups. Cacaspase-2 and Cacaspase-3 mRNA were both highly expressed in gills and labial palp and were significantly expressed highly in larvae during settlement and metamorphosis. Through the whole mount in situ hybridization, the location of Cacaspase-2 is in the foot of the oyster larvae and the location of Cacaspase-3 is in both the foot and velum tissues. These results implied that Cacaspase-2 and Cacaspase-3 genes play a key role in the loss of foot and Cacaspase-3 gene has an important function in the loss of velum during larvae metamorphosis in C. angulata.

  6. Molecular cloning, characterization and gene expression of an antioxidant enzyme catalase (MrCat) from Macrobrachium rosenbergii.

    PubMed

    Arockiaraj, Jesu; Easwvaran, Sarasvathi; Vanaraja, Puganeshwaran; Singh, Arun; Othman, Rofina Yasmin; Bhassu, Subha

    2012-05-01

    In this study, we reported a full length of catalase gene (designated as MrCat), identified from the transcriptome database of freshwater prawn Macrobrachium rosenbergii. The complete gene sequence of the MrCat is 2504 base pairs in length, and encodes 516 amino acids. The MrCat protein contains three domains such as catalase 1 (catalase proximal heme-ligand signature) at 350-358, catalase 2 (catalase proximal active site signature) at 60-76 and catalase 3 (catalase family profile) at 20-499. The mRNA expressions of MrCat in healthy and the infectious hypodermal and hematopoietic necrosis virus (IHHNV) challenged M. rosenbergii were examined using quantitative real time polymerase chain reaction (qRT-PCR). The MrCat is highly expressed in digestive tract and all the other tissues (walking leg, gills, muscle, hemocyte, hepatopancreas, pleopods, brain and eye stalk) of M. rosenbergii taken for analysis. The expression is strongly up-regulated in digestive tract after IHHNV challenge. To understand its biological activity, the recombinant MrCat gene was constructed and expressed in Escherichia coli BL21 (DE3). The recombinant MrCat existed in high thermal stability and broad spectrum of pH, which showed over 95% enzyme activity between pH 5 and 10.5, and was stable from 40 °C to 70 °C, and exhibited 85-100% enzyme activity from 30 °C to 40 °C.

  7. The phenylalanine ammonia-lyase gene family in Isatis indigotica Fort.: molecular cloning, characterization, and expression analysis.

    PubMed

    Ma, Rui-Fang; Liu, Qian-Zi; Xiao, Ying; Zhang, Lei; Li, Qing; Yin, Jun; Chen, Wan-Sheng

    2016-11-01

    Phenolic compounds, metabolites of the phenylpropanoid pathway, play an important role in the growth and environmental adaptation of many plants. Phenylalanine ammonia-lyase (PAL) is the first key enzyme of the phenylpropanoid pathway. The present study was designed to investigate whether there is a multi-gene family in I. Indigotic and, if so, to characterize their properties. We conducted a comprehensive survey on the transcription profiling database by using tBLASTn analysis. Several bioinformatics methods were employed to perform the prediction of composition and physicochemical characters. The expression levels of IiPAL genes in various tissues of I. indigotica with stress treatment were examined by quantitative real-time PCR. Protoplast transient transformation was used to observe the locations of IiPALs. IiPALs were functionally characterized by expression with pET-32a vector in Escherichia colis strain BL21 (DE3). Integration of transcripts and metabolite accumulations was used to reveal the relation between IiPALs and target compounds. An new gene (IiPAL2) was identified and both IiPALs had the conserved enzymatic active site Ala-Ser-Gly and were classified as members of dicotyledon. IiPAL1 and IiPAL2 were expressed in roots, stems, leaves, and flowers, with the highest expression levels of IiPAL1 and IiPAL2 being observed in stems and roots, respectively. The two genes responded to the exogenous elicitor in different manners. Subcellular localization experiment showed that both IiPALs were localized in the cytosol. The recombinant proteins were shown to catalyze the conversion of L-Phe to trans-cinnamic acid. Correlation analysis indicated that IiPAL1 was more close to the biosynthesis of secondary metabolites than IiPAL2. In conclusion, the present study provides a basis for the elucidation of the role of IiPALs genes in the biosynthesis of phenolic compounds, which will help further metabolic engineering to improve the accumulation of bioactive

  8. Molecular cloning of class III chitinase gene from Avicennia marina and its expression analysis in response to cadmium and lead stress.

    PubMed

    Wang, Li-Ying; Wang, You-Shao; Zhang, Jing-Ping; Gu, Ji-Dong

    2015-10-01

    Mangrove species have high tolerance to heavy metal pollution. Chitinases have been widely reported as defense proteins in response to heavy metal stress in terrestrial plants. In this study, a full-length cDNA sequence encoding an acidic and basic class III chitinase (AmCHI III) was cloned by using RT-PCR and RACE methods in Avicennia marina. AmCHI III mRNA expression in leaf of A. marina were investigated under Cd, Pb stresses on using real-time quantitative PCR. The deduced AmCHI III protein consists of 302 amino acids, including a signal putative peptide region, and a catalytic domain. Homology modeling of the catalytic domain revealed a typical molecular structure of class III plant chitinases. Results further demonstrated that the regulation of AmCHI III mRNA expression in leaves was strongly dependent on Cd, Pb stresses. AmCHI III mRNA expressions were significantly increased in response to Cd, Pb, and peaked at 7 days Cd-exposure, 7 days Pb-exposure, respectively. AmCHI III mRNA expression exhibited more sensitive to Pb stress than Cd stress. This work was the first time cloing chitinase from A. marina, and it brought evidence on chitinase gene involving in heavy metals (Cd(2+) and Pb(2+)) resistance or detoxification in plants. Further studies including the promoter and upstream regulation, gene over-expression and the response of mangrove chitinases to other stresses will shed more light on the role of chitinase in mangrove plants.

  9. Molecular cloning, gene expression analysis, and recombinant protein expression of novel silk proteins from larvae of a retreat-maker caddisfly, Stenopsyche marmorata.

    PubMed

    Bai, Xue; Sakaguchi, Mayo; Yamaguchi, Yuko; Ishihara, Shiori; Tsukada, Masuhiro; Hirabayashi, Kimio; Ohkawa, Kousaku; Nomura, Takaomi; Arai, Ryoichi

    2015-08-28

    Retreat-maker larvae of Stenopsyche marmorata, one of the major caddisfly species in Japan, produce silk threads and adhesives to build food capture nets and protective nests in water. Research on these underwater adhesive silk proteins potentially leads to the development of new functional biofiber materials. Recently, we identified four major S. marmorata silk proteins (Smsps), Smsp-1, Smsp-2, Smsp-3, and Smsp-4 from silk glands of S. marmorata larvae. In this study, we cloned full-length cDNAs of Smsp-2, Smsp-3, and Smsp-4 from the cDNA library of the S. marmorata silk glands to reveal the primary sequences of Smsps. Homology search results of the deduced amino acid sequences indicate that Smsp-2 and Smsp-4 are novel proteins. The Smsp-2 sequence [167 amino acids (aa)] has an array of GYD-rich repeat motifs and two (SX)4E motifs. The Smsp-4 sequence (132 aa) contains a number of GW-rich repeat motifs and three (SX)4E motifs. The Smsp-3 sequence (248 aa) exhibits high homology with fibroin light chain of other caddisflies. Gene expression analysis of Smsps by real-time PCR suggested that the gene expression of Smsp-1 and Smsp-3 was relatively stable throughout the year, whereas that of Smsp-2 and Smsp-4 varied seasonally. Furthermore, Smsps recombinant protein expression was successfully performed in Escherichia coli. The study provides new molecular insights into caddisfly aquatic silk and its potential for future applications.

  10. Molecular cloning, characterization, and promoter analysis of the isochorismate synthase (AaICS1) gene from Artemisia annua *

    PubMed Central

    Wang, Lu-yao; Zhang, Ying; Fu, Xue-qing; Zhang, Ting-ting; Ma, Jia-wei; Zhang, Li-da; Qian, Hong-mei; Tang, Ke-xuan; Li, Shan; Zhao, Jing-ya

    2017-01-01

    Isochorismate synthase (ICS) is a crucial enzyme in the salicylic acid (SA) synthesis pathway. The full-length complementary DNA (cDNA) sequence of the ICS gene was isolated from Artemisia annua L. The gene, named AaICS1, contained a 1710-bp open reading frame, which encoded a protein with 570 amino acids. Bioinformatics and comparative study revealed that the polypeptide protein of AaICS1 had high homology with ICSs from other plant species. Southern blot analysis suggested that AaICS1 might be a single-copy gene. Analysis of the 1470-bp promoter of AaICS1 identified distinct cis-acting regulatory elements, including TC-rich repeats, MYB binding site (MBS), and TCA-elements. An analysis of AaICS1 transcript levels in multifarious tissues of A. annua using quantitative real-time polymerase chain reaction (qRT-PCR) showed that old leaves had the highest transcription levels. AaICS1 was up-regulated under wounding, drought, salinity, and SA treatments. This was corroborated by the presence of the predicted cis-acting elements in the promoter region of AaICS1. Overexpressing transgenic plants and RNA interference transgenic lines of AaICS1 were generated and their expression was compared. High-performance liquid chromatography (HPLC) results from leaf tissue of transgenic A. annua showed an increase in artemisinin content in the overexpressing plants. These results confirm that AaICS1 is involved in the isochorismate pathway. PMID:28786241

  11. Molecular cloning and sequencing of infC, the gene encoding translation initiation factor IF3, from four enterobacterial species.

    PubMed

    Liveris, D; Schwartz, J J; Geertman, R; Schwartz, I

    1993-09-01

    Translation initiation factor IF3 plays a crucial role in initiation of protein synthesis in bacteria. In order to elucidate the IF3 structural elements required for these functions, the evolutionary conservation of IF3 and its gene, infC, was investigated. Homologous infC sequences from Salmonella typhimurium, Klebsiella pneumoniae, Serratia marcescens and Proteus vulgaris were amplified by the polymerase chain reaction and sequenced. Analysis of these sequences, as well as that from Bacillus stearothermophilus, revealed several regions (e.g. residues 62-73 and 173-177) of absolute sequence conservation, suggesting an important role for these regions in IF3 function.

  12. Detection and molecular cloning of CYP74Q1 gene: identification of Ranunculus acris leaf divinyl ether synthase.

    PubMed

    Gorina, Svetlana S; Toporkova, Yana Y; Mukhtarova, Lucia S; Chechetkin, Ivan R; Khairutdinov, Bulat I; Gogolev, Yuri V; Grechkin, Alexander N

    2014-09-01

    Enzymes of the CYP74 family, including the divinyl ether synthase (DES), play important roles in plant cell signalling and defence. The potent DES activities have been detected before in the leaves of the meadow buttercup (Ranunculus acris L.) and few other Ranunculaceae species. The nature of these DESs and their genes remained unrevealed. The PCR with degenerate primers enabled to detect the transcript of unknown P450 gene assigned as CYP74Q1. Besides, two more CYP74Q1 isoforms with minimal sequence variations have been found. The full length recombinant CYP74Q1 protein was expressed in Escherichia coli. The preferred substrates of this enzyme are the 13-hydroperoxides of α-linolenic and linoleic acids, which are converted to the divinyl ether oxylipins (ω5Z)-etherolenic acid, (9Z,11E)-12-[(1'Z,3'Z)-hexadienyloxy]-9,11-dodecadienoic acid, and (ω5Z)-etheroleic acid, (9Z,11E)-12-[(1'Z)-hexenyloxy]-9,11-dodecadienoic acid, respectively, as revealed by the data of mass spectrometry, NMR and UV spectroscopy. Thus, CYP74Q1 protein was identified as the R. acris DES (RaDES), a novel DES type and the opening member of new CYP74Q subfamily.

  13. The C. elegans gene pme-5: molecular cloning and role in the DNA-damage response of a tankyrase orthologue.

    PubMed

    Gravel, Catherine; Stergiou, Lilli; Gagnon, Steve N; Desnoyers, Serge

    2004-02-03

    Tankyrases are recently identified proteins characterized by ankyrin repeats and a poly(ADP-ribose) polymerase (PARP) signature motif. In vertebrates, tankyrases mediate protein-protein interactions via the ankyrin domain. Many partners have been identified that could function in telomere maintenance, signal transduction in vesicular transport, and cell death. To further our knowledge of tankyrases and to study their function in development, we sought and found a tankyrase-related gene in Caenorhabditis elegans that we named pme-5 (poly(ADP-ribose) metabolism enzyme-5). The protein encoded includes a large ankyrin domain and a catalytic PARP domain containing the well-conserved PARP signature sequence and the regulatory region. Unlike other tankyrases, PME-5 lacks a sterile-alpha module (SAM), but has a coiled coil domain which may mediate oligomerization. We also found that pme-5 mRNA is alternatively spliced at the fifth exon, producing a long (PME-5L) and a short (PME-5S) transcript. Both isoforms are constitutively expressed during the life cycle of C. elegans. We also show DNA damage increases expression of pme-5, a response that requires the DNA damage checkpoint gene hus-1. Moreover, DNA damage-induced germ cell apoptosis was slightly increased in pme-5(RNAi) hermaphrodites. Altogether, these data indicate that pme-5 is part of a DNA damage response pathway which leads to apoptosis in C. elegans.

