Sample records for gene order conservation

  1. Evolution of gene order conservation in prokaryotes

    PubMed Central

    Tamames, Javier


    Background As more complete genomes are sequenced, conservation of gene order between different organisms is emerging as an informative property of the genomes. Conservation of gene order has been used for predicting function and functional interactions of proteins, as well as for studying the evolutionary relationships between genomes. The reasons for the maintenance of gene order are still not well understood, as the organization of the prokaryote genome into operons and lateral gene transfer cannot possibly account for all the instances of conservation found. Comprehensive studies of gene order are one way of elucidating the nature of these maintaining forces. Results Gene order is extensively conserved between closely related species, but rapidly becomes less conserved among more distantly related organisms, probably in a cooperative fashion. This trend could be universal in prokaryotic genomes, as archaeal genomes are likely to behave similarly to bacterial genomes. Gene order conservation could therefore be used as a valid phylogenetic measure to study relationships between species. Even between very distant species, remnants of gene order conservation exist in the form of highly conserved clusters of genes. This suggests the existence of selective processes that maintain the organization of these regions. Because the clusters often span more than one operon, common regulation probably cannot be invoked as the cause of the maintenance of gene order. Conclusions Gene order conservation is a genomic measure that can be useful for studying relationships between prokaryotes and the evolutionary forces shaping their genomes. Gene organization is extensively conserved in some genomic regions, and further studies are needed to elucidate the reason for this conservation. PMID:11423009

  2. The determinants of gene order conservation in yeasts

    PubMed Central

    Poyatos, Juan F; Hurst, Laurence D


    Background Why do some groups of physically linked genes stay linked over long evolutionary periods? Although several factors are associated with the formation of gene clusters in eukaryotic genomes, the particular contribution of each feature to clustering maintenance remains unclear. Results We quantify the strength of the proposed factors in a yeast lineage. First we identify the magnitude of each variable to determine linkage conservation by using several comparator species at different distances to Saccharomyces cerevisiae. For adjacent gene pairs, in line with null simulations, intergenic distance acts as the strongest covariate. Which of the other covariates appear important depends on the comparator, although high co-expression is related to synteny conservation commonly, especially in the more distant comparisons, these being expected to reveal strong but relatively rare selection. We also analyze those pairs that are immediate neighbors through all the lineages considered. Current intergene distance is again the best predictor, followed by the local density of essential genes and co-regulation, with co-expression and recombination rate being the weakest predictors. The genome duplication seen in yeast leaves some mark on linkage conservation, as adjacent pairs resolved as single copy in all post-whole genome duplication species are more often found as adjacent in pre-duplication species. Conclusion Current intergene distance is consistently the strongest predictor of synteny conservation as expected under a simple null model. Other variables are of lesser importance and their relevance depends both on the species comparison in question and the fate of the duplicates following genome duplication. PMID:17983469

  3. Conserved Gene Order and Expanded Inverted Repeats Characterize Plastid Genomes of Thalassiosirales

    PubMed Central

    Ashworth, Matt P.; Baeshen, Nabih A.; Baeshen, Mohammad N.; Bahieldin, Ahmed; Theriot, Edward C.; Jansen, Robert K.


    Diatoms are mostly photosynthetic eukaryotes within the heterokont lineage. Variable plastid genome sizes and extensive genome rearrangements have been observed across the diatom phylogeny, but little is known about plastid genome evolution within order- or family-level clades. The Thalassiosirales is one of the more comprehensively studied orders in terms of both genetics and morphology. Seven complete diatom plastid genomes are reported here including four Thalassiosirales: Thalassiosira weissflogii, Roundia cardiophora, Cyclotella sp. WC03_2, Cyclotella sp. L04_2, and three additional non-Thalassiosirales species Chaetoceros simplex, Cerataulina daemon, and Rhizosolenia imbricata. The sizes of the seven genomes vary from 116,459 to 129,498 bp, and their genomes are compact and lack introns. The larger size of the plastid genomes of Thalassiosirales compared to other diatoms is due primarily to expansion of the inverted repeat. Gene content within Thalassiosirales is more conserved compared to other diatom lineages. Gene order within Thalassiosirales is highly conserved except for the extensive genome rearrangement in Thalassiosira oceanica. Cyclotella nana, Thalassiosira weissflogii and Roundia cardiophora share an identical gene order, which is inferred to be the ancestral order for the Thalassiosirales, differing from that of the other two Cyclotella species by a single inversion. The genes ilvB and ilvH are missing in all six diatom plastid genomes except for Cerataulina daemon, suggesting an independent gain of these genes in this species. The acpP1 gene is missing in all Thalassiosirales, suggesting that its loss may be a synapomorphy for the order and this gene may have been functionally transferred to the nucleus. Three genes involved in photosynthesis, psaE, psaI, psaM, are missing in Rhizosolenia imbricata, which represents the first documented instance of the loss of photosynthetic genes in diatom plastid genomes. PMID:25233465

  4. Unusual conservation of mitochondrial gene order in Crassostrea oysters: evidence for recent speciation in Asia

    PubMed Central


    Background Oysters are morphologically plastic and hence difficult subjects for taxonomic and evolutionary studies. It is long been suspected, based on the extraordinary species diversity observed, that Asia Pacific is the epicenter of oyster speciation. To understand the species diversity and its evolutionary history, we collected five Crassostrea species from Asia and sequenced their complete mitochondrial (mt) genomes in addition to two newly released Asian oysters (C. iredalei and Saccostrea mordax) for a comprehensive analysis. Results The six Asian Crassostrea mt genomes ranged from 18,226 to 22,446 bp in size, and all coded for 39 genes (12 proteins, 2 rRNAs and 25 tRNAs) on the same strand. Their genomes contained a split of the rrnL gene and duplication of trnM, trnK and trnQ genes. They shared the same gene order that differed from an Atlantic sister species by as many as nine tRNA changes (6 transpositions and 3 duplications) and even differed significantly from S. mordax in protein-coding genes. Phylogenetic analysis indicates that the six Asian Crassostrea species emerged between 3 and 43 Myr ago, while the Atlantic species evolved 83 Myr ago. Conclusions The complete conservation of gene order in the six Asian Crassostrea species over 43 Myr is highly unusual given the remarkable rate of rearrangements in their sister species and other bivalves. It provides strong evidence for the recent speciation of the six Crassostrea species in Asia. It further indicates that changes in mt gene order may not be strictly a function of time but subject to other constraints that are presently not well understood. PMID:21189147

  5. Mitochondrial genomes of Clymenella torquata (Maldanidae) and Riftia pachyptila (Siboglinidae): evidence for conserved gene order in annelida.


    Jennings, Robert M; Halanych, Kenneth M


    Mitochondrial genomes are useful tools for inferring evolutionary history. However, many taxa are poorly represented by available data. Thus, to further understand the phylogenetic potential of complete mitochondrial genome sequence data in Annelida (segmented worms), we examined the complete mitochondrial sequence for Clymenella torquata (Maldanidae) and an estimated 80% of the sequence of Riftia pachyptila (Siboglinidae). These genomes have remarkably similar gene orders to previously published annelid genomes, suggesting that gene order is conserved across annelids. This result is interesting, given the high variation seen in the closely related Mollusca and Brachiopoda. Phylogenetic analyses of DNA sequence, amino acid sequence, and gene order all support the recent hypothesis that Sipuncula and Annelida are closely related. Our findings suggest that gene order data is of limited utility in annelids but that sequence data holds promise. Additionally, these genomes show AT bias (approximately 66%) and codon usage biases but have a typical gene complement for bilaterian mitochondrial genomes. PMID:15483328

  6. Making teeth to order: conserved genes reveal an ancient molecular pattern in paddlefish (Actinopterygii)

    PubMed Central

    Smith, Moya M.; Johanson, Zerina; Butts, Thomas; Ericsson, Rolf; Modrell, Melinda; Tulenko, Frank J.; Davis, Marcus C.; Fraser, Gareth J.


    Ray-finned fishes (Actinopterygii) are the dominant vertebrate group today (+30 000 species, predominantly teleosts), with great morphological diversity, including their dentitions. How dental morphological variation evolved is best addressed by considering a range of taxa across actinopterygian phylogeny; here we examine the dentition of Polyodon spathula (American paddlefish), assigned to the basal group Acipenseriformes. Although teeth are present and functional in young individuals of Polyodon, they are completely absent in adults. Our current understanding of developmental genes operating in the dentition is primarily restricted to teleosts; we show that shh and bmp4, as highly conserved epithelial and mesenchymal genes for gnathostome tooth development, are similarly expressed at Polyodon tooth loci, thus extending this conserved developmental pattern within the Actinopterygii. These genes map spatio-temporal tooth initiation in Polyodon larvae and provide new data in both oral and pharyngeal tooth sites. Variation in cellular intensity of shh maps timing of tooth morphogenesis, revealing a second odontogenic wave as alternate sites within tooth rows, a dental pattern also present in more derived actinopterygians. Developmental timing for each tooth field in Polyodon follows a gradient, from rostral to caudal and ventral to dorsal, repeated during subsequent loss of teeth. The transitory Polyodon dentition is modified by cessation of tooth addition and loss. As such, Polyodon represents a basal actinopterygian model for the evolution of developmental novelty: initial conservation, followed by tooth loss, accommodating the adult trophic modification to filter-feeding. PMID:25788604

  7. Conservation of Gene Order and Content in the Circular Chromosomes of ‘Candidatus Liberibacter asiaticus’ and Other Rhizobiales

    PubMed Central

    Kuykendall, L. David; Shao, Jonathan Y.; Hartung, John S.


    ‘Ca. Liberibacter asiaticus,’ an insect-vectored, obligate intracellular bacterium associated with citrus-greening disease, also called “HLB," is a member of the Rhizobiales along with nitrogen-fixing microsymbionts Sinorhizobium meliloti and Bradyrhizobium japonicum, plant pathogen Agrobacterium tumefaciens and facultative intracellular mammalian pathogen Bartonella henselae. Comparative analyses of their circular chromosomes identified 514 orthologous genes shared among all five species. Shared among all five species are 50 identical blocks of microsyntenous orthologous genes (MOGs), containing a total of 283 genes. While retaining highly conserved genomic blocks of microsynteny, divergent evolution, horizontal gene transfer and niche specialization have disrupted macrosynteny among the five circular chromosomes compared. Highly conserved microsyntenous gene clusters help define the Rhizobiales, an order previously defined by 16S RNA gene similarity and herein represented by the three families: Bartonellaceae, Bradyrhizobiaceae and Rhizobiaceae. Genes without orthologs in the other four species help define individual species. The circular chromosomes of each of the five Rhizobiales species examined had genes lacking orthologs in the other four species. For example, 63 proteins are encoded by genes of ‘Ca. Liberibacter asiaticus’ not shared with other members of the Rhizobiales. Of these 63 proteins, 17 have predicted functions related to DNA replication or RNA transcription, and some of these may have roles related to low genomic GC content. An additional 17 proteins have predicted functions relevant to cellular processes, particularly modifications of the cell surface. Seventeen unshared proteins have specific metabolic functions including a pathway to synthesize cholesterol encoded by a seven-gene operon. The remaining 12 proteins encoded by ‘Ca. Liberibacter asiaticus’ genes not shared with other Rhizobiales are of bacteriophage origin.

  8. Gene order is conserved within the human chromosome 21 linkage group on mouse chromosome 10

    SciTech Connect

    Irving, N.G.; Cabin, D.E.; Swanson, D.A.; Reeves, R.H. )


    One hundred progeny from each of two intersubspecific mouse backcrosses were used to construct a comparative genetic map of a region of mouse chromosome 10 (MMU10) that is homologous to the distal tip of the long arm of human chromosome 21 (HSA21). The analysis included five genes and three simple sequence repeat markers, two of which flanked the HSA21-homologous cluster on either side. Analysis of 200 backcross progeny detected at least one crossover between each pair of adjacent genes and demonstrated that the proximal to distal orientation of the cluster was reversed between human and mouse. The order was determined to be Fyn-1-D10Mit20-S100b-Col6a1-Itgb2-Pfk1/D10Mit7-D10Mit11. Comparative mapping supports the order of corresponding markers on HSA21 determined using pulsed-field gel electrophoresis and radiation hybrid line data. However, sequence tagged site content mapping of human yeast artificial chromosomes (YACs) yielded conflicting data on the relative positions of human COL6A1 and S100B on HSA21. This discrepancy was resolved here by demonstrating that several key YACs used in the human contig analysis were mistyped for S100B. The murine map reported here provides a scaffold for construction of physical maps and yeast artificial chromosome contigs that will be useful in the development of mouse models for the study of Down syndrome. 28 refs., 4 figs., 2 tabs.

  9. A Gene-Based Genetic Linkage Map of the Collared Flycatcher (Ficedula albicollis) Reveals Extensive Synteny and Gene-Order Conservation During 100 Million Years of Avian Evolution

    PubMed Central

    Backström, Niclas; Karaiskou, Nikoletta; Leder, Erica H.; Gustafsson, Lars; Primmer, Craig R.; Qvarnström, Anna; Ellegren, Hans


    By taking advantage of a recently developed reference marker set for avian genome analysis we have constructed a gene-based genetic map of the collared flycatcher, an important “ecological model” for studies of life-history evolution, sexual selection, speciation, and quantitative genetics. A pedigree of 322 birds from a natural population was genotyped for 384 single nucleotide polymorphisms (SNPs) from 170 protein-coding genes and 71 microsatellites. Altogether, 147 gene markers and 64 microsatellites form 33 linkage groups with a total genetic distance of 1787 cM. Male recombination rates are, on average, 22% higher than female rates (total distance 1982 vs. 1627 cM). The ability to anchor the collared flycatcher map with the chicken genome via the gene-based SNPs revealed an extraordinary degree of both synteny and gene-order conservation during avian evolution. The great majority of chicken chromosomes correspond to a single linkage group in collared flycatchers, with only a few cases of inter- and intrachromosomal rearrangements. The rate of chromosomal diversification, fissions/fusions, and inversions combined is thus considerably lower in birds (0.05/MY) than in mammals (0.6–2.0/MY). A dearth of repeat elements, known to promote chromosomal breakage, in avian genomes may contribute to their stability. The degree of genome stability is likely to have important consequences for general evolutionary patterns and may explain, for example, the comparatively slow rate by which genetic incompatibility among lineages of birds evolves. PMID:18562642

  10. Judicial review of conservation orders

    SciTech Connect

    Brown, R.L. Jr.


    Judicial review of orders issued by the Commissioner of Conservation may be sought under the authority of both Louisiana Revised Statutes 49:964 and Louisiana Revised Statutes 30:12. These statutes differ with respect to who may bring an action, the form of relief the reviewing court may grant, the scope of the evidence considered by the reviewing court, and the standards on the burden of proof. The application of laches under 30:12 is inconsistent with the 30-day delay periods provided by 49:964, and it is unworkable to the extent that it ignores the underlying need for finality of conservation orders. The continuing threat of subsequent court review destroys the credibility of the orders. Finality could be achieved under the current use of latches if a judicial determination established a definite length of reasonable delay. It is up to the legislature to correct the uncertainty introduced by 30:12. 91 references.

  11. Genetic Mapping in a Natural Population of Collared Flycatchers (Ficedula albicollis): Conserved Synteny but Gene Order Rearrangements on the Avian Z Chromosome

    PubMed Central

    Backström, Niclas; Brandström, Mikael; Gustafsson, Lars; Qvarnström, Anna; Cheng, Hans; Ellegren, Hans


    Data from completely sequenced genomes are likely to open the way for novel studies of the genetics of nonmodel organisms, in particular when it comes to the identification and analysis of genes responsible for traits that are under selection in natural populations. Here we use the draft sequence of the chicken genome as a starting point for linkage mapping in a wild bird species, the collared flycatcher—one of the most well-studied avian species in ecological and evolutionary research. A pedigree of 365 flycatchers was established and genotyped for single nucleotide polymorphisms in 23 genes selected from (and spread over most of) the chicken Z chromosome. All genes were also found to be located on the Z chromosome in the collared flycatcher, confirming conserved synteny at the level of gene content across distantly related avian lineages. This high degree of conservation mimics the situation seen for the mammalian X chromosome and may thus be a general feature in sex chromosome evolution, irrespective of whether there is male or female heterogamety. Alternatively, such unprecedented chromosomal conservation may be characteristic of most chromosomes in avian genome evolution. However, several internal rearrangements were observed, meaning that the transfer of map information from chicken to nonmodel bird species cannot always assume conserved gene orders. Interestingly, the rate of recombination on the Z chromosome of collared flycatchers was only ∼50% that of chicken, challenging the widely held view that birds generally have high recombination rates. PMID:16783008

  12. The first complete mitochondrial genome sequences of Amblypygi (Chelicerata: Arachnida) reveal conservation of the ancestral arthropod gene order.


    Fahrein, Kathrin; Masta, Susan E; Podsiadlowski, Lars


    Amblypygi (whip spiders) are terrestrial chelicerates inhabiting the subtropics and tropics. In morphological and rRNA-based phylogenetic analyses, Amblypygi cluster with Uropygi (whip scorpions) and Araneae (spiders) to form the taxon Tetrapulmonata, but there is controversy regarding the interrelationship of these three taxa. Mitochondrial genomes provide an additional large data set of phylogenetic information (sequences, gene order, RNA secondary structure), but in arachnids, mitochondrial genome data are missing for some of the major orders. In the course of an ongoing project concerning arachnid mitochondrial genomics, we present the first two complete mitochondrial genomes from Amblypygi. Both genomes were found to be typical circular duplex DNA molecules with all 37 genes usually present in bilaterian mitochondrial genomes. In both species, gene order is identical to that of Limulus polyphemus (Xiphosura), which is assumed to reflect the putative arthropod ground pattern. All tRNA gene sequences have the potential to fold into structures that are typical of metazoan mitochondrial tRNAs, except for tRNA-Ala, which lacks the D arm in both amblypygids, suggesting the loss of this feature early in amblypygid evolution. Phylogenetic analysis resulted in weak support for Uropygi being the sister group of Amblypygi. PMID:19448726

  13. Conservation and gene banking

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Plant conservation has several objectives the main ones include safeguarding our food supply, preserving crop wild relatives for breeding and selection of new cultivars, providing material for industrial and pharmaceutical uses and preserving the beauty and diversity of our flora for generations to ...

  14. Karyotype evolution in monitor lizards: cross-species chromosome mapping of cDNA reveals highly conserved synteny and gene order in the Toxicofera clade.


    Srikulnath, Kornsorn; Uno, Yoshinobu; Nishida, Chizuko; Matsuda, Yoichi


    The water monitor lizard (Varanus salvator macromaculatus (VSA), Platynota) has a chromosome number of 2n = 40: its karyotype consists of 16 macrochromosomes and 24 microchromosomes. To delineate the process of karyotype evolution in V. salvator macromaculatus, we constructed a cytogenetic map with 86 functional genes and compared it with those of the butterfly lizard (Leiolepis reevesii rubritaeniata (LRE); 2n = 36) and Japanese four-striped rat snake (Elaphe quadrivirgata (EQU); 2n = 36), members of the Toxicofera clade. The syntenies and gene orders of macrochromosomes were highly conserved between these species except for several chromosomal rearrangements: eight pairs of VSA macrochromosomes and/or chromosome arms exhibited homology with six pairs of LRE macrochromosomes and eight pairs of EQU macrochromosomes. Furthermore, the genes mapped to microchromosomes of three species were all located on chicken microchromosomes or chromosome 4p. No reciprocal translocations were found in the species, and their karyotypic differences were caused by: low frequencies of interchromosomal rearrangements, such as tandem fusions, or centric fissions/fusions between macrochromosomes and between macro- and microchromosomes; and intrachromosomal rearrangements, such as paracentric inversions or centromere repositioning. The chromosomal rearrangements that occurred in macrochromosomes of the Varanus lineage were also identified through comparative cytogenetic mapping of V. salvator macromaculatus and V. exanthematicus. Morphologic differences in chromosomes 6-8 between the two species could have resulted from pericentric inversion or centromere repositioning. PMID:24343421

  15. Targeted gene flow for conservation.


    Kelly, Ella; Phillips, Ben L


    Anthropogenic threats often impose strong selection on affected populations, causing rapid evolutionary responses. Unfortunately, these adaptive responses are rarely harnessed for conservation. We suggest that conservation managers pay close attention to adaptive processes and geographic variation, with an eye to using them for conservation goals. Translocating pre-adapted individuals into recipient populations is currently considered a potentially important management tool in the face of climate change. Targeted gene flow, which involves moving individuals with favorable traits to areas where these traits would have a conservation benefit, could have a much broader application in conservation. Across a species' range there may be long-standing geographic variation in traits or variation may have rapidly developed in response to a threatening process. Targeted gene flow could be used to promote natural resistance to threats to increase species resilience. We suggest that targeted gene flow is a currently underappreciated strategy in conservation that has applications ranging from the management of invasive species and their impacts to controlling the impact and virulence of pathogens. PMID:26332195

  16. Time ordering of gene coexpression.


    Leng, Xiaoyan; Müller, Hans-Georg


    Temporal microarray gene expression profiles allow characterization of gene function through time dynamics of gene coexpression within the same genetic pathway. In this paper, we define and estimate a global time shift characteristic for each gene via least squares, inferred from pairwise curve alignments. These time shift characteristics of individual genes reflect a time ordering that is derived from ob- served temporal gene expression profiles. Once these time shift characteristics are obtained for each gene, they can be entered into further analyses, such as clustering. We illustrate the proposed methodology using Drosophila embryonic development and yeast cell-cycle gene expression profiles, as well as simulations. Feasibility is demonstrated through the successful recovery of time ordering. Estimated time shifts for Drosophila maternal and zygotic genes provide excellent discrimination between these two categories and confirm known genetic pathways through the time order of gene expression. The application to yeast cell-cycle data establishes a natural time order of genes that is in line with cell-cycle phases. The method does not require periodicity of gene expression profiles. Asymptotic justifications are also provided. PMID:16495429

  17. Evolution of mitochondrial gene order in Annelida.


    Weigert, Anne; Golombek, Anja; Gerth, Michael; Schwarz, Francine; Struck, Torsten H; Bleidorn, Christoph


    Annelida is a highly diverse animal group with over 21,000 described species. As part of Lophotrochozoa, the vast majority of annelids are currently classified into two groups: Errantia and Sedentaria, together forming Pleistoannelida. Besides these taxa, Sipuncula, Amphinomidae, Chaetopteridae, Oweniidae and Magelonidae can be found branching at the base of the tree. Comparisons of mitochondrial genomes have been used to investigate phylogenetic relationship within animal taxa. Complete annelid mitochondrial genomes are available for some Sedentaria and Errantia and in most cases exhibit a highly conserved gene order. Only two complete genomes have been published from the basal branching lineages and these are restricted to Sipuncula. We describe the first complete mitochondrial genome sequences for all other basal branching annelid families: Owenia fusiformis (Oweniidae), Magelona mirabilis (Magelonidae), Eurythoe complanata (Amphinomidae), Chaetopterus variopedatus and Phyllochaetopterus sp. (Chaetopteridae). The mitochondrial gene order of all these taxa is substantially different from the pattern found in Pleistoannelida. Additionally, we report the first mitochondrial genomes in Annelida that encode genes on both strands. Our findings demonstrate that the supposedly highly conserved mitochondrial gene order suggested for Annelida is restricted to Pleistoannelida, representing the ground pattern of this group. All investigated basal branching annelid taxa show a completely different arrangement of genes than observed in Pleistoannelida. The gene order of protein coding and ribosomal genes in Magelona mirabilis differs only in two transposition events from a putative lophotrochozoan ground pattern and might be the closest to an ancestral annelid pattern. The mitochondrial genomes of Myzostomida show the conserved pattern of Pleistoannelida, thereby supporting their inclusion in this taxon. PMID:26299879

  18. Complete DNA sequence of the mitochondrial genome of the sea-slug, Aplysia californica: conservation of the gene order in Euthyneura.


    Knudsen, Bjarne; Kohn, Andrea B; Nahir, Ben; McFadden, Catherine S; Moroz, Leonid L


    We have sequenced and characterized the complete mitochondrial genome of the sea slug, Aplysia californica, an important model organism in experimental biology and a representative of Anaspidea (Opisthobranchia, Gastropoda). The mitochondrial genome of Aplysia is in the small end of the observed sizes of animal mitochondrial genomes (14,117 bp, NCBI Accession No. NC_005827). The Aplysia genome, like most other mitochondrial genomes, encodes genes for 2 ribosomal subunit RNAs (small and large rRNAs), 22 tRNAs, and 13 protein subunits (cytochrome c oxidase subunits 1-3, cytochrome b apoenzyme, ATP synthase subunits 6 and 8, and NADH dehydrogenase subunits 1-6 and 4L). The gene order is virtually identical between opisthobranchs and pulmonates, with the majority of differences arising from tRNA translocations. In contrast, the gene order from representatives of basal gastropods and other molluscan classes is significantly different from opisthobranchs and pulmonates. The Aplysia genome was compared to all other published molluscan mitochondrial genomes and phylogenetic analyses were carried out using a concatenated protein alignment. Phylogenetic analyses using maximum likelihood based analyses of the well aligned regions of the protein sequences support both monophyly of Euthyneura (a group including both the pulmonates and opisthobranchs) and Opisthobranchia (as a more derived group). The Aplysia mitochondrial genome sequenced here will serve as an important platform in both comparative and neurobiological studies using this model organism. PMID:16230032

  19. Intron conservation in the fragile X gene (FMR 1)

    SciTech Connect

    Panther, R.; Ostrowski, R.S.; Stoerker, J.


    The intron probe STB12.3 was used to search for conservation of the intron sequence corresponding to the PstI fragment located approximately 450 bp downstream of the end of the first exon of the fragile X (FMR 1) gene. Standard techniques for DNA extraction, isolation, restriction enzyme digestion, blotting and probing were employed. The probe STB12.3 that hybridizes to an intron sequence in the human MR 1 gene is 1.2 bp long. Our results demonstrated that the STB12.3 sequence is conserved across at least two Kindgoms. Specifically, we have observed cross-hybridization between STB12.3 and sequences in Drosophila, Apis and Saccharomyces. Hybridization was not observed in Triticum. Most surprising was our observation of intron hybridization in Drosophila since Annemieke et al. (1991) did not find FMR 1 exon conservation in Drosophila. Intron sequence conservation had been previously reported but only between closely related (same Order) species.

  20. Conserved organization of genes in trypanosomatids.


    Bringaud, F; Vedrenne, C; Cuvillier, A; Parzy, D; Baltz, D; Tetaud, E; Pays, E; Venegas, J; Merlin, G; Baltz, T


    Trypanosomatids are unicellular protozoan parasites which constitute some of the most primitive eukaryotes. Leishmania spp, Trypanosoma cruzi and members of the Trypanosoma brucei group, which cause human diseases, are the most studied representatives of this large family. Here we report a comparative analysis of a large genomic region containing glucose transporter genes in three Salivarian trypanosomes (T. brucei, T. congolense and T. vivax), T. cruzi and Leishmania donovani. In T. brucei, the 8 kb (upstream) and 14 kb (downstream) regions flanking the glucose transporter genes cluster contain two and six new genes, respectively, six of them encoding proteins homologous to known eukaryotic proteins (phosphatidylinositol 3 kinase, ribosomal protein S12, DNAJ and three small G-proteins--Rab1, YPT6 and ARL3). This gene organization is identical in T. brucei, T. congolense and T. vivax suggesting that Salivarian trypanosomes have a high level of conservation in gene organization. In T. cruzi and Leishmania, the overall organization of this cluster is conserved, with insertion of additional genes when compared with T. brucei. Phylogenetic reconstitution based on glucose transporters is in accord with the monophyly of the genus Trypanosoma and the early separation of T. vivax within Salivarian trypanosomes. On the basis of gene organization, biochemical characteristics of isoforms and phylogeny, we discuss the genesis of the glucose transporter multigene family in Salivarian trypanosomes. PMID:9747975

  1. 77 FR 60381 - Migratory Bird Conservation; Executive Order 13186

    Federal Register 2010, 2011, 2012, 2013, 2014


    ... National Oceanic and Atmospheric Administration RIN 0648-XC148 Migratory Bird Conservation; Executive Order... the U.S. Fish and ] Wildlife Service (FWS) to promote the conservation of migratory birds. DATES: This... Migratory Birds''. One of the requirements of E.O. 13186 is that each Federal agency taking actions...

  2. Second-order accurate nonoscillatory schemes for scalar conservation laws

    NASA Technical Reports Server (NTRS)

    Huynh, Hung T.


    Explicit finite difference schemes for the computation of weak solutions of nonlinear scalar conservation laws is presented and analyzed. These schemes are uniformly second-order accurate and nonoscillatory in the sense that the number of extrema of the discrete solution is not increasing in time.

  3. Robust high-order space-time conservative schemes for solving conservation laws on hybrid meshes

    NASA Astrophysics Data System (ADS)

    Shen, Hua; Wen, Chih-Yung; Liu, Kaixin; Zhang, Deliang


    In this paper, the second-order space-time conservation element and solution element (CE/SE) method proposed by Chang (1995) [3] is implemented on hybrid meshes for solving conservation laws. In addition, the present scheme has been extended to high-order versions including third and fourth order. Most methodologies of proposed schemes are consistent with that of the original CE/SE method, including: (i) a unified treatment of space and time (thereby ensuring good conservation in both space and time); (ii) a highly compact node stencil (the solution node is calculated using only the neighboring mesh nodes) regardless of the order of accuracy at the cost of storing all derivatives. A staggered time marching strategy is adopted and the solutions are updated alternatively between cell centers and vertexes. To construct explicit high-order schemes, second- and third-order derivatives are calculated by a modified finite-difference/weighted-average procedure which is different from that used to calculate the first-order derivatives. The present schemes can be implemented on a wide variety of meshes, including triangular, quadrilateral and hybrid (consisting of both triangular and quadrilateral elements). Beyond that, it can be easily extended to arbitrary-order schemes and arbitrary shape of polygonal elements by using the present methodologies. A series of common benchmark examples are used to confirm the accuracy and robustness of the proposed schemes.

  4. CoreSVM: a generalized high-order spectral volume method bearing Conservative Order RElease

    NASA Astrophysics Data System (ADS)

    Lamouroux, Raphael; Gressier, Jeremie; Joly, Laurent; Grondin, Gilles


    The spectral volume method (SVM) introduced by Wang in 2002 is based on a compact polynomial reconstruction where the interpolation's degree is driven by the partition of the spectral volumes. We propose a generalization of the SVM which releases the polynomial degree from this constraint and more importantly that allows to resort to any polynomial order inferior to the regular stencil order without changing the original spectral volume partition. Using one-dimensional advection and Burgers equation, we prove that the proposed extended method exhibits versatile high-order convergence together with conservativity properties. This new method is thus named the CoreSVM for Conservative Order-REleased SVM and we therefore explore its potential towards the numerical simulation of stiff problems. It is stressed that CoreSVM is indeed particularly suited to handle discontinuities, as the order-reduction serves to damp the numerical oscillations due to Runge's phenomenon. To ensure computational stability, local p-coarsening is used to obtain the highest adequate polynomial degree. It is advocated finally that, since the CoreSVM sets the polynomial order adaptation free from any stencil changes, these features do not come at the expense of any extra remeshing or data adaptation cost. Part of this research was funded by the French DGA.

  5. Genes conserved for arbuscular mycorrhizal symbiosis identified through phylogenomics.


    Bravo, Armando; York, Thomas; Pumplin, Nathan; Mueller, Lukas A; Harrison, Maria J


    Arbuscular mycorrhizal symbiosis (AMS), a widespread mutualistic association of land plants and fungi(1), is predicted to have arisen once, early in the evolution of land plants(2-4). Consistent with this notion, several genes required for AMS have been conserved throughout evolution(5) and their symbiotic functions preserved, at least between monocot and dicot plants(6,7). Despite its significance, knowledge of the plants' genetic programme for AMS is limited. To date, most genes required for AMS have been found through commonalities with the evolutionarily younger nitrogen-fixing Rhizobium legume symbiosis (RLS)(8) or by reverse genetic analyses of differentially expressed candidate genes(9). Large sequence-indexed insertion mutant collections and recent genome editing technologies have vastly increased the power of reverse genetics but selection of candidate genes, from the thousands of genes that change expression during AMS, remains an arbitrary process. Here, we describe a phylogenomics approach to identify genes whose evolutionary history predicts conservation for AMS and we demonstrate the accuracy of the predictions through reverse genetics analysis. Phylogenomics analysis of 50 plant genomes resulted in 138 genes from Medicago truncatula predicted to function in AMS. This includes 15 genes with known roles in AMS. Additionally, we demonstrate that mutants in six previously uncharacterized AMS-conserved genes are all impaired in AMS. Our results demonstrate that phylogenomics is an effective strategy to identify a set of evolutionarily conserved genes required for AMS. PMID:27249190

  6. Switchgrass Gene Pools for Conservation and Restoration

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Panicum virgatum L. (switchgrass) is a perennial grass native to the North American tallgrass prairie and broadly adapted to the central and eastern USA. Movement of plant materials throughout this region creates the potential of contaminating local gene pools with genes that are not native to a lo...

  7. Physella acuta: atypical mitochondrial gene order among panpulmonates (Gastropoda)

    PubMed Central

    Nolan, Journey R.; Bergthorsson, Ulfar; Adema, Coen M.


    Mitochondrial (mt) sequences are frequently used for phylogenetic reconstruction and for identification of species of molluscs. This study expands the phylogenetic range of Hygrophila (Panpulmonata) for which such sequence data are available by characterizing the full mt genome of the invasive freshwater snail Physella acuta (Physidae). The mt genome sequences of two P. acuta isolates from Stubblefield Lake, New Mexico, USA, differed in length (14,490 vs 14,314 bp) and showed 11.49% sequence divergence, whereas ITS1 and ITS2 sequences from the nuclear genome differed by 1.75%. The mt gene order of P. acuta (cox1, P, nad6, nad5, nad1, D, F, cox2, Y, W, nad4L, C, Q, atp6, R, E, rrnS, M, T, cox3, I, nad2, K, V, rrnL, L1, A, cytb, G, H, L2, atp8, N, nad2, S1, S2, nad4) differs considerably from the relatively conserved gene order within Panpulmonata. Phylogenetic trees show that the 13 protein-encoding mt gene sequences (equivalent codons) of P. acuta group according to gastropod phylogeny, yet branch lengths and dN/dS ratios for P. acuta indicate elevated amino acid substitutions relative to other gastropods. This study indicates that mt sequences of P. acuta are phylogenetically informative despite a considerable intraspecific divergence and the atypical gene order in its mt genome. PMID:25368439

  8. Evolutionary conservation of regulatory elements in vertebrate HOX gene clusters

    SciTech Connect

    Santini, Simona; Boore, Jeffrey L.; Meyer, Axel


    Due to their high degree of conservation, comparisons of DNA sequences among evolutionarily distantly-related genomes permit to identify functional regions in noncoding DNA. Hox genes are optimal candidate sequences for comparative genome analyses, because they are extremely conserved in vertebrates and occur in clusters. We aligned (Pipmaker) the nucleotide sequences of HoxA clusters of tilapia, pufferfish, striped bass, zebrafish, horn shark, human and mouse (over 500 million years of evolutionary distance). We identified several highly conserved intergenic sequences, likely to be important in gene regulation. Only a few of these putative regulatory elements have been previously described as being involved in the regulation of Hox genes, while several others are new elements that might have regulatory functions. The majority of these newly identified putative regulatory elements contain short fragments that are almost completely conserved and are identical to known binding sites for regulatory proteins (Transfac). The conserved intergenic regions located between the most rostrally expressed genes in the developing embryo are longer and better retained through evolution. We document that presumed regulatory sequences are retained differentially in either A or A clusters resulting from a genome duplication in the fish lineage. This observation supports both the hypothesis that the conserved elements are involved in gene regulation and the Duplication-Deletion-Complementation model.

  9. Conservation of alternative polyadenylation patterns in mammalian genes

    PubMed Central

    Ara, Takeshi; Lopez, Fabrice; Ritchie, William; Benech, Philippe; Gautheret, Daniel


    Background Alternative polyadenylation is a widespread mechanism contributing to transcript diversity in eukaryotes. Over half of mammalian genes are alternatively polyadenylated. Our understanding of poly(A) site evolution is limited by the lack of a reliable identification of conserved, equivalent poly(A) sites among species. We introduce here a working definition of conserved poly(A) sites as sites that are both (i) properly aligned in human and mouse orthologous 3' untranslated regions (UTRs) and (ii) supported by EST or cDNA data in both species. Results We identified about 4800 such conserved poly(A) sites covering one third of the orthologous gene set studied. Characteristics of conserved poly(A) sites such as processing efficiency and tissue-specificity were analyzed. Conserved sites show a higher processing efficiency but no difference in tissular distribution when compared to non-conserved sites. In general, alternative poly(A) sites are species-specific and involve minor, non-conserved sites that are unlikely to play essential roles. However, there are about 500 genes with conserved tandem poly(A) sites. A significant fraction of these conserved tandems display a conserved arrangement of major/minor sites in their 3' UTR, suggesting that these alternative 3' ends may be under selection. Conclusion This analysis allows us to identify potential functional alternative poly(A) sites and provides clues on the selective mechanisms at play in the appearance of multiple poly(A) sites and their maintenance in the 3' UTRs of genes. PMID:16872498

  10. High-Order Space-Time Methods for Conservation Laws

    NASA Technical Reports Server (NTRS)

    Huynh, H. T.


    Current high-order methods such as discontinuous Galerkin and/or flux reconstruction can provide effective discretization for the spatial derivatives. Together with a time discretization, such methods result in either too small a time step size in the case of an explicit scheme or a very large system in the case of an implicit one. To tackle these problems, two new high-order space-time schemes for conservation laws are introduced: the first is explicit and the second, implicit. The explicit method here, also called the moment scheme, achieves a Courant-Friedrichs-Lewy (CFL) condition of 1 for the case of one-spatial dimension regardless of the degree of the polynomial approximation. (For standard explicit methods, if the spatial approximation is of degree p, then the time step sizes are typically proportional to 1/p(exp 2)). Fourier analyses for the one and two-dimensional cases are carried out. The property of super accuracy (or super convergence) is discussed. The implicit method is a simplified but optimal version of the discontinuous Galerkin scheme applied to time. It reduces to a collocation implicit Runge-Kutta (RK) method for ordinary differential equations (ODE) called Radau IIA. The explicit and implicit schemes are closely related since they employ the same intermediate time levels, and the former can serve as a key building block in an iterative procedure for the latter. A limiting technique for the piecewise linear scheme is also discussed. The technique can suppress oscillations near a discontinuity while preserving accuracy near extrema. Preliminary numerical results are shown

  11. Bioinformatic Identification of Conserved Cis-Sequences in Coregulated Genes.


    Bülow, Lorenz; Hehl, Reinhard


    Bioinformatics tools can be employed to identify conserved cis-sequences in sets of coregulated plant genes because more and more gene expression and genomic sequence data become available. Knowledge on the specific cis-sequences, their enrichment and arrangement within promoters, facilitates the design of functional synthetic plant promoters that are responsive to specific stresses. The present chapter illustrates an example for the bioinformatic identification of conserved Arabidopsis thaliana cis-sequences enriched in drought stress-responsive genes. This workflow can be applied for the identification of cis-sequences in any sets of coregulated genes. The workflow includes detailed protocols to determine sets of coregulated genes, to extract the corresponding promoter sequences, and how to install and run a software package to identify overrepresented motifs. Further bioinformatic analyses that can be performed with the results are discussed. PMID:27557771

  12. The drug target genes show higher evolutionary conservation than non-target genes

    PubMed Central

    Liu, Panpan; Luan, Meiwei; Zhu, Hongjie; Liu, Guiyou; Zhang, Mingming; Lv, Hongchao; Duan, Lian; Shang, Zhenwei; Li, Jin; Jiang, Yongshuai; Zhang, Ruijie


    Although evidence indicates that drug target genes share some common evolutionary features, there have been few studies analyzing evolutionary features of drug targets from an overall level. Therefore, we conducted an analysis which aimed to investigate the evolutionary characteristics of drug target genes. We compared the evolutionary conservation between human drug target genes and non-target genes by combining both the evolutionary features and network topological properties in human protein-protein interaction network. The evolution rate, conservation score and the percentage of orthologous genes of 21 species were included in our study. Meanwhile, four topological features including the average shortest path length, betweenness centrality, clustering coefficient and degree were considered for comparison analysis. Then we got four results as following: compared with non-drug target genes, 1) drug target genes had lower evolutionary rates; 2) drug target genes had higher conservation scores; 3) drug target genes had higher percentages of orthologous genes and 4) drug target genes had a tighter network structure including higher degrees, betweenness centrality, clustering coefficients and lower average shortest path lengths. These results demonstrate that drug target genes are more evolutionarily conserved than non-drug target genes. We hope that our study will provide valuable information for other researchers who are interested in evolutionary conservation of drug targets. PMID:26716901

  13. Training-Task Orders and Transfer in Conservation.

    ERIC Educational Resources Information Center

    May, Richard B.; Norton, Janice M.


    Two experiments were carried out in which groups of children (mean age = 68 months) were matched on number, length, mass, and liquid conservation scores and then trained on a distance-layout task developed by Inhelder et al (1974). (Author/MP)

  14. Using intron position conservation for homology-based gene prediction

    PubMed Central

    Keilwagen, Jens; Wenk, Michael; Erickson, Jessica L.; Schattat, Martin H.; Grau, Jan; Hartung, Frank


    Annotation of protein-coding genes is very important in bioinformatics and biology and has a decisive influence on many downstream analyses. Homology-based gene prediction programs allow for transferring knowledge about protein-coding genes from an annotated organism to an organism of interest. Here, we present a homology-based gene prediction program called GeMoMa. GeMoMa utilizes the conservation of intron positions within genes to predict related genes in other organisms. We assess the performance of GeMoMa and compare it with state-of-the-art competitors on plant and animal genomes using an extended best reciprocal hit approach. We find that GeMoMa often makes more precise predictions than its competitors yielding a substantially increased number of correct transcripts. Subsequently, we exemplarily validate GeMoMa predictions using Sanger sequencing. Finally, we use RNA-seq data to compare the predictions of homology-based gene prediction programs, and find again that GeMoMa performs well. Hence, we conclude that exploiting intron position conservation improves homology-based gene prediction, and we make GeMoMa freely available as command-line tool and Galaxy integration. PMID:26893356

  15. Using intron position conservation for homology-based gene prediction.


    Keilwagen, Jens; Wenk, Michael; Erickson, Jessica L; Schattat, Martin H; Grau, Jan; Hartung, Frank


    Annotation of protein-coding genes is very important in bioinformatics and biology and has a decisive influence on many downstream analyses. Homology-based gene prediction programs allow for transferring knowledge about protein-coding genes from an annotated organism to an organism of interest.Here, we present a homology-based gene prediction program called GeMoMa. GeMoMa utilizes the conservation of intron positions within genes to predict related genes in other organisms. We assess the performance of GeMoMa and compare it with state-of-the-art competitors on plant and animal genomes using an extended best reciprocal hit approach. We find that GeMoMa often makes more precise predictions than its competitors yielding a substantially increased number of correct transcripts. Subsequently, we exemplarily validate GeMoMa predictions using Sanger sequencing. Finally, we use RNA-seq data to compare the predictions of homology-based gene prediction programs, and find again that GeMoMa performs well.Hence, we conclude that exploiting intron position conservation improves homology-based gene prediction, and we make GeMoMa freely available as command-line tool and Galaxy integration. PMID:26893356

  16. Importance of gene flow to germplasm conservation and development

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Gene banks conserve and make available valuable germplasm that scientists and plant breeders can deploy to develop useful traits. The USDA National Plant Germplasm System (NPGS) manages over 542,000 germplasm accessions. A large part of our work is regenerating accessions when seed numbers decline. ...

  17. Conservation of Gbx genes from EHG homeobox in bivalve molluscs.


    Mesías-Gansbiller, Crimgilt; Sánchez, José L; Pazos, Antonio J; Lozano, Vanessa; Martínez-Escauriaza, Roi; Luz Pérez-Parallé, M


    Homeobox-containing genes encode a set of transcription factors that have been shown to control spatial patterning mechanisms in bilaterian organism development. The homeobox gene Gbx, included in the EHGbox cluster, is implicated in the development of the nervous system. In this study, we surveyed five different families of Bivalvia for the presence of Gbx genes by means of PCR with degenerate primers. We were able to recover seven Gbx gene fragments from five bivalve species: Solen marginatus, Mimachlamys varia, Venerupis pullastra, Ostrea edulis and Mytilus galloprovincialis (the derived amino acid sequence were designated Sma-Gbx, Cva-Gbx, Vpu-Gbx, Oed-Gbx and Mga-Gbx, respectively). These genes are orthologous to various Gbx genes present in bilaterian genomes. The Gbx genes in four Bivalvia families, namely Solenidae, Veneridae, Ostreidae and Mytilidae, are newly reported here and we also showed additional information of the Gbx genes of Pectinidae. The phylogenetic analyses by neighbour-joining, UPGMA, maximum parsimony and Bayesian analysis clearly indicated that the Gbx sequences formed a well supported clade and assigned these Gbx genes to the Gbx family. These data permit to confirm that the homeodomain of the Gbx family is highly conserved among these five distinct families of bivalve molluscs. PMID:22245384

  18. Characterization of Conserved and Non-conserved Imprinted Genes in Swine

    Technology Transfer Automated Retrieval System (TEKTRAN)

    In order to increase our understanding of the role of imprinted genes in swine reproduction we used two complementary approaches, analysis of imprinting by pyrosequencing, and expression profiling of parthenogenetic fetuses, to carry out a comprehensive analysis of this gene family in swine. Using A...

  19. Identifying Human Disease Genes through Cross-Species Gene Mapping of Evolutionary Conserved Processes

    PubMed Central

    Poot, Martin; Badea, Alexandra; Williams, Robert W.; Kas, Martien J.


    Background Understanding complex networks that modulate development in humans is hampered by genetic and phenotypic heterogeneity within and between populations. Here we present a method that exploits natural variation in highly diverse mouse genetic reference panels in which genetic and environmental factors can be tightly controlled. The aim of our study is to test a cross-species genetic mapping strategy, which compares data of gene mapping in human patients with functional data obtained by QTL mapping in recombinant inbred mouse strains in order to prioritize human disease candidate genes. Methodology We exploit evolutionary conservation of developmental phenotypes to discover gene variants that influence brain development in humans. We studied corpus callosum volume in a recombinant inbred mouse panel (C57BL/6J×DBA/2J, BXD strains) using high-field strength MRI technology. We aligned mouse mapping results for this neuro-anatomical phenotype with genetic data from patients with abnormal corpus callosum (ACC) development. Principal Findings From the 61 syndromes which involve an ACC, 51 human candidate genes have been identified. Through interval mapping, we identified a single significant QTL on mouse chromosome 7 for corpus callosum volume with a QTL peak located between 25.5 and 26.7 Mb. Comparing the genes in this mouse QTL region with those associated with human syndromes (involving ACC) and those covered by copy number variations (CNV) yielded a single overlap, namely HNRPU in humans and Hnrpul1 in mice. Further analysis of corpus callosum volume in BXD strains revealed that the corpus callosum was significantly larger in BXD mice with a B genotype at the Hnrpul1 locus than in BXD mice with a D genotype at Hnrpul1 (F = 22.48, p<9.87*10−5). Conclusion This approach that exploits highly diverse mouse strains provides an efficient and effective translational bridge to study the etiology of human developmental disorders, such as autism and schizophrenia

  20. Conserved gene clusters in bacterial genomes provide further support for the primacy of RNA

    NASA Technical Reports Server (NTRS)

    Siefert, J. L.; Martin, K. A.; Abdi, F.; Widger, W. R.; Fox, G. E.


    Five complete bacterial genome sequences have been released to the scientific community. These include four (eu)Bacteria, Haemophilus influenzae, Mycoplasma genitalium, M. pneumoniae, and Synechocystis PCC 6803, as well as one Archaeon, Methanococcus jannaschii. Features of organization shared by these genomes are likely to have arisen very early in the history of the bacteria and thus can be expected to provide further insight into the nature of early ancestors. Results of a genome comparison of these five organisms confirm earlier observations that gene order is remarkably unpreserved. There are, nevertheless, at least 16 clusters of two or more genes whose order remains the same among the four (eu)Bacteria and these are presumed to reflect conserved elements of coordinated gene expression that require gene proximity. Eight of these gene orders are essentially conserved in the Archaea as well. Many of these clusters are known to be regulated by RNA-level mechanisms in Escherichia coli, which supports the earlier suggestion that this type of regulation of gene expression may have arisen very early. We conclude that although the last common ancestor may have had a DNA genome, it likely was preceded by progenotes with an RNA genome.

  1. Reconstruction of ancestral gene orders using intermediate genomes

    PubMed Central


    Background The problem of reconstructing ancestral genomes in a given phylogenetic tree arises in many different comparative genomics fields. Here, we focus on reconstructing the gene order of ancestral genomes, a problem that has been largely studied in the past 20 years, especially with the increasing availability of whole genome DNA sequences. There are two main approaches to this problem: event-based methods, that try to find the ancestral genomes that minimize the number of rearrangement events in the tree; and homology-based, that look for conserved structures, such as adjacent genes in the extant genomes, to build the ancestral genomes. Results We propose algorithms that use the concept of intermediate genomes, arising in optimal pairwise rearrangement scenarios. We show that intermediate genomes have combinatorial properties that make them easy to reconstruct, and develop fast algorithms with better reconstructed ancestral genomes than current event-based methods. The proposed framework is also designed to accept extra information, such as results from homology-based approaches, giving rise to combined algorithms with better results than the original methods. PMID:26451811

  2. Deciphering the onychophoran 'segmentation gene cascade': Gene expression reveals limited involvement of pair rule gene orthologs in segmentation, but a highly conserved segment polarity gene network.


    Janssen, Ralf; Budd, Graham E


    The hallmark of the arthropods is their segmented body, although origin of segmentation, however, is unresolved. In order to shed light on the origin of segmentation we investigated orthologs of pair rule genes (PRGs) and segment polarity genes (SPGs) in a member of the closest related sister-group to the arthropods, the onychophorans. Our gene expression data analysis suggests that most of the onychophoran PRGs do not play a role in segmentation. One possible exception is the even-skipped (eve) gene that is expressed in the posterior end of the onychophoran where new segments are likely patterned, and is also expressed in segmentation-gene typical transverse stripes in at least a number of newly formed segments. Other onychophoran PRGs such as runt (run), hairy/Hes (h/Hes) and odd-skipped (odd) do not appear to have a function in segmentation at all. Onychophoran PRGs that act low in the segmentation gene cascade in insects, however, are potentially involved in segment-patterning. Most obvious is that from the expression of the pairberry (pby) gene ortholog that is expressed in a typical SPG-pattern. Since this result suggested possible conservation of the SPG-network we further investigated SPGs (and associated factors) such as Notum in the onychophoran. We find that the expression patterns of SPGs in arthropods and the onychophoran are highly conserved, suggesting a conserved SPG-network in these two clades, and indeed also in an annelid. This may suggest that the common ancestor of lophotrochozoans and ecdysozoans was already segmented utilising the same SPG-network, or that the SPG-network was recruited independently in annelids and onychophorans/arthropods. PMID:23880430

  3. DLGP: A database for lineage-conserved and lineage-specific gene pairs in animal and plant genomes.


    Wang, Dapeng


    The conservation of gene organization in the genome with lineage-specificity is an invaluable resource to decipher their potential functionality with diverse selective constraints, especially in higher animals and plants. Gene pairs appear to be the minimal structure for such kind of gene clusters that tend to reside in their preferred locations, representing the distinctive genomic characteristics in single species or a given lineage. Despite gene families having been investigated in a widespread manner, the definition of gene pair families in various taxa still lacks adequate attention. To address this issue, we report DLGP ( that stores the pre-calculated lineage-based gene pairs in currently available 134 animal and plant genomes and inspect them under the same analytical framework, bringing out a set of innovational features. First, the taxonomy or lineage has been classified into four levels such as Kingdom, Phylum, Class and Order. It adopts all-to-all comparison strategy to identify the possible conserved gene pairs in all species for each gene pair in certain species and reckon those that are conserved in over a significant proportion of species in a given lineage (e.g. Primates, Diptera or Poales) as the lineage-conserved gene pairs. Furthermore, it predicts the lineage-specific gene pairs by retaining the above-mentioned lineage-conserved gene pairs that are not conserved in any other lineages. Second, it carries out pairwise comparison for the gene pairs between two compared species and creates the table including all the conserved gene pairs and the image elucidating the conservation degree of gene pairs in chromosomal level. Third, it supplies gene order browser to extend gene pairs to gene clusters, allowing users to view the evolution dynamics in the gene context in an intuitive manner. This database will be able to facilitate the particular comparison between animals and plants, between vertebrates and arthropods, and

  4. Octocoral Mitochondrial Genomes Provide Insights into the Phylogenetic History of Gene Order Rearrangements, Order Reversals, and Cnidarian Phylogenetics

    PubMed Central

    Figueroa, Diego F.; Baco, Amy R.


    We use full mitochondrial genomes to test the robustness of the phylogeny of the Octocorallia, to determine the evolutionary pathway for the five known mitochondrial gene rearrangements in octocorals, and to test the suitability of using mitochondrial genomes for higher taxonomic-level phylogenetic reconstructions. Our phylogeny supports three major divisions within the Octocorallia and show that Paragorgiidae is paraphyletic, with Sibogagorgia forming a sister branch to the Coralliidae. Furthermore, Sibogagorgia cauliflora has what is presumed to be the ancestral gene order in octocorals, but the presence of a pair of inverted repeat sequences suggest that this gene order was not conserved but rather evolved back to this apparent ancestral state. Based on this we recommend the resurrection of the family Sibogagorgiidae to fix the paraphyly of the Paragorgiidae. This is the first study to show that in the Octocorallia, mitochondrial gene orders have evolved back to an ancestral state after going through a gene rearrangement, with at least one of the gene orders evolving independently in different lineages. A number of studies have used gene boundaries to determine the type of mitochondrial gene arrangement present. However, our findings suggest that this method known as gene junction screening may miss evolutionary reversals. Additionally, substitution saturation analysis demonstrates that while whole mitochondrial genomes can be used effectively for phylogenetic analyses within Octocorallia, their utility at higher taxonomic levels within Cnidaria is inadequate. Therefore for phylogenetic reconstruction at taxonomic levels higher than subclass within the Cnidaria, nuclear genes will be required, even when whole mitochondrial genomes are available. PMID:25539723

  5. A conserved family of elav-like genes in vertebrates.

    PubMed Central

    Good, P J


    A large family of genes encodes proteins with RNA recognition motifs that are presumed to bind RNA and to function in posttranscriptional regulation. Neural-specific members of this family include elav, a gene required for correct differentiation and maintenance of neurons in Drosophila melanogaster, and a related gene, HuD, which is expressed in human neuronal cells. I have identified genes related to elav and HuD in Xenopus laevis, zebrafish, and mouse that define a family of four closely related vertebrate elav-like genes (elrA, elrB, elrC, and elrD) in fish, frogs, and mammals. In addition to protein sequence conservation, a segment of the 3'-untranslated sequence of elrD is also conserved, implying a functional role in elrD expression. In adult frogs, elrC and elrD are exclusively expressed in the brain, whereas elrB is expressed in brain, testis, and ovary. During Xenopus development, elrC and elrD RNAs are detected by late gastrula and late neurula stages, respectively, whereas a nervous system-specific elrB RNA species is expressed by early tadpole stage. Additional elrB transcripts are detected in the ovary and early embryo, demonstrating a maternal supply of mRNA and possibly of protein. These expression patterns suggest a role for different elav-like genes in early development and neuronal differentiation. Surprisingly, elrA is expressed in all adult tissues tested and at all times during development. Thus, the widely expressed elrA is expected to have a related function in all cells. Images Fig. 4 Fig. 5 PMID:7753842

  6. Unusual Gene Order and Organization of the Sea Urchin HoxCluster

    SciTech Connect

    Richardson, Paul M.; Lucas, Susan; Cameron, R. Andrew; Rowen,Lee; Nesbitt, Ryan; Bloom, Scott; Rast, Jonathan P.; Berney, Kevin; Arenas-Mena, Cesar; Martinez, Pedro; Davidson, Eric H.; Peterson, KevinJ.; Hood, Leroy


    The highly consistent gene order and axial colinear expression patterns found in vertebrate hox gene clusters are less well conserved across the rest of bilaterians. We report the first deuterostome instance of an intact hox cluster with a unique gene order where the paralog groups are not expressed in a sequential manner. The finished sequence from BAC clones from the genome of the sea urchin, Strongylocentrotus purpuratus, reveals a gene order wherein the anterior genes (Hox1, Hox2 and Hox3) lie nearest the posterior genes in the cluster such that the most 3' gene is Hox5. (The gene order is : 5'-Hox1,2, 3, 11/13c, 11/13b, '11/13a, 9/10, 8, 7, 6, 5 - 3)'. The finished sequence result is corroborated by restriction mapping evidence and BAC-end scaffold analyses. Comparisons with a putative ancestral deuterostome Hox gene cluster suggest that the rearrangements leading to the sea urchin gene order were many and complex.

  7. Unusual Gene Order and Organization of the Sea Urchin Hox Cluster

    SciTech Connect

    Cameron, R A; Rowen, L; Nesbitt, R; Bloom, S; Rast, J P; Berney, K; Arenas-Mena, C; Martinez, P; Lucas, S; Richardson, P M; Davidson, E H; Peterson, K J; Hood, L


    The highly consistent gene order and axial colinear expression patterns found in vertebrate hox gene clusters are less well conserved across the rest of bilaterians. We report the first deuterostome instance of an intact hox cluster with a unique gene order where the paralog groups are not expressed in a sequential manner. The finished sequence from BAC clones from the genome of the sea urchin, Strongylocentrotus purpuratus, reveals a gene order wherein the anterior genes (Hox1, Hox2 and Hox3) lie nearest the posterior genes in the cluster such that the most 3 gene is Hox5. (The gene order is : 5-Hox1, 2, 3, 11/13c, 11/13b, 11/13a, 9/10, 8, 7, 6, 5 - 3). The finished sequence result is corroborated by restriction mapping evidence and BAC-end scaffold analyses. Comparisons with a putative ancestral deuterostome Hox gene cluster suggest that the rearrangements leading to the sea urchin gene order were many and complex.

  8. Conservation laws and a new expansion method for sixth order Boussinesq equation

    NASA Astrophysics Data System (ADS)

    Yokuş, Asıf; Kaya, Doǧan


    In this study, we analyze the conservation laws of a sixth order Boussinesq equation by using variational derivative. We get sixth order Boussinesq equation's traveling wave solutions with (1/G) -expansion method which we constitute newly by being inspired with (G/G) -expansion method which is suggested in [1]. We investigate conservation laws of the analytical solutions which we obtained by the new constructed method. The analytical solution's conductions which we get according to new expansion method are given graphically.

  9. Energy Stable Flux Formulas For The Discontinuous Galerkin Discretization Of First Order Nonlinear Conservation Laws

    NASA Technical Reports Server (NTRS)

    Barth, Timothy; Charrier, Pierre; Mansour, Nagi N. (Technical Monitor)


    We consider the discontinuous Galerkin (DG) finite element discretization of first order systems of conservation laws derivable as moments of the kinetic Boltzmann equation. This includes well known conservation law systems such as the Euler For the class of first order nonlinear conservation laws equipped with an entropy extension, an energy analysis of the DG method for the Cauchy initial value problem is developed. Using this DG energy analysis, several new variants of existing numerical flux functions are derived and shown to be energy stable.

  10. Characterization of Conserved and Nonconserved Imprinted Genes in Swine

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Genomic imprinting results in the silencing of a subset of mammalian alleles due to parent-of-origin inheritance. Due to the nature of their expression patterns they play a critical role in placental and early embryonic development. In order to increase our understanding of imprinted genes specifi...

  11. Inversions and Gene Order Shuffling in Anopheles gambiae and A. funestus

    NASA Astrophysics Data System (ADS)

    Sharakhov, Igor V.; Serazin, Andrew C.; Grushko, Olga G.; Dana, Ali; Lobo, Neil; Hillenmeyer, Maureen E.; Westerman, Richard; Romero-Severson, Jeanne; Costantini, Carlo; Sagnon, N'Fale; Collins, Frank H.; Besansky, Nora J.


    In tropical Africa, Anopheles funestus is one of the three most important malaria vectors. We physically mapped 157 A. funestus complementary DNAs (cDNAs) to the polytene chromosomes of this species. Sequences of the cDNAs were mapped in silico to the A. gambiae genome as part of a comparative genomic study of synteny, gene order, and sequence conservation between A. funestus and A. gambiae. These species are in the same subgenus and diverged about as recently as humans and chimpanzees. Despite nearly perfect preservation of synteny, we found substantial shuffling of gene order along corresponding chromosome arms. Since the divergence of these species, at least 70 chromosomal inversions have been fixed, the highest rate of rearrangement of any eukaryote studied to date. The high incidence of paracentric inversions and limited colinearity suggests that locating genes in one anopheline species based on gene order in another may be limited to closely related taxa.

  12. Similarity-based gene detection: using COGs to find evolutionarily-conserved ORFs

    PubMed Central

    Powell, Bradford C; Hutchison, Clyde A


    Background Experimental verification of gene products has not kept pace with the rapid growth of microbial sequence information. However, existing annotations of gene locations contain sufficient information to screen for probable errors. Furthermore, comparisons among genomes become more informative as more genomes are examined. We studied all open reading frames (ORFs) of at least 30 codons from the genomes of 27 sequenced bacterial strains. We grouped the potential peptide sequences encoded from the ORFs by forming Clusters of Orthologous Groups (COGs). We used this grouping in order to find homologous relationships that would not be distinguishable from noise when using simple BLAST searches. Although COG analysis was initially developed to group annotated genes, we applied it to the task of grouping anonymous DNA sequences that may encode proteins. Results "Mixed COGs" of ORFs (clusters in which some sequences correspond to annotated genes and some do not) are attractive targets when seeking errors of gene predicion. Examination of mixed COGs reveals some situations in which genes appear to have been missed in current annotations and a smaller number of regions that appear to have been annotated as gene loci erroneously. This technique can also be used to detect potential pseudogenes or sequencing errors. Our method uses an adjustable parameter for degree of conservation among the studied genomes (stringency). We detail results for one level of stringency at which we found 83 potential genes which had not previously been identified, 60 potential pseudogenes, and 7 sequences with existing gene annotations that are probably incorrect. Conclusion Systematic study of sequence conservation offers a way to improve existing annotations by identifying potentially homologous regions where the annotation of the presence or absence of a gene is inconsistent among genomes. PMID:16423288

  13. Expression analysis of five zebrafish RXFP3 homologues reveals evolutionary conservation of gene expression pattern.


    Donizetti, Aldo; Fiengo, Marcella; Iazzetti, Giovanni; del Gaudio, Rosanna; Di Giaimo, Rossella; Pariante, Paolo; Minucci, Sergio; Aniello, Francesco


    Relaxin peptides exert different functions in reproduction and neuroendocrine processes via interaction with two evolutionarily unrelated groups of receptors: RXFP1 and RXFP2 on one hand, RXFP3 and RXFP4 on the other hand. Evolution of receptor genes after splitting of tetrapods and teleost lineage led to a different retention rate between mammals and fish, with the latter having more gene copies compared to the former. In order to improve our knowledge on the evolution of the relaxin ligands/receptors system and have insights on their function in early stages of life, in the present paper we analyzed the expression pattern of five zebrafish RXFP3 homologue genes during embryonic development. In our analysis, we show that only two of the five genes are expressed during embryogenesis and that their transcripts are present in all the developmental stages. Spatial localization analysis of these transcripts revealed that the gene expression is restricted in specific territories starting from early pharyngula stage. Both genes are expressed in the brain but in different cell clusters and in extra-neural territories, one gene in the interrenal gland and the other in the pancreas. These two genes share expression territories with the homologue mammalian counterpart, highlighting a general conservation of gene expression regulatory processes and their putative function during evolution that are established early in vertebrate embryogenesis. PMID:25384467

  14. Mitochondrial gene order change in Schistosoma (Platyhelminthes: Digenea: Schistosomatidae).


    Webster, Bonnie L; Littlewood, D Timothy J


    In the flatworm genus Schistosoma, species of which include parasites of biomedical and veterinary importance, mitochondrial gene order is radically different in some species. A PCR-based survey of 19 schistosomatid spp. established which of 14 Schistosoma spp. have the ancestral (plesiomorphic) or derived gene order condition. A phylogeny for Schistosoma was estimated and used to infer the origin of the gene order change which is present in all members of a clade containing Schistosoma incognitum and members of the traditionally recognised Schistosoma indicum, Schistosoma mansoni and Schistosomahaematobium spp. groups. Schistosoma turkestanicum, with the plesiomorphic gene order state, is sister to this clade. Common interval analysis suggests change in gene order, from ancestral to derived, consisted of two sequential transposition events: (a) nad1_nad3 to nad3_nad1 and (b) [atp6,nad2]_[nad3,-nad1,cox1,rrnL,rrnS,cox2,nad6] to [nad3,nad1,cox1,rrnL,rrnS,cox2,nad6]_[atp6,nad2], where gene order offragments within square brackets remain unchanged. Gene order change is rare in parasitic flatworms and is a robust synapomorphy for schistosome spp. that exhibit it. The schistosomatid phylogeny casts some doubt on the origin of Schistosoma (Asian or African), highlights the propensity for species to hosts witch amongst mammalian (definitive) hosts, and indicates the likely importance of snail (intermediate)hosts in determining and defining patterns of schistosome radiation and continental invasion. Mitogenomic sampling of Schistosoma dattai and Schistosoma harinasutai to determine gene order, and within key species, especially S. turkestanicum and S. incognitum, to determine ancestral ranges, may help discover the geographic origins of gene order change in the genus. Samples of S. incognitum from India and Thailand suggest this taxon may include cryptic species. PMID:23362512

  15. The spatial fourth-order energy-conserved S-FDTD scheme for Maxwell's equations

    NASA Astrophysics Data System (ADS)

    Liang, Dong; Yuan, Qiang


    In this paper we develop a new spatial fourth-order energy-conserved splitting finite-difference time-domain method for Maxwell's equations. Based on the staggered grids, the splitting technique is applied to lead to a three-stage energy-conserved splitting scheme. At each stage, using the spatial fourth-order difference operators on the strict interior nodes by a linear combination of two central differences, one with a spatial step and the other with three spatial steps, we first propose the spatial high-order near boundary differences on the near boundary nodes which ensure the scheme to preserve energy conservations and to have fourth-order accuracy in space step. The proposed scheme has the important properties: energy-conserved, unconditionally stable, non-dissipative, high-order accurate, and computationally efficient. We first prove that the scheme satisfies energy conversations and is in unconditional stability. We then prove the optimal error estimates of fourth-order in spatial step and second-order in time step for the electric and magnetic fields and obtain the convergence and error estimate of divergence-free as well. Numerical dispersion analysis and numerical experiments are presented to confirm our theoretical results.

  16. Inference of gene interaction networks using conserved subsequential patterns from multiple time course gene expression datasets

    PubMed Central


    Motivation Deciphering gene interaction networks (GINs) from time-course gene expression (TCGx) data is highly valuable to understand gene behaviors (e.g., activation, inhibition, time-lagged causality) at the system level. Existing methods usually use a global or local proximity measure to infer GINs from a single dataset. As the noise contained in a single data set is hardly self-resolved, the results are sometimes not reliable. Also, these proximity measurements cannot handle the co-existence of the various in vivo positive, negative and time-lagged gene interactions. Methods and results We propose to infer reliable GINs from multiple TCGx datasets using a novel conserved subsequential pattern of gene expression. A subsequential pattern is a maximal subset of genes sharing positive, negative or time-lagged correlations of one expression template on their own subsets of time points. Based on these patterns, a GIN can be built from each of the datasets. It is assumed that reliable gene interactions would be detected repeatedly. We thus use conserved gene pairs from the individual GINs of the multiple TCGx datasets to construct a reliable GIN for a species. We apply our method on six TCGx datasets related to yeast cell cycle, and validate the reliable GINs using protein interaction networks, biopathways and transcription factor-gene regulations. We also compare the reliable GINs with those GINs reconstructed by a global proximity measure Pearson correlation coefficient method from single datasets. It has been demonstrated that our reliable GINs achieve much better prediction performance especially with much higher precision. The functional enrichment analysis also suggests that gene sets in a reliable GIN are more functionally significant. Our method is especially useful to decipher GINs from multiple TCGx datasets related to less studied organisms where little knowledge is available except gene expression data. PMID:26681650

  17. Phylogenetic Resolution of Deep Eukaryotic and Fungal Relationships Using Highly Conserved Low-Copy Nuclear Genes.


    Ren, Ren; Sun, Yazhou; Zhao, Yue; Geiser, David; Ma, Hong; Zhou, Xiaofan


    A comprehensive and reliable eukaryotic tree of life is important for many aspects of biological studies from comparative developmental and physiological analyses to translational medicine and agriculture. Both gene-rich and taxon-rich approaches are effective strategies to improve phylogenetic accuracy and are greatly facilitated by marker genes that are universally distributed, well conserved, and orthologous among divergent eukaryotes. In this article, we report the identification of 943 low-copy eukaryotic genes and we show that many of these genes are promising tools in resolving eukaryotic phylogenies, despite the challenges of determining deep eukaryotic relationships. As a case study, we demonstrate that smaller subsets of ∼20 and 52 genes could resolve controversial relationships among widely divergent taxa and provide strong support for deep relationships such as the monophyly and branching order of several eukaryotic supergroups. In addition, the use of these genes resulted in fungal phylogenies that are congruent with previous phylogenomic studies that used much larger datasets, and successfully resolved several difficult relationships (e.g., forming a highly supported clade with Microsporidia, Mitosporidium and Rozella sister to other fungi). We propose that these genes are excellent for both gene-rich and taxon-rich analyses and can be applied at multiple taxonomic levels and facilitate a more complete understanding of the eukaryotic tree of life. PMID:27604879

  18. Geometric conservation law and applications to high-order finite difference schemes with stationary grids

    NASA Astrophysics Data System (ADS)

    Deng, Xiaogang; Mao, Meiliang; Tu, Guohua; Liu, Huayong; Zhang, Hanxin


    The geometric conservation law (GCL) includes the volume conservation law (VCL) and the surface conservation law (SCL). Though the VCL is widely discussed for time-depending grids, in the cases of stationary grids the SCL also works as a very important role for high-order accurate numerical simulations. The SCL is usually not satisfied on discretized grid meshes because of discretization errors, and the violation of the SCL can lead to numerical instabilities especially when high-order schemes are applied. In order to fulfill the SCL in high-order finite difference schemes, a conservative metric method (CMM) is presented. This method is achieved by computing grid metric derivatives through a conservative form with the same scheme applied for fluxes. The CMM is proven to be a sufficient condition for the SCL, and can ensure the SCL for interior schemes as well as boundary and near boundary schemes. Though the first-level difference operators δ3 have no effects on the SCL, no extra errors can be introduced as δ3 = δ2. The generally used high-order finite difference schemes are categorized as central schemes (CS) and upwind schemes (UPW) based on the difference operator δ1 which are used to solve the governing equations. The CMM can be applied to CS and is difficult to be satisfied by UPW. Thus, it is critical to select the difference operator δ1 to reduce the SCL-related errors. Numerical tests based on WCNS-E-5 show that the SCL plays a very important role in ensuring free-stream conservation, suppressing numerical oscillations, and enhancing the robustness of the high-order scheme in complex grids.

  19. High-Order Entropy Stable Finite Difference Schemes for Nonlinear Conservation Laws: Finite Domains

    NASA Technical Reports Server (NTRS)

    Fisher, Travis C.; Carpenter, Mark H.


    Developing stable and robust high-order finite difference schemes requires mathematical formalism and appropriate methods of analysis. In this work, nonlinear entropy stability is used to derive provably stable high-order finite difference methods with formal boundary closures for conservation laws. Particular emphasis is placed on the entropy stability of the compressible Navier-Stokes equations. A newly derived entropy stable weighted essentially non-oscillatory finite difference method is used to simulate problems with shocks and a conservative, entropy stable, narrow-stencil finite difference approach is used to approximate viscous terms.

  20. Pangenome Analysis of Burkholderia pseudomallei: Genome Evolution Preserves Gene Order despite High Recombination Rates

    PubMed Central

    Spring-Pearson, Senanu M.; Stone, Joshua K.; Doyle, Adina; Allender, Christopher J.; Okinaka, Richard T.; Mayo, Mark; Broomall, Stacey M.; Hill, Jessica M.; Karavis, Mark A.; Hubbard, Kyle S.; Insalaco, Joseph M.; McNew, Lauren A.; Rosenzweig, C. Nicole; Gibbons, Henry S.; Currie, Bart J.; Wagner, David M.; Keim, Paul; Tuanyok, Apichai


    The pangenomic diversity in Burkholderia pseudomallei is high, with approximately 5.8% of the genome consisting of genomic islands. Genomic islands are known hotspots for recombination driven primarily by site-specific recombination associated with tRNAs. However, recombination rates in other portions of the genome are also high, a feature we expected to disrupt gene order. We analyzed the pangenome of 37 isolates of B. pseudomallei and demonstrate that the pangenome is ‘open’, with approximately 136 new genes identified with each new genome sequenced, and that the global core genome consists of 4568±16 homologs. Genes associated with metabolism were statistically overrepresented in the core genome, and genes associated with mobile elements, disease, and motility were primarily associated with accessory portions of the pangenome. The frequency distribution of genes present in between 1 and 37 of the genomes analyzed matches well with a model of genome evolution in which 96% of the genome has very low recombination rates but 4% of the genome recombines readily. Using homologous genes among pairs of genomes, we found that gene order was highly conserved among strains, despite the high recombination rates previously observed. High rates of gene transfer and recombination are incompatible with retaining gene order unless these processes are either highly localized to specific sites within the genome, or are characterized by symmetrical gene gain and loss. Our results demonstrate that both processes occur: localized recombination introduces many new genes at relatively few sites, and recombination throughout the genome generates the novel multi-locus sequence types previously observed while preserving gene order. PMID:26484663

  1. Identification and functional analysis of essential, conserved, housekeeping and duplicated genes.


    Arun, P V Parvati Sai; Miryala, Sravan Kumar; Chattopadhyay, Subhayan; Thiyyagura, Kranthi; Bawa, Payal; Bhattacharjee, Madhuchhanda; Yellaboina, Sailu


    Gene conservation, duplication and constitutive expression are intricately linked and strong predictors of essentiality. Here, we introduce metrics based on diversity indices to measure gene conservation, duplication and constitutive expression and validate them by measuring their performance in prediction of essential genes. Conservation and duplication were measured using the diversity indices on the bit score profile of Escherichia coli K12 orthologues, across the genomes, and paralogues, within the genome respectively. Constitutive expression was measured using expression diversity of E. coli K12 genes across different conditions. In addition, we developed a systematic method for enrichment analysis of gene-sets in a given ranked list of genes. The method was used to identify genome-wide functions of essential, conserved, constitutively expressed and duplicated genes. Furthermore, we also ranked various operons, complexes and pathways according to their essentiality, conservation, constitutive expression and duplication. PMID:27129600

  2. Second- and third-order upwind difference schemes for hyperbolic conservation laws

    NASA Technical Reports Server (NTRS)

    Yang, J. Y.


