Sample records for gene polymorphisms including

  1. Association of ACE Gene I/D polymorphism with migraine in Kashmiri population.

    PubMed

    Wani, Irfan Yousuf; Sheikh, Saleem; Shah, Zafar Amin; Pandith, Arshid A; Wani, Mushtaq; Asimi, Ravouf; Wani, Maqbool; Sheikh, Shahnawaz; Mehraj, Iqra

    2016-01-01

    Migraine is a complex, recurrent headache disorder that is one of the most common complaints in neurology practice. The role of various genes in its pathogenesis is being studied. We did this study to see whether an association exists between ACE gene I/D polymorphism and migraine in our region. The study included 100 patients diagnosed with migraine and 121 healthy controls. The study subject were age and gender matched. The analysis was based on Polymerase Chain Reaction (PCR) and included following steps: DNA extraction from blood, PCR and Restriction Fragment Length Polymorphism (RFLP). Out of 100 cases, 69 were females and 31 were males. Fifty-seven were having migraine without aura and 43 had migraine with aura. 45 of the cases had II polymorphism, 40 had ID polymorphism and 15 had DD polymorphism in ACE gene. We were not able to find a statistically significant association between ACE gene I/D polymorphism with migraine. The reason for difference in results between our study and other studies could be because of different ethnicity in study populations. So a continuous research is needed in this regard in order to find the genes and different polymorphism that increase the susceptibility of Kashmiri population to migraine.

  2. In silico screening of the chicken genome for overlaps between genomic regions: microRNA genes, coding and non-coding transcriptional units, QTL, and genetic variations.

    PubMed

    Zorc, Minja; Kunej, Tanja

    2016-05-01

    MicroRNAs (miRNAs) are a class of non-coding RNAs involved in posttranscriptional regulation of target genes. Regulation requires complementarity between target mRNA and the mature miRNA seed region, responsible for their recognition and binding. It has been estimated that each miRNA targets approximately 200 genes, and genetic variability of miRNA genes has been reported to affect phenotypic variability and disease susceptibility in humans, livestock species, and model organisms. Polymorphisms in miRNA genes could therefore represent biomarkers for phenotypic traits in livestock animals. In our previous study, we collected polymorphisms within miRNA genes in chicken. In the present study, we identified miRNA-related genomic overlaps to prioritize genomic regions of interest for further functional studies and biomarker discovery. Overlapping genomic regions in chicken were analyzed using the following bioinformatics tools and databases: miRNA SNiPer, Ensembl, miRBase, NCBI Blast, and QTLdb. Out of 740 known pre-miRNA genes, 263 (35.5 %) contain polymorphisms; among them, 35 contain more than three polymorphisms The most polymorphic miRNA genes in chicken are gga-miR-6662, containing 23 single nucleotide polymorphisms (SNPs) within the pre-miRNA region, including five consecutive SNPs, and gga-miR-6688, containing ten polymorphisms including three consecutive polymorphisms. Several miRNA-related genomic hotspots have been revealed in chicken genome; polymorphic miRNA genes are located within protein-coding and/or non-coding transcription units and quantitative trait loci (QTL) associated with production traits. The present study includes the first description of an exonic miRNA in a chicken genome, an overlap between the miRNA gene and the exon of the protein-coding gene (gga-miR-6578/HADHB), and the first report of a missense polymorphism located within a mature miRNA seed region. Identified miRNA-related genomic hotspots in chicken can serve researchers as a starting point for further functional studies and association studies with poultry production and health traits and the basis for systematic screening of exonic miRNAs and missense/miRNA seed polymorphisms in other genomes.

  3. HOTAIR gene polymorphisms contribute to increased neuroblastoma susceptibility in Chinese children.

    PubMed

    Yang, Xu; He, Jing; Chang, Yitian; Luo, Annie; Luo, Ailing; Zhang, Jiao; Zhang, Ruizhong; Xia, Huimin; Xu, Ling

    2018-06-15

    Neuroblastoma is the most frequently diagnosed extracranial solid tumor in children. Previous studies have shown that single-nucleotide polymorphisms in some genes are associated with the risk of multiple cancers, including neuroblastoma. Although Hox transcript antisense intergenic RNA (HOTAIR) gene polymorphisms have been investigated in a variety of cancers, to the authors' knowledge the relationships between HOTAIR gene polymorphisms and neuroblastoma susceptibility have not been reported to date. The objective of the current study was to evaluate the correlation between HOTAIR gene polymorphisms and neuroblastoma risk in Chinese children. The authors genotyped 6 polymorphisms (rs920778 A>G, rs12826786 C>T, rs4759314 A>G, rs7958904 G>C, rs874945 C>T, and rs1899663 C>A) of the HOTAIR gene in 2 Chinese populations including 393 neuroblastoma cases and 812 healthy controls. The strength of the associations was evaluated using odds ratios and 95% confidence intervals. Further stratification analyses were conducted to explore the association between the HOTAIR gene polymorphisms rs12826786 C>T, rs874945 C>T, and rs1899663 C>A with neuroblastoma susceptibility in terms of age, sex, clinical stage of disease, and sites of origin. The authors found that the rs12826786 C>T (P =.013), rs874945 C>T (P =.020), and rs1899663 C>A (P =.029) polymorphisms were significantly associated with increased neuroblastoma risk. In stratification analyses, these associations were more predominant in females and among patients with tumor in the retroperitoneal region or mediastinum. The remaining 3 polymorphisms were not found to be related to neuroblastoma susceptibility. The results of the current study verified that HOTAIR gene polymorphisms are associated with increased neuroblastoma risk and suggest that HOTAIR gene polymorphisms might be a potential biomarker for neuroblastoma susceptibility. Cancer 2018;124:2599-606. © 2018 American Cancer Society. © 2018 American Cancer Society.

  4. Associations between the rs6010620 polymorphism in RTEL1 and risk of glioma: a meta-analysis of 20,711 participants.

    PubMed

    Wu, Yao; Tong, Xiang; Tang, Ling-Li; Zhou, Kai; Zhong, Chuan-Hong; Jiang, Shu

    2014-01-01

    Associations between the rs6010620 polymorphism in the regulator of telomere elongation helicase1 (RTEL1) gene and glioma have been widely reported but the results were not inconclusive. The aim of the current study was to investigate the association between the rs6010620 polymorphism in RTEL1 gene and risk of glioma by meta-analysis. We searched PubMed, Embase, Wanfang Weipu and CNKI (China National Knowledge Infrastructure) databases, which included all research published 05 May 2014. A total of 8,292 cases and 12,419 controls from 14 case-control studies involving the rs6010620 polymorphism in the RTEL1 gene were included. Statistical analysis was performed using STATA 12.0 software. The results indicated that the rs6010620 polymorphism in RTEL1 gene was indeed associated with risk of glioma (OR=1.474, 95%CI=1.282-1.694, p<0.001). On subgroup analysis by ethnicity, we found associations between the rs6010620 polymorphism in the RTEL1 gene and risk of glioma in both Caucasians and Asians. The current meta-analysis suggested that the rs6010620 polymorphism in the RTEL1 gene might increase risk of glioma. In future, larger case-control studies are needed to confirm our results.

  5. Toward optimal set of single nucleotide polymorphism investigation before IVF.

    PubMed

    Ivanov, A V; Dedul, A G; Fedotov, Y N; Komlichenko, E V

    2016-10-01

    At present, the patient preparation for IVF needs to undergo a series of planned tests, including the genotyping of single nucleotide polymorphism (SNP) alleles of some genes. In former USSR countries, such investigation was not included in overwhelming majority of health insurance programs and paid by patient. In common, there are prerequisites to the study of more than 50 polymorphisms. An important faced task is to determine the optimal panel for SNP genotyping in terms of price/number of SNP. During 2009-2015 in the University Hospital of St. Petersburg State University, blood samples were analyzed from 550 women with different reproductive system disorders preparing for IVF and 46 healthy women in control group. In total, 28 SNP were analyzed in the genes of thrombophilia factors, folic acid cycle, detoxification system, and the renin-angiotensin system. The method used was real-time PCR. A significant increase in the frequency of pathological alleles of some polymorphisms in patients with habitual failure of IVF was shown, compared with the control group. As a result, two options defined panels for optimal typing SNP before IVF were composed. Standard panel includes 8 SNP, 5 in thromborhilic factors, and 3 in folic acid cycle genes. They are 20210 G > A of FII gene, R506Q G > A of FV gene (mutation Leiden), -675 5G > 4G of PAI-I gene, L33P T > C of ITGB3 gene, -455 G > A of FGB gene, 667 C > T of MTHFR gene, 2756 A > G of MTR gene, and 66 A > G of MTRR gene. Extended panel of 15 SNP also includes 807 C > T of ITGA2 gene, T154M C > T of GP1BA gene, second polymorphism 1298 A > C in MTHFR gene, polymorphisms of the renin-angiotensin gene AGT M235T T > C and -1166 A > C of AGTR1 gene, polymorphisms I105V A > G and A114V C > T of detoxification system gene GSTP. The results of SNP genotyping can be adjusted for treatment tactics and IVF, and also medical support getting pregnant. The success rate of IVF is increased as the result, especially in the group with the usual failure of IVF.

  6. Polymorphism at codon 36 of the p53 gene.

    PubMed

    Felix, C A; Brown, D L; Mitsudomi, T; Ikagaki, N; Wong, A; Wasserman, R; Womer, R B; Biegel, J A

    1994-01-01

    A polymorphism at codon 36 in exon 4 of the p53 gene was identified by single strand conformation polymorphism (SSCP) analysis and direct sequencing of genomic DNA PCR products. The polymorphic allele, present in the heterozygous state in genomic DNAs of four of 100 individuals (4%), changes the codon 36 CCG to CCA, eliminates a FinI restriction site and creates a BccI site. Including this polymorphism there are four known polymorphisms in the p53 coding sequence.

  7. Gene-gene interactions and gene polymorphisms of VEGFA and EG-VEGF gene systems in recurrent pregnancy loss.

    PubMed

    Su, Mei-Tsz; Lin, Sheng-Hsiang; Chen, Yi-Chi; Kuo, Pao-Lin

    2014-06-01

    Both vascular endothelial growth factor A (VEGFA) and endocrine gland-derived vascular endothelial growth factor (EG-VEGF) systems play major roles in angiogenesis. A body of evidence suggests VEGFs regulate critical processes during pregnancy and have been associated with recurrent pregnancy loss (RPL). However, little information is available regarding the interaction of these two major major angiogenesis-related systems in early human pregnancy. This study was conducted to investigate the association of gene polymorphisms and gene-gene interaction among genes in VEGFA and EG-VEGF systems and idiopathic RPL. A total of 98 women with history of idiopathic RPL and 142 controls were included, and 5 functional SNPs selected from VEGFA, KDR, EG-VEGF (PROK1), PROKR1 and PROKR2 were genotyped. We used multifactor dimensionality reduction (MDR) analysis to choose a best model and evaluate gene-gene interactions. Ingenuity pathways analysis (IPA) was introduced to explore possible complex interactions. Two receptor gene polymorphisms [KDR (Q472H) and PROKR2 (V331M)] were significantly associated with idiopathic RPL (P<0.01). The MDR test revealed that the KDR (Q472H) polymorphism was the best loci to be associated with RPL (P=0.02). IPA revealed EG-VEGF and VEGFA systems shared several canonical signaling pathways that may contribute to gene-gene interactions, including the Akt, IL-8, EGFR, MAPK, SRC, VHL, HIF-1A and STAT3 signaling pathways. Two receptor gene polymorphisms [KDR (Q472H) and PROKR2 (V331M)] were significantly associated with idiopathic RPL. EG-VEGF and VEGFA systems shared several canonical signaling pathways that may contribute to gene-gene interactions, including the Akt, IL-8, EGFR, MAPK, SRC, VHL, HIF-1A and STAT3.

  8. Novel Association of WNK4 Gene, Ala589Ser Polymorphism in Essential Hypertension, and Type 2 Diabetes Mellitus in Malaysia.

    PubMed

    Ghodsian, Nooshin; Ismail, Patimah; Ahmadloo, Salma; Heidari, Farzad; Haghvirdizadeh, Polin; Ataollahi Eshkoor, Sima; Etemad, Ali

    2016-01-01

    With-no-lysine (K) Kinase-4 (WNK4) consisted of unique serine and threonine protein kinases, genetically associated with an autosomal dominant form of hypertension. Argumentative consequences have lately arisen on the association of specific single nucleotide polymorphisms of WNK4 gene and essential hypertension (EHT). The aim of this study was to determine the association of Ala589Ser polymorphism of WNK4 gene with essential hypertensive patients in Malaysia. WNK4 gene polymorphism was specified utilizing mutagenically separated polymerase chain reaction (PCR) and restriction fragment length polymorphism (RFLP) method in 320 subjects including 163 cases and 157 controls. Close relation between Ala589Ser polymorphism and elevated systolic and diastolic blood pressure (SBP and DBP) was recognized. Sociodemographic factors including body mass index (BMI), age, the level of fasting blood sugar (FBS), low density lipoprotein (LDL), and triglyceride (TG) in the cases and healthy subjects exhibited strong differences (p < 0.05). The distribution of allele frequency and genotype of WNK4 gene Ala589Ser polymorphism showed significant differences (p < 0.05) between EHT subjects with or without type 2 diabetes mellitus (T2DM) and normotensive subjects, statistically. The WNK4 gene variation influences significantly blood pressure increase. Ala589Ser probably has effects on the enzymic activity leading to enhanced predisposition to the disorder.

  9. Sequence analysis of three canine adipokine genes revealed an association between TNF polymorphisms and obesity in Labrador dogs.

