Science.gov

Sample records for gene molecular cloning

  1. Gene Transfer and Molecular Cloning of the Human NGF Receptor

    NASA Astrophysics Data System (ADS)

    Chao, Moses V.; Bothwell, Mark A.; Ross, Alonzo H.; Koprowski, Hilary; Lanahan, Anthony A.; Buck, C. Randall; Sehgal, Amita

    1986-04-01

    Nerve growth factor (NGF) and its receptor are important in the development of cells derived from the neural crest. Mouse L cell transformants have been generated that stably express the human NGF receptor gene transfer with total human DNA. Affinity cross-linking, metabolic labeling and immunoprecipitation, and equilibrium binding with 125I-labeled NGF revealed that this NGF receptor had the same size and binding characteristics as the receptor from human melanoma cells and rat PC12 cells. The sequences encoding the NGF receptor were molecularly cloned using the human Alu repetitive sequence as a probe. A cosmid clone that contained the human NGF receptor gene allowed efficient transfection and expression of the receptor.

  2. Molecular cloning of gluconobacter oxydans DSM 2003 xylitol dehydrogenase gene.

    PubMed

    Sadeghi, H Mir Mohammad; Ahmadi, R; Aghaabdollahian, S; Mofid, M R; Ghaemi, Y; Abedi, D

    2011-01-01

    Due to the widespread applications of xylitol dehydrogenase, an enzyme used for the production of xylitol, the present study was designed for the cloning of xylitol dehydrogenase gene from Glcunobacter oxydans DSM 2003. After extraction of genomic DNA from this bacterium, xylitol dehydrogenase gene was replicated using polymerase chain reaction (PCR). The amplified product was entered into pTZ57R cloning vector by T/A cloning method and transformation was performed by heat shocking of the E. coli XL1-blue competent cells. Following plasmid preparation, the cloned gene was digested out and ligated into the expression vector pET-22b(+). Electrophoresis of PCR product showed a 789 bp band. Recombinant plasmid (rpTZ57R) was then constructed. This plasmid was double digested with XhoI and EcoRI resulting in 800 bp and 2900 bp bands. The obtained insert was ligated into pET-22b(+) vector and its orientation was confirmed with XhoI and BamHI restriction enzymes. In conclusion, in the present study the recombinant expression vector containing xylitol dehydrogenase gene has been constructed and can be used for the production of this enzyme in high quantities.

  3. Using "Pseudomonas Putida xylE" Gene to Teach Molecular Cloning Techniques for Undergraduates

    ERIC Educational Resources Information Center

    Dong, Xu; Xin, Yi; Ye, Li; Ma, Yufang

    2009-01-01

    We have developed and implemented a serial experiment in molecular cloning laboratory course for undergraduate students majored in biotechnology. "Pseudomonas putida xylE" gene, encoding catechol 2, 3-dioxygenase, was manipulated to learn molecular biology techniques. The integration of cloning, expression, and enzyme assay gave students…

  4. Molecular cloning of the 8000-base thyroglobulin structural gene.

    PubMed

    Christophe, D; Mercken, L; Brocas, H; Pohl, V; Vassart, G

    1982-03-01

    Bovine thyroglobulin mRNA was reverse-transcribed into full-length double-stranded cDNA. The existence of three HindIII restriction endonuclease sites in the 8000-base thyroglobulin structural gene had allowed the easy cloning of the two internal HindIII fragments [Christophe et al. (1980) Eur. J. Biochem. 111, 419-423]. In the present study, the central portion of the structural gene was cloned in Escherichia coli as two individual recombinant plasmids containing 2000-base-pair and 4700-base-pair segments located respectively 5' and 3' relative to the unique BamHI site of the cDNA. BamHI linkers were added to the double-stranded cDNA and, following restriction with HindIII, selective cloning of the 5' (2600-base-pair) and 3' (1000-base-pair) terminal HindIII fragments was achieved by inserting them between the HindIII and BamHI sites of the plasmid pBR322. Partial sequencing of the 1000-base-pair 3'-terminal fragment demonstrated the presence of an A-A-U-A-A-A sequence in the mRNA 14 bases upstream from a poly(A) tract corresponding to the 3' end of the mRNA. Together, the four clones represent about 99% of the thyroglobulin structural gene and provide the starting material for the determination of thyroglobulin primary structure.

  5. A highly efficient molecular cloning platform that utilises a small bacterial toxin gene.

    PubMed

    Mok, Wendy W K; Li, Yingfu

    2013-04-15

    Molecular cloning technologies that have emerged in recent years are more efficient and simpler to use than traditional strategies, but many have the disadvantages of requiring multiple steps and expensive proprietary enzymes. We have engineered cloning vectors containing variants of IbsC, a 19-residue toxin from Escherichia coli K-12. These toxic peptides offer selectivity to minimise the background, labour, and cost associated with conventional molecular cloning. As demonstrated with the cloning of reporter genes, this "detox cloning" system consistently produced over 95 % positive clones. Purification steps between digestion and ligation are not necessary, and the total time between digestion and plating of transformants can be as little as three hours. Thus, these IbsC-based cloning vectors are as reliable and amenable to high-throughput cloning as commercially available systems, and have the advantage of being more time-efficient and cost-effective.

  6. Molecular cloning of Taenia taeniaeformis oncosphere antigen genes.

    PubMed

    Cougle, W G; Lightowlers, M W; Bogh, H O; Rickard, M D; Johnson, K S

    1991-03-01

    Infection of mice with the cestode Taenia taeniaeformis exhibits several important features common to other cestode infections, including the ability to vaccinate with crude antigen mixtures. Partial purification of the protective oncosphere antigens has been reported with a cutout from deoxycholate (DOC) acrylamide gels; this cutout was called fraction II (FII), and comprises approximately 10% of total DOC-soluble oncosphere antigen. Western blots of DOC gels probed with anti-FII antisera revealed a series of 3-5 discrete bands within the FII region. Further fractionation of the FII antigens on DOC gels was impractical due to limitations in supply of oncospheres, so a cDNA library was constructed from 150 ng of oncosphere mRNA and screened with alpha-FII antisera. Two distinct clone families were identified, oncA and oncB. Antibodies affinity-purified on either of two representative members, oncA1 and oncB1, recognised all the FII bands. Individual FII bands excised from a DOC gel resolved into an overlapping series of molecules when re-run on SDS-PAGE, indicating that each FII band consisted of several polypeptides of differing molecular weight. Immunoprecipitates resolved on SDS-PAGE revealed that alpha-FII recognised 3 major oncosphere antigens, of 62, 34 and 25 kDa; antisera against oncB precipitated both the 34- and 25-kDa antigens, whereas alpha-oncA antisera precipitated the 62-kDa antigen. We conclude that oncA and oncB encode the major antigens in the FII complex. The 62-kDa antigen encoded by oncA1 was the only common antigen precipitated by anti-FII and two other antisera raised against different protective extracts, suggesting that it may be a protective component in all three. Southern blot results indicate that oncA and oncB are distinct genes present at low copy number in the genome. Evidence is also presented suggesting that some cestode mRNAs, including oncA, may use variant polyadenylation signals.

  7. Molecular transformation, gene cloning, and gene expression systems for filamentous fungi

    USGS Publications Warehouse

    Gold, Scott E.; Duick, John W.; Redman, Regina S.; Rodriguez, Rusty J.

    2001-01-01

    This chapter discusses the molecular transformation, gene cloning, and gene expression systems for filamentous fungi. Molecular transformation involves the movement of discrete amounts of DNA into cells, the expression of genes on the transported DNA, and the sustainable replication of the transforming DNA. The ability to transform fungi is dependent on the stable replication and expression of genes located on the transforming DNA. Three phenomena observed in bacteria, that is, competence, plasmids, and restriction enzymes to facilitate cloning, were responsible for the development of molecular transformation in fungi. Initial transformation success with filamentous fungi, involving the complementation of auxotrophic mutants by exposure to sheared genomic DNA or RNA from wt isolates, occurred with low transformation efficiencies. In addition, it was difficult to retrieve complementing DNA fragments and isolate genes of interest. This prompted the development of transformation vectors and methods to increase efficiencies. The physiological studies performed with fungi indicated that the cell wall could be removed to generate protoplasts. It was evident that protoplasts could be transformed with significantly greater efficiencies than walled cells.

  8. Molecular cloning and functional analysis of the goose FSHβ gene.

    PubMed

    Huang, Z; Li, X; Li, Y; Liu, R; Chen, Y; Wu, N; Wang, M; Song, Y; Yuan, X; Lan, L; Xu, Q; Chen, G; Zhao, W

    2015-01-01

    The objective of this investigation was to clone goose FSHβ-subunit cDNA and to construct a FSH fusion gene to identify the function of FSHβ mRNA during stages of the breeding cycle. The FSHβ gene was obtained by reverse transcription-PCR, and the full-length FSHβ mRNA sequence was amplified by rapid-amplification of cDNA ends. FSHβ mRNA expression was detected in reproductive tissues at different stages (pre-laying, laying period, and broody period). Additionally, the expression of 4 genes known to be involved in reproduction (FSHβ, GnRH, GH, and BMP) were evaluated in COS-7 cells expressing the fusion gene (pVITRO2-FSHαβ-CTP). The results show that the FSHβ gene consists of a 16 base pair (bp) 5'-untranslated region (UTR), 396 bp open reading frame, and alternative 3'-UTRs at 518 bp and 780 bp, respectively. qPCR analyses revealed that FSHβ mRNA is highly transcribed in reproductive tissues, including the pituitary, hypothalamus, ovaries, and oviduct. FSHβ mRNA expression increased and subsequently decreased in the pituitary, ovaries, and oviduct during the reproductive stages. Stable FSH expression was confirmed using enzyme-linked immunosorbent assays after transfection with the pVITRO2-FSHαβ-CTP plasmid. FSHβ, GnRH, and BMP expression increased significantly 36 h and 48 h after transfection with the fusion gene in COS-7 cells. The results demonstrate that the FSHβ subunit functions in the goose reproductive cycle and provides a theoretical basis for future breeding work.

  9. Molecular cloning and characterization of the Candida albicans enolase gene.

    PubMed Central

    Mason, A B; Buckley, H R; Gorman, J A

    1993-01-01

    A DNA clone containing the putative Candida albicans enolase gene (ENO1) was isolated from a genomic DNA library. The sequenced insert contained a continuous open reading frame of 1,320 bp. The predicted 440-amino-acid protein is 78 and 76% identical, respectively, to Saccharomyces cerevisiae enolase proteins 1 and 2. Only one enolase gene could be detected in C. albicans genomic DNA by Southern analysis with a homologous probe. Northern (RNA) analysis detected a single, abundant C. albicans ENO1 transcript of approximately 1,600 nucleotides. When cells were grown on glucose, levels of ENO1 mRNA were markedly increased by comparison with ENO1 mRNA levels in cells grown on ethanol, a gluconeogenic carbon source. In contrast to this glucose-mediated transcriptional induction, the carbon source had no dramatic effect on the levels of enolase protein or enzyme activity in the C. albicans strains tested. These results suggest that posttranscriptional mechanisms are responsible for modulating expression of the C. albicans enolase gene. Images PMID:8478328

  10. Molecular cloning.

    PubMed

    Lessard, Juliane C

    2013-01-01

    This protocol describes the basic steps involved in conventional plasmid-based cloning. The goals are to insert a DNA fragment of interest into a receiving vector plasmid, transform the plasmid into E. coli, recover the plasmid DNA, and check for correct insertion events.

  11. Molecular Cloning of the Human Genes(s) Directing the Synthesis of Nervous System Cholinesterases.

    DTIC Science & Technology

    1985-12-01

    AD-8163 229 MOLECULAR CLONING OF THE HUMAN GENES (S) DIRECTING THE 1/1 SYNTHESIS OF NERYOU.. (U) NEIZMANN INST OF SCIENCE REHOVOT (ISRAEL) DEPT OF...whether these forms are produced from discrete genes or by post-transcrip- tional and post-translational processing. In addition, the amino acid...brain cholinseee (aRE.) is =*rxm yet, Which leaves open several questions Of cosdeal 1. Are the various Ch foru produiced from discrete genes , or is

  12. Molecular cloning and expression of the mouse ornithine decarboxylase gene.

    PubMed Central

    McConlogue, L; Gupta, M; Wu, L; Coffino, P

    1984-01-01

    We used mRNA from a mutant S49 mouse lymphoma cell line that produces ornithine decarboxylase (OrnDCase) as its major protein product to synthesize and clone cDNA. Plasmids containing OrnDCase cDNA were identified by hybrid selection of OrnDCase mRNA and in vitro translation. The two of these with the largest inserts together span 2.05 kilobases of cDNA. Southern blot analysis of DNA from wild-type or mutant S49 cells, cleaved with EcoRI or with BamHI, revealed multiple bands homologous to OrnD-Case cDNA, only one of which was amplified in the mutant cells. RNA transfer blot analysis showed that the major OrnD-Case mRNA in the mouse lymphoma cells is 2.0 kilobases long. A similar size mRNA was found in mouse kidney and was more abundant in the kidneys of mice treated with testosterone, an inducer of OrnDCase activity in that tissue. Images PMID:6582509

  13. [Molecular cloning and expression of Nattokinase gene in Bacillus subtilis].

    PubMed

    Liu, B Y; Song, H Y

    2002-05-01

    In order to characterize biochemically the nattokinase,the nucleotide sequence of the nattokinase gene was amplified from the chromosomal DNA of B.subtilis (natto) by PCR. The expression plasmid pBL NK was constructed and was used to transform Bacillus subtilis containing a chromosomal deletion in its subtilisin gene. The supernatant of the culture was collected after 15 h culture. The target proteins were identified by SDS-PAGE. Nattokinase was purified by a method including ultrafiltration, Sephacryl S-100 gel filtration and S-Sepharose ion-exchange chromatography, and 100 mg of purified nattokinase was obtained from one liter of culture. The purity of the protein and the specific activity were 95% and 12 000 u/mg (compared to tPA), respectively.

  14. Molecular cloning, expression, and sequence of the pilin gene from nontypeable Haemophilus influenzae M37.

    PubMed Central

    Coleman, T; Grass, S; Munson, R

    1991-01-01

    Nontypeable Haemophilus influenzae M37 adheres to human buccal epithelial cells and exhibits mannose-resistant hemagglutination of human erythrocytes. An isogenic variant of this strain which was deficient in hemagglutination was isolated. A protein with an apparent molecular weight of 22,000 was present in the sodium dodecyl sulfate-polyacrylamide gel profile of sarcosyl-insoluble proteins from the hemagglutination-proficient strain but was absent from the profile of the isogenic hemagglutination-deficient variant. A monoclonal antibody which reacts with the hemagglutination-proficient isolate but not with the hemagglutination-deficient isolate has been characterized. This monoclonal antibody was employed in an affinity column for purification of the protein as well as to screen a genomic library for recombinant clones expressing the gene. Several clones which contained overlapping genomic fragments were identified by reaction with the monoclonal antibody. The gene for the 22-kDa protein was subcloned and sequenced. The gene for the type b pilin from H. influenzae type b strain MinnA was also cloned and sequenced. The DNA sequence of the strain MinnA gene was identical to that reported previously for two other type b strains. The DNA sequence of the strain M37 gene is 77% identical to that of the type b pilin gene, and the derived amino acid sequence is 68% identical to that of the type b pilin. Images PMID:1673447

  15. Molecular cloning and analysis of the CRY1 gene: a yeast ribosomal protein gene.

    PubMed Central

    Larkin, J C; Woolford, J L

    1983-01-01

    Using cloned DNA from the vicinity of the yeast mating type locus (MAT) as a probe, the wild type allele of the cryptopleurine resistance gene CRY1 has been isolated by the technique of chromosome walking and has been shown to be identical to the gene for ribosomal protein 59. A recessive cryR1 allele has also been cloned, using the integration excision method. The genetic distance from MAT to CRY1 is 2.2 cM, while the physical distance is 21 kb, giving a ratio of about 10 kb/cM for this interval. The phenotypic expression of both plasmid borne alleles of the gene can be detected in vivo. The use of this gene as a hybridization probe to examine RNA processing defects in the rna 2, rna 3, rna 4, rna 8, and rna 11 mutants is also discussed. Images PMID:6338478

  16. Molecular cloning and nucleotide sequence of a transforming gene detected by transfection of chicken B-cell lymphoma DNA

    NASA Astrophysics Data System (ADS)

    Goubin, Gerard; Goldman, Debra S.; Luce, Judith; Neiman, Paul E.; Cooper, Geoffrey M.

    1983-03-01

    A transforming gene detected by transfection of chicken B-cell lymphoma DNA has been isolated by molecular cloning. It is homologous to a conserved family of sequences present in normal chicken and human DNAs but is not related to transforming genes of acutely transforming retroviruses. The nucleotide sequence of the cloned transforming gene suggests that it encodes a protein that is partially homologous to the amino terminus of transferrin and related proteins although only about one tenth the size of transferrin.

  17. Cloning and molecular characterization of a putative voltage-gated sodium channel gene in the crayfish.

    PubMed

    Coskun, Cagil; Purali, Nuhan

    2016-06-01

    Voltage-gated sodium channel genes and associated proteins have been cloned and studied in many mammalian and invertebrate species. However, there is no data available about the sodium channel gene(s) in the crayfish, although the animal has frequently been used as a model to investigate various aspects of neural cellular and circuit function. In the present work, by using RNA extracts from crayfish abdominal ganglia samples, the complete open reading frame of a putative sodium channel gene has firstly been cloned and molecular properties of the associated peptide have been analyzed. The open reading frame of the gene has a length of 5793 bp that encodes for the synthesis of a peptide, with 1930 amino acids, that is 82% similar to the α-peptide of a sodium channel in a neighboring species, Cancer borealis. The transmembrane topology analysis of the crayfish peptide indicated a pattern of four folding domains with several transmembrane segments, as observed in other known voltage-gated sodium channels. Upon analysis of the obtained sequence, functional regions of the putative sodium channel responsible for the selectivity filter, inactivation gate, voltage sensor, and phosphorylation have been predicted. The expression level of the putative sodium channel gene, as defined by a qPCR method, was measured and found to be the highest in nervous tissue.

  18. Ethylene-regulated gene expression: molecular cloning of the genes encoding an endochitinase from Phaseolus vulgaris.

    PubMed Central

    Broglie, K E; Gaynor, J J; Broglie, R M

    1986-01-01

    A full-length copy of bean leaf chitinase mRNA has been cloned. The 1146-base-pair insert of pCH18 encodes the 27-residue amino-terminal signal peptide of the precursor and 301 residues of the mature protein. Utilizing pCH18 as a hybridization probe, we have shown that the increase in translatable chitinase mRNA seen upon ethylene treatment of bean seedlings is due to a 75- to 100-fold increase in steady-state mRNA levels. Southern blot analysis of bean genomic DNA revealed that chitinase is encoded by a small, multigene family consisting of approximately four members. From our nucleotide sequence analysis of five additional chitinase cDNA clones, it appears that at least two of these genes are expressed. Three of the bean chitinase genes have been isolated from a Sau3A genomic library and partially characterized. Images PMID:2428042

  19. Molecular cloning and sequences of lignin peroxidase genes of Phanerochaete chrysosporium.

    PubMed Central

    Schalch, H; Gaskell, J; Smith, T L; Cullen, D

    1989-01-01

    The genomic clones encoding lignin peroxidase isozyme H8 and two closely related genes were isolated from Phanerochaete chrysosporium BKM-1767, and their nucleotide sequences were determined. The positions and approximate lengths of introns were found to be highly conserved in all three clones. Analysis of homokaryotic derivatives indicated that the three clones are not alleles of the same gene(s). Images PMID:2761543

  20. Molecular cloning and characterization of the gene encoding rat submandibular gland apomucin, Mucsmg.

    PubMed

    Albone, E F; Hagen, F K; Szpirer, C; Tabak, L A

    1996-10-01

    Mucin glycoproteins are a major constituent of salivary secretions and play a primary role in the protection of the oral cavity. Rat submandibular glands (RSMG) synthesize and secrete a low molecular weight (114 kDa) mucin glycoprotein. We have isolated, partially sequenced, and characterized the gene which encodes the RSMG apomucin. The gene is encoded by three exons of 106 nt, 69 nt, and 991 nt, separated by introns of 921 nt and 12.5 kb. CAAT and TATA elements are present, at -68 and -26, respectively, in the 5' flanking sequence of the RSMG apomucin gene. The tandem repeat domain present in exon III consists of ten tandem repeats of 39 nt encoding the consensus sequence PTTDSTTPAPTTK. Sequence comparison and organization of the nucleic acid sequence encoding the tandem repeats of two alleles for this gene suggests that the apomucin gene has undergone recombinational events during its evolution. No significant sequence similarity was found with other mucin genes, or with other known salivary gland-specific genes. The gene was localized to rat chromosome 14 using somatic cell hybrids that segregate rat chromosomes. Since this, to our knowledge, represents the first RSMG mucin gene cloned, we have designated this gene Mucsmg.

  1. Molecular cloning and characterization of the human beta-like globin gene cluster.

    PubMed

    Fritsch, E F; Lawn, R M; Maniatis, T

    1980-04-01

    The genes encoding human embryonic (epsilon), fetal (G gamma, A gamma) and adult (delta, beta) beta-like globin polypeptides were isolated as a set of overlapping cloned DNA fragments from bacteriophage lambda libraries of high molecular weight (15-20 kb) chromosomal DNA. The 65 kb of DNA represented in these overlapping clones contains the genes for all five beta-like polypeptides, including the embryonic epsilon-globin gene, for which the chromosomal location was previously unknown. All five genes are transcribed from the same DNA strand and are arranged in the order 5'-epsilon-(13.3 kb)-G gamma-(3.5 kb)-A gamma-(13.9 kb)-delta-(5.4 kb)-beta-3'. Thus the genes are positioned on the chromosome in the order of their expression during development. In addition to the five known beta-like globin genes, we have detected two other beta-like globin sequences which do not correspond to known polypeptides. One of these sequences has been mapped to the A gamma-delta intergenic region while the other is located 6-9 kb 5' to the epsilon gene. Cross hybridization experiments between the intergenic sequences of the gene cluster have revealed a nonglobin repeat sequence (*) which is interspersed with the globin genes in the following manner: 5'-**epsilon-*G gamma-A gamma*-**delta-beta*-3'. Fine structure mapping of the region located 5' to the delta-globin gene revealed two repeats with a maximum size of 400 bp, which are separated by approximately 700 bp of DNA not repeated within the cluster. Preliminary experiments indicate that this repeat family is also repeated many times in the human genome.

  2. Molecular cloning and expression of the Leishmania tropica KMP-11 gene.

    PubMed

    Meriee, Mouayad; Soukkarieh, Chadi; Abbady, Abdul Qader A

    2014-08-01

    Kinetoplastid membrane protein-11 (KMP-11) is a small protein of 11 kDa present in all kinetoplastid protozoa studded so far. This protein which is highly expressed in all stages of the Leishmania life cycle is considered a potential candidate for a leishmaniasis vaccine against many leishmania species. KMP-11 has been recently described in Leishmania tropica. In the present study, the KMP-11 gene was extracted from L. tropica by PCR using two oligonucleotide primers designed to amplify the entire coding region of this gene. Then, the purified PCR products were successfully ligated into a high expression vector the pRSET-GFP. This expression vector provides the opportunity to clone the desired insert as a fusion protein with a GFP and a tag, polyhistidine region. The GFP use as a carrier to improve immune response and the polyhistidine tag facilitates detection of the expressed protein with anti-His antibodies and also purification of the protein using affinity purification. After wards KMP-11 coding region was sequenced and the recombinant protein was induced and purified from Escherichia coli cultures. The results of the present study will increase our knowledge about molecular cloning and expression of the L. tropica KMP-11 gene, and this may be used as an effective target for controlling cutenous leishmaniasis.

  3. Molecular cloning and characterization of two hypersensitive induced reaction genes from wheat infected by stripe rust pathogen

    Technology Transfer Automated Retrieval System (TEKTRAN)

    A novel gene induced during hypersensitive reaction (HIR) in wheat was identified using in silico cloning and designated as TaHIR2. The TaHIR2 gene was deduced to encode a 284-amino acid protein, whose molecular mass and isoelectric point (pI) were 31.05 kD and 5.18, respectively. Amino acid sequenc...

  4. Molecular cloning, expression pattern and comparative analysis of chitin synthase gene B in Spodoptera exigua.

    PubMed

    Kumar, N Senthil; Tang, Bin; Chen, Xiaofei; Tian, Honggang; Zhang, Wenqing

    2008-03-01

    The chitin synthase (CHS) gene B (4781 bp) of Spodoptera exigua (SeCHSB) was cloned by reverse-transcription PCR (RT-PCR) and 3'/5' RACE from the midgut. SeCHSB contains an open reading frame of 4572 nucleotides, encoding a protein of 1523 amino acids with a predicted molecular mass of approximately 174.6 kDa. Alignment of SeCHSB with class B CHSs of other insects showed a high degree of conservation in the putative catalytic domain region. The structure of the SeCHSB gene was analyzed and was found to be the same as that of Manduca sexta CHSB (MsCHSB), including 23 exons and 22 introns but without alternative exons. Southern blot analysis revealed that SeCHSB was a single copy gene and the presence of only two chitin synthase genes in S. exigua. Further investigation indicated that SeCHSB was specifically expressed in the midgut, and its transcript existed constitutively in the midgut from the 3rd instar larval stage to prepupae and reached highest expression on the 1st day of the fifth instar larval stage. These data suggest that SeCHSB is very important in midgut formation and development. Chitin synthase gene comparisons between different classes of insects using software tools revealed some interesting aspects of the similarity and divergence of the gene in the Class Insecta.

  5. Molecular cloning and evolutionary analysis of the GJA1 (connexin43) gene from bats (Chiroptera).

    PubMed

    Wang, Li; Li, Gang; Wang, Jinhong; Ye, Shaohui; Jones, Gareth; Zhang, Shuyi

    2009-04-01

    Gap junction protein connexin43 (Cx43), encoded by the GJA1 gene, is the most abundant connexin in the cardiovascular system and was reported as a crucial factor maintaining cardiac electrical conduction, as well as having a very important function in facilitating the recycling of potassium ions from hair cells in the cochlea back into the cochlear endolymph during auditory transduction processes. In mammals, bats are the only taxon possessing powered flight, placing exceptional demand on many organismal processes. To meet the demands of flying, the hearts of bats show many specialties. Moreover, ultrasonic echolocation allows bat species to orientate and often detect and locate food in darkness. In this study, we cloned the full-length coding region of GJA1 gene from 12 different species of bats and obtained orthologous sequences from other mammals. We used the maximum likelihood method to analyse the evolution of GJA1 gene in mammals and the lineage of bats. Our results showed this gene is much conserved in mammals, as well as in bats' lineage. Compared with other mammals, we found one private amino acid substitution shared by bats, which is located on the inner loop domain, as well as some species-specific amino acid substitutions. The evolution rate analyses showed the signature of purifying selection on not only different classification level lineages but also the different domains and amino acid residue sites of this gene. Also, we suggested that GJA1 gene could be used as a good molecular marker to do the phylogenetic reconstruction.

  6. Characterization, molecular cloning, and differential expression analysis of laccase genes from the edible mushroom Lentinula edodes.

    PubMed

    Zhao, J; Kwan, H S

    1999-11-01

    The effect of different substrates and various developmental stages (mycelium growth, primordium appearance, and fruiting-body formation) on laccase production in the edible mushroom Lentinula edodes was studied. The cap of the mature mushroom showed the highest laccase activity, and laccase activity was not stimulated by some well-known laccase inducers or sawdust. For our molecular studies, two genomic DNA sequences, representing allelic variants of the L. edodes lac1 gene, were isolated, and DNA sequence analysis demonstrated that lac1 encodes a putative polypeptide of 526 amino acids which is interrupted by 13 introns. The two allelic genes differ at 95 nucleotides, which results in seven amino acid differences in the encoded protein. The copper-binding domains found in other laccase enzymes are conserved in the L. edodes Lac1 proteins. A fragment of a second laccase gene (lac2) was also isolated, and competitive PCR showed that expression of lac1 and lac2 genes was different under various conditions. Our results suggest that laccases may play a role in the morphogenesis of the mushroom. To our knowledge, this is the first report on the cloning of genes involved in lignocellulose degradation in this economically important edible fungus.

  7. Molecular cloning and analysis of the gene encoding the thermostable penicillin G acylase from Alcaligenes faecalis.

    PubMed Central

    Verhaert, R M; Riemens, A M; van der Laan, J M; van Duin, J; Quax, W J

    1997-01-01

    Alcaligenes faecalis penicillin G acylase is more stable than the Escherichia coli enzyme. The activity of the A. faecalis enzyme was not affected by incubation at 50 degrees C for 20 min, whereas more than 50% of the E. coli enzyme was irreversibly inactivated by the same treatment. To study the molecular basis of this higher stability, the A. faecalis enzyme was isolated and its gene was cloned and sequenced. The gene encodes a polypeptide that is characteristic of periplasmic penicillin G acylase (signal peptide-alpha subunit-spacer-beta subunit). Purification, N-terminal amino acid analysis, and molecular mass determination of the penicillin G acylase showed that the alpha and beta subunits have molecular masses of 23.0 and 62.7 kDa, respectively. The length of the spacer is 37 amino acids. Amino acid sequence alignment demonstrated significant homology with the penicillin G acylase from E. coli A unique feature of the A. faecalis enzyme is the presence of two cysteines that form a disulfide bridge. The stability of the A. faecalis penicillin G acylase, but not that of the E. coli enzyme, which has no cysteines, was decreased by a reductant. Thus, the improved thermostability is attributed to the presence of the disulfide bridge. PMID:9292993

  8. Molecular cloning of the Escherichia coli B L-fucose-D-arabinose gene cluster.

    PubMed Central

    Elsinghorst, E A; Mortlock, R P

    1994-01-01

    To metabolize the uncommon pentose D-arabinose, enteric bacteria often recruit the enzymes of the L-fucose pathway by a regulatory mutation. However, Escherichia coli B can grow on D-arabinose without the requirement of a mutation, using some of the L-fucose enzymes and a D-ribulokinase that is distinct from the L-fuculokinase of the L-fucose pathway. To study this naturally occurring D-arabinose pathway, we cloned and partially characterized the E. coli B L-fucose-D-arabinose gene cluster and compared it with the L-fucose gene cluster of E. coli K-12. The order of the fucA, -P, -I, and -K genes was the same in the two E. coli strains. However, the E. coli B gene cluster contained a 5.2-kb segment located between the fucA and fucP genes that was not present in E. coli K-12. This segment carried the darK gene, which encodes the D-ribulokinase needed for growth on D-arabinose by E. coli B. The darK gene was not homologous with any of the L-fucose genes or with chromosomal DNA from other D-arabinose-utilizing bacteria. D-Ribulokinase and L-fuculokinase were purified to apparent homogeneity and partially characterized. The molecular weights, substrate specificities, and kinetic parameters of these two enzymes were very dissimilar, which together with DNA hybridization analysis, suggested that these enzymes are not related. D-Arabinose metabolism by E. coli B appears to be the result of acquisitive evolution, but the source of the darK gene has not been determined. Images PMID:7961494

  9. Molecular cloning and identification of the laspartomycin biosynthetic gene cluster from Streptomyces viridochromogenes

    PubMed Central

    Wang, Yang; Chen, Ying; Shen, Qirong; Yin, Xihou

    2011-01-01

    The biosynthetic gene cluster for laspartomycins, a family of 11 amino acid peptide antibiotics, has been cloned and sequenced from Streptomyces viridochromogenes ATCC 29814. Annotation of a segment of 88912 bp of S. viridochromogenes genomic sequence revealed the putative las cluster and its flanking regions which harbor 43 open reading frames. The lpm cluster, which spans approximately 60 kb, consists of 21 open reading frames. Those include four NRPS genes (lpmA/orf18, lpmB/orf25, lpmC/orf26 and lpmD/orf27), four genes (orfs 21, 22, 24 and 29) involved in the lipid tail biosynthesis and attachment, four regulatory genes (orfs 13, 19, 32 and 33) and three putative exporters or self-resistance genes (orfs 14, 20 and 30). In addition, the gene involved in the biosynthesis of the nonproteinogenic amino acid Pip was also identified in the lpm cluster while the genes necessary for the biosynthesis of the rare residue diaminopropionic acid (Dap) were found to reside elsewhere on the chromosome. Interestingly, the dabA, dabB and dabC genes predicted to code for the biosynthesis of the unusual amino acid diaminobutyric acid (Dab) are organized into the lpm cluster even though the Dab residue was not found in the laspartomycins. Disruption of the NRPS lpmC gene completely abolished laspartomycin production in the corresponding mutant strain. These findings will allow molecular engineering and combinatorial biosynthesis approaches to expand the structural diversity of the amphomycin-group peptide antibiotics including the laspartomycins and friulimicins. PMID:21640802

  10. Molecular cloning and characterization of a novel esophageal cancer related gene.

    PubMed

    Cui, Yongping; Bi, Meixia; Su, Tao; Liu, Hailing; Lu, Shih-Hsin

    2010-12-01

    We previously identified four novel cDNA fragments related to human esophageal cancer. One of the fragments was named esophageal cancer related gene 2 (ECRG2). We report here the molecular cloning, sequencing, and expression of the ECRG2 gene. The ECRG2 cDNA comprises a 258 bp nucleotide sequence which encodes for 85 amino acids with a predicted molecular weight of 9.2 kDa. Analysis of the protein sequence reveals the presence at the N terminus of a signal peptide followed by 56 amino acids with a significant degree of sequence similarity with the conserved Kazal domain which characterizes the serine protease inhibitor family. Pulse-chase experiments showed that ECRG2 protein was detected in both cell lysates and culture medium, indicating that the ECRG2 protein was extracellularly secreted after the post-translational cleavage. In vitro uPA/plasmin activity analysis showed the secreted ECRG2 protein inhibited the uPA/plasmin activity, indicating that ECRG2 may be a novel serine protease inhibitor. Northern blot analysis revealed the presence of the major band corresponding to a size of 569 kb throughout the fetal skin, thymus, esophagus, brain, lung, heart, stomach, liver, spleen, colon, kidney, testis, muscle, cholecyst tissues and adult esophageal mucosa, brain, thyroid tissue and mouth epithelia. However, ECRG2 gene was significantly down-regulated in primary esophageal cancer tissues. Taken together, these results indicate that ECRG2 is a novel member of the Kazal-type serine protease inhibitor family and may function as a tumor suppressor gene regulating the protease cascades during carcinogenesis and migration/invasion of esophageal cancer.

  11. Molecular cloning, characterization and expression of a novel Asr gene from Ginkgo biloba.

    PubMed

    Shen, Guoan; Pang, Yongzhen; Wu, Weisheng; Deng, Zhongxiang; Liu, Xuefen; Lin, Juan; Zhao, Lingxia; Sun, Xiaofen; Tang, Kexuan

    2005-09-01

    A new abscisic acid, stress and ripening (Asr) gene was cloned from Ginkgo biloba by rapid amplification of cDNA ends (RACE) method. The full-length cDNA of G. biloba Asr (designated as GbAsr) was 952 bp long and it contained a 543 bp open reading frame encoding a protein of 181 amino acids. GbASR was found to be rich in His, Lys, Glu and Ala, and it had extensive homology with those of other plant Asr genes via multiple alignment analysis. Phylogenetic tree analysis indicated that the GbASR had a closer relationship with ASR from pine, another gymnosperm species, than with angiosperm ASRs. Southern blot analysis indicated that GbAsr belonged to a small multigene family. RT-PCR analyses revealed that GbAsr had a distinct up-regulated transcript pattern in root, stem and leaf under mannitol, NaCl and ABA treatments. The recombinant GbASR protein was successfully expressed in E. coli strain with pET-32a vector, and the result showed that the molecular weight of the recombinant protein was about 20 kDa, a size in agreement with that of the predicted by bioinformatic analysis. The expression of the GbAsr in E. coli will facilitate further research on this gene.

  12. Molecular cloning and chromosomal localization of human holocarboxylase synthetase, a gene responsible for biotin dependency

    SciTech Connect

    Suzuki, Y.; Aoki, Y.; Ishida, Y.

    1994-09-01

    Holocarboxylase synthetase (HCS) catalyzes biotin incorporation into various carboxylases that require biotin as a prosthetic group. They are acetyl-CoA carboxylase, a rate-limiting enzyme of fatty acid synthesis; pyruvate carboxylase, a key enzyme of gluconeogenesis; propionyl-CoA carboxylase and 3-methylcrotonyl-CoA carboxylase, enzymes involved in amino acid catabolism. HCS is therefore involved in various metabolic processes and is a key enzyme for biotin utilization by mammalian cells. Deficiency of HCS in man is known to cause biotin-responsive multiple carboxylase deficiency. Isolation of cDNA clones for the enzyme is essential to understand HCS and its deficiency at the molecular level. We purified bovine liver HCS and sequenced its proteolytic peptides. Degenerative oligonucleotide primers were synthesized from the two peptide sequences and used to amplify a putative HCS cDNA fragment from human liver by PCR. Using the amplified DNA fragment as a probe, we screened {lambda}gt10 human liver cDNA library and isolated 12 positive clones. The isolated cDNAs encoded a protein of 726 amino acids with molecular mass of 80,759. The protein contained several sequences identical or similar to those of peptides derived from the bovine liver HCS. The predicted protein had a homologous region with BirA which acts as both a biotin-[acetyl-CoA-carboxylase] ligase and a biotin repressor in E. coli, suggesting a functional relationship between the two proteins. We expressed the protein using pET3 a vector in E. coli (BL21 strain) and raised antiserum against the expressed protein. The antiserum immunoprecipitated HCS activities of human lymphoblasts and bovine liver. A one-base deletion and a missense mutation were found in cells from siblings with HCS deficiency. The human HCS gene was assigned to chromosome 21, region 21q22.1 by fluorescence in situ hybridization analysis.

  13. Molecular Cloning and Sequencing of Hemoglobin-Beta Gene of Channel Catfish, Ictalurus Punctatus Rafinesque

    Technology Transfer Automated Retrieval System (TEKTRAN)

    : Hemoglobin-y gene of channel catfish , lctalurus punctatus, was cloned and sequenced . Total RNA from head kidneys was isolated, reverse transcribed and amplified . The sequence of the channel catfish hemoglobin-y gene consists of 600 nucleotides . Analysis of the nucleotide sequence reveals one o...

  14. Molecular cloning and prokaryotic expression of vp5 gene of grass carp reovirus strain GCRV096.

    PubMed

    Jian, Ji-chang; Wang, Ya; Yan, Xiu-ying; Ding, Yu; Wu, Zao-he; Lu, Yi-shan

    2013-12-01

    VP5 is an outer capsid protein of grass carp reovirus (GCRV). It is predicted to involve in helping GCRV enter the host cells. In this study, the full-length vp5 gene (accession number in GenBank: JN206664.1) was cloned from GCRV strain GCRV096, which was isolated from diseased grass carp (Ctenopharyngodon idella) in southern China by RT-PCR technique using the primers designed from the known vp5 gene sequences of other strains of GCRV published in GenBank. The ORF sequence of vp5 is composed of 1,947 nucleotides encoding a 648-residues protein with a calculated molecular mass of 68.6 kDa and an estimated isoelectric point of 6.1. Sequence analysis results showed that VP5 might serve as a penetration protein and play an important role in GCRV penetration into the host cells. A full length of vp5 gene was subcloned into the prokaryotic expression vector pET-28a (+) and the recombinant plasmid (pET/GCRV-VP5) was then transduced into Escherichia coli BL21 (DE3) cells to express VP5 in vitro. SDS-PAGE and western blotting analysis indicated that the protein expressed successfully. Results also showed that the fusion protein expressed in the form of inclusion body, and it expressed in the highest level when induced with 0.2-mM IPTG at 28 °C for 4 h. These results are important for the future study on the molecular structure, function, and immunogenicity of GCRV capsid protein.

  15. Molecular cloning of rat homologues of the Drosophila melanogaster dunce cAMP phosphodiesterase: evidence for a family of genes.

    PubMed Central

    Swinnen, J V; Joseph, D R; Conti, M

    1989-01-01

    To study the structure and function of cyclic nucleotide phosphodiesterases (PDEs) involved in mammalian gametogenesis, a rat testis cDNA library was screened at low stringency with a cDNA clone coding for the Drosophila melanogaster dunce-encoded PDE as a probe. This screening resulted in the isolation of two groups of cDNA clones, differing in their nucleotide sequences (ratPDE1 and ratPDE2). In the rat testis, RNA transcripts corresponding to both groups of clones were expressed predominantly in germ cells. Additional screenings of a Sertoli cell cDNA library with a ratPDE2 clone as a probe led to the isolation of two more groups of clones (rat-PDE3 and ratPDE4). Unlike ratPDE1 and ratPDE2, these clones hybridized to transcripts present predominantly in the Sertoli cell. In the middle of the coding region, all four groups of clones were homologous to each other. The deduced amino acid sequences of part of this region were also homologous to the D. melanogaster dunce PDE and to PDEs from bovine and yeast. These data indicate that a family of genes homologous to the D. melanogaster dunce-encoded PDE is present in the rat and that these genes are differentially expressed in somatic and germ cells of the seminiferous tubule. These findings provide a molecular basis for the observed heterogeneity of cAMP PDEs. Images PMID:2546153

  16. Molecular cloning and characterisation of the RESA gene, a marker of genetic diversity of Plasmodium falciparum.

    PubMed

    Moyano, Eva M; González, Luis Miguel; Cuevas, Laureano; Perez-Pastrana, Esperanza; Santa-Maria, Ysmael; Benito, Agustín

    2010-07-01

    To identity immunodiagnostic antigen genes, a Plasmodium falciparum (Dd2 clone) expression library was screened using human immune sera. The ring-infected erythrocyte surface antigen (RESA) was isolated: this antigen of the resistant clone presents repeat tandem sequences like the 3D7 clone, albeit in different numbers. RESA has been studied as a marker of genetic diversity, with different sizes being observed in different isolates and clones of Plasmodium falciparum. The native protein was localised in cultures by western-blot and immuno-transmission electron microscopy. The antigenicity of RESA was evaluated by ELISA, using the carboxy-terminal repeat region as antigen. The assay's sensitivity and specificity were 78.2 and 94% respectively.

  17. Molecular cloning and characterization of two novel cellulase genes from the mollusc Ampullaria crossean.

    PubMed

    Guo, Rui; Ding, Ming; Zhang, Si-Liang; Xu, Gen-Jun; Zhao, Fu-Kun

    2008-02-01

    Cellulase genes have been reported not only from fungi, bacteria and plant, but also from some invertebrate animals. Here, two cellulase (endo-beta-1,4-glucanase, EC 3.2.1.4) genes, eg27I and eg27II, were cloned from the freshwater snail Ampullaria crossean cDNA using degenerate primers. The nucleotide sequences of the two genes shared 94.5% identity. The open reading frames of both genes consisted of 588 bp, encoding 195 amino acids. Both EG27I and EG27II belong to the glycoside hydrolase family 45, and each lacks a carbohydrate-binding module. The presence of introns demonstrated a eukaryotic origin of the EG27 gene, and, in addition, successful cloning of EG27 cDNA supported endogenous production of EG27 cellulase by Ampullaria crossean. Investigation of the EG27 cDNA from A. crossean will provide further information on GHF45 cellulases.

  18. Molecular Cloning and Differential Expression of the Maize Ferredoxin Gene Family 1

    PubMed Central

    Hase, Toshiharu; Kimata, Yoko; Yonekura, Keiko; Matsumura, Tomohiko; Sakakibara, Hitoshi

    1991-01-01

    In maize (Zea mays L.), four ferredoxin (Fd) isoproteins, Fd I to Fd IV, are differentially distributed in photosynthetic and nonphotosynthetic organs of young seedlings (Y Kimata, T Hase [1989] Plant Physiol 89: 1193-1197). To understand structural characteristics of the Fd isoproteins and molecular mechanism of the differential expression of their genes, we have cloned and characterized three different maize Fd cDNAs. DNA sequence analyses showed that two of the cDNAs encoded the entire precursor polypeptides of Fd I and Fd III, which were composed of 150 and 152 amino acid residues, respectively, and the other encoded a 135 amino acid precursor polypeptide of Fd not yet identified. High degrees of homologies were found in the deduced amino acid sequences of mature regions of these Fd isoproteins, but the transit peptide of Fd III differed considerably from those of other Fd isoproteins. Fd I and the unidentified Fd were encoded mainly with codons ending in C or G, but such strong codon bias was not seen in Fd III. Gene specific probes for each cDNA were used to probe Northern blots of RNA isolated from leaves, mesocotyls, and roots of maize seedlings. The gene transcripts for Fd I and the unidentified Fd were restricted to leaves and their levels increased markedly upon illumination of etiolated seedlings, whereas that for Fd III was detected in all organs and its accumulation was not light dependent. This organ specific accumulation of Fd mRNAs corresponds exactly to the distribution pattern of Fd isoproteins. ImagesFigure 1Figure 5Figure 6Figure 7Figure 8 PMID:16668188

  19. Molecular cloning and expression analysis of the sucrose transporter gene family from Theobroma cacao L.

    PubMed

    Li, Fupeng; Wu, Baoduo; Qin, Xiaowei; Yan, Lin; Hao, Chaoyun; Tan, Lehe; Lai, Jianxiong

    2014-08-10

    In this study, we performed cloning and expression analysis of six putative sucrose transporter genes, designated TcSUT1, TcSUT2, TcSUT3, TcSUT4, TcSUT5 and TcSUT6, from the cacao genotype 'TAS-R8'. The combination of cDNA and genomic DNA sequences revealed that the cacao SUT genes contained exon numbers ranging from 1 to 14. The average molecular mass of all six deduced proteins was approximately 56 kDa (range 52 to 66 kDa). All six proteins were predicted to exhibit typical features of sucrose transporters with 12 trans-membrane spanning domains. Phylogenetic analysis revealed that TcSUT2 and TcSUT4 belonged to Group 2 SUT and Group 4 SUT, respectively, and the other TcSUT proteins were belonging to Group 1 SUT. Real-time PCR was conducted to investigate the expression pattern of each member of the SUT family in cacao. Our experiment showed that TcSUT1 was expressed dominantly in pods and that, TcSUT3 and TcSUT4 were highly expressed in both pods and in bark with phloem. Within pods, TcSUT1 and TcSUT4 were expressed more in the seed coat and seed from the pod enlargement stage to the ripening stage. TcSUT5 expression sharply increased to its highest expression level in the seed coat during the ripening stage. Expression pattern analysis indicated that TcSUT genes may be associated with photoassimilate transport into developing seeds and may, therefore, have an impact on seed production.

  20. Molecular cloning and structural characterization of the human histidase gene (HAL)

    SciTech Connect

    Suchi, Mariko; Sano, Hirofumi; Mizuno, Haruo; Wada, Yoshiro

    1995-09-01

    Histidase (EC 4.3.1.3) is a cytosolic enzyme that catalyzes the nonoxidative determination of histidine to urocanic acid. Histidinemia, resulting from reduced histidase activity as reported in Cambridge stock his/her mice and in humans, is the most frequent inborn metabolic error in Japan. The histidase chromosomal gene (HAL) was isolated from a {lambda}EMBL-3 human genomic library using the human histidase cDNA as a probe. Restriction mapping and Southern blot analysis of the isolated clones reveal a single-copy gene spanning approximately 25 kb and consisting of 21 exons. Exon 1 encodes only 5{prime} untranslated sequence of liver histidase mRNA, with protein coding beginning in exon 2. A rarely observed 5{prime}GC, similar to that reported in the human P-450(SCC) gene, is present in intron 20. All other splicing junctions adhere to the canonical GT/AG rule. A TATA box sequence is located 25 bp upstream of the liver histidase transcription initiation site determined by S1 nuclease protection analysis. Several liver- and epidermis-specific transcription factor binding sites, including C/EBP, NFIL6, HNF5, AP2/ KER1, MNF, and others, are also identified in the 5{prime} flanking region. Consistent with the hepatic and epidermal expression of histidase, this finding suggests that histidase transcription may be regulated by these factors. We further identify a polymorphism (A to G transition) in the histidase coding region of exon 16. The human histidase genomic structure presented here should facilitate the molecular investigation of symptomatic and asymptomatic forms of histidinemia. 69 refs., 4 figs., 1 tab.

  1. Molecular cloning, characterization and functional analysis of a heat shock protein 70 gene in Cyclina sinensis.

    PubMed

    Ren, Yipeng; Pan, Heting; Yang, Ying; Pan, Baoping; Bu, Wenjun

    2016-11-01

    Heat shock protein 70 (HSP70) is an important member of the heat shock protein superfamily and is involved in protecting organisms against various stressors. In the present study, we used RACE to clone a full-length Cyclina sinensis HSP70 cDNA termed CsHSP70. The full length of the CsHSP70 cDNA was 2308 bp, with a 5' untranslated region (UTR) of 42 bp, a 3' UTR of 268 bp, and an open reading frame (ORF) of 1998 bp encoding a polypeptide of 655 amino acids with an estimated molecular mass of 72.75 kDa and an estimated isoelectric point of 5.48. Quantitative real-time PCR was employed to analyze the tissue distribution and temporal expression of the CsHSP70 gene after bacterial challenge and cadmium (Cd) exposure. The CsHSP70 mRNA transcript was expressed ubiquitously in five examined tissues, with the highest expression in hemocytes (P < 0.05) and with the lowest expression in the hepatopancreas. Furthermore, the expression level of CsHSP70 in hemocytes at 3 h after Vibrio anguillarum challenge was extremely significantly up-regulated (P < 0.01). Moreover, the CsHSP70 transcript was up-regulated significantly following exposure to a safe Cd concentration (0.1 mg/L). Finally, after the CsHSP70 gene was silenced by RNA interference, the expression of the CsTLR13 and CsMyD88 genes were extremely significantly decreased (P < 0.01). The results indicated that CsHSP70 could play an important role in mediating the environmental stress and immune responses, and regulating TLR signaling pathway in C. sinensis.

  2. Molecular cloning and bioinformatic analysis of the Streptococcus agalactiae neuA gene isolated from tilapia.

    PubMed

    Wang, E L; Wang, K Y; Chen, D F; Geng, Y; Huang, L Y; Wang, J; He, Y

    2015-06-01

    Cytidine monophosphate (CMP) N-acetylneuraminic acid (NeuNAc) synthetase, which is encoded by the neuA gene, can catalyze the activation of sialic acid with CMP, and plays an important role in Streptococcus agalactiae infection pathogenesis. To study the structure and function of the S. agalactiae neuA gene, we isolated it from diseased tilapia, amplified it using polymerase chain reaction (PCR) with specific primers, and cloned it into a pMD19-T vector. The recombinant plasmid was confirmed by PCR and restriction enzyme digestion, and identified by sequencing. Molecular characterization analyses of the neuA nucleotide amino acid sequence were performed using bioinformatic tools and an online server. The results showed that the neuA nucleotide sequence contained a complete coding region, which comprised 1242 bp, encoding 413 amino acids (aa). The aa sequence was highly conserved and contained a Glyco_tranf_GTA_type superfamily and an SGNH_hydrolase superfamily conserved domain, which are related to sialic acid activation catalysis. The NeuA protein possessed many important sites related to post-translational modification, including 28 potential phosphorylation sites and 2 potential N-glycosylation sites, had no signal peptides or transmembrane regions, and was predicted to reside in the cytoplasm. Moreover, the protein had some B-cell epitopes, which suggests its potential in development of a vaccine against S. agalactiae infection. The codon usage frequency of neuA differed greatly in Escherichia coli and Homo sapiens genes, and neuA may be more efficiently expressed in eukaryotes (yeast). S. agalactiae neuA from tilapia maintains high structural homology and sequence identity with CMP-NeuNAc synthetases from other bacteria.

  3. Molecular cloning of the gene encoding the bovine brain ribonuclease and its expression in different regions of the brain.

    PubMed Central

    Sasso, M P; Carsana, A; Confalone, E; Cosi, C; Sorrentino, S; Viola, M; Palmieri, M; Russo, E; Furia, A

    1991-01-01

    In this paper we report the molecular cloning of the gene encoding the bovine brain ribonuclease. The nucleotide sequence determined in this work shows a high degree of identity to the homologous gene encoding the bovine pancreatic ribonuclease. Processing of the primary transcripts of these genes also follows a similar pathway, splicing of the unique intron in the 5' untranslated region occurs at corresponding positions. Expression of the bovine brain ribonuclease gene can be detected both at the transcriptional and translational levels in all the regions of the brain examined. Images PMID:1754384

  4. Molecular Cloning, Nucleotide Sequence, and Expression of Genes Encoding a Polycyclic Aromatic Ring Dioxygenase from Mycobacterium sp. Strain PYR-1

    PubMed Central

    Khan, Ashraf A.; Wang, Rong-Fu; Cao, Wei-Wen; Doerge, Daniel R.; Wennerstrom, David; Cerniglia, Carl E.

    2001-01-01

    Mycobacterium sp. strain PYR-1 degrades high-molecular-weight polycyclic hydrocarbons (PAHs) primarily through the introduction of both atoms of molecular oxygen by a dioxygenase. To clone the dioxygenase genes involved in PAH degradation, two-dimensional (2D) gel electrophoresis of PAH-induced proteins from cultures of Mycobacterium sp. strain PYR-1 was used to detect proteins that increased after phenanthrene, dibenzothiophene, and pyrene exposure. Comparison of proteins from induced and uninduced cultures on 2D gels indicated that at least six major proteins were expressed (105, 81, 52, 50, 43, and 13 kDa). The N-terminal sequence of the 50-kDa protein was similar to those of other dioxygenases. A digoxigenin-labeled oligonucleotide probe designed from this protein sequence was used to screen dioxygenase-positive clones from a genomic library of Mycobacterium sp. strain PYR-1. Three clones, each containing a 5,288-bp DNA insert with three genes of the dioxygenase system, were obtained. The genes in the DNA insert, from the 5′ to the 3′ direction, were a dehydrogenase, the dioxygenase small (β)-subunit, and the dioxygenase large (α)-subunit genes, arranged in a sequence different from those of genes encoding other bacterial dioxygenase systems. Phylogenetic analysis showed that the large α subunit did not cluster with most of the known α-subunit sequences but rather with three newly described α subunits of dioxygenases from Rhodococcus spp. and Nocardioides spp. The genes from Mycobacterium sp. strain PYR-1 were subcloned and overexpressed in Escherichia coli with the pBAD/ThioFusion system. The functionality of the genes for PAH degradation was confirmed in a phagemid clone containing all three genes, as well as in plasmid subclones containing the two genes encoding the dioxygenase subunits. PMID:11472934

  5. Molecular cloning of chitinase 33 (chit33) gene from Trichoderma atroviride

    PubMed Central

    Matroudi, S.; Zamani, M.R.; Motallebi, M.

    2008-01-01

    In this study Trichoderma atroviride was selected as over producer of chitinase enzyme among 30 different isolates of Trichoderma sp. on the basis of chitinase specific activity. From this isolate the genomic and cDNA clones encoding chit33 have been isolated and sequenced. Comparison of genomic and cDNA sequences for defining gene structure indicates that this gene contains three short introns and also an open reading frame coding for a protein of 321 amino acids. The deduced amino acid sequence includes a 19 aa putative signal peptide. Homology between this sequence and other reported Trichoderma Chit33 proteins are discussed. The coding sequence of chit33 gene was cloned in pEt26b(+) expression vector and expressed in E. coli. PMID:24031242

  6. Identification and molecular cloning of glutamate decarboxylase gene from Lactobacillus casei

    PubMed Central

    Tavakoli, Yasaman; Esmaeili, Abolghasem; Rabbani, Mohammad

    2015-01-01

    Gamma-amino butyric acid (GABA) possesses several physiological functions such as neurotransmission, induction of hypotension, diuretic and tranquilizer effects. Production of GABA-enriched products by lactic acid bacteria has been a focus of different researches in recent years because of their safety and health-promoting specifities. In this study, glutamate decarboxylase (gad) gene of a local strains Lactobacillus casei was identified and cloned. In order to clone the gad gene from this strain, the PCR was carried out using primers designed based on conserved regions. The PCR product was purified and ligated into PGEM-T vector. Comparison of obtained sequences shows that this fragment codes the pyridoxal 5′-phosphate binding region. This strain could possibly be used for the industrial GABA production and also for development of functional fermented foods. Gad gene manipulation can also either decrease or increase the activity of enzyme in bacteria. PMID:27844008

  7. Cloning, expression and molecular analysis of Iranian Brucella melitensis Omp25 gene for designing a subunit vaccine

    PubMed Central

    Yousefi, Soheil; Tahmoorespur, Mojtaba; Sekhavati, Mohammad Hadi

    2016-01-01

    Brucellosis is a well-known domestic animal infectious disease, which is caused by Brucella bacterium. The outer membrane protein 25 kDa (Omp25) gene plays an important role in simulating of TNF-α, IFN-α, macrophage, and cytokines cells. In the current study molecular cloning and expression analysis of Omp25 gene for designing a subunit vaccine against Brucella was investigated. Amplifying the full length of candidate gene was performed using specific primers. Sub-cloning of this gene conducted using pTZ57R/T vector in TOP10F strain of Escherichia coli(E.coli) as the host. Also, pET32(a)+ vector used for expression in BL21 (DE3) strain of E.coli. Omp25 gene with 642 bp size was amplified and cloned successfully. The expression results were confirmed by sequencing and sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) analyses which showed 42 kDa protein band correctly. Also, phylogenic analysis showed this gene has a near genetic relation with other Brucella strains. According to our results we can propose this gene as a candidate useful for stimulation of cell-mediated and humoral immunity system in future study. PMID:27920824

  8. Molecular cloning and characterization of mutant and wild-type human. beta. -actin genes

    SciTech Connect

    Leavitt, J.; Gunning, P.; Porreca, P.; Ng, S.Y.; Lin, C.H.; Kedes, L.

    1984-10-01

    There are more than 20 ..beta..-actin-specific sequences in the human genome, many of which are pseudogenes. To facilitate the isolation of potentially functional ..beta..-actin genes, they used the new method of B. Seed for selecting genomic clones by homologous recombination. A derivative of the ..pi..VX miniplasmid, ..pi..AN7..beta..1, was constructed by insertion of the 600-base-pair 3' untranslated region of the ..beta..-actin mRNA expressed in human fibroblasts. Five clones containing ..beta..-actin sequences were selected from an amplified human fetal gene library by homologous recombination between library phage and the miniplasmid. One of these clones contained a complete ..beta..-actin gene with a coding sequence identical to that determined for the mRNA of human fibroblasts. A DNA fragment consisting of mostly intervening sequences from this gene was then use to identify 13 independent recombinant copies of the analogous gene from two specially constructed gene libraries, each containing one of the two types of mutant ..beta..-actin genes found in a line of neoplastic human fibroblasts. The amino acid and nucleotide sequences encoded by the unmutated gene predict that a guanine-to-adenine transition is responsible for the glycine-to-aspartic acid mutation at codon 244 and would also result in the loss of a HaeIII site. Detection of this HaeIII polymorphism among the fibroblast-derived closed verified the identity of the ..beta..-actin gene expressed in human fibroblasts.

  9. [Structural organization of the human p53 gene. I. Molecular cloning of the human p53 gene].

    PubMed

    Bukhman, V L; Ninkina, N N; Chumakov, P M; Khilenkova, M A; Samarina, O P

    1987-09-01

    Human p53 gene was cloned from the normal human placenta DNA and DNA from the strain of human kidney carcinoma transplanted into nude mice. Representative gene library from tumor strain of human kidney carcinoma and library of 15 kb EcoRI fragments of DNA from normal human placenta were constructed. Maniatis gene library was also used. Five clones were isolated from kidney carcinoma library; they covered 27 kb and included full-length p53 gene of 19.5 kb and flanking sequences. From normal placenta libraries three overlapped clones were obtained. Restriction map of cloned sequences was constructed and polarity of the p53 gene determined. The first intron of the gene is large (10.4 kb); polymorphic BglII site was observed in this intron, which allows to discriminate between allelic genes. One of these (BglII-) is ten times more abundant that the other (BglII+). Both allelic genes are able to synthesize the 2.8 kb p53 gene.

  10. Identification and cloning of molecular markers for UV-B tolerant gene in wild sugarcane (Saccharum spontaneum L.).

    PubMed

    Li, Yuan; He, Yongmei; Zu, Yanqun; Zhan, Fangdong

    2011-11-03

    Previously we have selected wild sugarcane (Saccharum spontaneum L.) sterile lines that are tolerant or susceptible to UV-B radiation based on response index (RI) in a field screening test. The RI was established according to plant height, tiller number, leaf index, total biomass and brix under enhanced ultraviolet-B (UV-B, 280-310 nm) radiation. In this experiment, molecular markers linked to the UV-B tolerant and susceptible genes were identified and cloned. RAPD (Randomly amplified polymorphic DNAs) assay using 100 arbitrary primers followed by clustering analysis separated the tolerant and susceptible lines into two groups at the genetic distance of 0.380. The UV-B tolerant and susceptible gene pools were constructed and compared using the Bulked Segregate Analysis (BSA) approach. Of the 100 arbitrary RAPD primers, primer OPR16 produced polymorphic DNA banding patterns from both gene pools. The OPR16-1200 bp DNA fragment was only amplified from the tolerant lines and the OPR16-800 bp from the susceptible ones. These two PCR fragments were cloned onto T-vector. DNA sequence alignment analysis determined that 42% homology existed between the reverse and forward sequences of the OPR16-1200 bp clone, and 36% homology between the forward sequences of the OPR16-800 bp and OPR16-1200 bp clones. The two DNA clones were determined to be linked to the UV-B tolerant and susceptible genes, and they can be used to develop molecular markers for the associated traits.

  11. Molecular cloning, functional verification, and evolution of TmPm3, the powdery mildew resistance gene of Triticum monococcum L.

    PubMed

    Zhao, C Z; Li, Y H; Dong, H T; Geng, M M; Liu, W H; Li, F; Ni, Z F; Wang, X J; Xie, C J; Sun, Q X

    2016-04-26

    Powdery mildew (Pm) is one of the most harmful diseases in wheat. Three Pm-resistance genes, Pm3, Pm21, and Pm8, have been cloned but most Pm3/Pm8 alleles have lost their resistance to Pm in hexaploid wheat. In this study, a new Pm3 homolog gene (TmPm3) was isolated from Triticum monococcum L. using a homology-based cloning strategy, being the first report of a functional Pm3 homolog gene from a diploid wheat species. The transient expression of TmPm3 in leaf epidermal cells showed that over-expressed TmPm3 could significantly inhibit the penetration of Blumeria graminis f. sp tritici conidia spores and the formation of haustoria. Sequence analysis of Pm3 alleles shed new light on the evolution of Pm3 genes, providing a better understanding of the molecular basis of disease resistance. This study also suggested that homology-based cloning of resistance genes is a feasible method for the isolation of functional resistance genes from wheat germplasm.

  12. Molecular cloning of a gene encoding the histamine H2 receptor

    SciTech Connect

    Gantz, I.; Schaeffer, M.; DelValle, J.; Logsdon, C.; Campbell, V.; Uhler, M.; Yamada, Tadataka )

    1991-01-15

    The H2 subclass of histamine receptors mediates gastric acid secretion, and antagonists for this receptor have proven to be effective therapy for acid peptic disorders of the gastrointestinal tract. The physiological action of histamine has been shown to be mediated via a guanine nucleotide-binding protein linked to adenylate cyclase activation and cellular cAMP generation. The authors capitalized on the technique of polymerase chain reaction, using degenerate oligonucleotide primers based on the known homology between cellular receptors linked to guanine nucleotide-binding proteins to obtain a partial-length clone from canine gastric parietal cell cDNA. This clone was used to obtain a full-length receptor gene from a canine genomic library. Histamine increased in a dose-dependent manner cellular cAMP content in L cells permanently transfected with this gene, and preincubation of the cells with the H2-selective antagonist cimetidine shifted the dose-response curve to the right. Cimetidine inhibited the binding of the radiolabeled H2 receptor-selective ligand (methyl-{sup 3}H)tiotidine to the transfected cells in a dose-dependent fashion, but the H1-selective antagonist diphenhydramine did not. These data indicate that they have cloned a gene that encodes the H2 subclass of histamine receptors.

  13. Characterization of feline TRIM genes: molecular cloning, expression in tissues, and response to type I interferon.

    PubMed

    Koba, Ryota; Kokaji, Chika; Fujisaki, Gentoku; Oguma, Keisuke; Sentsui, Hiroshi

    2013-05-15

    Members of the tripartite motif (TRIM) protein family in mammals are responsible for various cellular processes. Previous studies have revealed that several TRIM proteins were induced by interferons (IFN) and that these proteins were involved in innate immune response against retroviral infection. Although retroviral infection is prevalent in domestic cats, the expression profiles and roles of feline TRIM genes against these viral infections are not well understood. In the present study, we examined tissue expression and IFN inducibility of nine feline TRIM genes. In addition, the complete coding sequences of six cloned TRIM genes were determined, and their structures were analyzed. Nine TRIM genes were expressed in feline tissues and five were up-regulated by type I IFN. The predicted amino acid sequence of six feline TRIM proteins showed high sequence similarities to other mammalian TRIM proteins, and suggest that feline TRIM genes are potentially involved in antiviral reactivity in IFN-mediated immune response.

  14. Molecular cloning, nucleotide sequence and expression of a Sulfolobus solfataricus gene encoding a class II fumarase.

    PubMed

    Colombo, S; Grisa, M; Tortora, P; Vanoni, M

    1994-01-03

    Fumarase catalyzes the interconversion of L-malate and fumarate. A Sulfolobus solfataricus fumarase gene (fumC) was cloned and sequenced. Typical archaebacterial regulatory sites were identified in the region flanking the fumC open reading frame. The fumC gene encodes a protein of 438 amino acids (47,899 Da) which shows several significant similarities with class II fumarases from both eubacterial and eukariotic sources as well as with aspartases. S. solfataricus fumarase expressed in Escherichia coli retains enzymatic activity and its thermostability is comparable to that of S. solfataricus purified enzyme despite a 11 amino acid C-terminal deletion.

  15. Molecular cloning and expression of the ilvGEDAY genes from Salmonella typhimurium.

    PubMed Central

    Blazey, D L; Kim, R; Burns, R O

    1981-01-01

    The ilvGEDAY genes of Salmonella typhimurium were cloned in Escherichia coli K-12 by in vitro recombination techniques. A single species of recombinant plasmid, designated pDU1, was obtained by selecting for Valr Ampr transformants of strain SK1592. pDU1 was shown to contain a 14-kilobase EcoRI partial digestion product of the S. typhimurium chromosome inserted into the EcoRI site of the pVH2124 cloning vector. The ilvGEDAY genes were found to occupy a maximum length of 7.5 kilobases. Restriction endonuclease analysis of the S. typhimurium ilv gene cluster provided another demonstration of the gene order as well as established the location of ilv Y between ilvA and ilvC. The presence of a ribosomal ribonucleic acid operon on the pDU1 insert, about 3 kilobases from the 5' end of ilvG, was shown by Southern hybridization. The expression of the ilvGEDA operon from pDU1 was found to be elevated, reflecting the increased gene dosage of the multicopy plasmid. A polarity was observed with respect to ilvEDA expression which is discussed in terms of the possible translational effects of the two internal promoter sequences, one located proximal to ilvE and the other located proximal to ilvD. Images PMID:6167564

  16. Molecular cloning and sequence analysis of the Zygosaccharomyces bailii HIS3 gene encoding the imidazole glycerolphosphate dehydratase.

    PubMed

    Branduardi, Paola

    2002-09-30

    Zygosaccharomyces bailii is a spoilage yeast belonging to the Zygosaccharomyces genus. In recent years these yeasts, due to their exceptional resistance to several stresses, have become more and more interesting as model organisms to study the molecular basis of the said resistance. A Z. bailii cDNA library has been built and the 672 bp nucleotide sequence coding for the HIS3 gene was cloned by complementation of a Saccharomyces cerevisiae his3 mutant strain. The deduced 223 amino acid sequence shares a high degree of homology with His3p homologues in other non-conventional yeast species. The GeneBank Accession No. is AY050224.

  17. Molecular Cloning of Adenosinediphosphoribosyl Transferase.

    DTIC Science & Technology

    1987-09-08

    ACCESSION NO.D,. 03261102F 2312 A~5 11. TITLE (include Securqt Classification) 0 Molecular Cloning of Adenosinediphosphoribosyl Transferase 12. PERSONAL...I’:- AFOSR.Tlt. 8 7 - 0 9 8,2 0IL * pi AFOSR- 85 -0377 PROGRESS REPORT Molecular Cloning of Adenosinediphosphoribosyl Transferase 5." Period of...Pharmacology and the Cardiovascular Research Institute September 8, 1987 .’, 5.’- "’S ". -f, AFOSR - 85 -0377 PROGRESS REPORT Molecular Cloning of

  18. Molecular cloning and expression profiling of multiple Dof genes of Sorghum bicolor (L) Moench.

    PubMed

    Gupta, Shubhra; Arya, Gulab C; Malviya, Neha; Bisht, Naveen C; Yadav, Dinesh

    2016-08-01

    DNA binding with one finger (Dof) proteins represent a family of plant specific transcription factors associated with diverse biological processes, such as seed maturation and germination, phytohormone and light mediated regulation, and plant responses to biotic and abiotic stresses. In present study, a total of 21 Dof genes from Sorghum bicolor were cloned, sequenced and in silico characterized for homology search, revealing their identity to Dof like proteins. The expression profiling of SbDof genes using quantitative RT-PCR in different tissue types and also under drought and salt stresses was attempted. The SbDof genes displayed differential expression either in their transcript abundance or in their expression patterns under normal growth condition. Two of the SbDof genes namely SbDof8 and SbDof12 showed comparatively high level of transcript abundance in all the tissue types tested; whereas some of the SbDof genes showed a distinct tissue specific expression pattern. Further a total of 13 SbDof genes showed differential expression when subjected to either of the abiotic stress i.e. drought or salinity. Three of the SbDof genes namely SbDof12, SbDof19 and SbDof24 were found to be up-regulated in response to drought and salt stress. Comparative analysis of SbDof genes expression revealed existence of a complex transcriptional and functional diversity across plant growth and developmental stages.

  19. Molecular cloning, tissue distribution, and daily rhythms of expression of per1 gene in European sea bass (Dicentrarchus labrax).

    PubMed

    Sánchez, Jose Antonio; Madrid, Juan Antonio; Sánchez-Vázquez, Francisco Javier

    2010-01-01

    Circadian rhythms are controlled by interlocked autoregulatory feedback loops consisting of interactions of a group of circadian clock genes and their proteins. The Period family is a group of genes that are essential components of the molecular clock. In the present study, we cloned a period gene (per1) of the European sea bass, a marine teleost of chronobiological interest. The cloned sequence encoded a protein consisting of 1436 amino acids that homology and phylogenic analyses showed to be related with fish PER1 proteins possessing very high identity with Oryzias latipes (Medaka) per1. Polymerase chain reaction screening of per1 expression showed that this gene is expressed in all the tissues analyzed (brain, heart, liver, gill, muscle, digestive tract, adipose tissue, spleen, and retina). In addition, a daily expression rhythm, with an acrophase (peak time) approximately ZT0 (lights-on), was found in the two tissue types investigated: neural (brain) and peripheral (liver and heart). In conclusion, identification and characterization of the gene encoding sea bass per1 provide valuable information for understanding the circadian mechanism at the molecular level in this species, although further research is needed to clarify the exact role that per1 plays in the circadian oscillator and the dual behavior of European sea bass.

  20. Molecular cloning and sequencing of the gene encoding the fimbrial subunit protein of Bacteroides gingivalis.

    PubMed Central

    Dickinson, D P; Kubiniec, M A; Yoshimura, F; Genco, R J

    1988-01-01

    The gene encoding the fimbrial subunit protein of Bacteroides gingivalis 381, fimbrilin, has been cloned and sequenced. The gene was present as a single copy on the bacterial chromosome, and the codon usage in the gene conformed closely to that expected for an abundant protein. The predicted size of the mature protein was 35,924 daltons, and the secretory form may have had a 10-amino-acid, hydrophilic leader sequence similar to the leader sequences of the MePhe fimbriae family. The protein sequence had no marked similarity to known fimbrial sequences, and no homologous sequences could be found in other black-pigmented Bacteroides species, suggesting that fimbrillin represents a class of fimbrial subunit protein of limited distribution. Images PMID:2895100

  1. Molecular cloning and expression analysis of a novel BCCP subunit gene from Aleurites moluccana.

    PubMed

    Xuan, W Y; Zhang, Y; Liu, Z Q; Feng, D; Luo, M Y

    2015-08-19

    Aleurites moluccana L. is grown as a roadside tree in southern China and the oil content of its seed is higher than other oil plants, such as Jatropha curcas and Camellia oleifera. A. moluccana is considered a promising energy plant because its seed oil could be used to produce biodiesel and bio-jet fuel. In addition, the bark, leaves, and kernels of A. moluccana have various medical and commercial uses. Here, a novel gene coding the biotin carboxyl carrier protein subunit (BCCP) was cloned from A. moluccana L. using the homology cloning method combined with rapid amplification of cDNA end (RACE) technology. The isolated full-length cDNA sequence (designated AM-accB) was 1188 bp, containing a 795-bp open reading frame coding for 265 amino acids. The deduced amino acid sequence of AM-accB contained a biotinylated domain located between amino acids 190 and 263. A. moluccana BCCP shows high identity at the amino acid level to its homologues in other higher plants, such as Vernicia fordii, J. curcas, and Ricinus communis (86, 77, and 70%, respectively), which all contain conserved domains for ACCase activity. The expression of the AM-accB gene during the middle stage of development and maturation in A. moluccana seeds was higher than that in early and later stages. The expression pattern of the AM-accB gene is very similar to that of the oil accumulation rate.

  2. Molecular cloning, expression, and evolution analysis of type II CHI gene from peanut (Arachis hypogaea L.).

    PubMed

    Liu, Yu; Zhao, Shuzhen; Wang, Jiangshan; Zhao, Chuanzhi; Guan, Hongshan; Hou, Lei; Li, Changsheng; Xia, Han; Wang, Xingjun

    2015-01-01

    Chalcone isomerase (CHI) plays critical roles in plant secondary metabolism, which is important for the interaction between plants and the environment. CHI genes are widely studied in various higher plants. However, little information about CHI genes is available in peanut. Based on conservation of CHI gene family, we cloned the peanut type II CHI gene (AhCHI II) cDNA and genome sequence. The amino acid sequence of peanut CHI II was highly homologous to type II CHI from other plant species. qRT-PCR results showed that peanut CHI II is mainly expressed in roots; however, peanut CHI I is mainly expressed in tissues with high content of anthocyanin. Gene duplication and gene cluster analysis indicated that CHI II was derived from CHI I 65 million years ago approximately. Our gene structure analysis results are not in agreement with the previous hypothesis that CHI II was derived from CHI I by the insertion of an intron into the first exon. Moreover, no positive selection pressure was found in CHIs, while, 32.1 % of sites were under neutral selection, which may lead to mutation accumulation and fixation during great changes of environment.

  3. Molecular cloning of allelopathy related genes and their relation to HHO in Eupatorium adenophorum.

    PubMed

    Guo, Huiming; Pei, Xixiang; Wan, Fanghao; Cheng, Hongmei

    2011-10-01

    In this study, conserved sequence regions of HMGR, DXR, and CHS (encoding 3-hydroxy-3-methylglutaryl-CoA reductase, 1-deoxyxylulose-5-phosphate reductoisomerase and chalcone synthase, respectively) were amplified by reverse transcriptase (RT)-PCR from Eupatorium adenophorum. Quantitative real-time PCR showed that the expression of CHS was related to the level of HHO, an allelochemical isolated from E. adenophorum. Semi-quantitative RT-PCR showed that there was no significant difference in expression of genes among three different tissues, except for CHS. Southern blotting indicated that at least three CHS genes are present in the E. adenophorum genome. A full-length cDNA from CHS genes (named EaCHS1, GenBank ID: FJ913888) was cloned. The 1,455 bp cDNA contained an open reading frame (1,206 bp) encoding a protein of 401 amino acids. Preliminary bioinformatics analysis of EaCHS1 revealed that EaCHS1 was a member of CHS family, the subcellular localization predicted that EaCHS1 was a cytoplasmic protein. To the best of our knowledge, this is the first report of conserved sequences of these genes and of a full-length EaCHS1 gene in E. adenophorum. The results indicated that CHS gene is related to allelopathy of E. adenophorum.

  4. Molecular cloning of a recA-like gene from the cyanobacterium Anabaena variabilis

    SciTech Connect

    Owttrim, G.W.; Coleman, J.R.

    1987-05-01

    A recA-like gene isolated from the cyanobacterium Anabaena variabilis was cloned and partially characterized. When introduced into Escherichia coli recA mutants, the 7.5-kilobase-pair plasmid-borne DNA insert restored resistance to methyl methanesulfonate and UV irradiation, as well as recombination proficiency when measured by Hfr-mediated conjugation. The cyanobacterial recA gene restored spontaneous but not mitomycin C-induced prophage production. Restriction analysis and subcloning yielded a 1.5-kilobase-pair Sau3A fragment which also restored methylmethane sulfonate resistance and coded for a 38- to 40-kilodalton polypeptide when expressed in an in vitro transcription-translation system.

  5. Molecular cloning, expression, and regulation of the ovalbumin gene in pigeon oviduct epithelial cells.

    PubMed

    Zhang, H; Lu, L Z; Chen, L; Tao, Z R; Chen, F; Zhong, S L; Liu, Y L; Tian, Y; Yan, P S

    2014-01-10

    The full-length pigeon ovalbumin (OVA) gene cDNA was cloned and sequenced by reverse transcription-polymerase chain reaction (RT-PCR) and rapid-amplification of cDNA ends. A 386-amino acid protein was predicted for the obtained sequence, which had 67% identity with the chicken protein. Similar to chicken OVA, the pigeon OVA gene is a non-inhibitory serine protease inhibitor. Quantitative PCR analysis revealed that pigeon OVA mRNA was highly expressed in the oviduct, and trace amounts were detected in other tissues. During the reproductive cycle, pigeon oviduct OVA mRNA expression reached its peak during the egg-laying stage, decreased with brooding, and then increased again during the squab-feeding period. Moreover, the relative OVA expression level in pigeon oviduct epithelial cells could be upregulated by a constant concentration of steroid hormones.

  6. Molecular cloning of a recA-like gene from the cyanobacterium Anabaena variabilis.

    PubMed Central

    Owttrim, G W; Coleman, J R

    1987-01-01

    A recA-like gene isolated from the cyanobacterium Anabaena variabilis was cloned and partially characterized. When introduced into Escherichia coli recA mutants, the 7.5-kilobase-pair plasmid-borne DNA insert restored resistance to methyl methanesulfonate and UV irradiation, as well as recombination proficiency when measured by Hfr-mediated conjugation. The cyanobacterial recA gene restored spontaneous but not mitomycin C-induced prophage production. Restriction analysis and subcloning yielded a 1.5-kilobase-pair Sau3A fragment which also restored methylmethane sulfonate resistance and coded for a 38- to 40-kilodalton polypeptide when expressed in an in vitro transcription-translation system. Images PMID:3032896

  7. Molecular cloning of the perilipin gene and its association with carcass and fat traits in Chinese ducks.

    PubMed

    Zhang, H L; Fan, H J; Liu, X L; Wu, Y; Hou, S S

    2013-05-13

    The perilipin (PLIN) gene is a candidate gene of carcass and fat traits in ducks. In order to study the molecular character of the PLIN gene and its function in different breeds of Chinese ducks, samples were obtained from the Chinese Academy of Agricultural Sciences Research Center for Birds, including 95 Peking ducks of the Z2 series, 91 Peking ducks of the Z4 series, 82 hybrid systems (Z2 x Z4), and 93 Cherry Valley ducks. We used RT-PCR and 3'-RACE to clone the duck PLIN gene, detect SNPs and analyze their associations with carcass and fat traits. A 2212-bp sequence was cloned with the complete coding region and a 3'-untranslated region. We found a nucleotide mutation (C → T) in exon 2 of the PLIN gene. There were no significant correlations between the 3 genotypes (CC, CT, TT) in breast muscle weight (BMW), leg muscle weight (LMW), subcutaneous fat weight (SFW), and intramuscular fat (IMF) in the Cherry Valley duck. The CC and CT genotypes had significant differences in carcass weight (CW), carcass net weight (CNW), and percentage of abdominal fat weight (AFW); there were significant differences in AFW and percentage of SFW. In Z4, there were no significant correlations between the 3 genotypes (TT, CC, and CT) in CW, BMW, LMW, SFW, AFW, the percentage of SFW and AFW, and IMF. CNW was significantly different between TT, CC, and CT genotypes. In Z2 x Z4, there were no significant correlations between the 3 genotypes in CW, BMW, LMW, SFW, AFW, the percentage of SFW and AFW, and IMF, while the CC and CT genotypes had significant differences in CNW. In Z2, there were no significant differences between the 3 genotypes in all traits. We deduced that the PLIN gene is a potential major gene. It is linked to a major gene affecting meat quality traits. This SNP has potential as a molecular marker for marker-assisted selection.

  8. Molecular cloning and characterization of a gene regulating flowering time from Alfalfa (Medicago sativa L.).

    PubMed

    Zhang, Tiejun; Chao, Yuehui; Kang, Junmei; Ding, Wang; Yang, Qingchuan

    2013-07-01

    Genes that regulate flowering time play crucial roles in plant development and biomass formation. Based on the cDNA sequence of Medicago truncatula (accession no. AY690425), the LFY gene of alfalfa was cloned. Sequence similarity analysis revealed high homology with FLO/LFY family genes of other plants. When fused to the green fluorescent protein, MsLFY protein was localized in the nucleus of onion (Allium cepa L.) epidermal cells. The RT-qPCR analysis of MsLFY expression patterns showed that the expression of MsLFY gene was at a low level in roots, stems, leaves and pods, and the expression level in floral buds was the highest. The expression of MsLFY was induced by GA3 and long photoperiod. Plant expression vector was constructed and transformed into Arabidopsis by the agrobacterium-mediated methods. PCR amplification with the transgenic Arabidopsis genome DNA indicated that MsLFY gene had integrated in Arabidopsis genome. Overexpression of MsLFY specifically caused early flowering under long day conditions compared with non-transgenic plants. These results indicated MsLFY played roles in promoting flowering time.