    Second- and third-order two time-level five-point explicit upwind-difference schemes are described for the numerical solution of hyperbolic systems of conservation laws and applied to the Euler equations of inviscid gas dynamics. Nonliner smoothing techniques are used to make the schemes total variation diminishing. In the method both hyperbolicity and conservation properties of the hyperbolic conservation laws are combined in a very natural way by introducing a normalized Jacobian matrix of the hyperbolic system. Entropy satisfying shock transition operators which are consistent with the upwind differencing are locally introduced when transonic shock transition is detected. Schemes thus constructed are suitable for shockcapturing calculations. The stability and the global order of accuracy of the proposed schemes are examined. Numerical experiments for the inviscid Burgers equation and the compressible Euler equations in one and two space dimensions involving various situations of aerodynamic interest are included and compared.


    SciTech Connect



    Identifying functions for all gene products in all sequenced organisms is a central challenge of the post-genomic era. However, at least 30-50% of the proteins encoded by any given genome are of unknown function, or wrongly or vaguely annotated. Many of these 'unknown' proteins are common to prokaryotes and plants. We accordingly set out to predict and experimentally test the functions of such proteins. Our approach to functional prediction is integrative, coupling the extensive post-genomic resources available for plants with comparative genomics based on hundreds of microbial genomes, and functional genomic datasets from model microorganisms. The early phase is computer-assisted; later phases incorporate intellectual input from expert plant and microbial biochemists. The approach thus bridges the gap between automated homology-based annotations and the classical gene discovery efforts of experimentalists, and is much more powerful than purely computational approaches to identifying gene-function associations. Among Arabidopsis genes, we focused on those (2,325 in total) that (i) are unique or belong to families with no more than three members, (ii) are conserved between plants and prokaryotes, and (iii) have unknown or poorly known functions. Computer-assisted selection of promising targets for deeper analysis was based on homology .. independent characteristics associated in the SEED database with the prokaryotic members of each family, specifically gene clustering and phyletic spread, as well as availability of functional genomics data, and publications that could link candidate families to general metabolic areas, or to specific functions. In-depth comparative genomic analysis was then performed for about 500 top candidate families, which connected ~55 of them to general areas of metabolism and led to specific functional predictions for a subset of ~25 more. Twenty predicted functions were experimentally tested in at least one prokaryotic organism via reverse

  4. 43 CFR 3513.23 - May BLM order a suspension of operations and production (conservation concerns)?

    Code of Federal Regulations, 2014 CFR


    ... 43 Public Lands: Interior 2 2014-10-01 2014-10-01 false May BLM order a suspension of operations and production (conservation concerns)? 3513.23 Section 3513.23 Public Lands: Interior Regulations Relating to Public Lands (Continued) BUREAU OF LAND MANAGEMENT, DEPARTMENT OF THE INTERIOR MINERALS MANAGEMENT (3000) LEASING OF SOLID MINERALS...

  5. On the Total Variation of High-Order Semi-Discrete Central Schemes for Conservation Laws

    NASA Technical Reports Server (NTRS)

    Bryson, Steve; Levy, Doron


    We discuss a new fifth-order, semi-discrete, central-upwind scheme for solving one-dimensional systems of conservation laws. This scheme combines a fifth-order WENO reconstruction, a semi-discrete central-upwind numerical flux, and a strong stability preserving Runge-Kutta method. We test our method with various examples, and give particular attention to the evolution of the total variation of the approximations.

  6. Third-order accurate entropy-stable schemes for initial-boundary-value conservation laws

    NASA Astrophysics Data System (ADS)

    Svärd, Magnus


    We consider initial-boundary-value conservation laws with the objective to obtain high-order approximations. We study two different approaches to obtain third-order accuracy, local entropy stability and a global bound on the entropy. The results are applicable to, for example the Euler equations of gas dynamics, for which we present numerical results demonstrating the robustness and accuracy of the scheme.

  7. A modified higher order Godunov’s scheme for stiff source conservative hydrodynamics

    NASA Astrophysics Data System (ADS)

    Miniati, Francesco; Colella, Phillip


    We present an efficient second-order accurate scheme to treat stiff source terms within the framework of higher order Godunov’s methods. We employ Duhamel’s formula to devise a modified predictor step which accounts for the effects of stiff source terms on the conservative fluxes and recovers the correct isothermal behavior in the limit of an infinite cooling/reaction rate. Source term effects on the conservative quantities are fully accounted for by means of a one-step, second-order accurate semi-implicit corrector scheme based on the deferred correction method of Dutt et al. We demonstrate the accurate, stable and convergent results of the proposed method through a set of benchmark problems for a variety of stiffness conditions and source types.

  8. Conservative high-order-accurate finite-difference methods for curvilinear grids

    NASA Technical Reports Server (NTRS)

    Rai, Man M.; Chakrvarthy, Sukumar


    Two fourth-order-accurate finite-difference methods for numerically solving hyperbolic systems of conservation equations on smooth curvilinear grids are presented. The first method uses the differential form of the conservation equations; the second method uses the integral form of the conservation equations. Modifications to these schemes, which are required near boundaries to maintain overall high-order accuracy, are discussed. An analysis that demonstrates the stability of the modified schemes is also provided. Modifications to one of the schemes to make it total variation diminishing (TVD) are also discussed. Results that demonstrate the high-order accuracy of both schemes are included in the paper. In particular, a Ringleb-flow computation demonstrates the high-order accuracy and the stability of the boundary and near-boundary procedures. A second computation of supersonic flow over a cylinder demonstrates the shock-capturing capability of the TVD methodology. An important contribution of this paper is the dear demonstration that higher order accuracy leads to increased computational efficiency.

  9. High Variability of Mitochondrial Gene Order among Fungi

    PubMed Central

    Aguileta, Gabriela; de Vienne, Damien M.; Ross, Oliver N.; Hood, Michael E.; Giraud, Tatiana; Petit, Elsa; Gabaldón, Toni


    From their origin as an early alpha proteobacterial endosymbiont to their current state as cellular organelles, large-scale genomic reorganization has taken place in the mitochondria of all main eukaryotic lineages. So far, most studies have focused on plant and animal mitochondrial (mt) genomes (mtDNA), but fungi provide new opportunities to study highly differentiated mtDNAs. Here, we analyzed 38 complete fungal mt genomes to investigate the evolution of mtDNA gene order among fungi. In particular, we looked for evidence of nonhomologous intrachromosomal recombination and investigated the dynamics of gene rearrangements. We investigated the effect that introns, intronic open reading frames (ORFs), and repeats may have on gene order. Additionally, we asked whether the distribution of transfer RNAs (tRNAs) evolves independently to that of mt protein-coding genes. We found that fungal mt genomes display remarkable variation between and within the major fungal phyla in terms of gene order, genome size, composition of intergenic regions, and presence of repeats, introns, and associated ORFs. Our results support previous evidence for the presence of mt recombination in all fungal phyla, a process conspicuously lacking in most Metazoa. Overall, the patterns of rearrangements may be explained by the combined influences of recombination (i.e., most likely nonhomologous and intrachromosomal), accumulated repeats, especially at intergenic regions, and to a lesser extent, mobile element dynamics. PMID:24504088

  10. The third order correction on Hawking radiation and entropy conservation during black hole evaporation process

    NASA Astrophysics Data System (ADS)

    Yan, Hao-Peng; Liu, Wen-Biao


    Using Parikh-Wilczek tunneling framework, we calculate the tunneling rate from a Schwarzschild black hole under the third order WKB approximation, and then obtain the expressions for emission spectrum and black hole entropy to the third order correction. The entropy contains four terms including the Bekenstein-Hawking entropy, the logarithmic term, the inverse area term, and the square of inverse area term. In addition, we analyse the correlation between sequential emissions under this approximation. It is shown that the entropy is conserved during the process of black hole evaporation, which consists with the request of quantum mechanics and implies the information is conserved during this process. We also compare the above result with that of pure thermal spectrum case, and find that the non-thermal correction played an important role.

  11. A Second-Order Iterative Implicit Explicit Hybrid Scheme for Hyperbolic Systems of Conservation Laws

    NASA Astrophysics Data System (ADS)

    Dai, Wenlong; Woodward, Paul R.


    An iterative implicit-explicit hybrid scheme is proposed for hyperbolic systems of conservation laws. Each wave in a system may be implicitly, or explicitly, or partially implicitly and partially explicitly treated depending on its associated Courant number in each numerical cell, and the scheme is able to smoothly switch between implicit and explicit calculations. The scheme is of Godunov-type in both explicit and implicit regimes, is in a strict conservation form, and is accurate to second-order in both space and time for all Courant numbers. The computer code for the scheme is easy to vectorize. Multicolors proposed in this paper may reduce the number of iterations required to reach a converged solution by several orders for a large time step. The feature of the scheme is shown through numerical examples.

  12. A High-Order Finite Spectral Volume Method for Conservation Laws on Unstructured Grids

    NASA Technical Reports Server (NTRS)

    Wang, Z. J.; Liu, Yen; Kwak, Dochan (Technical Monitor)


    A time accurate, high-order, conservative, yet efficient method named Finite Spectral Volume (FSV) is developed for conservation laws on unstructured grids. The concept of a 'spectral volume' is introduced to achieve high-order accuracy in an efficient manner similar to spectral element and multi-domain spectral methods. In addition, each spectral volume is further sub-divided into control volumes (CVs), and cell-averaged data from these control volumes is used to reconstruct a high-order approximation in the spectral volume. Riemann solvers are used to compute the fluxes at spectral volume boundaries. Then cell-averaged state variables in the control volumes are updated independently. Furthermore, TVD (Total Variation Diminishing) and TVB (Total Variation Bounded) limiters are introduced in the FSV method to remove/reduce spurious oscillations near discontinuities. A very desirable feature of the FSV method is that the reconstruction is carried out only once, and analytically, and is the same for all cells of the same type, and that the reconstruction stencil is always non-singular, in contrast to the memory and CPU-intensive reconstruction in a high-order finite volume (FV) method. Discussions are made concerning why the FSV method is significantly more efficient than high-order finite volume and the Discontinuous Galerkin (DG) methods. Fundamental properties of the FSV method are studied and high-order accuracy is demonstrated for several model problems with and without discontinuities.

  13. High-order entropy stable finite difference schemes for nonlinear conservation laws: Finite domains

    NASA Astrophysics Data System (ADS)

    Fisher, Travis C.; Carpenter, Mark H.


    Nonlinear entropy stability is used to derive provably stable high-order finite difference operators including boundary closure stencils, for the compressible Navier-Stokes equations. A comparison technique is used to derive a new Entropy Stable Weighted Essentially Non-Oscillatory (SSWENO) finite difference method, appropriate for simulations of problems with shocks. Viscous terms are approximated using conservative, entropy stable, narrow-stencil finite difference operators. The efficacy of the new discrete operators is demonstrated using both smooth and discontinuous test cases.

  14. Sequence Similarity of Clostridium difficile Strains by Analysis of Conserved Genes and Genome Content Is Reflected by Their Ribotype Affiliation

    PubMed Central

    Kurka, Hedwig; Ehrenreich, Armin; Ludwig, Wolfgang; Monot, Marc; Rupnik, Maja; Barbut, Frederic; Indra, Alexander; Dupuy, Bruno; Liebl, Wolfgang


    PCR-ribotyping is a broadly used method for the classification of isolates of Clostridium difficile, an emerging intestinal pathogen, causing infections with increased disease severity and incidence in several European and North American countries. We have now carried out clustering analysis with selected genes of numerous C. difficile strains as well as gene content comparisons of their genomes in order to broaden our view of the relatedness of strains assigned to different ribotypes. We analyzed the genomic content of 48 C. difficile strains representing 21 different ribotypes. The calculation of distance matrix-based dendrograms using the neighbor joining method for 14 conserved genes (standard phylogenetic marker genes) from the genomes of the C. difficile strains demonstrated that the genes from strains with the same ribotype generally clustered together. Further, certain ribotypes always clustered together and formed ribotype groups, i.e. ribotypes 078, 033 and 126, as well as ribotypes 002 and 017, indicating their relatedness. Comparisons of the gene contents of the genomes of ribotypes that clustered according to the conserved gene analysis revealed that the number of common genes of the ribotypes belonging to each of these three ribotype groups were very similar for the 078/033/126 group (at most 69 specific genes between the different strains with the same ribotype) but less similar for the 002/017 group (86 genes difference). It appears that the ribotype is indicative not only of a specific pattern of the amplified 16S–23S rRNA intergenic spacer but also reflects specific differences in the nucleotide sequences of the conserved genes studied here. It can be anticipated that the sequence deviations of more genes of C. difficile strains are correlated with their PCR-ribotype. In conclusion, the results of this study corroborate and extend the concept of clonal C. difficile lineages, which correlate with ribotypes affiliation. PMID:24482682

  15. Sequence similarity of Clostridium difficile strains by analysis of conserved genes and genome content is reflected by their ribotype affiliation.


    Kurka, Hedwig; Ehrenreich, Armin; Ludwig, Wolfgang; Monot, Marc; Rupnik, Maja; Barbut, Frederic; Indra, Alexander; Dupuy, Bruno; Liebl, Wolfgang


    PCR-ribotyping is a broadly used method for the classification of isolates of Clostridium difficile, an emerging intestinal pathogen, causing infections with increased disease severity and incidence in several European and North American countries. We have now carried out clustering analysis with selected genes of numerous C. difficile strains as well as gene content comparisons of their genomes in order to broaden our view of the relatedness of strains assigned to different ribotypes. We analyzed the genomic content of 48 C. difficile strains representing 21 different ribotypes. The calculation of distance matrix-based dendrograms using the neighbor joining method for 14 conserved genes (standard phylogenetic marker genes) from the genomes of the C. difficile strains demonstrated that the genes from strains with the same ribotype generally clustered together. Further, certain ribotypes always clustered together and formed ribotype groups, i.e. ribotypes 078, 033 and 126, as well as ribotypes 002 and 017, indicating their relatedness. Comparisons of the gene contents of the genomes of ribotypes that clustered according to the conserved gene analysis revealed that the number of common genes of the ribotypes belonging to each of these three ribotype groups were very similar for the 078/033/126 group (at most 69 specific genes between the different strains with the same ribotype) but less similar for the 002/017 group (86 genes difference). It appears that the ribotype is indicative not only of a specific pattern of the amplified 16S-23S rRNA intergenic spacer but also reflects specific differences in the nucleotide sequences of the conserved genes studied here. It can be anticipated that the sequence deviations of more genes of C. difficile strains are correlated with their PCR-ribotype. In conclusion, the results of this study corroborate and extend the concept of clonal C. difficile lineages, which correlate with ribotypes affiliation. PMID:24482682

  16. Functional conservation analysis and expression modes of grape anthocyanin synthesis genes responsive to low temperature stress.


    Zhang, Cheng; Jia, Haifeng; Wu, Weimin; Wang, Xicheng; Fang, Jinggui; Wang, Chen


    In grape cultivation, low temperature generally increases the expression of genes involved in synthesis of anthocyanin. In this study, multi-type structural analysis of the proteins encoded by five anthocyanin biosynthesis genes VvF3H, VvPAL, VvCHS3, VvCHS2 and VvLDOX, in addition to nine of their homologous genes revealed that proteins in grapevine shared a high similarity with that in kiwi, red orange and some other species in which the biosynthesis of anthocyanin significantly influenced by low temperature as proved by previous studies. Low temperature regulatory elements were also found in the promoter region of the grapevine genes VvCHS2, VvPAL and VvF3H. These findings indicate that the functions of anthocyanin biosynthesis genes in grapevine are conservative and might be sensitive to low temperature. In order to identify the specific expression patterns of the five anthocyanin biosynthesis genes and the changes of polyphenols, anthocyanins and flavonoids under low temperature stress. The transcription analysis of the five genes and the content of polyphenols, anthocyanins and flavonoids in grape skins were examined, by using Vitis vinifera L. cv. 'Yongyou 1' and 'Juxing' berries as experimental material and treated at 4°C and 25°C for 24h, 48 h, 72 h and 96 h. The results showed that low temperature greatly enhanced the expression of the five anthocyanin biosynthesis genes. Low temperature greatly slowed down the decomposition of polyphenol, anthocyanin, and flavonoid in grape skins. Our study also found that cv. 'Juxing' responded more sensitively to low temperature than cv. 'Yongyou 1'. All the findings would provide a basis for further study on the mechanism of anthocyanin biosynthesis under environmental stress. PMID:26253159

  17. High order filtering methods for approximating hyperbolic systems of conservation laws

    NASA Technical Reports Server (NTRS)

    Lafon, F.; Osher, S.


    The essentially nonoscillatory (ENO) schemes, while potentially useful in the computation of discontinuous solutions of hyperbolic conservation-law systems, are computationally costly relative to simple central-difference methods. A filtering technique is presented which employs central differencing of arbitrarily high-order accuracy except where a local test detects the presence of spurious oscillations and calls upon the full ENO apparatus to remove them. A factor-of-three speedup is thus obtained over the full-ENO method for a wide range of problems, with high-order accuracy in regions of smooth flow.

  18. Constructing conservation laws for fractional-order integro-differential equations

    NASA Astrophysics Data System (ADS)

    Lukashchuk, S. Yu.


    In a class of functions depending on linear integro-differential fractional-order variables, we prove an analogue of the fundamental operator identity relating the infinitesimal operator of a point transformation group, the Euler-Lagrange differential operator, and Noether operators. Using this identity, we prove fractional-differential analogues of the Noether theorem and its generalizations applicable to equations with fractional-order integrals and derivatives of various types that are Euler-Lagrange equations. In explicit form, we give fractional-differential generalizations of Noether operators that gives an efficient way to construct conservation laws, which we illustrate with three examples.

  19. Reanalyze unassigned reads in Sanger based metagenomic data using conserved gene adjacency

    PubMed Central


    Background Investigation of metagenomes provides greater insight into uncultured microbial communities. The improvement in sequencing technology, which yields a large amount of sequence data, has led to major breakthroughs in the field. However, at present, taxonomic binning tools for metagenomes discard 30-40% of Sanger sequencing data due to the stringency of BLAST cut-offs. In an attempt to provide a comprehensive overview of metagenomic data, we re-analyzed the discarded metagenomes by using less stringent cut-offs. Additionally, we introduced a new criterion, namely, the evolutionary conservation of adjacency between neighboring genes. To evaluate the feasibility of our approach, we re-analyzed discarded contigs and singletons from several environments with different levels of complexity. We also compared the consistency between our taxonomic binning and those reported in the original studies. Results Among the discarded data, we found that 23.7 ± 3.9% of singletons and 14.1 ± 1.0% of contigs were assigned to taxa. The recovery rates for singletons were higher than those for contigs. The Pearson correlation coefficient revealed a high degree of similarity (0.94 ± 0.03 at the phylum rank and 0.80 ± 0.11 at the family rank) between the proposed taxonomic binning approach and those reported in original studies. In addition, an evaluation using simulated data demonstrated the reliability of the proposed approach. Conclusions Our findings suggest that taking account of conserved neighboring gene adjacency improves taxonomic assignment when analyzing metagenomes using Sanger sequencing. In other words, utilizing the conserved gene order as a criterion will reduce the amount of data discarded when analyzing metagenomes. PMID:21083935

  20. Genome-wide gene order distances support clustering the gram-positive bacteria

    PubMed Central

    House, Christopher H.; Pellegrini, Matteo; Fitz-Gibbon, Sorel T.


    Initially using 143 genomes, we developed a method for calculating the pair-wise distance between prokaryotic genomes using a Monte Carlo method to estimate the conservation of gene order. The method was based on repeatedly selecting five or six non-adjacent random orthologs from each of two genomes and determining if the chosen orthologs were in the same order. The raw distances were then corrected for gene order convergence using an adaptation of the Jukes-Cantor model, as well as using the common distance correction D′ = −ln(1-D). First, we compared the distances found via the order of six orthologs to distances found based on ortholog gene content and small subunit rRNA sequences. The Jukes-Cantor gene order distances are reasonably well correlated with the divergence of rRNA (R2 = 0.24), especially at rRNA Jukes-Cantor distances of less than 0.2 (R2 = 0.52). Gene content is only weakly correlated with rRNA divergence (R2 = 0.04) over all distances, however, it is especially strongly correlated at rRNA Jukes-Cantor distances of less than 0.1 (R2 = 0.67). This initial work suggests that gene order may be useful in conjunction with other methods to help understand the relatedness of genomes. Using the gene order distances in 143 genomes, the relations of prokaryotes were studied using neighbor joining and agreement subtrees. We then repeated our study of the relations of prokaryotes using gene order in 172 complete genomes better representing a wider-diversity of prokaryotes. Consistently, our trees show the Actinobacteria as a sister group to the bulk of the Firmicutes. In fact, the robustness of gene order support was found to be considerably greater for uniting these two phyla than for uniting any of the proteobacterial classes together. The results are supportive of the idea that Actinobacteria and Firmicutes are closely related, which in turn implies a single origin for the gram-positive cell. PMID:25653643

  1. A high-order conservative collocation scheme and its application to global shallow-water equations

    NASA Astrophysics Data System (ADS)

    Chen, C.; Li, X.; Shen, X.; Xiao, F.


    In this paper, an efficient and conservative collocation method is proposed and used to develop a global shallow-water model. Being a nodal type high-order scheme, the present method solves the pointwise values of dependent variables as the unknowns within each control volume. The solution points are arranged as Gauss-Legendre points to achieve high-order accuracy. The time evolution equations to update the unknowns are derived under the flux reconstruction (FR) framework (Huynh, 2007). Constraint conditions used to build the spatial reconstruction for the flux function include the pointwise values of flux function at the solution points, which are computed directly from the dependent variables, as well as the numerical fluxes at the boundaries of the computational element, which are obtained as Riemann solutions between the adjacent elements. Given the reconstructed flux function, the time tendencies of the unknowns can be obtained directly from the governing equations of differential form. The resulting schemes have super convergence and rigorous numerical conservativeness. A three-point scheme of fifth-order accuracy is presented and analyzed in this paper. The proposed scheme is adopted to develop the global shallow-water model on the cubed-sphere grid, where the local high-order reconstruction is very beneficial for the data communications between adjacent patches. We have used the standard benchmark tests to verify the numerical model, which reveals its great potential as a candidate formulation for developing high-performance general circulation models.

  2. Discovery and assessment of conserved Pax6 target genes and enhancers

    PubMed Central

    Coutinho, Pedro; Pavlou, Sofia; Bhatia, Shipra; Chalmers, Kevin J.; Kleinjan, Dirk A.; van Heyningen, Veronica


    The characterization of transcriptional networks (TNs) is essential for understanding complex biological phenomena such as development, disease, and evolution. In this study, we have designed and implemented a procedure that combines in silico target screens with zebrafish and mouse validation, in order to identify cis-elements and genes directly regulated by Pax6. We chose Pax6 as the paradigm because of its crucial roles in organogenesis and human disease. We identified over 600 putative Pax6 binding sites and more than 200 predicted direct target genes, conserved in evolution from zebrafish to human and to mouse. This was accomplished using hidden Markov models (HMMs) generated from experimentally validated Pax6 binding sites. A small sample of genes, expressed in the neural lineage, was chosen from the predictions for RNA in situ validation using zebrafish and mouse models. Validation of DNA binding to some predicted cis-elements was also carried out using chromatin immunoprecipitation (ChIP) and zebrafish reporter transgenic studies. The results show that this combined procedure is a highly efficient tool to investigate the architecture of TNs and constitutes a useful complementary resource to ChIP and expression data sets because of its inherent spatiotemporal independence. We have identified several novel direct targets, including some putative disease genes, among them Foxp2; these will allow further dissection of Pax6 function in development and disease. PMID:21617155

  3. Chromatin higher-order structures and gene regulation

    PubMed Central

    Li, Guohong


    Genomic DNA in the eukaryotic nucleus is hierarchically packaged by histones into chromatin to fit inside the nucleus. The dynamics of higher-order chromatin compaction play a critical role in transcription and other biological processes inherent to DNA. Many factors, including histone variants, histone modifications, DNA methylation and the binding of non-histone architectural proteins regulate the structure of chromatin. Although the structure of nucleosomes, the fundamental repeating unit of chromatin, is clear, there is still much discussion on the higher-order levels of chromatin structure. In this review, we focus on the recent progress in elucidating the structure of the 30-nm chromatin fiber. We also discuss the structural plasticity/dynamics and epigenetic inheritance of higher-order chromatin and the roles of chromatin higher-order organization in eukaryotic gene regulation. PMID:21342762

  4. High order filtering methods for approximating hyberbolic systems of conservation laws

    NASA Technical Reports Server (NTRS)

    Lafon, F.; Osher, S.


    In the computation of discontinuous solutions of hyperbolic systems of conservation laws, the recently developed essentially non-oscillatory (ENO) schemes appear to be very useful. However, they are computationally costly compared to simple central difference methods. A filtering method which is developed uses simple central differencing of arbitrarily high order accuracy, except when a novel local test indicates the development of spurious oscillations. At these points, the full ENO apparatus is used, maintaining the high order of accuracy, but removing spurious oscillations. Numerical results indicate the success of the method. High order of accuracy was obtained in regions of smooth flow without spurious oscillations for a wide range of problems and a significant speed up of generally a factor of almost three over the full ENO method.

  5. High order conservative differencing for viscous terms and the application to vortex-induced vibration flows

    NASA Astrophysics Data System (ADS)

    Shen, Yiqing; Zha, Gecheng; Chen, Xiangying


    A new set of conservative 4th-order central finite differencing schemes for all the viscous terms of compressible Navier-Stokes equations are proposed and proved in this paper. These schemes are used with a 5th-order WENO scheme for inviscid flux and the stencil width of the central differencing scheme is designed to be within that of the WENO scheme. The central differencing schemes achieve the maximum order of accuracy in the stencil. This feature is important to keep the compactness of the overall discretization schemes and facilitate the boundary condition treatment. The algorithm is used to simulate the vortex-induced oscillations of an elastically mounted circular cylinder. The numerical results agree favorably with the experiment.

  6. High-order finite-volume methods for hyperbolic conservation laws on mapped multiblock grids

    NASA Astrophysics Data System (ADS)

    McCorquodale, P.; Dorr, M. R.; Hittinger, J. A. F.; Colella, P.


    We present an approach to solving hyperbolic conservation laws by finite-volume methods on mapped multiblock grids, extending the approach of Colella, Dorr, Hittinger, and Martin (2011) [10] for grids with a single mapping. We consider mapped multiblock domains for mappings that are conforming at inter-block boundaries. By using a smooth continuation of the mapping into ghost cells surrounding a block, we reduce the inter-block communication problem to finding an accurate, robust interpolation into these ghost cells from neighboring blocks. We demonstrate fourth-order accuracy for the advection equation for multiblock coordinate systems in two and three dimensions.

  7. High-order finite-volume methods for hyperbolic conservation laws on mapped multiblock grids

    SciTech Connect

    McCorquodale, P. W.; Colella, P.; Dorr, M. R.; Hittinger, J. A. F.


    We present an approach to solving hyperbolic conservation laws by finite-volume methods on mapped multiblock grids, extending the approach of Colella, Dorr, Hittinger, and Martin (2011) [10] for grids with a single mapping. We consider mapped multiblock domains for mappings that are conforming at inter-block boundaries. By using a smooth continuation of the mapping into ghost cells surrounding a block, we reduce the inter-block communication problem to finding an accurate, robust interpolation into these ghost cells from neighboring blocks. Lastly, we demonstrate fourth-order accuracy for the advection equation for multiblock coordinate systems in two and three dimensions.

  8. Redeployment of a conserved gene regulatory network during Aedes aegypti development.


    Suryamohan, Kushal; Hanson, Casey; Andrews, Emily; Sinha, Saurabh; Scheel, Molly Duman; Halfon, Marc S


    Changes in gene regulatory networks (GRNs) underlie the evolution of morphological novelty and developmental system drift. The fruitfly Drosophila melanogaster and the dengue and Zika vector mosquito Aedes aegypti have substantially similar nervous system morphology. Nevertheless, they show significant divergence in a set of genes co-expressed in the midline of the Drosophila central nervous system, including the master regulator single minded and downstream genes including short gastrulation, Star, and NetrinA. In contrast to Drosophila, we find that midline expression of these genes is either absent or severely diminished in A. aegypti. Instead, they are co-expressed in the lateral nervous system. This suggests that in A. aegypti this "midline GRN" has been redeployed to a new location while lost from its previous site of activity. In order to characterize the relevant GRNs, we employed the SCRMshaw method we previously developed to identify transcriptional cis-regulatory modules in both species. Analysis of these regulatory sequences in transgenic Drosophila suggests that the altered gene expression observed in A. aegypti is the result of trans-dependent redeployment of the GRN, potentially stemming from cis-mediated changes in the expression of sim and other as-yet unidentified regulators. Our results illustrate a novel "repeal, replace, and redeploy" mode of evolution in which a conserved GRN acquires a different function at a new site while its original function is co-opted by a different GRN. This represents a striking example of developmental system drift in which the dramatic shift in gene expression does not result in gross morphological changes, but in more subtle differences in development and function of the late embryonic nervous system. PMID:27341759

  9. Magnetic-charge ordering and phase transitions in monopole-conserved square spin ice

    PubMed Central

    Xie, Y.-L.; Du, Z.-Z.; Yan, Z.-B.; Liu, J.-M.


    Magnetic-charge ordering and corresponding magnetic/monopole phase transitions in spin ices are the emergent topics of condensed matter physics. In this work, we investigate a series of magnetic-charge (monopole) phase transitions in artificial square spin ice model using the conserved monopole density algorithm. It is revealed that the dynamics of low monopole density lattices is controlled by the effective Coulomb interaction and the Dirac string tension, leading to the monopole dimerization which is quite different from the dynamics of three-dimensional pyrochlore spin ice. The condensation of the monopole dimers into monopole crystals with staggered magnetic-charge order can be predicted clearly. For the high monopole density cases, the lattice undergoes two consecutive phase transitions from high-temperature paramagnetic/charge-disordered phase into staggered charge-ordered phase before eventually toward the long-range magnetically-ordered phase as the ground state which is of staggered charge order too. A phase diagram over the whole temperature-monopole density space, which exhibits a series of emergent spin and monopole ordered states, is presented. PMID:26511870

  10. Magnetic-charge ordering and phase transitions in monopole-conserved square spin ice

    NASA Astrophysics Data System (ADS)

    Xie, Y.-L.; Du, Z.-Z.; Yan, Z.-B.; Liu, J.-M.


    Magnetic-charge ordering and corresponding magnetic/monopole phase transitions in spin ices are the emergent topics of condensed matter physics. In this work, we investigate a series of magnetic-charge (monopole) phase transitions in artificial square spin ice model using the conserved monopole density algorithm. It is revealed that the dynamics of low monopole density lattices is controlled by the effective Coulomb interaction and the Dirac string tension, leading to the monopole dimerization which is quite different from the dynamics of three-dimensional pyrochlore spin ice. The condensation of the monopole dimers into monopole crystals with staggered magnetic-charge order can be predicted clearly. For the high monopole density cases, the lattice undergoes two consecutive phase transitions from high-temperature paramagnetic/charge-disordered phase into staggered charge-ordered phase before eventually toward the long-range magnetically-ordered phase as the ground state which is of staggered charge order too. A phase diagram over the whole temperature-monopole density space, which exhibits a series of emergent spin and monopole ordered states, is presented.

  11. Phase transitions and charge ordering in a square spin ice model with conserved monopole density

    NASA Astrophysics Data System (ADS)

    Xie, Yunlong; Zhou, Xiaohui; Liu, Jun-Ming


    Artificial spin ices represent a class of highly interested frustrated magnetic systems under intensive investigations for fascinating ground states and thermodynamics/dynamics of spin excitations in recent years. As one of these issues, magnetic charge ordering and the corresponding phase transitions in the two-dimensional system are emerging topics in condensed matter physics. In this work, we investigate all the monopole-ordered phases of the square spin ice model using the conserved monopole density algorithm. In low monopole density (ρ ~ 0), the Coulomb potential determines the monopoles' dynamics. We test the Coulomb's law in a two-dimension lattice and justify the monopole dimerization which is quite different from the three-dimensional pyrochlore spin ice. These monopole dimers are charge neutral, and the interactions between them have also been investigated using our algorithm. In the cases of high monopole density (ρ ~ 1), the system is similar to the dipolar kagome spin ice model, and our simulation results show that there exists an intermediate phase between the paramagnetic phase and the ordered magnetic phase. Such intermediate phase can be distinguished by the order of magnetic charges. In a cooling process, the system undergoes a two-stage magnetic phase transition before freezing to the long range magnetic ordered phase via a staggered charge ordering. Furthermore, a liquefaction process of monopole dimers can be justified upon the increasing effective internal pressure in the isothermal condition.

  12. Magnetic-charge ordering and phase transitions in monopole-conserved square spin ice.


    Xie, Y-L; Du, Z-Z; Yan, Z-B; Liu, J-M


    Magnetic-charge ordering and corresponding magnetic/monopole phase transitions in spin ices are the emergent topics of condensed matter physics. In this work, we investigate a series of magnetic-charge (monopole) phase transitions in artificial square spin ice model using the conserved monopole density algorithm. It is revealed that the dynamics of low monopole density lattices is controlled by the effective Coulomb interaction and the Dirac string tension, leading to the monopole dimerization which is quite different from the dynamics of three-dimensional pyrochlore spin ice. The condensation of the monopole dimers into monopole crystals with staggered magnetic-charge order can be predicted clearly. For the high monopole density cases, the lattice undergoes two consecutive phase transitions from high-temperature paramagnetic/charge-disordered phase into staggered charge-ordered phase before eventually toward the long-range magnetically-ordered phase as the ground state which is of staggered charge order too. A phase diagram over the whole temperature-monopole density space, which exhibits a series of emergent spin and monopole ordered states, is presented. PMID:26511870

  13. A new fifth order finite difference WENO scheme for solving hyperbolic conservation laws

    NASA Astrophysics Data System (ADS)

    Zhu, Jun; Qiu, Jianxian


    In this paper a new simple fifth order weighted essentially non-oscillatory (WENO) scheme is presented in the finite difference framework for solving the hyperbolic conservation laws. The new WENO scheme is a convex combination of a fourth degree polynomial with two linear polynomials in a traditional WENO fashion. This new fifth order WENO scheme uses the same five-point information as the classical fifth order WENO scheme [14,20], could get less absolute truncation errors in L1 and L∞ norms, and obtain the same accuracy order in smooth region containing complicated numerical solution structures simultaneously escaping nonphysical oscillations adjacent strong shocks or contact discontinuities. The associated linear weights are artificially set to be any random positive numbers with the only requirement that their sum equals one. New nonlinear weights are proposed for the purpose of sustaining the optimal fifth order accuracy. The new WENO scheme has advantages over the classical WENO scheme [14,20] in its simplicity and easy extension to higher dimensions. Some benchmark numerical tests are performed to illustrate the capability of this new fifth order WENO scheme.

  14. ECHO: a Eulerian conservative high-order scheme for general relativistic magnetohydrodynamics and magnetodynamics

    NASA Astrophysics Data System (ADS)

    Del Zanna, L.; Zanotti, O.; Bucciantini, N.; Londrillo, P.


    Aims:We present a new numerical code, ECHO, based on a Eulerian conservative high-order scheme for time dependent three-dimensional general relativistic magnetohydrodynamics (GRMHD) and magnetodynamics (GRMD). ECHO is aimed at providing a shock-capturing conservative method able to work at an arbitrary level of formal accuracy (for smooth flows), where the other existing GRMHD and GRMD schemes yield an overall second order at most. Moreover, our goal is to present a general framework based on the 3+1 Eulerian formalism, allowing for different sets of equations and different algorithms and working in a generic space-time metric, so that ECHO may be easily coupled to any solver for Einstein's equations. Methods: Our finite-difference conservative scheme previously developed for special relativistic hydrodynamics and MHD is extended here to the general relativistic case. Various high-order reconstruction methods are implemented and a two-wave approximate Riemann solver is used. The induction equation is treated by adopting the upwind constrained transport (UCT) procedures, appropriate to preserving the divergence-free condition of the magnetic field in shock-capturing methods. The limiting case of magnetodynamics (also known as force-free degenerate electrodynamics) is implemented by simply replacing the fluid velocity with the electromagnetic drift velocity and by neglecting the contribution of matter to the stress tensor. Results: ECHO is particularly accurate, efficient, versatile, and robust. It has been tested against several astrophysical applications, like magnetized accretion onto black holes and constant angular momentum thick disks threaded by toroidal fields. A novel test of the propagation of large-amplitude, circularly polarized Alfvén waves is proposed, and this allows us to prove the spatial and temporal high-order properties of ECHO very accurately. In particular, we show that reconstruction based on a monotonicity-preserving (MP) filter applied to a

  15. Conservation.

    ERIC Educational Resources Information Center

    National Audubon Society, New York, NY.

    This set of teaching aids consists of seven Audubon Nature Bulletins, providing the teacher and student with informational reading on various topics in conservation. The bulletins have these titles: Plants as Makers of Soil, Water Pollution Control, The Ground Water Table, Conservation--To Keep This Earth Habitable, Our Threatened Air Supply,…

  16. A high-order symmetrical weighted hybrid ENO-flux limiter scheme for hyperbolic conservation laws

    NASA Astrophysics Data System (ADS)

    Abedian, Rooholah; Adibi, Hojatollah; Dehghan, Mehdi


    In this paper, we propose a new weighted essentially non-oscillatory (WENO) procedure for solving hyperbolic conservation laws, on uniform meshes. The new scheme combines essentially non-oscillatory (ENO) reconstructions together with monotone upwind schemes for scalar conservation laws' interpolants. In a one-dimensional context, first, we obtain an optimum polynomial on a five-cells stencil. This optimum polynomial is fifth-order accurate in regions of smoothness. Next, we modify a third-order ENO polynomial by choosing an additional point inside the stencil in order to obtain the highest accuracy when combined with the Harten-Osher reconstruction-evolution method limiter. Then, we consider the optimum polynomial as a symmetric and convex combination of four polynomials with ideal weights. After that, following the methodology of the classic WENO procedure, we calculate non-oscillatory weights with the ideal weights. Also, the numerical solution is advanced in time by means of the linear multi-step total variation bounded (TV B) technique. Numerical examples on both scalar and gas dynamics problems confirm that the new scheme is non-oscillatory and yields sharp results when solving profiles with discontinuities. Comparing the new scheme with high-order WENO schemes shows that our method reduces smearing near shocks and corners, and in some cases it is more accurate near discontinuities. Finally, the new method is extended to multi-dimensional problems by a dimension-by-dimension approach. Several multi-dimensional examples are performed to show that our method remains non-oscillatory while giving good resolution of discontinuities.

  17. Conserved nodulation genes in Rhizobium meliloti and Rhizobium trifolii

    SciTech Connect

    Fisher, R.F.; Tu, J.K.; Long, S.R.


    Plasmids which contained wild-type or mutated Rhizobium meliloti nodulation (Nod) genes were introduced into Nod/sup -/ R. trifolii mutants ANU453 and ANU851 and tested for their ability to nodulate clover. Cloned wild-type and mutated R. meliloti Nod gene segments restored ANU851 to Nod/sup +/, with the exception of nodD mutants. Similarly, wild-type and mutant R. meliloti nod genes complemented ANU453 to Nod/sup +/, except for nod CII mutants. Thus, ANU851 identifies the equivalent of the R. meliloti nodD genes, and ANU453 specifies the equivalent of the R. meliloti nodCII genes. In addition, cloned wild-type R. trifolii nod genes were introduced into seven R. meliloti Nod/sup -/ mutants. All seven mutants were restored to Nod/sup +/ on alfalfa. Our results indicate that these genes represent common nodulation functions and argue for an allelic relationship between nod genes in R. meliloti and R. trifolii.


    Technology Transfer Automated Retrieval System (TEKTRAN)

    The regulator gene gacA influences production of several secondary metabolites in Pseudomonas spp. Primers and a probe for the gacA gene of Pseudomonas spp. were developed and a gacA fragment was sequenced from 10 strains isolated from different plant-associated environments. PCR analysis and Sou...

  19. Conservation in Mammals of Genes Associated with Aggression-Related Behavioral Phenotypes in Honey Bees.


    Liu, Hui; Robinson, Gene E; Jakobsson, Eric


    The emerging field of sociogenomics explores the relations between social behavior and genome structure and function. An important question is the extent to which associations between social behavior and gene expression are conserved among the Metazoa. Prior experimental work in an invertebrate model of social behavior, the honey bee, revealed distinct brain gene expression patterns in African and European honey bees, and within European honey bees with different behavioral phenotypes. The present work is a computational study of these previous findings in which we analyze, by orthology determination, the extent to which genes that are socially regulated in honey bees are conserved across the Metazoa. We found that the differentially expressed gene sets associated with alarm pheromone response, the difference between old and young bees, and the colony influence on soldier bees, are enriched in widely conserved genes, indicating that these differences have genomic bases shared with many other metazoans. By contrast, the sets of differentially expressed genes associated with the differences between African and European forager and guard bees are depleted in widely conserved genes, indicating that the genomic basis for this social behavior is relatively specific to honey bees. For the alarm pheromone response gene set, we found a particularly high degree of conservation with mammals, even though the alarm pheromone itself is bee-specific. Gene Ontology identification of human orthologs to the strongly conserved honey bee genes associated with the alarm pheromone response shows overrepresentation of protein metabolism, regulation of protein complex formation, and protein folding, perhaps associated with remodeling of critical neural circuits in response to alarm pheromone. We hypothesize that such remodeling may be an adaptation of social animals to process and respond appropriately to the complex patterns of conspecific communication essential for social organization

  20. Conservation in Mammals of Genes Associated with Aggression-Related Behavioral Phenotypes in Honey Bees

    PubMed Central

    Robinson, Gene E.; Jakobsson, Eric


    The emerging field of sociogenomics explores the relations between social behavior and genome structure and function. An important question is the extent to which associations between social behavior and gene expression are conserved among the Metazoa. Prior experimental work in an invertebrate model of social behavior, the honey bee, revealed distinct brain gene expression patterns in African and European honey bees, and within European honey bees with different behavioral phenotypes. The present work is a computational study of these previous findings in which we analyze, by orthology determination, the extent to which genes that are socially regulated in honey bees are conserved across the Metazoa. We found that the differentially expressed gene sets associated with alarm pheromone response, the difference between old and young bees, and the colony influence on soldier bees, are enriched in widely conserved genes, indicating that these differences have genomic bases shared with many other metazoans. By contrast, the sets of differentially expressed genes associated with the differences between African and European forager and guard bees are depleted in widely conserved genes, indicating that the genomic basis for this social behavior is relatively specific to honey bees. For the alarm pheromone response gene set, we found a particularly high degree of conservation with mammals, even though the alarm pheromone itself is bee-specific. Gene Ontology identification of human orthologs to the strongly conserved honey bee genes associated with the alarm pheromone response shows overrepresentation of protein metabolism, regulation of protein complex formation, and protein folding, perhaps associated with remodeling of critical neural circuits in response to alarm pheromone. We hypothesize that such remodeling may be an adaptation of social animals to process and respond appropriately to the complex patterns of conspecific communication essential for social organization

  1. Association of tissue lineage and gene expression: conservatively and differentially expressed genes define common and special functions of tissues

    PubMed Central


    Background Embryogenesis is the process by which the embryo is formed, develops, and establishes developmental hierarchies of tissues. The recent advance in microarray technology made it possible to investigate the tissue specific patterns of gene expression and their relationship with tissue lineages. This study is focused on how tissue specific functions, tissue lineage, and cell differentiation are correlated, which is essential to understand embryonic development and organism complexity. Results We performed individual gene and gene set based analysis on multiple tissue expression data, in association with the classic topology of mammalian fate maps of embryogenesis. For each sub-group of tissues on the fate map, conservatively, differentially and correlatively expressed genes or gene sets were identified. Tissue distance was found to correlate with gene expression divergence. Tissues of the ectoderm or mesoderm origins from the same segments on the fate map shared more similar expression pattern than those from different origins. Conservatively expressed genes or gene sets define common functions in a tissue group and are related to tissue specific diseases, which is supported by results from Gene Ontology and KEGG pathway analysis. Gene expression divergence is larger in certain human tissues than in the mouse homologous tissues. Conclusion The results from tissue lineage and gene expression analysis indicate that common function features of neighbor tissue groups were defined by the conservatively expressed genes and were related to tissue specific diseases, and differentially expressed genes contribute to the functional divergence of tissues. The difference of gene expression divergence in human and mouse homologous tissues reflected the organism complexity, i.e. distinct neural development levels and different body sizes. PMID:21172044

  2. Conservation of Transcription Start Sites within Genes across a Bacterial Genus

    PubMed Central

    Shao, Wenjun; Price, Morgan N.; Deutschbauer, Adam M.; Romine, Margaret F.


    ABSTRACT Transcription start sites (TSSs) lying inside annotated genes, on the same or opposite strand, have been observed in diverse bacteria, but the function of these unexpected transcripts is unclear. Here, we use the metal-reducing bacterium Shewanella oneidensis MR-1 and its relatives to study the evolutionary conservation of unexpected TSSs. Using high-resolution tiling microarrays and 5′-end RNA sequencing, we identified 2,531 TSSs in S. oneidensis MR-1, of which 18% were located inside coding sequences (CDSs). Comparative transcriptome analysis with seven additional Shewanella species revealed that the majority (76%) of the TSSs within the upstream regions of annotated genes (gTSSs) were conserved. Thirty percent of the TSSs that were inside genes and on the sense strand (iTSSs) were also conserved. Sequence analysis around these iTSSs showed conserved promoter motifs, suggesting that many iTSS are under purifying selection. Furthermore, conserved iTSSs are enriched for regulatory motifs, suggesting that they are regulated, and they tend to eliminate polar effects, which confirms that they are functional. In contrast, the transcription of antisense TSSs located inside CDSs (aTSSs) was significantly less likely to be conserved (22%). However, aTSSs whose transcription was conserved often have conserved promoter motifs and drive the expression of nearby genes. Overall, our findings demonstrate that some internal TSSs are conserved and drive protein expression despite their unusual locations, but the majority are not conserved and may reflect noisy initiation of transcription rather than a biological function. PMID:24987095

  3. Conservation of Transcription Start Sites within Genes across a Bacterial Genus

    SciTech Connect

    Shao, Wenjun; Price, Morgan N.; Deutschbauer, Adam M.; Romine, Margaret F.; Arkin, Adam P.


    Transcription start sites (TSSs) lying inside annotated genes, on the same or opposite strand, have been observed in diverse bacteria, but the function of these unexpected transcripts is unclear. Here, we use the metal-reducing bacterium Shewanella oneidensis MR-1 and its relatives to study the evolutionary conservation of unexpected TSSs. Using high-resolution tiling microarrays and 5'-end RNA sequencing, we identified 2,531 TSSs in S. oneidensis MR-1, of which 18% were located inside coding sequences (CDSs). Comparative transcriptome analysis with seven additional Shewanella species revealed that the majority (76%) of the TSSs within the upstream regions of annotated genes (gTSSs) were conserved. Thirty percent of the TSSs that were inside genes and on the sense strand (iTSSs) were also conserved. Sequence analysis around these iTSSs showed conserved promoter motifs, suggesting that many iTSS are under purifying selection. Furthermore, conserved iTSSs are enriched for regulatory motifs, suggesting that they are regulated, and they tend to eliminate polar effects, which confirms that they are functional. In contrast, the transcription of antisense TSSs located inside CDSs (aTSSs) was significantly less likely to be conserved (22%). However, aTSSs whose transcription was conserved often have conserved promoter motifs and drive the expression of nearby genes. Overall, our findings demonstrate that some internal TSSs are conserved and drive protein expression despite their unusual locations, but the majority are not conserved and may reflect noisy initiation of transcription rather than a biological function.

  4. Unconventional conservation among genes encoding small secreted salivary sland proteins from a gall midge

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Due to functional constraints associated with protein-coding sequences, introns and the 3’-untranslated region (UTR) of most genes vary the most, followed by the 5’-UTR. The coding region is the most conserved due to stronger functional constraints. During characterization of transcripts and gene...

  5. Conservation of Hox gene clusters in the self-fertilizing fish Kryptolebias marmoratus (Cyprinodontiformes; Rivulidae).


    Kim, B-M; Lee, B-Y; Lee, J-H; Rhee, J-S; Lee, J-S


    In this study, whole Hox gene clusters in the self-fertilizing mangrove killifish Kryptolebias marmoratus (Cyprinodontiformes; Rivulidae), a unique hermaphroditic vertebrate in which both sex organs are functional at the same time, were identified from whole genome and transcriptome sequences. The aim was to increase the understanding of the evolutionary status of conservation of this Hox gene cluster across fish species. PMID:26822496

  6. Conserving plants in gene banks and nature: Investigating complementarity with Trifolium thompsonii Morton

    Technology Transfer Automated Retrieval System (TEKTRAN)

    A standard conservation strategy for plant genetic resources integrates in situ (on-farm or wild) and ex situ (gene or field bank) approaches. Gene bank managers collect ex situ accessions that represent a comprehensive snap shot of the genetic diversity of in situ populations at a given time and pl...

  7. Comparative Mitogenomics of the Genus Odontobutis (Perciformes: Gobioidei: Odontobutidae) Revealed Conserved Gene Rearrangement and High Sequence Variations

    PubMed Central

    Ma, Zhihong; Yang, Xuefen; Bercsenyi, Miklos; Wu, Junjie; Yu, Yongyao; Wei, Kaijian; Fan, Qixue; Yang, Ruibin


    To understand the molecular evolution of mitochondrial genomes (mitogenomes) in the genus Odontobutis, the mitogenome of Odontobutis yaluensis was sequenced and compared with those of another four Odontobutis species. Our results displayed similar mitogenome features among species in genome organization, base composition, codon usage, and gene rearrangement. The identical gene rearrangement of trnS-trnL-trnH tRNA cluster observed in mitogenomes of these five closely related freshwater sleepers suggests that this unique gene order is conserved within Odontobutis. Additionally, the present gene order and the positions of associated intergenic spacers of these Odontobutis mitogenomes indicate that this unusual gene rearrangement results from tandem duplication and random loss of large-scale gene regions. Moreover, these mitogenomes exhibit a high level of sequence variation, mainly due to the differences of corresponding intergenic sequences in gene rearrangement regions and the heterogeneity of tandem repeats in the control regions. Phylogenetic analyses support Odontobutis species with shared gene rearrangement forming a monophyletic group, and the interspecific phylogenetic relationships are associated with structural differences among their mitogenomes. The present study contributes to understanding the evolutionary patterns of Odontobutidae species. PMID:26492246

  8. Genomic organization and gene expression of the multiple globins in Atlantic cod: conservation of globin-flanking genes in chordates infers the origin of the vertebrate globin clusters

    PubMed Central


    Background The vertebrate globin genes encoding the α- and β-subunits of the tetrameric hemoglobins are clustered at two unlinked loci. The highly conserved linear order of the genes flanking the hemoglobins provides a strong anchor for inferring common ancestry of the globin clusters. In fish, the number of α-β-linked globin genes varies considerably between different sublineages and seems to be related to prevailing physico-chemical conditions. Draft sequences of the Atlantic cod genome enabled us to determine the genomic organization of the globin repertoire in this marine species that copes with fluctuating environments of the temperate and Arctic regions. Results The Atlantic cod genome was shown to contain 14 globin genes, including nine hemoglobin genes organized in two unlinked clusters designated β5-α1-β1-α4 and β3-β4-α2-α3-β2. The diverged cod hemoglobin genes displayed different expression levels in adult fish, and tetrameric hemoglobins with or without a Root effect were predicted. The novel finding of maternally inherited hemoglobin mRNAs is consistent with a potential role played by fish hemoglobins in the non-specific immune response. In silico analysis of the six teleost genomes available showed that the two α-β globin clusters are flanked by paralogs of five duplicated genes, in agreement with the proposed teleost-specific duplication of the ancestral vertebrate globin cluster. Screening the genome of extant urochordate and cephalochordate species for conserved globin-flanking genes revealed linkage of RHBDF1, MPG and ARHGAP17 to globin genes in the tunicate Ciona intestinalis, while these genes together with LCMT are closely positioned in amphioxus (Branchiostoma floridae), but seem to be unlinked to the multiple globin genes identified in this species. Conclusion The plasticity of Atlantic cod to variable environmental conditions probably involves the expression of multiple globins with potentially different properties. The

  9. ProCARs: Progressive Reconstruction of Ancestral Gene Orders

    PubMed Central


    Background In the context of ancestral gene order reconstruction from extant genomes, there exist two main computational approaches: rearrangement-based, and homology-based methods. The rearrangement-based methods consist in minimizing a total rearrangement distance on the branches of a species tree. The homology-based methods consist in the detection of a set of potential ancestral contiguity features, followed by the assembling of these features into Contiguous Ancestral Regions (CARs). Results In this paper, we present a new homology-based method that uses a progressive approach for both the detection and the assembling of ancestral contiguity features into CARs. The method is based on detecting a set of potential ancestral adjacencies iteratively using the current set of CARs at each step, and constructing CARs progressively using a 2-phase assembling method. Conclusion We show the usefulness of the method through a reconstruction of the boreoeutherian ancestral gene order, and a comparison with three other homology-based methods: AnGeS, InferCARs and GapAdj. The program, written in Python, and the dataset used in this paper are available at PMID:26040958

  10. Conservation Laws and Symmetry Properties of a Class of Higher Order Theories of Gravity

    NASA Astrophysics Data System (ADS)

    Barraco, D.; Dominguez, E.; Guibert, R.; Hamity, V.


    We consider a class of fourth order theories of gravity with arbitrary matter fields arising from a diffeomorphism invariant Lagrangian density mathcal{L}_T = mathcal{L}_G + mathcal{L}_M, with mathcal{L}_G = sqrt { - g} left[ {R + hleft( R right)} right]and mathcal{L}_Mthe phenomenological representation of the nongravitational fields. We derive first the generalization of the Einstein pseudotensor and the von Freud superpotential. We then show, using the arbitrariness that is always present in the choice of pseudotensor and superpotential, that we can choose these superpotentials to have the same form as those for the Hilbert Lagrangian of general relativity (GR). In particular we may introduce the Moller superpotential of GR as associated with a double-index differential conservation law. Similarly, using the Moller superpotential we prove that we can choose the Komar vector of GR to construct a conserved quantity for isolated asymptotically flat systems. For the example R + R2theory we prove then, that the active mass is equal to the total energy (or inertial mass) of the system.

  11. Identification of a conserved set of upregulated genes in mouse skeletal muscle hypertrophy and regrowth

    PubMed Central

    Chaillou, Thomas; Jackson, Janna R.; England, Jonathan H.; Kirby, Tyler J.; Richards-White, Jena; Esser, Karyn A.; Dupont-Versteegden, Esther E.


    The purpose of this study was to compare the gene expression profile of mouse skeletal muscle undergoing two forms of growth (hypertrophy and regrowth) with the goal of identifying a conserved set of differentially expressed genes. Expression profiling by microarray was performed on the plantaris muscle subjected to 1, 3, 5, 7, 10, and 14 days of hypertrophy or regrowth following 2 wk of hind-limb suspension. We identified 97 differentially expressed genes (≥2-fold increase or ≥50% decrease compared with control muscle) that were conserved during the two forms of muscle growth. The vast majority (∼90%) of the differentially expressed genes was upregulated and occurred at a single time point (64 out of 86 genes), which most often was on the first day of the time course. Microarray analysis from the conserved upregulated genes showed a set of genes related to contractile apparatus and stress response at day 1, including three genes involved in mechanotransduction and four genes encoding heat shock proteins. Our analysis further identified three cell cycle-related genes at day and several genes associated with extracellular matrix (ECM) at both days 3 and 10. In conclusion, we have identified a core set of genes commonly upregulated in two forms of muscle growth that could play a role in the maintenance of sarcomere stability, ECM remodeling, cell proliferation, fast-to-slow fiber type transition, and the regulation of skeletal muscle growth. These findings suggest conserved regulatory mechanisms involved in the adaptation of skeletal muscle to increased mechanical loading. PMID:25554798

  12. A stable high-order Spectral Difference method for hyperbolic conservation laws on triangular elements

    NASA Astrophysics Data System (ADS)

    Balan, Aravind; May, Georg; Schöberl, Joachim


    Numerical schemes using piecewise polynomial approximation are very popular for high order discretization of conservation laws. While the most widely used numerical scheme under this paradigm appears to be the Discontinuous Galerkin method, the Spectral Difference scheme has often been found attractive as well, because of its simplicity of formulation and implementation. However, recently it has been shown that the scheme is not linearly stable on triangles. In this paper we present an alternate formulation of the scheme, featuring a new flux interpolation technique using Raviart-Thomas spaces, which proves stable under a similar linear analysis in which the standard scheme failed. We demonstrate viability of the concept by showing linear stability both in the semi-discrete sense and for time stepping schemes of the SSP Runge-Kutta type. Furthermore, we present convergence studies, as well as case studies in compressible flow simulation using the Euler equations.

  13. Identification of essential Alphaproteobacterial genes reveals operational variability in conserved developmental and cell cycle systems

    PubMed Central

    Curtis, Patrick D.; Brun, Yves V.


    Summary The cell cycle of Caulobacter crescentus is controlled by a complex signaling network that coordinates events. Genome sequencing has revealed many C. crescentus cell cycle genes are conserved in other Alphaproteobacteria, but it is not clear to what extent their function is conserved. As many cell cycle regulatory genes are essential in C. crescentus, the essential genes of two Alphaproteobacteria, Agrobacterium tumefaciens (Rhizobiales) and Brevundimonas subvibrioides (Caulobacterales), were elucidated to identify changes in cell cycle protein function over different phylogenetic distances as demonstrated by changes in essentiality. The results show the majority of conserved essential genes are involved in critical cell cycle processes. Changes in component essentiality reflect major changes in lifestyle, such as divisome components in A. tumefaciens resulting from that organism’s different growth pattern. Larger variability of essentiality was observed in cell cycle regulators, suggesting regulatory mechanisms are more customizable than the processes they regulate. Examples include variability in the essentiality of divJ and divK spatial cell cycle regulators, and non-essentiality of the highly conserved and usually essential DNA methyltransferase CcrM. These results show that while essential cell functions are conserved across varying genetic distance, much of a given organism’s essential gene pool is specific to that organism. PMID:24975755

  14. Evolutionary conservation in genes underlying human psychiatric disorders.


    Ogawa, Lisa M; Vallender, Eric J


    Many psychiatric diseases observed in humans have tenuous or absent analogs in other species. Most notable among these are schizophrenia and autism. One hypothesis has posited that these diseases have arisen as a consequence of human brain evolution, for example, that the same processes that led to advances in cognition, language, and executive function also resulted in novel diseases in humans when dysfunctional. Here, the molecular evolution of the protein-coding regions of genes associated with these and other psychiatric disorders are compared among species. Genes associated with psychiatric disorders are drawn from the literature and orthologous sequences are collected from eleven primate species (human, chimpanzee, bonobo, gorilla, orangutan, gibbon, macaque, baboon, marmoset, squirrel monkey, and galago) and 34 non-primate mammalian species. Evolutionary parameters, including dN/dS, are calculated for each gene and compared between disease classes and among species, focusing on humans and primates compared to other mammals, and on large-brained taxa (cetaceans, rhinoceros, walrus, bear, and elephant) compared to their small-brained sister species. Evidence of differential selection in humans to the exclusion of non-human primates was absent, however elevated dN/dS was detected in catarrhines as a whole, as well as in cetaceans, possibly as part of a more general trend. Although this may suggest that protein changes associated with schizophrenia and autism are not a cost of the higher brain function found in humans, it may also point to insufficiencies in the study of these diseases including incomplete or inaccurate gene association lists and/or a greater role of regulatory changes or copy number variation. Through this work a better understanding of the molecular evolution of the human brain, the pathophysiology of disease, and the genetic basis of human psychiatric disease is gained. PMID:24834046

  15. Evolutionary conservation in genes underlying human psychiatric disorders

    PubMed Central

    Ogawa, Lisa M.; Vallender, Eric J.


    Many psychiatric diseases observed in humans have tenuous or absent analogs in other species. Most notable among these are schizophrenia and autism. One hypothesis has posited that these diseases have arisen as a consequence of human brain evolution, for example, that the same processes that led to advances in cognition, language, and executive function also resulted in novel diseases in humans when dysfunctional. Here, the molecular evolution of the protein-coding regions of genes associated with these and other psychiatric disorders are compared among species. Genes associated with psychiatric disorders are drawn from the literature and orthologous sequences are collected from eleven primate species (human, chimpanzee, bonobo, gorilla, orangutan, gibbon, macaque, baboon, marmoset, squirrel monkey, and galago) and 34 non-primate mammalian species. Evolutionary parameters, including dN/dS, are calculated for each gene and compared between disease classes and among species, focusing on humans and primates compared to other mammals, and on large-brained taxa (cetaceans, rhinoceros, walrus, bear, and elephant) compared to their small-brained sister species. Evidence of differential selection in humans to the exclusion of non-human primates was absent, however elevated dN/dS was detected in catarrhines as a whole, as well as in cetaceans, possibly as part of a more general trend. Although this may suggest that protein changes associated with schizophrenia and autism are not a cost of the higher brain function found in humans, it may also point to insufficiencies in the study of these diseases including incomplete or inaccurate gene association lists and/or a greater role of regulatory changes or copy number variation. Through this work a better understanding of the molecular evolution of the human brain, the pathophysiology of disease, and the genetic basis of human psychiatric disease is gained. PMID:24834046

  16. Conserved cryptic recombination signals in Vκ gene segments are cleaved in small pre-B cells

    PubMed Central

    Lieberman, Anne E; Kuraoka, Masayuki; Davila, Marco; Kelsoe, Garnett; Cowell, Lindsay G


    Background The cleavage of recombination signals (RS) at the boundaries of immunoglobulin V, D, and J gene segments initiates the somatic generation of the antigen receptor genes expressed by B lymphocytes. RS contain a conserved heptamer and nonamer motif separated by non-conserved spacers of 12 or 23 nucleotides. Under physiologic conditions, V(D)J recombination follows the "12/23 rule" to assemble functional antigen-receptor genes, i.e., cleavage and recombination occur only between RS with dissimilar spacer types. Functional, cryptic RS (cRS) have been identified in VH gene segments; these VH cRS were hypothesized to facilitate self-tolerance by mediating VH → VHDJH replacements. At the Igκ locus, however, secondary, de novo rearrangements can delete autoreactive VκJκ joins. Thus, under the hypothesis that V-embedded cRS are conserved to facilitate self-tolerance by mediating V-replacement rearrangements, there would be little selection for Vκ cRS. Recent studies have demonstrated that VH cRS cleavage is only modestly more efficient than V(D)J recombination in violation of the 12/23 rule and first occurs in pro-B cells unable to interact with exogenous antigens. These results are inconsistent with a model of cRS cleavage during autoreactivity-induced VH gene replacement. Results To test the hypothesis that cRS are absent from Vκ gene segments, a corollary of the hypothesis that the need for tolerizing VH replacements is responsible for the selection pressure to maintain VH cRS, we searched for cRS in mouse Vκ gene segments using a statistical model of RS. Scans of 135 mouse Vκ gene segments revealed highly conserved cRS that were shown to be cleaved in the 103/BCL2 cell line and mouse bone marrow B cells. Analogous to results for VH cRS, we find that Vκ cRS are conserved at multiple locations in Vκ gene segments and are cleaved in pre-B cells. Conclusion Our results, together with those for VH cRS, support a model of cRS cleavage in which cleavage is

  17. Constraints on genes shape long-term conservation of macro-synteny in metazoan genomes

    PubMed Central


    Background Many metazoan genomes conserve chromosome-scale gene linkage relationships (“macro-synteny”) from the common ancestor of multicellular animal life [1-4], but the biological explanation for this conservation is still unknown. Double cut and join (DCJ) is a simple, well-studied model of neutral genome evolution amenable to both simulation and mathematical analysis [5], but as we show here, it is not sufficent to explain long-term macro-synteny conservation. Results We examine a family of simple (one-parameter) extensions of DCJ to identify models and choices of parameters consistent with the levels of macro- and micro-synteny conservation observed among animal genomes. Our software implements a flexible strategy for incorporating genomic context into the DCJ model to incorporate various types of genomic context (“DCJ-[C]”), and is available as open source software from Conclusions A simple model of genome evolution, in which DCJ moves are allowed only if they maintain chromosomal linkage among a set of constrained genes, can simultaneously account for the level of macro-synteny conservation and for correlated conservation among multiple pairs of species. Simulations under this model indicate that a constraint on approximately 7% of metazoan genes is sufficient to constrain genome rearrangement to an average rate of 25 inversions and 1.7 translocations per million years. PMID:22151646

  18. A cross-species bi-clustering approach to identifying conserved co-regulated genes

    PubMed Central

    Sun, Jiangwen; Jiang, Zongliang; Tian, Xiuchun; Bi, Jinbo


    Motivation: A growing number of studies have explored the process of pre-implantation embryonic development of multiple mammalian species. However, the conservation and variation among different species in their developmental programming are poorly defined due to the lack of effective computational methods for detecting co-regularized genes that are conserved across species. The most sophisticated method to date for identifying conserved co-regulated genes is a two-step approach. This approach first identifies gene clusters for each species by a cluster analysis of gene expression data, and subsequently computes the overlaps of clusters identified from different species to reveal common subgroups. This approach is ineffective to deal with the noise in the expression data introduced by the complicated procedures in quantifying gene expression. Furthermore, due to the sequential nature of the approach, the gene clusters identified in the first step may have little overlap among different species in the second step, thus difficult to detect conserved co-regulated genes. Results: We propose a cross-species bi-clustering approach which first denoises the gene expression data of each species into a data matrix. The rows of the data matrices of different species represent the same set of genes that are characterized by their expression patterns over the developmental stages of each species as columns. A novel bi-clustering method is then developed to cluster genes into subgroups by a joint sparse rank-one factorization of all the data matrices. This method decomposes a data matrix into a product of a column vector and a row vector where the column vector is a consistent indicator across the matrices (species) to identify the same gene cluster and the row vector specifies for each species the developmental stages that the clustered genes co-regulate. Efficient optimization algorithm has been developed with convergence analysis. This approach was first validated on

  19. The putative cell cycle gene, enhancer of rudimentary, encodes a highly conserved protein found in plants and animals.


    Gelsthorpe, M; Pulumati, M; McCallum, C; Dang-Vu, K; Tsubota, S I


    The enhancer of rudimentary gene, e(r), in Drosophila melanogaster encodes a protein, ER, whose function has been implicated in pyrimidine biosynthesis and the cell cycle (Wojcik et al. (1994) Genetics 138, 1163-1170). In order to identify conserved regions of the protein and potentially important functional domains, the e(r) gene was cloned and sequenced from two other insects (Drosophila virilis and Aedes aegypti) and three vertebrates (Homo sapiens, Mus musculus, and Brachydanio rerio) and sequenced from a flowering plant (Arabidopsis thaliana). These sequences along with those of a nematode (Caenorhabditis elegans) exhibit a high degree of identity. ER of Drosophila melanogaster is 76% identical to the three vertebrate proteins, 49% identical to the nematode protein, and 40% identical to the plant protein. There is high evolutionary conservation among the vertebrates. The mouse and human proteins are identical and differ from that of the zebrafish by a single conservative amino-acid change (valine for isoleucine). A dramatic sequence conservation is seen in the position of the hydrophobic amino acids. Of the 27 positions occupied by hydrophobic amino acids in ER of Drosophila melanogaster, 25 of the corresponding positions in the human protein, 23 of the positions in Caenorhabditis elegans, and 20 of the positions in Arabidopsis thaliana have hydrophobic amino acids. Most of these residues are present in three conserved amphipathic alpha-helices, which are proposed to function in protein-protein interactions. Two phosphorylation sites for casein kinase II (CKII) have also been conserved within the animal groups. Purified ER from Drosophila melanogaster is phosphorylated in vitro by CKII, arguing that these two sites are functional in vivo. A putative shift in the secondary structure of ER caused by the phosphorylation of these sites suggests that CKII may be regulating the activity of the ER in vivo. PMID:9074495

  20. Evolutionary Conservation and Network Structure Characterize Genes of Phenotypic Relevance for Mitosis in Human

    PubMed Central

    del Sol, Antonio


    The impact of gene silencing on cellular phenotypes is difficult to establish due to the complexity of interactions in the associated biological processes and pathways. A recent genome-wide RNA knock-down study both identified and phenotypically characterized a set of important genes for the cell cycle in HeLa cells. Here, we combine a molecular interaction network analysis, based on physical and functional protein interactions, in conjunction with evolutionary information, to elucidate the common biological and topological properties of these key genes. Our results show that these genes tend to be conserved with their corresponding protein interactions across several species and are key constituents of the evolutionary conserved molecular interaction network. Moreover, a group of bistable network motifs is found to be conserved within this network, which are likely to influence the network stability and therefore the robustness of cellular functioning. They form a cluster, which displays functional homogeneity and is significantly enriched in genes phenotypically relevant for mitosis. Additional results reveal a relationship between specific cellular processes and the phenotypic outcomes induced by gene silencing. This study introduces new ideas regarding the relationship between genotype and phenotype in the context of the cell cycle. We show that the analysis of molecular interaction networks can result in the identification of genes relevant to cellular processes, which is a promising avenue for future research. PMID:22577488

  1. Identification and analysis of a highly conserved chemotaxis gene cluster in Shewanella species.

    SciTech Connect

    Li, J.; Romine, Margaret F.; Ward, M.


    A conserved cluster of chemotaxis genes was identified from the genome sequences of fifteen Shewanella species. An in-frame deletion of the cheA-3 gene, which is located in this cluster, was created in S. oneidensis MR-1 and the gene shown to be essential for chemotactic responses to anaerobic electron acceptors. The CheA-3 protein showed strong similarity to Vibrio cholerae CheA-2 and P. aeruginosa CheA-1, two proteins that are also essential for chemotaxis. The genes encoding these proteins were shown to be located in chemotaxis gene clusters closely related to the cheA-3-containing cluster in Shewanella species. The results of this study suggest that a combination of gene neighborhood and homology analyses may be used to predict which cheA genes are essential for chemotaxis in groups of closely related microorganisms.

  2. Ordered expression pattern of Hox and ParaHox genes along the alimentary canal in the ascidian juvenile.


    Nakayama, Satoshi; Satou, Kunihiro; Orito, Wataru; Ogasawara, Michio


    The Hox and ParaHox genes of bilateria share a similar expression pattern along the body axis and are known to be associated with anterior-posterior patterning. In vertebrates, the Hox genes are also expressed in presomitic mesoderm and gut endoderm and the ParaHox genes show a restricted expression pattern in the gut-related derivatives. Regional expression patterns in the embryonic central nervous system of the basal chordates amphioxus and ascidian have been reported; however, little is known about their endodermal expression in the alimentary canal. We focus on the Hox and ParaHox genes in the ascidian Ciona intestinalis and investigate the gene expression patterns in the juvenile, which shows morphological regionality in the alimentary canal. Gene expression analyses by using whole-mount in situ hybridization reveal that all Hox genes have a regional expression pattern along the alimentary canal. Expression of Hox1 to Hox4 is restricted to the posterior region of pharyngeal derivatives. Hox5 to Hox13 show an ordered expression pattern correlated with each Hox gene number along the postpharyngeal digestive tract. This expression pattern along the anterior-posterior axis has also been observed in Ciona ParaHox genes. Our observations suggest that ascidian Hox and ParaHox clusters are dispersed; however, the ordered expression patterns along the alimentary canal appear to be conserved among chordates. PMID:26837224

  3. Syntenic conservation of HSP70 genes in cattle and humans

    SciTech Connect

    Grosz, M.D.; Womack, J.E.; Skow, L.C. )


    A phage library of bovine genomic DNA was screened for hybridization with a human HSP70 cDNA probe, and 21 positive plaques were identified and isolated. Restriction mapping and blot hybridization analysis of DNA from the recombinant plaques demonstrated that the cloned DNAs were derived from three different regions of the bovine genome. Ore region contains two tandemly arrayed HSP70 sequences, designated HSP70-1 and HSP70-2, separated by approximately 8 kb of DNA. Single HSP70 sequences, designated HSP70-3 and HSP70-4, were found in two other genomic regions. Locus-specific probes of unique flanking sequences from representative HSP70 clones were hybridized to restriction endonuclease-digested DNA from bovine-hamster and bovine-mouse somatic cell hybrid panels to determine the chromosomal location of the HSP70 sequences. The probe for the tandemly arrayed HSP70-1 and HSP70-2 sequences mapped to bovine chromosome 23, syntenic with glyoxalase 1, 21 steroid hydroxylase, and major histocompatibility class I loci. HSP70-3 sequences mapped to bovine chromosome 10, syntenic with nucleoside phosphorylase and murine osteosarcoma viral oncogene (v-fos), and HSP70-4 mapped to bovine syntenic group U6, syntenic with amylase 1 and phosphoglucomutase 1. On the basis of these data, the authors propose that bovine HSP70-1,2 are homologous to human HSPA1 and HSPA1L on chromosome 6p21.3, bovine HSP70-3 is the homolog of an unnamed human HSP70 gene on chromosome 14q22-q24, and bovine HSP70-4 is homologous to one of the human HSPA-6,-7 genes on chromosome 1. 34 refs., 2 figs., 1 tab.

  4. Conserved miR164-targeted NAC genes negatively regulate drought resistance in rice

    PubMed Central

    Xie, Kabin; Xiong, Lizhong


    MicroRNAs constitute a large group of endogenous small RNAs of ~22 nt that emerge as vital regulators, mainly by targeting mRNAs for post-transcriptional repression. Previous studies have revealed that the miR164 family in Arabidopsis is comprised of three members which guide the cleavage of the mRNAs of five NAC genes to modulate developmental processes. However, the functions of the miR164-targeted NAC genes in crops are poorly deciphered. In this study, the conserved features of six miR164-targeted NAC genes (OMTN1–OMTN6) in rice are described, and evidence is provided that four of them confer a negative regulatory role in drought resistance. OMTN proteins have the characteristics of typical NAC transcriptional factors. The miR164 recognition sites of the OMTN genes are highly conserved in rice germplasms. Deletion of the recognition sites impaired the transactivation activity, indicating that the conserved recognition sites play a crucial role in maintaining the function of the OMTN proteins. The OMTN genes were responsive to abiotic stresses, and showed diverse spatio-temporal expression patterns in rice. Overexpression of OMTN2, OMTN3, OMTN4, and OMTN6 in rice led to negative effects on drought resistance at the reproductive stage. The expression of numerous genes related to stress response, development, and metabolism was altered in OMTN2-, OMTN3-, OMTN4-, and OMTN6-overexpressing plants. Most of the up-regulated genes in the OMTN-overexpressing plants were down-regulated by drought stress. The results suggest that the conserved miR164-targeted NAC genes may be negative regulators of drought tolerance in rice, in addition to their reported roles in development. PMID:24604734

  5. Optimization of a large-scale gene disruption protocol in Dictyostelium and analysis of conserved genes of unknown function

    PubMed Central

    Torija, Patricia; Robles, Alicia; Escalante, Ricardo


    Background Development of the post-genomic age in Dictyostelium will require the existence of rapid and reliable methods to disrupt genes that would allow the analysis of entire gene families and perhaps the possibility to undertake the complete knock-out analysis of all the protein-coding genes present in Dictyostelium genome. Results Here we present an optimized protocol based on the previously described construction of gene disruption vectors by in vitro transposition. Our method allows a rapid selection of the construct by a simple PCR approach and subsequent sequencing. Disruption constructs were amplified by PCR and the products were directly transformed in Dictyostelium cells. The selection of homologous recombination events was also performed by PCR. We have constructed 41 disruption vectors to target genes of unknown function, highly conserved between Dictyostelium and human, but absent from the genomes of S. cerevisiae and S. pombe. 28 genes were successfully disrupted. Conclusion This is the first step towards the understanding of the function of these conserved genes and exemplifies the easiness to undertake large-scale disruption analysis in Dictyostelium. PMID:16945142

  6. Continuum Kinetic Plasma Modeling Using a Conservative 4th-Order Method with AMR

    NASA Astrophysics Data System (ADS)

    Vogman, Genia; Colella, Phillip


    When the number of particles in a Debye sphere is large, a plasma can be accurately represented by a distribution function, which can be treated as a continuous incompressible fluid in phase space. In the most general case the evolution of such a distribution function is described by the 6D Boltzmann-Maxwell partial differential equation system. To address the challenges associated with solving a 6D hyperbolic governing equation, a simpler 3D Vlasov-Poisson system is considered. A 4th-order accurate Vlasov-Poisson model has been developed in one spatial and two velocity dimensions. The governing equation is cast in conservation law form and is solved with a finite volume representation. Adaptive mesh refinement (AMR) is used to allow for efficient use of computational resources while maintaining desired levels of resolution. The model employs a flux limiter to remedy non-physical effects such as numerical dispersion. The model is tested on the two-stream, beam-plasma, and Dory-Guest-Harris instabilities. All results are compared with linear theory.