    PubMed

    Mankowska, M; Stachowiak, M; Graczyk, A; Ciazynska, P; Gogulski, M; Nizanski, W; Switonski, M

    2016-04-01

    Obesity is an emerging health problem in purebred dogs. Due to their crucial role in energy homeostasis control, genes encoding adipokines are considered candidate genes, and their variants may be associated with predisposition to obesity. Searching for polymorphism was carried out in three adipokine genes (TNF, RETN and IL6). The study was performed on 260 dogs, including lean (n = 109), overweight (n = 88) and obese (n = 63) dogs. The largest cohort was represented by Labrador Retrievers (n = 136). Altogether, 24 novel polymorphisms were identified: 12 in TNF (including one missense SNP), eight in RETN (including one missense SNP) and four in IL6. Distributions of five common SNPs (two in TNF, two in RETN and one in IL6) were further analyzed with regard to body condition score. Two SNPs in the non-coding parts of TNF (c.-40A>C and c.233+14G>A) were associated with obesity in Labrador dogs. The obtained results showed that the studied adipokine genes are highly polymorphic and two polymorphisms in the TNF gene may be considered as markers predisposing Labrador dogs to obesity. © 2015 Stichting International Foundation for Animal Genetics.

  10. Clinical study on gastric cancer susceptibility genes IL-10-1082 and TNF-α.

    PubMed

    Yu, T; Lu, Q; Ou, X L; Cao, D Z; Yu, Q

    2014-12-19

    TNF 308 gene polymorphism and IL-10 polymorphism provided evidence in diagnosing some types of cancer. We aimed to explore the relation of gene polymorphism with gastric cancer. A total of 360 cases of gastric cancer patients were included in the study. The genotypes GG, GA, and AA of the interleukin-10-1082 gene (IL-10-1082) and the tumor necrosis factor-alpha gene (TNF-α) 308 polymorphism were examined by chromogenic detection. Three hundred healthy individuals' gene as control group were also examined. The GA 308 genotype of TNF-α differed significantly between the control group and the gastric cancer group (X(2) = 9.32, P < 0.05). Genotype frequencies of A/A (17.2%), A/G (26.2%), and G/G (9.1%) of the IL-10-1082 gene polymorphism in the gastric cancer group differed significantly compared to those of the control group (X(2) = 20.32, P < 0.05). The IL-10-1082 gene and the GA 308 genotype of the TNF-α gene were found to be susceptibility genes for gastric cancer.

  11. Polymorphisms of three genes (ACE, AGT and CYP11B2) in the renin-angiotensin-aldosterone system are not associated with blood pressure salt sensitivity: A systematic meta-analysis.

    PubMed

    Sun, Jiahong; Zhao, Min; Miao, Song; Xi, Bo

    2016-01-01

    Many studies have suggested that polymorphisms of three key genes (ACE, AGT and CYP11B2) in the renin-angiotensin-aldosterone system (RAAS) play important roles in the development of blood pressure (BP) salt sensitivity, but they have revealed inconsistent results. Thus, we performed a meta-analysis to clarify the association. PubMed and Embase databases were searched for eligible published articles. Fixed- or random-effect models were used to pool odds ratios and 95% confidence intervals based on whether there was significant heterogeneity between studies. In total, seven studies [237 salt-sensitive (SS) cases and 251 salt-resistant (SR) controls] for ACE gene I/D polymorphism, three studies (130 SS cases and 221 SR controls) for AGT gene M235T polymorphism and three studies (113 SS cases and 218 SR controls) for CYP11B2 gene C344T polymorphism were included in this meta-analysis. The results showed that there was no significant association between polymorphisms of these three polymorphisms in the RAAS and BP salt sensitivity under three genetic models (all p > 0.05). The meta-analysis suggested that three polymorphisms (ACE gene I/D, AGT gene M235T, CYP11B2 gene C344T) in the RAAS have no significant effect on BP salt sensitivity.

  12. Associations of polymorphisms in the Pit-1 gene with growth and carcass traits in Angus beef cattle.

    PubMed

    Zhao, Q; Davis, M E; Hines, H C

    2004-08-01

    The Pit-1 gene was studied as a candidate for genetic markers of growth and carcass traits. Angus beef cattle that were divergently selected for high- or low-blood serum IGF-I concentration were used in this study. The single-strand conformation polymorphism method was used to identify polymorphism in the Pit-1 gene including regions from intron 2 to exon 6. Two polymorphisms, Pit1I3H (HinfI) and Pit1I3NL (NlaIII), were detected in intron 3 of the Pit-1 gene. One polymorphism, Pit1I4N (BstNI), was found in intron 4, and a single nucleotide polymorphism, Pit1I5, was found in intron 5. The previously reported polymorphism in exon 6, Pit1E6H (HinfI), was also studied in 416 Angus beef cattle. Associations of the polymorphisms with growth traits, carcass traits, and IGF-I concentration were analyzed using a general linear model procedure. No significant associations were observed between these polymorphisms and growth and carcass traits.

  13. Effects of CYP2C19 and P2Y12 Gene Polymorphisms on Clinical Results of Patients Using Clopidogrel after Acute Ischemic Cerebrovascular Disease

    PubMed Central

    Sen, HM; Silan, F; Silan, C; Degirmenci, Y; Ozisik Kamaran, HI

    2014-01-01

    The CY2C19 and P2Y12 gene polymorphisms are responsible for resistance to clopidogrel, known as drug unresponsiveness. In this study we researched the effect of gene polymorphism on clinical results of patients who began clopidogrel therapy after acute ischemic cerebrovascular disease. The study included 51 patients. The patient group included patients who had begun prophylactic clopidogrel due to acute ischemic cerebrovascular disease in the last 2 years. All patients were monitored by the Neurology Outpatient Clinic at Çanakkale Onsekiz Mart Üniversity Research Hospital, Çanakkale, Turkey, and only those monitored for at least 1 year were included in the study. When the *1, *2 and *3 alleles of the CYP2C19 gene polymorphism were evaluated, two patients were homozygotes for *2/*2, 13 patients were heterozygous for *1/*2 and 36 patients were homozygotes for the wild type *1/*1. No patient had the *3 allele. Three heterozygous patients, one for *2/*2 and two for *1/*2, stopped clopidogrel therapy due to repeated strokes and began taking warfarin. When evaluating P2Y12 52 (G>T) and 34 (C>T) polymorphisms, all alleles were of the wild type. The CYP2C19 and P2Y12 gene polymorphisms may cause recurring strokes linked to insufficient response to treatment of ischemic cerebrovascular disease. In our patient group, three patients suffered repeated strokes and these patients had the CYP2C19*2 gene polymorphism. As a result, before medication use, genetic testing is important for human life, quality of life and economic burden. PMID:25937796

  14. Gene analysis of steroid 5 alpha-reductase 1 in hyperandrogenic women.

    PubMed

    Eminović, Izet; Komel, Radovan; Prezelj, Janez; Karamehić, Jasenko; Gavrankapetanović, Faris; Heljić, Becir

    2005-08-01

    To examine the gene encoding for 5alpha-reductase type 1 in hyperandrogenic women, and assess the association of its eventual mutations or polymorphisms with the development of the hyperandrogenic female pattern. Sixteen hyperandrogenic women were included in the study. Single-stranded conformation polymorphism analysis (SSCP) and DNA sequencing were performed after polymerase chain reaction amplification of each of the 5 exons of the SRD5A1 gene in both hyperandrogenic and control group (16 participants). Sequence analysis identified the existence of many polymorphisms; in codon 24 of exon 1, GGC (Gly) into GAC (Asp); in codon 30 of exon 1, CGG (Arg) into CGC (Arg); in exon 3 codon 169, ACA to ACG (both encoding for threonine); in exon 5, AGA to AGG (both encoding for arginine, codon 260); and T/C polymorphism in intron 2. Polymorphisms were found in both groups. Polymorphisms of SRD5A1 gene were the same in both hyperandrogenic and healthy women, indicating no significant associations of genetic polymorphisms/variations of SRD5A1 gene with clinical manifestations of hyperandrogenic disorders in women.

  15. Estimation of the relationship between the polymorphisms of selected genes: ACE, AGTR1, TGFβ1 and GNB3 with the occurrence of primary vesicoureteral reflux.

    PubMed

    Życzkowski, Marcin; Żywiec, Joanna; Nowakowski, Krzysztof; Paradysz, Andrzej; Grzeszczak, Władyslaw; Gumprecht, Janusz

    2017-03-01

    Etiopathogenesis of VUR is composite and not fully understood. Many data indicate the importance of genetic predisposition. The aim of this study was to establish the relationship of selected polymorphisms: 14094 polymorphism of the ACE, polymorphism rs1800469 of TGFβ-1, rs5443 gene polymorphism of the GNB3 and receptor gene polymorphism rs5186 type 1 AGTR1 with the occurrence of the primary vesicoureteral reflux. The study included 190 children: 90 with the primary VUR confirmed with the voiding cystourethrogram and excluded secondary VUR and a control group of 100 children without a history of the diseases of the genitourinary tract. The study was planned in the scheme: "tested case versus control." Genomic DNA was isolated from the leukocytes of peripheral blood samples. The results were statistically analyzed in the Statistica 10 using χ 2 test and analysis of the variance Anova. Any of the four studied polymorphisms showed no difference in the distribution of genotypes between patients with primary vesicoureteral reflux and the control group. In patients with VUR and TT genotype polymorphism rs5443 GNB3 gene, the glomerular filtration rate was significantly higher than in patients with genotype CC or CT. (1) No relationship was found between the studied polymorphisms (14094 ACE gene, rs1800469 gene TGFβ1, GNB3 gene rs5443, rs5186 AGTR1 gene) and the occurrence of primary vesicoureteral reflux. (2) TT genotype polymorphism rs5443 GNB3 gene may be a protective factor for the improved renal function in patients with primary vesicoureteral reflux in patients with genotype CC or CT.

  16. The AVPR1A Gene and Its Single Nucleotide Polymorphism rs10877969: A Literature Review of Associations with Health Conditions and Pain.

    PubMed

    Roach, Keesha L; Hershberger, Patricia E; Rutherford, Julienne N; Molokie, Robert E; Wang, Zaijie Jim; Wilkie, Diana J

    2018-03-01

    Pain is the quintessential symptom for individuals suffering from sickle cell disease (SCD). Although the degree of suffering and the cost of treatment are staggering, SCD continues to be grossly understudied, including a lack of data for pain-related genes and prevalence of polymorphisms in this population. This lack of data adds to the inadequacy of pain therapy in this population. Pain genetics investigators have recently examined allele frequencies of single-nucleotide polymorphisms from candidate genes in people who have SCD. One of the genes identified was the arginine vasopressin receptor 1A gene (AVPR1A) and its associated single-nucleotide polymorphism (SNP) rs10877969. Progress in explaining pain-related polymorphisms associated with SCD can be facilitated by understanding the literature. The purpose of this literature review was to describe mechanisms of the polymorphic gene AVPR1A and the phenotypic variations associated with its SNPs relative to health conditions and pain. Published studies were included if the research addressed AVPR1A and was a full article in a peer-reviewed journal, in the English language, a human or animal study, and published 2009 to present. Abstracts were included if they were in English and provided information not found in a full article. The results of this review revealed that AVPR1A is associated with behavioral phenotypes, which include pair bonding, autism spectrum disorder, musical aptitude, infidelity, altruism, monogamy, mating, substance abuse, and alcohol preference. In addition, there were associations with pain, stress pain by sex, and sickle cell pain. Summary of this literature could provide insights into future pain research of this SNP in people with SCD. Copyright © 2018 American Society for Pain Management Nursing. Published by Elsevier Inc. All rights reserved.

  17. Epistatic interaction between FCRL3 and NFκB1 genes in Spanish patients with rheumatoid arthritis

    PubMed Central

    Martínez, A; Sánchez, E; Valdivia, A; Orozco, G; López‐Nevot, M A; Pascual‐Salcedo, D; Balsa, A; Fernández‐Gutiérrez, B; de la Concha, E G; García‐Sánchez, A; Koeleman, B P C; Urcelay, E; Martín, J

    2006-01-01

    Background A Japanese study has described a strong association between rheumatoid arthritis and several polymorphisms located in the Fc receptor‐like 3 (FCRL3) gene, a member of a family of genes related to Fc receptors located on chromosome 1q21–23. Objectives To evaluate the association between rheumatoid arthritis and FCLR3 polymorphisms in a large cohort of Caucasian patients with rheumatoid arthritis and healthy controls of Spanish origin. Owing to the described functional link between the FCRL3 polymorphisms and the transcription factor nuclear factor κB (NFκB), a functional polymorphism located in the NFκB1 gene was included. Methods 734 patients with rheumatoid arthritis from Madrid and Granada, Spain, were included in the study, along with 736 healthy controls. Polymorphisms in the FCRL3 gene were studied by TaqMan technology. The −94ins/delATTG NFκB1 promoter polymorphism was analysed by fragment analysis after polymerase chain reaction with labelled primers. Genotypes were compared using 3×2 contingency tables and χ2 values. Results No overall differences were found in any of the FCRL3 polymorphisms and in the NFκB1 promoter polymorphism when patients were compared with controls. However, when stratified according to NFκB1 genotypes, a susceptibility effect of FCRL3 polymorphisms was observed in patients who were heterozygotes for NFκB1 (pc = 0.003). Conclusions The FCRL3 polymorphisms associated with rheumatoid arthritis in a Japanese population are not associated per se with rheumatoid arthritis in a Spanish population. A genetic interaction was found between NFκB1 and FCRL3 in Spanish patients with rheumatoid arthritis. These findings may provide a general rationale for divergent genetic association results in different populations. PMID:16476711

  18. Androgen Receptor Gene Polymorphism, Aggression, and Reproduction in Tanzanian Foragers and Pastoralists

    PubMed Central

    Butovskaya, Marina L.; Lazebny, Oleg E.; Vasilyev, Vasiliy A.; Dronova, Daria A.; Karelin, Dmitri V.; Mabulla, Audax Z. P.; Shibalev, Dmitri V.; Shackelford, Todd K.; Fink, Bernhard; Ryskov, Alexey P.