  9. Molecular cloning, characterization and expression of the energy homeostasis-associated gene in piglet*

    PubMed Central

    Wang, Sheng-ping; Gao, Yun-ling; Liu, Gang; Deng, Dun; Chen, Rong-jun; Zhang, Yu-zhe; Li, Li-li; Wen, Qing-qi; Hou, Yong-qing; Feng, Ze-meng; Guo, Zhao-hui

    2015-01-01

    The energy homeostasis-associated (Enho) gene encodes a secreted protein, adropin, which regulates the expression of hepatic lipogenic genes and adipose tissue peroxisome proliferator-activated receptor γ, a major regulator of lipogenesis. In the present study, the porcine (Sus scrofa) homologue of the Enho gene, which was named pEnho, was amplified by reverse transcriptase polymerase chain reaction (RT-PCR) using oligonucleotide primers derived from in silico sequences. The gene sequence was submitted into the GenBank of NCBI, and the access number is GQ414763. The pEnho encodes a protein of 76 amino acids which shows 75% similarity to Homo sapiens adropin. The expression profile of pEnho in tissues (liver, muscle, anterior jejunum, posterior jejunum, and ileum) was determined by quantitative real-time RT-PCR. pEnho was localized on porcine chromosome 10 and no introns were found. In conclusion, pEnho was cloned and analysed with the aim of increasing knowledge about glucose and lipid metabolism in piglets and helping to promote the health and growth of piglets through adropin regulation. PMID:26055914

  10. Molecular cloning and characterization of a glucan synthase gene from the human pathogenic fungus Paracoccidioides brasiliensis.

    PubMed

    Pereira, M; Felipe, M S; Brígido, M M; Soares, C M; Azevedo, M O

    2000-03-30

    1,3-beta-D-glucan is a fungal cell wall polymer synthesized by the multi-subunit enzyme 1,3-beta-D-glucan synthase. A subunit of this integral membrane protein was first described as the product of the FKS1 gene from Saccharomyces cerevisiae using echinocandin mutants. Other FKS1 genes were also reported for Candida albicans, Aspergillus nidulans and Cryptococcus neoformans. Here, we report the nucleotide sequence of the first homologous FKS gene cloned from the pathogenic fungus Paracoccidioides brasiliensis. An open reading frame of 5942 bp was identified in the complete sequence, interrupted by two putative introns, the first close to the 5' end and the second close to the 3' end of the gene. A promoter region is also described containing consensus sequences such as canonical TATA and CAAT boxes and, possibly, multiple sites for glucose regulation by creA protein. The deduced sequence of 1926 amino acid show more than 85% similarity to FksAp from A. nidulans, and 71% to Fks1p and Fks2p from S. cerevisiae. Computational analysis of P. brasiliensis Fks1p suggests a similar structure to transmembrane proteins, such as FksAp, with the presence of two domains composed by hydrophobic helices that limit the putative highly hydrophilic catalytic domain within the cytoplasm.

  11. Molecular cloning and characterization of FGLamide allatostatin gene from the prawn, Macrobrachium rosenbergii.

    PubMed

    Yin, Guo-Li; Yang, Jin-Shu; Cao, Jun-Xia; Yang, Wei-Jun

    2006-06-01

    Allatostatins are important regulatory neuropeptides that inhibit juvenile hormone (JH) biosynthesis by the corpora allata (CA) in insects. However, to date, the structure and expression of the gene encoding allatostatins have not been reported in any species other than insects. In this study, we used a combination of a semi-nested polymerase chain reaction (PCR) and screening of a central nervous system cDNA library of Macrobrachium rosenbergii to isolate and sequence a cDNA clone (2885 bp) encoding a 701 amino acid FGLamide allatostatin precursor polypeptide. This is the first reported allatostatin gene in crustacean. The deduced precursor was conceptually split into at least 35 FGLamide allatostatins at dibasic cleavage sites (Lys and Lys/Arg), far more than reported for any other known FGLamide allatostatin precursors from insects (13-14 allatostatins). Reverse transcription-polymerase chain reaction (RT-PCR) analysis demonstrated that the gene was expressed in the brain, gut, thoracic and abdominal ganglia, but not in the heart, muscle, ovary, gill, or hepatopancreas. Furthermore, developmentally-dependent expression of the gene was observed in the brain and thoracic ganglia of the prawn by using semi-quantitative RT-PCR analysis.

  12. Molecular cloning, characterization and expression of the energy homeostasis-associated gene in piglet.

    PubMed

    Wang, Sheng-ping; Gao, Yun-ling; Liu, Gang; Deng, Dun; Chen, Rong-jun; Zhang, Yu-zhe; Li, Li-li; Wen, Qing-qi; Hou, Yong-qing; Feng, Ze-meng; Guo, Zhao-hui

    2015-06-01

    The energy homeostasis-associated (Enho) gene encodes a secreted protein, adropin, which regulates the expression of hepatic lipogenic genes and adipose tissue peroxisome proliferator-activated receptor γ, a major regulator of lipogenesis. In the present study, the porcine (Sus scrofa) homologue of the Enho gene, which was named pEnho, was amplified by reverse transcriptase polymerase chain reaction (RT-PCR) using oligonucleotide primers derived from in silico sequences. The gene sequence was submitted into the GenBank of NCBI, and the access number is GQ414763. The pEnho encodes a protein of 76 amino acids which shows 75% similarity to Homo sapiens adropin. The expression profile of pEnho in tissues (liver, muscle, anterior jejunum, posterior jejunum, and ileum) was determined by quantitative real-time RT-PCR. pEnho was localized on porcine chromosome 10 and no introns were found. In conclusion, pEnho was cloned and analysed with the aim of increasing knowledge about glucose and lipid metabolism in piglets and helping to promote the health and growth of piglets through adropin regulation.

  13. Molecular cloning, tissue expression and SNP analysis in the goat nerve growth factor gene.

    PubMed

    An, Xiaopeng; Bai, Long; Hou, Jinxing; Zhao, Haibo; Peng, Jiayin; Song, Yunxuan; Wang, Jiangang; Cao, Binyun

    2013-02-01

    In this study, we cloned the full coding region of NGF gene from the caprine ovary. Result showed the caprine NGF cDNA (GenBank Accession No. JQ308184) contained a 726 bp open reading frame encoding a protein with 241 amino acid residues. Bioinformatic analysis indicated that caprine NGF amino acid sequence was 83-99 % identical to that of mouse, pig, dog, human and bovine. It was predicted that caprine NGF contained nine serine phosphorylation loci, four threonine phosphorylation loci and nine specific PKC phosphorylation loci. The NGF mRNA expression pattern showed that NGF gene was expressed highly in ovary. This work provided an important experimental basis for further research on the function of NGF in goat. A single nucleotide polymorphism (A705G) in the coding region of NGF gene was detected by PCR-RFLP and DNA sequencing in 630 goats of three breeds. The frequencies of G allele were 0.52-0.61, and frequencies of A allele were 0.48-0.39 for SN, GZ and BG breeds, respectively. The does with GG genotype had higher litter size than those with GA and AA genotypes (P < 0.05). Hence, the biochemical and physiological functions, together with the results obtained in our investigation, suggest that the NGF gene could serve as a genetic marker for litter size in goat breeding.

  14. Molecular cloning of verrucosidin-producing Penicillium polonicum genes by differential screening to obtain a DNA probe.

    PubMed

    Aranda, E; Rodríguez, M; Benito, M J; Asensio, M A; Córdoba, J J

    2002-06-05

    A differential molecular screening procedure was developed to obtain DNA clones enriched for verrucosidin-related genes that could be used as DNA probes to detect verrucosidin-producing Penicillium polonicum. Permissive and nonpermissive conditions for verrucosidin production were selected to obtain differentiated poly (A)+ RNA for the cloning strategy. P. polonicum yielded the highest amount of verrucosidin when cultured in malt extract broth at 25 degrees C without shaking. These conditions were selected as verrucosidin permissive conditions. When shaking was applied to the verrucosidin permissive conditions, verrucosidin was not detected. Approximately 5000 transformants were obtained for the library of DNA fragments from verrucosidin-producing P. polonicum and hybridized with cDNA probes obtained from poly (A)+ RNA of permissive and nonpermissive conditions. A total of 120 clones hybridized only with the permissive cDNA probes. From these, eight representative DNA inserts selected on the basis of size and labelled with fluorescein-dUTP were assayed as DNA probes in the second differential screening by Northern hybridization. Probe SVr1 gave a strong hybridization signal selectively with poly (A)+ RNAs from high verrucosidin production. When this probe was assayed by dot blot hybridization with DNA of different moulds species, hybridization was detected only with DNA from the verrucosidin-producing strain. The strategy used in this work has proved to be useful to detect unknown genes related to mycotoxins. In addition, the DNA probe obtained should be considered for the detection of verrucosidin-producing moulds.

  15. Molecular cloning and expression analysis of a gene for sucrose transporter from pear (Pyrus bretschneideri Rehd.) fruit.

    PubMed

    Zhang, Huping; Zhang, Shujun; Qin, Gaihua; Wang, Lifen; Wu, Tao; Qi, Kaijie; Zhang, Shaoling

    2013-12-01

    Here we report the cloning of a sucrose transporter cDNA from pear (Pyrus bretschneideri Rehd. cv 'Yali') fruit and an analysis of the expression of the gene. A cDNA clone, designated PbSUT1 was identified as a sucrose transporter cDNA from its sequence homology at the amino acid level to sucrose transporters that have been cloned from other higher plant species. PbSUT1 potentially encoded a protein of 499 amino acid residues with a predicted molecular mass of 53.4 kDa and an isoelectric point (pI) of 9.21. Phylogenetic analysis revealed that the PbSUT1 belonged to type III SUTs and was more closely related to the MdSUT1 from apple fruit. Some major facilitator superfamily (MFS)-specific sequence motifs were found in the predicted PbSUT1 peptides, and an MFS_1 domain was located at the amino acid positions of 29-447 of the sequence. A study of gene expression along fruit development showed that PbSUT1 transcripts are present at all stages but significantly increase before fruit enlargement and during the ripening process with increasing sucrose levels. In contrast, the expression levels don't change much during the period of rapid fruit growth. This work shows that sucrose transporter may play a role in the accumulation of sugars during maturation and in maintaining the internal cellular distribution.

  16. Molecular cloning and expression of the IL-10 gene from guinea pigs.

    PubMed

    Dirisala, Vijaya R; Jeevan, Amminikutty; Bix, Gregory; Yoshimura, Teizo; McMurray, David N

    2012-04-25

    The Guinea pig (Cavia porcellus) is one of the most relevant small animals for modeling human tuberculosis (TB) in terms of susceptibility to low dose aerosol infection, the organization of granulomas, extrapulmonary dissemination and vaccine-induced protection. It is also considered to be a gold standard for a number of other infectious and non-infectious diseases; however, this animal model has a major disadvantage due to the lack of readily available immunological reagents. In the present study, we successfully cloned a cDNA for the critical Th2 cytokine, interleukin-10 (IL-10), from inbred Strain 2 guinea pigs using the DNA sequence information provided by the genome project. The complete open reading frame (ORF) consists of 537 base pairs which encodes a protein of 179 amino acids. This cDNA sequence exhibited 87% homology with human IL-10. Surprisingly, it showed only 84% homology with the previously published IL-10 sequence from the C4-deficient (C4D) guinea pig, leading us to clone IL-10 cDNA from the Hartley strain of guinea pig. The IL-10 gene from the Hartley strain showed 100% homology with the IL-10 sequence of Strain 2 guinea pigs. In order to validate the only published IL-10 sequence existing in Genbank reported from C4D guinea pigs, genomic DNA was isolated from tissues of C4D guinea pigs. Amplification with various sets of primers showed that the IL-10 sequence reported from C4D guinea pigs contained numerous errors. Hence the IL-10 sequence that is being reported by us replaces the earlier sequence making our IL-10 sequence to be the first one accurate from guinea pig. Recombinant guinea pig IL-10 proteins were subsequently expressed in both prokaryotic and eukaryotic cells, purified and were confirmed by N-terminal sequencing. Polyclonal anti-IL-10 antibodies were generated in rabbits using the recombinant IL-10 protein expressed in this study. Taken together, our results indicate that the DNA sequence information provided by the genome project

  17. Molecular cloning of the cytochrome aa3 gene from the archaeon (Archaebacterium) Halobacterium halobium.

    PubMed

    Denda, K; Fujiwara, T; Seki, M; Yoshida, M; Fukumori, Y; Yamanaka, T

    1991-11-27

    A novel aa3-type cytochrome oxidase from the extremely halophilic archaeon, Halobacterium halobium, differs significantly from those of other prokaryotic and eukaryotic cytochrome oxidases (Fujiwara, T., Fukumori, Y., and Yamanaka, T. (1989) J. Biochem. 105, 287-292). In the present study, we cloned and sequenced the gene which encodes the cytochrome aa3 by using the polymerase chain reaction methods. The deduced amino acid sequence of subunit I of H. halobium cytochrome aa3 was more similar to that of subunit I of the eukaryotic cytochrome (44%, maize mitochondria) than that of the cytochrome from other bacteria (36%, Paracoccus denitrificans). The consensus sequence in putative metal binding residues is well-conserved also in H. halobium cytochrome aa3.

  18. Molecular cloning, structure, and chromosomal localization of the human inducible nitric oxide synthase gene.

    PubMed

    Chartrain, N A; Geller, D A; Koty, P P; Sitrin, N F; Nussler, A K; Hoffman, E P; Billiar, T R; Hutchinson, N I; Mudgett, J S

    1994-03-04

    Nitric oxide, a multifunctional effector molecule synthesized by nitric oxide synthase (NOS) from L-arginine, conveys signals for vasorelaxation, neurotransmission, and cytotoxicity. Three different NOS isoforms have been identified which fall into two distinct types, constitutive and inducible. The inducible NOS (iNOS) isoform is expressed in a variety of cell types and tissues in response to inflammatory agents and cytokines. The human iNOS (NOS2) gene was isolated on overlapping cosmid clones from a human genomic library using both the murine macrophage and the human hepatocyte iNOS cDNAs as probes. All isolated cosmids were part of a single genomic locus and no other genomic loci were identified or isolated. Analysis of this locus indicated that the human iNOS gene is approximately 37 kilobases in length and consists of 26 exons and 25 introns. Primer extension analysis of lipopolysaccharide and cytokine-stimulated human hepatocyte RNA mapped the transcriptional initiation site 30 base pairs downstream of a TATA sequence, and a 400-base pair 5'-flanking region was found to be structurally similar to the recently described murine iNOS promoter. Polymerase chain reaction analysis of a human/rodent genomic DNA somatic cell hybrid panel and fluorescent in situ hybridization indicated that the human iNOS gene is located on chromosome 17 at position 17cen-q11.2.

  19. Molecular cloning of doublesex genes of four cladocera (water flea) species

    PubMed Central

    2013-01-01

    Background The gene doublesex (dsx) is known as a key factor regulating genetic sex determination in many organisms. We previously identified two dsx genes (DapmaDsx1 and DapmaDsx2) from a freshwater branchiopod crustacean, Daphnia magna, which are expressed in males but not in females. D. magna produces males by parthenogenesis in response to environmental cues (environmental sex determination) and we showed that DapmaDsx1 expression during embryonic stages is responsible for the male trait development. The D. magna dsx genes are thought to have arisen by a cladoceran-specific duplication; therefore, to investigate evolutionary conservation of sex specific expression of dsx genes and to further assess their functions in the environmental sex determination, we searched for dsx homologs in four closely related cladoceran species. Results We identified homologs of both dsx genes from, D. pulex, D. galeata, and Ceriodaphnia dubia, yet only a single dsx gene was found from Moina macrocopa. The deduced amino acid sequences of all 9 dsx homologs contained the DM and oligomerization domains, which are characteristic for all arthropod DSX family members. Molecular phylogenetic analysis suggested that the dsx gene duplication likely occurred prior to the divergence of these cladoceran species, because that of the giant tiger prawn Penaeus monodon is rooted ancestrally to both DSX1 and DSX2 of cladocerans. Therefore, this result also suggested that M. macrocopa lost dsx2 gene secondarily. Furthermore, all dsx genes identified in this study showed male-biased expression levels, yet only half of the putative 5’ upstream regulatory elements are preserved in D. magna and D. pulex. Conclusions The all dsx genes of five cladoceran species examined had similar amino acid structure containing highly conserved DM and oligomerization domains, and exhibited sexually dimorphic expression patterns, suggesting that these genes may have similar functions for environmental sex

  20. Molecular cloning and characterization of wheat calreticulin (CRT) gene involved in drought-stressed responses.

    PubMed

    Jia, Xiao-Yun; Xu, Chong-Yi; Jing, Rui-Lian; Li, Run-Zhi; Mao, Xin-Guo; Wang, Ji-Ping; Chang, Xiao-Ping

    2008-01-01

    Calreticulin (CRT) is a highly conserved and ubiquitously expressed Ca(2+)-binding protein in multicellular eukaryotes. CRT plays a crucial role in many cellular processes including Ca(2+) storage and release, protein synthesis, and molecular chaperone activity. To elucidate the function of CRTs in plant responses against drought, a main abiotic stress limiting cereal crop production worldwide, a full-length cDNA encoding calreticulin protein namely TaCRT was isolated from wheat (Triticum aestivum L.). The deduced amino acid sequence of TaCRT shares high homology with other plant CRTs. Phylogenetic analysis indicates that TaCRT cDNA clone encodes a wheat CRT3 isoform. Southern analysis suggests that the wheat genome contains three copies of TaCRT. Subcellular locations of TaCRT were the cytoplasm and nucleus, evidenced by transient expression of GFP fused with TaCRT in onion epidermal cells. Enhanced accumulation of TaCRT transcript was observed in wheat seedlings in response to PEG-induced drought stress. To investigate further whether TaCRT is involved in the drought-stress response, transgenic plants were constructed. Compared to the wild-type and GFP-expressing plants, TaCRT-overexpressing tobacco (Nicotiana benthamiana) plants grew better and exhibited less wilt under the drought stress. Moreover, TaCRT-overexpressing plants exhibited enhanced drought resistance to water deficit, as shown by their capacity to maintain higher WUE (water use efficiency), WRA (water retention ability), RWC (relative water content), and lower MDR (membrane damaging ratio) (P < or = 0.01) under water-stress conditions. In conclusion, a cDNA clone encoding wheat CRT was successfully isolated and the results suggest that TaCRT is involved in the plant response to drought stress, indicating a potential in the transgenic improvements of plant water-stress.

  1. Molecular cloning, identification, and chromosomal localization of two MADS box genes in peach (Prunus persica).

    PubMed

    Zhang, Lin; Xu, Yong; Ma, Rongcai

    2008-06-01

    MADS box proteins play an important role in floral development. To find genes involved in the floral transition of Prunus species, cDNAs for two MADS box genes, PpMADS1 and PpMADS10, were cloned using degenerate primers and 5'- and 3'-RACE based on the sequence database of P. persica and P. dulcis. The full length of PpMADS1 cDNA is 1,071 bp containing an open reading frame (ORF) of 717 bp and coding for a polypeptide of 238 amino acid residues. The full length of PpMADS10 cDNA is 937 bp containing an ORF of 633 bp and coding for a polypeptide of 210 amino acid residues. Sequence comparison revealed that PpMADS1 and PpMADS10 were highly homologous to genes AP1 and PI in Arabidopsis, respectively. Phylogenetic analysis indicated that PpMADS1 belongs to the euAP1 clade of class A, and PpMADS10 is a member of GLO/PI clade of class B. RT-PCR analysis showed that PpMADS1 was expressed in sepal, petal, carpel, and fruit, which was slightly different from the expression pattern of AP1; PpMADS10 was expressed in petal and stamen, which shared the same expression pattern as PI. Using selective mapping strategy, PpMADS1 was assigned onto the Bin1:50 on the G1 linkage group between the markers MCO44 and TSA2, and PpMADS10 onto the Bin1:73 on the same linkage group between the markers Lap-1 and FGA8. Our results provided the basis for further dissection of the two MADS box gene function.

  2. Molecular cloning, encoding sequence, and expression of vaccinia virus nucleic acid-dependent nucleoside triphosphatase gene.

    PubMed Central

    Rodriguez, J F; Kahn, J S; Esteban, M

    1986-01-01

    A rabbit poxvirus genomic library contained within the expression vector lambda gt11 was screened with polyclonal antiserum prepared against vaccinia virus nucleic acid-dependent nucleoside triphosphatase (NTPase)-I enzyme. Five positive phage clones containing from 0.72- to 2.5-kilobase-pair (kbp) inserts expressed a beta-galactosidase fusion protein that was reactive by immunoblotting with the NTPase-I antibody. Hybridization analysis allowed the location of this gene within the vaccinia HindIIID restriction fragment. From the known nucleotide sequence of the 16-kbp vaccinia HindIIID fragment, we identified a region that contains a 1896-base open reading frame coding for a 631-amino acid protein. Analysis of the complete sequence revealed a highly basic protein, with hydrophilic COOH and NH2 termini, various hydrophobic domains, and no significant homology to other known proteins. Translational studies demonstrate that NTPase-I belongs to a late class of viral genes. This protein is highly conserved among Orthopoxviruses. Images PMID:3025846

  3. Molecular cloning and functional characterization of a Δ6-fatty acid desaturase gene from Rhizopus oryzae.

    PubMed

    Zhu, Yu; Zhang, Bi-Bo

    2013-09-01

    The objective was to screen for and isolate a novel enzyme with the specific activity of a Δ6-fatty acid desaturase from Rhizopus oryzae. In this study, R. oryzae was identified as a novel fungal species that produces large amounts of γ-linolenic acid. A full-length cDNA, designated here as RoD6D, with high homology to fungal Δ6-fatty acid desaturase genes was isolated from R. oryzae by using the rapid amplification of cDNA ends method. It had an open reading frame of 1176 bp encoding a deduced polypeptide of 391 amino acids. Bioinformatics analysis characterized the putative RoD6D protein as a typical membrane-bound desaturase, including three conserved histidine-rich motifs, a hydropathy profile, and a cytochrome b5 -like domain in the N terminus. When the coding sequence was expressed in the Saccharomyces cerevisiae strain INVScl, the encoded product of RoD6D exhibited Δ6-fatty acid desaturase activity that led to the accumulation of γ-linolenic acid. The corresponding genomic sequence of RoD6D was 1565 bp in length, with five introns. This is the first report on the characterization and gene cloning of a Δ6-fatty acid desaturase of R. oryzae from Douchi.

  4. Gene cloning and molecular characterization of the Talaromyces thermophilus lipase catalyzed efficient hydrolysis and synthesis of esters.

    PubMed

    Romdhane, Ines Belhaj-Ben; Frikha, Fakher; Maalej-Achouri, Inès; Gargouri, Ali; Belghith, Hafedh

    2012-02-15

    A genomic bank from Talaromyces thermophilus fungus was constructed and screened using a previously isolated fragment lipase gene as probe. From several clones isolated, the nucleotide sequence of the lipase gene (TTL gene) was completed and sequenced. The TTL coding gene consists of an open reading frame (ORF) of 1083bp encoding a protein of 269 Aa with an estimated molecular mass of 30kDa. The TTL belongs to the same gene family as Thermomyces lanuginosus lipase (TLL, Lipolase®), a well known lipase with multiple applications. The promoter sequence of the TTL gene showed the conservation of known consensus sequences PacC, CreA, Hap2-3-4 and the existence of a particular sequence like the binding sites of Oleate Response Element (ORE) and Fatty acids Responsis Element (FARE) which are similar to that already found to be specific of lipolytic genes in Candida and Fusarium, respectively. Northern blot analysis showed that the TTL expression was much higher on wheat bran than on olive oil as sole carbon source. Compared to the Lipolase®, this enzyme was found to be more efficient for the hydrolysis and the synthesis of esters; and its synthetic efficiency even reached 91.6% from Waste Cooking Oil triglycerides.

  5. Molecular cloning and characterization of alpha - galactosidase gene from Glaciozyma antarctica

    NASA Astrophysics Data System (ADS)

    Moheer, Reyad Qaed Al; Bakar, Farah Diba Abu; Murad, Abdul Munir Abdul

    2015-09-01

    Psychrophilic enzymes are proteins produced by psychrophilic organisms which recently are the limelight for industrial applications. A gene encoding α-galactosidase from a psychrophilic yeast, Glaciozyma antarctica PI12 which belongs to glycoside hydrolase family 27, was isolated and analyzed using several bioinformatic tools. The cDNA of the gene with the size of 1,404-bp encodes a protein with 467 amino acid residues. Predicted molecular weight of protein was 48.59 kDa and hence we name the gene encoding α-galactosidase as GAL48. We found that the predicted protein sequences possessed signal peptide sequence and are highly conserved among other fungal α-galactosidase.

  6. Cloning, Characterization, and Molecular Application of a Beta-Agarase Gene from Vibrio sp. Strain V134▿

    PubMed Central

    Zhang, Wei-wei; Sun, Li

    2007-01-01

    V134, a marine isolate of the Vibrio genus, was found to produce a new beta-agarase of the GH16 family. The relevant agarase gene agaV was cloned from V134 and conditionally expressed in Escherichia coli. Enzyme activity analysis revealed that the optimum temperature and pH for the purified recombinant agarase were around 40°C and 7.0. AgaV was demonstrated to be useful in two aspects: first, as an agarolytic enzyme, the purified recombinant AgaV could be employed in the recovery of DNA from agarose gels; second, as a secretion protein, AgaV was explored at the genetic level and used as a reporter in the construction of a secretion signal trap which proved to be a simple and efficient molecular tool for the selection of genes encoding secretion proteins from both gram-positive and gram-negative bacteria. PMID:17337564

  7. Molecular cloning and expression analysis of an arginine decarboxylase gene from peach (Prunus persica).

    PubMed

    Liu, Ji Hong; Ban, Yusuke; Wen, Xiao-Peng; Nakajima, Ikuko; Moriguchi, Takaya

    2009-01-15

    Arginine decarboxylase (ADC), one of the enzymes responsible for putrescine (Put) biosynthesis, has been shown to be implicated in stress response. In the current paper attempts were made to clone and characterize a gene encoding ADC from peach (Prunus persica (L.) Batsch, 'Akatsuki'). Rapid amplification of cDNA ends (RACE) gave rise to a full-length ADC cDNA (PpADC) with a complete open reading frame of 2178 bp, encoding a 725 amino acid polypeptide. Homology search and sequence multi-alignment demonstrated that the deduced PpADC protein sequence shared a high identity with ADCs from other plants, including several highly conservative motifs and amino acids. Southern blotting indicated that PpADC existed in peach genome as a single gene. Expression levels of PpADC in different tissues of peach (P. persica 'Akatsuki') were spatially and developmentally regulated. Treatment of peach shoots from 'Mochizuki' with exogenous 5 mM Put, an indirect product of ADC, remarkably induced accumulation of PpADC mRNA. Transcripts of PpADC in peach leaves from 'Mochizuki' were quickly induced, either transiently or continuously, in response to dehydration, high salinity (200 mM NaCl), low temperature (4 degrees C) and heavy metal (150 microM CdCl(2)), but repressed by high temperature 37 degrees C) during a 2-day treatment, which changed in an opposite direction when the stresses were otherwise removed with the exception of CdCl(2) treatment. In addition, steady-state of PpADC mRNA could be also transiently up-regulated by abscisic acid (ABA) in 'Mochizuki' leaves. All of these, taken together, suggest that PpADC is a stress-responsive gene and can be considered as a potential target that is genetically manipulated so as to create novel germplasms with enhanced stress tolerance in the future.

  8. Molecular cloning and characterization of acrA and acrE genes of Escherichia coli.

    PubMed Central

    Ma, D; Cook, D N; Alberti, M; Pon, N G; Nikaido, H; Hearst, J E

    1993-01-01

    The DNA fragment containing the acrA locus of the Escherichia coli chromosome has been cloned by using a complementation test. The nucleotide sequence indicates the presence of two open reading frames (ORFs). Sequence analysis suggests that the first ORF encodes a 397-residue lipoprotein with a 24-amino-acid signal peptide at its N terminus. One inactive allele of acrA from strain N43 was shown to contain an IS2 element inserted into this ORF. Therefore, this ORF was designated acrA. The second downstream ORF is predicted to encode a transmembrane protein of 1,049 amino acids and is named acrE. Genes acrA and acrE are probably located on the same operon, and both of their products are likely to affect drug susceptibilities observed in wild-type cells. The cellular localizations of these polypeptides have been analyzed by making acrA::TnphoA and acrE::TnphoA fusion proteins. Interestingly, AcrA and AcrE share 65 and 77% amino acid identity with two other E. coli polypeptides, EnvC and EnvD, respectively. Drug susceptibilities in one acrA mutant (N43) and one envCD mutant (PM61) have been determined and compared. Finally, the possible functions of these proteins are discussed. Images PMID:8407802

  9. [Molecular cloning and characterization of a N-acetylneuraminate lyase gene from Staphylococcus hominis].

    PubMed

    Zhou, Chuanhua; Chen, Xi; Feng, Jinhui; Xiao, Dongguang; Wuz, Qiaqing; Zhu, Dunming

    2013-04-01

    A N-acetylneuraminate lyase gene (shnal) from Staphylococcus hominis was cloned into pET-28a and expressed in Escherichia coli BL21 (DE3) host cells. The recombinant enzyme was purified and characterized. It is a homotetrameric enzyme with the optimum pH at 8.0 for the cleavage direction and the optimum pH and temperature were 7.5 and 45 degrees C for the synthetic direction. The activity of ShNAL is stable when incubated at 45 degrees C for 2 h but decreased rapidly over 50 degrees C. ShNAL showed high stability in a wide range pH from 5.0 to 10.0 with the residual activity being > 70% when the enzyme was incubated in different buffers at 4 degrees C for 24 h. Its K(m) towards N-acetylneuraminic acid, pyruvate and ManNAc were (4.0 +/- 0.2) mmol/L, (35.1 +/- 3.2) mmol/L and (131.7 +/- 12.1) mmol/L, respectively. The k(cat)/K(m) value of Neu5Ac, ManNAc, and Pyr for ShNAL were 1.9 L/(mmol x s), 0.08 L/(mmol x s) and 0.08 L/(mmol x s), respectively.

  10. Molecular cloning and characterization of the light-harvesting chlorophyll a/b gene from the pigeon pea (Cajanus cajan).

    PubMed

    Qiao, Guang; Wen, Xiao-Peng; Zhang, Ting

    2015-12-01

    Light-harvesting chlorophyll a/b-binding proteins (LHCB) have been implicated in the stress response. In this study, a gene encoding LHCB in the pigeon pea was cloned and characterized. Based on the sequence of a previously obtained 327 bp Est, a full-length 793 bp cDNA was cloned using the rapid amplification of cDNA ends (RACE) method. It was designated CcLHCB1 and encoded a 262 amino acid protein. The calculated molecular weight of the CcLHCB1 protein was 27.89 kDa, and the theoretical isoelectric point was 5.29. Homology search and sequence multi-alignment demonstrated that the CcLHCB1 protein sequence shared a high identity with LHCB from other plants. Bioinformatics analysis revealed that CcLHCB1 was a hydrophobic protein with three transmembrane domains. By fluorescent quantitative real-time polymerase chain reaction (PCR), CcLHCB1 mRNA transcripts were detectable in different tissues (leaf, stem, and root), with the highest level found in the leaf. The expression of CcLHCB1 mRNA in the leaves was up-regulated by drought stimulation and AM inoculation. Our results provide the basis for a better understanding of the molecular organization of LCHB and might be useful for understanding the interaction between plants and microbes in the future.

  11. Immersing Undergraduate Students in the Research Experience: A Practical Laboratory Module on Molecular Cloning of Microbial Genes

    ERIC Educational Resources Information Center

    Wang, Jack T. H.; Schembri, Mark A.; Ramakrishna, Mathitha; Sagulenko, Evgeny; Fuerst, John A.

    2012-01-01

    Molecular cloning skills are an essential component of biological research, yet students often do not receive this training during their undergraduate studies. This can be attributed to the complexities of the cloning process, which may require many weeks of progressive design and experimentation. To address this issue, we incorporated an…

  12. Molecular cloning of the human eosinophil-derived neurotoxin: a member of the ribonuclease gene family.

    PubMed Central

    Rosenberg, H F; Tenen, D G; Ackerman, S J

    1989-01-01

    We have isolated a 725-base-pair cDNA clone for human eosinophil-derived neurotoxin (EDN). EDN is a distinct cationic protein of the eosinophil's large specific granule known primarily for its ability to induce ataxia, paralysis, and central nervous system cellular degeneration in experimental animals (Gordon phenomenon). The open reading frame encodes a 134-amino acid mature polypeptide with a molecular mass of 15.5 kDa and a 27-residue amino-terminal hydrophobic leader sequence. The sequence of the mature polypeptide is identical to that reported for human urinary ribonuclease [Beintema, J. J., Hofsteenge, J., Iwama, M., Morita, T., Ohgi, K., Irie, M., Sugiyama, R. H., Schieven, G. L., Dekker, C. A. & Glitz, D. G. (1988) Biochemistry 27, 4530-4538] and to the amino-terminal sequence of human liver ribonuclease [Sorrentino, S., Tucker, G. K. & Glitz, D. G. (1988) J. Biol. Chem. 263, 16125-16131]; the cDNA encodes a tryptophan in position 7, which was previously unidentified in the amino acid sequences of EDN or the urinary and liver ribonucleases. Both EDN and the related granule protein, eosinophil cationic protein, have ribonucleolytic activity; sequence similarities among EDN, eosinophil cationic protein, ribonucleases from liver, urine, and pancreas, and angiogenin define a ribonuclease multigene family. mRNA encoding EDN was detected in uninduced HL-60 cells and was up-regulated in cells induced toward eosinophilic differentiation with B-cell growth factor 2/interleukin 5 and toward neutrophilic differentiation with dimethyl sulfoxide. EDN mRNA was detected in mature neutrophils even though EDN-like neurotoxic activity is not found in neutrophil extracts. These results suggest that neutrophils contain a protein that is closely related or identical to EDN. Images PMID:2734298

  13. Molecular cloning, characterization and expression profiles of thioredoxin 1 and thioredoxin 2 genes in Mytilus galloprovincialis

    NASA Astrophysics Data System (ADS)

    Wang, Qing; Ning, Xuanxuan; Pei, Dong; Zhao, Jianmin; You, Liping; Wang, Chunyan; Wu, Huifeng

    2013-05-01

    Thioredoxin (Trx) proteins are involved in many biological processes especially the regulation of cellular redox homeostasis. In this study, two Trx cDNAs were cloned from the mussel Mytilus galloprovincialis using rapid amplifi cation of cDNA ends-polymerase chain reaction (RACE-PCR). The two cDNAs were named MgTrx1 and MgTrx2, respectively. The open reading frames of MgTrx1 and MgTrx2 were 318 and 507 base pairs (bp) and they encoded proteins of 105 and 168 amino acids with estimated molecular masses of 11.45 and 18.93 kDa, respectively. Sequence analysis revealed that both proteins possessed the conserved active site dithiol motif Cys-Gly-Pro-Cys. In addition, MgTrx2 also possessed a putative mitochondrial targeting signal suggesting that it is located in the mitochondria. Quantitative real-time polymerase chain reaction (qPCR) revealed that both MgTrx1 and MgTrx2 were constitutively expressed in all tissues examined. The MgTrx1 transcript was most abundant in hemocytes and gills, whereas the MgTrx2 transcript was most abundant in gonad, hepatopancreas, gill and hemocytes. Following Vibrio anguillarum challenge, the expression of MgTrx1 was up-regulated and reached its peak, at a value 10-fold the initial value, at 24 h. Subsequently, expression returned back to the original level. In contrast, the expression level of MgTrx2 was down-regulated following bacterial stimulation, with one fi fth of the control level evident at 12 h post challenge. These results suggest that MgTrx1 and MgTrx2 may play important roles in the response of M. galloprovincialis to bacterial challenge.

  14. Agouti signalling protein (ASIP) gene: molecular cloning, sequence characterisation and tissue distribution in domestic goose.

    PubMed

    Zhang, J; Wang, C; Liu, Y; Liu, J; Wang, H Y; Liu, A F; He, D Q

    2016-06-01

    Agouti signalling protein (ASIP) is an endogenous antagonist of melanocortin-1 receptor (MC1R) and is involved in the regulation of pigmentation in mammals. The objective of this study was to identify and characterise the ASIP gene in domestic goose. The goose ASIP cDNA consisted of a 44-nucleotide 5'-terminal untranslated region (UTR), a 390-nucleotide open-reading frame (ORF) and a 45-nucleotide 3'-UTR. The length of goose ASIP genomic DNA was 6176 bp, including three coding exons and two introns. Bioinformatic analysis indicated that the ORF encodes a protein of 130 amino-acid residues with a molecular weight of 14.88 kDa and an isoelectric point of 9.73. Multiple sequence alignments and phylogenetic analysis showed that the amino-acid sequence of ASIP was conserved in vertebrates, especially in the avian species. RT-qPCR showed that the goose ASIP mRNA was differentially expressed in the pigment deposition tissues, including eye, foot, feather follicle, skin of the back, as well as in skin of the abdomen. The expression level of the ASIP gene in skin of the abdomen was higher than that in skin of the back. Those findings will contribute to further understanding the functions of the ASIP gene in geese plumage colouring.

  15. Molecular Cloning and Co-Expression of Phytoene Synthase Gene from Kocuria gwangalliensis in Escherichia coli.

    PubMed

    Seo, Yong Bae; Choi, Seong-Seok; Lee, Jong Kyu; Kim, Nan-Hee; Choi, Mi Jin; Kim, Jong-Myoung; Jeong, Tae Hyug; Nam, Soo-Wan; Lim, Han Kyu; Kim, Gun-Do

    2015-11-01

    A phytoene synthase gene, crtB, was isolated from Kocuria gwangalliensis. The crtB with 1,092 bp full-length has a coding sequence of 948 bp and encodes a 316-amino-acids protein. The deduced amino acid sequence showed a 70.9% identity with a putative phytoene synthase from K. rhizophila. An expression plasmid, pCcrtB, containing the crtB gene was constructed, and E. coli cells containing this plasmid produced the recombinant protein of approximately 34 kDa , corresponding to the molecular mass of phytoene synthase. Biosynthesis of lycopene was confirmed when the plasmid pCcrtB was co-transformed into E. coli containing pRScrtEI carrying the crtE and crtI genes encoding lycopene biosynthetic pathway enzymes. The results obtained from this study will provide a base of knowledge about the phytoene synthase of K. gwangalliensis and can be applied to the production of carotenoids in a non-carotenoidproducing host.

  16. Molecular cloning and sequence analysis of prion protein gene in Xiji donkey in China.

    PubMed

    Zhang, Zhuming; Wang, Renli; Xu, Lihua; Yuan, Fangzhong; Zhou, Xiangmei; Yang, Lifeng; Yin, Xiaomin; Xu, Binrui; Zhao, Deming

    2013-10-25

    Prion diseases are a group of human and animal neurodegenerative disorders caused by the deposition of an abnormal isoform prion protein (PrP(Sc)) encoded by a single copy prion protein gene (PRNP). Prion disease has been reported in many herbivores but not in Equus and the species barrier might be playing a role in resistance of these species to the disease. Therefore, analysis of genotype of prion protein (PrP) in these species may help understand the transmission of the disease. Xiji donkey is a rare species of Equus not widely reared in Ningxia, China, for service, food and medicine, but its PRNP has not been studied. Based on the reported PrP sequence in GenBank we designed primers and amplified, cloned and sequenced the PRNP of Xiji donkey. The sequence analysis showed that the Xiji donkey PRNP was consisted of an open reading frame of 768 nucleotides encoding 256 amino acids. Amino acid residues unique to donkey as compared with some Equus animals, mink, cow, sheep, human, dog, sika deer, rabbit and hamster were identified. The results showed that the amino acid sequence of Xiji donkey PrP starts with the consensus sequence MVKSH, with almost identical amino acid sequence to the PrP of other Equus species in this study. Amino acid sequence analysis showed high identity within species and close relation to the PRNP of sika deer, sheep, dog, camel, cow, mink, rabbit and hamster with 83.1-99.7% identity. The results provided the PRNP data for an additional Equus species, which should be useful to the study of the prion disease pathogenesis, resistance and cross species transmission.

  17. Molecular cloning and characterization of SoxB2 gene from Zhikong scallop Chlamys farreri

    NASA Astrophysics Data System (ADS)

    He, Yan; Bao, Zhenmin; Guo, Huihui; Zhang, Yueyue; Zhang, Lingling; Wang, Shi; Hu, Jingjie; Hu, Xiaoli

    2013-11-01

    The Sox proteins play critical roles during the development of animals, including sex determination and central nervous system development. In this study, the SoxB2 gene was cloned from a mollusk, the Zhikong scallop ( Chlamys farreri), and characterized with respect to phylogeny and tissue distribution. The full-length cDNA and genomic DNA sequences of C. farreri SoxB2 ( Cf SoxB2) were obtained by rapid amplification of cDNA ends and genome walking, respectively, using a partial cDNA fragment from the highly conserved DNA-binding domain, i.e., the High Mobility Group (HMG) box. The full-length cDNA sequence of Cf SoxB2 was 2 048 bp and encoded 268 amino acids protein. The genomic sequence was 5 551 bp in length with only one exon. Several conserved elements, such as the TATA-box, GC-box, CAAT-box, GATA-box, and Sox/sry-sex/testis-determining and related HMG box factors, were found in the promoter region. Furthermore, real-time quantitative reverse transcription PCR assays were carried out to assess the mRNA expression of Cf SoxB 2 in different tissues. SoxB2 was highly expressed in the mantle, moderately in the digestive gland and gill, and weakly expressed in the gonad, kidney and adductor muscle. In male and female gonads at different developmental stages of reproduction, the expression levels of Cf SoxB2 were similar. Considering the specific expression and roles of SoxB 2 in other animals, in particular vertebrates, and the fact that there are many pallial nerves in the mantle, cerebral ganglia in the digestive gland and gill nerves in gill, we propose a possible essential role in nervous tissue function for Sox B 2 in C. farreri.

  18. Molecular cloning and characterization of a glycine-like receptor gene from the cattle tick Rhipicephalus (Boophilus) microplus (Acari: Ixodidae).

    PubMed

    Flores-Fernández, José Miguel; Gutiérrez-Ortega, Abel; Padilla-Camberos, Eduardo; Rosario-Cruz, Rodrigo; Hernández-Gutiérrez, Rodolfo; Martínez-Velázquez, Moisés

    2014-01-01

    The cattle tick Rhipicephalus (Boophilus) microplus is the most economically important ectoparasite affecting the cattle industry in tropical and subtropical areas around the world. The principal method of tick control has relied mainly on the use of chemical acaricides, including ivermectin; however, cattle tick populations resistant to ivermectin have recently been reported in Brazil, Mexico, and Uruguay. Currently, the molecular basis for ivermectin susceptibility and resistance are not well understood in R. microplus. This prompted us to search for potential molecular targets for ivermectin. Here, we report the cloning and molecular characterization of a R. microplus glycine-like receptor (RmGlyR) gene. The characterized mRNA encodes for a 464-amino acid polypeptide, which contains features common to ligand-gated ion channels, such as a large N-terminal extracellular domain, four transmembrane domains, a large intracellular loop and a short C-terminal extracellular domain. The deduced amino acid sequence showed around 30% identity to GlyRs from some invertebrate and vertebrate organisms. The polypeptide also contains the PAR motif, which is important for forming anion channels, and a conserved glycine residue at the third transmembrane domain, which is essential for high ivermectin sensitivity. PCR analyses showed that RmGlyR is expressed at egg, larval and adult developmental stages. Our findings suggest that the deduced receptor is an additional molecular target to ivermectin and it might be involved in ivermectin resistance in R. microplus.

  19. Cloning and molecular characterization of three novel LMW-i glutenin subunit genes from cultivated einkorn (Triticum monococcum L.).

    PubMed

    An, X; Zhang, Q; Yan, Y; Li, Q; Zhang, Y; Wang, A; Pei, Y; Tian, J; Wang, H; Hsam, S L K; Zeller, F J

    2006-08-01

    Three novel low molecular weight (LMW) glutenin subunits from cultivated einkorn (Triticum monococcum L., A(m)A(m), 2n = 2x = 14) were characterized by SDS-PAGE and molecular weights determined by MALDI-TOF-MS. Their coding genes were amplified and cloned with designed AS-PCR primers, revealing three complete gene sequences. All comprised upstream, open reading frame (ORF), downstream and no introns were present. The deduced amino acid sequences showed that all three genes, named as LMW-M1, LMW-M3 and LMW-M5, respectively, belonged to the LMW-i type subunits with the predicted molecular weight between 38.5206 and 38.7028 kDa. They showed high similarity with other LMW-i type genes from hexaploid bread wheats, but also displayed unique features. Particularly, LMW-M5 subunit contained an extra cysteine residue in the C-terminus except for eight conserved cysteines, which resulted from a single-nucleotide polymorphism (SNP) of the T-C transition, namely arginine --> cysteine substitution at position 242 from the N-terminal end. This is the first report that the LMW-i subunit contained nine cysteines residues that could result in a more highly cross-linked and more elastic glutenin suggesting that LMW-M5 gene may associates with good quality properties. In addition, a total of 25 SNPs and one insertions/deletions (InDels) were detected among three LMW-i genes, which could result in significant functional changes in polymer formation of gluten. It is anticipated that these SNPs could be used as reliable genetic markers during wheat quality improvement. The phylogenetic analysis indicated that LMW-i type genes apparently differed from LMW-m and LMW-s type genes and diverged early from the primitive LMW-GS gene family, at about 12.92 million years ago (MYA) while the differentiation of A(m) and A genomes was estimated at 3.98 MYA.

  20. Molecular cloning, expression analyses and primary evolution studies of REV- and TB1-like genes in bamboo.

    PubMed

    Peng, Hua-Zheng; Lin, Er-Pei; Sang, Qing-Liang; Yao, Sheng; Jin, Qun-Ying; Hua, Xi-Qi; Zhu, Mu-Yuan

    2007-09-01

    Most cultured bamboos are perennial woody evergreens that reproduce from rhizomes. It is unclear why some rhizome buds develop into aerial bamboo shoots instead of new rhizomes. REVOLUTA (REV)-like Class III homeodomain leucine-zipper (HD-Zip) proteins and TEOSINTE BRANCHED1 (TB1)-like transcription factors have been shown to play regulatory roles in meristem initiation and outgrowth. We cloned and analyzed the bamboo (Phyllostachys praecox C.D. Chu & C.S. Chao.) REV- (PpHB1) and TB1-like (PpTB1) gene. Gene expression was mainly detected by in situ hybridization. PpHB1 expression was detected in the tips of lateral buds, on the adaxial portion of the leaf and within the developing procambium, indicating its close correlation to rhizome bud formation and procambial development. PpTB1 expression was mainly detected on the top of buds at later developmental stages, suggesting it was more likely involved in bud outgrowth. Meristem genes might therefore serve as specific molecular markers of rhizome bud development and could be useful in studies designed to elucidate the mechanisms underlying bamboo shoot development. In addition, meristem genes such as TB1-like sequences may be useful in phylogenetic analyses of bamboo species.

  1. Molecular cloning and characterization of annexin genes in peanut (Arachis hypogaea L.).

    PubMed

    He, MeiJing; Yang, XinLei; Cui, ShunLi; Mu, GuoJun; Hou, MingYu; Chen, HuanYing; Liu, LiFeng

    2015-08-15

    Annexin, Ca(2+) or phospholipid binding proteins, with many family members are distributed throughout all tissues during plant growth and development. Annexins participate in a number of physiological processes, such as exocytosis, cell elongation, nodule formation in legumes, maturation and stress response. Six different full-length cDNAs and two partial-length cDNAs of peanut, (AnnAh1, AnnAh2, AnnAh3, AnnAh5, AnnAh6, AnnAh7, AnnAh4 and AnnAh8) encoding annexin proteins, were isolated and characterized using a RT-PCR/RACE-PCR based strategy. The predicted molecular masses of these annexins were 36.0kDa with acidic pIs of 5.97-8.81. ANNAh1, ANNAh2, ANNAh3, ANNAh5, ANNAh6 and ANNAh7 shared sequence similarity from 35.76 to 66.35% at amino acid level. Phylogenetic analysis revealed their evolutionary relationships with corresponding orthologous sequences in soybean and deduced proteins in various plant species. Real-time quantitative assays indicated that these genes were differentially expressed in various organs. Transcript level analysis for six annexin genes under stress conditions showed that these genes were regulated by drought, salinity, heavy metal stress, low temperature and hormone. Additionally, the prediction of cis-regulatory element suggested that different cis-responsive elements including stress- and hormone-responsive-related elements could respond to various stress conditions. These results indicated that members of AnnAhs family may play important roles in the adaptation of peanut to various environmental stresses.

  2. Molecular cloning of eucaryotic genes required for excision repair of UV-irradiated DNA: isolation and partial characterization of the RAD3 gene of Saccharomyces cerevisiae.

    PubMed Central

    Naumovski, L; Friedberg, E C

    1982-01-01

    We describe the molecular cloning of a 6-kilobase (kb) fragment of yeast chromosomal DNA containing the RAD3 gene of Saccharomyces cerevisiae. When present in the autonomously replicating yeast cloning vector YEp24, this fragment transformed two different UV-sensitive, excision repair-defective rad3 mutants of S. cerevisiae to UV resistance. The same result was obtained with a variety of other plasmids containing a 4.5-kb subclone of the 6-kb fragment. The UV sensitivity of mutants defective in the RAD1, RAD2, RAD4, and RAD14 loci was not affected by transformation with these plasmids. The 4.5-kb fragment was subcloned into the integrating yeast vector YIp5, and the resultant plasmid was used to transform the rad3-1 mutant to UV resistance. Both genetic and physical studies showed that this plasmid integrated by homologous recombination into the rad3 site uniquely. We conclude from these studies that the cloned DNA that transforms the rad3-1 mutant to UV resistance contains the yeast chromosomal RAD3 gene. The 4.5-kb fragment was mapped by restriction analysis, and studies on some of the subclones generated from this fragment indicate that the RAD3 gene is at least 1.5 kb in size. Images PMID:6749808

  3. Molecular cloning and characterization of four novel LMW glutenin subunit genes from Aegilops longissima, Triticum dicoccoides and T. zhukovskyi.

    PubMed

    Jiang, Chengxi; Pei, Yuhe; Zhang, Yanzhen; Li, Xiaohui; Yao, Danian; Yan, Yueming; Ma, Wujun; Hsam, S L K; Zeller, F J

    2008-04-01

    This paper reports cloning and characterisation of four novel low-molecular-weight glutenin subunit (LMW-GS) genes (designated as TzLMW-m2, TzLMW-m1, TdLMW-m1 and AlLMW-m2) from the genomic DNA of Triticum dicoccoides, T. zhukovskyi and Aegilops longissima. The coding regions of TzLMW-m2, TzLMW-m1, TdLMW-m1 and AlLMW-m2 were 1056 bp, 903 bp, 1056 bp and 1050 bp in length, encoding 350, 300, 350 and 348 amino acid residues, respectively. The deduced amino acid sequences showed that the four novel genes were classified as LMW-m types and the comparison results indicated that the four genes had a more similar structure and a higher level of homology with the LMW-m genes than the LMW-s and -i types genes. However, the first cysteine residue's positions of TzLMW-m2, TdLMW-m1 and AlLMW-m2 were different from the others. Moreover, AlLMW-m2, TdLMW-m1 and TzLMW-m2 all possessed a longer repetitive domain, which was considered to be associated with good quality of wheat. The secondary structure prediction revealed that the content of beta-strand in AlLMW-m2 and TdLMW-m1 exceeded the positive control, suggesting that AlLMW-m2 and TdLMW-m1 should be considered as candidate genes that may have positive effect on dough quality. In order to investigate the evolutionary relationship of the novel genes with the other LMW-GSs, a phylogenetic tree was constructed. The results lead to a speculation that AlLMW-m2, TdLMW-m1 and TzLMW-m2 may be the middle types during the evolution of LMW-m and LMW-s.

  4. Molecular cloning and functional characterization of the anthocyanidin reductase gene from Vitis bellula.

    PubMed

    Zhu, Yue; Peng, Qing-Zhong; Li, Ke-Gang; Xie, De-Yu

    2014-08-01

    Anthocyanidin reductase (ANR) is an NADPH-/NADH-dependent enzyme that transfers two hydrides to anthocyanidins to produce three types of isomeric flavan-3-ols. This reductase forms the ANR pathway toward the biosynthesis of proanthocyanidins (PAs, which are also called condensed tannins). Here, we report cloning and functional characterization of an ANR (called VbANR) homolog from the leaves of Vitis bellula, a newly developed grape crop in southern China. The open reading frame (ORF) of VbANR is 1,017 bp in length and encodes 339 amino acids. A phylogenetic analysis and an alignment using 17 sequences revealed that VbANR is approximately 99.9 % identical to the ANR homolog from Vitis vinifera. The VbANR ORF is fused to the Trx gene containing a His-tag in the pET32a(+) vector to obtain a pET32a(+)-VbANR construct for expressing the recombinant VbANR. In vitro enzyme assays show that VbANR converts cyanidin, delphinidin, and pelargonidin to their corresponding flavan-3-ols. Enzymatic products include 2S,3R-trans- and 2R,3R-cis-flavan-3-ols isomers, such as (-)-catechin and (-)-epicatechin. In addition, the third compound that is observed from the enzymatic products is most likely a 2S,3S-cis-flavan-3-ol. To analyze the kinetics and optimize pH and temperature values, a UV spectrometry method was developed to quantify the concentrations of total enzymatic products. The optimum pH and temperature values are 4.0 and 40 °C, respectively. The K m , K cat, V max, and K cat/K m values for pelargonidin and delphinidin were similar. In comparison, VbANR exhibits a slightly lower affinity to cyanidin. VbANR uses both NADPH and NADH but prefers to employ NADPH. GFP fusion and confocal microscopy analyses revealed the cytosolic localization of VbANR. The overexpression of VbANR in ban mutants reconstructed the biosynthetic pathway of PAs in the seed coat. These data demonstrate that VbANR forms the ANR pathway, leading to the formation of three types of isomeric flavan-3-ols

  5. The gene controlling marijuana psychoactivity: molecular cloning and heterologous expression of Delta1-tetrahydrocannabinolic acid synthase from Cannabis sativa L.

    PubMed

    Sirikantaramas, Supaart; Morimoto, Satoshi; Shoyama, Yoshinari; Ishikawa, Yu; Wada, Yoshiko; Shoyama, Yukihiro; Taura, Futoshi

    2004-09-17

    Delta(1)-tetrahydrocannabinolic acid (THCA) synthase is the enzyme that catalyzes oxidative cyclization of cannabigerolic acid into THCA, the precursor of Delta(1)-tetrahydrocannabinol. We cloned a novel cDNA (GenBank trade mark accession number AB057805) encoding THCA synthase by reverse transcription and polymerase chain reactions from rapidly expanding leaves of Cannabis sativa. This gene consists of a 1635-nucleotide open reading frame, encoding a 545-amino acid polypeptide of which the first 28 amino acid residues constitute the signal peptide. The predicted molecular weight of the 517-amino acid mature polypeptide is 58,597 Da. Interestingly, the deduced amino acid sequence exhibited high homology to berberine bridge enzyme from Eschscholtzia californica, which is involved in alkaloid biosynthesis. The liquid culture of transgenic tobacco hairy roots harboring the cDNA produced THCA upon feeding of cannabigerolic acid, demonstrating unequivocally that this gene encodes an active THCA synthase. Overexpression of the recombinant THCA synthase was achieved using a baculovirus-insect expression system. The purified recombinant enzyme contained covalently attached FAD cofactor at a molar ratio of FAD to protein of 1:1. The mutant enzyme constructed by changing His-114 of the wild-type enzyme to Ala-114 exhibited neither absorption characteristics of flavoproteins nor THCA synthase activity. Thus, we concluded that the FAD binding residue is His-114 and that the THCA synthase reaction is FAD-dependent. This is the first report on molecular characterization of an enzyme specific to cannabinoid biosynthesis.

  6. Molecular cloning and characterization of Crmdr1, a novel MDR-type ABC transporter gene from Catharanthus roseus.

    PubMed

    Jin, Hongbin; Liu, Donghui; Zuo, Kaijing; Gong, Yifu; Miao, Zhiqi; Chen, Yuhui; Ren, Weiwei; Sun, Xiaofen; Tang, Kexuan

    2007-08-01

    A novel gene encoding a MDR-like ABC transporter protein was cloned from Catharanthus roseus, a medicinal plant with more than 120 kinds of secondary metabolites, through rapid amplification of cDNA ends (RACE). This gene (named as Crmdr1; GenBank accession no.: DQ660356) had a total length of 4395 bp with an open reading frame of 3801 bp, and encoded a predicted polypeptide of 1266 amino acids with a molecular weight of 137.1 kDa. The CrMDR1 protein shared 59.8, 62.5, 60.0 and 58.2% identity with other MDR proteins isolated from Arabidopsis thaliana (AAD31576), Coptis japonica (CjMDR), Gossypium hirsutum (GhMDR) and Triticum aestivum (TaMDR) at amino acid level, respectively. Southern blot analysis showed that Crmdr1 was a low-copy gene. Expression pattern analysis revealed that Crmdr1 constitutively expressed in the root, stem and leaf, but with lower expression in leaf. The domains analysis showed that CrMDR1 protein possessed two transmembrane domains (TMDs) and two nucleotide binding domains (NBDs) arranging in "TMD1-NBD1-TMD2-NBD2" direction, which is consistent with other MDR transporters. Within NBDs three characteristic motifs common to all ABC transporters, "Walker A", "Walker B" and C motif, were found. These results indicate that CrMDR1 is a MDR-like ABC transporter protein that may be involved in the transport and accumulation of secondary metabolites.

  7. Cloning, sequencing, and expression of the gene encoding the high-molecular-weight cytochrome c from Desulfovibrio vulgaris Hildenborough

    SciTech Connect

    Pollock, W.B.R.; Voordouw, G. ); Loutfi, M.; Bruschi, M. ); Rapp-Giles, B.J.; Wall, J.D. )

    1991-01-01

    By using a synthetic deoxyoligonucleotide probe designed to recognize the structural gene for cytochrome cc{sub 3} from Desulfovibrio vulgaris Hildenborough, a 3.7-kb XhoI genomic DNA fragment containing the cc{sub 3} gene was isolated. The gene encodes a precursor polypeptide of 58.9 kDa, with an NH{sub 2}-terminal signal sequence of 31 residues. The mature polypeptide (55.7 kDa) has 16 heme binding sites of the form C-X-X-C-H. Covalent binding of heme to these 16 sites gives a holoprotein of 65.5 kDa with properties similar to those of the high-molecular-weight cytochrome c (Hmc) isolated from the same strain by Higuchi et al. Since the data indicate that cytochrome cc{sub 3} and Hmc are the same protein, the gene has been named hmc. The Hmc polypeptide contains 31 histidinyl residues, 16 of which are integral to heme binding sites. Thus, only 15 of the 16 hemes can have bis-histidinyl coordination. A comparison of the arrangement of heme binding sites and coordinated histidines in the amino acid sequences of cytochrome c{sub 3} and Hme from D. vulgaris Hildenborough suggest that the latter contains three cytochrome c{sub 3}-like domains. Cloning of the D. vulgaris Hildenborough hmc gene into the broad-host-range vector pJRD215 and subsequent conjugational transfer of the recombinant plasmid into D. desulfuricans G200 led to expression of a periplasmic Hmc gene produce with covalently bound hemes.

  8. Molecular Cloning and Characterization of Four Genes Encoding Ethylene Receptors Associated with Pineapple (Ananas comosus L.) Flowering.

    PubMed

    Li, Yun-He; Wu, Qing-Song; Huang, Xia; Liu, Sheng-Hui; Zhang, Hong-Na; Zhang, Zhi; Sun, Guang-Ming

    2016-01-01

    Exogenous ethylene, or ethephon, has been widely used to induce pineapple flowering, but the molecular mechanism behind ethephon induction is still unclear. In this study, we cloned four genes encoding ethylene receptors (designated AcERS1a, AcERS1b, AcETR2a, and AcETR2b). The 5' flanking sequences of these four genes were also cloned by self-formed adaptor PCR and SiteFinding-PCR, and a group of putative cis-acting elements was identified. Phylogenetic tree analysis indicated that AcERS1a, AcERS1b, AcETR2a, and AcETR2b belonged to the plant ERS1s and ETR2/EIN4-like groups. Quantitative real-time PCR showed that AcETR2a and AcETR2b (subfamily 2) were more sensitive to ethylene treatment compared with AcERS1a and AcERS1b (subfamily 1). The relative expression of AcERS1b, AcETR2a, and AcETR2b was significantly increased during the earlier period of pineapple inflorescence formation, especially at 1-9 days after ethylene treatment (DAET), whereas AcERS1a expression changed less than these three genes. In situ hybridization results showed that bract primordia (BP) and flower primordia (FP) appeared at 9 and 21 DAET, respectively, and flowers were formed at 37 DAET. AcERS1a, AcERS1b, AcETR2a, and AcETR2b were mainly expressed in the shoot apex at 1-4 DAET; thereafter, with the appearance of BP and FP, higher expression of these genes was found in these new structures. Finally, at 37 DAET, the expression of these genes was mainly focused in the flower but was also low in other structures. These findings indicate that these four ethylene receptor genes, especially AcERS1b, AcETR2a, and AcETR2b, play important roles during pineapple flowering induced by exogenous ethephon.

  9. Molecular Cloning and Characterization of Four Genes Encoding Ethylene Receptors Associated with Pineapple (Ananas comosus L.) Flowering

    PubMed Central

    Li, Yun-He; Wu, Qing-Song; Huang, Xia; Liu, Sheng-Hui; Zhang, Hong-Na; Zhang, Zhi; Sun, Guang-Ming

    2016-01-01

    Exogenous ethylene, or ethephon, has been widely used to induce pineapple flowering, but the molecular mechanism behind ethephon induction is still unclear. In this study, we cloned four genes encoding ethylene receptors (designated AcERS1a, AcERS1b, AcETR2a, and AcETR2b). The 5′ flanking sequences of these four genes were also cloned by self-formed adaptor PCR and SiteFinding-PCR, and a group of putative cis-acting elements was identified. Phylogenetic tree analysis indicated that AcERS1a, AcERS1b, AcETR2a, and AcETR2b belonged to the plant ERS1s and ETR2/EIN4-like groups. Quantitative real-time PCR showed that AcETR2a and AcETR2b (subfamily 2) were more sensitive to ethylene treatment compared with AcERS1a and AcERS1b (subfamily 1). The relative expression of AcERS1b, AcETR2a, and AcETR2b was significantly increased during the earlier period of pineapple inflorescence formation, especially at 1–9 days after ethylene treatment (DAET), whereas AcERS1a expression changed less than these three genes. In situ hybridization results showed that bract primordia (BP) and flower primordia (FP) appeared at 9 and 21 DAET, respectively, and flowers were formed at 37 DAET. AcERS1a, AcERS1b, AcETR2a, and AcETR2b were mainly expressed in the shoot apex at 1–4 DAET; thereafter, with the appearance of BP and FP, higher expression of these genes was found in these new structures. Finally, at 37 DAET, the expression of these genes was mainly focused in the flower but was also low in other structures. These findings indicate that these four ethylene receptor genes, especially AcERS1b, AcETR2a, and AcETR2b, play important roles during pineapple flowering induced by exogenous ethephon. PMID:27252725

  10. Molecular cloning and heterologous expression analysis of JrVTE1 gene from walnut (Juglans regia).

    PubMed

    Wang, Cancan; Li, Chuanrong; Leslie, Charles A; Sun, Qingrong; Guo, Xianfeng; Yang, Keqiang

    Tocopherol cyclase (VTE1) plays a key role in promoting the production of γ-tocopherol and improving total tocopherol content in photosynthetic organisms. Walnut is an important source of tocopherols in the human diet, and γ-tocopherol is the major tocopherol compound in walnut kernels. In this study, a full-length cDNA of the VTE1 gene was isolated from walnut using RT-PCR and RACE, and designated as JrVTE1. The full-length cDNA of the JrVTE1 gene contained a 1353-bp open-reading frame encoding a 451-amino-acid protein with a calculated molecular weight of 49.5 kDa. The deduced JrVTE1 protein had a considerable homology with other plant VTE1s and belonged to the tocopherol cyclase family. Functional characterization of JrVTE1 by heterologous expression was carried out in E. coli BL21 (DE3) and microshoot lines of the fruit trees jujube (Zizyphus jujuba var. spinosa) and pear (Pyrus communis) cultivar 'Old Home'. JrVTE1 in E. coli expressed as a 50 kDa protein, as expected. One or two copies of the transferred JrVTE1 gene were detected in the genomes of representative transgenic lines (from the initial transgenic plants) of jujube and pear by gel blots analysis. Over-expression of JrVTE1 in jujube and pear resulted in an accumulation of tocopherol and a shift in tocopherol composition in leaf, root and stem tissues. In the transgenic jujube, the total tocopherol content increased by 29.8 μg/g in the stems of line J3, 43.7 and 22.5 μg/g in the roots and leaves of line J1, respectively, whereas in the transgenic pear it increased by 47.3 μg/g in the leaf of line P3, and 16.7 and 10.4 μg/g in roots and stems of line P9, respectively. In the examined tissues of transgenic plants, the highest accumulation rate was the γ-tocopherol. These results indicate that JrVTE1 is one of the rate-limiting enzymes for tocopherol production and could be used to improve the tocopherol content of tree crops through genetic engineering.

  11. Molecular cloning and characterization of the ABA-specific glucosyltransferase gene from bean (Phaseolus vulgaris L.).

    PubMed

    Palaniyandi, Sasikumar Arunachalam; Chung, Gyuhwa; Kim, Sang Hyon; Yang, Seung Hwan

    2015-04-15

    Levels of the plant hormone abscisic acid (ABA) are maintained in homeostasis by a balance of its biosynthesis, catabolism and conjugation. The detailed molecular and signaling events leading to strict homeostasis are not completely understood in crop plants. In this study, we obtained cDNA of an ABA-inducible, ABA-specific UDP-glucosyltransferase (ABAGT) from the bean plant (Phaseolus vulgaris L.) involved in conjugation of a glucose residue to ABA to form inactive ABA-glucose ester (ABA-GE) to examine its role during development and abiotic stress in bean. The bacterially expressed PvABAGTase enzyme showed ABA-specific glucosylation activity in vitro. A higher level of the PvABAGT transcript was observed in mature leaves, mature flowers, roots, seed coats and embryos as well as upon rehydration following a period of dehydration. Overexpression of 35S::PvABAGT in Arabidopsis showed reduced sensitivity to ABA compared with WT. The transgenic plants showed a high level of ABA-GE without significant decrease in the level of ABA compared with the wild type (WT) during dehydration stress. Upon rehydration, the levels of ABA and phaseic acid (PA) decreased in the WT and the PvABAGT-overexpressing lines with high levels of ABA-GE only in the transgenic plants. Our findings suggest that the PvABAGT gene could play a role in ABA homeostasis during development and stress responses in bean and its overexpression in Arabidopsis did not alter ABA homeostasis during dehydration stress.

  12. Pseudomonas aeruginosa outer membrane lipoprotein I gene: molecular cloning, sequence, and expression in Escherichia coli.

    PubMed Central

    Duchêne, M; Barron, C; Schweizer, A; von Specht, B U; Domdey, H

    1989-01-01

    Lipoprotein I (OprI) is one of the major proteins of the outer membrane of Pseudomonas aeruginosa. Like porin protein F (OprF), it is a vaccine candidate because it antigenically cross-reacts with all serotype strains of the International Antigenic Typing Scheme. Since lipoprotein I was expressed in Escherichia coli under the control of its own promoter, we were able to isolate the gene by screening a lambda EMBL3 phage library with a mouse monoclonal antibody directed against lipoprotein I. The monocistronic OprI mRNA encodes a precursor protein of 83 amino acid residues including a signal peptide of 19 residues. The mature protein has a molecular weight of 6,950, not including bound glycerol and lipid. Although the amino acid sequences of protein I of P. aeruginosa and Braun's lipoprotein of E. coli differ considerably (only 30.1% identical amino acid residues), peptidoglycan in E. coli, are identical. Using lipoprotein I expressed in E. coli, it can now be tested whether this protein alone, without P. aeruginosa lipopolysaccharide contaminations, has a protective effect against P. aeruginosa infections. Images PMID:2502533

  13. Molecular cloning and characterization of a phytochelatin synthase gene, PvPCS1, from Pteris vittata L.

    PubMed

    Dong, Ruibin; Formentin, Elide; Losseso, Carmen; Carimi, Francesco; Benedetti, Piero; Terzi, Mario; Schiavo, Fiorella Lo

    2005-12-01

    Pteris vittata L. is a staggeringly efficient arsenic hyperaccumulator that has been shown to be capable of accumulating up to 23,000 microg arsenic g(-1), and thus represents a species that may fully exploit the adaptive potential of plants to toxic metals. However, the molecular mechanisms of adaptation to toxic metal tolerance and hyperaccumulation remain unknown, and P. vittata genes related to metal detoxification have not yet been identified. Here, we report the isolation of a full-length cDNA sequence encoding a phytochelatin synthase (PCS) from P. vittata. The cDNA, designated PvPCS1, predicts a protein of 512 amino acids with a molecular weight of 56.9 kDa. Homology analysis of the PvPCS1 nucleotide sequence revealed that it has low identity with most known plant PCS genes except AyPCS1, and the homology is largely confined to two highly conserved regions near the 5'-end, where the similarity is as high as 85-95%. The amino acid sequence of PvPCS1 contains two Cys-Cys motifs and 12 single Cys, only 4 of which (Cys-56, Cys-90/91, and Cys-109) in the N-terminal half of the protein are conserved in other known PCS polypeptides. When expressed in Saccharomyces cerevisae, PvPCS1 mediated increased Cd tolerance. Cloning of the PCS gene from an arsenic hyperaccumulator may provide information that will help further our understanding of the genetic basis underlying toxic metal tolerance and hyperaccumulation.

  14. Purine nucleoside phosphorylase from Pseudoalteromonas sp. Bsi590: molecular cloning, gene expression and characterization of the recombinant protein.

    PubMed

    Li, Xiaohui; Jiang, Xinyin; Li, Huirong; Ren, Daming

    2008-05-01

    The gene encoding purine nucleoside phosphorylase (PNP) from the cold-adapted marine bacterium Pseudoalteromonas sp. Bsi590 was identified, cloned and expressed in Escherichia coli. The gene encodes a polypeptide of 233 amino acids with a calculated molecular weight of 25,018 Da. Pseudoalteromonas sp. Bsi590 PNP (PiPNP) shares 60% amino sequence identity and conservation of amino acid residues involved in catalysis with mesophilic Escherichia coli deoD-encoded purine nucleoside phosphorylase (EcPNP). N-terminal his-tagged PiPNP and EcPNP were purified to apparent homogeneity using Ni2+-chelating column. Compared with EcPNP, PiPNP possessed a lower temperature optimum and thermal stability. As for PNP enzymes in general, PiPNP and EcPNP displayed complicated kinetic properties; PiPNP possessed higher Km and catalytic efficiency (kcat/Km) compared to EcPNP at 37 degrees C. Substrate specificity results showed PiPNP catalyzed the phosphorolytic cleavage of 6-oxopurine and 6-aminopurine nucleosides (or 2-deoxynucleosides), and to a lesser extent purine arabinosides. PiPNP showed a better activity with inosine while no activity toward pyrimidine nucleosides. The protein conformation was analyzed by temperature perturbation difference spectrum. Results showed that PiPNP had lower conformation transition point temperature than EcPNP; phosphate buffer and KCl had significant influence on PiPNP protein conformation stability and thermostability.

  15. Identification, molecular cloning and expression analysis of five RNA-dependent RNA polymerase genes in Salvia miltiorrhiza.

    PubMed

    Shao, Fenjuan; Lu, Shanfa

    2014-01-01

    RNA-dependent RNA polymerases (RDRs) act as key components of the small RNA biogenesis pathways and play significant roles in post-transcriptional gene silencing (PTGS) and antiviral defense. However, there is no information about the RDR gene family in Salvia miltiorrhiza, an emerging model medicinal plant with great economic value. Through genome-wide predication and subsequent molecular cloning, five full-length S. miltiorrhiza RDR genes, termed SmRDR1-SmRDR5, were identified. The length of SmRDR cDNAs varies between 3,262 (SmRDR5) and 4,130 bp (SmRDR3). The intron number of SmRDR genes varies from 3 (SmRDR1, SmRDR3 and SmRDR4) to 17 (SmRDR5). All of the deduced SmRDR protein sequences contain the conserved RdRp domain. Moreover, SmRDR2 and SmRDR4 have an additional RRM domain. Based on the phylogenetic tree constructed with sixteen RDRs from Arabidopsis, rice and S. miltiorrhiza, plant RDRs may be divided into four groups (RDR1-RDR4). The RDR1 group contains an AtRDR and an OsRDR, while includes two SmRDRs. On the contrary, the RDR3 group contains three AtRDRs and two OsRDRs, but has only one SmRDR. SmRDRs were differentially expressed in flowers, leaves, stems and roots of S. miltiorrhiza and responsive to methyl jasmonate treatment and cucumber mosaic virus infection. The results suggest the involvement of RDRs in S. miltiorrhiza development and response to abiotic and biotic stresses. It provides a foundation for further studying the regulation and biological functions of SmRDRs and the biogenesis pathways of small RNAs in S. miltiorrhiza.

  16. Molecular cloning and functional analysis of a novel oncogene, cancer-upregulated gene 2 (CUG2)

    SciTech Connect

    Lee, Soojin . E-mail: leesoojin@cnu.ac.kr; Gang, Jingu; Jeon, Sun Bok; Jung, Jinyoung; Song, Si Young; Koh, Sang Seok . E-mail: sskoh@kribb.re.kr

    2007-08-31

    We examined genome-wide differences in gene expression between tumor biopsies and normal tissues in order to identify differentially regulated genes in tumors. Cancer-upregulated gene 2 (CUG2) was identified as an expressed sequence tag (EST) that exhibits significant differential expression in multiple human cancer types. CUG2 showed weak sequence homology with the down-regulator of transcription 1 (DR1) gene, a human transcription repressor. We found that EGFP-CUG2 fusion proteins were predominantly localized in the nucleus, suggesting their putative role in gene regulation. In addition, CUG2-overexpressing mouse fibroblast cells exhibited distinct cancer-specific phenotypes in vitro and developed into tumors in nude mice. Taken together, these findings suggest that CUG2 is a novel tumor-associated gene that is commonly activated in various human cancers and exhibits high transforming activities; it possibly belongs to a transcription regulator family that is involved in tumor biogenesis.

  17. Molecular cloning and expression analyses of a novel swine gene--ARF4.

    PubMed

    Liu, G Y; Xiong, Y Z

    2009-03-01

    The mRNA differential display technique was performed to investigate the differences of gene expression in the longissimus muscle tissues from Meishan and Large White pigs. One novel gene that was differentially expressed was identified through semi-quantitative RT-PCR and the cDNA complete sequence was then obtained using the rapid amplification of cDNA ends (RACE) method. The nucleotide sequence of the gene is not homologous to any of the known porcine genes. The sequence prediction analysis revealed that the open reading frame of this gene encodes a protein of 180 amino acids that contains the putative conserved domain of ADP-ribosylation factor (ARF) which has high homology with the ADP-ribosylation factor 4 (ARF4) of six species-bovine (98%), human and orangutan (96%), African clawed frog (96%), mouse and rat (98%)-so that it can be defined as swine ADP-ribosylation factor 4 (ARF4). This novel porcine gene was finally assigned to GeneID:595108. The phylogenetic tree analysis revealed that the swine ARF4 has a closer genetic relationship with the rat and mouse ARF4 than with those of human and African clawed frog. The tissue expression analysis indicated that the swine ARF4 gene is over expressed in muscle, fat, heart, spleen, liver, and ovary and moderately expressed in lung and kidney but weakly expressed in small intestine. Our experiment is the first to establish the primary foundation for further research on the swine ARF4 gene.

  18. Molecular cloning and sequencing of pheU, a gene for Escherichia coli tRNAPhe.

    PubMed Central

    Schwartz, I; Klotsky, R A; Elseviers, D; Gallagher, P J; Krauskopf, M; Siddiqui, M A; Wong, J F; Roe, B A

    1983-01-01

    A recombinant plasmid (designated pID2) carrying the E. coli gene for tRNAPhe has been isolated from a plasmid bank constructed by the ligation of a total EcoRI digest of E. coli K12 DNA into the EcoRI site of pACYC184 DNA. The plasmid was selected by virtue of its ability to complement a temperature-sensitive lesion in the gene (PheS) for the alpha-subunit of phenylalanyl-tRNA synthetase. Crude tRNA isolated from such transformants exhibited elevated levels of phenylalanine acceptor activity. The tRNAPhe gene has been localized within the first 300 base pairs of a 3.6 kb SalI fragment of pID2. The sequence of the gene and its flanking regions is presented. Images PMID:6306588

  19. Molecular cloning, sequence characterization and expression pattern of Rab18 gene from watermelon (Citrullus lanatus).

    PubMed

    Xinli, Xiao; Lei, Peng

    2015-03-04

    The complete mRNA sequence of watermelon Rab18 gene was amplified through the rapid amplification of cDNA ends (RACE) method. The full-length mRNA was 1010 bp containing a 645 bp open reading frame, which encodes a protein of 214 amino acids. Sequence analysis revealed that watermelon Rab18 protein shares high homology with the Rab18 of cucumber (99%), muskmelon (98%), Morus notabilis (90%), tomato (89%), wine grape (89%) and potato (88%). Phylogenetic analysis revealed that watermelon Rab18 gene has a closer genetic relationship with Rab18 gene of cucumber and muskmelon. Tissue expression profile analysis indicated that watermelon Rab18 gene was highly expressed in root, stem and leaf, moderately expressed in flower and weakly expressed in fruit.

  20. Cloning and molecular evolution of the aldehyde dehydrogenase 2 gene (Aldh2) in bats (Chiroptera).

    PubMed

    Chen, Yao; Shen, Bin; Zhang, Junpeng; Jones, Gareth; He, Guimei

    2013-02-01

    Old World fruit bats (Pteropodidae) and New World fruit bats (Phyllostomidae) ingest significant quantities of ethanol while foraging. Mitochondrial aldehyde dehydrogenase (ALDH2, encoded by the Aldh2 gene) plays an important role in ethanol metabolism. To test whether the Aldh2 gene has undergone adaptive evolution in frugivorous and nectarivorous bats in relation to ethanol elimination, we sequenced part of the coding region of the gene (1,143 bp, ~73 % coverage) in 14 bat species, including three Old World fruit bats and two New World fruit bats. Our results showed that the Aldh2 coding sequences are highly conserved across all bat species we examined, and no evidence of positive selection was detected in the ancestral branches leading to Old World fruit bats and New World fruit bats. Further research is needed to determine whether other genes involved in ethanol metabolism have been the targets of positive selection in frugivorous and nectarivorous bats.

  1. Molecular cloning, characterization, and function analysis of a mevalonate pyrophosphate decarboxylase gene from Ganoderma lucidum.

    PubMed

    Shi, Liang; Qin, Lei; Xu, Yingjie; Ren, Ang; Fang, Xing; Mu, Dashuai; Tan, Qi; Zhao, Mingwen

    2012-05-01

    This study investigated the role of the mevalonate pyrophosphate decarboxylase gene in the triterpene biosynthetic pathway of Ganoderma lucidum. The mevalonate pyrophosphate decarboxylase gene (mvd) was isolated using a degenerate primer-PCR technique. An analysis of the Gl-mvd transcription profile revealed a positive correlation between the expression of the Gl-mvd gene and triterpene content changes in G. lucidum during development. Furthermore, a promoter deletion analysis was conducted in G. lucidum to investigate the promoter activity and the role of methyl jasmonate (MeJA) responsive elements in the mvd promoter under the MeJA elicitor. The overexpression of Gl-mvd increased triterpene accumulation compared with the wild-type strain and increased the expression of several genes involved in the triterpene biosynthetic pathway. The findings of this study suggest that mvd may play an important role in triterpene biosynthesis regulation. Moreover, there may be the interactions among the genes involved in the triterpene biosynthetic pathway in the G. lucidum. Additionally, this study provides an approach for improving triterpene content through the overexpression of a key gene.

  2. Molecular cloning of glycoside hydrolase family 45 cellulase genes from brackish water clam Corbicula japonica.

    PubMed

    Sakamoto, Kentaro; Toyohara, Haruhiko

    2009-04-01

    We previously reported endogenous Glycoside Hydrolase Family (GHF) 9 beta-1,4-glucanase gene, CjCel9A, from common Japanese freshwater clam Corbicula japonica. Here we identified another endogenous beta-1,4-glucanase genes which belong to GHF45 (CjCel45A, CjCel45B). Both genes encode ORF of 627 bp corresponding to 208 amino acids. CjCel45A and CjCel45B are different in 5' and 3'-untranslated regions and six nucleotides in the ORF. CjCEL45 has only one GHF45 catalytic domain without any carbohydrate binding modules as is the case with other molluskan GHF45 enzymes. Phylogenetic analysis and genomic structure of CjCel45 gene implies that this gene is likely to be acquired from fungi by common ancestor of mollusks. Reverse transcription (RT)-PCR analysis and in situ hybridization revealed that CjCel45A is likely to be expressed in the secretory cells in the digestive gland, suggesting that this cellulase is produced in the same site as CjCEL9A. CjCEL45A was successfully expressed in E. coli cells and zymographic analysis of the recombinant CjCEL45A showed that CjCEL45A is a functional beta-1,4-glucanase. The finding of multiple cellulase genes in C. japonica strongly supports our hypothesis that this species function as a cellulose decomposer in estuarine environments.