  14. Molecular Cloning and Expression Profile of a Halloween Gene Encoding Cyp307A1 From the Seabuckthorn Carpenterworm, Holcocerus hippophaecolus

    PubMed Central

    Zhou, Jiao; Zhang, Haolin; Li, Juan; Sheng, Xia; Zong, Shixiang; Luo, Youqing; Nagaoka, Kentaro; Weng, Qiang; Watanabe, Gen; Taya, Kazuyoshi

    2013-01-01

    20-Hydroxyecdyone, an active form of ecdysteroid, is the key hormone in insect growth and development. Halloween genes encode ecdysteroidogenic enzymes, including cytochrome P450 monooxygenase. CYP307A1 (spook) is accepted as an enzyme acting in the so-called ‘black box’ that includes a series of hypothetical and unproven reactions that finally result in the oxidation of 7-dehydrocholesterol to diketol. In this study, the Holcocerus hippophaecolus Hua (Lepidoptera: Cossidae) CYP307A1 (HhSpo) gene was identified and characterized. The obtained cDNA sequence was 2084 base pairs with an open reading frame of 537 animo acids, in which existed conserved motifs of CYP450 enzymes. The transcript profiles of HhSpo were analyzed in various tissues of final instar larvae. The highest expression was observed in the prothoracic gland, while expression level was low but significant in other tissues. These results suggest that the sequence character and expression profile of HhSpo were well conserved and provided the basic information for its functional analysis. PMID:23909572

  15. Molecular cloning and expression profile of a Halloween gene encoding Cyp307A1 from the seabuckthorn carpenterworm, Holcocerus hippophaecolus.

    PubMed

    Zhou, Jiao; Zhang, Haolin; Li, Juan; Sheng, Xia; Zong, Shixiang; Luo, Youqing; Nagaoka, Kentaro; Weng, Qiang; Watanabe, Gen; Taya, Kazuyoshi

    2013-01-01

    20-Hydroxyecdyone, an active form of ecdysteroid, is the key hormone in insect growth and development. Halloween genes encode ecdysteroidogenic enzymes, including cytochrome P450 monooxygenase. CYP307A1 (spook) is accepted as an enzyme acting in the so-called 'black box' that includes a series of hypothetical and unproven reactions that finally result in the oxidation of 7-dehydrocholesterol to diketol. In this study, the Holcocerus hippophaecolus Hua (Lepidoptera: Cossidae) CYP307A1 (HhSpo) gene was identified and characterized. The obtained cDNA sequence was 2084 base pairs with an open reading frame of 537 animo acids, in which existed conserved motifs of CYP450 enzymes. The transcript profiles of HhSpo were analyzed in various tissues of final instar larvae. The highest expression was observed in the prothoracic gland, while expression level was low but significant in other tissues. These results suggest that the sequence character and expression profile of HhSpo were well conserved and provided the basic information for its functional analysis.

  16. Molecular cloning and expression of a gene encoding alcohol acyltransferase (MdAAT2) from apple (cv. Golden Delicious).

    PubMed

    Li, Dapeng; Xu, Yunfeng; Xu, Gangming; Gu, Lingkun; Li, Dequan; Shu, Huairui

    2006-04-01

    Volatile esters are major aroma components of apple, and an alcohol acyltransferase (AAT) catalyzes the final step in ester biosynthesis. The gene MdAAT2, which encodes a predicted 51.2 kDa protein containing features of other acyl transferases, was isolated from Malus domestica Borkh. (cv. Golden Delicious). In contrast to other apple varieties, the MdAAT2 gene of Golden Delicious is exclusively expressed in the fruit. The MdAAT2 protein is about 47.9 kDa and mainly localized in the fruit peel, as indicated by immunoblot and immunolocalization analysis. Northern blot and immunoblot analysis showed that the transcription and translation of MdAAT2 have a positive correlation with apple AAT enzyme activity and ester production, except in the later ripening stage, suggesting that MdAAT2 is involved in the regulation of ester biosysthesis and that a post-translation modification may be involved in regulation of AAT enzyme activity. Tissue disk assays of fruit peel revealed that using extraneous alcohols can recover the corresponding ester formation. Transcription and translation of MdAAT2 were both depressed by 1-methylcyclopropene (1-MCP) treatment and subsequent ester production was also prevented. These results suggest that: (1) ester production is mainly regulated by MdAAT2; (2) ethylene is also involved in this regulatory progress and (3) ester compounds rely principally on the availability of substrates.

  17. [Molecular cloning and expression analysis of a SUPERMAN-like zinc finger protein gene in upland cotton].

    PubMed

    Yang, Yu-Wen; Ni, Wan-Chao; Zhang, Bao-Long; Shen, Xin-Lian; Zhang, Xiang-Gui; Xu, Ying-Jun; Yao, Shu

    2006-04-01

    The zinc finger proteins belong to the largest family of regulatory transcription factors, which play an important role in growth and development in animal and plant systems. SUPERMAN-like zinc finger protein gene has only one "finger like" motif. A pair of degenerate primers was designed according to the conserved regions, and 3 kinds of EST of this family were isolated from cotton through RT-PCR. The full length of one SUPERMAN-like zinc finger protein also has been acquired. The entire coding region is 744 bp and encodes a polypeptide of 248 amino acids with 40% homology to RBE protein of Arabidopsis deposited in the GenBank. This gene was designated as GZFP. It has the conserved zinc finger domain and the leucine rich region at the carboxyl terminus but no intron in the coding region. GZFP also has the plant nuclear localization signal. GZFP shows a more expression pattern in floral buds, ovaries, petals and roots than in phloem, xylem, fibers, leaves and seeds of cotton by RT-PCR, although it has a very low detection level and there is not any homologous ESTs found in the GenBank. Analysis of the 5' flanking sequence shows there are several regulatory elements responsible for pollen and root expression, four core sites required for binding of Dof proteins and four light-regulated elements.

  18. Molecular cloning and expression of a heat-shock cognate 70 (hsc70) gene from swordtail fish ( Xiphophorus helleri)

    NASA Astrophysics Data System (ADS)

    Li, Ningqiu; Fu, Xiaozhe; Han, Jingang; Shi, Cunbin; Huang, Zhibin; Wu, Shuqin

    2013-07-01

    Heat shock proteins are a family of molecular chaperones that are involved in many aspects of protein homeostasis. In the present study, a full-length cDNA, encoding the constitutively expressed 70-kDa heat shock cognate protein (Hsc70), was isolated from swordtail fish ( Xiphophorus helleri) and designated as XheHsc70. The Xhehsc70 cDNA was 2 104 bp long with an open reading frame of 1 941 bp, and it encoded a protein of 646 amino acids with a theoretical molecular weight of 70.77 kDa and an isoelectric point of 5.04. The deduced amino acid sequence shared 94.1%-98.6% identities with the Hsc70s from a number of other fish species. Tissue distribution results show that the Xhehsc70 mRNA was expressed in brain, heart, head kidney, kidney, spleen, liver, muscle, gill, and peripheral blood. After immunization with formalin-killed Vibrio alginolyticus cells there was a significant increase in the Xhehsc70 mRNA transcriptional level in the head kidney of the vaccinated fish compared with in the control at 6, 12, 24, and 48 h as shown by quantitative real time RT-PCR. Based on an analysis of the amino acid sequence of XheHsc70, its phylogeny, and Xhehsc70 mRNA expression, XheHsc70 was identified as a member of the cytoplasmic Hsc70 (constitutive) subfamily of the Hsp70 family of heat shock proteins, suggesting that it may play a role in the immune response. The Xhehsc70 cDNA sequence reported in this study was submitted to GenBank under the accession number JF739182.

  19. Molecular cloning, cDNA sequence, and chromosomal localization of the human phosphatidylinositol 3-kinase p110{alpha} (PIK3CA) gene

    SciTech Connect

    Volinia, S.; Hiles, I.; Waterfield, M.D.

    1994-12-01

    Phosphatidylinositol (PI) 3-kinase is a heterodimeric enzyme comprising a 110-kDa catalytic subunit and an 85-kDa regulatory subunit that binds to tyrosine phosphopeptide sites linked directly or indirectly to receptors serving diverse signal functions. Knowledge of the structure and function of PI 3-kinase was greatly advanced by the purification, cDNA cloning, and subsequent expression of the bovine enzyme. Here the cloning of the cDNA for the human p110{alpha}subunit of PI 3-kinase (PIK3CA), encoding a protein 99% identical to the bovine p110, and of its gene in YAC is described. The chromosomal localization of the gene for PIK3CA is shown to be at 3q21-qter as determined using somatic cell hybrids. In situ hybridization performed using Alu-PCR from the YAC DNA located the gene in 3q26.3. 30 refs., 3 figs., 1 tab.

  20. Molecular cloning of the BLADE-ON-PETIOLE gene and expression analyses during nodule development in Lupinus luteus.

    PubMed

    Frankowski, Kamil; Wilmowicz, Emilia; Kućko, Agata; Zienkiewicz, Agnieszka; Zienkiewicz, Krzysztof; Kopcewicz, Jan

    2015-05-01

    The BLADE-ON-PETIOLE (BOP) genes have been recently shown to play an essential role in many physiological processes, including embryogenesis, meristem determinacy, leaf patterning and nodule development. In our research we used Lupinus luteus, a plant with great agronomic potential due to its high protein content and nitrogen fixation ability. In this work, LlBOP in L. luteus was identified for the first time and its expression during nodule development was analyzed. The high expression levels of LlBOP and LlLbI (LEGHEMOGLOBIN), essential to nitrogen-fixing symbiosis, were noted in the developing root nodules and were correlated with the occurrence of leghemoglobin. All of these data indicate that LlBOP is an important regulator of root nodule formation and functioning in L. luteus. Copyright © 2015 Elsevier GmbH. All rights reserved.

  1. Molecular cloning and functional analysis of a blue light receptor gene MdCRY2 from apple (Malus domestica).

    PubMed

    Li, Yuan-Yuan; Mao, Ke; Zhao, Cheng; Zhao, Xian-Yan; Zhang, Rui-Fen; Zhang, Hua-Lei; Shu, Huai-Rui; Hao, Yu-Jin

    2013-04-01

    MdCRY2 was isolated from apple fruit skin, and its function was analyzed in MdCRY2 transgenic Arabidopsis. The interaction between MdCRY2 and AtCOP1 was found by yeast two-hybrid and BiFC assays. Cryptochromes are blue/ultraviolet-A (UV-A) light receptors involved in regulating various aspects of plant growth and development. Investigations of the structure and functions of cryptochromes in plants have largely focused on Arabidopsis (Arabidopsis thaliana), tomato (Solanum lycopersicum), pea (Pisum sativum), and rice (Oryza sativa). However, no data on the function of CRY2 are available in woody plants. In this study, we isolated a cryptochrome gene, MdCRY2, from apple (Malus domestica). The deduced amino acid sequences of MdCRY2 contain the conserved N-terminal photolyase-related domain and the flavin adenine dinucleotide (FAD) binding domain, as well as the C-terminal DQXVP-acidic-STAES (DAS) domain. Relationship analysis indicates that MdCRY2 shows the highest similarity to the strawberry FvCRY protein. The expression of MdCRY2 is induced by blue/UV-A light, which represents a 48-h circadian rhythm. To investigate the function of MdCRY2, we overexpressed the MdCRY2 gene in a cry2 mutant and wild type (WT) Arabidopsis, assessed the phenotypes of the resulting transgenic plants, and found that MdCRY2 functions to regulate hypocotyl elongation, root growth, flower initiation, and anthocyanin accumulation. Furthermore, we examined the interaction between MdCRY2 and AtCOP1 using a yeast two-hybrid assay and a bimolecular fluorescence complementation assay. These data provide functional evidence for a role of blue/UV-A light-induced MdCRY2 in controlling photomorphogenesis in apple.

  2. Molecular cloning, sequencing and functional study of the promoter region of the human alpha2C4-adrenergic receptor gene.

    PubMed

    Schaak, S; Devedjian, J C; Cayla, C; Sender, Y; Paris, H

    1997-12-01

    Screening of a human foetal brain genomic DNA library allowed us to isolate an EcoRI-EcoRI fragment containing 6 kb of the 5'-flanking region, the open reading frame and 4 kb of the 3'-flanking region of the alpha2C4 gene. Analysis of the sequenced region (4850 bp) revealed that the first 900 bp 5' to the start codon are very rich in GC (84%), contain several Sp1-binding sites and lack a consensus TATA box. The 5'- and 3'-ends of the alpha2C4 transcript were determined by RNase-protection assays carried out with a series of antisense probes. The data obtained with cellular RNA from HepG2 cells demonstrated that transcription is initiated 891 bases upstream of the translation-start site and that the polyadenylation site is located 550 bases downstream of the stop codon. These results are consistent with the existence of a non-conventional TATA box (TTAGAAA) and the presence of a unique polyadenylation signal (AATAAA). They also fit with the size of alpha2C4-RNA found by Northern-blot analysis (2.9 kb). The transcriptional activity of the alpha2C4 promoter region was investigated by transfecting several cell types with chimaeric constructs containing various fragments of the 5'-non-coding region and luciferase as a reporter gene. The activity of the construct containing the entire 5'-non-coding region appeared to depend on the host cell. Removal of the 5'-untranslated region resulted in loss of cell specificity and a concomitant increase in luciferase activity. Transfection of HepG2 and SK-N-MC cells with constructs deleted of additional 5'-flanking fragments permitted the definition of a minimal 200 bp promoter fragment containing the pseudo-TATA box and two putative SP1-binding sites.

  3. Cloning, molecular characterization, and spatial and developmental expression analysis of GPR41 and GPR43 genes in New Zealand rabbits.