    2015-01-01

    The androgen receptor (AR) gene polymorphism in humans is linked to aggression and may also be linked to reproduction. Here we report associations between AR gene polymorphism and aggression and reproduction in two small-scale societies in northern Tanzania (Africa)—the Hadza (monogamous foragers) and the Datoga (polygynous pastoralists). We secured self-reports of aggression and assessed genetic polymorphism of the number of CAG repeats for the AR gene for 210 Hadza men and 229 Datoga men (aged 17–70 years). We conducted structural equation modeling to identify links between AR gene polymorphism, aggression, and number of children born, and included age and ethnicity as covariates. Fewer AR CAG repeats predicted greater aggression, and Datoga men reported more aggression than did Hadza men. In addition, aggression mediated the identified negative relationship between CAG repeats and number of children born. PMID:26291982

  19. Association of interleukins genes polymorphisms with multi-drug resistant tuberculosis in Ukrainian population.

    PubMed

    Butov, Dmytro O; Kuzhko, Mykhaylo M; Makeeva, Natalia I; Butova, Tetyana S; Stepanenko, Hanna L; Dudnyk, Andrii B

    2016-01-01

    Multi-drug resistant tuberculosis (MDR TB) is a significant health problem in some parts of the world. Three major cytokines involved in TB immunopathogenesis include IL-2, IL-4 and IL-10. The susceptibility to MDR TB may be genetically determined. The aim of the study was to assess the association of IL-2, IL-4, IL-10 gene polymorphisms with multi-drug resistant tuberculosis (MDR TB) in Ukrainian population. We observed 140 patients suffering from infiltrative pulmonary tuberculosis (PT) and 30 apparently healthy subjects. The patients were assigned to two groups whether they suffer or do not suffer from pulmonary MDR TB. Interleukin gene (IL) polymorphisms, particularly T330G polymorphism in the IL-2 gene, C589T polymorphism in the IL-4 gene and G1082A polymorphism in the IL-10 gene were studied through polymerase chain reaction. Circulating levels of IL-2, IL-4 and IL-10 in venous blood were estimated using ELISA. Prior to treatment, patients with PT showed significant increase of IL-2 levels and decrease of IL-4 and IL-10 levels compared to apparently healthy subjects. Circulating IL-4 and IL-10 levels were significantly decreased whilst serum IL-2 level was significantly increased in patients with MDR TB compared to non-MDR TB. Low IL-4 and IL-10 secretion and considerable IL-2 alterations were shown to be significantly associated with mutations of homozygous and heterozygous genotypes affecting C589T polymorphism in the IL-4 gene, G1082A polymorphism in the IL-10 gene and T330G polymorphism in the IL-2 gene in patients with PT. Heterozygous genotype and mutations homozygous genotypes gene in polymorphisms determining specified cytokines' production is a PT risk factor and may lead to disease progression into chronic phase. Heterozygous genotype of aforementioned cytokine genetic polymorphisms was significantly the most frequent in patients with MDR TB.

  20. Lack of genetic diversity across diverse immune genes in an endangered mammal, the Tasmanian devil (Sarcophilus harrisii).

    PubMed

    Morris, Katrina M; Wright, Belinda; Grueber, Catherine E; Hogg, Carolyn; Belov, Katherine

    2015-08-01

    The Tasmanian devil (Sarcophilus harrisii) is threatened with extinction due to the spread of devil facial tumour disease. Polymorphisms in immune genes can provide adaptive potential to resist diseases. Previous studies in diversity at immune loci in wild species have almost exclusively focused on genes of the major histocompatibility complex (MHC); however, these genes only account for a fraction of immune gene diversity. Devils lack diversity at functionally important immunity loci, including MHC and Toll-like receptor genes. Whether there are polymorphisms at devil immune genes outside these two families is unknown. Here, we identify polymorphisms in a wide range of key immune genes, and develop assays to type single nucleotide polymorphisms (SNPs) within a subset of these genes. A total of 167 immune genes were examined, including cytokines, chemokines and natural killer cell receptors. Using genome-level data from ten devils, SNPs within coding regions, introns and 10 kb flanking genes of interest were identified. We found low polymorphism across 167 immune genes examined bioinformatically using whole-genome data. From this data, we developed long amplicon assays to target nine genes. These amplicons were sequenced in 29-220 devils and found to contain 78 SNPs, including eight SNPS within exons. Despite the extreme paucity of genetic diversity within these genes, signatures of balancing selection were exhibited by one chemokine gene, suggesting that remaining diversity may hold adaptive potential. The low functional diversity may leave devils highly vulnerable to infectious disease, and therefore, monitoring and preserving remaining diversity will be critical for the long-term management of this species. Examining genetic variation in diverse immune genes should be a priority for threatened wildlife species. This study can act as a model for broad-scale immunogenetic diversity analysis in threatened species. © 2015 The Authors. Molecular Ecology Published by John Wiley & Sons Ltd.

  1. Association between ACE (rs4646994), FABP2 (rs1799883), MTHFR (rs1801133), FTO (rs9939609) Genes Polymorphism and Type 2 Diabetes with Dyslipidemia.

    PubMed

    Raza, Syed Tasleem; Abbas, Shania; Siddiqi, Zeba; Mahdi, Farzana

    2017-01-01

    Diabetic dyslipidemia is one of the leading causes of coronary artery disease (CAD) death. Genetic and environmental factors play an important role in the development of type 2 diabetes mellitus (T2DM) and dyslipidemia. The present study was aimed to investigate the association of ACE (rs4646994), FABP2 (rs1799883), MTHFR (rs1801133) and FTO (rs9939609) genes polymorphism in T2DM with dyslipidemia. Totally, 559 subjects including 221 T2DM cases with dyslipidemia, 158 T2DM without dyslipidemia and 180 controls were enrolled. ACE genes polymorphism was evaluated by polymerase chain reaction (PCR), while MTHFR , FABP2 , FTO genes polymorphisms were evaluated by PCR and restriction fragment length polymorphism (RFLP). Significant association of ACE and MTHFR genes polymorphisms were found in both group of cases [T2DM with dyslipidemia (P<0.001, and P=0.008, respectively) and T2DM without dyslipidemia (P=0.003, and P=0.010, respectively)] while FABP2 and FTO genes polymorphisms were significantly associated with T2DM without dyslipidemia (P=0.038, and P= 0.019, respectively). This study concludes that ACE , FABP2 , FTO and MTHFR genes are associated with T2DM. Additionally, it also seems that ACE and MTHFR genes might be further associated with the development of dyslipidemia in T2DM cases.

  2. Impact of Maspin Polymorphism rs2289520 G/C and Its Interaction with Gene to Gene, Alcohol Consumption Increase Susceptibility to Oral Cancer Occurrence.

    PubMed

    Yang, Po-Yu; Miao, Nae-Fang; Lin, Chiao-Wen; Chou, Ying-Erh; Yang, Shun-Fa; Huang, Hui-Chuan; Chang, Hsiu-Ju; Tsai, Hsiu-Ting

    2016-01-01

    The purpose of this study was to identify gene polymorphisms of mammary serine protease inhibitor (Maspin) specific to patients with oral cancer susceptibility and clinicopathological status. Three single-nucleotide polymorphisms (SNPs) of the Maspin gene from 741 patients with oral cancer and 601 non-cancer controls were analyzed by real-time PCR. The participants with G/G homozygotes or with G/C heterozygotes of Maspin rs2289520 polymorphism had a 2.07-fold (p = 0.01) and a 2.01-fold (p = 0.02) risk of developing oral cancer compared to those with C/C homozygotes. Moreover, gene-gene interaction increased the risk of oral cancer susceptibility among subjects expose to oral cancer related risk factors, including areca, alcohol, and tobacco consumption. G allele of Maspin rs2289520 polymorphism may be a factor that increases the susceptibility to oral cancer. The interactions of gene to oral cancer-related environmental risk factors have a synergetic effect that can further enhance oral cancer development.

  3. Bactericidal/permeability increasing protein gene polymorphism and inflammatory bowel diseases: meta-analysis of five case-control studies.

    PubMed

    Fan, Lijuan; Fu, Guoning; Ding, Yuanyuan; Lv, Peng; Li, Hongyun

    2017-03-01

    Bactericidal/permeability increasing protein (BPI) gene polymorphisms have been extensively investigated in terms of their associations with inflammatory bowel disease (IBD), with contradictory results. The aim of this meta-analysis was to evaluate associations between BPI gene polymorphisms and the risk of IBD, Crohn's disease (CD), and ulcerative colitis (UC). Eligible studies from PubMed, Embase, and Cochrane library databases were identified. Ten studies (five CD and five UC) published in five papers were included in this meta-analysis. G645A polymorphism was associated with a decreased risk of UC in allele model, dominant model, and homozygous model. Our data suggested that BPI G645A polymorphism was associated with a decreased risk of UC; the BPI G645A polymorphism was not associated with the risk of CD.

  4. Polymorphisms in candidate genes for type 2 diabetes mellitus in a Mexican population with metabolic syndrome findings.

    PubMed

    Sánchez-Corona, J; Flores-Martínez, S E; Machorro-Lazo, M V; Galaviz-Hernández, C; Morán-Moguel, M C; Perea, F J; Mújica-López, K I; Vargas-Ancona, L; Laviada-Molina, H A; Fernández, V; Pardío, J; Arroyo, P; Barrera, H; Hanson, R L

    2004-01-01

    The metabolic or insulin resistance syndrome, characterized by hypertension, dyslipidemia, glucose intolerance and hyperinsulinemia, may have genetic determinants. The insulin gene (INS), insulin receptor gene (INSR) and insulin receptor substrate 1 gene (IRS1) have been proposed as candidate genes. We examined eight polymorphisms in these genes in 163 individuals from Yucatan, Mexico; this population has a high prevalence of obesity, type 2 diabetes mellitus and dyslipidemia. Subjects were evaluated for body mass index (BMI) and blood pressure. Blood samples were collected to determine glucose, insulin, triglycerides and cholesterol levels, as well as for DNA isolation. Restriction fragment length polymorphisms in INS, INSR and IRS1 were identified by polymerase chain reaction and digestion with selected restriction enzymes. Among the eight polymorphisms analyzed, the PstI polymorphism in INS was significantly associated with hypertriglyceridemia and with the presence of at least one abnormality related to the metabolic syndrome (P=0.007 and 0.004, respectively). The MaeIII polymorphism in INS was associated with fasting hyperinsulinemia (P=0.045). In multilocus analyses including both INS polymorphisms, significant associations were seen with hypertriglyceridemia (P=0.006), hypercholesterolemia (P=0.031) and with presence of at least one metabolic abnormality (P=0.009). None of the polymorphisms in INSR or IRS1 was associated with any of these traits. These findings suggest that the insulin gene may be an important determinant of metabolic syndrome, and particularly of dyslipidemia, in this population.

  5. [Association of vitamin D receptor gene polymorphisms with mild cognitive impairment among elderly ethnic Uygurs].

    PubMed

    Zhou, Xiaohui; Zhu, Meisheng; Ma, Li; Miao, Haijun

    2015-12-01

    To assess the association of vitamin D receptor gene (VDR) Apa I, Bsm I genotypes and allele frequencies and mild cognitive impairment (MCI) among elderly ethnic Uygurs from Xinjiang, China. The polymorphisms of the VDR genotypes (Apa I and Bsm I) were analyzed by the SNaPshot method in 124 MCI patients and 124 controls. Factors which can increase the risk for MCI have included the A allele of the Apa I polymorphism [OR=1.62, 95%CI(1.13-2.31)] and the AA genotype [OR=3.49, 95% CI(1.57-7.74)], the T allele of the Bsm I polymorphism [OR=1.94, 95%CI(1.24-3.05)], higher triglyceride and systolic blood pressure levels. Polymorphisms of the VDR gene including the A allele and AA genotype of Apa I, and the T allele of Bsm I are probably associated with MCI among elderly ethnic Uygurs, and so are higher levels of triglyceride and systolic blood pressure.

  6. Polymorphisms and linkage analysis for ICAM-1 and the selectin gene cluster

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Vora, D.K.; Rosenbloom, C.L.; Cottingham, R.W.

    1994-06-01

    Genetic polymorphisms in leukocyte and endothelial cell adhesion molecules may be important variables with regard to susceptibility to multifactorial disease processes that include an inflammatory component. For this reason, polymorphisms were sought for intercellular adhesion molecule-1 (ICAM-1; gene symbol ICAM1) and for the three genes in the selectin cluster, P-selectin, L-selectin, and E-selectin (gene symbols SELP, SELL, and SELE, respectively). Two amino acid polymorphisms were identified for ICAM-1; Gly or Arg at codon 241 and Lys or Glu at codon 469. Dinucleotide repeat polymorphisms were identified in the 3{prime}-untranslated region for ICAM-1 and in intron 9 for P-selectin. Restriction fragmentmore » length polymorphisms were found using cDNAs for each of the three selectin genes as probes; E-selectin with BglII, P-selectin with ScaI, and L-selectin with HincII. Linkage analysis was performed for the selectin gene cluster and for ICAM-1 using the CEPH families; ICAM-1 is very tightly linked to the LDL receptor on chromosome 19, and the selectin cluster is linked to markers at chromosome 1q23. 41 refs., 2 tabs.« less

  7. Vitamin D receptor gene Alw I, Fok I, Apa I, and Taq I polymorphisms in patients with urinary stone.

    PubMed

    Seo, Ill Young; Kang, In-Hong; Chae, Soo-Cheon; Park, Seung Chol; Lee, Young-Jin; Yang, Yun Sik; Ryu, Soo Bang; Rim, Joung Sik

    2010-04-01

    To evaluate vitamin D receptor (VDR) gene polymorphisms in Korean patients so as to identify the candidate genes associated with urinary stones. Urinary stones are a multifactorial disease that includes various genetic factors. A normal control group of 535 healthy subjects and 278 patients with urinary stones was evaluated. Of 125 patients who presented stone samples, 102 had calcium stones on chemical analysis. The VDR gene Alw I, Fok I, Apa I, and Taq I polymorphisms were evaluated using the polymerase chain reaction-restriction fragment length polymorphism analysis. Allelic and genotypic frequencies were calculated to identify associations in both groups. The haplotype frequencies of the VDR gene polymorphisms for multiple loci were also determined. For the VDR gene Alw I, Fok I, Apa I, and Taq I polymorphisms, there was no statistically significant difference between the patients with urinary stones and the healthy controls. There was also no statistically significant difference between the patients with calcium stones and the healthy controls. A novel haplotype (Ht 4; CTTT) was identified in 13.5% of the patients with urinary stones and in 8.3% of the controls (P = .001). The haplotype frequencies were significantly different between the patients with calcium stones and the controls (P = .004). The VDR gene Alw I, Fok I, Apa I, and Taq I polymorphisms does not seem to be candidate genetic markers for urinary stones in Korean patients. However, 1 novel haplotype of the VDR gene polymorphisms for multiple loci might be a candidate genetic marker. Copyright 2010 Elsevier Inc. All rights reserved.