  3. Molecular cloning and expression analysis of the STAT1 gene in the water buffalo (Bubalus bubalis).

    PubMed

    Deng, Tingxian; Pang, Chunying; Zhu, Peng; Liao, Biyun; Zhang, Ming; Yang, Bingzhuang; Liang, Xianwei

    2015-01-01

    Signal transducer and activator of transcription 1 (STAT1) is a critical component of the transcription factor complex in the interferon (IFN) signaling pathways. Of the seven STAT isoforms, STAT1 is a key mediator of type I and type III IFN signaling, but limited information is available for the STAT genes in the water buffalo. Here, we amplified and identified the complete coding sequence (CDS) of the buffalo STAT1 gene by using reverse transcription polymerase chain reaction (RT-PCR). Sequence analysis indicated that the buffalo STAT1 gene length size was 3437 bp, containing an open reading frame (ORF) of 2244 bp that encoded 747 amino acids for the first time. The buffalo STAT1 CDS showed 99, 98, 89, 93, 86, 85, and 87% identity with that of Bos taurus, Ovis aries, Homo sapiens, Sus scrofa, Rattus norvegicus, Mus musculus, and Capra hircus. The phylogenetic analyses revealed that the nearest relationship existed between the water buffalo and B. taurus. The STAT1 gene was ubiquitously expressed in 11 buffalo tissues by real-time PCR, whereas STAT1 was expressed at higher levels in the lymph. The STAT1 gene contained five targeted microRNA sequences compared with the B. taurus by the miRBase software that provide a fundamental for identifying the STAT1 gene function.

  4. Molecular cloning and characterization of lactate dehydrogenase gene from Eimeria tenella.

    PubMed

    Dong, Hui; Wang, Yange; Zhao, Qiping; Han, Hongyu; Zhu, Shunhai; Li, Liujia; Wu, Youling; Huang, Bing

    2014-08-01

    Lactate dehydrogenase (LDH) is a key enzyme in the glycolytic pathway and is crucial for parasite survival. In this study, we cloned and expressed the LDH of Eimeria tenella (EtLDH). Real-time polymerase chain reaction and Western blot analysis revealed that the expression of EtLDH was developmentally regulated at the messenger RNA (mRNA) and protein levels. EtLDH mRNA levels were higher in second-generation merozoites than in other developmental stages (unsporulated oocysts, sporulated oocysts, and sporozoites). EtLDH protein expression levels were most prominent in second-generation merozoites, moderately expressed in unsporulated oocysts and sporulated oocysts, and weakly detected in sporozoites. Immunostaining with anti-recombinant EtLDH (rEtLDH) antibody indicated that EtLDH was mainly located in the anterior region in free sporozoites and became concentrated in the anterior region of intracellular sporozoites except for the apex after invasion into DF-1 cells. Specific staining of EtLDH protein was more intense in trophozoites and immature first-generation schizonts, but decreased in mature first-generation schizonts. Inhibition of EtLDH function using specific antibodies cannot efficiently reduce the ability of E. tenella sporozoites to invade host cells. These results suggest that EtLDH may be involved in glycolysis during the first-generation merogony stage in E. tenella and has little role in host invasion.

  5. Cloning and molecular characterization of phospholipase D (PLD) delta gene from longan (Dimocarpus longan Lour.).

    PubMed

    You, Xiangrong; Zhang, Yayuan; Li, Li; Li, Zhichun; Li, Mingjuan; Li, Changbao; Zhu, Jianhua; Peng, Hongxiang; Sun, Jian

    2014-07-01

    Longan (Dimocarpus longan Lour.) is a non-climacteric fruit with a short postharvest life. The regulation of phospholipase D (PLD) activity closely relates to postharvest browning and senescence of longan fruit. In this study, a novel cDNA clone of longan PLDδ (LgPLDδ) was obtained and registered in GenBank (accession No. JF791814). The deduced amino acid sequence possessed all of the three typical domains of plant PLDs, a C2 domain and two catalytic HxKxxxxD motifs. The tertiary structure of LgPLDδ was further predicted. The western blot result showed that the LgPLDδ protein was specifically recognized by PLDδ antibody. The Q-RT-PCR (real-time quantitative PCR) result showed that the level of LgPLDδ mRNA expression was higher in senescent tissues than in developing tissues, which was also high in postharvest fruit. The western-blotting result further certified the different expression of LgPLDδ. These results provided a scientific basis for further investigating the mechanism of postharvest longan fruit adapting to environmental stress.

  6. Molecular cloning, sequence characterization, and gene expression profiling of a novel water buffalo (Bubalus bubalis) gene, AGPAT6.

    PubMed

    Song, S; Huo, J L; Li, D L; Yuan, Y Y; Yuan, F; Miao, Y W

    2013-10-01

    Several 1-acylglycerol-3-phosphate-O-acyltransferases (AGPATs) can acylate lysophosphatidic acid to produce phosphatidic acid. Of the eight AGPAT isoforms, AGPAT6 is a crucial enzyme for glycerolipids and triacylglycerol biosynthesis in some mammalian tissues. We amplified and identified the complete coding sequence (CDS) of the water buffalo AGPAT6 gene by using the reverse transcription-polymerase chain reaction, based on the conversed sequence information of the cattle or expressed sequence tags of other Bovidae species. This novel gene was deposited in the NCBI database (accession No. JX518941). Sequence analysis revealed that the CDS of this AGPAT6 encodes a 456-amino acid enzyme (molecular mass = 52 kDa; pI = 9.34). Water buffalo AGPAT6 contains three hydrophobic transmembrane regions and a signal 37-amino acid peptide, localized in the cytoplasm. The deduced amino acid sequences share 99, 98, 98, 97, 98, 98, 97 and 95% identity with their homologous sequences from cattle, horse, human, mouse, orangutan, pig, rat, and chicken, respectively. The phylogenetic tree analysis based on the AGPAT6 CDS showed that water buffalo has a closer genetic relationship with cattle than with other species. Tissue expression profile analysis shows that this gene is highly expressed in the mammary gland, moderately expressed in the heart, muscle, liver, and brain; weakly expressed in the pituitary gland, spleen, and lung; and almost silently expressed in the small intestine, skin, kidney, and adipose tissues. Four predicted microRNA target sites are found in the water buffalo AGPAT6 CDS. These results will establish a foundation for further insights into this novel water buffalo gene.

  7. Molecular cloning, recombinant gene expression, and antifungal activity of cystatin from taro (Colocasia esculenta cv. Kaosiung no. 1).

    PubMed

    Yang, A H; Yeh, K W

    2005-06-01

    A cDNA clone, designated CeCPI, encoding a novel phytocystatin was isolated from taro corms (Colocasia esculenta) using both degenerated primers/RT-PCR amplification and 5'-/3'-RACE extension. The full-length cDNA gene is 1,008 bp in size, encodes 206 amino acid residues, with a deduced molecular weight of 29 kDa. It contains a conserved reactive site motif Gln-Val-Val-Ser-Gly of cysteine protease inhibitors, and another consensus ARFAV sequence for phytocystatin. Sequence analysis revealed that CeCPI is phylogenetically closely related to Eudicots rather than to Monocots, despite taro belonging to Monocot. Recombinant GST-CeCPI fusion protein was overexpressed in Escherichia coli and its inhibitory activity against papain was identified on gelatin/SDS-PAGE. These results confirmed that recombinant CeCPI protein exhibited strong cysteine protease inhibitory activity. Investigation of its antifungal activity clearly revealed a toxic effect on the mycelium growth of phytopathogenic fungi, such as Sclerotium rolfsii Sacc. etc., at a concentration of 80 microg recombinant CeCPI/ ml. Moreover, mycelium growth was completely inhibited and the sclerotia lysed at a concentration of 150-200 microg/ml. Further studies have demonstrated that recombinant CeCPI is capable of acting against the endogenous cysteine proteinase in the fungal mycelium.

  8. Molecular cloning and characterization of a nonsymbiotic hemoglobin gene (GLB1) from Malus hupehensis Rehd. with heterologous expression in tomato.

    PubMed

    Shi, Xingzheng; Wang, Xinliang; Peng, Futian; Zhao, Yu

    2012-08-01

    Nonsymbiotic hemoglobins (nsHbs) are involved in a variety of cellular processes in plants. Previous studies indicate that nsHb expression improves plant tolerance during waterlogging and hypoxia. In the present work, the nsHb class-1 coding sequence was cloned from Malus hupehensis Rehd. var. pinyiensis Jiang and subsequently named MhGLB1. The results elucidated the expressed characteristics and physiological effects of MhGLB1. The full-length cDNA contained a 477 bp open reading frame encoding a protein with a molecular mass of 17.8 KDa with 158 amino acids. Quantitative real-time PCR analysis showed that MhGLB1 expresses in roots, stems and leaves growing under normal and nitrate-induced conditions. Hypoxic stress induced accumulation of MhGLB1 within 12 h, and abscisic acid significantly induced expression of MhGLB1 in roots. The photosynthetic, transpiration and stomatal conductance rates of transgenic MhGLB1 tomato plants decreased more slowly than that of wild-type plants under waterlogging treatment. These results indicated that the MhGLB1 gene has an important role in hypoxia.

  9. Molecular cloning and expression analyses of RPS3a gene from mulberry under abiotic stresses and among different mulberry varieties.

    PubMed

    Qian, J; Zhou, H; Zhao, M D; Wang, H; Li, F; Wang, Y H; Fang, R J; Zhao, W G; Kim, H J

    2016-04-28

    A full-length cDNA sequence coding ribosomal protein S3a of mulberry tree, which we designated MmRPS3a (GenBank accession No. KR610331), was cloned based on mulberry expressed sequence tags. Sequence analysis showed that the MmRPS3a is 1089 bp long and contains a 80-bp 5'-UTR (untranslated region) and a 220-bp 3'-UTR. Its open reading frame consists of a 789-bp encoding 262 amino acids with a predicted molecular weight of 30.053 kDa and an isoelectric point of 9.84. Homology analysis revealed that MmRPS3a gene is highly conservative in mulberry and other species including Morus notabilis, Theobroma cacao, and Ricinus communis. Phylogenetic analysis based on MmRPS3a of other species showed that mulberry had a closer relationship with Prunus persica, Arabidopsis thaliana, Solanum tuberosum, Solanum lycopersicum, and Vitis vinifera. The results of quantitative PCR analysis showed that the transcriptional level of MmRPS3a mRNA changed significantly under the conditions of hypothermia, aridity, salt stress, and varieties of differing resistances.

  10. Molecular cloning and characterization of pathogenesis-related protein family 10 gene from spinach (SoPR10).

    PubMed

    Bai, Xuegui; Long, Juan; He, Xiaozhao; Li, Shun; Xu, Huini

    2014-01-01

    PR10 genes encode small, intracellular proteins that respond to biotic and abiotic stresses. In this study, a cDNA clone (designated as SoPR10, GenBank Accession No. KC142174) encoding a PR10 protein from spinach (Spinacia oleracea L.) was isolated and characterized. SoPR10 encoded a 161-amino acid polypeptide with a predicted molecular mass of 19.76 kDa and a pI of 4.61. Real-time quantitative analysis indicated that SoPR10 was constitutively expressed in root and shoot. The abundance of SoPR10 in salt-resistant cultivar (Chaoji) was generally greater than in salt-sensitive cultivar (Daye) under 160 mM L(-1) NO3(-) treatment for 0.5, 3, and 6 h. The expression of SoPR10 was also induced by other abiotic stresses including polyethylene glycol, NaCl, salicylic acid, and H2O2. Our results indicated that SoPR10 might play important roles under nitrate stress and other abiotic stresses.

  11. Molecular cloning and functional analysis of the drought tolerance gene MsHSP70 from alfalfa (Medicago sativa L.).

    PubMed

    Li, Zhenyi; Long, Ruicai; Zhang, Tiejun; Wang, Zhen; Zhang, Fan; Yang, Qingchuan; Kang, Junmei; Sun, Yan

    2017-03-01

    Heat shock proteins (HSPs) are a ubiquitously expressed class of protective proteins that play a key role in plant response to stressful conditions. This study aimed to characterize and investigate the function of an HSP gene in alfalfa (Medicago sativa). MsHSP70, which contains a 2028-bp open reading frame, was identified through homology cloning. MsHSP70 shares high sequence identity (94.47%) with HSP70 from Medicago truncatula. Expression analysis of MsHSP70 in alfalfa organs revealed a relatively higher expression level in aerial organs such as flowers, stems and leaves than in roots. MsHSP70 was induced by heat shock, abscisic acid (ABA) and hydrogen peroxide. Transgenic Arabidopsis seedlings overexpressing MsHSP70 were hyposensitive to polyethylene glycol (PEG) and ABA treatments, suggesting that exogenous expression of MsHSP70 enhanced Arabidopsis tolerance to these stresses. Examination of physiological indexes related to drought and ABA stress demonstrated that in comparison with non-transgenic plants, T3 transgenic Arabidopsis plants had an increased proline content, higher superoxide dismutase (SOD) activity, and decreased malondialdehyde (MDA) content. Furthermore, higher relative water content (RWC) was detected in transgenic plants compared with non-transgenic plants under drought stress. These findings clearly indicate that molecular manipulation of MsHSP70 in plants can have substantial effects on stress tolerance.

  12. Molecular Cloning and Characterization of the Gene Coding for the Aerobic Azoreductase from Xenophilus azovorans KF46F

    PubMed Central

    Blümel, Silke; Knackmuss, Hans-Joachim; Stolz, Andreas

    2002-01-01

    The gene coding for an aerobic azoreductase was cloned from Xenophilus azovorans KF46F (formerly Pseudomonas sp. strain KF46F), which was previously shown to grow with the carboxylated azo compound 1-(4′-carboxyphenylazo)-2-naphthol (carboxy-Orange II) as the sole source of carbon and energy. The deduced amino acid sequence encoded a protein with a molecular weight of 30,278 and showed no significant homology to amino acid sequences currently deposited at the relevant data bases. A presumed NAD(P)H-binding site was identified in the amino-terminal region of the azoreductase. The enzyme was heterologously expressed in Escherichia coli and the azoreductase activities of resting cells and cell extracts were compared. The results suggested that whole cells of the recombinant E. coli strains were unable to take up sulfonated azo dyes and therefore did not show in vivo azoreductase activity. The turnover of several industrially relevant azo dyes by cell extracts from the recombinant E. coli strain was demonstrated. PMID:12147495

  13. Molecular cloning and characterization of the glyceraldehyde-3-phosphate dehydrogenase gene from Penicillium expansum PE-12.

    PubMed

    Zhang, T; Qi, Z; Yu, Q S; Tang, K X

    2013-07-15

    Penicillium expansum produces large amounts of lipase, which is widely used in laundry detergent and leather industry. We isolated the glyceraldehyde-3-phosphate dehydrogenase gene (PeGPD) from P. expansum PE-12 through reverse transcriptase PCR and 5'-3' rapid amplification of cDNA ends (RACE-PCR). The gene is 1266 bp long, including an ORF of 1014 bp, encoding a polypeptide chain of 337 amino acids. A phylogenetic tree based on GPD proteins showed that P. expansum is close to Aspergillus species, but comparatively distant from P. marneffei. Southern blot results revealed a single copy of PeGPD, and expression analysis gave evidence of high expression levels. PeGPD genes have potential for genetic engineering of P. expansum for industrial lipase production.

  14. Molecular Cloning and Expression Analysis of hyp-1 Type PR-10 Family Genes in Hypericum perforatum.

    PubMed

    Karppinen, Katja; Derzsó, Emese; Jaakola, Laura; Hohtola, Anja

    2016-01-01

    Hypericum perforatum L. is an important medicinal plant for the treatment of depression. The plant contains bioactive hypericins that accumulate in dark glands present especially in reproductive parts of the plant. In this study, pathogenesis-related class 10 (PR-10) family genes were identified in H. perforatum, including three previously unidentified members with sequence homology to hyp-1, a phenolic coupling protein that has earlier been suggested to participate in biosynthesis and binding/transportation of hypericin. The PR-10 genes showed constitutive but variable expression patterns in different H. perforatum tissues. They were all expressed at relatively high levels in leaves, variably in roots and low levels in stem and reproductive parts of the plant with no specific association with dark glands. The gene expression was up-regulated in leaves after salicylic acid, abscisic acid and wounding treatments but with variable levels. To study exact location of the gene expression, in situ hybridization of hyp-1 transcripts was performed and the accumulation of the Hyp-1 protein was examined in various tissues. The presence of Hyp-1 protein in H. perforatum tissues mostly paralleled with the mRNA levels. In situ RNA hybridization localized the hyp-1 transcripts predominantly in vascular tissues in root and stem, while in leaf the mRNA levels were high also in mesophyll cells in addition to vasculature. Our results indicate that the studied PR-10 genes are likely to contribute to the defense responses in H. perforatum. Furthermore, despite the location of the hyp-1 transcripts in vasculature, no support for the transportation of the Hyp-1 protein to dark glands was found in the current study. The present results together with earlier data question the role of the hyp-1 as a key gene responsible for the hypericin biosynthesis in dark glands of H. perforatum.

  15. Molecular Cloning and Expression Analysis of hyp-1 Type PR-10 Family Genes in Hypericum perforatum

    PubMed Central

    Karppinen, Katja; Derzsó, Emese; Jaakola, Laura; Hohtola, Anja

    2016-01-01

    Hypericum perforatum L. is an important medicinal plant for the treatment of depression. The plant contains bioactive hypericins that accumulate in dark glands present especially in reproductive parts of the plant. In this study, pathogenesis-related class 10 (PR-10) family genes were identified in H. perforatum, including three previously unidentified members with sequence homology to hyp-1, a phenolic coupling protein that has earlier been suggested to participate in biosynthesis and binding/transportation of hypericin. The PR-10 genes showed constitutive but variable expression patterns in different H. perforatum tissues. They were all expressed at relatively high levels in leaves, variably in roots and low levels in stem and reproductive parts of the plant with no specific association with dark glands. The gene expression was up-regulated in leaves after salicylic acid, abscisic acid and wounding treatments but with variable levels. To study exact location of the gene expression, in situ hybridization of hyp-1 transcripts was performed and the accumulation of the Hyp-1 protein was examined in various tissues. The presence of Hyp-1 protein in H. perforatum tissues mostly paralleled with the mRNA levels. In situ RNA hybridization localized the hyp-1 transcripts predominantly in vascular tissues in root and stem, while in leaf the mRNA levels were high also in mesophyll cells in addition to vasculature. Our results indicate that the studied PR-10 genes are likely to contribute to the defense responses in H. perforatum. Furthermore, despite the location of the hyp-1 transcripts in vasculature, no support for the transportation of the Hyp-1 protein to dark glands was found in the current study. The present results together with earlier data question the role of the hyp-1 as a key gene responsible for the hypericin biosynthesis in dark glands of H. perforatum. PMID:27148343

  16. Molecular cloning and functional analysis of an ethylene receptor gene from sugarcane (Saccharum spp.) by hormone and environmental stresses

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Ethylene receptor (ethylene response sensor, ERS) is the primary component involving in the ethylene biosynthesis and ethylene signal transduction pathway. In the present study, a GZ-ERS gene encoding ERS was cloned from a sugarcane cv. YL17 (Saccharum spp.) using RT-PCR and ligation-mediated PCR wi...

  17. Molecular cloning and expression analysis of multiple polyphenol oxidase genes in developing wheat (Triticum aestivum) kernels

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Polyphenol oxidase (PPO, EC 1.10.31) is a major cause of discoloring in raw dough containing wheat flour. Minimization of PPO activity has proven difficult because bread wheat is genetically complex, composed of the genomes of three grass species. The PPO-A1 and PPO-D1 genes, on chromosomes 2A and...

  18. Toward the molecular cloning of the Septoria nodorum blotch susceptibility gene Snn2 in wheat

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Septoria nodorum blotch is a disease of wheat caused by the necrotrophic fungus Parastagonospora nodorum. In the wheat-P. nodorum pathosystem, recognition of pathogen-produced necrotrophic effectors (NEs) by dominant host genes leads to host cell death, which allows the pathogen to gain nutrients an...

  19. Molecular cloning and expression profile analysis of three sunflower (Helianthus annuus) diterpene synthase genes.

    PubMed

    Pugliesi, Claudio; Fambrini, Marco; Salvini, Mariangela

    2011-02-01

    ent-Kaurene, a key precursor of gibberellins, is formed by the action of two diterpene synthases (diTPSs), ent-copalyl diphosphate synthase (CPS), and ent-kaurene synthase (KS). The full-length cDNAs of CPS- (HaCPS1L) and KS-like (HaKS2L and HaKS3L) genes were isolated from sunflower. The amino acid sequences of HaCPS1L, HaKS2L, and HaKS3L exhibit structural features and homology to diTPSs of several plant species involved in gibberellin biosynthesis. RT-PCR analysis indicates that the expression of all genes (HaCPS1L, HaKS2L, and HaKS3L) is highly regulated during growth and development. All three diTPSs are preferentially expressed in rapidly growing tissues. HaKS2L is expressed at a much lower level than the other two diTPS genes. During seed development, the high level of both HaCPS1L and HaKS3L transcripts correlated with the period of rapid growth of the embryo. The three diTPS genes are not subjected to feedback regulation by gibberellin activity.

  20. Molecular cloning, characterization and expression of the heat shock protein 60 gene from the human pathogenic fungus Paracoccidioides brasiliensis.

    PubMed

    Izacc, S M; Gomez, F J; Jesuino, R S; Fonseca, C A; Felipe, M S; Deepe, G S; Soares, C M

    2001-10-01

    A gene encoding the heat shock protein (HSP) 60 from Paracoccidioides brasiliensis (Pb) was cloned and characterized. The hsp60 gene is composed of three exons divided by two introns. Structural analysis of the promoter detected canonical sequences characteristic of regulatory regions from eukaryotic genes. The deduced amino acid sequence of the Pb hsp60 gene and the respective cloned cDNA consists of 592 residues highly homologous to other fungal HSP60 proteins. The hsp60 gene is present as a single copy in the genome, as shown by Southern blot analysis. The HSP60 protein was isolated from Pb yeast cellular extracts. N-terminal amino acid sequencing of HSP60 confirmed that the cloned hsp60 gene correlated to the predicted protein in Pb. HSP60 expression appeared to be regulated during form transition in Pb, as different levels of expression were detected in in vitro labeling of cells and northern blot analysis. The complete coding region of Pb hsp60 was fused with plasmid pGEX-4T-3 and expressed in Escherichia coli as a glutathione S-transferase-tagged recombinant protein. The protein reacted with a mouse monoclonal antibody raised to a human recombinant HSP60. Western immunoblot experiments demonstrated that the recombinant protein and the native HSP60 were recognized by sera from humans with paracoccidioidomycosis (PCM).

  1. Molecular cloning, characterization and expression analysis of a CC chemokine gene from miiuy croaker (Miichthys miiuy).

    PubMed

    Cheng, Yuanzhi; Sun, Yuena; Shi, Ge; Wang, Rixin; Xu, Tianjun

    2012-12-01

    Chemokines are a family of structurally related chemotactic cytokines that regulate the migration of leukocytes, under both physiological and inflammatory conditions. A partial cDNA of CC chemokine gene designed as Mimi-CC3 was isolated from miiuy croaker (Miichthys miiuy) spleen cDNA library. Unknown 3' part of the cDNA was amplified by 3'-RACE. The complete cDNA of Mimi-CC3 contains an 89-nt 5'-UTR, a 303-nt open reading frame and a 441-nt 3'-UTR. Three exons and two introns were identified in Mimi-CC3. The deduced Mimi-CC3 protein sequences contain a 22 amino acids signal peptide and a 78 amino acids mature polypeptide, which possesses the typical arrangement of four cysteines as found in other known CC chemokines. It shares low amino acid sequence identities with most other fish and mammalian CC chemokines (less than 54.1 %), but shares very high identities with large yellow croaker CC chemokine (94.6 %). Phylogenetic analysis showed that Mimi-CC3 gene may have an orthologous relationship with mammalian/amphibian CCL25 gene. Tissue expression distributed analysis showed that Mimi-CC3 gene was constitutively expressed in all nine tissues examined, although at different levels. Upon stimulated with Vibrio anguillarum, the time-course analysis using a real-time PCR showed that Mimi-CC3 transcript in kidney and liver was obviously up-regulated and reached the peak levels, followed by a recovery. Mimi-CC3 expression in kidney was more strongly increased than in liver. However, down-regulation was observed in spleen. These results indicated that Mimi-CC3 plays important roles in miiuy croaker immune response as well as in homeostatic mechanisms.

  2. Molecular cloning, characterization and expression analysis of TGF-β and receptor genes in the woodchuck model.

    PubMed

    Wang, Lu; Wang, Junzhong; Liu, Yana; Wang, Baoju; Yang, Shangqing; Yu, Qing; Roggendorf, Michael; Lu, Mengji; Liu, Jia; Yang, Dongliang

    2016-12-20

    Transforming growth factor beta (TGF-β) is an important cytokine with pleiotropic regulatory functions in the immune system and in the responses against viral infections. TGF-β acts on a variety of immune cells through the cell surface TGF-β receptor (University of Duisburg-EssenTGFBR). The woodchuck has been used as a biomedical model for studies of obesity and energy balance, endocrine and metabolic function, cardiovascular, cerebrovascular and neoplastic disease. Woodchucks infected with woodchuck hepatitis virus (WHV) represent an informative animal model to study hepatitis B virus (HBV) infection. In this study, the cDNA sequences of woodchuck TGF-β1, TGF-β2, TGFBR1 and TGFBR2 were cloned, sequenced and characterized. The full-length TGFBR1 cDNA sequence consisted of 1305bp coding sequence (CDS) that encoded 434 amino acids with a molecular weight of 48.9kDa. The phylogenetic tree analysis revealed that the woodchuck TGF-β family genes had a closer genetic relationship with Ictidomys tridecemlineatus. One antibody with cross-reactivity to woodchuck TGFBR1 was identified by flow cytometry. Moreover, the expression of these genes were analyzed at the transcriptional level. The quantitative PCR analysis showed that the TGF-β family transcripts were constitutively expressed in many tissues tested. Altered expression levels of the TGF-β family transcripts in the liver of WHV infected woodchucks were observed. These results serve as a foundation for further insight into the role of the TGF-β family in viral hepatitis in woodchuck model. Our work also possesses the potential value for characterizing the TGF-β family in other related diseases, such as obesity-related diseases, metabolic disorder, cardiovascular disease and cancer.

  3. Molecular cloning and developmental expression of the caveolin gene family in the amphibian Xenopus laevis.

    PubMed

    Razani, Babak; Park, David S; Miyanaga, Yuko; Ghatpande, Ashwini; Cohen, Justin; Wang, Xiao Bo; Scherer, Philipp E; Evans, Todd; Lisanti, Michael P

    2002-06-25

    Caveolae are approximately 50-100 nm invaginations of the plasma membrane thought to form as a result of a local accumulation of cholesterol, sphingolipids, and a unique family of three proteins known as the caveolins: Cav-1, -2, and -3. Here, we report the identification, sequence, and developmental expression of the three caveolin genes in the amphibian Xenopus laevis. Sequence comparisons show that Xenopus Cav-1, -2, and -3 are approximately 80, 64, and 45% identical, respectively, to their counterparts in humans. Furthermore, Northern blotting experiments demonstrate that the Xenopus caveolins have tissue-specific expression profiles consistent with those previously reported in adult mammals. In the adult frog, Xenopus Cav-1 and Cav-2 are most abundantly expressed in the fat body and the lungs, while Xenopus Cav-3 is primarily expressed in muscle tissue types (heart and skeletal muscle). However, our temporal and spatial analyses of these expression patterns during embryogenesis reveal several novel features, with possible relevance to developmental signaling. Transcripts encoding Xenopus Cav-1 and -2 first appear in the notochord of neurula stage embryos, which represents a key signaling tissue. In contrast, Xenopus Cav-3 shows a highly specific punctate expression pattern in the embryonic epidermis, similar to previous patterns implicated in Notch signaling. These findings are in striking contrast to their steady-state expression patterns in the adult frog. Taken together, our results show that the Xenopus caveolin gene family is present and differentially expressed in both embryonic and adult tissues. This report is the first detailed study of caveolin gene expression in a developing embryo.

  4. Molecular cloning and functional characterization of beta-N-acetylglucosaminidase genes from Sf9 cells.

    PubMed

    Aumiller, Jared J; Hollister, Jason R; Jarvis, Donald L

    2006-06-01

    Sf9, a cell line derived from the lepidopteran insect, Spodoptera frugiperda, is widely used as a host for recombinant glycoprotein expression and purification by baculovirus vectors. Previous studies have shown that this cell line has one or more beta-N-acetylglucosaminidase activities that may be involved in the degradation and/or processing of N-glycoprotein glycans. However, these enzymes and their functions remain poorly characterized. Therefore, the goal of this study was to isolate beta-N-acetylglucosaminidase genes from Sf9 cells, over-express the gene products, and characterize their enzymatic activities. A degenerate PCR approach yielded three Sf9 cDNAs, which appeared to encode two distinct beta-N-acetylglucosaminidases, according to bioinformatic analyses. Baculovirus-mediated expression of these two cDNA products induced membrane-associated beta-N-acetylglucosaminidase activities in Sf9 cells, which cleaved terminal N-acetylglucosamine residues from the alpha-3 and -6 branches of a biantennary N-glycan substrate with acidic pH optima and completely hydrolyzed chitotriose to its constituent N-acetylglucosamine monomers. GFP-tagged forms of both enzymes exhibited punctate cytoplasmic fluorescence, which did not overlap with either lysosomal or Golgi-specific dyes. Together, these results indicated that the two new Sf9 genes identified in this study encode broad-spectrum beta-N-acetylglucosaminidases that appear to have unusual intracellular distributions. Their relative lack of substrate specificity and acidic pH optima are consistent with a functional role for these enzymes in glycoprotein glycan and chitin degradation, but not with a role in N-glycoprotein glycan processing.

  5. Molecular Cloning and Expression Analysis of a Catalase Gene (NnCAT) from Nelumbo nucifera.

    PubMed

    Dong, Chen; Zheng, Xingfei; Diao, Ying; Wang, Youwei; Zhou, Mingquan; Hu, Zhongli

    2015-11-01

    Rapid amplification cDNA end (RACE) assay was established to achieve the complete cDNA sequence of a catalase gene (NnCAT) from Nelumbo nucifera. The obtained full-length cDNA was 1666 bp in size and contained a 1476-bp open reading frame. The 3D structural model of NnCAT was constructed by homology modeling. The putative NnCAT possessed all the main characteristic amino acid residues and motifs of catalase (CAT) protein family, and the phylogenetic analysis revealed that NnCAT grouped together with high plants. Moreover, recombinant NnCAT showed the CAT activity (758 U/mg) at room temperature, holding high activity during temperature range of 20-50 °C, then the optimal pH of recombinant protein was assessed from pH 4 to pH 11. Additionally, real-time PCR assay demonstrated that NnCAT mRNA was expressed in various tissues of N. nucifera, with the highest expression in young leaf and lowest level in the root, and mRNA level of NnCAT was significantly augmented in response to short-time mechanical wounding. Different expression pattern of NnCAT gene suggested that NnCAT probably played a defensive role in the initial stages of oxidative stress, regulating the level of reactive oxygen species (ROS) by extracellular stimuli such as short-time mechanical wounding.

  6. Molecular cloning and functional characterization of a mouse gene upregulated by lipopolysaccharide treatment reveals alternative splicing

    SciTech Connect

    Du, Kejun; Chen, Yaoming; Dai, Zongming; Bi, Yuan; Cai, Tongjian; Hou, Lichao; Chai, Yubo; Song, Qinghe; Chen, Sumin; Luo, Wenjing; Chen, Jingyuan

    2010-01-01

    Treatment of mouse cells with lipopolysaccharide (LPS) potently initiates an inflammatory response, but the underlying mechanisms are unclear. We therefore sought to characterize cDNA sequences of a new mouse LPS-responsive gene, and to evaluate the effects of MLrg. Full-length cDNAs were obtained from LPS-treated NIH3T3 cells. We report that the MLrg gene produces two alternative splice products (GenBank Accession Nos. (DQ316984) and (DQ320011)), respectively, encoding MLrgW and MLrgS polypeptides. Both proteins contain zinc finger and leucine zipper domains and are thus potential regulators of transcription. Expression of MLrgW and MLrgS were robustly upregulated following LPS treatment, and the proteins were localized predominantly in the nuclear membrane and cytoplasm. In stable transfectants over-expressing MLrgW the proportion of cells in G1 phase was significantly reduced, while in cells over-expressing MLrgS the proportion of cells in G2 was significantly increased; both proteins are thus potential regulators of cell cycle progression. Upregulation of MLrgW and MLrgS may be an important component of the LPS inflammatory pathway and of the host response to infection with GNB.

  7. Molecular cloning, expression profiles, and characterization of a novel polyphenol oxidase (PPO) gene in Hevea brasiliensis.

    PubMed

    Li, Dejun; Deng, Zhi; Liu, Changren; Zhao, Manman; Guo, Huina; Xia, Zhihui; Liu, Hui

    2014-01-01

    The polyphenol oxidase (PPO) is involved in undesirable browning in many plant foods. Although the PPOs have been studied by several researchers, the isolation and expression profiles of PPO gene were not reported in rubber tree. In this study, a new PPO gene, HbPPO, was isolated from Hevea brasiliensis. The sequence alignment showed that HbPPO indicated high identities to plant PPOs and belonged to dicot branch. The cis-acting regulatory elements related to stress/hormone responses were predicted in the promoter region of HbPPO. Real-time RT-PCR analyses showed that HbPPO expression varied widely depending on different tissues and developmental stages of leaves. Besides being associated with tapping panel dryness, the HbPPO transcripts were regulated by ethrel, wounding, H2O2, and methyl jasmonate treatments. Moreover, the correlation between latex coagulation rate and PPO activity was further confirmed in this study. Our results lay the foundation for further analyzing the function of HbPPO in rubber tree.

  8. Molecular cloning, characteristics and low temperature response of raffinose synthase gene in Cucumis sativus L.

    PubMed

    Sui, Xiao-lei; Meng, Fan-zhen; Wang, Hong-yun; Wei, Yu-xia; Li, Rui-fu; Wang, Zhen-yu; Hu, Li-ping; Wang, Shao-hui; Zhang, Zhen-xian

    2012-12-15

    Raffinose synthase (RS, EC2.4.1.82) is one of the key enzymes that channels sucrose into the raffinose family oligosaccharides (RFOs) biosynthetic pathway. However, the gene encoding RS is poorly characterized in cucumber (Cucumis sativus L.), which is a typical RFOs-translocating plant species. Here we isolated the gene encoding RS (CsRS) from the leaves of cucumber plants. The complete cDNA of CsRS consisted of 2552 nucleotides with an open reading frame encoding a polypeptide of 784 amino acid residues. Reverse transcription-polymerase chain reaction and RNA hybridization analysis revealed that expression of CsRS was the highest in leaves followed by roots, fruits, and stems. The RS activity was up-regulated and the raffinose content was high in the leaves of transgenic tobacco with over-expression of CsRS, while both the RS activity and the raffinose content decreased in the transgenic cucumber plants with anti-sense expression of CsRS. The expression of CsRS could be induced by low temperature and exogenous phytohormone abscisic acid (ABA). In cucumber growing under low temperature stress, CsRS expression, RS activity and raffinose content increased gradually in the leaves, the fruits, the stems and the roots. The most notable increase was observed in the leaves. Similarly, the expression of CsRS was induced in cucumber leaves and fruits with 200 μM and 150 μM ABA treatments, respectively.

  9. Molecular cloning and characterisation of sea bass (Dicentrarchus labrax L.) caspase-3 gene.

    PubMed

    Reis, Marta I R; Nascimento, Diana S; do Vale, Ana; Silva, Manuel T; dos Santos, Nuno M S

    2007-02-01

    Caspase-3 is one of the major caspases operating in apoptosis, cleaving and inactivating a number of molecules and largely contributing to the apoptotic phenotype and the dismantling of the apoptoting cell. The opening reading frame of sea bass (Dicentrarchus labrax L.) caspase-3 has 281 amino acids. The complete sequence of caspase-3 shows a very close homology to the correspondent sequence from other vertebrates, in particularly with that of Takifugu rubripes and Oryzias latipes, with 87.7 and 87.9% of similarity, respectively. Furthermore, the sea bass caspase-3 sequence retains the motifs that are functionally important, such as the pentapeptide active-site motif (QACRG) and the putative cleavage sites at the aspartic acids. In the sea bass genome, the caspase-3 gene exists as a single copy gene and is organised in six exons and five introns. A very low expression of caspase-3 was detected by RT-PCR in various organs of non-stimulated sea bass, with slightly higher levels in thymus and heart and was increased in head kidneys of Photobacterium damselae ssp. piscicida infected sea bass. This increased expression was accompanied by the occurrence of high numbers of apoptoting cells with activated caspase-3.

  10. Molecular cloning of ADIR, a novel interferon responsive gene encoding a protein related to the torsins.

    PubMed

    Dron, Michel; Meritet, Jean François; Dandoy-Dron, Françoise; Meyniel, Jean-Philippe; Maury, Chantal; Tovey, Michael G

    2002-03-01

    The expression of the previously uncharacterized gene Adir (for ATP dependent interferon responsive gene) was increased by 5- to 15-fold in tissue of the oral cavity or in spleen and liver of mice treated orally or intraperitoneally with IFN-alpha, and in mouse cells treated in vitro with IFN-alpha or IFN-gamma. The level of Adir mRNA was also increased 20- to 40-fold in the brains of animals infected with encephalomyocarditis virus. Adir is expressed ubiquitously in mouse tissues as 1.9-, 2.4-, and 3.5-kb mRNA transcripts encoding a 385-amino-acid protein with a conserved ATP binding domain containing typical nucleotide and Mg(2+) binding sites. We also characterized the human ortholog, ADIR, which is located on chromosome 1q25-q31 and contains six exons encoding a 397-amino-acid protein with 80% homology to the mouse protein. A single 2.3-kb mRNA was detected in all human tissues examined, except for placenta, which also contained a 1.25-kb tissue-specific transcript generated by alternative splicing and encoding a putative 336-amino-acid protein. Although ADIR exhibits low homology to DYT1 and TOR1B, the deduced ADIR protein sequences are highly homologous to torsin A and torsin B and more distantly related to members of the Clp/HSP100 family of proteins, suggesting that ADIR, like torsins, is related to the AAA chaperone-like family of ATPases. An ADIR-EGFP fusion protein expressed in HeLa cells was shown to be associated with the endoplasmic reticulum.

  11. Molecular cloning and characterization of genes involved in rosmarinic acid biosynthesis from Prunella vulgaris.

    PubMed

    Kim, Yeon Bok; Shin, YouJin; Tuan, Pham Anh; Li, Xiaohua; Park, Yunji; Park, Nam-il; Park, Sang Un

    2014-01-01

    Prunella vulgaris L., commonly known as "self-heal" or "heal-all," is a perennial herb with a long history of medicinal use. Phenylalanine ammonia-lyase (PAL), cinnamate 4-hydroxylase (C4H), and 4-coumarate:coenzyme-A (CoA) ligase (4CL) are important enzymes in the phenylpropanoid pathway and in the accumulation of rosmarinic acid (RA), which is a major secondary metabolite in P. vulgaris. In this study, we isolated cDNAs encoding PvPAL, PvC4H, and Pv4CL from P. vulgaris using rapid amplification of cDNA ends polymerase chain reaction (PCR). The amino acid sequence alignments of PvPAL, PvC4H, and Pv4CL showed high sequence identity to those of other plants. Quantitative real-time PCR analysis was used to determine the transcript levels of genes involved in RA biosynthesis in the flowers, leaves, stems, and roots of P. vulgaris. The transcript levels of PvPAL, PvC4H, and Pv4CL1 were the highest in flowers, whereas Pv4CL2 was the highest in roots. High-performance liquid chromatography analysis also showed the highest RA content in the flowers (3.71 mg/g dry weight). We suggest that the expression of the PvPAL, PvC4H, and Pv4CL1 genes is correlated with the accumulation of RA. Our results revealed that P. vulgaris flowers are appropriate for medicinal usage, and our findings provide support for increasing RA production in this plant.

  12. Molecular cloning and characterization of Escherichia coli K12 ygjG gene

    PubMed Central

    Samsonova, Natalya N; Smirnov, Sergey V; Altman, Irina B; Ptitsyn, Leonid R

    2003-01-01

    Background Putrescine is the intermediate product of arginine decarboxylase pathway in Escherichia coli which can be used as an alternative nitrogen source. Transaminase and dehydrogenase enzymes seem to be implicated in the degradative pathway of putrescine, in which this compound is converted into γ-aminobutyrate. But genes coding for these enzymes have not been identified so far. Results The 1.8-kbp DNA fragment containing E. coli K12 ygjG gene with aer-ygjG intergenic region was examined. It was found that the fragment contains σ54-depended open reading frame (ORF) of 1,380 nucleotides encoding a 459-amino acid polypeptide of approximately 49.6 kDa. The cytidine (C) residue localized 10 bp downstream of the σ54 promoter sequence was identified as the first mRNA base. The UUG translation initiation codon is situated 36 nucleotides downstream of the mRNA start. The YgjG was expressed as a his6-tag fused protein and purified to homogeneity. The protein catalyzed putrescine:2-oxoglutaric acid (2-OG) aminotransferase reaction (PATase, EC 2.6.1.29). The Km values for putrescine and 2-OG were found to be 9.2 mM and 19.0 mM, respectively. The recombinant enzyme also was able to transaminate cadaverine and, in lower extent, spermidine, and gave maximum activity at pH 9.0. Conclusion Expression of E. coli K12 ygjG coding region revealed σ54-depended ORF which encodes a 459-amino acid protein with putrescine:2-OG aminotransferase activity. The enzyme also was able to transaminate cadaverine and, in lower extent, spermidine. PMID:12617754

  13. Molecular cloning of the yeast mitochondrial aconitase gene (ACO1) and evidence of a synergistic regulation of expression by glucose plus glutamate.

    PubMed Central

    Gangloff, S P; Marguet, D; Lauquin, G J

    1990-01-01

    We have isolated genomic clones complementing the aconitase-deficient strain (glu1-1) of Saccharomyces cerevisiae. Identification of the aconitase gene was established by enzymatic assays and molecular analyses. The corresponding mRNA has been characterized, and its direction of transcription has been determined. The complete nucleotide sequence revealed strong amino acid homologies with the sequences of some peptides isolated from the mammalian protein. Disruption of the gene by deletion-insertion led to glutamate auxotrophy. Expression of the aconitase gene was sensitive to glucose repression and was synergistically down regulated by glucose and glutamate. Images PMID:1972545

  14. Designing and Cloning Molecular Constructs to Knock Out N-Acetylglucosamine Phosphatidylinositol De-N-Acetylase (GPI12) Gene in Leishmania major (MRHO/IR/75/ER)

    PubMed Central

    GHASEMI NEJAD ALMANI, Pooya; SHARIFI, Iraj; KAZEMI, Bahram; BABAEI, Zahra; BANDEHPOUR, Mojgan; SALARI, Samira; SAEDI DEZAKI, Ebrahim

    2016-01-01

    Background: Leishmaniasis represents a major public health concern in tropical and sub-tropical countries. At present, there is no efficacious vaccine against the disease and new control methods are needed. One way to access this important goal is to knock out genes of specific macromolecules to evaluate the effect of deletion on the growth, multiplication, pathogenesis and immunity of the parasite. The aim of this study was to design and clone molecular constructs to knock out N-acetylglucosamine phosphatidylinositol de-N-acetylase (GPI12) gene in Leishmania major. Methods: For designing and making molecular constructs, we used pLEXSY-neo2 and pLEXSY-hyg2 vectors. The molecular constructs were cloned in E. coli strain Top10. The molecular constructs were transfected by electroporation into L. major in two stages. Results: The molecular constructs were confirmed by Colony PCR and sequencing. The recombinant strains were isolated by selective antibiotics, after which they were confirmed by PCR, Southern and Western blots. Conclusion: Recombinant parasites were created and examined for subsequent study. With the use of molecular constructs, it was possible to remove and study gene GPI12 and to achieve a live recombinant Leishmania parasite that maintained the original form of the antigenic parasites. This achievement can be used as an experimental model for vaccine development studies. Further investigations are essential to check this model in a suitable host. PMID:28127356

  15. Molecular cloning of a Brassica napus thiohydroximate S-glucosyltransferase gene and its expression in Escherichia coli.

    PubMed

    Marillia, Elizabeth-France; MacPherson, Jim M.; Tsang, Edward W. T.; Van Audenhove, Katrien; Keller, Wilf A.; GrootWassink, Jan W. D.

    2001-10-01

    A genomic clone encoding a thiohydroximate S-glucosyltransferase (S-GT) was isolated from Brassica napus by library screening with probes generated by PCR using degenerated primers. Its corresponding cDNA was amplified by rapid amplification of cDNA ends (RACE) PCR and also cloned by cDNA library screening. The genomic clone was 5 896 bp long and contained a 173-bp intron. At least two copies of the S-GT gene were present in B. napus. The full-length cDNA clone was 1.5 kb long and contained an open reading frame encoding a 51-kDa polypeptide. The deduced amino acid sequence shared a significant degree of homology with other glucosyltransferases characterized in other species, including a highly conserved motif within this family of enzymes corresponding to the glucose-binding domain. The recombinant protein was expressed in Escherichia coli, and the enzyme activity was tested by a biochemical assay based on the measure of glucose incorporation. The high thiohydroximate S-GT activity detected from the recombinant protein confirmed that this clone was indeed a S-glucosyltransferase.

  16. Molecular cloning, expression analysis and cellular localization of an LFRFamide gene in the cuttlefish Sepiella japonica.

    PubMed

    Cao, Zi-Hao; Sun, Lian-Lian; Chi, Chang-Feng; Liu, Hui-Hui; Zhou, Li-Qing; Lv, Zhen-Ming; Wu, Chang-Wen

    2016-06-01

    Neuropeptides are important regulators of physiological processes in metazoans, such as feeding, reproduction, and heart activities. In this study, an LFRFamide gene was identified from the cuttlefish Sepiella japonica (designated as SjLFRFamide). The full-length sequence of SjLFRFamide cDNA has 841bp, and the open reading frame contains 567bp encoding 188 amino acids, which shared high similarity with precursor SOFaRP2 from Sepia officinalis. The deduced SjLFRFamdie precursor protein contains a signal peptide and four different FLPs (FMRFamide-like peptides): one pentapeptide (TIFRFamide), two hexapeptides (NSLFRFamide and GNLFRFamide) and one heptapeptide (PHTPFRFamide). Multiple sequence alignment showed that SjLFRFamide contains rather conserved mature peptides, which all ended in FRF. The phylogenetic analysis suggests that SjLFRFamide belongs to the LFRFamide subfamily. The tissue distribution analysis through quantitative real-time PCR method showed that SjLFRFamide mRNA is significantly expressed in the brain, and slight trace are detected in female nidamental gland and accessory nidamental gland. In situ hybridization assay of the brain indicated that SjLFRFamide is transcribed in several different functional lobes, suggesting SjLFRFamide might associate with multiple physiological regulations, such as feeding, chromatophore regulation and reproduction. This is the first study describing LFRFamide in S. japonica, which might have great importance for cuttlefish artificial breeding.

  17. Molecular cloning and characterization of novel phytocystatin gene from turmeric, Curcuma longa.

    PubMed

    Chan, Seow-Neng; Abu Bakar, Norliza; Mahmood, Maziah; Ho, Chai-Ling; Shaharuddin, Noor Azmi

    2014-01-01

    Phytocystatin, a type of protease inhibitor (PI), plays major roles in plant defense mechanisms and has been reported to show antipathogenic properties and plant stress tolerance. Recombinant plant PIs are gaining popularity as potential candidates in engineering of crop protection and in synthesizing medicine. It is therefore crucial to identify PI from novel sources like Curcuma longa as it is more effective in combating against pathogens due to its novelty. In this study, a novel cDNA fragment encoding phytocystatin was isolated using degenerate PCR primers, designed from consensus regions of phytocystatin from other plant species. A full-length cDNA of the phytocystatin gene, designated CypCl, was acquired using 5'/3' rapid amplification of cDNA ends method and it has been deposited in NCBI database (accession number KF545954.1). It has a 687 bp long open reading frame (ORF) which encodes 228 amino acids. BLAST result indicated that CypCl is similar to cystatin protease inhibitor from Cucumis sativus with 74% max identity. Sequence analysis showed that CypCl contains most of the motifs found in a cystatin, including a G residue, LARFAV-, QxVxG sequence, PW dipeptide, and SNSL sequence at C-terminal extension. Phylogenetic studies also showed that CypCl is related to phytocystatin from Elaeis guineensis.

  18. Molecular Cloning and Characterization of Novel Phytocystatin Gene from Turmeric, Curcuma longa

    PubMed Central

    Chan, Seow-Neng; Abu Bakar, Norliza; Mahmood, Maziah; Ho, Chai-Ling

    2014-01-01

    Phytocystatin, a type of protease inhibitor (PI), plays major roles in plant defense mechanisms and has been reported to show antipathogenic properties and plant stress tolerance. Recombinant plant PIs are gaining popularity as potential candidates in engineering of crop protection and in synthesizing medicine. It is therefore crucial to identify PI from novel sources like Curcuma longa as it is more effective in combating against pathogens due to its novelty. In this study, a novel cDNA fragment encoding phytocystatin was isolated using degenerate PCR primers, designed from consensus regions of phytocystatin from other plant species. A full-length cDNA of the phytocystatin gene, designated CypCl, was acquired using 5′/3′ rapid amplification of cDNA ends method and it has been deposited in NCBI database (accession number KF545954.1). It has a 687 bp long open reading frame (ORF) which encodes 228 amino acids. BLAST result indicated that CypCl is similar to cystatin protease inhibitor from Cucumis sativus with 74% max identity. Sequence analysis showed that CypCl contains most of the motifs found in a cystatin, including a G residue, LARFAV-, QxVxG sequence, PW dipeptide, and SNSL sequence at C-terminal extension. Phylogenetic studies also showed that CypCl is related to phytocystatin from Elaeis guineensis. PMID:25853138

  19. Molecular cloning and characterization of a flavanone 3-Hydroxylase gene from Artemisia annua L.

    PubMed

    Xiong, Shuo; Tian, Na; Long, Jinhua; Chen, Yuhong; Qin, Yu; Feng, Jinyu; Xiao, Wenjun; Liu, Shuoqian

    2016-08-01

    Flavonoids were found to synergize anti-malaria and anti-cancer compounds in Artemisia annua, a very important economic crop in China. In order to discover the regulation mechanism of flavonoids in Artemisia annua, the full length cDNA of flavanone 3-hydroxylase (F3H) were isolated from Artemisia annua for the first time by using RACE (rapid amplification of cDNA ends). The completed open read frame of AaF3H was 1095 bp and it encoded a 364-amino acid protein with a predicted molecular mass of 41.18 kDa and a pI of 5.67. The recombinant protein of AaF3H was expressed in E. coli BL21(DE3) as His-tagged protein, purified by Ni-NTA agrose affinity chromatography, and functionally characterized in vitro. The results showed that the His-tagged protein (AaF3H) catalyzed naringenin to dihydrokaempferol in the present of Fe(2+). The Km for naringenin was 218.03 μM. The optimum pH for AaF3H reaction was determined to be pH 8.5, and the optimum temperature was determined to be 35 °C. The AaF3H transcripts were found to be accumulated in the cultivar with higher level of flavonoids than that with lower level of flavonoids, which implied that AaF3H was a potential target for regulation of flavonoids biosynthesis in Artemisia annua through metabolic engineering.

  20. Molecular cloning of a mouse DNA repair gene that complements the defect of group-A xeroderma pigmentosum

    SciTech Connect

    Tanaka, K.; Satokata, I.; Ogita, Z.; Uchida, T.; Okada, Y.

    1989-07-01

    For isolation of the gene responsible for xeroderma pigmentosum (XP) complementation group A, plasmid pSV2gpt and genomic DNA from a mouse embryo were cotransfected into XP2OSSV cells, a group-A XP cell line. Two primary UV-resistant XP transfectants were isolated from about 1.6 X 10(5) pSV2gpt-transformed XP colonies. pSV2gpt and genomic DNA from the primary transfectants were again cotransfected into XP2OSSV cells and a secondary UV-resistant XP transfectant was obtained by screening about 4.8 X 10(5) pSV2gpt-transformed XP colonies. The secondary transfectant retained fewer mouse repetitive sequences. A mouse gene that complements the defect of XP2OSSV cells was cloned into an EMBL3 vector from the genome of a secondary transfectant. Transfections of the cloned DNA also conferred UV resistance on another group-A XP cell line but not on XP cell lines of group C, D, F, or G. Northern blot analysis of poly(A)+ RNA with a subfragment of cloned mouse DNA repair gene as the probe revealed that an approximately 1.0 kilobase mRNA was transcribed in the donor mouse embryo and secondary transfectant, and approximately 1.0- and approximately 1.3-kilobase mRNAs were transcribed in normal human cells, but none of these mRNAs was detected in three strains of group-A XP cells. These results suggest that the cloned DNA repair gene is specific for group-A XP and may be the mouse homologue of the group-A XP human gene.

  1. Molecular cloning of a mouse DNA repair gene that complements the defect of group-A xeroderma pigmentosum.

    PubMed Central

    Tanaka, K; Satokata, I; Ogita, Z; Uchida, T; Okada, Y

    1989-01-01

    For isolation of the gene responsible for xeroderma pigmentosum (XP) complementation group A, plasmid pSV2gpt and genomic DNA from a mouse embryo were cotransfected into XP2OSSV cells, a group-A XP cell line. Two primary UV-resistant XP transfectants were isolated from about 1.6 X 10(5) pSV2gpt-transformed XP colonies. pSV2gpt and genomic DNA from the primary transfectants were again cotransfected into XP2OSSV cells and a secondary UV-resistant XP transfectant was obtained by screening about 4.8 X 10(5) pSV2gpt-transformed XP colonies. The secondary transfectant retained fewer mouse repetitive sequences. A mouse gene that complements the defect of XP2OSSV cells was cloned into an EMBL3 vector from the genome of a secondary transfectant. Transfections of the cloned DNA also conferred UV resistance on another group-A XP cell line but not on XP cell lines of group C, D, F, or G. Northern blot analysis of poly(A)+ RNA with a subfragment of cloned mouse DNA repair gene as the probe revealed that an approximately 1.0 kilobase mRNA was transcribed in the donor mouse embryo and secondary transfectant, and approximately 1.0- and approximately 1.3-kilobase mRNAs were transcribed in normal human cells, but none of these mRNAs was detected in three strains of group-A XP cells. These results suggest that the cloned DNA repair gene is specific for group-A XP and may be the mouse homologue of the group-A XP human gene. Images PMID:2748601

  2. Molecular Cloning and Expression Analysis of Eight PgWRKY Genes in Panax ginseng Responsive to Salt and Hormones.

    PubMed

    Xiu, Hao; Nuruzzaman, Mohammed; Guo, Xiangqian; Cao, Hongzhe; Huang, Jingjia; Chen, Xianghui; Wu, Kunlu; Zhang, Ru; Huang, Yuzhao; Luo, Junli; Luo, Zhiyong

    2016-03-04

    Despite the importance of WRKY genes in plant physiological processes, little is known about their roles in Panax ginseng C.A. Meyer. Forty-eight unigenes on this species were previously reported as WRKY transcripts using the next-generation sequencing (NGS) technology. Subsequently, one gene that encodes PgWRKY1 protein belonging to subgroup II-d was cloned and functionally characterized. In this study, eight WRKY genes from the NGS-based transcriptome sequencing dataset designated as PgWRKY2-9 have been cloned and characterized. The genes encoding WRKY proteins were assigned to WRKY Group II (one subgroup II-c, four subgroup II-d, and three subgroup II-e) based on phylogenetic analysis. The cDNAs of the cloned PgWRKYs encode putative proteins ranging from 194 to 358 amino acid residues, each of which includes one WRKYGQK sequence motif and one C₂H₂-type zinc-finger motif. Quantitative real-time PCR (qRT-PCR) analysis demonstrated that the eight analyzed PgWRKY genes were expressed at different levels in various organs including leaves, roots, adventitious roots, stems, and seeds. Importantly, the transcription responses of these PgWRKYs to methyl jasmonate (MeJA) showed that PgWRKY2, PgWRKY3, PgWRKY4, PgWRKY5, PgWRKY6, and PgWRKY7 were downregulated by MeJA treatment, while PgWRKY8 and PgWRKY9 were upregulated to varying degrees. Moreover, the PgWRKY genes increased or decreased by salicylic acid (SA), abscisic acid (ABA), and NaCl treatments. The results suggest that the PgWRKYs may be multiple stress-inducible genes responding to both salt and hormones.

  3. Molecular cloning and regulatory analysis of the cuticle-degrading-protease structural gene from the entomopathogenic fungus Metarhizium anisopliae.

    PubMed

    St Leger, R J; Frank, D C; Roberts, D W; Staples, R C

    1992-03-15

    The proteinaceous insect cuticle is an effective barrier against most microbes, but entomopathogenic fungi can breach it using extracellular proteases. We report here the isolation and characterization of a cDNA clone of the cuticle-degrading protease (Pr1) of Metarhizium anisopliae. The cDNA sequence revealed that Pr1 is synthesized as a large precursor (40.3 kDa) containing a signal peptide, a propeptide and the mature protein predicted to have a molecular mass of 28.6 kDa. The primary structure of Pr1 has extensive similarity with enzymes of the subtilisin subclass of serine endopeptidases and the serine, histidine and aspartate components of the active site in subtilisins are preserved. Proteinase K demonstrated the closest sequence similarity to Pr1 (61%) but Pr1 was twofold more effective than proteinase K at degrading isolated cuticles of Manduca sexta and 33-fold more effective at degrading structural proteins bound to the cuticle by covalent bonds. We postulate that the additional positively charged residues on the surface of the Pr1 molecule, as determined using proteinase K, may facilitate electrostatic binding to cuticle proteins which is a prerequisite for activity. Northern-blot analysis of RNA and nuclear run-on assays demonstrated transcriptional control of the expression of Pr1 during nutrient deprivation and during the formation of infection structures. Southern-blot analysis demonstrated that genes with significant homologies to Metarhizium Pr1 were present in the entomopathogens Aspergillus flavus and Verticillium lecanii but not Zoophthora (= Erynia) radicans.

  4. Molecular cloning and differential expression analysis of a squalene synthase gene from Dioscorea zingiberensis, an important pharmaceutical plant.

    PubMed

    Ye, Yun; Wang, Runfa; Jin, Liang; Shen, Junhao; Li, Xiaotong; Yang, Ting; Zhou, Mengzhuo; Yang, Zhifan; Chen, Yongqin

    2014-09-01

    Diosgenin is a steroid derived from cholesterol in plants and used as a typical initial intermediate for synthesis of numerous steroidal drugs in the world. Commercially, this compound is extracted mainly from the rhizomes or tubers of some Dioscorea species. Squalene synthase (SQS: EC 2.5.1.21) catalyzes the condensation of two molecules of farnesyl diphosphate to form squalene, the first committed step for biosynthesis of plant sterols including cholesterol, and is thought to play an important role in diosgenin biosynthesis. A full-length cDNA of a putative squalene synthase gene was cloned from D. zingiberensis and designated as DzSQS (Genbank Accession Number KC960673). DzSQS was contained an open reading frame of 1,230 bp encoding a polypeptide of 409 amino acids with a predicted molecular weight of 46 kDa and an isoelectric point of 6.2. The deduced amino acid sequence of DzSQS shared over 70 % sequence identity with those of SQSs from other plants. The truncated DzSQS in which 24 amino acids were deleted from the carboxy terminus was expressed in Escherichia coli, and the resultant bacterial crude extract was incubated with farnesyl diphosphate and NADPH. GC-MS analysis showed that squalene was detected in the in vitro reaction mixture. Quantitative real-time PCR analysis revealed that DzSQS was expressed from highest to lowest order in mature leaves, newly-formed rhizomes, young leaves, young stems, and two-year-old rhizomes of D. zingiberensis.

  5. Molecular cloning and mRNA expression of geraniol-inducible genes in cultured shoot primordia of Matricaria chamomilla.

    PubMed

    Ashida, Yoshiyuki; Nishimoto, Masaki; Matsushima, Akihito; Watanabe, Junko; Hirata, Toshifumi

    2002-11-01

    Genes for two geraniol-responsive factors, designated McEREBP1 and McWRKY1, from cultured shoot primordia of Matricaria chamomilla were cloned. The deduced amino acid sequences of these genes were highly similar to those of the family of ethylene-responsive element binding proteins and elicitor-induced DNA-binding proteins containing a WRKY domain, respectively. The levels of McEREBP1 and McWRKY1 mRNAs were maximum when measured 1 h after treatment of the cultured cells with geraniol.

  6. Molecular cloning and expression analysis of small ubiquitin-like modifier (SUMO) genes from grouper (Epinephelus coioides).

    PubMed

    Xu, Meng; Wei, Jingguang; Chen, Xiuli; Gao, Pin; Zhou, Yongcan; Qin, Qiwei

    2016-01-01

    Small ubiquitin-like modifier (SUMO) is a group of proteins binding to lysine residues of target proteins and thereby modifying their stability, activity and subcellular localization. In the present study, two SUMO homolog genes (EcSUMO1 and EcSUMO2) from grouper (Epinephelus coioides) were cloned and characterized. The full-length sequence of EcSUMO1 was 749 bp in length and contained a predicted open reading frame of 306 bp encoding 101 amino acids with a molecular mass of 11.34 kDa. The full-length sequence of EcSUMO2 was 822 bp in length and contained a predicted open reading frame of 291 bp encoding 96 amino acids with a molecular mass of 10.88 kDa EcSUMO1 shares 44.55% identity with EcSUMO2. EcSUMO1 shares 99%, 90%, and 88% identity with those from Oreochromis niloticus, Danio rerio, and Homo sapiens, respectively. EcSUMO2 shares 98%, 93%, and 96% identity with those from Anoplopoma fimbria, D.rerio, and H. sapiens, respectively. Quantitative real-time PCR analysis indicated that EcSUMO1 and EcSUMO2 were constitutively expressed in all of the analyzed tissues in healthy grouper, but the expression of EcSUMO2 was higher than that of EcSUMO1. EcSUMO1 and EcSUMO2 were identified as a remarkably (P < 0.01) up-regulated responding to poly(I:C) and Singapore grouper iridovirus (SGIV) stimulation in head kidney of groupers. EcSUMO1 and EcSUMO2 were distributed in both cytoplasm and nucleus in GS cells. Over-expressed EcSUMO1 and EcSUMO2 enhanced SGIV and Red-spotted grouper nervous necrosis virus (RGNNV) replication during viral infection in vitro. Our study was an important attempt to understand the SUMO pathway in fish, which may provide insights into the regulatory mechanism of viral infection in E.coioides under farmed conditions.

  7. Expressed sequence tags and molecular cloning and characterization of gene encoding pinoresinol/lariciresinol reductase from Podophyllum hexandrum.

    PubMed

    Wankhede, Dhammaprakash Pandhari; Biswas, Dipul Kumar; Rajkumar, Subramani; Sinha, Alok Krishna

    2013-12-01

    Podophyllotoxin, an aryltetralin lignan, is the source of important anticancer drugs etoposide, teniposide, and etopophos. Roots/rhizome of Podophyllum hexandrum form one of the most important sources of podophyllotoxin. In order to understand genes involved in podophyllotoxin biosynthesis, two suppression subtractive hybridization libraries were synthesized, one each from root/rhizome and leaves using high and low podophyllotoxin-producing plants of P. hexandrum. Sequencing of clones identified a total of 1,141 Expressed Sequence Tags (ESTs) resulting in 354 unique ESTs. Several unique ESTs showed sequence similarity to the genes involved in metabolism, stress/defense responses, and signalling pathways. A few ESTs also showed high sequence similarity with genes which were shown to be involved in podophyllotoxin biosynthesis in other plant species such as pinoresinol/lariciresinol reductase. A full length coding sequence of pinoresinol/lariciresinol reductase (PLR) has been cloned from P. hexandrum which was found to encode protein with 311 amino acids and show sequence similarity with PLR from Forsythia intermedia and Linum spp. Spatial and stress-inducible expression pattern of PhPLR and other known genes of podophyllotoxin biosynthesis, secoisolariciresinol dehydrogenase (PhSDH), and dirigent protein oxidase (PhDPO) have been studied. All the three genes showed wounding and methyl jasmonate-inducible expression pattern. The present work would form a basis for further studies to understand genomics of podophyllotoxin biosynthesis in P. hexandrum.

  8. Three slow skeletal muscle troponin genes in small-tailed Han sheep (Ovis aries): molecular cloning, characterization and expression analysis.

    PubMed

    Sun, Yan; Wang, Guizhi; Ji, Zhibin; Chao, Tianle; Liu, Zhaohua; Wang, Xiaolong; Liu, Guanqing; Wu, Changhao; Wang, Jianmin

    2016-09-01

    To explore the basic characteristics and expressing profile of the three slow skeletal muscle troponin genes TNNC1 (Troponin C type 1), TNNI1 (troponin I type 1) and TNNT1 (troponin T type 1). Three purebred Dorper sheep and another three purebred small-tailed Han sheep were selected. The sequence of the genes from the small-tailed Han sheep was cloned using rapid amplification of cDNA ends and reverse transcription-polymerase chain reaction; The characteristics of the predicted amino acids sequences were analyzed using bioinformatics analysis software; Gene expression analyses were performed using quantitative reverse transcription PCR. The full-length cDNA sequences of the genes were 707, 898, and 1001 bp, respectively, and were submitted to GenBank under accession numbers KR153938, KT218688 and KT218690. The three predicted proteins were predicted to be hydrophilic, non-secretory proteins and contain several phosphorylation sites. Multiple alignments and phylogenetic tree analyses showed that the predicted proteins were relatively conserved in mammals. The expression results of the three genes in eight tissues of Dorper and small-tailed Han sheep revealed that the three genes had a similar mRNA expression pattern, whereas distinct differences were observed among the eight tissues of the two sheep species. We cloned the full-length cDNA of the three genes, analyzed the amino acid sequences, and determined the expression levels of the genes. These results might play important roles in facilitating the future research of the three genes.

  9. Molecular cloning and characterization of the obg gene of Streptomyces griseus in relation to the onset of morphological differentiation.

    PubMed Central

    Okamoto, S; Itoh, M; Ochi, K

    1997-01-01

    Morphological differentiation in microorganisms is usually accompanied by a decrease in intracellular GTP pool size, as has been demonstrated in bacillaceae, streptomycetaceae, and yeasts. The obg gene, which codes for a GTP-binding protein belonging to the GTPase superfamily of proteins, was cloned from Streptomyces griseus IFO13189. The gene is located just downstream of the genes for ribosomal proteins L21 and L27, encoded a protein of 478 amino acids (51 kDa), and possessed three consensus motifs which confer GTP-binding ability; Obg protein expressed in Escherichia coli bound GTP, as demonstrated using a UV cross-linking method. Introduction of multiple copies of obg into wild-type S. griseus suppressed aerial mycelium development in cells on solid media. However, no effect on streptomycin production was detected, indicating that Obg is involved in the regulation of the onset of morphological but not physiological differentiation. Multiple copies of obg also suppressed submerged spore formation in liquid culture. Southern hybridization studies indicated that genes homologous to obg exist widely in streptomycetes, and an obg homolog was successfully cloned from S. coelicolor A3(2). We propose that by monitoring the intracellular GTP pool size, the Obg protein is involved in sensing changes in the nutritional environment leading ultimately to morphological differentiation. PMID:8981995

  10. Molecular cloning of functional genes for high growth-temperature and salt tolerance of the basidiomycete Fomitopsis pinicola isolated in a mangrove forest in Micronesia.

    PubMed

    Miyazaki, Yasumasa; Hiraide, Masakazu; Shibuya, Hajime

    2007-01-01

    Several functional genes encoding putative proteins, heat shock protein 70, sphingosine phosphate lyase, and Na+/H+ antiporter, were cloned from the basidiomycete Fomitopsis pinicola, a wood-rotting fungus isolated in the tropical mangrove forest of Pohnpei Island of the Federated States of Micronesia. The deduced amino acid sequences of the obtained genes involved in heat shock resistance, lipid synthesis, and salt tolerance showed diverse similarities to other homologous proteins. Molecular phylogenetic trees of these proteins suggested that encoded proteins of the cloned genes of F. pinicola differed remarkably from other homologs in various organisms, even fungal proteins. Putative candidates for other genes related to several cellular metabolisms were also amplified, implying the possible existence of those genes in F. pinicola. This is the first report of possibly functional genes derived from a basidiomycetous mushroom growing in tropical islands such as Micronesia. The genes found in this study might play important roles in the cellular survival of the basidiomycete F. pinicola under severe environmental conditions.

  11. Molecular cloning and expression of genes encoding a novel dioxygenase involved in low- and high-molecular-weight polycyclic aromatic hydrocarbon degradation in Mycobacterium vanbaalenii PYR-1.

    PubMed

    Kim, Seong-Jae; Kweon, Ohgew; Freeman, James P; Jones, Richard C; Adjei, Michael D; Jhoo, Jin-Woo; Edmondson, Ricky D; Cerniglia, Carl E

    2006-02-01

    Mycobacterium vanbaalenii PYR-1 is able to metabolize a wide range of low- and high-molecular-weight (HMW) polycyclic aromatic hydrocarbons (PAHs). A 20-kDa protein was upregulated in PAH-metabolizing M. vanbaalenii PYR-1 cells compared to control cultures. The differentially expressed protein was identified as a beta subunit of the terminal dioxygenase using mass spectrometry. PCR with degenerate primers designed based on de novo sequenced peptides and a series of plaque hybridizations were done to screen the M. vanbaalenii PYR-1 genomic library. The genes, designated nidA3B3, encoding the alpha and beta subunits of terminal dioxygenase, were subsequently cloned and sequenced. The deduced enzyme revealed close similarities to the corresponding PAH ring-hydroxylating dioxygenases from Mycobacterium and Rhodococcus spp. but had the highest similarity, 61.9%, to the alpha subunit from Nocardioides sp. strain KP7. The alpha subunit also showed 52% sequence homology with the previously reported NidA from M. vanbaalenii PYR-1. The genes nidA3B3 were subcloned into the expression vector pET-17b, and the enzyme activity in Escherichia coli cells was reconstituted through coexpression with the ferredoxin (PhdC) and ferredoxin reductase (PhdD) genes of the phenanthrene dioxygenase from Nocardioides sp. strain KP7. The recombinant PAH dioxygenase appeared to favor the HMW PAH substrates fluoranthene, pyrene, and phenanthrene. Several other PAHs, including naphthalene, anthracene, and benz[a]anthracene, were also converted to their corresponding cis-dihydrodiols. The recombinant E. coli, however, did not show any dioxygenation activity for phthalate and biphenyl. The upregulation of nidA3B3 in M. vanbaalenii PYR-1 induced by PAHs was confirmed by reverse transcription-PCR analysis.

  12. Molecular progress on the mapping and cloning of functional genes for blast disease in rice (Oryza sativa L.): current status and future considerations.

    PubMed

    Ashkani, S; Rafii, M Y; Shabanimofrad, M; Ghasemzadeh, A; Ravanfar, S A; Latif, M A

    2016-01-01

    Rice blast disease, which is caused by the fungal pathogen Magnaporthe oryzae, is a recurring problem in all rice-growing regions of the world. The use of resistance (R) genes in rice improvement breeding programmes has been considered to be one of the best options for crop protection and blast management. Alternatively, quantitative resistance conferred by quantitative trait loci (QTLs) is also a valuable resource for the improvement of rice disease resistance. In the past, intensive efforts have been made to identify major R-genes as well as QTLs for blast disease using molecular techniques. A review of bibliographic references shows over 100 blast resistance genes and a larger number of QTLs (∼500) that were mapped to the rice genome. Of the blast resistance genes, identified in different genotypes of rice, ∼22 have been cloned and characterized at the molecular level. In this review, we have summarized the reported rice blast resistance genes and QTLs for utilization in future molecular breeding programmes to introgress high-degree resistance or to pyramid R-genes in commercial cultivars that are susceptible to M. oryzae. The goal of this review is to provide an overview of the significant studies in order to update our understanding of the molecular progress on rice and M. oryzae. This information will assist rice breeders to improve the resistance to rice blast using marker-assisted selection which continues to be a priority for rice-breeding programmes.

  13. Molecular cloning of the Pseudomonas carboxypeptidase G2 gene and its expression in Escherichia coli and Pseudomonas putida.

    PubMed Central

    Minton, N P; Atkinson, T; Sherwood, R F

    1983-01-01

    The gene coding for carboxypeptidase G2 was cloned from Pseudomonas sp. strain RS-16 into Escherichia coli W5445 by inserting Sau3A-generated DNA fragments into the BamHI site of pBR322. The plasmid isolated, pNM1, was restriction mapped, and the position of the gene on the 5.8-megadalton insert was pinpointed by subcloning. The expression of carboxypeptidase in E. coli was 100-fold lower than in the Pseudomonas sp. strain. When the cloned gene was subcloned into the Pseudomonas vector pKT230 and introduced into Pseudomonas putida 2440, a 30-fold increase in expression over that obtained in E. coli was observed. High expression (up to 5% soluble protein) was obtained in E. coli by subcloning a 3.1-megadalton Bg/II fragment into the BamHI site of pAT153. The increased expression was orientation dependent and is presumed to be due to transcriptional readthrough from the Tc promoter of the vector. Production of carboxypeptidase was shown to be induced (two-fold) by the presence of folic acid, and the mature protein was shown to be located in the periplasmic space of E. coli. Images PMID:6358192

  14. Molecular cloning, nucleotide sequence, and expression of a carboxypeptidase-encoding gene from the archaebacterium Sulfolobus solfataricus.

    PubMed Central

    Colombo, S; Toietta, G; Zecca, L; Vanoni, M; Tortora, P

    1995-01-01

    Mammalian metallocarboxypeptidases play key roles in major biological processes, such as digestive-protein degradation and specific proteolytic processing. A Sulfolobus solfataricus gene (cpsA) encoding a recently described zinc carboxypeptidase with an unusually broad substrate specificity was cloned, sequenced, and expressed in Escherichia coli. Despite the lack of overall sequence homology with known carboxypeptidases, seven homology blocks, including the Zn-coordinating and catalytic residues, were identified by multiple alignment with carboxypeptidases A, B, and T. S. solfataricus carboxypeptidase expressed in E. coli was found to be enzymatically active, and both its substrate specificity and thermostability were comparable to those of the purified S. solfataricus enzyme. PMID:7559343

  15. Molecular cloning, nucleotide sequence, and expression of a carboxypeptidase-encoding gene from the archaebacterium Sulfolobus solfataricus.

    PubMed

    Colombo, S; Toietta, G; Zecca, L; Vanoni, M; Tortora, P

    1995-10-01

    Mammalian metallocarboxypeptidases play key roles in major biological processes, such as digestive-protein degradation and specific proteolytic processing. A Sulfolobus solfataricus gene (cpsA) encoding a recently described zinc carboxypeptidase with an unusually broad substrate specificity was cloned, sequenced, and expressed in Escherichia coli. Despite the lack of overall sequence homology with known carboxypeptidases, seven homology blocks, including the Zn-coordinating and catalytic residues, were identified by multiple alignment with carboxypeptidases A, B, and T. S. solfataricus carboxypeptidase expressed in E. coli was found to be enzymatically active, and both its substrate specificity and thermostability were comparable to those of the purified S. solfataricus enzyme.

  16. Molecular cloning, nucleotide sequence, and expression in Escherichia coli of a hemolytic toxin (aerolysin) gene from Aeromonas trota

    SciTech Connect

    Khan, A.A.; Kim, E.; Cerniglia, C.E.

    1998-07-01

    Aeromonas trota AK2, which was derived from ATCC 49659 and produces the extracellular pore-forming hemolytic toxin aerolysin, was mutagenized with the transposon mini-Tn5Km1 to generate a hemolysin-deficient mutant, designated strain AK253. Southern blotting data indicated that an 8.7-kb NotI fragment of the genomic DNA of strain AK253 contained the kanamycin resistance gene of mini-Tn5Km1. The 8.7-kb NotI DNA fragment was cloned into the vector pGEM5Zf({minus}) by selecting for kanamycin resistance, and the resultant clone, pAK71, showed aerolysin activity in Escherichia coli JM109. The nucleotide sequence of the aerA gene, located on the 1.8-kb ApaI-EcoRI fragment, was determined to consist of 1,479 bp and to have an ATG initiation codon and a TAA termination codon. An in vitro coupled transcription-translation analysis of the 1.8-kb region suggested that the aerA gene codes for a 54-kDa protein, in agreement with nucleotide sequence data. The deduced amino acid sequence of the aerA gene product of A. trota exhibited 99% homology with the amino acid sequence of the aerA product of Aeromonas sobria AB3 and 57% homology with the amino acid sequences of the products of the aerA genes of Aeromonas salmonicida 17-2 and A. sobria 33.

  17. Molecular Cloning, Expression, and Identification of Bre Genes Involved in Glycosphingolipids Synthesis in Helicoverpa armigera (Lepidoptera: Noctuidae).

    PubMed

    Zhang, Dandan; Xiao, Yutao; Hussain Dhiloo, Khalid; Soberon, Mario; Bravo, Alejandra; Wu, Kongming

    2016-05-17

    Glycosphingolipids (GSLs) play important roles in the cellular biology of vertebrate and invertebrate organisms, such as cell differentiation, tumor metastasis, and cell coordination. GSLs also serve as receptors for different bacterial toxins. For example, in the nematode Caenorhabditis elegans, GSLs function as receptors of the insecticidal Cry toxins produced by Bacillus thuringiensis (Bt), and mutations in bre genes involved in GSLs synthesis resulted in resistance to Cry5 toxin in this organism. However, the information of GSLs function in insects is still limited. In this study, three genes for glycosyltransferases, bre2, bre3, and bre4, from Helicoverpa armigera were identified and cloned. The previously reported bre5 gene from H. armigera was also analyzed. Protein sequence alignments revealed that proteins codified by H. armigera Bre shared high identity with homologous proteins from other organisms. Expression profile analysis revealed that the expressions of bre genes varied in the different tissues and also in the different developmental stages of H. armigera. Finally, the heterologous expression of bre genes in Trichoplusia ni Hi5 cell line showed that the corresponding translated proteins were localized in the cytoplasm of Hi5 cells. These results provide the bases for further functional studies of bre genes and analyzing potential roles of GSLs in mode of action of Cry1A toxin in H. armigera.

  18. Molecular cloning and characterization of CFT1, a developmentally regulated avian alpha(1,3)-fucosyltransferase gene.

    PubMed

    Lee, K P; Carlson, L M; Woodcock, J B; Ramachandra, N; Schultz, T L; Davis, T A; Lowe, J B; Thompson, C B; Larsen, R D

    1996-12-20

    Although coordinate expression of carbohydrate epitopes during development is well described, mechanisms which regulate this expression remain largely unknown. In this study we demonstrate that developing chicken B cells express the LewisX terminal oligosaccharide structure in a stage-specific manner. To examine regulation of this expression, we have cloned and expressed the chicken alpha(1,3)-fucosyltransferase gene involved in LewisX biosynthesis, naming it chicken fucosyltransferase 1 (CFT1). CFT1 is characterized by a single long open reading frame of 356 amino acids encoding a type II transmembrane glycoprotein. The domain structure and predicted amino acid sequence are highly conserved between CFT1 and mammalian FucTIV genes (52.8% and 46.3% identity to mouse and human respectively). In vitro CFT1 fucosyltransferase activity utilizes LacNAc > 3'sialyl-LacNAc acceptors with almost no utilization of other neutral type II (lactose, 2-fucosyllactose), or type I (lacto-N-biose I) acceptors. CFT1-transfected cells make cell surface LewisX (COS-7) and LewisX + VIM-2 structures (Chinese hamster ovary). CFT1 gene expression is tissue-specific and includes embryonic thymus and bursa. Furthermore, expression of the CFT1 gene and cell surface LewisX structures are closely linked during B cell development. These findings reveal the evolutionary conservation between nonmammalian and mammalian alpha(1,3)-fucosyltransferase genes and demonstrate a role for fucosyltransferase gene regulation in the developmental expression of oligosaccharide structures.

  19. Molecular cloning of the Clostridium botulinum structural gene encoding the type B neurotoxin and determination of its entire nucleotide sequence.

    PubMed Central

    Whelan, S M; Elmore, M J; Bodsworth, N J; Brehm, J K; Atkinson, T; Minton, N P

    1992-01-01

    DNA fragments derived from the Clostridium botulinum type A neurotoxin (BoNT/A) gene (botA) were used in DNA-DNA hybridization reactions to derive a restriction map of the region of the C. botulinum type B strain Danish chromosome encoding botB. As the one probe encoded part of the BoNT/A heavy (H) chain and the other encoded part of the light (L) chain, the position and orientation of botB relative to this map were established. The temperature at which hybridization occurred indicated that a higher degree of DNA homology occurred between the two genes in the H-chain-encoding region. By using the derived restriction map data, a 2.1-kb BglII-XbaI fragment encoding the entire BoNT/B L chain and 108 amino acids of the H chain was cloned and characterized by nucleotide sequencing. A contiguous 1.8-kb XbaI fragment encoding a further 623 amino acids of the H chain was also cloned. The 3' end of the gene was obtained by cloning a 1.6-kb fragment amplified from genomic DNA by inverse polymerase chain reaction. Translation of the nucleotide sequence derived from all three clones demonstrated that BoNT/B was composed of 1,291 amino acids. Comparative alignment of its sequence with all currently characterized BoNTs (A, C, D, and E) and tetanus toxin (TeTx) showed that a wide variation in percent homology occurred dependent on which component of the dichain was compared. Thus, the L chain of BoNT/B exhibits the greatest degree of homology (50% identity) with the TeTx L chain, whereas its H chain is most homologous (48% identity) with the BoNT/A H chain. Overall, the six neurotoxins were shown to be composed of highly conserved amino acid domains interceded with amino acid tracts exhibiting little overall similarity. In total, 68 amino acids of an average of 442 are absolutely conserved between L chains and 110 of 845 amino acids are conserved between H chains. Conservation of Trp residues (one in the L chain and nine in the H chain) was particularly striking. The most

  20. Molecular cloning and expression of squalene synthase and 2,3-oxidosqualene cyclase genes in persimmon (Diospyros kaki L.) fruits.