  7. Vertebrate paralogous conserved noncoding sequences may be related to gene expressions in brain.


    Matsunami, Masatoshi; Saitou, Naruya


    Vertebrate genomes include gene regulatory elements in protein-noncoding regions. A part of gene regulatory elements are expected to be conserved according to their functional importance, so that evolutionarily conserved noncoding sequences (CNSs) might be good candidates for those elements. In addition, paralogous CNSs, which are highly conserved among both orthologous loci and paralogous loci, have the possibility of controlling overlapping expression patterns of their adjacent paralogous protein-coding genes. The two-round whole-genome duplications (2R WGDs), which most probably occurred in the vertebrate common ancestors, generated large numbers of paralogous protein-coding genes and their regulatory elements. These events could contribute to the emergence of vertebrate features. However, the evolutionary history and influences of the 2R WGDs are still unclear, especially in noncoding regions. To address this issue, we identified paralogous CNSs. Region-focused Basic Local Alignment Search Tool (BLAST) search of each synteny block revealed 7,924 orthologous CNSs and 309 paralogous CNSs conserved among eight high-quality vertebrate genomes. Paralogous CNSs we found contained 115 previously reported ones and newly detected 194 ones. Through comparisons with VISTA Enhancer Browser and available ChIP-seq data, one-third (103) of paralogous CNSs detected in this study showed gene regulatory activity in the brain at several developmental stages. Their genomic locations are highly enriched near the transcription factor-coding regions, which are expressed in brain and neural systems. These results suggest that paralogous CNSs are conserved mainly because of maintaining gene expression in the vertebrate brain. PMID:23267051

  8. A conserved set of maternal genes? Insights from a molluscan transcriptome.


    Liu, M Maureen; Davey, John W; Jackson, Daniel J; Blaxter, Mark L; Davison, Angus


    The early animal embryo is entirely reliant on maternal gene products for a 'jump-start' that transforms a transcriptionally inactive embryo into a fully functioning zygote. Despite extensive work on model species, it has not been possible to perform a comprehensive comparison of maternally-provisioned transcripts across the Bilateria because of the absence of a suitable dataset from the Lophotrochozoa. As part of an ongoing effort to identify the maternal gene that determines left-right asymmetry in snails, we have generated transcriptome data from 1 to 2-cell and ~32-cell pond snail (Lymnaea stagnalis) embryos. Here, we compare these data to maternal transcript datasets from other bilaterian metazoan groups, including representatives of the Ecydysozoa and Deuterostomia. We found that between 5 and 10% of all L. stagnalis maternal transcripts (~300-400 genes) are also present in the equivalent arthropod (Drosophila melanogaster), nematode (Caenorhabditis elegans), urochordate (Ciona intestinalis) and chordate (Homo sapiens, Mus musculus, Danio rerio) datasets. While the majority of these conserved maternal transcripts ("COMATs") have housekeeping gene functions, they are a non-random subset of all housekeeping genes, with an overrepresentation of functions associated with nucleotide binding, protein degradation and activities associated with the cell cycle. We conclude that a conserved set of maternal transcripts and their associated functions may be a necessary starting point of early development in the Bilateria. For the wider community interested in discovering conservation of gene expression in early bilaterian development, the list of putative COMATs may be useful resource. PMID:25690965

  9. A Collection of Conserved Noncoding Sequences to Study Gene Regulation in Flowering Plants1[OPEN

    PubMed Central


    Transcription factors (TFs) regulate gene expression by binding cis-regulatory elements, of which the identification remains an ongoing challenge owing to the prevalence of large numbers of nonfunctional TF binding sites. Powerful comparative genomics methods, such as phylogenetic footprinting, can be used for the detection of conserved noncoding sequences (CNSs), which are functionally constrained and can greatly help in reducing the number of false-positive elements. In this study, we applied a phylogenetic footprinting approach for the identification of CNSs in 10 dicot plants, yielding 1,032,291 CNSs associated with 243,187 genes. To annotate CNSs with TF binding sites, we made use of binding site information for 642 TFs originating from 35 TF families in Arabidopsis (Arabidopsis thaliana). In three species, the identified CNSs were evaluated using TF chromatin immunoprecipitation sequencing data, resulting in significant overlap for the majority of data sets. To identify ultraconserved CNSs, we included genomes of additional plant families and identified 715 binding sites for 501 genes conserved in dicots, monocots, mosses, and green algae. Additionally, we found that genes that are part of conserved mini-regulons have a higher coherence in their expression profile than other divergent gene pairs. All identified CNSs were integrated in the PLAZA 3.0 Dicots comparative genomics platform ( together with new functionalities facilitating the exploration of conserved cis-regulatory elements and their associated genes. The availability of this data set in a user-friendly platform enables the exploration of functional noncoding DNA to study gene regulation in a variety of plant species, including crops. PMID:27261064

  10. A Collection of Conserved Noncoding Sequences to Study Gene Regulation in Flowering Plants.


    Van de Velde, Jan; Van Bel, Michiel; Vaneechoutte, Dries; Vandepoele, Klaas


    Transcription factors (TFs) regulate gene expression by binding cis-regulatory elements, of which the identification remains an ongoing challenge owing to the prevalence of large numbers of nonfunctional TF binding sites. Powerful comparative genomics methods, such as phylogenetic footprinting, can be used for the detection of conserved noncoding sequences (CNSs), which are functionally constrained and can greatly help in reducing the number of false-positive elements. In this study, we applied a phylogenetic footprinting approach for the identification of CNSs in 10 dicot plants, yielding 1,032,291 CNSs associated with 243,187 genes. To annotate CNSs with TF binding sites, we made use of binding site information for 642 TFs originating from 35 TF families in Arabidopsis (Arabidopsis thaliana). In three species, the identified CNSs were evaluated using TF chromatin immunoprecipitation sequencing data, resulting in significant overlap for the majority of data sets. To identify ultraconserved CNSs, we included genomes of additional plant families and identified 715 binding sites for 501 genes conserved in dicots, monocots, mosses, and green algae. Additionally, we found that genes that are part of conserved mini-regulons have a higher coherence in their expression profile than other divergent gene pairs. All identified CNSs were integrated in the PLAZA 3.0 Dicots comparative genomics platform ( together with new functionalities facilitating the exploration of conserved cis-regulatory elements and their associated genes. The availability of this data set in a user-friendly platform enables the exploration of functional noncoding DNA to study gene regulation in a variety of plant species, including crops. PMID:27261064

  11. Lie symmetry analysis, conservation laws and exact solutions of the seventh-order time fractional Sawada-Kotera-Ito equation

    NASA Astrophysics Data System (ADS)

    Yaşar, Emrullah; Yıldırım, Yakup; Khalique, Chaudry Masood

    In this paper Lie symmetry analysis of the seventh-order time fractional Sawada-Kotera-Ito (FSKI) equation with Riemann-Liouville derivative is performed. Using the Lie point symmetries of FSKI equation, it is shown that it can be transformed into a nonlinear ordinary differential equation of fractional order with a new dependent variable. In the reduced equation the derivative is in Erdelyi-Kober sense. Furthermore, adapting the Ibragimov's nonlocal conservation method to time fractional partial differential equations, we obtain conservation laws of the underlying equation. In addition, we construct some exact travelling wave solutions for the FSKI equation using the sub-equation method.

  12. Effects of the light goose conservation order on non-target waterfowl distribution during spring migration

    USGS Publications Warehouse

    Dinges, Andrew J.; Webb, Elisabeth B.; Vrtiska, Mark P.


    The Light Goose Conservation Order (LGCO) was initiated in 1999 to reduce mid-continent populations of light geese (lesser snow geese Chen caerulescens and Ross's geese C. rossi). However, concern about potential for LGCO activities (i.e. hunting activities) to negatively impact non-target waterfowl species during spring migration in the Rainwater Basin (RWB) of Nebraska prompted agency personnel to limit the number of hunt days each week and close multiple public wetlands to LGCO activities entirely. To evaluate the effects of the LGCO in the RWB, we quantified waterfowl density at wetlands open and closed to LGCO hunting and recorded all hunter encounters during springs 2011 and 2012. We encountered a total of 70 hunting parties on 22 study wetlands, with over 90% of these encounters occurring during early season when the majority of waterfowl used the RWB region. We detected greater overall densities of dabbling ducks Anas spp., as well as for mallards A. platyrhynchos and northern pintails A. acuta on wetlands closed to the LGCO. We detected no effects of hunt day in the analyses of dabbling duck densities. We detected no differences in mean weekly dabbling duck densities among wetlands open to hunting, regardless of weekly or cumulative hunting encounter frequency throughout early season. Additionally, hunting category was not a predictor for the presence of greater white-fronted geese Anser albifronsin a logistic regression model. Given that dabbling duck densities were greater on wetlands closed to hunting, providing wetlands free from hunting disturbance as refugia during the LGCO remains an important management strategy at migration stopover sites. However, given that we did not detect an effect of hunt day or hunting frequency on dabbling duck density, our results suggest increased hunting frequency at sites already open to hunting would likely have minimal impacts on the distribution of non-target waterfowl species using the region for spring

  13. Gene structure and evolution of transthyretin in the order Chiroptera.


    Khwanmunee, Jiraporn; Leelawatwattana, Ladda; Prapunpoj, Porntip


    Bats are mammals in the order Chiroptera. Although many extensive morphologic and molecular genetics analyses have been attempted, phylogenetic relationships of bats has not been completely resolved. The paraphyly of microbats is of particular controversy that needs to be confirmed. In this study, we attempted to use the nucleotide sequence of transthyretin (TTR) intron 1 to resolve the relationship among bats. To explore its utility, the complete sequences of TTR gene and intron 1 region of bats in Vespertilionidae: genus Eptesicus (Eptesicus fuscus) and genus Myotis (Myotis brandtii, Myotis davidii, and Myotis lucifugus), and Pteropodidae (Pteropus alecto and Pteropus vampyrus) were extracted from the retrieved sequences, whereas those of Rhinoluphus affinis and Scotophilus kuhlii were amplified and sequenced. The derived overall amino sequences of bat TTRs were found to be very similar to those in other eutherians but differed from those in other classes of vertebrates. However, missing of amino acids from N-terminal or C-terminal region was observed. The phylogenetic analysis of amino acid sequences suggested bat and other eutherian TTRs lineal descent from a single most recent common ancestor which differed from those of non-placental mammals and the other classes of vertebrates. The splicing of bat TTR precursor mRNAs was similar to those of other eutherian but different from those of marsupial, bird, reptile and amphibian. Based on TTR intron 1 sequence, the inferred evolutionary relationship within Chiroptera revealed more closely relatedness of R. affinis to megabats than to microbats. Accordingly, the paraphyly of microbats was suggested. PMID:26681450

  14. Discovery of five conserved β-defensin gene clusters using a computational search strategy

    PubMed Central

    Schutte, Brian C.; Mitros, Joseph P.; Bartlett, Jennifer A.; Walters, Jesse D.; Jia, Hong Peng; Welsh, Michael J.; Casavant, Thomas L.; McCray, Paul B.


    The innate immune system includes antimicrobial peptides that protect multicellular organisms from a diverse spectrum of microorganisms. β-Defensins comprise one important family of mammalian antimicrobial peptides. The annotation of the human genome fails to reveal the expected diversity, and a recent query of the draft sequence with the blast search engine found only one new β-defensin gene (DEFB3). To define better the β-defensin gene family, we adopted a genomics approach that uses hmmer, a computational search tool based on hidden Markov models, in combination with blast. This strategy identified 28 new human and 43 new mouse β-defensin genes in five syntenic chromosomal regions. Within each syntenic cluster, the gene sequences and organization were similar, suggesting each cluster pair arose from a common ancestor and was retained because of conserved functions. Preliminary analysis indicates that at least 26 of the predicted genes are transcribed. These results demonstrate the value of a genomewide search strategy to identify genes with conserved structural motifs. Discovery of these genes represents a new starting point for exploring the role of β-defensins in innate immunity. PMID:11854508

  15. Discovering gene re-ranking efficiency and conserved gene-gene relationships derived from gene co-expression network analysis on breast cancer data

    PubMed Central

    Bourdakou, Marilena M.; Athanasiadis, Emmanouil I.; Spyrou, George M.


    Systemic approaches are essential in the discovery of disease-specific genes, offering a different perspective and new tools on the analysis of several types of molecular relationships, such as gene co-expression or protein-protein interactions. However, due to lack of experimental information, this analysis is not fully applicable. The aim of this study is to reveal the multi-potent contribution of statistical network inference methods in highlighting significant genes and interactions. We have investigated the ability of statistical co-expression networks to highlight and prioritize genes for breast cancer subtypes and stages in terms of: (i) classification efficiency, (ii) gene network pattern conservation, (iii) indication of involved molecular mechanisms and (iv) systems level momentum to drug repurposing pipelines. We have found that statistical network inference methods are advantageous in gene prioritization, are capable to contribute to meaningful network signature discovery, give insights regarding the disease-related mechanisms and boost drug discovery pipelines from a systems point of view. PMID:26892392

  16. A high order approximation of hyperbolic conservation laws in networks: Application to one-dimensional blood flow

    NASA Astrophysics Data System (ADS)

    Müller, Lucas O.; Blanco, Pablo J.


    We present a methodology for the high order approximation of hyperbolic conservation laws in networks by using the Dumbser-Enaux-Toro solver and exact solvers for the classical Riemann problem at junctions. The proposed strategy can be applied to any hyperbolic system, conservative or non-conservative, and possibly with flux functions containing discontinuous parameters, as long as an exact or approximate Riemann problem solver is available. The methodology is implemented for a one-dimensional blood flow model that considers discontinuous variations of mechanical and geometrical properties of vessels. The achievement of formal order of accuracy, as well as the robustness of the resulting numerical scheme, is verified through the simulation of both, academic tests and physiological flows.

  17. Acceleration of X-chromosome gene order evolution in the cattle lineage

    PubMed Central

    Park, Woncheoul; Oh, Hee-Seok; Kim, Heebal


    The gene order on the X chromosome of eutherians is generally highly conserved, although an increase in the rate of rearrangement has been reported in the rodent lineage. Conservation of the X chromosome is thought to be caused by selection related to maintenance of dosage compensation. However, we herein reveal that the cattle (Btau4.0) lineage has experienced a strong increase in the rate of X-chromosome rearrangement, much stronger than that previously reported for rodents. We also show that this increase is not matched by a similar increase on the autosomes and cannot be explained by assembly errors. Furthermore, we compared the difference in two cattle genome assemblies: Btau4.0 and Btau6.0 (Bos taurus UMD3.1). The results showed a discrepancy between Btau4.0 and Btau6.0 cattle assembly version data, and we believe that Btau6.0 cattle assembly version data are not more reliable than Btau4.0. [BMB Reports 2013; 46(6): 310-315] PMID:23790974

  18. Acceleration of X-chromosome gene order evolution in the cattle lineage.


    Park, Woncheoul; Oh, Hee-Seok; Kim, Heebal


    The gene order on the X chromosome of eutherians is generally highly conserved, although an increase in the rate of rearrangement has been reported in the rodent lineage. Conservation of the X chromosome is thought to be caused by selection related to maintenance of dosage compensation. However, we herein reveal that the cattle (Btau4.0) lineage has experienced a strong increase in the rate of X-chromosome rearrangement, much stronger than that previously reported for rodents. We also show that this increase is not matched by a similar increase on the autosomes and cannot be explained by assembly errors. Furthermore, we compared the difference in two cattle genome assemblies: Btau4.0 and Btau6.0 (Bos taurus UMD3.1). The results showed a discrepancy between Btau4.0 and Btau6.0 cattle assembly version data, and we believe that Btau6.0 cattle assembly version data are not more reliable than Btau4.0. PMID:23790974

  19. Conservation of Pax gene expression in ectodermal placodes of the lamprey

    NASA Technical Reports Server (NTRS)

    McCauley, David W.; Bronner-Fraser, Marianne


    Ectodermal placodes contribute to the cranial ganglia and sense organs of the head and, together with neural crest cells, represent defining features of the vertebrate embryo. The identity of different placodes appears to be specified in part by the expression of different Pax genes, with Pax-3/7 class genes being expressed in the trigeminal placode of mice, chick, frogs and fish, and Pax-2/5/8 class genes expressed in the otic placode. Here, we present the cloning and expression pattern of lamprey Pax-7 and Pax-2, which mark the trigeminal and otic placodes, respectively, as well as other structures characteristic of vertebrate Pax genes. These results suggest conservation of Pax genes and placodal structures in basal and derived vertebrates.

  20. Regulation of SHOOT MERISTEMLESS genes via an upstream-conserved noncoding sequence coordinates leaf development

    PubMed Central

    Uchida, Naoyuki; Townsley, Brad; Chung, Kook-Hyun; Sinha, Neelima


    The indeterminate shoot apical meristem of plants is characterized by the expression of the Class 1 KNOTTED1-LIKE HOMEOBOX (KNOX1) genes. KNOX1 genes have been implicated in the acquisition and/or maintenance of meristematic fate. One of the earliest indicators of a switch in fate from indeterminate meristem to determinate leaf primordium is the down-regulation of KNOX1 genes orthologous to SHOOT MERISTEMLESS (STM) in Arabidopsis (hereafter called STM genes) in the initiating primordia. In simple leafed plants, this down-regulation persists during leaf formation. In compound leafed plants, however, KNOX1 gene expression is reestablished later in the developing primordia, creating an indeterminate environment for leaflet formation. Despite this knowledge, most aspects of how STM gene expression is regulated remain largely unknown. Here, we identify two evolutionarily conserved noncoding sequences within the 5′ upstream region of STM genes in both simple and compound leafed species across monocots and dicots. We show that one of these elements is involved in the regulation of the persistent repression and/or the reestablishment of STM expression in the developing leaves but is not involved in the initial down-regulation in the initiating primordia. We also show evidence that this regulation is developmentally significant for leaf formation in the pathway involving ASYMMETRIC LEAVES1/2 (AS1/2) gene expression; these genes are known to function in leaf development. Together, these findings reveal a regulatory point of leaf development mediated through a conserved, noncoding sequence in STM genes. PMID:17898165

  1. Epigenetic conservation at gene regulatory elements revealed by non-methylated DNA profiling in seven vertebrates.


    Long, Hannah K; Sims, David; Heger, Andreas; Blackledge, Neil P; Kutter, Claudia; Wright, Megan L; Grützner, Frank; Odom, Duncan T; Patient, Roger; Ponting, Chris P; Klose, Robert J


    Two-thirds of gene promoters in mammals are associated with regions of non-methylated DNA, called CpG islands (CGIs), which counteract the repressive effects of DNA methylation on chromatin. In cold-blooded vertebrates, computational CGI predictions often reside away from gene promoters, suggesting a major divergence in gene promoter architecture across vertebrates. By experimentally identifying non-methylated DNA in the genomes of seven diverse vertebrates, we instead reveal that non-methylated islands (NMIs) of DNA are a central feature of vertebrate gene promoters. Furthermore, NMIs are present at orthologous genes across vast evolutionary distances, revealing a surprising level of conservation in this epigenetic feature. By profiling NMIs in different tissues and developmental stages we uncover a unifying set of features that are central to the function of NMIs in vertebrates. Together these findings demonstrate an ancient logic for NMI usage at gene promoters and reveal an unprecedented level of epigenetic conservation across vertebrate evolution. DOI: PMID:23467541

  2. Fibrinogen {alpha} genes: Conservation of bipartite transcripts and carboxy-terminal-extended {alpha} subunits in vertebrates

    SciTech Connect

    Fu, Y.; Cao, Y.; Hertzberg, K.M.; Grieninger, G.


    All three well-studied subunits of the clotting protein fibrinogen ({alpha}, {beta}, {gamma}) share N-terminal structural homologies, but until recently only the {beta} and {gamma} chains were recognized as having similar globular C-termini. With the discovery of an extra exon in the human fibrinogen {alpha} gene (exon VI), a minor form of the {alpha} subunit ({alpha}{sub E}) with an extended {beta}- and {gamma}-like C-terminus has been identified. In the present study, the polymerase chain reaction has been used to identify sequences that encode counterparts to {alpha}{sub E} in chicken, rabbit, rat, and baboon. The basic six-exon structure of the fibrinogen {alpha} genes is shown to be conserved among mammals and birds, as are the intron positions. Bipartite transcripts - still bearing an intron prior to the last exon - are found among the products of the various vertebrate fibrinogen {alpha} genes. The last exon represents the largest conserved segment of the gene and, in each species examined, encodes exactly 236 amino acids. The C-termini of these {alpha}{sub E} chains align without a single gap and are between 76 and 99% identical. Since the exon VI-encoded domain of {alpha}{sub E} is as well conserved as the corresponding regions of the {beta} and {gamma} chains, it follows that it is equally important and that {alpha}{sub E}-fibrinogen plays a vital, if as-yet unrecognized physiological role. 21 refs., 7 figs., 1 tab.

  3. Gene expression of pluripotency determinants is conserved between mammalian and planarian stem cells

    PubMed Central

    Önal, Pinar; Grün, Dominic; Adamidi, Catherine; Rybak, Agnieszka; Solana, Jordi; Mastrobuoni, Guido; Wang, Yongbo; Rahn, Hans-Peter; Chen, Wei; Kempa, Stefan; Ziebold, Ulrike; Rajewsky, Nikolaus


    Freshwater planaria possess extreme regeneration capabilities mediated by abundant, pluripotent stem cells (neoblasts) in adult animals. Although planaria emerged as an attractive in vivo model system for stem cell biology, gene expression in neoblasts has not been profiled comprehensively and it is unknown how molecular mechanisms for pluripotency in neoblasts relate to those in mammalian embryonic stem cells (ESCs). We purified neoblasts and quantified mRNA and protein expression by sequencing and shotgun proteomics. We identified ∼4000 genes specifically expressed in neoblasts, including all ∼30 known neoblast markers. Genes important for pluripotency in ESCs, including regulators as well as targets of OCT4, were well conserved and upregulated in neoblasts. We found conserved expression of epigenetic regulators and demonstrated their requirement for planarian regeneration by knockdown experiments. Post-transcriptional regulatory genes characteristic for germ cells were also enriched in neoblasts, suggesting the existence of a common ancestral state of germ cells and ESCs. We conclude that molecular determinants of pluripotency are conserved throughout evolution and that planaria are an informative model system for human stem cell biology. PMID:22543868

  4. G-boxes, bigfoot genes, and environmental response: characterization of intragenomic conserved noncoding sequences in Arabidopsis.


    Freeling, Michael; Rapaka, Lakshmi; Lyons, Eric; Pedersen, Brent; Thomas, Brian C


    A tetraploidy left Arabidopsis thaliana with 6358 pairs of homoeologs that, when aligned, generated 14,944 intragenomic conserved noncoding sequences (CNSs). Our previous work assembled these phylogenetic footprints into a database. We show that known transcription factor (TF) binding motifs, including the G-box, are overrepresented in these CNSs. A total of 254 genes spanning long lengths of CNS-rich chromosomes (Bigfoot) dominate this database. Therefore, we made subdatabases: one containing Bigfoot genes and the other containing genes with three to five CNSs (Smallfoot). Bigfoot genes are generally TFs that respond to signals, with their modal CNS positioned 3.1 kb 5' from the ATG. Smallfoot genes encode components of signal transduction machinery, the cytoskeleton, or involve transcription. We queried each subdatabase with each possible 7-nucleotide sequence. Among hundreds of hits, most were purified from CNSs, and almost all of those significantly enriched in CNSs had no experimental history. The 7-mers in CNSs are not 5'- to 3'-oriented in Bigfoot genes but are often oriented in Smallfoot genes. CNSs with one G-box tend to have two G-boxes. CNSs were shared with the homoeolog only and with no other gene, suggesting that binding site turnover impedes detection. Bigfoot genes may function in adaptation to environmental change. PMID:17496117

  5. Achieving spectrum conservation for the minimum-span and minimum-order frequency assignment problems

    NASA Technical Reports Server (NTRS)

    Heyward, Ann O.


    Effective and efficient solutions of frequency assignment problems assumes increasing importance as the radiofrequency spectrum experiences ever increasing utilization by diverse communications services, requiring that the most efficient use of this resource be achieved. The research presented explores a general approach to the frequency assignment problem, in which such problems are categorized by the appropriate spectrum conserving objective function, and are each treated as an N-job, M-machine scheduling problem appropriate for the objective. Results obtained and presented illustrate that such an approach presents an effective means of achieving spectrum conserving frequency assignments for communications systems in a variety of environments.

  6. [Identification of new conserved and variable regions in the 16S rRNA gene of acetic acid bacteria and acetobacteraceae family].


    Chakravorty, S; Sarkar, S; Gachhui, R


    The Acetobacteraceae family of the class Alpha Proteobacteria is comprised of high sugar and acid tolerant bacteria. The Acetic Acid Bacteria are the economically most significant group of this family because of its association with food products like vinegar, wine etc. Acetobacteraceae are often hard to culture in laboratory conditions and they also maintain very low abundances in their natural habitats. Thus identification of the organisms in such environments is greatly dependent on modern tools of molecular biology which require a thorough knowledge of specific conserved gene sequences that may act as primers and or probes. Moreover unconserved domains in genes also become markers for differentiating closely related genera. In bacteria, the 16S rRNA gene is an ideal candidate for such conserved and variable domains. In order to study the conserved and variable domains of the 16S rRNA gene of Acetic Acid Bacteria and the Acetobacteraceae family, sequences from publicly available databases were aligned and compared. Near complete sequences of the gene were also obtained from Kombucha tea biofilm, a known Acetobacteraceae family habitat, in order to corroborate the domains obtained from the alignment studies. The study indicated that the degree of conservation in the gene is significantly higher among the Acetic Acid Bacteria than the whole Acetobacteraceae family. Moreover it was also observed that the previously described hypervariable regions V1, V3, V5, V6 and V7 were more or less conserved in the family and the spans of the variable regions are quite distinct as well. PMID:26510592

  7. Conservative Politicians Are Lashing Out at Courts That Order Equal Funding for Education

    ERIC Educational Resources Information Center

    Corriher, Billy


    Conservative governors and legislators across America are angry at the third branch of government. Some of these lawmakers are pushing legislation that could throw judges off the bench, while others are pushing to limit judicial authority. In one state, a governor unilaterally removed a justice of the state supreme court. Another Republican…

  8. 75 FR 69653 - Energy Conservation Program for Consumer Products: Decision and Order Granting a Waiver to...

    Federal Register 2010, 2011, 2012, 2013, 2014


    ... of Energy Efficiency and Renewable Energy Energy Conservation Program for Consumer Products: Decision... Procedure AGENCY: Office of Energy Efficiency and Renewable Energy, Department of Energy. ACTION: Decision... representations concerning the energy efficiency of these products unless the product has been tested......

  9. Conservation of DNA curvature signals in regulatory regions of prokaryotic genes

    PubMed Central

    Jáuregui, Ruy; Abreu-Goodger, Cei; Moreno-Hagelsieb, Gabriel; Collado-Vides, Julio; Merino, Enrique


    DNA curvature plays a well-characterized role in many transcriptional regulation mechanisms. We present evidence for the conservation of curvature signals in putative regulatory regions of several archaeal and eubacterial genomes. Genes with highly curved upstream regions were identified in orthologous groups, based on the annotations of the Cluster of Orthologous Groups of proteins (COG) database. COGs possessing a significant number of genes with curvature signals were analyzed, and conserved properties were found in several cases. Curvature signals related to regulatory sites, previously described in single organisms, were located in a broad spectrum of bacterial genomes. Global regulatory proteins, such as HU, IHF and FIS, known to bind to curved DNA and to be autoregulated, were found to present conserved DNA curvature signals in their regulatory regions, emphasizing the fact that structural parameters of the DNA molecule are conserved elements in the process of transcriptional regulation of some systems. It is currently an open question whether these diverse systems are part of an integrated global regulatory response in different microorganisms. PMID:14627810

  10. Conserved or lost: molecular evolution of the key gene GULO in vertebrate vitamin C biosynthesis.


    Yang, Hongwen


    L-gulono-gamma-lactone oxidase (GULO) catalyzes the final step in vertebrate vitamin C biosynthesis. Vitamin C-incapable vertebrates lack the GULO gene. Gene structure and phylogenetic analyses showed that vertebrate GULO genes are 64-95% identical at the amino acid level and consist of 11 conserved exons. GULO pseudogenes have multiple indel mutations and premature stop codons in higher primates, guinea pigs, and some bats. No GULO-like sequences were identified in teleost fishes. During animal GULO evolution, exon F was subdivided into F1 and F2. Additional GULO retropseudogenes were identified in dogs, cats, and giant pandas. GULO-flanking genome regions acquired frequent segment translocations and inversions during vertebrate evolution. Purifying selection was detected across vertebrate GULO genes (d(N)/d(S) = 0.069), except for some positively selected sites identified in sharks and frogs. These positive sites demonstrated little functional significance when mapped onto the three-dimensional GULO protein structure. Vertebrate GULO genes are conserved except for those that are lost. PMID:23404229

  11. Review: Progress in the Researches on Insect Mitochondrial Genome and Analysis of Gene Order

    NASA Astrophysics Data System (ADS)

    Hu, Li; Jianyu, Gao; Haiyu, Liu; Wanzhi, Cai


    Insect mitochondrial genome is a double-stranded circular genomes which range from 14,503 bp to 19,571 bp in size. Nearly all the sequenced insect mitochondrial genomes encode 37 genes: two for rRNAs, 13 for proteins and 22 for tRNAs. This review compares and summarizes the features of complete mitochondrial genomes from 175 sequenced species of insects in 22 orders. The genomic organization, contents, gene order, and rearrangements of gene order are analyzed.

  12. Plastid-LCGbase: a collection of evolutionarily conserved plastid-associated gene pairs.


    Wang, Dapeng; Yu, Jun


    Plastids carry their own genetic material that encodes a variable set of genes that are limited in number but functionally important. Aside from orthology, the lineage-specific order and orientation of these genes are also relevant. Here, we develop a database, Plastid-LCGbase (, which focuses on organizational variability of plastid genes and genomes from diverse taxonomic groups. The current Plastid-LCGbase contains information from 470 plastid genomes and exhibits several unique features. First, through a genome-overview page generated from OrganellarGenomeDRAW, it displays general arrangement of all plastid genes (circular or linear). Second, it shows patterns and modes of all paired plastid genes and their physical distances across user-defined lineages, which are facilitated by a step-wise stratification of taxonomic groups. Third, it divides the paired genes into three categories (co-directionally-paired genes or CDPGs, convergently-paired genes or CPGs and divergently-paired genes or DPGs) and three patterns (separation, overlap and inclusion) and provides basic statistics for each species. Fourth, the gene pairing scheme is expandable, where neighboring genes can also be included in species-/lineage-specific comparisons. We hope that Plastid-LCGbase facilitates gene variation (insertion-deletion, translocation and rearrangement) and transcription-level studies of plastid genomes. PMID:25378306

  13. Rescue of Drosophila labial null mutant by the chicken ortholog Hoxb-1 demonstrates that the function of Hox genes is phylogenetically conserved.


    Lutz, B; Lu, H C; Eichele, G; Miller, D; Kaufman, T C


    Hox complexes are important players in the establishment of the body plan of invertebrates and vertebrates. Sequence comparison demonstrates a remarkable phylogenetic conservation of key structural features of Hox genes. The correlation between the physical order of genes along the chromosomes and their domains of function along the body axis is conserved between arthropods and vertebrates. Ectopic expression experiments suggest that the functions of homeo proteins also are conserved between invertebrates and vertebrates. However, it remains an open question whether vertebrate Hox genes expressed under the control of Drosophila regulatory sequences can substitute the function of Drosophila Hox genes. We have studied this issue with the Drosophila labial (lab) gene and its chicken ortholog gHoxb-1. We fused the entire protein-coding region of gHoxb-1 with previously identified regulatory sequences of lab. This approach places gHoxb-1 into the normal embryonic spatiotemporal context in which lab acts. Ten transgenic lines carrying gHoxb-1 were established and tested for their ability to rescue lab null mutant animals. Eight lines rescued with high efficiency, embryonic lethality, and abnormal head morphogenesis, two defects observed in lab null mutant embryos. The rescue with the gHoxb-1 minigene was close to the efficiency of that obtained with the Drosophila lab minigene. This indicates that gHoxb-1 protein can regulate lab target genes and thereby restore embryonic viability. This is striking, as Lab and gHoxb-1 proteins are divergent except for their homeo domains and a short stretch of amino acids amino-terminal to the homeo domain. Our findings demonstrate a functional conservation of the lab class homeo proteins between insects and vertebrates and support the view that function of Hox genes resides in relatively few conserved motifs and largely in the homeo domain. PMID:8566751

  14. Genomic Locations of Conserved Noncoding Sequences and Their Proximal Protein-Coding Genes in Mammalian Expression Dynamics.


    Babarinde, Isaac Adeyemi; Saitou, Naruya


    Experimental studies have found the involvement of certain conserved noncoding sequences (CNSs) in the regulation of the proximal protein-coding genes in mammals. However, reported cases of long range enhancer activities and inter-chromosomal regulation suggest that proximity of CNSs to protein-coding genes might not be important for regulation. To test the importance of the CNS genomic location, we extracted the CNSs conserved between chicken and four mammalian species (human, mouse, dog, and cattle). These CNSs were confirmed to be under purifying selection. The intergenic CNSs are often found in clusters in gene deserts, where protein-coding genes are in paucity. The distribution pattern, ChIP-Seq, and RNA-Seq data suggested that the CNSs are more likely to be regulatory elements and not corresponding to long intergenic noncoding RNAs. Physical distances between CNS and their nearest protein coding genes were well conserved between human and mouse genomes, and CNS-flanking genes were often found in evolutionarily conserved genomic neighborhoods. ChIP-Seq signal and gene expression patterns also suggested that CNSs regulate nearby genes. Interestingly, genes with more CNSs have more evolutionarily conserved expression than those with fewer CNSs. These computationally obtained results suggest that the genomic locations of CNSs are important for their regulatory functions. In fact, various kinds of evolutionary constraints may be acting to maintain the genomic locations of CNSs and protein-coding genes in mammals to ensure proper regulation. PMID:27017584

  15. Three Dimensional Organization of Genome Might Have Guided the Dynamics of Gene Order Evolution in Eukaryotes

    PubMed Central

    Bagadia, Meenakshi; Singh, Arashdeep; Singh Sandhu, Kuljeet


    In eukaryotes, genes are nonrandomly organized into short gene-dense regions or “gene-clusters” interspersed by long gene-poor regions. How these gene-clusters have evolved is not entirely clear. Gene duplication may not account for all the gene-clusters since the genes in most of the clusters do not exhibit significant sequence similarity. In this study, using genome-wide data sets from budding yeast, fruit-fly, and human, we show that: 1) long-range evolutionary repositioning of genes strongly associate with their spatial proximity in the nucleus; 2) presence of evolutionary DNA break-points at involved loci hints at their susceptibility to undergo long-range genomic rearrangements; and 3) correlated epigenetic and transcriptional states of engaged genes highlight the underlying evolutionary constraints. The significance of observation 1, 2, and 3 are particularly stronger for the instances of inferred evolutionary gain, as compared with loss, of linear gene-clustering. These observations suggest that the long-range genomic rearrangements guided through 3D genome organization might have contributed to the evolution of gene order. We further hypothesize that the evolution of linear gene-clusters in eukaryotic genomes might have been mediated through spatial interactions among distant loci in order to optimize co-ordinated regulation of genes. We model this hypothesis through a heuristic model of gene-order evolution. PMID:26957031

  16. Discovery of functional non-coding conserved regions in the α-synuclein gene locus

    PubMed Central

    Sterling, Lori; Walter, Michael; Ting, Dennis; Schüle, Birgitt


    Several single nucleotide polymorphisms (SNPs) and the Rep-1 microsatellite marker of the α-synuclein ( SNCA) gene have consistently been shown to be associated with Parkinson’s disease, but the functional relevance is unclear. Based on these findings we hypothesized that conserved cis-regulatory elements in the SNCA genomic region regulate expression of SNCA, and that SNPs in these regions could be functionally modulating the expression of SNCA, thus contributing to neuronal demise and predisposing to Parkinson’s disease. In a pair-wise comparison of a 206kb genomic region encompassing the SNCA gene, we revealed 34 evolutionary conserved DNA sequences between human and mouse. All elements were cloned into reporter vectors and assessed for expression modulation in dual luciferase reporter assays.  We found that 12 out of 34 elements exhibited either an enhancement or reduction of the expression of the reporter gene. Three elements upstream of the SNCA gene displayed an approximately 1.5 fold (p<0.009) increase in expression. Of the intronic regions, three showed a 1.5 fold increase and two others indicated a 2 and 2.5 fold increase in expression (p<0.002). Three elements downstream of the SNCA gene showed 1.5 fold and 2.5 fold increase (p<0.0009). One element downstream of SNCA had a reduced expression of the reporter gene of 0.35 fold (p<0.0009) of normal activity. Our results demonstrate that the SNCA gene contains cis-regulatory regions that might regulate the transcription and expression of SNCA. Further studies in disease-relevant tissue types will be important to understand the functional impact of regulatory regions and specific Parkinson’s disease-associated SNPs and its function in the disease process. PMID:25566351

  17. Intracisternal A-particle genes in Mus musculus: A conserved family of retrovirus-like elements

    SciTech Connect

    Kuff, E.L.; Smith, L.A.; Lueders, K.K.


    The structural organization of intracisternal A-particle genes has been studied, using isolates from a mouse gene library in lambda phage Charon 4A. The predominant gene form among the isolates was 7.3 kilobases (kb) in length. R-loops between the 7-kb (35S) A-particle genomic ribonucleic acid and several of these genes were colinear, with no visible evidence of intervening deoxyribonucleic acid sequences. Restriction endonuclease fragments encompassing the 5' and 3' regions of one 7.3b gene were separately subcloned into pBR322. Heteroduplexes between the two subclones revealed an approximately 300-base pair segment of terminally redundant sequences. The cloned 3' fragment hybridized with restriction fragments from the 5' end of several other A-particle genes, demonstrating the presence of common (though not necessarily identical) terminally repeated sequences. The relative abundance of restriction site variants was highly conserved in 12 laboratory strains of Mus musculus, in embryonic and adult tissues of a single inbred strain, and in the SC-1 cell line of feral mouse origin, but appeared to differ in a feral Japanese substrain, Mus musculus molossinus. Some evidence suggests that subsets of A-particle genes may have similar flanking sequences. The results are discussed in terms of the evolution of this multigene family.

  18. Evolutionary analysis of multidrug resistance genes in fungi - impact of gene duplication and family conservation.


    Gossani, Cristiani; Bellieny-Rabelo, Daniel; Venancio, Thiago M


    Although the emergence of bacterial drug resistance is of great concern to the scientific community, few studies have evaluated this phenomenon systematically in fungi by using genome-wide datasets. In the present study, we assembled a large compendium of Saccharomyces cerevisiae chemical genetic data to study the evolution of multidrug resistance genes (MDRs) in the fungal lineage. We found that MDRs typically emerge in widely conserved families, most of which containing homologs from pathogenic fungi, such as Candida albicans and Coccidioides immitis, which could favor the evolution of drug resistance in those species. By integrating data from chemical genetics with protein family conservation, genetic and protein interactions, we found that gene families rarely have more than one MDR, indicating that paralogs evolve asymmetrically with regard to multidrug resistance roles. Furthermore, MDRs have more genetic and protein interaction partners than non-MDRs, supporting their participation in complex biochemical systems underlying the tolerance to multiple bioactive molecules. MDRs share more chemical genetic interactions with other MDRs than with non-MDRs, regardless of their evolutionary affinity. These results suggest the existence of an intricate system involved in the global drug tolerance phenotypes. Finally, MDRs are more likely to be hit repeatedly by mutations in laboratory evolution experiments, indicating that they have great adaptive potential. The results presented here not only reveal the main genomic features underlying the evolution of MDRs, but also shed light on the gene families from which drug resistance is more likely to emerge in fungi. PMID:25220072

  19. Evolutionary Conservation of Xylan Biosynthetic Genes in Selaginella moellendorffii and Physcomitrella patens.


    Haghighat, Marziyeh; Teng, Quincy; Zhong, Ruiqin; Ye, Zheng-Hua


    Xylan is a major cross-linking hemicellulose in secondary walls of vascular tissues, and the recruitment of xylan as a secondary wall component was suggested to be a pivotal event for the evolution of vascular tissues. To decipher the evolution of xylan structure and xylan biosynthetic genes, we analyzed xylan substitution patterns and characterized genes mediating methylation of glucuronic acid (GlcA) side chains in xylan of the model seedless vascular plant, Selaginella moellendorffii, and investigated GT43 genes from S. moellendorffii and the model non-vascular plant, Physcomitrella patens, for their roles in xylan biosynthesis. Using nuclear magentic resonance spectroscopy, we have demonstrated that S. moellendorffii xylan consists of β-1,4-linked xylosyl residues subsituted solely with methylated GlcA residues and that xylans from both S. moellendorffii and P. patens are acetylated at O-2 and O-3. To investigate genes responsible for GlcA methylation of xylan, we identified two DUF579 genes in the S. moellendorffii genome and showed that one of them, SmGXM, encodes a glucuronoxylan methyltransferase capable of adding the methyl group onto the GlcA side chain of xylooligomers. Furthermore, we revealed that the two GT43 genes in S. moellendorffii, SmGT43A and SmGT43B, are functional orthologs of the Arabidopsis xylan backbone biosynthetic genes IRX9 and IRX14, respectively, indicating the evolutionary conservation of the involvement of two functionally non-redundant groups of GT43 genes in xylan backbone biosynthesis between seedless and seed vascular plants. Among the five GT43 genes in P. patens, PpGT43A was found to be a functional ortholog of Arabidopsis IRX9, suggesting that the recruitment of GT43 genes in xylan backbone biosynthesis occurred when non-vascular plants appeared on land. PMID:27345025

  20. Functional conservation and diversification of the soybean maturity gene E1 and its homologs in legumes

    PubMed Central

    Zhang, Xingzheng; Zhai, Hong; Wang, Yaying; Tian, Xiaojie; Zhang, Yupeng; Wu, Hongyan; Lü, Shixiang; Yang, Guang; Li, Yuqiu; Wang, Lu; Hu, Bo; Bu, Qingyun; Xia, Zhengjun


    Gene regulatory networks involved in flowering time and photoperiodic responses in legumes remain unknown. Although the major maturity gene E1 has been successfully deciphered in soybean, knowledge on the functional conservation of this gene is limited to a certain extent to E1 homologs in legumes. The ectopic expression of Phvul.009G204600 (PvE1L), an E1 homolog from common bean, delayed the onset of flowering in soybean. By contrast, the ectopic expression of Medtr2g058520 (MtE1L) from Medicago truncatula did not affect the flowering of soybean. Characterization of the late-flowering mte1l mutant indicated that MtE1L promoted flowering in Medicago truncatula. Moreover, all transgenic E1, PvE1L and MtE1L soybean lines exhibited phenotypic changes in terms of plant height. Transgenic E1 or PvE1L plants were taller than the wild-type, whereas transgenic MtE1L plants produced dwarf phenotype with few nodes and short internode. Thus, functional conservation and diversification of E1 family genes from legumes in the regulation of flowering and plant growth may be associated with lineage specification and genomic duplication. PMID:27405888

  1. Conserved synteny at the protein family level reveals genes underlying Shewanella species cold tolerance and predicts their novel phenotypes

    SciTech Connect

    Karpinets, Tatiana V.; Obraztsova, Anna; Wang, Yanbing; Schmoyer, Denise D.; Kora, Guruprasad; Park, Byung H.; Serres, Margrethe H.; Romine, Margaret F.; Land, Miriam L.; Kothe, Terence B.; Fredrickson, Jim K.; Nealson, Kenneth H.; Uberbacher, Edward


    Bacteria of the genus Shewanella can thrive in different environments and demonstrate significant variability in their metabolic and ecophysiological capabilities including cold and salt tolerance. Genomic characteristics underlying this variability across species are largely unknown. In this study we address the problem by a comparison of the physiological, metabolic and genomic characteristics of 19 sequenced Shewanella species. We have employed two novel approaches based on association of a phenotypic trait with the number of the trait-specific protein families (Pfam domains) and on the conservation of synteny (order in the genome) of the trait-related genes. Our first approach is top-down and involves experimental evaluation and quantification of the species’ cold tolerance followed by identification of the correlated Pfam domains and genes with a conserved synteny. The second, a bottom-up approach, predicts novel phenotypes of the species by calculating profiles of each Pfam domain among their genomes and following pair-wise correlation of the profiles and their network clustering. Using the first approach we find a link between cold and salt tolerance of the species and the presence in the genome of a Na+/H+ antiporter gene cluster. Other cold tolerance related genes includes peptidases, chemotaxis sensory transducer proteins, a cysteine exporter, and helicases. Using the bottom-up approach we found several novel phenotypes in the newly sequenced Shewanella species, including degradation of aromatic compounds by an aerobic hybrid pathway in S. woodyi, degradation of ethanolamine by S. benthica, and propanediol degradation by S. putrefaciens CN32 and S. sp. W3-18-1.

  2. A Large Gene Cluster Encoding Several Magnetosome Proteins Is Conserved in Different Species of Magnetotactic Bacteria

    PubMed Central

    Grünberg, Karen; Wawer, Cathrin; Tebo, Bradley M.; Schüler, Dirk


    In magnetotactic bacteria, a number of specific proteins are associated with the magnetosome membrane (MM) and may have a crucial role in magnetite biomineralization. We have cloned and sequenced the genes of several of these polypeptides in the magnetotactic bacterium Magnetospirillum gryphiswaldense that could be assigned to two different genomic regions. Except for mamA, none of these genes have been previously reported to be related to magnetosome formation. Homologous genes were found in the genome sequences of M. magnetotacticum and magnetic coccus strain MC-1. The MM proteins identified display homology to tetratricopeptide repeat proteins (MamA), cation diffusion facilitators (MamB), and HtrA-like serine proteases (MamE) or bear no similarity to known proteins (MamC and MamD). A major gene cluster containing several magnetosome genes (including mamA and mamB) was found to be conserved in all three of the strains investigated. The mamAB cluster also contains additional genes that have no known homologs in any nonmagnetic organism, suggesting a specific role in magnetosome formation. PMID:11571158

  3. Mammalian ets-1 and ets-2 genes encode highly conserved proteins

    SciTech Connect

    Watson, D.K.; McWilliams, M.J.; Lapis, P.; Lautenberger, J.A.; Schweinfest, C.W.; Papas, T.S. )


    Cellular ets sequences homologous to v-ets of the avian leukemia virus E26 are highly conserved. In mammals the ets sequences are dispersed on two separate chromosomal loci, called ets-1 and ets-2. To determine the structure of these two genes and identify the open reading frames that code for the putative proteins, the authors have sequenced human ets-1 cDNAs and ets-2 cDNA clones obtained from both human and mouse. The human ETS1 gene is capable of encoding a protein of 441 amino acids. This protein is >95% identical to the chicken c-ets-1 gene product. Thus, the human ETS1 gene is homologous to the chicken c-ets-1 gene, the protooncogene that the E26 virus transduced. Human and mouse ets-2 cDNA clones are closely related and contain open reading frames capable of encoding proteins of 469 and 468 residues, respectively. Direct comparison of these data with previously published finding indicates that ets is a family of genes whose members share distinct domains.

  4. Mammalian ets-1 and ets-2 genes encode highly conserved proteins.

    PubMed Central

    Watson, D K; McWilliams, M J; Lapis, P; Lautenberger, J A; Schweinfest, C W; Papas, T S


    Cellular ets sequences homologous to v-ets of the avian leukemia virus E26 are highly conserved. In mammals the ets sequences are dispersed on two separate chromosomal loci, called ets-1 and ets-2. To determine the structure of these two genes and identify the open reading frames that code for the putative proteins, we have sequenced human ets-1 cDNAs and ets-2 cDNA clones obtained from both human and mouse. The human ETS1 gene is capable of encoding a protein of 441 amino acids. This protein is greater than 95% identical to the chicken c-ets-1 gene product. Thus, the human ETS1 gene is homologous to the chicken c-ets-1 gene, the protooncogene that the E26 virus transduced. Human and mouse ets-2 cDNA clones are closely related and contain open reading frames capable of encoding proteins of 469 and 468 residues, respectively. Direct comparison of these data with previously published findings indicates that ets is a family of genes whose members share distinct domains. PMID:2847145

  5. Blueprint for a minimal photoautotrophic cell: conserved and variable genes in Synechococcus elongatus PCC 7942

    PubMed Central


    Background Simpler biological systems should be easier to understand and to engineer towards pre-defined goals. One way to achieve biological simplicity is through genome minimization. Here we looked for genomic islands in the fresh water cyanobacteria Synechococcus elongatus PCC 7942 (genome size 2.7 Mb) that could be used as targets for deletion. We also looked for conserved genes that might be essential for cell survival. Results By using a combination of methods we identified 170 xenologs, 136 ORFans and 1401 core genes in the genome of S. elongatus PCC 7942. These represent 6.5%, 5.2% and 53.6% of the annotated genes respectively. We considered that genes in genomic islands could be found if they showed a combination of: a) unusual G+C content; b) unusual phylogenetic similarity; and/or c) a small number of the highly iterated palindrome 1 (HIP1) motif plus an unusual codon usage. The origin of the largest genomic island by horizontal gene transfer (HGT) could be corroborated by lack of coverage among metagenomic sequences from a fresh water microbialite. Evidence is also presented that xenologous genes tend to cluster in operons. Interestingly, most genes coding for proteins with a diguanylate cyclase domain are predicted to be xenologs, suggesting a role for horizontal gene transfer in the evolution of Synechococcus sensory systems. Conclusions Our estimates of genomic islands in PCC 7942 are larger than those predicted by other published methods like SIGI-HMM. Our results set a guide to non-essential genes in S. elongatus PCC 7942 indicating a path towards the engineering of a model photoautotrophic bacterial cell. PMID:21226929

  6. Identification of a conserved family of Meis1-related homeobox genes.


    Steelman, S; Moskow, J J; Muzynski, K; North, C; Druck, T; Montgomery, J C; Huebner, K; Daar, I O; Buchberg, A M


    Meis1 locus was isolated as a common site of viral integration involved in myeloid leukemia in BXH-2 mice. Meis1 encodes a novel homeobox protein belonging to the TALE (three amino acid loop extension) family of homeodomain-containing proteins. The homeodomain of Meis1 is the only known motif within the entire 390-amino-acid protein. Southern blot analyses using the Meis1 homeodomain as a probe revealed the existence family of Meis1-related genes (Mrgs) in several diverged species. In addition, the 3' untranslated region (UTR) Meis1 was remarkably conserved in evolution. To gain a further understanding of the role Meis1 plays in leukemia and development, as well as to identify conserved regions of the protein that might reveal function, we cloned and characterized Mrgs from the mouse and human genomes. We report the sequence of Mrg1 and MRG2 as well as their chromosomal locations in murine and human genomes. Both Mrgs share a high degree of sequence identity with the protein coding region of Meis1. We have also cloned the Xenopus laevis ortholog of (XMeis1). Sequence comparison of the murine and Xenopus clones reveals that Meis1 is highly conserved throughout its coding sequence as well as the 3' UTR. Finally, comparison of Meis1 and the closely related Mrgs to known homeoproteins suggests that Meis1 represents a new subfamily of TALE homeobox genes. PMID:9049632

  7. Conservation of the central MHC genome: PFGE mapping and RFLP analysis of complement, HSP70, and TNF genes in the goat.


    Cameron, P U; Tabarias, H A; Pulendran, B; Robinson, W; Dawkins, R L


    A degree of conservation of the genes located between class II and class I [central major histocompatibility complex (MHC) genes] is apparent among mammalian species including primates and the mouse. Few others have been analyzed. The caprine MHC is of particular interest, since it has recently been observed that susceptibility to a lentivirus-induced polyarthritis (caprine arthritis) segregates with serologically defined MHC class I antigens. This arthritis resembles, in a number of respects, rheumatoid arthritis in man. Human cDNA probes were used to examine the caprine central MHC and class I and II genes by restriction fragment length polymorphism (RFLP) and by pulsed field gel electrophoresis (PFGE) in order to define the polymorphism and linkage of central MHC genes to class I and class II genes. An outbred population of dairy goats (Saanen, British Alpine, Anglo Nubian, and Toggenberg) was examined for class I and class II RFLPs. Both regions were found to be highly polymorphic. The number of fragments hybridizing to an HLA-B7 probe after Eco RI, Bam HI, Bgl II, or Hind III digestion suggests there may be 10-13 class I genes. The degree of polymorphism was comparable to that reported in the mouse. Limited polymorphism was found in the central MHC genes. The caprine C4 and CYP21 genes were duplicated and demonstrated RFLP with Bam HI, Hind III, Eco RV, and Taq I. An infrequent Taq I C2 polymorphism was found. PFGE revealed substantial conservation of both the order and linkage of the central MHC genes when compared with mouse and man. C4, C2, CYP21, HSP70, and tumor necrosis factor (TNF) genes are all located within 800 kilobase (kb) of the class I loci. Distant from the class I region, the C4, C2, and CYP21 genes are linked on a short genomic segment (180 kb Not I and 190 kb Pvu I fragments). HSP70 cohybridizes with the complement genes on a 380 kb Mlu I fragment. Linkage of HSP70, TNF, and class I genes was found on a single Not I fragment (610 kb). TNF and

  8. Divergent mechanisms regulate conserved cardiopharyngeal development and gene expression in distantly related ascidians

    PubMed Central

    Stolfi, Alberto; Lowe, Elijah K; Racioppi, Claudia; Ristoratore, Filomena; Brown, C Titus; Swalla, Billie J; Christiaen, Lionel


    Ascidians present a striking dichotomy between conserved phenotypes and divergent genomes: embryonic cell lineages and gene expression patterns are conserved between distantly related species. Much research has focused on Ciona or Halocynthia spp. but development in other ascidians remains poorly characterized. In this study, we surveyed the multipotent myogenic B7.5 lineage in Molgula spp. Comparisons to the homologous lineage in Ciona revealed identical cell division and fate specification events that result in segregation of larval, cardiac, and pharyngeal muscle progenitors. Moreover, the expression patterns of key regulators are conserved, but cross-species transgenic assays uncovered incompatibility, or ‘unintelligibility’, of orthologous cis-regulatory sequences between Molgula and Ciona. These sequences drive identical expression patterns that are not recapitulated in cross-species assays. We show that this unintelligibility is likely due to changes in both cis- and trans-acting elements, hinting at widespread and frequent turnover of regulatory mechanisms underlying otherwise conserved aspects of ascidian embryogenesis. DOI: PMID:25209999

  9. Composition and Expression of Conserved MicroRNA Genes in Diploid Cotton (Gossypium) Species

    PubMed Central

    Gong, Lei; Kakrana, Atul; Arikit, Siwaret; Meyers, Blake C.; Wendel, Jonathan F.


    MicroRNAs are ubiquitous in plant genomes but vary greatly in their abundance within and conservation among plant lineages. To gain insight into the evolutionary birth/death dynamics of microRNA families, we sequenced small RNA and 5′-end PARE libraries generated from two closely related species of Gossypium. Here, we demonstrate that 33 microRNA families, with similar copy numbers and average evolutionary rates, are conserved in the two congeneric cottons. Analysis of the presence/absence of these microRNA families in other land plants sheds light on their depth of phylogenetic origin and lineage-specific loss/gain. Conserved microRNA families in Gossypium exhibit a striking interspecific asymmetry in expression, potentially connected to relative proximity to neighboring transposable elements. A complex correlated expression pattern of microRNA target genes with their controlling microRNAs indicates that possible functional divergence of conserved microRNA families can also exist even within a single plant genus. PMID:24281048

  10. Cloning and physical mapping of RNA polymerase genes from Methanobacterium thermoautotrophicum and comparison of homologies and gene orders with those of RNA polymerase genes from other methanogenic archaebacteria

    SciTech Connect

    Schallenberg, J.; Moes, M.; Truss, M.; Reiser, W.; Thomm, M.; Stetter, K.O.; Klein, A.


    The structural genes encoding the four largest subunits of RNA polymerase, A, B', B'', and C, were physically mapped in Methanobacterium thermoautotrophicum Winter. The genes formed a cluster in the order B'', B', A, C and had a common orientation. DNA hybridization experiments yielded different degrees of homology between RNA polymerase gene sequences of different species of Methanobacterium and Methanococcus voltae. No homology was detectable between Methanobacterium thermoautotrophicum and Methanosarcina barkeri. From Southern hybridization experiments in which probes of the four genes from Methanobacterium thermoautotrophicum Winter and restriction digests of the genomic DNAs of the different methanogens were used, a common gene order of the RNA polymerase genes could be deduced.

  11. A re-averaged WENO reconstruction and a third order CWENO scheme for hyperbolic conservation laws

    NASA Astrophysics Data System (ADS)

    Huang, Chieh-Sen; Arbogast, Todd; Hung, Chen-Hui


    A WENO re-averaging (or re-mapping) technique is developed that converts function averages on one grid to another grid to high order. Nonlinear weighting gives the essentially non-oscillatory property to the re-averaged function values. The new reconstruction grid is used to obtain a standard high order WENO reconstruction of the function averages at a select point. By choosing the reconstruction grid to include the point of interest, a high order function value can be reconstructed using only positive linear weights. The re-averaging technique is applied to define two variants of a classic CWENO3 scheme that combines two linear polynomials to obtain formal third order accuracy. Such a scheme cannot otherwise be defined, due to the nonexistence of linear weights for third order reconstruction at the center of a grid element. The new scheme uses a compact stencil of three solution averages, and only positive linear weights are used. The scheme extends easily to problems in higher space dimensions, essentially as a tensor product of the one-dimensional scheme. The scheme maintains formal third order accuracy in higher dimensions. Numerical results show that this CWENO3 scheme is third order accurate for smooth problems and gives good results for non-smooth problems, including those with shocks.

  12. Conserved and Diversified Gene Families of Monovalent Cation/H+ Antiporters from Algae to Flowering Plants

    PubMed Central

    Chanroj, Salil; Wang, Guoying; Venema, Kees; Zhang, Muren Warren; Delwiche, Charles F.; Sze, Heven


    All organisms have evolved strategies to regulate ion and pH homeostasis in response to developmental and environmental cues. One strategy is mediated by monovalent cation–proton antiporters (CPA) that are classified in two superfamilies. Many CPA1 genes from bacteria, fungi, metazoa, and plants have been functionally characterized; though roles of plant CPA2 genes encoding K+-efflux antiporter (KEA) and cation/H+ exchanger (CHX) families are largely unknown. Phylogenetic analysis showed that three clades of the CPA1 Na+–H+ exchanger (NHX) family have been conserved from single-celled algae to Arabidopsis. These are (i) plasma membrane-bound SOS1/AtNHX7 that share ancestry with prokaryote NhaP, (ii) endosomal AtNHX5/6 that is part of the eukaryote Intracellular-NHE clade, and (iii) a vacuolar NHX clade (AtNHX1–4) specific to plants. Early diversification of KEA genes possibly from an ancestral cyanobacterium gene is suggested by three types seen in all plants. Intriguingly, CHX genes diversified from three to four members in one subclade of early land plants to 28 genes in eight subclades of Arabidopsis. Homologs from Spirogyra or Physcomitrella share high similarity with AtCHX20, suggesting that guard cell-specific AtCHX20 and its closest relatives are founders of the family, and pollen-expressed CHX genes appeared later in monocots and early eudicots. AtCHX proteins mediate K+ transport and pH homeostasis, and have been localized to intracellular and plasma membrane. Thus KEA genes are conserved from green algae to angiosperms, and their presence in red algae and secondary endosymbionts suggest a role in plastids. In contrast, AtNHX1–4 subtype evolved in plant cells to handle ion homeostasis of vacuoles. The great diversity of CHX genes in land plants compared to metazoa, fungi, or algae would imply a significant role of ion and pH homeostasis at dynamic endomembranes in the vegetative and reproductive success of flowering plants. PMID:22639643

  13. Production of bioactive diterpenoids in the euphorbiaceae depends on evolutionarily conserved gene clusters.


    King, Andrew J; Brown, Geoffrey D; Gilday, Alison D; Larson, Tony R; Graham, Ian A


    The Euphorbiaceae produce a diverse range of diterpenoids, many of which have pharmacological activities. These diterpenoids include ingenol mebutate, which is licensed for the treatment of a precancerous skin condition (actinic keratosis), and phorbol derivatives such as resiniferatoxin and prostratin, which are undergoing investigation for the treatment of severe pain and HIV, respectively. Despite the interest in these diterpenoids, their biosynthesis is poorly understood at present, with the only characterized step being the conversion of geranylgeranyl pyrophosphate into casbene. Here, we report a physical cluster of diterpenoid biosynthetic genes from castor (Ricinus communis), including casbene synthases and cytochrome P450s from the CYP726A subfamily. CYP726A14, CYP726A17, and CYP726A18 were able to catalyze 5-oxidation of casbene, a conserved oxidation step in the biosynthesis of this family of medicinally important diterpenoids. CYP726A16 catalyzed 7,8-epoxidation of 5-keto-casbene and CYP726A15 catalyzed 5-oxidation of neocembrene. Evidence of similar gene clustering was also found in two other Euphorbiaceae, including Euphorbia peplus, the source organism of ingenol mebutate. These results demonstrate conservation of gene clusters at the higher taxonomic level of the plant family and that this phenomenon could prove useful in further elucidating diterpenoid biosynthetic pathways. PMID:25172144

  14. TOPAZ1, a Novel Germ Cell-Specific Expressed Gene Conserved during Evolution across Vertebrates

    PubMed Central

    Baillet, Adrienne; Le Bouffant, Ronan; Volff, Jean Nicolas; Luangpraseuth, Alix; Poumerol, Elodie; Thépot, Dominique; Pailhoux, Eric; Livera, Gabriel; Cotinot, Corinne; Mandon-Pépin, Béatrice


    Background We had previously reported that the Suppression Subtractive Hybridization (SSH) approach was relevant for the isolation of new mammalian genes involved in oogenesis and early follicle development. Some of these transcripts might be potential new oocyte and granulosa cell markers. We have now characterized one of them, named TOPAZ1 for the Testis and Ovary-specific PAZ domain gene. Principal Findings Sheep and mouse TOPAZ1 mRNA have 4,803 bp and 4,962 bp open reading frames (20 exons), respectively, and encode putative TOPAZ1 proteins containing 1,600 and 1653 amino acids. They possess PAZ and CCCH domains. In sheep, TOPAZ1 mRNA is preferentially expressed in females during fetal life with a peak during prophase I of meiosis, and in males during adulthood. In the mouse, Topaz1 is a germ cell-specific gene. TOPAZ1 protein is highly conserved in vertebrates and specifically expressed in mouse and sheep gonads. It is localized in the cytoplasm of germ cells from the sheep fetal ovary and mouse adult testis. Conclusions We have identified a novel PAZ-domain protein that is abundantly expressed in the gonads during germ cell meiosis. The expression pattern of TOPAZ1, and its high degree of conservation, suggests that it may play an important role in germ cell development. Further characterization of TOPAZ1 may elucidate the mechanisms involved in gametogenesis, and particularly in the RNA silencing process in the germ line. PMID:22069478

  15. [Construction of recombinant adenoviral vector expressing genes of the conservative influenza proteins M2 and nucleoprotein].


    Esmagambetov, I B; Sedova, E S; Shcherbinin, D N; Lysenko, A A; Garas, M N; Shmarov, M M; Logunov, D Iu


    Influenza is a highly contagious and one of the most massive infection diseases. General epidemiological significance has a strain, which belongs to subtype A. A high degree of genetic variety leads to the permanent changes in the antigenic structure of the influenza virus. Therefore, the current influenza vaccines require periodic updating of the composition of strains. Presently, it is important to develop a universal vaccine that can protect against different strains of influenza A virus at the same time and is based on the conserved antigens of the influenza virus. The recombinant adenovirus vectors expressing genes of conserved viral antigenes may be a promising candidate vaccine against influenza A. Using the method of the homologous recombination, we developed in this study recombinant adenovirus of fifth serotype that expresses genes of the ion channel M2 and nucleoprotein NP of the influenza virus A. Genes of the consensus protein M2 and NP of human influenza A virus were included into the structure of the viral genome. The expression of the antigens M2 and NP using recombinant adenovirus vector was detected by a Western blot assay. The immunogenicity of the developed recombinant adenovirus vector was demonstrated by the intranasal immunization of laboratory mice. PMID:25080815

  16. Nucleotide Variation and Conservation at the Dpp Locus, a Gene Controlling Early Development in Drosophila

    PubMed Central

    Richter, B.; Long, M.; Lewontin, R. C.; Nitasaka, E.


    A study of polymorphism and species divergence of the dpp gene of Drosophila has been made. Eighteen lines from a population of D. melanogaster were sequenced for 5200 bp of the Hin region of the gene, coding for the dpp polypeptide. A comparison was made with sequence from D. simulans. Ninety-six silent polymorphisms and three amino acid replacement polymorphisms were found. The overall silent polymorphism (0.0247) is low, but haplotype diversity (0.0066 for effectively silent sites and 0.0054 for all sites) is in the range found for enzyme loci. Amino acid variation is absent in the N-terminal signal peptide, the C-terminal TGF-β peptide and in the N-terminal half of the pro-protein region. At the nucleotide level there is strong conservation in the middle half of the large intron and in the 3' untranslated sequence of the last exon. The 3' untranslated conservation, which is perfect for 110 bp among all the divergent species, is unexplained. There is strong positive linkage disequilibrium among polymorphic sites, with stretches of apparent gene conversion among originally divergent sequences. The population apparently is a migration mixture of divergent clades. PMID:9071586

  17. Characterization of a novel gene adjacent to PAX6, revealing synteny conservation with functional significance.


    Kleinjan, Dirk A; Seawright, Anne; Elgar, Greg; van Heyningen, Veronica


    The human eye anomaly aniridia is normally caused by intragenic mutations of PAX6. Several cases of aniridia are, however, associated with chromosomal rearrangements that leave the PAX6 gene intact. We have identified and characterized a novel gene, PAXNEB (C11orf19), downstream (telomeric) of PAX6. Sequence analysis, including interspecies comparisons, show this gene to consist of 10 exons, with an unusually large final intron spanning 134 kb in human and 18 kb in Fugu. This intron is disrupted by each chromosomal rearrangement. The 2-kb PAXNEB transcript, encoding a 424-amino acid protein, is expressed in all cell lines tested. The homologous mouse cDNA is broadly expressed in mouse embryos. PAXNEB is highly conserved from mammals to fish, with some regions of the protein showing conservation to invertebrates, yeast, and plants. The possible role of PAXNEB in aniridia was assessed. Using a transgenic mouse model, we show that the aniridia phenotype of the chromosomal rearrangement cases is not due to the heterozygous loss of PAXNEB function. PMID:11889558

  18. Conserved Overlapping Gene Arrangement, Restricted Expression, and Biochemical Activities of DNA Polymerase ν (POLN)*

    PubMed Central

    Takata, Kei-ichi; Tomida, Junya; Reh, Shelley; Swanhart, Lisa M.; Takata, Minoru; Hukriede, Neil A.; Wood, Richard D.


    DNA polymerase ν (POLN) is one of 16 DNA polymerases encoded in vertebrate genomes. It is important to determine its gene expression patterns, biological roles, and biochemical activities. By quantitative analysis of mRNA expression, we found that POLN from the zebrafish Danio rerio is expressed predominantly in testis. POLN is not detectably expressed in zebrafish embryos or in mouse embryonic stem cells. Consistent with this, injection of POLN-specific morpholino antisense oligonucleotides did not interfere with zebrafish embryonic development. Analysis of transcripts revealed that vertebrate POLN has an unusual gene expression arrangement, sharing a first exon with HAUS3, the gene encoding augmin-like complex subunit 3. HAUS3 is broadly expressed in embryonic and adult tissues, in contrast to POLN. Differential expression of POLN and HAUS3 appears to arise by alternate splicing of transcripts in mammalian cells and zebrafish. When POLN was ectopically overexpressed in human cells, it specifically coimmunoprecipitated with the homologous recombination factors BRCA1 and FANCJ, but not with previously suggested interaction partners (HELQ and members of the Fanconi anemia core complex). Purified zebrafish POLN protein is capable of thymine glycol bypass and strand displacement, with activity dependent on a basic amino acid residue known to stabilize the primer-template. These properties are conserved with the human enzyme. Although the physiological function of pol ν remains to be clarified, this study uncovers distinctive aspects of its expression control and evolutionarily conserved properties of this DNA polymerase. PMID:26269593

  19. Identification of Conserved, RpoS-Dependent Stationary-Phase Genes of Escherichia coli

    PubMed Central

    Schellhorn, Herb E.; Audia, Jonathon P.; Wei, Linda I. C.; Chang, Lily


    During entry into stationary phase, many free-living, gram-negative bacteria express genes that impart cellular resistance to environmental stresses, such as oxidative stress and osmotic stress. Many genes that are required for stationary-phase adaptation are controlled by RpoS, a conserved alternative sigma factor, whose expression is, in turn, controlled by many factors. To better understand the numbers and types of genes dependent upon RpoS, we employed a genetic screen to isolate more than 100 independent RpoS-dependent gene fusions from a bank of several thousand mutants harboring random, independent promoter-lacZ operon fusion mutations. Dependence on RpoS varied from 2-fold to over 100-fold. The expression of all fusion mutations was normal in an rpoS/rpoS+ merodiploid (rpoS background transformed with an rpoS-containing plasmid). Surprisingly, the expression of many RpoS-dependent genes was growth phase dependent, albeit at lower levels, even in an rpoS background, suggesting that other growth-phase-dependent regulatory mechanisms, in addition to RpoS, may control postexponential gene expression. These results are consistent with the idea that many growth-phase-regulated functions in Escherichia coli do not require RpoS for expression. The identities of the 10 most highly RpoS-dependent fusions identified in this study were determined by DNA sequence analysis. Three of the mutations mapped to otsA, katE, ecnB, and osmY—genes that have been previously shown by others to be highly RpoS dependent. The six remaining highly-RpoS-dependent fusion mutations were located in other genes, namely, gabP, yhiUV, o371, o381, f186, and o215. PMID:9829938

  20. Strict evolutionary conservation followed rapid gene loss on human and rhesus Y chromosomes.


    Hughes, Jennifer F; Skaletsky, Helen; Brown, Laura G; Pyntikova, Tatyana; Graves, Tina; Fulton, Robert S; Dugan, Shannon; Ding, Yan; Buhay, Christian J; Kremitzki, Colin; Wang, Qiaoyan; Shen, Hua; Holder, Michael; Villasana, Donna; Nazareth, Lynne V; Cree, Andrew; Courtney, Laura; Veizer, Joelle; Kotkiewicz, Holland; Cho, Ting-Jan; Koutseva, Natalia; Rozen, Steve; Muzny, Donna M; Warren, Wesley C; Gibbs, Richard A; Wilson, Richard K; Page, David C


    The human X and Y chromosomes evolved from an ordinary pair of autosomes during the past 200-300 million years. The human MSY (male-specific region of Y chromosome) retains only three percent of the ancestral autosomes' genes owing to genetic decay. This evolutionary decay was driven by a series of five 'stratification' events. Each event suppressed X-Y crossing over within a chromosome segment or 'stratum', incorporated that segment into the MSY and subjected its genes to the erosive forces that attend the absence of crossing over. The last of these events occurred 30 million years ago, 5 million years before the human and Old World monkey lineages diverged. Although speculation abounds regarding ongoing decay and looming extinction of the human Y chromosome, remarkably little is known about how many MSY genes were lost in the human lineage in the 25 million years that have followed its separation from the Old World monkey lineage. To investigate this question, we sequenced the MSY of the rhesus macaque, an Old World monkey, and compared it to the human MSY. We discovered that during the last 25 million years MSY gene loss in the human lineage was limited to the youngest stratum (stratum 5), which comprises three percent of the human MSY. In the older strata, which collectively comprise the bulk of the human MSY, gene loss evidently ceased more than 25 million years ago. Likewise, the rhesus MSY has not lost any older genes (from strata 1-4) during the past 25 million years, despite its major structural differences to the human MSY. The rhesus MSY is simpler, with few amplified gene families or palindromes that might enable intrachromosomal recombination and repair. We present an empirical reconstruction of human MSY evolution in which each stratum transitioned from rapid, exponential loss of ancestral genes to strict conservation through purifying selection. PMID:22367542

  1. 76 FR 13169 - Energy Conservation Program for Consumer Products: Decision and Order Granting a Waiver to...

    Federal Register 2010, 2011, 2012, 2013, 2014


    ...The U.S. Department of Energy (DOE) gives notice of the decision and order (Case No. CW-014) that grants to Samsung Electronics America, Inc. (Samsung) a waiver from the DOE clothes washer test procedure for determining the energy consumption of clothes washers. Under today's decision and order, Samsung shall be required to test and rate its clothes washers with larger clothes containers using......

  2. Second order symmetry-preserving conservative Lagrangian scheme for compressible Euler equations in two-dimensional cylindrical coordinates

    SciTech Connect

    Cheng, Juan; Shu, Chi-Wang


    In applications such as astrophysics and inertial confinement fusion, there are many three-dimensional cylindrical-symmetric multi-material problems which are usually simulated by Lagrangian schemes in the two-dimensional cylindrical coordinates. For this type of simulation, a critical issue for the schemes is to keep spherical symmetry in the cylindrical coordinate system if the original physical problem has this symmetry. In the past decades, several Lagrangian schemes with such symmetry property have been developed, but all of them are only first order accurate. In this paper, we develop a second order cell-centered Lagrangian scheme for solving compressible Euler equations in cylindrical coordinates, based on the control volume discretizations, which is designed to have uniformly second order accuracy and capability to preserve one-dimensional spherical symmetry in a two-dimensional cylindrical geometry when computed on an equal-angle-zoned initial grid. The scheme maintains several good properties such as conservation for mass, momentum and total energy, and the geometric conservation law. Several two-dimensional numerical examples in cylindrical coordinates are presented to demonstrate the good performance of the scheme in terms of accuracy, symmetry, non-oscillation and robustness. The advantage of higher order accuracy is demonstrated in these examples.