  8. PAI-1 4G/5G gene polymorphism is associated with angiographic patency in ST-elevation myocardial infarction patients treated with thrombolytic therapy.

    PubMed

    Ozkan, Bugra; Cagliyan, Caglar E; Elbasan, Zafer; Uysal, Onur K; Kalkan, Gulhan Y; Bozkurt, Mehmet; Tekin, Kamuran; Bozdogan, Sevcan T; Ozalp, Ozge; Duran, Mustafa; Sahin, Durmus Y; Cayli, Murat

    2012-09-01

    In this study, we examined the relationship between PAI-1 4G/5G polymorphism and patency of the infarct-related artery after thrombolysis in patients with ST-elevation myocardial infarction (STEMI). Acute STEMI patients who received thrombolytic therapy within first 12 h were included in our study. The PAI-1 4G/5G promoter region insertion/deletion polymorphism was studied from venous blood samples. Patients with the PAI-1 4G/5G gene polymorphism were included in group 1 and the others were included in group 2. Coronary angiography was performed in all patients in the first 24 h after receiving thrombolytic therapy. Thrombolysis in myocardial infarction (TIMI) 0-1 flow in the infarct-related artery was considered as 'no flow', TIMI 2 flow as 'slow flow', and TIMI 3 flow as 'normal flow'. A total of 61 patients were included in our study. Thirty patients (49.2%) were positive for the PAI-1 4G/5G gene polymorphism, whereas 31 of them (50.8%) were in the control group. There were significantly more patients with 'no flow' (14 vs. 6; P=0.02) and less patients with 'normal flow' (8 vs. 19; P=0.02) in group 1. In addition, time to thrombolytic therapy (TTT) was maximum in the 'no flow' group and minimum in the 'normal flow' group (P=0.005). In the logistic regression analysis, TTT (odds ratio: 0.9898; 95% confidence interval: 0.982-0.997; P=0.004) and the PAI-1 4G/5G gene polymorphism (odds ratio: 4.621; 95% confidence interval: 1.399-15.268; P<0.01) were found to be independently associated with post-thrombolytic 'no flow'. The PAI-1 4G/5G gene polymorphism and TTT are associated independently with 'no flow' after thrombolysis in patients with STEMI.

  9. Genetic polymorphism of estrogen receptor alpha gene in Egyptian women with type II diabetes mellitus

    PubMed Central

    Motawi, Tarek M.K.; El-Rehany, Mahmoud A.; Rizk, Sherine M.; Ramzy, Maggie M.; el-Roby, Doaa M.

    2015-01-01

    Estrogen might play an important role in type 2 diabetes mellitus pathogenesis. A number of polymorphisms have been reported in the estrogen receptor alpha gene including the XbaI and PvuII restriction enzyme polymorphisms. The aim of this study was to determine if ESRα gene polymorphisms are associated with type 2 diabetes mellitus and correlated with lipid profile. Ninety diabetic Egyptian patients were compared with forty healthy controls. ESRα genotyping of PvuII and XbaI was performed using restriction fragment length polymorphism analysis. Our study showed that there is more significant difference in the frequency of C and G polymorphic allele between patients and control groups in PvuII and XbaI respectively. Also carriers of minor C and G alleles of PvuII and XbaI gene polymorphisms were associated with increased fasting blood glucose and disturbance in lipid profile as there is an increase in total cholesterol, triglycerides and Low density lipoprotein. So findings of present study suggest the possibility that PvuII and XbaI polymorphisms in ERα are related to T2DM and with increased serum lipids among Egyptian population. PMID:26401488

  10. The BTNL2 G16071A gene polymorphism increases granulomatous disease susceptibility: A meta-analysis including FPRP test of 8710 participants.

    PubMed

    Tong, Xiang; Ma, Yao; Niu, Xundong; Yan, Zhipeng; Liu, Sitong; Peng, Bo; Peng, Shifeng; Fan, Hong

    2016-07-01

    The butyrophilin-like 2 (BTNL2) G16071A gene polymorphism has been implicated in the susceptibility to granulomatous diseases, but the results were inconclusive. The objective of the current study was to precisely explore the relationship between BTNL2 G16071A gene polymorphism and granulomatous disease susceptibility by the meta-analysis including false-positive report probability (FPRP) test. A systematic literature search in the PubMed, Embase, and Wanfang databases, China National Knowledge Internet, and commercial Internet search engines was conducted to identify studies published up to April 1, 2016. The odds ratio (OR) with 95% confidence interval (CI) was used to assess the effect size. Statistical analysis was conducted using the STATA 12.0 software and FPRP test sheet. In total, all 4324 cases and 4386 controls from 14 eligible studies were included in the current meta-analysis. By the overall meta-analysis, we found a significant association between BTNL2 G16071A gene polymorphism and granulomatous disease susceptibility (A vs G: OR = 1.25, 95% CI = 1.07-1.45, P = 0.005). The meta-regression analyses showed that a large proportion of the between-study heterogeneity was significantly attributed to the ethnicity (A vs G, P = 0.013) and the types of granulomatous diseases (A vs G, P = 0.002). By the subgroup meta-analysis, the BTNL2 G16071A gene polymorphism was associated with granulomatous disease susceptibility in Caucasians (A vs G: OR = 1.37, 95% CI = 1.18-1.58, P < 0.001). Moreover, a significant relationship between the BTNL2 G16071A gene polymorphism and sarcoidosis susceptibility (A vs G: OR = 1.52, 95% CI = 1.39-1.66, P < 0.001) was found. However, to avoid the "false-positive report," we further investigated the significant associations observed in the present meta-analysis by the FPRP test. Interestingly, the results of FPRP test indicated that the BTNL2 G16071A gene polymorphism was truly associated with sarcoidosis susceptibility (A vs G, FPRP < 0.001). Additionally, the FPRP test confirmed that the BTNL2 G16071A gene polymorphism was associated only with granulomatous disease susceptibility among Caucasians (A vs G, FPRP < 0.001) at the level of a prior probability, which was 0.001. The meta-analysis indicated that BTNL2 G16071A gene polymorphism may as a likelihood factor contributed to granulomatous disease susceptibility, especially increasing the sarcoidosis susceptibility. In addition, the polymorphism may be greatly associated with likelihood of granulomatous diseases among Caucasians.

  11. IL-10 and IL-12B gene polymorphisms in a multiethnic Malaysian population.

    PubMed

    Sam, S S; Teoh, B T; AbuBakar, S

    2015-04-13

    Inheritance of polymorphisms in the interleukin (IL)-10 promoter and IL-12B genes, which influence cytokine production and activities, may define the balance in T helper response in infection and autoimmune diseases. In the present study, we investigated the distribution of the IL-10 promoter and IL-12B gene polymorphisms in a multiethnic Malaysian population. Overall, our findings suggest that the IL-12B and IL-10 -592 genotypes were distributed homogenously across all major ethnic groups, including Malays, Chinese, and Indians, except for polymorphisms at IL-10 -1082. At this gene locus, the ethnic Chinese showed a significantly lower allele frequency of -1082G (2.1%) compared to the Malay (12.2%) and Indian (15.3%) populations. Results for the IL-12B and IL-10 gene polymorphisms were consistent with those reported for the Asian population, but markedly different from those of the African and Caucasian populations. Our findings suggest that there are specific genetic variations between different ethnic groups, which should be examined in all gene population-based association studies.

  12. [Association between MAOA-u VNTR polymorphism and its interaction with stressful life events and major depressive disorder in adolescents].

    PubMed

    Ma, Jing; Yu, Shun-Ying; Liang, Shan; Ding, Jun; Feng, Zhe; Yang, Fan; Gao, Wei-Jia; Lin, Jia-Ni; Huang, Chun-Xiang; Liu, Xue-Jun; Su, Lin-Yan

    2013-07-01

    To investigate whether the genetic polymorphism, upstream variable number of tandem repeats (uVNTR), in the monoamine oxidase A (MAOA) gene, is associated with major depressive disorder (MDD) in adolescents and to test whether there is gene-environment interaction between MAOA-uVNTR polymorphism and stressful life events (SLEs). A total of 394 Chinese Han subjects, including 187 adolescent patients with MDD and 207 normal students as a control group, were included in the study. Genotyping was performed by SNaP-shot assay. SLEs in the previous 12 months were evaluated. The groups were compared in terms of the frequency distributions of MAOA-uVNTR genotypes and alleles using statistical software. The binary logistic regression model of gene-environment interaction was established to analyze the association of the gene-environment interaction between MAOA-u VNTR genotypes and SLEs with adolescent MDD. The distribution profiles of MAOA-u VNTR genotypes and alleles were not related to the onset of MDD, severity of depression, comorbid anxiety and suicidal ideation/behavior/attempt in adolescents. The gene-environment interaction between MAOA-u VNTR genotypes and SLEs was not associated with MDD in male or female adolescents. It is not proven that MAOA-u VNTR polymorphism is associated with adolescent MDD. There is also no gene-environment interaction between MAOA-u VNTR polymorphism and SLEs that is associated with adolescent MDD.

  13. Association between ADAM metallopeptidase domain 33 gene polymorphism and risk of childhood asthma: a meta-analysis.

    PubMed

    Sun, F J; Zou, L Y; Tong, D M; Lu, X Y; Li, J; Deng, C B

    2017-08-31

    This study aimed to investigate the association between ADAM metallopeptidase domain 33 (ADAM33) gene polymorphisms and the risk of childhood asthma. The relevant studies about the relationship between ADAM33 gene polymorphisms and childhood asthma were searched from electronic databases and the deadline of retrieval was May 2016. The single nucleotide polymorphisms (SNPs) of ADAM33 (rs511898, rs2280092, rs3918396, rs528557, rs2853209, rs44707, rs2280091 and rs2280089) were analyzed based on several models including the allele, codominant, recessive and dominant models. The results showed that the ADAM33 rs2280091 polymorphism in all four genetic models was associated with an increased risk of childhood asthma. Positive associations were also found between the polymorphisms rs2280090, rs2787094, rs44707 and rs528557 and childhood asthma in some genetic models. This meta-analysis suggested that ADAM33 polymorphisms rs2280091, rs2280090, rs2787094, rs44707 and rs528557 were significantly associated with a high risk of childhood asthma.

  14. Genetic variation in eleven phase I drug metabolism genes in an ethnically diverse population.

    PubMed

    Solus, Joseph F; Arietta, Brenda J; Harris, James R; Sexton, David P; Steward, John Q; McMunn, Chara; Ihrie, Patrick; Mehall, Janelle M; Edwards, Todd L; Dawson, Elliott P

    2004-10-01

    The extent of genetic variation found in drug metabolism genes and its contribution to interindividual variation in response to medication remains incompletely understood. To better determine the identity and frequency of variation in 11 phase I drug metabolism genes, the exons and flanking intronic regions of the cytochrome P450 (CYP) isoenzyme genes CYP1A1, CYP1A2, CYP2A6, CYP2B6, CYP2C8, CYP2C9, CYP2C19, CYP2D6, CYP2E1, CYP3A4 and CYP3A5 were amplified from genomic DNA and sequenced. A total of 60 kb of bi-directional sequence was generated from each of 93 human DNAs, which included Caucasian, African-American and Asian samples. There were 388 different polymorphisms identified. These included 269 non-coding, 45 synonymous and 74 non-synonymous polymorphisms. Of these, 54% were novel and included 176 non-coding, 14 synonymous and 21 non-synonymous polymorphisms. Of the novel variants observed, 85 were represented by single occurrences of the minor allele in the sample set. Much of the variation observed was from low-frequency alleles. Comparatively, these genes are variation-rich. Calculations measuring genetic diversity revealed that while the values for the individual genes are widely variable, the overall nucleotide diversity of 7.7 x 10(-4) and polymorphism parameter of 11.5 x 10(-4) are higher than those previously reported for other gene sets. Several independent measurements indicate that these genes are under selective pressure, particularly for polymorphisms corresponding to non-synonymous amino acid changes. There is relatively little difference in measurements of diversity among the ethnic groups, but there are large differences among the genes and gene subfamilies themselves. Of the three CYP subfamilies involved in phase I drug metabolism (1, 2, and 3), subfamily 2 displays the highest levels of genetic diversity.

  15. Prothrombin polymorphism A19911G, factor V HR2 haplotype A4070G, and plasminogen activator-inhibitor-1 polymorphism 4G/5G and the risk of retinal vein occlusion.

    PubMed

    Kuhli-Hattenbach, Claudia; Hellstern, Peter; Nägler, Dorit Karin; Kohnen, Thomas; Hattenbach, Lars-Olof

    2017-01-01

    Thus far, no data has become available to evaluate systematically the prevalences of prothrombin polymorphism A19911G (PT A19911G), factor V HR2 haplotype A4070G (FV A4070G), or plasminogen activator-inhibitor-1 polymorphism 4G/5G (PAI-1 4G/5G) in patients who develop retinal vein occlusion (RVO) without cardiovascular risk factors. We retrospectively evaluated comprehensive thrombophilia data from 42 preselected RVO patients without cardiovascular risk factors. The prevalences of different gene mutations and polymorphisms including factor V Leiden mutation G1691A (FVL), FV A4070G, prothrombin mutation G20210A, PT A19911G, and PAI-1 4G/5G were compared with 241 healthy controls matched for age and sex. A total of 20 patients (47.7%) were found to carry thrombophilic gene polymorphisms including FVL, FV A4070G, and homozygous PT A19911G compared with 72 of 241 controls (29.9%; p = 0.03). Subgroup analysis of patients with a significant personal or family history of thromboembolism revealed a high prevalence of FVL, FV A4070G, and homozygous PT A19911G (p = 0.005). FV A4070G was found to be significantly associated with at least two other heterozygous or one homozygous gene polymorphisms (p = 0.02). Multivariate analysis revealed the presence of FVL (p = 0.0017) and homozygous PT A19911G (p = 0.03) polymorphism as independent risk factors for the development of RVO. Our results indicate that in selected RVO patients screening for thrombophilic gene polymorphisms including FVL, FV A4070G and homozygous PT G19911A may be helpful in a high percentage of cases. Our findings suggest that hereditary thrombophilia associated with RVO is more likely to be multigenic than caused by any single risk factor.