    PubMed

    Zhou, Chunhua; Zhao, Daqiu; Sheng, Yanle; Liang, Guohua; Tao, Jun

    2012-02-01

    Oleanolic acid (OA) and ursolic acid (UA) are the main triterpene acids in persimmon fruit, and squalene synthase and 2,3-oxidosqualene cyclases are important enzymes in pentacyclic triterpene biosynthesis. In order to study their relationship, DkSQS and DkOSC were cloned from persimmon fruits in the present study. The full-length cDNA of DkSQS was 1647 bp, containing an open reading frame (ORF) of 1245 bp that encoded a peptide of 415 amino acids (AA). The 3'-end of DkOSC cDNA fragment contained 522 bp, including a partial ORF of 298 bp, a full poly A tail that encoded 98 AA. Two cultivars of persimmon, i.e. cv. Nishimurawase and cv. Niuxinshi, were used to study the content of OA and UA and the related gene expression. Results showed that OA and UA contents changed in both cultivars during fruit development, the difference in cv. Nishimurawase was greater than that in cv. Niuxinshi. The expression of DkSQS and DkOSC had no obvious correlation with the biosynthesis of OA and UA in the flesh. There may be two main reasons. Firstly, different enzymes involved in the biosynthesis of triterpenes and mutual adjustment were existed in different gene expressions. Secondly, it was not clear that the DkOSC cloned in this research belonged to which subfamily. Therefore, the real relationship between triterpenes and DkSQS and DkOSC in persimmon fruits is still to be revealed.

  1. Molecular cloning, sequencing and expression in Escherichia coli of the bean yellow mosaic virus coat protein gene.

    PubMed

    Hammond, J; Hammond, R W

    1989-08-01

    The sequence of 1015 nucleotides from the 3' poly(A) tract of the potyvirus bean yellow mosaic virus (BYMV) RNA has been determined from two cDNA clones. This sequence contained a single long open reading frame (ORF) starting upstream of the cloned region. The ORF was expressed as a fusion protein in Escherichia coli, and the product was detected by antibodies specific for the coat protein of BYMV. The predicted length of the coat protein gene was 822 nucleotides, corresponding to a 273 amino acid coat protein of Mr 30910. The deduced amino acid sequence of the BYMV coat protein was compared to the chemically determined amino acid composition of purified virion protein, and of protein prepared from trypsin-treated virions. The nucleotide and deduced amino acid sequences were compared to the sequences of the coat protein genes of other potyviruses. The BYMV coat protein gene was found to be 50 to 61% homologous to those of other potyviruses at both the nucleotide and amino acid levels; the greatest variation was between the 5'-proximal one-fifth of the genes. Amino acid sequences and hydrophilicity plots of the different potyvirus coat proteins showed similarities which indicated that the structure of the coat protein is highly conserved; a non-terminal region of variability was predicted to be exposed on the exterior of the virion. A putative cleavage site at a glutamine-serine dipeptide was identified by similarity in context to the cleavage sites of tobacco etch virus and tobacco vein mottling virus coat proteins from the viral polyproteins. The BYMV 3'-terminal non-coding region of 166 nucleotides is followed by a poly(A) tract.

  2. Molecular cloning, characterization and differential expression of novel phytocystatin gene during tropospheric ozone stress in maize (Zea mays) leaves.

    PubMed

    Ahmad, Rafiq; Zuily-Fodil, Yasmine; Passaquet, Chantal; Ali Khan, Sabaz; Repellin, Anne

    2015-03-01

    In this study, a full-length cDNA encoding a novel phytocystatin gene, designated CC14, was identified in maize leaves. The CC14 gene sequence reported in this study has been deposited in the GenBank database (accession number JF290478). The CC14 gene was cloned into an expression vector pET30 EK/LIC and was then transformed into Escherichia coli strain BL21 (DE3) pLysS to produce a recombinant CC14 protein. The recombinant protein was purified by nickel nitrilotriacetic acid affinity chromatography after induction with 1 mM IPTG. The purified CC14 protein was electrophoresed on SDS-PAGE and a protein 25 kDa in size was observed. Antiprotease activities of the purified recombinant CC14 protein against cysteine proteases and commercially available papain were tested. The results showed that CC14 purified protein suppressed 100% activity of papain and 57-86% plant cysteine protease activity. Moreover, an upregulation of CC14 gene expression was observed after 20 days of ozone stress in maize leaves. Together, these observations concurred to conclude that CC14 gene could potentially be used as a basis for the development of transgenic crops and natural pesticides that resist biotic and abiotic stresses.

  3. Molecular cloning and characterization of a mammalian excision repair gene that partially restores UV resistance to xeroderma pigmentosum complementation group D cells

    SciTech Connect

    Arrand, J.E.; Bone, N.M.; Johnson, R.T. )

    1989-09-01

    A hamster DNA repair gene has been isolated by cosmid rescue after two rounds of transfection of an immortalized xeroderma pigmentosum (XP) complementation group D cell line with neomycin-resistance gene (neo)-tagged normal hamster DNA and selection with G418 and ultraviolet irradiation. The functional length of the sequence has been defined as 11.5 kilobase pairs by measurement of the region of overlap between two hamster DNA-containing cosmids, cloned by selection for the integrated neo gene, that are able to confer an increase in resistance to ultraviolet irradiation on two XP-D cell line but not on an XP-A line. Detailed molecular characterization of the hamster repair gene has revealed no obvious similarities to two human excision repair genes (ERCC1 and ERCC2) that correct repair-defective hamster cells but have no effect on XP cells. Hybridization analyses of normal human and XP cell genomic DNAs and mRNAs, using a cosmid-clone probe from which repeated sequences have been removed, show that homologues are present and expressed in all cases.

  4. Molecular cloning and expression analysis of KIN10 and cold-acclimation related genes in wild banana 'Huanxi' (Musa itinerans).

    PubMed

    Liu, Weihua; Cheng, Chunzhen; Lai, Gongti; Lin, Yuling; Lai, Zhongxiong

    2015-01-01

    Banana cultivars may experience chilling or freezing injury in some of their cultivated regions, where wild banana can still grow very well. The clarification of the cold-resistant mechanism of wild banana is vital for cold-resistant banana breeding. In this study, the central stress integrator gene KIN10 and some cold-acclimation related genes (HOS1 and ICE1s) from the cold-resistant wild banana 'Huanxi' (Musa itinerans) were cloned and their expression patterns under different temperature treatments were analyzed. Thirteen full-length cDNA transcripts including 6 KIN10s, 1 HOS1 and 6 ICE1s were successfully cloned. Quantitative real-time PCR (qRT-PCR) results showed that all these genes had the highest expression levels at the critical temperature of banana (13 °C). Under chilling temperature (4 °C), the expression level of KIN10 reduced significantly but the expression of HOS1 was still higher than that at the optimal temperature (28 °C, control). Both KIN10 and HOS1 showed the lowest expression levels at 0 °C, the expression level of ICE1, however, was higher than control. As sucrose plays role in plant cold-acclimation and in regulation of KIN10 and HOS1 bioactivities, the sucrose contents of wild banana under different temperatures were detected. Results showed that the sucrose content increased as temperature lowered. Our result suggested that KIN10 may participate in cold stress response via regulating sucrose biosynthesis, which is helpful in regulating cold acclimation pathway in wild banana.

  5. Molecular cloning and characterization of cDNAs of the superoxide dismutase gene family in the resurrection plant Haberlea rhodopensis.

    PubMed

    Apostolova, Elena; Rashkova, Maya; Anachkov, Nikolay; Denev, Iliya; Toneva, Valentina; Minkov, Ivan; Yahubyan, Galina

    2012-06-01

    Resurrection plants can tolerate almost complete water loss in their vegetative parts. The superoxide dismutases (SODs) are essential enzymes of defense against the oxidative damage caused by water stress. Here, we cloned and characterized cDNAs of the SOD gene family in the resurrection plant Haberlea rhodopensis. Seven full-length cDNAs, and their partial genomic clones, were obtained by combination of degenerate PCR, RT-PCR and RACE. The derived amino acid sequences exhibited a very high degree of similarity to cytosolic Cu,Zn-SODs (HrCSD2, HrCSD3), chloroplastic Cu,Zn-SODs (HrCSD5), other Cu,Zn-SODs (HrCSD4), Mn-SODs (HrMSD) and Fe-SODs (HrFSD). One cDNA turned out to be a pseudogene (HrCSD1). All identified SOD genes were found expressed at transcriptional level--the HrCSD2, HrCSD5, HrMSD and HrFSD were constitutively expressed in all organs, while the HrCSD3 and HrCSD4 were organ-specific. The transcripts of the housekeeping SOD genes were detected at significant levels even in air-dry leaves. The multigene SOD family of H. rhodopensis is the first studied SOD family amongst resurrection plant species. Our finding of well expressed SOD transcripts in fully dehydrated leaves correlates with retention of SOD activity, and with the ability of H. rhodopensis to revive upon rehydration. Because of the endemic relict nature of that species, our findings may help to further elucidate the evolutionary relationships among different SOD isoforms from distinct plant species.

  6. Molecular cloning and expression of key gene encoding hypothetical DNA polymerase from B. mori parvo-like virus.

    PubMed

    Zhang, Junhong; Li, Guohui; Chen, Huiqing; Li, Xiaogang; Lv, Meng; Chen, Keping; Yao, Qin

    2010-10-01

    BmPLV-Z is the abbreviation for Bombyx mori parvo-like virus (China isolate). This is a novel virus with two single-stranded linear DNA molecules, viz., VD1 (6543 bp) and VD2 (6022 bp), which are encapsidated respectively into separate virions. Analysis of the deduced amino acid sequence of VD1-ORF4 indicated the existence of a putative DNA-polymerase with exonuclease activity, possibly involved in the replication of BmPLV-Z. In the present study, a recombinant baculovirus was constructed to express the full length of the protein encoded by the VD1-ORF4 gene (3318 bp). In addition, a 2163-bp fragment amplified from the very same gene was cloned into prokaryotic expression vector pET-30a and expressed in E.coli Rosetta 2 (DE3) pLysS. The expressed fusion protein was employed to immunize New Zealand white rabbits for the production of an antiserum, afterwards used for examining the expression of the protein encoded by VD1-ORF4 gene in Sf-9 cells infected with recombinant baculovirus. Western blot analysis of extracts from thus cells infected revealed a specific band of about 120 kDa, thereby indicating that the full length protein encoded by the VD1-ORF4 gene had been successfully and stably expressed in Sf-9 cells.

  7. Molecular Cloning and Gene Expression Analysis of the Leptin Receptor in the Chinese Mitten Crab Eriocheir sinensis

    PubMed Central

    Jiang, Hui; Ren, Fei; Sun, Jiangling; He, Lin; Li, Weiwei; Xie, Yannan; Wang, Qun

    2010-01-01

    Background Leptin is an adipocyte-derived hormone with multiple functions that regulates energy homeostasis and reproductive functions. Increased knowledge of leptin receptor function will enhance our understanding of the physiological roles of leptin in animals. Methodology/Principal Findings In the present study, a full-length leptin receptor (lepr) cDNA, consisting of 1,353 nucleotides, was cloned from Chinese mitten crab (Eriocheir sinensis) using rapid amplification of cDNA ends (RACE) following the identification of a single expressed sequence tag (EST) clone in a cDNA library. The lepr cDNA consisted of a 22-nucleotide 5′-untranslated region (5′ UTR), a 402-nucleotide open reading frame (ORF) and a 929-nucleotide 3′ UTR. Multiple sequence alignments revealed that Chinese mitten crab lepr shared a conserved vacuolar protein sorting 55 (Vps55) domain with other species. Chinese mitten crab lepr expression was determined in various tissues and at three different reproductive stages using quantitative real-time RT-PCR. Lepr expression was highest in the intestine, thoracic ganglia, gonad, and accessory gonad, moderate in hepatopancreas and cranial ganglia, and low in muscle, gill, heart, haemocytes, and stomach. Furthermore, lepr expression was significantly higher in the intestine, gonad and thoracic ganglia in immature crabs relative to precocious and mature crabs. In contrast, lepr expression was significantly lower in the hepatopancreas of immature crabs relative to mature crabs. Conclusions/Significance We are the first to identify the lepr gene and to determine its gene expression patterns in various tissues and at three different reproductive stages in Chinese mitten crab. Taken together, our results suggest that lepr may be involved in the nutritional regulation of metabolism and reproduction in Chinese mitten crabs. PMID:20567508

  8. Molecular Cloning and Characterization of the Helicobacter pylori fliD Gene, an Essential Factor in Flagellar Structure and Motility

    PubMed Central

    Seong Kim, Jang; Hoon Chang, Ji; Il Chung, Soo; Sun Yum, Jung

    1999-01-01

    Helicobacter pylori colonizes the human stomach and can cause gastroduodenal disease. Flagellar motility is regarded as a major factor in the colonizing ability of H. pylori. The functional roles of flagellar structural proteins other than FlaA, FlaB, and FlgE are not well understood. The fliD operon of H. pylori consists of flaG, fliD, and fliS genes, in the order stated, under the control of a ς28-dependent promoter. In an effort to elucidate the function of the FliD protein, a hook-associated protein 2 homologue, in flagellar morphogenesis and motility, the fliD gene (2,058 bp) was cloned and isogenic mutants were constructed by disruption of the fliD gene with a kanamycin resistance cassette and electroporation-mediated allelic-exchange mutagenesis. In the fliD mutant, morphologically abnormal flagellar appendages in which very little filament elongation was apparent were observed. The fliD mutant strain was completely nonmotile, indicating that these abnormal flagella were functionally defective. Furthermore, the isogenic fliD mutant of H. pylori SS1, a mouse-adapted strain, was not able to colonize the gastric mucosae of host mice. These results suggest that H. pylori FliD is an essential element in the assembly of the functional flagella that are required for colonization of the gastric mucosa. PMID:10559162

  9. Molecular Cloning and Characterization of Full-Length cDNA of Calmodulin Gene from Pacific Oyster Crassostrea gigas

    PubMed Central

    Li, Xing-Xia; Yu, Wen-Chao; Cai, Zhong-Qiang; He, Cheng; Wei, Na

    2016-01-01

    The shell of the pearl oyster (Pinctada fucata) mainly comprises aragonite whereas that of the Pacific oyster (Crassostrea gigas) is mainly calcite, thereby suggesting the different mechanisms of shell formation between above two mollusks. Calmodulin (CaM) is an important gene for regulating the uptake, transport, and secretion of calcium during the process of shell formation in pearl oyster. It is interesting to characterize the CaM in oysters, which could facilitate the understanding of the different shell formation mechanisms among mollusks. We cloned the full-length cDNA of Pacific oyster CaM (cgCaM) and found that the cgCaM ORF encoded a peptide of 113 amino acids containing three EF-hand calcium-binding domains, its expression level was highest in the mantle, hinting that the cgCaM gene is probably involved in shell formation of Pacific oyster, and the common ancestor of Gastropoda and Bivalvia may possess at least three CaM genes. We also found that the numbers of some EF hand family members in highly calcified species were higher than those in lowly calcified species and the numbers of these motifs in oyster genome were the highest among the mollusk species with whole genome sequence, further hinting the correlation between CaM and biomineralization. PMID:27703977

  10. Molecular cloning and chromosomal assignment of the human brain-type phosphodiesterase I/nucleotide pyrophosphatase gene (PDNP2)

    SciTech Connect

    Kawagoe, Hiroyuki; Soma, Osamu; Goji, Junko

    1995-11-20

    Phosphodiesterase I/nucleotide pyrophosphatase is a widely expressed membrane-bound enzyme that cleaves diester bonds of a variety of substrates. We have cloned brain-type cDNA for this enzyme from rat brain and designated it PD-I{alpha}. In this study we have isolated cDNA and genomic DNA encoding human PD-I{alpha}. Human PD-I{alpha} cDNA, designated PDNP2 in HGMW nomenclature, has a 2589-nucleotide open reading frame encoding a polypeptide of 863 amino acids with a calculated M{sub r} of 99,034. Northern blot analysis revealed that human PD-I{alpha} transcript was present in brain, lung, placenta, and kidney. The database analysis showed that human PD-I{alpha} was identical with human autotaxin (ATX), a novel tumor motility-stimulating factor, except that human PD-I{alpha} lacks 156 nucleotides and 52 amino acids of human ATX. Human PD-I{alpha} and human ATX are likely to be alternative splicing products from the same gene. The 5{prime} region of the human PDNP2 gene contains four putative binding sites of transcription factor Sp1 without typical TATA or CAAT boxes, and there is a potential octamer binding motif in intron 2. From the results of fluorescence in situ hybridization, the human PDNP2 gene is located at chromosome 8q24.1. 17 refs., 3 figs.

  11. Molecular cloning and functional characterization of Catharanthus roseus hydroxymethylbutenyl 4-diphosphate synthase gene promoter from the methyl erythritol phosphate pathway.

    PubMed

    Ginis, Olivia; Courdavault, Vincent; Melin, Céline; Lanoue, Arnaud; Giglioli-Guivarc'h, Nathalie; St-Pierre, Benoit; Courtois, Martine; Oudin, Audrey

    2012-05-01

    The Madagascar periwinkle produces monoterpenoid indole alkaloids (MIA) of high interest due to their therapeutical values. The terpenoid moiety of MIA is derived from the methyl erythritol phosphate (MEP) and seco-iridoid pathways. These pathways are regarded as the limiting branch for MIA biosynthesis in C. roseus cell and tissue cultures. In previous studies, we demonstrated a coordinated regulation at the transcriptional and spatial levels of genes from both pathways. We report here on the isolation of the 5'-flanking region (1,049 bp) of the hydroxymethylbutenyl 4-diphosphate synthase (HDS) gene from the MEP pathway. To investigate promoter transcriptional activities, the HDS promoter was fused to GUS reporter gene. Agrobacterium-mediated transformation of young tobacco leaves revealed that the cloned HDS promoter displays a tissue-specific GUS staining restricted to the vascular region of the leaves and limited to a part of the vein that encompasses the phloem in agreement with the previous localization of HDS transcripts in C. roseus aerial organs. Further functional characterizations in stably or transiently transformed C. roseus cells allowed us to identify the region that can be consider as the minimal promoter and to demonstrate the induction of HDS promoter by several hormonal signals (auxin, cytokinin, methyljasmonate and ethylene) leading to MIA production. These results, and the bioinformatic analysis of the HDS 5'-region, suggest that the HDS promoter harbours a number of cis-elements binding specific transcription factors that would regulate the flux of terpenoid precursors involved in MIA biosynthesis.

  12. Molecular Cloning and Characterization of Full-Length cDNA of Calmodulin Gene from Pacific Oyster Crassostrea gigas.

    PubMed

    Li, Xing-Xia; Yu, Wen-Chao; Cai, Zhong-Qiang; He, Cheng; Wei, Na; Wang, Xiao-Tong; Yue, Xi-Qing

    2016-01-01

    The shell of the pearl oyster (Pinctada fucata) mainly comprises aragonite whereas that of the Pacific oyster (Crassostrea gigas) is mainly calcite, thereby suggesting the different mechanisms of shell formation between above two mollusks. Calmodulin (CaM) is an important gene for regulating the uptake, transport, and secretion of calcium during the process of shell formation in pearl oyster. It is interesting to characterize the CaM in oysters, which could facilitate the understanding of the different shell formation mechanisms among mollusks. We cloned the full-length cDNA of Pacific oyster CaM (cgCaM) and found that the cgCaM ORF encoded a peptide of 113 amino acids containing three EF-hand calcium-binding domains, its expression level was highest in the mantle, hinting that the cgCaM gene is probably involved in shell formation of Pacific oyster, and the common ancestor of Gastropoda and Bivalvia may possess at least three CaM genes. We also found that the numbers of some EF hand family members in highly calcified species were higher than those in lowly calcified species and the numbers of these motifs in oyster genome were the highest among the mollusk species with whole genome sequence, further hinting the correlation between CaM and biomineralization.

  13. Molecular Cloning and Characterization of DXS and DXR Genes in the Terpenoid Biosynthetic Pathway of Tripterygium wilfordii

    PubMed Central

    Tong, Yuru; Su, Ping; Zhao, Yujun; Zhang, Meng; Wang, Xiujuan; Liu, Yujia; Zhang, Xianan; Gao, Wei; Huang, Luqi

    2015-01-01

    1-Deoxy-d-xylulose-5-phosphate synthase (DXS) and 1-deoxy-d-xylulose-5-phosphate reductoisomerase (DXR) genes are the key enzyme genes of terpenoid biosynthesis but still unknown in Tripterygium wilfordii Hook. f. Here, three full-length cDNA encoding DXS1, DXS2 and DXR were cloned from suspension cells of T. wilfordii with ORF sizes of 2154 bp (TwDXS1, GenBank accession no.KM879187), 2148 bp (TwDXS2, GenBank accession no.KM879186), 1410 bp (TwDXR, GenBank accession no.KM879185). And, the TwDXS1, TwDXS2 and TwDXR were characterized by color complementation in lycopene accumulating strains of Escherichia coli, which indicated that they encoded functional proteins and promoted lycopene pathway flux. TwDXS1 and TwDXS2 are constitutively expressed in the roots, stems and leaves and the expression level showed an order of roots > stems > leaves. After the suspension cells were induced by methyl jasmonate, the mRNA expression level of TwDXS1, TwDXS2, and TwDXR increased, and triptophenolide was rapidly accumulated to 149.52 µg·g−1, a 5.88-fold increase compared with the control. So the TwDXS1, TwDXS2, and TwDXR could be important genes involved in terpenoid biosynthesis in Tripterygium wilfordii Hook. f. PMID:26512659

  14. Molecular cloning and expression of chitin deacetylase 1 gene from the gills of Penaeus monodon (black tiger shrimp).

    PubMed

    Sarmiento, Katreena P; Panes, Vivian A; Santos, Mudjekeewis D

    2016-08-01

    Chitin deacetylases have been identified and studied in several fungi and insects but not in crustaceans. These glycoproteins function in catalyzing the conversion of chitin to chitosan by the hydrolysis of N-acetamido bonds of chitin. Here, for the first time, the full length cDNA of chitin deacetylase (CDA) gene from crustaceans was fully cloned using a partial fragment obtained from a transcriptome database of the gills of black tiger shrimp Penaeus monodon that survived White Spot Syndrome Virus (WSSV) infection employing Rapid Amplification of cDNA Ends (RACE) PCR. The shrimp CDA, named PmCDA1, was further characterized by in silico analysis, and its constitutive expression determined in apparently healthy shrimp through reverse transcription PCR (RT-PCR). Results revealed that the P. monodon chitin deacetylase (PmCDA1) is 2176 bp-long gene with an open reading frame (ORF) of 1596 bp encoding for 532 amino acids. Phylogenetic analysis revealed that PmCDA1 belongs to Group I CDAs together with CDA1 and CDA2 proteins found in insects. Moreover, PmCDA1 is composed of a conserved chitin-binding peritrophin-A domain (CBD), a low-density lipoprotein receptor class A domain (LDL-A) and a catalytic domain that is part of CE4 superfamily, all found in group I CDAs, which are known to serve critical immune function against WSSV. Finally, high expression of PmCDA1 gene in the gills of apparently healthy P. monodon was observed suggesting important basal function of the gene in this tissue. Taken together, this is a first report of the full chitin deacetylase 1 (CDA1) gene in crustaceans particularly in shrimp that exhibits putative immune function against WSSV and is distinctly highly expressed in the gills of shrimp.

  15. Molecular cloning, expression, and chromosomal localization of the gene encoding a human myeloid membrane antigen (gp150).

    PubMed Central

    Look, A T; Peiper, S C; Rebentisch, M B; Ashmun, R A; Roussel, M F; Lemons, R S; Le Beau, M M; Rubin, C M; Sherr, C J

    1986-01-01

    DNA from a tertiary mouse cell transformant containing amplified human sequences encoding a human myeloid membrane glycoprotein, gp150, was used to construct a bacteriophage lambda library. A single recombinant phage containing 12 kilobases (kb) of human DNA was isolated, and molecular subclones were then used to isolate the complete gp150 gene from a human placental genomic DNA library. The intact gp150 gene, assembled from three recombinant phages, proved to be biologically active when transfected into NIH 3T3 cells. Molecular probes from the gp150 locus annealed with a 4.0-kb polyadenylated RNA transcript derived from human myeloid cell lines and from tertiary mouse cell transformants. The gp150 gene was assigned to human chromosome 15, and was subchromosomally localized to bands q25-26 by in situ hybridization. The chromosomal location of the gp150 gene coincides cytogenetically with the region assigned to the c-fes proto-oncogene, another human gene specifically expressed by myeloid cells. Images PMID:2428842

  16. Molecular cloning and characterization of Siamese crocodile (Crocodylus siamensis) copper, zinc superoxide dismutase (CSI-Cu,Zn-SOD) gene.

    PubMed

    Sujiwattanarat, Penporn; Pongsanarakul, Parinya; Temsiripong, Yosapong; Temsiripong, Theeranan; Thawornkuno, Charin; Uno, Yoshinobu; Unajak, Sasimanas; Matsuda, Yoichi; Choowongkomon, Kiattawee; Srikulnath, Kornsorn

    2016-01-01

    Superoxide dismutase (SOD, EC 1.15.1.1) is an antioxidant enzyme found in all living cells. It regulates oxidative stress by breaking down superoxide radicals to oxygen and hydrogen peroxide. A gene coding for Cu,Zn-SOD was cloned and characterized from Siamese crocodile (Crocodylus siamensis; CSI). The full-length expressed sequence tag (EST) of this Cu,Zn-SOD gene (designated as CSI-Cu,Zn-SOD) contained 462bp encoding a protein of 154 amino acids without signal peptides, indicated as intracellular CSI-Cu,Zn-SOD. This agreed with the results from the phylogenetic tree, which indicated that CSI-Cu,Zn-SOD belonged to the intracellular Cu,Zn-SOD. Chromosomal location determined that the CSI-Cu,Zn-SOD was localized to the proximal region of the Siamese crocodile chromosome 1p. Several highly conserved motifs, two conserved signature sequences (GFHVHEFGDNT and GNAGGRLACGVI), and conserved amino acid residues for binding copper and zinc (His(47), His(49), His(64), His(72), His(81), Asp(84), and His(120)) were also identified in CSI-Cu,Zn-SOD. Real-time PCR analysis showed that CSI-Cu,Zn-SOD mRNA was expressed in all the tissues examined (liver, pancreas, lung, kidney, heart, and whole blood), which suggests a constitutively expressed gene in these tissues. Expression of the gene in Escherichia coli cells followed by purification yielded a recombinant CSI-Cu,Zn-SOD, with Km and Vmax values of 6.075mM xanthine and 1.4×10(-3)mmolmin(-1)mg(-1), respectively. This Vmax value was 40 times lower than native Cu,Zn-SOD (56×10(-3)mmolmin(-1)mg(-1)), extracted from crocodile erythrocytes. This suggests that cofactors, protein folding properties, or post-translational modifications were lost during the protein purification process, leading to a reduction in the rate of enzyme activity in bacterial expression of CSI-Cu,Zn-SOD.

  17. Molecular Cloning, Expression Pattern and Genotypic Effects on Glucoraphanin Biosynthetic Related Genes in Chinese Kale (Brassica oleracea var. alboglabra Bailey).

    PubMed

    Yin, Ling; Chen, Changming; Chen, Guoju; Cao, Bihao; Lei, Jianjun

    2015-11-11

    Glucoraphanin is a plant secondary metabolite that is involved in plant defense and imparts health-promoting properties to cruciferous vegetables. In this study, three genes involved in glucoraphanin metabolism, branched-chain aminotransferase 4 (BCAT4), methylthioalkylmalate synthase 1 (MAM1) and dihomomethionine N-hydroxylase (CYP79F1), were cloned from Chinese kale (Brassica oleracea var. alboglabra Bailey). Sequence homology and phylogenetic analysis identified these genes and confirmed the evolutionary status of Chinese kale. The transcript levels of BCAT4, MAM1 and CYP79F1 were higher in cotyledon, leaf and stem compared with flower and silique. BCAT4, MAM1 and CYP79F1 were expressed throughout leaf development with lower transcript levels during the younger stages. Glucoraphanin content varied extensively among different varieties, which ranged from 0.25 to 2.73 µmol·g(-1) DW (dry weight). Expression levels of BCAT4 and MAM1 were high at vegetative-reproductive transition phase, while CYP79F1 was expressed high at reproductive phase. BCAT4, MAM1 and CYP79F1 were expressed significantly high in genotypes with high glucoraphanin content. All the results provided a better understanding of the roles of BCAT4, MAM1 and CYP79F1 in the glucoraphanin biosynthesis of Chinese kale.

  18. Molecular Cloning, Bioinformatic Analysis, and Expression of Bombyx mori Lebocin 5 Gene Related to Beauveria bassiana Infection

    PubMed Central

    Lü, Dingding; Hou, Chengxiang; Qin, Guangxing; Gao, Kun; Chen, Tian

    2017-01-01

    A full-length cDNA of lebocin 5 (BmLeb5) was first cloned from silkworm, Bombyx mori, by rapid amplification of cDNA ends. The BmLeb5 gene is 808 bp in length and the open reading frame encodes a 179-amino acid hydroxyproline-rich peptide. Bioinformatic analysis results showed that BmLeb5 owns an O-glycosylation site and four RXXR motifs as other lebocins. Sequence similarity and phylogenic analysis results indicated that lebocins form a multiple gene family in silkworm as cecropins. Quantitative real-time PCR analysis revealed that BmLeb5 was highest expressed in the fat body. In the silkworm larvae infected by Beauveria bassiana, the expression level of BmLeb5 was upregulated in the fat body and hemolymph which are the most important immune tissues in silkworm. The recombinant protein of BmLeb5 was for the first time successfully expressed with prokaryotic expression system and purified. There are no reports so far that the expression of lebocins could be induced by entomopathogenic fungus. Our study suggested that BmLeb5 might play an important role in the immune response of silkworm to defend B. bassiana infection. The results also provided helpful information for further studying the lebocin family functioned in antifungal immune response in the silkworm. PMID:28194425

  19. Molecular Cloning, Bioinformatic Analysis, and Expression of Bombyx mori Lebocin 5 Gene Related to Beauveria bassiana Infection.

    PubMed

    Lü, Dingding; Hou, Chengxiang; Qin, Guangxing; Gao, Kun; Chen, Tian; Guo, Xijie

    2017-01-01

    A full-length cDNA of lebocin 5 (BmLeb5) was first cloned from silkworm, Bombyx mori, by rapid amplification of cDNA ends. The BmLeb5 gene is 808 bp in length and the open reading frame encodes a 179-amino acid hydroxyproline-rich peptide. Bioinformatic analysis results showed that BmLeb5 owns an O-glycosylation site and four RXXR motifs as other lebocins. Sequence similarity and phylogenic analysis results indicated that lebocins form a multiple gene family in silkworm as cecropins. Quantitative real-time PCR analysis revealed that BmLeb5 was highest expressed in the fat body. In the silkworm larvae infected by Beauveria bassiana, the expression level of BmLeb5 was upregulated in the fat body and hemolymph which are the most important immune tissues in silkworm. The recombinant protein of BmLeb5 was for the first time successfully expressed with prokaryotic expression system and purified. There are no reports so far that the expression of lebocins could be induced by entomopathogenic fungus. Our study suggested that BmLeb5 might play an important role in the immune response of silkworm to defend B. bassiana infection. The results also provided helpful information for further studying the lebocin family functioned in antifungal immune response in the silkworm.

  20. Molecular cloning and expression analysis of a novel gene DGCR8 located in the DiGeorge syndrome chromosomal region.

    PubMed

    Shiohama, Aiko; Sasaki, Takashi; Noda, Setsuko; Minoshima, Shinsei; Shimizu, Nobuyoshi

    2003-04-25

    We have identified and cloned a novel gene (DGCR8) from the human chromosome 22q11.2. This gene is located in the DiGeorge syndrome chromosomal region (DGCR). It consists of 14 exons spanning over 35kb and produces transcripts with ORF of 2322bp, encoding a protein of 773 amino acids. We also isolated a mouse ortholog Dgcr8 and found it has 95.3% identity with human DGCR8 at the amino acid sequence level. Northern blot analysis of human and mouse tissues from adult and fetus showed rather ubiquitous expression. However, the in situ hybridization of mouse embryos revealed that mouse Dgcr8 transcripts are localized in neuroepithelium of primary brain, limb bud, vessels, thymus, and around the palate during the developmental stages of embryos. The expression profile of Dgcr8 in developing mouse embryos is consistent with the clinical phenotypes including congenital heart defects and palate clefts associated with DiGeorge syndrome (DGS)/conotruncal anomaly face syndrome (CAFS)/velocardiofacial syndrome (VCFS), which are caused by monoallelic microdeletion of chromosome 22q11.2.

  1. Molecular cloning and functional expression analysis of a new gene encoding geranylgeranyl diphosphate synthase from hazel (Corylus avellana L. Gasaway).

    PubMed

    Wang, Yechun; Miao, Zhiqi; Tang, Kexuan

    2010-10-01

    Geranylgeranyl diphosphate synthase (GGPPS) [EC 2.5.1.29] catalyzes the biosynthesis of geranylgeranyl diphosphate (GGPP), which is a key precursor for diterpenes such as taxol. Herein, a full-length cDNA encoding GGPPS (designated as CgGGPPS) was cloned and characterized from hazel (Corylus avellana L. Gasaway), a taxol-producing angiosperms. The full-length cDNA of CgGGPPS was 1515 bp with a 1122 bp open reading frame (ORF) encoding a 373 amino acid polypeptide. The CgGGPPS genomic DNA sequence was also obtained, revealing CgGGPPS gene was not interrupted by an intron. Southern blot analysis indicated that CgGGPPS belonged to a small gene family. Tissue expression pattern analysis indicated that CgGGPPS expressed the highest in leaves. RT-PCR analysis indicated that CgGGPPS expression could be induced by exogenous methyl jasmonate acid. Furthermore, carotenoid accumulation was observed in Escherichia coli carrying pACCAR25ΔcrtE plasmid carrying CgGGPPS. The result revealed that cDNA encoded a functional GGPP synthase.

  2. Molecular cloning and functional identification of a novel phenylacetyl-CoA ligase gene from Penicillium chrysogenum.

    PubMed

    Wang, Fu-Qiang; Liu, Jing; Dai, Meng; Ren, Zhi-Hong; Su, Cai-Yun; He, Jian-Gong

    2007-08-24

    A novel phenylacetyl-CoA ligase gene, designated phlB, was cloned and identified from the penicillin producing strain Penicillium chrysogenum based on subtractive suppression hybridization approach. The phlB gene contains a 1686-bp open-reading frame and encodes a protein of approximately 62.6 kDa. The deduced amino acid sequence shows about 35% identity to the characterized P. chrysogenum phenylacetyl-CoA ligase Phl and has a peroxisomal targeting signal on its C-terminal. Recombinant PhlB protein was overexpressed in Escherichia coli and purified by nickel affinity chromatography. Enzymatic assay confirmed that recombinant PhlB can catalyze the reaction of phenylacetic acid (PAA) with CoA to yield phenylacetyl-CoA. The expression level of phlB in the penicillin producing medium supplemented with PAA, the side chain precursor of penicillin G, was about 2.5-fold higher than that in medium without PAA. The study suggested that PhlB might participate in the activation of PAA during penicillin biosynthesis in P. chrysogenum.

  3. Cloning of the rice seed alpha-globulin-encoding gene: sequence similarity of the 5'-flanking region to those of the genes encoding wheat high-molecular-weight glutenin and barley D hordein.

    PubMed

    Nakase, M; Hotta, H; Adachi, T; Aoki, N; Nakamura, R; Masumura, T; Tanaka, K; Matsuda, T

    1996-05-08

    A genomic clone encoding the rice endosperm major globulin (alpha-globulin) with an apparent molecular mass of 26 kDa was isolated, and its nucleotide (nt) sequence and transcription start point (tsp) were determined. The tsp was identical to that of the gene encoding the wheat high-molecular-weight (HMW) glutenin subunit. The consensus '-300 element' and an A + T-rich sequence exist upstream from the TATA box in the 5'-flanking region. A nt sequence of about 130 bp in the 5'-flanking region was found to be markedly homologous to those of the genes encoding the wheat HMW glutenin subunit and barley D hordein.

  4. Molecular cloning and characterization of the Ehrlichia chaffeensis variable-length PCR target: an antigen-expressing gene that exhibits interstrain variation.

    PubMed

    Sumner, J W; Childs, J E; Paddock, C D

    1999-05-01

    A clone expressing an immunoreactive protein with an apparent molecular mass of 44 kDa was selected from an Ehrlichia chaffeensis Arkansas genomic library by probing with anti-E. chaffeensis hyperimmune mouse ascitic fluid. Nucleotide sequencing revealed an open reading frame (ORF) capable of encoding a 198-amino-acid polypeptide. The ORF contained four imperfect, direct, tandem 90-bp repeats. The nucleotide and deduced amino acid sequences did not show close homologies to entries in the molecular databases. PCR with primers whose sequences matched the sequences flanking the ORF was performed with DNA samples extracted from cell cultures infected with nine different isolates of E. chaffeensis, blood samples from seven patients with monocytic ehrlichiosis, and Amblyomma americanum ticks collected in four different states. The resulting amplicons varied in length, containing three to six repeat units. This gene, designated the variable-length PCR target, is useful for PCR detection of E. chaffeensis and differentiation of isolates.

  5. Molecular cloning and characterization of a heme oxygenase1 gene from sunflower and its expression profiles in salinity acclimation.

    PubMed

    Zhu, Kaikai; Jin, Qijiang; Samma, Muhammad Kaleem; Lin, Guoqing; Shen, Wenbiao

    2014-06-01

    Heme oxygenase1 (HO1) is involved in protecting plants from environmental stimuli. In this study, a sunflower (Helianthus annuus L.) HO1 gene (HaHO1) was cloned and sequenced. It was confirmed that HaHO1 encodes a precursor protein of 32.93 kDa with an N-terminal plastid transit peptide which was validated by subcellular localization. The amino acid sequence of HaHO1 shared high homology with other plant HO1s. The predicted three-dimensional structure showed a high degree of structural conservation as compared to the known HO1 crystal structures. Phylogenetic analysis revealed that HaHO1 clearly grouped with the plant HO1-like sequences. Moreover, the purified recombinant mature HaHO1 expressed in Escherichia coli exhibits HO activity. Thus, it was concluded that HaHO1 encodes a functional HO1 in sunflower. Additionally, HaHO1 gene was ubiquitously expressed in all tested tissues, and induced differentially during different growth stages after germination, and could be differentially induced by several stresses and hemin treatment. For example, a pretreatment with a low concentration of NaCl (25 mM) could lead to the induction of HaHO1 gene expression and thereafter a salinity acclamatory response. Above cytoprotective effect could be impaired by the potent HO1 inhibitor zinc protoporphyrin IX (ZnPPIX), which was further rescued by the addition of 50% carbon monoxide aqueous solution (in particular) or bilirubin, two catalytic by-products of HO1, respectively. Similarly, a HO1 inducer, hemin, could mimic the salinity acclamatory response. Together, these findings strongly suggested that the up-regulation of HaHO1 might be required for the observed salinity acclimation in sunflower plants.

  6. Molecular cloning and characterization of genes required for ribose transport and utilization in Escherichia coli K-12.

    PubMed Central

    Iida, A; Harayama, S; Iino, T; Hazelbauer, G L

    1984-01-01

    We isolated spontaneous and transposon insertion mutants of Escherichia coli K-12 that were specifically defective in utilization or in high-affinity transport of D-ribose (or in both). Cotransduction studies located all of the mutations near ilv, at the same position as previously identified mutations causing defects in ribokinase ( rbsK ) or ribose transport ( rbsP ). Plasmids that complemented the rbs mutations were isolated from the collection of ColE1 hybrid plasmids constructed by Clarke and Carbon. Analysis of those plasmids as well as of fragments cloned into pBR322 and pACYC184 allowed definition of the rbs region. Products of rbs genes were identified by examination of the proteins produced in minicells containing various rbs plasmids. We identified four rbs genes: rbsB , which codes for the 29-kilodalton ribose-binding protein; rbsK , which codes for the 34-kilodalton ribokinase ; rbsA , which codes for a 50-kilodalton protein required for high-affinity transport; and rbsC , which codes for a 27-kilodalton protein likely to be a transport system component. Our studies showed that these genes are transcribed from a common promoter in the order rbsA rbsC rbsB rbsK . It appears that the high-affinity transport system for ribose consists of the three components, ribose-binding protein, the 50-kilodalton RbsA protein, and the 27-kilodalton RbsC protein, although a fourth, unidentified component could exist. Mutants defective in this transport system, but normal for ribokinase , are able to grow normally on high concentrations of the sugar, indicating that there is at least a second, low-affinity transport system for ribose in E. coli K-12. Images PMID:6327617

  7. Molecular cloning and expression analysis of the ethylene insensitive3 (EIN3) gene in cucumber (Cucumis sativus).

    PubMed

    Bie, B B; Pan, J S; He, H L; Yang, X Q; Zhao, J L; Cai, R

    2013-10-07

    The plant gaseous hormone ethylene regulates many aspects of plant growth, development, and responses to the environment. Ethylene insensitive3 (EIN3) is a key transcription factor involved in the ethylene signal transduction pathway. To gain a better understanding of this particular pathway in cucumber, the full-length cDNA encoding EIN3 (designated as CsEIN3) was cloned from cucumber for the first time by rapid amplification of cDNA ends. The full length of CsEIN3 was 2560 bp, with an open reading frame of 1908 bp encoding 635 amino acids. Sequence alignment and phylogenetic analyses revealed that CsEIN3 has high homology with other plant EIN3/EIL proteins that were derived from a common ancestor during evolution, and CsEIN3 was grouped into a cluster along with melon. Homology modeling demonstrated that CsEIN3 has a highly similar structure to the specific DNA-binding domain contained in EIN3/EIL proteins. Based on quantitative reverse transcription-polymerase chain reaction analysis, we found that CsEIN3 was constitutively expressed in all organs examined, and was increased during flower development and maturation in both male and female flowers. Our results suggest that CsEIN3 is involved in processes of flower development. In conclusion, this study will provide the basis for further study on the role of EIN3 in relevant biological processes of cucumber and on the molecular mechanism of the cucumber ethylene signaling pathway.

  8. Molecular cloning of the heat shock protein 20 gene from Paphia textile and its expression in response to heat shock

    NASA Astrophysics Data System (ADS)

    Li, Jiakai; Wu, Xiangwei; Tan, Jing; Zhao, Ruixiang; Deng, Lingwei; Liu, Xiande

    2015-07-01

    P. textile is an important aquaculture species in China and is mainly distributed in Fujian, Guangdong, and Guangxi Provinces. In this study, an HSP20 cDNA designated PtHSP20 was cloned from P. textile. The full-length cDNA of PtHSP20 is 1 090 bp long and contains a 5' untranslated region (UTR) of 93 bp, a 3' UTR of 475 bp, and an open reading frame (ORF) of 522 bp. The PtHSP20 cDNA encodes 173 amino acid residues and has a molecular mass of 20.22 kDa and an isoelectric point of 6.2. Its predicted amino acid sequence shows that PtHSP20 contains a typical α-crystallin domain (residues 77-171) and three polyadenylation signal-sequences at the C-terminus. According to an amino acid sequence alignment, PtHSP20 shows moderate homology to other mollusk sHSPs. PtHSP20 mRNA was present in all of the test tissues including the heart, digestive gland, adductor muscle, gonad, gill, and mantle, with the highest concentration found in the gonad. Under the stress of high temperature, the expression of PtHSP20 mRNA was down-regulated in all of the tissues except the adductor muscle and gonad.

  9. Molecular cloning and sequence of the thdF gene involved in the thiophene and furan oxidation by Escherichia coli

    SciTech Connect

    Alam, K.Y.; Clark, D.P.

    1990-01-01

    Since sulfur dioxide emission from burning high sulfur coals is a major contributor to acid rain, it is important to develop bacteria which are capable of efficiently removing the sulfur from coal before combustion. Inorganic sulfur can be removed from coal by certain strains of Thiobacillus or Sulfolobus; however the organic sulfur remains intransigent. Since high sulfur Illinois coals typically contain 60% to 70% of their sulfur in the form of the heterocyclic thiophene ring we have started to investigate the biodegradation of derivatives of thiophene and the corresponding oxygen heterocycle, furan. Our previous work resulted in the isolation of a triple mutant, NAR30, capable of oxidizing a range of furan and thiophene derivatives. However, NAR30 does not completely degrade thiophenes or furans and its oxidation of these compounds is slow and inefficient. We decided to clone the thd genes both in order to increase the efficiency of degradation and to investigate the nature of the reactions involved. 37 refs., 4 figs., 3 tabs.

  10. Molecular cloning and expression profile of an abiotic stress and hormone responsive MYB transcription factor gene from Panax ginseng.

    PubMed

    Afrin, Sadia; Zhu, Jie; Cao, Hongzhe; Huang, Jingjia; Xiu, Hao; Luo, Tiao; Luo, Zhiyong

    2015-04-01

    The v-myb avian myeloblastosis viral oncogene homolog (MYB) family constitutes one of the most abundant groups of transcription factors and plays vital roles in developmental processes and defense responses in plants. A ginseng (Panax ginseng C.A. Meyer) MYB gene was cloned and designated as PgMYB1. The cDNA of PgMYB1 is 762 base pairs long and encodes the R2R3-type protein consisting 238 amino acids. Subcellular localization showed that PgMYB1-mGFP5 fusion protein was specifically localized in the nucleus. To understand the functional roles of PgMYB1, we investigated the expression patterns of PgMYB1 in different tissues and under various conditions. Quantitative real-time polymerase chain reaction and western blot analysis showed that PgMYB1 was expressed at higher level in roots, leaves, and lateral roots than in stems and seeds. The expression of PgMYB1 was up-regulated by abscisic acid, salicylic acid, NaCl, and cold (chilling), and down-regulated by methyl jasmonate. These results suggest that PgMYB1 might be involved in responding to environmental stresses and hormones.

  11. Cloning

    MedlinePlus

    Cloning describes the processes used to create an exact genetic replica of another cell, tissue or organism. ... named Dolly. There are three different types of cloning: Gene cloning, which creates copies of genes or ...

  12. Molecular cloning, tissue expression of gene Muc2 in blunt snout bream Megalobrama amblycephala and regulation after re-feeding

    NASA Astrophysics Data System (ADS)

    Xue, Chunyu; Xi, Bingwen; Ren, Mingchun; Dong, Jingjing; Xie, Jun; Xu, Pao

    2015-03-01

    Mucins are important components of mucus, which form a natural, physical, biochemical and semipermeable mucosal layer on the epidermis of fish gills, skin, and the gastrointestinal tract. As the first step towards characterizing the function of Muc2, we cloned a partial Megalobrama amblycephala Muc2 cDNA of 2 175 bp, and analyzed its tissue-specific expression pattern by quantitative real-time PCR (qPCR). The obtained sequence comprised 41 bp 5'-untranslated region (5'-UTR), 2 134 bp open reading frame encoding a protein of 711 amino acids. BLAST searching and phylogenetic analysis showed that the predicted protein contained several common secreted mucin-module domains (VWD-C8-TIL-VWD-C8) and had high homology with mucins from other vertebrates. Among four candidate reference genes ( β- Actin, RPI13α, RPII, 18S) for the qPCR, RPII was chosen as an appropriate reference gene because of its lowest variation in different tissues. M. amblycephala Muc2 was mainly expressed in the intestine, in the order (highest to lowest) middle-intestine > fore-intestine > hind-intestine. Muc2 was expressed relatively poorly in other organs (brain, liver, kidney, spleen, skin and gill). Furthermore, after 20-days of starvation, M. amblycephala Muc2 expressions after refeeding for 0 h, 3 h, 16 h, 3 d, and 10 d were significantly decreased in the three intestinal segments ( P<0.05) at 16 h, and were then upregulated to near the initial level at 10 d.

  13. Molecular cloning and characterization of the MsHSP17.7 gene from Medicago sativa L.

    PubMed

    Li, Zhen-Yi; Long, Rui-Cai; Zhang, Tie-Jun; Yang, Qing-Chuan; Kang, Jun-Mei

    2016-08-01

    Heat shock proteins (HSPs) are ubiquitous protective proteins that play crucial roles in plant development and adaptation to stress, and the aim of this study is to characterize the HSP gene in alfalfa. Here we isolated a small heat shock protein gene (MsHSP17.7) from alfalfa by homology-based cloning. MsHSP17.7 contains a 477-bp open reading frame and encodes a protein of 17.70-kDa. The amino acid sequence shares high identity with MtHSP (93.98 %), PsHSP17.1 (83.13 %), GmHSP17.9 (74.10 %) and SlHSP17.6 (79.25 %). Phylogenetic analysis revealed that MsHSP17.7 belongs to the group of cytosolic class II small heat shock proteins (sHSP), and likely localizes to the cytoplasm. Quantitative RT-PCR indicated that MsHSP17.7 was induced by heat shock, high salinity, peroxide and drought stress. Prokaryotic expression indicated that the salt and peroxide tolerance of Escherichia coli was remarkably enhanced. Transgenic Arabidopsis plants overexpressing MsHSP17.7 exhibited increased root length of transgenic Arabidopsis lines under salt stress compared to the wild-type line. The malondialdehyde (MDA) levels in the transgenic lines were significantly lower than in wild-type, although proline levels were similar between transgenic and wild-type lines. MsHSP17.7 was induced by heat shock, high salinity, oxidative stress and drought stress. Overexpression analysis suggests that MsHSP17.7 might play a key role in response to high salinity stress.

  14. Molecular cloning and characterization of a novel soybean gene encoding a leucine-zipper-like protein induced to salt stress.

    PubMed

    Aoki, Ayako; Kanegami, Akemi; Mihara, Michiko; Kojima, Toshio; Shiraiwa, Masakazu; Takahara, Hidenari

    2005-08-15

    To understand molecular responses to salt stress in soybean (Glycine max [L.] Merr.), we identified 106 salt-inducible soybean genes that expressed differentially at 72 h after 100 mM NaCl treatment using the cDNA-amplified fragment length polymorphism (AFLP) method. The genes were designated as G. max Transcript-Derived Fragments (GmTDFs). Among these genes, we characterized a soybean gene GmTDF-5 that encoded an unknown protein of 367 amino acids. The GmTDF-5 protein was a putative cytosolic protein with two leucine-zipper motifs at the N-terminal and was calculated as 40.7 kDa. Southern blot analysis indicated that GmTDF-5 presents as an intron-less single gene on soybean genome and possibly distributes narrowly throughout the higher plants. By 100 mM NaCl treatment, the gene expression of GmTDF-5 was induced in the stem and lower-expanded leaf, and the amount of mRNA increased 5.1- and 2.0-fold up to 72 h, respectively. Interestingly, GmTDF-5 expression in the upper-leaf appeared dramatically with 10.0-fold increase at 72 h after the salt stress, but not until 48 h. Hyperosmotic pressure (mannitol treatment) and dehydration also caused the increases similar to NaCl treatment in the levels of GmTDF-5 expression. These results suggest that GmTDF-5 might be a novel cytosolic leucine-zipper-like protein functioning in mature organs of soybean shoot against water-potential changes.

  15. Molecular cloning and functional analysis of the gene encoding 3-hydroxy-3-methylglutaryl coenzyme A reductase from hazel (Corylus avellana L. Gasaway).

    PubMed

    Wang, Yechun; Guo, Binhui; Zhang, Fei; Yao, Hongyan; Miao, Zhiqi; Tang, Kexuan

    2007-11-30

    The enzyme 3-hydroxy-3-methylglutaryl-CoA reductase (HMGR; EC1.1.1.34) catalyzes the first committed step of isoprenoids biosynthesis in MVA pathway. Here we report for the first time the cloning and characterization of a full-length cDNA encoding HMGR (designated as CgHMGR, GenBank accession number EF206343) from hazel (Corylus avellana L. Gasaway), a taxol-producing plant species. The full-length cDNA of CgHMGR was 2064 bp containing a 1704-bp ORF encoding 567 amino acids. Bioinformatic analyses revealed that the deduced CgHMGR had extensive homology with other plant HMGRs and contained two transmembrane domains and a catalytic domain. The predicted 3-D model of CgHMGR had a typical spatial structure of HMGRs. Southern blot analysis indicated that CgHMGR belonged to a small gene family. Expression analysis revealed that CgHMGR expressed high in roots, and low in leaves and stems, and the expression of CgHMGR could be up-regulated by methyl jasmonate (MeJA). The functional color assay in Escherichia coli showed that CgHMGR could accelerate the biosynthesis of beta-carotene, indicating that CgHMGR encoded a functional protein. The cloning, characterization and functional analysis of CgHMGR gene will enable us to further understand the role of CgHMGR involved in taxol biosynthetic pathway in C. avellana at molecular level.

  16. Molecular Cloning and Sequence Analysis of the Sta58 Major Antigen Gene of Rickettsia tsutsugamushi: Sequence homology and Antigenic Comparison of Sta58 to the 60-Kilodalton Family of Stress Proteins

    DTIC Science & Technology

    1990-05-01

    on the cell envelopes of Rickettsia 29. Messing, J. 1983. New M13 vectors for cloning. Methods prowazekii, Rickettsia rickettsii , and Rickettsia ...gene of Rickettsia tsu sugamushi:Sequence homology and antigenic comparison to the 60-kilodalton family of stresproteins. 12. PERSONAL AUTHOR(S...IuwRnuiy dy "jmber FIELD GROUP S ROUP Rickettsia tsutsugamushi, antigens, molecular cloning,. FIED_ GROU__ SUB-GROUP scrub typhus, heat-shock proteins

  17. First molecular cloning and gene expression analysis of teleost CD42 (glycoprotein Ib beta chain) GPIb-IX-V subunit from rock bream, Oplegnathus fasciatus.

    PubMed

    Jeong, Ji-Min; Kim, Ju-Won; Kim, Do-Hyung; Park, Chan-Il

    2015-04-01

    CD42 is a platelet membrane glycoprotein Ib that plays a key role in haemostasis and thrombin-induced platelet activation. Here, we report the molecular cloning and sequence analysis of the CD42c gene from rock bream (Oplegnathus fasciatus). Rock bream CD42 (RbCD42c) gene expression profiles were determined after infection with Streptococcus iniae, Edwardsiella tarda and red seabream iridovirus (RSIV). The full-length RbCD42c cDNA contained an open reading frame of 624 bp encoding 207 amino acids. The deduced amino acid sequences of the leucine-rich repeat (LRR)-N terminal and LRR-C terminal were conserved between fish and mammals. RbCD42c was highly expressed in red blood cells, spleen, gill, liver and kidney of healthy rock bream. The RbCD42c gene was not significantly up- or downregulated after E. tarda exposure. However, RbCD42c gene expression was upregulated in kidney, spleen and gill after S. iniae infection. RbCD42c was upregulated in spleen, liver and gill, but downregulated in kidney 24 and 48 h after RSIV infection. These results suggest that RbCD42c has different expression patterns after infection with bacterial or viral pathogens. This gene may be directly involved in haemostasis.

  18. Molecular Cloning and Characterization of Three Genes Encoding Dihydroflavonol-4-Reductase from Ginkgo biloba in Anthocyanin Biosynthetic Pathway

    PubMed Central

    Hua, Cheng; Linling, Li; Shuiyuan, Cheng; Fuliang, Cao; Feng, Xu; Honghui, Yuan; Conghua, Wu

    2013-01-01

    Dihydroflavonol-4-reductase (DFR, EC1.1.1.219) catalyzes a key step late in the biosynthesis of anthocyanins, condensed tannins (proanthocyanidins), and other flavonoids important to plant survival and human nutrition. Three DFR cDNA clones (designated GbDFRs) were isolated from the gymnosperm Ginkgo biloba. The deduced GbDFR proteins showed high identities to other plant DFRs, which form three distinct DFR families. Southern blot analysis showed that the three GbDFRs each belong to a different DFR family. Phylogenetic tree analysis revealed that the GbDFRs share the same ancestor as other DFRs. The expression of the three recombinant GbDFRs in Escherichia coli showed that their actual protein sizes were in agreement with predictions from the cDNA sequences. The recombinant proteins were purified and their activity was analyzed; both GbDFR1 and GbDFR3 could catalyze dihydroquercetin conversion to leucocyanidin, while GbDFR2 catalyzed dihydrokaempferol conversion to leucopelargonidin. qRT-PCR showed that the GbDFRs were expressed in a tissue-specific manner, and transcript accumulation for the three genes was highest in young leaves and stamens. These transcription patterns were in good agreement with the pattern of anthocyanin accumulation in G.biloba. The expression profiles suggested that GbDFR1 and GbDFR2 are mainly involved in responses to plant hormones, environmental stress and damage. During the annual growth cycle, the GbDFRs were significantly correlated with anthocyanin accumulation in leaves. A fitted linear curve showed the best model for relating GbDFR2 and GbDFR3 with anthocyanin accumulation in leaves. GbDFR1 appears to be involved in environmental stress response, while GbDFR3 likely has primary functions in the synthesis of anthocyanins. These data revealed unexpected properties and differences in three DFR proteins from a single species. PMID:23991027

  19. Molecular cloning and expression of a gene that controls the high-temperature regulon of Escherichia coli.

    PubMed Central

    Neidhardt, F C; VanBogelen, R A; Lau, E T

    1983-01-01

    The high-temperature production (HTP) regulon of Escherichia coli consists of a set of operons that are induced coordinately by a shift to a high temperature under the control of a single chromosomal gene called htpR or hin. To identify more components of this regulon, the rates of synthesis of many polypeptides resolved on two-dimensional polyacrylamide gels were measured in various strains by pulse-labeling after a temperature shift-up. A total of 13 polypeptides were found to be heat inducible only in cells bearing a normal htpR gene on the chromosome or on a plasmid; on this basis these polypeptides were designated products of the HTP regulon. Several hybrid plasmids that contain segments of the E. coli chromosome in the 75-min region were found to carry the htpR gene. A restriction map of this region was constructed, and selected fragments were subcloned and tested for the ability to complement an htpR mutant. The polypeptides encoded by these fragments were detected by permitting expression in maxicells, minicells, and chloramphenicol-treated cells. Complementation was accompanied by production of a polypeptide having a molecular weight of approximately 33,000. This polypeptide, designated F33.4, was markedly reduced in amount in an htpR mutant expected to contain very little htpR gene product. Polypeptide F33.4 is postulated to be the product of htpR and to be an effector that controls heat induction of the HTP regulon. Images PMID:6337122

  20. Molecular cloning and characterization of a gene encoding RING zinc finger ankyrin protein from drought-tolerant Artemisia desertorum.

    PubMed

    Yang, Xiuhong; Sun, Chao; Hu, Yuanlei; Lin, Zhongping

    2008-03-01

    A RING zinc finger ankyrin protein gene,designated AdZFP1, was isolated from drought-tolerant Artemisia desertorum Spreng by mRNA differential display and RACE. Its cDNA was 1723 bp and encoded a putative protein of 445 amino acids with a predicted molecular mass of 47.9 kDa and an isoelectric point (pI) of 7.49. A typical C3HC4- type RING finger domain was found at the C-terminal region of the AdZFP1 protein,and several groups of ankyrin repeats were found at the N-terminal region. Alignments of amino acid sequence showed that AdZFP1 was 66% identical to the Arabidopsis thaliana putative RING zinc finger ankyrin protein AAN31869. Transcriptional analysis showed that AdZFP1 was inducible under drought stress in root,stem and leaf of the plant.Semi-quantitative reverse- transcriptase-polymerase chain reaction (RT-PCR) analysis showed that the transcript of AdZFP1 was strongly induced by exogenous abscisic acid (ABA) and also by salinity,cold and heat to some extent. Overexpression of the AdZFP1 gene in transgenic tobacco enhanced their tolerance to drought stress.

  1. Molecular cloning and evolutionary analysis of captive forest musk deer bitter taste receptor gene T2R16.

    PubMed

    Zhao, G J; Wu, N; Li, D Y; Zeng, D J; Chen, Q; Lu, L; Feng, X L; Zhang, C L; Zheng, C L; Jie, H

    2015-12-08

    Sensing bitter tastes is crucial for most animals because it can prevent them from ingesting harmful food. This process is mainly mediated by the bitter taste receptors (T2R) that are largely expressed in the taste buds. Previous studies have identified some T2R gene repertoires. Marked variation in repertoire size has been noted among species. However, research on T2Rs is still limited and the mechanisms underlying the evolution of vertebrate T2Rs remain poorly understood. In the present study, we analyzed the structure and features of the protein encoded by the forest musk deer (Moschus berezovskii) T2R16 and submitted the gene sequence to NCBI GenBank. The results showed that the full coding DNA sequence (CDS) of musk deer T2R16 (GenBank accession No. KP677279) was 906 bp, encoding 301 amino acids, which contained ATG start codon and TGA stop codon, with a calculated molecular weight of 35.03 kDa and an isoelectric point of 9.56. The T2R16 protein receptor had seven conserved transmembrane regions. Hydrophobicity analysis showed that most amino acid residues in T2R16 protein were hydrophobic, and the grand average of hydrophobicity (GRAVY) was 0.657. Phylogenetic analysis based on this gene revealed that forest musk deer had the closest association with sheep (Ovis aries), as compared to cow (Bos taurus), Tursiops truncatus, and other species, whereas it was genetically farthest from humans (Homo sapiens). We hope these results would complement the existing data on T2R16 and encourage further research in this respect.

  2. Molecular cloning and characterization of multidomain xylanase from manure library

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The gene (manf-x10) encoding xylanase from an environmental genomic DNA library was cloned and expressed in Escherichia coli. The encoded enzyme was predicted to be 467 amino acids with a molecular mass of 50.3 kD. The recombinant ManF-X10 was purified by HisTrap affinity column and showed activit...

  3. Analysis of the ergosterol biosynthesis pathway cloning, molecular characterization and phylogeny of lanosterol 14 α-demethylase (ERG11) gene of Moniliophthora perniciosa

    PubMed Central

    de Oliveira Ceita, Geruza; Vilas-Boas, Laurival Antônio; Castilho, Marcelo Santos; Carazzolle, Marcelo Falsarella; Pirovani, Carlos Priminho; Selbach-Schnadelbach, Alessandra; Gramacho, Karina Peres; Ramos, Pablo Ivan Pereira; Barbosa, Luciana Veiga; Pereira, Gonçalo Amarante Guimarães; Góes-Neto, Aristóteles

    2014-01-01

    The phytopathogenic fungus Moniliophthora perniciosa (Stahel) Aime & Philips-Mora, causal agent of witches’ broom disease of cocoa, causes countless damage to cocoa production in Brazil. Molecular studies have attempted to identify genes that play important roles in fungal survival and virulence. In this study, sequences deposited in the M. perniciosa Genome Sequencing Project database were analyzed to identify potential biological targets. For the first time, the ergosterol biosynthetic pathway in M. perniciosa was studied and the lanosterol 14α-demethylase gene (ERG11) that encodes the main enzyme of this pathway and is a target for fungicides was cloned, characterized molecularly and its phylogeny analyzed. ERG11 genomic DNA and cDNA were characterized and sequence analysis of the ERG11 protein identified highly conserved domains typical of this enzyme, such as SRS1, SRS4, EXXR and the heme-binding region (HBR). Comparison of the protein sequences and phylogenetic analysis revealed that the M. perniciosa enzyme was most closely related to that of Coprinopsis cinerea. PMID:25505843

  4. Molecular cloning and characterization of a human cDNA and gene encoding a novel acid ceramidase-like protein.

    PubMed

    Hong, S B; Li, C M; Rhee, H J; Park, J H; He, X; Levy, B; Yoo, O J; Schuchman, E H

    1999-12-01

    Computer-assisted database analysis of sequences homologous to human acid ceramidase (ASAH) revealed a 1233-bp cDNA (previously designated cPj-LTR) whose 266-amino-acid open reading frame had approximately 36% identity with the ASAH polypeptide. Based on this high degree of homology, we undertook further molecular characterization of cPj-LTR and now report the full-length cDNA sequence, complete gene structure (renamed human ASAHL since it is a human acid ceramidase-like sequence), chromosomal location, primer extension and promoter analysis, and transient expression results. The full-length human ASAHL cDNA was 1825 bp and contained an open-reading frame encoding a 359-amino-acid polypeptide that was 33% identical and 69% similar to the ASAH polypeptide over its entire length. Numerous short regions of complete identity were observed between these two sequences and two sequences obtained from the Caenorhabditis elegans genome database. The 30-kb human ASAHL genomic sequence contained 11 exons, which ranged in size from 26 to 671 bp, and 10 introns, which ranged from 150 bp to 6.4 kb. The gene was localized to the chromosomal region 4q21.1 by fluorescence in situ hybridization analysis. Northern blotting experiments revealed a major 2.0-kb ASAHL transcript that was expressed at high levels in the liver and kidney, but at relatively low levels in other tissues such as the lung, heart, and brain. Sequence analysis of the 5'-flanking region of the human ASAHL gene revealed a putative promoter region that lacked a TATA box and was GC rich, typical features of a housekeeping gene promoter, as well as several tissue-specific and/or hormone-induced transcription regulatory sites. 5'-Deletion analysis localized the promoter activity to a 1. 1-kb fragment within this region. A major transcription start site also was located 72 bp upstream from the ATG translation initiation site by primer extension analysis. Expression analysis of a green fluorescence protein/ASAHL fusion

  5. Molecular cloning of the human UMP synthase gene and characterization of point mutations in two hereditary orotic aciduria families.

    PubMed Central

    Suchi, M; Mizuno, H; Kawai, Y; Tsuboi, T; Sumi, S; Okajima, K; Hodgson, M E; Ogawa, H; Wada, Y

    1997-01-01

    Uridine monophosphate (UMP) synthase is a bifunctional enzyme catalyzing the last two steps of de novo pyrimidine biosynthesis, orotate phosphoribosyltransferase (OPRT) and orotidine-5'-monophosphate decarboxylase (ODC). Loss of either enzymatic activity results in hereditary orotic aciduria, a rare autosomal recessive disorder characterized by retarded growth, anemia, and excessive urinary excretion of orotic acid. We have isolated the UMP synthase chromosomal gene from a lambdaEMBL-3 human genomic library and report a single-copy gene spanning approximately 15 kb. The UMP synthase genomic structure encodes six exons ranging in size from 115 bp to 672 bp, and all splicing junctions adhere to the canonical GT/AG rule. Cognate promoter elements implicated in glucocorticoid- and cAMP-mediated regulation as well as in liver-, myeloid-, and lymphocyte-specific expression are located within the 5' flanking sequence. Molecular investigation of UMP synthase deficiency in a Japanese orotic aciduria patient revealed mutations R96G (A-to-G transition; nt 286) and G429R (G-to-C transversion; nt 1285) in one allele and V109G (T-to-G transversion; nt 326) in the other allele. Expression of human UMP synthase cDNAs containing these mutations in pyrimidine auxotrophic Escherichia coli and in recombinant baculovirus-infected Sf21 cells demonstrates impaired activity presumably associated with the urinary orotic acid substrate accumulations observed in vivo. We further establish the identity of two polymorphisms, G213A (v = .26) and 440Gpoly (v = .27) located in exons 3 and 6, respectively, which did not significantly compromise either OPRT or ODC function. Images Figure 1 Figure 4 Figure 5 PMID:9042911

  6. Molecular cloning and characterization of amh, dax1 and cyp19a1a genes and their response to 17α-methyltestosterone in Pengze crucian carp.

    PubMed

    Li, Meng; Wang, Lihong; Wang, Houpeng; Liang, Hongwei; Zheng, Yao; Qin, Fang; Liu, Shaozhen; Zhang, Yingying; Wang, Zaizhao

    2013-05-01

    The proteins encoded by amh, dax1 and cyp19a1a play important roles in gonad differentiation. Their functions have been far less studied in teleosts. In this study, the full-length cDNAs of amh, dax1 and cyp19a1a were cloned and characterized in a triploid gynogenic fish, the Pengze crucian carp. Their expression profilings in juvenile development, adult tissues and juveniles exposed to 100 ng/L 17α-methyltestosterone (MT) were investigated. Results showed that their putative proteins shared high identities to their counterparts in cyprinid fish species, respectively. The tissue distribution results indicated that amh and cyp19a1a were predominantly expressed in the ovary and dax1 was dominantly expressed in the liver. Gene profiling in the developmental stages showed that all the three target genes had a consistent highest expression at 48 days post hatching (dph). The period of 48 dph appeared to be a key time during the process of the gonad development of Pengze crucian carp. 100 ng/L MT significantly increased the mRNA expression of amh at 2- and 4-week exposures and enhanced dax1 and cyp19a1a at 6-week exposure. The present study indicated that MT could influence the gonad development in Pengze crucian carp by disturbing sex-differentiation associated gene expression. Furthermore, the present study will be of great significance to broaden the understanding of molecular mechanisms of the physiological processes of reproduction in fish.

  7. Cloning of rat homeobox genes

    SciTech Connect

    Sakoyama, Yasuhiko; Mizuta, Ikuko; Ogasawara, Naotake

    1994-10-01

    We report the isolation of nine rat cognates of mouse homeoboxes within the four Hox gene clusters and a rat homologue of mouse IPF1 homeobox, RHbox No. 13A. The sequences of nine cloned homeoboxes are highly similar to those of the mouse and human homeoboxes in the Hox clusters. The restriction enzyme sites and map distances between each of the homeoboxes on the rat genome are nearly identical to those of mouse and human. Thus, we conclude that the isolated homeoboxes are the rat homologues of mouse homeoboxes within the four Hox clusters. A novel homeobox RHbox No. 13A is different from the Drosophila Antennapedia (Antp) sequence but is highly similar to the XlHbox8 (Xenopus laevis) and HtrA2 (Helobdella triserialis) homeoboxes. Forty-two amino acids of the last two-thirds of the RHbox No. 13A, XlHbox8, and mouse IPF1 homeodomains completely matched. In addition, these four homeodomains contain a unique His residue in the recognition helix of a helix-turn-helix DNA-binding motif. This His residue is not found in any of the previously published mammalian homeodomain sequences except mouse IPF1. 24 refs., 4 figs.

  8. Molecular cloning, nucleotide sequencing, and expression of genes encoding alcohol dehydrogenases from the thermophile Thermoanaerobacter brockii and the mesophile Clostridium beijerinckii.

    PubMed

    Peretz, M; Bogin, O; Tel-Or, S; Cohen, A; Li, G; Chen, J S; Burstein, Y

    1997-08-01

    Proteins play a pivotal role in thermophily. Comparing the molecular properties of homologous proteins from thermophilic and mesophilic bacteria is important for understanding the mechanisms of microbial adaptation to extreme environments. The thermophile Thermoanaerobacter (Thermoanaerobium) brockii and the mesophile Clostridium beijerinckii contain an NADP(H)-linked, zinc-containing secondary alcohol dehydrogenase (TBADH and CBADH) showing a similarly broad substrate range. The structural genes encoding the TBADH and the CBADH were cloned, sequenced, and highly expressed in Escherichia coli. The coding sequences of the TB adh and the CB adh genes are, respectively, 1056 and 1053 nucleotides long. The TB adh gene encoded an amino acid sequence identical to that of the purified TBADH. Alignment of the deduced amino acid sequences of the TB and CB adh genes showed a 76% identity and a 86% similarity, and the two genes had a similar preference for codons with A or T in the third position. Multiple sequence alignment of ADHs from different sources revealed that two (Cys-46 and His-67) of the three ligands for the catalytic Zn atom of the horse-liver ADH are preserved in TBADH and CBADH. Both the TBADH and CBADH were homotetramers. The substrate specificities and thermostabilities of the TBADH and CBADH expressed inE. coli were identical to those of the enzymes isolated from T. brockii and C. beijerinckii, respectively. A comparison of the amino acid composition of the two ADHs suggests that the presence of eight additional proline residues in TBADH than in CBADH and the exchange of hydrophilic and large hydrophobic residues in CBADH for the small hydrophobic amino acids Pro, Ala, and Val in TBADH might contribute to the higher thermostability of the T. brockii enzyme.

  9. Molecular Cloning, Characterization, and Expression of MiSOC1: A Homolog of the Flowering Gene SUPPRESSOR OF OVEREXPRESSION OF CONSTANS1 from Mango (Mangifera indica L)

    PubMed Central

    Wei, Junya; Liu, Debing; Liu, Guoyin; Tang, Jie; Chen, Yeyuan

    2016-01-01

    MADS-box transcription factor plays a crucial role in plant development, especially controlling the formation and development of floral organs. Mango (Mangifera indica L) is an economically important fruit crop, but its molecular control of flowering is largely unknown. To better understand the molecular basis of flowering regulation in mango, we isolated and characterized the MiSOC1, a putative mango orthologs for the Arabidopsis SUPPRESSOR OF OVEREXPRESSION OF CONSTANS1/AGAMOUS-LIKE 20 (SOC1/AGL20) with homology-based cloning and RACE. The full-length cDNA (GenBank accession No.: KP404094) is 945 bp in length including a 74 bp long 5′ UTR and a 189 bp long 3′ UTR and the open reading frame was 733 bps, encoding 223 amino acids with molecular weight 25.6 kD. Both sequence alignment and phylogenetic analysis all indicated that deduced protein contained a conservative MADS-box and semi-conservative K domain and belonged to the SOC1/TM3 subfamily of the MADS-box family. Quantitative real-time PCR was performed to investigate the expression profiles of MiSOC1 gene in different tissues/organs including root, stem, leaves, flower bud, and flower. The result indicated MiSOC1 was widely expressed at different levels in both vegetative and reproductive tissues/organs with the highest expression level in the stems’ leaves and inflorescences, low expression in roots and flowers. The expression of MiSOC1 in different flower developmental stages was different while same tissue –specific pattern among different varieties. In addition, MiSOC1 gene expression was affect by ethephon while high concentration ethephon inhibit the expression of MiSOC1. Overexpression of MiSOC1 resulted in early flowering in Arabidopsis. In conclusion, these results suggest that MiSOC1 may act as induce flower function in mango. PMID:27965680

  10. Molecular Cloning, Characterization, and Expression of MiSOC1: A Homolog of the Flowering Gene SUPPRESSOR OF OVEREXPRESSION OF CONSTANS1 from Mango (Mangifera indica L).

    PubMed

    Wei, Junya; Liu, Debing; Liu, Guoyin; Tang, Jie; Chen, Yeyuan

    2016-01-01

    MADS-box transcription factor plays a crucial role in plant development, especially controlling the formation and development of floral organs. Mango (Mangifera indica L) is an economically important fruit crop, but its molecular control of flowering is largely unknown. To better understand the molecular basis of flowering regulation in mango, we isolated and characterized the MiSOC1, a putative mango orthologs for the Arabidopsis SUPPRESSOR OF OVEREXPRESSION OF CONSTANS1/AGAMOUS-LIKE 20 (SOC1/AGL20) with homology-based cloning and RACE. The full-length cDNA (GenBank accession No.: KP404094) is 945 bp in length including a 74 bp long 5' UTR and a 189 bp long 3' UTR and the open reading frame was 733 bps, encoding 223 amino acids with molecular weight 25.6 kD. Both sequence alignment and phylogenetic analysis all indicated that deduced protein contained a conservative MADS-box and semi-conservative K domain and belonged to the SOC1/TM3 subfamily of the MADS-box family. Quantitative real-time PCR was performed to investigate the expression profiles of MiSOC1 gene in different tissues/organs including root, stem, leaves, flower bud, and flower. The result indicated MiSOC1 was widely expressed at different levels in both vegetative and reproductive tissues/organs with the highest expression level in the stems' leaves and inflorescences, low expression in roots and flowers. The expression of MiSOC1 in different flower developmental stages was different while same tissue -specific pattern among different varieties. In addition, MiSOC1 gene expression was affect by ethephon while high concentration ethephon inhibit the expression of MiSOC1. Overexpression of MiSOC1 resulted in early flowering in Arabidopsis. In conclusion, these results suggest that MiSOC1 may act as induce flower function in mango.

  11. Molecular cloning and characterization of two novel genes from hexaploid wheat that encode double PR-1 domains coupled with a receptor-like protein kinase

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Hexaploid wheat (Triticum aestivum L.) contains at least 23 TaPr-1 genes encoding the group 1 pathogenesis-related (PR-1) proteins as identified in our previous work. Here we report the cloning and characterization of TaPr-1-rk1 and TaPr-1-rk2, two novel genes closely related to the wheat PR-1 famil...

  12. Molecular cloning and functional analysis of GbRVd, a gene in Gossypium barbadense that plays an important role in conferring resistance to Verticillium wilt.

    PubMed

    Yang, Jun; Ma, Qing; Zhang, Yan; Wang, Xingfen; Zhang, Guiyin; Ma, Zhiying

    2016-01-10

    Most of the disease resistance genes already characterized in plants encode nucleotide-binding site-leucine rich repeat (NBS-LRR) proteins that have key roles in resistance to Verticillium dahliae. Using a cDNA library and RACE protocols, we cloned a coiled-coil (CC)-NBS-LRR-type gene, GbRVd, from a resistant tetraploid cotton species, Gossypium barbadense (RVd=Resistance to V. dahliae). We also applied RT-qPCR and VIGS technologies to analyze how expression of GbRVd was induced upon attack by V. dahliae. Its 2862-bp ORF encodes a predicted protein containing 953 amino acid residues, with a predicted molecular weight of 110.17kDa and an isoelectric point of 5.87. GbRVd has three domains - CC, NBS, and LRR - and is most closely related to Gossypium raimondii RVd (88% amino acid identity). Profiling demonstrated that GbRVd is constitutively expressed in all tested tissues, and transcript levels are especially high in the leaves. In plants inoculated with V. dahliae, GbRVd was significantly up-regulated when compared with the control, with expression peaking at 48h post-inoculation. Silencing of GbRVd in cotton through VIGS dramatically down-regulated SA, NO, and H2O2 production, resulting in greater susceptibility to V. dahliae. Taken together, these results suggest that GbRVd has an important role in protecting G. barbadense against infection by V. dahliae.

  13. Molecular cloning and characterization of a novel adenylyl cyclase gene, HpAC1, involved in stress signaling in Hippeastrum x hybridum.

    PubMed

    Swieżawska, Brygida; Jaworski, Krzysztof; Pawełek, Agnieszka; Grzegorzewska, Weronika; Szewczuk, Piotr; Szmidt-Jaworska, Adriana

    2014-07-01

    Adenylyl cyclases (ACs) are enzymes that generate cyclic AMP, which is involved in different physiological and developmental processes in a number of organisms. Here, we report the cloning and characterization of a new plant adenylyl cyclases (AC) gene, designated HpAC1, from Hippeastrum x hybridum. This gene encodes a protein of 206 amino acids with a calculated molecular mass of 23 kD and an isoelectric point of 5.07. The predicted amino acid sequence contains all the typical features of and shows high identity with putative plant ACs. The purified, recombinant HpAC1 is able to convert ATP to cAMP. The complementation test that was performed to analyze the ability of HpAC1 to compensate for the AC deficiency in the Escherichia coli SP850 strain revealed that HpAC1 functions as an adenylyl cyclase and produces cyclic AMP. Moreover, it was shown that the transcript level of HpAC1 and cyclic AMP concentration changed during certain stress conditions. Both mechanical damage and Phoma narcissi infection lead to two sharp increases in HpAC1 mRNA levels during a 72-h test cycle. Changes in intracellular cAMP level were also observed. These results may indicate the participation of a cAMP-dependent pathway both in rapid and systemic reactions induced after disruption of symplast and apoplast continuity.

  14. Cloning and molecular characterization of a glycerol-3-phosphate O-acyltransferase (GPAT) gene from Echium (Boraginaceae) involved in the biosynthesis of cutin polyesters.

    PubMed

    Mañas-Fernández, Aurora; Li-Beisson, Yonghua; Alonso, Diego López; García-Maroto, Federico

    2010-09-01

    The glycerol-based lipid polyester called cutin is a main component of cuticle, the protective interface of aerial plant organs also controlling compound exchange with the environment. Though recent progress towards understanding of cutin biosynthesis has been made in Arabidopsis thaliana, little is known in other plants. One key step in this process is the acyl transfer reaction to the glycerol backbone. Here we report the cloning and molecular characterization of EpGPAT1, a gene encoding a glycerol-3-phosphate O-acyltransferase (GPAT) from Echium pitardii (Boraginaceae) with high similarity to the AtGPAT4/AtGPAT8 of Arabidopsis. Quantitative analysis by qRT-PCR showed highest expression of EpGPAT1 in seeds, roots, young leaves and flowers. Acyltransferase activity of EpGPAT1 was evidenced by heterologous expression in yeast. Ectopic expression in leaves of tobacco plants lead to an increase of C16 and C18 hydroxyacids and alpha,omega-diacids in the cell wall fraction, indicating a role in the biosynthesis of polyesters. Analysis of the genomic organization in Echium revealed the presence of EpGPAT2, a closely related gene which was found to be mostly expressed in developing leaves and flowers. The presence of a conserved HAD-like domain at the N-terminal moiety of GPATs from Echium, Arabidopsis and other plant species suggests a possible phosphohydrolase activity in addition to the reported acyltransferase activity. Evolutive implications of this finding are discussed.

  15. Identification, molecular cloning, and transcription analysis of the Choristoneura fumiferana nuclear polyhedrosis virus spindle-like protein gene.