    PubMed

    Fu, C Y; Liu, L; Gao, Q; Sui, X Y; Li, F C

    2017-10-01

    Short-chain fatty acids (SCFAs) play a regulatory role in various physiological processes in mammals and act as endogenous ligands for the G protein-coupled receptors (GPR) 41 and 43. The role of GPR41 and GPR43 in mediating SCFA signaling in the rabbit remains unclear. The present study was to investigate the sequence of the GPR41 and GPR43 messenger RNA (mRNA) and their expression pattern in different tissues and developmental stages in New Zealand rabbit. Comparison of genomic sequences in GenBank using the Basic Local Alignment Search Tool program suggested that the New Zealand rabbit GPR41 mRNA has high similarities with the human (84%), bovine (84%) and Capra hircus (84%) genes. Similarly, GPR43 mRNA has high similarity with the rat (84%) and mouse (84%) genes. Real-time PCR results indicated that GPR41 and GPR43 mRNA were expressed throughout rabbit's whole development and were expressed in several tissues. G protein-coupled receptor 41 and GPR43 mRNA were most highly expressed in pancreas (P<0.05) and s.c. adipose tissue (P<0.05), respectively. The expression levels of GPR41 mRNA was down-regulated in duodenum, cecum (P<0.05) and pancreas and up-regulated in jejunum, ileum, adipose tissue and spleen during growth. G protein-coupled receptor 43GPR43 mRNA was highly expressed in the duodenum, jejunum, ileum, colon, cecum and lung at 15th day (P<0.05), whereas the expression levels in the pancreas and spleen increased later after birth, with the highest expression at 60th day (P<0.05).

  4. Molecular cloning and sequence analysis of the gene encoding OmpL1, a transmembrane outer membrane protein of pathogenic Leptospira spp.

    PubMed Central

    Haake, D A; Champion, C I; Martinich, C; Shang, E S; Blanco, D R; Miller, J N; Lovett, M A

    1993-01-01

    Pathogenic Leptospira spp. are spirochetes that have a low transmembrane outer membrane protein content relative to that of enteric gram-negative bacteria. In a previous study we identified a 31-kDa surface protein that was present in strains of Leptospira alstoni in amounts which correlated with the outer membrane particle density observed by freeze fracture electron microscopy (D. A. Haake, E. M. Walker, D. R. Blanco, C. A. Bolin, J. N. Miller, and M. A. Lovett, Infect. Immun. 59:1131-1140, 1991). The N-terminal amino acid sequence was used to design a pair of oligonucleotides which were utilized to screen a lambda ZAP II library containing EcoRI fragments of L. alstoni DNA. A 2.5-kb DNA fragment which contained the entire structural ompL1 gene was identified. The structural gene deduced from the sequence of this DNA fragment would encode a 320-amino-acid polypeptide with a 24-amino-acid leader peptide and a leader peptidase I cleavage site. Processing of OmpL1 results in a mature protein with a predicted molecular mass of 31,113 Da. Secondary-structure prediction identified repeated stretches of amphipathic beta-sheets typical of outer membrane protein membrane-spanning sequences. A topological model of OmpL1 containing 10 transmembrane segments is suggested. A recombinant OmpL1 fusion protein was expressed in Escherichia coli in order to immunize rabbits with the purified protein. Upon Triton X-114 extraction of L. alstoni and phase separation, anti-OmpL1 antiserum recognized a single band on immunoblots of the hydrophobic detergent fraction which was not present in the hydrophilic aqueous fraction. Immunoelectron microscopy with anti-OmpL1 antiserum demonstrates binding to the surface of intact L. alstoni. DNA hybridization studies indicate that the ompL1 gene is present in a single copy in all pathogenic Leptospira species that have been tested and is absent in nonpathogenic Leptospira species. OmpL1 may be the first spirochetal transmembrane outer membrane

  5. Molecular cloning and expression of an encoding galactinol synthase gene (AnGolS1) in seedling of Ammopiptanthus nanus

    PubMed Central

    Liu, YuDong; Zhang, Li; Chen, LiJing; Ma, Hui; Ruan, YanYe; Xu, Tao; Xu, ChuanQiang; He, Yi; Qi, MingFang

    2016-01-01

    Based on the galactinol synthase (AnGolS1) fragment sequence from a cold-induced Suppression Subtractive Hybridization (SSH) library derived from Ammopiptanthus nanus (A. nanus) seedlings, AnGolS1 mRNA (including the 5′ UTR and 3′ UTR) (GenBank accession number: GU942748) was isolated and characterized by rapid amplification of cDNA ends polymerase chain reaction (RACE–PCR). A substrate reaction test revealed that AnGolS1 possessed galactinol synthase activity in vitro and could potentially be an early-responsive gene. Furthermore, quantitative real-time PCR (qRT-PCR) indicated that AnGolS1 was responded to cold, salts and drought stresses, however, significantly up-regulated in all origans by low temperatures, especially in plant stems. In addition, the hybridization signals in the fascicular cambium were strongest in all cells under low temperature. Thus, we propose that AnGolS1 plays critical roles in A. nanus low-temperature stress resistance and that fascicular cambium cells could be involved in AnGolS1 mRNA transcription, galactinol transportation and coordination under low-temperature stress. PMID:27786294

  6. Molecular cloning, characterization and expression analysis of ubiquitin protein ligase gene (As-ubpl) from Artemia sinica.

    PubMed

    Li, Zengrong; Yao, Feng; Chen, Yifei; Zhang, Rui; Lv, Ying; Zhao, Na; Wang, Ting; Xin, Wenting; Hou, Lin; Zou, Xiangyang

    2013-06-01

    Ubiquitylation is an important protein post-translational regulation pathway, which is involved in controlling protein degradation, tumor occurrence and cell cycle regulation. E3 ubiquitin protein ligase (UBPL) plays a crucial role of the conjugation of activated ubiquitin to protein substrates and leads to targeting proteins for degradation by the proteasome. We amplified one full-length cDNA of the A. sinica UBPL (As-ubpl) gene by RACE technology. The full-length cDNA of As-ubpl is composed of 2931 bp, with a 2571 bp open reading frame (ORF) that encodes a polypeptide of 856 amino acids with a C2 domain, two domains with two conserved Trp (W) residues (WW) and a homologous to E6-AP Carboxyl Terminus (HECT) domain. The amount of As-ubpl showed from real-time PCR indicates that a high expression levels of As-ubpl at 20 h, 40 h and 3 days of embryo development, with highest expression levels appearing in the larval stage (40 h). Furthermore, As-ubpl transcripts were highly up-regulated under salinity (50‰) and low temperature stress (15 °C). These results indicate that As-ubpl is involved in protein regulation of the postdiapause development and in responses to salinity and low temperature stress. Copyright © 2013 Elsevier Inc. All rights reserved.

  7. Molecular cloning, functional analysis and localization of a novel gene encoding polygalacturonase-inhibiting protein in Chorispora bungeana.

    PubMed

    Di, Cuixia; Li, Ming; Long, Feng; Bai, Muqun; Liu, Yajie; Zheng, Xiaolin; Xu, Shijian; Xiang, Yun; Sun, Zhenglong; An, Lizhe

    2009-12-01

    Polygalacturonase-inhibiting proteins (PGIPs) are plant defense proteins. To date, no spatial distribution of PGIPs and interaction between PGIPs and nitric oxide (NO) in plant were described. Here, we first reported the full-length cDNA sequence of PGIP of Chorispora bungeana (CbPGIP1). Notably, immunofluorescence localization showed that the CbPGIP was evenly distributed in leaves but it was mainly localized in epidermis and vascular bundle in stems and roots. Further studies indicated that CbPGIP had higher abundance in roots than in stems and leaves. Conversely, the bulk PGIP of C. bungeana showed a higher activity in leaves than in stems and roots. In addition, quantitative real-time polymerase chain reaction demonstrated that CbPGIP1 expression was induced by Stemphylium solani, salicylic acid (SA), 4, -4 degrees C and NO. This is a first report attempting to predict if NO can induce the PGIP expression. Taken together, these findings showed that the gene was spatially regulated and NO and SA might take part in CbPGIP1 expression induced by biotic and abiotic stresses. This study highlighted the potential importance of CbPGIP1 and NO in plant resistance.

  8. Molecular cloning, expression, and stress response of the estrogen-related receptor gene (AccERR) from Apis cerana cerana

    NASA Astrophysics Data System (ADS)

    Zhang, Weixing; Zhu, Ming; Zhang, Ge; Liu, Feng; Wang, Hongfang; Guo, Xingqi; Xu, Baohua

    2016-04-01

    Estrogen-related receptor (ERR), which belongs to the nuclear receptor superfamily, has been implicated in diverse physiological processes involving the estrogen signaling pathway. However, little information is available on ERR in Apis cerana cerana. In this report, we isolated the ERR gene and investigated its involvement in antioxidant defense. Quantitative real-time polymerase chain reaction (qPCR) revealed that the highest mRNA expression occurred in eggs during different developmental stages. The expression levels of AccERR were highest in the muscle, followed by the rectum. The predicted transcription factor binding sites in the promoter of AccERR suggested that AccERR potentially functions in early development and in environmental stress responses. The expression of AccERR was induced by cold (4 °C), heat (42 °C), ultraviolet light (UV), HgCl2, and various types of pesticides (phoxim, deltamethrin, triadimefon, and cyhalothrin). Western blot was used to measure the expression levels of AccERR protein. These data suggested that AccERR might play a vital role in abiotic stress responses.

  9. Molecular cloning, expression, purification and characterization of a novel cellulase gene (Bh-EGaseI) in the beetle Batocera horsfieldi.

    PubMed

    Mei, Hui-Zhen; Xia, Ding-Guo; Zhao, Qiao-Ling; Zhang, Guo-Zheng; Qiu, Zhi-Yong; Qian, Ping; Lu, Cheng

    2016-01-15

    Wood-feeding insects depend heavily on the secretion of a combination of cellulases, mainly endoglucanases and other glucanases such as exoglucanases and xylanases, to achieve efficient digestion of the cellulose of cellulosic materials. In this paper, we report a novel cellulose Bh-EGaseI belonging to the glycoside hydrolase family 45(gh45-1) obtained from the beetle Batocera horsfieldi. The Bh-EGaseI gene spans 714 bp and consists of three exons coding 237 amino acid residues. The cDNA encoding Bh-EGaseI was expressed as 25 KDa in baculovirus-infected Bombyx mori larvae. The expression products of Bh-EGaseI from larval hemolymph showed a specific enzymatic activity of approximately 1030.87 IU per mg. The enzyme was active over a wide range of pH and temperatures; optimal activity was observed at 40 °C and pH 4.0. The effects of ions on Bh-EGaseI activity were also studied, and results indicated that activity decreased to different extents upon addition of ions. Investigations on Bh-EGaseI facilitate their potential application in the production of bioenergy and biomaterials from cellulosic biomass in the future. Copyright © 2015 Elsevier B.V. All rights reserved.

  10. Molecular cloning and expression analysis of PDK family genes in Xenopus laevis reveal oocyte-specific PDK isoform.

    PubMed

    Terazawa, Yumiko; Tokmakov, Alexander A; Shirouzu, Mikako; Yokoyama, Shigeyuki

    2005-12-30

    Pyruvate dehydrogenase kinase (PDK) inactivates the multienzyme mitochondrial pyruvate dehydrogenase complex by the phosphorylation of three seryl residues in the pyruvate dehydrogenase moiety, and thus plays an important role in the control of glucose homeostasis. Genetically and biochemically distinct PDK family isozymes have been identified in mammalian species. In the present study, we demonstrate that the complete family of expressed PDK family genes in the tissues of the African clawed frog, Xenopus laevis, consists of four members, which are divided into two evolutionary groups. Xenopus PDKs (xPDKs) share an overall homology of about 70% to the human isoforms of PDK. The abundance of mRNAs for the four xPDK isoforms was analyzed by the real-time reverse transcriptase PCR technique in the various tissues of Xenopus laevis, including heart, lung, spleen, liver, kidney, skin, testis, oocytes, and eggs. Our data suggest that one of the xPDK isozymes can be referred to as an oocyte-specific xPDK. Functional differences between the xPDK isoforms are discussed, based on their different tissue-specific distributions and phylogenetic similarities to human PDKs.

  11. Molecular cloning, characterization and gene expression of murrel CXC chemokine receptor 3a against sodium nitrite acute toxicity and microbial pathogens.

    PubMed

    Bhatt, Prasanth; Chaurasia, Mukesh Kumar; Palanisamy, Rajesh; Kumaresan, Venkatesh; Arasu, Abirami; Sathyamoorthi, Akila; Gnanam, Annie J; Kasi, Marimuthu; Pasupuleti, Mukesh; Ramaswamy, Harikrishnan; Arockiaraj, Jesu

    2014-08-01

    CXCR3 is a CXC chemokine receptor 3 which binds to CXC ligand 4 (CXCL4), 9, 10 and 11. CXC chemokine receptor 3a (CXCR3a) is one of the splice variants of CXCR3. It plays crucial role in defense and other physiological processes. In this study, we report the molecular cloning, characterization and gene expression of CXCR3a from striped murrel Channa striatus (Cs). The full length CsCXCR3a cDNA sequence was obtained from the constructed cDNA library of striped murrel by cloning and sequencing using an internal sequencing primer. The full length sequence is 1425 nucleotides in length including an open reading frame of 1086 nucleotides which is encoded with a polypeptide of 361 amino acids (mol. wt. 40 kDa). CsCXCR3a domain analysis showed that the protein contains a G protein coupled receptor between 55 and 305 along with its family signature at 129-145. The transmembrane prediction analysis showed that CsCXCR3a protein contains 7 transmembrane helical regions at 34-65, 80-106, 113-146, 154-181, 208-242, 249-278 and 284-308. The 'DRY' motif from CsCXCR3a protein sequence at (140)Asp-(141)Arg-(142)Tyr which is responsible for G-protein binding is also highly conserved with CXCR3 from other species. Phylogenetic tree showed that the CXC chemokine receptors 3, 4, 5 and 6, each formed a separate clade, but 1 and 2 were clustered together, which may be due to the high similarity between these receptors. The predicted 3D structure revealed cysteine residues, which are responsible for 'CXC' motif at 116 and 198. The CsCXR3a transcript was found to be high in kidney, further its expression was up-regulated by sodium nitrite acute toxicity exposure, fungal, bacterial and poly I:C challenges. Overall, these results supported the active involvement of CsCXCR3a in inflammatory process of striped murrel during infection. However, further study is necessary to explore the striped murrel chemokine signaling pathways and their roles in defense system.