  16. Meta-analysis of genetic studies from journals published in China of ischemic stroke in the Han Chinese population.

    PubMed

    Xu, Xiaowei; Li, Jiejie; Sheng, Wenli; Liu, Lin

    2008-01-01

    The aim of this study was to confirm the nature and number of genes contributing to stroke risk and qualify the genetic risk of each susceptibility gene in the Han Chinese population. After collecting all case-control studies related to DNA polymorphism of any candidate gene for ischemic stroke in Han Chinese, strict selection criteria and exclusion criteria were determined and different effect models were used according to the difference in heterogeneity. Meta-analyses were carried out by Revman 4.0 software and the publication bias was further evaluated through calculation of fail-safe numbers in the included gene polymorphisms. Seventy-six studies were included in the meta-analyses which were all published in mainland China and referred to 6 candidate genes and 7 polymorphisms. Among the gene polymorphisms tested in the study, association of gene polymorphisms with increasing risk of ischemic stroke was confirmed in 6 polymorphisms including angiotensin-converting enzyme insertion/deletion (ACE I/D; OR = 1.87, 95% CI = 1.45-2.42), methylenetetrahydrofolate reductase (MTHFR) C677T (OR = 1.55, 95% CI = 1.26-1.90), plasminogen activator inhibitor 1 (PAI-1) 4G/5G (OR = 1.79, 95% CI = 1.20-2.67), beta-fibrinogen (beta-Fg) -455A/G (OR = 1.48, 95% CI = 1.14-1.92), beta-Fg -148T/C (OR = 1.72, 95% CI = 1.42-2.07), apolipoprotein E (ApoE) epsilon2-4 (OR = 2.39, 95% CI = 1.94-2.95). Because of the obvious publication bias, the association between paraoxonase 1 (PON-1) polymorphisms and stroke risk was not established although the OR of the meta-analysis suggested a positive result (OR = 1.14, 95% CI = 1.01-1.35). ACE D/I, MTHFR C677T, beta-Fg -455A/G, beta-Fg -148T/C, PAI-1 4G/5G, and ApoE epsilon2-4 were associated with risk of ischemic stroke in Han Chinese. (c) 2008 S. Karger AG, Basel

  17. Associations of SAA1 gene polymorphism with lipid lelvels and osteoporosis in Chinese women.

    PubMed

    Feng, Zheng-Ping; Li, Xiao-Yu; Jiang, Rong; Deng, Hua-Cong; Yang, Mei; Zhou, Qin; Que, Wen-Jun; Du, Jia

    2013-03-22

    The development of osteoporosis is associated with several risk factors, such as genetic polymorphisms and enviromental factors. This study assessed the correlation between SAA1 gene rs12218 polymorphism and HDL-C lelvels and osteoporosis in a population of Chinese women. A total of 387 postmenopausal female patients who were diagnosed with osteoporosis (case group) based on bone mineral density measurements via dual-energy x-ray absorptiometry and 307 females with no osteoporosis (control group) were included in this study. Correlations between SAA1 gene rs12218 polymorphism and osteoporosis and HDL-C level were investigated through the identification of SAA1 gene rs12218 polymorphism genotypes using the polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP). The TT genotype of rs12218 was more frequently in osteoporosis patients than in control subjects (P <0.001). And the rs12218 was found to be associated with plasma TG, HDL-C, LDL-C, and BMD levels in osteoporosis patients (P<0.05). The present results indicate that both osteoporosis and lipids levels are associated with the TT genotype of rs12218 in the human SAA1 gene.

  18. Associations of SAA1 gene polymorphism with Lipid lelvels and osteoporosis in Chinese women

    PubMed Central

    2013-01-01

    Background The development of osteoporosis is associated with several risk factors, such as genetic polymorphisms and enviromental factors. This study assessed the correlation between SAA1 gene rs12218 polymorphism and HDL-C lelvels and osteoporosis in a population of Chinese women. Methods A total of 387 postmenopausal female patients who were diagnosed with osteoporosis (case group) based on bone mineral density measurements via dual-energy x-ray absorptiometry and 307 females with no osteoporosis (control group) were included in this study. Correlations between SAA1 gene rs12218 polymorphism and osteoporosis and HDL-C level were investigated through the identification of SAA1 gene rs12218 polymorphism genotypes using the polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP). Results The TT genotype of rs12218 was more frequently in osteoporosis patients than in control subjects (P <0.001). And the rs12218 was found to be associated with plasma TG, HDL-C, LDL-C, and BMD levels in osteoporosis patients (P<0.05). Conclusions The present results indicate that both osteoporosis and lipids levels are associated with the TT genotype of rs12218 in the human SAA1 gene. PMID:23522429

  19. Association of vitamin D receptor BsmI (rs1544410) gene polymorphism with the chronic kidney disease susceptibility.

    PubMed

    Zhou, Tian-Biao; Jiang, Zong-Pei; Huang, Miao-Fang

    2015-02-01

    Association of vitamin D receptor (VDR) BsmI (rs1544410) gene polymorphism with the chronic kidney disease (CKD) susceptibility from the published reports are still conflicting. This meta-analysis was performed to evaluate the relationship between VDR BsmI (rs1544410) gene polymorphism and the risk of CKD. The association studies were identified from PubMed, Cochrane Library and China Biological Medicine Database on 1 March 2014, and eligible investigations were included and synthesized using meta-analysis method. Nine reports were recruited into this meta-analysis for the association of VDR BsmI gene polymorphism with CKD susceptibility. In this meta-analysis for overall populations, the BsmI B allele BB genotype and bb genotype were not associated with the risk of CKD (B allele: OR = 1.12, 95% CI: 0.88-1.44, p = 0.36; BB genotype: OR = 1.15, 95% CI: 0.81-1.62, p = 0.43; bb genotype: OR = 0.86, 95% CI: 0.61-1.20, p = 0.36). Furthermore, VDR BsmI gene polymorphism was not associated with CKD susceptibility in Asians and in Caucasians. In conclusion, the BsmI gene polymorphism was not associated with CKD susceptibility in overall populations, in Asians and in Caucasians. However, more studies should be conducted to confirm it.

  20. Genetic polymorphism of antioxidant enzymes in eosinophilic and non-eosinophilic nasal polyposis.

    PubMed

    Akyigit, Abdulvahap; Keles, Erol; Etem, Ebru Onalan; Ozercan, Ibrahim; Akyol, Hatice; Sakallioglu, Oner; Karlidag, Turgut; Polat, Cahit; Kaygusuz, Irfan; Yalcin, Sinasi

    2017-01-01

    Chronic rhinosinusitis with nasal polyps (CRSwNP) is a chronic inflammatory disease of the paranasal sinuses, and its pathophysiology is not yet precisely known. It is suggested that oxygen free radicals play an important role in the pathogenesis of nasal polyposis. This study aimed to identify genetic polymorphisms of superoxide dismutase (SOD 2), catalase (CAT), and inducible nitric oxide synthase (iNOS) enzymes in eosinophilic CRSwNP and non-eosinophilic CRSwNP patients; the study also aimed to evaluate the effect of genetic polymorphism of antioxidant enzymes on CRSwNP etiopathogenesis. One hundred thirty patients, who received endoscopic sinus surgery due to CRSwNP, and 188 control individuals were included in this study. Nasal polyp tissues were divided into two groups histopathologically as eosinophilic CRSwNP and non-eosinophilic CRSwNP. Venous blood samples were taken from the patient and control groups. Polymorphisms in the Ala16Va1 gene, which is the most common variation of SOD-2 gene, and 21 A/T polymorphisms in catalase gene were evaluated with the restriction fragment length polymorphism method and -277 C/T polymorphism in the iNOS gene was evaluated with the DNA sequencing method. The GG genotype distribution for the (-277) A/G polymorphism in the iNOS gene was a statistically significant difference between eosinophilic CRSwNP and control groups (p < 0.05). The CC genotype distribution for the SOD2 A16V (C/T) polymorphism was not statistically significant in all groups (p > 0.05). The TT genotype distribution for the A/T polymorphism in catalase gene at position -21 was statistically significant differences in eosinophilic CRSwNP and control groups (p < 0.05). Increased free oxygen radical levels, which are considered effective factors in the pathogenesis of CRSwNP, can occur due to genetic polymorphism of enzymes in the antioxidant system and genetic polymorphism of antioxidant enzymes in eosinophilic CRSwNP patients might contribute to the pathophysiology.

  1. No association of the G972S polymorphism of the insulin receptor substrate-1 gene with polycystic ovary syndrome in lean PCOS women with biochemical hyperandrogenemia.

    PubMed

    Marioli, Dimitra J; Koika, Vasiliki; Adonakis, George L; Saltamavros, Alexandros D; Karela, Anastasia; Armeni, Anastasia K; Tsapanos, Vasilios S; Decavalas, George O; Georgopoulos, Neoklis A

    2010-06-01

    The aim of the present study was to determine the prevalence and association of the G972S polymorphism of the insulin receptor substrate-1 gene (IRS-1 G972S SNP) with polycystic ovary syndrome (PCOS) and insulin resistance-related traits in a distinct phenotypic group of lean PCOS women with biochemical hyperandrogenemia, excluding obesity, which is considered to be an aggravating parameter of insulin resistance. The study included 162 women with PCOS and 122 regularly menstruating, ovulatory women as controls. Physical measurements included weight, height, fat-free mass, fat mass, systolic and diastolic blood pressure and resting heart rate. Biochemical parameters included the serum testosterone, free testosterone, androstenedione, total cholesterol, triglycerides, HDL and LDL cholesterol and glucose levels. Insulin resistance was assessed by determining fasting insulin levels, fasting glucose levels, the fasting glucose/insulin ratio, as well as the HOMA and QUICKI indexes. All DNA samples were genotyped by a PCR-restriction fragment length polymorphism (RLFP) assay. No association of the genotype frequencies of the G972S polymorphism in insulin receptor substrate-1 gene (IRS-1 G972S SNP) with PCOS phenotype and insulin resistance was detected. The G972S polymorphism of the IRS-1 gene should not be viewed as major contributor to the development of PCOS or as a causative variant for insulin resistance.

  2. Polymorphisms and pharmacogenomics for the toxicity of methotrexate monotherapy in patients with rheumatoid arthritis

    PubMed Central

    Qiu, Qi; Huang, Jing; Lin, Yang; Shu, Xiaoming; Fan, Huizheng; Tu, Zhihua; Zhou, Youwen; Xiao, Cheng

    2017-01-01

    Abstract Background: Methotrexate (MTX) is widely used and considered a first-line disease modifying antirheumatic drug (DMARD) for the treatment of rheumatoid arthritis (RA). However, 10% to 30% of patients discontinue therapy within a year of starting the treatment, usually because of undesirable side effects. Many of the relevant genes have been investigated to estimate the association between gene polymorphisms and MTX toxicity in RA patients, although inconsistent results have been reported. Methods: We searched EMBASE and PubMed in February 2016 for polymorphisms and pharmacogenomics study of the toxicity of MTX monotherapy in RA patients. The meta-analysis was stratified by whether genetic variants associated with MTX toxicity. Results: A total of 42 publications that included 28 genes with 88 gene SNPs associated with the transporters, enzymes, and metabolites of MTX or the progression of RA were included in the SR, and 31 studies were included in 7 meta-analyses. The meta-analysis showed a significant association between the toxicity of MTX and the RFC-1 80G > A (rs1051266) polymorphism in the European RA patients. Conclusion: RFC-1 80G > A (rs1051266) polymorphism was associated with MTX toxicity, and larger and more stringent study designs may provide more accurate results for the effect of these SNPs on the MTX toxicity. PMID:28296761

  3. Association of ACE, FABP2 and GST genes polymorphism with essential hypertension risk among a North Indian population.

    PubMed

    Abbas, Shania; Raza, Syed Tasleem; Chandra, Anu; Rizvi, Saliha; Ahmed, Faisal; Eba, Ale; Mahdi, Farzana

    2015-01-01

    Hypertension has a multi-factorial background based on genetic and environmental interactive factors. ACE, FABP2 and GST genes have been suggested to be involved in the development of hypertension. However, the results have been inconsistent. The present study was carried out to investigate the association of ACE (rs4646994), FABP2 (rs1799883) and GST (GSTM1 null or positive genotype and GSTT1 null or positive genotype) genes polymorphism with essential HTN cases and controls. This study includes 138 essential hypertension (HTN) patients and 116 age-, sex- and ethnicity-matched control subjects. GST (GSTM1 null or positive genotype and GSTT1 null or positive genotype) genes polymorphisms were evaluated by multiplex PCR, ACE (rs4646994) gene polymorphisms by PCR and FABP2 (rs1799883) gene polymorphisms by PCR-RFLP method. Significant differences were obtained in the frequencies of ACE DD, II genotype (p = 0.006, 0.003), GSTT1 null, GSTM1 positive genotype (p = 0.048, 0.010) and FABP2 Ala54/Ala54 genotype (p = 0.049) between essential HTN cases and controls. It is concluded that ACE (rs 4646994), FABP2 (rs1799883) and GST (GSTM1 null or positive genotype and GSTT1 null or positive genotype) genes polymorphism are associated with HTN. Further investigation with a larger sample size may be required to validate this study.