    PubMed

    Liu, J J; Carstens, E B

    1996-09-15

    The Choristoneura fumiferana nuclear polyhedrosis virus spindle-like protein (slp) gene has been identified and localized immediately downstream and in the same orientation as the CfMNPV DNA polymerase gene. The slp gene is 1101 bp long, predicted to code for a 366 amino acid (42.1 kDa) polypeptide. Transcriptional analysis revealed that the CfMNPV slp gene is expressed at late times postinfection, beginning at 24 hr postinfection and is most abundantly expressed after 36 hr. Transcription initiates within a single baculovirus consensus late start site sequence (GTAAG) at position -18 relative to the translation start codon. Based on amino acid comparisons, the CfMNPV gene is closely related to other similar baculovirus genes and distantly but recognizably related to the fusolin proteins of two entomopoxviruses. The conservation of amino acid sequence, glycosylation signals and specific domains throughout the protein suggest that this gene product may play an important role in insect DNA virus replication.

  16. Restoration of Chinese hamster cell radiation resistance by the human repair gene ERCC-5 and progress in molecular cloning of this gene

    SciTech Connect

    Strniste, G.F.; Chen, D.J.; deBruin, D.; McCoy, L.S.; Luke, J.A.; Mudgett, J.S.; Nickols, J.W.; Okinaka, R.T.; Tesmer, J.G.; MacInnes, M.A.

    1988-01-01

    The uv-sensitive Chinese hamster cell uv-135 is being used to identify and isolate the human gene, ERCC-5, which corrects nucleotide excision repair in this incision-defective mutant. A cosmid library, constructed from a 3/sup 0/ transformant of uv-135, has been screened for transfected gpt and human Alu family sequences. An ordered physical map of overlapping positives cosmids has been determined. Molecular evidence suggests a region of this map of <40 Kbp contains the ERCC-5 gene. 10 refs., 2 figs.

  17. Molecular cloning and expression of α-globin and β-globin genes from crocodile (Crocodylus siamensis).

    PubMed

    Anwised, Preeyanan; Kabbua, Thai; Temsiripong, Theeranan; Dhiravisit, Apisak; Jitrapakdee, Sarawut; Araki, Tomohiro; Yoneda, Kazunari; Thammasirirak, Sompong

    2013-03-01

    The first report of complete nucleotide sequences for α- and β-globin chains from the Siamese hemoglobin (Crocodylus siamensis) is given in this study. The cDNAs encoding α- and β-globins were cloned by RT-PCR using the degenerate primers and by the rapid amplification of cDNA ends method. The full-length α-globin cDNA contains an open reading frame of 423 nucleotides encoding 141 amino acid residues, whereas the β-globin cDNA contains an open reading frame of 438 nucleotides encoding 146 amino acid residues. The authenticity of both α- and β-globin cDNA clones were also confirmed by the heterologous expression in Escherichia coli (E. coli). This is the first time that the recombinant C. siamensis globins were produced in prokaryotic system. Additionally, the heme group was inserted into the recombinant proteins and purified heme-bound proteins were performed by affinity chromatography using Co(2+)-charged Talon resins. The heme-bound proteins appeared to have a maximum absorbance at 415 nm, indicated that the recombinant proteins bound to oxygen and formed active oxyhemoglobin (HbO2). The results indicated that recombinant C. siamensis globins were successfully expressed in prokaryotic system and possessed an activity as ligand binding protein.

  18. Identification and molecular cloning of three Halloween genes in the varroa mite, Varroa destructor (Anderson & Trueman) (Acari: Varroidae)

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Biosynthesis of 20-hydroxyecdysone (20E) in insects involves the action of five cytochrome P450s collectively known as Halloween genes. The complete transcripts of 3 Halloween genes [spook (Vdspo), disembodied (Vddib) and shade (Vdshd)] from the varroa mite were identified, sequenced and mapped to t...

  19. Molecular cloning and characterization of genes for antibodies generated by orbital tissue-infiltrating B-cells in Graves` ophthalmopathy

    SciTech Connect

    Jaume, J.C.; Portolano, S.; Prummel, M.F.; McLachlan, S.M.; Rapoport, B.

    1994-02-01

    Graves` ophthalmopathy is a distressing autoimmune disease of unknown etiology. Analysis of the genes for antibodies secreted by orbital tissue-infiltrating plasma cells might provide insight into the pathogenesis of this disease. The authors, therefore, constructed an immunoglobulin heavy (H) chain and an immunoglobulin k light (L) chain cDNA library from the orbital tissue of a patient with active Graves` ophthalmopathy. Analysis of 15 H (IgG1) and 15 L (k) chains revealed a restricted spectrum of variable region genes. Fourteen of 15 variable k genes were about 94% homologous to the closest known germline gene, KL012. Thirteen of 15 H chain genes were 91% and 90% homologous to the closest germline genes, DP10 and hv1263, respectively. Remarkably, these germline genes also code for other autoantibodies to striated muscle (KL012) and thyroid peridase (KL012 and hv1263). These studies raise the possibility that particular germline genes may be associated with autoimmunity in humans. Further, the present study opens the way to identifying ocular autoantigens that may be the target of an humoral immune response. 29 refs., 4 figs., 1 tab.

  20. Advances and applications of molecular cloning in clinical microbiology.

    PubMed

    Sharma, Kamal; Mishra, Ajay Kumar; Mehraj, Vikram; Duraisamy, Ganesh Selvaraj

    2014-10-01

    Molecular cloning is based on isolation of a DNA sequence of interest to obtain multiple copies of it in vitro. Application of this technique has become an increasingly important tool in clinical microbiology due to its simplicity, cost effectiveness, rapidity, and reliability. This review entails the recent advances in molecular cloning and its application in the clinical microbiology in the context of polymicrobial infections, recombinant antigens, recombinant vaccines, diagnostic probes, antimicrobial peptides, and recombinant cytokines. Culture-based methods in polymicrobial infection have many limitation, which has been overcome by cloning techniques and provide gold standard technique. Recombinant antigens produced by cloning technique are now being used for screening of HIV, HCV, HBV, CMV, Treponema pallidum, and other clinical infectious agents. Recombinant vaccines for hepatitis B, cholera, influenza A, and other diseases also use recombinant antigens which have replaced the use of live vaccines and thus reduce the risk for adverse effects. Gene probes developed by gene cloning have many applications including in early diagnosis of hereditary diseases, forensic investigations, and routine diagnosis. Industrial application of this technology produces new antibiotics in the form of antimicrobial peptides and recombinant cytokines that can be used as therapeutic agents.

  1. [Molecular cloning, sequence analysis and stress-related changes of the heat shock protein 60 gene in Neobenedenia melleni].

    PubMed

    Wang, Fang; Chen, Jiong; Shi, Yu-Hong; Lu, Xin-Jiang; Li, Ming-Yun

    2012-12-01

    Heat shock protein 60 is an essential chaperone that can maintain the natural structure and function of mitochondrial proteins. Here, we successfully cloned the full length cDNA of HSP60 from Neobenedenia melleni, designated as NmHSP60. Real-time quantitative PCR and Western blot were used to analyze the expression change of NmHSP60 under different temperature and salinity. Compared with the typical 25 Degrees Celsius, expressions decreased dramatically in eggs and adults at 18 Degrees Celsius. Conversely, at 32 Degrees Celsius, expression increase dramatically in adults. Compared with salinity 24, expressions were significantly down-regulated in adults at salinity 18, and up-regulated in eggs at salinity 30. Experimental results suggest that NmHSP60 may play an significant role in N. melleni's adaptation to adverse environmental conditions.

  2. Molecular cloning of alcohol dehydrogenase genes of the yeast Pichia stipitis and identification of the fermentative ADH.

    PubMed

    Passoth, V; Schäfer, B; Liebel, B; Weierstall, T; Klinner, U

    1998-10-01

    Two Pichia stipitis ADH genes (PsADH1 and PsADH2) were isolated by complementation of a Saccharomyces cerevisiae Adh(-)-mutant. The genes enabled the transformants to grow in the presence of antimycin A on glucose, to use ethanol as sole carbon source and made them sensitive to allylalcohol. The sequences of the genes showed similarities of 70-77% to sequences of ADH genes of Candida albicans, Kluyveromyces lactis, K. marxianus, and S. cerevisiae and about 60% homology to those of Schizosaccharomyces pombe and Aspergillus flavus. Southern hybridization experiments suggested that P. stipitis has only these two ADH genes. Both genes are located on the largest chromosome of P. stipitis. PsADH2 encodes for the ADH activity that is responsible for ethanol formation at oxygen limitation. The gene is regulated at the transcriptional level. Moreover, also in cells grown on ethanol, only PsADH2 transcript was found. PsADH1 transcript was detected under aerobic conditions on fermentable carbon sources.

  3. Molecular cloning, sequence identification and tissue expression profile of three novel sheep (Ovis aries) genes - BCKDHA, NAGA and HEXA.

    PubMed

    Liu, G Y; Gao, S Z

    2009-01-01

    The complete coding sequences of three sheep genes- BCKDHA, NAGA and HEXA were amplified using the reverse transcriptase polymerase chain reaction (RT-PCR), based on the conserved sequence information of the mouse or other mammals. The nucleotide sequences of these three genes revealed that the sheep BCKDHA gene encodes a protein of 313 amino acids which has high homology with the BCKDHA gene that encodes a protein of 447 amino acids that has high homology with the Branched chain keto acid dehydrogenase El, alpha polypeptide (BCKDHA) of five species chimpanzee (93%), human (96%), crab-eating macaque (93%), bovine (98%) and mouse (91%). The sheep NAGA gene encodes a protein of 411 amino acids that has high homology with the alpha-N-acetylgalactosaminidase (NAGA) of five species human (85%), bovine (94%), mouse (91%), rat (83%) and chicken (74%). The sheep HEXA gene encodes a protein of 529 amino acids that has high homology with the hexosaminidase A(HEXA) of five species bovine (98%), human (84%), Bornean orangután (84%), rat (80%) and mouse (81%). Finally these three novel sheep genes were assigned to GenelDs: 100145857, 100145858 and 100145856. The phylogenetic tree analysis revealed that the sheep BCKDHA, NAGA, and HEXA all have closer genetic relationships to the BCKDHA, NAGA, and HEXA of bovine. Tissue expression profile analysis was also carried out and results revealed that sheep BCKDHA, NAGA and HEXA genes were differentially expressed in tissues including muscle, heart, liver, fat, kidney, lung, small and large intestine. Our experiment is the first to establish the primary foundation for further research on these three sheep genes.

  4. Molecular cloning and functional characterization of the lycopene ε-cyclase gene via virus-induced gene silencing and its expression pattern in Nicotiana tabacum.

    PubMed

    Shi, Yanmei; Wang, Ran; Luo, Zhaopeng; Jin, Lifeng; Liu, Pingping; Chen, Qiansi; Li, Zefeng; Li, Feng; Wei, Chunyang; Wu, Mingzhu; Wei, Pan; Xie, He; Qu, Lingbo; Lin, Fucheng; Yang, Jun

    2014-08-22

    Lycopene ε-cyclase (ε-LCY) is a key enzyme that catalyzes the synthesis of α-branch carotenoids through the cyclization of lycopene. Two cDNA molecules encoding ε-LCY (designated Ntε-LCY1 and Ntε-LCY2) were cloned from Nicotiana tabacum. Ntε-LCY1 and Ntε-LCY2 are encoded by two distinct genes with different evolutionary origins, one originating from the tobacco progenitor, Nicotiana sylvestris, and the other originating from Nicotiana tomentosiformis. The two coding regions are 97% identical at the nucleotide level and 95% identical at the amino acid level. Transcripts of Ntε-LCY were detectable in both vegetative and reproductive organs, with a relatively higher level of expression in leaves than in other tissues. Subcellular localization experiments using an Ntε-LCY1-GFP fusion protein demonstrated that mature Ntε-LCY1 protein is localized within the chloroplast in Bright Yellow 2 suspension cells. Under low-temperature and low-irradiation stress, Ntε-LCY transcript levels substantially increased relative to control plants. Tobacco rattle virus (TRV)-mediated silencing of ε-LCY in Nicotiana benthamiana resulted in an increase of β-branch carotenoids and a reduction in the levels of α-branch carotenoids. Meanwhile, transcripts of related genes in the carotenoid biosynthetic pathway observably increased, with the exception of β-OHase in the TRV-ε-lcy line. Suppression of ε-LCY expression was also found to alleviate photoinhibition of Potosystem II in virus-induced gene silencing (VIGS) plants under low-temperature and low-irradiation stress. Our results provide insight into the regulatory role of ε-LCY in plant carotenoid biosynthesis and suggest a role for ε-LCY in positively modulating low temperature stress responses.

  5. Molecular Cloning and Functional Characterization of the Lycopene ε-Cyclase Gene via Virus-Induced Gene Silencing and Its Expression Pattern in Nicotiana tabacum

    PubMed Central

    Shi, Yanmei; Wang, Ran; Luo, Zhaopeng; Jin, Lifeng; Liu, Pingping; Chen, Qiansi; Li, Zefeng; Li, Feng; Wei, Chunyang; Wu, Mingzhu; Wei, Pan; Xie, He; Qu, Lingbo; Lin, Fucheng; Yang, Jun

    2014-01-01

    Lycopene ε-cyclase (ε-LCY) is a key enzyme that catalyzes the synthesis of α-branch carotenoids through the cyclization of lycopene. Two cDNA molecules encoding ε-LCY (designated Ntε-LCY1 and Ntε-LCY2) were cloned from Nicotiana tabacum. Ntε-LCY1 and Ntε-LCY2 are encoded by two distinct genes with different evolutionary origins, one originating from the tobacco progenitor, Nicotiana sylvestris, and the other originating from Nicotiana tomentosiformis. The two coding regions are 97% identical at the nucleotide level and 95% identical at the amino acid level. Transcripts of Ntε-LCY were detectable in both vegetative and reproductive organs, with a relatively higher level of expression in leaves than in other tissues. Subcellular localization experiments using an Ntε-LCY1-GFP fusion protein demonstrated that mature Ntε-LCY1 protein is localized within the chloroplast in Bright Yellow 2 suspension cells. Under low-temperature and low-irradiation stress, Ntε-LCY transcript levels substantially increased relative to control plants. Tobacco rattle virus (TRV)-mediated silencing of ε-LCY in Nicotiana benthamiana resulted in an increase of β-branch carotenoids and a reduction in the levels of α-branch carotenoids. Meanwhile, transcripts of related genes in the carotenoid biosynthetic pathway observably increased, with the exception of β-OHase in the TRV-ε-lcy line. Suppression of ε-LCY expression was also found to alleviate photoinhibition of Potosystem II in virus-induced gene silencing (VIGS) plants under low-temperature and low-irradiation stress. Our results provide insight into the regulatory role of ε-LCY in plant carotenoid biosynthesis and suggest a role for ε-LCY in positively modulating low temperature stress responses. PMID:25153631

  6. Molecular approach to annelid regeneration: cDNA subtraction cloning reveals various novel genes that are upregulated during the large-scale regeneration of the oligochaete, Enchytraeus japonensis.

    PubMed

    Myohara, Maroko; Niva, Cintia Carla; Lee, Jae Min

    2006-08-01

    To identify genes specifically activated during annelid regeneration, suppression subtractive hybridization was performed with cDNAs from regenerating and intact Enchytraeus japonensis, a terrestrial oligochaete that can regenerate a complete organism from small body fragments within 4-5 days. Filter array screening subsequently revealed that about 38% of the forward-subtracted cDNA clones contained genes that were upregulated during regeneration. Two hundred seventy-nine of these clones were sequenced and found to contain 165 different sequences (79 known and 86 unknown). Nine clones were fully sequenced and four of these sequences were matched to known genes for glutamine synthetase, glucosidase 1, retinal protein 4, and phosphoribosylaminoimidazole carboxylase, respectively. The remaining five clones encoded an unknown open-reading frame. The expression levels of these genes were highest during blastema formation. Our present results, therefore, demonstrate the great potential of annelids as a new experimental subject for the exploration of unknown genes that play critical roles in animal regeneration.

  7. Two beta-glycanase genes are clustered in Bacillus polymyxa: molecular cloning, expression, and sequence analysis of genes encoding a xylanase and an endo-beta-(1,3)-(1,4)-glucanase.

    PubMed

    Gosalbes, M J; Pérez-González, J A; González, R; Navarro, A

    1991-12-01

    Two genes, xynD and gluB, encoding a xylanase and an endo-beta-(1,3)-(1,4)-glucanase (lichenase) from Bacillus polymyxa have been cloned and expressed in Escherichia coli and Bacillus subtilis. A sequenced DNA fragment of 4,466 bp contains both genes, which are separated by 155 bp. The xynD and gluB genes encode proteins of 67.8 kDa (XYND) and 27 kDa (GLUB). Two peptides with molecular masses of 62 and 53 kDa appear in cell extracts of E. coli and culture supernatants of B. subtilis clones containing the xynD gene. Both peptides show xylanase activity in zymogram analysis. The XYND enzyme also shows alpha-L-arabinofuranosidase activity. The XYND peptide and the xylanase XYNZ from Clostridium thermocellum (O. Grépinet, M. C. Chebrou, and P. Béguin, J. Bacteriol. 170:4582-4588, 1988) show 64% homology in a stretch of about 280 amino acids.

  8. Two beta-glycanase genes are clustered in Bacillus polymyxa: molecular cloning, expression, and sequence analysis of genes encoding a xylanase and an endo-beta-(1,3)-(1,4)-glucanase.

    PubMed Central

    Gosalbes, M J; Pérez-González, J A; González, R; Navarro, A

    1991-01-01

    Two genes, xynD and gluB, encoding a xylanase and an endo-beta-(1,3)-(1,4)-glucanase (lichenase) from Bacillus polymyxa have been cloned and expressed in Escherichia coli and Bacillus subtilis. A sequenced DNA fragment of 4,466 bp contains both genes, which are separated by 155 bp. The xynD and gluB genes encode proteins of 67.8 kDa (XYND) and 27 kDa (GLUB). Two peptides with molecular masses of 62 and 53 kDa appear in cell extracts of E. coli and culture supernatants of B. subtilis clones containing the xynD gene. Both peptides show xylanase activity in zymogram analysis. The XYND enzyme also shows alpha-L-arabinofuranosidase activity. The XYND peptide and the xylanase XYNZ from Clostridium thermocellum (O. Grépinet, M. C. Chebrou, and P. Béguin, J. Bacteriol. 170:4582-4588, 1988) show 64% homology in a stretch of about 280 amino acids. Images FIG. 3 PMID:1938968

  9. Molecular cloning of a coiled-coil-nucleotide-binding-site-leucine-rich repeat gene from pearl millet and its expression pattern in response to the downy mildew pathogen.

    PubMed

    Veena, Mariswamy; Melvin, Prasad; Prabhu, Sreedhara Ashok; Shailasree, Sekhar; Shetty, Hunthrike Shekar; Kini, Kukkundoor Ramachandra

    2016-03-01

    Downy mildew caused by Sclerospora graminicola is a devastating disease of pearl millet. Based on candidate gene approach, a set of 22 resistance gene analogues were identified. The clone RGPM 301 (AY117410) containing a partial sequence shared 83% similarity to rice R-proteins. A full-length R-gene RGA RGPM 301 of 3552 bp with 2979 bp open reading frame encoding 992 amino acids was isolated by the degenerate primers and rapid amplification of cDNA ends polymerase chain reaction (RACE-PCR) approach. It had a molecular mass of 113.96 kDa and isoelectric point (pI) of 8.71. The sequence alignment and phylogenetic analysis grouped it to a non-TIR NBS LRR group. The quantitative real-time PCR (qRT-PCR) analysis revealed higher accumulation of the transcripts following inoculation with S. graminicola in the resistant cultivar (IP18296) compared to susceptible cultivar (7042S). Further, significant induction in the transcript levels were observed when treated with abiotic elicitor β-aminobutyric acid (BABA) and biotic elicitor Pseudomonas fluorescens. Exogenous application of phytohormones jasmonic acid or salicylic acid also up-regulated the expression levels of RGA RGPM 301. The treatment of cultivar IP18296 with mitogen-activated protein kinase (MPK) inhibitors (PD98059 and U0126) suppressed the levels of RGA RGPM 301. A 3.5 kb RGA RGPM 301 which is a non-TIR NBS-LRR protein was isolated from pearl millet and its up-regulation during downy mildew interaction was demonstrated by qRT-PCR. These studies indicate a role for this RGA in pearl millet downy mildew interaction.

  10. ERCC2: cDNA cloning and molecular characterization of a human nucleotide excision repair gene with high homology to yeast RAD3.

    PubMed Central

    Weber, C A; Salazar, E P; Stewart, S A; Thompson, L H

    1990-01-01

    Human ERCC2 genomic clones give efficient, stable correction of the nucleotide excision repair defect in UV5 Chinese hamster ovary cells. One clone having a breakpoint just 5' of classical promoter elements corrects only transiently, implicating further flanking sequences in stable gene expression. The nucleotide sequences of a cDNA clone and genomic flanking regions were determined. The ERCC2 translated amino acid sequence has 52% identity (73% homology) with the yeast nucleotide excision repair protein RAD3. RAD3 is essential for cell viability and encodes a protein that is a single-stranded DNA dependent ATPase and an ATP dependent helicase. The similarity of ERCC2 and RAD3 suggests a role for ERCC2 in both cell viability and DNA repair and provides the first insight into the biochemical function of a mammalian nucleotide excision repair gene. Images Fig. 5. PMID:2184031

  11. Mismatch Repair in Schizosaccharomyces Pombe Requires the Mutl Homologous Gene Pms1: Molecular Cloning and Functional Analysis

    PubMed Central

    Schar, P.; Baur, M.; Schneider, C.; Kohli, J.

    1997-01-01

    Homologues of the bacterial mutS and mutL genes involved in DNA mismatch repair have been found in organisms from bacteria to humans. Here, we describe the structure and function of a newly identified Schizosaccharomyces pombe gene that encodes a predicted amino acid sequence of 794 residues with a high degree of homology to MutL related proteins. On the basis of its closer relationship to the eukaryotic ``PMS'' genes than to the ``MLH'' genes, we have designated the S. pombe homologue pms1. Disruption of the pms1 gene causes a significant increase of spontaneous mutagenesis as documented by reversion rate measurements. Tetrad analyses of crosses homozygous for the pms1 mutation reveal a reduction of spore viability from >92% to 80% associated with a low proportion (~50%) of meioses producing four viable spores and a significant, allele-dependent increase of the level of post-meiotic segregation of genetic marker allele pairs. The mutant phenotypes are consistent with a general function of pms1 in correction of mismatched base pairs arising as a consequence of DNA polymerase errors during DNA synthesis, or of hybrid DNA formation between homologous but not perfectly complementary DNA strands during meiotic recombination. PMID:9258673

  12. Molecular cloning and functional analysis of the duck TIR domain-containing adaptor inducing IFN-β (TRIF) gene.

    PubMed

    Wei, Xiaoqin; Qian, Wei; Sizhu, Suolang; Shi, Lijuan; Jin, Meilin; Zhou, Hongbo

    2016-12-01

    Toll-like receptors (TLRs) trigger the innate immune response by responding to specific components of microorganisms. The TIR domain-containing adaptor inducing IFN-β (TRIF) plays an essential role in mammalian TLR-mediated signaling. The role of TRIF in ducks (duTRIF) remains poorly understood. In this study, we cloned and characterized the full-length coding sequence of duTRIF from duck embryo fibroblasts (DEFs). In healthy ducks, duTRIF transcripts were broadly expressed in different tissues, with higher expression levels in the spleen and liver. Using quantitative real-time PCR (qRT-PCR), we demonstrated the upregulation of duTRIF in DEFs infected with AIV or DTMUV, and DEFs treated with Poly I:C or LPS. Overexpression of duTRIF was able to induce the NF-κB and IFN-β expression. Furthermore, the IFN induction function of duTRIF was impaired when Ala517 was mutated to Pro or His. Taken together, these results suggested that duTRIF regulated duck innate immune responses.

  13. [Molecular cloning, structural analysis, and expression of zona pellucida glycoprotein ZP3 gene from Chinese zokor, Myospalax fontanierii].

    PubMed

    Sui, D D; Wu, J L; Zhang, H; Li, H; Zhou, Z M; Zhang, D H; Han, C X

    2014-01-01

    The zona pellucida 3 (ZP3) plays a crucial role in reproductive immunology. We obtained a full-length cDNA encoding Chinese Zokor zp3, using rapid amplification of cDNA ends-polymerase chain reaction (RACE-PCR). The cDNA contains an open reading frame of 1269 nucleotides encoding a polypeptide of 422 amino acid residues. The amino acid sequence has a high degree of homology with hamster (78%), mouse (76%), and rat (74%). XhoI and SacI sites restricted 1158 bp fragment of zokor ZP3 cDNA, excluding the signal sequence and transmembrane-like domain was cloned under the phage T7 promoterlac operator control in the pET-28a(+) vector. Recombinant pET-zokorZP3 (r-ZP3) was expressed as a poly-histidine fusion protein in E. coli strain BL21 (DE3). Optimum expression of r-ZP3 was observed at 28 degrees C, 1 mM IPTG and 2 h of inducing. The purified protein was tested by Western blot.

  14. Molecular Cloning, Characterization and mRNA Expression of a Chitin Synthase 2 Gene from the Oriental Fruit Fly, Bactrocera dorsalis (Diptera: Tephritidae)

    PubMed Central

    Chen, Li; Yang, Wen-Jia; Cong, Lin; Xu, Kang-Kang; Wang, Jin-Jun

    2013-01-01

    Chitin synthase (CHS), a potential target for eco-friendly insecticides, plays an essential role in chitin formation in insects. In this study, a full-length cDNA encoding chitin synthase 2 (BdCHS2) was cloned and characterized in the oriental fruit fly, Bactrocera dorsalis. The BdCHS2 cDNA had 4417 nucleotides, containing an open reading frame of 4122 nucleotides, which encoded 1373 amino acid residues with a predicted molecular weight of 158.5 kDa. Phylogenetic analysis with other insect CHSs suggested that BdCHS2 belongs to insect CHS2. The BdCHS2 transcript was predominately found in midgut but was detected at low levels in fat body, Malpighian tubules, integument, and trachea. Moreover, BdCHS2 was expressed in all developmental stages, and highly expressed in the feeding stages. There was a positive relationship between BdCHS2 expression and total chitin content during development. Furthermore, both the gene expression and chitin content in midgut decreased when the insect was fed for 24 h, then starved for 24 h, while they increased dramatically and rapidly under the condition of starvation for 24 h then feeding for 24 h. These results suggest that BdCHS2 may play an important role in regulating chitin content of the midgut, and subsequently affect the growth and development of B. dorsalis. PMID:23965972

  15. Molecular cloning and functional characterization of the sex-determination gene doublesex in the sexually dimorphic broad-horned beetle Gnatocerus cornutus (Coleoptera, Tenebrionidae).

    PubMed

    Gotoh, Hiroki; Ishiguro, Mai; Nishikawa, Hideto; Morita, Shinichi; Okada, Kensuke; Miyatake, Takahisa; Yaginuma, Toshinobu; Niimi, Teruyuki

    2016-07-11

    Various types of weapon traits found in insect order Coleoptera are known as outstanding examples of sexually selected exaggerated characters. It is known that the sex determination gene doublesex (dsx) plays a significant role in sex-specific expression of weapon traits in various beetles belonging to the superfamily Scarabaeoidea. Although sex-specific weapon traits have evolved independently in various Coleopteran groups, developmental mechanisms of sex-specific expression have not been studied outside of the Scarabaeoidea. In order to test the hypothesis that dsx-dependent sex-specific expression of weapon traits is a general mechanism among the Coleoptera, we have characterized the dsx in the sexually dimorphic broad-horned beetle Gnatocerus cornutus (Tenebrionidea, Tenebirionidae). By using molecular cloning, we identified five splicing variants of Gnatocerus cornutus dsx (Gcdsx), which are predicted to code four different isoforms. We found one male-specific variant (GcDsx-M), two female-specific variants (GcDsx-FL and GcDsx-FS) and two non-sex-specific variants (correspond to a single isoform, GcDsx-C). Knockdown of all Dsx isoforms resulted in intersex phenotype both in male and female. Also, knockdown of all female-specific isoforms transformed females to intersex phenotype, while did not affect male phenotype. Our results clearly illustrate the important function of Gcdsx in determining sex-specific trait expression in both sexes.

  16. Molecular cloning and functional characterization of the sex-determination gene doublesex in the sexually dimorphic broad-horned beetle Gnatocerus cornutus (Coleoptera, Tenebrionidae)

    PubMed Central

    Gotoh, Hiroki; Ishiguro, Mai; Nishikawa, Hideto; Morita, Shinichi; Okada, Kensuke; Miyatake, Takahisa; Yaginuma, Toshinobu; Niimi, Teruyuki

    2016-01-01

    Various types of weapon traits found in insect order Coleoptera are known as outstanding examples of sexually selected exaggerated characters. It is known that the sex determination gene doublesex (dsx) plays a significant role in sex-specific expression of weapon traits in various beetles belonging to the superfamily Scarabaeoidea. Although sex-specific weapon traits have evolved independently in various Coleopteran groups, developmental mechanisms of sex-specific expression have not been studied outside of the Scarabaeoidea. In order to test the hypothesis that dsx-dependent sex-specific expression of weapon traits is a general mechanism among the Coleoptera, we have characterized the dsx in the sexually dimorphic broad-horned beetle Gnatocerus cornutus (Tenebrionidea, Tenebirionidae). By using molecular cloning, we identified five splicing variants of Gnatocerus cornutus dsx (Gcdsx), which are predicted to code four different isoforms. We found one male-specific variant (GcDsx-M), two female-specific variants (GcDsx-FL and GcDsx-FS) and two non-sex-specific variants (correspond to a single isoform, GcDsx-C). Knockdown of all Dsx isoforms resulted in intersex phenotype both in male and female. Also, knockdown of all female-specific isoforms transformed females to intersex phenotype, while did not affect male phenotype. Our results clearly illustrate the important function of Gcdsx in determining sex-specific trait expression in both sexes. PMID:27404087

  17. Molecular cloning, characterization and mRNA expression of a chitin synthase 2 gene from the oriental fruit fly, Bactrocera dorsalis (Diptera: Tephritidae).

    PubMed

    Chen, Li; Yang, Wen-Jia; Cong, Lin; Xu, Kang-Kang; Wang, Jin-Jun

    2013-08-19

    Chitin synthase (CHS), a potential target for eco-friendly insecticides, plays an essential role in chitin formation in insects. In this study, a full-length cDNA encoding chitin synthase 2 (BdCHS2) was cloned and characterized in the oriental fruit fly, Bactrocera dorsalis. The BdCHS2 cDNA had 4417 nucleotides, containing an open reading frame of 4122 nucleotides, which encoded 1373 amino acid residues with a predicted molecular weight of 158.5 kDa. Phylogenetic analysis with other insect CHSs suggested that BdCHS2 belongs to insect CHS2. The BdCHS2 transcript was predominately found in midgut but was detected at low levels in fat body, Malpighian tubules, integument, and trachea. Moreover, BdCHS2 was expressed in all developmental stages, and highly expressed in the feeding stages. There was a positive relationship between BdCHS2 expression and total chitin content during development. Furthermore, both the gene expression and chitin content in midgut decreased when the insect was fed for 24 h, then starved for 24 h, while they increased dramatically and rapidly under the condition of starvation for 24 h then feeding for 24 h. These results suggest that BdCHS2 may play an important role in regulating chitin content of the midgut, and subsequently affect the growth and development of B. dorsalis.

  18. Molecular cloning, mRNA expression and tissue distribution analysis of Slc7a11 gene in alpaca (Lama paco) skins associated with different coat colors.

    PubMed

    Tian, Xue; Meng, Xiaolin; Wang, Liangyan; Song, Yunfei; Zhang, Danli; Ji, Yuankai; Li, Xuejun; Dong, Changsheng

    2015-01-25

    Slc7a11 encoding solute carrier family 7 member 11 (amionic amino acid transporter light chain, xCT), has been identified to be a critical genetic regulator of pheomelanin synthesis in hair and melanocytes. To better understand the molecular characterization of Slc7a11 and the expression patterns in skin of white versus brown alpaca (lama paco), we cloned the full length coding sequence (CDS) of alpaca Slc7a11 gene and analyzed the expression patterns using Real Time PCR, Western blotting and immunohistochemistry. The full length CDS of 1512bp encodes a 503 amino acid polypeptide. Sequence analysis showed that alpaca xCT contains 12 transmembrane regions consistent with the highly conserved amino acid permease (AA_permease_2) domain similar to other vertebrates. Sequence alignment and phylogenetic analysis revealed that alpaca xCT had the highest identity and shared the same branch with Camelus ferus. Real Time PCR and Western blotting suggested that xCT was expressed at significantly high levels in brown alpaca skin, and transcripts and protein possessed the same expression pattern in white and brown alpaca skins. Additionally, immunohistochemical analysis further demonstrated that xCT staining was robustly increased in the matrix and root sheath of brown alpaca skin compared with that of white. These results suggest that Slc7a11 functions in alpaca coat color regulation and offer essential information for further exploration on the role of Slc7a11 in melanogenesis.

  19. Molecular cloning, characterization and expression profiles of multiple leptin genes and a leptin receptor gene in orange-spotted grouper (Epinephelus coioides).

    PubMed

    Zhang, Huixian; Chen, Huapu; Zhang, Yong; Li, Shuisheng; Lu, Danqi; Zhang, Haifa; Meng, Zining; Liu, Xiaochun; Lin, Haoran

    2013-01-15

    Leptin plays key roles in body weight regulation, energy metabolism, food intake, reproduction and immunity in mammals. However, its function in teleosts is still unclear. In the present study, two leptin genes (gLepA and gLepB) and one leptin receptor gene (gLepR) were cloned and characterized in orange-spotted grouper (Epinephelus coioides). The cDNAs of gLepA and gLepB were 671 bp and 684 bp in length, encoding for proteins of 161 amino acid (aa) and 158 aa, respectively. The three-dimensional (3D) structures modeling of gLepA and gLepB showed strong conservation of tertiary structure with that of other vertebrates. The total length of gLepR cDNA was 4242 bp, encoding a protein of 1169 aa which contained all functionally important domains conserved among vertebrate LEPR. Tissue distribution analysis showed that gLepA was highly expressed in cerebellum, liver and ovary, while gLepB mRNA abundantly in the brain regions, as well as in the ovary with some extend. The gLepR was mainly expressed in kidney, head kidney and most of brain regions. Analysis of expression profiles of gLep and gLepR genes during the embryonic stages showed that high expression of gLepR was observed in the brain vesicle stage, while neither gLepA nor gLepB mRNA was detected during different embryonic stages. Finally, fasting and refeeding experiments were carried out to investigate the possible function of leptin genes in food intake and energy metabolism, and the results showed that a significant increase of gLepA expression in the liver was induced by food deprivation in both short-term (7 days) and long-term (3 weeks) fasting and gLepA mRNA upregulation was eliminated after refeeding, while gLepB wasn't detected in the liver of grouper during fasting. No significant differences in hypothalamic leptin and leptin receptor expression were found during short-term fasting and refeeding. Hepatic expression of gLepA mRNA increased significantly 9h after a single meal. These results suggested g

  20. Molecular cloning and characterization of a ToxA-like gene from the maize pathogen Cochliobolus heterostrophus

    Technology Transfer Automated Retrieval System (TEKTRAN)

    ToxA, the first discovered fungal proteinaceous host-selective toxin, was originally identified from the tan spot fungus Pyrenophora tritici-repentis (Ptr). Homologues of the PtrToxA gene have not been identified from any other ascomycetes except the leaf/glume blotch fungus Stagonospora nodorum, w...

  1. Molecular cloning and characterization of the mouse carboxyl ester lipase gene and evidence for expression in the lactating mammary gland

    SciTech Connect

    Lidmer, A.S.; Lundberg, L.; Kannius, M.; Bjursell, G.

    1995-09-01

    DNA hybridization was used to isolate a 2.04-kb cDNA encoding carboxyl ester lipase (CEL) from a mouse lactating mammary gland, {lambda}gt10 cDNA library. The cDNA sequence translated into a protein of 599 amino acids, including 20 amino acids of a putative signal peptide. Comparison of the deduced amino acid sequence of the mouse CEL with CEL from five other species revealed that there is a high degree of a homology between the different species. The mouse CEL gene was also isolated and found to span approximately 7.2 kb and to include 11 exons. This organization is similar to those of the recently reported human and rat CEL genes. We have also analyzed expression of the CEL gene in the mammary glands from other species by performing a Northern blot analysis with RNA from goat and cow. The results show that the gene is expressed in both species. 36 refs., 6 figs., 1 tab.

  2. Cloning, expression, and molecular characterization of the gene encoding an extremely thermostable [4Fe-4S] ferredoxin from the hyperthermophilic archaeon Pyrococcus furiosus.

    PubMed Central

    Heltzel, A; Smith, E T; Zhou, Z H; Blamey, J M; Adams, M W

    1994-01-01

    The gene for ferredoxin from the hyperthermophilic archaeon Pyrococcus furiosus was cloned, sequenced, and expressed in Escherichia coli. The coding region confirmed the determined amino acid sequence. Putative archaeon-type transcriptional regulatory elements were identified. The fdxA gene appears to be an independent transcriptional unit. Recombinant ferredoxin was indistinguishable from the protein purified from P. furiosus in its thermal stability and in the potentiometric and spectroscopic properties of its [4Fe-4S] cluster. PMID:8045914

  3. Molecular cloning of a putative receptor protein kinase gene encoded at the self-incompatibility locus of Brassica oleracea

    SciTech Connect

    Stein, J.C.; Howlett, B.; Boyes, D.C.; Nasrallah, M.E.; Nasrallah, J.B. )

    1991-10-01

    Self-recognition between pollen and stigma during pollination in Brassica oleracea is genetically controlled by the multiallelic self-incompatibility locus (S). The authors describe the S receptor kinase (SRK) gene, a previously uncharacterized gene that residues at the S locus. The nucleotide sequences of genomic DNA and of cDNAs corresponding to SRK predict a putative transmembrane receptor having serine/threonine-specific protein kinase activity. Its extracellular domain exhibits striking homology to the secreted product of the S-locus genotypes are highly polymorphic and have apparently evolved in unison with genetically linked alleles of SLG. SRK directs the synthesis of several alternative transcripts, which potentially encode different protein products, and these transcripts were detected exclusively in reproductive organs. The identification of SRK may provide new perspectives into the signal transduction mechanism underlying pollen recognition.

  4. Molecular cloning, characterization and gene expression of an antioxidant enzyme catalase (MrCat) from Macrobrachium rosenbergii.

    PubMed

    Arockiaraj, Jesu; Easwvaran, Sarasvathi; Vanaraja, Puganeshwaran; Singh, Arun; Othman, Rofina Yasmin; Bhassu, Subha

    2012-05-01

    In this study, we reported a full length of catalase gene (designated as MrCat), identified from the transcriptome database of freshwater prawn Macrobrachium rosenbergii. The complete gene sequence of the MrCat is 2504 base pairs in length, and encodes 516 amino acids. The MrCat protein contains three domains such as catalase 1 (catalase proximal heme-ligand signature) at 350-358, catalase 2 (catalase proximal active site signature) at 60-76 and catalase 3 (catalase family profile) at 20-499. The mRNA expressions of MrCat in healthy and the infectious hypodermal and hematopoietic necrosis virus (IHHNV) challenged M. rosenbergii were examined using quantitative real time polymerase chain reaction (qRT-PCR). The MrCat is highly expressed in digestive tract and all the other tissues (walking leg, gills, muscle, hemocyte, hepatopancreas, pleopods, brain and eye stalk) of M. rosenbergii taken for analysis. The expression is strongly up-regulated in digestive tract after IHHNV challenge. To understand its biological activity, the recombinant MrCat gene was constructed and expressed in Escherichia coli BL21 (DE3). The recombinant MrCat existed in high thermal stability and broad spectrum of pH, which showed over 95% enzyme activity between pH 5 and 10.5, and was stable from 40 °C to 70 °C, and exhibited 85-100% enzyme activity from 30 °C to 40 °C.

  5. Molecular cloning of two molluscan caspases and gene functional analysis during Crassostrea angulata (Fujian oyster) larval metamorphosis.

    PubMed

    Yang, Bingye; Li, Lingling; Pu, Fei; You, Weiwei; Huang, Heqing; Ke, Caihuan

    2015-05-01

    Caspases have been demonstrated to possess important functions in apoptosis and immune system in vertebrate. But there is less information reported on the oyster larval development. In the present work, two full-length molluscan caspase genes, named Cacaspase-2 and Cacaspase-3, were characterized for the first time from Fujian oyster, Crassostrea angulata. Which respectively encode two predicted proteins both containing two caspase domains of p20 and p10 including the cysteine active site pentapeptide "QACRG" and the histidine active site signature. Otherwise Cacaspase-2 also contains a caspase recruitment domain. Homology and phylogenetic analysis showed that Cacaspase-2 shared high similarity with initiator caspase-2 groups, but Cacaspase-3 clustered together with executioner caspase-3 groups. Cacaspase-2 and Cacaspase-3 mRNA were both highly expressed in gills and labial palp and were significantly expressed highly in larvae during settlement and metamorphosis. Through the whole mount in situ hybridization, the location of Cacaspase-2 is in the foot of the oyster larvae and the location of Cacaspase-3 is in both the foot and velum tissues. These results implied that Cacaspase-2 and Cacaspase-3 genes play a key role in the loss of foot and Cacaspase-3 gene has an important function in the loss of velum during larvae metamorphosis in C. angulata.

  6. The phenylalanine ammonia-lyase gene family in Isatis indigotica Fort.: molecular cloning, characterization, and expression analysis.

    PubMed

    Ma, Rui-Fang; Liu, Qian-Zi; Xiao, Ying; Zhang, Lei; Li, Qing; Yin, Jun; Chen, Wan-Sheng

    2016-11-01

    Phenolic compounds, metabolites of the phenylpropanoid pathway, play an important role in the growth and environmental adaptation of many plants. Phenylalanine ammonia-lyase (PAL) is the first key enzyme of the phenylpropanoid pathway. The present study was designed to investigate whether there is a multi-gene family in I. Indigotic and, if so, to characterize their properties. We conducted a comprehensive survey on the transcription profiling database by using tBLASTn analysis. Several bioinformatics methods were employed to perform the prediction of composition and physicochemical characters. The expression levels of IiPAL genes in various tissues of I. indigotica with stress treatment were examined by quantitative real-time PCR. Protoplast transient transformation was used to observe the locations of IiPALs. IiPALs were functionally characterized by expression with pET-32a vector in Escherichia colis strain BL21 (DE3). Integration of transcripts and metabolite accumulations was used to reveal the relation between IiPALs and target compounds. An new gene (IiPAL2) was identified and both IiPALs had the conserved enzymatic active site Ala-Ser-Gly and were classified as members of dicotyledon. IiPAL1 and IiPAL2 were expressed in roots, stems, leaves, and flowers, with the highest expression levels of IiPAL1 and IiPAL2 being observed in stems and roots, respectively. The two genes responded to the exogenous elicitor in different manners. Subcellular localization experiment showed that both IiPALs were localized in the cytosol. The recombinant proteins were shown to catalyze the conversion of L-Phe to trans-cinnamic acid. Correlation analysis indicated that IiPAL1 was more close to the biosynthesis of secondary metabolites than IiPAL2. In conclusion, the present study provides a basis for the elucidation of the role of IiPALs genes in the biosynthesis of phenolic compounds, which will help further metabolic engineering to improve the accumulation of bioactive

  7. Molecular cloning of class III chitinase gene from Avicennia marina and its expression analysis in response to cadmium and lead stress.

    PubMed

    Wang, Li-Ying; Wang, You-Shao; Zhang, Jing-Ping; Gu, Ji-Dong

    2015-10-01

    Mangrove species have high tolerance to heavy metal pollution. Chitinases have been widely reported as defense proteins in response to heavy metal stress in terrestrial plants. In this study, a full-length cDNA sequence encoding an acidic and basic class III chitinase (AmCHI III) was cloned by using RT-PCR and RACE methods in Avicennia marina. AmCHI III mRNA expression in leaf of A. marina were investigated under Cd, Pb stresses on using real-time quantitative PCR. The deduced AmCHI III protein consists of 302 amino acids, including a signal putative peptide region, and a catalytic domain. Homology modeling of the catalytic domain revealed a typical molecular structure of class III plant chitinases. Results further demonstrated that the regulation of AmCHI III mRNA expression in leaves was strongly dependent on Cd, Pb stresses. AmCHI III mRNA expressions were significantly increased in response to Cd, Pb, and peaked at 7 days Cd-exposure, 7 days Pb-exposure, respectively. AmCHI III mRNA expression exhibited more sensitive to Pb stress than Cd stress. This work was the first time cloing chitinase from A. marina, and it brought evidence on chitinase gene involving in heavy metals (Cd(2+) and Pb(2+)) resistance or detoxification in plants. Further studies including the promoter and upstream regulation, gene over-expression and the response of mangrove chitinases to other stresses will shed more light on the role of chitinase in mangrove plants.

  8. Molecular cloning, gene expression analysis, and recombinant protein expression of novel silk proteins from larvae of a retreat-maker caddisfly, Stenopsyche marmorata.

    PubMed

    Bai, Xue; Sakaguchi, Mayo; Yamaguchi, Yuko; Ishihara, Shiori; Tsukada, Masuhiro; Hirabayashi, Kimio; Ohkawa, Kousaku; Nomura, Takaomi; Arai, Ryoichi

    2015-08-28

    Retreat-maker larvae of Stenopsyche marmorata, one of the major caddisfly species in Japan, produce silk threads and adhesives to build food capture nets and protective nests in water. Research on these underwater adhesive silk proteins potentially leads to the development of new functional biofiber materials. Recently, we identified four major S. marmorata silk proteins (Smsps), Smsp-1, Smsp-2, Smsp-3, and Smsp-4 from silk glands of S. marmorata larvae. In this study, we cloned full-length cDNAs of Smsp-2, Smsp-3, and Smsp-4 from the cDNA library of the S. marmorata silk glands to reveal the primary sequences of Smsps. Homology search results of the deduced amino acid sequences indicate that Smsp-2 and Smsp-4 are novel proteins. The Smsp-2 sequence [167 amino acids (aa)] has an array of GYD-rich repeat motifs and two (SX)4E motifs. The Smsp-4 sequence (132 aa) contains a number of GW-rich repeat motifs and three (SX)4E motifs. The Smsp-3 sequence (248 aa) exhibits high homology with fibroin light chain of other caddisflies. Gene expression analysis of Smsps by real-time PCR suggested that the gene expression of Smsp-1 and Smsp-3 was relatively stable throughout the year, whereas that of Smsp-2 and Smsp-4 varied seasonally. Furthermore, Smsps recombinant protein expression was successfully performed in Escherichia coli. The study provides new molecular insights into caddisfly aquatic silk and its potential for future applications.

  9. Molecular cloning and sequencing of infC, the gene encoding translation initiation factor IF3, from four enterobacterial species.

    PubMed

    Liveris, D; Schwartz, J J; Geertman, R; Schwartz, I

    1993-09-01

    Translation initiation factor IF3 plays a crucial role in initiation of protein synthesis in bacteria. In order to elucidate the IF3 structural elements required for these functions, the evolutionary conservation of IF3 and its gene, infC, was investigated. Homologous infC sequences from Salmonella typhimurium, Klebsiella pneumoniae, Serratia marcescens and Proteus vulgaris were amplified by the polymerase chain reaction and sequenced. Analysis of these sequences, as well as that from Bacillus stearothermophilus, revealed several regions (e.g. residues 62-73 and 173-177) of absolute sequence conservation, suggesting an important role for these regions in IF3 function.

  10. Detection and molecular cloning of CYP74Q1 gene: identification of Ranunculus acris leaf divinyl ether synthase.

    PubMed

    Gorina, Svetlana S; Toporkova, Yana Y; Mukhtarova, Lucia S; Chechetkin, Ivan R; Khairutdinov, Bulat I; Gogolev, Yuri V; Grechkin, Alexander N

    2014-09-01

    Enzymes of the CYP74 family, including the divinyl ether synthase (DES), play important roles in plant cell signalling and defence. The potent DES activities have been detected before in the leaves of the meadow buttercup (Ranunculus acris L.) and few other Ranunculaceae species. The nature of these DESs and their genes remained unrevealed. The PCR with degenerate primers enabled to detect the transcript of unknown P450 gene assigned as CYP74Q1. Besides, two more CYP74Q1 isoforms with minimal sequence variations have been found. The full length recombinant CYP74Q1 protein was expressed in Escherichia coli. The preferred substrates of this enzyme are the 13-hydroperoxides of α-linolenic and linoleic acids, which are converted to the divinyl ether oxylipins (ω5Z)-etherolenic acid, (9Z,11E)-12-[(1'Z,3'Z)-hexadienyloxy]-9,11-dodecadienoic acid, and (ω5Z)-etheroleic acid, (9Z,11E)-12-[(1'Z)-hexenyloxy]-9,11-dodecadienoic acid, respectively, as revealed by the data of mass spectrometry, NMR and UV spectroscopy. Thus, CYP74Q1 protein was identified as the R. acris DES (RaDES), a novel DES type and the opening member of new CYP74Q subfamily.

  11. The C. elegans gene pme-5: molecular cloning and role in the DNA-damage response of a tankyrase orthologue.

    PubMed

    Gravel, Catherine; Stergiou, Lilli; Gagnon, Steve N; Desnoyers, Serge

    2004-02-03

    Tankyrases are recently identified proteins characterized by ankyrin repeats and a poly(ADP-ribose) polymerase (PARP) signature motif. In vertebrates, tankyrases mediate protein-protein interactions via the ankyrin domain. Many partners have been identified that could function in telomere maintenance, signal transduction in vesicular transport, and cell death. To further our knowledge of tankyrases and to study their function in development, we sought and found a tankyrase-related gene in Caenorhabditis elegans that we named pme-5 (poly(ADP-ribose) metabolism enzyme-5). The protein encoded includes a large ankyrin domain and a catalytic PARP domain containing the well-conserved PARP signature sequence and the regulatory region. Unlike other tankyrases, PME-5 lacks a sterile-alpha module (SAM), but has a coiled coil domain which may mediate oligomerization. We also found that pme-5 mRNA is alternatively spliced at the fifth exon, producing a long (PME-5L) and a short (PME-5S) transcript. Both isoforms are constitutively expressed during the life cycle of C. elegans. We also show DNA damage increases expression of pme-5, a response that requires the DNA damage checkpoint gene hus-1. Moreover, DNA damage-induced germ cell apoptosis was slightly increased in pme-5(RNAi) hermaphrodites. Altogether, these data indicate that pme-5 is part of a DNA damage response pathway which leads to apoptosis in C. elegans.

  12. Molecular cloning and expression of a heat-shock cognate 70 (hsc70) gene from swordtail fish ( Xiphophorus helleri)

    NASA Astrophysics Data System (ADS)

    Li, Ningqiu; Fu, Xiaozhe; Han, Jingang; Shi, Cunbin; Huang, Zhibin; Wu, Shuqin

    2013-07-01

    Heat shock proteins are a family of molecular chaperones that are involved in many aspects of protein homeostasis. In the present study, a full-length cDNA, encoding the constitutively expressed 70-kDa heat shock cognate protein (Hsc70), was isolated from swordtail fish ( Xiphophorus helleri) and designated as XheHsc70. The Xhehsc70 cDNA was 2 104 bp long with an open reading frame of 1 941 bp, and it encoded a protein of 646 amino acids with a theoretical molecular weight of 70.77 kDa and an isoelectric point of 5.04. The deduced amino acid sequence shared 94.1%-98.6% identities with the Hsc70s from a number of other fish species. Tissue distribution results show that the Xhehsc70 mRNA was expressed in brain, heart, head kidney, kidney, spleen, liver, muscle, gill, and peripheral blood. After immunization with formalin-killed Vibrio alginolyticus cells there was a significant increase in the Xhehsc70 mRNA transcriptional level in the head kidney of the vaccinated fish compared with in the control at 6, 12, 24, and 48 h as shown by quantitative real time RT-PCR. Based on an analysis of the amino acid sequence of XheHsc70, its phylogeny, and Xhehsc70 mRNA expression, XheHsc70 was identified as a member of the cytoplasmic Hsc70 (constitutive) subfamily of the Hsp70 family of heat shock proteins, suggesting that it may play a role in the immune response. The Xhehsc70 cDNA sequence reported in this study was submitted to GenBank under the accession number JF739182.

  13. Molecular cloning and sequence analysis of the gene encoding OmpL1, a transmembrane outer membrane protein of pathogenic Leptospira spp.

    PubMed Central

    Haake, D A; Champion, C I; Martinich, C; Shang, E S; Blanco, D R; Miller, J N; Lovett, M A

    1993-01-01

    Pathogenic Leptospira spp. are spirochetes that have a low transmembrane outer membrane protein content relative to that of enteric gram-negative bacteria. In a previous study we identified a 31-kDa surface protein that was present in strains of Leptospira alstoni in amounts which correlated with the outer membrane particle density observed by freeze fracture electron microscopy (D. A. Haake, E. M. Walker, D. R. Blanco, C. A. Bolin, J. N. Miller, and M. A. Lovett, Infect. Immun. 59:1131-1140, 1991). The N-terminal amino acid sequence was used to design a pair of oligonucleotides which were utilized to screen a lambda ZAP II library containing EcoRI fragments of L. alstoni DNA. A 2.5-kb DNA fragment which contained the entire structural ompL1 gene was identified. The structural gene deduced from the sequence of this DNA fragment would encode a 320-amino-acid polypeptide with a 24-amino-acid leader peptide and a leader peptidase I cleavage site. Processing of OmpL1 results in a mature protein with a predicted molecular mass of 31,113 Da. Secondary-structure prediction identified repeated stretches of amphipathic beta-sheets typical of outer membrane protein membrane-spanning sequences. A topological model of OmpL1 containing 10 transmembrane segments is suggested. A recombinant OmpL1 fusion protein was expressed in Escherichia coli in order to immunize rabbits with the purified protein. Upon Triton X-114 extraction of L. alstoni and phase separation, anti-OmpL1 antiserum recognized a single band on immunoblots of the hydrophobic detergent fraction which was not present in the hydrophilic aqueous fraction. Immunoelectron microscopy with anti-OmpL1 antiserum demonstrates binding to the surface of intact L. alstoni. DNA hybridization studies indicate that the ompL1 gene is present in a single copy in all pathogenic Leptospira species that have been tested and is absent in nonpathogenic Leptospira species. OmpL1 may be the first spirochetal transmembrane outer membrane

  14. Molecular cloning and expression analysis of PDK family genes in Xenopus laevis reveal oocyte-specific PDK isoform.

    PubMed

    Terazawa, Yumiko; Tokmakov, Alexander A; Shirouzu, Mikako; Yokoyama, Shigeyuki

    2005-12-30

    Pyruvate dehydrogenase kinase (PDK) inactivates the multienzyme mitochondrial pyruvate dehydrogenase complex by the phosphorylation of three seryl residues in the pyruvate dehydrogenase moiety, and thus plays an important role in the control of glucose homeostasis. Genetically and biochemically distinct PDK family isozymes have been identified in mammalian species. In the present study, we demonstrate that the complete family of expressed PDK family genes in the tissues of the African clawed frog, Xenopus laevis, consists of four members, which are divided into two evolutionary groups. Xenopus PDKs (xPDKs) share an overall homology of about 70% to the human isoforms of PDK. The abundance of mRNAs for the four xPDK isoforms was analyzed by the real-time reverse transcriptase PCR technique in the various tissues of Xenopus laevis, including heart, lung, spleen, liver, kidney, skin, testis, oocytes, and eggs. Our data suggest that one of the xPDK isozymes can be referred to as an oocyte-specific xPDK. Functional differences between the xPDK isoforms are discussed, based on their different tissue-specific distributions and phylogenetic similarities to human PDKs.

  15. Molecular cloning, expression, purification and characterization of a novel cellulase gene (Bh-EGaseI) in the beetle Batocera horsfieldi.

    PubMed

    Mei, Hui-Zhen; Xia, Ding-Guo; Zhao, Qiao-Ling; Zhang, Guo-Zheng; Qiu, Zhi-Yong; Qian, Ping; Lu, Cheng

    2016-01-15

    Wood-feeding insects depend heavily on the secretion of a combination of cellulases, mainly endoglucanases and other glucanases such as exoglucanases and xylanases, to achieve efficient digestion of the cellulose of cellulosic materials. In this paper, we report a novel cellulose Bh-EGaseI belonging to the glycoside hydrolase family 45(gh45-1) obtained from the beetle Batocera horsfieldi. The Bh-EGaseI gene spans 714 bp and consists of three exons coding 237 amino acid residues. The cDNA encoding Bh-EGaseI was expressed as 25 KDa in baculovirus-infected Bombyx mori larvae. The expression products of Bh-EGaseI from larval hemolymph showed a specific enzymatic activity of approximately 1030.87 IU per mg. The enzyme was active over a wide range of pH and temperatures; optimal activity was observed at 40 °C and pH 4.0. The effects of ions on Bh-EGaseI activity were also studied, and results indicated that activity decreased to different extents upon addition of ions. Investigations on Bh-EGaseI facilitate their potential application in the production of bioenergy and biomaterials from cellulosic biomass in the future.

  16. Molecular cloning and expression of an encoding galactinol synthase gene (AnGolS1) in seedling of Ammopiptanthus nanus

    PubMed Central

    Liu, YuDong; Zhang, Li; Chen, LiJing; Ma, Hui; Ruan, YanYe; Xu, Tao; Xu, ChuanQiang; He, Yi; Qi, MingFang

    2016-01-01

    Based on the galactinol synthase (AnGolS1) fragment sequence from a cold-induced Suppression Subtractive Hybridization (SSH) library derived from Ammopiptanthus nanus (A. nanus) seedlings, AnGolS1 mRNA (including the 5′ UTR and 3′ UTR) (GenBank accession number: GU942748) was isolated and characterized by rapid amplification of cDNA ends polymerase chain reaction (RACE–PCR). A substrate reaction test revealed that AnGolS1 possessed galactinol synthase activity in vitro and could potentially be an early-responsive gene. Furthermore, quantitative real-time PCR (qRT-PCR) indicated that AnGolS1 was responded to cold, salts and drought stresses, however, significantly up-regulated in all origans by low temperatures, especially in plant stems. In addition, the hybridization signals in the fascicular cambium were strongest in all cells under low temperature. Thus, we propose that AnGolS1 plays critical roles in A. nanus low-temperature stress resistance and that fascicular cambium cells could be involved in AnGolS1 mRNA transcription, galactinol transportation and coordination under low-temperature stress. PMID:27786294

  17. Molecular cloning, expression, and stress response of the estrogen-related receptor gene (AccERR) from Apis cerana cerana

    NASA Astrophysics Data System (ADS)

    Zhang, Weixing; Zhu, Ming; Zhang, Ge; Liu, Feng; Wang, Hongfang; Guo, Xingqi; Xu, Baohua

    2016-04-01

    Estrogen-related receptor (ERR), which belongs to the nuclear receptor superfamily, has been implicated in diverse physiological processes involving the estrogen signaling pathway. However, little information is available on ERR in Apis cerana cerana. In this report, we isolated the ERR gene and investigated its involvement in antioxidant defense. Quantitative real-time polymerase chain reaction (qPCR) revealed that the highest mRNA expression occurred in eggs during different developmental stages. The expression levels of AccERR were highest in the muscle, followed by the rectum. The predicted transcription factor binding sites in the promoter of AccERR suggested that AccERR potentially functions in early development and in environmental stress responses. The expression of AccERR was induced by cold (4 °C), heat (42 °C), ultraviolet light (UV), HgCl2, and various types of pesticides (phoxim, deltamethrin, triadimefon, and cyhalothrin). Western blot was used to measure the expression levels of AccERR protein. These data suggested that AccERR might play a vital role in abiotic stress responses.

  18. Molecular cloning, characterization and gene expression of murrel CXC chemokine receptor 3a against sodium nitrite acute toxicity and microbial pathogens.

    PubMed

    Bhatt, Prasanth; Chaurasia, Mukesh Kumar; Palanisamy, Rajesh; Kumaresan, Venkatesh; Arasu, Abirami; Sathyamoorthi, Akila; Gnanam, Annie J; Kasi, Marimuthu; Pasupuleti, Mukesh; Ramaswamy, Harikrishnan; Arockiaraj, Jesu

    2014-08-01

    CXCR3 is a CXC chemokine receptor 3 which binds to CXC ligand 4 (CXCL4), 9, 10 and 11. CXC chemokine receptor 3a (CXCR3a) is one of the splice variants of CXCR3. It plays crucial role in defense and other physiological processes. In this study, we report the molecular cloning, characterization and gene expression of CXCR3a from striped murrel Channa striatus (Cs). The full length CsCXCR3a cDNA sequence was obtained from the constructed cDNA library of striped murrel by cloning and sequencing using an internal sequencing primer. The full length sequence is 1425 nucleotides in length including an open reading frame of 1086 nucleotides which is encoded with a polypeptide of 361 amino acids (mol. wt. 40 kDa). CsCXCR3a domain analysis showed that the protein contains a G protein coupled receptor between 55 and 305 along with its family signature at 129-145. The transmembrane prediction analysis showed that CsCXCR3a protein contains 7 transmembrane helical regions at 34-65, 80-106, 113-146, 154-181, 208-242, 249-278 and 284-308. The 'DRY' motif from CsCXCR3a protein sequence at (140)Asp-(141)Arg-(142)Tyr which is responsible for G-protein binding is also highly conserved with CXCR3 from other species. Phylogenetic tree showed that the CXC chemokine receptors 3, 4, 5 and 6, each formed a separate clade, but 1 and 2 were clustered together, which may be due to the high similarity between these receptors. The predicted 3D structure revealed cysteine residues, which are responsible for 'CXC' motif at 116 and 198. The CsCXR3a transcript was found to be high in kidney, further its expression was up-regulated by sodium nitrite acute toxicity exposure, fungal, bacterial and poly I:C challenges. Overall, these results supported the active involvement of CsCXCR3a in inflammatory process of striped murrel during infection. However, further study is necessary to explore the striped murrel chemokine signaling pathways and their roles in defense system.

  19. Molecular cloning and mRNA expression of a hepcidin gene from the spinyhead croaker, Collichthys lucidus.

    PubMed

    Sang, C; Lin, Y; Jiang, K; Zhang, F; Song, W

    2015-12-07

    Antimicrobial peptides are important components that participate in host innate immune activities and play crucial roles in host defense against microbial invasion. Hepcidin is an antimicrobial peptide and iron-regulatory molecule that primarily functions in the liver. In the present study, we first obtained a full-length cDNA sequence of hepcidin and its corresponding genomic DNA sequence from Collichthys lucidus using RT-PCR and rapid amplification of cDNA ends (RACE), and then analyzed these sequences using bioinformatics software. The results showed that C. lucidus hepcidin (CL-hepc) possesses two introns and three exons in the genomic DNA, with a length of 816 bp. The open reading frame was 264 bp, encoding an 87 amino acid peptide, and with high similarity (88.89%) to 83416593 Larimichthys crocea (ABC18307) and relatively low similarity (47.73%) to 158358729 L. crocea (ABY84845.1). The pre-peptide contained a signal peptide (28 amino acids), a prodomain (34 amino acids), and a mature peptide (25 amino acids). The predicted 25 amino acid hepcidin mature peptide included 8 conserved cysteine residues. Quantitative real-time reverse transcription-PCR analysis revealed specific expression patterns of CL-hepc, with the highest expression observed in the liver, relatively low expression observed in the gill and spleen, and almost no expression detected in other tissues analyzed. In conclusion, we identified a hepcidin from C. lucidus that has common expression patterns with other hepcidins. However, as this hepcidin is inconsistent with two other hepcidins from L. crocea in terms of the phylogenetic tree, the presence of another hepcidin gene warrants further investigation.

  20. Ovarian cysteine proteinases in the teleost Fundulus heteroclitus: molecular cloning and gene expression during vitellogenesis and oocyte maturation.

    PubMed

    Fabra, Mercedes; Cerdà, Joan

    2004-03-01

    The cysteine proteinases cathepsins B and L are members of the multigene family of lysosomal proteases that have been implicated in the processing of yolk proteins (YPs) in teleost oocytes. However, the full identification of the type of cathepsins expressed in fish ovarian follicles and embryos, as well as their regulatory mechanisms and specific function(s), are not yet elucidated. In this study, cDNAs encoding cathepsins B, L, F, K, S, Z, C, and H have been isolated from the teleost Fundulus heteroclitus, and the analysis of their deduced amino acid sequences revealed highly similar structural features to vertebrate orthologs, and confirmed in this species the existence of cathepsin L-like, cathepsin B-like, and cathepsin F-like subfamilies of cysteine proteinases. While all identified cathepsins were expressed in ovarian follicles, the corresponding mRNAs showed different temporal expression patterns. Thus, similar mRNA levels of cathepsins L, F, S, B, C, and Z were found throughout the oocyte growth or vitellogenesis period, whereas those for cathepsin H and K appeared to decrease as vitellogenesis advanced. During oocyte maturation, a transient accumulation of cathepsins L, S, H, and F mRNAs, approximately a 3-, 1.5-, 1.6-, and 6-fold increase, respectively, was detected in ovarian follicles within the 20-25 hr after hormone stimulation, coincident with the maximum proteolysis of the oocyte major YPs. The specific temporal pattern of expression of these genes may indicate a potential role of cathepsin L-like and cathepsin F proteases in the YP processing events occurring during fish oocyte maturation and/or early embryogenesis.

  1. Cloning, molecular characterization, and expression analysis of the signal transducer and activator of transcription 3 (STAT₃) gene from grass carp (Ctenopharyngodon idellus).

    PubMed

    Guo, Ting; Leng, Xiang-Jun; Wu, Xiao-Feng; Li, Jia-Le; Gao, Jian-Zhong; Li, Xiao-Qin; Gan, Tian; Wei, Jing

    2013-11-01

    Signal transducer and activator of transcription 3 (STAT₃) binds to Janus kinase 2 (JAK₂) to initiate the JAK₂/STAT₃ signal transduction pathway, which plays an important role in cancer cell proliferation, immune regulation, reproduction, lipid metabolism, and other physiological processes of the organism. In this study, the cDNA sequence of the STAT₃ gene from grass carp was cloned using RACE (rapid-amplification of cDNA ends). Twelve characteristics of the STAT₃ gene and its encoded protein sequence were predicted and analyzed using bioinformatics methods; these features included the general physical and chemical properties, the hydrophobicity, the secondary structure and the three-dimensional structure of the protein. Quantitative real-time PCR was employed to detect grass carp STAT₃ expression pattern in different tissues. The results showed that the full-length STAT₃ gene from grass carp is 2739-bp long and contains a 216-bp 5'UTR, a 300-bp 3'UTR, and a 2223-bp open reading frame (ORF) that encodes a 740-amino acid peptide. The deduced protein exhibited 99%∼94% homology to the STAT₃ protein of zebrafish (Danio rerio), medaka (Oryzias latipes), turbot (Scophthalmus maximus), white-spotted char (Salvelinus leucomaenis), mandarin fish (Siniperca chuatsi), rainbow trout (Oncorhynchus mykiss), and green pufferfish (Tetraodon fluviatilis). The deduced grass carp STAT₃ protein contains a protein interaction domain, an alpha domain, a DNA binding domain, and an SH2 domain. The STAT₃ protein of grass carp is a hydrophilic and non-secretory protein, and its molecular mass and isoeletronic point were found to be 98,5412.1 Da and 6.39, respectively. The structural elements of STAT₃ included α-helixes, β-sheets, and loops. The grass carp STAT₃ is expressed in all of the six tissues tested, which were the liver, spleen, gill, muscle, heart, and brain. The highest expression level was found in the liver (P < 0.05), whereas a significantly

  2. Molecular cloning and expression of the male sterility-related CtYABBY1 gene in flowering Chinese cabbage (Brassica campestris L. ssp chinensis var. parachinensis).

    PubMed

    Zhang, X L; Zhang, L G

    2014-06-10

    Expression of the YABBY gene family in the abaxial surface of lateral plant organs determines abaxial destiny of cells, enhances growth and expansion of lateral organs, and plays an important role in polar establishment of lateral organs. However, the YABBY gene has not been studied in male sterility and fertility restoration. We homologously cloned the CtYABBY1 gene of male-sterile TC1 in Brassica campestris L. ssp chinensis var. parachinensis; its expression was analyzed by real-time PCR. A 937-bp sequence was cloned from TC1 and named CtYABBY1. The ORF of this gene has 702 bp, contains a "C2C2 zinc finger" motif at the N-terminal end, and a "YABBY" structural domain at the C-terminal end. This gene had the highest homology with DBC43-3-2 gene in B. campetris ssp pekinensis. Expression of CtYABBY1 gene has a wide range of functions. It is involved in growth and development of lateral organs, such as leaves and flowers, enhancing expansion of the area and volume of young organs. CtYABBY1 is a gene that promotes thermo-sensitive fertility restoration. At room temperature, expression level of this gene was found to be lower in the stamens of sterile flowers. After treating TC1 at a low temperature of 2°-6°C for 20 days, expression of this gene was upregulated in the stamen of fertile flowers. We conclude that male sterility in TC1 is negatively regulated by this gene, which facilitates transition from male sterility to fertility.

  3. Identification of BRCA1 and 2 Other Tumor Suppressor Genes on Chromosome 17 Through Positional Cloning

    DTIC Science & Technology

    1996-07-01

    Molecular cloning , DNA sequence analysis, and1 biochemical characterization of a novel 65-kDa FK506-hinding protein (FKBP65). J Biol Chem 270, 29336...S., Wong, K., Chan, R., Lau, C., Tsao, S., Knapp, R., and Berkowitz, R. (1994). Molecular cloning of differentially expressed genes in human

  4. [Molecular cloning of some components of the translation apparatus of fission yeast Schizosaccharomyces pombe and a list of its cytoplasm ic proteins genes].

    PubMed

    Shpakovskiĭ, G V; Baranova, G M; Wood, V; Gwilliam, R G; Shematorova, E K; Korol'chuk, O L; Lebedenko, E N

    1999-06-01

    Full-length cDNAs of four new genes encoding cytoplasmic ribosomal proteins L14 and L20 (large ribosomal subunit) and S1 and S27 (small ribosomal subunit) were isolated and sequenced during the analysis of the fission yeast Schizosaccharomyces pombe genome. One of the Sz. pombe genes encoding translation elongation factor EF-2 was also cloned and its precise position on chromosome I established. A unified nomenclature was proposed, and the list of all known genetic determinants encoding cytoplasmic ribosomal proteins of Sz. pombe was compiled. By now, 76 genes/cDNAs encoding different ribosomal proteins have been identified in the fission yeast genome. Among them, 35 genes are duplicated and three homologous genes are identified for each of the ribosomal proteins L2, L16, P1, and P2.

  5. [Mapping and cloning of low phosphorus tolerance genes in soybeans].

    PubMed

    Dan, Zhang; Haina, Song; Hao, Cheng; Deyue, Yu

    2015-04-01

    Soybean is a major source of edible oil and phytoprotein. Low phosphorus available in soil is an important factor limiting the current soybean production. Effective ways to solve the problem include identification of germplasms and genes tolerant to low-phosphorus stress, and cultivation of soybean varieties with high phosphorus efficiency. Recently many researches have been carrying out investigations to map and clone genes related to phosphorus efficiency in soybeans. However, due to the complexity of the soybean genome and little knowledge of functional genes, it has been difficult to understand the mechanism of soybean tolerance to low phosphorus. Although quantitative trait locus (QTL) mapping related to low phosphorus tolerance has made some progress, it remains elusive to obtain accurate candidate genes for molecular breeding applications, due to the limited accuracy of QTL. Even for the cloned soybean low phosphorus tolerance genes, the molecular mechanisms are largely unknown, further limiting the application to breeding. In this review, we summarize the progresses on mapping, cloning and functional characterization of soybean low phosphorus tolerance genes.

  6. Molecular Cloning of HbPR-1 Gene from Rubber Tree, Expression of HbPR-1 Gene in Nicotiana benthamiana and Its Inhibition of Phytophthora palmivora

    PubMed Central

    Khunjan, Uraiwan; Ekchaweng, Kitiya; Panrat, Tanate; Tian, Miaoying; Churngchow, Nunta

    2016-01-01

    This is the first report to present a full-length cDNA (designated HbPR-1) encoding a putative basic HbPR-1 protein from rubber tree (Hevea brasiliensis) treated with salicylic acid. It was characterized and also expressed in Nicotiana benthamiana using Agrobacterium-mediated transient gene expression system in order to investigate the role of HbPR-1 gene in rubber tree against its oomycete pathogen Phytopthora palmivora and to produce recombinant HbPR-1 protein for microbial inhibition test. The HbPR-1 cDNA was 647 bp long and contained an open reading frame of 492 nucleotides encoding 163 amino acid residues with a predicted molecular mass of 17,681 Da and an isoelectric point (pI) of 8.56, demonstrating that HbPR-1 protein belongs to the basic PR-1 type. The predicted 3D structure of HbPR-1 was composed of four α-helices, three β-sheets, seven strands, and one junction loop. Expression and purification of recombinant HbPR-1 protein were successful using Agrobacterium-mediated transient expression and one-step of affinity chromatography. Heterologous expression of HbPR-1 in N. benthamiana reduced necrosis areas which were inoculated with P. palmivora zoospores, indicating that the expressed HbPR-1 protein played an important role in plant resistance to pathogens. The purified recombinant HbPR-1 protein was found to inhibit 64% of P. palmivora zoospore germination on a water agar plate compared with control, suggesting that it was an antimicrobial protein against P. palmivora. PMID:27337148

  7. Molecular Cloning of HbPR-1 Gene from Rubber Tree, Expression of HbPR-1 Gene in Nicotiana benthamiana and Its Inhibition of Phytophthora palmivora.

    PubMed

    Khunjan, Uraiwan; Ekchaweng, Kitiya; Panrat, Tanate; Tian, Miaoying; Churngchow, Nunta

    2016-01-01

    This is the first report to present a full-length cDNA (designated HbPR-1) encoding a putative basic HbPR-1 protein from rubber tree (Hevea brasiliensis) treated with salicylic acid. It was characterized and also expressed in Nicotiana benthamiana using Agrobacterium-mediated transient gene expression system in order to investigate the role of HbPR-1 gene in rubber tree against its oomycete pathogen Phytopthora palmivora and to produce recombinant HbPR-1 protein for microbial inhibition test. The HbPR-1 cDNA was 647 bp long and contained an open reading frame of 492 nucleotides encoding 163 amino acid residues with a predicted molecular mass of 17,681 Da and an isoelectric point (pI) of 8.56, demonstrating that HbPR-1 protein belongs to the basic PR-1 type. The predicted 3D structure of HbPR-1 was composed of four α-helices, three β-sheets, seven strands, and one junction loop. Expression and purification of recombinant HbPR-1 protein were successful using Agrobacterium-mediated transient expression and one-step of affinity chromatography. Heterologous expression of HbPR-1 in N. benthamiana reduced necrosis areas which were inoculated with P. palmivora zoospores, indicating that the expressed HbPR-1 protein played an important role in plant resistance to pathogens. The purified recombinant HbPR-1 protein was found to inhibit 64% of P. palmivora zoospore germination on a water agar plate compared with control, suggesting that it was an antimicrobial protein against P. palmivora.

  8. Molecular cloning, partial genomic structure and functional characterization of succinic semialdehyde dehydrogenase genes from the parasitic insects Lucilia cuprina and Ctenocephalides felis.

    PubMed

    Rothacker, B; Werr, M; Ilg, T

    2008-06-01

    The enzyme succinic semialdehyde dehydrogenase (SSADH; EC1.2.1.24) is a component of the gamma-aminobutyric acid degradation pathway in mammals and is essential for development and function of the nervous system. Here we report the identification, cDNA cloning and functional expression of SSADH from the parasitic insects Lucilia cuprina and Ctenocephalides felis. The recombinant proteins possess potent NAD+-dependent SSADH activity, while their catalytic efficiency for other aldehyde substrates is lower. A genomic copy of the L. cuprina SSADH gene contains two introns, while a genomic gene version of C. felis is devoid of introns. In contrast to the single copy SSADH genes in Drosophila melanogaster and mammals, in L. cuprina and C. felis, multiple SSADH gene copies are present in the genome.

  9. Molecular structure of bovine Gtl2 gene and DNA methylation status of Dlk1-Gtl2 imprinted domain in cloned bovines.

    PubMed

    Su, Hong; Li, Dongjie; Hou, Xiaohui; Tan, Beibei; Hu, Jiaqi; Zhang, Cui; Dai, Yunping; Li, Ning; Li, Shijie

    2011-08-01

    Somatic cell nuclear transfer (SCNT) is an inefficient process, which is due to incomplete reprogramming of the donor nucleus. DNA methylation of imprinted genes is essential to the reprogramming of the somatic cell nucleus in SCNT. Dlk1-Gtl2 imprinted domain has been widely studied in mouse and human. However, little is known in bovine, possibly because of limited appropriate sequences of bovine. In our study, we first isolated the cDNA sequence and found multiple transcript variants occurred in bovine Gtl2 gene, which was conserved among species. A probably 110-kb-long Dlk1-Gtl2 imprinted domain was detected on bovine chromosome 21. We identified the putative Gtl2 DMR and IG-DMR corresponding to the mouse and human DMRs and assessed the methylation status of the two DMRs and Dlk1 5' promoter in lungs of deceased SCNT bovines that died within 48h after birth and the normal controls. In cloned bovines, Gtl2 DMR exhibited hypermethylation, which was similar to controls. However, the methylation status of IG-DMR and Dlk1 5' promoter in clones was significantly different from controls, with severe loss of methylation in IG-DMR and hypermethylation in the Dlk1 5' promoter region. Our data suggested that abnormal methylation patterns of IG-DMR may lead to the abnormal expression of Gtl2 and Dlk1 5' hypermethylated promoter is associated with the aberrant development of lungs of cloned bovines, which consequently may contribute to the low efficiency of SCNT.

  10. Molecular cloning and DNA sequence analysis of genes encoding cytotoxic T lymphocyte-defined HLA-A3 subtypes: the E1 subtype.

    PubMed

    Cowan, E P; Jordan, B R; Coligan, J E

    1985-10-01

    Influenza-specific cytotoxic T cells restricted by HLA-A3 and allogeneic CTL specific for HLA-A3 recognize differences between serologically indistinguishable HLA-A3 antigens. Previous biochemical studies have indicated that such differential recognition can be explained by alterations in the primary structure of class I heavy chains. Characterization of these sequence differences may therefore identify portions of the class I molecule that form determinants recognized by CTL. In this study, we describe the cloning and sequencing of an HLA-A3 subtype from donor E1 (E1-A3). Cloning of the gene encoding E1-A3 was simplified by determining that a 15.5-kb BamHI fragment contains the complete gene and is characteristic of HLA-A3 and only one other class I gene (HLA-A11). Comparison of the E1-A3 sequence to that of a previously sequenced HLA-A3 gene for exons encoding extracellular class I domains revealed three nucleotide differences. All of these differences were located within a discrete region of exon 3 (encoding the alpha 2 domain) and result in a change of two amino acids, at positions 152 (Glu----Val) and 156 (Leu----Gln). This finding suggests that these amino acids are crucial for the information of a determinant recognized by CTL. Furthermore, the altered nucleotide sequence of E1-A3 is identical to the sequence of the HLA-Aw24 gene for codons 128 to 161. These observations of multiple clustered changes in the E1-A3 subtype (relative to the prototype sequence) and identity of the altered sequence with the sequence of another class I gene support the concept that gene conversion is a primary mechanism for the generation of class I polymorphism.

  11. Teaching molecular genetics: chapter 4-positional cloning of genetic disorders.

    PubMed

    Puliti, Aldamaria; Caridi, Gianluca; Ravazzolo, Roberto; Ghiggeri, Gian Marco

    2007-12-01

    Positional cloning is the approach of choice for the identification of genetic mutations underlying the pathological development of diseases with simple Mendelian inheritance. It consists of different consecutive steps, starting with recruitment of patients and DNA collection, that are critical to the overall process. A genetic analysis of the enrolled patients and their families is performed, based on genetic recombination frequencies generated by meiotic cross-overs and on genome-wide molecular studies, to define a critical DNA region of interest. This analysis culminates in a statistical estimate of the probability that disease features may segregate in the families independently or in association with specific molecular markers located in known regions. In this latter case, a marker can be defined as being linked to the disease manifestations. The genetic markers define an interval that is a function of their recombination frequencies with the disease, in which the disease gene is localised. The identification and characterisation of chromosome abnormalities as translocations, deletions and duplications by classical cytogenetic methods or by the newly developed microarray-based comparative genomic hybridisation (array CGH) technique may define extensions and borders of the genomic regions involved. The step following the definition of a critical genomic region is the identification of candidate genes that is based on the analysis of available databases from genome browsers. Positional cloning culminates in the identification of the causative gene mutation, and the definition of its functional role in the pathogenesis of the disorder, by the use of cell-based or animal-based experiments. More often, positional cloning ends with the generation of mice with homologous mutations reproducing the human clinical phenotype. Altogether, positional cloning has represented a fundamental step in the research on genetic renal disorders, leading to the definition of several

  12. Molecular cloning, sequencing and tissue expression of vasotocin and isotocin precursor genes from Ostariophysian catfishes: phylogeny and evolutionary considerations in teleosts

    PubMed Central

    Banerjee, Putul; Chaube, Radha; Joy, Keerikkattil P.