  12. Ovarian cysteine proteinases in the teleost Fundulus heteroclitus: molecular cloning and gene expression during vitellogenesis and oocyte maturation.

    PubMed

    Fabra, Mercedes; Cerdà, Joan

    2004-03-01

    The cysteine proteinases cathepsins B and L are members of the multigene family of lysosomal proteases that have been implicated in the processing of yolk proteins (YPs) in teleost oocytes. However, the full identification of the type of cathepsins expressed in fish ovarian follicles and embryos, as well as their regulatory mechanisms and specific function(s), are not yet elucidated. In this study, cDNAs encoding cathepsins B, L, F, K, S, Z, C, and H have been isolated from the teleost Fundulus heteroclitus, and the analysis of their deduced amino acid sequences revealed highly similar structural features to vertebrate orthologs, and confirmed in this species the existence of cathepsin L-like, cathepsin B-like, and cathepsin F-like subfamilies of cysteine proteinases. While all identified cathepsins were expressed in ovarian follicles, the corresponding mRNAs showed different temporal expression patterns. Thus, similar mRNA levels of cathepsins L, F, S, B, C, and Z were found throughout the oocyte growth or vitellogenesis period, whereas those for cathepsin H and K appeared to decrease as vitellogenesis advanced. During oocyte maturation, a transient accumulation of cathepsins L, S, H, and F mRNAs, approximately a 3-, 1.5-, 1.6-, and 6-fold increase, respectively, was detected in ovarian follicles within the 20-25 hr after hormone stimulation, coincident with the maximum proteolysis of the oocyte major YPs. The specific temporal pattern of expression of these genes may indicate a potential role of cathepsin L-like and cathepsin F proteases in the YP processing events occurring during fish oocyte maturation and/or early embryogenesis.

  13. Molecular cloning and mRNA expression of a hepcidin gene from the spinyhead croaker, Collichthys lucidus.

    PubMed

    Sang, C; Lin, Y; Jiang, K; Zhang, F; Song, W

    2015-12-07

    Antimicrobial peptides are important components that participate in host innate immune activities and play crucial roles in host defense against microbial invasion. Hepcidin is an antimicrobial peptide and iron-regulatory molecule that primarily functions in the liver. In the present study, we first obtained a full-length cDNA sequence of hepcidin and its corresponding genomic DNA sequence from Collichthys lucidus using RT-PCR and rapid amplification of cDNA ends (RACE), and then analyzed these sequences using bioinformatics software. The results showed that C. lucidus hepcidin (CL-hepc) possesses two introns and three exons in the genomic DNA, with a length of 816 bp. The open reading frame was 264 bp, encoding an 87 amino acid peptide, and with high similarity (88.89%) to 83416593 Larimichthys crocea (ABC18307) and relatively low similarity (47.73%) to 158358729 L. crocea (ABY84845.1). The pre-peptide contained a signal peptide (28 amino acids), a prodomain (34 amino acids), and a mature peptide (25 amino acids). The predicted 25 amino acid hepcidin mature peptide included 8 conserved cysteine residues. Quantitative real-time reverse transcription-PCR analysis revealed specific expression patterns of CL-hepc, with the highest expression observed in the liver, relatively low expression observed in the gill and spleen, and almost no expression detected in other tissues analyzed. In conclusion, we identified a hepcidin from C. lucidus that has common expression patterns with other hepcidins. However, as this hepcidin is inconsistent with two other hepcidins from L. crocea in terms of the phylogenetic tree, the presence of another hepcidin gene warrants further investigation.

  14. Molecular cloning, genomic organization, chromosome mapping, tissues expression pattern and identification of a novel splicing variant of porcine CIDEb gene

    SciTech Connect

    Li, YanHua; Li, AiHua; Yang, Z.Q.

    2016-09-09

    Cell death-inducing DNA fragmentation factor-α-like effector b (CIDEb) is a member of the CIDE family of apoptosis-inducing factors, CIDEa and CIDEc have been reported to be Lipid droplets (LDs)-associated proteins that promote atypical LD fusion in adipocytes, and responsible for liver steatosis under fasting and obese conditions, whereas CIDEb promotes lipid storage under normal diet conditions [1], and promotes the formation of triacylglyceride-enriched VLDL particles in hepatocytes [2]. Here, we report the gene cloning, chromosome mapping, tissue distribution, genetic expression analysis, and identification of a novel splicing variant of the porcine CIDEb gene. Sequence analysis shows that the open reading frame of the normal porcine CIDEb isoform covers 660bp and encodes a 219-amino acid polypeptide, whereas its alternative splicing variant encodes a 142-amino acid polypeptide truncated at the fourth exon and comprised of the CIDE-N domain and part of the CIDE-C domain. The deduced amino acid sequence of normal porcine CIDEb shows an 85.8% similarity to the human protein and 80.0% to the mouse protein. The CIDEb genomic sequence spans approximately 6KB comprised of five exons and four introns. Radiation hybrid mapping demonstrated that porcine CIDEb is located at chromosome 7q21 and at a distance of 57cR from the most significantly linked marker, S0334, regions that are syntenic with the corresponding region in the human genome. Tissue expression analysis indicated that normal CIDEb mRNA is ubiquitously expressed in many porcine tissues. It was highly expressed in white adipose tissue and was observed at relatively high levels in the liver, lung, small intestine, lymphatic tissue and brain. The normal version of CIDEb was the predominant form in all tested tissues, whereas the splicing variant was expressed at low levels in all examined tissues except the lymphatic tissue. Furthermore, genetic expression analysis indicated that CIDEb mRNA levels were

  15. Cloning, molecular characterization, and expression analysis of the signal transducer and activator of transcription 3 (STAT₃) gene from grass carp (Ctenopharyngodon idellus).

    PubMed

    Guo, Ting; Leng, Xiang-Jun; Wu, Xiao-Feng; Li, Jia-Le; Gao, Jian-Zhong; Li, Xiao-Qin; Gan, Tian; Wei, Jing

    2013-11-01

    Signal transducer and activator of transcription 3 (STAT₃) binds to Janus kinase 2 (JAK₂) to initiate the JAK₂/STAT₃ signal transduction pathway, which plays an important role in cancer cell proliferation, immune regulation, reproduction, lipid metabolism, and other physiological processes of the organism. In this study, the cDNA sequence of the STAT₃ gene from grass carp was cloned using RACE (rapid-amplification of cDNA ends). Twelve characteristics of the STAT₃ gene and its encoded protein sequence were predicted and analyzed using bioinformatics methods; these features included the general physical and chemical properties, the hydrophobicity, the secondary structure and the three-dimensional structure of the protein. Quantitative real-time PCR was employed to detect grass carp STAT₃ expression pattern in different tissues. The results showed that the full-length STAT₃ gene from grass carp is 2739-bp long and contains a 216-bp 5'UTR, a 300-bp 3'UTR, and a 2223-bp open reading frame (ORF) that encodes a 740-amino acid peptide. The deduced protein exhibited 99%∼94% homology to the STAT₃ protein of zebrafish (Danio rerio), medaka (Oryzias latipes), turbot (Scophthalmus maximus), white-spotted char (Salvelinus leucomaenis), mandarin fish (Siniperca chuatsi), rainbow trout (Oncorhynchus mykiss), and green pufferfish (Tetraodon fluviatilis). The deduced grass carp STAT₃ protein contains a protein interaction domain, an alpha domain, a DNA binding domain, and an SH2 domain. The STAT₃ protein of grass carp is a hydrophilic and non-secretory protein, and its molecular mass and isoeletronic point were found to be 98,5412.1 Da and 6.39, respectively. The structural elements of STAT₃ included α-helixes, β-sheets, and loops. The grass carp STAT₃ is expressed in all of the six tissues tested, which were the liver, spleen, gill, muscle, heart, and brain. The highest expression level was found in the liver (P < 0.05), whereas a significantly

  16. Molecular cloning, mRNA expression and nutritional regulation of a Δ6 fatty acyl desaturase-like gene of mud crab, Scylla paramamosain.

    PubMed

    Lin, Zhideng; Hao, Meilin; Zhu, Dashi; Li, Shengkang; Wen, Xiaobo

    2017-06-01

    Fatty acyl desaturases (Fads) are critical enzymes in the pathways for the biosynthesis of the highly unsaturated fatty acids (HUFA). Here we report on the molecular cloning, tissue expression and nutritional regulation of a Δ6 fatty acyl desaturase-like (Δ6 Fad-like) gene from mud crab, Scylla paramamosain. The full-length cDNA was 1973bp, with a 201bp of 5'-UTR, a 443bp of 3'-UTR, and an ORF of 1329bp that encoded a protein of 442 amino acids. Bioinformatics analysis showed that the deduced peptide sequence possessed the typical features of the microsomal Fads, including N-terminal cytochrome b5 domain containing the heme-binding motif (H-P-G-G), three histidine-rich boxes and three membrane-spanning regions. Sequence comparison revealed that the predicted protein had a high percentage identity (>53%) with Δ6 Fads from other crustacean species. The tissue distribution of mud crab Δ6 Fad-like mRNA was found predominantly in hepatopancreas, with lower expression levels in all other tissues. Quantitative real-time PCR showed that the Δ6 Fad-like transcriptional levels in hepatopancreas gradually increased with the increased replacement of dietary fish oil (FO) by soybean oil (SO). The replacement ratio of FO by SO up to 60%, 80%, and 100% were significantly up-regulated by about 2.40-fold, 2.99-fold and 3.02-fold compared with that in the control group (100% FO) respectively (P<0.05). These results may contribute to better understanding the HUFA biosynthetic pathway and regulation mechanism in this species. Copyright © 2017 Elsevier Inc. All rights reserved.

  17. Molecular cloning of the DNA gyrase genes from Methylovorus sp. strain SS1 and the mechanism of intrinsic quinolone resistance in methylotrophic bacteria.

    PubMed

    Kim, Kwang-Seo; Kim, Jeong Hoon; Kim, Do Yeob; Kim, Hyun Jong; Park, Sang Tae; Kim, Young Min

    2005-12-31

    The genes encoding the DNA gyrase A (GyrA) and B subunits (GyrB) of Methylovorus sp. strain SS1 were cloned and sequenced. gyrA and gyrB coded for proteins of 846 and 799 amino acids with calculated molecular weights of 94,328 and 88,714, respectively, and complemented Escherichia coli gyrA and gyrB temperature sensitive (ts) mutants. To analyze the role of type II topoisomerases in the intrinsic quinolone resistance of methylotrophic bacteria, the sequences of the quinolone resistance-determining regions (QRDRs) in the A subunit of DNA gyrase and the C subunit (ParC) of topoisomerase IV (Topo IV) of Methylovorus sp. strain SS1, Methylobacterium extorquens AM1 NCIB 9133, Methylobacillus sp, strain SK1 DSM 8269, and Methylophilus methylotrophus NCIB 10515 were determined. The deduced amino acid sequences of the QRDRs of the ParCs in the four methylotrophic bacteria were identical to that of E. coli ParC. The sequences of the QRDR in GyrA were also identical to those in E. coli GyrA except for the amino acids at positions 83, 87, or 95. The Ser83 to Thr substitution in Methylovorus sp. strain SS1, and the Ser83 to Leu and Asp87 to Asn substitutions in the three other methylotrophs, agreed well with the minimal inhibitory concentrations of quinolones in the four bacteria, suggesting that these residues play a role in the intrinsic susceptibility of methylotrophic bacteria to quinolones.

  18. Molecular cloning and expression of the male sterility-related CtYABBY1 gene in flowering Chinese cabbage (Brassica campestris L. ssp chinensis var. parachinensis).

    PubMed

    Zhang, X L; Zhang, L G

    2014-06-10

    Expression of the YABBY gene family in the abaxial surface of lateral plant organs determines abaxial destiny of cells, enhances growth and expansion of lateral organs, and plays an important role in polar establishment of lateral organs. However, the YABBY gene has not been studied in male sterility and fertility restoration. We homologously cloned the CtYABBY1 gene of male-sterile TC1 in Brassica campestris L. ssp chinensis var. parachinensis; its expression was analyzed by real-time PCR. A 937-bp sequence was cloned from TC1 and named CtYABBY1. The ORF of this gene has 702 bp, contains a "C2C2 zinc finger" motif at the N-terminal end, and a "YABBY" structural domain at the C-terminal end. This gene had the highest homology with DBC43-3-2 gene in B. campetris ssp pekinensis. Expression of CtYABBY1 gene has a wide range of functions. It is involved in growth and development of lateral organs, such as leaves and flowers, enhancing expansion of the area and volume of young organs. CtYABBY1 is a gene that promotes thermo-sensitive fertility restoration. At room temperature, expression level of this gene was found to be lower in the stamens of sterile flowers. After treating TC1 at a low temperature of 2°-6°C for 20 days, expression of this gene was upregulated in the stamen of fertile flowers. We conclude that male sterility in TC1 is negatively regulated by this gene, which facilitates transition from male sterility to fertility.