  4. The Association of Polymorphisms in Leptin/Leptin Receptor Genes and Ghrelin/Ghrelin Receptor Genes With Overweight/Obesity and the Related Metabolic Disturbances: A Review.

    PubMed

    Ghalandari, Hamid; Hosseini-Esfahani, Firoozeh; Mirmiran, Parvin

    2015-07-01

    Leptin and ghrelin are two important appetite and energy balance-regulating peptides. Common polymorphisms in the genes coding these peptides and their related receptors are shown to be associated with body weight, different markers of obesity and metabolic abnormalities. This review article aims to investigate the association of common polymorphisms of these genes with overweight/obesity and the metabolic disturbances related to it. The keywords leptin, ghrelin, polymorphism, single-nucleotide polymorphism (SNP), obesity, overweight, Body Mass Index, metabolic syndrome, and type 2 diabetes mellitus (T2DM) (MeSH headings) were used to search in the following databases: Pubmed, Sciencedirect (Elsevier), and Google scholar. Overall, 24 case-control studies, relevant to our topic, met the criteria and were included in the review. The most prevalent leptin/leptin receptor genes (LEP/LEPR) and ghrelin/ghrelin receptor genes (GHRL/GHSR) single nucleotide polymorphisms studied were LEP G-2548A, LEPR Q223R, and Leu72Met, respectively. Nine studies of the 17 studies on LEP/LEPR, and three studies of the seven studies on GHRL/GHSR showed significant relationships. In general, our study suggests that the association between LEP/LEPR and GHRL/GHSR with overweight/obesity and the related metabolic disturbances is inconclusive. These results may be due to unidentified gene-environment interactions. More investigations are needed to further clarify this association.

  5. A meta-analysis of xeroderma pigmentosum gene D Ls751Gln polymorphism and susceptibility to hepatocellular carcinoma.

    PubMed

    Wang, Yu; Zhao, Yingren; Zhang, Aiyun; Ma, Juan; Wang, Zhenzhen; Zhang, Xu

    2015-01-01

    Hepatocellular carcinoma (HCC) is one of most common malignant tumors worldwide, but with unclear mechanisms. Xeroderma pigmentosum gene D (XPD) is one important DNA damage repair gene and can be involved in protein mutation. Currently little has been known about XPD polymorphism and HCC susceptibility in Chinese people. This study used a meta-analysis approach to comprehensively investigate the correlation between XPD polymorphism and HCC susceptibility in Chinese population, based on previously published literatures. A computer retrieval system was used to collect all case-control studies about XPD Lys751Gln polymorphism and HCC susceptibility. Data in literatures were extracted for meta-analysis. After the primary screening, four independent studies, which were published in 3 English articles and one Chinese article, were recruited in this study. There were 1,717 samples included in all studies. Using Gln/Gln + Lys/Gln, Lys/Lys + Lys/Gln and Lys allels as the reference, HCC disease alleles including Lys/Lys, Gln/Gln and Gln had OR values (95% CI, I(2)) of 1.007 (0.657~4.672, 91%), 3.516 (0.220~20.661, 48%) and 3.225 (0.278~12.326, 84%), respectively. The polymorphism of XPD751 loci is closely correlated with primary HCC. Lys751Gln polymorphism of XPD gene can be used as one susceptibility factor for HCC.

  6. Relation between osteonecrosis of the femoral head and PAI-1 4G/5G gene polymorphism: a meta-analysis.

    PubMed

    Zeng, Zheng; Wang, Bing; Pan, Haitao

    2015-01-01

    The aim of this study was to investigate the association of plasminogen activator inhibitor-1 (PAI-1) 4G/5G gene polymorphism and osteonecrosis of the femoral head (ONFH). The pooled relative risk ratio (RR) and 95% confidence intervals (95% CI) were calculated using the the RevMan 5.0 software. The present study included 969 patients with ONFH and 419 healthy controls. The Meta analysis results showed: There is association between PAI-1 gene 4G/5G polymorphism and the increasing risk of ONFH (allele model: RR = 1.24, 95% CI = 1.16 ~ 1.33; dominant genetic model: RR = 1.12, 95% CI = 1.05 ~ 1.18). It was found that the association between PAI-1 gene 4 G/5 G polymorphism and the susceptibility of ONFH (P < 0.05) through the comparison of Caucasian population and Asian people according to the analysis of different races. There is association between PAI-1 gene 4 G/5 G polymorphism and the increasing of the susceptibility of ONFH.

  7. C282Y polymorphism in the HFE gene is associated with risk of breast cancer.

    PubMed

    Liu, Xiaoyan; Lv, Chunlei; Luan, Xiaorong; Lv, Ming

    2013-10-01

    The C282Y and H63D polymorphisms in the HFE gene have been implicated in susceptibility of breast cancer, but a number of studies have reported inconclusive results. The aim of this study is to investigate the association between the C282Y and H63D polymorphisms in the HFE gene and breast cancer risk by meta-analysis. We searched PubMed and Embase databases, covering all related studies until March 2, 2013. Statistical analysis was performed using STATA 10.0. A total of 7 studies including 1,720 cases and 18,296 controls for HFE C282Y polymorphism and 5 studies including 942 cases and 1,571 controls for HFE H63D polymorphism were included in the meta-analysis. The results showed that HFE C282Y polymorphism was significantly associated with increased risk of breast cancer under homozygotes vs. wild-type model (OR = 2.06, 95%CI = 1.19-3.58) and recessive model (OR = 1.98, 95%CI = 1.14-3.44) but not under heterozygotes vs. wild-type model (OR = 0.97, 95%CI = 0.70-1.35), dominant model (OR = 1.00, 95%CI = 0.72-1.40) and multiplicative model (OR = 1.04, 95%CI = 0.76-1.42). However, we did not find any association between HFE H63D polymorphism and breast cancer risk under all genetic models. This current meta-analysis suggested that C282Y polymorphism rather than H63D might be associated with increased risk of breast cancer.

  8. Estrogen Receptor 1 ( ESR1) Gene Polymorphisms and Obesity Phenotypes in a Population of Young Adults.

    PubMed

    Correa-Rodríguez, María; Schmidt-RioValle, Jacqueline; González-Jiménez, Emilio; Rueda-Medina, Blanca

    2017-06-01

    Obesity is considered an increasingly serious health problem determined by multiple genetic and environmental factors. Estrogens have been found to play a major role in body weight and adiposity regulation through estrogen receptor 1 ( ESR1). The aim of this study was to determine whether genotype and haplotype frequencies of ESR1 polymorphisms are associated with body composition measures in a population of 572 young adults. A lack of significant association between genotypes of ESR1 gene polymorphisms and obesity phenotypes was seen after adjustment for confounding factors. Linkage disequilibrium (LD) analysis identified a single LD block for the ESR1 gene including PvuII and XbaI single-nucleotide polymorphisms (SNPs) (pairwise r 2 = .66). None of the haplotypes identified revealed statistically significant associations with any of the obesity phenotypes. Our results suggest that polymorphisms of the ESR1 gene do not contribute significantly to the genetic risk for obesity phenotypes in a population of young Caucasian adults.

  9. Cytokine gene polymorphisms in bullous pemphigoid in a Chinese population.

    PubMed

    Chang, Y T; Liu, H N; Yu, C W; Lin, M W; Huang, C H; Chen, C C; Liu, M T; Lee, D D; Wang, W J; Tsai, S F

    2006-01-01

    Bullous pemphigoid (BP) is an autoimmune bullous disease mostly associated with autoantibodies to the hemidesmosomal BP autoantigens BP180 and BP230. High levels of interleukin (IL)-1beta, IL-4, IL-5, IL-6, IL-8, IL-10, IL-13, tumour necrosis factor (TNF)-alpha and interferon (IFN)-gamma have been detected in skin lesions or sera of patients with BP. Cytokine gene polymorphisms may affect cytokine production and contribute to susceptibility to autoimmune diseases. Until now, no cytokine gene polymorphism study has been conducted on patients with BP. We aimed to determine whether the genetic polymorphisms of the cytokine genes might influence the development of BP. DNA samples were obtained from 96 BP patients and 174 control subjects. Using direct sequencing and microsatellite genotyping, we examined 23 polymorphisms in 11 cytokine genes including the IL-1alpha, IL-1beta, IL-1 receptor antagonist, IL-4, IL-6, IL-8, IL-10, IL-13, IL-4 receptor, TNF-alpha and IFN-gamma genes. Although the BP patients were more likely to carry the -511T and -31C alleles of the IL-1beta gene (P = 0.04), the significance disappeared after correction for multiple testing (Pc). There was complete linkage disequilibrium between the -511T and -31C alleles of the IL-1beta gene. In female patients with BP, the associations with IL-1beta (-511T) and (-31C) alleles were much stronger (68% vs. 40.6%, odds ratio = 3.11, Pc = 0.006). No significantly different allelic and genotypic distributions of other cytokine gene polymorphisms could be found between the patients with BP and controls. Moreover, no association with the extent of disease involvement (localized or generalized) was observed. The IL-1beta (-511) and (-31) polymorphisms were significantly associated with BP in women. The other genetic polymorphisms of cytokine genes that we analysed do not appear to be associated with BP susceptibility in our Chinese population.

  10. Candidate genes for COPD in two large data sets.

    PubMed

    Bakke, P S; Zhu, G; Gulsvik, A; Kong, X; Agusti, A G N; Calverley, P M A; Donner, C F; Levy, R D; Make, B J; Paré, P D; Rennard, S I; Vestbo, J; Wouters, E F M; Anderson, W; Lomas, D A; Silverman, E K; Pillai, S G

    2011-02-01

    Lack of reproducibility of findings has been a criticism of genetic association studies on complex diseases, such as chronic obstructive pulmonary disease (COPD). We selected 257 polymorphisms of 16 genes with reported or potential relationships to COPD and genotyped these variants in a case-control study that included 953 COPD cases and 956 control subjects. We explored the association of these polymorphisms to three COPD phenotypes: a COPD binary phenotype and two quantitative traits (post-bronchodilator forced expiratory volume in 1 s (FEV₁) % predicted and FEV₁/forced vital capacity (FVC)). The polymorphisms significantly associated to these phenotypes in this first study were tested in a second, family-based study that included 635 pedigrees with 1,910 individuals. Significant associations to the binary COPD phenotype in both populations were seen for STAT1 (rs13010343) and NFKBIB/SIRT2 (rs2241704) (p<0.05). Single-nucleotide polymorphisms rs17467825 and rs1155563 of the GC gene were significantly associated with FEV₁ % predicted and FEV₁/FVC, respectively, in both populations (p<0.05). This study has replicated associations to COPD phenotypes in the STAT1, NFKBIB/SIRT2 and GC genes in two independent populations, the associations of the former two genes representing novel findings.

  11. Polymorphisms in the circadian expressed genes PER3 and ARNTL2 are associated with diurnal preference and GNβ3 with sleep measures

    PubMed Central

    Parsons, Michael J; Lester, Kathryn J; Barclay, Nicola L; Archer, Simon N; Nolan, Patrick M; Eley, Thalia C; Gregory, Alice M

    2014-01-01

    Sleep and circadian rhythms are intrinsically linked, with several sleep traits, including sleep timing and duration, influenced by both sleep homeostasis and the circadian phase. Genetic variation in several circadian genes has been associated with diurnal preference (preference in timing of sleep), although there has been limited research on whether they are associated with other sleep measurements. We investigated whether these genetic variations were associated with diurnal preference (Morningness–Eveningness Questionnaire) and various sleep measures, including: the global Pittsburgh Sleep Quality index score; sleep duration; and sleep latency and sleep quality. We genotyped 10 polymorphisms in genes with circadian expression in participants from the G1219 sample (n = 966), a British longitudinal population sample of young adults. We conducted linear regressions using dominant, additive and recessive models of inheritance to test for associations between these polymorphisms and the sleep measures. We found a significant association between diurnal preference and a polymorphism in period homologue 3 (PER3) (P < 0.005, recessive model) and a novel nominally significant association between diurnal preference and a polymorphism in aryl hydrocarbon receptor nuclear translocator-like 2 (ARNTL2) (P < 0.05, additive model). We found that a polymorphism in guanine nucleotide binding protein beta 3 (GNβ3) was associated significantly with global sleep quality (P < 0.005, recessive model), and that a rare polymorphism in period homologue 2 (PER2) was associated significantly with both sleep duration and quality (P < 0.0005, recessive model). These findings suggest that genes with circadian expression may play a role in regulating both the circadian clock and sleep homeostasis, and highlight the importance of further studies aimed at dissecting the specific roles that circadian genes play in these two interrelated but unique behaviours. PMID:24635757

  12. Polymorphism analysis of prion protein gene in 11 Pakistani goat breeds

    PubMed Central

    Hassan, Mohammad Farooque; Khan, Sher Hayat; Babar, Masroor Ellahi; Yang, Lifeng; Ali, Tariq; Khan, Jamal Muhammad; Shah, Syed Zahid Ali; Zhou, Xiangmei; Hussain, Tanveer; Zhu, Ting; Hussain, Tariq; Zhao, Deming

    2016-01-01

    ABSTRACT The association between caprine PrP gene polymorphisms and its susceptibility to scrapie has been investigated in current years. As the ORF of the PrP gene is extremely erratic in different breeds of goats, we studied the PrP gene polymorphisms in 80 goats which belong to 11 Pakistani indigenous goat breeds from all provinces of Pakistan. A total of 6 distinct polymorphic sites (one novel) with amino acid substitutions were identified in the PrP gene which includes 126 (A -> G), 304 (G -> T), 379 (A -> G), 414 (C -> T), 428 (A -> G) and 718 (C -> T). The locus c.428 was found highly polymorphic in all breeds as compare to other loci. On the basis of these PrP variants NJ phylogenetic tree was constructed through MEGA6.1 which showed that all goat breeds along with domestic sheep and Mauflon sheep appeared as in one clade and sharing its most recent common ancestors (MRCA) with deer species while Protein analysis has shown that these polymorphisms can lead to varied primary, secondary and tertiary structure of protein. Based on these polymorphic variants, genetic distance, multidimensional scaling plot and principal component analyses revealed the clear picture regarding greater number of substitutions in cattle PrP regions as compared to the small ruminant species. In particular these findings may pinpoint the fundamental control over the scrapie in Capra hircus on genetic basis. PMID:27388702

  13. Promoter polymorphisms of ST3GAL4 and ST6GAL1 genes and associations with risk of premalignant and malignant lesions of the cervix.