    2015-01-01

    Basic and neutral neurohypophyseal (NH) nonapeptides have evolved from vasotocin (VT) by a gene duplication at the base of the gnathostome lineage. In teleosts, VT and IT are the basic and neutral peptides, respectively. In the present study, VT and IT precursor genes of Heteropneustes fossilis and Clarias batrachus (Siluriformes, Ostariophysi) were cloned and sequenced. The channel catfish Icatalurus punctatus NH precursor sequences were obtained from EST database. The catfish NH sequences were used along with the available Acanthopterygii and other vertebrate NH precursor sequences to draw phylogenetic inference on the evolutionary history of the teleost NH peptides. Synteny analysis of the NH gene loci in various teleost species was done to complement the phylogenetic analysis. In H. fossilis, the NH transcripts were also sequenced from the ovary. The cloned genes and the deduced precursor proteins showed conserved characteristics of the NH nonapeptide precursors. The genes are expressed in brain and ovary (follicular envelope) of H. fossilis with higher transcript abundance in the brain. The addition of the catfish sequences in the phylogenetic analysis revealed that the VT and IT precursors of the species-rich superorders of teleosts have a distinct phylogenetic history with the Acanthopterygii VT and IT precursors sharing a less evolutionary distance and the Ostariophysi VT and IT having a greater evolutionary distance. The genomic location of VT and IT precursors, and synteny analysis of the NH loci lend support to the phylogenetic inference and suggest a footprint of fish- specific whole genome duplication (3R) and subsequent diploidization in the NH loci. The VT and IT precursor genes are most likely lineage-specific paralogs resulting from differential losses of the 3R NH paralogs in the two superorders. The independent yet consistent retention of VT and IT in the two superorders might be directed by a stringent ligand-receptor selectivity. PMID:26029040

  13. Molecular cloning and characterization of the afa-7 and afa-8 gene clusters encoding afimbrial adhesins in Escherichia coli strains associated with diarrhea or septicemia in calves.

    PubMed

    Lalioui, L; Jouve, M; Gounon, P; Le Bouguenec, C

    1999-10-01

    The afa gene clusters, which encode proteins involved in adhesion to epithelial cells, from Escherichia coli strains associated with urinary and intestinal infections in humans have been characterized. Pathogenic isolates of bovine and porcine origin that possess afa-related sequences have recently been described. We report in this work the cloning and characterization of the afa-7 and afa-8 gene clusters from bovine isolates. Hybridization and sequencing experiments revealed that despite similarity in genetic organization, the afa-7 and afa-8 genes, and the well-characterized afa-3 operon expressed by human-pathogenic isolates, correspond to three different members of the afa family of gene clusters. However, like the afa-3 gene cluster, both the afa-7 and afa-8 gene clusters were found to encode an afimbrial adhesin (AfaE) and an invasin (AfaD). The AfaD peptides encoded by the three gene clusters were only 45% identical, but functional complementation experiments indicated that they belong to the same family of invasins. Hemagglutination and adhesion assays demonstrated that the AfaE-VII and AfaE-VIII adhesins bind to different receptors and that these receptors are not the human decay-accelerating factor recognized to be the receptor of all previously described AfaE adhesins. The AfaE-VIII adhesin is very similar to the M agglutinin of human-uropathogenic strains. We used PCR assays to screen 25 bovine strains for afaD and afaE genes of either the afa-7 or afa-8 gene cluster. The afa-8 gene cluster was highly prevalent in bovine isolates previously reported to carry afa-related sequences (23 of 24 strains), particularly in strains producing cytotoxic necrotizing factors (16 of 16 strains). The location of the afa-8 gene cluster on the plasmids or chromosome of these isolates suggests that it could be carried by a mobile element, facilitating its dissemination among bovine-pathogenic E. coli strains.

  14. Molecular cloning and RNA interference-mediated functional characterization of a Halloween gene spook in the white-backed planthopper Sogatella furcifera

    PubMed Central

    2013-01-01

    Background Ecdysteroid hormones ecdysone and 20-hydroxyecdysone play fundamental roles in insect postembryonic development and reproduction. Five cytochrome P450 monooxygenases (CYPs), encoded by Halloween genes, have been documented to be involved in the ecdysteroidogenesis in insect species of diverse orders such as Diptera, Lepidoptera and Orthoptera. Up to now, however, the involvement of the Halloween genes in ecdysteroid synthesis has not been confirmed in hemipteran insect species. Results In the present paper, a Halloween gene spook (Sfspo, Sfcyp307a1) was cloned in the hemipteran Sogatella furcifera. SfSPO has three insect conserved P450 motifs, i.e., Helix-K, PERF and heme-binding motifs. Temporal and spatial expression patterns of Sfspo were evaluated by qPCR. Sfspo showed three expression peaks in late second-, third- and fourth-instar stages. In contrast, the expression levels were lower and formed three troughs in the newly-molted second-, third- and fourth-instar nymphs. On day 3 of the fourth-instar nymphs, Sfspo clearly had a high transcript level in the thorax where PGs were located. Dietary introduction of double-stranded RNA (dsRNA) of Sfspo into the second instars successfully knocked down the target gene, and greatly reduced expression level of ecdysone receptor (EcR) gene. Moreover, knockdown of Sfspo caused lethality and delayed development during nymphal stages. Furthermore, application of 20-hydroxyecdysone on Sfspo-dsRNA-exposed nymphs did not increase Sfspo expression, but could almost completely rescue SfEcR expression, and relieved the negative effects on nymphal survival and development. Conclusion In S. furcifera, Sfspo was cloned and the conservation of SfSPO is valid. Thus, SfSPO is probably also involved in ecdysteroidogenesis for hemiptera. PMID:24007644

  15. Molecular cloning of tissue-specific transcripts of a transketolase-related gene: Implications for the evolution of new vertebrate genes

    SciTech Connect

    Coy, J.F.; Duebel, S.; Kioschis, P.; Delius, H.; Poustka, A.

    1996-03-05

    As part of a systematic search for differentially expressed genes, we have isolated a novel transketolase-related gene (TKR) (HGMW-approved symbol TKT), located between the green color vision pigment gene (GCP) and the ABP-280 filamin gene (FLN1) in Xq28. Transcripts encoding tissue-specific protein isoforms could be isolated. Comparison with known transketolases (TK) demonstrated a TKR-specific deletion mutating one thiamine binding site. Genomic sequencing of the TKR gene revealed the presence of a pseudoexon as well as the acquisition of a tissue-specific spliced exon compared to TK. Since it has been postulated that the vertebrate genome arose by two cycles of tetraploidization from a cephalochordate genome, this could represent an example of the modulation of the function of a preexisting transketolase gene by gene duplication. Thiamine defiency is closely involved with two neurological disorders, Beriberi and Wernicke-Korsakoff syndromes, and in both of these conditions TK with altered activity are found. We discuss the possible involvement of TKR in explaining the observed variant transketolase forms. 34 refs., 4 figs., 1 tab.

  16. Molecular Cloning, Expression of minD Gene from Lactobacillus acidophilus VTCC-B-871 and Analyses to Identify Lactobacillus rhamnosus PN04 from Vietnam Hottuynia cordata Thunb.

    PubMed

    Nguyen, Tu Hoang Khue; Doan, Vinh Thi Thanh; Ha, Ly Dieu; Nguyen, Huu Ngoc

    2013-12-01

    The minD gene encoding an inhibitor cell division MinD homolog from Lactobacillus acidophilus VTCC-B-871 was cloned. We showed that there were 97 % homology between minD genes of L. acidophilus VTCC-B-871 and Lactobacillus rhamnosus GG and Lactobacillus rhamnosus Lc705. Based on the analysis of the DNA sequence data from the L. rhamnosus genome project and sequenced minD gene of L. acidophilus VTCC-B-871, a pair of primers was designed to identified the different minD genes from L. acidophilus ATCC 4356, L. rhamnosus ATCC 11443. Besides, the polymerase chain reaction product of minD gene was also obtained in L. rhamnosus PN04, a strain was isolated from Vietnamese Hottuynia cordata Thunb. In addition, we performed a phylogenetic analysis of the deduced amino acid sequence of MinD homologs from L. acidophilus VTCC-B-871 with the other strains and compared the predicted three-dimension structure of L. acidophilus VTCC-B-871 MinD with Escherichia coli MinD, there are similarity that showed evolution of these strains. The overexpression of L. acidophilus VTCC-B-871 MinD in E. coli led to cell filamentation in IPTG and morphology changes in different sugar stresses, interestingly. The present study is the first report characterizing the Lactobacilus MinD homolog that will be useful in probiotic field.

  17. Positional cloning of disease genes on chromosome 16

    SciTech Connect

    Doggett, N.; Bruening, M.; Callen, D.; Gardiner, M.; Lerner, T.

    1996-04-01

    The project seeks to elucidate the molecular basis of an important genetic disease (Batten`s disease) by molecular cloning of the affected gene by utilizing an overlapping clone map of chromosome 16. Batten disease (also known as juvenile neuronal ceroid lipofuscinosis) is a recessively inherited neurodegenerative disorder of childhood characterized by progressive loss of vision, seizures, and psychomoter disturbances. The Batten disease gene was genetically mapped to the chromosome region 16p 12.1 in close linkage with the genetic markers D16S299 and D16S298. Exon amplification of a cosmid containing D16S298 yielded a candidate gene that was disrupted by a 1 kb genomic deletion in all patients containing the most common haplotype for the disease. Two separate deletions and a point mutation altering a splice site in three unrelated families have confirmed the gene as the Batten disease gene. The disease gene encodes a novel 438 amino acid membrane binding protein of unknown function.

  18. Alpha-amylase genes (amyR2 and amyE+) from an alpha-amylase-hyperproducing Bacillus subtilis strain: molecular cloning and nucleotide sequences.

    PubMed Central

    Yamazaki, H; Ohmura, K; Nakayama, A; Takeichi, Y; Otozai, K; Yamasaki, M; Tamura, G; Yamane, K

    1983-01-01

    amyR2, amyE+, and aroI+ alleles from an alpha-amylase-hyperproducing strain, Bacillus subtilis NA64, were cloned in temperate B. subtilis phage p11, and the amyR2 and amyE+ genes were then recloned in plasmid pUB110, which was designated pTUB4. The order of the restriction sites, ClaI-EcoRI-PstI-SalI-SmaI, found in the DNA fragment carrying amyR2 and amyE+ from the phage genome was also found in the 2.3-kilobase insert of pTUB4. Approximately 2,600 base pairs of the DNA nucleotide sequence of the amyR2 and amyE+ gene region in pTUB4 were determined. Starting from an ATG initiator codon, an open reading frame was composed of a total 1,776 base pairs (592 amino acids). Among the 1,776 base pairs, 1,674 (558 amino acids) were found in the cloned DNA fragment, and 102 base pairs (34 amino acids) were in the vector pUB110 DNA. The COOH terminal region of the alpha-amylase of pTUB4 was encoded in pUB110. The electrophoretic mobility in a 7.5% polyacrylamide gel of the alpha-amylase was slightly faster than that of the parental alpha-amylases. The NH2 termination portion of the gene encoded a 41-amino acid-long signal sequence (Ohmura et al., Biochem. Biophys. Res. Commun. 112:687-683, 1983). The DNA sequence of the mature extracellular alpha-amylase, a potential RNA polymerase recognition site and Pribnow box (TTGATAGAGTGATTGTGATAATTTAAAAT), and an AT-rich inverted repeat structure which has free energy of -8.2 kcal/mol (-34.3 kJ/mol) were identified. The AT-rich inverted repeat structure seemed to correspond to the hyperproducing character. The nucleotide sequence around the region was quite different from the promoter region of the B. subtilis 168 alpha-amylase gene which was cloned in the Escherichia coli vector systems. Images PMID:6413492

  19. Molecular Cloning and Evidence for Osmoregulation of the Δ1-Pyrroline-5-Carboxylate Reductase (proC) Gene in Pea (Pisum sativum L.) 12

    PubMed Central

    Williamson, Cynthia L.; Slocum, Robert D.

    1992-01-01

    Several cDNA clones encoding Δ1-pyrroline-5-carboxylate reductase (P5CR, l-proline:NAD[P]+ 5-oxidoreductase, EC 1.5.1.2), which catalyzes the terminal step in proline biosynthesis, were isolated from a pea leaf library screened with a 32P-labeled Aval fragment of a soybean nodule P5CR cDNA (A.J. Delauney, D.P.S. Verma [1990] Mol Gen Genet 221: 299-305). DNA sequence analysis of one full-length 1.3-kb clone (pPPS3) indicated that the pea P5CR gene contains a single major open reading frame encoding a polypeptide of 28,242 Da. Genomic analysis suggested that two to three copies of the P5CR gene are present per haploid genome in pea. The primary structure of pea P5CR is 85% identical with that of soybean and exhibits significant homology to human, yeast, and Escherichia coli P5CR. The sequence of one of four highly conserved domains found in all prokaryotic and eukaryotic P5CRs is similar to the consensus sequence for the NAD(P)H-binding site of other enzymes. The pea P5CR cDNA hybridized to two transcripts, 1.3 and 1.1 kb in size, in polyadenylated RNA purified from leaf tissues of mature, light-grown plants (4 weeks old). Only the 1.3-kb transcript was detected in younger (1 week old) greened seedlings or in etiolated seedlings. In greened seedlings, steady-state levels of this 1.3-kb mRNA increased approximately 5-fold in root tissues within 6 h after plants were irrigated with 0.4 m NaCl, suggesting that expression of the P5CR gene is osmoregulated. Images Figure 3 Figure 4 Figure 5 PMID:11537868

  20. Molecular cloning and characterization of drought stress responsive abscisic acid-stress-ripening (Asr 1) gene from wild jujube, Ziziphus nummularia (Burm.f.) Wight & Arn.

    PubMed

    Padaria, Jasdeep Chatrath; Yadav, Radha; Tarafdar, Avijit; Lone, Showkat Ahmad; Kumar, Kanika; Sivalingam, Palaiyur Nanjappan

    2016-08-01

    Drought is a calamitous abiotic stress hampering agricultural productivity all over the world and its severity is likely to increase further. Abscisic acid-stress-ripening proteins (ASR), are a group of small hydrophilic proteins which are induced by abscisic acid, stress and ripening in many plants. In the present study, ZnAsr 1 gene was fully characterized for the first time from Ziziphus nummularia, which is one of the most low water forbearing plant. Full length ZnAsr 1 gene was characterised and in silico analysis of ZnASR1 protein was done for predicting its phylogeny and physiochemical properties. To validate transcriptional pattern of ZnAsr 1 in response to drought stress, expression profiling in polyethylene glycol (PEG) induced Z. nummularia seedlings was studied by RT-qPCR analysis and heterologous expression of the recombinant ZnAsr1 in Escherichia coli. The nucleotide sequence analysis revealed that the complete open reading frame of ZnAsr 1 is 819 bp long encoding a protein of 273 amino acid residues, consisting of a histidine rich N terminus with an abscisic acid/water deficit stress domain and a nuclear targeting signal at the C terminus. In expression studies, ZnAsr 1 gene was found to be highly upregulated under drought stress and recombinant clones of E. coli cells expressing ZnASR1 protein showed better survival in PEG containing media. ZnAsr1 was proven to enhance drought stress tolerance in the recombinant E.coli cells expressing ZnASR1. The cloned ZnAsr1 after proper validation in a plant system, can be used to develop drought tolerant transgenic crops.

  1. Molecular cloning and characterization of ETHYLENE OVERPRODUCER 1-LIKE 1 gene, LeEOL1, from tomato (Lycopersicon esculentum Mill.) fruit.

    PubMed

    Zhu, Hong-Liang; Zhu, Ben-Zhong; Shao, Yi; Lin, Xi-Jin; Wang, Xiao-Guang; Gao, Hong-Yan; Xie, Yun-Hong; Li, Ying-Cong; Luo, Yun-Bo

    2007-04-01

    Recently, ETHYLENE OVERPRODUCER 1 (ETO1) had been cloned and identified as a negative post-transcriptional regulator in the ethylene biosynthesis in Arabidopsis. However, little was known about the role of ETO1 in other species, especially in tomato, which was an ideal model for studying the biosynthesis of ethylene during tomato fruit ripening. In this study, a tomato ETHYLENE OVERPRODUCER 1-LIKE 1 (LeEOL1) was cloned. The LeEOL1 cDNA was 3,515 bp long and carried an ORF that putatively encoded a polypeptide of 886 amino acids with a predicted molecular mass of 95 kDa. It shared 74% identity in amino acid sequence with Arabidopsis EOL1 and had one BTB (Broad-complex, Tramtrack, Bric-à-brac) domain and two TPR (tetratricopeptide repeat) domains, which were also conserved domains in AtEOL1. RT-PCR analysis of the temporal expression of LeEOL1 showed that its transcript decreased companied with increase of ethylene production in tomato ripening. The level of LeEOL1 transcripts in wild type tomato fruit at mature green stage did not distinctively change when treated with exogenous ethylene.

  2. Phenylalanine ammonia-lyase in tobacco. Molecular cloning and gene expression during the hypersensitive reaction to tobacco mosaic virus and the response to a fungal elicitor.

    PubMed Central

    Pellegrini, L; Rohfritsch, O; Fritig, B; Legrand, M

    1994-01-01

    A tobacco (Nicotiana tabacum L. cv Samsun NN) cDNA clone coding the enzyme phenylalanine ammonia-lyase (PAL) was isolated from a cDNA library made from polyadenylated RNA purified from tobacco mosaic virus (TMV)-infected leaves. Southern analysis indicated that, in tobacco, PAL is encoded by a small family of two to four unclustered genes. Northern analysis showed that PAL genes are weakly expressed under normal physiological conditions, they are moderately and transiently expressed after wounding, but they are strongly induced during the hypersensitive reaction to TMV or to a fungal elicitor. Ribonuclease protection experiments confirmed this evidence and showed the occurrence of two highly homologous PAL messengers originating from a single gene or from two tightly co-regulated genes. By in situ RNA-RNA hybridization PAL transcripts were shown to accumulate in a narrow zone of leaf tissue surrounding necrotic lesions caused by TMV infection or treatment with the fungal elicitor. In this zone, no cell specificity was observed and there was a decreasing gradient of labeling from the edge of necrosis. Some labeling was also found in various cell types of young, healthy stems and was shown to accumulate in large amounts in the same cell types after the deposition of an elicitor solution at the top of the decapitated plant. PMID:7824656

  3. A modified version of the digestion-ligation cloning method for more efficient molecular cloning.

    PubMed

    Gao, Song; Li, Yanling; Zhang, Jiannan; Chen, Hongman; Ren, Daming; Zhang, Lijun; An, Yingfeng

    2014-05-15

    Here we describe a modified version of the digestion-ligation approach for efficient molecular cloning. In comparison with the original method, the modified method has the additional steps of gel purification and a second ligation after the first ligation of the linearized vector and DNA insert. During this process, the efficiency and reproducibility could be significantly improved for both stick-end cloning and blunt-end cloning. As an improvement of the very important molecular cloning technique, this method may find a wide range of applications in bioscience and biotechnology.

  4. Cloning and Sequencing the First HLA Gene

    PubMed Central

    Jordan, Bertrand R.

    2010-01-01

    This Perspectives article recounts the isolation and sequencing of the first human histocompatibility gene (HLA) in 1980–1981. At the time, general knowledge of the molecules of the immune system was already fairly extensive, and gene rearrangements in the immunoglobulin complex (discovered in 1976) had generated much excitement: HLA was quite obviously the next frontier. The author was able to use a homologous murine H-2 cDNA to identify putative human HLA genomic clones in a λ-phage library and thus to isolate and sequence the first human histocompatibility gene. This personal account relates the steps that led to this result, describes the highly competitive international environment, and highlights the role of location, connections, and sheer luck in such an achievement. It also puts this work in perspective with a short description of the current knowledge of histocompatibility genes and, finally, presents some reflections on the meaning of “discovery.” PMID:20457890

  5. Molecular cloning of the plasma membrane H(+)-ATPase from Kluyveromyces lactis: a single nucleotide substitution in the gene confers ethidium bromide resistance and deficiency in K+ uptake.

    PubMed Central

    Miranda, M; Ramírez, J; Peña, A; Coria, R

    1995-01-01

    A Kluyveromyces lactis strain resistant to ethidium bromide and deficient in potassium uptake was isolated. Studies on the proton-pumping activity of the mutant strain showed that a decreased H(+)-ATPase specific activity was responsible for the observed phenotypes. The putative K. lactis PMA1 gene encoding the plasma membrane H(+)-ATPase was cloned by its ability to relieve the potassium transport defect of this mutant and by reversing its resistance to ethidium bromide. Its deduced amino acid sequence predicts a protein 899 residues long that is structurally colinear in its full length to H(+)-ATPases cloned from different yeasts, except for the presence of a variable N-terminal domain. By PCR-mediated amplification, we identified a transition from G to A that rendered the substitution of the fully conserved methionine at position 699 by isoleucine. We attribute to this amino acid change the low capacity of the mutant H(+)-ATPase to pump out protons. PMID:7730265

  6. The alpha- and beta-expansin and xyloglucan endotransglucosylase/hydrolase gene families of wheat: molecular cloning, gene expression, and EST data mining.

    PubMed

    Liu, Yong; Liu, Dongcheng; Zhang, Haiying; Gao, Hongbo; Guo, Xiaoli; Wang, Daowen; Zhang, Xiangqi; Zhang, Aimin

    2007-10-01

    Expansins and xyloglucan endotransglucosylase/hydrolases (XTHs) are families of extracellular proteins with members that have been shown to play an important role in cell wall growth. In this study, three, six, and five members of the wheat alpha-expansin (TaEXPA1 to TaEXPA3), beta-expansin (TaEXPB1 to TaEXPB6), and XTH (TaXTH1 to TaXTH5) gene families, respectively, were isolated from a dwarf wheat line. The mRNA expression analysis by real-time RT-PCR indicates that these genes display different transcription levels in different stages/organs/treatments, possibly suggesting their functional roles in the cell wall expansion process. Moreover, the comparison of the expression levels reveals that most of the expansins show lower expression than the XTHs. Finally, we present the analysis of wheat alpha- and beta-expansins and XTH families by expressed sequence tag data mining.

  7. Two leptin genes and a leptin receptor gene of female chub mackerel (Scomber japonicus): Molecular cloning, tissue distribution and expression in different obesity indices and pubertal stages.

    PubMed

    Ohga, Hirofumi; Matsumori, Kojiro; Kodama, Ryoko; Kitano, Hajime; Nagano, Naoki; Yamaguchi, Akihiko; Matsuyama, Michiya

    2015-10-01

    Leptin is a hormone produced by fat cells that regulates the amount of fat stored in the body and conveys nutritional status to the reproductive axis in mammals. In the present study we identified two subtypes of leptin genes (lepa and lepb) and a leptin receptor gene (lepr) from chub mackerel (Scomber japonicus) and there gene expression under different feeding conditions (control and high-feed) and pubertal development stages was analyzed using quantitative real-time PCR. The protein lengths of LepA, LepB and LepR were 161 amino acids (aa), 163 aa and 1149 aa, respectively and both leptin subtypes shared only 15% similarity in aa sequences. In pubertal females, lepa was expressed in the brain, pituitary gland, liver, adipose tissue and ovary; however, in adult (gonadal maturation after the second in the life) females, lepa was expressed only in the liver. lepb was expressed primarily in the brain of all fish tested and was expressed strongly in the adipose tissue of adults. lepr was characterized by expression in the pituitary. The high-feed group showed a high conditioning factor level; unexpectedly, hepatic lepa and brain lepr were significantly more weakly expressed compared with the control-feed group. Furthermore, the expression levels of lepa, lepb and lepr genes showed no significant differences between pre-pubertal and post-pubertal fish. On the other hand, pituitary fshβ and lhβ showed no significant differences between different feeding groups of pre-pubertal fish. In contrast, fshβ and lhβ expressed abundantly in the post-pubertal fish of control feed group. Based on these results, whether leptin plays an important role in the nutritional status and pubertal onset of chub mackerel remains unknown.

  8. Molecular cloning and chromosomal localization of the human cyclin C (CCNC) and cyclin E (CCNE) genes: Deletion of the CCNC gene in human tumors

    SciTech Connect

    Li, Haimin; Lahti, J.M.; Kidd, V.J.

    1996-03-01

    The human G1-phase cyclins are important regulators of cell cycle progression that interact with various cyclin-dependent kinases and facilitate entry into S-phase. We have confirmed the localization of the human cyclin C (CCNC) gene to chromosome 6q21 and of human cyclin E (CCNE to 19q12). The CCNC gene structure was also determined, and we have shown that it is deleted in a subset of acute lymphoblastic leukemias, including a patient sample containing a t(2;6)(p21;q15), with no apparent cytogenetic deletion. Single-strand conformational polymorphism analysis of the remaining CCNC allele from patients with a deletion of one allele established that there were no further mutations within the exons or the flanking intronic sequences. These results suggest either that haploinsufficiency of the cyclin C protein is sufficient to promote tumorigenesis or that the important tumor suppressor gene is linked to the CCNC locus. 48 refs., 4 figs., 1 tab.

  9. Molecular cloning, heterologous expression, and primary structure of the structural gene for the copper enzyme nitrous oxide reductase from denitrifying Pseudomonas stutzeri.

    PubMed Central

    Viebrock, A; Zumft, W G

    1988-01-01

    The nos genes of Pseudomonas stutzeri are required for the anaerobic respiration of nitrous oxide, which is part of the overall denitrification process. A nos-coding region of ca. 8 kilobases was cloned by plasmid integration and excision. It comprised nosZ, the structural gene for the copper-containing enzyme nitrous oxide reductase, genes for copper chromophore biosynthesis, and a supposed regulatory region. The location of the nosZ gene and its transcriptional direction were identified by using a series of constructs to transform Escherichia coli and express nitrous oxide reductase in the heterologous background. Plasmid pAV5021 led to a nearly 12-fold overexpression of the NosZ protein compared with that in the P. stutzeri wild type. The complete sequence of the nosZ gene, comprising 1,914 nucleotides, together with 282 nucleotides of 5'-flanking sequences and 238 nucleotides of 3'-flanking sequences was determined. An open reading frame coded for a protein of 638 residues (Mr, 70,822) including a presumed signal sequence of 35 residues for protein export. The presequence is in conformity with the periplasmic location of the enzyme. Another open reading frame of 2,097 nucleotides, in the opposite transcriptional direction to that of nosZ, was excluded by several criteria from representing the coding region for nitrous oxide reductase. Codon usage for nosZ of P. stutzeri showed a high G + C content in the degenerate codon position (83.9% versus an average of 60.2%) and relaxed codon usage for the Glu codon, characteristic features of Pseudomonas genes from other species. E. coli nitrous oxide reductase was purified to homogeneity. It had the Mr of the P. stutzeri enzyme but lacked the copper chromophore. Images PMID:3049543

  10. Molecular cloning of cDNAs encoding human carnitine acetyltransferase and mapping of the corresponding gene to chromosome 9q34.1

    SciTech Connect

    Corti, O.; Finocchiaro, G.; DiDonato, S.

    1994-09-01

    Using a combination of PCR screening of cDNA libraries and reverse transcription PCR, we have cloned three overlapping DNA fragments that encode human carnitine acetyltransferase (CAT), a key enzyme for metabolic pathways involved with the control of the acyl-Co/CoA ratio in mitochondria, peroxisomes, and endoplasmic reticulum. The resulting cDNA (2436 bp) hybridizes to a mRNA species of {approximately}2.9 kb that is particularly abundant in skeletal muscle and encodes a 68-kDa protein containing a peroxisomal targeting signal. The sequence matches those of several tryptic peptides obtained from purified human liver CAT and shows striking similarities with other members of the carnitine/choline acetyltransferase family very distant throughout evolution. CAT cDNA has also been used for fluorescence in situ hybridization on metaphase spreads of human chromosomes, and the corresponding gene, CAT1, has been mapped to chromosome 9q34.1. 29 refs., 4 figs.

  11. Molecular cloning, expression pattern analysis of porcine Rb1 gene and its regulatory roles during primary dedifferentiated fat cells adipogenic differentiation.

    PubMed

    Hu, Xiaoming; Luo, Pei; Peng, Xuewu; Song, Tongxing; Zhou, Yuanfei; Wei, Hongkui; Peng, Jian; Jiang, Siwen

    2015-04-01

    Adipocytes are the main constituent of adipose tissue and are considered to be a corner stone in the homeostatic control of whole body metabolism. Recent reports evidenced that retinoblastoma 1 (Rb1) gene plays an important role in fat development and adipogenesis in mice. Here, we cloned the partial cDNA sequences of the porcine Rb1 gene which contains the complete coding sequences (CDS) of 2820bp encoding a protein of 939 amino acids. Bioinformatic analysis revealed that the CDS of porcine Rb1 was highly identical with those of cattle, human and mice. The porcine Rb1 has three typical conserved structural domains, including Rb-A pocket domain, CYCLIN domain and C-terminus domain, and the phylogenetic tree indicates a closer genetic relationship with cattle and human. Tissue distribution analysis showed that Rb1 expression appeared to be ubiquitously in various tissues, being higher in heart, liver, muscle, and stomach. Furthermore, significant downregulation of Rb1 was found at the initial stage of dedifferentiated fat (DFAT) cells adipogenic differentiation. With the knockdown of the Rb1 expression by siRNA, the number of DFAT cells recruited to white rather than brown adipogenesis was promoted, and mRNA levels of adipogenic markers, such as PPARγ, aP2, LPL and adiponectin and protein expression of PPARγ and adiponectin were increased after hormone stimulation. The underlying mechanisms may be that knockdown of Rb1 promotes the mitotic clonal expansion and PPARγ expression by derepressing the transcriptional activity of E2F so as to facilitate the first steps of adipogenesis. In summary, we cloned and characterized an important negative regulator in adipogenic commitment of porcine DFAT cells.

  12. Molecular Cloning, Characterization, and Functional Analysis of Acetyl-CoA C-Acetyltransferase and Mevalonate Kinase Genes Involved in Terpene Trilactone Biosynthesis from Ginkgo biloba.

    PubMed

    Chen, Qiangwen; Yan, Jiaping; Meng, Xiangxiang; Xu, Feng; Zhang, Weiwei; Liao, Yongling; Qu, Jinwang

    2017-01-02

    Ginkgolides and bilobalide, collectively termed terpene trilactones (TTLs), are terpenoids that form the main active substance of Ginkgo biloba. Terpenoids in the mevalonate (MVA) biosynthetic pathway include acetyl-CoA C-acetyltransferase (AACT) and mevalonate kinase (MVK) as core enzymes. In this study, two full-length (cDNAs) encoding AACT (GbAACT, GenBank Accession No. KX904942) and MVK (GbMVK, GenBank Accession No. KX904944) were cloned from G. biloba. The deduced GbAACT and GbMVK proteins contain 404 and 396 amino acids with the corresponding open-reading frame (ORF) sizes of 1215 bp and 1194 bp, respectively. Tissue expression pattern analysis revealed that GbAACT was highly expressed in ginkgo fruits and leaves, and GbMVK was highly expressed in leaves and roots. The functional complementation of GbAACT in AACT-deficient Saccharomyces cerevisiae strain Δerg10 and GbMVK in MVK-deficient strain Δerg12 confirmed that GbAACT mediated the conversion of mevalonate acetyl-CoA to acetoacetyl-CoA and GbMVK mediated the conversion of mevalonate to mevalonate phosphate. This observation indicated that GbAACT and GbMVK are functional genes in the cytosolic mevalonate (MVA) biosynthesis pathway. After G. biloba seedlings were treated with methyl jasmonate and salicylic acid, the expression levels of GbAACT and GbMVK increased, and TTL production was enhanced. The cloning, characterization, expression and functional analysis of GbAACT and GbMVK will be helpful to understand more about the role of these two genes involved in TTL biosynthesis.

  13. Molecular cloning and promoter analysis of the specific salicylic acid biosynthetic pathway gene phenylalanine ammonia-lyase (AaPAL1) from Artemisia annua.

    PubMed

    Zhang, Ying; Fu, Xueqing; Hao, Xiaolong; Zhang, Lida; Wang, Luyao; Qian, Hongmei; Zhao, Jingya

    2016-07-01

    Phenylalanine ammonia-lyase (PAL) is the key enzyme in the biosynthetic pathway of salicylic acid (SA). In this study, a full-length cDNA of PAL gene (named as AaPAL1) was cloned from Artemisia annua. The gene contains an open reading frame of 2,151 bps encoding 716 amino acids. Comparative and bioinformatics analysis revealed that the polypeptide protein of AaPAL1 was highly homologous to PALs from other plant species. Southern blot analysis revealed that it belonged to a gene family with three members. Quantitative RT-PCR analysis of various tissues of A. annua showed that AaPAL1 transcript levels were highest in the young leaves. A 1160-bp promoter region was also isolated resulting in identification of distinct cis-regulatory elements including W-box, TGACG-motif, and TC-rich repeats. Quantitative RT-PCR indicated that AaPAL1 was upregulated by salinity, drought, wounding, and SA stresses, which were corroborated positively with the identified cis-elements within the promoter region. AaPAL1 was successfully expressed in Escherichia. coli and the enzyme activity of the purified AaPAL1 was approximately 287.2 U/mg. These results substantiated the involvement of AaPAL1 in the phenylalanine pathway.

  14. Molecular cloning, gene structure, expression profile and functional characterization of the mouse glutamate transporter (EAAT3) interacting protein GTRAP3-18.

    PubMed

    Butchbach, Matthew E R; Lai, Liching; Lin, Chien-liang Glenn

    2002-06-12

    Glutamate is an important amino acid implicated in energy metabolism, protein biosynthesis and neurotransmission. The Na(+)-dependent high-affinity excitatory amino acid transporter EAAT3 (EAAC1) facilitates glutamate uptake into most cells. Recently, a novel rat EAAT3-interacting protein called GTRAP3-18 has been identified by a yeast two-hybrid screening. GTRAP3-18 functions as a negative modulator of EAAT3-mediated glutamate transport. In order to further understand the function and regulation of GTRAP3-18, we cloned the mouse orthologue to GTRAP3-18 and determined its gene structure and its expression pattern. GTRAP3-18 encodes a 188-residue hydrophobic protein whose sequence is highly conserved amongst vertebrates. Mouse and human GTRAP3-18 genes contain three exons separated by two introns. The GTRAP3-18 gene is found on mouse chromosome 6D3 and on human chromosome 3p14, a susceptibility locus for cancer and epilepsy. GTRAP3-18 protein and RNA were found both in neuronal rich regions of the brain and in non-neuronal tissues such as the kidney, heart and skeletal muscle. Mouse GTRAP3-18 inhibited EAAT3-mediated glutamate transport in a dose-dependent manner. These studies show that GTRAP3-18 is a ubiquitously expressed protein that functions as a negative regulator of EAAT3 function.

  15. Molecular cloning and characterization of two novel genes from hexaploid wheat that encode double PR-1 domains coupled with a receptor-like protein kinase.

    PubMed

    Lu, Shunwen; Faris, Justin D; Edwards, Michael C

    2017-04-01

    Hexaploid wheat (Triticum aestivum L.) contains at least 23 TaPr-1 genes encoding the group 1 pathogenesis-related (PR-1) proteins as identified in our previous work. Here, we report the cloning and characterization of TaPr-1-rk1 and TaPr-1-rk2, two novel genes closely related to the wheat PR-1 family. The two TaPr-1-rk genes are located on homoeologous chromosomes 3D and 3A, respectively, and each contains a large open reading frame (7385 or 6060 bp) that is interrupted by seven introns and subjected to alternative splicing (AS) with five or six isoforms of mRNA transcripts. The deduced full-length TaPR-1-RK1 and TaPR-1-RK2 proteins (95% identity) contain two repeat PR-1 domains, the second of which is fused via a transmembrane helix to a serine/threonine kinase catalytic (STKc) domain characteristic of receptor-like protein kinases. Phylogenetic analysis indicated that the two PR-1 domains of the TaPR-1-RK proteins form sister clades with their homologues identified in other monocot plants and are well separated from stand-alone PR-1 proteins, whereas the STKc domains may have originated from cysteine-rich receptor-like kinases (CRKs). Reverse-transcriptase-PCR analysis revealed that the TaPr-1-rk genes are predominantly expressed in wheat leaves and their expression levels are elevated in response to pathogen attack, such as infection by barley stripe mosaic virus (BSMV), and also to stress conditions, most obviously, to soil salinity. This is the first report of PR-1-CRK hybrid proteins in wheat. The data may shed new insights into the function/evolutionary origin of the PR-1 family and the STKc-mediated defense/stress response pathways in plants.

  16. Molecular cloning and expression analysis of PDR1-like gene in ginseng subjected to salt and cold stresses or hormonal treatment.

    PubMed

    Zhang, Ru; Zhu, Jie; Cao, Hong-Zhe; An, Yan-Ru; Huang, Jing-Jia; Chen, Xiang-Hui; Mohammed, Nuruzzaman; Afrin, Sadia; Luo, Zhi-Yong

    2013-10-01

    The plant pleiotropic drug resistance (PDR) family of ATP-binding cassette (ABC) transporters is potentially involved in diverse biological processes. Currently, little is known about their actual physiological functions. A Panax ginseng PDR transporter gene (PgPDR1) was cloned and the cDNA has an open reading frame of 4344 bp. The deduced amino acid sequence contained the characteristic domains of PDR transporters: Walker A, Walker B, and ABC signature. Genomic DNA hybridization analysis indicated that one copy of PgPDR1 gene was present in P. ginseng. Subcellular localization showed that PgPDR1-GFP fusion protein was specifically localized in the cell membrane. Promoter region analysis revealed the presence of cis-acting elements, some of which are putatively involved in response to hormone, light and stress. To understand the functional roles of PgPDR1, we investigated the expression patterns of PgPDR1 in different tissues and under various conditions. Quantitative real-time PCR (qRT-PCR) and Western blotting analysis showed that PgPDR1 was expressed at a high level in the roots and leaves compared to seeds and stems. The expression of PgPDR1 was up-regulated by salicylic acid (SA) or chilling, down-regulated by ABA, and regulated differently at transcript and protein levels by MeJA. These results suggest that PgPDR1 might be involved in responding to environmental stresses and hormones.

  17. Molecular cloning, expression of CPR gene from Rhizopus oryzae into Rhizopus nigericans and its application in the 11α-hydroxylation of 16α, 17-epoxy-progesterone.

    PubMed

    Chen, Xiaolong; Luo, Xinrong; Cao, Feifei; Zhu, Tingheng; Fan, Yongxian; Jia, Xiaoqing; Shen, Yinchu

    2014-11-01

    The hydroxylations of the steroid skeleton structure are catalyzed by a family of enzymes, the cytochromes P450 (CYPs). In this study, the pCB1004-PgpdA plasmid was used for cloning the cytochrome P450 reductase (CPR) gene from Rhizopus oryzae into Rhizopus nigericans to strengthen the expression of CPR gene in R. nigericans with REMI (Restriction Enzyme Mediate Integration) mediated protoplast transformation. The conditions for the protoplast production of R. nigericans were optimized as follows: 75 μg/mL yatalase, 50 μg/mL lywallzyme, fungus age of 12h, digestion time of 3 h and digestion temperature of 30°C. REMI mediated protoplast transformation with plasmid pCB1004-PgpdA into R. nigericans was performed to construct the transformants. More than 30 transformants were successfully selected from the hygromycin B-resistant plates and 6 transformants had the abilities to improve the biotransformation of 16α, 17-epoxyprogesterone. The highest biotransformation rate of the transformants was 65.38%, which was 7.06% higher than that of the original strain.

  18. Molecular cloning, characterization and expression analysis of the protein arginine N-methyltransferase 1 gene (As-PRMT1) from Artemia sinica.

    PubMed

    Jiang, Xue; Yao, Feng; Li, Xuejie; Jia, Baolin; Zhong, Guangying; Zhang, Jianfeng; Zou, Xiangyang; Hou, Lin

    2015-07-01

    Protein arginine N-methyltransferase 1 (PRMT1) is an important epigenetic regulation factor in eukaryotic genomes. PRMT1 is involved in histone arginine loci methylation modification, changes in eukaryotic genomes' chromatin structure, and gene expression regulation. In the present paper, the full-length 1201-bp cDNA sequence of the PRMT1 homolog of Artemia sinica (As-PRMT1) was cloned for the first time. The putative As-PRMT1 protein comprises 346 amino acids with a SAM domain and a PRMT5 domain. Multiple sequence alignments revealed that the putative sequence of As-PRMT1 protein was relatively conserved across species, especially in the SAM domain. As-PRMT1 is widely expressed during embryo development of A. sinica. This is followed by a dramatic upregulation after diapause termination and then downregulation from the nauplius stage. Furthermore, As-PRMT1 transcripts are highly upregulated under conditions of high salinity and low temperature stress. These findings suggested that As-PRMT1 is a stress-related factor that might promote or inhibit the expression of certain genes, play a critical role in embryonic development and in resistance to low temperature and high salinity stress.

  19. Cloning and Molecular Characterization of a Metabolic Gene with Developmental Functions in Drosophila. I. Analysis of the Head Function of Punch

    PubMed Central

    McLean, J. R.; Boswell, R.; O'Donnell, J.

    1990-01-01

    In an effort to understand the functions of pterins throughout development we have been studying Punch (Pu), the structural gene for the enzyme GTP cyclohydrolase in Drosophila melanogaster. This enzyme catalyzes the first step in the pterin biosynthetic pathway. The Pu gene product is required for vital functions at two distinct stages in embryogenesis, and a pigmentation function in the eye of the young adult. We have localized the Pu region to 29 kb of DNA through the analysis of lesions present in Pu mutants. Since all of the mutations that were mapped affect the eye pigmentation function of Pu, and since this function is the best defined biochemically, we have concentrated on identifying and characterizing Pu products required for eye pigmentation in our initial examination of the cloned region. Four different transcripts from this region are expressed in the adult head. We show that one of these transcripts, the 1.7-kb species, is responsible for the pigmentation function through the analysis of mutant transcripts and the use of an in vitro translation assay. A 2-kb region lying within the locus is specifically required for this eye pigmentation function. PMID:2127575

  20. Molecular cloning of two distinct precursor genes of NdWFamide, a d-tryptophan-containing neuropeptide of the sea hare, Aplysia kurodai.

    PubMed

    Morishita, Fumihiro; Furukawa, Yasuo; Matsushima, Osamu

    2012-12-01

    NdWFamide (NdWFa) is a D-tryptophan-containing cardioexcitatory neuropeptide in gastropod mollusks, such as Aplysia kurodai and Lymanea stagnalis. In this study, we have cloned two cDNA encoding distinct precursors for NdWFa from the abdominal ganglion of A. kurodai. One of the predicted precursor proteins consisted of 90 amino acids (NWF90), and the other consisted of 87 amino acids (NWF87). Both of the predicted precursor proteins have one NWFGKR sequence preceded by the N-terminal signal peptide. Sequential double staining by in situ hybridization (ISH) and immunostaining with anti-NdWFa antibody suggested that NdWFa-precursor and NdWFa peptide co-exist in neurons located in the right-upper quadrant region of the abdominal ganglion. In ISH, NWF90-specific signal and NWF87-specific one were found in different subsets of neurons in the abdominal ganglia of Aplysia. The expression level of NWF90 gene estimated by RT-PCR is much higher than that of NWF87 gene. These results suggest that NWF90 precursor is the major source of NdWFa in Aplysia ganglia.

  1. Molecular cloning of LIM homeodomain transcription factor Lhx2 as a transcription factor of porcine follicle-stimulating hormone beta subunit (FSHβ) gene.

    PubMed

    Kato, Takako; Ishikawa, Akio; Yoshida, Saishu; Sano, Yoshiya; Kitahara, Kousuke; Nakayama, Michie; Susa, Takao; Kato, Yukio

    2012-01-01

    We cloned the LIM-homeodomain protein LHX2 as a transcription factor for the porcine follicle-stimulating hormone β subunit gene (Fshβ) by the Yeast One-Hybrid Cloning System using the upstream region of -852/-746 bases (b) from the transcription start site, called Fd2, as a bait sequence. The reporter assay in LβT2 and CHO cells revealed the presence of an LHX2-responsive region other than Fd2. A potential LHX2 binding sequence was confirmed as AATTAAT containing a consensus homeodomain binding core sequence AATT by Systematic Evolution of Ligands by Exponential Enrichment analysis. DNase I footprinting demonstrated three AATTAAT sequences located at regions -835/-829, -818/-812 and -806/-800 b in the Fd2 region and 12 binding sites in the distal and proximal regions mostly containing an AATT-core sequence. RT-PCR analysis of Lhx2 expression during porcine fetal and postnatal pituitary development showed a gradual increase from fetal day (f) 40 to postnatal day (p) 8 followed by a slight decrease to p230, suggesting that LHX2 may play its role largely in the late fetal and postnatal periods. The analyses of Lhx2 expression in pituitary tumor-derived cell lines showed their expressions in cell lines including αT31, LβT2 and others. Since LHX2 was previously identified as a transcription factor for Cga and the in vitro experiments in the present study suggested that LHX2 regulated the expression of Fshβ, it is possible that LHX2 controls the synthesis of FSH at the transcription level.

  2. V7, A novel leukocyte surface protein that participates in T cell activation. II. Molecular cloning and characterization of the V7 gene

    SciTech Connect

    Ruegg, C.L.; Rivas, A.; Madani, N.D.

    1995-05-01

    V7 is a cell surface glycoprotein expressed on Ag-activated T cells, monocytes, and granulocytes, as well as subpopulations of T cells and accessory cells present in thymic medulla and tonsil. A mAb directed against V7 inhibits the proliferative response to T cells to allogeneic cells or immobilized anti-CD3 Ab, but no lectin mitogens, suggesting that V7 plays a role in TCR/CD3-mediated T cell activation. We have used the anti-V7 Ab in eukaryotic expression cloning experiments to isolate a cDNA clone containing a 3,340-bp insert that encodes V7 when transiently expressed in simian and murine fibroblastoid cells. DNA sequence analysis revealed a novel 1,021-amino acid open reading frame the structure of which conforms to the category of type I integral membrane proteins. The protein sequence includes a 20-residue putative hydrophobic signal sequence followed by a putative extracellular domain of 934 amino acids, a prototypic hydrophobic transmembrane spanning a domain of 25 residues, and finally a short and highly charged putative cytoplasmic domain of 42 residues. The extracellular domain contains seven pairs of regularly spaced cysteine residues, suggestive of Ig-like domains. On the basis of statistical analysis of the sequences of the putative cysteine loops, all seven of the Ig-like domains belong to the variable, or V-type, category. By using fluorescence in situ hybridization, we have mapped the V7 gene to human chromosome 1p13. Thus, the V7 glycoprotein represents a novel member of the Ig superfamily that is involved in critical intracellular signals essential for immune function. 44 refs., 8 figs., 21 tabs.

  3. Molecular cloning, characterization and expression of heat shock protein 70 gene from the oyster Crassostrea hongkongensis responding to thermal stress and exposure of Cu(2+) and malachite green.

    PubMed

    Zhang, Zhanhui; Zhang, Qizhong

    2012-04-15

    Heat shock protein 70 (HSP70) acts mostly as a molecular chaperone and plays a key role in the process of protecting cells by facilitating the folding of nascent peptides and the cellular stress response. The cDNA of the oyster Crassostrea hongkongensis hsp70 (designated chhsp70) was cloned with the techniques of homological cloning and rapid amplification of cDNA ends (RACE). The full-length chhsp70 cDNA was 2251bp, consisting of a 130bp 5'-UTR, 216bp 3'-UTR with a canonical polyadenylation signal sequence AATAAA and a poly (A) tail, and an open reading frame of 1905bp, which encoded a polypeptide of 634 amino acids. Three classical HSP signature motifs were detected in ChHSP70, i.e., DLGTT-S-V, IFDLGGGTFDVSIL and VVLVGGSTRIPKIQK. BLAST analysis revealed that the ChHSP70 shared high identity with other bivalve HSP70. The phylogenetic analysis indicated that the ChHSP70 was a member of the HSP70 family. The chhsp70 mRNA transcripts were quantified by fluorescent real time RT-PCR under both unstressed and stressed conditions, i. e., heat shock and exposure to Cu(2+) and malachite green. Basal expression level was similar in mantle, gill, digestive gland, and heart, but higher in muscle than that in the others. A similar trend showed that the chhsp70 mRNA expression significantly increased at 3-6h, then dropped and returned to control level at 24h in the five tissues and organs mentioned above after heat shock. A clearly time-dependent expression pattern of chhsp70 mRNA in digestive gland and gill of the oyster was observed after exposure of Cu(2+) and malachite green. In the two tissues, the chhsp70 mRNA level reached the maximum at 6h after malachite green exposure and on day 4 after Cu(2+) exposure, and then decreased progressively to the control level. The results indicated that ChHSP70 of the oyster is an inducible protein, and plays an important role in response to the Cu(2+) and malachite green polluted stress, so chhsp70 might be used as a potential molecular

  4. Cloning and Characterization of the RecA Gene of Aquaspirillum magnetotacticum

    DTIC Science & Technology

    1988-01-01

    complementation studies with the RecA proteins of Proteus vulgaris , Shigella flexneri, Erwinia carotovara, and E. coli B/r (West et al. 1983; Keener et al...Cloning and characterization of recA genes from Proteus vulgaris , Erwinia carotovora, Shigella flexneri, and Escherichia coli B/r. J Bacteriol 160...Cloning and Characterization of the re A Gene of (Aquaspirililun iagnetotacticum N N I Amy E. Berson, Debra V. Hudson, and Nahid S. Waleh++ Molecular

  5. Molecular cloning and sequence of the thdF gene, which is involved in thiophene and furan oxidation by Escherichia coli

    SciTech Connect

    Alam, K.Y.; Clark, D.P. )

    1991-10-01

    The authors' previous work resulted in the isolation of mutant strains of Escherichia coli K-12 which were able to oxidize furans and thiophenes as a result of mutations in several novel genes. Some of the genes involved in thiophene oxidation fragment which encodes a previously undiscovered gene involved in thiophene oxidation. Three proteins with approximate molecular sizes of 48, 30, and 26 kDa were overproduced by cells carrying pKA10. Maxicell experiments and DNA sequence analysis indicated that the 480 and 26-kDa proteins are encoded by pKA10, whereas the 30-kDa protein is apparently chromosomally derived. A cassette specifying kanamycin resistance was inserted into various sites on pKA10. An insertion which abolished the 48-kDa protein also abolished thiophene oxidation. Chromosomal integration of pKA::Kan allowed us to locate the chromosomal insert of pKA10 at 84 min on the E. coli genetic map by transduction. Since no previously identified genes involved in thiophene metabolism are located in this region, we designated the gene for the 48-kDa protein as thdF. Sequencing of the 3.8-kb insert revealed an overlap of several hundred bases with the regulatory and structural regions of the tnaA gene, which is also located at 84 min. The 26-kDa protein is probably truncated tnaA protein, An open reading frame corresponding to the 48-kDa thdF protein was located next to the tnaA gene, which encodes tryptophanase, but was transcribed in the opposite sense.

  6. Molecular cloning and chromosomal mapping of bone marrow stromal cell surface gene, BST2, that may be involved in pre-B-cell growth

    SciTech Connect

    Ishikawa, Jun; Kaisho, Tsuneyasu; Tomizawa, Hitoshi

    1995-04-10

    Bone marrow stromal cells regulate B-cell growth and development through their surface molecules and cytokines. In this study, we generated a mAb, RS38, that recognized a novel human membrane protein, BST-2, expressed on bone marrow stromal cell lines and synovial cell lines. We cloned a cDNA encoding BST-2 from a rheumatoid arthritis-derived synovial cell line. BST-2 is a 30- to 36-kDa type II transmembrane protein, consisting of 180 amino acids. The BST-2 gene (HGMW-approved symbol BST2) is located on chromosome 19p13.2. BST-2 is expressed not only on certain bone marrow stromal cell lines but also on various normal tissues, although its expression pattern is different from that of another bone marrow stromal cell surface molecule, BST-1. BST-2 surface expression on fibroblast cell lines facilitated the stromal cell-dependent growth of a murine bone marrow-derived pre-B-cell line, DW34. The results suggest that BST-2 may be involved in pre-B-cell growth. 45 refs., 7 figs., 2 tabs.

  7. The multigene family of lysophosphatidate acyltransferase (LPAT)-related enzymes in Ricinus communis: cloning and molecular characterization of two LPAT genes that are expressed in castor seeds.

    PubMed

    Arroyo-Caro, José María; Chileh, Tarik; Kazachkov, Michael; Zou, Jitao; Alonso, Diego López; García-Maroto, Federico

    2013-02-01

    The multigene family encoding proteins related to lysophosphatidyl-acyltransferases (LPATs) has been analyzed in the castor plant Ricinus communis. Among them, two genes designated RcLPAT2 and RcLPATB, encoding proteins with LPAT activity and expressed in the developing seed, have been cloned and characterized in some detail. RcLPAT2 groups with well characterized members of the so-called A-class LPATs and it shows a generalized expression pattern in the plant and along seed development. Enzymatic assays of RcLPAT2 indicate a preference for ricinoleoyl-CoA over other fatty acid thioesters when ricinoleoyl-LPA is used as the acyl acceptor, while oleoyl-CoA is the preferred substrate when oleoyl-LPA is employed. RcLPATB groups with B-class LPAT enzymes described as seed specific and selective for unusual fatty acids. However, RcLPATB exhibit a broad specificity on the acyl-CoAs, with saturated fatty acids (12:0-16:0) being the preferred substrates. RcLPATB is upregulated coinciding with seed triacylglycerol accumulation, but its expression is not restricted to the seed. These results are discussed in the light of a possible role for LPAT isoenzymes in the channelling of ricinoleic acid into castor bean triacylglycerol.

  8. Molecular cloning of MSSP-2, a c-myc gene single-strand binding protein: characterization of binding specificity and DNA replication activity.

    PubMed Central

    Takai, T; Nishita, Y; Iguchi-Ariga, S M; Ariga, H

    1994-01-01

    We have previously reported the human cDNA encoding MSSP-1, a sequence-specific double- and single-stranded DNA binding protein [Negishi, Nishita, Saëgusa, Kakizaki, Galli, Kihara, Tamai, Miyajima, Iguchi-Ariga and Ariga (1994) Oncogene, 9, 1133-1143]. MSSP-1 binds to a DNA replication origin/transcriptional enhancer of the human c-myc gene and has turned out to be identical with Scr2, a human protein which complements the defect of cdc2 kinase in S.pombe [Kataoka and Nojima (1994) Nucleic Acid Res., 22, 2687-2693]. We have cloned the cDNA for MSSP-2, another member of the MSSP family of proteins. The MSSP-2 cDNA shares highly homologous sequences with MSSP-1 cDNA, except for the insertion of 48 bp coding 16 amino acids near the C-terminus. Like MSSP-1, MSSP-2 has RNP-1 consensus sequences. The results of the experiments using bacterially expressed MSSP-2, and its deletion mutants, as histidine fusion proteins suggested that the binding specificity of MSSP-2 to double- and single-stranded DNA is the same as that of MSSP-1, and that the RNP consensus sequences are required for the DNA binding of the protein. MSSP-2 stimulated the DNA replication of an SV40-derived plasmid containing the binding sequence for MSSP-1 or -2. MSSP-2 is hence suggested to play an important role in regulation of DNA replication. Images PMID:7838710

  9. Molecular cloning, functional expression, and characterization of isolectin genes of hemolytic lectin CEL-III from the marine invertebrate Cucumaria echinata.

    PubMed

    Shimizu, Yoshiki; Yamazaki, Hiroshi; Yoshida, Shigeto; Yonekura, Masami; Kouzuma, Yoshiaki

    2012-01-01

    CEL-III is a hemolytic lectin purified from the marine invertebrate Cucumaria echinata. Previous research has indictated that CEL-III is composed of several isoforms. Here we identified five CEL-III isolectin genes, designated CEL-III-L1, CEL-III-L2, CEL-III-S1, CEL-III-S2, and CEL-III-LS1, by cDNA cloning. The deduced amino acid sequences suggested they shared 94.0-99.8% identical residues. Among the amino acid residues involved in carbohydrate binding, the His residue, which contributes to stacking with sugar, in subdomain 1α was replaced by Tyr in CEL-III-L2. The recombinant proteins were expressed in Escherichia coli or insect cells. rCEL-III-L2 showed higher hemolytic activity than those of the other isolectins. Furthermore, an apparent oligomer band of rCEL-III-L2 was detected on erythrocyte membranes, although the other isolectins showed smear bands. These results suggest that Tyr36 of CEL-III-L2 is important for the expression of hemolytic activity and oligomerization.

  10. Molecular cloning of the SMAD4 gene and its mRNA expression analysis in ovarian follicles of the Yangzhou goose (Anser cygnoides).

    PubMed

    Huang, Z; Yuan, X; Wang, M; Wu, N; Song, Y; Chen, Y; Zhang, Y; Xu, Q; Chen, G; Zhao, W

    2016-08-01

    Mothers against decapentaplegic homolog 4 (SMAD4) is an important protein in animal reproduction. It plays pivotal roles in cellular pathways, including apoptosis. The expression profile of the SMAD4 gene in goose ovarian follicles has not been reported. In this study, the SMAD4 coding sequence was cloned from the Yangzhou goose. A phylogenetic analysis was performed and mRNA expression was examined in various tissues using quantitative real-time PCR. An alternative splice form of SMAD4, SMAD4-b having 1656 bp, was identified. SMAD4-a mRNA was widely expressed in various healthy tissues, whereas SMAD4-b was very weakly expressed. SMAD4 mRNA in the ovary and oviduct was significantly higher than that in the pituitary and hypothalamus. SMAD4 mRNA expression analysis in hierarchical follicles showed that the level of SMAD4 mRNA was higher in large white follicles and post-ovulatory follicles than in the other follicles. The results indicate that SMAD4 might be involved in the recruitment of hierarchical follicles.

  11. Molecular cloning and nutrient regulation analysis of long chain acyl-CoA synthetase 1 gene in grass carp, Ctenopharyngodon idella L.

    PubMed

    Cheng, Han-Liang; Chen, Shuai; Xu, Jian-He; Yi, Le-Fei; Peng, Yong-Xing; Pan, Qian; Shen, Xin; Dong, Zhi-Guo; Zhang, Xia-Qing; Wang, Wen-Xiang

    2017-02-01

    Long chain acyl-CoA synthetase 1 (ACSL1), a key regulatory enzyme of fatty acid metabolism, catalyzes the conversion of long-chain fatty acids to acyl-coenzyme A. The full-length cDNAs of ACSL1a and ACSL1b were cloned from the liver of a grass carp. Both cDNAs contained a 2094bp open reading frame encoding 697 amino acids. Amino acid sequence alignment showed that ACSL1a shared 73.5% sequence identity with ACSL1b. Each of the two ACSL1s proteins had a transmembrane domain, a P-loop domain, and L-, A-, and G-motifs, which were relatively conserved in comparison to other vertebrates. Relative expression profile of ACSL1 mRNAs in different tissues indicated that ACSL1a is highly expressed in heart, mesenteric adipose, and brain tissues, whereas ACSL1b is highly expressed in heart, white muscle, foregut, and liver tissues. Nutrient regulation research showed that the expression levels of ACSL1a and ACSL1b were significantly down-regulated when 3, 6, and 9% fish oil were added in diet of grass carp as compared to the control group. However, no significant difference in the levels of ACSL1 mRNA was observed between the experimental groups. This study demonstrated the relationship between ACSL1a and ACSL1b genes in grass carp and laid a foundation for further research on ACSL family members in other species.

  12. Polyhydroxyalkanoate production by a novel bacterium Massilia sp. UMI-21 isolated from seaweed, and molecular cloning of its polyhydroxyalkanoate synthase gene.

    PubMed

    Han, Xuerong; Satoh, Yasuharu; Kuriki, Yumi; Seino, Teruyuki; Fujita, Shinji; Suda, Takanori; Kobayashi, Takanori; Tajima, Kenji

    2014-11-01

    We successfully isolated one microorganism (UMI-21) from Ulva, a green algae that contains starch. The strain UMI-21 can produce polyhydroxyalkanoate (PHA) from starch, maltotriose, or maltose as a sole carbon source. Taxonomic studies and 16S rDNA sequence analysis revealed that strain UMI-21 was phylogenetically related to species of the genus Massilia. The PHA content under the cultivation condition using a 10-L jar fermentor was 45.5% (w/w). This value was higher than that obtained after cultivation in a flask, suggesting the possibility of large-scale PHA production by UMI-21 from starch. A major issue for the industrial production of microbial PHAs is the very high production cost. Starch is a relatively inexpensive substrate that is also found in abundant seaweeds such as Ulva. Therefore, the strain isolated in this study may be very useful for producing PHA from seaweeds containing polysaccharides such as starch. In addition, a 3.7-kbp DNA fragment containing the whole PHA synthase gene (phaC) was obtained from the strain UMI-21. The results of open reading frame (ORF) analysis suggested that the DNA fragment contained two ORFs, which were composed of 1740 (phaC) and 564 bp (phaR). The deduced amino acid sequence of PhaC from strain UMI-21 shared high similarity with PhaC from Ralstonia eutropha, which is a representative PHA-producing bacterium with a class I PHA synthase. This is the first report for the cloning of the PHA synthase gene from Massilia species.

  13. Molecular cloning and transcript expression of genes encoding two types of lipoprotein lipase in the ovary of cutthroat trout, Oncorhynchus clarki.

    PubMed

    Ryu, Yong-Woon; Tanaka, Ricako; Kasahara, Ayumi; Ito, Yuta; Hiramatsu, Naoshi; Todo, Takashi; Sullivan, Craig V; Hara, Akihiko

    2013-03-01

    Large amounts of neutral lipids (NLs) are stored as lipid droplets in the ooplasm of fish oocytes, providing an essential energy resource for developing embryos and larvae. However, little is known about the origin of such lipids or about mechanisms underlying their uptake and accumulation in oocytes. We have proposed a model for this lipidation of teleost oocytes, as follows: very low density lipoprotein (Vldl) is metabolized by lipoprotein lipase (Lpl) outside and/or inside of the oocyte and the resulting fatty acids (FAs) are then utilized for de novo biosynthesis of NLs. As a first step toward verification of this model, cDNAs for genes encoding two types of Lpl, lpl and lpl2, were cloned from the ovary of cutthroat trout, Oncorhynchus clarki. Examination of Lpl polypeptide sequences deduced from the cDNAs revealed features similar to LPLs/Lpls in other species, including several conserved structural and functional domains. Both types of lpl mRNA were highly expressed in lipid storage tissues (e.g., adipose tissue, muscle, and ovary) and were predominantly expressed in the granulosa cells of ovarian follicles. Ovarian lpl1 mRNA levels showed a remarkable peak in April (early oocyte lipid droplet stage) and then decreased to low values sustained until November (mid-vitellogenesis), after which time a small peak in lpl1 gene expression was observed in December (late vitellogenesis). The mRNA levels of lpl2 also were elevated in April and were highest in June (late lipid droplet stage), but did not show other pronounced changes. These results suggest that, in the cutthroat trout, Vldl is metabolized by the action of Lpls in the granulosa cell layer to generate free FAs for uptake and biosynthesis of neutral lipids by growing oocytes.

  14. Molecular cloning and characterization of the human ASB-8 gene encoding a novel member of ankyrin repeat and SOCS box containing protein family.

    PubMed

    Liu, Yongzhong; Li, Jinjun; Zhang, Fengrui; Qin, Wenxin; Yao, Genfu; He, Xianghuo; Xue, Peng; Ge, Chao; Wan, Dafang; Gu, Jianren

    2003-01-24

    We have cloned a new member of human ankyrin repeat and SOCS box containing protein family (ASB), designed as hASB-8, from a human placental cDNA library and further extended by 5(') and 3(')-RACE. The full-length cDNA was 2545bp in length, with a predicted open reading frame encoding a protein of 288 amino acids, which was 96% identical to mouse ASB-8 protein. Computer analysis revealed that the deduced amino acid sequence of the human ASB-8 contained four Ankyrin repeats and one SOCS box. The gene had four exons separated by three introns and was mapped to human chromosome 12q13. Human ASB-8 mRNA was expressed at the highest level of expression in skeletal muscle and at a varied level of expression in heart, brain, placenta, liver, kidney, and pancreas. The transcript of hASB-8 was not detected in adult normal lung tissue, but found in lung carcinoma cell lines SPC-A1, A549, and NCI-H446. Subcellular localization analysis showed that the EGFP-tagged hASB-8 protein was localized at cytoplasm in human hepatocellular carcinoma cell line BEL-7402. We also provided evidence that hASB-8 could interact with Elongin B-C complex in vitro. Furthermore, transfection with the truncated mutant of hASB-8 cDNA lacking SOCS box could suppress cell growth of lung adenocarcinoma SPC-A1 cells in vitro, which suggests that this gene might be related to the development of lung cancer.

  15. Molecular cloning, genomic structure, polymorphism analysis and recombinant expression of a α1-antitrypsin like gene from swamp eel, Monopterus albus.

    PubMed

    Li, Wei; Wang, Quanhe; Li, Shaobin; Jiang, Ao; Sun, Wenxiu

    2017-03-01

    Alpha-1-antitrypsin (AAT) is a highly polymorphic glycoprotein antiprotease, involved in the regulation of human immune response. Beyond some genomic characterization and a few protein characterizations, the function of teleost AAT remains uncertain. In this study we cloned an AAT-like gene from a swamp eel liver identifying four exons and three introns, and the full-length cDNA. The elucidated swamp eel AAT amino acid sequence showed high homology with known AATs from other teleosts. The swamp eel AAT was examined both in ten healthy tissues and in four bacterially-stimulated tissues resulting in up-regulation of swamp eel AAT at different times. Swamp eel AAT transcripts were ubiquitously but unevenly expressed in ten tissues. Further, the mature peptide sequence of swamp eel AAT was subcloned and transformed into E. coli with the recombinant proteins successfully inhibiting bovine trypsin activity. Analysis of recombinant AAT showed equimolar formation of irreversible complexes with proteinases, high stability at pH 7.0-10.0 and temperatures below 55 °C. Serum AAT protein level significantly increased in response to inflammation with AAT anti-sera, and, NF-κB, apolipoprotein A1 and transferrin gene expression were dramatically decreased over 72 h post recombinant AAT injection. Lastly, examination of swamp eel AAT allelic polymorphism identified all alleles in both healthy and diseased stock except allele*g, found only in diseased stock, but without statistical difference between the distribution frequency of allele*g in the two stocks. These results are crucial to our ongoing study of the role of teleost AAT in the innate immune system.

  16. Mouse ornithine decarboxylase gene: cloning, structure, and expression.

    PubMed Central

    Brabant, M; McConlogue, L; van Daalen Wetters, T; Coffino, P

    1988-01-01

    We used molecular cloning to isolate a functional gene for mouse ornithine decarboxylase (OrnDCase; L-ornithine carboxy-lyase, EC 4.1.1.17) from a cell line in which that gene had been selectively amplified. The position of the 5' terminus of the mRNA was identified, and the coding sequence was shown to be preceded by a 312- or 313-nucleotide (nt) untranslated leader. The latter is highly G + C rich, particularly in its 5'-most portion. The leader can be anticipated to have extensive and stable secondary structure. The transcription unit of the gene is of relatively small size, approximately equal to 6.2 kilobases (kb) from the start site to the proximal site of polyadenylylation. Sequence analysis of DNA near the transcription start position demonstrated the presence of a "TATA" box, but no "CAAT" box. Functional properties of the cloned gene were tested by transfecting it into cultured cells. Expression of the putative full-length gene efficiently conferred ornithine decarboxylase activity on recipient mutant cells deficient in that activity. To assess the function and strength of the OrnDCase promoter region and to delimit its boundaries, we used a transient expression assay. Upstream of a bacterial chloramphenicol acetyltransferase gene was placed a portion of the OrnDCase gene, including the presumed promoter region, spanning a region from approximately equal to 3.0 kb 5' of the site of transcription initiation to the first 250 nt of the transcript. When expressed in mouse NIH 3T3 cells, this OrnDCase genomic element was comparable in strength to the Rous sarcoma virus long terminal repeat promoter. A similar construct, truncated so as to retain only 264 base pairs of the OrnDCase gene 5' to the site of transcription start, yielded undiminished levels of expression. Images PMID:3353375

  17. Molecular cloning and sequence analysis of a PVGOX gene encoding glucose oxidase in Penicillium viticola F1 strain and it's expression quantitation.

    PubMed

    Khan, Ibrar; Qayyum, Sadia; Ahmed, Shehzad; Niaz, Zeeshan; Fatima, Nighat; Chi, Zhen-Ming

    2016-11-05

    The PVGOX gene (accession number: KT452630) was isolated from genomic DNA of the marine fungi Penicillium viticola F1 by Genome Walking and their expression analysis was done by Fluorescent RT-PCR. An open reading frame of 1806bp encoding a 601 amino acid protein (isoelectric point: 5.01) with a calculated molecular weight of 65,535.4 was characterized. The deduced protein showed 75%, 71%, 69% and 64% identity to those deduced from the glucose oxidase (GOX) genes from different fungal strains including; Talaromyces variabilis, Beauveria bassiana, Aspergillus terreus, and Aspergillus niger, respectively. The promoter of the gene (intronless) had two TATA boxes around the base pair number -88 and -94 and as well as a CAAT box at -100. However, the terminator of the PVGOX gene does not contain any polyadenylation site (AATAAA). The protein deduced from the PVGOX gene had a signal peptide containing 17 amino acids, three cysteine residues and six potential N-linked glycosylation sites, among them, -N-K-T-Y- at 41 amino acid, -N-R-S-L- at 113 amino acid, -N-G-T-I- at 192 amino acid, -N-T-T-A at 215 amino acid, -N-F-T-E at 373 amino acid and -N-V-T-A- at 408 amino acid were the most possible N-glycosylation sites. Furthermore, the relative transcription level of the PVGOX gene was also stimulated in the presence of 4% (w/v) of calcium carbonate and 0.5 % (v/v) of CSL in the production medium compared with that of the PVGOX gene when the fungal strain F1 was grown in the absence of calcium carbonate and CSL in the production medium, suggesting that under the optimal conditions, the expression of the PVGOX gene responsible for gluconic acid biosynthesis was enhanced, leading to increased gluconic acid production. Therefore, the highly glycosylated oxidase enzyme produced by P. viticola F1 strain might be a good producer in the fermentation process for the industrial level production of gluconic acid.

  18. Molecular cloning and characterization of a putative lipopolysaccharide-induced TNF-alpha factor (LITAF) gene homologue from Zhikong scallop Chlamys farreri.

    PubMed

    Yu, Yundong; Qiu, Limei; Song, Linsheng; Zhao, Jianmin; Ni, Duojiao; Zhang, Ying; Xu, Wei

    2007-08-01

    LPS-induced TNF-alpha factor (LITAF) is a novel transcriptional factor that was first discovered in LPS-stimulated human macrophage cell line THP-1. LITAF can bind to TNF-alpha promoter to regulate its expression. The first scallop LITAF (named as CfLITAF) was cloned from Zhikong scallop Chlamys farreri by Expressed Sequence Tag (EST) and Polymerase Chain Reaction (PCR) techniques. The cDNA of CfLITAF was of 1240 bp and consisted of a 5' untranslated region (UTR) of 112 bp, a 3' UTR of 678 bp and an open reading frame (ORF) of 450 bp encoding a polypeptide of 149 amino acids with an estimated molecular mass of 16.08 kDa and theoretical isoelectric point of 6.77. A typical conserved LITAF-domain was identified in CfLITAF by SMART analysis. Homology analysis of the deduced amino acid sequence of CfLITAF with other known sequences by using the BLAST program revealed that CfLITAF was homologous to the LITAF from human and rat (Identity = 46%), cattle, horse, mouse and chicken (Identity = 48%), western clawed frog (Identity=42%), and zebrafish (Identity = 50%). The mRNA expression of CfLITAF in different tissues including haemocytes, muscle, mantle, heart, gill and gonad, and the temporal expression in haemocytes challenged by LPS or peptidoglycan (PGN) were measured by Real-time RT-PCR. CfLITAF mRNA transcripts could be detected in all tissues examined and be up-regulated in haemocytes after LPS challenge. No significant changes were observed after PGN stimulation. All these data indicated the existence of LITAF in scallop and also provided clue on the presence of TNF-alpha-like molecules in invertebrates.

  19. Molecular Cloning, Characterization, and Expression of a Catalase Gene in the Japanese Scallop Mizuhopecten yessoensis Induced in the Presence of Cadmium

    NASA Astrophysics Data System (ADS)

    Gao, Jialong; Ishizaki, Shoichiro; Nagashima, Yuji

    2016-03-01

    Cadmium (Cd) is known to influence the oxidative status of marine organisms and can induce the formation of reactive oxygen species (ROS). Catalase (CAT) is one of the important enzymes involved in scavenging high levels of ROS. In present study, we cloned CAT cDNA and investigated the response of this enzyme at the transcriptional level in the Japanese scallop Mizuhopecten yessoensis exposed to Cd. The full-length CAT cDNA (MyCAT) of 1,870 nucleotides including a 57 bp 5'-UTR, a coding sequence of 1,500 bp and a 313 bp 3'-UTR were identified from the scallop. The deduced amino acid sequence of MyCAT corresponds to 499 amino acids with predicted molecular weight of 56.48 kDa and contains highly conserved motifs of the proximal heme-binding site RLFSYSTH, proximal active signature FNRERIPERVVHAKGGG and three catalytic amino acid residues His72, Asn145, and Tyr355. Its significant homology to CATs from multiple alignments revealed that MyCAT had a high identity with CATs from other mollusks. CAT mRNA expression analysis revealed that expression level was highest in the digestive gland ( p < 0.01) but weak in muscle. Following exposure to 200 and 400 µg/l of Cd, a high amount of Cd was found to have accumulated in the digestive gland and CAT mRNA expression had significantly increased in this organ among 7-day exposed scallops ( p < 0.001). The result demonstrated that antioxidant enzymes such as CAT play important roles in counteracting Cd stress in M. yessoensis.

  20. Molecular cloning of chicken aggrecan. Structural analyses.

    PubMed Central

    Chandrasekaran, L; Tanzer, M L

    1992-01-01

    The large, aggregating chondroitin sulphate proteoglycan of cartilage, aggrecan, has served as a generic model of proteoglycan structure. Molecular cloning of aggrecans has further defined their amino acid sequences and domain structures. In this study, we have obtained the complete coding sequence of chicken sternal cartilage aggrecan by a combination of cDNA and genomic DNA sequencing. The composite sequence is 6117 bp in length, encoding 1951 amino acids. Comparison of chicken aggrecan protein primary structure with rat, human and bovine aggrecans has disclosed both similarities and differences. The domains which are most highly conserved at 70-80% identity are the N-terminal domains G1 and G2 and the C-terminal domain G3. The chondroitin sulphate domain of chicken aggrecan is smaller than that of rat and human aggrecans and has very distinctive repeat sequences. It has two separate sections, one comprising 12 consecutive Ser-Gly-Glu repeats of 20 amino acids each, adjacent to the other which has 23 discontinuous Ser-Gly-Glu repeats of 10 amino acids each; this latter region, N-terminal to the former one, appears to be unique to chicken aggrecan. The two regions contain a total of 94 potential chondroitin sulphate attachment sites. Genomic comparison shows that, although chicken exons 11-14 are identical in size to the rat and human exons, chicken exon 10 is the smallest of the three species. This is also reflected in the size of its chondroitin sulphate coding region and in the total number of Ser-Gly pairs. The putative keratan sulphate domain shows 31-45% identity with the other species and lacks the repetitive sequences seen in the others. In summary, while the linear arrangement of specific domains of chicken aggrecan is identical to that in the aggrecans of other species, and while there is considerable identity of three separate domains, chicken aggrecan demonstrates unique features, notably in its chondroitin sulphate domain and its keratan sulphate

  1. The clock gene Period3 in the nocturnal flatfish Solea senegalensis: Molecular cloning, tissue expression and daily rhythms in central areas.

    PubMed

    Martín-Robles, Agueda J; Isorna, Esther; Whitmore, David; Muñoz-Cueto, José A; Pendón, Carlos

    2011-05-01

    Clock genes are responsible for generating and sustaining most rhythmic daily functions in vertebrates. Their expression is endogenously driven, although they are entrained by external cues such as light, temperature and nutrient availability. In the present study, a full-length coding region of Solea senegalensis clock gene Period3 (Per3) has been isolated from sole brain as a first step in understanding the molecular basis underlying circadian rhythms in this nocturnal species. The complete cDNA is 4141 base pairs (bp) in length, including an ORF of 3804bp, a 5'UTR of 247bp and a 3'UTR of 90bp. It encodes a putative PERIOD3 protein (PER3) of 1267 amino acids which shares the main functional domains conserved between transcription factors regulating the circadian clock pathway. Sole PER3 displays high identity with PER3 proteins from teleost species (61-77%) and lower identity (39-46%) with other vertebrate PER3 sequences. This gene is expressed in all examined tissues, being mRNA expression particularly evident in retina, cerebellum, diencephalon, optic tectum, liver and ovary. Per3 exhibits a significant daily oscillation in retina and optic tectum but not in diencephalon and cerebellum. Our results suggest an important role of Per3 in the circadian clockwork machinery of visually-related areas of sole.

  2. Molecular cloning and expression of the vitellogenin gene and its correlation with ovarian development in an invasive pest Octodonta nipae on two host plants.

    PubMed

    Li, Jin-Lei; Tang, Bao-Zhen; Hou, You-Ming; Xie, Yi-Xing

    2016-10-01

    There is an ongoing relationship between host plants and herbivores. The nutrient substances and secondary compounds found in the host plant can not only impact the growth and development process of herbivores, but, more importantly, may also affect their survival and reproductive fitness. Vitellogenesis is the core process of reproductive regulation and is generally considered as a reliable indicator for evaluating the degree of ovarian development in females. Vitellogenin (Vg) plays a critical role in the synthesis and secretion of yolk protein. In this study, the full-length cDNA of the Vg gene in an alien invasive species, the nipa palm hispid beetle Octodonta nipae Maulik (Coleoptera: Chrysomelidae) (OnVg) was cloned and, the effect of host plant on the OnVg expression level and ovarian development was investigated. The results revealed that the OnVg was highly and exclusively expressed in adult females, but barely detectable in larvae, pupae and adult males. The relative expression level of OnVg and egg hatchability were much higher in females fed on Phoenix canariensis (their preferred host) than those fed on Phoenix roebelenii. A positive correlation relationship between OnVg expression and egg hatchability was also detected. Additionally, the anatomy of the female reproductive system showed that the ovaries of individuals fed on P. canariensis were considerably more developed than in females fed on P. roebelenii. The results may be applicable to many pest management situations through reproductive disturbance by alternating host plant species or varieties or by reproductive regulation through vitellogenesis mediated by specific endocrine hormones.

  3. Molecular cloning of complex chromosomal translocation t(8;14;12)(q24.1;q32.3;q24.1) in a Burkitt lymphoma cell line defines a new gene (BCL7A) with homology to caldesmon.

    PubMed

    Zani, V J; Asou, N; Jadayel, D; Heward, J M; Shipley, J; Nacheva, E; Takasuki, K; Catovsky, D; Dyer, M J

    1996-04-15

    Chromosome 12q24.1 is a recurrent breakpoint in high-grade B-cell non-Hodgkin lymphoma (B-NHL). To identify the genes involved at 12q24.1, molecular cloning of a three-way translocation t(8;14;12)(q24.1;q32.3;q24.1) in a Burkitt lymphoma cell line (Wien 133) was performed; all four translocation breakpoints were cloned and sequenced. Analysis of clones encompassing the der(12)(12;14)(q24.1;q32.3) breakpoint showed a CpG island from chromosome 12q24.1 juxtaposed in a tail-to-tail configuration with a productively rearranged Ig VH4-DH-JH5 gene. A total of 4.5 kb of genomic DNA including the CpG island was sequenced and analyzed using gene-identification programs; all three programs identified a potential 92-bp exon within the centromeric boundary of the CpG island. Using this as a probe, an RNA transcript of 3.8 kb, expressed at low levels in a wide variety of normal tissues, was detected. Overlapping cDNA clones were isolated and sequenced. The longest open-reading frame predicted a serine-rich protein of 231 amino acids. This protein, termed BCL7A, exhibited no recognizable protein motifs but showed homology with the actin-binding protein, caldesmon. In Wien 133, the BCL7A breakpoint occurred within the first intron and resulted in a MYC-BCL7A fusion transcript, with exon I of BCL7A being replaced by MYC exon I. The normal, untranslocated allele of BCL7A was also expressed without mutation. One of the 11 other B-NHL cell lines examined with 12q24.1 cytogenetic abnormalities, a mediastinal B-NHL cell line (Karpas 1106), showed biallelic rearrangement within the first intron of BCL7A, which was adjacent to the breakpoint observed in Wien 133. Disruption of the amino-terminus of BCL7A defines a new mechanism in the pathogenesis of a subset of high-grade B-NHL.

  4. Molecular cloning of the mouse grb2 gene: differential interaction of the Grb2 adaptor protein with epidermal growth factor and nerve growth factor receptors.

    PubMed Central

    Suen, K L; Bustelo, X R; Pawson, T; Barbacid, M

    1993-01-01

    We report the isolation and molecular characterization of the mouse grb2 gene. The product of this gene, the Grb2 protein, is highly related to the Caenorhabditis elegans sem-5 gene product and the human GRB2 protein and displays the same SH3-SH2-SH3 structural motifs. In situ hybridization studies revealed that the mouse grb2 gene is widely expressed throughout embryonic development (E9.5 to P0). However, grb2 transcripts are not uniformly distributed, and in certain tissues (e.g., thymus) they appear to be regulated during development. Recent genetic and biochemical evidence has implicated the Grb2 protein in the signaling pathways that link cell surface tyrosine kinase receptors with Ras. We have investigated the association of the Grb2 protein with epidermal growth factor (EGF) and nerve growth factor (NGF) receptors in PC12 pheochromocytoma cells. EGF treatment of PC12 cells results in the rapid association of Grb2 with the activated EGF receptors, an interaction mediated by the Grb2 SH2 domain. However, Grb2 does not bind to NGF-activated Trk receptors. Mitogenic signaling of NGF in NIH 3T3 cells ectopically expressing Trk receptors also takes place without detectable association between Grb2 and Trk. These results suggest that whereas EGF and NGF can activate the Ras signaling pathway in PC12 cells, only the EGF receptor is likely to do so through a direct interaction with Grb2. Finally, binding studies with glutathione S-transferase fusion proteins indicate that Grb2 binds two distinct subsets of proteins which are individually recognized by its SH2 and SH3 domains. These observations add further support to the concept that Grb2 is a modular adaptor protein. Images PMID:7689150

  5. Molecular cloning of cDNAs encoding human GLEPP1, a membrane protein tyrosine phosphatase: characterization of the GLEPP1 protein distribution in human kidney and assignment of the GLEPP1 gene to human chromosome 12p12-p13.