  19. Molecular cloning of murine Pig-a, a gene for GPI-anchor biosynthesis, and demonstration of interspecies conservation of its structure, function, and genetic locus

    SciTech Connect

    Kawagoe, Kazuyoshi; Takeda, Junji; Kinoshita, Taroh

    1994-10-01

    Many membrane proteins are anchored to the cell membrane by glycosylphosphatidylinositol (GPI). The core structure and biosynthesis of the GPI anchor are well conserved in eukaryote cells. We previously cloned a human PIGA gene that participates in GPI anchor biosynthesis. We have now cloned complementary and genomic DNA of Pig-a, the murine homologue of PIGA, and compared its function and gene structure with those of PIGA. The deduced amino acid sequence of mouse PIG-A is 88% identical with that of human PIG-A. Transfection of Pig-a cDNA complemented the defects of both a PIG-A-deficient murine cell line and a PIG-A-deficient human cell line, demonstrating that functions of mouse and human PIG-A are conserved. Like human PIGA, the chromosomal Pig-a gene has six exons and spans approximately 16 kb. Moreover, Pig-a was mapped to X-F3/4, which is syntenic to human Xp22.1, where PIGA is located. Thus, murine Pig-a provides a good animal model to study paroxysmal nocturnal hemoglobinuria, a disease caused by a somatic mutation of PIGA. Database analysis demonstrated that a yeast gene, SPT14, is homologous to Pig-a and PIGA and that these genes are members of a glycosyltransferase gene family.

  20. Identification of BRCA1 and 2 Other Tumor Suppressor Genes on Chromosome 17 Through Positional Cloning

    DTIC Science & Technology

    1996-07-01

    Molecular cloning , DNA sequence analysis, and1 biochemical characterization of a novel 65-kDa FK506-hinding protein (FKBP65). J Biol Chem 270, 29336...S., Wong, K., Chan, R., Lau, C., Tsao, S., Knapp, R., and Berkowitz, R. (1994). Molecular cloning of differentially expressed genes in human

  1. [Molecular cloning of some components of the translation apparatus of fission yeast Schizosaccharomyces pombe and a list of its cytoplasm ic proteins genes].

    PubMed

    Shpakovskiĭ, G V; Baranova, G M; Wood, V; Gwilliam, R G; Shematorova, E K; Korol'chuk, O L; Lebedenko, E N

    1999-06-01

    Full-length cDNAs of four new genes encoding cytoplasmic ribosomal proteins L14 and L20 (large ribosomal subunit) and S1 and S27 (small ribosomal subunit) were isolated and sequenced during the analysis of the fission yeast Schizosaccharomyces pombe genome. One of the Sz. pombe genes encoding translation elongation factor EF-2 was also cloned and its precise position on chromosome I established. A unified nomenclature was proposed, and the list of all known genetic determinants encoding cytoplasmic ribosomal proteins of Sz. pombe was compiled. By now, 76 genes/cDNAs encoding different ribosomal proteins have been identified in the fission yeast genome. Among them, 35 genes are duplicated and three homologous genes are identified for each of the ribosomal proteins L2, L16, P1, and P2.

  2. [Mapping and cloning of low phosphorus tolerance genes in soybeans].

    PubMed

    Dan, Zhang; Haina, Song; Hao, Cheng; Deyue, Yu

    2015-04-01

    Soybean is a major source of edible oil and phytoprotein. Low phosphorus available in soil is an important factor limiting the current soybean production. Effective ways to solve the problem include identification of germplasms and genes tolerant to low-phosphorus stress, and cultivation of soybean varieties with high phosphorus efficiency. Recently many researches have been carrying out investigations to map and clone genes related to phosphorus efficiency in soybeans. However, due to the complexity of the soybean genome and little knowledge of functional genes, it has been difficult to understand the mechanism of soybean tolerance to low phosphorus. Although quantitative trait locus (QTL) mapping related to low phosphorus tolerance has made some progress, it remains elusive to obtain accurate candidate genes for molecular breeding applications, due to the limited accuracy of QTL. Even for the cloned soybean low phosphorus tolerance genes, the molecular mechanisms are largely unknown, further limiting the application to breeding. In this review, we summarize the progresses on mapping, cloning and functional characterization of soybean low phosphorus tolerance genes.

  3. Molecular cloning of the {alpha}3 chain of human type IX collagen: Linkage of the gene COL9A3 to chromosome 20q13.3

    SciTech Connect

    Brewton, R.G.; Wood, B.M.; Ren, Z.X.

    1995-11-20

    Type IX collagen is composed of three polypeptides derived from the human genes COL9A1, COL9A2, and COL9A3 that assemble to form a mature collagen molecule with the structure {alpha}1(IX){alpha}2(IX){alpha}3(IX). We have identified overlapping cDNA and genomic clones that encode for the entire {alpha}3 chain of human type IX collagen. Tryptic peptides from the human {alpha}3(IX) collagen chain were subjected to N-terminal amino acid sequencing, and a stretch of 124 contiguous amino acids that included the NC1, COL1, and NC2 domains was obtained. Degenerate oligonucleotide primers were designed based on the amino acid sequences of the human tryptic peptides as well as bovine peptides and sequences from chicken cDNA clones. These primers were used to amplify three overlapping PCR products that covered the majority of the human {alpha}3(IX) collagen. PCR products were then used to identify overlapping cDNA clones from a human chondrocyte library. A {lambda} genomic clone was identified that contained the 5{prime}-most exon that encodes the signal peptide to complete the entire structure of the human {alpha}3(IX) collagen chain. Genomic amplification identified a single-strand conformational polymorphism in COL1 that was used to map COL9A3 to chromosome 20q13.3 by linkage analysis. The present study completes the structure of human type IX collagen, and linkage for COL9A3 completes the genomic mapping of cartilage collagen genes. These data will greatly assist the genetic screening of families with degenerative cartilage and eye diseases by allowing investigators to screen for a complete set of candidate collagen gene markers. 38 refs., 4 figs., 1 tab.

  4. Molecular Cloning of HbPR-1 Gene from Rubber Tree, Expression of HbPR-1 Gene in Nicotiana benthamiana and Its Inhibition of Phytophthora palmivora

    PubMed Central

    Khunjan, Uraiwan; Ekchaweng, Kitiya; Panrat, Tanate; Tian, Miaoying; Churngchow, Nunta

    2016-01-01

    This is the first report to present a full-length cDNA (designated HbPR-1) encoding a putative basic HbPR-1 protein from rubber tree (Hevea brasiliensis) treated with salicylic acid. It was characterized and also expressed in Nicotiana benthamiana using Agrobacterium-mediated transient gene expression system in order to investigate the role of HbPR-1 gene in rubber tree against its oomycete pathogen Phytopthora palmivora and to produce recombinant HbPR-1 protein for microbial inhibition test. The HbPR-1 cDNA was 647 bp long and contained an open reading frame of 492 nucleotides encoding 163 amino acid residues with a predicted molecular mass of 17,681 Da and an isoelectric point (pI) of 8.56, demonstrating that HbPR-1 protein belongs to the basic PR-1 type. The predicted 3D structure of HbPR-1 was composed of four α-helices, three β-sheets, seven strands, and one junction loop. Expression and purification of recombinant HbPR-1 protein were successful using Agrobacterium-mediated transient expression and one-step of affinity chromatography. Heterologous expression of HbPR-1 in N. benthamiana reduced necrosis areas which were inoculated with P. palmivora zoospores, indicating that the expressed HbPR-1 protein played an important role in plant resistance to pathogens. The purified recombinant HbPR-1 protein was found to inhibit 64% of P. palmivora zoospore germination on a water agar plate compared with control, suggesting that it was an antimicrobial protein against P. palmivora. PMID:27337148

  5. Molecular Cloning of HbPR-1 Gene from Rubber Tree, Expression of HbPR-1 Gene in Nicotiana benthamiana and Its Inhibition of Phytophthora palmivora.

    PubMed

    Khunjan, Uraiwan; Ekchaweng, Kitiya; Panrat, Tanate; Tian, Miaoying; Churngchow, Nunta

    2016-01-01

    This is the first report to present a full-length cDNA (designated HbPR-1) encoding a putative basic HbPR-1 protein from rubber tree (Hevea brasiliensis) treated with salicylic acid. It was characterized and also expressed in Nicotiana benthamiana using Agrobacterium-mediated transient gene expression system in order to investigate the role of HbPR-1 gene in rubber tree against its oomycete pathogen Phytopthora palmivora and to produce recombinant HbPR-1 protein for microbial inhibition test. The HbPR-1 cDNA was 647 bp long and contained an open reading frame of 492 nucleotides encoding 163 amino acid residues with a predicted molecular mass of 17,681 Da and an isoelectric point (pI) of 8.56, demonstrating that HbPR-1 protein belongs to the basic PR-1 type. The predicted 3D structure of HbPR-1 was composed of four α-helices, three β-sheets, seven strands, and one junction loop. Expression and purification of recombinant HbPR-1 protein were successful using Agrobacterium-mediated transient expression and one-step of affinity chromatography. Heterologous expression of HbPR-1 in N. benthamiana reduced necrosis areas which were inoculated with P. palmivora zoospores, indicating that the expressed HbPR-1 protein played an important role in plant resistance to pathogens. The purified recombinant HbPR-1 protein was found to inhibit 64% of P. palmivora zoospore germination on a water agar plate compared with control, suggesting that it was an antimicrobial protein against P. palmivora.

  6. Molecular cloning of the cowpea leghemoglobin II gene and expression of its cDNA in Escherichia coli. Purification and characterization of the recombinant protein.

    PubMed Central

    Arredondo-Peter, R; Moran, J F; Sarath, G; Luan, P; Klucas, R V

    1997-01-01

    Cowpea (Vigna unguiculata) nodules contain three leghemoglobins (LbI, LbII, and LbIII) that are encoded by at least two genes. We have cloned and sequenced the gene that encodes for LbII (lbII), the most abundant Lb in cowpea nodules, using total DNA as the template for PCR. Primers were designed using the sequence of the soybean lbc gene. The lbII gene is 679 bp in length and codes for a predicted protein of 145 amino acids. Using sequences of the cowpea lbII gene for the synthesis of primers and total nodule RNA as the template, we cloned a cDNA for LbII into a constitutive expression vector (pEMBL19+) and then expressed it in Escherichia coli. Recombinant LbII (rLbII) and native LbII (nLbII) from cowpea nodules were purified to homogeneity using standard techniques. Properties of rLbII were compared with nLbII by partially sequencing the proteins and by sodium dodecyl sulfate- and isoelectric focusing polyacrylamide gel electrophoresis, western-blot analysis using anti-soybean Lba antibodies, tryptic and chymotryptic mapping, and spectrophotometric techniques. The data showed that the structural and spectral characteristics of rLbII and nLbII were similar. The rLbII was reversibly oxygenated/deoxygenated, showing that it is a functional hemoglobin. PMID:9193085

  7. Aberrant gene expression in deceased transgenic cloned calves.

    PubMed

    Zhang, L; Wang, S H; Dai, Y P; Li, N

    2009-05-01

    Several transgenic cloned species have been obtained; however, the efficiency of transgenic cloning remains very low, even lower than cloning. Many experiments have demonstrated abnormal growth and development, and inappropriate gene expression in cloned animals. In this study, we examined the expression of 19 development-related genes in lungs of three normal controls and three aberrant transgenic cloned calves. Results showed in transgenic cloned calves, 84.2% genes had decreased expression levels, however, 5.3% genes had increased levels. This study suggests transgenic cloning and the aberrant expression would cause abnormal growth and development in transgenic cloned calves. To our knowledge, this is the first time that gene expression was examined in transgenic cloned cattle. These findings may have some implications in understanding the low efficiency of the transgenic cloning.

  8. Molecular structure of bovine Gtl2 gene and DNA methylation status of Dlk1-Gtl2 imprinted domain in cloned bovines.

    PubMed

    Su, Hong; Li, Dongjie; Hou, Xiaohui; Tan, Beibei; Hu, Jiaqi; Zhang, Cui; Dai, Yunping; Li, Ning; Li, Shijie

    2011-08-01

    Somatic cell nuclear transfer (SCNT) is an inefficient process, which is due to incomplete reprogramming of the donor nucleus. DNA methylation of imprinted genes is essential to the reprogramming of the somatic cell nucleus in SCNT. Dlk1-Gtl2 imprinted domain has been widely studied in mouse and human. However, little is known in bovine, possibly because of limited appropriate sequences of bovine. In our study, we first isolated the cDNA sequence and found multiple transcript variants occurred in bovine Gtl2 gene, which was conserved among species. A probably 110-kb-long Dlk1-Gtl2 imprinted domain was detected on bovine chromosome 21. We identified the putative Gtl2 DMR and IG-DMR corresponding to the mouse and human DMRs and assessed the methylation status of the two DMRs and Dlk1 5' promoter in lungs of deceased SCNT bovines that died within 48h after birth and the normal controls. In cloned bovines, Gtl2 DMR exhibited hypermethylation, which was similar to controls. However, the methylation status of IG-DMR and Dlk1 5' promoter in clones was significantly different from controls, with severe loss of methylation in IG-DMR and hypermethylation in the Dlk1 5' promoter region. Our data suggested that abnormal methylation patterns of IG-DMR may lead to the abnormal expression of Gtl2 and Dlk1 5' hypermethylated promoter is associated with the aberrant development of lungs of cloned bovines, which consequently may contribute to the low efficiency of SCNT.

  9. Molecular cloning, partial genomic structure and functional characterization of succinic semialdehyde dehydrogenase genes from the parasitic insects Lucilia cuprina and Ctenocephalides felis.