  3. The a(3) Scheme--A Fourth-Order Space-Time Flux-Conserving and Neutrally Stable CESE Solver

    NASA Technical Reports Server (NTRS)

    Chang, Sin-Chung


    The CESE development is driven by a belief that a solver should (i) enforce conservation laws in both space and time, and (ii) be built from a non-dissipative (i.e., neutrally stable) core scheme so that the numerical dissipation can be controlled effectively. To initiate a systematic CESE development of high order schemes, in this paper we provide a thorough discussion on the structure, consistency, stability, phase error, and accuracy of a new 4th-order space-time flux-conserving and neutrally stable CESE solver of an 1D scalar advection equation. The space-time stencil of this two-level explicit scheme is formed by one point at the upper time level and three points at the lower time level. Because it is associated with three independent mesh variables (the numerical analogues of the dependent variable and its 1st-order and 2ndorder spatial derivatives, respectively) and three equations per mesh point, the new scheme is referred to as the a(3) scheme. Through the von Neumann analysis, it is shown that the a(3) scheme is stable if and only if the Courant number is less than 0.5. Moreover, it is established numerically that the a(3) scheme is 4th-order accurate.

  4. The Trypanosoma cruzi genome; conserved core genes and extremely variable surface molecule families.


    Andersson, Björn


    The protozoan parasite Trypanosoma cruzi is an important but neglected pathogen that causes chagas disease, which affects millions of people, mainly in latin America. The population structure and epidemiology of the parasite are complex, with much variability among strains. The genome sequence of a reference strain, CL Brener, was published in 2005, and the availability of this sequence has both revealed the complexity of the parasite genome and greatly facilitated research into parasite biology and pathogenesis, by making the sequences of more than 8000 core genes available. The T. cruzi genome is highly repetitive, which has resulted in inaccuracies in the genome sequence, and attempts have been made to provide a deeper analysis of repeated genes as a complement to the genome sequence. The genome was found to be organized in stable core regions containing housekeeping and other genes, surrounded by highly repetitive, often sub-telomeric highly variable regions containing multiple members of large families of surface molecule genes. Comparative sequencing of T. cruzi strains has been initiated and the results show that the core gene content of the parasite is highly conserved, but that much sequence variability, 3-4% difference at the DNA level on average between strains in coding regions, is present. The additional genomes will improve the understanding of parasite biology and epidemiology. PMID:21624458

  5. Transcriptome Analysis Reveals Strain-Specific and Conserved Stemness Genes in Schmidtea mediterranea

    PubMed Central

    Lu, Yi-Chien; Horowitz, Michael; Graveley, Brenton R.


    The planarian Schmidtea mediterranea is a powerful model organism for studying stem cell biology due to its extraordinary regenerative ability mediated by neoblasts, a population of adult somatic stem cells. Elucidation of the S. mediterranea transcriptome and the dynamics of transcript expression will increase our understanding of the gene regulatory programs that regulate stem cell function and differentiation. Here, we have used RNA-Seq to characterize the S. mediterranea transcriptome in sexual and asexual animals and in purified neoblast and differentiated cell populations. Our analysis identified many uncharacterized genes, transcripts, and alternatively spliced isoforms that are differentially expressed in a strain or cell type-specific manner. Transcriptome profiling of purified neoblasts and differentiated cells identified neoblast-enriched transcripts, many of which likely play important roles in regeneration and stem cell function. Strikingly, many of the neoblast-enriched genes are orthologs of genes whose expression is enriched in human embryonic stem cells, suggesting that a core set of genes that regulate stem cell function are conserved across metazoan species. PMID:22496805

  6. Comprehensive analysis of imprinted genes in maize reveals allelic variation for imprinting and limited conservation with other species.


    Waters, Amanda J; Bilinski, Paul; Eichten, Steven R; Vaughn, Matthew W; Ross-Ibarra, Jeffrey; Gehring, Mary; Springer, Nathan M


    In plants, a subset of genes exhibit imprinting in endosperm tissue such that expression is primarily from the maternal or paternal allele. Imprinting may arise as a consequence of mechanisms for silencing of transposons during reproduction, and in some cases imprinted expression of particular genes may provide a selective advantage such that it is conserved across species. Separate mechanisms for the origin of imprinted expression patterns and maintenance of these patterns may result in substantial variation in the targets of imprinting in different species. Here we present deep sequencing of RNAs isolated from reciprocal crosses of four diverse maize genotypes, providing a comprehensive analysis that allows evaluation of imprinting at more than 95% of endosperm-expressed genes. We find that over 500 genes exhibit statistically significant parent-of-origin effects in maize endosperm tissue, but focused our analyses on a subset of these genes that had >90% expression from the maternal allele (69 genes) or from the paternal allele (108 genes) in at least one reciprocal cross. Over 10% of imprinted genes show evidence of allelic variation for imprinting. A comparison of imprinting in maize and rice reveals that 13% of genes with syntenic orthologs in both species exhibit conserved imprinting. Genes that exhibit conserved imprinting between maize and rice have elevated nonsynonymous to synonymous substitution ratios compared with other imprinted genes, suggesting a history of more rapid evolution. Together, these data suggest that imprinting only has functional relevance at a subset of loci that currently exhibit imprinting in maize. PMID:24218619

  7. Conservation and diversity of gene families explored using the CODEHOP strategy in higher plants

    PubMed Central

    Morant, Marc; Hehn, Alain; Werck-Reichhart, Danièle


    Background Availability of genomewide information on an increasing but still limited number of plants offers the possibility of identifying orthologues, or related genes, in species with major economical impact and complex genomes. In this paper we exploit the recently described CODEHOP primer design and PCR strategy for targeted isolation of homologues in large gene families. Results The method was tested with two different objectives. The first was to analyze the evolution of the CYP98 family of cytochrome P450 genes involved in 3-hydroxylation of phenolic compounds and lignification in a broad range of plant species. The second was to isolate an orthologue of the sorghum glucosyl transferase UGT85B1 and to determine the complexity of the UGT85 family in wheat. P450s of the CYP98 family or closely related sequences were found in all vascular plants. No related sequence was found in moss. Neither extensive duplication of the CYP98 genes nor an orthologue of UGT85B1 were found in wheat. The UGT85A subfamily was however found to be highly variable in wheat. Conclusions Our data are in agreement with the implication of CYP98s in lignification and the evolution of 3-hydroxylation of lignin precursors with vascular plants. High conservation of the CYP98 family strongly argues in favour of an essential function in plant development. Conversely, high duplication and diversification of the UGT85A gene family in wheat suggests its involvement in adaptative response and provides a valuable pool of genes for biotechnological applications. This work demonstrates the high potential of the CODEHOP strategy for the exploration of large gene families in plants. PMID:12153706

  8. Conservation and divergence of autonomous pathway genes in the flowering regulatory network of Beta vulgaris

    PubMed Central

    Abou-Elwafa, Salah F.; Büttner, Bianca; Chia, Tansy; Schulze-Buxloh, Gretel; Hohmann, Uwe; Mutasa-Göttgens, Effie; Jung, Christian; Müller, Andreas E.


    The transition from vegetative growth to reproductive development is a complex process that requires an integrated response to multiple environmental cues and endogenous signals. In Arabidopsis thaliana, which has a facultative requirement for vernalization and long days, the genes of the autonomous pathway function as floral promoters by repressing the central repressor and vernalization-regulatory gene FLC. Environmental regulation by seasonal changes in daylength is under control of the photoperiod pathway and its key gene CO. The root and leaf crop species Beta vulgaris in the caryophyllid clade of core eudicots, which is only very distantly related to Arabidopsis, is an obligate long-day plant and includes forms with or without vernalization requirement. FLC and CO homologues with related functions in beet have been identified, but the presence of autonomous pathway genes which function in parallel to the vernalization and photoperiod pathways has not yet been reported. Here, this begins to be addressed by the identification and genetic mapping of full-length homologues of the RNA-regulatory gene FLK and the chromatin-regulatory genes FVE, LD, and LDL1. When overexpressed in A. thaliana, BvFLK accelerates bolting in the Col-0 background and fully complements the late-bolting phenotype of an flk mutant through repression of FLC. In contrast, complementation analysis of BvFVE1 and the presence of a putative paralogue in beet suggest evolutionary divergence of FVE homologues. It is further shown that BvFVE1, unlike FVE in Arabidopsis, is under circadian clock control. Together, the data provide first evidence for evolutionary conservation of components of the autonomous pathway in B. vulgaris, while also suggesting divergence or subfunctionalization of one gene. The results are likely to be of broader relevance because B. vulgaris expands the spectrum of evolutionarily diverse species which are subject to differential developmental and/or environmental regulation

  9. 75 FR 62127 - Energy Conservation Program for Consumer Products: Decision and Order Granting a Waiver to...

    Federal Register 2010, 2011, 2012, 2013, 2014


    ... energy and water consumption. DATES: This Decision and Order is effective October 7, 2010. FOR FURTHER... softener regeneration. Whirlpool's petition was published in the Federal Register on July 15, 2010. 75 FR... to the regeneration operation in the measurement of water consumption during an individual...

  10. Area-preserving dynamics of a long slender finger by curvature: A test case for globally conserved phase ordering

    SciTech Connect

    Peleg, Avner; Meerson, Baruch; Vilenkin, Arkady; Conti, Massimo


    A long and slender finger can serve as a simple {open_quotes}test bed{close_quotes} for different phase-ordering models. In this work, the globally conserved, interface-controlled dynamics of a long finger is investigated, analytically and numerically, in two dimensions. An important limit is considered when the finger dynamics is reducible to area-preserving motion by curvature. A free boundary problem for the finger shape is formulated. An asymptotic perturbation theory is developed that uses the finger aspect ratio as a small parameter. The leading-order approximation is a modification of the Mullins finger (a well-known analytic solution) whose width is allowed to slowly vary with time. This time dependence is described, in the leading order, by an exponential law with the characteristic time proportional to the (constant) finger area. The subleading terms of the asymptotic theory are also calculated. Finally, the finger dynamics is investigated numerically, employing the Ginzburg-Landau equation with a global conservation law. The theory is in very good agreement with the numerical solution.

  11. Polymerase Chain Reaction (PCR)-based methods for detection and identification of mycotoxigenic Penicillium species using conserved genes

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Polymerase chain reaction amplification of conserved genes and sequence analysis provides a very powerful tool for the identification of toxigenic as well as non-toxigenic Penicillium species. Sequences are obtained by amplification of the gene fragment, sequencing via capillary electrophoresis of d...

  12. Analysis of TALE superclass homeobox genes (MEIS, PBC, KNOX, Iroquois, TGIF) reveals a novel domain conserved between plants and animals.

    PubMed Central

    Bürglin, T R


    A new Caenorhabditis elegans homeobox gene, ceh-25, is described that belongs to the TALE superclass of atypical homeodomains, which are characterized by three extra residues between helix 1 and helix 2. ORF and PCR analysis revealed a novel type of alternative splicing within the homeobox. The alternative splicing occurs such that two different homeodomains can be generated, which differ in their first 25 amino acids. ceh-25 is an orthologue of the vertebrate Meis genes and it shares a new conserved domain of 130 amino acids with them. A thorough analysis of all TALE homeobox genes was performed and a new classification is presented. Four TALE classes are identified in animals: PBC, MEIS, TGIF and IRO (Iroquois); two types in fungi: the mating type genes (M-ATYP) and the CUP genes; and two types in plants: KNOX and BEL. The IRO class has a new conserved motif downstream of the homeodomain. For the KNOX class, a conserved domain, the KNOX domain, was defined upstream of the homeodomain. Comparison of the KNOX domain and the MEIS domain shows significant sequence similarity revealing the existence of an archetypal group of homeobox genes that encode two associated conserved domains. Thus TALE homeobox genes were already present in the common ancestor of plants, fungi and animals and represent a branch distinct from the typical homeobox genes. PMID:9336443

  13. The physics of the second-order gyrokinetic magnetohydrodynamic Hamiltonian: μ conservation, Galilean invariance, and ponderomotive potential

    SciTech Connect

    Krommes, J. A.


    Some physical interpretations are given of the well-known second-order gyrokinetic Hamiltonian in the magnetohydrodynamic limit. Its relations to the conservation of the true (Galilean-invariant) magnetic moment and fluid nonlinearities are described. Subtleties about its derivation as a cold-ion limit are explained; it is important to take that limit in the frame moving with the E×B velocity. The discussion also provides some geometric understanding of certain well-known Lie generating functions, and it makes contact with general discussions of ponderomotive potentials and the thermodynamics of dielectric media.

  14. 75 FR 25224 - Energy Conservation Program for Commercial Equipment: Decision and Order Granting a Waiver to...

    Federal Register 2010, 2011, 2012, 2013, 2014


    ...This notice publishes the U.S. Department of Energy's (DOE) decision and order in Case No. CAC-025, which grants a waiver to Daikin from the existing DOE test procedure applicable to commercial package central air conditioners and heat pumps. The waiver is specific to the Daikin variable speed and variable refrigerant volume VRV-III-C (commercial) multi-split heat pumps and heat recovery......

  15. EST analysis in Ginkgo biloba: an assessment of conserved developmental regulators and gymnosperm specific genes

    PubMed Central

    Brenner, Eric D; Katari, Manpreet S; Stevenson, Dennis W; Rudd, Stephen A; Douglas, Andrew W; Moss, Walter N; Twigg, Richard W; Runko, Suzan J; Stellari, Giulia M; McCombie, WR; Coruzzi, Gloria M


    Background Ginkgo biloba L. is the only surviving member of one of the oldest living seed plant groups with medicinal, spiritual and horticultural importance worldwide. As an evolutionary relic, it displays many characters found in the early, extinct seed plants and extant cycads. To establish a molecular base to understand the evolution of seeds and pollen, we created a cDNA library and EST dataset from the reproductive structures of male (microsporangiate), female (megasporangiate), and vegetative organs (leaves) of Ginkgo biloba. Results RNA from newly emerged male and female reproductive organs and immature leaves was used to create three distinct cDNA libraries from which 6,434 ESTs were generated. These 6,434 ESTs from Ginkgo biloba were clustered into 3,830 unigenes. A comparison of our Ginkgo unigene set against the fully annotated genomes of rice and Arabidopsis, and all available ESTs in Genbank revealed that 256 Ginkgo unigenes match only genes among the gymnosperms and non-seed plants – many with multiple matches to genes in non-angiosperm plants. Conversely, another group of unigenes in Gingko had highly significant homology to transcription factors in angiosperms involved in development, including MADS box genes as well as post-transcriptional regulators. Several of the conserved developmental genes found in Ginkgo had top BLAST homology to cycad genes. We also note here the presence of ESTs in G. biloba similar to genes that to date have only been found in gymnosperms and an additional 22 Ginkgo genes common only to genes from cycads. Conclusion Our analysis of an EST dataset from G. biloba revealed genes potentially unique to gymnosperms. Many of these genes showed homology to fully sequenced clones from our cycad EST dataset found in common only with gymnosperms. Other Ginkgo ESTs are similar to developmental regulators in higher plants. This work sets the stage for future studies on Ginkgo to better understand seed and pollen evolution, and to

  16. Sphingolipids, Transcription Factors, and Conserved Toolkit Genes: Developmental Plasticity in the Ant Cardiocondyla obscurior

    PubMed Central

    Schrader, Lukas; Simola, Daniel F.; Heinze, Jürgen; Oettler, Jan


    Developmental plasticity allows for the remarkable morphological specialization of individuals into castes in eusocial species of Hymenoptera. Developmental trajectories that lead to alternative caste fates are typically determined by specific environmental stimuli that induce larvae to express and maintain distinct gene expression patterns. Although most eusocial species express two castes, queens and workers, the ant Cardiocondyla obscurior expresses diphenic females and males; this provides a unique system with four discrete phenotypes to study the genomic basis of developmental plasticity in ants. We sequenced and analyzed the transcriptomes of 28 individual C. obscurior larvae of known developmental trajectory, providing the first in-depth analysis of gene expression in eusocial insect larvae. Clustering and transcription factor binding site analyses revealed that different transcription factors and functionally distinct sets of genes are recruited during larval development to induce the four alternative trajectories. In particular, we found complex patterns of gene regulation pertaining to sphingolipid metabolism, a conserved molecular pathway involved in development, obesity, and aging. PMID:25725431

  17. Conserved regulation of the Caenorhabditis elegans labial/Hox1 gene ceh-13.


    Streit, Adrian; Kohler, Reto; Marty, Thomas; Belfiore, Marco; Takacs-Vellai, Krisztina; Vigano, Maria-Alessandra; Schnabel, Ralf; Affolter, Markus; Müller, Fritz


    Caenorhabditis elegans contains a set of six cluster-type homeobox (Hox) genes that are required during larval development. Some of them, but unlike in flies not all of them, are also required during embryogenesis. It has been suggested that the control of the embryonic expression of the worm Hox genes might differ from that of other species by being regulated in a lineal rather than a regional mode. Here, we present a trans-species analysis of the cis-regulatory region of ceh-13, the worm ortholog of the Drosophila labial and the vertebrate Hox1 genes, and find that the molecular mechanisms that regulate its expression may be similar to what has been found in species that follow a regulative, non-cell-autonomous mode of development. We have identified two enhancer fragments that are involved in different aspects of the embryonic ceh-13 expression pattern. We show that important features of comma-stage expression depend on an autoregulatory input that requires ceh-13 and ceh-20 functions. Our data show that the molecular nature of Hox1 class gene autoregulation has been conserved between worms, flies, and vertebrates. The second regulatory sequence is sufficient to drive correct early embryonic expression of ceh-13. Interestingly, this enhancer fragment acts as a response element of the Wnt/WG signaling pathway in Drosophila embryos. PMID:11820809

  18. SHOX gene and conserved noncoding element deletions/duplications in Colombian patients with idiopathic short stature

    PubMed Central

    Sandoval, Gloria Tatiana Vinasco; Jaimes, Giovanna Carola; Barrios, Mauricio Coll; Cespedes, Camila; Velasco, Harvy Mauricio


    SHOX gene mutations or haploinsufficiency cause a wide range of phenotypes such as Leri Weill dyschondrosteosis (LWD), Turner syndrome, and disproportionate short stature (DSS). However, this gene has also been found to be mutated in cases of idiopathic short stature (ISS) with a 3–15% frequency. In this study, the multiplex ligation-dependent probe amplification (MLPA) technique was employed to determine the frequency of SHOX gene mutations and their conserved noncoding elements (CNE) in Colombian patients with ISS. Patients were referred from different centers around the county. From a sample of 62 patients, 8.1% deletions and insertions in the intragenic regions and in the CNE were found. This result is similar to others published in other countries. Moreover, an isolated case of CNE 9 duplication and a new intron 6b deletion in another patient, associated with ISS, are described. This is one of the first studies of a Latin American population in which deletions/duplications of the SHOX gene and its CNE are examined in patients with ISS. PMID:24689071

  19. Conservation in the involvement of heterochronic genes and hormones during developmental transitions.


    Faunes, Fernando; Larraín, Juan


    Developmental transitions include molting in some invertebrates and the metamorphosis of insects and amphibians. While the study of Caenorhabditis elegans larval transitions was crucial to determine the genetic control of these transitions, Drosophila melanogaster and Xenopus laevis have been classic models to study the role of hormones in metamorphosis. Here we review how heterochronic genes (lin-4, let-7, lin-28, lin-41), hormones (dafachronic acid, ecdysone, thyroid hormone) and the environment regulate developmental transitions. Recent evidence suggests that some heterochronic genes also regulate transitions in higher organisms that they are controlled by hormones involved in metamorphosis. We also discuss evidence demonstrating that heterochronic genes and hormones regulate the proliferation and differentiation of embryonic and neural stem cells. We propose the hypothesis that developmental transitions are regulated by an evolutionary conserved mechanism in which heterochronic genes and hormones interact to control stem/progenitor cells proliferation, cell cycle exit, quiescence and differentiation and determine the proper timing of developmental transitions. Finally, we discuss the relevance of these studies to understand post-embryonic development, puberty and regeneration in humans. PMID:27297887

  20. Conservation, Duplication, and Divergence of Five Opsin Genes in Insect Evolution

    PubMed Central

    Feuda, Roberto; Marlétaz, Ferdinand; Bentley, Michael A.; Holland, Peter W.H.


    Opsin proteins covalently bind to small molecular chromophores and each protein-chromophore complex is sensitive to particular wavelengths of light. Multiple opsins with different wavelength absorbance peaks are required for color vision. Comparing opsin responses is challenging at low light levels, explaining why color vision is often lost in nocturnal species. Here, we investigated opsin evolution in 27 phylogenetically diverse insect species including several transitions between photic niches (nocturnal, diurnal, and crepuscular). We find widespread conservation of five distinct opsin genes, more than commonly considered. These comprise one c-opsin plus four r-opsins (long wavelength sensitive or LWS, blue sensitive, ultra violet [UV] sensitive and the often overlooked Rh7 gene). Several recent opsin gene duplications are also detected. The diversity of opsin genes is consistent with color vision in diurnal, crepuscular, and nocturnal insects. Tests for positive selection in relation to photic niche reveal evidence for adaptive evolution in UV-sensitive opsins in day-flying insects in general, and in LWS opsins of day-flying Lepidoptera specifically. PMID:26865071

  1. A Gene Mutated in Nephronophthisis and Retinitis Pigmentosa Encodes a Novel Protein, Nephroretinin, Conserved in Evolution

    PubMed Central

    Otto, Edgar; Hoefele, Julia; Ruf, Rainer; Mueller, Adelheid M.; Hiller, Karl S.; Wolf, Matthias T. F.; Schuermann, Maria J.; Becker, Achim; Birkenhäger, Ralf; Sudbrak, Ralf; Hennies, Hans C.; Nürnberg, Peter; Hildebrandt, Friedhelm


    Nephronophthisis (NPHP) comprises a group of autosomal recessive cystic kidney diseases, which constitute the most frequent genetic cause for end-stage renal failure in children and young adults. The most prominent histologic feature of NPHP consists of development of renal fibrosis, which, in chronic renal failure of any origin, represents the pathogenic event correlated most strongly to loss of renal function. Four gene loci for NPHP have been mapped to chromosomes 2q13 (NPHP1), 9q22 (NPHP2), 3q22 (NPHP3), and 1p36 (NPHP4). At all four loci, linkage has also been demonstrated in families with the association of NPHP and retinitis pigmentosa, known as “Senior-Løken syndrome” (SLS). Identification of the gene for NPHP type 1 had revealed nephrocystin as a novel docking protein, providing new insights into mechanisms of cell-cell and cell-matrix signaling. We here report identification of the gene (NPHP4) causing NPHP type 4, by use of high-resolution haplotype analysis and by demonstration of nine likely loss-of-function mutations in six affected families. NPHP4 encodes a novel protein, nephroretinin, that is conserved in evolution—for example, in the nematode Caenorhabditis elegans. In addition, we demonstrate two loss-of-function mutations of NPHP4 in patients from two families with SLS. Thus, we have identified a novel gene with critical roles in renal tissue architecture and ophthalmic function. PMID:12205563

  2. A well-conserved Plasmodium falciparum var gene shows an unusual stage-specific transcript pattern

    PubMed Central

    Kyes, Sue A.; Christodoulou, Zoe; Raza, Ahmed; Horrocks, Paul; Pinches, Robert; Rowe, J. Alexandra; Newbold, Chris I.


    Summary The var multicopy gene family encodes Plasmodium falciparum erythrocyte membrane protein 1 (PfEMP1) variant antigens, which, through their ability to adhere to a variety of host receptors, are thought to be important virulence factors. The predominant expression of a single cytoadherent PfEMP1 type on an infected red blood cell, and the switching between different PfEMP1 types to evade host protective antibody responses, are processes thought to be controlled at the transcriptional level. Contradictory data have been published on the timing of var gene transcription. Reverse transcription-polymerase chain reaction (RT-PCR) data suggested that transcription of the predominant var gene occurs in the later (pigmented trophozoite) stages, whereas Northern blot data indicated such transcripts only in early (ring) stages. We investigated this discrepancy by Northern blot, with probes covering a diverse var gene repertoire. We confirm that almost all var transcript types were detected only in ring stages. However, one type, the well-conserved varCSA transcript, was present constitutively in different laboratory parasites and does not appear to undergo antigenic variation. Although varCSA has been shown to encode a chondroitin sulphate A (CSA)-binding PfEMP1, we find that the presence of full-length varCSA transcripts does not correlate with the CSA-binding phenotype. PMID:12787360

  3. The human archain gene, ARCN1, has highly conserved homologs in rice and drosophila

    SciTech Connect

    Radice, P.; Jones, C.; Perry, H.


    A novel human gene, ARCN1, has been identified in chromosome band 11q23.3. It maps approximately 50 kb telomeric to MLL, a gene that is disrupted in a number of leukemia-associated translocation chromosomes. cDNA clones representing ARCN1 hybridize to 4-kb mRNA species present in all tissues tested. Sequencing of cDNAs suggests that at least two forms of mRNA with alternative 5 {prime} ends are present within the cell. The mRNA with the longest open reading frame gives rise to a protein of 57 kDa. Although the sequence reported is novel, remarkable similarity is observed with two predicted protein sequences from partial DNA sequences generated by rice (Oryza sativa) and fruit fly (Drosophila melanogaster) genome projects. The degree of sequence conservation is comparable to that observed for highly conserved structural proteins, such as heat shock protein HSP70, and is greater than that of {gamma}-gubulin and heat shock protein HSP60. A more distant relationship to the group of clathrin-associated proteins suggests a possible role in vesicle structure or trafficking. In view of its ancient pedigree and a potential involvement in cellular architecture, the authors propose that the ARCN1 protein be named archain. 20 refs., 5 figs.

  4. Nematode orphan genes are adopted by conserved regulatory networks and find a home in ecology

    PubMed Central

    Mayer, Melanie G; Sommer, Ralf J


    Nematode dauer formation represents an essential survival and dispersal strategy and is one of a few ecologically relevant traits that can be studied in laboratory approaches. Under harsh environmental conditions, the nematode model organisms Caenorhabditis elegans and Pristionchus pacificus arrest their development and induce the formation of stress-resistant dauer larvae in response to dauer pheromones, representing a key example of phenotypic plasticity. Previous studies have indicated that in P. pacificus, many wild isolates show cross-preference of dauer pheromones and compete for access to a limited food source. When investigating the genetic mechanisms underlying this intraspecific competition, we recently discovered that the orphan gene dauerless (dau-1) controls dauer formation by copy number variation. Our results show that dau-1 acts in parallel to or downstream of steroid hormone signaling but upstream of the nuclear hormone receptor daf-12, suggesting that DAU-1 represents a novel inhibitor of DAF-12. Phylogenetic analysis reveals that the observed copy number variation is part of a complex series of gene duplication events that occurred over short evolutionary time scales. Here, we comment on the incorporation of novel or fast-evolving genes into conserved genetic networks as a common principle for the evolution of phenotypic plasticity and intraspecific competition. We discuss the possibility that orphan genes might often function in the regulation and execution of ecologically relevant traits. Given that only few ecological processes can be studied in model organisms, the function of such genes might often go unnoticed, explaining the large number of uncharacterized genes in model system genomes. PMID:27123366

  5. Nematode orphan genes are adopted by conserved regulatory networks and find a home in ecology.


    Mayer, Melanie G; Sommer, Ralf J


    Nematode dauer formation represents an essential survival and dispersal strategy and is one of a few ecologically relevant traits that can be studied in laboratory approaches. Under harsh environmental conditions, the nematode model organisms Caenorhabditis elegans and Pristionchus pacificus arrest their development and induce the formation of stress-resistant dauer larvae in response to dauer pheromones, representing a key example of phenotypic plasticity. Previous studies have indicated that in P. pacificus, many wild isolates show cross-preference of dauer pheromones and compete for access to a limited food source. When investigating the genetic mechanisms underlying this intraspecific competition, we recently discovered that the orphan gene dauerless (dau-1) controls dauer formation by copy number variation. Our results show that dau-1 acts in parallel to or downstream of steroid hormone signaling but upstream of the nuclear hormone receptor daf-12, suggesting that DAU-1 represents a novel inhibitor of DAF-12. Phylogenetic analysis reveals that the observed copy number variation is part of a complex series of gene duplication events that occurred over short evolutionary time scales. Here, we comment on the incorporation of novel or fast-evolving genes into conserved genetic networks as a common principle for the evolution of phenotypic plasticity and intraspecific competition. We discuss the possibility that orphan genes might often function in the regulation and execution of ecologically relevant traits. Given that only few ecological processes can be studied in model organisms, the function of such genes might often go unnoticed, explaining the large number of uncharacterized genes in model system genomes. PMID:27123366

  6. Whole genome sequencing of Ethiopian highlanders reveals conserved hypoxia tolerance genes

    PubMed Central


    Background Although it has long been proposed that genetic factors contribute to adaptation to high altitude, such factors remain largely unverified. Recent advances in high-throughput sequencing have made it feasible to analyze genome-wide patterns of genetic variation in human populations. Since traditionally such studies surveyed only a small fraction of the genome, interpretation of the results was limited. Results We report here the results of the first whole genome resequencing-based analysis identifying genes that likely modulate high altitude adaptation in native Ethiopians residing at 3,500 m above sea level on Bale Plateau or Chennek field in Ethiopia. Using cross-population tests of selection, we identify regions with a significant loss of diversity, indicative of a selective sweep. We focus on a 208 kbp gene-rich region on chromosome 19, which is significant in both of the Ethiopian subpopulations sampled. This region contains eight protein-coding genes and spans 135 SNPs. To elucidate its potential role in hypoxia tolerance, we experimentally tested whether individual genes from the region affect hypoxia tolerance in Drosophila. Three genes significantly impact survival rates in low oxygen: cic, an ortholog of human CIC, Hsl, an ortholog of human LIPE, and Paf-AHα, an ortholog of human PAFAH1B3. Conclusions Our study reveals evolutionarily conserved genes that modulate hypoxia tolerance. In addition, we show that many of our results would likely be unattainable using data from exome sequencing or microarray studies. This highlights the importance of whole genome sequencing for investigating adaptation by natural selection. PMID:24555826

  7. Genes of the most conserved WOX clade in plants affect root and flower development in Arabidopsis

    PubMed Central


    Background The Wuschel related homeobox (WOX) family proteins are key regulators implicated in the determination of cell fate in plants by preventing cell differentiation. A recent WOX phylogeny, based on WOX homeodomains, showed that all of the Physcomitrella patens and Selaginella moellendorffii WOX proteins clustered into a single orthologous group. We hypothesized that members of this group might preferentially share a significant part of their function in phylogenetically distant organisms. Hence, we first validated the limits of the WOX13 orthologous group (WOX13 OG) using the occurrence of other clade specific signatures and conserved intron insertion sites. Secondly, a functional analysis using expression data and mutants was undertaken. Results The WOX13 OG contained the most conserved plant WOX proteins including the only WOX detected in the highly proliferating basal unicellular and photosynthetic organism Ostreococcus tauri. A large expansion of the WOX family was observed after the separation of mosses from other land plants and before monocots and dicots have arisen. In Arabidopsis thaliana, AtWOX13 was dynamically expressed during primary and lateral root initiation and development, in gynoecium and during embryo development. AtWOX13 appeared to affect the floral transition. An intriguing clade, represented by the functional AtWOX14 gene inside the WOX13 OG, was only found in the Brassicaceae. Compared to AtWOX13, the gene expression profile of AtWOX14 was restricted to the early stages of lateral root formation and specific to developing anthers. A mutational insertion upstream of the AtWOX14 homeodomain sequence led to abnormal root development, a delay in the floral transition and premature anther differentiation. Conclusion Our data provide evidence in favor of the WOX13 OG as the clade containing the most conserved WOX genes and established a functional link to organ initiation and development in Arabidopsis, most likely by preventing premature

  8. Gene expression suggests conserved aspects of Hox gene regulation in arthropods and provides additional support for monophyletic Myriapoda.


    Janssen, Ralf; Budd, Graham E


    Antisense transcripts of Ultrabithorax (aUbx) in the millipede Glomeris and the centipede Lithobius are expressed in patterns complementary to that of the Ubx sense transcripts. A similar complementary expression pattern has been described for non-coding RNAs (ncRNAs) of the bithoraxoid (bxd) locus in Drosophila, in which the transcription of bxd ncRNAs represses Ubx via transcriptional interference. We discuss our findings in the context of possibly conserved mechanisms of Ubx regulation in myriapods and the fly.Bicistronic transcription of Ubx and Antennapedia (Antp) has been reported previously for a myriapod and a number of crustaceans. In this paper, we show that Ubx/Antp bicistronic transcripts also occur in Glomeris and an onychophoran, suggesting further conserved mechanisms of Hox gene regulation in arthropods.Myriapod monophyly is supported by the expression of aUbx in all investigated myriapods, whereas in other arthropod classes, including the Onychophora, aUbx is not expressed. Of the two splice variants of Ubx/Antp only one could be isolated from myriapods, representing a possible further synapomorphy of the Myriapoda. PMID:20849647

  9. A high-order finite-volume method for hyperbolic conservation laws on locally-refined grids

    SciTech Connect

    McCorquodale, Peter; Colella, Phillip


    We present a fourth-order accurate finite-volume method for solving time-dependent hyperbolic systems of conservation laws on Cartesian grids with multiple levels of refinement. The underlying method is a generalization of that in [5] to nonlinear systems, and is based on using fourth-order accurate quadratures for computing fluxes on faces, combined with fourth-order accurate Runge?Kutta discretization in time. To interpolate boundary conditions at refinement boundaries, we interpolate in time in a manner consistent with the individual stages of the Runge-Kutta method, and interpolate in space by solving a least-squares problem over a neighborhood of each target cell for the coefficients of a cubic polynomial. The method also uses a variation on the extremum-preserving limiter in [8], as well as slope flattening and a fourth-order accurate artificial viscosity for strong shocks. We show that the resulting method is fourth-order accurate for smooth solutions, and is robust in the presence of complex combinations of shocks and smooth flows.

  10. High-order conservative finite difference GLM-MHD schemes for cell-centered MHD

    NASA Astrophysics Data System (ADS)

    Mignone, Andrea; Tzeferacos, Petros; Bodo, Gianluigi


    We present and compare third- as well as fifth-order accurate finite difference schemes for the numerical solution of the compressible ideal MHD equations in multiple spatial dimensions. The selected methods lean on four different reconstruction techniques based on recently improved versions of the weighted essentially non-oscillatory (WENO) schemes, monotonicity preserving (MP) schemes as well as slope-limited polynomial reconstruction. The proposed numerical methods are highly accurate in smooth regions of the flow, avoid loss of accuracy in proximity of smooth extrema and provide sharp non-oscillatory transitions at discontinuities. We suggest a numerical formulation based on a cell-centered approach where all of the primary flow variables are discretized at the zone center. The divergence-free condition is enforced by augmenting the MHD equations with a generalized Lagrange multiplier yielding a mixed hyperbolic/parabolic correction, as in Dedner et al. [J. Comput. Phys. 175 (2002) 645-673]. The resulting family of schemes is robust, cost-effective and straightforward to implement. Compared to previous existing approaches, it completely avoids the CPU intensive workload associated with an elliptic divergence cleaning step and the additional complexities required by staggered mesh algorithms. Extensive numerical testing demonstrate the robustness and reliability of the proposed framework for computations involving both smooth and discontinuous features.

  11. Deep Conservation of Genes Required for Both Drosophila melanogaster and Caenorhabditis elegans Sleep Includes a Role for Dopaminergic Signaling

    PubMed Central

    Singh, Komudi; Ju, Jennifer Y.; Walsh, Melissa B.; DiIorio, Michael A.; Hart, Anne C.


    Objectives: Cross-species conservation of sleep-like behaviors predicts the presence of conserved molecular mechanisms underlying sleep. However, limited experimental evidence of conservation exists. Here, this prediction is tested directly. Measurements and Results: During lethargus, Caenorhabditis elegans spontaneously sleep in short bouts that are interspersed with bouts of spontaneous locomotion. We identified 26 genes required for Drosophila melanogaster sleep. Twenty orthologous C. elegans genes were selected based on similarity. Their effect on C. elegans sleep and arousal during the last larval lethargus was assessed. The 20 most similar genes altered both the quantity of sleep and arousal thresholds. In 18 cases, the direction of change was concordant with Drosophila studies published previously. Additionally, we delineated a conserved genetic pathway by which dopamine regulates sleep and arousal. In C. elegans neurons, G-alpha S, adenylyl cyclase, and protein kinase A act downstream of D1 dopamine receptors to regulate these behaviors. Finally, a quantitative analysis of genes examined herein revealed that C. elegans arousal thresholds were directly correlated with amount of sleep during lethargus. However, bout duration varies little and was not correlated with arousal thresholds. Conclusions: The comprehensive analysis presented here suggests that conserved genes and pathways are required for sleep in invertebrates and, likely, across the entire animal kingdom. The genetic pathway delineated in this study implicates G-alpha S and previously known genes downstream of dopamine signaling in sleep. Quantitative analysis of various components of quiescence suggests that interdependent or identical cellular and molecular mechanisms are likely to regulate both arousal and sleep entry. Citation: Singh K, Ju JY, Walsh MB, Dilorio MA, Hart AC. Deep conservation of genes required for both Drosophila melanogaster and Caenorhabditis elegans sleep includes a role for

  12. H3K36ac Is an Evolutionary Conserved Plant Histone Modification That Marks Active Genes.


    Mahrez, Walid; Arellano, Minerva Susana Trejo; Moreno-Romero, Jordi; Nakamura, Miyuki; Shu, Huan; Nanni, Paolo; Köhler, Claudia; Gruissem, Wilhelm; Hennig, Lars


    In eukaryotic cells, histones are subject to a large number of posttranslational modifications whose sequential or combinatorial action affects chromatin structure and genome function. We identified acetylation at Lys-36 in histone H3 (H3K36ac) as a new chromatin modification in plants. The H3K36ac modification is evolutionary conserved in seed plants, including the gymnosperm Norway spruce (Picea abies) and the angiosperms rice (Oryza sativa), tobacco (Nicotiana tabacum), and Arabidopsis (Arabidopsis thaliana). In Arabidopsis, H3K36ac is highly enriched in euchromatin but not in heterochromatin. Genome-wide chromatin immunoprecipitation sequencing experiments revealed that H3K36ac peaks at the 5' end of genes, mainly on the two nucleosomes immediately distal to the transcription start site, independently of gene length. H3K36ac overlaps with H3K4me3 and the H2A.Z histone variant. The histone acetyl transferase GCN5 and the histone deacetylase HDA19 are required for H3K36ac homeostasis. H3K36ac and H3K36me3 show negative crosstalk, which is mediated by GCN5 and the histone methyl transferase SDG8. Although H3K36ac is associated with gene activity, we did not find a linear relationship between H3K36ac and transcript levels, suggesting that H3K36ac is a binary indicator of transcription. PMID:26764380

  13. A higher-order conservation element solution element method for solving hyperbolic differential equations on unstructured meshes

    NASA Astrophysics Data System (ADS)

    Bilyeu, David

    This dissertation presents an extension of the Conservation Element Solution Element (CESE) method from second- to higher-order accuracy. The new method retains the favorable characteristics of the original second-order CESE scheme, including (i) the use of the space-time integral equation for conservation laws, (ii) a compact mesh stencil, (iii) the scheme will remain stable up to a CFL number of unity, (iv) a fully explicit, time-marching integration scheme, (v) true multidimensionality without using directional splitting, and (vi) the ability to handle two- and three-dimensional geometries by using unstructured meshes. This algorithm has been thoroughly tested in one, two and three spatial dimensions and has been shown to obtain the desired order of accuracy for solving both linear and non-linear hyperbolic partial differential equations. The scheme has also shown its ability to accurately resolve discontinuities in the solutions. Higher order unstructured methods such as the Discontinuous Galerkin (DG) method and the Spectral Volume (SV) methods have been developed for one-, two- and three-dimensional application. Although these schemes have seen extensive development and use, certain drawbacks of these methods have been well documented. For example, the explicit versions of these two methods have very stringent stability criteria. This stability criteria requires that the time step be reduced as the order of the solver increases, for a given simulation on a given mesh. The research presented in this dissertation builds upon the work of Chang, who developed a fourth-order CESE scheme to solve a scalar one-dimensional hyperbolic partial differential equation. The completed research has resulted in two key deliverables. The first is a detailed derivation of a high-order CESE methods on unstructured meshes for solving the conservation laws in two- and three-dimensional spaces. The second is the code implementation of these numerical methods in a computer code. For

  14. A WDR Gene Is a Conserved Member of a Chitin Synthase Gene Cluster and Influences the Cell Wall in Aspergillus nidulans

    PubMed Central

    Guerriero, Gea; Silvestrini, Lucia; Obersriebnig, Michael; Hausman, Jean-Francois; Strauss, Joseph; Ezcurra, Inés


    WD40 repeat (WDR) proteins are pleiotropic molecular hubs. We identify a WDR gene that is a conserved genomic neighbor of a chitin synthase gene in Ascomycetes. The WDR gene is unique to fungi and plants, and was called Fungal Plant WD (FPWD). FPWD is within a cell wall metabolism gene cluster in the Ascomycetes (Pezizomycotina) comprising chsD, a Chs activator and a GH17 glucanase. The FPWD, AN1556.2 locus was deleted in Aspergillus nidulans strain SAA.111 by gene replacement and only heterokaryon transformants were obtained. The re-annotation of Aspergilli genomes shows that AN1556.2 consists of two tightly linked separate genes, i.e., the WDR gene and a putative beta-flanking gene of unknown function. The WDR and the beta-flanking genes are conserved genomic neighbors localized within a recently identified metabolic cell wall gene cluster in genomes of Aspergilli. The heterokaryons displayed increased susceptibility to drugs affecting the cell wall, and their phenotypes, observed by optical, confocal, scanning electron and atomic force microscopy, suggest cell wall alterations. Quantitative real-time PCR shows altered expression of some cell wall-related genes. The possible implications on cell wall biosynthesis are discussed. PMID:27367684

  15. A kinetic scheme for the Navier-Stokes equations and high-order methods for hyperbolic conservation laws

    NASA Astrophysics Data System (ADS)

    May, Georg

    This dissertation revolves around algorithm development in the context of numerical methods for hyperbolic conservation laws and the compressible Navier-Stokes equations, with particular emphasis on unstructured meshes. Three distinct topics may be identified: Firstly, a new kinetic scheme for the compressible Navier-Stokes equations is developed. Kinetic numerical schemes are based on the discretization of a probability density function. In the context of fluid flow such schemes have a natural basis rooted in the kinetic theory of gases. A significant advantage of kinetic schemes is that they allow a compact, completely mesh-independent discretization of the Navier-Stokes equations, which makes them well suited for next-generation solvers on general unstructured meshes. The new kinetic scheme is based on the Xu-Prenderaast BGK scheme, and achieves a dramatic reduction in computational cost, while also improving and clarifying the formulation with respect to the underlying kinetic gas theory. The second topic addresses high-order numerical methods for conservation laws on unstructured meshes. High-order methods potentially produce higher accuracy with fewer degrees of freedom, compared to standard first or second order accurate schemes, while formulation for unstructured meshes makes complex computational domains amenable. The Spectral Difference Method offers a remarkably simple alternative to such high-order schemes for unstructured meshes as the Discontinuous Galerkin and Spectral Volume Methods. Significant contributions to the development of the Spectral Difference Method are presented, including stability analysis, viscous formulation, and h/p-multigrid convergence acceleration. Finally, the theory of Gibbs-complementary reconstruction is utilized in the context of high-order numerical methods for hyperbolic equations. Gibbs-complementary reconstruction makes it possible to extract pointwise high-order convergence in the spectral approximation of non

  16. Conservative second-order gravitational self-force on circular orbits and the effective one-body formalism

    NASA Astrophysics Data System (ADS)

    Bini, Donato; Damour, Thibault


    We consider Detweiler's redshift variable z for a nonspinning mass m1 in circular motion (with orbital frequency Ω ) around a nonspinning mass m2. We show how the combination of effective-one-body (EOB) theory with the first law of binary dynamics allows one to derive a simple, exact expression for the functional dependence of z on the (gauge-invariant) EOB gravitational potential u =(m1+m2)/R . We then use the recently obtained high-post-Newtonian(PN)-order knowledge of the main EOB radial potential A (u ;ν ) [where ν =m1m2/(m1+m2)2] to decompose the second-self-force-order contribution to the function z (m2Ω ,m1/m2) into a known part (which goes beyond the 4PN level in including the 5PN logarithmic term and the 5.5PN contribution) and an unknown one [depending on the yet unknown, 5PN, 6 PN ,… , contributions to the O (ν2) contribution to the EOB radial potential A (u ;ν )]. We apply our results to the second-self-force-order contribution to the frequency shift of the last stable orbit. We indicate the expected singular behaviors, near the lightring, of the second-self-force-order contributions to both the redshift and the EOB A potential. Our results should help both in extracting information of direct dynamical significance from ongoing second-self-force-order computations and in parametrizing their global strong-field behaviors. We also advocate computing second-self-force-order conservative quantities by iterating the time-symmetric Green-function in the background spacetime.

  17. Transcriptional Control of Photosynthesis Genes: The Evolutionarily Conserved Regulatory Mechanism in Plastid Genome Function

    PubMed Central

    Puthiyaveetil, Sujith; Ibrahim, Iskander M.; Jeličić, Branka; Tomašić, Ana; Fulgosi, Hrvoje; Allen, John F.


    Chloroplast sensor kinase (CSK) is a bacterial-type sensor histidine kinase found in chloroplasts—photosynthetic plastids—in eukaryotic plants and algae. Using a yeast two-hybrid screen, we demonstrate recognition and interactions between: CSK, plastid transcription kinase (PTK), and a bacterial-type RNA polymerase sigma factor-1 (SIG-1). CSK interacts with itself, with SIG-1, and with PTK. PTK also interacts directly with SIG-1. PTK has previously been shown to catalyze phosphorylation of plastid-encoded RNA polymerase (PEP), suppressing plastid transcription nonspecifically. Phospho-PTK is inactive as a PEP kinase. Here, we propose that phospho-CSK acts as a PTK kinase, releasing PTK repression of chloroplast transcription, while CSK also acts as a SIG-1 kinase, blocking transcription specifically at the gene promoter of chloroplast photosystem I. Oxidation of the photosynthetic electron carrier plastoquinone triggers phosphorylation of CSK, inducing chloroplast photosystem II while suppressing photosystem I. CSK places photosystem gene transcription under the control of photosynthetic electron transport. This redox signaling pathway has its origin in cyanobacteria, photosynthetic prokaryotes from which chloroplasts evolved. The persistence of this mechanism in cytoplasmic organelles of photosynthetic eukaryotes is in precise agreement with the CoRR hypothesis for the function of organellar genomes: the plastid genome and its primary gene products are Co-located for Redox Regulation. Genes are retained in plastids primarily in order for their expression to be subject to this rapid and robust redox regulatory transcriptional control mechanism, whereas plastid genes also encode genetic system components, such as some ribosomal proteins and RNAs, that exist in order to support this primary, redox regulatory control of photosynthesis genes. Plastid genome function permits adaptation of the photosynthetic apparatus to changing environmental conditions of light

  18. Conservation of lipid metabolic gene transcriptional regulatory networks in fish and mammals.


    Carmona-Antoñanzas, Greta; Tocher, Douglas R; Martinez-Rubio, Laura; Leaver, Michael J


    Lipid content and composition in aquafeeds have changed rapidly as a result of the recent drive to replace ecologically limited marine ingredients, fishmeal and fish oil (FO). Terrestrial plant products are the most economic and sustainable alternative; however, plant meals and oils are devoid of physiologically important cholesterol and long-chain polyunsaturated fatty acids (LC-PUFA), eicosapentaenoic (EPA), docosahexaenoic (DHA) and arachidonic (ARA) acids. Although replacement of dietary FO with vegetable oil (VO) has little effect on growth in Atlantic salmon (Salmo salar), several studies have shown major effects on the activity and expression of genes involved in lipid homeostasis. In vertebrates, sterols and LC-PUFA play crucial roles in lipid metabolism by direct interaction with lipid-sensing transcription factors (TFs) and consequent regulation of target genes. The primary aim of the present study was to elucidate the role of key TFs in the transcriptional regulation of lipid metabolism in fish by transfection and overexpression of TFs. The results show that the expression of genes of LC-PUFA biosynthesis (elovl and fads2) and cholesterol metabolism (abca1) are regulated by Lxr and Srebp TFs in salmon, indicating highly conserved regulatory mechanism across vertebrates. In addition, srebp1 and srebp2 mRNA respond to replacement of dietary FO with VO. Thus, Atlantic salmon adjust lipid metabolism in response to dietary lipid composition through the transcriptional regulation of gene expression. It may be possible to further increase efficient and effective use of sustainable alternatives to marine products in aquaculture by considering these important molecular interactions when formulating diets. PMID:24177230

  19. Conserving Plants in Gene Banks and Nature: Investigating Complementarity with Trifolium thompsonii Morton

    PubMed Central

    Greene, Stephanie L.; Kisha, Theodore J.; Yu, Long-Xi; Parra-Quijano, Mauricio


    A standard conservation strategy for plant genetic resources integrates in situ (on-farm or wild) and ex situ (gene or field bank) approaches. Gene bank managers collect ex situ accessions that represent a comprehensive snap shot of the genetic diversity of in situ populations at a given time and place. Although simple in theory, achieving complementary in situ and ex situ holdings is challenging. Using Trifolium thompsonii as a model insect-pollinated herbaceous perennial species, we used AFLP markers to compare genetic diversity and structure of ex situ accessions collected at two time periods (1995, 2004) from four locations, with their corresponding in situ populations sampled in 2009. Our goal was to assess the complementarity of the two approaches. We examined how gene flow, selection and genetic drift contributed to population change. Across locations, we found no difference in diversity between ex situ and in situ samples. One population showed a decline in genetic diversity over the 15 years studied. Population genetic differentiation among the four locations was significant, but weak. Association tests suggested infrequent, long distance gene flow. Selection and drift occurred, but differences due to spatial effects were three times as strong as differences attributed to temporal effects, and suggested recollection efforts could occur at intervals greater than fifteen years. An effective collecting strategy for insect pollinated herbaceous perennial species was to sample >150 plants, equalize maternal contribution, and sample along random transects with sufficient space between plants to minimize intrafamilial sampling. Quantifying genetic change between ex situ and in situ accessions allows genetic resource managers to validate ex situ collecting and maintenance protocols, develop appropriate recollection intervals, and provide an early detection mechanism for identifying problematic conditions that can be addressed to prevent further decline in

  20. Conserved and novel gene expression between regeneration and asexual fission in Nematostella vectensis.


    Burton, Patrick M; Finnerty, John R


    Due to work in model systems (e.g., flies and mice), the molecular mechanisms of embryogenesis are known in exquisite detail. However, these organisms are incapable of asexual reproduction and possess limited regenerative abilities. Thus, the mechanisms of alternate developmental trajectories and their relation to embryonic mechanisms remain understudied. Because these developmental trajectories are present in a diverse group of animal phyla spanning the metazoan phylogeny, including cnidarians, annelids, and echinoderms, they are likely to have played a major role in animal evolution. The starlet sea anemone Nematostella vectensis, an emerging model system, undergoes larval development, asexual fission, and complete bi-directional regeneration in the field and laboratory. In order to investigate to what extent embryonic patterning mechanisms are utilized during alternate developmental trajectories, we examined expression of developmental regulatory genes during regeneration and fission. When compared to previously reported embryonic expression patterns, we found that all genes displayed some level of expression consistent with embryogenesis. However, five of seven genes investigated also displayed striking differences in gene expression between one or more developmental trajectory. These results demonstrate that alternate developmental trajectories utilize distinct molecular mechanisms upstream of major developmental regulatory genes such as fox, otx, and Hox-like. PMID:19184098

  1. On a fourth order accurate implicit finite difference scheme for hyperbolic conservation laws. II - Five-point schemes

    NASA Technical Reports Server (NTRS)

    Harten, A.; Tal-Ezer, H.


    This paper presents a family of two-level five-point implicit schemes for the solution of one-dimensional systems of hyperbolic conservation laws, which generalized the Crank-Nicholson scheme to fourth order accuracy (4-4) in both time and space. These 4-4 schemes are nondissipative and unconditionally stable. Special attention is given to the system of linear equations associated with these 4-4 implicit schemes. The regularity of this system is analyzed and efficiency of solution-algorithms is examined. A two-datum representation of these 4-4 implicit schemes brings about a compactification of the stencil to three mesh points at each time-level. This compact two-datum representation is particularly useful in deriving boundary treatments. Numerical results are presented to illustrate some properties of the proposed scheme.

  2. On a fourth order accurate implicit finite difference scheme for hyperbolic conservation laws. I - Nonstiff strongly dynamic problems

    NASA Technical Reports Server (NTRS)

    Harten, A.; Tal-Ezer, H.


    An implicit finite difference method of fourth order accuracy in space and time is introduced for the numerical solution of one-dimensional systems of hyperbolic conservation laws. The basic form of the method is a two-level scheme which is unconditionally stable and nondissipative. The scheme uses only three mesh points at level t and three mesh points at level t + delta t. The dissipative version of the basic method given is conditionally stable under the CFL (Courant-Friedrichs-Lewy) condition. This version is particularly useful for the numerical solution of problems with strong but nonstiff dynamic features, where the CFL restriction is reasonable on accuracy grounds. Numerical results are provided to illustrate properties of the proposed method.

  3. Theory of Metastable State Relaxation for Non-Critical Binary Systems with Non-Conserved Order Parameter

    NASA Technical Reports Server (NTRS)

    Izmailov, Alexander; Myerson, Allan S.


    A new mathematical ansatz for a solution of the time-dependent Ginzburg-Landau non-linear partial differential equation is developed for non-critical systems such as non-critical binary solutions (solute + solvent) described by the non-conserved scalar order parameter. It is demonstrated that in such systems metastability initiates heterogeneous solute redistribution which results in formation of the non-equilibrium singly-periodic spatial solute structure. It is found how the time-dependent period of this structure evolves in time. In addition, the critical radius r(sub c) for solute embryo of the new solute rich phase together with the metastable state lifetime t(sub c) are determined analytically and analyzed.

  4. Co-conservation of rRNA tetraloop sequences and helix length suggests involvement of the tetraloops in higher-order interactions

    NASA Technical Reports Server (NTRS)

    Hedenstierna, K. O.; Siefert, J. L.; Fox, G. E.; Murgola, E. J.


    Terminal loops containing four nucleotides (tetraloops) are common in structural RNAs, and they frequently conform to one of three sequence motifs, GNRA, UNCG, or CUUG. Here we compare available sequences and secondary structures for rRNAs from bacteria, and we show that helices capped by phylogenetically conserved GNRA loops display a strong tendency to be of conserved length. The simplest interpretation of this correlation is that the conserved GNRA loops are involved in higher-order interactions, intramolecular or intermolecular, resulting in a selective pressure for maintaining the lengths of these helices. A small number of conserved UNCG loops were also found to be associated with conserved length helices, consistent with the possibility that this type of tetraloop also takes part in higher-order interactions.

  5. Higher-order structure of bovine mitochondrial tRNA(Phe) lacking the 'conserved' GG and T psi CG sequences as inferred by enzymatic and chemical probing.

    PubMed Central

    Wakita, K; Watanabe, Y; Yokogawa, T; Kumazawa, Y; Nakamura, S; Ueda, T; Watanabe, K; Nishikawa, K


    Bovine mitochondrial (mt) phenylalanine tRNA (tRNA(Phe)), which lacks the 'conserved' GG and T psi YCG sequences, was efficiently purified by the selective hybridization method using a solid phase DNA probe. The entire nucleotide sequence of the tRNA, including modified nucleotides, was determined and its higher-order structure was investigated using RNaseT2 and chemical reagents as structural probes. The D and T loop regions as well as the anticodon loop region were accessible to RNaseT2, and the N-3 positions of cytidines present in the D and T loops were easily modified under the native conditions in the presence of 10mM Mg2+. On the other hand, the nucleotides present in the extra loop were protected from the chemical modification under the native conditions. From the results of these probing analyses and a comparison of the sequences of mitochondrial tRNA(Phe) genes from various organisms, it was inferred that bovine mt tRNA(Phe) lacks the D loop/T loop tertiary interactions, but does have the canonical extra loop/D stem interactions, which seem to be the main factor for bovine mt tRNA(Phe) to preserve its L-shaped higher-order structure. Images PMID:7510390

  6. Conservation, Spillover and Gene Flow within a Network of Northern European Marine Protected Areas

    PubMed Central

    Huserbråten, Mats Brockstedt Olsen; Moland, Even; Knutsen, Halvor; Olsen, Esben Moland; André, Carl; Stenseth, Nils Chr.


    To ensure that marine protected areas (MPAs) benefit conservation and fisheries, the effectiveness of MPA designs has to be evaluated in field studies. Using an interdisciplinary approach, we empirically assessed the design of a network of northern MPAs where fishing for European lobster (Homarusgammarus) is prohibited. First, we demonstrate a high level of residency and survival (50%) for almost a year (363 days) within MPAs, despite small MPA sizes (0.5-1 km2). Second, we demonstrate limited export (4.7%) of lobsters tagged within MPAs (N = 1810) to neighbouring fished areas, over a median distance of 1.6 km out to maximum 21 km away from MPA centres. In comparison, median movement distance of lobsters recaptured within MPAs was 164 m, and recapture rate was high (40%). Third, we demonstrate a high level of gene flow within the study region, with an estimated FST of less than 0.0001 over a ≈ 400 km coastline. Thus, the restricted movement of older life stages, combined with a high level of gene flow suggests that connectivity is primarily driven by larval drift. Larval export from the MPAs can most likely affect areas far beyond their borders. Our findings are of high importance for the design of MPA networks for sedentary species with pelagic early life stages. PMID:24039927

  7. Conserved Senescence Associated Genes and Pathways in Primary Human Fibroblasts Detected by RNA-Seq.


    Marthandan, S; Baumgart, M; Priebe, S; Groth, M; Schaer, J; Kaether, C; Guthke, R; Cellerino, A; Platzer, M; Diekmann, S; Hemmerich, P


    Cellular senescence correlates with changes in the transcriptome. To obtain a complete view on senescence-associated transcription networks and pathways, we assessed by deep RNA sequencing the transcriptomes of five of the most commonly used laboratory strains of human fibroblasts during their transition into senescence. In a number of cases, we verified the RNA-seq data by real-time PCR. By determining cellular protein levels we observed that the age-related expression of most but not all genes is regulated at the transcriptional level. We found that 78% of the age-affected differentially expressed genes were commonly regulated in the same direction (either up- or down-regulated) in all five fibroblast strains, indicating a strong conservation of age-associated changes in the transcriptome. KEGG pathway analyses confirmed up-regulation of the senescence-associated secretory phenotype and down-regulation of DNA synthesis/repair and most cell cycle pathways common in all five cell strains. Newly identified senescence-induced pathways include up-regulation of endocytotic/phagocytic pathways and down-regulation of the mRNA metabolism and the mRNA splicing pathways. Our results provide an unprecedented comprehensive and deep view into the individual and common transcriptome and pathway changes during the transition into of senescence of five human fibroblast cell strains. PMID:27140416

  8. Conserved Senescence Associated Genes and Pathways in Primary Human Fibroblasts Detected by RNA-Seq

    PubMed Central

    Marthandan, S.; Baumgart, M.; Priebe, S.; Groth, M.; Schaer, J.; Kaether, C.; Guthke, R.; Cellerino, A.; Platzer, M.; Diekmann, S.; Hemmerich, P.


    Cellular senescence correlates with changes in the transcriptome. To obtain a complete view on senescence-associated transcription networks and pathways, we assessed by deep RNA sequencing the transcriptomes of five of the most commonly used laboratory strains of human fibroblasts during their transition into senescence. In a number of cases, we verified the RNA-seq data by real-time PCR. By determining cellular protein levels we observed that the age-related expression of most but not all genes is regulated at the transcriptional level. We found that 78% of the age-affected differentially expressed genes were commonly regulated in the same direction (either up- or down-regulated) in all five fibroblast strains, indicating a strong conservation of age-associated changes in the transcriptome. KEGG pathway analyses confirmed up-regulation of the senescence-associated secretory phenotype and down-regulation of DNA synthesis/repair and most cell cycle pathways common in all five cell strains. Newly identified senescence-induced pathways include up-regulation of endocytotic/phagocytic pathways and down-regulation of the mRNA metabolism and the mRNA splicing pathways. Our results provide an unprecedented comprehensive and deep view into the individual and common transcriptome and pathway changes during the transition into of senescence of five human fibroblast cell strains. PMID:27140416

  9. The current source of human Alu retroposons is a conserved gene shared with Old World monkey

    SciTech Connect

    Britten, R.J.; Stout, D.B.; Davidson, E.H. )


    A significant fraction of human Alu repeated sequences are members of the precise, recently inserted class. A cloned member of this class has been used as a probe for interspecies hybridization and thermal stability determination. The probe was reassociated with human, mandrill, and spider monkey DNA under conditions such that only almost perfectly matching duplexes could form. Equally precise hybrids were formed with human and mandrill DNA (Old World monkey) but not with spider monkey DNA (New World). These measurements as well as reassociation kinetics show the presence in mandrill DNA of many precise class Alu sequences that are very similar or identical in quantity and sequence to those in human DNA. Human and mandrill are moderately distant species with a single-copy DNA divergence of about 6%. Nevertheless, their recently inserted Alu sequences arise by retroposition of transcripts of source genes with nearly identical sequences. Apparently a gene present in our common ancestor at the time of branching was inherited and highly conserved in sequence in both the lineage of Old World monkeys and the lineage of apes and man.

  10. Nuclear reorganisation and chromatin decondensation are conserved, but distinct, mechanisms linked to Hox gene activation.


    Morey, Céline; Da Silva, Nelly R; Perry, Paul; Bickmore, Wendy A


    The relocalisation of some genes to positions outside chromosome territories, and the visible decondensation or unfolding of interphase chromatin, are two striking facets of nuclear reorganisation linked to gene activation that have been assumed to be related to each other. Here, in a study of nuclear reorganisation around the Hoxd cluster, we suggest that this may not be the case. Despite its very different genomic environment from Hoxb, Hoxd also loops out from its chromosome territory, and unfolds, upon activation in differentiating embryonic stem (ES) cells and in the tailbud of the embryo. However, looping out and decondensation are not simply two different manifestations of the same underlying change in chromatin structure. We show that, in the limb bud of the embryonic day 9.5 embryo, where Hoxd is also activated, there is visible decondensation of chromatin but no detectable movement of the region out from the chromosome territory. During ES cell differentiation, decondensed alleles can also be found inside of chromosome territories, and loci that have looped out of the territories can appear to still be condensed. We conclude that evolutionarily conserved chromosome remodelling mechanisms, predating the duplication of mammalian Hox loci, underlie Hox regulation along the rostrocaudal embryonic axis. However, we suggest that separate modes of regulation can modify Hoxd chromatin in different ways in different developmental contexts. PMID:17251268

  11. Conservation of structure in the human gene encoding argininosuccinate synthetase and the argG genes of the archaebacteria Methanosarcina barkeri MS and Methanococcus vannielii

    SciTech Connect

    Morris, C.J.; Reeve, J.N.


    The DNA sequences of the argG genes of Methanosarcina barkeri MS and Methanococcus vannielii were determined. The polypeptide products of these methanogen genes have amino acid sequences which are 50% identical to each other and 38% identical to the amino acid sequence encoded by the exons of the human argininosuccinate synthetase gene. Introns in the human chromosomal gene separate regions which encode amino acids conserved in both the archaebacterial and human gene products. An open reading frame immediately upstream of argG in Methanosarcina barkeri MS codes for an amino acid sequence which is 45 and 31% identical to the sequences of the large subunits of carbamyl phosphate synthetase in Escherichia coli and Saccharomyces cerevisiae, respectively. If this gene encodes carbamyl phosphate synthetase in Methanosarcina barkeri, this is the first example, in an archaebacterium, of physical linkage of genes that encode enzymes which catalyze reactions in the same amino acid biosynthetic pathway.

  12. SCNN1, an epithelial cell sodium channel gene in the conserved linkage group on mouse chromosome 6 and human chromosome 12

    SciTech Connect

    Meisler, M.H.; Barrow, L.L.; Canessa, C.M.


    SCNN1, a gene encoding a nonvoltage-gated sodium channel, was detected using a rat colon cDNA probe with homology to Caenorhabditis elegans degenerin genes. Human SCNN1 was assigned to chromosome 12 using the NIGMS hybrid mapping panel 2. Mouse SCNN1 was mapped to a conserved linkage group on distal chromosome 6. The observed order of mouse genes was centromere-Raf1-(2.1 {plus_minus} 2.1)Scnn1, Vwf-(1.9 {plus_minus} 1.9)-Ntf3, with 0/101 recombinants between Scnn1 and Vwf. No rearrangements of genomic DNA were detected in the linked mouse mutations deaf waddler (dfw) and opisthotonus (opt). 10 refs., 1 fig.

  13. Conservation of the Exon-Intron Structure of Long Intergenic Non-Coding RNA Genes in Eutherian Mammals.


    Chernikova, Diana; Managadze, David; Glazko, Galina V; Makalowski, Wojciech; Rogozin, Igor B


    The abundance of mammalian long intergenic non-coding RNA (lincRNA) genes is high, yet their functions remain largely unknown. One possible way to study this important question is to use large-scale comparisons of various characteristics of lincRNA with those of protein-coding genes for which a large body of functional information is available. A prominent feature of mammalian protein-coding genes is the high evolutionary conservation of the exon-intron structure. Comparative analysis of putative intron positions in lincRNA genes from various mammalian genomes suggests that some lincRNA introns have been conserved for over 100 million years, thus the primary and/or secondary structure of these molecules is likely to be functionally important. PMID:27429005

  14. Multiple Herbicide Resistance in Lolium multiflorum and Identification of Conserved Regulatory Elements of Herbicide Resistance Genes.


    Mahmood, Khalid; Mathiassen, Solvejg K; Kristensen, Michael; Kudsk, Per


    Herbicide resistance is a ubiquitous challenge to herbicide sustainability and a looming threat to control weeds in crops. Recently four genes were found constituently over-expressed in herbicide resistant individuals of Lolium rigidum, a close relative of Lolium multiflorum. These include two cytochrome P450s, one nitronate monooxygenase and one glycosyl-transferase. Higher expressions of these four herbicide metabolism related (HMR) genes were also observed after herbicides exposure in the gene expression databases, indicating them as reliable markers. In order to get an overview of herbicidal resistance status of L. multiflorum L, 19 field populations were collected. Among these populations, four populations were found to be resistant to acetolactate synthase (ALS) inhibitors while three exhibited resistance to acetyl-CoA carboxylase (ACCase) inhibitors in our initial screening and dose response study. The genotyping showed the presence of mutations Trp-574-Leu and Ile-2041-Asn in ALS and ACCase, respectively, and qPCR experiments revealed the enhanced expression of HMR genes in individuals of certain resistant populations. Moreover, co-expression networks and promoter analyses of HMR genes in O. sativa and A. thaliana resulted in the identification of a cis-regulatory motif and zinc finger transcription factors. The identified transcription factors were highly expressed similar to HMR genes in response to xenobiotics whereas the identified motif is known to play a vital role in coping with environmental stresses and maintaining genome stability. Overall, our findings provide an important step forward toward a better understanding of metabolism-based herbicide resistance that can be utilized to devise novel strategies of weed management. PMID:27547209

  15. Multiple Herbicide Resistance in Lolium multiflorum and Identification of Conserved Regulatory Elements of Herbicide Resistance Genes

    PubMed Central

    Mahmood, Khalid; Mathiassen, Solvejg K.; Kristensen, Michael; Kudsk, Per


    Herbicide resistance is a ubiquitous challenge to herbicide sustainability and a looming threat to control weeds in crops. Recently four genes were found constituently over-expressed in herbicide resistant individuals of Lolium rigidum, a close relative of Lolium multiflorum. These include two cytochrome P450s, one nitronate monooxygenase and one glycosyl-transferase. Higher expressions of these four herbicide metabolism related (HMR) genes were also observed after herbicides exposure in the gene expression databases, indicating them as reliable markers. In order to get an overview of herbicidal resistance status of L. multiflorum L, 19 field populations were collected. Among these populations, four populations were found to be resistant to acetolactate synthase (ALS) inhibitors while three exhibited resistance to acetyl-CoA carboxylase (ACCase) inhibitors in our initial screening and dose response study. The genotyping showed the presence of mutations Trp-574-Leu and Ile-2041-Asn in ALS and ACCase, respectively, and qPCR experiments revealed the enhanced expression of HMR genes in individuals of certain resistant populations. Moreover, co-expression networks and promoter analyses of HMR genes in O. sativa and A. thaliana resulted in the identification of a cis-regulatory motif and zinc finger transcription factors. The identified transcription factors were highly expressed similar to HMR genes in response to xenobiotics whereas the identified motif is known to play a vital role in coping with environmental stresses and maintaining genome stability. Overall, our findings provide an important step forward toward a better understanding of metabolism-based herbicide resistance that can be utilized to devise novel strategies of weed management. PMID:27547209

  16. Patterns of evolutionary conservation of ascorbic acid-related genes following whole-genome triplication in Brassica rapa.


    Duan, Weike; Song, Xiaoming; Liu, Tongkun; Huang, Zhinan; Ren, Jun; Hou, Xilin; Du, Jianchang; Li, Ying


    Ascorbic acid (AsA) is an important antioxidant in plants and an essential vitamin for humans. Extending the study of AsA-related genes from Arabidopsis thaliana to Brassica rapa could shed light on the evolution of AsA in plants and inform crop breeding. In this study, we conducted whole-genome annotation, molecular-evolution and gene-expression analyses of all known AsA-related genes in B. rapa. The nucleobase-ascorbate transporter (NAT) gene family and AsA l-galactose pathway genes were also compared among plant species. Four important insights gained are that: 1) 102 AsA-related gene were identified in B. rapa and they mainly diverged 12-18 Ma accompanied by the Brassica-specific genome triplication event; 2) during their evolution, these AsA-related genes were preferentially retained, consistent with the gene dosage hypothesis; 3) the putative proteins were highly conserved, but their expression patterns varied; and 4) although the number of AsA-related genes is higher in B. rapa than in A. thaliana, the AsA contents and the numbers of expressed genes in leaves of both species are similar, the genes that are not generally expressed may serve as substitutes during emergencies. In summary, this study provides genome-wide insights into evolutionary history and mechanisms of AsA-related genes following whole-genome triplication in B. rapa. PMID:25552535

  17. How developments in cryobiology, reproductive technologies and conservation genomics could shape gene banking strategies for (farm) animals.


    Woelders, H; Windig, J; Hiemstra, S J


    Many local breeds are currently at risk because of replacement by a limited number of specialized commercial breeds. Concurrently, for many breeds, allelic diversity within breeds declines because of inbreeding. Gene banking of germplasm may serve to secure the breeds and the alleles for any future use, for instance to recover a lost breed, to address new breeding goals, to support breeding schemes in small populations to minimize inbreeding, and for conservation genetics and genomics research. Developments in cryobiology and reproductive technology have generated several possibilities for preserving germplasm in farm animals. Furthermore, in some mammalian and bird species, gene banking of material is difficult or impossible, requiring development of new alternative methods or improvement of existing methods. Depending on the species, there are interesting possibilities or research developments in the use of epididymal spermatozoa, oocytes and embryos, ovarian and testicular tissue, primordial germ cells, and somatic cells for the conservation of genetic diversity in farm- and other animal species. Rapid developments in genomics research also provide new opportunities to optimize conservation and sampling strategies and to characterize genome-wide genetic variation. With regard to gene banks for farm animals, collaboration between European countries is being developed through a number of organizations, aimed at sharing knowledge and expertise between national programmes. It would be useful to explore further collaboration between countries, within the framework of a European gene banking strategy that should minimize costs of conservation and maximize opportunities for exploitation and sustainable use of genetic diversity. PMID:22827380

  18. An evolutionarily conserved gene, FUWA, plays a role in determining panicle architecture, grain shape and grain weight in rice.


    Chen, Jun; Gao, He; Zheng, Xiao-Ming; Jin, Mingna; Weng, Jian-Feng; Ma, Jin; Ren, Yulong; Zhou, Kunneng; Wang, Qi; Wang, Jie; Wang, Jiu-Lin; Zhang, Xin; Cheng, Zhijun; Wu, Chuanyin; Wang, Haiyang; Wan, Jian-Min


    Plant breeding relies on creation of novel allelic combinations for desired traits. Identification and utilization of beneficial alleles, rare alleles and evolutionarily conserved genes in the germplasm (referred to as 'hidden' genes) provide an effective approach to achieve this goal. Here we show that a chemically induced null mutation in an evolutionarily conserved gene, FUWA, alters multiple important agronomic traits in rice, including panicle architecture, grain shape and grain weight. FUWA encodes an NHL domain-containing protein, with preferential expression in the root meristem, shoot apical meristem and inflorescences, where it restricts excessive cell division. Sequence analysis revealed that FUWA has undergone a bottleneck effect, and become fixed in landraces and modern cultivars during domestication and breeding. We further confirm a highly conserved role of FUWA homologs in determining panicle architecture and grain development in rice, maize and sorghum through genetic transformation. Strikingly, knockdown of the FUWA transcription level by RNA interference results in an erect panicle and increased grain size in both indica and japonica genetic backgrounds. This study illustrates an approach to create new germplasm with improved agronomic traits for crop breeding by tapping into evolutionary conserved genes. PMID:26043067


    EPA Science Inventory

    The GRK4 subfamily of G protein-coupled receptor kinases. Alternative splicing, gene organization, and sequence conservation.

    Premont RT, Macrae AD, Aparicio SA, Kendall HE, Welch JE, Lefkowitz RJ.

    Department of Medicine, Howard Hughes Medical Institute, Duke Univer...