    PubMed

    Wiggins, R C; Wiggins, J E; Goyal, M; Wharram, B L; Thomas, P E

    1995-05-01

    Human glomerular epithelial protein 1 (GLEPP1), a receptor-like membrane protein tyrosine phosphatase (PTPase), was cloned and sequenced from a human renal cortical cDNA library. The human nucleotide and derived amino acid sequences were, respectively, 90 and 97% identical to those of rabbit. Human GLEPP1 is predicted to contain 1188 amino acids. The predicted mature protein is 1159 amino acids long and contains a large extracellular domain, a single transmembrane domain, and a single intracellular PTPase domain. Monoclonal and polyclonal antibodies raised against a human GLEPP1 fusion protein recognized a protein with distribution restricted to the glomerulus in human kidney and with an apparent molecular weight of approximately 200 kDa. The GLEPP1 gene was assigned to human chromosome 12p12-p13 by fluorescence in situ hybridization.

  6. Molecular Cloning and Characterization of Novel Morus alba Germin-Like Protein Gene Which Encodes for a Silkworm Gut Digestion-Resistant Antimicrobial Protein

    PubMed Central

    Patnaik, Bharat Bhusan; Kim, Dong Hyun; Oh, Seung Han; Song, Yong-Su; Chanh, Nguyen Dang Minh; Kim, Jong Sun; Jung, Woo-jin; Saha, Atul Kumar; Bindroo, Bharat Bhushan; Han, Yeon Soo

    2012-01-01

    Background Silkworm fecal matter is considered one of the richest sources of antimicrobial and antiviral protein (substances) and such economically feasible and eco-friendly proteins acting as secondary metabolites from the insect system can be explored for their practical utility in conferring broad spectrum disease resistance against pathogenic microbial specimens. Methodology/Principal Findings Silkworm fecal matter extracts prepared in 0.02 M phosphate buffer saline (pH 7.4), at a temperature of 60°C was subjected to 40% saturated ammonium sulphate precipitation and purified by gel-filtration chromatography (GFC). SDS-PAGE under denaturing conditions showed a single band at about 21.5 kDa. The peak fraction, thus obtained by GFC wastested for homogeneityusing C18reverse-phase high performance liquid chromatography (HPLC). The activity of the purified protein was tested against selected Gram +/− bacteria and phytopathogenic Fusarium species with concentration-dependent inhibitionrelationship. The purified bioactive protein was subjected to matrix-assisted laser desorption and ionization-time of flight mass spectrometry (MALDI-TOF-MS) and N-terminal sequencing by Edman degradation towards its identification. The N-terminal first 18 amino acid sequence following the predicted signal peptide showed homology to plant germin-like proteins (Glp). In order to characterize the full-length gene sequence in detail, the partial cDNA was cloned and sequenced using degenerate primers, followed by 5′- and 3′-rapid amplification of cDNA ends (RACE-PCR). The full-length cDNA sequence composed of 630 bp encoding 209 amino acids and corresponded to germin-like proteins (Glps) involved in plant development and defense. Conclusions/Significance The study reports, characterization of novel Glpbelonging to subfamily 3 from M. alba by the purification of mature active protein from silkworm fecal matter. The N-terminal amino acid sequence of the purified protein was found

  7. Molecular Cloning, Heterologous Expression, and Functional Characterization of an NADPH-Cytochrome P450 Reductase Gene from Camptotheca acuminata, a Camptothecin-Producing Plant

    PubMed Central

    Chen, Fei; Yang, Yun; Yang, Lixia; Zhang, Guolin; Luo, Yinggang

    2015-01-01

    Camptothecin (CAM), a complex pentacyclic pyrroloqinoline alkaloid, is the starting material for CAM-type drugs that are well-known antitumor plant drugs. Although many chemical and biological research efforts have been performed to produce CAM, a few attempts have been made to uncover the enzymatic mechanism involved in the biosynthesis of CAM. Enzyme-catalyzed oxidoreduction reactions are ubiquitously presented in living organisms, especially in the biosynthetic pathway of most secondary metabolites such as CAM. Due to a lack of its reduction partner, most catalytic oxidation steps involved in the biosynthesis of CAM have not been established. In the present study, an NADPH-cytochrome P450 reductase (CPR) encoding gene CamCPR was cloned from Camptotheca acuminata, a CAM-producing plant. The full length of CamCPR cDNA contained an open reading frame of 2127-bp nucleotides, corresponding to 708-amino acid residues. CamCPR showed 70 ~ 85% identities to other characterized plant CPRs and it was categorized to the group II of CPRs on the basis of the results of multiple sequence alignment of the N-terminal hydrophobic regions. The intact and truncate CamCPRs with N- or C-terminal His6-tag were heterologously overexpressed in Escherichia coli. The recombinant enzymes showed NADPH-dependent reductase activity toward a chemical substrate ferricyanide and a protein substrate cytochrome c. The N-terminal His6-tagged CamCPR showed 18- ~ 30-fold reduction activity higher than the C-terminal His6-tagged CamCPR, which supported a reported conclusion, i.e., the last C-terminal tryptophan of CPRs plays an important role in the discrimination between NADPH and NADH. Co-expression of CamCPR and a P450 monooxygenase, CYP73A25, a cinnamate 4-hydroxylase from cotton, and the following catalytic formation of p-coumaric acid suggested that CamCPR transforms electrons from NADPH to the heme center of P450 to support its oxidation reaction. Quantitative real-time PCR analysis showed that

  8. Molecular cloning, characterization and expression analysis of the gene encoding 1-deoxy-D-xylulose 5-phosphate reductoisomerase from Aquilaria sinensis (Lour.) Gilg.

    PubMed

    Liu, Juan; Xu, Yanhong; Liang, Liang; Wei, Jianhe

    2015-06-01

    The major constituents of agarwood oils are sesquiterpenes that are obtained from isoprenoid precursors through the plastidial methylerythritol phosphate (MEP) pathway and the cytosolic mevalonate pathway. In this study, a novel full-length cDNA of 1-deoxy-D-xylulose 5-phosphate reductoisomerase (DXR), which was the second key enzyme in the plastid MEP pathway of sesquiterpenes biosynthesis was isolated from the stem of Aquilaria sinensis (Lour.) Gilg by the methods of reverse transcription polymerase chain reaction (RT-PCR) and rapid amplification of cDNA ends (RACE) technique for the first time, and named as AsDXR. The full-length cDNA of AsDXR was 1768 bp, containing a 1437 bp open reading frame (ORF) encoding a polypeptide of 478 amino acids with a molecular weight of 51.859 kD and the theoretical isoelectric point of 6.29. Comparative and bioinformatic analysis of the deduced AsDXR protein showed extensive homology with DXRs from other plant species, especially Theobroma cacao and Gossypium barbadense, and contained a conserved transit peptide for plastids, and extended pro-rich region and a highly conserved NADPH-binding motif owned by all plant DXRs. Southern blot analysis indicated that AsDXR belonged to a small gene family. Tissue expression pattern analysis revealed that AsDXR expressed strongly in root and stem, but weakly in leaf. Additionally, AsDXR expression was found to be activated by exogenous elicitor of MeJA (methyl jasmonate). The contents of three sesquiterpenes (α-guaiene, α-humulene and Δ-guaiene) were significantly induced by MeJA. This study enables us to further elucidate the role of AsDXR in the biosynthesis of agarwood sesquiterpenes in A. sinensis at the molecular level.

  9. Cloning of the cytotoxin-hemolysin gene of Vibrio vulnificus.

    PubMed Central

    Wright, A C; Morris, J G; Maneval, D R; Richardson, K; Kaper, J B

    1985-01-01

    Genes encoding the cytotoxin-hemolysin of Vibrio vulnificus were cloned in Escherichia coli by using the lytic cloning vector, lambda 1059. Subcloning in plasmid pBR325 resulted in the isolation of a 3.2-kilobase DNA fragment containing the cytotoxin gene. By using this fragment as a DNA probe, homologous gene sequences were detected in all 54 V. vulnificus strains studied; homologous sequences were present in none of 96 isolates from 29 other bacterial species. PMID:4066036

  10. Molecular cloning, expression profile and promoter analysis of a novel ethylene responsive transcription factor gene GhERF4 from cotton (Gossypium hirstum).

    PubMed

    Jin, Long-Guo; Liu, Jin-Yuan

    2008-01-01

    Ethylene-responsive element binding factors (ERFs) are plant-specific transcription factors, many of which have been linked to stress responses. A novel ERF gene, designated GhERF4, was isolated by RACE-PCR from Gossypium hirsutum. The GhERF4 cDNA has a total length of 1061bp with an open reading frame of 669bp, encoding a protein of 222 amino acids with a molecular weight of 23.5kDa and a calculated pI of 9.03. Sequence alignment shows that GhERF4 contains a 58 amino acid long AP2/ERF domain and a RKRP nuclear localization signal, and belongs to a group II protein in the ERF subfamily as typified by the C-terminal ERF-associated Amphiphilic Repression (EAR) motif. Southern blot analysis indicates that GhERF4 is a single copy gene in cotton genome. Using green fluorescent protein fusion, we demonstrate that GhERF4 accumulates specifically in the nucleus of onion epidermis cells. Semi-quantitative RT-PCR reveals that GhERF4 is constitutively expressed in true leaves, roots, seeds and stems. The transcripts of GhERF4 accumulate highly and rapidly when plants are treated with exogenous ethylene, salt, cold, drought stresses and exogenous abscisic acid (ABA) treatment, suggesting that GhERF4 is regulated by certain components of the stress signaling pathway. Promoter analysis indicates that the 5' upstream region of GhERF4 possesses some elements induced by physiological and environmental factors. These results indicate that GhERF4 may play an important role in response to ethylene, ABA and environmental stresses.

  11. Molecular cloning and characterization of l-methionine γ-lyase from Streptomyces avermitilis.

    PubMed

    Kudou, Daizou; Yasuda, Eri; Hirai, Yoshiyuki; Tamura, Takashi; Inagaki, Kenji

    2015-10-01

    A pyridoxal 5'-phosphate-dependent methionine γ-lyase (MGL) was cloned from Streptomyces avermitilis catalyzed the degradation of methionine to α-ketobutyrate, methanethiol, and ammonia. The sav7062 gene (1,242 bp) was corresponded to 413 amino acid residues with a molecular mass of 42,994 Da. The deduced amino acid sequence showed a high degree of similarity to those of other MGL enzymes. The sav7062 gene was overexpressed in Escherichia coli. The enzyme was purified to homogeneity and exhibited the MGL catalytic activities. We cloned the enzyme that has the MGL activity in Streptomyces for the first time.

  12. [A review of the genomic and gene cloning studies in trees].

    PubMed

    Yin, Tong-Ming

    2010-07-01

    Supported by the Department of Energy (DOE) of U.S., the first tree genome, black cottonwood (Populus trichocarpa), has been completely sequenced and publicly release. This is the milestone that indicates the beginning of post-genome era for forest trees. Identification and cloning genes underlying important traits are one of the main tasks for the post-genome-era tree genomic studies. Recently, great achievements have been made in cloning genes coordinating important domestication traits in some crops, such as rice, tomato, maize and so on. Molecular breeding has been applied in the practical breeding programs for many crops. By contrast, molecular studies in trees are lagging behind. Trees possess some characteristics that make them as difficult organisms for studying on locating and cloning of genes. With the advances in techniques, given also the fast growth of tree genomic resources, great achievements are desirable in cloning unknown genes from trees, which will facilitate tree improvement programs by means of molecular breeding. In this paper, the author reviewed the progress in tree genomic and gene cloning studies, and prospected the future achievements in order to provide a useful reference for researchers working in this area.

  13. Molecular cloning and expression of Hedychium coronarium farnesyl pyrophosphate synthase gene and its possible involvement in the biosynthesis of floral and wounding/herbivory induced leaf volatile sesquiterpenoids.

    PubMed

    Lan, Jian-bin; Yu, Rang-cai; Yu, Yun-yi; Fan, Yan-ping

    2013-04-15

    Farnesyl pyrophosphate synthase (FPPS EC 2.5.1.10) catalyzes the production of farnesyl pyrophosphate (FPP), which is a key precursor for many sesquiterpenoids such as floral scent and defense volatiles against herbivore attack. Here we report a new full-length cDNA encoding farnesyl diphosphate synthase from Hedychium coronarium. The open reading frame for full-length HcFPPS encodes a protein of 356 amino acids, which is 1068 nucleotides long with calculated molecular mass of 40.7 kDa. Phylogenetic tree analysis indicates that HcFPPS belongs to the plant FPPS super-family and has strong relationship with FPPS from Musa acuminata. Expression of the HcFPPS gene in Escherichia coli yielded FPPS activity. Tissue-specific and developmental analyses of the HcFPPS mRNA and corresponding volatile sesquiterpenoid levels in H. coronarium flowers revealed that the HcFPPS might play a regulatory role in floral volatile sesquiterpenoid biosynthesis. The emission of the FPP-derived volatile terpenoid correlates with strong expression of HcFPPS induced by mechanical wounding and Udaspes folus-damage in leaves, which suggests that HcFPPS may have an important ecological function in H. coronarium vegetative organ.

  14. Molecular cloning and expression analysis of the retinoid X receptor (RXR) gene in golden pompano Trachinotus ovatus fed Artemia nauplii with different enrichments.

    PubMed

    Yang, Qibin; Zheng, Panlong; Ma, Zhenhua; Li, Tao; Jiang, Shigui; Qin, Jian G

    2015-12-01

    The retinoid X receptors (RXRs) are involved in the skeletal development and other biological process such as blood vessel formation and metabolism. Partial sequences of RXRα and β genes were obtained, and their expressions were quantified on golden pompano Trachinotus ovatus at 28 days post hatching (DPH) to explore the molecular response to nutritional manipulation in fish larvae. As live food, Artemia nauplii were separately enriched with Nannochloropsis and Algamac 3080 and non-enriched Artemia nauplii (control) for fish feeding. The expressions of RXRs were detected in the embryos and fish larvae at early stages, suggesting that the skeletal development in golden pompano initiated before yolk re-sorption completion. Fish fed non-enriched Artemia nauplii ended up with higher jaw malformation. The highest specific growth rate was obtained when fish were fed with the Artemia nauplii enriched with Algamac 3080, and the lowest growth rate was observed when fish were fed with unenriched Artemia nauplii. The highest survival was obtained when fish were fed with non-enriched or Nannochloropsis-enriched Artemia nauplii. This study indicates that the use of enriched formula for Artemia nauplii can significantly affect the expression levels of RXRs and jaw malformation of golden pompano larvae, but there is no clear correlation between RXRs expressions and malformation rates when fish are subjected to nutrient challenge.

  15. Pathogenicity of molecularly cloned bovine leukemia virus.

    PubMed Central

    Rovnak, J; Boyd, A L; Casey, J W; Gonda, M A; Jensen, W A; Cockerell, G L

    1993-01-01

    To delineate the mechanisms of bovine leukemia virus (BLV) pathogenesis, four full-length BLV clones, 1, 8, 9, and 13, derived from the transformed cell line FLK-BLV and a clone construct, pBLV913, were introduced into bovine spleen cells by microinjection. Microinjected cells exhibited cytopathic effects and produced BLV p24 and gp51 antigens and infectious virus. The construct, pBLV913, was selected for infection of two sheep by inoculation of microinjected cells. After 15 months, peripheral blood mononuclear cells from these sheep served as inocula for the transfer of infection to four additional sheep. All six infected sheep seroconverted to BLV and had detectable BLV DNA in peripheral blood mononuclear cells after amplification by polymerase chain reaction. Four of the six sheep developed altered B/T-lymphocyte ratios between 33 and 53 months postinfection. One sheep died of unrelated causes, and one remained hematologically normal. Two of the affected sheep developed B lymphocytosis comparable to that observed in animals inoculated with peripheral blood mononuclear cells from BLV-infected cattle. This expanded B-lymphocyte population was characterized by elevated expression of B-cell surface markers, spontaneous blastogenesis, virus expression in vitro, and increased, polyclonally integrated provirus. One of these two sheep developed lymphocytic leukemia-lymphoma at 57 months postinfection. Leukemic cells had the same phenotype and harbored a single, monoclonally integrated provirus but produced no virus after in vitro cultivation. The range in clinical response to in vivo infection with cloned BLV suggests an important role for host immune response in the progression of virus replication and pathogenesis. Images PMID:8230433

  16. Molecular cloning of sea bass (Dicentrarchus labrax L.) caspase-8 gene and its involvement in Photobacterium damselae ssp. piscicida triggered apoptosis.

    PubMed

    Reis, Marta I R; Costa-Ramos, Carolina; do Vale, Ana; dos Santos, Nuno M S

    2010-07-01

    Caspase-8 is an initiator caspase that plays a crucial role in some cases of apoptosis by extrinsic and intrinsic pathways. Caspase-8 structure and function have been extensively studied in mammals, but in fish the characterization of that initiator caspase is still scarce. In this work, the sea bass counterpart of mammalian caspase-8 was sequenced and characterized, and its involvement in the apoptogenic activity of a toxin from a fish pathogen was assessed. A 2472 bp cDNA of sea bass caspase-8 was obtained, consisting of 1455 bp open reading frame coding for 484 amino acids and with a predicted molecular weight of 55.2 kDa. The sea bass caspase-8 gene has 6639 bp and is organized in 11 introns and 12 exons. Several distinctive features of sea bass caspase-8 were identified, which include two death effector domains, the caspase family domains p20 and p10, the caspase-8 active-site pentapeptide and potential aspartic acid cleavage sites. The sea bass caspase-8 sequence revealed a significant degree of similarity to corresponding sequences from several vertebrate taxonomic groups. A low expression of sea bass caspase-8 was detected in various tissues of non-stimulated sea bass. Furthermore, it is shown that stimulation of sea bass with mid-exponential phase culture supernatants from Photobacterium damselae ssp. piscicida (Phdp), known to induce selective apoptosis of macrophages and neutrophils, resulted in an increased expression of caspase-8 in the spleen, one of the main affected organs by Phdp infection.

  17. Molecular Transfer of Nematode Resistance Genes

    PubMed Central

    Williamson, V. M.; Ho, J.-Y.; Ma, H. M.

    1992-01-01

    Recombinant DNA techniques have been used to introduce agronomically valuable traits, including resistance to viruses, herbicides, and insects, into crop plants. Introduction of these genes into plants frequently involves Agrobacterium-mediated gene transfer. The potential exists for applying this technology to nematode control by introducing genes conferring resistance to nematodes. Transferred genes could include those encoding products detrimental to nematode development or reproduction as well as cloned host resistance genes. Host genes that confer resistance to cyst or root-knot nematode species have been identified in many plants. The best characterized is Mi, a gene that confers resistance to root-knot nematodes in tomato. A map-based cloning approach is being used to isolate the gene. For development of a detailed map of the region of the genome surrounding Mi, DNA markers genetically linked to Mi have been identified and analyzed in tomato lines that have undergone a recombination event near Mi. The molecular map will be used to identify DNA corresponding to Mi. We estimate that a clone of Mi will be obtained in 2-5 years. An exciting prospect is that introduction of this gene will confer resistance in plant species without currently available sources of resistance. PMID:19282989

  18. Molecular cloning of the gene for the human placental GTP-binding protein Gp (G25K): identification of this GTP-binding protein as the human homolog of the yeast cell-division-cycle protein CDC42.

    PubMed Central

    Shinjo, K; Koland, J G; Hart, M J; Narasimhan, V; Johnson, D I; Evans, T; Cerione, R A

    1990-01-01

    We have isolated cDNA clones from a human placental library that code for a low molecular weight GTP-binding protein originally designated Gp (also called G25K). This identification is based on comparisons with the available peptide sequences for the purified human Gp protein and the use of two highly specific anti-peptide antibodies. The predicted amino acid sequence of the protein is very similar to those of various members of the ras superfamily of low molecular weight GTP-binding proteins, including the N-, Ki-, and Ha-ras proteins (30-35% identical), the rho proteins (approximately 50% identical), and the rac proteins (approximately 70% identical). The highest degree of sequence identity (80%) is found with the Saccharomyces cerevisiae cell-division-cycle protein CDC42. The human placental gene, which we designate CDC42Hs, complements the cdc42-1 mutation in S. cerevisiae, which suggests that this GTP-binding protein is the human homolog of the yeast protein. Images PMID:2124704

  19. Molecular cloning of the gene for the human placental GTP-binding protein Gp (G25K): identification of this GTP-binding protein as the human homolog of the yeast cell-division-cycle protein CDC42.

    PubMed

    Shinjo, K; Koland, J G; Hart, M J; Narasimhan, V; Johnson, D I; Evans, T; Cerione, R A

    1990-12-01

    We have isolated cDNA clones from a human placental library that code for a low molecular weight GTP-binding protein originally designated Gp (also called G25K). This identification is based on comparisons with the available peptide sequences for the purified human Gp protein and the use of two highly specific anti-peptide antibodies. The predicted amino acid sequence of the protein is very similar to those of various members of the ras superfamily of low molecular weight GTP-binding proteins, including the N-, Ki-, and Ha-ras proteins (30-35% identical), the rho proteins (approximately 50% identical), and the rac proteins (approximately 70% identical). The highest degree of sequence identity (80%) is found with the Saccharomyces cerevisiae cell-division-cycle protein CDC42. The human placental gene, which we designate CDC42Hs, complements the cdc42-1 mutation in S. cerevisiae, which suggests that this GTP-binding protein is the human homolog of the yeast protein.

  20. Molecular cloning of the gene for the human placental GTP-binding protein G sub p (G25K): Identification of this GTP-binding protein as the human homolog of the yeast cell-division-cycle protein CDC42

    SciTech Connect

    Shinjo, K.; Koland, J.G.; Hart, M.J.; Narasimhan, V.; Cerione, R.A. ); Johnson, D.I. ); Evans, T. )

    1990-12-01

    The authors have isolated cDNA clones from a human placental library that code for a low molecular weight GTP-binding protein originally designated G{sub p} (also called G25K). This identification is based on comparisons with the available peptide sequences for the purified human G{sub p} protein and the use of two highly specific anti-peptide antibodies. The predicted amino acid sequence of the protein is very similar to those of various members of the ras superfamily of low molecular weight GTP-binding proteins, including the N-, Ki-, and Ha-ras proteins (30-35% identical), the rho proteins and the rac proteins. The highest degree of sequence identity (80%) is found with the Saccharomyces cerevisiae cell division-cycle protein CDC42. The human placental gene, which they designate CDC42Hs, complements the cdc42-1 mutation in S. cerevisiae, which suggests that this GTP-binding protein is the human homolog of the yeast protein.

  1. Molecular cloning of human terminal deoxynucleotidyltransferase.

    PubMed Central

    Peterson, R C; Cheung, L C; Mattaliano, R J; Chang, L M; Bollum, F J

    1984-01-01

    A cDNA of the human terminal deoxynucleotidyltransferase (TdT; "terminal transferase," EC 2.7.7.31) was isolated from a human lymphoblastoid cell cDNA library in lambda gt 11 by using immunological procedures. Four inserts containing 723 to 939 base pairs were recloned in pBR322 for hybridization and preliminary sequence studies. mRNA selected by hybridization to recombinant DNA was translated to a 58-kDa peptide that specifically immunoprecipitated with rabbit antibodies to calf terminal transferase and mouse monoclonal antibody to human terminal transferase. Blot hybridization of total poly(A)+ RNA from KM3 (TdT+) cells with nick-translated pBR322 recombinant DNA detected a message of about 2000 nucleotides, sufficient to code for the 580 amino acids in the protein. mRNA from terminal transferase- cells gave no signal in hybrid selection or RNA blot hybridization. The complete sequence of the 939-base-pair insert sequence was obtained from deletions cloned in pUC8. The DNA sequence contains an open reading frame coding for 238 amino acids, about 40% of the protein. Three peptides isolated by HPLC from tryptic digests of succinylated 58-kDa calf thymus terminal transferase were sequenced, providing 20, 18, and 22 residues of peptide sequence. A search of the translated sequence of the 939-base-pair insert shows three regions beginning after arginine that have greater than 90% homology with the sequence determined from the calf thymus terminal transferase peptides. These results provide unambiguous evidence that the human terminal transferase sequence has been cloned. Images PMID:6087320

  2. Mega primer-mediated molecular cloning strategy for chimaeragenesis and long DNA fragment insertion.

    PubMed

    Zhang, Hui; Liu, Chang-Jun; Jiang, Hui; Zhou, Lu; Li, Wen-Ying; Zhu, Ling-Yun; Wu, Lei; Meng, Er; Zhang, Dong-Yi

    2017-04-30

    Molecular cloning methods based on primer and overlap-extension PCR are widely used due to their simplicity, reliability, low cost and high efficiency. In this article, an efficient mega primer-mediated (MP) cloning strategy for chimaeragenesis and long DNA fragment insertion is presented. MP cloning is a seamless, restriction/ligation-independent method that requires only three steps: (i) the first PCR for mega primer generation; (ii) the second PCR for exponential amplification mediated by the mega primers and (iii) DpnI digestion and transformation. Most importantly, for chimaeragenesis, genes can be assembled and constructed into the plasmid vector in a single PCR step. By employing this strategy, we successfully inserted four DNA fragments (approximately 500 bp each) into the same vector simultaneously. In conclusion, the strategy proved to be a simple and efficient tool for seamless cloning.

  3. Cloning and expression of the leukotoxin gene from Actinobacillus actinomycetemcomitans.

    PubMed Central

    Kolodrubetz, D; Dailey, T; Ebersole, J; Kraig, E

    1989-01-01

    The leukotoxin produced by Actinobacillus actinomycetemcomitans has been implicated in the etiology of juvenile periodontitis. To initiate a genetic analysis of the role of this protein in disease, we have cloned the leukotoxin gene in Escherichia coli. Recombinant colonies carrying toxin gene sequences were isolated by screening a genomic A. actinomycetemcomitans library with a DNA probe for the leukotoxin gene from a related bacterium, Pasteurella haemolytica. To demonstrate that the cloned A. actinomycetemcomitans DNA contained a functional leukotoxin gene, protein extracts of E. coli containing the A. actinomycetemcomitans clone were tested directly for leukotoxic activity against human cell lines in chromium release assays. A construct containing the entire cloned region produced a functional toxin. No cytotoxicity was seen when extracts from cells containing plasmids with deletions in the putative coding region were used. Furthermore, the toxin produced by the cloned gene has the same target cell specificity as the leukotoxin extracted directly from A. actinomycetemcomitans. These results indicate that sequences encoding a functional leukotoxin have been cloned and are expressed in E. coli. Southern blot analysis of DNA from leukotoxin-producing (Lkt+) and non-leukotoxin-producing (Lkt-) strains indicated that the Lkt- strain also contained a copy of the gene. Images PMID:2707855

  4. Development of plasmid cloning vectors for Thermus thermophilus HB8: Expression of a heterologous, plasmid-borne kanamycin nucleotidyltransferase gene

    SciTech Connect

    Mather, M.W.; Fee, J.A. )

    1992-01-01

    While several thermus genes have been cloned and T. thermophilus has been shown to be transformable, molecular genetic studies of these thermophiles have been hampered by the absence of selectable cloning vectors. The authors have constructed a selectable plasmid by random insertion of a heterologous gene encoding a thermostable kanamycin nucleotidyltransferase activity into a cryptic, multicopy plasmid from T. thermophilus HB8. This plasmid should serve as a suitable starting point for the development of a gene expression system for T. thermophilus.

  5. Cloning, expression, and bioinformatics analysis of the sheep CARP gene.

    PubMed

    Ma, Guoda; Wang, Haiyang; Li, You; Cui, Lili; Cui, Yudong; Li, Qingzhang; Li, Keshen; Zhao, Bin

    2013-06-01

    The cardiac ankyrin repeat protein (CARP) is a multifunctional protein that is expressed specifically in mammalian cardiac muscle and plays important roles in stress responses, transcriptional regulation, myofibrillar assembly, and the development of cardiac and skeletal muscle. In this study, the sheep homolog of the CARP gene was cloned and characterized. The coding region of the gene consists of 960 bp and encodes 319 amino acids with molecular weight 36.2 KD. Bioinformatics analysis demonstrated that the 3' untranslated region (3'-UTR) of the gene contains many AU-rich elements that are associated with mRNA stability and a potential regulatory site for miRNA binding. The protein was predicted to contain 14 potential phosphorylation sites and an O-GlcNAc glycosylation site and to be expressed in both the nucleus and cytoplasm. The evolutionary analysis revealed that the sheep CARP exhibited a high level of homology with the mammalian counterparts; however, the protein exhibited an increased evolutionary distance from the chicken, frog, and fish homologs. RT-PCR revealed that in addition to its high mRNA expression level in cardiac muscle, trace amounts of the sheep CARP mRNA were expressed in the skeletal muscle, stomach, and small intestine. However, western blot analysis demonstrated that the CARP protein was expressed only in cardiac muscle. The coding sequence was cloned into the pET30a-TEV-LIC vector, and the soluble CARP-MBP (maltose-binding protein) fusion protein was expressed in a prokaryotic host and purified by affinity chromatography. Our data provide the basis for future studies of the structure and function of sheep CARP.

  6. Cloning of the lambda resistant genes from Brevibacterium albidum and Proteus vulgaris into Escherichia coli.

    PubMed

    Chae, K S; Yoo, O J

    1986-11-14

    Genes from Proteus vulgaris ATCC13315 and Brevibacterium albidum ATCC15831 were introduced into Escherichia coli, which rendered the host resistant to coliphage lambda. The clones transformed by any one of the two recombinant plasmids, pRMG101 or pRMG216, were totally resistant against the infection of virulent lambda and N4, but sensitive to ø80, T4 and T7. However, when maltose transport systems of the clones were induced by maltose, the clones were no more resistant to the phage: thus, this phenotype was thought to be due to the inhibition of phage adsorption onto the cell surface. The gene product was shown by SDS-PAGE of membrane protein-enriched extract of the clone. Molecular weight as measured was about 40,000 dalton, which coincide with that inferred from the nucleotide sequences.

  7. Molecular cloning and expression of a larval immunogenic protein from the cattle tick Boophilus annulatus.

    PubMed

    Shahein, Yasser Ezzat

    2008-02-15

    A full-length cDNA of an immunogenic protein was cloned from a cDNA library of the local Egyptian cattle tick Boophilus annulatus. Antibodies raised against B. annulatus larval proteins were used to screen a cDNA expression library. A 936bp cloned fragment was sequenced and showed an open reading frame of 516bp encoding a protein of 171 amino acids. Comparison of the deduced amino acid sequence with protein data bank revealed that the sequence is related to a sequence isolated from the hard tick Haemaphysalis qinghaiensis (Hq05). Southern blot analysis of B. annulatus genomic DNA showed that the cloned cDNA hybridized to double bands per restriction digest, suggesting that the cloned cDNA is a double copy gene. Amino acid analysis of the cloned gene revealed the presence of two casein kinase II phosphorylation sites in the N-terminal domain suggesting that this molecule may be involved in the signal transduction or gene expression pathways. RT-PCR and northern blotting revealed the presence of two isoforms of the Ba05 gene in salivary glands and in the 3-day-old eggs. The cloned gene without the signal peptide, was expressed in Escherichia coli under T7 promotor of pET-30b vector, and purified under denaturation conditions. The purified protein appeared as a single band on 12% SDS-PAGE with a molecular weight around 22.8kDa including the histidine tag of the vector. Antibodies raised against the purified molecule were used to detect the B. annulatus homologue to the Hq05 gene in whole tick, larvae and gut protein extracts. Immunoblotting revealed the presence of this molecule Ba05 only in whole tick and larval protein extracts and not in the gut protein extract. Using the same antibodies, homologues to the Ba05 gene were detected in other tick species as Hyalomma dromedarii and Rhipicephalus sp. but not in Ornithodoros moubata.

  8. Infectious virus replication in papillomas induced by molecularly cloned cottontail rabbit papillomavirus DNA.

    PubMed Central

    Brandsma, J L; Xiao, W

    1993-01-01

    The ability to obtain infectious papillomavirus virions from molecularly cloned DNA has not been previously reported. We demonstrate here that viral genomes isolated from a recombinant++ DNA clone of cottontail rabbit papillomavirus (CRPV) gave rise to infectious virus when inoculated into cottontail rabbit skin. Replication occurred in papillomas that formed at inoculation sites. Extract of a DNA-induced papilloma was serially passaged to naive rabbits with high efficiency. Complete virus was fractionated on cesium chloride density gradients, and papillomavirus particles were visualized by electron microscopy. CRPV DNA isolated from virions contained DNA sequence polymorphisms that are characteristic of the input CRPV-WA strain of virus, thereby proving that the newly generated virus originated from the molecularly cloned viral genome. These findings indicate that this will be a useful system in which to perform genetic analysis of viral gene functions involved in replication. Images PMID:8380092

  9. Human blood group genes 2004: chromosomal locations and cloning strategies.

    PubMed

    Lögdberg, Lennart; Reid, Marion E; Lamont, Ryan E; Zelinski, Teresa

    2005-01-01

    Of the 29 human blood group system genes, 27 have been localized to 14 autosomes and 2 have been assigned to the X chromosome. It is remarkable that 28 of the 29 system genes have now been localized to a single cytogenetic band on a specific chromosome. In this review, we summarize the chromosomal locations and cloning strategies used for those genes encoding blood group systems. We highlight such information about the 3 most recently defined blood group systems (I, GLOB, and GIL). In addition, we provide new information about 2 older blood group systems (SC and RAPH) whose polymorphisms have been defined in cloned genes.

  10. Molecular cloning of mRNA sequences encoding rat lens crystallins.

    PubMed Central

    Dodemont, H J; Andreoli, P M; Moormann, R J; Ramaekers, F C; Schoenmakers, J G; Bloemendal, H

    1981-01-01

    To provide access to crystallin-specific DNA sequences, we have constructed plasmid clones bearing duplex DNA sequences complementary to crystallin mRNAs isolated from rat lens. Optimization of the cDNA reaction conditions enabled us to fractionate three double-stranded (ds) cDNA groups. Molecular cloning of dC-tailed ds cDNAs into the Pst I site of dG-tailed pBR322 yielded crystallin-specific clones of each group. By means of positive hybridization selection and translation, recombinant plasmids containing cDNA sequences coding for rat lens polypeptides from alpha-, beta-, and gamma-crystallins could be identified. The established cDNA clones have been used for a blot-hybridization analysis to map the crystallin mRNAs from which they originated. Both procedures revealed a high degree of homology between the gamma-crystallin sequences. From the beta-crystallin class, the beta H-specific cDNA coding for the beta B1a polypeptide was obtained. The alpha A-chain clone did not show any cross-hybridization to the alpha B-chain mRNA despite the existence of 60% homology between the corresponding gene products. As this clone hybridized to both alpha A2 and alpha AIns mRNAs, sequence analysis was applied for further characterization. The results showed that the cloned cDNA corresponds to the alpha A2 sequence exclusively. Images PMID:6946472

  11. Molecular biological enhancement of coal desulfurization: Cloning and expression of the sulfoxide/sulfone/sulfonate/sulfate genes in Pseudomonads and Thiobacillae

    SciTech Connect

    Krawiec, S.

    1991-08-30

    The DbtS{sup +} phenotype is defined as the selective ability to oxidize the sulfur in dibenzothiophene (DBT) successively to dibenzothiophene-5-oxide, dibenzosulfone, and, finally, either o, o'-biphenol or monohydroxybiphenyl. By using a fluorescent assay, many Pseudomonas putida isolates having a DbtS{sup +} phenotype have been obtained. The ability of the isolates to generate o, o'-biphenol was confirmed with HPLC shortly after the time of isolation. The broad-host-range plasmid, R68.45, was introduced from P. putida PRS 2003 into many soil isolates. The plasmid was able to mobilize the determinants for the DbtS{sup +} phenotype. Accordingly, R68.45 and the determinants of the phenotype could be transferred simultaneously form soil isolates to P. aeruginosa 27853. The DbtS{sup +} phenotype in the isolates and in P. aeruginosa 27853 has proven to be unstable. Whether the instability is genetic, physiological, some combination of these two, or is founded on some other phenomenon is not known. Fresh Gram-positive isolates with the DbtS{sup +} phenotype have been isolated using the sulfur bioavailability assay. The DbtS{sup +} phenotype in these isolates appears to be stable. The product of desulfurization of DBT of dibenzosulfone is monohydroxybiphenyl. The nature of the endproduct has been confirmed by HPLC, colorimetry, GC/mass spectroscopy, and UV absorption. The kinetics of monohydroxybiphenyl production are being studied in batch and continuous culture. Study of the basis of cloning with R68.45 has continued. Data regarding in vivo cloning with R68.45 will be important when the genetic determinants for the DbtS{sup +} phenotype must be moved from one species to another by natural processes'' rather than through methods of genetic engineering. 8 refs., 3 figs.

  12. Molecular cloning and functional characterization of avian interleukin-19

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The present study describes the cloning and functional characterization of avian interleukin (IL)-19, a cytokine that, in mammals, alters the balance of Th1 and Th2 cells in favor of the Th2 phenotype. The full-length avian IL-19 gene, located on chromosome 26, was amplified from LPS-stimulated chi...

  13. Molecular cloning and analysis of functional cDNA and genomic clones encoding bovine cellular retinoic acid-binding protein.

    PubMed Central

    Shubeita, H E; Sambrook, J F; McCormick, A M

    1987-01-01

    A recombinant cDNA clone, pCRABP-HS1, encoding cellular retinoic acid-binding protein was isolated from a bovine adrenal cDNA library. COS-7 cells transfected with pCRABP-HS1 produced a biologically active retinoic acid-binding protein molecule of the expected molecular mass (15.5 kDa). RNA blot hybridization analysis using pCRABP-HS1 as a probe revealed a single 1050-nucleotide mRNA species in bovine adrenal, uterus, and testis, tissues that contain the highest levels of retinoic acid-binding activity. No hybridization was detected in RNA extracted from ovary, spleen, kidney, or liver, which contain relatively low levels of cellular retinoic acid-binding protein activity. Analysis of genomic clones isolated from an EcoRI bovine genomic library demonstrated that the bovine cellular retinoic acid-binding protein gene is composed of four exons and three introns. Two putative promoter sequences were identified in the cloned 5' sequence of the gene. Images PMID:3039499

  14. Molecular cloning and analysis of functional cDNA and genomic clones encoding bovine cellular retinoic acid-binding protein.

    PubMed

    Shubeita, H E; Sambrook, J F; McCormick, A M

    1987-08-01

    A recombinant cDNA clone, pCRABP-HS1, encoding cellular retinoic acid-binding protein was isolated from a bovine adrenal cDNA library. COS-7 cells transfected with pCRABP-HS1 produced a biologically active retinoic acid-binding protein molecule of the expected molecular mass (15.5 kDa). RNA blot hybridization analysis using pCRABP-HS1 as a probe revealed a single 1050-nucleotide mRNA species in bovine adrenal, uterus, and testis, tissues that contain the highest levels of retinoic acid-binding activity. No hybridization was detected in RNA extracted from ovary, spleen, kidney, or liver, which contain relatively low levels of cellular retinoic acid-binding protein activity. Analysis of genomic clones isolated from an EcoRI bovine genomic library demonstrated that the bovine cellular retinoic acid-binding protein gene is composed of four exons and three introns. Two putative promoter sequences were identified in the cloned 5' sequence of the gene.

  15. [Construction of directional T vector for gene cloning and expression].

    PubMed

    Zhong, Xing; Zhai, Chao; Chen, Liang; Yu, Xiaolan; Jiang, Sijing; Yan, Hong; Yang, Dengxiang; Ma, Lixin

    2013-04-01

    Traditional T vector cloning method requires onerous procedures for identifying recombinant, and directional cloning was impossible. In order to overcome these problems, we have devised a directional T vector pETG based on pET-23a(+). For gene cloning, 7 bp partial LacO sequence was introduced into DNA fragment to reconstitute a full length LacO with Bfu I digested T vector. After transformation, blue colonies were selected on LB plate supplemented with X-gal. Restriction enzyme digestion and PCR identification showed that all blue colonies contained the directionally inserted recombinants and the recombinant efficiency was nearly 100%. We have successfully cloned 103 genes from human liver cDNA; in the study complicated procedures for screening of recombinant were not required. Eight pETG clones were picked for protein expression, and all the clones successfully produced corresponding proteins. We demonstrated that the directional T vector was successfully constructed, and it was very suitable for gene cloning and expression.

  16. Molecular cloning and expression analysis of RrNHX1 and RrVHA-c genes related to salt tolerance in wild Rosa rugosa

    PubMed Central

    Feng, Liguo; Ding, Han; Wang, Jia; Wang, Meng; Xia, Wei; Zang, Shu; Sheng, Lixia

    2015-01-01

    Salt stress is one important factor influencing the growth and development of plants, and salt tolerance of plants is a result of combined action of multiple genes and mechanisms. Rosa rugosa is not only an important ornamental plant, but also the natural aromatic plant of high value. Wild R. rugosa which is naturally distributed on the coast and islands of China has a good salt tolerance due to the special living environment. Here, the vacuolar Na+/H+ reverse transporter gene (NHX1) and the vacuolar H+-ATPase subunit C gene (VHA-c) closely related to plant salt tolerance were isolated from wild R. rugosa, and the expression patterns in R. rugosa leaves of the two genes under NaCl stress were determined by real-time quantitative fluorescence PCR. The results showed that the RrNHX1 protein is a constitutive Na+/H+ reverse transporter, the expression of the RrNHX1 gene first increased and then decreased with the increasing salt concentration, and had a time-controlled effect. The RrVHA-c gene is suggestive of the housekeeping feature, its expression pattern showed a similar variation trend with the RrNHX1 gene under the stress of different concentrations of NaCl, and its temporal expression level under 200 mM NaCl stress presented bimodal change. These findings indicated that RrNHX1 and RrVHA-c genes are closely associated with the salt tolerance trait of wild R. rugosa. PMID:26150747

  17. Evolution of the thioester-containing proteins (TEPs) of the arthropoda, revealed by molecular cloning of TEP genes from a spider, Hasarius adansoni.

    PubMed

    Sekiguchi, Reo; Fujito, Naoko T; Nonaka, Masaru

    2012-02-01

    The thioester-containing protein (TEP) family of genes, found in most Eumetazoan genomes, is classified into two subfamilies: the alpha-2-macroglobulin (A2M) subfamily and the C3 subfamily. Many A2M subfamily members, including insect TEP (iTEP), have been reported from the Arthropoda, whereas the C3 subfamily members have been reported only from two horseshoe crab species thus far. To elucidate the evolution of these genes among the Arthropoda, TEP genes were isolated from a spider, Hasarius adansoni (Chelicerata), by reverse transcription polymerase chain reaction (RT-PCR) amplification using universal degenerate primers specific for the thioester region. Four different TEP genes were identified. Phylogenetic analysis using the entire amino acid sequences of these and various other TEP sequences from the Eumetazoa indicated that two of the spider genes are type C3 (HaadC3-1 and HaadC3-2), one is type A2M (HaadA2M) and the other is closely related to iTEP (HaadiTEP). These results suggest that the common ancestor of the Arthropoda possessed at least three TEP genes, C3, A2M and iTEP and that they were lost differentially in the Crustacean and Hexapodan lineages.

  18. Express primer tool for high-throughput gene cloning and expression.

    SciTech Connect

    Yoon, J. R.; Laible, P. D.; Gu, M.; Scott, H. N.; Collart, F. R.; Biosciences Division

    2002-12-01

    High-throughput approaches for gene cloning and expression require the development of new nonstandard tools for molecular biologists and biochemists. We introduce a Web-based tool to design primers specifically for the generation of expression clones for both laboratory-scale and high-throughput projects. The application is designed not only to allow the user complete flexibility to specify primer design parameters but also to minimize the amount of manual intervention needed to generate a large number of primers for the simultaneous amplification of multiple target genes.

  19. Molecular cloning, purification and characterization of Brugia malayi phosphoglycerate kinase.

    PubMed

    Kumar, Ranjeet; Doharey, Pawan Kumar; Saxena, Jitendra Kumar; Rathaur, Sushma

    2017-04-01

    Phosphoglycerate kinase (PGK) is a glycolytic enzyme present in many parasites. It has been reported as a candidate molecule for drug and vaccine developments. In the present study, a full-length cDNA encoding the Brugia malayi 3-phosphoglycerate kinase (BmPGK) with an open reading frame of 1.3 kb was isolated and PCR amplified and cloned. The exact size of the BmPGK's ORF is 1377 bps. The BmPGK gene was subcloned into pET-28a (+) expression vector, the expressed enzyme was purified by affinity column and characterized. The SDS-PAGE analysis revealed native molecular weight of recombinant Brugia malayi 3-phosphoglycerate kinase (rBmPGK) to be ∼45 kDa. The enzyme was found sensitive to temperature and pH, it showed maximum activity at 25 °C and pH 8.5. The Km values for PGA and ATP were 1.77 and 0.967 mM, respectively. The PGK inhibitor, clorsulon and antifilarial drugs albendazole and ivermectin inhibited the enzyme. The specific inhibitor of PGK, clorsulon, competitively inhibited enzyme with Ki value 1.88 μM. Albendazole also inhibited PGK competitively with Ki value 35.39 μM. Further these inhibitory studies were confirmed by docking and molecular simulation of drugs with enzyme. Clorsulon interacted with substrate binding site with glutamine 37 as well as in hinge regions with aspartic acid 385 and valine 387 at ADP binding site. On the other hand albendazole interacted with asparagine 335 residues. These effects were in good association with binding interactions. Thus current study might help in designing and synthesis of effective inhibitors for this novel drug target and understanding their mode of interaction with the potent anthelmintic drugs.

  20. Molecular cloning and characterization of KIFC1-like kinesin gene (es-KIFC1) in the testis of the Chinese mitten crab Eriocheir sinensis.

    PubMed

    Wang, Da-Hui; Yang, Wan-Xi

    2010-10-01

    KIFC1 is essential for acrosome biogenesis and nuclear reshaping during the spermiogenesis of mammals. To explore its functions during the same process in the Chinese mitten crab Eriocheir sinensis, we have cloned and sequenced the cDNA of a mammalian KIFC1 homologue (termed es-KIFC1) from the total RNA of the testis. The 2340bp es-KIFC1 cDNA contained a 102bp 5' untranslated region, a 117bp 3' untranslated region and a 2121bp open reading frame. The putative es-KIFC1 protein owns the divergent tail domain, stalk domain and conserved carboxyl motor domain. Protein alignment demonstrated that es-KIFC1 had 36.9%, 37.3%, 36.6%, 37.6%, and 37.5% identity with its homologues in chicken, human, mouse, zebrafish and African clawed frog, respectively. The phylogenetic tree revealed that es-KIFC1 is more related to vertebrate KIFC1 than invertebrate (NCD). Tissue expression analysis showed the presence of es-KIFC1 in the testis, hepatopancreas, gill, muscle and heart. In situ hybridization showed that the es-KIFC1 mRNA was localized in the proacrosomal vesicle and the periphery of the nuclear membrane in early and middle spermatids. In late spermatids and spermatozoa, es-KIFC1 was expressed in the acrosomal tubule and the band between the acrosome and the nucleus. Therefore, es-KIFC1 probably performs critical functions in the spermiogenesis of E.sinensis.

  1. Molecular cloning and characterization of amh and dax1 genes and their expression during sex inversion in rice-field eel Monopterus albus

    PubMed Central

    Hu, Qing; Guo, Wei; Gao, Yu; Tang, Rong; Li, Dapeng

    2015-01-01

    The full-length cDNAs of amh and dax1 in the hermaphrodite, rice-field eel (Monopterus albus), were cloned and characterized in this study. Multiple sequence alignment revealed Dax1 was well conserved among vertebrates, whereas Amh had a low degree of similarity between different vertebrates. Their expression profiles in gonads during the course of sex inversion and tissues were investigated. The tissue distribution indicated amh was expressed mostly in gonads and was scarcely detectable in other tissues, whereas the expression of dax1 was widespread among the different tissues, especially liver and gonads. amh was scarcely detectable in ovaries whereas it was abundantly expressed in both ovotestis and testis. By contrast, dax1 was highly expressed in ovaries, especially in ♀IV (ovaries in IV stage), but it was decreased significantly in ♀/♂I (ovotestis in I stage). Its expression was increased again in ♀/♂III (ovotestis in III stage), and then decreased to a low level in testis. These significant different expression patterns of amh and dax1 suggest the increase of amh expression and the decline of dax1 expression are important for the activation of testis development, and the high level of amh and a low level of dax1 expression are necessary for maintenance of testis function. PMID:26578091

  2. Molecular cloning, characterization and expression analysis of TLR9, MyD88 and TRAF6 genes in common carp (Cyprinus carpio)

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Induction of innate immune pathways is critical for early host defense but there is limited understanding of how teleost fish recognize pathogen molecules and activate these pathways. In mammals, cells of the innate immune system detect pathogenic molecular structures using pattern recognition rece...

  3. Molecular cloning and sequence analysis of the Sta58 major antigen gene of Rickettsia tsutsugamushi: sequence homology and antigenic comparison of Sta58 to the 60-kilodalton family of stress proteins.

    PubMed Central

    Stover, C K; Marana, D P; Dasch, G A; Oaks, E V

    1990-01-01

    The scrub typhus 58-kilodalton (kDa) antigen (Sta58) of Rickettsia tsutsugamushi is a major protein antigen often recognized by humans infected with scrub typhus rickettsiae. A 2.9-kilobase HindIII fragment containing a complete sta58 gene was cloned in Escherichia coli and found to express the entire Sta58 antigen and a smaller protein with an apparent molecular mass of 11 kDa (Stp11). DNA sequence analysis of the 2.9-kilobase HindIII fragment revealed two adjacent open reading frames encoding proteins of 11 (Stp11) and 60 (Sta58) kDa. Comparisons of deduced amino acid sequences disclosed a high degree of homology between the R. tsutsugamushi proteins Stp11 and Sta58 and the E. coli proteins GroES and GroEL, respectively, and the family of primordial heat shock proteins designated Hsp10 Hsp60. Although the sequence homology between the Sta58 antigen and the Hsp60 protein family is striking, the Sta58 protein appeared to be antigenically distinct among a sample of other bacterial Hsp60 homologs, including the typhus group of rickettsiae. The antigenic uniqueness of the Sta58 antigen indicates that this protein may be a potentially protective antigen and a useful diagnostic reagent for scrub typhus fever. Images PMID:2108930

  4. Map-Based Cloning of Genes Important for Maize Anther Development

    NASA Astrophysics Data System (ADS)

    Anaya, Y.; Walbot, V.; Nan, G.

    2012-12-01

    Map-Based cloning for maize mutant MS13 . Scientists still do not understand what decides the fate of a cell in plants. Many maize genes are important for anther development and when they are disrupted, the anthers do not shed pollen, i.e. male sterile. Since the maize genome has been fully sequenced, we conduct map-based cloning using a bulk segregant analysis strategy. Using PCR (polymerase chain reaction), we look for biomarkers that are linked to our gene of interest, Male Sterile 13 (MS13). Recombinations occur more often if the biomarkers are further away from the gene, therefore we can estimate where the gene is and design more PCR primers to get closer to our gene. Genetic and molecular analysis will help distinguish the role of key genes in setting cell fates before meiosis and for being in charge of the switch from mitosis to meiosis.

  5. Elevating crop disease resistance with cloned genes

    PubMed Central

    Jones, Jonathan D. G.; Witek, Kamil; Verweij, Walter; Jupe, Florian; Cooke, David; Dorling, Stephen; Tomlinson, Laurence; Smoker, Matthew; Perkins, Sara; Foster, Simon

    2014-01-01

    Essentially all plant species exhibit heritable genetic variation for resistance to a variety of plant diseases caused by fungi, bacteria, oomycetes or viruses. Disease losses in crop monocultures are already significant, and would be greater but for applications of disease-controlling agrichemicals. For sustainable intensification of crop production, we argue that disease control should as far as possible be achieved using genetics rather than using costly recurrent chemical sprays. The latter imply CO2 emissions from diesel fuel and potential soil compaction from tractor journeys. Great progress has been made in the past 25 years in our understanding of the molecular basis of plant disease resistance mechanisms, and of how pathogens circumvent them. These insights can inform more sophisticated approaches to elevating disease resistance in crops that help us tip the evolutionary balance in favour of the crop and away from the pathogen. We illustrate this theme with an account of a genetically modified (GM) blight-resistant potato trial in Norwich, using the Rpi-vnt1.1 gene isolated from a wild relative of potato, Solanum venturii, and introduced by GM methods into the potato variety Desiree. PMID:24535396

  6. Molecular cloning of ID4, a novel dominant negative helix-loop-helix human gene on chromosome 6p21.3-p22

    SciTech Connect

    Pagliuca, A.; Bartoli, P.C.; Saccone, S.

    1995-05-01

    Transcription factors containing a basic helix-loop-helix (bHLH) motif regulate the expression of tissue-specific genes in a number of mammalian and insect systems. DNA-binding activity of the bHLH proteins is dependent upon formation of homo- and/or heterodimers. Dominant negative HLH proteins (Id-related genes) also contain the HLH-dimerization domain but lack the DNA-binding basic domain. Consequently, Id proteins inhibit binding to DNA and transcriptional transactivation by heterodimerization with bHLH proteins. The authors report here the cDNA sequence of a novel human HLH gene (HGMW-approved symbol ID4) that lacks the basic domain. ID4 is differentially expressed in adult organs in four mRNA molecules, which are presumably a result of differential splicing and/or alternative usage of the polyadenylation sites. Transfection experiments indicated that enforced expression of Id-4H protein inhibits the trans-activation of the muscle creatine kinase E-box enhancer by MyoD. Finally, the authors localized the ID4 gene to the chromosome 6p21-p22 region. 18 refs., 4 figs.

  7. Recombinant baculovirus as a highly potent vector for gene therapy of human colorectal carcinoma: molecular cloning, expression, and in vitro characterization.

    PubMed

    Paul, Arghya; Jardin, Barbara A; Kulamarva, Arun; Malhotra, Meenakshi; Elias, Cynthia B; Prakash, Satya

    2010-06-01

    Present therapeutic strategies for most cancers are restricted mainly to the primary tumors and are also not very effective in controlling metastatic states. Alternatively, gene therapy can be a potential option for treating such cancers. Currently mammalian viral-based cancer gene therapy is the most popular approach, but the efficacy has been shown to be quite low in clinical trials. In this study, for the first time, the insect cell-specific baculovirus Autographa californica multiple nucleopolyhedrovirus (AcMNPV) has been evaluated as a vector for gene delivery to colorectal cancer cells. Experiments involving factorial design were employed to study the individual and combined effects of different parameters such as multiplicity of infection (MOI), viral incubation time and epigenetic factors on transduction efficiency. The results demonstrate that baculovirus gene delivery system holds immense potential for development of a new generation of highly effective virotherapy for colorectal, as well as other major carcinomas (breast, pancreas, and brain), and offers significant benefits to traditional animal virus-based vectors with respect to safety concerns.

  8. Molecular cloning of a novel human gene encoding a 63-kDa protein and its sublocalization within the 11q13 locus

    SciTech Connect

    Perelman, B.; Dafni, N.; Naiman, T.

    1997-05-01

    A human cDNA previously isolated by virtue of its ability to complement partially the ultraviolet sensitivity of a xeroderma pigmentosum cell line was further characterized. The transcription unit is expressed as a single 4.0-kb mRNA that encodes a novel 63-kDa cytoplasmic protein, possibly initiating from an internal AUG codon. The gene encoding this protein, named UVRAG, has been extremely well conserved during evolution, implying an important role for this gene product in cell metabolism. The transcribed mRNA is constitutively expressed in a wide variety of human tissues. The protein encoded by this gene is predicted to contain a coiled-coil structure and is likely to be metabolically unstable based on the occurrence of a strong PEST domain. UVRAG was assigned to human chromosome 11 by Southern hybridization to a somatic cell hybrid panel. Fluorescence in situ hybridization coupled with PCR analysis of human/rodent somatic cell hybrids containing segments of human chromosome 11 has localized this gene to a subregion of 11q13 in between the D11S916 and the D11S906 loci. Importantly, this region has been shown to be amplified in a variety of human malignancies, including breast cancer. 28 refs., 7 figs.

  9. Molecular cloning and characterization of a salinity stress-induced gene encoding DEAD-box helicase from the halophyte Apocynum venetum.

    PubMed

    Liu, H H; Liu, J; Fan, S L; Song, M Z; Han, X L; Liu, F; Shen, F F

    2008-01-01

    The genes encoding DEAD-box helicases play a key role in various abiotic stresses, including temperature, light, oxygen, and salt stress. A salt-responsive gene, designated AvDH1, was isolated from the halophyte dogbane (Apocynum venetum) by using suppression subtractive hybridization and RACE (rapid amplification of cDNA ends) PCR. The deduced amino acid sequence has nine conserved helicase motifs of the DEAD-box protein family. The AvDH1 gene is present as a single copy in the dogbane genome. This gene is expressed in response to NaCl and not polyethlene glycol (PEG) nor abscisic acid, and its expression increases with time. The transcription of AvDH1 is also induced by low temperature (4 degrees C), but its accumulation first increases then decreases with time. The purified recombinant protein contains ATP-dependent DNA helicase activity, ATP-independent RNA helicase activity, and DNA- or RNA-dependent ATPase activity. The ATPase activity of AvDH1 is stimulated more by single-stranded DNA than by double-stranded DNA or RNA. These results suggested that AvDH1 belonging to the DEAD-box helicase family is induced by salinity, functions as a typical helicase to unwind DNA and RNA, and may play an important role in salinity tolerance.

  10. Molecular Cloning and Functional Analysis of Gene Clusters for the Biosynthesis of Indole-Diterpenes in Penicillium crustosum and P. janthinellum

    PubMed Central

    Nicholson, Matthew J.; Eaton, Carla J.; Stärkel, Cornelia; Tapper, Brian A.; Cox, Murray P.; Scott, Barry

    2015-01-01

    The penitremane and janthitremane families of indole-diterpenes are abundant natural products synthesized by Penicillium crustosum and P. janthinellum. Using a combination of PCR, cosmid library screening, and Illumina sequencing we have identified gene clusters encoding enzymes for the synthesis of these compounds. Targeted deletion of penP in P. crustosum abolished the synthesis of penitrems A, B, D, E, and F, and led to accumulation of paspaline, a key intermediate for paxilline biosynthesis in P. paxilli. Similarly, deletion of janP and janD in P. janthinellum abolished the synthesis of prenyl-elaborated indole-diterpenes, and led to accumulation in the latter of 13-desoxypaxilline, a key intermediate for the synthesis of the structurally related aflatremanes synthesized by Aspergillus flavus. This study helps resolve the genetic basis for the complexity of indole-diterpene natural products found within the Penicillium and Aspergillus species. All indole-diterpene gene clusters identified to date have a core set of genes for the synthesis of paspaline and a suite of genes encoding multi-functional cytochrome P450 monooxygenases, FAD dependent monooxygenases, and prenyl transferases that catalyse various regio- and stereo- specific oxidations that give rise to the diversity of indole-diterpene products synthesized by this group of fungi. PMID:26213965

  11. Molecular cloning and expression of PoIR2, a novel gene involved in immune response in Japanese flounder ( Paralichthys olivaceus)

    NASA Astrophysics Data System (ADS)

    Li, Shuo; Li, Chunmei; Wang, Xubo; Wang, Yanan; Liu, Zhipeng; Zhai, Teng; Zhang, Quanqi

    2010-03-01

    A novel immune-related gene was expressed in Japanese flounder ( Paralichthys olivaceus) injected with Vibrio anguillarum. The complete cDNA contained a 169 bp 5’UTR, a 336 bp open reading frame (ORF) encoding 111 amino acids and a 556bp 3’UTR. Six exons and five introns were identified in the PoIR2 gene. Blastp similarity comparison showed its encoding protein had 50% similarity to Danio rerio neuromedin S (NMS), but further alignment indicated they did not have NMS C-terminal conservational signature domain. So it was not defined as an NMS homologue. Protein structure analysis indicated it had a 26aa signal peptide and was a secretory pathway protein. RT-PCR demonstrated that the expression of PoIR2 was quickly induced and drastically increased in liver, kidney, spleen, gills, intestine, heart, and skeletal muscle after infected with V. anguillarum. These results indicated that the PoIR2 might play some important role in Japanese flounder immune response system. This gene was named PoIR2 ( P.olivaceus immune-related gene 2, GenBank accession number: EU224372). The mature PoIR2 peptide was expressed in BL21(DE3) pLysS using pET-32a(+) vector and a great part of the recombinant mature peptide existed as soluble type.

  12. Molecular cloning, expression of a big defensin gene from bay scallop Argopecten irradians and the antimicrobial activity of its recombinant protein.

    PubMed

    Zhao, Jianmin; Song, Linsheng; Li, Chenghua; Ni, Duojiao; Wu, Longtao; Zhu, Ling; Wang, Hao; Xu, Wei

    2007-01-01

    Antimicrobial peptides are important components of the host innate immune responses by exerting broad-spectrum microbicidal activity against pathogenic microbes. The first mollusk big defensin (designated AiBD) cDNA was cloned from bay scallop Argopecten irradians by expressed sequence tag (EST) and rapid amplification of cDNA ends (RACE) techniques. The scallop AiBD consisted of 531 nucleotides with a canonical polyadenylation signal sequence AATAAA and a poly(A) tail, encoding a polypeptide of 122 amino acids. The high similarity of AiBD deduced amino acid sequence with big defensin from Tachypleus tridentatus and Branchiostoma belcheri tsingtaunese indicated that AiBD should be a member of big defensin family. The expression of AiBD in various tissues was measured by using Northern blotting analysis. mRNA transcripts of AiBD could be detected in haemocytes of unchallenged scallops. The temporal expression of AiBD in haemolymph after Vibrio anguilarum challenge was recorded by quantitative real time PCR. The relative expression level of AiBD in haemolymph was up-regulated evenly in the first 8 h, followed by a drastic increase, and increased 131.1-fold at 32 h post-injection. These results indicated that AiBD could be induced by bacterial challenge, and it should participate in the immune responses of A. irradians. Biological activity assay revealed that recombinant AiBD could inhibit the growth of both Gram-positive and Gram-negative bacteria, and also showed strong fungicidal activity towards the expression host. Recombinant expression of AiBD made it possible to further characterize its functions involved in immune responses, and also provided a potential therapeutic agent for disease control in aquaculture.

  13. Molecular cloning, characterization and expression analysis of Toll-like receptor 5M gene in Japanese sea perch (Lateolabrax japonicas) after bacterial infection.

    PubMed

    Wang, Chengyang; Zhao, Chao; Fu, Mingjun; Bao, Weiyang; Qiu, Lihua

    2016-09-01

    Toll-like receptor 5M belongs to Toll-like receptors (TLRs) family, which plays a crucial role in innate immunity due to its important role in the recognition of bacteria invasion and in the activation of immune related pathways downstream. In the present study, we firstly cloned the full-length cDNAs of TLR 5M (LjTLR 5M) from Japanese sea perch (Lateolabrax japonicas). The full-length cDNAs of LjTLR 5M include an open reading frame (ORF) of 2676 bp encoding a polypeptide of 891 amino acid residues. The deduced amino acid sequence analysis showed that LiTLR 5M contains LRRs (extracellular leucine rich repeats), transmembrane and TIR (Toll/interleukin-1 receptor) domain. Transcriptional expression analysis indicated that LiTLR 5M mRNAs were ubiquitously expressed in wide array of tissues and the peak level was observed in the head-kidney. The expression patterns of LjTLR 5M after Vibro harveyi and Streptococus agalactiae infection were detected by qRT-PCR, and the results showed that LjTLR 5M was significant up-regulated in spleen, liver and head-kidney. Additionally, the expression patterns of LjTLR 5M in infected spleen and head-kidney were further validated by in situ hybridization (ISH). In summary, these findings indicate that LjTLR 5M is significant induced after different bacterial infection and is involved in immune response. Furthermore, this study will provide foundational information for other TLRs research of L. japonicas against different bacterial pathogens invasion.

  14. Molecular cloning and characterization of the genes encoding an auxin efflux carrier and the auxin influx carriers associated with the adventitious root formation in mango (Mangifera indica L.) cotyledon segments.

    PubMed

    Li, Yun-He; Zou, Ming-Hong; Feng, Bi-Hong; Huang, Xia; Zhang, Zhi; Sun, Guang-Ming

    2012-06-01

    Polar auxin transport (PAT) plays an important role in the adventitious root formation of mango cotyledon segments, but the molecular mechanism remains unclear. In this study, we cloned a gene encoding an auxin efflux carrier (designated as MiPIN1), and we cloned four genes encoding auxin influx carriers (designated as MiAUX1, MiAUX2, MiAUX3 and MiAUX4). The results of a phylogenetic tree analysis indicated that MiPIN1 and the MiAUXs belong to plant PIN and AUXs/LAXs groups. Quantitative real-time PCR indicated that the expression of MiPIN1 and the MiAUXs was lowest at 0 days but sharply increased on and after day 4. During the root formation in the mango cotyledon segments, the MiPIN1 expression in the distal cut surface (DCS) was always higher than the expression in the proximal cut surface (PCS) whereas the expression of the MiAUXs in the PCS was usually higher than in the DCS. This expression pattern might be result in the PAT from the DCS to the PCS, which is essential for the adventitious root formation in the PCS. Our previous study indicated that a pre-treatment of embryos with indole-3-butyric acid (IBA) significantly promoted adventitious rooting in PCS whereas a pre-treatment with 2,3,5-triiodobenzoic acid (TIBA) completely inhibited this rooting. In this study, however, IBA and TIBA pre-treatments slightly changed the expression of MiPIN1. In contrast, while the MiAUX3 and MiAUX4 expression levels were significantly up-regulated by the IBA pre-treatment, the expression levels were down-regulated by the TIBA pre-treatment. These findings imply that MiAUX3 and MiAUX4 are more sensitive to the IBA and TIBA treatments and that they might play important roles during adventitious root formation in mango cotyledon segments.

  15. Molecular cloning and sequence analysis of the gene coding for the 57kDa soluble antigen of the salmonid fish pathogen Renibacterium salmoninarum

    USGS Publications Warehouse

    Chien, Maw-Sheng; Gilbert , Teresa L.; Huang, Chienjin; Landolt, Marsha L.; O'Hara, Patrick J.; Winton, James R.

    1992-01-01

    The complete sequence coding for the 57-kDa major soluble antigen of the salmonid fish pathogen, Renibacterium salmoninarum, was determined. The gene contained an opening reading frame of 1671 nucleotides coding for a protein of 557 amino acids with a calculated Mr value of 57190. The first 26 amino acids constituted a signal peptide. The deduced sequence for amino acid residues 27–61 was in agreement with the 35 N-terminal amino acid residues determined by microsequencing, suggesting the protein in synthesized as a 557-amino acid precursor and processed to produce a mature protein of Mr 54505. Two regions of the protein contained imperfect direct repeats. The first region contained two copies of an 81-residue repeat, the second contained five copies of an unrelated 25-residue repeat. Also, a perfect inverted repeat (including three in-frame UAA stop codons) was observed at the carboxyl-terminus of the gene.

  16. Growth regulation, imprinting, and epigenetic transcription-related gene expression differs in lung of deceased transgenic cloned and normal goats.

    PubMed

    Meng, Li; Jia, Ruo-Xin; Sun, Yan-Yan; Wang, Zi-Yu; Wan, Yong-Jie; Zhang, Yan-Li; Zhong, Bu-Shuai; Wang, Feng

    2014-02-01

    Somatic cell nuclear transfer (SCNT) is a promising technique to produce mammalian transgenic clones. Only a small proportion of manipulated embryos, however, can develop into viable offspring. The abnormal growth and development of cloned animals, furthermore, are accompanied by aberrant lung development. Our objective was to investigate molecular background of lung developmental problems in transgenic (random insertion of exogenous DNA) cloned goats. We examined expression of 15 genes involved in growth regulation, imprinting, and epigenetic transcription in lung tissue of deceased transgenic cloned and normal goats of various ages. Compared with normal goats of the same age from conventional reproduction, expression of 13 genes (BMP4, FGF10, GHR, HGFR, PDGFR, RABP, VEGF, H19, CDKNIC, PCAF, MeCP2, HDAC1, and Dnmt3b) decreased in transgenic cloned goats that died at or shortly after birth; Expression of eight genes (FGF10, PDGFR, RABP, VEGF, PCAF, HDAC1, MeCP2, and Dnmt3b) decreased in fetal death of transgenic cloned goats. Expression of two epigenetic transcription genes (PCAF and Dnmt3b) decreased in disease death of transgenic cloned goats (1-4 months old). Disruptions in gene expression might be associated with the high neonatal mortality in transgenic cloned animals. These findings have implications in understanding the low efficiency of transgenic cloning.

  17. Molecular cloning of the tomato Hairless gene implicates actin dynamics in trichome-mediated defense and mechanical properties of stem tissue

    PubMed Central

    Kang, Jin-Ho; Campos, Marcelo L.; Zemelis-Durfee, Starla; Al-Haddad, Jameel M.; Jones, A. Daniel; Telewski, Frank W.; Brandizzi, Federica; Howe, Gregg A.

    2016-01-01

    Trichomes are epidermal structures that provide a first line of defense against arthropod herbivores. The recessive hairless (hl) mutation in tomato (Solanum lycopersicum L.) causes severe distortion of trichomes on all aerial tissues, impairs the accumulation of sesquiterpene and polyphenolic compounds in glandular trichomes, and compromises resistance to the specialist herbivore Manduca sexta. Here, we demonstrate that the tomato Hl gene encodes a subunit (SRA1) of the highly conserved WAVE regulatory complex that controls nucleation of actin filaments in a wide range of eukaryotic cells. The tomato SRA1 gene spans a 42-kb region containing both Solyc11g013280 and Solyc11g013290. The hl mutation corresponds to a complex 3-kb deletion that removes the last exon of the gene. Expression of a wild-type SRA1 cDNA in the hl mutant background restored normal trichome development, accumulation of glandular trichome-derived metabolites, and resistance to insect herbivory. These findings establish a role for SRA1 in the development of tomato trichomes and also implicate the actin-cytoskeleton network in cytosolic control of specialized metabolism for plant defense. We also show that the brittleness of hl mutant stems is associated with altered mechanical and cell morphological properties of stem tissue, and demonstrate that this defect is directly linked to the mutation in SRA1. PMID:27481446

  18. Molecular cloning of the tomato Hairless gene implicates actin dynamics in trichome-mediated defense and mechanical properties of stem tissue.

    PubMed

    Kang, Jin-Ho; Campos, Marcelo L; Zemelis-Durfee, Starla; Al-Haddad, Jameel M; Jones, A Daniel; Telewski, Frank W; Brandizzi, Federica; Howe, Gregg A

    2016-10-01

    Trichomes are epidermal structures that provide a first line of defense against arthropod herbivores. The recessive hairless (hl) mutation in tomato (Solanum lycopersicum L.) causes severe distortion of trichomes on all aerial tissues, impairs the accumulation of sesquiterpene and polyphenolic compounds in glandular trichomes, and compromises resistance to the specialist herbivore Manduca sexta Here, we demonstrate that the tomato Hl gene encodes a subunit (SRA1) of the highly conserved WAVE regulatory complex that controls nucleation of actin filaments in a wide range of eukaryotic cells. The tomato SRA1 gene spans a 42-kb region containing both Solyc11g013280 and Solyc11g013290 The hl mutation corresponds to a complex 3-kb deletion that removes the last exon of the gene. Expression of a wild-type SRA1 cDNA in the hl mutant background restored normal trichome development, accumulation of glandular trichome-derived metabolites, and resistance to insect herbivory. These findings establish a role for SRA1 in the development of tomato trichomes and also implicate the actin-cytoskeleton network in cytosolic control of specialized metabolism for plant defense. We also show that the brittleness of hl mutant stems is associated with altered mechanical and cell morphological properties of stem tissue, and demonstrate that this defect is directly linked to the mutation in SRA1.

  19. Molecular cloning and characterization of GhAPm, a gene encoding the μ subunit of the clathrin-associated adaptor protein complex that is associated with cotton (Gossypium hirsutum) fiber development.

    PubMed

    Zhou, Tao; Zhang, Rui; Yang, Dawei; Guo, Sandui

    2011-06-01

    The clathrin-associated adaptor protein (AP) complexes are the primary clathrin adaptors that contribute to the formation of clathrin-coated vesicles (CCVs). The GhAPm gene (GenBank accession number: GU359054), which encodes the medium subunit of the AP complexes, was cloned from cotton by rapid amplification of cDNA ends-polymerase chain reaction (RACE-PCR). The full-length cDNA was 1590 bp in size and encoded an open reading frame (ORF) of 416 amino acids with a molecular weight of 46 kDa. The GhAPm protein shared 81-85% identity at the amino acid level with the AP complex μ subunits isolated from Vitis vinifera, Glycine max, Populus trichocarpa, Ricinus communis and Arabidopsis thaliana, respectively. The corresponding genomic DNA, containing eight exons and seven introns, was isolated and analyzed. Also, a 5'-flanking region was analyzed, and a group of putative cis-acting elements were identified. DNA gel blot analysis showed that there is only one GhAPm gene in the cotton genome. Real-time RT-PCR analysis revealed that GhAPm is expressed in the root, stem, leaf, petal, ovule, and fiber. However, the interesting finding is that GhAPm expression level was shown to increase steadily as the cotton fiber develops. In 30 DPA fibers, expression increases sharply and arrives at a peak then the expression levels decrease rapidly. Based on these data, we propose that GhAPm has a critical role in cotton membrane trafficking and fiber development.

  20. Cloning and characterisation of JAZ gene family in Hevea brasiliensis.

    PubMed

    Hong, H; Xiao, H; Yuan, H; Zhai, J; Huang, X

    2015-05-01

    Mechanical wounding or treatment with exogenous jasmonates (JA) induces differentiation of the laticifer in Hevea brasiliensis. JA is a key signal for latex biosynthesis and wounding response in the rubber tree. Identification of JAZ (jasmonate ZIM-domain) family of proteins that repress JA responses has facilitated rapid progress in understanding how this lipid-derived hormone controls gene expression and related physiological processes in plants. In this work, the full-length cDNAs of six JAZ genes were cloned from H. brasiliensis (termed HbJAZ). These HbJAZ have different lengths and sequence diversity, but all of them contain Jas and ZIM domains, and two of them contain an ERF-associated amphiphilic repression (EAR) motif in the N-terminal. Real-time RT-PCR analyses revealed that HbJAZ have different expression patterns and tissue specificity. Four HbJAZ were up-regulated, one was down-regulated, while two were less effected by rubber tapping treatment, suggesting that they might play distinct roles in the wounding response. A yeast two-hybrid assay revealed that HbJAZ proteins interact with each other to form homologous or heterogeneous dimer complexes, indicating that the HbJAZ proteins may expand their function through diverse JAZ-JAZ interactions. This work lays a foundation for identification of the JA signalling pathway and molecular mechanisms of latex biosynthesis in rubber trees.

  1. Cloning and molecular characterization of an ethylene receptor gene, MiERS1, expressed during mango fruitlet abscission and fruit ripening.

    PubMed

    Ish-Shalom, Mazal; Dahan, Yardena; Maayan, Inbar; Irihimovitch, Vered

    2011-08-01

    We isolated and characterized a mango (Mangifera indica L.) cDNA homolog of the ethylene receptor gene ERS1, designated MiERS1. Genomic Southern blot analysis suggested the existence of a second gene with homology to MiERS1. Spatial and temporal expression patterns of MiERS1 were first studied during fruitlet drop and compared with those of a previously identified MiETR1 gene that encodes an ETR1-type ethylene receptor. Experiments were conducted on developing fruitlet explants in which fruitlet abscission was induced by ethephon treatment. Northern analysis revealed a notable increase in MiERS1 mRNA levels in the fruitlet's activated abscission zone within 24 h of ethephon application, followed by a decreasing pattern 48 h post-treatment. A transient, albeit lesser, increase in MiERS1 mRNA levels was also observed in treated fruitlet seed and mesocarp tissues. In contrast, in the abscission zone, accumulation of MiETR1 transcript remained unchanged; a temporal increase in MiETR1 transcript level was observed in the fruitlet mesocarp, whereas in the seed, MiETR1 expression had already dropped by 24 h. Expression profiles of MiERS1 and MiETR1 were then studied during fruit ripening. In agreement with a previous study and coinciding with the climacteric rise in ethylene production, RNA blot analysis revealed that during fruit ripening, MiETR1 mRNA level increases in both mesocarp and seed tissues. Unexpectedly, however, in those same tissues, MiERS1 transcript accumulation was barely detected. Collectively, our data highlight MiERS1's possible specific function in regulating fruitlet abscission rather than fruit ripening.

  2. Molecular cloning and biological characterization of full-length HIV-1 subtype C from Botswana.

    PubMed

    Ndung'u, T; Renjifo, B; Novitsky, V A; McLane, M F; Gaolekwe, S; Essex, M

    2000-12-20

    Human immunodeficiency virus type 1 (HIV-1) subtype C is now responsible for more than half of all HIV-1 infections in the global epidemic and for the high levels of HIV-1 prevalence in southern Africa. To facilitate studies of the biological nature and the underlying molecular determinants of this virus, we constructed eight full-length proviral clones from two asymptomatic and three AIDS patients infected with HIV-1 subtype C from Botswana. Analysis of viral lysates showed that Gag, Pol, and Env structural proteins were present in the virions. In four clones, the analysis suggested inefficient envelope glycoprotein processing. Nucleotide sequence analysis of the eight clones did not reveal frameshifts, deletions, premature truncations, or translational stop codons in any structural, regulatory, or accessory genes. None of the subtype C clones were replication competent in donor peripheral blood mononuclear cells (PBMCs), macrophages, Jurkat(tat) cells, or U87. CD4.CCR5 cells. However, infection by two clones could be rescued by complementation with a functional subtype C envelope clone, resulting in a productive infection of PBMCs, macrophages, and U87. CD4.CCR5 cells.

  3. Molecular cloning and characterization of UDP-glucose: furaneol glucosyltransferase gene from grapevine cultivar Muscat Bailey A (Vitis labrusca × V. vinifera).

    PubMed

    Sasaki, Kanako; Takase, Hideki; Kobayashi, Hironori; Matsuo, Hironori; Takata, Ryoji

    2015-10-01

    2,5-Dimethyl-4-hydroxy-3(2H)-furanone (furaneol) is an important aroma compound in fruits, such as pineapple and strawberry, and is reported to contribute to the strawberry-like note in some wines. Several grapevine species are used in winemaking, and furaneol is one of the characteristic aroma compounds in wines made from American grape (Vitis labrusca) and its hybrid grape. Furaneol glucoside was recently isolated as an important furaneol derivative from the hybrid grapevine cultivar, Muscat Bailey A (V. labrusca × V. vinifera), and this was followed by its isolation from some fruits such as strawberry and tomato. Furaneol glucoside is a significant 'aroma precursor of wine' because furaneol is liberated from it during alcoholic fermentation. In this study, a glucosyltransferase gene from Muscat Bailey A (UGT85K14), which is responsible for the glucosylation of furaneol was identified. UGT85K14 was expressed in the representative grape cultivars regardless of species, indicating that furaneol glucoside content is regulated by the biosynthesis of furaneol. On the other hand, furaneol glucoside content in Muscat Bailey A berry during maturation might be controlled by the expression of UGT85K14 along with the biosynthesis of furaneol. Recombinant UGT85K14 expressed in Escherichia coli is able to transfer a glucose moiety from UDP-glucose to the hydroxy group of furaneol, indicating that this gene might be UDP-glucose: furaneol glucosyltransferase in Muscat Bailey A.

  4. Molecular cloning and characterization of an F-box family gene CarF-box1 from chickpea (Cicer arietinum L.).

    PubMed

    Jia, Yuying; Gu, Hanyan; Wang, Xiansheng; Chen, Quanjia; Shi, Shubing; Zhang, Jusong; Ma, Lin; Zhang, Hua; Ma, Hao

    2012-03-01

    F-box protein family has been found to play important roles in plant development and abiotic stress responses via the ubiquitin pathway. In this study, an F-box gene CarF-box1 (for Cicer arietinum F-box gene 1, Genbank accession no. GU247510) was isolated based on a cDNA library constructed with chickpea seedling leaves treated by polyethylene glycol. CarF-box1 encoded a putative protein with 345 amino acids and contained no intron within genomic DNA sequence. CarF-box1 is a KFB-type F-box protein, having a conserved F-box domain in the N-terminus and a Kelch repeat domain in the C-terminus. CarF-box1 was localized in the nucleus. CarF-box1 exhibited organ-specific expression and showed different expression patterns during seed development and germination processes, especially strongly expressed in the blooming flowers. In the leaves, CarF-box1 could be significantly induced by drought stress and slightly induced by IAA treatment, while in the roots, CarF-box1 could be strongly induced by drought, salinity and methyl jasmonate stresses. Our results suggest that CarF-box1 encodes an F-box protein and may be involved in various plant developmental processes and abiotic stress responses.

  5. Molecular cloning and characterization of unfolded protein response genes from large yellow croaker (Larimichthys crocea) and their expression in response to dietary fatty acids.