    PubMed

    Rothacker, B; Werr, M; Ilg, T

    2008-06-01

    The enzyme succinic semialdehyde dehydrogenase (SSADH; EC1.2.1.24) is a component of the gamma-aminobutyric acid degradation pathway in mammals and is essential for development and function of the nervous system. Here we report the identification, cDNA cloning and functional expression of SSADH from the parasitic insects Lucilia cuprina and Ctenocephalides felis. The recombinant proteins possess potent NAD+-dependent SSADH activity, while their catalytic efficiency for other aldehyde substrates is lower. A genomic copy of the L. cuprina SSADH gene contains two introns, while a genomic gene version of C. felis is devoid of introns. In contrast to the single copy SSADH genes in Drosophila melanogaster and mammals, in L. cuprina and C. felis, multiple SSADH gene copies are present in the genome.

  10. Teaching molecular genetics: chapter 4-positional cloning of genetic disorders.

    PubMed

    Puliti, Aldamaria; Caridi, Gianluca; Ravazzolo, Roberto; Ghiggeri, Gian Marco

    2007-12-01

    Positional cloning is the approach of choice for the identification of genetic mutations underlying the pathological development of diseases with simple Mendelian inheritance. It consists of different consecutive steps, starting with recruitment of patients and DNA collection, that are critical to the overall process. A genetic analysis of the enrolled patients and their families is performed, based on genetic recombination frequencies generated by meiotic cross-overs and on genome-wide molecular studies, to define a critical DNA region of interest. This analysis culminates in a statistical estimate of the probability that disease features may segregate in the families independently or in association with specific molecular markers located in known regions. In this latter case, a marker can be defined as being linked to the disease manifestations. The genetic markers define an interval that is a function of their recombination frequencies with the disease, in which the disease gene is localised. The identification and characterisation of chromosome abnormalities as translocations, deletions and duplications by classical cytogenetic methods or by the newly developed microarray-based comparative genomic hybridisation (array CGH) technique may define extensions and borders of the genomic regions involved. The step following the definition of a critical genomic region is the identification of candidate genes that is based on the analysis of available databases from genome browsers. Positional cloning culminates in the identification of the causative gene mutation, and the definition of its functional role in the pathogenesis of the disorder, by the use of cell-based or animal-based experiments. More often, positional cloning ends with the generation of mice with homologous mutations reproducing the human clinical phenotype. Altogether, positional cloning has represented a fundamental step in the research on genetic renal disorders, leading to the definition of several

  11. Molecular cloning and DNA sequence analysis of genes encoding cytotoxic T lymphocyte-defined HLA-A3 subtypes: the E1 subtype.

    PubMed

    Cowan, E P; Jordan, B R; Coligan, J E

    1985-10-01

    Influenza-specific cytotoxic T cells restricted by HLA-A3 and allogeneic CTL specific for HLA-A3 recognize differences between serologically indistinguishable HLA-A3 antigens. Previous biochemical studies have indicated that such differential recognition can be explained by alterations in the primary structure of class I heavy chains. Characterization of these sequence differences may therefore identify portions of the class I molecule that form determinants recognized by CTL. In this study, we describe the cloning and sequencing of an HLA-A3 subtype from donor E1 (E1-A3). Cloning of the gene encoding E1-A3 was simplified by determining that a 15.5-kb BamHI fragment contains the complete gene and is characteristic of HLA-A3 and only one other class I gene (HLA-A11). Comparison of the E1-A3 sequence to that of a previously sequenced HLA-A3 gene for exons encoding extracellular class I domains revealed three nucleotide differences. All of these differences were located within a discrete region of exon 3 (encoding the alpha 2 domain) and result in a change of two amino acids, at positions 152 (Glu----Val) and 156 (Leu----Gln). This finding suggests that these amino acids are crucial for the information of a determinant recognized by CTL. Furthermore, the altered nucleotide sequence of E1-A3 is identical to the sequence of the HLA-Aw24 gene for codons 128 to 161. These observations of multiple clustered changes in the E1-A3 subtype (relative to the prototype sequence) and identity of the altered sequence with the sequence of another class I gene support the concept that gene conversion is a primary mechanism for the generation of class I polymorphism.

  12. Molecular biology of pyridine nucleotide biosynthesis in Escherichia coli. Cloning and characterization of quinolinate synthesis genes nadA and nadB.

    PubMed

    Flachmann, R; Kunz, N; Seifert, J; Gütlich, M; Wientjes, F J; Läufer, A; Gassen, H G

    1988-08-01

    The two genes, nadA and nadB, responsible for quinolinate biosynthesis from aspartate and dihydroxyacetone phosphate in Escherichia coli were cloned and characterized. Quinolinate (pyridine-2,3-dicarboxylate) is the biosynthetic precursor of the pyridine ring of NAD. Gene nadA was identified by complementation in three different nadA mutant strains. Sequence analysis provided an 840-bp open reading frame coding for a 31,555-Da protein. Gene nadB was identified by complementation in a nadB mutant strain and by the L-aspartate oxidase activity of its gene product. Sequence analysis showed a 1620-bp open reading frame coding for a 60,306-Da protein. For both genes, promoter regions and ribosomal binding sites were assigned by comparison to consensus sequences. The nadB gene product, L-aspartate oxidase, was purified to homogeneity and the N-terminal sequence of 19 amino acids was determined. The enzyme was shown to be specific for L-aspartate. High-copy-number vectors, carrying either gene nadA, nadB or nadA + nadB, increased quinolinate production 1.5-fold, 2.0-fold and 15-fold respectively. Both gene products seem to be equally rate-limiting in quinolinate synthesis.

  13. Molecular cloning, sequencing and tissue expression of vasotocin and isotocin precursor genes from Ostariophysian catfishes: phylogeny and evolutionary considerations in teleosts

    PubMed Central

    Banerjee, Putul; Chaube, Radha; Joy, Keerikkattil P.

    2015-01-01

    Basic and neutral neurohypophyseal (NH) nonapeptides have evolved from vasotocin (VT) by a gene duplication at the base of the gnathostome lineage. In teleosts, VT and IT are the basic and neutral peptides, respectively. In the present study, VT and IT precursor genes of Heteropneustes fossilis and Clarias batrachus (Siluriformes, Ostariophysi) were cloned and sequenced. The channel catfish Icatalurus punctatus NH precursor sequences were obtained from EST database. The catfish NH sequences were used along with the available Acanthopterygii and other vertebrate NH precursor sequences to draw phylogenetic inference on the evolutionary history of the teleost NH peptides. Synteny analysis of the NH gene loci in various teleost species was done to complement the phylogenetic analysis. In H. fossilis, the NH transcripts were also sequenced from the ovary. The cloned genes and the deduced precursor proteins showed conserved characteristics of the NH nonapeptide precursors. The genes are expressed in brain and ovary (follicular envelope) of H. fossilis with higher transcript abundance in the brain. The addition of the catfish sequences in the phylogenetic analysis revealed that the VT and IT precursors of the species-rich superorders of teleosts have a distinct phylogenetic history with the Acanthopterygii VT and IT precursors sharing a less evolutionary distance and the Ostariophysi VT and IT having a greater evolutionary distance. The genomic location of VT and IT precursors, and synteny analysis of the NH loci lend support to the phylogenetic inference and suggest a footprint of fish- specific whole genome duplication (3R) and subsequent diploidization in the NH loci. The VT and IT precursor genes are most likely lineage-specific paralogs resulting from differential losses of the 3R NH paralogs in the two superorders. The independent yet consistent retention of VT and IT in the two superorders might be directed by a stringent ligand-receptor selectivity. PMID:26029040

  14. Molecular cloning, DNA structure, and RNA analysis of the arginase gene in Saccharomyces cerevisiae. A study of cis-dominant regulatory mutations.

    PubMed Central

    Jauniaux, J C; Dubois, E; Vissers, S; Crabeel, M; Wiame, J M

    1982-01-01

    The Saccharomyces cerevisiae gene cargA + or CAR1 , encoding arginase has been cloned by recovering function in transformed yeast cells. It was used to analyse RNA and chromosomal DNA from six strains bearing cis-dominant regulatory mutations leading to constitutive arginase synthesis. The DNA from the four cargA + O- strains in which constitutive arginase synthesis was independent of the mating-type functions showed no detectable differences with the wild- typye . The cargA + O- mutations were, therefore, small alterations, possibly single base substitutions. On the other hand, the cargA + Oh-1 and cargA + Oh-2 mutations, leading to a constitutive and mating-type dependent arginase synthesis, were identified as insertions. Their size and restriction pattern strongly suggested that they were induced by the Ty1 yeast transposable element. This was confirmed by cloning and analysis of the cargA + Oh-1 mutant gene. The concentration of arginase RNA was significantly increased in the mutants, indicating that the regulation of arginase synthesis was exerted, at least in part, at the level of RNA synthesis or stability. In the cargA + Oh-2 strain the Ty1 element was located at a distance of approximately 600 base pairs from the insertion present in the cargA + Oh-1 strain. This result suggests either a surprisingly large arginase regulatory region or an indirect influence of the Ty1 element on gene expression over long distances. Images Fig. 2. Fig. 3. Fig. 4. PMID:6329729

  15. Molecular cloning, DNA structure, and RNA analysis of the arginase gene in Saccharomyces cerevisiae. A study of cis-dominant regulatory mutations.

    PubMed

    Jauniaux, J C; Dubois, E; Vissers, S; Crabeel, M; Wiame, J M

    1982-01-01

    The Saccharomyces cerevisiae gene cargA + or CAR1 , encoding arginase has been cloned by recovering function in transformed yeast cells. It was used to analyse RNA and chromosomal DNA from six strains bearing cis-dominant regulatory mutations leading to constitutive arginase synthesis. The DNA from the four cargA + O- strains in which constitutive arginase synthesis was independent of the mating-type functions showed no detectable differences with the wild- typye . The cargA + O- mutations were, therefore, small alterations, possibly single base substitutions. On the other hand, the cargA + Oh-1 and cargA + Oh-2 mutations, leading to a constitutive and mating-type dependent arginase synthesis, were identified as insertions. Their size and restriction pattern strongly suggested that they were induced by the Ty1 yeast transposable element. This was confirmed by cloning and analysis of the cargA + Oh-1 mutant gene. The concentration of arginase RNA was significantly increased in the mutants, indicating that the regulation of arginase synthesis was exerted, at least in part, at the level of RNA synthesis or stability. In the cargA + Oh-2 strain the Ty1 element was located at a distance of approximately 600 base pairs from the insertion present in the cargA + Oh-1 strain. This result suggests either a surprisingly large arginase regulatory region or an indirect influence of the Ty1 element on gene expression over long distances.

  16. Molecular cloning and characterization of the afa-7 and afa-8 gene clusters encoding afimbrial adhesins in Escherichia coli strains associated with diarrhea or septicemia in calves.

    PubMed

    Lalioui, L; Jouve, M; Gounon, P; Le Bouguenec, C

    1999-10-01

    The afa gene clusters, which encode proteins involved in adhesion to epithelial cells, from Escherichia coli strains associated with urinary and intestinal infections in humans have been characterized. Pathogenic isolates of bovine and porcine origin that possess afa-related sequences have recently been described. We report in this work the cloning and characterization of the afa-7 and afa-8 gene clusters from bovine isolates. Hybridization and sequencing experiments revealed that despite similarity in genetic organization, the afa-7 and afa-8 genes, and the well-characterized afa-3 operon expressed by human-pathogenic isolates, correspond to three different members of the afa family of gene clusters. However, like the afa-3 gene cluster, both the afa-7 and afa-8 gene clusters were found to encode an afimbrial adhesin (AfaE) and an invasin (AfaD). The AfaD peptides encoded by the three gene clusters were only 45% identical, but functional complementation experiments indicated that they belong to the same family of invasins. Hemagglutination and adhesion assays demonstrated that the AfaE-VII and AfaE-VIII adhesins bind to different receptors and that these receptors are not the human decay-accelerating factor recognized to be the receptor of all previously described AfaE adhesins. The AfaE-VIII adhesin is very similar to the M agglutinin of human-uropathogenic strains. We used PCR assays to screen 25 bovine strains for afaD and afaE genes of either the afa-7 or afa-8 gene cluster. The afa-8 gene cluster was highly prevalent in bovine isolates previously reported to carry afa-related sequences (23 of 24 strains), particularly in strains producing cytotoxic necrotizing factors (16 of 16 strains). The location of the afa-8 gene cluster on the plasmids or chromosome of these isolates suggests that it could be carried by a mobile element, facilitating its dissemination among bovine-pathogenic E. coli strains.

  17. Molecular cloning of a glycosylphosphatidylinositol-anchored molecule CDw108.

    PubMed

    Yamada, A; Kubo, K; Takeshita, T; Harashima, N; Kawano, K; Mine, T; Sagawa, K; Sugamura, K; Itoh, K

    1999-04-01

    CDw108, also known as the John-Milton-Hagen human blood group Ag, is an 80-kDa glycosylphosphatidylinositol (GPI)-anchored membrane glycoprotein that is preferentially expressed on activated lymphocytes and E. The molecular characteristics and biological function of the CDw108 were not clarified previously. In this manuscript, we identify the cDNA clone containing the entire coding sequence of the CDw108 gene and report its molecular characteristics. The 1998-base pairs of the open reading frame of the cloned cDNA encoded a protein of 666 amino acids (aa), including the 46 aa of the signal peptide and the 19 aa of the GPI-anchor motif. Thus, the membrane-anchoring form of CDw108 was the 602 aa, and the estimated molecular mass of the unglycosylated form was 68 kDa. The RGD (Arg-Gly-Asp) cell attachment sequence and the five potential N-linked glycosylation sites were located on the membrane-anchoring form. Flow cytometric and immunoprecipitation analyses of the CDw108 cDNA transfectants confirmed that the cloned cDNA encoded the native form of CDw108. The CDw108 mRNA was expressed in activated PBMCs as well as in the spleen, thymus, testis, placenta, and brain, but was not expressed in any other tissues tested. Radiation hybrid mapping indicated that the CDw108 gene was located in the middle of the long arm of chromosome 15 (15q23-24). This molecular information will be critical for understanding the biological function of the CDw108 Ag.