  20. A conserved splicing mechanism of the LMNA gene controls premature aging.


    Lopez-Mejia, Isabel C; Vautrot, Valentin; De Toledo, Marion; Behm-Ansmant, Isabelle; Bourgeois, Cyril F; Navarro, Claire L; Osorio, Fernando G; Freije, José M P; Stévenin, James; De Sandre-Giovannoli, Annachiara; Lopez-Otin, Carlos; Lévy, Nicolas; Branlant, Christiane; Tazi, Jamal


    Hutchinson-Gilford progeria syndrome (HGPS) is a rare genetic disorder phenotypically characterized by many features of premature aging. Most cases of HGPS are due to a heterozygous silent mutation (c.1824C>T; p.Gly608Gly) that enhances the use of an internal 5' splice site (5'SS) in exon 11 of the LMNA pre-mRNA and leads to the production of a truncated protein (progerin) with a dominant negative effect. Here we show that HGPS mutation changes the accessibility of the 5'SS of LMNA exon 11 which is sequestered in a conserved RNA structure. Our results also reveal a regulatory role of a subset of serine-arginine (SR)-rich proteins, including serine-arginine rich splicing factor 1 (SRSF1) and SRSF6, on utilization of the 5'SS leading to lamin A or progerin production and a modulation of this regulation in the presence of the c.1824C>T mutation is shown directly on HGPS patient cells. Mutant mice carrying the equivalent mutation in the LMNA gene (c.1827C>T) also accumulate progerin and phenocopy the main cellular alterations and clinical defects of HGPS patients. RNAi-induced depletion of SRSF1 in the HGPS-like mouse embryonic fibroblasts (MEFs) allowed progerin reduction and dysmorphic nuclei phenotype correction, whereas SRSF6 depletion aggravated the HGPS-like MEF's phenotype. We demonstrate that changes in the splicing ratio between lamin A and progerin are key factors for lifespan since heterozygous mice harboring the mutation lived longer than homozygous littermates but less than the wild-type. Genetic and biochemical data together favor the view that physiological progerin production is under tight control of a conserved splicing mechanism to avoid precocious aging. PMID:21875900

  1. A Functionally Conserved Gene Regulatory Network Module Governing Olfactory Neuron Diversity.


    Li, Qingyun; Barish, Scott; Okuwa, Sumie; Maciejewski, Abigail; Brandt, Alicia T; Reinhold, Dominik; Jones, Corbin D; Volkan, Pelin Cayirlioglu


    Sensory neuron diversity is required for organisms to decipher complex environmental cues. In Drosophila, the olfactory environment is detected by 50 different olfactory receptor neuron (ORN) classes that are clustered in combinations within distinct sensilla subtypes. Each sensilla subtype houses stereotypically clustered 1-4 ORN identities that arise through asymmetric divisions from a single multipotent sensory organ precursor (SOP). How each class of SOPs acquires a unique differentiation potential that accounts for ORN diversity is unknown. Previously, we reported a critical component of SOP diversification program, Rotund (Rn), increases ORN diversity by generating novel developmental trajectories from existing precursors within each independent sensilla type lineages. Here, we show that Rn, along with BarH1/H2 (Bar), Bric-à-brac (Bab), Apterous (Ap) and Dachshund (Dac), constitutes a transcription factor (TF) network that patterns the developing olfactory tissue. This network was previously shown to pattern the segmentation of the leg, which suggests that this network is functionally conserved. In antennal imaginal discs, precursors with diverse ORN differentiation potentials are selected from concentric rings defined by unique combinations of these TFs along the proximodistal axis of the developing antennal disc. The combinatorial code that demarcates each precursor field is set up by cross-regulatory interactions among different factors within the network. Modifications of this network lead to predictable changes in the diversity of sensilla subtypes and ORN pools. In light of our data, we propose a molecular map that defines each unique SOP fate. Our results highlight the importance of the early prepatterning gene regulatory network as a modulator of SOP and terminally differentiated ORN diversity. Finally, our model illustrates how conserved developmental strategies are used to generate neuronal diversity. PMID:26765103

  2. A Functionally Conserved Gene Regulatory Network Module Governing Olfactory Neuron Diversity

    PubMed Central

    Okuwa, Sumie; Maciejewski, Abigail; Brandt, Alicia T.; Reinhold, Dominik; Jones, Corbin D.; Volkan, Pelin Cayirlioglu


    Sensory neuron diversity is required for organisms to decipher complex environmental cues. In Drosophila, the olfactory environment is detected by 50 different olfactory receptor neuron (ORN) classes that are clustered in combinations within distinct sensilla subtypes. Each sensilla subtype houses stereotypically clustered 1–4 ORN identities that arise through asymmetric divisions from a single multipotent sensory organ precursor (SOP). How each class of SOPs acquires a unique differentiation potential that accounts for ORN diversity is unknown. Previously, we reported a critical component of SOP diversification program, Rotund (Rn), increases ORN diversity by generating novel developmental trajectories from existing precursors within each independent sensilla type lineages. Here, we show that Rn, along with BarH1/H2 (Bar), Bric-à-brac (Bab), Apterous (Ap) and Dachshund (Dac), constitutes a transcription factor (TF) network that patterns the developing olfactory tissue. This network was previously shown to pattern the segmentation of the leg, which suggests that this network is functionally conserved. In antennal imaginal discs, precursors with diverse ORN differentiation potentials are selected from concentric rings defined by unique combinations of these TFs along the proximodistal axis of the developing antennal disc. The combinatorial code that demarcates each precursor field is set up by cross-regulatory interactions among different factors within the network. Modifications of this network lead to predictable changes in the diversity of sensilla subtypes and ORN pools. In light of our data, we propose a molecular map that defines each unique SOP fate. Our results highlight the importance of the early prepatterning gene regulatory network as a modulator of SOP and terminally differentiated ORN diversity. Finally, our model illustrates how conserved developmental strategies are used to generate neuronal diversity. PMID:26765103

  3. Isolation and characterization of the human aldehyde oxidase gene: conservation of intron/exon boundaries with the xanthine oxidoreductase gene indicates a common origin.

    PubMed Central

    Terao, M; Kurosaki, M; Demontis, S; Zanotta, S; Garattini, E


    Aldehyde oxidase (AO) is a molybdo-flavo enzyme involved in the metabolism of various endogenous and exogenous N-heterocyclic compounds of pharmacological and toxicological importance. The enzyme is the product of a gene which is implicated in the aetio-pathogenesis of familial recessive amyotrophic lateral sclerosis. Here, we report the cloning and structural characterization of the human AO gene. AO is a single copy gene approximately 85 kb long with 35 transcribed exons. The transcription-initiation site and the sequence of the 5'-flanking region, containing several putative regulatory elements, were determined. The 5'-flanking region contains a functional promoter, as assessed by appropriate reporter constructs in transient transfection experiments. Comparison of the AO gene structure shows conservation of the position and type of exon/intron junctions relative to those observed in the gene coding for another molybdo-flavoprotein, i.e. xanthine oxidoreductase (XOR). As the two genes code for proteins with a high level of amino acid identity, our results strongly suggest that the AO and XOR genetic loci arose as the consequence of a duplication event. Southern blot analysis conducted on genomic DNA from various animal species with specific cDNA probes indicates that the AO gene is less conserved than the XOR gene during evolution. PMID:9601067

  4. Comparative Analysis of Pistil Transcriptomes Reveals Conserved and Novel Genes Expressed in Dry, Wet, and Semidry Stigmas1[W

    PubMed Central

    Allen, Alexandra M.; Lexer, Christian; Hiscock, Simon J.


    Fertilization in angiosperms depends on a complex cellular “courtship” between haploid pollen and diploid pistil. These pollen-pistil interactions are regulated by a diversity of molecules, many of which remain to be identified and characterized. Thus, it is unclear to what extent these processes are conserved among angiosperms, a fact confounded by limited sampling across taxa. Here, we report the analysis of pistil-expressed genes in Senecio squalidus (Asteraceae), a species from euasterid II, a major clade for which there are currently no data on pistil-expressed genes. Species from the Asteraceae characteristically have a “semidry stigma,” intermediate between the “wet” and “dry” stigmas typical of the majority of angiosperms. Construction of pistil-enriched cDNA libraries for S. squalidus allowed us to address two hypotheses: (1) stigmas of S. squalidus will express genes common to wet and dry stigmas and genes specific to the semidry stigma characteristic of the Asteraceae; and (2) genes potentially essential for pistil function will be conserved between diverse angiosperm groups and therefore common to all currently available pistil transcriptome data sets, including S. squalidus. Our data support both these hypotheses. The S. squalidus pistil transcriptome contains novel genes and genes previously identified in pistils of species with dry stigmas and wet stigmas. Comparative analysis of the five pistil transcriptomes currently available (Oryza sativa, Crocus sativus, Arabidopsis thaliana, Nicotiana tabacum, and S. squalidus), representing four major angiosperm clades and the three stigma states, identified novel genes and conserved genes potentially regulating pollen-pistil interaction pathways common to monocots and eudicots. PMID:20813907

  5. GPSy: a cross-species gene prioritization system for conserved biological processes—application in male gamete development

    PubMed Central

    Britto, Ramona; Sallou, Olivier; Collin, Olivier; Michaux, Grégoire; Primig, Michael; Chalmel, Frédéric


    We present gene prioritization system (GPSy), a cross-species gene prioritization system that facilitates the arduous but critical task of prioritizing genes for follow-up functional analyses. GPSy’s modular design with regard to species, data sets and scoring strategies enables users to formulate queries in a highly flexible manner. Currently, the system encompasses 20 topics related to conserved biological processes including male gamete development discussed in this article. The web server-based tool is freely available at PMID:22570409

  6. Complete structural organization of the human {alpha}1(V) collagen gene (COL5A1): Divergence from the conserved organization of other characterized fibrillar collagen genes

    SciTech Connect

    Takahara, Kazuhiko; Hoffman, G.G.; Greenspan, D.S.


    Genes that encode the vertebrate fibrillar collagen types I-III have previously been shown to share a highly conserved intron/exon organization, thought to reflect common ancestry and evolutionary pressures at the protein level. We report here the complete intron/exon organization of COL5A1, the human gene that encodes the {alpha}1 chain of fibrillar collagen type V. The structure of COL5A1 is shown to be considerably diverged from the conserved structure of the genes for fibrillar collagen types I-III. COL5A1 has 66 exons, which is greater than the number of exons found in the genes for collagen types I-III. The increased number of exons is partly due to the increased size of the pro-{alpha}1(V) N-propeptide, relative to the sizes of the N-propeptides of the types I-III procollagen molecules. In addition, however, the increased number of exons is due to differences in the intron/exon organization of the triple-helix coding region of COL5A1 compared to the organization of the triple-helix coding regions of the genes for collagen types I-III. Of particular interest is the increase of 54 bp exons in this region of COL5A1, strongly supporting the proposal that the triple-helix coding regions of fibrillar collagen genes evolved from duplication of a 54 bp primordial genetic element. Moreover, comparison of the structure of COL5A1 to the highly conserved structure of the genes of collagen types I-III provides insights into the probable structure of the ancestral gene that gave rise to what appears to be two classes of vertebrate fibrillar collagen genes. 50 refs., 5 figs.

  7. SMARCA4 regulates gene expression and higher-order chromatin structure in proliferating mammary epithelial cells.


    Barutcu, A Rasim; Lajoie, Bryan R; Fritz, Andrew J; McCord, Rachel P; Nickerson, Jeffrey A; van Wijnen, Andre J; Lian, Jane B; Stein, Janet L; Dekker, Job; Stein, Gary S; Imbalzano, Anthony N


    The packaging of DNA into chromatin plays an important role in transcriptional regulation and nuclear processes. Brahma-related gene-1 SMARCA4 (also known as BRG1), the essential ATPase subunit of the mammalian SWI/SNF chromatin remodeling complex, uses the energy from ATP hydrolysis to disrupt nucleosomes at target regions. Although the transcriptional role of SMARCA4 at gene promoters is well-studied, less is known about its role in higher-order genome organization. SMARCA4 knockdown in human mammary epithelial MCF-10A cells resulted in 176 up-regulated genes, including many related to lipid and calcium metabolism, and 1292 down-regulated genes, some of which encode extracellular matrix (ECM) components that can exert mechanical forces and affect nuclear structure. ChIP-seq analysis of SMARCA4 localization and SMARCA4-bound super-enhancers demonstrated extensive binding at intergenic regions. Furthermore, Hi-C analysis showed extensive SMARCA4-mediated alterations in higher-order genome organization at multiple resolutions. First, SMARCA4 knockdown resulted in clustering of intra- and inter-subtelomeric regions, demonstrating a novel role for SMARCA4 in telomere organization. SMARCA4 binding was enriched at topologically associating domain (TAD) boundaries, and SMARCA4 knockdown resulted in weakening of TAD boundary strength. Taken together, these findings provide a dynamic view of SMARCA4-dependent changes in higher-order chromatin organization and gene expression, identifying SMARCA4 as a novel component of chromatin organization. PMID:27435934

  8. Variable Gene Dispersal Conditions and Spatial Deforestation Patterns Can Interact to Affect Tropical Tree Conservation Outcomes

    PubMed Central

    Kashimshetty, Yamini; Pelikan, Stephan; Rogstad, Steven H.


    Tropical lowland rain forest (TLRF) biodiversity is under threat from anthropogenic factors including deforestation which creates forest fragments of different sizes that can further undergo various internal patterns of logging. Such interventions can modify previous equilibrium abundance and spatial distribution patterns of offspring recruitment and/or pollen dispersal. Little is known about how these aspects of deforestation and fragmentation might synergistically affect TLRF tree recovery demographics and population genetics in newly formed forest fragments. To investigate these TLRF anthropogenic disturbance processes we used the computer program NEWGARDEN (NG), which models spatially-explicit, individual-based plant populations, to simulate 10% deforestation in six different spatial logging patterns for the plant functional type of a long-lived TLRF canopy tree species. Further, each logging pattern was analyzed under nine varying patterns of offspring versus pollen dispersal distances that could have arisen post-fragmentation. Results indicated that gene dispersal condition (especially via offspring) had a greater effect on population growth and genetic diversity retention (explaining 98.5% and 88.8% of the variance respectively) than spatial logging pattern (0.2% and 4.7% respectively), with ‘Near’ distance dispersal maximizing population growth and genetic diversity relative to distant dispersal. Within logged regions of the fragment, deforestation patterns closer to fragment borders more often exhibited lower population recovery rates and founding genetic diversity retention relative to more centrally located logging. These results suggest newly isolated fragments have populations that are more sensitive to the way in which their offspring and pollen dispersers are affected than the spatial pattern in which subsequent logging occurs, and that large variation in the recovery rates of different TLRF tree species attributable to altered gene dispersal

  9. Genome engineering uncovers 54 evolutionarily conserved and testis-enriched genes that are not required for male fertility in mice.


    Miyata, Haruhiko; Castaneda, Julio M; Fujihara, Yoshitaka; Yu, Zhifeng; Archambeault, Denise R; Isotani, Ayako; Kiyozumi, Daiji; Kriseman, Maya L; Mashiko, Daisuke; Matsumura, Takafumi; Matzuk, Ryan M; Mori, Masashi; Noda, Taichi; Oji, Asami; Okabe, Masaru; Prunskaite-Hyyrylainen, Renata; Ramirez-Solis, Ramiro; Satouh, Yuhkoh; Zhang, Qian; Ikawa, Masahito; Matzuk, Martin M


    Gene-expression analysis studies from Schultz et al. estimate that more than 2,300 genes in the mouse genome are expressed predominantly in the male germ line. As of their 2003 publication [Schultz N, Hamra FK, Garbers DL (2003) Proc Natl Acad Sci USA 100(21):12201-12206], the functions of the majority of these testis-enriched genes during spermatogenesis and fertilization were largely unknown. Since the study by Schultz et al., functional analysis of hundreds of reproductive-tract-enriched genes have been performed, but there remain many testis-enriched genes for which their relevance to reproduction remain unexplored or unreported. Historically, a gene knockout is the "gold standard" to determine whether a gene's function is essential in vivo. Although knockout mice without apparent phenotypes are rarely published, these knockout mouse lines and their phenotypic information need to be shared to prevent redundant experiments. Herein, we used bioinformatic and experimental approaches to uncover mouse testis-enriched genes that are evolutionarily conserved in humans. We then used gene-disruption approaches, including Knockout Mouse Project resources (targeting vectors and mice) and CRISPR/Cas9, to mutate and quickly analyze the fertility of these mutant mice. We discovered that 54 mutant mouse lines were fertile. Thus, despite evolutionary conservation of these genes in vertebrates and in some cases in all eukaryotes, our results indicate that these genes are not individually essential for male mouse fertility. Our phenotypic data are highly relevant in this fiscally tight funding period and postgenomic age when large numbers of genomes are being analyzed for disease association, and will prevent unnecessary expenditures and duplications of effort by others. PMID:27357688

  10. Novel parasitic nematode-specific protein of bovine filarial parasite Setaria digitata displays conserved gene structure and ubiquitous expression.


    Rodrigo, W W; Dassanayake, R S; Weerasena, S J; Silva Gunawardene, Y I


    Setaria digitata is an animal filarial parasite, which can cause fatal diseases to livestock such as cattle, sheep, goat, buffaloes, horses etc. inflicting considerable economic losses to livelihood of livestock farmers. In spite of this, the biology and parasitic nature of this organism is largely unknown. As a step towards understanding these, we screened the cDNA library of S. digitata and identified an open reading frame that code for parasitic nematode-specific protein, which showed a significant homology to functionally and structurally unannotated sequences of parasitic nematodes Wuchereria bancrofti, Brugia malayi, Onchocerca volvulus, Loa loa etc., suggesting its role in parasitism. RT-PCR analysis indicated that the S. digitata novel gene (SDNP) is expressed in adult female and male, and microfilariae. Southern hybridization studies revealed that this gene is a single-copy gene. Sequence analysis of the genomic region obtained from overlapping PCR amplification indicated that the size of the genomic region is 1819 bp in which four exons encoding 205 amino acids were interrupted by three introns of varying lengths of 419, 659 and 123 bp, and also the expansion of the size of the introns of S. digitata compared to its orthologues by integrating micro and mini-satellite containing sequence. Sequences around the splice junctions were conserved and agreed with the general GT-AG splicing rule. The gene was found to be AT rich with a GC content of 38.1%. Bioinformatic analysis indicated that the gene structure of SDNP and its orthologues is conserved and it expressed ubiqutously in all the stages of nematode's life cycle. Therefore, taking these outcomes together, it can be concluded that SDNP is a parasitic nematode-specific, single copy gene having conserved gene structure of four exons interrupted by three introns and that the gene is expressed ubiquitously throughout nematode's life cycle. PMID:25382479

  11. Integrating bioinformatic resources to predict transcription factors interacting with cis-sequences conserved in co-regulated genes

    PubMed Central


    Background Using motif detection programs it is fairly straightforward to identify conserved cis-sequences in promoters of co-regulated genes. In contrast, the identification of the transcription factors (TFs) interacting with these cis-sequences is much more elaborate. To facilitate this, we explore the possibility of using several bioinformatic and experimental approaches for TF identification. This starts with the selection of co-regulated gene sets and leads first to the prediction and then to the experimental validation of TFs interacting with cis-sequences conserved in the promoters of these co-regulated genes. Results Using the PathoPlant database, 32 up-regulated gene groups were identified with microarray data for drought-responsive gene expression from Arabidopsis thaliana. Application of the binding site estimation suite of tools (BEST) discovered 179 conserved sequence motifs within the corresponding promoters. Using the STAMP web-server, 49 sequence motifs were classified into 7 motif families for which similarities with known cis-regulatory sequences were identified. All motifs were subjected to a footprintDB analysis to predict interacting DNA binding domains from plant TF families. Predictions were confirmed by using a yeast-one-hybrid approach to select interacting TFs belonging to the predicted TF families. TF-DNA interactions were further experimentally validated in yeast and with a Physcomitrella patens transient expression system, leading to the discovery of several novel TF-DNA interactions. Conclusions The present work demonstrates the successful integration of several bioinformatic resources with experimental approaches to predict and validate TFs interacting with conserved sequence motifs in co-regulated genes. PMID:24773781

  12. Maximal Expression of the Evolutionarily Conserved Slit2 Gene Promoter Requires Sp1.


    Saunders, Jacquelyn; Wisidagama, D Roonalika; Morford, Travis; Malone, Cindy S


    Slit2 is a neural axon guidance and chemorepellent protein that stimulates motility in a variety of cell types. The role of Slit2 in neural development and neoplastic growth and migration has been well established, while the genetic mechanisms underlying regulation of the Slit2 gene have not. We identified the core and proximal promoter of Slit2 by mapping multiple transcriptional start sites, analyzing transcriptional activity, and confirming sequence homology for the Slit2 proximal promoter among a number of species. Deletion series and transient transfection identified the Slit2 proximal promoter as within 399 base pairs upstream of the start of transcription. A crucial region for full expression of the Slit2 proximal promoter lies between 399 base pairs and 296 base pairs upstream of the start of transcription. Computer modeling identified three transcription factor-binding consensus sites within this region, of which only site-directed mutagenesis of one of the two identified Sp1 consensus sites inhibited transcriptional activity of the Slit2 proximal promoter (-399 to +253). Bioinformatics analysis of the Slit2 proximal promoter -399 base pair to -296 base pair region shows high sequence conservation over twenty-two species, and that this region follows an expected pattern of sequence divergence through evolution. PMID:26456684

  13. Conserved requirement for EGF–CFC genes in vertebrate left–right axis formation

    PubMed Central

    Yan, Yu-Ting; Gritsman, Kira; Ding, Jixiang; Burdine, Rebecca D.; Corrales, JoMichelle D.; Price, Sandy M.; Talbot, William S.; Schier, Alexander F.; Shen, Michael M.


    Specification of the left–right (L-R) axis in the vertebrate embryo requires transfer of positional information from the node to the periphery, resulting in asymmetric gene expression in the lateral plate mesoderm. We show that this activation of L-R lateral asymmetry requires the evolutionarily conserved activity of members of the EGF–CFC family of extracellular factors. Targeted disruption of murine Cryptic results in L-R laterality defects including randomization of abdominal situs, hyposplenia, and pulmonary right isomerism, as well as randomized embryo turning and cardiac looping. Similarly, zebrafish one-eyed pinhead (oep) mutants that have been rescued partially by mRNA injection display heterotaxia, including randomization of heart looping and pancreas location. In both Cryptic and oep mutant embryos, L-R asymmetric expression of Nodal/cyclops, Lefty2/antivin, and Pitx2 does not occur in the lateral plate mesoderm, while in Cryptic mutants Lefty1 expression is absent from the prospective floor plate. Notably, L-R asymmetric expression of Nodal at the lateral edges of the node is still observed in Cryptic mutants, indicating that L-R specification has occurred in the node but not the lateral plate. Combined with the previous finding that oep is required for nodal signaling in zebrafish, we propose that a signaling pathway mediated by Nodal and EGF–CFC activities is essential for transfer of L-R positional information from the node. PMID:10521397

  14. The UVS9 gene of Chlamydomonas encodes an XPG homolog with a new conserved domain.


    Deitsch, Erin; Hibbard, Erin M; Petersen, Jason L


    Nucleotide excision repair (NER) is a key pathway for removing DNA damage that destabilizes the DNA double helix. During NER a protein complex coordinates to cleave the damaged DNA strand on both sides of the damage. The resulting lesion-containing oligonucleotide is displaced from the DNA and a replacement strand is synthesized using the undamaged strand as template. Ultraviolet (UV) light is known to induce two primary forms of DNA damage, the cyclobutane pyrimidine dimer and the 6-4 photoproduct, both of which destabilize the DNA double helix. The uvs9 strain of Chlamydomonas reinhardtii was isolated based on its sensitivity to UV light and was subsequently shown to have a defect in NER. In this work, the UVS9 gene was cloned through molecular mapping and shown to encode a homolog of XPG, the structure-specific nuclease responsible for cleaving damaged DNA strands 3' to sites of damage during NER. 3' RACE revealed that the UVS9 transcript is alternatively polyadenylated. The predicted UVS9 protein is nearly twice as long as other XPG homologs, primarily due to an unusually long spacer region. Despite this difference, amino acid sequence alignment of UVS9p with XPG homologs revealed a new conserved domain involved in TFIIH interaction. PMID:26658142

  15. Dose-sensitivity, conserved non-coding sequences, and duplicate gene retention through multiple tetraploidies in the grasses.


    Schnable, James C; Pedersen, Brent S; Subramaniam, Sabarinath; Freeling, Michael


    Whole genome duplications, or tetraploidies, are an important source of increased gene content. Following whole genome duplication, duplicate copies of many genes are lost from the genome. This loss of genes is biased both in the classes of genes deleted and the subgenome from which they are lost. Many or all classes are genes preferentially retained as duplicate copies are engaged in dose sensitive protein-protein interactions, such that deletion of any one duplicate upsets the status quo of subunit concentrations, and presumably lowers fitness as a result. Transcription factors are also preferentially retained following every whole genome duplications studied. This has been explained as a consequence of protein-protein interactions, just as for other highly retained classes of genes. We show that the quantity of conserved noncoding sequences (CNSs) associated with genes predicts the likelihood of their retention as duplicate pairs following whole genome duplication. As many CNSs likely represent binding sites for transcriptional regulators, we propose that the likelihood of gene retention following tetraploidy may also be influenced by dose-sensitive protein-DNA interactions between the regulatory regions of CNS-rich genes - nicknamed bigfoot genes - and the proteins that bind to them. Using grass genomes, we show that differential loss of CNSs from one member of a pair following the pre-grass tetraploidy reduces its chance of retention in the subsequent maize lineage tetraploidy. PMID:22645525

  16. Dose–Sensitivity, Conserved Non-Coding Sequences, and Duplicate Gene Retention Through Multiple Tetraploidies in the Grasses

    PubMed Central

    Schnable, James C.; Pedersen, Brent S.; Subramaniam, Sabarinath; Freeling, Michael


    Whole genome duplications, or tetraploidies, are an important source of increased gene content. Following whole genome duplication, duplicate copies of many genes are lost from the genome. This loss of genes is biased both in the classes of genes deleted and the subgenome from which they are lost. Many or all classes are genes preferentially retained as duplicate copies are engaged in dose sensitive protein–protein interactions, such that deletion of any one duplicate upsets the status quo of subunit concentrations, and presumably lowers fitness as a result. Transcription factors are also preferentially retained following every whole genome duplications studied. This has been explained as a consequence of protein–protein interactions, just as for other highly retained classes of genes. We show that the quantity of conserved noncoding sequences (CNSs) associated with genes predicts the likelihood of their retention as duplicate pairs following whole genome duplication. As many CNSs likely represent binding sites for transcriptional regulators, we propose that the likelihood of gene retention following tetraploidy may also be influenced by dose–sensitive protein–DNA interactions between the regulatory regions of CNS-rich genes – nicknamed bigfoot genes – and the proteins that bind to them. Using grass genomes, we show that differential loss of CNSs from one member of a pair following the pre-grass tetraploidy reduces its chance of retention in the subsequent maize lineage tetraploidy. PMID:22645525

  17. The pseudogenes of Mycobacterium leprae reveal the functional relevance of gene order within operons.


    Muro, Enrique M; Mah, Nancy; Moreno-Hagelsieb, Gabriel; Andrade-Navarro, Miguel A


    Almost 50 years following the discovery of the prokaryotic operon, the functional relevance of gene order within operons remains unclear. In this work, we take advantage of the eroded genome of Mycobacterium leprae to add evidence supporting the notion that functionally less important genes have a tendency to be located at the end of its operons. M. leprae's genome includes 1133 pseudogenes and 1614 protein-coding genes and can be compared with the close genome of M. tuberculosis. Assuming M. leprae's pseudogenes to represent dispensable genes, we have studied the position of these pseudogenes in the operons of M. leprae and of their orthologs in M. tuberculosis. We observed that both tend to be located in the 3' (downstream) half of the operon (P-values of 0.03 and 0.18, respectively). Analysis of pseudogenes in all available prokaryotic genomes confirms this trend (P-value of 7.1 × 10(-7)). In a complementary analysis, we found a significant tendency for essential genes to be located at the 5' (upstream) half of the operon (P-value of 0.006). Our work provides an indication that, in prokarya, functionally less important genes have a tendency to be located at the end of operons, while more relevant genes tend to be located toward operon starts. PMID:21051341

  18. The pseudogenes of Mycobacterium leprae reveal the functional relevance of gene order within operons

    PubMed Central

    Muro, Enrique M.; Mah, Nancy; Moreno-Hagelsieb, Gabriel; Andrade-Navarro, Miguel A.


    Almost 50 years following the discovery of the prokaryotic operon, the functional relevance of gene order within operons remains unclear. In this work, we take advantage of the eroded genome of Mycobacterium leprae to add evidence supporting the notion that functionally less important genes have a tendency to be located at the end of its operons. M. leprae’s genome includes 1133 pseudogenes and 1614 protein-coding genes and can be compared with the close genome of M. tuberculosis. Assuming M. leprae’s pseudogenes to represent dispensable genes, we have studied the position of these pseudogenes in the operons of M. leprae and of their orthologs in M. tuberculosis. We observed that both tend to be located in the 3′ (downstream) half of the operon (P-values of 0.03 and 0.18, respectively). Analysis of pseudogenes in all available prokaryotic genomes confirms this trend (P-value of 7.1 × 10−7). In a complementary analysis, we found a significant tendency for essential genes to be located at the 5′ (upstream) half of the operon (P-value of 0.006). Our work provides an indication that, in prokarya, functionally less important genes have a tendency to be located at the end of operons, while more relevant genes tend to be located toward operon starts. PMID:21051341

  19. Conservation of the gene for outer membrane protein OprF in the family Pseudomonadaceae: sequence of the Pseudomonas syringae oprF gene.

    PubMed Central

    Ullstrom, C A; Siehnel, R; Woodruff, W; Steinbach, S; Hancock, R E


    The conservation of the oprF gene for the major outer membrane protein OprF was determined by restriction mapping and Southern blot hybridization with the Pseudomonas aeruginosa oprF gene as a probe. The restriction map was highly conserved among 16 of the 17 serotype strains and 42 clinical isolates of P. aeruginosa. Only the serotype 12 isolate and one clinical isolate showed small differences in restriction pattern. Southern probing of PstI chromosomal digests of 14 species from the family Pseudomonadaceae revealed that only the nine members of rRNA homology group I hybridized with the oprF gene. To reveal the actual extent of homology, the oprF gene and its product were characterized in Pseudomonas syringae. Nine strains of P. syringae from seven different pathovars hybridized with the P. aeruginosa gene to produce five different but related restriction maps. All produced an OprF protein in their outer membranes with the same apparent molecular weight as that of P.aeruginosa OprF. In each case the protein reacted with monoclonal antibody MA4-10 and was similarly heat and 2-mercaptoethanol modifiable. The purified OprF protein of the type strain P. syringae pv. syringae ATCC 19310 reconstituted small channels in lipid bilayer membranes. The oprF gene from this latter strain was cloned and sequenced. Despite the low level of DNA hybridization between P. aeruginosa and P. syringae DNA, the OprF gene was highly conserved between the species with 72% DNA sequence identity and 68% amino acid sequence identity overall. The carboxy terminus-encoding region of P. syringae oprF showed 85 and 33% identity, respectively, with the same regions of the P. aeruginosa oprF and Escherichia coli ompA genes. Images PMID:1898935

  20. Conservation and Expression Patterns Divergence of Ascorbic Acid d-mannose/l-galactose Pathway Genes in Brassica rapa.


    Duan, Weike; Ren, Jun; Li, Yan; Liu, Tongkun; Song, Xiaoming; Chen, Zhongwen; Huang, Zhinan; Hou, Xilin; Li, Ying


    Ascorbic acid (AsA) participates in diverse biological processes, is regulated by multiple factors and is a potent antioxidant and cellular reductant. The D-Mannose/L-Galactose pathway is a major plant AsA biosynthetic pathway that is highly connected within biosynthetic networks, and generally conserved across plants. Previous work has shown that, although most genes of this pathway are expressed under standard growth conditions in Brassica rapa, some paralogs of these genes are not. We hypothesize that regulatory evolution in duplicate AsA pathway genes has occurred as an adaptation to environmental stressors, and that gene retention has been influenced by polyploidation events in Brassicas. To test these hypotheses, we explored the conservation of these genes in Brassicas and their expression patterns divergence in B. rapa. Similar retention and a high degree of gene sequence similarity were identified in B. rapa (A genome), B. oleracea (C genome) and B. napus (AC genome). However, the number of genes that encode the same type of enzymes varied among the three plant species. With the exception of GMP, which has nine genes, there were one to four genes that encoded the other enzymes. Moreover, we found that expression patterns divergence widely exists among these genes. (i) VTC2 and VTC5 are paralogous genes, but only VTC5 is influenced by FLC. (ii) Under light treatment, PMI1 co-regulates the AsA pool size with other D-Man/L-Gal pathway genes, whereas PMI2 is regulated only by darkness. (iii) Under NaCl, Cu(2+), MeJA and wounding stresses, most of the paralogs exhibit different expression patterns. Additionally, GME and GPP are the key regulatory enzymes that limit AsA biosynthesis in response to these treatments. In conclusion, our data support that the conservative and divergent expression patterns of D-Man/L-Gal pathway genes not only avoid AsA biosynthesis network instability but also allow B. rapa to better adapt to complex environments. PMID:27313597

  1. Conservation and Expression Patterns Divergence of Ascorbic Acid d-mannose/l-galactose Pathway Genes in Brassica rapa

    PubMed Central

    Duan, Weike; Ren, Jun; Li, Yan; Liu, Tongkun; Song, Xiaoming; Chen, Zhongwen; Huang, Zhinan; Hou, Xilin; Li, Ying


    Ascorbic acid (AsA) participates in diverse biological processes, is regulated by multiple factors and is a potent antioxidant and cellular reductant. The D-Mannose/L-Galactose pathway is a major plant AsA biosynthetic pathway that is highly connected within biosynthetic networks, and generally conserved across plants. Previous work has shown that, although most genes of this pathway are expressed under standard growth conditions in Brassica rapa, some paralogs of these genes are not. We hypothesize that regulatory evolution in duplicate AsA pathway genes has occurred as an adaptation to environmental stressors, and that gene retention has been influenced by polyploidation events in Brassicas. To test these hypotheses, we explored the conservation of these genes in Brassicas and their expression patterns divergence in B. rapa. Similar retention and a high degree of gene sequence similarity were identified in B. rapa (A genome), B. oleracea (C genome) and B. napus (AC genome). However, the number of genes that encode the same type of enzymes varied among the three plant species. With the exception of GMP, which has nine genes, there were one to four genes that encoded the other enzymes. Moreover, we found that expression patterns divergence widely exists among these genes. (i) VTC2 and VTC5 are paralogous genes, but only VTC5 is influenced by FLC. (ii) Under light treatment, PMI1 co-regulates the AsA pool size with other D-Man/L-Gal pathway genes, whereas PMI2 is regulated only by darkness. (iii) Under NaCl, Cu2+, MeJA and wounding stresses, most of the paralogs exhibit different expression patterns. Additionally, GME and GPP are the key regulatory enzymes that limit AsA biosynthesis in response to these treatments. In conclusion, our data support that the conservative and divergent expression patterns of D-Man/L-Gal pathway genes not only avoid AsA biosynthesis network instability but also allow B. rapa to better adapt to complex environments. PMID:27313597

  2. Genome engineering uncovers 54 evolutionarily conserved and testis-enriched genes that are not required for male fertility in mice

    PubMed Central

    Miyata, Haruhiko; Castaneda, Julio M.; Fujihara, Yoshitaka; Yu, Zhifeng; Archambeault, Denise R.; Isotani, Ayako; Kiyozumi, Daiji; Kriseman, Maya L.; Mashiko, Daisuke; Matsumura, Takafumi; Matzuk, Ryan M.; Mori, Masashi; Noda, Taichi; Oji, Asami; Okabe, Masaru; Prunskaite-Hyyrylainen, Renata; Ramirez-Solis, Ramiro; Satouh, Yuhkoh; Zhang, Qian; Ikawa, Masahito; Matzuk, Martin M.


    Gene-expression analysis studies from Schultz et al. estimate that more than 2,300 genes in the mouse genome are expressed predominantly in the male germ line. As of their 2003 publication [Schultz N, Hamra FK, Garbers DL (2003) Proc Natl Acad Sci USA 100(21):12201–12206], the functions of the majority of these testis-enriched genes during spermatogenesis and fertilization were largely unknown. Since the study by Schultz et al., functional analysis of hundreds of reproductive-tract–enriched genes have been performed, but there remain many testis-enriched genes for which their relevance to reproduction remain unexplored or unreported. Historically, a gene knockout is the “gold standard” to determine whether a gene’s function is essential in vivo. Although knockout mice without apparent phenotypes are rarely published, these knockout mouse lines and their phenotypic information need to be shared to prevent redundant experiments. Herein, we used bioinformatic and experimental approaches to uncover mouse testis-enriched genes that are evolutionarily conserved in humans. We then used gene-disruption approaches, including Knockout Mouse Project resources (targeting vectors and mice) and CRISPR/Cas9, to mutate and quickly analyze the fertility of these mutant mice. We discovered that 54 mutant mouse lines were fertile. Thus, despite evolutionary conservation of these genes in vertebrates and in some cases in all eukaryotes, our results indicate that these genes are not individually essential for male mouse fertility. Our phenotypic data are highly relevant in this fiscally tight funding period and postgenomic age when large numbers of genomes are being analyzed for disease association, and will prevent unnecessary expenditures and duplications of effort by others. PMID:27357688

  3. Genome-Wide Gene Expression Profiling Reveals Conserved and Novel Molecular Functions of the Stigma in Rice1[W

    PubMed Central

    Li, Meina; Xu, Wenying; Yang, Wenqiang; Kong, Zhaosheng; Xue, Yongbiao


    In angiosperms, the stigma provides initial nutrients and guidance cues for pollen grain germination and tube growth. However, little is known about the genes that regulate these processes in rice (Oryza sativa). Here, we generate rice stigma-specific or -preferential gene expression profiles through comparing genome-wide expression patterns of hand-dissected, unpollinated stigma at anthesis with seven tissues, including seedling shoot, seedling root, mature anther, ovary at anthesis, seeds 5 d after pollination, 10-d-old embryo, 10-d-old endosperm, and suspension-cultured cells by using both 57 K Affymetrix rice whole-genome array and 10 K rice cDNA microarray. A high reproducibility of the microarray results was detected between the two different technology platforms. In total, we identified 548 genes to be expressed specifically or predominantly in the stigma papillar cells of rice. Real-time quantitative reverse transcription-polymerase chain reaction analysis of 34 selected genes all confirmed their stigma-specific expression. The expression of five selected genes was further validated by RNA in situ hybridization. Gene Ontology analysis shows that several auxin-signaling components, transcription, and stress-related genes are significantly overrepresented in the rice stigma gene set. Interestingly, most of them also share several cis-regulatory elements with known stress-responsive genes, supporting the notion of an overlap of genetic programs regulating pollination and stress/defense responses. We also found that genes involved in cell wall metabolism and cellular communication appear to be conserved in the stigma between rice and Arabidopsis (Arabidopsis thaliana). Our results indicate that the stigmas appear to have conserved and novel molecular functions between rice and Arabidopsis. PMID:17556504

  4. The first myriapod genome sequence reveals conservative arthropod gene content and genome organisation in the centipede Strigamia maritima.


    Chipman, Ariel D; Ferrier, David E K; Brena, Carlo; Qu, Jiaxin; Hughes, Daniel S T; Schröder, Reinhard; Torres-Oliva, Montserrat; Znassi, Nadia; Jiang, Huaiyang; Almeida, Francisca C; Alonso, Claudio R; Apostolou, Zivkos; Aqrawi, Peshtewani; Arthur, Wallace; Barna, Jennifer C J; Blankenburg, Kerstin P; Brites, Daniela; Capella-Gutiérrez, Salvador; Coyle, Marcus; Dearden, Peter K; Du Pasquier, Louis; Duncan, Elizabeth J; Ebert, Dieter; Eibner, Cornelius; Erikson, Galina; Evans, Peter D; Extavour, Cassandra G; Francisco, Liezl; Gabaldón, Toni; Gillis, William J; Goodwin-Horn, Elizabeth A; Green, Jack E; Griffiths-Jones, Sam; Grimmelikhuijzen, Cornelis J P; Gubbala, Sai; Guigó, Roderic; Han, Yi; Hauser, Frank; Havlak, Paul; Hayden, Luke; Helbing, Sophie; Holder, Michael; Hui, Jerome H L; Hunn, Julia P; Hunnekuhl, Vera S; Jackson, LaRonda; Javaid, Mehwish; Jhangiani, Shalini N; Jiggins, Francis M; Jones, Tamsin E; Kaiser, Tobias S; Kalra, Divya; Kenny, Nathan J; Korchina, Viktoriya; Kovar, Christie L; Kraus, F Bernhard; Lapraz, François; Lee, Sandra L; Lv, Jie; Mandapat, Christigale; Manning, Gerard; Mariotti, Marco; Mata, Robert; Mathew, Tittu; Neumann, Tobias; Newsham, Irene; Ngo, Dinh N; Ninova, Maria; Okwuonu, Geoffrey; Ongeri, Fiona; Palmer, William J; Patil, Shobha; Patraquim, Pedro; Pham, Christopher; Pu, Ling-Ling; Putman, Nicholas H; Rabouille, Catherine; Ramos, Olivia Mendivil; Rhodes, Adelaide C; Robertson, Helen E; Robertson, Hugh M; Ronshaugen, Matthew; Rozas, Julio; Saada, Nehad; Sánchez-Gracia, Alejandro; Scherer, Steven E; Schurko, Andrew M; Siggens, Kenneth W; Simmons, DeNard; Stief, Anna; Stolle, Eckart; Telford, Maximilian J; Tessmar-Raible, Kristin; Thornton, Rebecca; van der Zee, Maurijn; von Haeseler, Arndt; Williams, James M; Willis, Judith H; Wu, Yuanqing; Zou, Xiaoyan; Lawson, Daniel; Muzny, Donna M; Worley, Kim C; Gibbs, Richard A; Akam, Michael; Richards, Stephen


    Myriapods (e.g., centipedes and millipedes) display a simple homonomous body plan relative to other arthropods. All members of the class are terrestrial, but they attained terrestriality independently of insects. Myriapoda is the only arthropod class not represented by a sequenced genome. We present an analysis of the genome of the centipede Strigamia maritima. It retains a compact genome that has undergone less gene loss and shuffling than previously sequenced arthropods, and many orthologues of genes conserved from the bilaterian ancestor that have been lost in insects. Our analysis locates many genes in conserved macro-synteny contexts, and many small-scale examples of gene clustering. We describe several examples where S. maritima shows different solutions from insects to similar problems. The insect olfactory receptor gene family is absent from S. maritima, and olfaction in air is likely effected by expansion of other receptor gene families. For some genes S. maritima has evolved paralogues to generate coding sequence diversity, where insects use alternate splicing. This is most striking for the Dscam gene, which in Drosophila generates more than 100,000 alternate splice forms, but in S. maritima is encoded by over 100 paralogues. We see an intriguing linkage between the absence of any known photosensory proteins in a blind organism and the additional absence of canonical circadian clock genes. The phylogenetic position of myriapods allows us to identify where in arthropod phylogeny several particular molecular mechanisms and traits emerged. For example, we conclude that juvenile hormone signalling evolved with the emergence of the exoskeleton in the arthropods and that RR-1 containing cuticle proteins evolved in the lineage leading to Mandibulata. We also identify when various gene expansions and losses occurred. The genome of S. maritima offers us a unique glimpse into the ancestral arthropod genome, while also displaying many adaptations to its specific

  5. The First Myriapod Genome Sequence Reveals Conservative Arthropod Gene Content and Genome Organisation in the Centipede Strigamia maritima

    PubMed Central

    Chipman, Ariel D.; Ferrier, David E. K.; Brena, Carlo; Qu, Jiaxin; Hughes, Daniel S. T.; Schröder, Reinhard; Torres-Oliva, Montserrat; Znassi, Nadia; Jiang, Huaiyang; Almeida, Francisca C.; Alonso, Claudio R.; Apostolou, Zivkos; Aqrawi, Peshtewani; Arthur, Wallace; Barna, Jennifer C. J.; Blankenburg, Kerstin P.; Brites, Daniela; Capella-Gutiérrez, Salvador; Coyle, Marcus; Dearden, Peter K.; Du Pasquier, Louis; Duncan, Elizabeth J.; Ebert, Dieter; Eibner, Cornelius; Erikson, Galina; Evans, Peter D.; Extavour, Cassandra G.; Francisco, Liezl; Gabaldón, Toni; Gillis, William J.; Goodwin-Horn, Elizabeth A.; Green, Jack E.; Griffiths-Jones, Sam; Grimmelikhuijzen, Cornelis J. P.; Gubbala, Sai; Guigó, Roderic; Han, Yi; Hauser, Frank; Havlak, Paul; Hayden, Luke; Helbing, Sophie; Holder, Michael; Hui, Jerome H. L.; Hunn, Julia P.; Hunnekuhl, Vera S.; Jackson, LaRonda; Javaid, Mehwish; Jhangiani, Shalini N.; Jiggins, Francis M.; Jones, Tamsin E.; Kaiser, Tobias S.; Kalra, Divya; Kenny, Nathan J.; Korchina, Viktoriya; Kovar, Christie L.; Kraus, F. Bernhard; Lapraz, François; Lee, Sandra L.; Lv, Jie; Mandapat, Christigale; Manning, Gerard; Mariotti, Marco; Mata, Robert; Mathew, Tittu; Neumann, Tobias; Newsham, Irene; Ngo, Dinh N.; Ninova, Maria; Okwuonu, Geoffrey; Ongeri, Fiona; Palmer, William J.; Patil, Shobha; Patraquim, Pedro; Pham, Christopher; Pu, Ling-Ling; Putman, Nicholas H.; Rabouille, Catherine; Ramos, Olivia Mendivil; Rhodes, Adelaide C.; Robertson, Helen E.; Robertson, Hugh M.; Ronshaugen, Matthew; Rozas, Julio; Saada, Nehad; Sánchez-Gracia, Alejandro; Scherer, Steven E.; Schurko, Andrew M.; Siggens, Kenneth W.; Simmons, DeNard; Stief, Anna; Stolle, Eckart; Telford, Maximilian J.; Tessmar-Raible, Kristin; Thornton, Rebecca; van der Zee, Maurijn; von Haeseler, Arndt; Williams, James M.; Willis, Judith H.; Wu, Yuanqing; Zou, Xiaoyan; Lawson, Daniel; Muzny, Donna M.; Worley, Kim C.; Gibbs, Richard A.; Akam, Michael; Richards, Stephen


    Myriapods (e.g., centipedes and millipedes) display a simple homonomous body plan relative to other arthropods. All members of the class are terrestrial, but they attained terrestriality independently of insects. Myriapoda is the only arthropod class not represented by a sequenced genome. We present an analysis of the genome of the centipede Strigamia maritima. It retains a compact genome that has undergone less gene loss and shuffling than previously sequenced arthropods, and many orthologues of genes conserved from the bilaterian ancestor that have been lost in insects. Our analysis locates many genes in conserved macro-synteny contexts, and many small-scale examples of gene clustering. We describe several examples where S. maritima shows different solutions from insects to similar problems. The insect olfactory receptor gene family is absent from S. maritima, and olfaction in air is likely effected by expansion of other receptor gene families. For some genes S. maritima has evolved paralogues to generate coding sequence diversity, where insects use alternate splicing. This is most striking for the Dscam gene, which in Drosophila generates more than 100,000 alternate splice forms, but in S. maritima is encoded by over 100 paralogues. We see an intriguing linkage between the absence of any known photosensory proteins in a blind organism and the additional absence of canonical circadian clock genes. The phylogenetic position of myriapods allows us to identify where in arthropod phylogeny several particular molecular mechanisms and traits emerged. For example, we conclude that juvenile hormone signalling evolved with the emergence of the exoskeleton in the arthropods and that RR-1 containing cuticle proteins evolved in the lineage leading to Mandibulata. We also identify when various gene expansions and losses occurred. The genome of S. maritima offers us a unique glimpse into the ancestral arthropod genome, while also displaying many adaptations to its specific

  6. Isolation of the mouse (MFH-1) and human (FKHL14) mesenchyme fork head-1 genes reveals conservation of their gene and protein structures

    SciTech Connect

    Miura, Naoyuki; Iida, Kiyoshi; Yang, Xiao-Li


    The very recently found evolutionarily conserved DNA-binding domain of 100 amino acids, termed the fork head domain, emerged from a sequence comparison of the rat hepatocyte transcription factor HNF-3{alpha} and the homeotic gene fork head of Drosophila. We previously isolated a new member of this family, the mesenchyme fork head-1 (MFH-1) gene, which is expressed in developing mesenchyme. Here we describe the isolation of the mouse (MFH-1) and human (FKHL14) chromosomal MFH-1 genes and the determination of the gene and protein structures of MFH-1. We found that the MFH-1 gene has no introns and that the identity of the amino acid sequences of mouse and human MFH-1 proteins is 94%. We also investigated the transcriptional activity of the mouse and human MFH-1 proteins and found that both proteins act as positive transactivators. 31 refs., 3 figs.

  7. G-NEST: A gene neighborhood scoring tool to identify co-conserved, co-expressed genes

    Technology Transfer Automated Retrieval System (TEKTRAN)

    In previous studies, gene neighborhoods--spatial clusters of co-expressed genes in the genome--have been defined using arbitrary rules such as requiring adjacency, a minimum number of genes, a fixed window size, or a minimum expression level. In the current study, we developed a Gene Neighborhood Sc...

  8. Multi-species sequence comparison reveals conservation of ghrelin gene-derived splice variants encoding a truncated ghrelin peptide.


    Seim, Inge; Jeffery, Penny L; Thomas, Patrick B; Walpole, Carina M; Maugham, Michelle; Fung, Jenny N T; Yap, Pei-Yi; O'Keeffe, Angela J; Lai, John; Whiteside, Eliza J; Herington, Adrian C; Chopin, Lisa K


    The peptide hormone ghrelin is a potent orexigen produced predominantly in the stomach. It has a number of other biological actions, including roles in appetite stimulation, energy balance, the stimulation of growth hormone release and the regulation of cell proliferation. Recently, several ghrelin gene splice variants have been described. Here, we attempted to identify conserved alternative splicing of the ghrelin gene by cross-species sequence comparisons. We identified a novel human exon 2-deleted variant and provide preliminary evidence that this splice variant and in1-ghrelin encode a C-terminally truncated form of the ghrelin peptide, termed minighrelin. These variants are expressed in humans and mice, demonstrating conservation of alternative splicing spanning 90 million years. Minighrelin appears to have similar actions to full-length ghrelin, as treatment with exogenous minighrelin peptide stimulates appetite and feeding in mice. Forced expression of the exon 2-deleted preproghrelin variant mirrors the effect of the canonical preproghrelin, stimulating cell proliferation and migration in the PC3 prostate cancer cell line. This is the first study to characterise an exon 2-deleted preproghrelin variant and to demonstrate sequence conservation of ghrelin gene-derived splice variants that encode a truncated ghrelin peptide. This adds further impetus for studies into the alternative splicing of the ghrelin gene and the function of novel ghrelin peptides in vertebrates. PMID:26792793

  9. Strong conservation of non-coding sequences during vertebrates evolution: potential involvement in post-transcriptional regulation of gene expression.

    PubMed Central

    Duret, L; Dorkeld, F; Gautier, C


    Comparison of nucleotide sequences from different classes of vertebrates that diverged more than 300 million years ago, revealed the existence of highly conserved regions (HCRs) with more than 70% similarity over 100 to 1450 nt in non-coding parts of genes. Such a conservation is unexpected because it is much longer and stronger than what is necessary for specifying the binding of a regulatory protein. HCRs are relatively frequent, particularly in genes that are essential to cell life. In multigene families, conserved regions are specific of each isotype and are probably involved in the control of their specific pattern of expression. Studying HCRs distribution within genes showed that functional constraints are generally much stronger in 3'-non-coding regions than in promoters or introns. The 3'-HCRs are particularly A + T-rich and are always located in the transcribed untranslated regions of genes, which suggests that they are involved in post-transcriptional processes. However, current knowledge of mechanisms that regulate mRNA export, localisation, translation, or degradation is not sufficient to explain the strong functional constraints that we have characterised. PMID:8506129

  10. Understanding the basis of a novel fruit type in Brassicaceae: conservation and deviation in expression patterns of six genes

    PubMed Central


    Background Variation in fruit morphology is important for plant fitness because it influences dispersal capabilities. Approximately half the members of tribe Brassiceae (Brassicaceae) exhibit fruits with segmentation and variable dehiscence, called heteroarthrocarpy. The knowledge of the genetics of fruit patterning in Arabidopsis offers the opportunity to ask: (1) whether this genetic pathway is conserved in taxa with different fruit morphologies; (2) how the pathway may be modified to produce indehiscence; and (3) whether the pathway has been recruited for a novel abscission zone. Methods We identified homologs of ALCATRAZ, FRUITFULL, INDEHISCENT, SHATTERPROOF, and REPLUMLESS from two taxa, representing different types of heteroarthrocarpy. Comparative gene expression of twelve loci was assessed to address how their expression may have been modified to produce heteroarthrocarpy. Results Studies demonstrated overall conservation in gene expression patterns between dehiscent segments of Erucaria erucarioides and Arabidopsis, with some difference in expression of genes that position the valve margin. In contrast, indehiscence in heteroarthrocarpic fruit segments was correlated with the elimination of the entire valve margin pathway in Erucaria and Cakile lanceolata as well as its absence from a novel lateral abscission zone. Conclusions These findings suggest that modifications in the valve margin positioning genes are responsible for differences between heteroarthrocarpic and Arabidopsis-like fruits and support the hypothesis that heteroarthrocarpy evolved via repositioning the valve margin. They also highlight conservation in the dehiscence pathway across Brassicaceae. PMID:22943452

  11. Evolutionary relationships among copies of feather beta ({beta}) keratin genes from several avian orders.


    Glenn, Travis C; French, Jeffrey O; Heincelman, Traci J; Jones, Kenneth L; Sawyer, Roger H


    The feather beta (β) keratins of the white leghorn chicken (order Galliformes, Gallus gallus domesticus) are the products of a multigene family that includes claw, feather, feather-like, and scale genes (Presland et al. 1989a). Here we characterize the feather β-keratin genes in additional bird species. We designed primers for polymerase chain reactions (PCR) using sequences available from chicken, cloned the resulting amplicons to isolate individual copies, and sequenced multiple clones from each PCR reaction for which we obtained amplicons of the expected size. Feather β-keratins of 18 species from eight avian orders demonstrate DNA sequence variation within and among taxa, even in the protein-coding regions of the genes. Phylogenies of these data suggest that Galliformes (fowl-like birds), Psittaciformes (parrots), and possibly Falconiformes (birds of prey) existed as separate lineages before duplication of the feather β-keratin gene began in Ciconiiformes (herons, storks, and allies), Gruiformes (cranes, rails, and allies), and Piciformes (woodpeckers and allies). Sequences from single species of Coraciiformes (kingfishers) and Columbiformes (pigeons) are monophyletic and strikingly divergent, suggesting feather β-keratin genes in these birds also diverged after these species last shared a common ancestor with the other taxa investigated. Overall, these data demonstrate considerable variation in this structural protein in the relatively recent history of birds, and raise questions concerning the origin and homology of claw, feather-like, and scale β-keratins of birds and the reptilian β-keratins. PMID:21669807

  12. Conservation of the function counts: homologous neurons express sequence-related neuropeptides that originate from different genes.


    Neupert, Susanne; Huetteroth, Wolf; Schachtner, Joachim; Predel, Reinhard


    By means of single-cell matrix assisted laser desorption/ionization time-of-flight mass spectrometry, we analysed neuropeptide expression in all FXPRLamide/pheromone biosynthesis activating neuropeptide synthesizing neurons of the adult tobacco hawk moth, Manduca sexta. Mass spectra clearly suggest a completely identical processing of the pheromone biosynthesis activating neuropeptide-precursor in the mandibular, maxillary and labial neuromeres of the subesophageal ganglion. Only in the pban-neurons of the labial neuromere, products of two neuropeptide genes, namely the pban-gene and the capa-gene, were detected. Both of these genes expressed, amongst others, sequence-related neuropeptides (extended WFGPRLamides). We speculate that the expression of the two neuropeptide genes is a plesiomorph character typical of moths. A detailed examination of the neuroanatomy and the peptidome of the (two) pban-neurons in the labial neuromere of moths with homologous neurons of different insects indicates a strong conservation of the function of this neuroendocrine system. In other insects, however, the labial neurons either express products of the fxprl-gene or products of the capa-gene. The processing of the respective genes is reduced to extended WFGPRLamides in each case and yields a unique peptidome in the labial cells. Thus, sequence-related messenger molecules are always produced in these cells and it seems that the respective neurons recruited different neuropeptide genes for this motif. PMID:19712058

  13. Trypanosoma rangeli and Trypanosoma cruzi: molecular characterization of genes encoding putative calcium-binding proteins, highly conserved in trypanosomatids.


    Porcel, B M; Bontempi, E J; Henriksson, J; Rydåker, M; Aslund, L; Segura, E L; Pettersson, U; Ruiz, A M


    Genes encoding a 29-kDa flagellar calcium-binding protein (F29) in Trypanosoma cruzi, strongly homologous to EF-hand calcium-binding protein-encoding genes previously reported in this parasite, were isolated by immunoscreening. F29 is encoded by a number of very similar genes, highly conserved among different T. cruzi isolates. The genes are located on a pair of homologous chromosomes, arranged in one or two clusters of tandem repeats. PCR amplification of Trypanosoma rangeli genomic DNA, using primers derived from the T. cruzi F29 sequence made it possible to isolate the homologous gene in T. rangeli, encoding a 23-kDa protein called TrCaBP. Gene sequence comparisons showed homology to EF-hand calcium-binding proteins from T. cruzi (82.8%), Trypanosoma brucei brucei (60.2%), and Entamoeba histolytica (28.4%). Northern blot analysis revealed that the TrCaBP gene is expressed in T. rangeli as a polyadenylated transcript. The TrCaBP-encoding genes are present in at least 20 copies per cell, organized in tandem arrays, on large T. rangeli chromosomes in some isolates and on two smaller ones in others. This gene, however, seems to be absent from Leishmania. PMID:8948328

  14. Conserved cis-regulatory modules in promoters of genes encoding wheat high-molecular-weight glutenin subunits

    PubMed Central

    Ravel, Catherine; Fiquet, Samuel; Boudet, Julie; Dardevet, Mireille; Vincent, Jonathan; Merlino, Marielle; Michard, Robin; Martre, Pierre


    The concentration and composition of the gliadin and glutenin seed storage proteins (SSPs) in wheat flour are the most important determinants of its end-use value. In cereals, the synthesis of SSPs is predominantly regulated at the transcriptional level by a complex network involving at least five cis-elements in gene promoters. The high-molecular-weight glutenin subunits (HMW-GS) are encoded by two tightly linked genes located on the long arms of group 1 chromosomes. Here, we sequenced and annotated the HMW-GS gene promoters of 22 electrophoretic wheat alleles to identify putative cis-regulatory motifs. We focused on 24 motifs known to be involved in SSP gene regulation. Most of them were identified in at least one HMW-GS gene promoter sequence. A common regulatory framework was observed in all the HMW-GS gene promoters, as they shared conserved cis-regulatory modules (CCRMs) including all the five motifs known to regulate the transcription of SSP genes. This common regulatory framework comprises a composite box made of the GATA motifs and GCN4-like Motifs (GLMs) and was shown to be functional as the GLMs are able to bind a bZIP transcriptional factor SPA (Storage Protein Activator). In addition to this regulatory framework, each HMW-GS gene promoter had additional motifs organized differently. The promoters of most highly expressed x-type HMW-GS genes contain an additional box predicted to bind R2R3-MYB transcriptional factors. However, the differences in annotation between promoter alleles could not be related to their level of expression. In summary, we identified a common modular organization of HMW-GS gene promoters but the lack of correlation between the cis-motifs of each HMW-GS gene promoter and their level of expression suggests that other cis-elements or other mechanisms regulate HMW-GS gene expression. PMID:25429295

  15. A Conserved Helicobacter pylori Gene, HP0102, Is Induced Upon Contact With Gastric Cells and Has Multiple Roles in Pathogenicity.


    Bhattacharya, Saurabh; Mukherjee, Oindrilla; Mukhopadhyay, Asish K; Chowdhury, Rukhsana


    Contact with host cells is recognized as a signal capable of triggering expression of bacterial genes important for host pathogen interaction. Adherence of Helicobacter pylori to the gastric epithelial cell line AGS strongly upregulated expression of a gene, HP0102, in the adhered bacteria in all strains examined, including several Indian clinical isolates. The gene is highly conserved and ubiquitously present in all 69 sequenced H. pylori genomes at the same genomic locus, as well as in 15 Indian clinical isolates. The gene is associated with 2 distinct phenotypes related to pathogenicity. In AGS cell-adhered H. pylori, it has a role in upregulation of cagA expression from a specific σ(28)-RNAP promoter and consequent induction of the hummingbird phenotype in the infected AGS cells. Furthermore, HP0102 has a role in chemotaxis and a ΔHP0102 mutant exhibited low acid-escape response that might account for the poor colonization efficiency of the mutant. PMID:27056952

  16. Genetic diversity of the conserved motifs of six bacterial leaf blight resistance genes in a set of rice landraces

    PubMed Central


    Background Bacterial leaf blight (BLB) caused by the vascular pathogen Xanthomonas oryzae pv. oryzae (Xoo) is one of the most serious diseases leading to crop failure in rice growing countries. A total of 37 resistance genes against Xoo has been identified in rice. Of these, ten BLB resistance genes have been mapped on rice chromosomes, while 6 have been cloned, sequenced and characterized. Diversity analysis at the resistance gene level of this disease is scanty, and the landraces from West Bengal and North Eastern states of India have received little attention so far. The objective of this study was to assess the genetic diversity at conserved domains of 6 BLB resistance genes in a set of 22 rice accessions including landraces and check genotypes collected from the states of Assam, Nagaland, Mizoram and West Bengal. Results In this study 34 pairs of primers were designed from conserved domains of 6 BLB resistance genes; Xa1, xa5, Xa21, Xa21(A1), Xa26 and Xa27. The designed primer pairs were used to generate PCR based polymorphic DNA profiles to detect and elucidate the genetic diversity of the six genes in the 22 diverse rice accessions of known disease phenotype. A total of 140 alleles were identified including 41 rare and 26 null alleles. The average polymorphism information content (PIC) value was 0.56/primer pair. The DNA profiles identified each of the rice landraces unequivocally. The amplified polymorphic DNA bands were used to calculate genetic similarity of the rice landraces in all possible pair combinations. The similarity among the rice accessions ranged from 18% to 89% and the dendrogram produced from the similarity values was divided into 2 major clusters. The conserved domains identified within the sequenced rare alleles include Leucine-Rich Repeat, BED-type zinc finger domain, sugar transferase domain and the domain of the carbohydrate esterase 4 superfamily. Conclusions This study revealed high genetic diversity at conserved domains of six BLB

  17. Conservation and expression of PIWI-interacting RNA pathway genes in male and female adult gonad of amniotes.


    Lim, Shu Ly; Tsend-Ayush, Enkhjargal; Kortschak, R Daniel; Jacob, Reuben; Ricciardelli, Carmela; Oehler, Martin K; Grützner, Frank


    The PIWI-interacting RNA (piRNA) pathway is essential for germline development and transposable element repression. Key elements of this pathway are members of the piRNA-binding PIWI/Argonaute protein family and associated factors (e.g., VASA, MAELSTROM, and TUDOR domain proteins). PIWI-interacting RNAs have been identified in mouse testis and oocytes, but information about the expression of the different piRNA pathway genes, in particular in the mammalian ovary, remains incomplete. We investigated the evolution and expression of piRNA pathway genes in gonads of amniote species (chicken, platypus, and mouse). Database searches confirm a high level of conservation and revealed lineage-specific gain and loss of Piwi genes in vertebrates. Expression analysis in mammals shows that orthologs of Piwi-like (Piwil) genes, Mael (Maelstrom), Mvh (mouse vasa homolog), and Tdrd1 (Tudor domain-containing protein 1) are expressed in platypus adult testis. In contrast to mouse, Piwil4 is expressed in platypus and human adult testis. We found evidence for Mael and Piwil2 expression in mouse Sertoli cells. Importantly, we show mRNA expression of Piwil2, Piwil4, and Mael in oocytes and supporting cells of human, mouse, and platypus ovary. We found no Piwil1 expression in mouse and chicken ovary. The conservation of gene expression in somatic parts of the gonad and germ cells of species that diverged over 800 million yr ago indicates an important role in adult male and female gonad. PMID:24108303

  18. Macrotene chromosomes provide insights to a new mechanism of high-order gene amplification in eukaryotes

    PubMed Central

    Thierry, Agnès; Khanna, Varun; Créno, Sophie; Lafontaine, Ingrid; Ma, Laurence; Bouchier, Christiane; Dujon, Bernard


    Copy number variation of chromosomal segments is now recognized as a major source of genetic polymorphism within natural populations of eukaryotes, as well as a possible cause of genetic diseases in humans, including cancer, but its molecular bases remain incompletely understood. In the baker’s yeast Saccharomyces cerevisiae, a variety of low-order amplifications (segmental duplications) were observed after adaptation to limiting environmental conditions or recovery from gene dosage imbalance, and interpreted in terms of replication-based mechanisms associated or not with homologous recombination. Here we show the emergence of novel high-order amplification structures, with corresponding overexpression of embedded genes, during evolution under favourable growth conditions of severely unfit yeast cells bearing genetically disabled genomes. Such events form massively extended chromosomes, which we propose to call macrotene, whose characteristics suggest the products of intrachromosomal rolling-circle type of replication structures, probably initiated by increased accidental template switches under important cellular stress conditions. PMID:25635677

  19. Multiple Conserved Heteroplasmic Sites in tRNA Genes in the Mitochondrial Genomes of Terrestrial Isopods (Oniscidea).


    Chandler, Christopher H; Badawi, Myriam; Moumen, Bouziane; Grève, Pierre; Cordaux, Richard


    Mitochondrial genome structure and organization are relatively conserved among metazoans. However, in many isopods, especially the terrestrial isopods (Oniscidea), the mitochondrial genome consists of both ∼14-kb linear monomers and ∼28-kb circular dimers. This unusual organization is associated with an ancient and conserved constitutive heteroplasmic site. This heteroplasmy affects the anticodon of a tRNA gene, allowing this single locus to function as a "dual" tRNA gene for two different amino acids. Here, we further explore the evolution of these unusual mitochondrial genomes by assembling complete mitochondrial sequences for two additional Oniscidean species, Trachelipus rathkei and Cylisticus convexus. Strikingly, we find evidence of two additional heteroplasmic sites that also alter tRNA anticodons, creating additional dual tRNA genes, and that are conserved across both species. These results suggest that the unique linear/circular organization of isopods' mitochondrial genomes may facilitate the evolution of stable mitochondrial heteroplasmies, and, conversely, once such heteroplasmies have evolved, they constrain the multimeric structure of the mitochondrial genome in these species. Finally, we outline some possible future research directions to identify the factors influencing mitochondrial genome evolution in this group. PMID:25911226

  20. Multiple Conserved Heteroplasmic Sites in tRNA Genes in the Mitochondrial Genomes of Terrestrial Isopods (Oniscidea)

    PubMed Central

    Chandler, Christopher H.; Badawi, Myriam; Moumen, Bouziane; Grève, Pierre; Cordaux, Richard


    Mitochondrial genome structure and organization are relatively conserved among metazoans. However, in many isopods, especially the terrestrial isopods (Oniscidea), the mitochondrial genome consists of both ∼14-kb linear monomers and ∼28-kb circular dimers. This unusual organization is associated with an ancient and conserved constitutive heteroplasmic site. This heteroplasmy affects the anticodon of a tRNA gene, allowing this single locus to function as a “dual” tRNA gene for two different amino acids. Here, we further explore the evolution of these unusual mitochondrial genomes by assembling complete mitochondrial sequences for two additional Oniscidean species, Trachelipus rathkei and Cylisticus convexus. Strikingly, we find evidence of two additional heteroplasmic sites that also alter tRNA anticodons, creating additional dual tRNA genes, and that are conserved across both species. These results suggest that the unique linear/circular organization of isopods’ mitochondrial genomes may facilitate the evolution of stable mitochondrial heteroplasmies, and, conversely, once such heteroplasmies have evolved, they constrain the multimeric structure of the mitochondrial genome in these species. Finally, we outline some possible future research directions to identify the factors influencing mitochondrial genome evolution in this group. PMID:25911226

  1. Well-balanced high-order centred schemes for non-conservative hyperbolic systems. Applications to shallow water equations with fixed and mobile bed

    NASA Astrophysics Data System (ADS)

    Canestrelli, Alberto; Siviglia, Annunziato; Dumbser, Michael; Toro, Eleuterio F.


    This paper concerns the development of high-order accurate centred schemes for the numerical solution of one-dimensional hyperbolic systems containing non-conservative products and source terms. Combining the PRICE-T method developed in [Toro E, Siviglia A. PRICE: primitive centred schemes for hyperbolic system of equations. Int J Numer Methods Fluids 2003;42:1263-91] with the theoretical insights gained by the recently developed path-conservative schemes [Castro M, Gallardo J, Parés C. High-order finite volume schemes based on reconstruction of states for solving hyperbolic systems with nonconservative products applications to shallow-water systems. Math Comput 2006;75:1103-34; Parés C. Numerical methods for nonconservative hyperbolic systems: a theoretical framework. SIAM J Numer Anal 2006;44:300-21], we propose the new PRICE-C scheme that automatically reduces to a modified conservative FORCE scheme if the underlying PDE system is a conservation law. The resulting first-order accurate centred method is then extended to high order of accuracy in space and time via the ADER approach together with a WENO reconstruction technique. The well-balanced properties of the PRICE-C method are investigated for the shallow water equations. Finally, we apply the new scheme to the shallow water equations with fix bottom topography and with variable bottom solving an additional sediment transport equation.

  2. Gene Order of Encephalomyocarditis Virus as Determined by Studies with Pactamycin

    PubMed Central

    Butterworth, Byron E.; Rueckert, Roland R.


    Previous work has shown that translation of the encephalomyocarditis (EMC) viral ribonucleic acid (RNA) generates at least three primary products, polypeptides A, F, and C. The A and C polypeptides then undergo post-translational cleavages to complete the production of the stable viral polypeptides (δ, β, γ, α, G, I, F, H, and E). In this communication we show that A, F, and C are produced in equimolar amounts giving further support to the theory that the RNA of picornaviruses has only a single site for the initiation of protein synthesis. The biosynthesis of viral proteins in EMC virus-infected HeLa cells was studied in the presence of pactamycin at concentrations which preferentially inhibit the initiation of protein synthesis. The amount of each polypeptide formed during the residual period of protein synthesis observed after the addition of pactamycin was used as a criterion for ordering the genes on the viral RNA. The results obtained indicate that the primary gene products are ordered on the EMC viral RNA 5′ → 3′ A-F-C and that the stable products are ordered δ-β-γ-α-G-I-F-H-E. Moreover, the intermediate chains B and ε map in the capsid region, whereas the intermediate chain D maps in the E region. This order is largely consistent with previously established relationships of the viral polypeptides and thus indicates that pactamycin is a valid tool for “genetic” mapping of polycistronic RNA molecules with single initiation sites. PMID:4337167

  3. Worldwide HLA-E nucleotide and haplotype variability reveals a conserved gene for coding and 3' untranslated regions.


    Felício, L P; Porto, I O P; Mendes-Junior, C T; Veiga-Castelli, L C; Santos, K E; Vianello-Brondani, R P; Sabbagh, A; Moreau, P; Donadi, E A; Castelli, E C


    The human leukocyte antigen-E (HLA-E) locus is a human major histocompatibility complex (MHC) gene associated with immune-modulation and suppression of the immune response by the interaction with specific natural killer (NK) and T cell receptors (TCRs). It is considered one of the most conserved genes of the human MHC; however, this low nucleotide variability seems to be a consequence of the scarce number of studies focusing on this subject. In this manuscript we assessed the nucleotide variability at the HLA-E coding and 3' untranslated regions (3'UTRs) in Brazil and in the populations from the 1000Genomes Consortium. Twenty-eight variable sites arranged into 33 haplotypes were detected and most of these haplotypes (98.2%) are encoding one of the two HLA-E molecules found worldwide, E*01:01 and E*01:03. Moreover, three worldwide spread haplotypes, associated with the coding alleles E*01:01:01, E*01:03:01 and E*01:03:02, account for 85% of all HLA-E haplotypes, suggesting that they arose early before human speciation. In addition, the low nucleotide diversity found for the HLA-E coding and 3'UTR in worldwide populations suggests that the HLA-E gene is in fact a conserved gene, which might be a consequence of its key role in the modulation of the immune system. PMID:24400773

  4. Xenopus cytoskeletal actin and human c-fos gene promoters share a conserved protein-binding site.


    Mohun, T; Garrett, N; Treisman, R


    Xenopus laevis cytoskeletal actin gene promoters contain a 20-bp sequence homologous to the serum response element (SRE) required for transient human c-fos gene transcription in response to serum factors. Both sequences bind the same factor in HeLa cell extracts, as shown by binding competition, DNase I and dimethylsulphate (DMS) protection and DMS interference assays. A similar protein is present in Xenopus laevis oocytes. Sequences containing the SRE homology are essential for constitutive activity of the actin promoter in both Xenopus and mouse cells, and a synthetic SRE functions as a promoter element in these cells. In mouse cells, transcription of both transfected Xenopus actin and actin/c-fos fusion genes is activated following serum stimulation. These data suggest that the SRE and its cognate protein form part of a regulatory pathway that has been highly conserved during evolution. PMID:3582369

  5. Xenopus cytoskeletal actin and human c-fos gene promoters share a conserved protein-binding site.

    PubMed Central

    Mohun, T; Garrett, N; Treisman, R


    Xenopus laevis cytoskeletal actin gene promoters contain a 20-bp sequence homologous to the serum response element (SRE) required for transient human c-fos gene transcription in response to serum factors. Both sequences bind the same factor in HeLa cell extracts, as shown by binding competition, DNase I and dimethylsulphate (DMS) protection and DMS interference assays. A similar protein is present in Xenopus laevis oocytes. Sequences containing the SRE homology are essential for constitutive activity of the actin promoter in both Xenopus and mouse cells, and a synthetic SRE functions as a promoter element in these cells. In mouse cells, transcription of both transfected Xenopus actin and actin/c-fos fusion genes is activated following serum stimulation. These data suggest that the SRE and its cognate protein form part of a regulatory pathway that has been highly conserved during evolution. Images Fig. 2. Fig. 3. Fig. 4. Fig. 5. Fig. 6. PMID:3582369

  6. Analysis of the relationship between longitudinal gene expressions and ordered categorical event data

    PubMed Central

    Rajicic, Natasa; Finkelstein, Dianne M.; Schoenfeld, David A.


    SUMMARY The NIH project ”Inflammatory and Host Response to Injury” (Glue) is being conducted to study the changes in the body over time in response to trauma and burn. Patients are monitored for changes in their clinical status, such as the onset of and recovery from organ failure. Blood samples are drawn over the first days and weeks after the injury to obtain gene expression levels over time. Our goal was to develop a method of selecting genes that differentially expressed in patients who either improved or experienced organ failure. For this, we needed a test for the association between longitudinal gene expressions and the time to the occurrence of ordered categorical outcomes indicating recovery, stable disease, and organ failure. We propose a test for which the relationship between the gene expression and the events is modeled using the cumulative proportional odds model that is a generalization of the Pooling Repeated Observation (PRO) method. Given the high-dimensionality of the microarray data, it was necessary to control for the multiplicity of the testing. To control for the false discovery rate (FDR), we applied both a permutational approach as well as Efron's empirical estimation methods. We explore our method through simulations and provide the analysis of the multi-center, longitudinal study of immune response to inflammation and trauma ( PMID:19618375

  7. 76 FR 17637 - Energy Conservation Program for Consumer Products: Decision and Order Granting a Waiver to Miele...

    Federal Register 2010, 2011, 2012, 2013, 2014


    ... of Energy Efficiency and Renewable Energy Energy Conservation Program for Consumer Products: Decision... Procedure (Case No. CD-005) AGENCY: Office of Energy Efficiency and Renewable Energy, Department of Energy... March 24, 2011. Kathleen Hogan, Deputy Assistant Secretary for Energy Efficiency, Office of...

  8. 76 FR 11233 - Energy Conservation Program for Consumer Products: Decision and Order Granting a Waiver to LG...

    Federal Register 2010, 2011, 2012, 2013, 2014


    ... of Energy Efficiency and Renewable Energy Energy Conservation Program for Consumer Products: Decision... Procedure AGENCY: Office of Energy Efficiency and Renewable Energy, Department of Energy. ACTION: Decision... concerning the energy efficiency of these products unless the product has been tested consistent with...