    PubMed

    Liao, Kai; Yan, Jing; Li, Songlin; Wang, Tianjiao; Xu, Wei; Mai, Kangsen; Ai, Qinghui

    2017-01-01

    The unfolded protein response (UPR) is a mechanism to cope with perturbed endoplasmic reticulum (ER) functions or accumulation of unfolded protein in the ER in eukaryotic cells. Furthermore, the UPR also participates in a number of physiological and pathological processes, such as nutrient sensing, lipid synthesis, and inflammatory response. In this study, four UPR-related genes (GRP78/BiP, ATF6α, XBP1 and CHO) were isolated characterized from large yellow croaker (Larimichthys crocea), and their expression in response to dietary lipid sources (various fatty acids) such as fish oil (FO), palmic acid (PA), olive oil (OO), sunflower oil (SO), and perilla oil (PO), were examined following feeding. The results showed that the four UPR-related proteins contained highly conserved functional domains and had the closest phylogenetic relationships with other fishes. Additionally, these genes were ubiquitously expressed in large yellow croaker, as in zebrafish and medaka. Moreover, GRP78, ATF6α and spliced XBP1 (XBP1s) mRNA levels in the liver, not in adipose tissue, were significantly increased in the SO group compared to the other groups (P<0.05). These results indicated that dietary SO activated UPR, and the activation of UPR might provide a mechanism to improve ER function, but probably stimulated lipid synthesis and caused inflammatory response in the liver of large yellow croaker.

  6. Molecular cloning and characterization of two novel autophagy-related genes belonging to the ATG8 family from the cattle tick Rhipicephalus (Boophilus) microplus (Acari: Ixodidae).

    PubMed

    Flores Fernández, José Miguel; Gutiérrez Ortega, Abel; Rosario Cruz, Rodrigo; Padilla Camberos, Eduardo; Alvarez, Angel H; Martínez Velázquez, Moisés

    2014-12-01

    Rhipicephalus (Boophilus) microplus is an obligate haematophagous arthropod and the major problem for cattle industry due to economic losses it causes. The parasite shows a remarkable adaptability to changing environmental conditions as well as an exceptional ability to survive long-term starvation. This ability has been related to a process of intracellular protein degradation called autophagy. This process in ticks is still poorly understood and only few autophagy-related (ATG) genes have been characterized. The aim of the present study was to examine the ESTs database, BmiGI, of R. microplus searching for ATG homologues. We predicted five putative ATG genes, ATG3, ATG4, ATG6 and two ATG8s. Further characterization led to the identification of RmATG8a and RmATG8b, homologues of GABARAP and MAP1LC3, respectively, and both of them belonging to the ATG8 family. PCR analyses showed that the expression level of RmATG8a and RmATG8b was higher in egg and larval stages when compared to ovary and midgut from adult ticks. This up-regulation coincides with the period in which ticks are in a starvation state, suggesting that autophagy is active in R. microplus.

  7. Molecular cloning, characterization, and expression of an alfalfa (Medicago sativa L.) heme oxygenase-1 gene, MsHO1, which is pro-oxidants-regulated.

    PubMed

    Fu, Guang-Qing; Xu, Sheng; Xie, Yan-Jie; Han, Bin; Nie, Li; Shen, Wen-Biao; Wang, Ren

    2011-07-01

    It has been documented that plant heme oxygenase-1 (HO-1; EC 1.14.99.3) is both development- and stress-regulated, thus it plays a vital role in light signalling and stress responses. In this study, an alfalfa (Medica sativa L.) HO-1 gene MsHO1 was isolated and sequenced. It contains four exons and three introns within genomic DNA sequence and encodes a polypeptide with 283 amino acids. MsHO1 had a conserved HO signature sequence and showed high similarity to other HOs in plants, especially HO-1 isoform. The MsHO1:GFP fusion protein was localized in the chloroplast. Further biochemical activity analysis of mature MsHO1, which was expressed in Escherichia coli, showed that the Vmax was 48.78 nmol biliverdin-IXα (BV) h⁻¹ nmol⁻¹ protein with an apparent Km value for hemin of 2.33 μM, and the optimum Tm and pH were 37 °C and 7.2, respectively. Results of semi-quantitative RT-PCR and western blot showed that the expressions of MsHO1 were higher in alfalfa stems and leaves than those in germinating seeds and roots. Importantly, MsHO1 gene expression and protein level were induced significantly by some pro-oxidant compounds, including hemin and nitric oxide (NO) donor sodium nitroprusside (SNP). In conclusion, MsHO1 may play an important role in oxidative responses.

  8. Molecular cloning, phylogenetic analysis, and expression patterns of LATERAL SUPPRESSOR-LIKE and REGULATOR OF AXILLARY MERISTEM FORMATION-LIKE genes in sunflower (Helianthus annuus L.).

    PubMed

    Fambrini, Marco; Salvini, Mariangela; Pugliesi, Claudio

    2017-03-01

    The wild sunflower (Helianthus annuus) plants develop a highly branched form with numerous small flowering heads. The origin of a no branched sunflower, producing a single large head, has been a key event in the domestication process of this species. The interaction between hormonal factors and several genes organizes the initiation and outgrowth of axillary meristems (AMs). From sunflower, we have isolated two genes putatively involved in this process, LATERAL SUPPRESSOR (LS)-LIKE (Ha-LSL) and REGULATOR OF AXILLARY MERISTEM FORMATION (ROX)-LIKE (Ha-ROXL), encoding for a GRAS and a bHLH transcription factor (TF), respectively. Typical amino acid residues and phylogenetic analyses suggest that Ha-LSL and Ha-ROXL are the orthologs of the branching regulator LS and ROX/LAX1, involved in the growth habit of both dicot and monocot species. qRT-PCR analyses revealed a high accumulation of Ha-LSL transcripts in roots, vegetative shoots, and inflorescence shoots. By contrast, in internodal stems and young leaves, a lower amount of Ha-LSL transcripts was observed. A comparison of transcription patterns between Ha-LSL and Ha-ROXL revealed some analogies but also remarkable differences; in fact, the gene Ha-ROXL displayed a low expression level in all organs analyzed. In situ hybridization (ISH) analysis showed that Ha-ROXL transcription was strongly restricted to a small domain within the boundary zone separating the shoot apical meristem (SAM) and the leaf primordia and in restricted regions of the inflorescence meristem, beforehand the separation of floral bracts from disc flower primordia. These results suggested that Ha-ROXL may be involved to establish a cell niche for the initiation of AMs as well as flower primordia. The accumulation of Ha-LSL transcripts was not restricted to the boundary zones in vegetative and inflorescence shoots, but the mRNA activity was expanded in other cellular domains of primary shoot apical meristem as well as AMs. In addition, Ha

  9. Cloning, chromosomal localization, SNP detection and association analysis of the porcine IRS-1 gene.

    PubMed

    Niu, P-X; Huang, Z; Li, C-C; Fan, B; Li, K; Liu, B; Yu, M; Zhao, S-H

    2009-11-01

    Insulin receptor substrate-1(IRS-1) gene is one member of the Insulin receptor substrate (IRS) gene family, which plays an important role in mediating the growth of skeletal muscle and the molecular metabolism of type 2 diabetes. Here, we cloned a 3,573 bp fragment of the partial CDS sequence of porcine IRS-1 gene by in silicon cloning strategy and RT-PCR method. The porcine IRS-1 gene was assigned to SSC15q25 by using IMpRH. Sequencing of PCR products from Duroc and Tibetan pig breeds identified one SNP in exon 1 of porcine IRS-1 gene (C3257A polymorphisms). Association analysis of genotypes with the growth traits, anatomy traits, meat quality traits and physiological biochemical indexes traits showed that different genotypes at locus 3,257 of IRS-1 have significant differences in carcass straight length in pigs (P = 0.0102 \\ 0.05).

  10. Molecular cloning and functional characterization of a novel apple MdCIPK6L gene reveals its involvement in multiple abiotic stress tolerance in transgenic plants.

    PubMed

    Wang, Rong-Kai; Li, Ling-Li; Cao, Zhong-Hui; Zhao, Qiang; Li, Ming; Zhang, Ling-Yun; Hao, Yu-Jin

    2012-05-01

    CBL-interacting protein kinases (CIPKs) are involved in many aspects of plant responses to abiotic stresses. However, their functions are poorly understood in fruit trees. In this study, a salt-induced MdCIPK6L gene was isolated from apple. Its expression was positively induced by abiotic stresses, stress-related hormones and exogenous Ca(2+). MdCIPK6L was not homologous to AtSOS2, however, its ectopic expression functionally complemented Arabidopsis sos2 mutant. Furthermore, yeast two-hybrid assay showed that MdCIPK6L protein interacted with AtSOS3, indicating that it functions in salt tolerance partially like AtSOS2 through SOS pathway. As a result, the overexpression of both MdCIPK6L and MdCIPK6LT175D remarkably enhanced the tolerance to salt, osmotic/drought and chilling stresses, but did not affect root growth, in transgenic Arabidopsis and apple. Also, T-to-D mutation to MdCIPK6L at Thr175 did not affect its function. These differences between MdCIPK6L and other CIPKs, especially CIPK6s, indicate that MdCIPK6L encodes a novel CIPK in apple. Finally, MdCIPK6L overexpression also conferred tolerance to salt, drought and chilling stresses in transgenic tomatoes. Therefore, MdCIPK6L functions in stress tolerance crossing the species barriers, and is supposed to be a potential candidate gene to improve stress tolerance by genetic manipulation in apple and other crops.

  11. An upstream initiator caspase 10 of snakehead murrel Channa striatus, containing DED, p20 and p10 subunits: molecular cloning, gene expression and proteolytic activity.

    PubMed

    Arockiaraj, Jesu; Gnanam, Annie J; Muthukrishnan, Dhanaraj; Pasupuleti, Mukesh; Milton, James; Singh, Arun

    2013-02-01

    Caspase 10 (CsCasp10) was identified from a constructed cDNA library of freshwater murrel (otherwise called snakehead) Channa striatus. The CsCasp10 is 1838 base pairs (bp) in length and it is encoding 549 amino acid (aa) residues. CsCasp10 amino acid contains two death effector domains (DED) in the N-terminal at 2-77 and 87-154 and it contains caspase family p20 domain (large subunit) and caspase family p10 domain (small subunit) in the C-terminal at 299-425 and 449-536 respectively. Pairwise analysis of CsCasp10 showed the highest sequence similarity (79%) with caspase 10 of Paralichthys olivaceus. Moreover, the phylogenetic analysis showed that CsCasp10 is clustered together with other fish caspase 10, formed a sister group with caspase 10 from other lower vertebrates including amphibian, reptile and birds and finally clustered together with higher vertebrates such as mammals. Significantly (P < 0.05) highest CsCasp10 gene expression was noticed in gills and lowest in intestine. Furthermore, the CsCasp10 gene expression in C. striatus was up-regulated in gills by fungus Aphanomyces invadans and bacteria Aeromonas hydrophila induction. The proteolytic activity was analyzed using the purified recombinant CsCasp10 protein. The results showed the proteolytic activity of CsCasp10 for caspase 10 substrate was 2.5 units per μg protein. Moreover, the proteolytic activities of CsCasp10 in kidney and spleen induced by A. invadans and A. hydrophila stimulation were analyzed by caspase 10 activity assay kit. All these results showed that CsCasp10 are participated in immunity of C. striatus against A. invadans and A. hydrophila infection.

  12. Molecular cloning and functional analysis of a UV-B photoreceptor gene, MdUVR8 (UV Resistance Locus 8), from apple.

    PubMed

    Zhao, Cheng; Mao, Ke; You, Chun-Xiang; Zhao, Xian-Yan; Wang, Shu-Hui; Li, Yuan-Yuan; Hao, Yu-Jin

    2016-06-01

    UVR8 (UV Resistance Locus 8) is an ultraviolet-B (UV-B; 280-315nm) light receptor that is involved in regulating many aspects of plant growth and development. UV-B irradiation can increase the development of flower and fruit coloration in many fruit trees, such as grape, pear and apple. Previous investigations of the structure and functions of UVR8 in plants have largely focused on Arabidopsis. Here, we isolated the UVR8 gene from apple (Malus domestica) and analyzed its function in transgenic Arabidopsis. Genomic and protein sequence analysis showed that MdUVR8 shares high similarity with the AtUVR8 protein from Arabidopsis, including the conserved seven-bladed β-propeller, the C27 region, the 3 "GWRHT" motifs and crucial amino-acid residues (14 Trps, 2 Args). A point mutation prediction and three-dimensional structural analysis of MdUVR8 indicated that it has a similar structure to AtUVR8 and that the crucial residues are also important in MdUVR8. In terms of transcript levels, MdUVR8 expression was up-regulated by UV-B light, which suggests that its expression follows a 24-h circadian rhythm. Using heterologous expression of MdUVR8 in both uvr8-1 mutant and wild-type (WT) Arabidopsis, we found that MdUVR8 regulates hypocotyl elongation and gene expression under UV-B light. These data provide functional evidence for a role of MdUVR8 in controlling photomorphogenesis under UV-B light and indicate that the function of UVR8 is conserved between Arabidopsis and apple. Furthermore, we examined the interaction between MdUVR8 and MdCOP1 (constitutive photomorphogenic1) using a yeast two-hybrid assay and a co-immunoprecipitation assay. This interaction provides a direction for investigating the regulatory mechanisms of the UV-B-light pathway in apple.

  13. Random cloning of genes from mouse chromosome 17.

    PubMed Central

    Kasahara, M; Figueroa, F; Klein, J

    1987-01-01

    We describe a method for isolating cosmid clones randomly from mouse chromosome 17. A cosmid library was constructed from the mouse-Chinese hamster cell line R4 4-1 that contains a limited amount of mouse DNA (chromosomes 17 and 18 and some other unidentified material) on a Chinese hamster background. The library was screened with the murine repetitive sequence probe pMBA14, which selectively hybridizes with mouse DNA. The mouse-derived cosmid clones thus identified were individually hybridized with DNA from the mouse-Syrian hamster cell line JS17 containing all mouse chromosomes except chromosome 17 on a Syrian hamster background. We deduced that the cosmid clones that contained sequences absent in JS17 were derived from mouse chromosome 17. One of the chromosome 17-derived cosmid clones, 3-4-1 (located proximal to the T122/T66C segment) was found to be highly polymorphic among European wild-mouse populations and may be a useful probe to elucidate the evolution and migration of Mus species. The randomly isolated mouse-derived cosmid clones can also be screened for the presence of functional genes. Using testicular cDNA as a probe, a testis-specific gene was cloned from mouse chromosome 17. Images PMID:3472212

  14. Molecular cloning and characterization of WdTUP1, a gene that encodes a potential transcriptional repressor important for yeast-hyphal transitions in Wangiella (Exophiala) dermatitidis

    PubMed Central

    Liu, Hongbo; Abramczyk, Dariusz; Cooper, Chester R; Zheng, Li; Park, Changwon; Szaniszlo, Paul. J.

    2008-01-01

    The general transcriptional repressor Tup1p is known to influence cell development in many fungi. To determine whether the Tup1p ortholog (WdTup1p) of Wangiella dermatitidis also influences cellular development in this melanized, polymorphic human pathogen, the gene (WdTUP1) that encodes this transcription factor was isolated, sequenced and disrupted. Phylogenetic analysis showed that the WdTup1p sequence was closely related to homologues in other polymorphic, conidiogenous fungi. Disruption of WdTUP1 produced mutants (wdtup1Δ) with pronounced growth and cellular abnormalities, including slow growth on various agar media and exclusively as a filamentous morphotype in liquid media. We concluded that WdTup1p represents an important switch regulator that controls the yeast-to-filamentous growth transition. However, detailed observations of the filamentous growth of the disruption mutant showed that the hyphae produced by the wdtup1Δ mutants, unlike those of the wild type, were arrested at a stage prior to the formation of true hyphae and subsequent conidia production. PMID:18061494

  15. Molecular cloning and gene expression of Cg-Foxl2 during the development and the adult gametogenetic cycle in the oyster Crassostrea gigas.

    PubMed

    Naimi, Amine; Martinez, Anne-Sophie; Specq, Marie-Laure; Diss, Blandine; Mathieu, Michel; Sourdaine, Pascal

    2009-09-01

    A Foxl2 ortholog has been identified in a lophotrochozoa, the pacific oyster, which is a successive irregular hermaphrodite mollusc. Its cDNA has been called Cg-Foxl2 (Crassostrea gigas Foxl2) and the deduced protein sequence is 367aa long. This sequence contains the conserved domain Forkhead box and its gene is devoid of intron at least in the first 926 bp of the cDNA, as found for Foxl2 factors. Real time PCR and in situ hybridization have shown a gonadic male and female Cg-Foxl2 expression which increases during the adult gametogenetic cycle for both sexes, but with a significant increase occurring earlier in females than in males. In females this increase corresponds to the vitellogenetic stage. During development, a peak of Cg-DMl (a potential factor of the male gonadic differentiation) and Oyvlg (a germ cell marker) expression and a significant decrease of Cg-Foxl2 expression were observed after metamorphosis in 1-1.5-month-old spats, a period of development when primordial germ cells may differentiate into germinal stem cells during the first gonadic establishment.

  16. Molecular cloning, characterization and expression analysis of the SAMS gene during adventitious root development in IBA-induced tetraploid black locust.

    PubMed

    Quan, Jine; Zhang, Sheng; Zhang, Chunxia; Meng, Sen; Zhao, Zhong; Xu, Xuexuan

    2014-01-01

    S-Adenosylmethionine synthetase (SAMS) catalyzes the synthesis of S-adenosylmethionine (SAM), a precursor for ethylene and polyamine biosynthesis. Here, we report the isolation of the 1498 bp full-length cDNA sequence encoding tetraploid black locust (Robinia pseudoacacia L.) SAMS (TrbSAMS), which contains an open reading frame of 1179 bp encoding 392 amino acids. The amino acid sequence of TrbSAMS has more than 94% sequence identity to SAMSs from other plants, with a closer phylogenetic relationship to SAMSs from legumes than to SAMS from other plants. The TrbSAMS monomer consists of N-terminal, central, and C-terminal domains. Subcellular localization analysis revealed that the TrbSAMS protein localizes mainly to in the cell membrane and cytoplasm of onion epidermal cells and Arabidopsis mesophyll cell protoplasts. Indole-3-butyric acid (IBA)-treated cuttings showed higher levels of TrbSAMS transcript than untreated control cuttings during root primordium and adventitious root formation. TrbSAMS and its downstream genes showed differential expression in shoots, leaves, bark, and roots, with the highest expression observed in bark. IBA-treated cuttings also showed higher SAMS activity than control cuttings during root primordium and adventitious root formation. These results indicate that TrbSAMS might play an important role in the regulation of IBA-induced adventitious root development in tetraploid black locust cuttings.

  17. Molecular cloning of a putative divalent-cation transporter gene as a new genetic marker for the identification of Lactobacillus brevis strains capable of growing in beer.

    PubMed

    Hayashi, N; Ito, M; Horiike, S; Taguchi, H

    2001-05-01

    Random amplified polymorphic DNA (RAPD) PCR analysis of Lactobacillus brevis isolates from breweries revealed that one of the random primers could distinguish beer-spoilage strains of L. brevis from nonspoilage strains. The 1.1-kb DNA fragment amplified from all beer-spoilers included one open reading frame, termed hitA (hop-inducible cation transporter), which encodes an integral membrane protein with 11 putative trans-membrane domains and a binding protein-dependent transport signature of a non-ATP binding membrane transporter common to several prokaryotic and eukaryotic transporters. The hitA polypeptide is homologous to the natural resistance-associated macrophage protein (Nramp) family characterized as divalent-cation transport proteins in many prokaryotic and eukaryotic organisms. Northern blot analysis indicated that the hitA transcripts are expressed in cells cultivated in MRS broth supplemented with hop bitter compounds, which act as mobile-carrier ionophores, dissipating the trans-membrane pH gradient in bacteria sensitive to the hop bitter compounds by exchanging H+ for cellular divalent cations such as Mn2+. This suggests that the hitA gene products may play an important role in making the bacteria resistant to hop bitter compounds in beer by transporting metal ions such as Mn2+ into cells that no longer maintain the proton gradient.

  18. Molecular cloning of mevalonate pathway genes from Taraxacum brevicorniculatum and functional characterisation of the key enzyme 3-hydroxy-3-methylglutaryl-coenzyme A reductase.

    PubMed

    van Deenen, Nicole; Bachmann, Anne-Lena; Schmidt, Thomas; Schaller, Hubert; Sand, Jennifer; Prüfer, Dirk; Schulze Gronover, Christian

    2012-04-01

    Taraxacum brevicorniculatum is known to produce high quality rubber. The biosynthesis of rubber is dependent on isopentenyl pyrophosphate (IPP) precursors derived from the mevalonate (MVA) pathway. The cDNA sequences of seven MVA pathway genes from latex of T. brevicorniculatum were isolated, including three cDNA sequences encoding for 3-hydroxy-3-methylglutaryl-coenzyme A (HMG-CoA) reductases (TbHMGR1-3). Expression analyses indicate an important role of TbHMGR1 as well as for the HMG-CoA synthase (TbHMGS), the diphosphomevalonate decarboxylase and the mevalonate kinase in the provision of precursors for rubber biosynthesis. The amino acid sequences of the TbHMGRs show the typical motifs described for plant HMGRs such as two transmembrane domains and a catalytic domain containing two HMG-CoA and two NADP(H) binding sites. The functionality of the HMGRs was demonstrated by complementation assay using an IPP auxotroph mutant of Escherichia coli. Furthermore, the transient expression of the catalytic domains of TbHMGR1 and TbHMGR2 in Nicotiana benthamiana resulted in a strong accumulation of sterol precursors, one of the major groups of pathway end-products.

  19. Molecular cloning and characterization of the light-regulation and circadian-rhythm of the VDE gene promoter from Zingiber officinale.

    PubMed

    Zhao, Wenchao; Wang, Shaohui; Li, Xin; Huang, Hongyu; Sui, Xiaolei; Zhang, Zhenxian

    2012-08-01

    Ginger (Zingiber officinale Rosc.) is prone to photoinhibition under intense sunlight. Excessive light can be dissipated by the xanthophyll cycle, where violaxanthin de-epoxidase (VDE) plays a critical role in protecting the photosynthesis apparatus from the damage of excessive light. We isolated ~2.0 kb of ginger VDE (GVDE) gene promoter, which contained the circadian box, I-box, G-box and GT-1 motif. Histochemical staining of Arabidopsis indicated the GVDE promoter was active in almost all organs, especially green tissues. β-glucuronidase (GUS) activity driven by GVDE promoter was repressed rather than activated by high light. GUS activity was altered by hormones, growth regulators and abiotic stresses, which increased with 2,4-dichlorophenoxyacetic acid and decreased with abscisic acid, salicylic acid, zeatin, salt (sodium chloride) and polyethylene glycol. Interestingly, GUS activities with gibberellin or indole-3-acetic acid increased in the short-term (24 h) and decreased in the long-term (48 and 72 h). Analysis of 5' flank deletion found two crucial functional regions residing in -679 to -833 and -63 to -210. Northern blotting analysis found transcription to be regulated by the endogenous circadian clock. Finally, we found a region necessary for regulating the circadian rhythm and another for the basic promoter activity. Key message A novel promoter, named GVDE promoter, was first isolated and analyzed in this study. We have determined one region crucial for promoter activity and another responsible for keeping circadian rhythms.

  20. Molecular cloning and expression of a cucumber (Cucumis sativus L.) heme oxygenase-1 gene, CsHO1, which is involved in adventitious root formation.

    PubMed

    Li, Mei-Yue; Cao, Ze-Yu; Shen, Wen-Biao; Cui, Jin

    2011-10-15

    Our previous work showed that in cucumber (Cucumis sativus), auxin rapidly induces heme oxygenase (HO) activity and the product of HO action, carbon monoxide (CO), then triggers the signal transduction events leading to adventitious root formation. In this study, the cucumber HO-1 gene (named as CsHO1) was isolated and sequenced. It contains four exons and three introns and encodes a polypeptide of 291 amino acids. Further results show that CsHO1 shares a high homology with plant HO-1 proteins and codes a 33.3 kDa protein with a 65-amino transit peptide, predicting a mature protein of 26.1 kDa. The mature CsHO1 was expressed in Escherichia coli to produce a fusion protein, which exhibits HO activity. The CsHO1:GFP fusion protein was localized in the chloroplast. Related biochemical analyses of mature CsHO1, including Vmax, Km, Topt and pHopt, were also investigated. CsHO1 mRNA was found in germinating seeds, roots, stem, and especially in leaf tissues. Several well-known adventitious root inducers, including auxin, ABA, hemin, nitric oxide donor sodium nitroprusside (SNP), CaCl(2), and sodium hydrosulfide (NaHS), differentially up-regulate CsHO1 transcripts and corresponding protein levels. These results suggest that CsHO1 may be involved in cucumber adventitious rooting.

  1. Molecular cloning and functional analysis of two phosphate transporter genes from Rhizopogon luteolus and Leucocortinarius bulbiger, two ectomycorrhizal fungi of Pinus tabulaeformis.

    PubMed

    Zheng, Rong; Wang, Jugang; Liu, Min; Duan, Guozhen; Gao, Xiaomin; Bai, Shulan; Han, Yachao

    2016-10-01

    Inorganic phosphorus (Pi) is essential for plant growth, and phosphate (P) deficiency is a primary limiting factor in Pinus tabulaeformis development in northern China. P acquisition in mycorrhizal plants is highly dependent on the activities of phosphate transporters of their root-associated fungi. In the current study, two phosphate transporter genes, RlPT and LbPT, were isolated from Rhizopogon luteolus and Leucocortinarius bulbiger, respectively, two ectomycorrhizal fungi forming symbiotic interactions with the P. tabulaeformis. Phylogenetic analysis suggested that the sequence of the phosphate transporter of L. bulbiger is most closely related to a phosphate transporter of Hebeloma cylindrosporum, whereas the phosphate transporter of R. luteolus is most closely related to that of Piloderma croceum. The subcellular localization indicated that RlPT and LbPT were expressed in the plasma membrane. The complementation assay in yeast indicated that both RlPT and LbPT partially compensated for the absence of phosphate transporter activity in the MB192 yeast strain, with a K m value of 57.90 μmol/L Pi for RlPT and 35.87 μmol/L Pi for LbPT. qPCR analysis revealed that RlPT and LbPT were significantly up-regulated at lower P availability, which may enhance P uptake and transport under Pi starvation. Our results suggest that RlPT and LbPT presumably play a key role in Pi acquisition by P. tabulaeformis via ectomycorrhizal fungi.

  2. Molecular cloning, pathologically-correlated expression and functional characterization of the colonystimulating factor 1 receptor (CSF-1R) gene from a teleost, Plecoglossus altivelis

    PubMed Central

    CHEN, Qiang; LU, Xin-Jiang; LI, Ming-Yun; CHEN, Jiong

    2016-01-01

    Colony-stimulating factor 1 receptor (CSF-1R) is an important regulator of monocytes/macrophages (MO/MΦ). Although several CSF-1R genes have been identified in teleosts, the precise role of CSF- 1R in ayu (Plecoglossus altivelis) remains unclear. In this study, we characterized the CSF-1R homologue from P. altivelis, and named it PaCSF-1R. Multiple sequence alignment and phylogenetic tree analysis showed that PaCSF-1R was most closely related to that of Japanese ricefish (Oryzias latipes). Tissue distribution and expression analysis showed that the PaCSF-1R transcript was mainly expressed in the head kidney-derived MO/MΦ, spleen, and head kidney, and its expression was significantly altered in various tissues upon Vibrio anguillarum infection. After PaCSF-1R neutralization for 48 h, the phagocytic activity of MO/MΦ was significantly decreased, suggesting that PaCSF-1R plays a role in regulating the phagocytic function of ayu MO/MΦ. PMID:27029867

  3. Molecular cloning, characterization, and expression pattern of the ultraspiracle gene homolog (RXR/USP) from the hemimetabolous insect Periplaneta americana (Dictyoptera, Blattidae) during vitellogenesis.

    PubMed

    Elgendy, Azza M; Elmogy, Mohamed; Takeda, Makio

    2014-02-01

    Ecdysteroid and sequiterpenoids juvenile hormones play a gonadotrophic role in the insect adult female vitellogenesis. The molecular basis of hormone action has been analyzed in great detail in flies and moths, but rarely in primitive insect orders. The primitive hemimetabolous insect Periplaneta americana was used, as a model, to isolate and characterize, for the first time, two cDNAs of RXR/USP, a component of the heterodimeric ecdysone receptor. These two cDNAs correspond to two isoforms, named PamRXR-S (short form) and PamRXR-L (long form). Both are identical except for 25 amino acids deletion/insertion located in the loop between helices H1 and H3 of the ligand-binding domain. The two isoforms are differentially expressed in different tissues as revealed by RT-PCR and northern blot analysis. In fat body, brain, ovary, and muscle tissues, the predominant form was PamRXR-S, whereas PamRXR-L was abundant in ovaries. The PamRXR transcript was detected during all stages of vitellogenesis in the fat body with different levels. It was little low during the early vitellogenic period (days 2, 3), then a peak of increase was detected during days 4-6 (day 5) which was followed by another peak of increase at the end of vitellogenesis, day 9. We assumed that PamRXR might play a dual role of induction of vitellogenin through JH at early vitellogenesis and suppression through 20E during late vitellogenesis. The present work will pave the way for several other investigations to understand both the ecdysteroid-dependent genetic hierarchy and JH mechanism controlling vitellogenesis in the American cockroach, P. americana.

  4. Molecular cloning and amino acid sequence of human 5-lipoxygenase

    SciTech Connect

    Matsumoto, T.; Funk, C.D.; Radmark, O.; Hoeoeg, J.O.; Joernvall, H.; Samuelsson, B.

    1988-01-01

    5-Lipoxygenase (EC 1.13.11.34), a Ca/sup 2 +/- and ATP-requiring enzyme, catalyzes the first two steps in the biosynthesis of the peptidoleukotrienes and the chemotactic factor leukotriene B/sub 4/. A cDNA clone corresponding to 5-lipoxygenase was isolated from a human lung lambda gt11 expression library by immunoscreening with a polyclonal antibody. Additional clones from a human placenta lambda gt11 cDNA library were obtained by plaque hybridization with the /sup 32/P-labeled lung cDNA clone. Sequence data obtained from several overlapping clones indicate that the composite DNAs contain the complete coding region for the enzyme. From the deduced primary structure, 5-lipoxygenase encodes a 673 amino acid protein with a calculated molecular weight of 77,839. Direct analysis of the native protein and its proteolytic fragments confirmed the deduced composition, the amino-terminal amino acid sequence, and the structure of many internal segments. 5-Lipoxygenase has no apparent sequence homology with leukotriene A/sub 4/ hydrolase or Ca/sup 2 +/-binding proteins. RNA blot analysis indicated substantial amounts of an mRNA species of approx. = 2700 nucleotides in leukocytes, lung, and placenta.

  5. Molecular cloning and expression analysis of rainbow trout (Oncorhynchus mykiss) CCAAT/enhancer binding protein genes and their responses to induction by GH in vitro and in vivo.

    PubMed

    Lo, Jay H; Chiou, Pinwen Peter; Lin, C M; Chen, Thomas T

    2007-08-01

    CCAAT/enhancer-binding proteins (C/EBPs) are transcription factors consisting of six isoforms and play diverse physiological roles in vertebrates. In rainbow trout (Oncorhynchus mykiss), in addition to the reported C/EBPbeta1, we have isolated cDNA of four other isoforms, C/EBPalpha, C/EBPbeta2, C/EBPdelta1, C/EBPdelta2, from the liver. Comparison of the deduced amino acid sequence of rainbow trout C/EBPs with those of other vertebrates revealed that C/EBP isoforms are highly conserved. The profiles of tissue-specific expression of individual C/EBP isoform mRNA, determined by quantitative real-time (RT)-PCR showed distinct patterns. Furthermore, injection of bovine GH into yearling rainbow trout resulted in a significant increase of mRNA levels of C/EBPbeta1, C/EBPbeta2, and C/EBPdelta2 but not C/EBPalpha and C/EBPdelta1 in the liver. GH-dependent increase of mRNA levels of C/EBPbeta1, C/EBPbeta2, C/EBPdelta2, and IGF-II were also confirmed by treating rainbow trout hepatoma cells expressing a goldfish GH receptor with bGH. Together with our previous findings, the results presented in this paper strengthen our previous hypothesis that GH may regulate the expression of the IGF-II gene via mediating the expression of C/EBPbeta1, C/EBPbeta2, and C/EBPdelta2 mRNA.

  6. Molecular Cloning of a cDNA Encoding for Taenia solium TATA-Box Binding Protein 1 (TsTBP1) and Study of Its Interactions with the TATA-Box of Actin 5 and Typical 2-Cys Peroxiredoxin Genes

    PubMed Central

    Rodríguez-Lima, Oscar; García-Gutierrez, Ponciano; Jiménez, Lucía; Zarain-Herzberg, Ángel; Lazzarini, Roberto; Landa, Abraham

    2015-01-01

    TATA-box binding protein (TBP) is an essential regulatory transcription factor for the TATA-box and TATA-box-less gene promoters. We report the cloning and characterization of a full-length cDNA that encodes a Taenia solium TATA-box binding protein 1 (TsTBP1). Deduced amino acid composition from its nucleotide sequence revealed that encodes a protein of 238 residues with a predicted molecular weight of 26.7 kDa, and a theoretical pI of 10.6. The NH2-terminal domain shows no conservation when compared with to pig and human TBP1s. However, it shows high conservation in size and amino acid identity with taeniids TBP1s. In contrast, the TsTBP1 COOH-terminal domain is highly conserved among organisms, and contains the amino acids involved in interactions with the TATA-box, as well as with TFIIA and TFIIB. In silico TsTBP1 modeling reveals that the COOH-terminal domain forms the classical saddle structure of the TBP family, with one α-helix at the end, not present in pig and human. Native TsTBP1 was detected in T. solium cysticerci´s nuclear extract by western blot using rabbit antibodies generated against two synthetic peptides located in the NH2 and COOH-terminal domains of TsTBP1. These antibodies, through immunofluorescence technique, identified the TBP1 in the nucleus of cells that form the bladder wall of cysticerci of Taenia crassiceps, an organism close related to T. solium. Electrophoretic mobility shift assays using nuclear extracts from T. solium cysticerci and antibodies against the NH2-terminal domain of TsTBP1 showed the interaction of native TsTBP1 with the TATA-box present in T. solium actin 5 (pAT5) and 2-Cys peroxiredoxin (Ts2-CysPrx) gene promoters; in contrast, when antibodies against the anti-COOH-terminal domain of TsTBP1 were used, they inhibited the binding of TsTBP1 to the TATA-box of the pAT5 promoter gene. PMID:26529408

  7. Molecular Cloning of a cDNA Encoding for Taenia solium TATA-Box Binding Protein 1 (TsTBP1) and Study of Its Interactions with the TATA-Box of Actin 5 and Typical 2-Cys Peroxiredoxin Genes.

    PubMed

    Rodríguez-Lima, Oscar; García-Gutierrez, Ponciano; Jiménez, Lucía; Zarain-Herzberg, Ángel; Lazzarini, Roberto; Landa, Abraham

    2015-01-01

    TATA-box binding protein (TBP) is an essential regulatory transcription factor for the TATA-box and TATA-box-less gene promoters. We report the cloning and characterization of a full-length cDNA that encodes a Taenia solium TATA-box binding protein 1 (TsTBP1). Deduced amino acid composition from its nucleotide sequence revealed that encodes a protein of 238 residues with a predicted molecular weight of 26.7 kDa, and a theoretical pI of 10.6. The NH2-terminal domain shows no conservation when compared with to pig and human TBP1s. However, it shows high conservation in size and amino acid identity with taeniids TBP1s. In contrast, the TsTBP1 COOH-terminal domain is highly conserved among organisms, and contains the amino acids involved in interactions with the TATA-box, as well as with TFIIA and TFIIB. In silico TsTBP1 modeling reveals that the COOH-terminal domain forms the classical saddle structure of the TBP family, with one α-helix at the end, not present in pig and human. Native TsTBP1 was detected in T. solium cysticerci´s nuclear extract by western blot using rabbit antibodies generated against two synthetic peptides located in the NH2 and COOH-terminal domains of TsTBP1. These antibodies, through immunofluorescence technique, identified the TBP1 in the nucleus of cells that form the bladder wall of cysticerci of Taenia crassiceps, an organism close related to T. solium. Electrophoretic mobility shift assays using nuclear extracts from T. solium cysticerci and antibodies against the NH2-terminal domain of TsTBP1 showed the interaction of native TsTBP1 with the TATA-box present in T. solium actin 5 (pAT5) and 2-Cys peroxiredoxin (Ts2-CysPrx) gene promoters; in contrast, when antibodies against the anti-COOH-terminal domain of TsTBP1 were used, they inhibited the binding of TsTBP1 to the TATA-box of the pAT5 promoter gene.

  8. [Research progress on the cloning of Mendel's gene in pea (Pisum sativum L.) and its application in genetics teaching].

    PubMed

    He, Feng-Hua; Zhu, Bi-Yan; Gao, Feng; Li, Shao-Shan; Li, Niang-Hui

    2013-07-01

    One hundred and fifty years ago, Gregor Mendel investigated the segregation of seven traits in pea (Pisum sativum) and established the law of segregation and the law of independent assortment in genetics. After the two laws of genetics were rediscovered in 1900, the seven traits have been extensively investigated in the fields of plant physiology and biochemistry as well as in the cell and molecular levels. Recently, with the development of molecular technology in genetics, four genes for seed shape (R), stem length (Le), cotyledon colour (I), and flower colour (A) have been cloned and sequenced; and another three genes for immature pod colour (Gp), fasciation (Fa) and pod form (V) have been located in the linkage groups, respectively. The identification and cloning of the four Mendel's genes will help deeply understand the basic concept of gene in many respects: like the diversity of gene function, the different origins for gene mutation in molecular level, and the molecular nature of a dominant gene or a recessive gene. In teaching of genetics, the introduction of most recent research advancements of cloning of Mendel's genes to the students and the interpretation of the Mendel's laws in molecular level will help students promote their learning interests in genetics and help students grasp the whole content from classical genetics to molecular genetics and the developmental direction of this subject.

  9. Cloning and expression of the potato alternative oxidase gene

    SciTech Connect

    Hiser, C.; McIntosh, L. Michigan State Univ., East Lansing )

    1990-05-01

    Mitochondria from 24-hour-aged potato slices possess an alternative path capacity and a 36kD protein not present in fresh potato mitochondria. This 36kD protein was identified by a monoclonal antibody against the Sauromatum guttatum alternative oxidase. These results suggest de novo synthesis of the 36kD protein during the aging process. To investigate this phenomenon, a clone containing a potato alternative oxidase gene was isolated from a cDNA library using the S. guttatum gene as a probe. This clone shows areas of high homology to the S. guttatum gene. Norther blots of RNA from fresh and 24-hour-aged potato slices are being probed with the potato gene to examine its expression in relation to the appearance of the 36kD protein.

  10. Molecular cloning of seal myoglobin mRNA.

    PubMed Central

    Wood, D; Blanchetot, A; Jeffreys, A J

    1982-01-01

    Grey seal skeletal muscle containing high levels of myoglobin was used to prepare poly(A)+ RNA. In vitro translation of this RNA produced a range of polypeptides including myoglobin. cDNA was prepared by reverse transcription of muscle poly(A)+ RNA and cloned into the plasmid pAT 153. 4% of cDNA recombinants were shown to contain myoglobin cDNA inserts. DNA sequence analysis of one clone (pSM 178) which contained a relatively large myoglobin cDNA insert showed an incomplete cDNA comprising the terminal 293 nucleotides of 3' non-translated mRNA sequences. Hybridization experiments using this myoglobin cDNA indicated that seal myoglobin is coded by a single gene which is transcribed to give a 1400 nucleotide mRNA considerably longer than related haemoglobin mRNAs. Images PMID:6185919

  11. Cloning an expressed gene shared by the human sex chromosomes

    SciTech Connect

    Darling, S.M.; Banting, G.S.; Pym, B.; Wolfe, J.; Goodfellow, P.N.

    1986-01-01

    The existence of genes shared by mammalian sex chromosomes has been predicted on both evolutionary and functional grounds. However, the only experimental evidence for such genes in humans is the cell-surface antigen encoded by loci on the X and Y chromosomes (MIC2X and MIC2Y, respectively), which is recognized by the monoclonal antibody 12E7. Using the bacteriophage lambdagt11 expression system in Escherichia coli and immunoscreening techniques, the authors have isolated a cDNA clone whose primary product is recognized by 12E7. Southern blot analysis using somatic cell hybrids containing only the human X or Y chromosomes shows that the sequences reacting with the cDNA clone are localized to the sex chromosomes. In addition, the clone hybridizes to DNAs isolated from mouse cells that have been transfected with human DNA and selected for 12E7 expression on the fluorescence-activated cell sorter. The authors conclude that the cDNA clone encodes the 12E7 antigen, which is the primary product of the MIC2 loci. The clone was used to explore sequence homology between MIC2X and MIC2Y; these loci are closely related, if not identical.

  12. [Cloning and diversity analysis of microorganism genes from alkalescence soil].

    PubMed

    Hu, Ting-Ting; Jiang, Cheng-Jian; Liang, Xuan; Long, Wen-Jie; Wu, Bo

    2006-10-01

    The metagenomic DNAs were extracted and purified from alkalescence environmental samples directly. On the basis of the metagenomic DNA, the alkaline soil 16S rDNA library composed of 5,562 positive clones was constructed. The phylogenic tree indicated that the bacteria from the alkaline soils were bio-diversity. The metagenomic DNA library named AL01 was constructed by inserting restriction fragments of the purified DNAs into plasmids pGEM-3Zf(+) vector. This library contained 23,650 positive clones and the average foreign DNA fragments were about 3.2 kb. The length of the library covered 75.68 Mb. The efficiency of the metagenomic library was approximately 6,000 clones from 1g dry soil samples. After screening AL01 DNA library with the screening tactics of enzymes, we confirmed that a positive clone, designated pGXAA2011, contained an alkaline protease gene AP01. Enzymatic analysis proved that its reaction optimum pH was 9.5 and the optimum temperature was 40 degrees C. Furthermore, a clone, designated pGXAG142 was screened from metagenomic DNA library, which expresses beta-glucosidase. DNA sequence indicated that the potential ORF of pGXAG142, which was named unglu01, there was no DNA or amino acids identity with the known beta-glucosidase genes in the Genbank. The integrated ORF was cloned into pETBlue-2 vector and was then transformed into Tuner(DE3)pLacI. The recombinant expression clone could express beta-glucosidase on the screening plate clearly and the analysis of SDS-PAGE indicated that the target protein was about 29 kDa.

  13. Ancient DNA: extraction, characterization, molecular cloning, and enzymatic amplification.

    PubMed

    Pääbo, S

    1989-03-01

    Several chemical and enzymatic properties were examined in the DNA extracted from dry remains of soft tissues that vary in age from 4 to 13,000 years and represent four species, including two extinct animals (the marsupial wolf and giant ground sloth). The DNA obtained was invariably of a low average molecular size and damaged by oxidative processes, which primarily manifest themselves as modifications of pyrimidines and sugar residues as well as baseless sites and intermolecular cross-links. This renders molecular cloning difficult. However, the polymerase chain reaction can be used to amplify and study short mitochondrial DNA sequences that are of anthropological and evolutionary significance. This opens up the prospect of performing diachronical studies of molecular evolutionary genetics.

  14. Molecular cloning, functional expression and characterization of (E)-beta farnesene synthase from Citrus junos.

    PubMed

    Maruyama, T; Ito, M; Honda, G

    2001-10-01

    We cloned the gene of the acyclic sesquiterpene synthase, (E)-beta-farnesene synthase (CJFS) from Yuzu (Citrus junos, Rutaceae). The function of CJFS was elucidated by the preparation of recombinant protein and subsequent enzyme assay. CJFS consisted of 1867 nucleotides including 1680 bp of coding sequence encoding a protein of 560 amino acids with a molecular weight of 62 kDa. The deduced amino acid sequence possessed characteristic amino acid residues, such as the DDxxD motif, which are highly conserved among terpene synthases. This is the first report of the cloning of a terpene synthase from a Rutaceous plant. A possible reaction mechanism for terpene biosynthesis is also discussed on the basis of sequence comparison of CJFS with known sesquiterpene synthase genes.

  15. The Metarhizium anisopliae trp1 gene: cloning and regulatory analysis.

    PubMed

    Staats, Charley Christian; Silva, Marcia Suzana Nunes; Pinto, Paulo Marcos; Vainstein, Marilene Henning; Schrank, Augusto

    2004-07-01

    The trp1 gene from the entomopathogenic fungus Metarhizium anisopliae, cloned by heterologous hybridization with the plasmid carrying the trpC gene from Aspergillus nidulans, was sequence characterized. The predicted translation product has the conserved catalytic domains of glutamine amidotransferase (G domain), indoleglycerolphosphate synthase (C domain), and phosphoribosyl anthranilate isomerase (F domain) organized as NH2-G-C-F-COOH. The ORF is interrupted by a single intron of 60 nt that is position conserved in relation to trp genes from Ascomycetes and length conserved in relation to Basidiomycetes species. RT-PCR analysis suggests constitutive expression of trp1 gene in M. anisopliae.

  16. Microdissection and molecular manipulation of single chromosomes in woody fruit trees with small chromosomes using pomelo (Citrus grandis) as a model. II. Cloning of resistance gene analogs from single chromosomes.

    PubMed

    Huang, D; Wu, W; Lu, L

    2004-05-01

    Amplification of resistance gene analogs (RGAs) is both a useful method for acquiring DNA markers closely linked to disease resistance (R) genes and a potential approach for the rapid cloning of R genes in plants. However, the screening of target sequences from among the numerous amplified RGAs can be very laborious. The amplification of RGAs from specific chromosomes could greatly reduce the number of RGAs to be screened and, consequently, speed up the identification of target RGAs. We have developed two methods for amplifying RGAs from single chromosomes. Method 1 uses products of Sau3A linker adaptor-mediated PCR (LAM-PCR) from a single chromosome as the templates for RGA amplification, while Method 2 directly uses a single chromosomal DNA molecule as the template. Using a pair of degenerate primers designed on the basis of the conserved nucleotide-binding-site motifs in many R genes, RGAs were successfully amplified from single chromosomes of pomelo using both these methods. Sequencing and cluster analysis of RGA clones obtained from single chromosomes revealed the number, type and organization of R-gene clusters on the chromosomes. We suggest that Method 1 is suitable for analyzing chromosomes that are unidentifiable under a microscope, while Method 2 is more appropriate when chromosomes can be clearly identified.

  17. Cloning and nucleotide sequence of the aroA gene of Bordetella pertussis.

    PubMed Central

    Maskell, D J; Morrissey, P; Dougan, G

    1988-01-01

    The aroA locus of Bordetella pertussis, encoding 5-enolpyruvylshikimate 3-phosphate synthase, has been cloned into Escherichia coli by using a cosmid vector. The gene is expressed in E. coli and complemented an E. coli aroA mutant. The nucleotide sequence of the B. pertussis aroA gene was determined and contains an open reading frame encoding 442 amino acids, with a calculated molecular weight for 5-enolpyruvylshikimate 3-phosphate synthase of 46,688. The amino acid sequence derived from the nucleotide sequence shows homology with the published amino acid sequences of aroA gene products of other microorganisms. PMID:2897356

  18. The Cloning of the BRCA1 Gene

    DTIC Science & Technology

    1997-09-01

    Chromosome 17, Breast-Ovarian Cancer Syndrome 15. NUMBER OF PAGES 21 16. PRICE CODE 17. SECURITY CLASSIFICATION OF REPORT Unclassified 18. SECURITY...the breast-ovarian cancer syndrome as well. From 1990-1994, a series of experiments in several laboratories confirmed that BRCA1 was the gene...of mutations present in the families with the breast ovarian cancer syndrome . The objectives of the study were stated as follows: 1) To identify

  19. Cloning and sequence analysis of an actin gene in aloe.

    PubMed

    Wen, S S; He, D W; Liao, C M; Li, J; Wen, G Q; Liu, X H

    2014-07-04

    Aloe (Aloe spp), containing abundant polysaccharides and numerous bioactive ingredients, has remarkable medical, ornamental, calleidic, and edible values. In the present study, the total RNA was extracted from aloe leaf tissue. The isolated high-quality RNA was further used to clone actin gene by using reverse transcription-polymerase chain reaction (RT-PCR). The result of sequence analysis for the amplified fragment revealed that the cloned actin gene was 1012 bp in length (GenBank accession No. KC751541.1) and contained a 924-bp coding region and encoded a protein consisting of 307 amino acids. Homologous alignment showed that it shared over 80 and 96% identity with the nucleotide and amino acid sequences of actin from other plants, respectively. In addition, the cloned gene was used for phylogenetic analyses based on the deduced amino acid sequences, and the results suggested that the actin gene is highly conserved in evolution. The findings of this study will be useful for investigating the expression patterns of other genes in Aloe.

  20. Cloning and characterization of ribulose bisphosphate carboxylase gene of a carboxydobacterium, hydrogenophagea pseudoflava DSM 1084.

    PubMed

    Lee, S N; Kim, Y M

    1998-10-31

    The ribulose bisphosphate carboxylase/oxygenase rbcL and rbcS genes of a carbon monoxide-oxidizing bacterium, Hydrogenophaga pseudoflava DSM 1084, were cloned and sequenced. The cloned rbcL and rbcS genes had open reading frames of 1422 and 351 nucleotides encoding RbcL and RbcS with calculated molecular masses of 52,689 and 13,541, respectively. The known active site residues in other RbcL proteins were conserved in the H. pseudoflava proteins. The H. pseudoflava RbcS protein lacked the 12-residue internal sequence found in the plant enzymes. The 2 genes were separated by a 134 bp intergenic region and cotranscribed as a 2.0 kb rbcLS mRNA. Novel two perfect 9 bp direct repeats overlapping with two dyad symmetries were found in the rbcLS promoter region.

  1. Molecular cloning and characterisation of banana fruit polyphenol oxidase.

    PubMed

    Gooding, P S; Bird, C; Robinson, S P

    2001-09-01

    Polyphenol oxidase (PPO; EC 1.10.3.2) is the enzyme thought to be responsible for browning in banana [Musa cavendishii (AAA group, Cavendish subgroup) cv. Williams] fruit. Banana flesh was high in PPO activity throughout growth and ripening. Peel showed high levels of activity early in development but activity declined until ripening started and then remained constant. PPO activity in fruit was not substantially induced after wounding or treatment with 5-methyl jasmonate. Banana flowers and unexpanded leaf roll had high PPO activities with lower activities observed in mature leaves, roots and stem. Four different PPO cDNA clones were amplified from banana fruit (BPO1, BPO11, BPO34 and BPO35). Full-length cDNA and genomic clones were isolated for the most abundant sequence (BPO1) and the genomic clone was found to contain an 85-bp intron. Introns have not been previously found in PPO genes. Northern analysis revealed the presence of BPO1 mRNA in banana flesh early in development but little BPO1 mRNA was detected at the same stage in banana peel. BPO11 transcript was only detected in very young flesh and there was no detectable expression of BPO34 or BPO35 in developing fruit samples. PPO transcripts were also low throughout ripening in both flesh and peel. BPO1 transcripts were readily detected in flowers, stem, roots and leaf roll samples but were not detected in mature leaves. BPO11 showed a similar pattern of expression to BPO1 in these tissues but transcript levels were much lower. BPO34 and BPO35 mRNAs were only detected at a low level in flowers and roots and BPO34 transcript was detected in mature leaves, the only clone to do so. The results suggest that browning of banana fruit during ripening results from release of pre-existing PPO enzyme, which is synthesised very early in fruit development.

  2. Cloning of the Rhodobacter capsulatus hemA gene.

    PubMed Central

    Biel, S W; Wright, M S; Biel, A J

    1988-01-01

    Portions of the Rhodobacter capsulatus hemA gene have been cloned from a hemA::Tn5 insertion strain into the lambda bacteriophage derivative EMBL3. A cosmid containing the wild-type R. capsulatus hemA gene was isolated by complementation of the hemA::Tn5 mutant. The cosmid contains a 1.4-kilobase EcoRI fragment that spans the hemA::Tn5 insertion site. The entire hemA gene is contained in this fragment and the adjacent 0.6-kilobase EcoRI fragment. Images PMID:2842318

  3. Molecular cloning of MER-2, a human chromosome-11-encoded red blood cell antigen, using linkage of cotransfected markers.

    PubMed

    Bill, J; Palmer, E; Jones, C

    1987-09-01

    We report the molecular cloning of a human gene MER-2 located on chromosome 11 that encodes a cell surface antigen which is polymorphic on red blood cells. An essential element of the cloning strategy was cotransfection-induced linkage of pSV2-neo, which encodes resistance to the antibiotic G418, to the human MER-2 gene. An important feature of the pSV2-neo construct is that the same gene (the transposon, Tn5) that encodes G418 resistance in eukaryotic cells confers neomycin resistance in bacteria. Chinese hamster ovary (CHO) cells were cotransfected with pSV2-neo and genomic DNA from a CHO X human cell hybrid containing a single human chromosome (chromosome 11). Transfectants expressing both the human MER-2 gene and G418 resistance were isolated by selection in the antibiotic G418, followed by indirect immunofluorescence using the monoclonal antibody 1D12, which recognizes the MER-2 antigen, manual enrichment, and single-cell cloning. Genomic DNA from a primary transfectant positive for MER-2 expression and G418 resistance was used to construct a cosmid library and cosmid clones able to grow in neomycin were isolated. Of 150,000 cosmid clones screened, 90 were resistant to neomycin and of these, 11 contained human repetitive sequences. Five neomycin-resistant cosmid clones containing human repetitive DNA were able to transfect CHO cells for G418 resistance and MER-2 expression.

  4. The first BAFF gene cloned from the cartilaginous fish.

    PubMed

    Ren, Wenhua; Pang, Shuying; You, Fengtao; Zhou, Lidan; Zhang, Shuangquan

    2011-12-01

    B-cell activating factor (BAFF), a member of the TNF family, is critical to the survival, proliferation, maturation, and differentiation of B-cells. In the present study, a CpBAFF was amplified from the white-spotted catshark (Chiloscyllium plagiosum) using RT-PCR and RACE (rapid amplification of cDNA end) techniques. To our knowledge, this is the first report of any BAFF gene being cloned from a cartilaginous fish. The open reading frame (ORF) of CpBAFF cDNA consists of 819 bases encoding a protein of 272 amino acids. This protein was found to contain a predicted transmembrane domain, a putative furin protease cleavage site, and a typical TNF homology domain corresponding to other identified BAFF homologues. Sequence alignment showed that CpBAFF shares 37-57% identity with BAFF amino acid sequences reported in other vertebrates. Three-dimensional structure modeling analysis revealed a soluble mature portion of CpBAFF (CpsBAFF) with a long D-E loop specific to the BAFF gene, which has not been found in other reported TNF proteins. Phylogenetic reconstruction showed that CpBAFF is most closely related to other fish BAFFs and clusters with BAFF genes from higher vertebrates (reptiles, birds, and mammals). Real-time quantitative RT-PCR demonstrated that CpBAFF mRNA expression was high in the spleen but moderate in the kidney and branchia. Recombinant CpsBAFF fused to NusA-His(6)-tag was efficiently expressed in Escherichia coli BL21 (DE3), and a molecular weight of approximately 83 kDa was determined using SDS-PAGE and Western blotting. In vitro MTT assay indicated that the purified pET43.1a (+)-CpsBAFF protein can co-stimulate the proliferation of mammalian B-cells with anti-IgM in a dose-dependent manner. The present findings not only present novel information that may be relevant to shark immunity but also provide some new insights into the origins and evolution of immunity in all vertebrates.

  5. Isolation and partial characterization of infectious molecular clones of feline immunodeficiency virus obtained directly from bone marrow DNA of a naturally infected cat.

    PubMed Central

    Siebelink, K H; Chu, I H; Rimmelzwaan, G F; Weijer, K; Osterhaus, A D; Bosch, M L

    1992-01-01

    Replication-competent molecular clones of feline immunodeficiency virus (FIV) were isolated directly from the DNA of bone marrow cells of a naturally FIV-infected cat. After transfection in a feline kidney cell line (CrFK) and subsequent cocultivation with peripheral blood mononuclear cells (PBMC), the viral progeny of the clones was infectious for PBMC but not for CrFK cells. PBMC infected with these clones showed syncytium formation, a decrease in cell viability, and gradual loss of CD4+ cells. The restriction maps of these clones differed from those obtained for previously described molecular clones of FIV derived from cats in the United States. The predicted amino acid sequence similarity of the envelope genes of the two clones was 99.3%, whereas the similarities of the sequences of the clones to those of two molecular clones from the United States, Petaluma and PPR, were 86 and 88%, respectively. Most of the differences between the amino acid sequences of the two clones and those of the clones from the United States were found in five different hypervariable (HV) regions, HV-1 through HV-5. The viral progeny of one of these clones was inoculated into two specific-pathogen-free cats. The animals seroconverted, and the virus could be reisolated from their PBMC. Images PMID:1309891

  6. Cloning and expression of genes encoding Haemophilus somnus antigens.

    PubMed Central

    Corbeil, L B; Chikami, G; Yarnall, M; Smith, J; Guiney, D G

    1988-01-01

    A genomic library of Haemophilus somnus 2336, a virulent isolate from a calf with pneumonia (later used to reproduce H. somnus experimental pneumonia), was constructed in the cosmid vector pHC79. The gene bank in Escherichia coli DH1 was screened by filter immunoassay with convalescent-phase serum, which reacted with several outer membrane antigens of H. somnus. On Western blotting (immunoblotting) of immunoreactive colonies, five clones were found to express proteins which comigrated with H. somnus surface antigens. Three clones (DH1 pHS1, pHS3, and pHS4) expressed both a 120-kilodalton (kDa) antigen and a 76-kDa antigen, one clone (DH1 pHS2) expressed only the 76-kDa antigen, and the fifth clone (DH1 pHS5) expressed a 60-kDa antigen. The 120-kDa and 76-kDa antigens were found internally, whereas the 60-kDa protein was detected in the DH1 pHS5 culture supernatant as membrane blebs or insoluble protein. Both the H. somnus 120-kDa antigen and the recombinant 120-kDa antigen had immunoglobulin Fc-binding activity. Restriction endonuclease mapping demonstrated that the genomic DNA inserts of clones expressing the 76-kDa antigen shared a common 28.4-kilobase-pair region, and the three clones also expressing the 120-kDa antigen shared an additional 7.0-kilobase-pair region. The restriction endonuclease map of pHS5, which expressed the 60-kDa antigen, was not similar to the maps of the other four plasmids. Since these three H. somnus antigens reacted with protective convalescent-phase serum, the recombinants which express these proteins should be useful in further studies of protective immunity in bovine H. somnus disease. Images PMID:2843469

  7. Molecular and cytogenetic characterization of expanded B-cell clones from multiclonal versus monoclonal B-cell chronic lymphoproliferative disorders

    PubMed Central

    Henriques, Ana; Rodríguez-Caballero, Arancha; Criado, Ignacio; Langerak, Anton W.; Nieto, Wendy G.; Lécrevisse, Quentin; González, Marcos; Cortesão, Emília; Paiva, Artur; Almeida, Julia; Orfao, Alberto

    2014-01-01

    Chronic antigen-stimulation has been recurrently involved in the earlier stages of monoclonal B-cell lymphocytosis, chronic lymphocytic leukemia and other B-cell chronic lymphoproliferative disorders. The expansion of two or more B-cell clones has frequently been reported in individuals with these conditions; potentially, such coexisting clones have a greater probability of interaction with common immunological determinants. Here, we analyzed the B-cell receptor repertoire and molecular profile, as well as the phenotypic, cytogenetic and hematologic features, of 228 chronic lymphocytic leukemia-like and non-chronic lymphocytic leukemia-like clones comparing multiclonal (n=85 clones from 41 cases) versus monoclonal (n=143 clones) monoclonal B-cell lymphocytosis, chronic lymphocytic leukemia and other B-cell chronic lymphoproliferative disorders. The B-cell receptor of B-cell clones from multiclonal cases showed a slightly higher degree of HCDR3 homology than B-cell clones from mono clonal cases, in association with unique hematologic (e.g. lower B-lymphocyte counts) and cytogenetic (e.g. lower frequency of cytogenetically altered clones) features usually related to earlier stages of the disease. Moreover, a subgroup of coexisting B-cell clones from individual multiclonal cases which were found to be phylogenetically related showed unique molecular and cytogenetic features: they more frequently shared IGHV3 gene usage, shorter HCDR3 sequences with a greater proportion of IGHV mutations and del(13q14.3), than other unrelated B-cell clones. These results would support the antigen-driven nature of such multiclonal B-cell expansions, with potential involvement of multiple antigens/epitopes. PMID:24488564

  8. Cloning, expression and purification of d-tagatose 3-epimerase gene from Escherichia coli JM109.

    PubMed

    He, Xiaoliang; Zhou, Xiaohui; Yang, Zi; Xu, Le; Yu, Yuxiu; Jia, Lingling; Li, Guoqing

    2015-10-01

    An unknown d-tagatose 3-epimerase (DTE) containing a IoIE domain was identified and cloned from Escherichia coli. This gene was subcloned into the prokaryotic expression vector pET-15b, and induced by IPTG in E. coli BL21 expression system. Through His-select gel column purification and fast-protein liquid chromatography, highly purified and stable DTE protein was produced. The molecular weight of the DTE protein was estimated to be 29.8kDa. The latest 83 DTE sequences from public database were selected and analyzed by molecular clustering, multi-sequence alignment. DTEs were roughly divided into five categories.

  9. Molecular cloning and functional analysis of a 10-epi-junenol synthase from Inula hupehensis.

    PubMed

    Gou, Jun-Bo; Li, Zhen-Qiu; Li, Chang-Fu; Chen, Fang-Fang; Lv, Shi-You; Zhang, Yan-Sheng

    2016-09-01

    Junenol based-eudesmanolides have been detected in many compositae plant species and were reported to exhibit various pharmacological activities. So far, the gene encoding junenol synthase has never been isolated. Here we report the molecular cloning and functional analysis of a 10-epi-junenol synthase from Inula hupehensis (designated IhsTPS1). IhsTPS1 converts the substrate farnesyl diphosphate into multiple sesquiterpenes with the product 10-epi-junenol being predominant. The transcript levels of IhsTPS1 correlate well with the accumulation pattern of 10-epi-junenol in I. hupehensis organs, supporting its biochemical roles in vivo.

  10. Cloning of the Protective Antigen Gene of Bacillus anthracis

    DTIC Science & Technology

    1983-09-01

    of the complicated precedents of duplicate toxin genes in chro- muumm mosomall and plasmid DNA of B. thuringiensis (Schnepf and Whitely, 1981; Klier...OiL V4. 34. S-W7. SW 1v 99 CwI 0193 by MT 0 009-7483/06O-002.00/0 mU"- - 1*;)-0Cloning of the Protective Antigen Gene OCT 19 MI L Sof Bacillus ...Sumnler uncertain, it is probably caused by other Bacillus antigens, 4 t which may include LF and EF. PA produced from recom- A The - "w t of a

  11. Molecularly tagged genes and quantitative trait loci in cucumber

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Since the release of the cucumber draft genome, significant progress has been made in molecular mapping, tagging or cloning of horticulturally important genes and quantitative trait loci (QTLs) in cucumber, which provides the foundation for practicing marker-assisted selection in cucumber breeding. ...

  12. Ab initio multiple cloning algorithm for quantum nonadiabatic molecular dynamics.

    PubMed

    Makhov, Dmitry V; Glover, William J; Martinez, Todd J; Shalashilin, Dmitrii V

    2014-08-07

    We present a new algorithm for ab initio quantum nonadiabatic molecular dynamics that combines the best features of ab initio Multiple Spawning (AIMS) and Multiconfigurational Ehrenfest (MCE) methods. In this new method, ab initio multiple cloning (AIMC), the individual trajectory basis functions (TBFs) follow Ehrenfest equations of motion (as in MCE). However, the basis set is expanded (as in AIMS) when these TBFs become sufficiently mixed, preventing prolonged evolution on an averaged potential energy surface. We refer to the expansion of the basis set as "cloning," in analogy to the "spawning" procedure in AIMS. This synthesis of AIMS and MCE allows us to leverage the benefits of mean-field evolution during periods of strong nonadiabatic coupling while simultaneously avoiding mean-field artifacts in Ehrenfest dynamics. We explore the use of time-displaced basis sets, "trains," as a means of expanding the basis set for little cost. We also introduce a new bra-ket averaged Taylor expansion (BAT) to approximate the necessary potential energy and nonadiabatic coupling matrix elements. The BAT approximation avoids the necessity of computing electronic structure information at intermediate points between TBFs, as is usually done in saddle-point approximations used in AIMS. The efficiency of AIMC is demonstrated on the nonradiative decay of the first excited state of ethylene. The AIMC method has been implemented within the AIMS-MOLPRO package, which was extended to include Ehrenfest basis functions.

  13. Ab initio multiple cloning algorithm for quantum nonadiabatic molecular dynamics

    SciTech Connect

    Makhov, Dmitry V.; Shalashilin, Dmitrii V.; Glover, William J.; Martinez, Todd J.

    2014-08-07

    We present a new algorithm for ab initio quantum nonadiabatic molecular dynamics that combines the best features of ab initio Multiple Spawning (AIMS) and Multiconfigurational Ehrenfest (MCE) methods. In this new method, ab initio multiple cloning (AIMC), the individual trajectory basis functions (TBFs) follow Ehrenfest equations of motion (as in MCE). However, the basis set is expanded (as in AIMS) when these TBFs become sufficiently mixed, preventing prolonged evolution on an averaged potential energy surface. We refer to the expansion of the basis set as “cloning,” in analogy to the “spawning” procedure in AIMS. This synthesis of AIMS and MCE allows us to leverage the benefits of mean-field evolution during periods of strong nonadiabatic coupling while simultaneously avoiding mean-field artifacts in Ehrenfest dynamics. We explore the use of time-displaced basis sets, “trains,” as a means of expanding the basis set for little cost. We also introduce a new bra-ket averaged Taylor expansion (BAT) to approximate the necessary potential energy and nonadiabatic coupling matrix elements. The BAT approximation avoids the necessity of computing electronic structure information at intermediate points between TBFs, as is usually done in saddle-point approximations used in AIMS. The efficiency of AIMC is demonstrated on the nonradiative decay of the first excited state of ethylene. The AIMC method has been implemented within the AIMS-MOLPRO package, which was extended to include Ehrenfest basis functions.

  14. Functional Identification and Characterization of Genes Cloned from Halophyte Seashore Paspalum Conferring Salinity and Cadmium Tolerance

    PubMed Central

    Chen, Yu; Chen, Chuanming; Tan, Zhiqun; Liu, Jun; Zhuang, Lili; Yang, Zhimin; Huang, Bingru

    2016-01-01

    Salinity-affected and heavy metal-contaminated soils limit the growth of glycophytic plants. Identifying genes responsible for superior tolerance to salinity and heavy metals in halophytes has great potential for use in developing salinity- and Cd-tolerant glycophytes. The objective of this study was to identify salinity- and Cd-tolerance related genes in seashore paspalum (Paspalum vaginatum), a halophytic perennial grass species, using yeast cDNA expression library screening method. Based on the Gateway-compatible vector system, a high-quality entry library was constructed, which contained 9.9 × 106 clones with an average inserted fragment length of 1.48 kb representing a 100% full-length rate. The yeast expression libraries were screened in a salinity-sensitive and a Cd-sensitive yeast mutant. The screening yielded 32 salinity-tolerant clones harboring 18 salinity-tolerance genes and 20 Cd-tolerant clones, including five Cd-tolerance genes. qPCR analysis confirmed that most of the 18 salinity-tolerance and five Cd-tolerance genes were up-regulated at the transcript level in response to salinity or Cd stress in seashore paspalum. Functional analysis indicated that salinity-tolerance genes from seashore paspalum could be involved mainly in photosynthetic metabolism, antioxidant systems, protein modification, iron transport, vesicle traffic, and phospholipid biosynthesis. Cd-tolerance genes could be associated with regulating pathways that are involved in phytochelatin synthesis, HSFA4-related stress protection, CYP450 complex, and sugar metabolism. The 18 salinity-tolerance genes and five Cd-tolerance genes could be potentially used as candidate genes for genetic modification of glycophytic grass species to improve salinity and Cd tolerance and for further analysis of molecular mechanisms regulating salinity and Cd tolerance. PMID:26904068

  15. Molecular cloning of cecropin B responsive endonucleases in Yersinia ruckeri

    Technology Transfer Automated Retrieval System (TEKTRAN)

    We have previously demonstrated that Yersinia ruckeri resists cecropin B in an inducible manner. In this study, we sought to identify the molecular changes responsible for the inducible cecropin B resistance of Y. ruckeri. Differences in gene expression associated with the inducible resistance were ...

  16. Cloning, characterization and targeting of the mouse HEXA gene

    SciTech Connect

    Wakamatsu, N.; Trasler, J.M.; Gravel, R.A.

    1994-09-01

    The HEXA gene, encoding the {alpha} subunit of {beta}-hexosaminidase A, is essential for the metabolism of ganglioside G{sub M2}, and defects in this gene cause Tay-Sachs disease in humans. To elucidate the role of the gene in the nervous system of the mouse and to establish a mouse model of Tay-Sachs disease, we have cloned and characterized the HEXA gene and targeted a disruption of the gene in mouse ES cells. The mouse HEXA gene spans {approximately}26 kb and consists of 14 exons, similar to the human gene. A heterogeneous transcription initiation site was identified 21-42 bp 5{prime} of the initiator ATG, with two of the sites fitting the consensus CTCA (A = start) as seen for some weak initiator systems. Promoter analysis showed that the first 150 bp 5{prime} of the ATG contained 85% of promoter activity observed in constructs containing up to 1050 bp of 5{prime} sequence. The active region contained a sequence matching that of the adenovirus major late promoter upstream element factor. A survey of mouse tissues showed that the highest mRNA levels were in (max to min): testis (5.5 x brain cortex), adrenal, epididymis, heart, brain, lung, kidney, and liver (0.3 x brain cortex). A 12 kb BstI/SalI fragment containing nine exons was disrupted with the insertion of the bacterial neo{sup r} gene in exon 11 and was targeted into 129/Sv ES cells by homologous recombination. Nine of 153 G418 resistant clones were correctly targeted as confirmed by Southern blotting. The heterozygous ES cells were microinjected into mouse blastocysts and implanted into pseudo-pregnant mice. Nine male chimeric mice, showing that 40-95% chimerism for the 129/Sv agouti coat color marker, are being bred in an effort to generate germline transmission of the disrupted HEXA gene.

  17. Molecular cloning of a lectin cDNA from Alocasia macrorrhiza and prediction of its characteristics.

    PubMed

    Zhu, Ya-Ran; Wang, Jie; Huang, Bing-Qiu; Hou, Xue-Wen

    2006-12-01

    The cDNA of Alocasia macrorrhiza lectin (aml, GenBank accession number: DQ340864) was cloned by RACE-PCR and its characteristics were predicted by various bioinformatics tools. GSPs (Gene Specific Primers) were designed according to the conserved regions of the genes encoded for lectins and similar proteins from the same family Araceae. Total RNAs were extracted from the tubers of A macrorrhiza by Qiagen RNeasy mini kit. The 3'- and 5'-RACE-PCRs were performed with the isolated total RNAs by SMART(TM)RACE cDNA amplification kit from BD Biosciences Clontech Company, respectively. The purified PCR products were ligated with pMD 18-T vector, and the confirmed clones were sequenced. The full-length cDNA of aml was obtained by combination of 3'- and 5'-end sequences, and was then confirmed by full-length 3'-RACE-PCR. The aml cDNA is 1 124 bp long. The deduced amino acid length of AML lectin is 270 aa. Its relative molecular weight is 29.7 kD. The results of homologous analysis showed a high similarity between AML and other mannose-binding lectins and similar proteins from Araceae family. Two typical B-lectin domains and three mannose- binding motifs were found in the sequence of AML. With all these taken together, it can be concluded that this newly cloned aml cDNA encodes for a mannose-binding lectin.

  18. Analysis of nuclear reprogramming in cloned miniature pig embryos by expression of Oct-4 and Oct-4 related genes

    SciTech Connect

    Lee, Eugine; Lee, So Hyun; Kim, Sue

    2006-10-06

    Xenotransplantation is a rapidly expanding field of research and cloned miniature pigs have been considered as a model animal for it. However, the efficiency of somatic cell nuclear transfer (SCNT) is extremely low, with most clones resulting in early lethality and several kinds of aberrant development. A possible explanation for the developmental failure of SCNT embryos is insufficient reprogramming of the somatic cell nucleus by the oocyte. In order to test this, we analyzed the reprogramming capacity of differentiated fibroblast cell nuclei and embryonic germ cell nuclei with Oct-4 and Oct-4 related genes (Ndp5211, Dppa2, Dppa3, and Dppa5), which are important for embryonic development, Hand1 and GATA-4, which are important for placental development, as molecular markers using RT-PCR. The Oct-4 expression level was significantly lower (P < 0.05) in cloned hatched blastocysts derived from fibroblasts and many of fibroblast-derived clones failed to reactivate at least one of the tested genes, while most of the germ cell clones and control embryos correctly expressed these genes. In conclusion, our results suggest that the reprogramming of fibroblast-derived cloned embryos is highly aberrant and this improper reprogramming could be one reason of the early lethality and post-implantation anomalies of somatic cell-derived clones.

  19. Molecular cloning and evolutionary analysis of GJB6 in mammals.

    PubMed

    Ru, Binghua; Han, Naijian; He, Guimei; Brayer, Kathryn; Zhang, Shuyi; Wang, Zhe

    2012-04-01

    GJB6 plays a crucial role in hearing. In mammals, bats use ultrasonic echolocation for orientation and locating prey. To investigate the evolution of GJB6 in mammals, we cloned the full-length coding region of GJB6 from 16 species of bats and 4 other mammal species and compared them with orthologous sequences in 11 other mammals. The results show purifying selection on GJB6 in mammals, as well as in the bat lineage, which indicates an important role for GJB6 in mammal hearing. We also found one unique amino acid substitution shared by 16 species of bats and 10 shared by two species of artiodactyls. This positioned the artiodactyls at an abnormal location in the gene tree. In addition, the cytoplasmic loop and carboxy terminus were more variable than other domains in all the mammals. These results demonstrate that GJB6 is basically conserved in mammals but has undergone relatively rapid evolution in particular lineages and domains.

  20. Cloning and characterization of a murine SIL gene

    SciTech Connect

    Collazo-Garcia, N.; Scherer, P.; Aplan, P.D.

    1995-12-10

    The human SIL gene is disrupted by a site-specific interstitial deletion in 25% of children with T-cell acute lymphoblastic leukemia. Since transcriptionally active genes are prone to recombination events, the recurrent nature of this lesion suggests that the SIL gene product is transcriptionally active in the cell type that undergoes this interstitial deletion and that the SIL gene product may play a role in normal lymphoid development. To facilitate studies of SIL gene function, we have cloned and characterized a murine SIL gene. The predicted murine SIL protein is 75% identical to the human gene, with good homology throughout the open reading frame. An in vitro translated SIL cDNA generated a protein slightly larger than the predicted 139-kDa protein. Although a prior report detected SIL mRNA expression exclusively in hematopoietic tissues, a sensitive RT-PCR assay demonstrated SIL expression to be ubiquitous, detectable in all tissues examined. Since the RT-PCR assay suggested that SIL mRNA expression was higher in rapidly proliferating tissues, we assayed SIL mRNA expression using a murine erythroleukemia model of terminal differentiation and found it to be dramatically decreased in conjunction with terminal differentiation. These studies demonstrate that the human SIL gene product is quite well conserved in rodents and suggest that the SIL gene product may play a role in cell proliferation. 26 refs., 6 figs.

  1. CXPD: Cloning and characterization of the Chinese hamster XPD gene

    SciTech Connect

    Kirchner, J.M.; Salazar, E.P.; Lamerdin, J.E.; Carrano, A.V.; Weber, C.A.

    1994-12-31

    The Chinese hamster Xeroderma Pigmentosum group D (CXPD) nucleotide excision repair gene was cloned from the V79 cell line, and its nucleotide sequence was determined. The -15 kb gene is comprised of 23 exons with a 2283 base open reading frame. The predicted 760 amino acid protein is 98%, 51%, and 54% identical to the human ERCC2/XPD, the S. cerevisiae RAD3, and the S. pombe rad15 proteins, respectively. The promoter region of the CXPD gene contains a pyrimidine-rich stretch similar to sequences found in the promoter regions of two other nucleotide excision repair genes, a GC box, a putative {alpha}-Pal transcription factor binding site, and two CAAT boxes. We are creating mutants in CHO cell lines corresponding to those found in the rad3ts, rem-1 and rem-2 mutant alleles of S. cerevisiae, which do not cause UV-sensitivity. After modification of cloned CXPD fragments by site-directed mutagenesis, the DNAs will be targeted into UV-sensitive CHO group 2 cell lines. We have identified the mutation in the single CXPD alleles of UV5 and UVL-13. SInce the mutations in these lines are sufficiently near the sites of the rad3ts and both rem mutations, we will introduce the altered DNAs into these group 2 cell lines and select for UV-resistance. These new CHO mutants may provide insights into possible roles of CXPD in DNA replication fidelity, and mismatch repair and may confirm the predicted essential function.

  2. Molecular cloning of porcine growth differentiation factor 9 (GDF-9) cDNA and its role in early folliculogenesis: direct ovarian injection of GDF-9 gene fragments promotes early folliculogenesis.

    PubMed

    Shimizu, Takashi; Miyahayashi, Yasunori; Yokoo, Masaki; Hoshino, Yumi; Sasada, Hiroshi; Sato, Eimei

    2004-11-01

    Growth differentiation factor-9 (GDF-9) is a growth factor secreted by oocytes in growing ovarian follicles. To investigate the ovarian function of GDF-9 in pigs, we first cloned porcine GDF-9 complementary DNA (cDNA), and then injected its gene fragments into the ovary in gilts. Porcine GDF-9 has open reading frame (ORF) homologies of 81.4%, 84.6%, 84.2%, 72.7% and 72.6% with its human, bovine, ovine, rat and mouse counterparts respectively. Regarding the deduced amino-acid sequence of the mature protein, the corresponding homologies reach 92.1%, 97.8%, 97.0%, 89.6% and 88.1% respectively. To investigate the role of GDF-9 in early folliculogenesis, the ovaries of 2-month-old prepubertal gilts were injected with GDF-9 gene fragments. The injection of porcine GDF-9 gene fragments resulted in an increase in the number of primary, secondary and tertiary follicles, concomitant with a decrease in the number of primordial follicles. These results indicated that exogenous GDF-9 can promote early folliculogenesis in the porcine ovary, and that a technique for direct ovarian injection of GFD-9 gene fragments may contribute to a novel therapy for prevention and treatment of infertility associated with ovarian dysfunction.

  3. Molecular cloning and heterologous expression of progesterone 5beta-reductase from Digitalis lanata Ehrh.

    PubMed

    Herl, Vanessa; Fischer, Gabriele; Müller-Uri, Frieder; Kreis, Wolfgang

    2006-02-01

    A full-length cDNA clone that encodes progesterone 5beta-reductase (5beta-POR) was isolated from Digitalis lanata leaves. The reading frame of the 5beta-POR gene is 1170 nucleotides corresponding to 389 amino acids. For expression, a Sph1/Sal1 5beta-POR fragment was cloned into the pQE vector and was transformed into Escherichia coli strain M15[pREP4]. The recombinant gene was functionally expressed and the recombinant enzyme was characterized. The K(m) and v(max) values for the putative natural substrate progesterone were calculated to be 0.120 mM and 45 nkat mg(-1) protein, respectively. Only 5beta-pregnane-3,20-dione but not its alpha-isomer was formed when progesterone was used as the substrate. Kinetic constants for cortisol, cortexone, 4-androstene-3,17-dione and NADPH were also determined. The molecular organization of the 5beta-POR gene in D. lanata was determined by Southern blot analysis. The 5beta-POR is highly conserved within the genus Digitalis and the respective genes and proteins share considerable homology to putative progesterone reductases from other plant species.

  4. Molecular cloning and in vitro expression of a cDNA clone for human cellular tumor antigen p53.

    PubMed Central

    Harlow, E; Williamson, N M; Ralston, R; Helfman, D M; Adams, T E

    1985-01-01

    Three clones for the human tumor antigen p53 were isolated from a cDNA library prepared from A431 cells. One of these clones, pR4-2, contains the entire coding region for human p53. This clone directs the synthesis of a polypeptide with the correct molecular weight and immunological epitopes of an authentic p53 molecule in an in vitro transcription-translation reaction. Although the pR4-2 clone contains the coding region for p53, it is not a full-length copy of the human p53 mRNA. Northern analysis showed that the p53 mRNA is approximately 2,500 nucleotides long, whereas the pR4-2 insert is only 1,760 base pairs in length. Analysis of the DNA sequence of this clone suggests that the human p53 polypeptide has 393 amino acids. We compared the predicted amino acid sequence of the pR4-2 clone with similar clones for the mouse p53 and found long regions of amino acid homology between these two molecules. Images PMID:3894933

  5. Cloning, sequencing and expression of the gene encoding the extracellular metalloprotease of Aeromonas caviae.

    PubMed

    Kawakami, K; Toma, C; Honma, Y

    2000-01-01

    A gene (apk) encoding the extracellular protease of Aeromonas caviae Ae6 has been cloned and sequenced. For cloning the gene, the DNA genomic library was screened using skim milk LB agar. One clone harboring plasmid pKK3 was selected for sequencing. Nucleotide sequencing of the 3.5 kb region of pKK3 revealed a single open reading frame (ORF) of 1,785 bp encoding 595 amino acids. The deduced polypeptide contained a putative 16-amino acid signal peptide followed by a large propeptide. The N-terminal amino acid sequence of purified recombinant protein (APK) was consistent with the DNA sequence. This result suggested a mature protein of 412 amino acids with a molecular mass of 44 kDa. However, the molecular mass of purified recombinant APK revealed 34 kDa by SDS-PAGE, suggesting that further processing at the C-terminal region took place. The 2 motifs of zinc binding sites deduced are highly conserved in the APK as well as in other zinc metalloproteases including V