  18. Molecular cloning and RNA interference-mediated functional characterization of a Halloween gene spook in the white-backed planthopper Sogatella furcifera

    PubMed Central

    2013-01-01

    Background Ecdysteroid hormones ecdysone and 20-hydroxyecdysone play fundamental roles in insect postembryonic development and reproduction. Five cytochrome P450 monooxygenases (CYPs), encoded by Halloween genes, have been documented to be involved in the ecdysteroidogenesis in insect species of diverse orders such as Diptera, Lepidoptera and Orthoptera. Up to now, however, the involvement of the Halloween genes in ecdysteroid synthesis has not been confirmed in hemipteran insect species. Results In the present paper, a Halloween gene spook (Sfspo, Sfcyp307a1) was cloned in the hemipteran Sogatella furcifera. SfSPO has three insect conserved P450 motifs, i.e., Helix-K, PERF and heme-binding motifs. Temporal and spatial expression patterns of Sfspo were evaluated by qPCR. Sfspo showed three expression peaks in late second-, third- and fourth-instar stages. In contrast, the expression levels were lower and formed three troughs in the newly-molted second-, third- and fourth-instar nymphs. On day 3 of the fourth-instar nymphs, Sfspo clearly had a high transcript level in the thorax where PGs were located. Dietary introduction of double-stranded RNA (dsRNA) of Sfspo into the second instars successfully knocked down the target gene, and greatly reduced expression level of ecdysone receptor (EcR) gene. Moreover, knockdown of Sfspo caused lethality and delayed development during nymphal stages. Furthermore, application of 20-hydroxyecdysone on Sfspo-dsRNA-exposed nymphs did not increase Sfspo expression, but could almost completely rescue SfEcR expression, and relieved the negative effects on nymphal survival and development. Conclusion In S. furcifera, Sfspo was cloned and the conservation of SfSPO is valid. Thus, SfSPO is probably also involved in ecdysteroidogenesis for hemiptera. PMID:24007644

  19. Molecular cloning and RNA interference-mediated functional characterization of a Halloween gene spook in the white-backed planthopper Sogatella furcifera.

    PubMed

    Jia, Shuang; Wan, Pin-Jun; Zhou, Li-Tao; Mu, Li-Li; Li, Guo-Qing

    2013-09-04

    Ecdysteroid hormones ecdysone and 20-hydroxyecdysone play fundamental roles in insect postembryonic development and reproduction. Five cytochrome P450 monooxygenases (CYPs), encoded by Halloween genes, have been documented to be involved in the ecdysteroidogenesis in insect species of diverse orders such as Diptera, Lepidoptera and Orthoptera. Up to now, however, the involvement of the Halloween genes in ecdysteroid synthesis has not been confirmed in hemipteran insect species. In the present paper, a Halloween gene spook (Sfspo, Sfcyp307a1) was cloned in the hemipteran Sogatella furcifera. SfSPO has three insect conserved P450 motifs, i.e., Helix-K, PERF and heme-binding motifs. Temporal and spatial expression patterns of Sfspo were evaluated by qPCR. Sfspo showed three expression peaks in late second-, third- and fourth-instar stages. In contrast, the expression levels were lower and formed three troughs in the newly-molted second-, third- and fourth-instar nymphs. On day 3 of the fourth-instar nymphs, Sfspo clearly had a high transcript level in the thorax where PGs were located. Dietary introduction of double-stranded RNA (dsRNA) of Sfspo into the second instars successfully knocked down the target gene, and greatly reduced expression level of ecdysone receptor (EcR) gene. Moreover, knockdown of Sfspo caused lethality and delayed development during nymphal stages. Furthermore, application of 20-hydroxyecdysone on Sfspo-dsRNA-exposed nymphs did not increase Sfspo expression, but could almost completely rescue SfEcR expression, and relieved the negative effects on nymphal survival and development. In S. furcifera, Sfspo was cloned and the conservation of SfSPO is valid. Thus, SfSPO is probably also involved in ecdysteroidogenesis for hemiptera.

  20. Molecular cloning and characterization of mouse Gipc3.

    PubMed

    Saitoh, Tetsuroh; Mine, Tetsuya; Katoh, Masaru

    2002-03-01

    GIPC1/GIPC interacts with GTPase-activating protein RGS-GAIP, transmembrane protein M-SemF, receptor tyrosine kinase TrkA, integrin alpha 6A subunit, and TGF beta type III receptor. Kermit, a Xenopus orthologue of human GIPC1, interacts with Frizzled-3 (FZD3) class of WNT receptor. We have recently cloned and characterized human GIPC2 and GIPC3. Here, we identified mouse Gipc3 gene fragments by using bioinformatics, and isolated mouse Gipc3 cDNAs by using cDNA-PCR. Mouse Gipc3 gene encoded a 297-amino-acid protein, showing 86.2% total-amino-acid identity with human GIPC3. In addition to the central PDZ domain, GIPC homologous domain 1 (GH1 domain) and GH2 domain were found to be conserved among mouse Gipc3, Gipc1, Gipc2, and Xenopus Kermit. Mouse Gipc3 gene was found to consist of 6 exons, and exon-intron structure was well conserved between mouse Gipc3 gene and human GIPC3 gene. Mouse Gipc3 mRNA was relatively highly expressed in adult lung, and was also expressed in brain and testis, but was almost undetectable in 7-, 11-, 15, and 17-day whole embryos. This is the first report on molecular cloning and initial characterization of mouse Gipc3.

  1. The human osmoregulatory Na{sup +}/myo-inositol cotransporter gene (SLC5A3): Molecular cloning and localization to chromosome 21

    SciTech Connect

    Berry, G.T.; Mallee, J.J.; Muenke, M.

    1995-01-20

    A human Na{sup +}/myo-inositol cotransporter (SLC5A3) gene was cloned; sequencing revealed a single intron-free open reading frame of 2157 nucleotides. Containing 718 amino acid residues, the predicted protein is highly homologous to the product of the canine osmoregulatory SLC5A3 gene. The SLC5A3 protein is number 3 of the solute carrier family 5 and was previously designated SMIT. Using fluorescence in situ hybridization, the human SLC5A3 gene was localized to band q22 on chromosome 21. Many tissues including brain demonstrate gene expression. The inability of a trisomic 21 cell to downregulate expression of three copies of this osmoregulatory gene could result in increased flux of both myo-inositol and Na{sup +} across the plasma membrane. The potential consequences include perturbations in the cell membrane potential and tissue osmolyte levels. The SLC5A3 gene may play a role in the pathogenesis of Down syndrome. 54 refs., 4 figs.

  2. Rapid extraction and purification of environmental DNA for molecular cloning applications and molecular diversity studies.

    PubMed

    Santosa, D A

    2001-01-01

    A rapid method for the extraction and purification of DNA from environmental samples for molecular cloning applications was developed. The indigenous cells from plant debris, organic materials, sediments, and soils were lysed directly by using DAS-IZ solution and the nucleic acids were precipitated with isopropanol. A simple purification step using DAS-IIZ solution without binding matrix produced highly pure, colorless and undegraded DNA with molecular weight of more than 20 kb. The superiority of this method was tested for wide applications in molecular cloning, i.e., construction of genomic library by using Lambda DASHII Vector and GigapackIII XL, plasmid library, cloning of gene encoding protease, and molecular microbial diversity analysis. An additional advantage of this method is that only 0.1 g of sample is required, if analysis of many samples in short time should be done. To extract large amounts of environmental DNA for molecular cloning lasts only 30 min and to purify it less than 1 h.

  3. Molecular cloning of tissue-specific transcripts of a transketolase-related gene: Implications for the evolution of new vertebrate genes

    SciTech Connect

    Coy, J.F.; Duebel, S.; Kioschis, P.; Delius, H.; Poustka, A.

    1996-03-05

    As part of a systematic search for differentially expressed genes, we have isolated a novel transketolase-related gene (TKR) (HGMW-approved symbol TKT), located between the green color vision pigment gene (GCP) and the ABP-280 filamin gene (FLN1) in Xq28. Transcripts encoding tissue-specific protein isoforms could be isolated. Comparison with known transketolases (TK) demonstrated a TKR-specific deletion mutating one thiamine binding site. Genomic sequencing of the TKR gene revealed the presence of a pseudoexon as well as the acquisition of a tissue-specific spliced exon compared to TK. Since it has been postulated that the vertebrate genome arose by two cycles of tetraploidization from a cephalochordate genome, this could represent an example of the modulation of the function of a preexisting transketolase gene by gene duplication. Thiamine defiency is closely involved with two neurological disorders, Beriberi and Wernicke-Korsakoff syndromes, and in both of these conditions TK with altered activity are found. We discuss the possible involvement of TKR in explaining the observed variant transketolase forms. 34 refs., 4 figs., 1 tab.

  4. A novel lipopolysaccharide-induced transcription factor regulating tumor necrosis factor α gene expression: Molecular cloning, sequencing, characterization, and chromosomal assignment

    PubMed Central

    Myokai, Fumio; Takashiba, Shogo; Lebo, Roger; Amar, Salomon

    1999-01-01

    Lipopolysaccharide (LPS) is a potent stimulator of monocytes and macrophages, causing secretion of tumor necrosis factor α (TNF-α) and other inflammatory mediators. Given the deleterious effects to the host of TNF-α, it has been postulated that TNF-α gene expression must be tightly regulated. The nature of the nuclear factor(s) that control TNF-α gene transcription in humans remains obscure, although NF-κB has been suggested. Our previous studies pertaining to macrophage response to LPS identified a novel DNA-binding domain located from −550 to −487 in the human TNF-α promoter that contains transcriptional activity, but lacks any known NF-κB-binding sites. We have used this DNA fragment to isolate and purify a 60-kDa protein binding to this fragment and obtained its amino-terminal sequence, which was used to design degenerate probes to screen a cDNA library from THP-1 cells. A novel cDNA clone (1.8 kb) was isolated and fully sequenced. Characterization of this cDNA clone revealed that its induction was dependent on LPS activation of THP-1 cells; hence, the name LPS-induced TNF-alpha factor (LITAF). Inhibition of LITAF mRNA expression in THP-1 cells resulted in a reduction of TNF-α transcripts. In addition, high level of expression of LITAF mRNA was observed predominantly in the placenta, peripheral blood leukocytes, lymph nodes, and the spleen. Finally, chromosomal localization using fluorescence in situ hybridization revealed that LITAF mapped to chromosome 16p12–16p13.3. Together, these findings suggest that LITAF plays an important role in the activation of the human TNF-α gene and proposes a new mechanism to control TNF-α gene expression. PMID:10200294

  5. Cloning, characterization, and genomic structure of the mouse Ikbkap gene.

    PubMed

    Cuajungco, M P; Leyne, M; Mull, J; Gill, S P; Gusella, J F; Slaugenhaupt, S A

    2001-09-01

    Our laboratory recently reported that mutations in the human I-kappaB kinase-associated protein (IKBKAP) gene are responsible for familial dysautonomia (FD). Interestingly, amino acid substitutions in the IKAP correlate with increased risk for childhood bronchial asthma. Here, we report the cloning and genomic characterization of the mouse Ikbkap gene, the homolog of human IKBKAP. Like its human counterpart, Ikbkap encodes a protein of 1332 amino acids with a molecular weight of approximately 150 kDa. The Ikbkap gene product, Ikap, contains 37 exons that span approximately 51 kb. The protein shows 80% amino acid identity with human IKAP. It shows very high conservation across species and is homologous to the yeast Elp1/Iki3p protein, which is a member of the Elongator complex. The Ikbkap gene maps to chromosome 4 in a region that is syntenic to human chromosome 9q31.3. Because no animal model of FD currently exists, cloning of the mouse Ikbkap gene is an important first step toward creating a mouse model for FD. In addition, cloning of Ikbkap is crucial to the characterization of the putative mammalian Elongator complex.

  6. Molecular Cloning, Expression of minD Gene from Lactobacillus acidophilus VTCC-B-871 and Analyses to Identify Lactobacillus rhamnosus PN04 from Vietnam Hottuynia cordata Thunb.

    PubMed

    Nguyen, Tu Hoang Khue; Doan, Vinh Thi Thanh; Ha, Ly Dieu; Nguyen, Huu Ngoc

    2013-12-01

    The minD gene encoding an inhibitor cell division MinD homolog from Lactobacillus acidophilus VTCC-B-871 was cloned. We showed that there were 97 % homology between minD genes of L. acidophilus VTCC-B-871 and Lactobacillus rhamnosus GG and Lactobacillus rhamnosus Lc705. Based on the analysis of the DNA sequence data from the L. rhamnosus genome project and sequenced minD gene of L. acidophilus VTCC-B-871, a pair of primers was designed to identified the different minD genes from L. acidophilus ATCC 4356, L. rhamnosus ATCC 11443. Besides, the polymerase chain reaction product of minD gene was also obtained in L. rhamnosus PN04, a strain was isolated from Vietnamese Hottuynia cordata Thunb. In addition, we performed a phylogenetic analysis of the deduced amino acid sequence of MinD homologs from L. acidophilus VTCC-B-871 with the other strains and compared the predicted three-dimension structure of L. acidophilus VTCC-B-871 MinD with Escherichia coli MinD, there are similarity that showed evolution of these strains. The overexpression of L. acidophilus VTCC-B-871 MinD in E. coli led to cell filamentation in IPTG and morphology changes in different sugar stresses, interestingly. The present study is the first report characterizing the Lactobacilus MinD homolog that will be useful in probiotic field.