  9. Localization of a highly conserved human potassium channel gene (NGK2-KV4-KCNC1) to chromosome 11p15

    SciTech Connect

    Ried, T.; Ward, D.C. ); Rudy, B.; Miera, V.S. de; Lau, D.; Sen, K. )


    Several genes (the Shaker or Sh gene family) encoding components of voltage-gated K[sub +] channels have been identified in various species. Based on sequence similarities Sh genes are classified into four groups or subfamilies. Mammalian genes of each one of these subfamilies also show high levels of sequence similarity to one of four related Drosophila genes: Shaker, Shab, Shaw, and Shal. Here we report the isolation of human cDNAs for a Shaw-related product (NGK2,KV2.1a) previously identified in rat and mice. A comparison of the nucleotide and deduced amino acid sequence of NGK2 in rodents and humans shows that this product is highly conserved in mammals; the human NGK2 protein shows over 99% amino acid sequence identity to its rodent homologue. The gene (NGK2-KV4; KCNC1) encoding NGK2 was mapped to human chromosome 11p15 by fluorescence in situ hybridization with the human NGK2 cDNAs. 65 refs., 2 figs., 1 tab.

  10. Conserved globulin gene across eight grass genomes identify fundamental units of the loci encoding seed storage proteins.


    Gu, Yong Qiang; Wanjugi, Humphrey; Coleman-Derr, Devin; Kong, Xiuying; Anderson, Olin D


    The wheat high molecular weight (HMW) glutenins are important seed storage proteins that determine bread-making quality in hexaploid wheat (Triticum aestivum). In this study, detailed comparative sequence analyses of large orthologous HMW glutenin genomic regions from eight grass species, representing a wide evolutionary history of grass genomes, reveal a number of lineage-specific sequence changes. These lineage-specific changes, which resulted in duplications, insertions, and deletions of genes, are the major forces disrupting gene colinearity among grass genomes. Our results indicate that the presence of the HMW glutenin gene in Triticeae genomes was caused by lineage-specific duplication of a globulin gene. This tandem duplication event is shared by Brachypodium and Triticeae genomes, but is absent in rice, maize, and sorghum, suggesting the duplication occurred after Brachypodium and Triticeae genomes diverged from the other grasses ~35 Ma ago. Aside from their physical location in tandem, the sequence similarity, expression pattern, and conserved cis-acting elements responsible for endosperm-specific expression further support the paralogous relationship between the HMW glutenin and globulin genes. While the duplicated copy in Brachypodium has apparently become nonfunctional, the duplicated copy in wheat has evolved to become the HMW glutenin gene by gaining a central prolamin repetitive domain. PMID:19707805

  11. Higher-order conservative interpolation between control-volume meshes: Application to advection and multiphase flow problems with dynamic mesh adaptivity

    NASA Astrophysics Data System (ADS)

    Adam, A.; Pavlidis, D.; Percival, J. R.; Salinas, P.; Xie, Z.; Fang, F.; Pain, C. C.; Muggeridge, A. H.; Jackson, M. D.


    A general, higher-order, conservative and bounded interpolation for the dynamic and adaptive meshing of control-volume fields dual to continuous and discontinuous finite element representations is presented. Existing techniques such as node-wise interpolation are not conservative and do not readily generalise to discontinuous fields, whilst conservative methods such as Grandy interpolation are often too diffusive. The new method uses control-volume Galerkin projection to interpolate between control-volume fields. Bounded solutions are ensured by using a post-interpolation diffusive correction. Example applications of the method to interface capturing during advection and also to the modelling of multiphase porous media flow are presented to demonstrate the generality and robustness of the approach.

  12. The human SUMF1 gene, required for posttranslational sulfatase modification, defines a new gene family which is conserved from pro- to eukaryotes.


    Landgrebe, Jobst; Dierks, Thomas; Schmidt, Bernhard; von Figura, Kurt


    Recently, the human C(alpha)-formylglycine (FGly)-generating enzyme (FGE), whose deficiency causes the autosomal-recessively transmitted lysosomal storage disease multiple sulfatase deficiency (MSD), has been identified. In sulfatases, FGE posttranslationally converts a cysteine residue to FGly, which is part of the catalytic site and is essential for sulfatase activity. FGE is encoded by the sulfatase modifying factor 1 (SUMF1) gene, which defines a new gene family comprising orthologs from prokaryotes to higher eukaryotes. The genomes of E. coli, S. cerevisiae and C. elegans lack SUMF1, indicating a phylogenetic gap and the existence of an alternative FGly-generating system. The genomes of vertebrates including mouse, man and pufferfish contain a sulfatase modifying factor 2 (SUMF2) gene encoding an FGE paralog of unknown function. SUMF2 evolved from a single exon SUMF1 gene as found in diptera prior to divergent intron acquisition. In several prokaryotic genomes, the SUMF1 gene is cotranscribed with genes encoding sulfatases which require FGly modification. The FGE protein contains a single domain that is made up of three highly conserved subdomains spaced by nonconserved sequences of variable lengths. The similarity among the eukaryotic FGE orthologs varies between 72% and 100% for the three subdomains and is highest for the C-terminal subdomain, which is a hotspot for mutations in MSD patients. PMID:14563551

  13. The complete mitochondrial genome sequence of the tubeworm Lamellibrachia satsuma and structural conservation in the mitochondrial genome control regions of Order Sabellida.


    Patra, Ajit Kumar; Kwon, Yong Min; Kang, Sung Gyun; Fujiwara, Yoshihiro; Kim, Sang-Jin


    The control region of the mitochondrial genomes shows high variation in conserved sequence organizations, which follow distinct evolutionary patterns in different species or taxa. In this study, we sequenced the complete mitochondrial genome of Lamellibrachia satsuma from the cold-seep region of Kagoshima Bay, as a part of whole genome study and extensively studied the structural features and patterns of the control region sequences. We obtained 15,037 bp of mitochondrial genome using Illumina sequencing and identified the non-coding AT-rich region or control region (354 bp, AT=83.9%) located between trnH and trnR. We found 7 conserved sequence blocks (CSB), scattered throughout the control region of L. satsuma and other taxa of Annelida. The poly-TA stretches, which commonly form the stem of multiple stem-loop structures, are most conserved in the CSB-I and CSB-II regions. The mitochondrial genome of L. satsuma encodes a unique repetitive sequence in the control region, which forms a unique secondary structure in comparison to Lamellibrachia luymesi. Phylogenetic analyses of all protein-coding genes indicate that L. satsuma forms a monophyletic clade with L. luymesi along with other tubeworms found in cold-seep regions (genera: Lamellibrachia, Escarpia, and Seepiophila). In general, the control region sequences of Annelida could be aligned with certainty within each genus, and to some extent within the family, but with a higher rate of variation in conserved regions. PMID:26776396

  14. Akirins, highly conserved nuclear proteins, required for NF-κB dependent gene expression in Drosophila and mice

    PubMed Central

    Goto, Akira; Matsushita, Kazufumi; Gesellchen, Viola; Chamy, Laure El; Kuttenkeuler, David; Takeuchi, Osamu; Hoffmann, Jules A.; Akira, Shizuo; Boutros, Michael; Reichhart, Jean-Marc


    During a genome-wide RNAi screen, we isolated CG8580 as a gene involved in the innate immune response of Drosophila. CG8580, which we named Akirin, acts in parallel with the NF-κB transcription factor downstream of the Imd pathway and was required for defense against Gram-negative bacteria. Akirin is highly conserved and the human genome contains two homologues, one of which was able to rescue the loss of function phenotype in Drosophila cells. Akirins had a strict nuclear localization. Knockout of both Akirin homologues in mice revealed that one had an essential function downstream of Toll-like receptor, tumor necrosis factor and interleukin 1-β (IL-1β) signaling pathways leading to the production of IL-6. Thus, Akirin is a conserved nuclear factor required for innate immune responses. PMID:18066067

  15. Akirins are highly conserved nuclear proteins required for NF-kappaB-dependent gene expression in drosophila and mice.


    Goto, Akira; Matsushita, Kazufumi; Gesellchen, Viola; El Chamy, Laure; Kuttenkeuler, David; Takeuchi, Osamu; Hoffmann, Jules A; Akira, Shizuo; Boutros, Michael; Reichhart, Jean-Marc


    During a genome-wide screen with RNA-mediated interference, we isolated CG8580 as a gene involved in the innate immune response of Drosophila melanogaster. CG8580, which we called Akirin, encoded a protein that acted in parallel with the NF-kappaB transcription factor downstream of the Imd pathway and was required for defense against Gram-negative bacteria. Akirin is highly conserved, and the human genome contains two homologs, one of which was able to rescue the loss-of-function phenotype in drosophila cells. Akirins were strictly localized to the nucleus. Knockout of both Akirin homologs in mice showed that one had an essential function downstream of the Toll-like receptor, tumor necrosis factor and interleukin (IL)-1beta signaling pathways leading to the production of IL-6. Thus, Akirin is a conserved nuclear factor required for innate immune responses. PMID:18066067

  16. Production of Bioactive Diterpenoids in the Euphorbiaceae Depends on Evolutionarily Conserved Gene Clusters[C][W][OPEN

    PubMed Central

    King, Andrew J.; Brown, Geoffrey D.; Gilday, Alison D.; Larson, Tony R.; Graham, Ian A.


    The Euphorbiaceae produce a diverse range of diterpenoids, many of which have pharmacological activities. These diterpenoids include ingenol mebutate, which is licensed for the treatment of a precancerous skin condition (actinic keratosis), and phorbol derivatives such as resiniferatoxin and prostratin, which are undergoing investigation for the treatment of severe pain and HIV, respectively. Despite the interest in these diterpenoids, their biosynthesis is poorly understood at present, with the only characterized step being the conversion of geranylgeranyl pyrophosphate into casbene. Here, we report a physical cluster of diterpenoid biosynthetic genes from castor (Ricinus communis), including casbene synthases and cytochrome P450s from the CYP726A subfamily. CYP726A14, CYP726A17, and CYP726A18 were able to catalyze 5-oxidation of casbene, a conserved oxidation step in the biosynthesis of this family of medicinally important diterpenoids. CYP726A16 catalyzed 7,8-epoxidation of 5-keto-casbene and CYP726A15 catalyzed 5-oxidation of neocembrene. Evidence of similar gene clustering was also found in two other Euphorbiaceae, including Euphorbia peplus, the source organism of ingenol mebutate. These results demonstrate conservation of gene clusters at the higher taxonomic level of the plant family and that this phenomenon could prove useful in further elucidating diterpenoid biosynthetic pathways. PMID:25172144

  17. Conservation of the Low-shear Modeled Microgravity Response in Enterobacteriaceae and Analysis of the trp Genes in this Response.


    Soni, Anjali; O'Sullivan, Laura; Quick, Laura N; Ott, C Mark; Nickerson, Cheryl A; Wilson, James W


    Low fluid shear force, including that encountered in microgravity models, induces bacterial responses, but the range of bacteria capable of responding to this signal remains poorly characterized. We systematically analyzed a range of Gram negative Enterobacteriaceae for conservation of the low-shear modeled microgravity (LSMMG) response using phenotypic assays, qPCR, and targeted mutations. Our results indicate LSMMG response conservation across Enterobacteriacae with potential variance in up- or down-regulation of a given response depending on genus. Based on the data, we analyzed the role of the trp operon genes and the TrpR regulator in the LSMMG response using targeted mutations in these genes in S. Typhimurium and E. coli. We found no alteration of the LSMMG response compared to WT in these mutant strains under the conditions tested here. To our knowledge, this study is first-of-kind for Citrobacter, Enterobacter, and Serratia, presents novel data for Escherichia, and provides the first analysis of trp genes in LSMMG responses. This impacts our understanding of how LSMMG affects bacteria and our ability to modify bacteria with this condition in the future. PMID:25006354

  18. The conserved plant sterility gene HAP2 functions after attachment of fusogenic membranes in Chlamydomonas and Plasmodium gametes

    PubMed Central

    Liu, Yanjie; Tewari, Rita; Ning, Jue; Blagborough, Andrew M.; Garbom, Sara; Pei, Jimin; Grishin, Nick V.; Steele, Robert E.; Sinden, Robert E.; Snell, William J.; Billker, Oliver


    The cellular and molecular mechanisms that underlie species-specific membrane fusion between male and female gametes remain largely unknown. Here, by use of gene discovery methods in the green alga Chlamydomonas, gene disruption in the rodent malaria parasite Plasmodium berghei, and distinctive features of fertilization in both organisms, we report discovery of a mechanism that accounts for a conserved protein required for gamete fusion. A screen for fusion mutants in Chlamydomonas identified a homolog of HAP2, an Arabidopsis sterility gene. Moreover, HAP2 disruption in Plasmodium blocked fertilization and thereby mosquito transmission of malaria. HAP2 localizes at the fusion site of Chlamydomonas minus gametes, yet Chlamydomonas minus and Plasmodium hap2 male gametes retain the ability, using other, species-limited proteins, to form tight prefusion membrane attachments with their respective gamete partners. Membrane dye experiments show that HAP2 is essential for membrane merger. Thus, in two distantly related eukaryotes, species-limited proteins govern access to a conserved protein essential for membrane fusion. PMID:18367645

  19. A Functional Genomic Screen for Evolutionarily Conserved Genes Required for Lifespan and Immunity in Germline-Deficient C. elegans

    PubMed Central

    Sinha, Amit; Rae, Robbie


    The reproductive system regulates lifespan in insects, nematodes and vertebrates. In Caenorhabditis elegans removal of germline increases lifespan by 60% which is dependent upon insulin signaling, nuclear hormone signaling, autophagy and fat metabolism and their microRNA-regulators. Germline-deficient C. elegans are also more resistant to various bacterial pathogens but the underlying molecular mechanisms are largely unknown. Firstly, we demonstrate that previously identified genes that regulate the extended lifespan of germline-deficient C. elegans (daf-2, daf-16, daf-12, tcer-1, mir-7.1 and nhr-80) are also essential for resistance to the pathogenic bacterium Xenorhabdus nematophila. We then use a novel unbiased approach combining laser cell ablation, whole genome microarrays, RNAi screening and exposure to X. nematophila to generate a comprehensive genome-wide catalog of genes potentially required for increased lifespan and innate immunity in germline-deficient C. elegans. We find 3,440 genes to be upregulated in C. elegans germline-deficient animals in a gonad dependent manner, which are significantly enriched for genes involved in insulin signaling, fatty acid desaturation, translation elongation and proteasome complex function. Using RNAi against a subset of 150 candidate genes selected from the microarray results, we show that the upregulated genes such as transcription factor DAF-16/FOXO, the PTEN homolog lipid phosphatase DAF-18 and several components of the proteasome complex (rpn-6.1, rpn-7, rpn-9, rpn-10, rpt-6, pbs-3 and pbs-6) are essential for both lifespan and immunity of germline deficient animals. We also identify a novel role for genes including par-5 and T12G3.6 in both lifespan-extension and increased survival on X. nematophila. From an evolutionary perspective, most of the genes differentially expressed in germline deficient C. elegans also show a conserved expression pattern in germline deficient Pristionchus pacificus, a nematode species

  20. Differential Responses to Wnt and PCP Disruption Predict Expression and Developmental Function of Conserved and Novel Genes in a Cnidarian

    PubMed Central

    Lapébie, Pascal; Ruggiero, Antonella; Barreau, Carine; Chevalier, Sandra; Chang, Patrick; Dru, Philippe; Houliston, Evelyn; Momose, Tsuyoshi


    We have used Digital Gene Expression analysis to identify, without bilaterian bias, regulators of cnidarian embryonic patterning. Transcriptome comparison between un-manipulated Clytia early gastrula embryos and ones in which the key polarity regulator Wnt3 was inhibited using morpholino antisense oligonucleotides (Wnt3-MO) identified a set of significantly over and under-expressed transcripts. These code for candidate Wnt signaling modulators, orthologs of other transcription factors, secreted and transmembrane proteins known as developmental regulators in bilaterian models or previously uncharacterized, and also many cnidarian-restricted proteins. Comparisons between embryos injected with morpholinos targeting Wnt3 and its receptor Fz1 defined four transcript classes showing remarkable correlation with spatiotemporal expression profiles. Class 1 and 3 transcripts tended to show sustained expression at “oral” and “aboral” poles respectively of the developing planula larva, class 2 transcripts in cells ingressing into the endodermal region during gastrulation, while class 4 gene expression was repressed at the early gastrula stage. The preferential effect of Fz1-MO on expression of class 2 and 4 transcripts can be attributed to Planar Cell Polarity (PCP) disruption, since it was closely matched by morpholino knockdown of the specific PCP protein Strabismus. We conclude that endoderm and post gastrula-specific gene expression is particularly sensitive to PCP disruption while Wnt-/β-catenin signaling dominates gene regulation along the oral-aboral axis. Phenotype analysis using morpholinos targeting a subset of transcripts indicated developmental roles consistent with expression profiles for both conserved and cnidarian-restricted genes. Overall our unbiased screen allowed systematic identification of regionally expressed genes and provided functional support for a shared eumetazoan developmental regulatory gene set with both predicted and previously

  1. Computational identification of conserved transcription factor binding sites upstream of genes induced in rat brain by transient focal ischemic stroke.


    Pulliam, John V K; Xu, Zhenfeng; Ford, Gregory D; Liu, Cuimei; Li, Yonggang; Stovall, Kyndra C; Cannon, Virginetta S; Tewolde, Teclemichael; Moreno, Carlos S; Ford, Byron D


    Microarray analysis has been used to understand how gene regulation plays a critical role in neuronal injury, survival and repair following ischemic stroke. To identify the transcriptional regulatory elements responsible for ischemia-induced gene expression, we examined gene expression profiles of rat brains following focal ischemia and performed computational analysis of consensus transcription factor binding sites (TFBS) in the genes of the dataset. In this study, rats were sacrificed 24 h after middle cerebral artery occlusion (MCAO) stroke and gene transcription in brain tissues following ischemia/reperfusion was examined using Affymetrix GeneChip technology. The CONserved transcription FACtor binding site (CONFAC) software package was used to identify over-represented TFBS in the upstream promoter regions of ischemia-induced genes compared to control datasets. CONFAC identified 12 TFBS that were statistically over-represented from our dataset of ischemia-induced genes, including three members of the Ets-1 family of transcription factors (TFs). Microarray results showed that mRNA for Ets-1 was increased following tMCAO but not pMCAO. Immunohistochemical analysis of Ets-1 protein in rat brains following MCAO showed that Ets-1 was highly expressed in neurons in the brain of sham control animals. Ets-1 protein expression was virtually abolished in injured neurons of the ischemic brain but was unchanged in peri-infarct brain areas. These data indicate that TFs, including Ets-1, may influence neuronal injury following ischemia. These findings could provide important insights into the mechanisms that lead to brain injury and could provide avenues for the development of novel therapies. PMID:23246490

  2. Conserved variation: identifying patterns of stability and variability in BCR and TCR V genes with different diversity and richness metrics

    NASA Astrophysics Data System (ADS)

    Schwartz, Gregory W.; Hershberg, Uri


    The immune system can detect most invading pathogens. The potential for detection of pathogens is dependent on the somatic diversity of the immune repertoires. While it is known that this somatic diversity is carefully generated, it is unclear how the diversity is distributed in the different genes encoding receptors of immune cells. Utilizing different metrics for richness and diversity at the level of small sequence fragments, we present here an analysis of the entire known human germline repertoire as represented by the sequences from the ImMunoGeneTics database of immune receptors. We have developed a fragment sequence quantification analysis to track variation of repertoires with different degrees of precision. Somatic diversity has previously been functionally characterized mostly by division of the V gene sequences into the more conserved and invariant framework (FR) of the receptor and more varied complementarity determining regions (CDR), that interact with the antigen. We find that CDR and FR can be explicitly identified with our sequence fragment diversity quantification technique. In terms of diversity, CDR and FR are especially distinct in B cell V genes. T cell V genes show less of the CDR/FR periodicity but are more diverse overall. Our analysis further shows that there are other areas of diversity outside the CDR and FR that are found widely dispersed in T cell receptor V genes and more tightly focused in FR1 and FR3 in the B cell receptor V genes. The diversity we observe is not dependent on allelic differences nor is this diversity segregated by individual V gene families. We would thus expect that each individual exhibit a diversity equivalent to that of the entire potential repertoire.

  3. Conservation of a vitellogenin gene cluster in oviparous vertebrates and identification of its traces in the platypus genome.


    Babin, Patrick J


    Vitellogenin (Vtg) derivatives are the main egg-yolk proteins in most oviparous animal species, and are, therefore, key players in reproduction and embryo development. Conserved synteny and phylogeny were used to identify a Vtg gene cluster (VGC) that had been evolutionarily conserved in most oviparous vertebrates, encompassing the three linked Vtgs on chicken (Gallus gallus) chromosome 8. Tandem arranged homologs to chicken VtgII and VtgIII were retrieved in similar locations in Xenopus (Xenopus tropicalis) and homologous transcribed inverted genes were found in medaka (Oryzias latipes), stickleback (Gasterosteus aculeatus), pufferfish (Takifugu rubripes), and Tetrahodon (Tetraodon nigroviridis), while zebrafish (Danio rerio) Vtg3 may represent a residual trace of VGC in this genome. Vtgs were not conserved in the paralogous chromosomal segment attributed to a whole-genome duplication event in the ancestor of teleosts, while tandem duplicated forms have survived the recent African clawed frog (Xenopus laevis) tetraploidization. Orthologs to chicken VtgI were found in similar locations in teleost fish, as well as in the platypus (Ornithorhynchus anatinus). Additional Vtg fragments found suggested that VGC had been conserved in this egg-laying mammal. A low ratio of nonsynonymous-to-synonymous substitution values and the paucity of pseudogene features suggest functional platypus Vtg products. Genomic identification of Vtgs, Apob, and Mtp in this genome, together with maximum likelihood and Bayesian inference phylogenetic analyses, support the existence of these three large lipid transfer protein superfamily members at the base of the mammalian lineage. In conclusion, the establishment of a VGC in the vertebrate lineage predates the divergence of ray-finned fish and tetrapods and the shift in reproductive and developmental strategy observed between prototherians and therians may be associated with its loss, as shown by its absence from the genomic resources currently

  4. Identification of Novel Human Genes Evolutionarily Conserved in Caenorhabditis elegans by Comparative Proteomics

    PubMed Central

    Lai, Chun-Hung; Chou, Chang-Yuan; Ch'ang, Lan-Yang; Liu, Chung-Shyan; Lin, Wen-chang


    Modern biomedical research greatly benefits from large-scale genome-sequencing projects ranging from studies of viruses, bacteria, and yeast to multicellular organisms, like Caenorhabditis elegans. Comparative genomic studies offer a vast array of prospects for identification and functional annotation of human ortholog genes. We presented a novel comparative proteomic approach for assembling human gene contigs and assisting gene discovery. The C. elegans proteome was used as an alignment template to assist in novel human gene identification from human EST nucleotide databases. Among the available 18,452 C. elegans protein sequences, our results indicate that at least 83% (15,344 sequences) of C. elegans proteome has human homologous genes, with 7,954 records of C. elegans proteins matching known human gene transcripts. Only 11% or less of C. elegans proteome contains nematode-specific genes. We found that the remaining 7,390 sequences might lead to discoveries of novel human genes, and over 150 putative full-length human gene transcripts were assembled upon further database analyses. [The sequence data described in this paper have been submitted to the GenBank data library under accession nos. AF132936–AF132973, AF151799–AF151909, and AF152097.] PMID:10810093

  5. Pi class glutathione S-transferase genes are regulated by Nrf 2 through an evolutionarily conserved regulatory element in zebrafish

    PubMed Central

    Suzuki, Takafumi; Takagi, Yaeko; Osanai, Hitoshi; Li, Li; Takeuchi, Miki; Katoh, Yasutake; Kobayashi, Makoto; Yamamoto, Masayuki


    Pi class GSTs (glutathione S-transferases) are a member of the vertebrate GST family of proteins that catalyse the conjugation of GSH to electrophilic compounds. The expression of Pi class GST genes can be induced by exposure to electrophiles. We demonstrated previously that the transcription factor Nrf 2 (NF-E2 p45-related factor 2) mediates this induction, not only in mammals, but also in fish. In the present study, we have isolated the genomic region of zebrafish containing the genes gstp1 and gstp2. The regulatory regions of zebrafish gstp1 and gstp2 have been examined by GFP (green fluorescent protein)-reporter gene analyses using microinjection into zebrafish embryos. Deletion and point-mutation analyses of the gstp1 promoter showed that an ARE (antioxidant-responsive element)-like sequence is located 50 bp upstream of the transcription initiation site which is essential for Nrf 2 transactivation. Using EMSA (electrophoretic mobility-shift assay) analysis we showed that zebrafish Nrf 2–MafK heterodimer specifically bound to this sequence. All the vertebrate Pi class GST genes harbour a similar ARE-like sequence in their promoter regions. We propose that this sequence is a conserved target site for Nrf 2 in the Pi class GST genes. PMID:15654768

  6. SPN1, a conserved gene identified by suppression of a postrecruitment-defective yeast TATA-binding protein mutant.

    PubMed Central

    Fischbeck, Julie A; Kraemer, Susan M; Stargell, Laurie A


    Little is known about TATA-binding protein (TBP) functions after recruitment to the TATA element, although several TBP mutants display postrecruitment defects. Here we describe a genetic screen for suppressors of a postrecruitment-defective TBP allele. Suppression was achieved by a single point mutation in a previously uncharacterized Saccharomyces cerevisiae gene, SPN1 (suppresses postrecruitment functions gene number 1). SPN1 is an essential yeast gene that is highly conserved throughout evolution. The suppressing mutation in SPN1 substitutes an asparagine for an invariant lysine at position 192 (spn1(K192N)). The spn1(K192N) strain is able to suppress additional alleles of TBP that possess postrecruitment defects, but not a TBP allele that is postrecruitment competent. In addition, Spn1p does not stably associate with TFIID in vivo. Cells containing the spn1(K192N) allele exhibit a temperature-sensitive phenotype and some defects in activated transcription, whereas constitutive transcription appears relatively robust in the mutant background. Consistent with an important role in postrecruitment functions, transcription from the CYC1 promoter, which has been shown to be regulated by postrecruitment mechanisms, is enhanced in spn1(K192N) cells. Moreover, we find that SPN1 is a member of the SPT gene family, further supporting a functional requirement for the SPN1 gene product in transcriptional processes. PMID:12524336

  7. Overexpression screens identify conserved dosage chromosome instability genes in yeast and human cancer.


    Duffy, Supipi; Fam, Hok Khim; Wang, Yi Kan; Styles, Erin B; Kim, Jung-Hyun; Ang, J Sidney; Singh, Tejomayee; Larionov, Vladimir; Shah, Sohrab P; Andrews, Brenda; Boerkoel, Cornelius F; Hieter, Philip


    Somatic copy number amplification and gene overexpression are common features of many cancers. To determine the role of gene overexpression on chromosome instability (CIN), we performed genome-wide screens in the budding yeast for yeast genes that cause CIN when overexpressed, a phenotype we refer to as dosage CIN (dCIN), and identified 245 dCIN genes. This catalog of genes reveals human orthologs known to be recurrently overexpressed and/or amplified in tumors. We show that two genes, TDP1, a tyrosyl-DNA-phosphdiesterase, and TAF12, an RNA polymerase II TATA-box binding factor, cause CIN when overexpressed in human cells. Rhabdomyosarcoma lines with elevated human Tdp1 levels also exhibit CIN that can be partially rescued by siRNA-mediated knockdown of TDP1 Overexpression of dCIN genes represents a genetic vulnerability that could be leveraged for selective killing of cancer cells through targeting of an unlinked synthetic dosage lethal (SDL) partner. Using SDL screens in yeast, we identified a set of genes that when deleted specifically kill cells with high levels of Tdp1. One gene was the histone deacetylase RPD3, for which there are known inhibitors. Both HT1080 cells overexpressing hTDP1 and rhabdomyosarcoma cells with elevated levels of hTdp1 were more sensitive to histone deacetylase inhibitors valproic acid (VPA) and trichostatin A (TSA), recapitulating the SDL interaction in human cells and suggesting VPA and TSA as potential therapeutic agents for tumors with elevated levels of hTdp1. The catalog of dCIN genes presented here provides a candidate list to identify genes that cause CIN when overexpressed in cancer, which can then be leveraged through SDL to selectively target tumors. PMID:27551064

  8. GeConT 2: gene context analysis for orthologous proteins, conserved domains and metabolic pathways

    PubMed Central

    Martinez-Guerrero, C. E.; Ciria, R.; Abreu-Goodger, C.; Moreno-Hagelsieb, G.; Merino, E.


    The Gene Context Tool (GeConT) allows users to visualize the genomic context of a gene or a group of genes and their orthologous relationships within fully sequenced bacterial genomes. The new version of the server incorporates information from the COG, Pfam and KEGG databases, allowing users to have an integrated graphical representation of the function of genes at multiple levels, their phylogenetic distribution and their genomic context. The sequence of any of the genes can be easily retrieved, as well as the 5′ or 3′ regulatory regions, greatly facilitating further types of analysis. GeConT 2 is available at: PMID:18511460

  9. An Amphioxus Gli Gene Reveals Conservation of Midline Patterning and the Evolution of Hedgehog Signalling Diversity in Chordates

    PubMed Central

    Shimeld, Sebastian M.; van den Heuvel, Marcel; Dawber, Rebecca; Briscoe, James


    Background Hedgehog signalling, interpreted in receiving cells by Gli transcription factors, plays a central role in the development of vertebrate and Drosophila embryos. Many aspects of the signalling pathway are conserved between these lineages, however vertebrates have diverged in at least one key aspect: they have evolved multiple Gli genes encoding functionally-distinct proteins, increasing the complexity of the hedgehog-dependent transcriptional response. Amphioxus is one of the closest living relatives of the vertebrates, having split from the vertebrate lineage prior to the widespread gene duplication prominent in early vertebrate evolution. Principal Findings We show that amphioxus has a single Gli gene, which is deployed in tissues adjacent to sources of hedgehog signalling derived from the midline and anterior endoderm. This shows the duplication and divergence of the Gli gene family, and hence the origin of vertebrate Gli functional diversity, was specific to the vertebrate lineage. However we also show that the single amphioxus Gli gene produces two distinct transcripts encoding different proteins. We utilise three tests of Gli function to examine the transcription regulatory capacities of these different proteins, demonstrating one has activating activity similar to Gli2, while the other acts as a weak repressor, similar to Gli3. Conclusions These data show that vertebrates and amphioxus have evolved functionally-similar repertoires of Gli proteins using parallel molecular routes; vertebrates via gene duplication and divergence, and amphioxus via alternate splicing of a single gene. Our results demonstrate that similar functional complexity of intercellular signalling can be achieved via different evolutionary pathways. PMID:17848995

  10. Abscisic acid-induced gene expression in the liverwort Marchantia polymorpha is mediated by evolutionarily conserved promoter elements.


    Ghosh, Totan K; Kaneko, Midori; Akter, Khaleda; Murai, Shuhei; Komatsu, Kenji; Ishizaki, Kimitsune; Yamato, Katsuyuki T; Kohchi, Takayuki; Takezawa, Daisuke


    Abscisic acid (ABA) is a phytohormone widely distributed among members of the land plant lineage (Embryophyta), regulating dormancy, stomata closure and tolerance to environmental stresses. In angiosperms (Magnoliophyta), ABA-induced gene expression is mediated by promoter elements such as the G-box-like ACGT-core motifs recognized by bZIP transcription factors. In contrast, the mode of regulation by ABA of gene expression in liverworts (Marchantiophyta), representing one of the earliest diverging land plant groups, has not been elucidated. In this study, we used promoters of the liverwort Marchantia polymorpha dehydrin and the wheat Em genes fused to the β-glucuronidase (GUS) reporter gene to investigate ABA-induced gene expression in liverworts. Transient assays of cultured cells of Marchantia indicated that ACGT-core motifs proximal to the transcription initiation site play a role in the ABA-induced gene expression. The RY sequence recognized by B3 transcriptional regulators was also shown to be responsible for the ABA-induced gene expression. In transgenic Marchantia plants, ABA treatment elicited an increase in GUS expression in young gemmalings, which was abolished by simultaneous disruption of the ACGT-core and RY elements. ABA-induced GUS expression was less obvious in mature thalli than in young gemmalings, associated with reductions in sensitivity to exogenous ABA during gametophyte growth. In contrast, lunularic acid, which had been suggested to function as an ABA-like substance, had no effect on GUS expression. The results demonstrate the presence of ABA-specific response mechanisms mediated by conserved cis-regulatory elements in liverworts, implying that the mechanisms had been acquired in the common ancestors of embryophytes. PMID:26456006

  11. Human Polynucleotide Phosphorylase (hPNPaseold-35): An evolutionary conserved gene with an expanding repertoire of RNA degradation functions

    PubMed Central

    Das, Swadesh K.; Bhutia, Sujit K.; Sokhi, Upneet K.; Dash, Rupesh; Azab, Belal; Sarkar, Devanand; Fisher, Paul B.


    Human polynucleotide phosphorylase (hPNPaseold-35) is an evolutionary conserved RNA processing enzyme with expanding roles in regulating cellular physiology. hPNPaseold-35 was cloned using an innovative “overlapping pathway screening” strategy designed to identify genes coordinately regulated during the processes of cellular differentiation and senescence. Although hPNPaseold-35 structurally and biochemically resembles PNPase of other species, overexpression and inhibition studies reveal that hPNPaseold-35 has evolved to serve more specialized and diversified functions in humans. Targeting specific mRNA or non-coding small microRNA (miRNA), hPNPaseold-35 modulates gene expression that in turn plays a pivotal role in regulating normal physiological and pathological processes. In these contexts, targeted overexpression of hPNPaseold-35 represents a novel strategy to selectively downregulate RNA expression and consequently intervene in a variety of pathophysiological conditions. PMID:21151174

  12. Comparative Mitogenomics of Leeches (Annelida: Clitellata): Genome Conservation and Placobdella-Specific trnD Gene Duplication

    PubMed Central

    Moya, Andrés; Siddall, Mark E.; Latorre, Amparo


    Mitochondrial DNA sequences, often in combination with nuclear markers and morphological data, are frequently used to unravel the phylogenetic relationships, population dynamics and biogeographic histories of a plethora of organisms. The information provided by examining complete mitochondrial genomes also enables investigation of other evolutionary events such as gene rearrangements, gene duplication and gene loss. Despite efforts to generate information to represent most of the currently recognized groups, some taxa are underrepresented in mitochondrial genomic databases. One such group is leeches (Annelida: Hirudinea: Clitellata). Herein, we expand our knowledge concerning leech mitochondrial makeup including gene arrangement, gene duplication and the evolution of mitochondrial genomes by adding newly sequenced mitochondrial genomes for three bloodfeeding species: Haementeria officinalis, Placobdella lamothei and Placobdella parasitica. With the inclusion of three new mitochondrial genomes of leeches, a better understanding of evolution for this organelle within the group is emerging. We found that gene order and genomic arrangement in the three new mitochondrial genomes is identical to previously sequenced members of Clitellata. Interestingly, within Placobdella, we recovered a genus-specific duplication of the trnD gene located between cox2 and atp8. We performed phylogenetic analyses using 12 protein-coding genes and expanded our taxon sampling by including GenBank sequences for 39 taxa; the analyses confirm the monophyletic status of Clitellata, yet disagree in several respects with other phylogenetic hypotheses based on morphology and analyses of non-mitochondrial data. PMID:27176910

  13. Comparative Mitogenomics of Leeches (Annelida: Clitellata): Genome Conservation and Placobdella-Specific trnD Gene Duplication.


    Oceguera-Figueroa, Alejandro; Manzano-Marín, Alejandro; Kvist, Sebastian; Moya, Andrés; Siddall, Mark E; Latorre, Amparo


    Mitochondrial DNA sequences, often in combination with nuclear markers and morphological data, are frequently used to unravel the phylogenetic relationships, population dynamics and biogeographic histories of a plethora of organisms. The information provided by examining complete mitochondrial genomes also enables investigation of other evolutionary events such as gene rearrangements, gene duplication and gene loss. Despite efforts to generate information to represent most of the currently recognized groups, some taxa are underrepresented in mitochondrial genomic databases. One such group is leeches (Annelida: Hirudinea: Clitellata). Herein, we expand our knowledge concerning leech mitochondrial makeup including gene arrangement, gene duplication and the evolution of mitochondrial genomes by adding newly sequenced mitochondrial genomes for three bloodfeeding species: Haementeria officinalis, Placobdella lamothei and Placobdella parasitica. With the inclusion of three new mitochondrial genomes of leeches, a better understanding of evolution for this organelle within the group is emerging. We found that gene order and genomic arrangement in the three new mitochondrial genomes is identical to previously sequenced members of Clitellata. Interestingly, within Placobdella, we recovered a genus-specific duplication of the trnD gene located between cox2 and atp8. We performed phylogenetic analyses using 12 protein-coding genes and expanded our taxon sampling by including GenBank sequences for 39 taxa; the analyses confirm the monophyletic status of Clitellata, yet disagree in several respects with other phylogenetic hypotheses based on morphology and analyses of non-mitochondrial data. PMID:27176910

  14. Phylogenetic relationships among insect orders based on three nuclear protein-coding gene sequences.


    Ishiwata, Keisuke; Sasaki, Go; Ogawa, Jiro; Miyata, Takashi; Su, Zhi-Hui


    Many attempts to resolve the phylogenetic relationships of higher groups of insects have been made based on both morphological and molecular evidence; nonetheless, most of the interordinal relationships of insects remain unclear or are controversial. As a new approach, in this study we sequenced three nuclear genes encoding the catalytic subunit of DNA polymerase delta and the two largest subunits of RNA polymerase II from all insect orders. The predicted amino acid sequences (In total, approx. 3500 amino acid sites) of these proteins were subjected to phylogenetic analyses based on the maximum likelihood and Bayesian analysis methods with various models. The resulting trees strongly support the monophyly of Palaeoptera, Neoptera, Polyneoptera, and Holometabola, while within Polyneoptera, the groupings of Isoptera/"Blattaria"/Mantodea (Superorder Dictyoptera), Dictyoptera/Zoraptera, Dermaptera/Plecoptera, Mantophasmatodea/Grylloblattodea, and Embioptera/Phasmatodea are supported. Although Paraneoptera is not supported as a monophyletic group, the grouping of Phthiraptera/Psocoptera is robustly supported. The interordinal relationships within Holometabola are well resolved and strongly supported that the order Hymenoptera is the sister lineage to all other holometabolous insects. The other orders of Holometabola are separated into two large groups, and the interordinal relationships of each group are (((Siphonaptera, Mecoptera), Diptera), (Trichoptera, Lepidoptera)) and ((Coleoptera, Strepsiptera), (Neuroptera, Raphidioptera, Megaloptera)). The sister relationship between Strepsiptera and Diptera are significantly rejected by all the statistical tests (AU, KH and wSH), while the affinity between Hymenoptera and Mecopterida are significantly rejected only by AU and KH tests. Our results show that the use of amino acid sequences of these three nuclear genes is an effective approach for resolving the relationships of higher groups of insects. PMID:21075208

  15. Evolutionary conservation of candidate osmoregulation genes in plant phloem sap-feeding insects.


    Jing, X; White, T A; Luan, J; Jiao, C; Fei, Z; Douglas, A E


    The high osmotic pressure generated by sugars in plant phloem sap is reduced in phloem-feeding aphids by sugar transformations and facilitated water flux in the gut. The genes mediating these osmoregulatory functions have been identified and validated empirically in the pea aphid Acyrthosiphon pisum: sucrase 1 (SUC1), a sucrase in glycoside hydrolase family 13 (GH13), and aquaporin 1 (AQP1), a member of the Drosophila integral protein (DRIP) family of aquaporins. Here, we describe molecular analysis of GH13 and AQP genes in phloem-feeding representatives of the four phloem-feeding groups: aphids (Myzus persicae), coccids (Planococcus citri), psyllids (Diaphorina citri, Bactericera cockerelli) and whiteflies (Bemisia tabaci MEAM1 and MED). A single candidate GH13-SUC gene and DRIP-AQP gene were identified in the genome/transcriptome of most insects tested by the criteria of sequence motif and gene expression in the gut. Exceptionally, the psyllid Ba. cockerelli transcriptome included a gut-expressed Pyrocoelia rufa integral protein (PRIP)-AQP, but has no DRIP-AQP transcripts, suggesting that PRIP-AQP is recruited for osmoregulatory function in this insect. This study indicates that phylogenetically related SUC and AQP genes may generally mediate osmoregulatory functions in these diverse phloem-feeding insects, and provides candidate genes for empirical validation and development as targets for osmotic disruption of pest species. PMID:26896054

  16. The Drosophila wings apart gene anchors a novel, evolutionarily conserved pathway of neuromuscular development.


    Morriss, Ginny R; Jaramillo, Carmelita T; Mikolajczak, Crystal M; Duong, Sandy; Jaramillo, Maryann S; Cripps, Richard M


    wings apart (wap) is a recessive, semilethal gene located on the X chromosome in Drosophila melanogaster, which is required for normal wing-vein patterning. We show that the wap mutation also results in loss of the adult jump muscle. We use complementation mapping and gene-specific RNA interference to localize the wap locus to the proximal X chromosome. We identify the annotated gene CG14614 as the gene affected by the wap mutation, since one wap allele contains a non-sense mutation in CG14614, and a genomic fragment containing only CG14614 rescues the jump-muscle phenotypes of two wap mutant alleles. The wap gene lies centromere-proximal to touch-insensitive larva B and centromere-distal to CG14619, which is tentatively assigned as the gene affected in introverted mutants. In mutant wap animals, founder cell precursors for the jump muscle are specified early in development, but are later lost. Through tissue-specific knockdowns, we demonstrate that wap function is required in both the musculature and the nervous system for normal jump-muscle formation. wap/CG14614 is homologous to vertebrate wdr68, DDB1 and CUL4 associated factor 7, which also are expressed in neuromuscular tissues. Thus, our findings provide insight into mechanisms of neuromuscular development in higher animals and facilitate the understanding of neuromuscular diseases that may result from mis-expression of muscle-specific or neuron-specific genes. PMID:24026097

  17. The sexually dimorphic on the Y-chromosome gene (sdY) is a conserved male-specific Y-chromosome sequence in many salmonids

    PubMed Central

    Yano, Ayaka; Nicol, Barbara; Jouanno, Elodie; Quillet, Edwige; Fostier, Alexis; Guyomard, René; Guiguen, Yann


    All salmonid species investigated to date have been characterized with a male heterogametic sex-determination system. However, as these species do not share any Y-chromosome conserved synteny, there remains a debate on whether they share a common master sex-determining gene. In this study, we investigated the extent of conservation and evolution of the rainbow trout (Oncorhynchus mykiss) master sex-determining gene, sdY (sexually dimorphic on the Y-chromosome), in 15 different species of salmonids. We found that the sdY sequence is highly conserved in all salmonids and that sdY is a male-specific Y-chromosome gene in the majority of these species. These findings demonstrate that most salmonids share a conserved sex-determining locus and also strongly suggest that sdY may be this conserved master sex-determining gene. However, in two whitefish species (subfamily Coregoninae), sdY was found both in males and females, suggesting that alternative sex-determination systems may have also evolved in this family. Based on the wide conservation of sdY as a male-specific Y-chromosome gene, efficient and easy molecular sexing techniques can now be developed that will be of great interest for studying these economically and environmentally important species. PMID:23745140

  18. Stress Responses of Small Heat Shock Protein Genes in Lepidoptera Point to Limited Conservation of Function across Phylogeny

    PubMed Central

    Zhang, Bo; Zheng, Jincheng; Peng, Yu; Liu, Xiaoxia; Hoffmann, Ary A.; Ma, Chun-Sen


    The small heat shock protein (sHsp) family is thought to play an important role in protein refolding and signal transduction, and thereby protect organisms from stress. However little is known about sHsp function and conservation across phylogenies. In the current study, we provide a comprehensive assessment of small Hsp genes and their stress responses in the oriental fruit moth (OFM), Grapholita molesta. Fourteen small heat shock proteins of OFM clustered with related Hsps in other Lepidoptera despite a high level of variability among them, and in contrast to the highly conserved Hsp11.1. The only known lepidopteran sHsp ortholog (Hsp21.3) was consistently unaffected under thermal stress in Lepidoptera where it has been characterized. However the phylogenetic position of the sHsps within the Lepidoptera was not associated with conservation of induction patterns under thermal extremes or diapause. These findings suggest that the sHsps have evolved rapidly to develop new functions within the Lepidoptera. PMID:26196395

  19. Different Sets of Post-Embryonic Development Genes Are Conserved or Lost in Two Caryophyllales Species (Reaumuria soongorica and Agriophyllum squarrosum).


    Zhao, Pengshan; Zhang, Jiwei; Zhao, Xin; Chen, Guoxiong; Ma, Xiao-Fei


    Reaumuria soongorica and sand rice (Agriophyllum squarrosum) belong to the clade of Caryophyllales and are widely distributed in the desert regions of north China. Both plants have evolved many specific traits and adaptation strategies to cope with recurring environmental threats. However, the genetic basis that underpins their unique traits and adaptation remains unknown. In this study, the transcriptome data of R. soongorica and sand rice were compared with three other species with previously sequenced genomes (Arabidopsis thaliana, Oryza sativa, and Beta vulgaris). Four different gene sets were identified, namely, the genes conserved in both species, those lost in both species, those conserved in R. soongorica only, and those conserved in sand rice only. Gene ontology showed that post-embryonic development genes (PEDGs) were enriched in all gene sets, and different sets of PEDGs were conserved or lost in both the R. soongorica and sand rice genomes. Expression profiles of Arabidopsis orthologs further provided some clues to the function of the species-specific conserved PEDGs. Such orthologs included LEAFY PETIOLE, which could be a candidate gene involved in the development of branch priority in sand rice. PMID:26815143

  20. Different Sets of Post-Embryonic Development Genes Are Conserved or Lost in Two Caryophyllales Species (Reaumuria soongorica and Agriophyllum squarrosum)

    PubMed Central

    Zhao, Pengshan; Zhang, Jiwei; Zhao, Xin; Chen, Guoxiong; Ma, Xiao-Fei


    Reaumuria soongorica and sand rice (Agriophyllum squarrosum) belong to the clade of Caryophyllales and are widely distributed in the desert regions of north China. Both plants have evolved many specific traits and adaptation strategies to cope with recurring environmental threats. However, the genetic basis that underpins their unique traits and adaptation remains unknown. In this study, the transcriptome data of R. soongorica and sand rice were compared with three other species with previously sequenced genomes (Arabidopsis thaliana, Oryza sativa, and Beta vulgaris). Four different gene sets were identified, namely, the genes conserved in both species, those lost in both species, those conserved in R. soongorica only, and those conserved in sand rice only. Gene ontology showed that post-embryonic development genes (PEDGs) were enriched in all gene sets, and different sets of PEDGs were conserved or lost in both the R. soongorica and sand rice genomes. Expression profiles of Arabidopsis orthologs further provided some clues to the function of the species-specific conserved PEDGs. Such orthologs included LEAFY PETIOLE, which could be a candidate gene involved in the development of branch priority in sand rice. PMID:26815143

  1. An expanded inventory of conserved meiotic genes provides evidence for sex in Trichomonas vaginalis.


    Malik, Shehre-Banoo; Pightling, Arthur W; Stefaniak, Lauren M; Schurko, Andrew M; Logsdon, John M


    Meiosis is a defining feature of eukaryotes but its phylogenetic distribution has not been broadly determined, especially among eukaryotic microorganisms (i.e. protists)-which represent the majority of eukaryotic 'supergroups'. We surveyed genomes of animals, fungi, plants and protists for meiotic genes, focusing on the evolutionarily divergent parasitic protist Trichomonas vaginalis. We identified homologs of 29 components of the meiotic recombination machinery, as well as the synaptonemal and meiotic sister chromatid cohesion complexes. T. vaginalis has orthologs of 27 of 29 meiotic genes, including eight of nine genes that encode meiosis-specific proteins in model organisms. Although meiosis has not been observed in T. vaginalis, our findings suggest it is either currently sexual or a recent asexual, consistent with observed, albeit unusual, sexual cycles in their distant parabasalid relatives, the hypermastigotes. T. vaginalis may use meiotic gene homologs to mediate homologous recombination and genetic exchange. Overall, this expanded inventory of meiotic genes forms a useful "meiosis detection toolkit". Our analyses indicate that these meiotic genes arose, or were already present, early in eukaryotic evolution; thus, the eukaryotic cenancestor contained most or all components of this set and was likely capable of performing meiotic recombination using near-universal meiotic machinery. PMID:18663385

  2. Autosomal location of genes from the conserved mammalian X in the platypus (Ornithorhynchus anatinus): implications for mammalian sex chromosome evolution.


    Waters, Paul D; Delbridge, Margaret L; Deakin, Janine E; El-Mogharbel, Nisrine; Kirby, Patrick J; Carvalho-Silva, Denise R; Graves, Jennifer A Marshall


    Mammalian sex chromosomes evolved from an ancient autosomal pair. Mapping of human X- and Y-borne genes in distantly related mammals and non-mammalian vertebrates has proved valuable to help deduce the evolution of this unique part of the genome. The platypus, a monotreme mammal distantly related to eutherians and marsupials, has an extraordinary sex chromosome system comprising five X and five Y chromosomes that form a translocation chain at male meiosis. The largest X chromosome (X1), which lies at one end of the chain, has considerable homology to the human X. Using comparative mapping and the emerging chicken database, we demonstrate that part of the therian X chromosome, previously thought to be conserved across all mammals, was lost from the platypus X1 to an autosome. This region included genes flanking the XIST locus, and also genes with Y-linked homologues that are important to male reproduction in therians. Since these genes lie on the X in marsupials and eutherians, and also on the homologous region of chicken chromosome 4, this represents a loss from the monotreme X rather than an additional evolutionary stratum of the human X. PMID:15973504

  3. cDNA sequence, genomic organization, and evolutionary conservation of a novel gene from the WAGR region

    SciTech Connect

    Schwartz, F.; Eisenman, R.; Knoll, J.; Bruns, G.


    A new gene (239FB) with predominant and differential expression in fetal brain has recently been isolated from a chromosome 11p13-p14 boundary area near FSHB. The corresponding mRNA has an open reading frame of 294 amino acids, a 3` untranslated region of 1247 nucleotides, and a highly GC-rich 5` untranslated region. The coding and 3` UT sequence is specified by 6 exons within nearly 87 kb of isolated genomic locus. The 5` end region of the transcript maps adjacent to the only genomically defined CpG island in a chromosomal subregion that may be associated with part of the mental retardation of some WAGR (Wilms tumor, aniridia, genitourinary anomalies, and mental retardation) syndrome patients. In addition to nucleotide and amino acid similarity to an EST from a normalized infant brain cDNA library, the predicted protein has extensive similarity to Caenorhbditis elegans polypeptides of, as yet, unknown function. The 239FB locus is, therefore, likely part of a family of genes with two members expressed in human brain. The extensive conservation of the predicted protein suggests a fundamental function of the gene product and will enable evaluation of the role of the 239FB gene in neurogenesis in model organisms. 48 refs., 4 figs., 1 tab.

  4. Conserved factor Dhp1/Rat1/Xrn2 triggers premature transcription termination and nucleates heterochromatin to promote gene silencing

    PubMed Central

    Chalamcharla, Venkata R.; Folco, H. Diego; Dhakshnamoorthy, Jothy; Grewal, Shiv I. S.


    Cotranscriptional RNA processing and surveillance factors mediate heterochromatin formation in diverse eukaryotes. In fission yeast, RNAi machinery and RNA elimination factors including the Mtl1–Red1 core and the exosome are involved in facultative heterochromatin assembly; however, the exact mechanisms remain unclear. Here we show that RNA elimination factors cooperate with the conserved exoribonuclease Dhp1/Rat1/Xrn2, which couples pre-mRNA 3′-end processing to transcription termination, to promote premature termination and facultative heterochromatin formation at meiotic genes. We also find that Dhp1 is critical for RNAi-mediated heterochromatin assembly at retroelements and regulated gene loci and facilitates the formation of constitutive heterochromatin at centromeric and mating-type loci. Remarkably, our results reveal that Dhp1 interacts with the Clr4/Suv39h methyltransferase complex and acts directly to nucleate heterochromatin. Our work uncovers a previously unidentified role for 3′-end processing and transcription termination machinery in gene silencing through premature termination and suggests that noncanonical transcription termination by Dhp1 and RNA elimination factors is linked to heterochromatin assembly. These findings have important implications for understanding silencing mechanisms targeting genes and repeat elements in higher eukaryotes. PMID:26631744

  5. Comparative analysis of zygotic developmental genes in Rhodnius prolixus genome shows conserved features on the tracheal developmental pathway.


    Lavore, A; Pascual, A; Salinas, F M; Esponda-Behrens, N; Martinez-Barnetche, J; Rodriguez, M; Rivera-Pomar, R


    Most of the in-depth studies on insect developmental genetic have been carried out in the fruit fly Drosophila melanogaster, an holometabolous insect, so much more still remains to be studied in hemimetabolous insects. Having Rhodnius prolixus sequenced genome available, we search for orthologue genes of zygotic signaling pathways, segmentation, and tracheogenesis in the R. prolixus genome and in three species of Triatoma genus transcriptomes, concluding that there is a high level of gene conservation. We also study the function of two genes required for tracheal system development in D. melanogaster - R. prolixus orthologues: trachealess (Rp-trh) and empty spiracles (Rp-ems). From that we see that Rp-trh is required for early tracheal development since Rp-trh RNAi shows that the primary tracheal branches fail to form. On the other hand, Rp-ems is implied in the proper formation of the posterior tracheal branches, in a similar way to D. melanogaster. These results represent the initial characterization of the genes involved in the tracheal development of an hemimetabolous insect building a bridge between the current genomic era and V. Wigglesworth's classical studies on insects' respiratory system physiology. PMID:26187251

  6. Computational identification and characterization of conserved miRNAs and their target genes in beet (Beta vulgaris).


    Li, J L; Cui, J; Cheng, D Y


    Highly conserved endogenous non-coding microRNAs (miRNAs) play important roles in plants and animals by silencing genes via destruction or blocking of translation of homologous mRNA. Sugar beet, Beta vulgaris, is one of the most important sugar crops in China, with properties that include wide adaptability and strong tolerance to salinity and impoverished soils. Seedlings of B. vulgaris can grow in soils containing up to 0.6% salt; it is important to understand the molecular mechanisms of salt tolerance to enrich genetic resources for breeding salt-tolerant sugar beets. Here, we report 13 mature miRNAs from 12 families, predicted using an in silico approach from 29,857 expressed sequence tags and 279,223 genome survey sequences. The psRNATarget server predicted 25 target genes for the 13 miRNAs. Most of the target genes appeared to encode transcription factors or were involved in metabolism, signal transduction, stress response, growth, and development. These results improve our understanding of the molecular mechanisms of miRNA in beet and may aid in the development of novel and precise techniques for understanding post-transcriptional gene-silencing mechanisms in response to stress tolerance. PMID:26345842

  7. Automated conserved non-coding sequence (CNS) discovery reveals differences in gene content and promoter evolution among grasses

    PubMed Central

    Turco, Gina; Schnable, James C.; Pedersen, Brent; Freeling, Michael


    Conserved non-coding sequences (CNS) are islands of non-coding sequence that, like protein coding exons, show less divergence in sequence between related species than functionless DNA. Several CNSs have been demonstrated experimentally to function as cis-regulatory regions. However, the specific functions of most CNSs remain unknown. Previous searches for CNS in plants have either anchored on exons and only identified nearby sequences or required years of painstaking manual annotation. Here we present an open source tool that can accurately identify CNSs between any two related species with sequenced genomes, including both those immediately adjacent to exons and distal sequences separated by >12 kb of non-coding sequence. We have used this tool to characterize new motifs, associate CNSs with additional functions, and identify previously undetected genes encoding RNA and protein in the genomes of five grass species. We provide a list of 15,363 orthologous CNSs conserved across all grasses tested. We were also able to identify regulatory sequences present in the common ancestor of grasses that have been lost in one or more extant grass lineages. Lists of orthologous gene pairs and associated CNSs are provided for reference inbred lines of arabidopsis, Japonica rice, foxtail millet, sorghum, brachypodium, and maize. PMID:23874343

  8. Rapid pair-wise synteny analysis of large bacterial genomes using web-based GeneOrder4.0

    PubMed Central


    Background The growing whole genome sequence databases necessitate the development of user-friendly software tools to mine these data. Web-based tools are particularly useful to wet-bench biologists as they enable platform-independent analysis of sequence data, without having to perform complex programming tasks and software compiling. Findings GeneOrder4.0 is a web-based "on-the-fly" synteny and gene order analysis tool for comparative bacterial genomics (ca. 8 Mb). It enables the visualization of synteny by plotting protein similarity scores between two genomes and it also provides visual annotation of "hypothetical" proteins from older archived genomes based on more recent annotations. Conclusions The web-based software tool GeneOrder4.0 is a user-friendly application that has been updated to allow the rapid analysis of synteny and gene order in large bacterial genomes. It is developed with the wet-bench researcher in mind. PMID:20178631

  9. Climate-Driven Reshuffling of Species and Genes: Potential Conservation Roles for Species Translocations and Recombinant Hybrid Genotypes.


    Scriber, Jon Mark


    Comprising 50%-75% of the world's fauna, insects are a prominent part of biodiversity in communities and ecosystems globally. Biodiversity across all levels of biological classifications is fundamentally based on genetic diversity. However, the integration of genomics and phylogenetics into conservation management may not be as rapid as climate change. The genetics of hybrid introgression as a source of novel variation for ecological divergence and evolutionary speciation (and resilience) may generate adaptive potential and diversity fast enough to respond to locally-altered environmental conditions. Major plant and herbivore hybrid zones with associated communities deserve conservation consideration. This review addresses functional genetics across multi-trophic-level interactions including "invasive species" in various ecosystems as they may become disrupted in different ways by rapid climate change. "Invasive genes" (into new species and populations) need to be recognized for their positive creative potential and addressed in conservation programs. "Genetic rescue" via hybrid translocations may provide needed adaptive flexibility for rapid adaptation to environmental change. While concerns persist for some conservationists, this review emphasizes the positive aspects of hybrids and hybridization. Specific implications of natural genetic introgression are addressed with a few examples from butterflies, including transgressive phenotypes and climate-driven homoploid recombinant hybrid speciation. Some specific examples illustrate these points using the swallowtail butterflies (Papilionidae) with their long-term historical data base (phylogeographical diversity changes) and recent (3-decade) climate-driven temporal and genetic divergence in recombinant homoploid hybrids and relatively recent hybrid speciation of Papilio appalachiensis in North America. Climate-induced "reshuffling" (recombinations) of species composition, genotypes, and genomes may become

  10. 77 FR 59918 - Energy Conservation Program for Consumer Products: Decision and Order Granting a Waiver to BSH...

    Federal Register 2010, 2011, 2012, 2013, 2014


    ...The U.S. Department of Energy (DOE) gives notice of the decision and order (Case No. DW-008) that grants to BSH Corporation (BSH) a waiver from the DOE dishwasher test procedure for certain basic models containing integrated or built-in water softeners. Under today's decision and order, BSH shall be required to test and rate its dishwashers with integrated water softeners using an alternate......

  11. 77 FR 59916 - Energy Conservation Program for Consumer Products: Decision and Order Granting a Waiver to BSH...

    Federal Register 2010, 2011, 2012, 2013, 2014


    ...The U.S. Department of Energy (DOE) gives notice of the decision and order (Case No. DW-007) that grants to BSH Corporation (BSH) a waiver from the DOE dishwasher test procedure for certain basic models containing integrated or built-in water softeners. Under today's decision and order, BSH shall be required to test and rate its dishwashers with integrated water softeners using an alternate......

  12. 75 FR 25228 - Energy Conservation Program for Consumer Products: Decision and Order Denying a Waiver to PB Heat...

    Federal Register 2010, 2011, 2012, 2013, 2014


    ...This notice publishes DOE's Decision and Order in Case No. WAV-0140, which denies a waiver to PB Heat, LLC (PB) from the existing DOE residential furnace and boiler test procedure. This Decision and Order pertains to PB's PO-50, PO-60, PO-63, and PO-73 models of oil- fired boilers. DOE previously published the PB Petition for Waiver and solicited comments, data, and information regarding the......

  13. Patterns of genetic differentiation at MHC class I genes and microsatellites identify conservation units in the giant panda

    PubMed Central


    Background Evaluating patterns of genetic variation is important to identify conservation units (i.e., evolutionarily significant units [ESUs], management units [MUs], and adaptive units [AUs]) in endangered species. While neutral markers could be used to infer population history, their application in the estimation of adaptive variation is limited. The capacity to adapt to various environments is vital for the long-term survival of endangered species. Hence, analysis of adaptive loci, such as the major histocompatibility complex (MHC) genes, is critical for conservation genetics studies. Here, we investigated 4 classical MHC class I genes (Aime-C, Aime-F, Aime-I, and Aime-L) and 8 microsatellites to infer patterns of genetic variation in the giant panda (Ailuropoda melanoleuca) and to further define conservation units. Results Overall, we identified 24 haplotypes (9 for Aime-C, 1 for Aime-F, 7 for Aime-I, and 7 for Aime-L) from 218 individuals obtained from 6 populations of giant panda. We found that the Xiaoxiangling population had the highest genetic variation at microsatellites among the 6 giant panda populations and higher genetic variation at Aime-MHC class I genes than other larger populations (Qinling, Qionglai, and Minshan populations). Differentiation index (FST)-based phylogenetic and Bayesian clustering analyses for Aime-MHC-I and microsatellite loci both supported that most populations were highly differentiated. The Qinling population was the most genetically differentiated. Conclusions The giant panda showed a relatively higher level of genetic diversity at MHC class I genes compared with endangered felids. Using all of the loci, we found that the 6 giant panda populations fell into 2 ESUs: Qinling and non-Qinling populations. We defined 3 MUs based on microsatellites: Qinling, Minshan-Qionglai, and Daxiangling-Xiaoxiangling-Liangshan. We also recommended 3 possible AUs based on MHC loci: Qinling, Minshan-Qionglai, and Daxiangling

  14. The Two-Component Camassa-Holm Equations CH(2,1) and CH(2,2): First-Order Integrating Factors and Conservation Laws

    NASA Astrophysics Data System (ADS)

    Euler, Marianna; Euler, Norbert; Wolf, Thomas


    Recently, Holm and Ivanov, proposed and studied a class of multi-component generalizations of the Camassa-Holm equations [D. D. Holm and R. I. Ivanov, Multi-component generalizations of the CH equation: geometrical aspects, peakons and numerical examples, J. Phys A: Math. Theor.43 (2010) 492001 (20pp)]. We consider two of those systems, denoted by Holm and Ivanov by CH(2,1) and CH(2,2), and report a class of integrating factors and its corresponding conservation laws for these two systems. In particular, we obtain the complete set of first-order integrating factors for the systems in Cauchy-Kovalevskaya form and evaluate the corresponding sets of conservation laws for CH(2,1) and CH(2,2).

  15. Transcriptional regulation of the human, porcine and bovine OCTN2 gene by PPARα via a conserved PPRE located in intron 1

    PubMed Central


    Background The novel organic cation transporter 2 (OCTN2) is the physiologically most important carnitine transporter in tissues and is responsible for carnitine absorption in the intestine, carnitine reabsorption in the kidney and distribution of carnitine between tissues. Genetic studies clearly demonstrated that the mouse OCTN2 gene is directly regulated by peroxisome proliferator-activated receptor α (PPARα). Despite its well conserved role as an important regulator of lipid catabolism in general, the specific genes under control of PPARα within each lipid metabolic pathway were shown to differ between species and it is currently unknown whether the OCTN2 gene is also a PPARα target gene in pig, cattle, and human. In the present study we examined the hypothesis that the porcine, bovine, and human OCTN2 gene are also PPARα target genes. Results Using positional cloning and reporter gene assays we identified a functional PPRE, each in the intron 1 of the porcine, bovine, and human OCTN2 gene. Gel shift assay confirmed binding of PPARα to this PPRE in the porcine, bovine, and the human OCTN2 gene. Conclusions The results of the present study show that the porcine, bovine, and human OCTN2 gene, like the mouse OCTN2 gene, is directly regulated by PPARα. This suggests that regulation of genes involved in carnitine uptake by PPARα is highly conserved across species. PMID:25299939

  16. Conservation of the Duchenne muscular dystrophy gene in mice and humans

    SciTech Connect

    Hoffman, E.P.; Monaco, A.P.; Feener, C.C.; Kunkel, L.M.


    A portion of the Duchenne muscular dystrophy (DMD) gene transcript from human fetal skeletal muscle and mouse adult heart was sequence, representing approximately 25 percent of the total, 14-kb DMD transcript. The nucleic acid and predicted amino acid sequences from the two species are nearly 90 percent homologous. The amino acid sequence that is predicted from this portion of the DMD gene indicates that the protein product might serve a structural role in muscle, but the abundance and tissue distribution of the messenger RNA suggest that the DMD protein is not nebulin.

  17. High-order central ENO finite-volume scheme for hyperbolic conservation laws on three-dimensional cubed-sphere grids

    NASA Astrophysics Data System (ADS)

    Ivan, L.; De Sterck, H.; Susanto, A.; Groth, C. P. T.


    A fourth-order accurate finite-volume scheme for hyperbolic conservation laws on three-dimensional (3D) cubed-sphere grids is described. The approach is based on a central essentially non-oscillatory (CENO) finite-volume method that was recently introduced for two-dimensional compressible flows and is extended to 3D geometries with structured hexahedral grids. Cubed-sphere grids feature hexahedral cells with nonplanar cell surfaces, which are handled with high-order accuracy using trilinear geometry representations in the proposed approach. Varying stencil sizes and slope discontinuities in grid lines occur at the boundaries and corners of the six sectors of the cubed-sphere grid where the grid topology is unstructured, and these difficulties are handled naturally with high-order accuracy by the multidimensional least-squares based 3D CENO reconstruction with overdetermined stencils. A rotation-based mechanism is introduced to automatically select appropriate smaller stencils at degenerate block boundaries, where fewer ghost cells are available and the grid topology changes, requiring stencils to be modified. Combining these building blocks results in a finite-volume discretization for conservation laws on 3D cubed-sphere grids that is uniformly high-order accurate in all three grid directions. While solution-adaptivity is natural in the multi-block setting of our code, high-order accurate adaptive refinement on cubed-sphere grids is not pursued in this paper. The 3D CENO scheme is an accurate and robust solution method for hyperbolic conservation laws on general hexahedral grids that is attractive because it is inherently multidimensional by employing a K-exact overdetermined reconstruction scheme, and it avoids the complexity of considering multiple non-central stencil configurations that characterizes traditional ENO schemes. Extensive numerical tests demonstrate fourth-order convergence for stationary and time-dependent Euler and magnetohydrodynamic flows on

  18. Kullback-Leibler information for ordering genes using sperm typing and radiation-hybrid mapping. Technical report

    SciTech Connect

    Chernoff, H.


    Two technologies applicable to gene mapping are those of sperm typing and radiation hybrid mapping. Sperm typing makes use of the polymerase chain reaction, a biochemical technique which allows enormous amplification (production of multiple copies) of small, selected DNA fragments from a single chromosome. A sample of sperm from a single donor is analyzed to see which alleles (distinct forms of the various genes) are present in the individual sperms. The frequencies with which the various possibilities occur can be used to supply estimates of the ordering and of the recombination probabilities among the genes for which that donor is heterozygous (having different alleles of the same gene.)

  19. Nme Gene Family Evolutionary History Reveals Pre-Metazoan Origins and High Conservation between Humans and the Sea Anemone, Nematostella vectensis

    PubMed Central

    Desvignes, Thomas; Pontarotti, Pierre; Bobe, Julien


    Background The Nme gene family is involved in multiple physiological and pathological processes such as cellular differentiation, development, metastatic dissemination, and cilia functions. Despite the known importance of Nme genes and their use as clinical markers of tumor aggressiveness, the associated cellular mechanisms remain poorly understood. Over the last 20 years, several non-vertebrate model species have been used to investigate Nme functions. However, the evolutionary history of the family remains poorly understood outside the vertebrate lineage. The aim of the study was thus to elucidate the evolutionary history of the Nme gene family in Metazoans. Methodology/Principal Findings Using a total of 21 eukaryote species including 14 metazoans, the evolutionary history of Nme genes was reconstructed in the metazoan lineage. We demonstrated that the complexity of the Nme gene family, initially thought to be restricted to chordates, was also shared by the metazoan ancestor. We also provide evidence suggesting that the complexity of the family is mainly a eukaryotic innovation, with the exception of Nme8 that is likely to be a choanoflagellate/metazoan innovation. Highly conserved gene structure, genomic linkage, and protein domains were identified among metazoans, some features being also conserved in eukaryotes. When considering the entire Nme family, the starlet sea anemone is the studied metazoan species exhibiting the most conserved gene and protein sequence features with humans. In addition, we were able to show that most of the proteins known to interact with human NME proteins were also found in starlet sea anemone. Conclusion/Significance Together, our observations further support the association of Nme genes with key cellular functions that have been conserved throughout metazoan evolution. Future investigations of evolutionarily conserved Nme gene functions using the starlet sea anemone could shed new light on a wide variety of key developmental and

  20. Marker genes that are less conserved in their sequences are useful for predicting genome-wide similarity levels between closely related prokaryotic strains


    Lan, Yemin; Rosen, Gail; Hershberg, Ruth


    The 16s rRNA gene is so far the most widely used marker for taxonomical classification and separation of prokaryotes. Since it is universally conserved among prokaryotes, it is possible to use this gene to classify a broad range of prokaryotic organisms. At the same time, it has often been noted that the 16s rRNA gene is too conserved to separate between prokaryotes at finer taxonomic levels. In this paper, we examine how well levels of similarity of 16s rRNA and 73 additional universal or nearly universal marker genes correlate with genome-wide levels of gene sequence similarity. We demonstrate that themore » percent identity of 16s rRNA predicts genome-wide levels of similarity very well for distantly related prokaryotes, but not for closely related ones. In closely related prokaryotes, we find that there are many other marker genes for which levels of similarity are much more predictive of genome-wide levels of gene sequence similarity. Finally, we show that the identities of the markers that are most useful for predicting genome-wide levels of similarity within closely related prokaryotic lineages vary greatly between lineages. However, the most useful markers are always those that are least conserved in their sequences within each lineage. In conclusion, our results show that by choosing markers that are less conserved in their sequences within a lineage of interest, it is possible to better predict genome-wide gene sequence similarity between closely related prokaryotes than is possible using the 16s rRNA gene. We point readers towards a database we have created (POGO-DB) that can be used to easily establish which markers show lowest levels of sequence conservation within different prokaryotic lineages.« less

  1. Salmonid genomes have a remarkably expanded akirin family, coexpressed with genes from conserved pathways governing skeletal muscle growth and catabolism

    PubMed Central

    Kristjánsson, Bjarni K.; Johnston, Ian A.


    Metazoan akirin genes regulate innate immunity, myogenesis, and carcinogenesis. Invertebrates typically have one family member, while most tetrapod and teleost vertebrates have one to three. We demonstrate an expanded repertoire of eight family members in genomes of four salmonid fishes, owing to paralog preservation after three tetraploidization events. Retention of paralogs secondarily lost in other teleosts may be related to functional diversification and posttranslational regulation. We hypothesized that salmonid akirins would be transcriptionally regulated in fast-twitch skeletal muscle during activation of conserved pathways governing catabolism and growth. The in vivo nutritional state of Arctic charr (Salvelinus alpinus L.) was experimentally manipulated, and transcript levels for akirin family members and 26 other genes were measured by quantitative real-time PCR (qPCR), allowing the establishment of a similarity network of expression profiles. In fasted muscle, a class of akirins was upregulated, with one family member showing high coexpression with catabolic genes coding the NF-κB p65 subunit, E2 ubiquitin-conjugating enzymes, E3 ubiquitin ligases, and IGF-I receptors. Another class of akirin was upregulated with subsequent feeding, coexpressed with 14-3-3 protein genes. There was no similarity between expression profiles of akirins with IGF hormones or binding protein genes. The level of phylogenetic relatedness of akirin family members was not a strong predictor of transcriptional responses to nutritional state, or differences in transcript abundance levels, indicating a complex pattern of regulatory evolution. The salmonid akirins epitomize the complexity linking the genome to physiological phenotypes of vertebrates with a history of tetraploidization. PMID:20388840

  2. Salmonid genomes have a remarkably expanded akirin family, coexpressed with genes from conserved pathways governing skeletal muscle growth and catabolism.


    Macqueen, Daniel J; Kristjánsson, Bjarni K; Johnston, Ian A


    Metazoan akirin genes regulate innate immunity, myogenesis, and carcinogenesis. Invertebrates typically have one family member, while most tetrapod and teleost vertebrates have one to three. We demonstrate an expanded repertoire of eight family members in genomes of four salmonid fishes, owing to paralog preservation after three tetraploidization events. Retention of paralogs secondarily lost in other teleosts may be related to functional diversification and posttranslational regulation. We hypothesized that salmonid akirins would be transcriptionally regulated in fast-twitch skeletal muscle during activation of conserved pathways governing catabolism and growth. The in vivo nutritional state of Arctic charr (Salvelinus alpinus L.) was experimentally manipulated, and transcript levels for akirin family members and 26 other genes were measured by quantitative real-time PCR (qPCR), allowing the establishment of a similarity network of expression profiles. In fasted muscle, a class of akirins was upregulated, with one family member showing high coexpression with catabolic genes coding the NF-kappaB p65 subunit, E2 ubiquitin-conjugating enzymes, E3 ubiquitin ligases, and IGF-I receptors. Another class of akirin was upregulated with subsequent feeding, coexpressed with 14-3-3 protein genes. There was no similarity between expression profiles of akirins with IGF hormones or binding protein genes. The level of phylogenetic relatedness of akirin family members was not a strong predictor of transcriptional responses to nutritional state, or differences in transcript abundance levels, indicating a complex pattern of regulatory evolution. The salmonid akirins epitomize the complexity linking the genome to physiological phenotypes of vertebrates with a history of tetraploidization. PMID:20388840

  3. Morgan’s Legacy: Fruit Flies and the Functional Annotation of Conserved Genes

    PubMed Central

    Bellen, Hugo J.; Yamamoto, Shinya


    In 1915, “The Mechanism of Mendelian Heredity” was published by four prominent Drosophila geneticists. They discovered that genes form linkage groups on chromosomes inherited in a Mendelian fashion and laid the genetic foundation that promoted Drosophila as a model organism. Flies continue to offer great opportunities, including studies in the field of functional genomics. PMID:26406362

  4. Transcriptome shock invokes disruption of parental expression-conserved genes in tetraploid wheat

    PubMed Central

    Zhang, Huakun; Gou, Xiaowan; Zhang, Ai; Wang, Xutong; Zhao, Na; Dong, Yuzhu; Li, Linfeng; Liu, Bao


    Allopolyploidy often triggers phenotypic novelty and gene expression remolding in the resulting polyploids. In this study, we employed multiple phenotypic and genetic approaches to investigate the nature and consequences of allotetraploidization between A- and S-subgenome of tetraploid wheat. Results showed that karyotype of the nascent allopolyploid plants (AT2) is stable but they showed clear novelty in multiple morphological traits which might have positively contributed to the initial establishment of the tetraploids. Further microarray-based transcriptome profiling and gene-specific cDNA-pyrosequencing have documented that transcriptome shock was exceptionally strong in AT2, but a substantial proportion of the induced expression changes was rapidly stabilized in early generations. Meanwhile, both additive and nonadditive expression genes showed extensive homeolog expression remodeling and which have led to the subgenome expression dominance in leaf and young inflorescence of AT2. Through comparing the homeolog-expressing patterns between synthetic and natural tetraploid wheats, it appears that the shock-induced expression changes at both the total expression level and subgenome homeolog partitioning are evolutionarily persistent. Together, our study shed new light on how gene expression changes have rapidly occurred at the initial stage following allotetraploidization, as well as their evolutionary relevance, which may have implications for wheat improvements. PMID:27198893

  5. Transcriptome shock invokes disruption of parental expression-conserved genes in tetraploid wheat.


    Zhang, Huakun; Gou, Xiaowan; Zhang, Ai; Wang, Xutong; Zhao, Na; Dong, Yuzhu; Li, Linfeng; Liu, Bao


    Allopolyploidy often triggers phenotypic novelty and gene expression remolding in the resulting polyploids. In this study, we employed multiple phenotypic and genetic approaches to investigate the nature and consequences of allotetraploidization between A- and S-subgenome of tetraploid wheat. Results showed that karyotype of the nascent allopolyploid plants (AT2) is stable but they showed clear novelty in multiple morphological traits which might have positively contributed to the initial establishment of the tetraploids. Further microarray-based transcriptome profiling and gene-specific cDNA-pyrosequencing have documented that transcriptome shock was exceptionally strong in AT2, but a substantial proportion of the induced expression changes was rapidly stabilized in early generations. Meanwhile, both additive and nonadditive expression genes showed extensive homeolog expression remodeling and which have led to the subgenome expression dominance in leaf and young inflorescence of AT2. Through comparing the homeolog-expressing patterns between synthetic and natural tetraploid wheats, it appears that the shock-induced expression changes at both the total expression level and subgenome homeolog partitioning are evolutionarily persistent. Together, our study shed new light on how gene expression changes have rapidly occurred at the initial stage following allotetraploidization, as well as their evolutionary relevance, which may have implications for wheat improvements. PMID:27198893

  6. DoOPSearch: a web-based tool for finding and analysing common conserved motifs in the promoter regions of different chordate and plant genes

    PubMed Central

    Sebestyén, Endre; Nagy, Tibor; Suhai, Sándor; Barta, Endre


    Background The comparative genomic analysis of a large number of orthologous promoter regions of the chordate and plant genes from the DoOP databases shows thousands of conserved motifs. Most of these motifs differ from any known transcription factor binding site (TFBS). To identify common conserved motifs, we need a specific tool to be able to search amongst them. Since conserved motifs from the DoOP databases are linked to genes, the result of such a search can give a list of genes that are potentially regulated by the same transcription factor(s). Results We have developed a new tool called DoOPSearch for the analysis of the conserved motifs in the promoter regions of chordate or plant genes. We used the orthologous promoters of the DoOP database to extract thousands of conserved motifs from different taxonomic groups. The advantage of this approach is that different sets of conserved motifs might be found depending on how broad the taxonomic coverage of the underlying orthologous promoter sequence collection is (consider e.g. primates vs. mammals or Brassicaceae vs. Viridiplantae). The DoOPSearch tool allows the users to search these motif collections or the promoter regions of DoOP with user supplied query sequences or any of the conserved motifs from the DoOP database. To find overrepresented gene ontologies, the gene lists obtained can be analysed further using a modified version of the GeneMerge program. Conclusion We present here a comparative genomics based promoter analysis tool. Our system is based on a unique collection of conserved promoter motifs characteristic of different taxonomic groups. We offer both a command line and a web-based tool for searching in these motif collections using user specified queries. These can be either short promoter sequences or consensus sequences of known transcription factor binding sites. The GeneMerge analysis of the search results allows the user to identify statistically overrepresented Gene Ontology terms that

  7. 78 FR 53448 - Energy Conservation Program for Consumer Products: Decision and Order Granting a Waiver to BSH...