    PubMed

    Rivera-Juarez, Maria de Los Angeles; Rosas-Murrieta, Nora Hilda; Mendieta-Carmona, Victoriano; Hernandez-Pacheco, Raquel Esneidy; Zamora-Ginez, Irma; Rodea-Avila, Carlos; Apresa-Garcia, Teresa; Garay-Villar, Onix; Aguilar-Lemarroy, Adriana; Jave-Suarez, Luis Felipe; Diaz-Orea, Maria Alicia; Milflores-Flores, Lorena; Reyes-Salinas, Juan Salvador; Ceja-Utrera, Francisco Javier; Vazquez-Zamora, Victor Javier; Vargas-Maldonado, Tomas; Reyes-Carmona, Sandra; Sosa-Jurado, Francisca; Santos-Lopez, Gerardo; Reyes-Leyva, Julio; Vallejo-Ruiz, Veronica

    2014-01-01

    Sialyltransferase gene expression is altered in several cancers, including examples in the cervix. Transcriptional regulation of the responsible genes depends on different promoters. We aimed to determine the association of single-nucleotide polymorphisms in the B3 promoter of the ST3GAL4 gene and the P1 promoter of the ST6GAL1 gene with cervical premalignant lesions or cervical cancer. A blood sample and/or cervical scrapes were obtained from 104 women with normal cytology, 154 with premalignant lesions and 100 with cervical cancer. We also included 119 blood samples of random donors. The polymorphisms were identified by sequencing from PCR products. For the B3 promoter, a fragment of 506 bp (from nucleotide -408 to +98) was analyzed, and for the P1 promoter a 490 bp (-326 to +164) fragment. The polymorphism analysis showed that at SNP rs10893506, genotypes CC and CT of the ST3GAL4 B3 promoter were associated with the presence of premalignant lesions (OR=2.89; 95%CI 1.72-4.85) and cervical cancer (OR=2.23; 95%CI 1.27-3.91). We detected only one allele of each polymorphism in the ST6GAL1 P1 promoter. We did not detect any genetic variability in the P1 promoter region in our study population. Our results suggest that the rs10893506 polymorphism -22C/T may increase susceptibility to premalignant and malignant lesions of the cervix.

  14. Pregnane X Receptor Polymorphisms and Risk of Inflammatory Bowel Disease: A Meta-Analysis.

    PubMed

    Guo, Xiaolan; Yan, Ming

    2017-08-01

    Pregnane X receptor (PXR) gene polymorphisms have been widely studied in terms of the association with inflammatory bowel disease (IBD), with inconsistent results. The present meta-analysis was performed to assess the association between PXR gene polymorphisms and the susceptibility of IBD, Crohn's disease (CD), and ulcerative colitis (UC). PubMed, Wanfang, and CNKI databases were searched for eligible studies before November 1, 2016. Pooled odds ratios (ORs) and 95% confidence intervals (95% CIs) were used to calculate the various genetic models using either a fixed-effect or a random-effect model. The heterogeneity of the included studies was examined with Cochran Q and I 2 statistics. Begg's rank correlation test and Egger's linear regression test were used to assess the publication bias. A total of six studies with 4248 cases and 3853 controls were included in this meta-analysis. Three PXR gene polymorphisms were evaluated: rs1523127, rs2276707, and rs6785049. Our analyses of rs1523127, rs2276707, and rs6785049 suggested that PXR gene polymorphism had no obvious influence on the risk of IBD in Caucasians. Subgroup analyses based on disease type showed similar results. Our meta-analysis revealed that PXR gene polymorphism may not be significantly associated with IBD susceptibility. However, the number of original studies was limited and further studies with large samples are needed to verify the results. PXR = pregnane X receptor, IBD = inflammatory bowel disease, CD = Crohn's disease, UC = ulcerative colitis, ORs = pooled odds ratios, 95% CIs = 95% confidence intervals, NOS = Newcastle-Ottawa scale, HWE = Hardy-Weinberg equilibrium.

  15. Toll-like receptor 2 gene polymorphisms in Chinese Holstein cattle and their associations with bovine tuberculosis.

    PubMed

    Zhao, Zhanqin; Xue, Yun; Hu, Zhigang; Zhou, Feng; Ma, Beibei; Long, Ta; Xue, Qiao; Liu, Huisheng

    2017-04-01

    This study evaluated whether there was an association between polymorphisms within the Toll-like receptor 2 gene (TLR2) of Chinese Holstein cattle and susceptibility to bovine tuberculosis (BTB). In a case-control study including 210 BTB cases and 237 control cattle, we found only two common single-nucleotide polymorphisms (SNPs) within the entire coding region of the TLR2 gene, A631G (rs95214857) and T1707C (rs1388116488). Additionally, the allele and genotype distributions of A631G and T1707C were not different between case and control groups, indicated that these SNPs were not associated with susceptibility to BTB. These results suggested that polymorphisms in the TLR2 gene might not play a significant role in the BTB risk in Chinese Holstein cattle. Copyright © 2017 Elsevier B.V. All rights reserved.

  16. Association of polymorphic markers of genes FTO, KCNJ11, CDKAL1, SLC30A8, and CDKN2B with type 2 diabetes mellitus in the Russian population.

    PubMed

    Nikitin, Aleksey G; Potapov, Viktor Y; Brovkina, Olga I; Koksharova, Ekaterina O; Khodyrev, Dmitry S; Philippov, Yury I; Michurova, Marina S; Shamkhalova, Minara S; Vikulova, Olga K; Smetanina, Svetlana A; Suplotova, Lyudmila A; Kononenko, Irina V; Kalashnikov, Viktor Y; Smirnova, Olga M; Mayorov, Alexander Y; Nosikov, Valery V; Averyanov, Alexander V; Shestakova, Marina V

    2017-01-01

    The association of type 2 diabetes mellitus (T2DM) with the KCNJ11, CDKAL1, SLC30A8, CDKN2B, and FTO genes in the Russian population has not been well studied. In this study, we analysed the population frequencies of polymorphic markers of these genes. The study included 862 patients with T2DM and 443 control subjects of Russian origin. All subjects were genotyped for 10 single nucleotide polymorphisms (SNPs) of the genes using real-time PCR (TaqMan assays). HOMA-IR and HOMA- β were used to measure insulin resistance and β -cell secretory function, respectively. The analysis of the frequency distribution of polymorphic markers for genes KCNJ11, CDKAL1, SLC30A8 and CDKN2B showed statistically significant associations with T2DM in the Russian population. The association between the FTO gene and T2DM was not statistically significant. The polymorphic markers rs5219 of the KCNJ11 gene, rs13266634 of the SLC30A8 gene, rs10811661 of the CDKN2B gene and rs9465871 , rs7756992 and rs10946398 of the CDKAL1 gene showed a significant association with impaired glucose metabolism or impaired β -cell function. In the Russian population, genes, which affect insulin synthesis and secretion in the β -cells of the pancreas, play a central role in the development of T2DM.

  17. No Association between Personality and Candidate Gene Polymorphisms in a Wild Bird Population

    PubMed Central

    Durieux, Gillian; Burke, Terry; Dugdale, Hannah L.

    2015-01-01

    Consistency of between-individual differences in behaviour or personality is a phenomenon in populations that can have ecological consequences and evolutionary potential. One way that behaviour can evolve is to have a genetic basis. Identifying the molecular genetic basis of personality could therefore provide insight into how and why such variation is maintained, particularly in natural populations. Previously identified candidate genes for personality in birds include the dopamine receptor D4 (DRD4), and serotonin transporter (SERT). Studies of wild bird populations have shown that exploratory and bold behaviours are associated with polymorphisms in both DRD4 and SERT. Here we tested for polymorphisms in DRD4 and SERT in the Seychelles warbler (Acrocephalus sechellensis) population on Cousin Island, Seychelles, and then investigated correlations between personality and polymorphisms in these genes. We found no genetic variation in DRD4, but identified four polymorphisms in SERT that clustered into five haplotypes. There was no correlation between bold or exploratory behaviours and SERT polymorphisms/haplotypes. The null result was not due to lack of power, and indicates that there was no association between these behaviours and variation in the candidate genes tested in this population. These null findings provide important data to facilitate representative future meta-analyses on candidate personality genes. PMID:26473495

  18. Reward dependence is related to norepinephrine transporter T-182C gene polymorphism in a Korean population.

    PubMed

    Ham, Byung-Joo; Choi, Myoung-Jin; Lee, Heon-Jeong; Kang, Rhee-Hun; Lee, Min-Soo

    2005-06-01

    It is well established that approximately 50% of the variance in personality traits is genetic. The goal of this study was to investigate a relationship between personality traits and the T-182C polymorphism in the norepinephrine transporter gene. The participants included 115 healthy adults with no history of psychiatric disorders and other physical illness during the past 6 months. All participants were tested with the Temperament and Character Inventory and genotyped norepinephrine transporter gene polymorphism. Differences on the Temperament and Character Inventory dimensions among three groups were examined with one-way analysis of variance. Our study suggests that the norepinephrine transporter T-182C gene polymorphism is associated with reward dependence in Koreans, but the small number of study participants and their sex and age heterogeneity limits generalization of our results. Further studies are necessary with a larger number of homogeneous participants to confirm whether the norepinephrine transporter gene is related to personality traits.

  19. Drivers of genetic diversity in secondary metabolic gene clusters within a fungal species

    PubMed Central

    Lind, Abigail L.; Wisecaver, Jennifer H.; Lameiras, Catarina; Wiemann, Philipp; Palmer, Jonathan M.; Keller, Nancy P.; Rodrigues, Fernando; Goldman, Gustavo H.

    2017-01-01

    Filamentous fungi produce a diverse array of secondary metabolites (SMs) critical for defense, virulence, and communication. The metabolic pathways that produce SMs are found in contiguous gene clusters in fungal genomes, an atypical arrangement for metabolic pathways in other eukaryotes. Comparative studies of filamentous fungal species have shown that SM gene clusters are often either highly divergent or uniquely present in one or a handful of species, hampering efforts to determine the genetic basis and evolutionary drivers of SM gene cluster divergence. Here, we examined SM variation in 66 cosmopolitan strains of a single species, the opportunistic human pathogen Aspergillus fumigatus. Investigation of genome-wide within-species variation revealed 5 general types of variation in SM gene clusters: nonfunctional gene polymorphisms; gene gain and loss polymorphisms; whole cluster gain and loss polymorphisms; allelic polymorphisms, in which different alleles corresponded to distinct, nonhomologous clusters; and location polymorphisms, in which a cluster was found to differ in its genomic location across strains. These polymorphisms affect the function of representative A. fumigatus SM gene clusters, such as those involved in the production of gliotoxin, fumigaclavine, and helvolic acid as well as the function of clusters with undefined products. In addition to enabling the identification of polymorphisms, the detection of which requires extensive genome-wide synteny conservation (e.g., mobile gene clusters and nonhomologous cluster alleles), our approach also implicated multiple underlying genetic drivers, including point mutations, recombination, and genomic deletion and insertion events as well as horizontal gene transfer from distant fungi. Finally, most of the variants that we uncover within A. fumigatus have been previously hypothesized to contribute to SM gene cluster diversity across entire fungal classes and phyla. We suggest that the drivers of genetic diversity operating within a fungal species shown here are sufficient to explain SM cluster macroevolutionary patterns. PMID:29149178

  20. TNF-308 G/A polymorphism and risk of acne vulgaris: a meta-analysis.

    PubMed

    Yang, Jian-Kang; Wu, Wen-Juan; Qi, Jue; He, Li; Zhang, Ya-Ping

    2014-01-01

    The -308 G/A polymorphism in the tumor necrosis factor (TNF) gene has been implicated in the risk of acne vulgaris, but the results are inconclusive. The present meta-analysis aimed to investigate the overall association between the -308 G/A polymorphism and acne vulgaris risk. We searched in Pubmed, Embase, Web of Science and CNKI for studies evaluating the association between the -308 G/A gene polymorphism and acne vulgaris risk. Data were extracted and statistical analysis was performed using STATA 12.0 software. A total of five publications involving 1553 subjects (728 acne vulgaris cases and 825 controls) were included in this meta-analysis. Combined analysis revealed a significant association between this polymorphism and acne vulgaris risk under recessive model (OR = 2.73, 95% CI: 1.37-5.44, p = 0.004 for AA vs. AG + GG). Subgroup analysis by ethnicity showed that the acne vulgaris risk associated with the -308 G/A gene polymorphism was significantly elevated among Caucasians under recessive model (OR = 2.34, 95% CI: 1.13-4.86, p = 0.023). This meta-analysis suggests that the -308 G/A polymorphism in the TNF gene contributes to acne vulgaris risk, especially in Caucasian populations. Further studies among different ethnicity populations are needed to validate these findings.