  7. Positional cloning of disease genes on chromosome 16

    SciTech Connect

    Doggett, N.; Bruening, M.; Callen, D.; Gardiner, M.; Lerner, T.

    1996-04-01

    The project seeks to elucidate the molecular basis of an important genetic disease (Batten`s disease) by molecular cloning of the affected gene by utilizing an overlapping clone map of chromosome 16. Batten disease (also known as juvenile neuronal ceroid lipofuscinosis) is a recessively inherited neurodegenerative disorder of childhood characterized by progressive loss of vision, seizures, and psychomoter disturbances. The Batten disease gene was genetically mapped to the chromosome region 16p 12.1 in close linkage with the genetic markers D16S299 and D16S298. Exon amplification of a cosmid containing D16S298 yielded a candidate gene that was disrupted by a 1 kb genomic deletion in all patients containing the most common haplotype for the disease. Two separate deletions and a point mutation altering a splice site in three unrelated families have confirmed the gene as the Batten disease gene. The disease gene encodes a novel 438 amino acid membrane binding protein of unknown function.

  8. Molecular cloning and characterization of two genes for the biotin carboxylase and carboxyltransferase subunits of acetyl coenzyme A carboxylase in Myxococcus xanthus.

    PubMed

    Kimura, Y; Miyake, R; Tokumasu, Y; Sato, M

    2000-10-01

    We have cloned a DNA fragment from a genomic library of Myxococcus xanthus using an oligonucleotide probe representing conserved regions of biotin carboxylase subunits of acetyl coenzyme A (acetyl-CoA) carboxylases. The fragment contained two open reading frames (ORF1 and ORF2), designated the accB and accA genes, capable of encoding a 538-amino-acid protein of 58.1 kDa and a 573-amino-acid protein of 61.5 kDa, respectively. The protein (AccA) encoded by the accA gene was strikingly similar to biotin carboxylase subunits of acetyl-CoA and propionyl-CoA carboxylases and of pyruvate carboxylase. The putative motifs for ATP binding, CO(2) fixation, and biotin binding were found in AccA. The accB gene was located upstream of the accA gene, and they formed a two-gene operon. The protein (AccB) encoded by the accB gene showed high degrees of sequence similarity with carboxyltransferase subunits of acetyl-CoA and propionyl-CoA carboxylases and of methylmalonyl-CoA decarboxylase. Carboxybiotin-binding and acyl-CoA-binding domains, which are conserved in several carboxyltransferase subunits of acyl-CoA carboxylases, were found in AccB. An accA disruption mutant showed a reduced growth rate and reduced acetyl-CoA carboxylase activity compared with the wild-type strain. Western blot analysis indicated that the product of the accA gene was a biotinylated protein that was expressed during the exponential growth phase. Based on these results, we propose that this M. xanthus acetyl-CoA carboxylase consists of two subunits, which are encoded by the accB and accA genes, and occupies a position between prokaryotic and eukaryotic acetyl-CoA carboxylases in terms of evolution.

  9. Alpha-amylase genes (amyR2 and amyE+) from an alpha-amylase-hyperproducing Bacillus subtilis strain: molecular cloning and nucleotide sequences.

    PubMed Central

    Yamazaki, H; Ohmura, K; Nakayama, A; Takeichi, Y; Otozai, K; Yamasaki, M; Tamura, G; Yamane, K

    1983-01-01

    amyR2, amyE+, and aroI+ alleles from an alpha-amylase-hyperproducing strain, Bacillus subtilis NA64, were cloned in temperate B. subtilis phage p11, and the amyR2 and amyE+ genes were then recloned in plasmid pUB110, which was designated pTUB4. The order of the restriction sites, ClaI-EcoRI-PstI-SalI-SmaI, found in the DNA fragment carrying amyR2 and amyE+ from the phage genome was also found in the 2.3-kilobase insert of pTUB4. Approximately 2,600 base pairs of the DNA nucleotide sequence of the amyR2 and amyE+ gene region in pTUB4 were determined. Starting from an ATG initiator codon, an open reading frame was composed of a total 1,776 base pairs (592 amino acids). Among the 1,776 base pairs, 1,674 (558 amino acids) were found in the cloned DNA fragment, and 102 base pairs (34 amino acids) were in the vector pUB110 DNA. The COOH terminal region of the alpha-amylase of pTUB4 was encoded in pUB110. The electrophoretic mobility in a 7.5% polyacrylamide gel of the alpha-amylase was slightly faster than that of the parental alpha-amylases. The NH2 termination portion of the gene encoded a 41-amino acid-long signal sequence (Ohmura et al., Biochem. Biophys. Res. Commun. 112:687-683, 1983). The DNA sequence of the mature extracellular alpha-amylase, a potential RNA polymerase recognition site and Pribnow box (TTGATAGAGTGATTGTGATAATTTAAAAT), and an AT-rich inverted repeat structure which has free energy of -8.2 kcal/mol (-34.3 kJ/mol) were identified. The AT-rich inverted repeat structure seemed to correspond to the hyperproducing character. The nucleotide sequence around the region was quite different from the promoter region of the B. subtilis 168 alpha-amylase gene which was cloned in the Escherichia coli vector systems. Images PMID:6413492

  10. A modified version of the digestion-ligation cloning method for more efficient molecular cloning.

    PubMed

    Gao, Song; Li, Yanling; Zhang, Jiannan; Chen, Hongman; Ren, Daming; Zhang, Lijun; An, Yingfeng

    2014-05-15

    Here we describe a modified version of the digestion-ligation approach for efficient molecular cloning. In comparison with the original method, the modified method has the additional steps of gel purification and a second ligation after the first ligation of the linearized vector and DNA insert. During this process, the efficiency and reproducibility could be significantly improved for both stick-end cloning and blunt-end cloning. As an improvement of the very important molecular cloning technique, this method may find a wide range of applications in bioscience and biotechnology.

  11. Molecular cloning and characterization of ETHYLENE OVERPRODUCER 1-LIKE 1 gene, LeEOL1, from tomato (Lycopersicon esculentum Mill.) fruit.

    PubMed

    Zhu, Hong-Liang; Zhu, Ben-Zhong; Shao, Yi; Lin, Xi-Jin; Wang, Xiao-Guang; Gao, Hong-Yan; Xie, Yun-Hong; Li, Ying-Cong; Luo, Yun-Bo

    2007-04-01

    Recently, ETHYLENE OVERPRODUCER 1 (ETO1) had been cloned and identified as a negative post-transcriptional regulator in the ethylene biosynthesis in Arabidopsis. However, little was known about the role of ETO1 in other species, especially in tomato, which was an ideal model for studying the biosynthesis of ethylene during tomato fruit ripening. In this study, a tomato ETHYLENE OVERPRODUCER 1-LIKE 1 (LeEOL1) was cloned. The LeEOL1 cDNA was 3,515 bp long and carried an ORF that putatively encoded a polypeptide of 886 amino acids with a predicted molecular mass of 95 kDa. It shared 74% identity in amino acid sequence with Arabidopsis EOL1 and had one BTB (Broad-complex, Tramtrack, Bric-à-brac) domain and two TPR (tetratricopeptide repeat) domains, which were also conserved domains in AtEOL1. RT-PCR analysis of the temporal expression of LeEOL1 showed that its transcript decreased companied with increase of ethylene production in tomato ripening. The level of LeEOL1 transcripts in wild type tomato fruit at mature green stage did not distinctively change when treated with exogenous ethylene.

  12. Molecular cloning and characterization of drought stress responsive abscisic acid-stress-ripening (Asr 1) gene from wild jujube, Ziziphus nummularia (Burm.f.) Wight & Arn.

    PubMed

    Padaria, Jasdeep Chatrath; Yadav, Radha; Tarafdar, Avijit; Lone, Showkat Ahmad; Kumar, Kanika; Sivalingam, Palaiyur Nanjappan

    2016-08-01

    Drought is a calamitous abiotic stress hampering agricultural productivity all over the world and its severity is likely to increase further. Abscisic acid-stress-ripening proteins (ASR), are a group of small hydrophilic proteins which are induced by abscisic acid, stress and ripening in many plants. In the present study, ZnAsr 1 gene was fully characterized for the first time from Ziziphus nummularia, which is one of the most low water forbearing plant. Full length ZnAsr 1 gene was characterised and in silico analysis of ZnASR1 protein was done for predicting its phylogeny and physiochemical properties. To validate transcriptional pattern of ZnAsr 1 in response to drought stress, expression profiling in polyethylene glycol (PEG) induced Z. nummularia seedlings was studied by RT-qPCR analysis and heterologous expression of the recombinant ZnAsr1 in Escherichia coli. The nucleotide sequence analysis revealed that the complete open reading frame of ZnAsr 1 is 819 bp long encoding a protein of 273 amino acid residues, consisting of a histidine rich N terminus with an abscisic acid/water deficit stress domain and a nuclear targeting signal at the C terminus. In expression studies, ZnAsr 1 gene was found to be highly upregulated under drought stress and recombinant clones of E. coli cells expressing ZnASR1 protein showed better survival in PEG containing media. ZnAsr1 was proven to enhance drought stress tolerance in the recombinant E.coli cells expressing ZnASR1. The cloned ZnAsr1 after proper validation in a plant system, can be used to develop drought tolerant transgenic crops.

  13. Molecular cloning, expression, and functional analysis of the copper amine oxidase gene in the endophytic fungus Shiraia sp. Slf14 from Huperzia serrata.

    PubMed

    Yang, Huilin; Peng, Silu; Zhang, Zhibin; Yan, Riming; Wang, Ya; Zhan, Jixun; Zhu, Du

    2016-12-01

    Huperzine A (HupA) is a drug used for the treatment of Alzheimer's disease. However, the biosynthesis of this medicinally important compound is not well understood. The HupA biosynthetic pathway is thought to be initiated by the decarboxylation of lysine to form cadaverine, which is then converted to 5-aminopentanal by copper amine oxidase (CAO). In this study, we cloned and expressed an SsCAO gene from a HupA-producing endophytic fungus, Shiraia sp. Slf14. Analysis of the deduced protein amino acid sequence showed that it contained the Asp catalytic base, conserved motif Asn-Tyr-Asp/Glu, and three copper-binding histidines. The cDNA of SsCAO was amplified and expressed in Escherichia coli BL21(DE3), from which a 76 kDa protein was obtained. The activity of this enzyme was tested, which provided more information about the SsCAO gene in the endophytic fungus. Gas Chromatograph-Mass Spectrometry (GC-MS) revealed that this SsCAO could accept cadaverine as a substrate to produce 5-aminopentanal, the precursor of HupA. Phylogenetic tree analysis indicated that the SsCAO from Shiraia sp. Slf14 was closely related to Stemphylium lycopersici CAO. This is the first report on the cloning and expression of a CAO gene from HupA-producing endophytic fungi. Functional characterization of this enzyme provides new insights into the biosynthesis of the HupA an anti-Alzheimer's drug. Copyright © 2016 Elsevier Inc. All rights reserved.

  14. Molecular Cloning and Evidence for Osmoregulation of the Δ1-Pyrroline-5-Carboxylate Reductase (proC) Gene in Pea (Pisum sativum L.) 12

    PubMed Central

    Williamson, Cynthia L.; Slocum, Robert D.

    1992-01-01

    Several cDNA clones encoding Δ1-pyrroline-5-carboxylate reductase (P5CR, l-proline:NAD[P]+ 5-oxidoreductase, EC 1.5.1.2), which catalyzes the terminal step in proline biosynthesis, were isolated from a pea leaf library screened with a 32P-labeled Aval fragment of a soybean nodule P5CR cDNA (A.J. Delauney, D.P.S. Verma [1990] Mol Gen Genet 221: 299-305). DNA sequence analysis of one full-length 1.3-kb clone (pPPS3) indicated that the pea P5CR gene contains a single major open reading frame encoding a polypeptide of 28,242 Da. Genomic analysis suggested that two to three copies of the P5CR gene are present per haploid genome in pea. The primary structure of pea P5CR is 85% identical with that of soybean and exhibits significant homology to human, yeast, and Escherichia coli P5CR. The sequence of one of four highly conserved domains found in all prokaryotic and eukaryotic P5CRs is similar to the consensus sequence for the NAD(P)H-binding site of other enzymes. The pea P5CR cDNA hybridized to two transcripts, 1.3 and 1.1 kb in size, in polyadenylated RNA purified from leaf tissues of mature, light-grown plants (4 weeks old). Only the 1.3-kb transcript was detected in younger (1 week old) greened seedlings or in etiolated seedlings. In greened seedlings, steady-state levels of this 1.3-kb mRNA increased approximately 5-fold in root tissues within 6 h after plants were irrigated with 0.4 m NaCl, suggesting that expression of the P5CR gene is osmoregulated. Images Figure 3 Figure 4 Figure 5 PMID:11537868

  15. Cloning of expansin genes in ramie (Boehmeria nivea L.) based on universal fast walking.

    PubMed

    Chen, Jie; Dai, Lunjin; Wang, Bo; Liu, Lijun; Peng, Dingxiang

    2015-09-10

    Gene cloning is the first step to study the expression profiles and functions of a particular gene; considerable cloning methods have been developed. Expansin, thought to involve in the cell-wall modification events, was not cloned in ramie (Boehmeria nivea L.), which is one of the most important bast fiber crops with little conducted molecular research, especially on its fiber development. Studying the expansin gene family will uncover its possible relationship with ramie fiber development and other growth events. As a result, five expansin genes were cloned with full-length and their sequence information was investigated. Additionally, the phylogenetic analysis was conducted, which suggested that the cloned genes belong to the α-subfamily, and these genes</