    Federal Register 2010, 2011, 2012, 2013, 2014


    ...The U.S. Department of Energy (DOE) gives notice of the decision and order (Case No. CD-007) that grants to BSH Home Appliances Corporation (BSH) a waiver from the DOE clothes dryer test procedure. The waiver pertains to the models of condensing residential clothes dryer specified in BSH's petition. Condensing clothes dryers cannot be tested using the currently applicable DOE test procedure.......

  8. 75 FR 51262 - Energy Conservation Program for Consumer Products: Decision and Order Granting a Waiver to GE...

    Federal Register 2010, 2011, 2012, 2013, 2014


    ... published in the Federal Register on April 17, 2007. 72 FR 19189. DOE granted the GE petition in a decision & order published on February 27, 2008. 73 FR 10425. On February 16, 2010, GE informed DOE that it has... Register on April 29, 2010. 75 FR 22586. Assertions and Determinations GE's Petition for Waiver: In...

  9. 78 FR 17927 - Energy Conservation Program for Consumer Products: Decision and Order Granting a Waiver to BSH...

    Federal Register 2010, 2011, 2012, 2013, 2014


    ... water consumption. DATES: This Decision and Order is effective March 25, 2013 through May 29, 2013. FOR... petition was published in the Federal Register on December 31, 2012. 77 FR 77064. In every respect except... (76 FR 38144), and the December 7th and March 27th petitions on October 1, 2012 (77 FR 59916 and 77...

  10. A subgroup of MYB transcription factor genes undergoes highly conserved alternative splicing in Arabidopsis and rice.


    Li, Jigang; Li, Xiaojuan; Guo, Lei; Lu, Feng; Feng, Xiaojie; He, Kun; Wei, Liping; Chen, Zhangliang; Qu, Li-Jia; Gu, Hongya


    MYB transcription factor genes play important roles in many developmental processes and in various defence responses of plants. Two Arabidopsis R2R3-type MYB genes, AtMYB59 and AtMYB48, were found to undergo similar alternative splicing. Both genes have four distinctively spliced transcripts that encode either MYB-related proteins or R2R3-MYB proteins. An extensive BLAST search of the GenBank database resulted in finding and cloning two rice homologues, both of which were also found to share a similar alternative splicing pattern. In a semi-quantitative study, the expression of one splice variant of AtMYB59 was found to be differentially regulated in treatments with different phytohormones and stresses. GFP fusion protein analysis revealed that both of the two predicted nuclear localization signals (NLSs) in the R3 domain are required for localizing to the nucleus. Promoter-GUS analysis in transgenic plants showed that 5'-UTR is sufficient for the translation initiation of type 3 transcripts (encoding R2R3-MYB proteins), but not for type 2 transcripts (encoding MYB-related proteins). Moreover, a new type of non-canonical intron, with the same nucleotide repeats at the 5' and 3' splice sites, was identified. Thirty-eight Arabidopsis and rice genes were found to have this type of non-canonical intron, most of which undergo alternative splicing. These data suggest that this subgroup of transcription factor genes may be involved in multiple biological processes and may be transcriptionally regulated by alternative splicing. PMID:16531467

  11. Conserved and divergent expression patterns of the proteolipid protein gene family in the amphibian central nervous system.


    Yoshida, M; Shan, W S; Colman, D R


    The recent discovery of a proteolipid protein gene family has revealed that its members are in fact widely distributed and are not exclusively associated with myelination. To date, three different gene products, DMalpha/DM-20/PLP, DMbeta/M6a, and DMgamma/M6b, have been isolated from certain primitive fish species, mouse, and human central nervous system (CNS). We cloned Xenopus laevis orthologues of DMbeta/M6a and DMgamma/M6b and investigated the expression patterns of these gene transcripts as well as that of PLP in developing Xenopus CNS. As is the case in shark and mouse, the mRNA encoding the major myelin integral protein, PLP, is first detected at stage 42/43 in tadpoles and is exclusively found in morphologically recognizable oligodendrocytes throughout the brain, while DMbeta mRNA is solely expressed in young presumptive neurons in the gray matter. There exist two distinct DMgamma mRNAs and, in contrast to these evolutionarily conserved expression patterns, DMgamma mRNAs distribute uniquely within the ventricular zone in young tadpoles (stage 25) through maturity. Furthermore, both DMbeta and DMgamma are expressed in the developing retina, and their distributions are different from one other. In Xenopus CNS, therefore, the expression patterns of three proteolipid proteins, PLP, DMbeta, and DMgamma, are distinct from each other, implying very different roles for their protein products within the cell populations in which they are expressed. PMID:10397631

  12. H3K36ac Is an Evolutionary Conserved Plant Histone Modification That Marks Active Genes1[OPEN

    PubMed Central

    Arellano, Minerva Susana Trejo; Shu, Huan; Gruissem, Wilhelm


    In eukaryotic cells, histones are subject to a large number of posttranslational modifications whose sequential or combinatorial action affects chromatin structure and genome function. We identified acetylation at Lys-36 in histone H3 (H3K36ac) as a new chromatin modification in plants. The H3K36ac modification is evolutionary conserved in seed plants, including the gymnosperm Norway spruce (Picea abies) and the angiosperms rice (Oryza sativa), tobacco (Nicotiana tabacum), and Arabidopsis (Arabidopsis thaliana). In Arabidopsis, H3K36ac is highly enriched in euchromatin but not in heterochromatin. Genome-wide chromatin immunoprecipitation sequencing experiments revealed that H3K36ac peaks at the 5′ end of genes, mainly on the two nucleosomes immediately distal to the transcription start site, independently of gene length. H3K36ac overlaps with H3K4me3 and the H2A.Z histone variant. The histone acetyl transferase GCN5 and the histone deacetylase HDA19 are required for H3K36ac homeostasis. H3K36ac and H3K36me3 show negative crosstalk, which is mediated by GCN5 and the histone methyl transferase SDG8. Although H3K36ac is associated with gene activity, we did not find a linear relationship between H3K36ac and transcript levels, suggesting that H3K36ac is a binary indicator of transcription. PMID:26764380

  13. The clot gene of Drosophila melanogaster encodes a conserved member of the thioredoxin-like protein superfamily.


    Giordano, E; Peluso, I; Rendina, R; Digilio, A; Furia, M


    The conversion of pyruvoyl-H(4)-pterin to pyrimidodiazepine (PDA), which is an essential step in the biosynthesis of the red components of Drosophila eye pigments known as drosopterins, requires the products of the genes sepia and clot. While the product of sepia has been shown to correspond to the enzyme PDA-synthase, the role of clot remains unknown, although the clot(1) allele was one of the first eye-color mutants to be isolated in Drosophila melanogaster,and much genetic and biochemical data has become available since. Here we report the cloning of the clot gene, describe its molecular organization and characterize the sequence alterations associated with the alleles cl(1) and cl(2). The coding properties of the gene show that it encodes a protein related to the Glutaredoxin class of the Thioredoxin-like enzyme superfamily, conserved members of which are found in human, mouse and plants. We suggest that the Clot protein is an essential component of a glutathione redox system required for the final step in the biosynthetic pathway for drosopterins. PMID:12589444

  14. Many or most genes in Arabidopsis transposed after the origin of the order Brassicales

    PubMed Central

    Freeling, Michael; Lyons, Eric; Pedersen, Brent; Alam, Maqsudul; Ming, Ray; Lisch, Damon


    Previous to this work, typical genes were thought to move from one position to another infrequently. On the contrary, we now estimate that between one-fourth and three-fourths of the genes in Arabidopsis transposed in the Brassicales. We used the CoGe comparative genomics system to perform and visualize multiple orthologous chromosomal alignments. Using this tool, we found large differences between different categories of genes. Ten of the gene families examined, including genes in most transcription factor families, exhibited a median frequency of 5% transposed genes. In contrast, other gene families were composed largely of transposed genes: NB-LRR disease-resistance genes, genes encoding MADS-box and B3 transcription factors, and genes encoding F-box proteins. A unique method involving transposition-rich regions of genome allowed us to obtain an indirect estimate of the positional stability of the average gene. The observed differences between gene families raise important questions concerning the causes and consequences of gene transposition. PMID:18836034

  15. Genomic organization and mapping of the mouse P26s4 ATPase gene: A member of the remarkably conserved AAA gene family

    SciTech Connect

    Hoyle, J.; Fisher, E.M.C.


    The eukaryotic genome contains a large family of ATPases in which each member has at least one highly conserved domain of approximately 200 amino acids with an ATP binding motif (the {open_quotes}AAA{close_quotes} domain). AAA ATPases play diverse roles in the cell and are of considerable interest to researchers investigating a number of different phenomena, including control of the cell cycle. We have characterized the mouse P26s4 AAA ATPase gene that encodes a subunit of the 26S protease, a multimeric complex that is responsible for the ubiquitin- and ATP-dependent degradation of specific proteins. The normal functioning of eukaryotic cells depends on this pathway to remove regulatory proteins such as cyclins or signal transduction molecules from the intracellular environment, with the appropriate timing to allow normal cell division and development. We have isolated mouse P26s4 cDNAs and mapped the P26s4 gene to chromosome 12. We have analyzed the intron-exon structure of the P26s4 genomic locus and have determined that the gene contains at least 10 introns, the first of which separates the start methionine from the rest of the coding sequence. 18 refs., 2 figs.

  16. Identification and comparative analysis of ncRNAs in human, mouse and zebrafish indicate a conserved role in regulation of genes expressed in brain.


    Qu, Zhipeng; Adelson, David L


    ncRNAs (non-coding RNAs), in particular long ncRNAs, represent a significant proportion of the vertebrate transcriptome and probably regulate many biological processes. We used publically available ESTs (Expressed Sequence Tags) from human, mouse and zebrafish and a previously published analysis pipeline to annotate and analyze the vertebrate non-protein-coding transcriptome. Comparative analysis confirmed some previously described features of intergenic ncRNAs, such as a positionally biased distribution with respect to regulatory or development related protein-coding genes, and weak but clear sequence conservation across species. Significantly, comparative analysis of developmental and regulatory genes proximate to long ncRNAs indicated that the only conserved relationship of these genes to neighbor long ncRNAs was with respect to genes expressed in human brain, suggesting a conserved, ncRNA cis-regulatory network in vertebrate nervous system development. Most of the relationships between long ncRNAs and proximate coding genes were not conserved, providing evidence for the rapid evolution of species-specific gene associated long ncRNAs. We have reconstructed and annotated over 130,000 long ncRNAs in these three species, providing a significantly expanded number of candidates for functional testing by the research community. PMID:23284966

  17. Functional conservation of cis-regulatory elements of heat-shock genes over long evolutionary distances.


    He, Zhengying; Eichel, Kelsie; Ruvinsky, Ilya


    Transcriptional control of gene regulation is an intricate process that requires precise orchestration of a number of molecular components. Studying its evolution can serve as a useful model for understanding how complex molecular machines evolve. One way to investigate evolution of transcriptional regulation is to test the functions of cis-elements from one species in a distant relative. Previous results suggested that few, if any, tissue-specific promoters from Drosophila are faithfully expressed in C. elegans. Here we show that, in contrast, promoters of fly and human heat-shock genes are upregulated in C. elegans upon exposure to heat. Inducibility under conditions of heat shock may represent a relatively simple "on-off" response, whereas complex expression patterns require integration of multiple signals. Our results suggest that simpler aspects of regulatory logic may be retained over longer periods of evolutionary time, while more complex ones may be diverging more rapidly. PMID:21799932

  18. Resolution of deep angiosperm phylogeny using conserved nuclear genes and estimates of early divergence times.


    Zeng, Liping; Zhang, Qiang; Sun, Renran; Kong, Hongzhi; Zhang, Ning; Ma, Hong


    Angiosperms are the most successful plants and support human livelihood and ecosystems. Angiosperm phylogeny is the foundation of studies of gene function and phenotypic evolution, divergence time estimation and biogeography. The relationship of the five divergent groups of the Mesangiospermae (~99.95% of extant angiosperms) remains uncertain, with multiple hypotheses reported in the literature. Here transcriptome data sets are obtained from 26 species lacking sequenced genomes, representing each of the five groups: eudicots, monocots, magnoliids, Chloranthaceae and Ceratophyllaceae. Phylogenetic analyses using 59 carefully selected low-copy nuclear genes resulted in highly supported relationships: sisterhood of eudicots and a clade containing Chloranthaceae and Ceratophyllaceae, with magnoliids being the next sister group, followed by monocots. Our topology allows a re-examination of the evolutionary patterns of 110 morphological characters. The molecular clock estimates of Mesangiospermae diversification during the late to middle Jurassic correspond well to the origins of some insects, which may have been a factor facilitating early angiosperm radiation. PMID:25249442

  19. Resolution of deep angiosperm phylogeny using conserved nuclear genes and estimates of early divergence times

    PubMed Central

    Zeng, Liping; Zhang, Qiang; Sun, Renran; Kong, Hongzhi; Zhang, Ning; Ma, Hong


    Angiosperms are the most successful plants and support human livelihood and ecosystems. Angiosperm phylogeny is the foundation of studies of gene function and phenotypic evolution, divergence time estimation and biogeography. The relationship of the five divergent groups of the Mesangiospermae (~99.95% of extant angiosperms) remains uncertain, with multiple hypotheses reported in the literature. Here transcriptome data sets are obtained from 26 species lacking sequenced genomes, representing each of the five groups: eudicots, monocots, magnoliids, Chloranthaceae and Ceratophyllaceae. Phylogenetic analyses using 59 carefully selected low-copy nuclear genes resulted in highly supported relationships: sisterhood of eudicots and a clade containing Chloranthaceae and Ceratophyllaceae, with magnoliids being the next sister group, followed by monocots. Our topology allows a re-examination of the evolutionary patterns of 110 morphological characters. The molecular clock estimates of Mesangiospermae diversification during the late to middle Jurassic correspond well to the origins of some insects, which may have been a factor facilitating early angiosperm radiation. PMID:25249442

  20. The evolutionarily conserved gene LNP-1 is required for synaptic vesicle trafficking and synaptic transmission.


    Ghila, Luiza; Gomez, Marie


    The control of vesicle-mediated transport in nerve cells is of great importance in the function, development and maintenance of synapse. In this paper, we characterize the new Caenorhabditis elegans gene, lnp-1. The lnp-1 gene is broadly distributed in many neuronal structures and its localization is dependent of the UNC-104/kinesin protein. Deletion mutations in lnp-1 result in increased resistance to aldicarb, an acetylcholinesterase inhibitor, and in locomotor defects. However, sensitivity to levamisole, a nicotinic agonist which, unlike aldicarb, only affects postsynaptic function, was similar to that of wild-type animals, suggesting a presynaptic function for LNP-1 in neurotransmission. The mislocalization of presynaptic proteins, such as synaptobrevin-1 or RAB-3, in lnp-1 mutants further supports this hypothesis. In summary, our studies suggest that LNP-1 plays a role in synaptogenesis by regulating vesicular transport or localization. PMID:18279315

  1. Distorting Gene Pools by Conservation: Assessing the Case of Doomed Turtle Eggs

    NASA Astrophysics Data System (ADS)

    Mrosovsky, N.


    Sea turtles have a high reproductive output and high mortality at early stages of the life cycle. In particular, many nests are laid below or close to high tide lines, and subsequently large numbers of eggs may be inundated and destroyed. A common conservation procedure is to relocate such doomed eggs to higher ground. This article examines this practice in the light of recent data revealing that some individual turtles tend to nest relatively near the water and others relatively higher up the beach. Discussion is focused on the question of why apparently poor placement of nests has not been selected against. Comparison between the ecology of leatherback and hawksbill turtle nesting beaches suggests that predictability of environmental conditions on the nesting beaches has an important influence on patterns of nest-site selection. Options are outlined for the management of nesting beaches where a high proportion of turtle eggs is subject to destruction by flooding.

  2. Structure Conservation and Differential Expression of Farnesyl Diphosphate Synthase Genes in Euphorbiaceous Plants

    PubMed Central

    Guo, Dong; Li, Hui-Liang; Peng, Shi-Qing


    Farnesyl diphosphate synthase (FPS) is a key enzyme of isoprenoids biosynthesis. However, knowledge of the FPSs of euphorbiaceous species is limited. In this study, ten FPSs were identified in four euphorbiaceous plants. These FPSs exhibited similar exon/intron structure. The deduced FPS proteins showed close identities and exhibited the typical structure of plant FPS. The members of the FPS family exhibit tissue expression patterns that vary among several euphorbiaceous plant species under normal growth conditions. The expression profiles reveal spatial and temporal variations in the expression of FPSs of different tissues from Euphorbiaceous plants. Our results revealed wide conservation of FPSs and diverse expression in euphorbiaceous plants during growth and development. PMID:26389894

  3. Functional conservation and diversification of APETALA1/FRUITFULL genes in Brachypodium distachyon.


    Li, Qi; Wang, Ye; Wang, Fuxiang; Guo, Yuyu; Duan, Xueqing; Sun, Jinhao; An, Hailong


    The duplicated grass APETALA1/FRUITFULL (AP1/FUL) genes have distinct but overlapping patterns of expression, suggesting their discrete roles in transition to flowering, specification of spikelet meristem identity and specification of floral organ identity. In this study, we analyzed the expression patterns and functions of four AP1/FUL paralogs (BdVRN1, BdFUL2, BdFUL3 and BdFUL4) in Brachypodium distachyon, a model plant for the temperate cereals and related grasses. Among the four genes tested, only BdVRN1 could remember the prolonged cold treatment. The recently duplicated BdVRN1 and BdFUL2 genes were expressed in a highly consistent manner and ectopic expressions of them caused similar phenotypes such as extremely early flowering and severe morphological alterations of floral organs, indicating their redundant roles in floral transition, inflorescence development and floral organ identity. In comparison, ectopic expressions of BdFUL3 and BdFUL4 only caused a moderate early flowering phenotype, suggesting their divergent function. In yeast two-hybrid assay, both BdVRN1 and BdFUL2 physically interact with SEP proteins but only BdFUL2 is able to form a homodimer. BdVRN1 also interacts weakly with BdFUL2. Our results indicate that, since the separation of AP1/FUL genes in grasses, the process of sub- or neo-functionalization has occurred and paralogs function redundantly and/or separately in flowering competence and inflorescence development. PMID:26856680

  4. Conservation of novel Mahya genes shows the existence of neural functions common between Hymenoptera and Deuterostome.


    Tsuchimoto, Mayumi; Yasuo, Shinobu; Funada, Masahiro; Aoki, Makoto; Sasagawa, Hiromi; Yoshimura, Takashi; Tadauchi, Osamu; Cameron, Sydney A; Kitagawa, Yasuo; Kadowaki, Tatsuhiko


    Honeybees have been shown to exhibit cognitive performances that were thought to be specific to some vertebrates. However, the molecular and cellular mechanisms of such cognitive abilities of the bees have not been understood. We have identified a novel gene, Mahya, expressed in the brain of the honeybee, Apis mellifera, and other Hymenoptera. Mahya orthologues are present in Deuterostomes but are absent or highly diverged in nematodes and, intriguingly, in two dipteran insects (fruit fly and mosquito) and Lepidoptera (silk moth). Mahya genes encode novel secretory proteins with a follistatin-like domain (Kazal-type serine/threonine protease inhibitor domain and EF-hand calcium-binding domain), two immunoglobulin domains, and a C-terminal novel domain. Honeybee Mahya is expressed in the mushroom bodies and antennal lobes of the brain. Zebra fish Mahya orthologues are expressed in the olfactory bulb, telencephalon, habenula, optic tectum, and cerebellum of the brain. Mouse Mahya orthologues are expressed in the olfactory bulb, hippocampus, and cerebellum of the brain. These results suggest that Mahya may be involved in learning and memory and in processing of sensory information in Hymenoptera and vertebrates. Furthermore, the limited existence of Mahya in the genomes of Hymenoptera and Deuterostomes supports the hypothesis that the genes typically represented by Mahya were lost or highly diverged during the evolution of the central nervous system of specific Bilaterian branches under the specific selection and subsequent adaptation associated with different ecologies and life histories. PMID:16193321

  5. The peptidylarginine deiminase gene is a conserved feature of Porphyromonas gingivalis

    PubMed Central

    Gabarrini, Giorgio; de Smit, Menke; Westra, Johanna; Brouwer, Elisabeth; Vissink, Arjan; Zhou, Kai; A. Rossen, John W.; Stobernack, Tim; van Dijl, Jan Maarten; Jan van Winkelhoff, Arie


    Periodontitis is an infective process that ultimately leads to destruction of the soft and hard tissues that support the teeth (the periodontium). Periodontitis has been proposed as a candidate risk factor for development of the autoimmune disease rheumatoid arthritis (RA). Porphyromonas gingivalis, a major periodontal pathogen, is the only known prokaryote expressing a peptidyl arginine deiminase (PAD) enzyme necessary for protein citrullination. Antibodies to citrullinated proteins (anti-citrullinated protein antibodies, ACPA) are highly specific for RA and precede disease onset. Objective of this study was to assess P. gingivalis PAD (PPAD) gene expression and citrullination patterns in representative samples of P. gingivalis clinical isolates derived from periodontitis patients with and without RA and in related microbes of the Porphyromonas genus. Our findings indicate that PPAD is omnipresent in P. gingivalis, but absent in related species. No significant differences were found in the composition and expression of the PPAD gene of P. gingivalis regardless of the presence of RA or periodontal disease phenotypes. From this study it can be concluded that if P. gingivalis plays a role in RA, it is unlikely to originate from a variation in PPAD gene expression. PMID:26403779

  6. The Internally Self-fertilizing Hermaphroditic Teleost Rivulus marmoratus (Cyprinodontiformes, Rivulidae) beta-Actin Gene: Amplification and Sequence Analysis with Conserved Primers.




    To determine the ease and feasibility of amplifying the beta-actin gene in fish by the polymerase chain reaction (PCR), genomic DNAs of several fish (Rivulus, Southern top mouth minnow, common fat minnow, oily bitterling, carp, Far Eastern catfish, medaka, and European flounder) were extracted and used as a template with conserved primers, designed on the basis of high amino acid homology (approximately 98% or more). Among them, the self-fertilizing hermaphroditic fish Rivulus marmoratus was chosen for further characterization. After amplification of the Rivulus beta-actin PCR product with Taq polymerase, PCR product was subcloned to pCRII vector. After restriction enzyme mapping of Rivulus beta-actin gene, the amplified insert was sequenced using ALF Express automatic DNA sequencer with conserved internal primers. The R. marmoratus beta-actin gene consists of 1763 bp encoding 375 amino acids including 5 exons and 4 introns. The splicing and acceptance sites of the exon and intron boundaries of the Rivulus beta-actin gene were highly conserved with consensus sequences (GT/AG). The amino acid homology of R. marmoratus beta-actin to other species was high: 98.93% to human; 98.93%, Atlantic salmon; 98.93%, common carp; 98.93%, grass carp; 98.93%, zebrafish; 98.67%, medaka; and 98.40%, sea bream. To determine the expression of the R. marmoratus beta-actin gene in liver and ovary, reverse transcriptase-polymerase chain reaction was carried out with internal primers. In conclusion, these universal primers are successful in the rapid cloning of the fish beta-actin gene by PCR, based on a high homology of the beta-actin gene conserved through evolution. This approach will be applicable to the isolation of other beta-actin homologues in the investigation of phylogenetic comparisons of fish species, along with a possible application to cloning strategy in other conserved genes. PMID:10811955

  7. Characterization of Major Surface Glycoprotein Genes of Human Pneumocystis carinii and High-Level Expression of a Conserved Region

    PubMed Central

    Mei, Qin; Turner, Ross E.; Sorial, Vivian; Klivington, Diane; Angus, C. William; Kovacs, Joseph A.


    To facilitate studies of Pneumocystis carinii infection in humans, we undertook to better characterize and to express the major surface glycoprotein (MSG) of human P. carinii, an important protein in host-pathogen interactions. Seven MSG genes were cloned from a single isolate by PCR or genomic library screening and were sequenced. The predicted proteins, like rat MSGs, were closely related but unique variants, with a high level of conservation among cysteine residues. A conserved immunodominant region (of approximately 100 amino acids) near the carboxy terminus was expressed at high levels in Escherichia coli and used in Western blot studies. All 49 of the serum samples, which were taken from healthy controls as well as from patients with and without P. carinii pneumonia, were reactive with this peptide by Western blotting, supporting the hypothesis that most adult humans have been infected with P. carinii at some point. This recombinant MSG fragment, which is the first human P. carinii antigen available in large quantities, may be a useful reagent for investigating the epidemiology of P. carinii infection in humans. PMID:9712777

  8. Identification of conserved microRNAs and their target genes in Nile tilapia (Oreochromis niloticus) by bioinformatic analysis.


    Li, X H; Wu, J S; Tang, L H; Hu, D


    MicroRNAs (miRNAs) are a class of non-coding RNAs that play important roles in posttranscriptional regulation of target genes. miRNAs are involved in multiple biological processes by degrading targeted mRNAs or repressing mRNA translation in various organisms. Their conserved nature in various organisms makes them a good source of new miRNA discovery using comparative genomic approaches. In the present study, conserved Nile tilapia (Oreochromis niloticus) miRNAs were identified using a bioinformatic strategy based on expressed sequence tag and genome survey sequence databases. A total of 21 new miRNAs were detected and were found to belong to 17 families. Using mature miRNA sequences as queries, potential targets for tilapia miRNAs were predicted using a local BLAST program and the miRanda software. Target proteins identified using miRanda and BLAST analyses included transcription factors and molecules important in metabolism, transportation, immunity, stress-related activity, growth, and development. These miRNAs and their targets in tilapia may increase the understanding of the role of miRNAs in regulating the growth and development of tilapia. PMID:25867427

  9. Phylogeny of Syndermata (syn. Rotifera): Mitochondrial gene order verifies epizoic Seisonidea as sister to endoparasitic Acanthocephala within monophyletic Hemirotifera.


    Sielaff, Malte; Schmidt, Hanno; Struck, Torsten H; Rosenkranz, David; Mark Welch, David B; Hankeln, Thomas; Herlyn, Holger


    A monophyletic origin of endoparasitic thorny-headed worms (Acanthocephala) and wheel-animals (Rotifera) is widely accepted. However, the phylogeny inside the clade, be it called Syndermata or Rotifera, has lacked validation by mitochondrial (mt) data. Herein, we present the first mt genome of the key taxon Seison and report conflicting results of phylogenetic analyses: while mt sequence-based topologies showed monophyletic Lemniscea (Bdelloidea+Acanthocephala), gene order analyses supported monophyly of Pararotatoria (Seisonidea+Acanthocephala) and Hemirotifera (Bdelloidea+Pararotatoria). Sequence-based analyses obviously suffered from substitution saturation, compositional bias, and branch length heterogeneity; however, we observed no compromising effects in gene order analyses. Moreover, gene order-based topologies were robust to changes in coding (genes vs. gene pairs, two-state vs. multistate, aligned vs. non-aligned), tree reconstruction methods, and the treatment of the two monogonont mt genomes. Thus, mt gene order verifies seisonids as sister to acanthocephalans within monophyletic Hemirotifera, while deviating results of sequence-based analyses reflect artificial signal. This conclusion implies that the complex life cycle of extant acanthocephalans evolved from a free-living state, as retained by most monogononts and bdelloids, via an epizoic state with a simple life cycle, as shown by seisonids. Hence, Acanthocephala represent a rare example where ancestral transitional stages have counterparts amongst the closest relatives. PMID:26702959

  10. The "eyes absent" (eya) gene in the eye-bearing hydrozoan jellyfish Cladonema radiatum: conservation of the retinal determination network.


    Graziussi, Daria Federica; Suga, Hiroshi; Schmid, Volker; Gehring, Walter Jakob


    Eyes absent (Eya) is a member of the Retinal Determination Gene Network (RDGN), a set of genes responsible for eye specification in Drosophila. Eya is a dual function protein, working as a transcription factor in the nucleus and as a tyrosine phosphatase in the cytoplasm. It had been shown that Pax and Six family genes, main components of the RDGN, are present in the hydrozoan Cladonema radiatum and that they are expressed in the eye. However, nothing had been known about the Eya family in hydrozoan jellyfish. Here we report the presence of an Eya homologue (CrEya) in Cladonema. Real-time PCR analysis and in situ hybridization showed that CrEya is expressed in the eye. Furthermore, the comprehensive survey of eukaryote genomes revealed that the acquisition of the N-terminal transactivation domain, including the EYA Domain 2 and its adjacent sequence shared by all eumetazoans, happened early in evolution, before the separation of Cnidaria and Bilateria. Our results uncover the evolution of the two domains and show a conservation of the expression pattern of the Eya gene between Cnidaria and Bilateria, which, together with previous data, supports the hypothesis of the monophyletic origin of metazoans eyes. We additionally show that CrEya is also expressed in the oocytes, where two other members of the RDGN, CrPaxB, and Six4/5-Cr, are known to be expressed. These data suggest that several members of the RDGN have begun to be localized also into the different context of egg development early in the course of metazoan evolution. PMID:22821862

  11. The chick and human collagen alpha1(XII) gene promoter--activity of highly conserved regions around the first exon and in the first intron.


    Chiquet, M; Mumenthaler, U; Wittwer, M; Jin, W; Koch, M


    A single gene encodes collagen XII, an extracellular matrix protein with three large fibronectin-related subunits connected via a short collagen triple helix. Since collagen XII is a component of a specific subset of collagen fibrils in tissues bearing high tensile stress, we are interested to know how its restricted expression is regulated. To this aim, we have isolated the region around the first exon of both the chick and human collagen alpha1(XII) gene. The upstream sequences of the two genes share common features but are not related. Strong similarity starts about 100 bp 5' of the first exon and ends 100 bp into the first intron. In addition, two large conserved regions (56-63% similarity) were found in the first intron. A single major and two clusters of minor transcription start sites were identified in both the chick and human gene. To test for promoter activity, conserved fragments from the chick gene were cloned into reporter plasmids for transient transfection of fibroblasts. A 70-bp stretch containing a conserved nuclear factor-1 binding sequence just upstream of the first transcription start site was found to work as a basal promoter. An adjacent, but nonoverlapping short segment including the more downstream start sites and a conserved TATTAA sequence exhibited independent promoter activity. GC-rich sequences just 5' and 3' of the minimal promoter fragments were required for full activity. In contrast, inclusion of more upstream sequences (up to 2.4 kb) had no effect. The two conserved regions in the first intron showed no promoter activity on their own but modulated activity when linked to autologous or heterologous promoters. Specifically, one of these intronic regions might contain enhancer element(s) that respond to mechanical stress acting on the fibroblasts. We conclude that the collagen XII gene is driven by a basal promoter with two halves that can act independently; conserved control regions are located around the first exon and in the first

  12. Energy-momentum conserving higher-order time integration of nonlinear dynamics of finite elastic fiber-reinforced continua

    NASA Astrophysics Data System (ADS)

    Erler, Norbert; Groß, Michael


    Since many years the relevance of fibre-reinforced polymers is steadily increasing in fields of engineering, especially in aircraft and automotive industry. Due to the high strength in fibre direction, but the possibility of lightweight construction, these composites replace more and more traditional materials as metals. Fibre-reinforced polymers are often manufactured from glass or carbon fibres as attachment parts or from steel or nylon cord as force transmission parts. Attachment parts are mostly subjected to small strains, but force transmission parts usually suffer large deformations in at least one direction. Here, a geometrically nonlinear formulation is necessary. Typical examples are helicopter rotor blades, where the fibres have the function to stabilize the structure in order to counteract large centrifugal forces. For long-run analyses of rotor blade deformations, we have to apply numerically stable time integrators for anisotropic materials. This paper presents higher-order accurate and numerically stable time stepping schemes for nonlinear elastic fibre-reinforced continua with anisotropic stress behaviour.

  13. A ribosomal protein gene cluster is encoded in the mitochondrial DNA of Dictyostelium discoideum: UGA termination codons and similarity of gene order to Acanthamoeba castellanii.


    Iwamoto, M; Pi, M; Kurihara, M; Morio, T; Tanaka, Y


    We sequenced a region of about 14.5 kb downstream from the ribosomal protein L11 gene (rpl11) in the mitochondrial DNA (54+/-2 kb) of the cellular slime mold Dictyostelium discoideum. Sequence analysis revealed that eleven ribosomal protein genes and six open reading frames (ORFs) formed a cluster arranged in the order: rpl11-orf189-rps12-rps7-rpl2-rps19-+ ++orf425-orf1740-rpl16-rpl14-orf188- rps14-rps8-rpl6-rps13-orf127-orf796. This order was very similar to that of homologous genes in Acanthamoeba castellanii mitochondrial DNA. The N-terminal region of ORF425 and the C-terminal region of ORF1740 had partial similarities to the S3 ribosomal protein of other organisms. The termination codons of rpl16 and orf188 were UGA, which has not hitherto been found in genes encoded in D. discoideum mitochondrial DNA. PMID:9560439

  14. New insights into the wheat chromosome 4D structure and virtual gene order, revealed by survey pyrosequencing

    PubMed Central

    Helguera, Marcelo; Rivarola, Máximo; Clavijo, Bernardo; Martis, Mihaela M.; Vanzetti, Leonardo S.; González, Sergio; Garbus, Ingrid; Leroy, Phillippe; Šimková, Hana; Valárik, Miroslav; Caccamo, Mario; Doležel, Jaroslav; Mayer, Klaus F.X.; Feuillet, Catherine; Tranquilli, Gabriela; Paniego, Norma; Echenique, Viviana


    Survey sequencing of the bread wheat (Triticum aestivum L.) genome (AABBDD) has been approached through different strategies delivering important information. However, the current wheat sequence knowledge is not complete. The aim of our study is to provide different and complementary set of data for chromosome 4D. A survey sequence was obtained by pyrosequencing of flow-sorted 4DS (7.2×) and 4DL (4.1×) arms. Single ends (SE) and long mate pairs (LMP) reads were assembled into contigs (223 Mb) and scaffolds (65 Mb) that were aligned to Aegilops tauschii draft genome (DD), anchoring 34 Mb to chromosome 4. Scaffolds annotation rendered 822 gene models. A virtual gene order comprising 1973 wheat orthologous gene loci and 381 wheat gene models was built. This order was largely consistent with the scaffold order determined based on a published high density map from the Ae. tauschii chromosome 4, using bin-mapped 4D ESTs as a common reference. The virtual order showed a higher collinearity with homeologous 4B compared to 4A. Additionally, a virtual map was constructed and ∼5700 genes (∼2200 on 4DS and ∼3500 on 4DL) predicted. The sequence and virtual order obtained here using the 454 platform were compared with the Illumina one used by the IWGSC, giving complementary information. PMID:25711827

  15. The bi-Hamiltonian structure of some nonlinear fifth- and seventh-order differential equations and recursion formulas for their symmetries and conserved covariants

    NASA Astrophysics Data System (ADS)

    Fuchssteiner, Benno; Oevel, Walter


    Using a bi-Hamiltonian formulation we give explicit formulas for the conserved quantities and infinitesimal generators of symmetries for some nonlinear fifth- and seventh-order nonlinear partial differential equations; among them, the Caudrey-Dodd-Gibbon-Sawada-Kotera equation and the Kupershmidt equation. We show that the Lie algebras of the symmetry groups of these equations are of a very special form: Among the C∞ vector fields they are generated from two given commuting vector fields by a recursive application of a single operator. Furthermore, for some higher order equations, those multisoliton solutions, which for ||t||→∞ asymptotically decompose into traveling wave solutions, are characterized as eigenvector decompositions of certain operators.

  16. Role of conserved cis-regulatory elements in the post-transcriptional regulation of the human MECP2 gene involved in autism

    PubMed Central


    Background The MECP2 gene codes for methyl CpG binding protein 2 which regulates activities of other genes in the early development of the brain. Mutations in this gene have been associated with Rett syndrome, a form of autism. The purpose of this study was to investigate the role of evolutionarily conserved cis-elements in regulating the post-transcriptional expression of the MECP2 gene and to explore their possible correlations with a mutation that is known to cause mental retardation. Results A bioinformatics approach was used to map evolutionarily conserved cis-regulatory elements in the transcribed regions of the human MECP2 gene and its mammalian orthologs. Cis-regulatory motifs including G-quadruplexes, microRNA target sites, and AU-rich elements have gained significant importance because of their role in key biological processes and as therapeutic targets. We discovered in the 5′-UTR (untranslated region) of MECP2 mRNA a highly conserved G-quadruplex which overlapped a known deletion in Rett syndrome patients with decreased levels of MeCP2 protein. We believe that this 5′-UTR G-quadruplex could be involved in regulating MECP2 translation. We mapped additional evolutionarily conserved G-quadruplexes, microRNA target sites, and AU-rich elements in the key sections of both untranslated regions. Our studies suggest the regulation of translation, mRNA turnover, and development-related alternative MECP2 polyadenylation, putatively involving interactions of conserved cis-regulatory elements with their respective trans factors and complex interactions among the trans factors themselves. We discovered highly conserved G-quadruplex motifs that were more prevalent near alternative splice sites as compared to the constitutive sites of the MECP2 gene. We also identified a pair of overlapping G-quadruplexes at an alternative 5′ splice site that could potentially regulate alternative splicing in a negative as well as a positive way in the MECP2 pre

  17. Gene Coexpression and Evolutionary Conservation Analysis of the Human Preimplantation Embryos.


    Liu, Tiancheng; Yu, Lin; Ding, Guohui; Wang, Zhen; Liu, Lei; Li, Hong; Li, Yixue


    Evolutionary developmental biology (EVO-DEVO) tries to decode evolutionary constraints on the stages of embryonic development. Two models--the "funnel-like" model and the "hourglass" model--have been proposed by investigators to illustrate the fluctuation of selective pressure on these stages. However, selective indices of stages corresponding to mammalian preimplantation embryonic development (PED) were undetected in previous studies. Based on single cell RNA sequencing of stages during human PED, we used coexpression method to identify gene modules activated in each of these stages. Through measuring the evolutionary indices of gene modules belonging to each stage, we observed change pattern of selective constraints on PED for the first time. The selective pressure decreases from the zygote stage to the 4-cell stage and increases at the 8-cell stage and then decreases again from 8-cell stage to the late blastocyst stages. Previous EVO-DEVO studies concerning the whole embryo development neglected the fluctuation of selective pressure in these earlier stages, and the fluctuation was potentially correlated with events of earlier stages, such as zygote genome activation (ZGA). Such oscillation in an earlier stage would further affect models of the evolutionary constraints on whole embryo development. Therefore, these earlier stages should be measured intensively in future EVO-DEVO studies. PMID:26273607

  18. The conserved mitochondrial gene distribution in relatives of Turritopsis nutricula, an immortal jellyfish

    PubMed Central

    Devarapalli, Pratap; Kumavath, Ranjith N; Barh, Debmalya; Azevedo, Vasco


    Turritopsis nutricula (T. nutricula) is the one of the known reported organisms that can revert its life cycle to the polyp stage even after becoming sexually mature, defining itself as the only immortal organism in the animal kingdom. Therefore, the animal is having prime importance in basic biological, aging, and biomedical researches. However, till date, the genome of this organism has not been sequenced and even there is no molecular phylogenetic study to reveal its close relatives. Here, using phylogenetic analysis based on available 16s rRNA gene and protein sequences of Cytochrome oxidase subunit-I (COI or COX1) of T. nutricula, we have predicted the closest relatives of the organism. While we found Nemopsis bachei could be closest organism based on COX1 gene sequence; T. dohrnii may be designated as the closest taxon to T. nutricula based on rRNA. Moreover, we have figured out four species that showed similar root distance based on COX1 protein sequence. PMID:25352727

  19. The conserved mitochondrial gene distribution in relatives of Turritopsis nutricula, an immortal jellyfish.


    Devarapalli, Pratap; Kumavath, Ranjith N; Barh, Debmalya; Azevedo, Vasco


    Turritopsis nutricula (T. nutricula) is the one of the known reported organisms that can revert its life cycle to the polyp stage even after becoming sexually mature, defining itself as the only immortal organism in the animal kingdom. Therefore, the animal is having prime importance in basic biological, aging, and biomedical researches. However, till date, the genome of this organism has not been sequenced and even there is no molecular phylogenetic study to reveal its close relatives. Here, using phylogenetic analysis based on available 16s rRNA gene and protein sequences of Cytochrome oxidase subunit-I (COI or COX1) of T. nutricula, we have predicted the closest relatives of the organism. While we found Nemopsis bachei could be closest organism based on COX1 gene sequence; T. dohrnii may be designated as the closest taxon to T. nutricula based on rRNA. Moreover, we have figured out four species that showed similar root distance based on COX1 protein sequence. PMID:25352727

  20. Conserved distal promoter of the agouti signaling protein (ASIP) gene controls sexual dichromatism in chickens.


    Oribe, Eri; Fukao, Ayaka; Yoshihara, Chihiro; Mendori, Misa; Rosal, Karen G; Takahashi, Sumio; Takeuchi, Sakae


    Brilliant plumage is typical of male birds, thus sexual plumage dichromatism is seen in many avian species; however, the molecular mechanism underlying this remains unclear. The agouti signaling protein (ASIP) is a paracrine factor that stimulates yellow/red pigment (pheomelanin) synthesis and inhibits black/brown pigment (eumelanin) synthesis in follicular melanocytes. In mammals, the distal promoter of the ASIP gene acts exclusively on the ventral side of the body to create a countershading pigmentation pattern by stimulating pheomelanin synthesis in the ventrum. Here, we examined the role of the distal ASIP promoter in controlling estrogen-dependent sexual dichromatism in chickens. Reverse-transcription polymerase chain reaction analyses revealed that ASIP class 1 mRNAs transcribed by the distal promoter were expressed exclusively on the ventral side of chicks and adult females displaying countershading. In showy adult males, the ASIP class 1 mRNAs were expressed in gold-colored ornamental feathers grown on the back. In the presence of estrogen, males molted into female-like plumage and ASIP class 1 mRNAs expression was altered to female patterns. These results suggest that the distal ASIP promoter produces countershading in chicks and adult females, similar to the ventral-specific ASIP promoter in mammals. In addition, the class 1 promoter plays an important role for creating sexual plumage dichromatism controlled by estrogen. This is the first evidence for a pigmentation gene having been modified in its expression during evolution to develop phenotypic diversity between individuals of different sexes. PMID:22554923

  1. Species identification using genetic tools: the value of nuclear and mitochondrial gene sequences in whale conservation.


    Palumbi, S R; Cipriano, F


    DNA sequence analysis is a powerful tool for identifying the source of samples thought to be derived from threatened or endangered species. Analysis of mitochondrial DNA (mtDNA) from retail whale meat markets has shown consistently that the expected baleen whale in these markets, the minke whale, makes up only about half the products analyzed. The other products are either unregulated small toothed whales like dolphins or are protected baleen whales such as humpback, Bryde's, fin, or blue whales. Independent verification of such mtDNA identifications requires analysis of nuclear genetic loci, but this is technically more difficult than standard mtDNA sequencing. In addition, evolution of species-specific sequences (i.e., fixation of sequence differences to produce reciprocally monophyletic gene trees) is slower in nuclear than in mitochondrial genes primarily because genetic drift is slower at nuclear loci. When will use of nuclear sequences allow forensic DNA identification? Comparison of neutral theories of coalescence of mitochondrial and nuclear loci suggests a simple rule of thumb. The "three-times rule" suggests that phylogenetic sorting at nuclear loci is likely to produce species-specific sequences when mitochondrial alleles are reciprocally monophyletic and the branches leading to the mtDNA sequences of a species are three times longer than the average difference observed within species. A preliminary test of the three-times rule, which depends on many assumptions about the species and genes involved, suggests that blue and fin whales should have species-specific sequences at most neutral nuclear loci, whereas humpback and fin whales should show species-specific sequences at fewer nuclear loci. Partial sequences of actin introns from these species confirm the predictions of the three-times rule and show that blue and fin whales are reciprocally monophyletic at this locus. These intron sequences are thus good tools for the identification of these species

  2. Evolutionarily Conserved Regulatory Motifs in the Promoter of the Arabidopsis Clock Gene LATE ELONGATED HYPOCOTYL[C][W

    PubMed Central

    Spensley, Mark; Kim, Jae-Yean; Picot, Emma; Reid, John; Ott, Sascha; Helliwell, Chris; Carré, Isabelle A.


    The transcriptional regulation of the LATE ELONGATED HYPOCOTYL (LHY) gene is key to the structure of the circadian oscillator, integrating information from multiple regulatory pathways. We identified a minimal region of the LHY promoter that was sufficient for rhythmic expression. Another upstream sequence was also required for appropriate waveform of transcription and for maximum amplitude of oscillations under both diurnal and free-running conditions. We showed that two classes of protein complexes interact with a G-box and with novel 5A motifs; mutation of these sites reduced the amplitude of oscillation and broadened the peak of expression. A genome-wide bioinformatic analysis showed that these sites were enriched in phase-specific clusters of rhythmically expressed genes. Comparative genomic analyses showed that these motifs were conserved in orthologous promoters from several species. A position-specific scoring matrix for the 5A sites suggested similarity to CArG boxes, which are recognized by MADS box transcription factors. In support of this, the FLOWERING LOCUS C (FLC) protein was shown to interact with the LHY promoter in planta. This suggests a mechanism by which FLC might affect circadian period. PMID:19789276

  3. Nitrogen remobilization and conservation, and underlying senescence-associated gene expression in the perennial switchgrass Panicum virgatum.


    Yang, Jiading; Worley, Eric; Ma, Qin; Li, Jun; Torres-Jerez, Ivone; Li, Gaoyang; Zhao, Patrick X; Xu, Ying; Tang, Yuhong; Udvardi, Michael


    Improving nitrogen (N) remobilization from aboveground to underground organs during yearly shoot senescence is an important goal for sustainable production of switchgrass (Panicum virgatum) as a biofuel crop. Little is known about the genetic control of senescence and N use efficiency in perennial grasses such as switchgrass, which limits our ability to improve the process. Switchgrass aboveground organs (leaves, stems and inflorescences) and underground organs (crowns and roots) were harvested every month over a 3-yr period. Transcriptome analysis was performed to identify genes differentially expressed in various organs during development. Total N content in aboveground organs increased from spring until the end of summer, then decreased concomitant with senescence, while N content in underground organs exhibited an increase roughly matching the decrease in shoot N during fall. Hundreds of senescence-associated genes were identified in leaves and stems. Functional grouping indicated that regulation of transcription and protein degradation play important roles in shoot senescence. Coexpression networks predict important roles for five switchgrass NAC (NAM, ATAF1,2, CUC2) transcription factors (TFs) and other TF family members in orchestrating metabolism of carbohydrates, N and lipids, protein modification/degradation, and transport processes during senescence. This study establishes a molecular basis for understanding and enhancing N remobilization and conservation in switchgrass. PMID:26935010

  4. Quantitative gene expression profiling of mouse brain regions reveals differential transcripts conserved in human and affected in disease models.


    Brochier, Camille; Gaillard, Marie-Claude; Diguet, Elsa; Caudy, Nicolas; Dossat, Carole; Ségurens, Béatrice; Wincker, Patrick; Roze, Emmanuel; Caboche, Jocelyne; Hantraye, Philippe; Brouillet, Emmanuel; Elalouf, Jean-Marc; de Chaldée, Michel


    Using serial analysis of gene expression, we collected quantitative transcriptome data in 11 regions of the adult wild-type mouse brain: the orbital, prelimbic, cingulate, motor, somatosensory, and entorhinal cortices, the caudate-putamen, the nucleus accumbens, the thalamus, the substantia nigra, and the ventral tegmental area. With >1.2 million cDNA tags sequenced, this database is a powerful resource to explore brain functions and disorders. As an illustration, we performed interregional comparisons and found 315 differential transcripts. Most of them are poorly characterized and 20% lack functional annotation. For 78 differential transcripts, we provide independent expression level measurements in mouse brain regions by real-time quantitative RT-PCR. We also show examples where we used in situ hybridization to achieve infrastructural resolution. For 30 transcripts, we next demonstrated that regional enrichment is conserved in the human brain. We then quantified the expression levels of region-enriched transcripts in the R6/2 mouse model of Huntington disease and the 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine (MPTP) mouse model of Parkinson disease and observed significant alterations in the striatum, cerebral cortex, thalamus and substantia nigra of R6/2 mice and in the striatum of MPTP-treated mice. These results show that the gene expression data provided here for the mouse brain can be used to explore pathophysiological models and disclose transcripts differentially expressed in human brain regions. PMID:18252803

  5. A highly conserved baculovirus gene p48 (ac103) is essential for BV production and ODV envelopment

    SciTech Connect

    Yuan Meijin; Wu Wenbi; Liu Chao; Wang Yanjie; Hu Zhaoyang; Yang Kai Pang Yi


    Autographa californica multiple nucleopolyhedrovirus (AcMNPV) p48 (ac103) is a highly conserved baculovirus gene of unknown function. In the present study, we generated a knockout of the p48 gene in an AcMNPV bacmid and investigated the role of P48 in baculovirus life cycle. The p48-null Bacmid vAc{sup P48-KO-PH-GFP} was unable to propagate in cell culture, while a 'repair' Bacmid vAc{sup P48-REP-PH-GFP} was able to replicate in a manner similar to a wild-type Bacmid vAc{sup PH-GFP}. Titration assays and Western blotting confirmed that vAc{sup P48-KO-PH-GFP} was unable to produce budded viruses (BVs). qPCR analysis showed that p48 deletion did not affect viral DNA replication. Electron microscopy indicated that P48 was required for nucleocapsid envelopment to form occlusion-derived viruses (ODVs) and their subsequent occlusion. Confocal analysis showed that P48 prominently condensed in the centre of the nucleus. Our results demonstrate that P48 plays an essential role in BV production and ODV envelopment in the AcMNPV life cycle.

  6. Inactivation of conserved genes induces microbial aversion, drug detoxification, and innate immunity in C.elegans

    PubMed Central

    Melo, Justine A.; Ruvkun, Gary


    Summary The nematode C. elegans consumes benign bacteria such as E. coli and is repelled by pathogens and toxins. Here we show that RNAi and toxin-mediated disruption of core cellular activities, including translation, respiration, and protein turnover, stimulates behavioral avoidance of attractive E. coli. RNAi of such essential processes also induces expression of detoxification and innate immune response genes in the absence of toxins or pathogens. Disruption of core processes in non-neuronal tissues can stimulate aversion behavior, revealing a neuroendocrine axis of control. Microbial avoidance requires serotonergic and Jnk kinase signaling. We propose that surveillance pathways oversee critical cellular activities to detect pathogens, many of which deploy toxins and virulence factors to disrupt these same host pathways. Variation in cellular surveillance and endocrine pathways controlling behavior, detoxification and immunity selected by past toxin or microbial interactions could underlie aberrant responses to foods, medicines, and microbes. PMID:22500807

  7. A fungal conserved gene from the basidiomycete Hebeloma cylindrosporum is essential for efficient ectomycorrhiza formation.


    Doré, Jeanne; Marmeisse, Roland; Combier, Jean-Philippe; Gay, Gilles


    We used Agrobacterium-mediated insertional mutagenesis to identify genes in the ectomycorrhizal fungus Hebeloma cylindrosporum that are essential for efficient mycorrhiza formation. One of the mutants presented a dramatically reduced ability to form ectomycorrhizas when grown in the presence of Pinus pinaster. It failed to form mycorrhizas in the presence of glucose at 0.5 g liter(-1), a condition favorable for mycorrhiza formation by the wild-type strain. However, it formed few mycorrhizas when glucose was replaced by fructose or when glucose concentration was increased to 1 g liter(-1). Scanning electron microscopy examination of these mycorrhizas revealed that this mutant was unable to differentiate true fungal sheath and Hartig net. Molecular analyses showed that the single-copy disrupting T-DNA was integrated 6,884 bp downstream from the start codon, of an open reading frame potentially encoding a 3,096-amino-acid-long protein. This gene, which we named HcMycE1, has orthologs in numerous fungi as well as different other eukaryotic microorganisms. RNAi inactivation of HcMycE1 in the wild-type strain also led to a mycorrhizal defect, demonstrating that the nonmycorrhizal phenotype of the mutant was due to mutagenic T-DNA integration in HcMycE1. In the wild-type strain colonizing P. pinaster roots, HcMycE1 was transiently upregulated before symbiotic structure differentiation. Together with the inability of the mutant to differentiate these structures, this suggests that HcMycE1 plays a crucial role upstream of the fungal sheath and Hartig net differentiation. This study provides the first characterization of a fungal mutant altered in mycorrhizal ability. PMID:24918768

  8. Chicken interferon consensus sequence-binding protein (ICSBP) and interferon regulatory factor (IRF) 1 genes reveal evolutionary conservation in the IRF gene family.

    PubMed Central

    Jungwirth, C; Rebbert, M; Ozato, K; Degen, H J; Schultz, U; Dawid, I B


    Members of the IRF family mediate transcriptional responses to interferons (IFNs) and to virus infection. So far, proteins of this family have been studied only among mammalian species. Here we report the isolation of cDNA clones encoding two members of this family from chicken, interferon consensus sequence-binding protein (ICSBP) and IRF-1. The predicted chicken ICSBP and IRF-1 proteins show high levels of sequence similarity to their corresponding human and mouse counterparts. Sequence identities in the putative DNA-binding domains of chicken and human ICSBP and IRF-1 were 97% and 89%, respectively, whereas the C-terminal regions showed identities of 64% and 51%; sequence relationships with mouse ICSBP and IRF-1 are very similar. Chicken ICSBP was found to be expressed in several embryonic tissues, and both chicken IRF-1 and ICSBP were strongly induced in chicken fibroblasts by IFN treatment, supporting the involvement of these factors in IFN-regulated gene expression. The presence of proteins homologous to mammalian IRF family members, together with earlier observations on the occurrence of functionally homologous IFN-responsive elements in chicken and mammalian genes, highlights the conservation of transcriptional mechanisms in the IFN system, a finding that contrasts with the extensive sequence and functional divergence of the IFNs. Images Fig. 3 Fig. 4 Fig. 5 PMID:7536924

  9. The Histone Modification H3K27me3 Is Retained after Gene Duplication and Correlates with Conserved Noncoding Sequences in Arabidopsis

    PubMed Central

    Berke, Lidija; Snel, Berend


    The histone modification H3K27me3 is involved in repression of transcription and plays a crucial role in developmental transitions in both animals and plants. It is deposited by PRC2 (Polycomb repressive complex 2), a conserved protein complex. In Arabidopsis thaliana, H3K27me3 is found at 15% of all genes. These tend to encode transcription factors and other regulators important for development. However, it is not known how PRC2 is recruited to target loci nor how this set of target genes arose during Arabidopsis evolution. To resolve the latter, we integrated A. thaliana gene families with five independent genome-wide H3K27me3 data sets. Gene families were either significantly enriched or depleted of H3K27me3, showing a strong impact of shared ancestry to H3K27me3 distribution. To quantify this, we performed ancestral state reconstruction of H3K27me3 on phylogenetic trees of gene families. The set of H3K27me3-marked genes changed less than expected by chance, suggesting that H3K27me3 was retained after gene duplication. This retention suggests that the PRC2-recruiting signal could be encoded in the DNA and also conserved among certain duplicated genes. Indeed, H3K27me3-marked genes were overrepresented among paralogs sharing conserved noncoding sequences (CNSs) that are enriched with transcription factor binding sites. The association of upstream CNSs with H3K27me3-marked genes represents the first genome-wide connection between H3K27me3 and potential regulatory elements in plants. Thus, we propose that CNSs likely function as part of the PRC2 recruitment in plants. PMID:24567304

  10. Mitochondrial genome rearrangements at low taxonomic levels: three distinct mitogenome gene orders in the genus Pseudoniphargus (Crustacea: Amphipoda).


    Stokkan, Morten; Jurado-Rivera, Jose A; Juan, Carlos; Jaume, Damià; Pons, Joan


    A comparison of mitochondrial genomes of three species of the amphipod Pseudoniphargus revealed the occurrence of a surprisingly high level of gene rearrangement involving protein-coding genes that is a rare phenomenon at low taxonomic levels. The three Pseudoniphargus mitogenomes also display a unique gene arrangement with respect to either the presumed Pancrustacean order or those known for other amphipods. Relative long non-coding sequences appear adjacent to the putative breakage points involved in gene rearrangements of protein coding genes. Other details of the newly obtained mitochondrial genomes - e.g., gene content, nucleotide composition and codon usage - are similar to those found in the mitogenomes of other amphipod species studied. They all contain the typical mitochondrial genome set consisting of 13 protein-coding genes, 22 tRNAs, and two rRNAS, as well as a large control region. The secondary structures and characteristics of tRNA and ribosomal mitochondrial genes of these three species are also discussed. PMID:26329687

  11. A Survey of the Gene Repertoire of Gigaspora rosea Unravels Conserved Features among Glomeromycota for Obligate Biotrophy.


    Tang, Nianwu; San Clemente, Hélène; Roy, Sébastien; Bécard, Guillaume; Zhao, Bin; Roux, Christophe


    Arbuscular mycorrhizal (AM) fungi are a diverse group of soil fungi (Glomeromycota) that form the most ancient mutualistic association termed AM symbiosis with a majority of land plants, improving their nutrition uptake and resistance to stresses. In contrast to their great ecological implications, the knowledge of the molecular biological mechanisms involved is still scant, partly due to the limited genomic resources available. Here, we describe the gene repertoire of a new AM fungus Gigaspora rosea (Diversisporales). Among the 86332 non-redundant virtual transcripts assembled, 15346 presented similarities with proteins in the Refseq database and 10175 were assigned with GO terms. KOG and Interpro domain annotations clearly showed an enrichment of genes involved in signal transduction in G. rosea. KEGG pathway analysis indicates that most primary metabolic processes are active in G. rosea. However, as for Rhizophagus irregularis, several metabolic genes were not found, including the fatty acid synthase (FAS) gene. This finding supports the hypothesis that AM fungi depend on the lipids produced by their hosts. Furthermore, the presence of a large number of transporters and 100s of secreted proteins, together with the reduced number of plant cell wall degrading enzymes could be interpreted as an evolutionary adaptation to its mutualistic obligate biotrophy. The detection of meiosis-related genes suggests that G. rosea might use a cryptic sexual process. Lastly, a phylogeny of basal fungi clearly shows Glomeromycota as a sister clade to Mucoromycotina, not only to the Mucorales or Mortierellales. The characterization of the gene repertoire from an AM fungal species belonging to the order of Diversisporales and its comparison with the gene sets of R. irregularis (Glomerales) and Gigaspora margarita (Diversisporales), reveal that AM fungi share several features linked to mutualistic obligate biotrophy. This work contributes to lay the foundation for forthcoming studies

  12. A Survey of the Gene Repertoire of Gigaspora rosea Unravels Conserved Features among Glomeromycota for Obligate Biotrophy

    PubMed Central

    Tang, Nianwu; San Clemente, Hélène; Roy, Sébastien; Bécard, Guillaume; Zhao, Bin; Roux, Christophe


    Arbuscular mycorrhizal (AM) fungi are a diverse group of soil fungi (Glomeromycota) that form the most ancient mutualistic association termed AM symbiosis with a majority of land plants, improving their nutrition uptake and resistance to stresses. In contrast to their great ecological implications, the knowledge of the molecular biological mechanisms involved is still scant, partly due to the limited genomic resources available. Here, we describe the gene repertoire of a new AM fungus Gigaspora rosea (Diversisporales). Among the 86332 non-redundant virtual transcripts assembled, 15346 presented similarities with proteins in the Refseq database and 10175 were assigned with GO terms. KOG and Interpro domain annotations clearly showed an enrichment of genes involved in signal transduction in G. rosea. KEGG pathway analysis indicates that most primary metabolic processes are active in G. rosea. However, as for Rhizophagus irregularis, several metabolic genes were not found, including the fatty acid synthase (FAS) gene. This finding supports the hypothesis that AM fungi depend on the lipids produced by their hosts. Furthermore, the presence of a large number of transporters and 100s of secreted proteins, together with the reduced number of plant cell wall degrading enzymes could be interpreted as an evolutionary adaptation to its mutualistic obligate biotrophy. The detection of meiosis-related genes suggests that G. rosea might use a cryptic sexual process. Lastly, a phylogeny of basal fungi clearly shows Glomeromycota as a sister clade to Mucoromycotina, not only to the Mucorales or Mortierellales. The characterization of the gene repertoire from an AM fungal species belonging to the order of Diversisporales and its comparison with the gene sets of R. irregularis (Glomerales) and Gigaspora margarita (Diversisporales), reveal that AM fungi share several features linked to mutualistic obligate biotrophy. This work contributes to lay the foundation for forthcoming studies

  13. EBSeq-HMM: a Bayesian approach for identifying gene-expression changes in ordered RNA-seq experiments

    PubMed Central

    Leng, Ning; Li, Yuan; McIntosh, Brian E.; Nguyen, Bao Kim; Duffin, Bret; Tian, Shulan; Thomson, James A.; Dewey, Colin N.; Stewart, Ron; Kendziorski, Christina


    Motivation: With improvements in next-generation sequencing technologies and reductions in price, ordered RNA-seq experiments are becoming common. Of primary interest in these experiments is identifying genes that are changing over time or space, for example, and then characterizing the specific expression changes. A number of robust statistical methods are available to identify genes showing differential expression among multiple conditions, but most assume conditions are exchangeable and thereby sacrifice power and precision when applied to ordered data. Results: We propose an empirical Bayes mixture modeling approach called EBSeq-HMM. In EBSeq-HMM, an auto-regressive hidden Markov model is implemented to accommodate dependence in gene expression across ordered conditions. As demonstrated in simulation and case studies, the output proves useful in identifying differentially expressed genes and in specifying gene-specific expression paths. EBSeq-HMM may also be used for inference regarding isoform expression. Availability and implementation: An R package containing examples and sample datasets is available at Bioconductor. Contact: Supplementary information: Supplementary data are available at Bioinformatics online. PMID:25847007

  14. Comparative Developmental Transcriptomics Reveals Rewiring of a Highly Conserved Gene Regulatory Network during a Major Life History Switch in the Sea Urchin Genus Heliocidaris

    PubMed Central

    Israel, Jennifer W.; Martik, Megan L.; Byrne, Maria; Raff, Elizabeth C.; Raff, Rudolf A.; McClay, David R.; Wray, Gregory A.


    The ecologically significant shift in developmental strategy from planktotrophic (feeding) to lecithotrophic (nonfeeding) development in the sea urchin genus Heliocidaris is one of the most comprehensively studied life history transitions in any animal. Although the evolution of lecithotrophy involved substantial changes to larval development and morphology, it is not known to what extent changes in gene expression underlie the developmental differences between species, nor do we understand how these changes evolved within the context of the well-defined gene regulatory network (GRN) underlying sea urchin development. To address these questions, we used RNA-seq to measure expression dynamics across development in three species: the lecithotroph Heliocidaris erythrogramma, the closely related planktotroph H. tuberculata, and an outgroup planktotroph Lytechinus variegatus. Using well-established statistical methods, we developed a novel framework for identifying, quantifying, and polarizing evolutionary changes in gene expression profiles across the transcriptome and within the GRN. We found that major changes in gene expression profiles were more numerous during the evolution of lecithotrophy than during the persistence of planktotrophy, and that genes with derived expression profiles in the lecithotroph displayed specific characteristics as a group that are consistent with the dramatically altered developmental program in this species. Compared to the transcriptome, changes in gene expression profiles within the GRN were even more pronounced in the lecithotroph. We found evidence for conservation and likely divergence of particular GRN regulatory interactions in the lecithotroph, as well as significant changes in the expression of genes with known roles in larval skeletogenesis. We further use coexpression analysis to identify genes of unknown function that may contribute to both conserved and derived developmental traits between species. Collectively, our results

  15. Comparative Developmental Transcriptomics Reveals Rewiring of a Highly Conserved Gene Regulatory Network during a Major Life History Switch in the Sea Urchin Genus Heliocidaris.


    Israel, Jennifer W; Martik, Megan L; Byrne, Maria; Raff, Elizabeth C; Raff, Rudolf A; McClay, David R; Wray, Gregory A


    The ecologically significant shift in developmental strategy from planktotrophic (feeding) to lecithotrophic (nonfeeding) development in the sea urchin genus Heliocidaris is one of the most comprehensively studied life history transitions in any animal. Although the evolution of lecithotrophy involved substantial changes to larval development and morphology, it is not known to what extent changes in gene expression underlie the developmental differences between species, nor do we understand how these changes evolved within the context of the well-defined gene regulatory network (GRN) underlying sea urchin development. To address these questions, we used RNA-seq to measure expression dynamics across development in three species: the lecithotroph Heliocidaris erythrogramma, the closely related planktotroph H. tuberculata, and an outgroup planktotroph Lytechinus variegatus. Using well-established statistical methods, we developed a novel framework for identifying, quantifying, and polarizing evolutionary changes in gene expression profiles across the transcriptome and within the GRN. We found that major changes in gene expression profiles were more numerous during the evolution of lecithotrophy than during the persistence of planktotrophy, and that genes with derived expression profiles in the lecithotroph displayed specific characteristics as a group that are consistent with the dramatically altered developmental program in this species. Compared to the transcriptome, changes in gene expression profiles within the GRN were even more pronounced in the lecithotroph. We found evidence for conservation and likely divergence of particular GRN regulatory interactions in the lecithotroph, as well as significant changes in the expression of genes with known roles in larval skeletogenesis. We further use coexpression analysis to identify genes of unknown function that may contribute to both conserved and derived developmental traits between species. Collectively, our results

  16. Theory of Metastable State Relaxation in a Gravitational Field for Non-Critical Binary Systems with Non-Conserved Order Parameter

    NASA Technical Reports Server (NTRS)

    Izmailov, Alexander F.; Myerson, Allan S.


    A new mathematical ansatz is developed for solution of the time-dependent Ginzburg-Landau nonlinear partial differential equation describing metastable state relaxation in binary (solute+solvent) non-critical solutions with non-conserved scalar order parameter in presence of a gravitational field. It has been demonstrated analytically that in such systems metastability initiates heterogeneous solute redistribution which results in the formation of a non-equilibrium singly-periodic spatial solute structure in the new solute-rich phase. The critical radius of nucleation and the induction time in these systems are gravity-dependent. It has also been proved that metastable state relaxation in vertical columns of supersaturated non-critical binary solutions leads to formation of the solute concentration gradient. Analytical expression for this concentration gradient is found and analysed. It is concluded that gravity can initiate phase separation (nucleation or spinodal decomposition).

  17. Conservation laws and dark-soliton solutions of an integrable higher-order nonlinear Schrödinger equation for a density-modulated quantum condensate

    NASA Astrophysics Data System (ADS)

    Liu, De-Yin; Tian, Bo; Sun, Wen-Rong; Wang, Yun-Po


    In this paper, an integrable higher-order nonlinear Schrödinger equation for a density-modulated quantum condensate is investigated. Based on the Ablowitz-Kaup-Newell-Segur system, an infinite number of conservation laws are obtained. Introducing an auxiliary function, we derive the bilinear forms and construct the dark-soliton solutions with the help of the Hirota method and symbolic computation. Dark one, two, and three solitons are analyzed graphically. Via asymptotic analysis, interactions between the two dark solitons are proved to be elastic. We see that the coefficients in the equation only affect the soliton velocity. We analyze the linear stability of the plane wave solutions in the presence of a small perturbation.

  18. Lax pair, conservation laws and solitons for a (2 + 1)-dimensional fourth-order nonlinear Schrödinger equation governing an α-helical protein

    NASA Astrophysics Data System (ADS)

    Chai, Jun; Tian, Bo; Zhen, Hui-Ling; Sun, Wen-Rong


    Energy transfer through a (2+1)-dimensional α-helical protein can be described by a (2+1)-dimensional fourth-order nonlinear Schrödinger equation. For such an equation, a Lax pair and the infinitely-many conservation laws are derived. Using an auxiliary function and a bilinear formulation, we get the one-, two-, three- and N-soliton solutions via the Hirota method. The soliton velocity is linearly related to the lattice parameter γ, while the soliton' direction and amplitude do not depend on γ. Interactions between the two solitons are elastic, while those among the three solitons are pairwise elastic. Oblique, head-on and overtaking interactions between the two solitons are displayed. Oblique interaction among the three solitons and interactions among the two parallel solitons and a single one are presented as well.

  19. Sequence conservation of the rad21 Schizosaccharomyces pombe DNA double-strand break repair gene in human and mouse

    SciTech Connect

    McKay, M.J.; Troelstra, C.; Kanaar, R.


    The rad21 gene of Schizosaccharomyces pombe is involved in the repair of ionizing radiation-induced DNA double-strand breaks. The isolation of mouse and human putative homologs of rad21 is reported here. Alignment of the predicted amino acid sequence of Rad21 with the mammalian proteins showed that the similarity was distributed across the length of the proteins, with more highly conserved regions at both termini. The mHR21{sup sp} (mouse homolog of Rad21, S. pombe) and hHR21{sup sp} (human homolog of Rad21, S. pombe) predicted proteins were 96% identical, whereas the human and S. pombe proteins were 25% identical and 47% similar. RNA blot analysis showed that mHR21{sup sp} mRNA was abundant in all adult mouse tissues examined, with highest expression in testis and thymus. In addition to a 3.1-kb constitutive mRNA transcript, a 2.2-kb transcript was present at a high level in postmeiotic spermatids, while expression of the 3.1-kb mRNA in testis was confined to the meiotic compartment. hHR21{sup sp} mRNA was cell-cycle regulated in human cells, increasing in late S phase to a peak in G2 phase. The level of hHR21{sup sp} transcripts was not altered by exposure of normal diploid fibroblasts to 10 Gy ionizing radiation. In situ hybridization showed that mHR21{sup sp} resided on chromosome 15D3, whereas hHR21{sup sp} localized to the syntenic 8q24 region. Elevated expression of mHR21{sup sp} in testis and thymus supports a possible role for the rad21 mammalian homologs in V(D)J and meiotic recombination, respectively. Cell cycle regulation of rad21, retained from S. pombe to human, is consistent with a conservation of function between S. pombe and human rad21 genes. 62 refs., 8 figs., 1 tab.

  20. An overview on the role of Hexanchiformes in marine ecosystems: biology, ecology and conservation status of a primitive order of modern sharks.


    Barnett, A; Braccini, J M; Awruch, C A; Ebert, D A


    The large size, high trophic level and wide distribution of Hexanchiformes (cow and frilled sharks) should position this order as important apex predators in coastal and deep-water ecosystems. This review synthesizes available information on Hexanchiformes, including information not yet published, with the purpose of evaluating their conservation status and assessing their ecological roles in the dynamics of marine ecosystems. Comprising six species, this group has a wide global distribution, with members occurring from shallow coastal areas to depths of c. 2500 m. The limited information available on their reproductive biology suggests that they could be vulnerable to overexploitation (e.g. small litter sizes for most species and suspected long gestation periods). Most of the fishing pressure exerted on Hexanchiformes is in the form of commercial by-catch or recreational fishing. Comprehensive stock and impact assessments are unavailable for most species in most regions due to limited information on life history and catch and abundance time series. When hexanchiform species have been commercially harvested, however, they have been unable to sustain targeted fisheries for long periods. The potentially high vulnerability to intense fishing pressure warrants a conservative exploitation of this order until thorough quantitative assessments are conducted. At least some species have been shown to be significant apex predators in the systems they inhabit. Should Hexanchiformes be removed from coastal and deep-water systems, the lack of sympatric shark species that share the same resources suggests no other species would be capable of fulfilling their apex predator role in the short term. This has potential ecosystem consequences such as meso-predator release or trophic cascades. This review proposes some hypotheses on the ecology of Hexanchiformes and their role in ecosystem dynamics, highlighting the areas where critical information is required to stimulate research

  1. Linkage of TATA-binding protein and proteasome subunit C5 genes in mice and humans reveals synteny conserved between mammals and invertebrates.


    Trachtulec, Z; Hamvas, R M; Forejt, J; Lehrach, H R; Vincek, V; Klein, J


    The TATA-binding protein (TBP) is a factor required for the transcription of all classes of eukaryotic genes. Here, we demonstrate that in the mouse the TBP-encoding gene (Tbp) resides next to the proteasomal subunit C5-encoding gene (Psmb1). The genes are located on mouse chromosome 17 in the t complex within the Hybrid sterility 1 (Hst1) region. We demonstrate that the homologous human genes (TBP AND PSMB1) are tightly linked on the long arm of chromosome 6, in a region syntenic with the proximal part of mouse chromosome 17. The mouse Tbp and Psmb1 and the human TBP and PSMB1 genes are transcribed in the opposite orientation. The TATA-binding protein and proteasomal subunit C5 genes are also linked on chromosome III of Caenorhabditis elegans, and together they are linked to other genes whose homologs map to human chromosome 6 and mouse chromosome 17. In the Drosophila genome, the housekeeping TATA-binding protein gene maps close to two other genes with homologs in the mammalian major histocompatibility complex. There thus exists conserved synteny of unrelated genes between mammals and invertebrates. PMID:9286694

  2. The Expression and Function of the Achaete-Scute Genes in Tribolium castaneum Reveals Conservation and Variation in Neural Pattern Formation and Cell Fate Specification

    NASA Technical Reports Server (NTRS)

    Wheeler, Scott R.; Carrico, Michelle L.; Wilson, Beth A.; Brown, Susan J.; Skeath, James B.


    SUMMARY The study of achaete-scute (ac/sc) genes has recently become a paradigm to understand the evolution and development of the arthropod nervous system. We describe the identification and characterization of the ache genes in the coleopteran insect species Tribolium castaneum. We have identified two Tribolium ache genes - achaete-scute homolog (Tc-ASH) a proneural gene and asense (Tc-ase) a neural precursor gene that reside in a gene complex. Focusing on the embryonic central nervous system we fmd that Tc-ASH is expressed in all neural precursors and the proneural clusters from which they segregate. Through RNAi and misexpression studies we show that Tc-ASH is necessary for neural precursor formation in Triboliurn and sufficient for neural precursor formation in Drosophila. Comparison of the function of the Drosophila and Triboliurn proneural ac/sc genes suggests that in the Drosophila lineage these genes have maintained their ancestral function in neural precursor formation and have acquired a new role in the fate specification of individual neural precursors. Furthermore, we find that Tc-use is expressed in all neural precursors suggesting an important and conserved role for asense genes in insect nervous system development. Our analysis of the Triboliurn ache genes indicates significant plasticity in gene number, expression and function, and implicates these modifications in the evolution of arthropod neural development.

  3. The expression and function of the achaete-scute genes in Tribolium castaneum reveals conservation and variation in neural pattern formation and cell fate specification

    NASA Technical Reports Server (NTRS)

    Wheeler, Scott R.; Carrico, Michelle L.; Wilson, Beth A.; Brown, Susan J.; Skeath, James B.


    The study of achaete-scute (ac/sc) genes has recently become a paradigm to understand the evolution and development of the arthropod nervous system. We describe the identification and characterization of the ac/sc genes in the coleopteran insect species Tribolium castaneum. We have identified two Tribolium ac/sc genes - achaete-scute homolog (Tc-ASH) a proneural gene and asense (Tc-ase) a neural precursor gene that reside in a gene complex. Focusing on the embryonic central nervous system we find that Tc-ASH is expressed in all neural precursors and the proneural clusters from which they segregate. Through RNAi and misexpression studies we show that Tc-ASH is necessary for neural precursor formation in Tribolium and sufficient for neural precursor formation in Drosophila. Comparison of the function of the Drosophila and Tribolium proneural ac/sc genes suggests that in the Drosophila lineage these genes have maintained their ancestral function in neural precursor formation and have acquired a new role in the fate specification of individual neural precursors. Furthermore, we find that Tc-ase is expressed in all neural precursors suggesting an important and conserved role for asense genes in insect nervous system development. Our analysis of the Tribolium ac/sc genes indicates significant plasticity in gene number, expression and function, and implicates these modifications in the evolution of arthropod neural development.

  4. Detection of a conserved arrangement of three tRNA genes in the sunflower mitochondrial genome. Identification, mapping and expression of trnC-trnN-trnY genes.


    Ceci, L R; Ambrosini, M; Fiorella, S; Gallerani, R


    The genes coding for tRNA-Cys (trnC), tRNA-Asn (trnN) and tRNA-Tyr (trnY) have been sequenced in a region of about 3.0 kb of the sunflower mitochondrial DNA. The trnC and trnY are genuine mitochondrial genes, while the trnN gene has a chloroplast origin. Despite their heterologous origin the three genes are transcribed. Their arrangement is the first detected in a highly conserved form in a specific group of advanced dicots. PMID:8061634

  5. Branching genes are conserved across species. Genes controlling a novel signal in pea are coregulated by other long-distance signals.


    Johnson, Xenie; Brcich, Tanya; Dun, Elizabeth A; Goussot, Magali; Haurogné, Karine; Beveridge, Christine A; Rameau, Catherine


    Physiological and genetic studies with the ramosus (rms) mutants in garden pea (Pisum sativum) and more axillary shoots (max) mutants in Arabidopsis (Arabidopsis thaliana) have shown that shoot branching is regulated by a network of long-distance signals. Orthologous genes RMS1 and MAX4 control the synthesis of a novel graft-transmissible branching signal that may be a carotenoid derivative and acts as a branching inhibitor. In this study, we demonstrate further conservation of the branching control system by showing that MAX2 and MAX3 are orthologous to RMS4 and RMS5, respectively. This is consistent with the long-standing hypothesis that branching in pea is regulated by a novel long-distance signal produced by RMS1 and RMS5 and that RMS4 is implicated in the response to this signal. We examine RMS5 expression and show that it is more highly expressed relative to RMS1, but under similar transcriptional regulation as RMS1. Further expression studies support the hypothesis that RMS4 functions in shoot and rootstock and participates in the feedback regulation of RMS1 and RMS5 expression. This feedback involves a second novel long-distance signal that is lacking in rms2 mutants. RMS1 and RMS5 are also independently regulated by indole-3-acetic acid. RMS1, rather than RMS5, appears to be a key regulator of the branching inhibitor. This study presents new interactions between RMS genes and provides further evidence toward the ongoing elucidation of a model of axillary bud outgrowth in pea. PMID:16980559

  6. The legume NOOT-BOP-COCH-LIKE genes are conserved regulators of abscission, a major agronomical trait in cultivated crops.


    Couzigou, Jean-Malo; Magne, Kevin; Mondy, Samuel; Cosson, Viviane; Clements, Jonathan; Ratet, Pascal


    Plants are able to lose organs selectively through a process called abscission. This process relies on the differentiation of specialized territories at the junction between organs and the plant body that are called abscission zones (AZ). Several genes control the formation or functioning of these AZ. We have characterized BLADE-ON-PETIOLE (BOP) orthologues from several legume plants and studied their roles in the abscission process using a mutant approach. Here, we show that the Medicago truncatula NODULE ROOT (NOOT), the Pisum sativum COCHLEATA (COCH) and their orthologue in Lotus japonicus are strictly necessary for the abscission of not only petals, but also leaflets, leaves and fruits. We also showed that the expression pattern of the M. truncatula pNOOT::GUS fusion is associated with functional and vestigial AZs when expressed in Arabidopsis. In addition, we show that the stip mutant from Lupinus angustifolius, defective in stipule formation and leaf abscission, is mutated in a BOP orthologue. In conclusion, this study shows that this clade of proteins plays an important conserved role in promoting abscission of all aerial organs studied so far. PMID:26390061

  7. West syndrome caused by homozygous variant in the evolutionary conserved gene encoding the mitochondrial elongation factor GUF1.


    Alfaiz, Ali Abdullah; Müller, Verena; Boutry-Kryza, Nadia; Ville, Dorothée; Guex, Nicolas; de Bellescize, Julitta; Rivier, Clotilde; Labalme, Audrey; des Portes, Vincent; Edery, Patrick; Till, Marianne; Xenarios, Ioannis; Sanlaville, Damien; Herrmann, Johannes M; Lesca, Gaétan; Reymond, Alexandre


    West syndrome (WS), defined by the triad of infantile spasms, pathognomonic hypsarrhythmia and developmental regression, is a rare epileptic disease affecting about 1:3500 live births. To get better insights on the genetic of this pathology, we exome-sequenced the members of a consanguineous family affected with isolated WS. We identified a homozygous variant (c.1825G>T/p.(Ala609Ser)) in the GUF1 gene in the three affected siblings. GUF1 encodes a protein essential in conditions that counteract faithful protein synthesis: it is able to remobilize stuck ribosomes and transiently inhibit the elongation process to optimize protein synthesis. The variant identified in the WS family changes an alanine residue conserved in all eukaryotic organisms and positioned within the tRNA-binding moiety of this nuclear genome-encoded mitochondrial translational elongation factor. Yeast complementation assays show that the activity of GUF1(A609S) is modified in suboptimal environments. We suggest a new link between improper assembly of respiratory chain complexes and WS. PMID:26486472

  8. Enhancer of Rudimentary(p1), E(r)(p1), a Highly Conserved Enhancer of the Rudimentary Gene

    PubMed Central

    Wojcik, E.; Murphy, A. M.; Fares, H.; Dang-Vu, K.; Tsubota, S. I.


    A hybrid dysgenesis-induced mutation, enhancer of rudimentary(p1) (e(r)(p1)), is a recessive enhancer of a weak rudimentary mutant phenotype in Drosophila melanogaster. The e(r) gene was cloned using P element tagging and localized to region 8B on the X chromosome. It encodes a 1.0-kb and a 1.2-kb transcript. The 1.0-kb transcript is present in both adult males and females, while the 1.2-kb transcript is predominantly found in females. The difference in the lengths of the two e(r) transcripts is caused by two different polyadenylation sites spaced 228 bp apart. The amounts of both of these transcripts are drastically reduced in the e(r)(p1) mutant. The P element in e(r)(p1) is inserted in the 5'-untranslated leader region near the start of transcription. It may be producing its effect by suppressing transcription and/or by providing transcription termination and polyadenylation signals. The putative e(r) protein is 104 amino acids in length and bears no striking resemblance to protein sequences in GenBank or PIR. While its biochemical function is unknown at this time, sequence analysis indicates that the e(r) protein is highly conserved and, presumably, functionally very important. The amino acid sequences of the D. melanogaster and the Drosophila virilis proteins are 95% identical. PMID:7896098

  9. Analysis of an Ordered, Comprehensive STM Mutant Library in Infectious Borrelia burgdorferi: Insights into the Genes Required for Mouse Infectivity

    PubMed Central

    Lin, Tao; Gao, Lihui; Zhang, Chuhua; Odeh, Evelyn; Jacobs, Mary B.; Coutte, Loïc; Chaconas, George; Philipp, Mario T.; Norris, Steven J.


    The identification of genes important in the pathogenesis of Lyme disease Borrelia has been hampered by exceedingly low transformation rates in low-passage, infectious organisms. Using the infectious, moderately transformable B. burgdorferi derivative 5A18NP1 and signature-tagged versions of the Himar1 transposon vector pGKT, we have constructed a defined transposon library for the efficient genome-wide investigation of genes required for wild-type pathogenesis, in vitro growth, physiology, morphology, and plasmid replication. To facilitate analysis, the insertion sites of 4,479 transposon mutants were determined by sequencing. The transposon insertions were widely distributed across the entire B. burgdorferi genome, with an average of 2.68 unique insertion sites per kb DNA. The 10 linear plasmids and 9 circular plasmids had insertions in 33 to 100 percent of their predicted genes. In contrast, only 35% of genes in the 910 kb linear chromosome had incapacitating insertions; therefore, the remaining 601 chromosomal genes may represent essential gene candidates. In initial signature-tagged mutagenesis (STM) analyses, 434 mutants were examined at multiple tissue sites for infectivity in mice using a semi-quantitative, Luminex-based DNA detection method. Examples of genes found to be important in mouse infectivity included those involved in motility, chemotaxis, the phosphoenolpyruvate phosphotransferase system, and other transporters, as well as putative plasmid maintenance genes. Availability of this ordered STM library and a high-throughput screening method is expected to lead to efficient assessment of the roles of B. burgdorferi genes in the infectious cycle and pathogenesis of Lyme disease. PMID:23133514

  10. A phylotranscriptomic analysis of gene family expansion and evolution in the largest order of pleurocarpous mosses (Hypnales, Bryophyta).


    Johnson, Matthew G; Malley, Claire; Goffinet, Bernard; Shaw, A Jonathan; Wickett, Norman J


    The pleurocarpous mosses (i.e., Hypnanae) are a species-rich group of land plants comprising about 6,000 species that share the development of female sex organs on short lateral branches, a derived trait within mosses. Many of the families within Hypnales, the largest order of pleurocarpous mosses, trace their origin to a rapid radiation less than 100 million years ago, just after the rise of the angiosperms. As a result, the phylogenetic resolution among families of Hypnales, necessary to test evolutionary hypotheses, has proven difficult using one or few loci. We present the first phylogenetic inference from high-throughput sequence data (transcriptome sequences) for pleurocarpous mosses. To test hypotheses of gene family evolution, we built a species tree of 21 pleurocarpous and six acrocarpous mosses using over one million sites from 659 orthologous genes. We used the species tree to investigate the genomic consequences of the shift to pleurocarpy and to identify whether patterns common to other plant radiations (gene family expansion, whole genome duplication, or changes in the molecular signatures of selection) could be observed. We found that roughly six percent of all gene families have expanded in the pleurocarpous mosses, relative to acrocarpous mosses. These gene families are enriched for several gene ontology (GO) terms, including interaction with other organisms. The increase in copy number coincident with the radiation of Hypnales suggests that a process such as whole genome duplication or a burst of small-scale duplications occurred during the diversification. In over 500 gene families we found evidence of a reduction in purifying selection. These gene families are enriched for several terms in the GO hierarchy related to "tRNA metabolic process." Our results reveal candidate genes and pathways that may be associated with the transition to pleurocarpy, illustrating the utility of phylotranscriptomics for the study of molecular evolution in non

  11. D2 Region of the 28S RNA Gene: A Too-Conserved Fragment for Inferences on Phylogeny of South American Triatomines.


    Guerra, Ana Letícia; Alevi, Kaio Cesar Chaboli; Banho, Cecília Artico; de Oliveira, Jader; da Rosa, João Aristeu; Vilela de Azeredo-Oliveira, Maria Tercília


    The brasiliensis complex is composed of five triatomine species, and different approaches suggest that Triatoma lenti and Triatoma petrochiae may be the new members. Therefore, this study sought to analyze the phylogenetic relationships within this complex by means of the D2 region of the 28S RNA gene, and to analyze the degree of polymorphism and phylogenetic significance of this gene for South American triatomines. Phylogenetic analysis by using sequence fragments of the D2 domain did not allow to perform phylogenetic inferences on species within the brasiliensis complex, because the gene alignment composed of a matrix with 37 specimens exhibited only two variable sites along the 567 base pairs used. Furthermore, if all South American species are included, only four variable sites were detected, reflecting the high degree of gene conservation. Therefore, we do not recommend the use of this gene for phylogenetic reconstruction for this group of Chagas disease vectors. PMID:27382073

  12. Conservation laws, bilinear forms and solitons for a fifth-order nonlinear Schrödinger equation for the attosecond pulses in an optical fiber

    SciTech Connect

    Chai, Jun; Tian, Bo Zhen, Hui-Ling; Sun, Wen-Rong


    Under investigation in this paper is a fifth-order nonlinear Schrödinger equation, which describes the propagation of attosecond pulses in an optical fiber. Based on the Lax pair, infinitely-many conservation laws are derived. With the aid of auxiliary functions, bilinear forms, one-, two- and three-soliton solutions in analytic forms are generated via the Hirota method and symbolic computation. Soliton velocity varies linearly with the coefficients of the high-order terms. Head-on interaction between the bidirectional two solitons and overtaking interaction between the unidirectional two solitons as well as the bound state are depicted. For the interactions among the three solitons, two head-on and one overtaking interactions, three overtaking interactions, an interaction between a bound state and a single soliton and the bound state are displayed. Graphical analysis shows that the interactions between the two solitons are elastic, and interactions among the three solitons are pairwise elastic. Stability analysis yields the modulation instability condition for the soliton solutions.

  13. A prognosis classifier for breast cancer based on conserved gene regulation between mammary gland development and tumorigenesis: a multiscale statistical model.


    Tian, Yingpu; Chen, Baozhen; Guan, Pengfei; Kang, Yujia; Lu, Zhongxian


    Identification of novel cancer genes for molecular therapy and diagnosis is a current focus of breast cancer research. Although a few small gene sets were identified as prognosis classifiers, more powerful models are still needed for the definition of effective gene sets for the diagnosis and treatment guidance in breast cancer. In the present study, we have developed a novel statistical approach for systematic analysis of intrinsic correlations of gene expression between development and tumorigenesis in mammary gland. Based on this analysis, we constructed a predictive model for prognosis in breast cancer that may be useful for therapy decisions. We first defined developmentally associated genes from a mouse mammary gland epithelial gene expression database. Then, we found that the cancer modulated genes were enriched in this developmentally associated genes list. Furthermore, the developmentally associated genes had a specific expression profile, which associated with the molecular characteristics and histological grade of the tumor. These result suggested that the processes of mammary gland development and tumorigenesis share gene regulatory mechanisms. Then, the list of regulatory genes both on the developmental and tumorigenesis process was defined an 835-member prognosis classifier, which showed an exciting ability to predict clinical outcome of three groups of breast cancer patients (the predictive accuracy 64∼72%) with a robust prognosis prediction (hazard ratio 3.3∼3.8, higher than that of other clinical risk factors (around 2.0-2.8)). In conclusion, our results identified the conserved molecular mechanisms between mammary gland development and neoplasia, and provided a unique potential model for mining unknown cancer genes and predicting the clinical status of breast tumors. These findings also suggested that developmental roles of genes may be important criteria for selecting genes for prognosis prediction in breast cancer. PMID:23565194

  14. Aire controls gene expression in the thymic epithelium with ordered stochasticity

    PubMed Central

    Meredith, Matthew; Zemmour, David; Mathis, Diane; Benoist, Christophe


    Aire controls immunologic tolerance by inducing the ectopic thymic expression of many tissue-specific genes, acting broadly by removing stops on the transcriptional machinery. To better understand Aire’s specificity, we performed single-cell RNAseq and DNA methylation analysis in Aire-sufficient and -deficient medullary epithelial cells (mTECs). Each of Aire’s target genes was induced in only a minority of mTECs, independently of DNA methylation patterns, as small inter-chromosomal gene clusters activated in concert in a proportion of mTECs. These microclusters differed between individual mice, and thus suggest an organization of the DNA or of the epigenome that results from stochastic determinism, but is bookmarked and stable through mTEC divisions, ensuring more effective presentation of self-antigens, and favoring diversity of self-tolerance between individuals. PMID:26237550

  15. Complete mitochondrial genome of Tubulipora flabellaris (Bryozoa: Stenolaemata): the first representative from the class Stenolaemata with unique gene order.


    Sun, Ming'an; Shen, Xin; Liu, Huilian; Liu, Xixing; Wu, Zhigang; Liu, Bin


    Mitochondrial genomes play a significant role in the reconstruction of phylogenetic relationships within metazoans. There are still many controversies concerning the phylogenetic position of the phylum Bryozoa. In this research, we have finished the complete mitochondrial genome of one bryozoan (Tubulipora flabellaris), which is the first representative from the class Stenolaemata. The complete mitochondrial genome of T. flabellaris is 13,763bp in length and contains 36 genes, which lacks the atp8 gene in contrast to the typical metazoan mitochondrial genomes. Gene arrangement comparisons indicate that the mitochondrial genome of T. flabellaris has unique gene order when compared with other metazoans. The four known bryozoans complete mitochondrial genomes also have very different gene arrangements, indicates that bryozoan mitochondrial genomes have experienced drastic rearrangements. To investigate the phylogenetic relationship of Bryozoa, phylogenetic analyses based on amino acid sequences of 11 protein coding genes (excluding atp6 and atp8) from 26 metazoan complete mitochondrial genomes were made utilizing Maximum Likelihood (ML) and Bayesian methods, respectively. The results indicate the monopoly of Lophotrochozoa and a close relationship between Chaetognatha and Bryozoa. However, more evidences are needed to clarify the relationship between two groups. Lophophorate appeared to be polyphyletic according to our analyses. Meanwhile, neither analysis supports close relationship between Branchiopod and Phoronida. Four bryozoans form a clade and the relationship among them is T. flabellaris+(F. hispida+(B. neritina+W. subtorquata)), which is in coincidence with traditional classification system. PMID:21867967

  16. Separation of the PROX1 gene from upstream conserved elements in a complex inversion/translocation patient with hypoplastic left heart.


    Gill, Harinder K; Parsons, Sian R; Spalluto, Cosma; Davies, Angela F; Knorz, Victoria J; Burlinson, Clare E G; Ng, Bee Ling; Carter, Nigel P; Ogilvie, Caroline Mackie; Wilson, David I; Roberts, Roland G


    Hypoplastic left heart (HLH) occurs in at least 1 in 10 000 live births but may be more common in utero. Its causes are poorly understood but a number of affected cases are associated with chromosomal abnormalities. We set out to localize the breakpoints in a patient with sporadic HLH and a de novo translocation. Initial studies showed that the apparently simple 1q41;3q27.1 translocation was actually combined with a 4-Mb inversion, also de novo, of material within 1q41. We therefore localized all four breakpoints and found that no known transcription units were disrupted. However we present a case, based on functional considerations, synteny and position of highly conserved non-coding sequence elements, and the heterozygous Prox1(+/-) mouse phenotype (ventricular hypoplasia), for the involvement of dysregulation of the PROX1 gene in the aetiology of HLH in this case. Accordingly, we show that the spatial expression pattern of PROX1 in the developing human heart is consistent with a role in cardiac development. We suggest that dysregulation of PROX1 gene expression due to separation from its conserved upstream elements is likely to have caused the heart defects observed in this patient, and that PROX1 should be considered as a potential candidate gene for other cases of HLH. The relevance of another breakpoint separating the cardiac gene ESRRG from a conserved downstream element is also discussed. PMID:19471316

  17. A non-variational approach to the construction of new 'higher-order' conservation laws of the family of nonlinear equations α( ut + 3 uux) + β( utxx + 2 uxuxx + uuxxx) - γuxxx = 0

    NASA Astrophysics Data System (ADS)

    Kara, A. H.; Bokhari, Ashfaque H.


    In this paper, we study and classify the conservation laws of the combined nonlinear KdV, Camassa-Holm, Hunter-Saxton and the inviscid Burgers equation which arises in, inter alia, shallow water equations. It is shown that these can be obtained by variational methods but the main focus of the paper is the construction of the conservation laws as a consequence of the interplay between symmetry generators and 'multipliers', particularly, the higher-order ones.

  18. Comparative Genomic and Phylogenetic Analyses of Gammaproteobacterial glg Genes Traced the Origin of the Escherichia coli Glycogen glgBXCAP Operon to the Last Common Ancestor of the Sister Orders Enterobacteriales and Pasteurellales

    PubMed Central

    Almagro, Goizeder; Viale, Alejandro M.; Montero, Manuel; Rahimpour, Mehdi; Muñoz, Francisco José; Baroja-Fernández, Edurne; Bahaji, Abdellatif; Zúñiga, Manuel; González-Candelas, Fernando; Pozueta-Romero, Javier


    Production of branched α-glucan, glycogen-like polymers is widely spread in the Bacteria domain. The glycogen pathway of synthesis and degradation has been fairly well characterized in the model enterobacterial species Escherichia coli (order Enterobacteriales, class Gammaproteobacteria), in which the cognate genes (branching enzyme glgB, debranching enzyme glgX, ADP-glucose pyrophosphorylase glgC, glycogen synthase glgA, and glycogen phosphorylase glgP) are clustered in a glgBXCAP operon arrangement. However, the evolutionary origin of this particular arrangement and of its constituent genes is unknown. Here, by using 265 complete gammaproteobacterial genomes we have carried out a comparative analysis of the presence, copy number and arrangement of glg genes in all lineages of the Gammaproteobacteria. These analyses revealed large variations in glg gene presence, copy number and arrangements among different gammaproteobacterial lineages. However, the glgBXCAP arrangement was remarkably conserved in all glg-possessing species of the orders Enterobacteriales and Pasteurellales (the E/P group). Subsequent phylogenetic analyses of glg genes present in the Gammaproteobacteria and in other main bacterial groups indicated that glg genes have undergone a complex evolutionary history in which horizontal gene transfer may have played an important role. These analyses also revealed that the E/P glgBXCAP genes (a) share a common evolutionary origin, (b) were vertically transmitted within the E/P group, and (c) are closely related to glg genes of some phylogenetically distant betaproteobacterial species. The overall data allowed tracing the origin of the E. coli glgBXCAP operon to the last common ancestor of the E/P group, and also to uncover a likely glgBXCAP transfer event from the E/P group to particular lineages of the Betaproteobacteria. PMID:25607991

  19. Systems-level approaches reveal conservation of trans-regulated genes in the rat and genetic determinants of blood pressure in humans

    PubMed Central

    Langley, Sarah R.; Bottolo, Leonardo; Kunes, Jaroslav; Zicha, Josef; Zidek, Vaclav; Hubner, Norbert; Cook, Stuart A.; Pravenec, Michal; Aitman, Timothy J.; Petretto, Enrico


    Aims Human genome-wide association studies (GWAS) of hypertension identified only few susceptibility loci with large effect that were replicated across populations. The vast majority of genes detected by GWAS has small effect and the regulatory mechanisms through which these genetic variants cause disease remain mostly unclear. Here, we used comparative genomics between human and an established rat model of hypertension to explore the transcriptional mechanisms mediating the effect of genes identified in 15 hypertension GWAS. Methods and results Time series analysis of radiotelemetric blood pressure (BP) was performed to assess 11 parameters of BP variation in recombinant inbred strains derived from the spontaneously hypertensive rat. BP data were integrated with ∼27 000 expression quantative trait loci (eQTLs) mapped across seven tissues, detecting >8000 significant associations between eQTL genes and BP variation in the rat. We then compiled a large catalogue of human genes from GWAS of hypertension and identified a subset of 2292 rat–human orthologous genes. Expression levels for 795 (34%) of these genes correlated with BP variation across rat tissues: 51 genes were cis-regulated, whereas 459 were trans-regulated and enriched for ‘calcium signalling pathway’ (P = 9.6 × 10−6) and ‘ion channel’ genes (P = 3.5 × 10−7), which are important determinants of hypertension. We identified 158 clusters of trans-eQTLs, annotated the underlying ‘master regulator’ genes and found significant over-representation in the human hypertension gene set (enrichment P = 5 × 10−4). Conclusion We showed extensive conservation of trans-regulated genes and their master regulators between rat and human hypertension. These findings reveal that small-effect genes associated with hypertension by human GWAS are likely to exert their action through coordinate regulation of pathogenic pathways. PMID:23118132

  20. Sequence Evaluation of FGF and FGFR Gene Conserved Non-Coding Elements in Non-Syndromic Cleft Lip and Palate Cases

    PubMed Central

    Riley, Bridget M.; Murray, Jeffrey C.


    Non-syndromic cleft lip and palate (NS CLP) is a complex birth defect resulting from multiple genetic and environmental factors. We have previously reported the sequencing of the coding region of genes in the fibroblast growth factor (FGF) signaling pathway, in which missense and non-sense mutations contribute to approximately 5%–6% NS CLP cases. In this article we report the sequencing of conserved non-coding elements (CNEs) in and around 11 of the FGF and FGFR genes, which identified 55 novel variants. Seven of variants are highly conserved among ≥8 species and 31 variants alter transcription factor binding sites, 8 of which are important for craniofacial development. Additionally, 15 NS CLP patients had a combination of coding mutations and CNE variants, suggesting that an accumulation of variants in the FGF signaling pathway may contribute to clefting. PMID:17963255

  1. Var Gene promoter activation in clonal Plasmodium falciparum isolates follows a hierarchy and suggests a conserved switching program that is independent of genetic background.


    Enderes, Corinna; Kombila, Davy; Dal-Bianco, Matthias; Dzikowski, Ron; Kremsner, Peter; Frank, Matthias


    Antigenic variation of Plasmodium falciparum is mediated by a mutually exclusive expression mechanism that limits expression to an individual member of the multicopy var gene family. This process determines the antigenic and adhesive phenotype of the infected red blood cell. Previously, we showed that var gene switching is influenced by chromosomal position. Here, we address whether var gene transcription follows a general conserved pattern in long-term laboratory parasites and in recently culture-adapted field parasites. Activation of the var gene family was monitored in biological replicates in each parasite isolate every 3-5 generations for up to 3 months. We used transgenic parasites carrying a drug-selectable marker at a defined var locus to characterize var gene activation after the exclusive expression of the transgene. Transgenic parasites exhibited a repeatable hierarchy of var gene activation and a fluctuating transcriptional activity of the transgenic var locus. Transcriptional profiling of wild-type laboratory and field parasites showed a universal bias toward transcription of UpsC var genes and a fluctuating transcriptional activity of the dominant var promoter. The data suggest the existence of an intrinsic var gene transcription program that is independent of genetic background. PMID:21926380

  2. Divergent intron conservation in the mitochondrial nad2 gene: signatures for the three bryophyte classes (mosses, liverworts, and hornworts) and the lycophytes.


    Pruchner, Dagmar; Beckert, Susanne; Muhle, Hermann; Knoop, Volker


    The slow-evolving mitochondrial DNAs of plants have potentially conserved information on the phylogenetic branching of the earliest land plants. We present the nad2 gene structures in hornworts and liverworts and in the presumptive earliest-branching vascular land plant clade, the Lycopodiopsida. Taken together with the recently obtained nad2 data for mosses, each class of bryophytes presents another pattern of angiosperm-type introns conserved in nad2: intron nad2i1 in mosses; intron nad2i3 in liverworts; and both introns, nad2i3 and nad2i4, in hornworts. The lycopods Isoetes and Lycopodium show diverging intron conservation and feature a unique novel intron, termed nad2i3b. Hence, mitochondrial introns in general are positionally stable in the bryophytes and provide significant intraclade phylogenetic information, but the nad2 introns, in particular, cannot resolve the interclade relationships of the bryophyte classes and to the tracheophytes. The necessity for RNA editing to reconstitute conserved codon entities in nad2 is obvious for all clades except the marchantiid liverworts. Finally, we find that particularly small group II introns appear as a general feature of the Isoetes chondriome. Plant mitochondrial peculiarities such as RNA editing frequency, U-to-C type of RNA editing, and small group II introns appear to be genus-specific rather than gene-specific features. PMID:12187380

  3. The chromosome localization and the HCF repeats of the human host cell factor gene (HCFC1) are conserved in the mouse homologue

    SciTech Connect

    Frattini, A.; Faranda, S.; Sacco, M.G.; Villa, A.; Vezzoni, P.


    The gene encoding the human host cell factor (HCFC1) has recently been cloned and mapped to Xq28. HCFC1 codes for a family of related polypeptides that apparently arise from posttranslational processing. Six extremely conserved 19-amino-acid (aa)-long motifs, unique to HCFC1 and located in the middle of the protein, could play a role in this processing or could be instrumental to the physiological role of the protein. Alternatively, these repeats could have arisen from recent duplications and may not have any specific function. To resolve this issue, we cloned the homologous region from the mouse Hcfc1 gene and demonstrated that the 19-aa motifs are extremely conserved in sequence, number, and genomic organization, while the {open_quotes}linker{close_quotes} region between the third and fourth repeat is not. This suggests an important function for these repeats. In addition, by RT-PCR analysis of human RNA and comparison to the human genomic sequence, an alternative transcript including a 44-aa in-frame insertion, driving from the 3{prime} nd of intron 18, was found. The significance of this alternative transcript is unknown, since it was not detectable in the mouse. The mouse Hcfc1 gene maps to a region syntenic to Xq28, and, as in human, is in close proximity to the Renin-binding protein gene, in a 100-kb region also including the L1cam and Vasopressin receptor type 2 genes. 8 refs., 2 figs.

  4. The black-pearl gene of Drosophila defines a novel conserved protein family and is required for larval growth and survival.


    Becker, S; Gehrsitz, A; Bork, P; Buchner, S; Buchner, E


    Using a transposon insertion line of the Drosophila Genome Project we have cloned the black-pearl gene (blp), analyzed cDNA clones, generated various mutants, and characterized their phenotypes. The blp gene codes for a protein of 15.7 kDa calculated molecular weight that has been conserved from yeast to plants and mammals with high homology. A domain of these new proteins shows distant similarity to DnaJ domains indicating a functionally relevant interaction with other proteins. The P element insertion in line P1539 lies within the 5' untranslated leader of the black-pearl gene. Flies homozygous for this insertion are semi-lethal, escapers produce very few offspring and show melanotic inclusions in the hemocoel ('black pearls') similar to various melanotic 'tumor' mutants. Two small deletions confined to the blp gene and two EMS-induced mutations are homozygous lethal. These null mutants appear normal up to a prolonged first instar larval stage but fail to grow and die. Thus in Drosophila the blp gene is specifically required for larval growth. The evolutionary conservation in both unicellular and multicellular organisms suggests for the new protein family described here a fundamental role in cell growth. PMID:11179663

  5. Anthropogenic and natural drivers of gene flow in a temperate wild fruit tree: a basis for conservation and breeding programs in apples

    PubMed Central

    Cornille, Amandine; Feurtey, Alice; Gélin, Uriel; Ropars, Jeanne; Misvanderbrugge, Kristine; Gladieux, Pierre; Giraud, Tatiana


    Gene flow is an essential component of population adaptation and species evolution. Understanding of the natural and anthropogenic factors affecting gene flow is also critical for the development of appropriate management, breeding, and conservation programs. Here, we explored the natural and anthropogenic factors impacting crop-to-wild and within wild gene flow in apples in Europe using an unprecedented dense sampling of 1889 wild apple (Malus sylvestris) from European forests and 339 apple cultivars (Malus domestica). We made use of genetic, environmental, and ecological data (microsatellite markers, apple production across landscapes and records of apple flower visitors, respectively). We provide the first evidence that both human activities, through apple production, and human disturbance, through modifications of apple flower visitor diversity, have had a significant impact on crop-to-wild interspecific introgression rates. Our analysis also revealed the impact of previous natural climate change on historical gene flow in the nonintrogressed wild apple M. sylvestris, by identifying five distinct genetic groups in Europe and a north–south gradient of genetic diversity. These findings identify human activities and climate as key drivers of gene flow in a wild temperate fruit tree and provide a practical basis for conservation, agroforestry, and breeding programs for apples in Europe. PMID:25926882

  6. The weakness of tight ties: why scientists almost destroyed the Coachella Valley multispecies habitat conservation plan in order to save it.


    Goldstein, Bruce Evan


    Two groups of biologists were responsible for an unprecedented delay in completing a endangered species habitat conservation plan in the Coachella Valley of southern California. While antagonism grew as each group relentlessly promoted their perspective on whether to add a few areas to the habitat preserve, their inability to resolve their differences was not simply a matter of mistrust or poor facilitation. I analyze how these biologists practiced science in a way that supported specific institutional and ecological relationships that in turn provided a setting in which each group's biological expertise was meaningful, credible, and useful. This tight coupling between scientific practice and society meant that something was more important to these scientists than finishing the plan. For both factions of biologists, ensuring the survival of native species in the valley rested on their ability to catalyze institutional relationships that were compatible with their scientific practice. Understanding this co-production of science and the social order is a first step toward effectively incorporating different experts in negotiation and implementation of technically complex collaborative agreements. PMID:20614119

  7. The Weakness of Tight Ties: Why Scientists Almost Destroyed the Coachella Valley Multispecies Habitat Conservation Plan in Order to Save it

    NASA Astrophysics Data System (ADS)

    Goldstein, Bruce Evan


    Two groups of biologists were responsible for an unprecedented delay in completing a endangered species habitat conservation plan in the Coachella Valley of southern California. While antagonism grew as each group relentlessly promoted their perspective on whether to add a few areas to the habitat preserve, their inability to resolve their differences was not simply a matter of mistrust or poor facilitation. I analyze how these biologists practiced science in a way that supported specific institutional and ecological relationships that in turn provided a setting in which each group’s biological expertise was meaningful, credible, and useful. This tight coupling between scientific practice and society meant that something was more important to these scientists than finishing the plan. For both factions of biologists, ensuring the survival of native species in the valley rested on their ability to catalyze institutional relationships that were compatible with their scientific practice. Understanding this co-production of science and the social order is a first step toward effectively incorporating different experts in negotiation and implementation of technically complex collaborative agreements.

  8. Evolutionary conservation of the mouse apolipoprotein e-c1-c2 gene cluster: Structure and genetic variability in inbred mice

    SciTech Connect

    Hoffer, M.J.V.; Hofker, M.H.; Eck, M.M. van; Frants, R.R. ); Havekes, L.M. )


    The human apolipoprotein E (APOE), APOC1, pseudo APOC1 (APOC1[prime]), and APOC2 genes are clustered within 48 kb on the long arm of chromosome 19. A mouse Apoe cDNA probe was used to isolate overlapping cosmid clones from a cosmid library of the C57BL/Rij inbred mouse strain. These clones were investigated for the presence of the Apocl and Apoc2 genes by heterologous hybridization. Our results show that the Apoe-cl-c2 gene cluster is conserved in the mouse. In line with evolutionary data, the mouse lacks the equivalent of APOC1[prime]. These data were confirmed using a mouse Apoc2 cDNA clone, and surprisingly the CDNA clone isolated here was 965 bp in size, which is on average 450 bp longer than other APOC2 cDNAs described so far. Correspondingly, the Apoc2 gene occupies an unusually large genomic region, due to an extended 5[prime] end. Interestingly, a variable number of tandem repeat (VNTR) in the third intron of the human APOC2 gene shows a high sequence homology and is located at the identical position in the mouse gene. Despite the high copy number of this VNTR (27 or 34 copies) only two variants were found among 11 different inbred strains. With the aid of six restriction fragment length variations in this gene cluster only two different haplotypes could be deduced, indicating that the Apoe-cl-c2 gene cluster is highly conserved in the inbred strains that were studied. 32 refs., 5 figs., 1 tab.

  9. RNA-seq of the aging brain in the short-lived fish N. furzeri - conserved pathways and novel genes associated with neurogenesis.


    Baumgart, Mario; Groth, Marco; Priebe, Steffen; Savino, Aurora; Testa, Giovanna; Dix, Andreas; Ripa, Roberto; Spallotta, Francesco; Gaetano, Carlo; Ori, Michela; Terzibasi Tozzini, Eva; Guthke, Reinhard; Platzer, Matthias; Cellerino, Alessandro


    The brains of teleost fish show extensive adult neurogenesis and neuronal regeneration. The patterns of gene regulation during fish brain aging are unknown. The short-lived teleost fish Nothobranchius furzeri shows markers of brain aging including reduced learning performances, gliosis, and reduced adult neurogenesis. We used RNA-seq to quantify genome-wide transcript regulation and sampled five different time points to characterize whole-genome transcript regulation during brain aging of N. furzeri. Comparison with human datasets revealed conserved up-regulation of ribosome, lysosome, and complement activation and conserved down-regulation of synapse, mitochondrion, proteasome, and spliceosome. Down-regulated genes differ in their temporal profiles: neurogenesis and extracellular matrix genes showed rapid decay, synaptic and axonal genes a progressive decay. A substantial proportion of differentially expressed genes (~40%) showed inversion of their temporal profiles in the last time point: spliceosome and proteasome showed initial down-regulation and stress-response genes initial up-regulation. Extensive regulation was detected for chromatin remodelers of the DNMT and CBX families as well as members of the polycomb complex and was mirrored by an up-regulation of the H3K27me3 epigenetic mark. Network analysis showed extensive coregulation of cell cycle/DNA synthesis genes with the uncharacterized zinc-finger protein ZNF367 as central hub. In situ hybridization showed that ZNF367 is expressed in neuronal stem cell niches of both embryonic zebrafish and adult N. furzeri. Other genes down-regulated with age, not previously associated with adult neurogenesis and with similar patterns of expression are AGR2, DNMT3A, KRCP, MEX3A, SCML4, and CBX1. CBX7, on the other hand, was up-regulated with age. PMID:25059688

  10. Analysis of the grape MYB R2R3 subfamily reveals expanded wine quality-related clades and conserved gene structure organization across Vitis and Arabidopsis genomes

    PubMed Central

    Matus, José Tomás; Aquea, Felipe; Arce-Johnson, Patricio


    Background The MYB superfamily constitutes the most abundant group of transcription factors described in plants. Members control processes such as epidermal cell differentiation, stomatal aperture, flavonoid synthesis, cold and drought tolerance and pathogen resistance. No genome-wide characterization of this family has been conducted in a woody species such as grapevine. In addition, previous analysis of the recently released grape genome sequence suggested expansion events of several gene families involved in wine quality. Results We describe and classify 108 members of the grape R2R3 MYB gene subfamily in terms of their genomic gene structures and similarity to their putative Arabidopsis thaliana orthologues. Seven gene models were derived and analyzed in terms of gene expression and their DNA binding domain structures. Despite low overall sequence homology in the C-terminus of all proteins, even in those with similar functions across Arabidopsis and Vitis, highly conserved motif sequences and exon lengths were found. The grape epidermal cell fate clade is expanded when compared with the Arabidopsis and rice MYB subfamilies. Two anthocyanin MYBA related clusters were identified in chromosomes 2 and 14, one of which includes the previously described grape colour locus. Tannin related loci were also detected with eight candidate homologues in chromosomes 4, 9 and 11. Conclusion This genome wide transcription factor analysis in Vitis suggests that clade-specific grape R2R3 MYB genes are expanded while other MYB genes could be well conserved compared to Arabidopsis. MYB gene abundance, homology and orientation within particular loci also suggests that expanded MYB clades conferring quality attributes of grapes and wines, such as colour and astringency, could possess redundant, overlapping and cooperative functions. PMID:18647406

  11. RNA-seq of the aging brain in the short-lived fish N. furzeri – conserved pathways and novel genes associated with neurogenesis

    PubMed Central

    Baumgart, Mario; Groth, Marco; Priebe, Steffen; Savino, Aurora; Testa, Giovanna; Dix, Andreas; Ripa, Roberto; Spallotta, Francesco; Gaetano, Carlo; Ori, Michela; Terzibasi Tozzini, Eva; Guthke, Reinhard; Platzer, Matthias; Cellerino, Alessandro


    The brains of teleost fish show extensive adult neurogenesis and neuronal regeneration. The patterns of gene regulation during fish brain aging are unknown. The short-lived teleost fish Nothobranchius furzeri shows markers of brain aging including reduced learning performances, gliosis, and reduced adult neurogenesis. We used RNA-seq to quantify genome-wide transcript regulation and sampled five different time points to characterize whole-genome transcript regulation during brain aging of N. furzeri. Comparison with human datasets revealed conserved up-regulation of ribosome, lysosome, and complement activation and conserved down-regulation of synapse, mitochondrion, proteasome, and spliceosome. Down-regulated genes differ in their temporal profiles: neurogenesis and extracellular matrix genes showed rapid decay, synaptic and axonal genes a progressive decay. A substantial proportion of differentially expressed genes (∼40%) showed inversion of their temporal profiles in the last time point: spliceosome and proteasome showed initial down-regulation and stress-response genes initial up-regulation. Extensive regulation was detected for chromatin remodelers of the DNMT and CBX families as well as members of the polycomb complex and was mirrored by an up-regulation of the H3K27me3 epigenetic mark. Network analysis showed extensive coregulation of cell cycle/DNA synthesis genes with the uncharacterized zinc-finger protein ZNF367 as central hub. In situ hybridization showed that ZNF367 is expressed in neuronal stem cell niches of both embryonic zebrafish and adult N. furzeri. Other genes down-regulated with age, not previously associated with adult neurogenesis and with similar patterns of expression are AGR2, DNMT3A, KRCP, MEX3A, SCML4, and CBX1. CBX7, on the other hand, was up-regulated with age. PMID:25059688

  12. Sub-optimal phenotypes of double-knockout mutants of Escherichia coli depend on the order of gene deletions.


    Gawand, Pratish; Said Abukar, Fatumina; Venayak, Naveen; Partow, Siavash; Motter, Adilson E; Mahadevan, Radhakrishnan


    Metabolic networks are characterized by multiple redundant reactions that do not have a clear biological function. The redundancies in the metabolic networks are implicated in adaptation to random mutations and survival under different environmental conditions. Reactions that are not active under wild-type growth conditions, but get transiently activated after a mutation event such as gene deletion are known as latent reactions. Characterization of multiple-gene knockout mutants can identify the physiological roles of latent reactions. In this study, we characterized double-gene deletion mutants of E. coli with the aim of investigating the sub-optimal physiology of the mutants and the possible roles of latent reactions. Specifically, we investigated the effects of the deletion of the glyoxylate-shunt gene aceA (encoding a latent reaction enzyme, isocitrate lyase) on the growth characteristics of the mutant E. coli Δpgi. The deletion of aceA reduced the growth rate of E. coli Δpgi, indicating that the activation of the glyoxylate shunt plays an important role in adaptation of the mutant E. coli Δpgi when no other latent reactions are concurrently inactivated. We also investigated the effect of the order of the gene deletions on the growth rates and substrate uptake rates of the double-gene deletion mutants. The results indicate that the order in which genes are deleted determines the phenotype of the mutants during the sub-optimal growth phase. To elucidate the mechanism behind the difference between the observed phenotypes, we carried out transcriptomic analysis and constraint-based modeling of the mutants. Transcriptomic analysis showed differential expression of the gene aceK (encoding the protein isocitrate dehydrogenase kinase) involved in controlling the isocitrate flux through the TCA cycle and the glyoxylate shunt. Higher acetate production in the E. coli ΔaceA1 Δpgi2 mutant was consistent with the increased aceK expression, which limits the TCA cycle

  13. Conservation of two lineages of peroxisomal (Type I) 3-ketoacyl-CoA thiolases in land plants, specialization of the genes in Brassicaceae, and characterization of their expression in Arabidopsis thaliana

    PubMed Central

    Bussell, John D


    Arabidopsis thaliana has three genes encoding type I 3-ketoacyl-CoA thiolases (KAT1, KAT2, and KAT5), one of which (KAT5) is alternatively transcribed to produce both peroxisomal and cytosolic proteins. To evaluate the potential importance of these four gene products, their evolutionary history in plants and their expression patterns in Arabidopsis were investigated. Land plants as a whole have gene lineages corresponding to KAT2 and KAT5, implying conservation of distinct functions for these two genes. By contrast, analysis of synteny shows that KAT1 arose by duplication of the KAT2 locus. KAT1 is found in the Brassicaceae family, including in the genera Arabidopsis, Capsella, Thellungiella (=Eutrema) and Brassica, but not in the more distantly related Caricaceae (order Brassicales), or other plants. Gene expression analysis using qRT-PCR and β-glucuronidase reporter genes showed strong expression of KAT2 during germination and in many plant tissues throughout the life cycle, consistent with its observed dominant function in fatty acid β-oxidation. KAT1 was expressed very weakly while KAT5 was most strongly expressed during flower development and in seedlings after germination. Isoform-specific qRT-PCR analysis and promoter β-glucuronidase reporters revealed that the two splicing variants of KAT5 have similar expression profiles. Alternative splicing of KAT5 to produce cytosolic and peroxisomal proteins is specific to and ubiquitous in the Brassicaceae, and possibly had an earlier origin in the order Brassicales. This implies that an additional function for KAT5 arose between 43 and 115 mybp. We speculate that this KAT5 mutation was recruited for a cytosolic function in secondary metabolism. PMID:23066143

  14. Spliceosomal introns in the 5′ untranslated region of plant BTL RING-H2 ubiquitin ligases are evolutionary conserved and required for gene expression

    PubMed Central


    Background Introns located close to the 5′ end of a gene or in the 5′ untranslated region often exert positive effects on gene expression. This effect, known as intron-mediated enhancement (IME), has been observed in diverse eukaryotic organisms, including plants. The sequences involved in IME seem to be spread across the intron and function in an additive manner. The IMEter algorithm was developed to predict plant introns that may enhance gene expression. We have identified several plant members of the BTL class of E3s, which may have orthologs across eukaryotes, that contain a 5′UTR intron. The RING finger E3 ligases are key enzymes of the ubiquitination system that mediate the transfer of ubiquitin to substrates. Results In this study, we retrieved BTL sequences from several angiosperm species and found that 5′UTR introns showing a strong IMEter score were predicted, suggesting that they may be conserved by lineage. Promoter-GUS fusion lines were used to confirm the IME effect of these 5′UTR introns on gene expression. IMEter scores of BTLs were compared with the 5′UTR introns of two gene families MHX and polyubiquitin genes. Conclusions Analysis performed in two Arabidopsis BTL E3 ligases genes indicated that the 5′UTR introns were essential for gene expression in all the tissues tested. Comparison of the average 5′UTR intron size on three gene families in ten angiosperm species suggests that a prevalent size for a 5′UTR intron is in the range of 600 nucleotides, and that the overall IMEter score within a gene family is preserved across several angiosperms. Our results indicated that gene expression dependent on a 5′UTR intron is an efficient regulatory mechanism in BTL E3 ligases that has been preserved throughout plant evolution. PMID:24228887

  15. Comparative functional genomics revealed conservation and diversification of three enhancers of the isl1 gene for motor and sensory neuron-specific expression.


    Uemura, Osamu; Okada, Yohei; Ando, Hideki; Guedj, Mickael; Higashijima, Shin-Ichi; Shimazaki, Takuya; Chino, Naoichi; Okano, Hideyuki; Okamoto, Hitoshi


    Islet-1 (Isl1) is a member of the Isl1 family of LIM-homeodomain transcription factors (LIM-HD) that is expressed in a defined subset of motor and sensory neurons during vertebrate embryogenesis. To investigate how this specific expression of isl1 is regulated, we searched for enhancers of the isl1 gene that are conserved in vertebrate evolution. Initially, two enhancer elements, CREST1 and CREST2, were identified downstream of the isl1 locus in the genomes of fugu, chick, mouse, and human by BLAST searching for highly similar elements to those originally identified as motor and sensory neuron-specific enhancers in the zebrafish genome. The combined action of these elements is sufficient for completely recapitulating the subtype-specific expression of the isl1 gene in motor neurons of the mouse spinal cord. Furthermore, by direct comparison of the upstream flanking regions of the zebrafish and human isl1 genes, we identified another highly conserved noncoding element, CREST3, and subsequently C3R, a similar element to CREST3 with two CDP CR1 recognition motifs, in the upstream regions of all other isl1 family members. In mouse and human, CRESTs are located as far as more than 300 kb away from the isl1 locus, while they are much closer to the isl1 locus in zebrafish. Although all of zebrafish CREST2, CREST3, and C3R activate gene expression in the sensory neurons of zebrafish, CREST2 of mouse and human does not have the sequence necessary for sensory neuron-specific expression. Our results revealed both a remarkable conservation of the regulatory elements regulating subtype-specific gene expression in motor and sensory neurons and the dynamic process of reorganization of these elements whereby each element increases the level of cell-type specificity by losing redundant functions with the other elements during vertebrate evolution. PMID:15680372

  16. Chromosome-wide mapping of DNA methylation patterns in normal and malignant prostate cells reveals pervasive methylation of gene-associated and conserved intergenic sequences

    PubMed Central


    Background DNA methylation has been linked to genome regulation and dysregulation in health and disease respectively, and methods for characterizing genomic DNA methylation patterns are rapidly emerging. We have developed/refined methods for enrichment of methylated genomic fragments using the methyl-binding domain of the human MBD2 protein (MBD2-MBD) followed by analysis with high-density tiling microarrays. This MBD-chip approach was used to characterize DNA methylation patterns across all non-repetitive sequences of human chromosomes 21 and 22 at high-resolution in normal and malignant prostate cells. Results Examining this data using computational methods that were designed specifically for DNA methylation tiling array data revealed widespread methylation of both gene promoter and non-promoter regions in cancer and normal cells. In addition to identifying several novel cancer hypermethylated 5' gene upstream regions that mediated epigenetic gene silencing, we also found several hypermethylated 3' gene downstream, intragenic and intergenic regions. The hypermethylated intragenic regions were highly enriched for overlap with intron-exon boundaries, suggesting a possible role in regulation of alternative transcriptional start sites, exon usage and/or splicing. The hypermethylated intergenic regions showed significant enrichment for conservation across vertebrate species. A sampling of these newly identified promoter (ADAMTS1 and SCARF2 genes) and non-promoter (downstream or within DSCR9, C21orf57 and HLCS genes) hypermethylated regions were effective in distinguishing malignant from normal prostate tissues and/or cell lines. Conclusions Comparison of chromosome-wide DNA methylation patterns in normal and malignant prostate cells revealed significant methylation of gene-proximal and conserved intergenic sequences. Such analyses can be easily extended for genome-wide methylation analysis in health and disease. PMID:21669002

  17. Is It an Ant or a Butterfly? Convergent Evolution in the Mitochondrial Gene Order of Hymenoptera and Lepidoptera

    PubMed Central

    Babbucci, Massimiliano; Basso, Andrea; Scupola, Antonio; Patarnello, Tomaso; Negrisolo, Enrico


    Insect mitochondrial genomes (mtDNA) are usually double helical and circular molecules containing 37 genes that are encoded on both strands. The arrangement of the genes is not constant for all species, and produces distinct gene orders (GOs) that have proven to be diagnostic in defining clades at different taxonomic levels. In general, it is believed that distinct taxa have a very low chance of sharing identically arranged GOs. However, examples of identical, homoplastic local rearrangements occurring in distinct taxa do exist. In this study, we sequenced the complete mtDNAs of the ants Formica fusca and Myrmica scabrinodis (Formicidae, Hymenoptera) and compared their GOs with those of other Insecta. The GO of F. fusca was found to be identical to the GO of Dytrisia (the largest clade of Lepidoptera). This finding is the first documented case of an identical GO shared by distinct groups of Insecta, and it is the oldest known event of GO convergent evolution in animals. Both Hymenoptera and Lepidoptera acquired this GO early in their evolution. Using a phylogenetic approach combined with new bioinformatic tools, the chronological order of the evolutionary events that produced the diversity of the hymenopteran GOs was determined. Additionally, new local homoplastic rearrangements shared by distinct groups of insects were identified. Our study showed that local and global homoplasies affecting the insect GOs are more widespread than previously thought. Homoplastic GOs can still be useful for characterizing the various clades, provided that they are appropriately considered in a phylogenetic and taxonomic context. PMID:25480682

  18. Engineering broad root-knot resistance in transgenic plants by RNAi silencing of a conserved and essential root-knot nematode parasitism gene

    PubMed Central

    Huang, Guozhong; Allen, Rex; Davis, Eric L.; Baum, Thomas J.; Hussey, Richard S.


    Secreted parasitism proteins encoded by parasitism genes expressed in esophageal gland cells mediate infection and parasitism of plants by root-knot nematodes (RKN). Parasitism gene 16D10 encodes a conserved RKN secretory peptide that stimulates root growth and functions as a ligand for a putative plant transcription factor. We used in vitro and in vivo RNA interference approaches to silence this parasitism gene in RKN and validate that the parasitism gene has an essential function in RKN parasitism of plants. Ingestion of 16D10 dsRNA in vitro silenced the target parasitism gene in RKN and resulted in reduced nematode infectivity. In vivo expression of 16D10 dsRNA in Arabidopsis resulted in resistance effective against the four major RKN species. Because no known natural resistance gene has this wide effective range of RKN resistance, bioengineering crops expressing dsRNA that silence target RKN parasitism genes to disrupt the parasitic process represents a viable and flexible means of developing novel durable RKN-resistant crops and could provide crops with unprecedented broad resistance to RKN. PMID:16985000

  19. Conservation of AtTZF1, AtTZF2, and AtTZF3 homolog gene regulation by salt stress in evolutionarily distant plant species

    PubMed Central

    D’Orso, Fabio; De Leonardis, Anna M.; Salvi, Sergio; Gadaleta, Agata; Ruberti, Ida; Cattivelli, Luigi; Morelli, Giorgio; Mastrangelo, Anna M.


    Arginine-rich tandem zinc-finger proteins (RR-TZF) participate in a wide range of plant developmental processes and adaptive responses to abiotic stress, such as cold, salt, and drought. This study investigates the conservation of the genes AtTZF1-5 at the level of their sequences and expression across plant species. The genomic sequences of the two RR-TZF genes TdTZF1-A and TdTZF1-B were isolated in durum wheat and assigned to chromosomes 3A and 3B, respectively. Sequence comparisons revealed that they encode proteins that are highly homologous to AtTZF1, AtTZF2, and AtTZF3. The expression profiles of these RR-TZF durum wheat and Arabidopsis proteins support a common function in the regulation of seed germination and responses to abiotic stress. In particular, analysis of plants with attenuated and overexpressed AtTZF3 indicate that AtTZF3 is a negative regulator of seed germination under conditions of salt stress. Finally, comparative sequence analyses establish that the RR-TZF genes are encoded by lower plants, including the bryophyte Physcomitrella patens and the alga Chlamydomonas reinhardtii. The regulation of the Physcomitrella AtTZF1-2-3-like genes by salt stress strongly suggests that a subgroup of the RR-TZF proteins has a function that has been conserved throughout evolution. PMID:26136754

  20. Evolution of the Order Urostylida (Protozoa, Ciliophora): New Hypotheses Based on Multi-Gene Information and Identification of Localized Incongruence

    PubMed Central

    Yi, Zhenzhen; Song, Weibo


    Previous systematic arrangement on the ciliate order Urostylida was mainly based on morphological data and only about 20% taxa were analyzed using molecular phylogenetic analyses. In the present investigation, 22 newly sequenced species for which alpha-tubulin, SSU rRNA genes or ITS1-5.8S-ITS2 region were sampled, refer to all families within the order. Following conclusions could be drawn: (1) the order Urostylida is not monophyletic, but a core group is always present; (2) among the family Urostylidae, six of 10 sequenced genera are rejected belonging to this family; (3) the genus Epiclintes is confirmed belonging to its own taxon; (4) the family Pseudokeronopsidae undoubtedly belongs to the core portion of urostylids; however, some or most of its members should be transferred to the family Urostylidae; (5) Bergeriellidae is confirmed to be a valid family; (6) the distinction of the taxon Acaudalia is not supported; (7) the morphology-based genus Anteholosticha is extremely polyphyletic; (8) ITS2 secondary structures of Pseudoamphisiella and Psammomitra are rather different from other urostylids; (9) partition addition bootstrap alteration (PABA) result shows that bootstrap values usually tend to increase as more gene partitions are included. PMID:21408166

  1. Microcollinearity in an ethylene receptor coding gene region of the Coffea canephora genome is extensively conserved with Vitis vinifera and other distant dicotyledonous sequenced genomes

    PubMed Central

    Guyot, Romain; de la Mare, Marion; Viader, Véronique; Hamon, Perla; Coriton, Olivier; Bustamante-Porras, José; Poncet, Valérie; Campa, Claudine; Hamon, Serge; de Kochko, Alexandre


    Background Coffea canephora, also called Robusta, belongs to the Rubiaceae, the fourth largest angiosperm family. This diploid species (2x = 2n = 22) has a fairly small genome size of ≈ 690 Mb and despite its extreme economic importance, particularly for developing countries, knowledge on the genome composition, structure and evolution remain very limited. Here, we report the 160 kb of the first C. canephora Bacterial Artificial Chromosome (BAC) clone ever sequenced and its fine analysis. Results This clone contains the CcEIN4 gene, encoding an ethylene receptor, and twenty other predicted genes showing a high gene density of one gene per 7.8 kb. Most of them display perfect matches with C. canephora expressed sequence tags or show transcriptional activities through PCR amplifications on cDNA libraries. Twenty-three transposable elements, mainly Class II transposon derivatives, were identified at this locus. Most of these Class II elements are Miniature Inverted-repeat Transposable Elements (MITE) known to be closely associated with plant genes. This BAC composition gives a pattern similar to those found in gene rich regions of Solanum lycopersicum and Medicago truncatula genomes indicating that the CcEIN4 regions may belong to a gene rich region in the C. canephora genome. Comparative sequence analysis indicated an extensive conservation between C. canephora and most of the reference dicotyledonous genomes studied in this work, such as tomato (S. lycopersicum), grapevine (V. vinifera), barrel medic M. truncatula, black cottonwood (Populus trichocarpa) and Arabidopsis thaliana. The higher degree of microcollinearity was found between C. canephora and V. vinifera, which belong respectively to the Asterids and Rosids, two clades that diverged more than 114 million years ago. Conclusion This study provides a first glimpse of C. canephora genome composition and evolution. Our data revealed a remarkable conservation of the microcollinearity between C. canephora and V

  2. Molecular Characterization of the 14-3-3 Gene Family in Brachypodium distachyon L. Reveals High Evolutionary Conservation and Diverse Responses to Abiotic Stresses

    PubMed Central

    Cao, Hui; Xu, Yuxing; Yuan, Linlin; Bian, Yanwei; Wang, Lihui; Zhen, Shoumin; Hu, Yingkao; Yan, Yueming


    The 14-3-3 gene family identified in all eukaryotic organisms is involved in a wide range of biological processes, particularly in resistance to various abiotic stresses. Here, we performed the first comprehensive study on the molecular characterization, phylogenetics, and responses to various abiotic stresses of the 14-3-3 gene family in Brachypodium distachyon L. A total of seven 14-3-3 genes from B. distachyon and 120 from five main lineages among 12 species were identified, which were divided into five well-conserved subfamilies. The molecular structure analysis showed that the plant 14-3-3 gene family is highly evolutionarily conserved, although certain divergence had occurred in different subfamilies. The duplication event investigation revealed that segmental duplication seemed to be the predominant form by which the 14-3-3 gene family had expanded. Moreover, seven critical amino acids were detected, which may contribute to functional divergence. Expression profiling analysis showed that BdGF14 genes were abundantly expressed in the roots, but showed low expression in the meristems. All seven BdGF14 genes showed significant expression changes under various abiotic stresses, including heavy metal, phytohormone, osmotic, and temperature stresses, which might play important roles in responses to multiple abiotic stresses mainly through participating in ABA-dependent signaling and reactive oxygen species-mediated MAPK cascade signaling pathways. In particular, BdGF14 genes generally showed upregulated expression in response to multiple stresses of high temperature, heavy metal, abscisic acid (ABA), and salicylic acid (SA), but downregulated expression under H2O2, NaCl, and polyethylene glycol (PEG) stresses. Meanwhile, dynamic transcriptional expression analysis of BdGF14 genes under longer treatments with heavy metals (Cd2+, Cr3+, Cu2+, and Zn2+) and phytohormone (ABA) and recovery revealed two main expression trends in both roots and leaves: up-down and up

  3. Functional Conservation and Divergence of Four Ginger AP1/AGL9 MADS–Box Genes Revealed by Analysis of Their Expression and Protein–Protein Interaction, and Ectopic Expression of AhFUL Gene in Arabidopsis

    PubMed Central

    Song, Juanjuan; Sun, Wei; Xia, Kuaifei; Liao, Jingping; Zhang, Mingyong


    Alpinia genus are known generally as ginger–lilies for showy flowers in the ginger family, Zingiberaceae, and their floral morphology diverges from typical monocotyledon flowers. However, little is known about the functions of ginger MADS–box genes in floral identity. In this study, four AP1/AGL9 MADS–box genes were cloned from Alpinia hainanensis, and protein–protein interactions (PPIs) and roles of the four genes in floral homeotic conversion and in floral evolution are surveyed for the first time. AhFUL is clustered to the AP1lineage, AhSEP4 and AhSEP3b to the SEP lineage, and AhAGL6–like to the AGL6 lineage. The four genes showed conserved and divergent expression patterns, and their encoded proteins were localized in the nucleus. Seven combinations of PPI (AhFUL–AhSEP4, AhFUL–AhAGL6–like, AhFUL–AhSEP3b, AhSEP4–AhAGL6–like, AhSEP4–AhSEP3b, AhAGL6–like–AhSEP3b, and AhSEP3b–AhSEP3b) were detected, and the PPI patterns in the AP1/AGL9 lineage revealed that five of the 10 possible combinations are conserved and three are variable, while conclusions cannot yet be made regarding the other two. Ectopic expression of AhFUL in Arabidopsis thaliana led to early flowering and floral organ homeotic conversion to sepal–like or leaf–like. Therefore, we conclude that the four A. hainanensis AP1/AGL9 genes show functional conservation and divergence in the floral identity from other MADS–box genes. PMID:25461565

  4. Enrichment of Conserved Synaptic Activity-Responsive Element in Neuronal Genes Predicts a Coordinated Response of MEF2, CREB and SRF

    PubMed Central

    Rodríguez-Tornos, Fernanda M.; San Aniceto, Iñigo; Cubelos, Beatriz; Nieto, Marta


    A unique synaptic activity-responsive element (SARE) sequence, composed of the consensus binding sites for SRF, MEF2 and CREB, is necessary for control of transcriptional upregulation of the Arc gene in response to synaptic activity. We hypothesize that this sequence is a broad mechanism that regulates gene expression in response to synaptic activation and during plasticity; and that analysis of SARE-containing genes could identify molecular mechanisms involved in brain disorders. To search for conserved SARE sequences in the mammalian genome, we used the SynoR in silico tool, and found the SARE cluster predominantly in the regulatory regions of genes expressed specifically in the nervous system; most were related to neural development and homeostatic maintenance. Two of these SARE sequences were tested in luciferase assays and proved to promote transcription in response to neuronal activation. Supporting the predictive capacity of our candidate list, up-regulation of several SARE containing genes in response to neuronal activity was validated using external data and also experimentally using primary cortical neurons and quantitative real time RT-PCR. The list of SARE-containing genes includes several linked to mental retardation and cognitive disorders, and is significantly enriched in genes that encode mRNA targeted by FMRP (fragile X mental retardation protein). Our study thus supports the idea that SARE sequences are relevant transcriptional regulatory elements that participate in plasticity. In addition, it offers a comprehensive view of how activity-responsive transcription factors coordinate their actions and increase the selectivity of their targets. Our data suggest that analysis of SARE-containing genes will reveal yet-undescribed pathways of synaptic plasticity and additional candidate genes disrupted in mental disease. PMID:23382855

  5. The type 1 human immunodeficiency virus Tat binding protein is a transcriptional activator belonging to an additional family of evolutionarily conserved genes.

    PubMed Central

    Ohana, B; Moore, P A; Ruben, S M; Southgate, C D; Green, M R; Rosen, C A


    The type 1 human immunodeficiency virus Tat protein is a powerful transcriptional activator when bound to an RNA structure (TAR) present at the extreme 5' terminus of viral mRNA. Since transcriptional activation requires binding of Tat to RNA, it has been suggested that Tat enhances initiation or elongation through a direct interaction with cellular transcription factors. Here we show through protein fusion experiments that the previously identified cellular Tat binding protein, TBP-1, although unable to bind DNA, is a strong transcriptional activator when brought into proximity of several promoter elements. Transcriptional activity depends upon the integrity of at least two highly conserved domains: one resembling a nucleotide-binding motif and the other motif common to proteins with helicase activity. Our studies further reveal that TBP-1 represents one member of a large, highly conserved gene family that encodes proteins demonstrating strong amino acid conservation across species. Finally, we identified a second family member that, although 77% similar to TBP-1, does not activate transcription from the promoters examined. This finding, together with the observation that TBP-1 does not activate each promoter examined, suggests that this gene family may encode promoter-specific transcriptional activators. Images PMID:8419915

  6. Members of a new family of DNA-binding proteins bind to a conserved cis-element in the promoters of alpha-Amy2 genes.


    Rushton, P J; Macdonald, H; Huttly, A K; Lazarus, C M; Hooley, R


    The promoters of wheat, barley and wild oat alpha-Amy2 genes contain a number of conserved cis-acting elements that bind nuclear protein, we report here the isolation of two cDNAs encoding proteins (ABF1 and ABF2) that bind specifically to one of these elements, Box 2 (ATTGACTTGACCGTCATCGG). The two proteins are unrelated to each other except for a conserved region of 56-58 amino acids that consists of 25 highly conserved amino acids followed by a putative zinc finger motif, C-X4-5-C-X22-23-H-X1-H. ABF1 contains two such conserved regions, whereas ABF2 possesses only one but also contains a potential leucine zipper motif, suggesting that it could form homo- or heterodimers. ABF1 and ABF2 expressed in Escherichia coli bound specifically to Box 2 probes in gel retardation experiments; this binding was abolished by the transition-metal-chelating agent, 1,10-o-phenanthroline and by EDTA. We propose that ABF1 and ABF2 are representatives of two classes of a new family of plant sequence-specific DNA-binding proteins. PMID:8541496

  7. The complete mitochondrial genome of the grand jackknife clam, Solen grandis (Bivalvia: Solenidae): a novel gene order and unusual non-coding region.


    Yuan, Yang; Li, Qi; Kong, Lingfeng; Yu, Hong


    Molluscs in general, and bivalves in particular, exhibit an extraordinary degree of mitochondrial gene order variation when compared with other metazoans. The complete mitochondrial genome of Solen grandis (Bivalvia: Solenidae) was determined using long-PCR and genome walking techniques. The entire mitochondrial genome sequence of S. grandis is 16,784 bp in length, and contains 36 genes including 12 protein-coding genes (atp8 is absent), 2 ribosomal RNAs, and 22 tRNAs. All genes are encoded on the same strand. Compared with other species, it bears a novel gene order. Besides these, we find a peculiar non-coding region of 435 bp with a microsatellite-like (TA)(12) element, poly-structures and many hairpin structures. In contrast to the available heterodont mitochondrial genomes from GenBank, the complete mtDNA of S. grandis has the shortest cox3 gene, and the longest atp6, nad4, nad5 genes. PMID:21598108

  8. Surf5: A gene in the tightly clustered mouse surfeit locus is highly conserved and transcribed divergently from the rpL7A (Surf3) gene

    SciTech Connect

    Garson, K.; Duhig, T.; Armes, N.; Colombo, P.; Fried, M.


    The four previously characterized genes (Surf1 to 4) of the mouse Surfeit locus do not share any sequence homology, and the transcription of each gene alternates with respect to its neighbors. Adjacent Surfeit genes are separated by very small distances, and two of the genes overlap at their 3{prime} ends. In this work we have further defined the Surfeit gene cluster by the isolation of Surf5, a fifth gene of the locus, and determination of its relationship to the other Surfeit genes. Surf5 does not share any sequence homology with the four cloned Surfeit genes. The transcription of Surf5 is divergent with respect to its neighbor the Surf3 gene, and the 5{prime} ends of Surf5 and Surf3 are separated by only 159 bp, suggesting the presence of a second bidirectional promoter in the locus. The 3{prime} end of Surf5 maps only 68 bp away from the processed 3{prime} end of a pseudogene. The human and partial chicken Surf5 coding regions show greater than 95% identity, and a Caenorhabditis elegans homologue shows 38% identity and 56% similarity with the mouse Surf5 amino acid sequence. The 3.5-kb transcript of Surf5 encodes a small hydrophilic protein of 140 amino acid residues, which differs from the ribosomal protein L7a encoded by the Surf3 gene or the integral membrane protein encoded by the Surf4 gene. Subcellular fractionation located the Surf5 protein to the soluble fraction of the cytoplasm. The Surfeit locus appears to represent a novel type of gene cluster in which the genes are unrelated by sequence or function; however, their organization may play a role in their gene expression. 44 refs., 5 figs.

  9. Animal models and conserved processes

    PubMed Central


    Background The concept of conserved processes presents unique opportunities for using nonhuman animal models in biomedical research. However, the concept must be examined in the context that humans and nonhuman animals are evolved, complex, adaptive systems. Given that nonhuman animals are examples of living systems that are differently complex from humans, what does the existence of a conserved gene or process imply for inter-species extrapolation? Methods We surveyed the literature including philosophy of science, biological complexity, conserved processes, evolutionary biology, comparative medicine, anti-neoplastic agents, inhalational anesthetics, and drug development journals in order to determine the value of nonhuman animal models when studying conserved processes. Results Evolution through natural selection has employed components and processes both to produce the same outcomes among species but also to generate different functions and traits. Many genes and processes are conserved, but new combinations of these processes or different regulation of the genes involved in these processes have resulted in unique organisms. Further, there is a hierarchy of organization in complex living systems. At some levels, the components are simple systems that can be analyzed by mathematics or the physical sciences, while at other levels the system cannot be fully analyzed by reducing it to a physical system. The study of complex living systems must alternate between focusing on the parts and examining the intact whole organism while taking into account the connections between the two. Systems biology aims for this holism. We examined the actions of inhalational anesthetic agents and anti-neoplastic agents in order to address what the characteristics of complex living systems imply for inter-species extrapolation of traits and responses related to conserved processes. Conclusion We conclude that even the presence of conserved processes is insufficient for inter

  10. New insights on the transcriptional regulation of CD69 gene through a potent enhancer located in the conserved non-coding sequence 2.


    Laguna, Teresa; Notario, Laura; Pippa, Raffaella; Fontela, Miguel G; Vázquez, Berta N; Maicas, Miren; Aguilera-Montilla, Noemí; Corbí, Ángel L; Odero, María D; Lauzurica, Pilar


    The CD69 type II C-type lectin is one of the earliest indicators of leukocyte activation acting in lymphocyte migration and cytokine secretion. CD69 expression in hematopoietic lineage undergoes rapid changes depending on the cell-lineage, the activation state or the localization of the cell where it is expressed, suggesting a complex and tightly controlled regulation. Here we provide new insights on the transcriptional regulation of CD69 gene in mammal species. Through in silico studies, we analyzed several regulatory features of the 4 upstream conserved non-coding sequences (CNS 1-4) previously described, confirming a major function of CNS2 in the transcriptional regulation of CD69. In addition, multiple transcription binding sites are identified in the CNS2 region by DNA cross-species conservation analysis. By functional approaches we defined a core region of 226bp located within CNS2 as the main enhancer element of CD69 transcription in the hematopoietic cells analyzed. By chromatin immunoprecipitation, binding of RUNX1 to the core-CNS2 was shown in a T cell line. In addition, we found an activating but not essential role of RUNX1 in CD69 gene transcription by site-directed mutagenesis and RNA silencing, probably through the interaction with this potent enhancer specifically in the hematopoietic lineage. In summary, in this study we contribute with new evidences to the landscape of the transcriptional regulation of the CD69 gene. PMID:25801305

  11. Identification of proliferation-induced genes in Arabidopsis thaliana. Characterization of a new member of the highly evolutionarily conserved histone H2A.F/Z variant subfamily.

    PubMed Central

    Callard, D; Mazzolini, L


    The changes in gene expression associated with the reinitiation of cell division and subsequent progression through the cell cycle in Arabidopsis thaliana cell-suspension cultures were investigated. Partial synchronization of cells was achieved by a technique combining phosphate starvation and a transient treatment with the DNA replication inhibitor aphidicolin. Six cDNAs corresponding to genes highly induced in proliferating cells and showing cell-cycle-regulated expression were obtained by the mRNA differential display technique. Full-length cDNA clones (cH2BAt and cH2AvAt) corresponding to two of the display products were subsequently isolated. The cH2BAt clone codes for a novel histone H2B protein, whereas the cH2AvAt cDNA corresponds to a gene encoding a new member of the highly conserved histone H2A.F/Z subfamily of chromosomal proteins. Further studies indicated that H2AvAt mRNA expression is tightly correlated with cell proliferation in cell-suspension cultures, and that closely related analogs of the encoded protein exist in Arabidopsis. The implications of the conservation of histone H2A.F/Z variants in plants are discussed. PMID:9414552

  12. spalt encodes an evolutionarily conserved zinc finger protein of novel structure which provides homeotic gene function in the head and tail region of the Drosophila embryo.

    PubMed Central

    Kühnlein, R P; Frommer, G; Friedrich, M; Gonzalez-Gaitan, M; Weber, A; Wagner-Bernholz, J F; Gehring, W J; Jäckle, H; Schuh, R