  1. The BTNL2 G16071A gene polymorphism increases granulomatous disease susceptibility

    PubMed Central

    Tong, Xiang; Ma, Yao; Niu, Xundong; Yan, Zhipeng; Liu, Sitong; Peng, Bo; Peng, Shifeng; Fan, Hong

    2016-01-01

    Abstract Objective: The butyrophilin-like 2 (BTNL2) G16071A gene polymorphism has been implicated in the susceptibility to granulomatous diseases, but the results were inconclusive. The objective of the current study was to precisely explore the relationship between BTNL2 G16071A gene polymorphism and granulomatous disease susceptibility by the meta-analysis including false-positive report probability (FPRP) test. Methods: A systematic literature search in the PubMed, Embase, and Wanfang databases, China National Knowledge Internet, and commercial Internet search engines was conducted to identify studies published up to April 1, 2016. The odds ratio (OR) with 95% confidence interval (CI) was used to assess the effect size. Statistical analysis was conducted using the STATA 12.0 software and FPRP test sheet. Results: In total, all 4324 cases and 4386 controls from 14 eligible studies were included in the current meta-analysis. By the overall meta-analysis, we found a significant association between BTNL2 G16071A gene polymorphism and granulomatous disease susceptibility (A vs G: OR = 1.25, 95% CI = 1.07–1.45, P = 0.005). The meta-regression analyses showed that a large proportion of the between-study heterogeneity was significantly attributed to the ethnicity (A vs G, P = 0.013) and the types of granulomatous diseases (A vs G, P = 0.002). By the subgroup meta-analysis, the BTNL2 G16071A gene polymorphism was associated with granulomatous disease susceptibility in Caucasians (A vs G: OR = 1.37, 95% CI = 1.18–1.58, P < 0.001). Moreover, a significant relationship between the BTNL2 G16071A gene polymorphism and sarcoidosis susceptibility (A vs G: OR = 1.52, 95% CI = 1.39–1.66, P < 0.001) was found. However, to avoid the “false-positive report,” we further investigated the significant associations observed in the present meta-analysis by the FPRP test. Interestingly, the results of FPRP test indicated that the BTNL2 G16071A gene polymorphism was truly associated with sarcoidosis susceptibility (A vs G, FPRP < 0.001). Additionally, the FPRP test confirmed that the BTNL2 G16071A gene polymorphism was associated only with granulomatous disease susceptibility among Caucasians (A vs G, FPRP < 0.001) at the level of a prior probability, which was 0.001. Conclusion: The meta-analysis indicated that BTNL2 G16071A gene polymorphism may as a likelihood factor contributed to granulomatous disease susceptibility, especially increasing the sarcoidosis susceptibility. In addition, the polymorphism may be greatly associated with likelihood of granulomatous diseases among Caucasians. PMID:27472712

  2. The Association of Polymorphisms in Leptin/Leptin Receptor Genes and Ghrelin/Ghrelin Receptor Genes With Overweight/Obesity and the Related Metabolic Disturbances: A Review

    PubMed Central

    Ghalandari, Hamid; Hosseini-Esfahani, Firoozeh; Mirmiran, Parvin

    2015-01-01

    Context: Leptin and ghrelin are two important appetite and energy balance-regulating peptides. Common polymorphisms in the genes coding these peptides and their related receptors are shown to be associated with body weight, different markers of obesity and metabolic abnormalities. This review article aims to investigate the association of common polymorphisms of these genes with overweight/obesity and the metabolic disturbances related to it. Evidence Acquisition: The keywords leptin, ghrelin, polymorphism, single-nucleotide polymorphism (SNP), obesity, overweight, Body Mass Index, metabolic syndrome, and type 2 diabetes mellitus (T2DM) (MeSH headings) were used to search in the following databases: Pubmed, Sciencedirect (Elsevier), and Google scholar. Overall, 24 case-control studies, relevant to our topic, met the criteria and were included in the review. Results: The most prevalent leptin/leptin receptor genes (LEP/LEPR) and ghrelin/ghrelin receptor genes (GHRL/GHSR) single nucleotide polymorphisms studied were LEP G-2548A, LEPR Q223R, and Leu72Met, respectively. Nine studies of the 17 studies on LEP/LEPR, and three studies of the seven studies on GHRL/GHSR showed significant relationships. Conclusions: In general, our study suggests that the association between LEP/LEPR and GHRL/GHSR with overweight/obesity and the related metabolic disturbances is inconclusive. These results may be due to unidentified gene-environment interactions. More investigations are needed to further clarify this association. PMID:26425125

  3. Methylenetetrahydrofolate reductase C677T and A1298C gene polymorphisms and therapy-related toxicity in children treated for acute lymphoblastic leukemia and non-Hodgkin lymphoma.

    PubMed

    Kantar, Mehmet; Kosova, Buket; Cetingul, Nazan; Gumus, Sevinc; Toroslu, Ertug; Zafer, Nur; Topcuoglu, Nejat; Aksoylar, Serap; Cinar, Mehtap; Tetik, Asli; Eroglu, Zuhal

    2009-06-01

    This study aimed to investigate the association of the methylenetetrahydrofolate reductase (MTHFR) gene C677T and A1298C polymorphisms with serum drug levels and toxicities after high-dose methotrexate (MTX) infusion. The study included 37 children with acute lymphoblastic leukemia or non-Hodgkin lymphoma. Serum MTX levels and toxicities of bone marrow, liver and kidney were analysed. Genotype analysis of the C677T and A1298C gene polymorphisms from genomic DNA of the subjects was performed by real-time PCR. Subjects with MTHFR polymorphism for C677T (CT, TT) had significantly higher MTX levels at 24 h (p = 0.009), and these genotypes did not seem to cause toxicity. Subjects with MTHFR polymorphism for A1298C (AC, CC) had significantly higher MTX levels at 48 h (p = 0.02), and had more grade III/IV anemia (p = 0.02), thrombocytopenia (p = 0.0001), elevated AST levels (p = 0.04) and frequent febrile neutropenic episodes (p = 0.004). The present study suggests that A1298C gene, but not C677T polymorphism is associated with MTX-related toxicity.

  4. Antioxidant-related gene polymorphisms associated with the cardio-ankle vascular index in young Russians.

    PubMed

    Sorokin, Alexander V; Kotani, Kazuhiko; Bushueva, Olga Y; Polonikov, Alexey V

    2016-04-01

    The cardio-ankle vascular index is a measure of arterial stiffness, whereas oxidative stress underlies arterial pathology. This study aimed to investigate the association between the cardio-ankle vascular index and antioxidant-related gene polymorphisms in young Russians. A total of 89 patients (mean age, 21.6 years) were examined by the cardio-ankle vascular index and for 15 gene polymorphisms related to antioxidant enzymes including FMO3 (flavin-containing monooxygenase 3), GPX1 (glutathione peroxidase 1), and GPX4 (glutathione peroxidase 4). A higher cardio-ankle vascular index level was detected in carriers with the KK-genotype of FMO3 polymorphism rs2266782 than in those without (mean levels: 6.2 versus 5.6, respectively, p<0.05). Similarly, a higher cardio-ankle vascular index level was seen in carriers with the CC-genotype of GPX4 polymorphism rs713041 than in those without (6.0 versus 5.5, respectively, p<0.05). We did not observe significant associations between the cardio-ankle vascular index levels and the other gene polymorphisms. Although carriers with the LL-genotype of GPX1 polymorphism rs1050450 showed a higher diastolic blood pressure level than those without, the polymorphism did not affect the cardio-ankle vascular index level. This study showed a significant association between rs2266782 and rs713041 polymorphisms and arterial stiffness, as measured by the cardio-ankle vascular index, in young Russians. The pathways utilised by antioxidant enzymes may be responsible for early arterial stiffening in the Russian population.

  5. Endometriosis and RAS system gene polymorphisms: the association of ACE A2350G polymorphism with endometriosis in Polish individuals.

    PubMed

    Kowalczyńska, Liliana J; Ferenc, Tomasz; Wojciechowski, Michał; Mordalska, Anna; Pogoda, Krzysztof; Malinowski, Andrzej

    2014-05-01

    To analyze the polymorphisms of angiotensin I converting enzyme (ACE) gene (insertion/deletion [I/D], A2350G) and angiotensin II type 1 receptor gene (A1166C) in women with endometriosis and to determine the correlation of the identified genotypes with the severity of the disease. Additionally, to estimate the prognostic value of the polymorphisms in patients with endometriosis treated due to infertility. The study group included 241 women, the control group (without endometriosis)-127. The molecular analysis was performed by polymerase chain reaction (PCR) and PCR-restriction fragment length polymorphism technique. For I/D ACE and A1166C AT1 polymorphisms no significant differences were observed between the study and control groups and between the severity grades of the disease (p>0.05). For A2350G ACE polymorphism the frequency of genotypes for the study and control groups respectively was the following: AA-31.54%, AG-54.36%, GG-14.11% and AA-55.12%, AG-36.22%, GG-8.66% (x(2)=19.36, p<0.0001). Statistically significant differences were found between the frequency of A and G alleles between both groups (x(2)=15.16, p=0.0001), but not when individual grades of the disease severity were compared. There was no association between the investigated polymorphisms and the effect of infertility treatment. A2350G polymorphism (allele G, AG genotype) of ACE gene seems to be associated with the development of endometriosis.

  6. MBL, P2X7, and SLC11A1 gene polymorphisms in patients with oropharyngeal tularemia.

    PubMed

    Somuk, Battal Tahsin; Koc, Sema; Ates, Omer; Göktas, Göksel; Soyalic, Harun; Uysal, Ismail Onder; Gurbuzler, Levent; Sapmaz, Emrah; Sezer, Saime; Eyibilen, Ahmet

    2016-11-01

    A significant association was found of oropharyngeal tularemia with SLC11A1 allele polymorphism (INT4 G/C) and MBL2 C + 4T (P/Q). These results indicate C allele and Q allele might be a risk factor for the development of oropharyngeal tularemia. This study aimed to investigate the relationship of SLC11A1, MBL, and P2X 7 gene polymorphism with oropharyngeal tularemia. The study included totally 120 patients who were diagnosed with oropharyngeal tularemia. Frequencies of polymorphisms in the following genes were analyzed both in the patient and control groups in the study: SLC11A1 (5'(GT) n Allele 2/3, Int4 G/C, 3' UTR, D543N G/A), MBL (MBL2 C + 4T (P/Q), and P2X 7 (-762 C/T and 1513 A/C). Among all polymorphisms that were investigated in this study, SLC11A1 gene showed a significance in the distriburtion of polymorphism allelle frequency at the INT4 region. Frequency of C allele was 54 (28%) in patients with oropharyngeal tularemia, and 31 (13%) in the control group (p = 0.006 and OR = 1.96 (1.21-3.20)). An association was detected between MBL2 C + 4T (P/Q) gene polymorphism and oropharyngeal tularemia (p < 0.005 and OR = 0.30 (0.19-0.48)). No significant relation was found between P2X 7 (-762 C/T and 1513 A/C) gene polymorphism and oropharyngeal tularemia in this study (p > 0.05).

  7. Association between polymorphisms in prostanoid receptor genes and aspirin-intolerant asthma.

    PubMed

    Kim, Sang-Heon; Kim, Yoon-Keun; Park, Heung-Woo; Jee, Young-Koo; Kim, Sang-Hoon; Bahn, Joon-Woo; Chang, Yoon-Seok; Kim, Seung-Hyun; Ye, Young-Min; Shin, Eun-Soon; Lee, Jong-Eun; Park, Hae-Sim; Min, Kyung-Up

    2007-04-01

    Genetic predisposition is linked to the pathogenesis of aspirin-intolerant asthma. Most candidate gene approaches have focused on leukotriene-related pathways, whereas there have been relatively few studies evaluating the effects of polymorphisms in prostanoid receptor genes on the development of aspirin-intolerant asthma. Therefore, we investigated the potential association between prostanoid receptor gene polymorphisms and the aspirin-intolerant asthma phenotype. We screened for genetic variations in the prostanoid receptor genes PTGER1, PTGER2, PTGER3, PTGER4, PTGDR, PTGIR, PTGFR, and TBXA2R using direct sequencing, and selected 32 tagging single nucleotide polymorphisms among the 77 polymorphisms with frequencies >0.02 based on linkage disequilibrium for genotyping. We compared the genotype distributions and allele frequencies of three participant groups (108 patients with aspirin-intolerant asthma, 93 patients with aspirin-tolerant asthma, and 140 normal controls). Through association analyses studies of the 32 single nucleotide polymorphisms, the following single nucleotide polymorphisms were found to have significant associations with the aspirin-intolerant asthma phenotype: -616C>G (P=0.038) and -166G>A (P=0.023) in PTGER2; -1709T>A (P=0.043) in PTGER3; -1254A>G (P=0.018) in PTGER4; 1915T>C (P=0.015) in PTGIR; and -4684C>T (P=0.027), and 795T>C (P=0.032) in TBXA2R. In the haplotype analysis of each gene, the frequency of PTGIR ht3[G-G-C-C], which includes 1915T>C, differed significantly between the aspirin-intolerant asthma patients and aspirin-tolerant asthma patients (P=0.015). These findings suggest that genetic polymorphisms in PTGER2, PTGER3, PTGER4, PTGIR, and TBXA2R play important roles in the pathogenesis of aspirin-intolerant asthma.

  8. ACE Gene I/D Polymorphism and Obesity in 1,574 Patients with Type 2 Diabetes Mellitus.

    PubMed

    Pan, Yan-Hong; Wang, Min; Huang, Yan-Mei; Wang, Ying-Hui; Chen, Yin-Ling; Geng, Li-Jun; Zhang, Xiao-Xi; Zhao, Hai-Lu

    2016-01-01

    Association between ACE gene I/D polymorphism and the risk of overweight/obesity remains controversial. We investigated the possible relationship between ACE gene I/D polymorphism and obesity in Chinese type 2 diabetes mellitus (T2DM) patients. In this study, obesity was defined as a body mass index (BMI) value ≥ 25 kg/m 2 and subjects were classified into 4 groups (lean, normal, overweight, and obese). PCR (polymerase chain reaction) was used to detect the ACE gene I/D polymorphism in T2DM patients. Metabolic measurements including blood glucose, lipid profile, and blood pressure were obtained. Frequencies of the ACE genotypes (DD, ID, and II) were not significant among the 4 groups of BMI-defined patients ( P = 0.679) while ACE II carriers showed higher systolic blood pressure (SBP) and pulse pressure (PP) (all P < 0.050). Hyperglycemia, hypertension, and dyslipidemia in these T2DM patients were found to be significantly associated with BMI. In conclusion, the relationship of ACE gene I/D polymorphism with obesity is insignificant in Chinese patients with T2DM. SBP and PP might be higher in the ACE II carriers than in the DD and ID carriers.

  9. Assessment of the relationship between ACE I/D gene polymorphism and renal allograft survival.

    PubMed

    Yang, Chun-Hua; Lu, Yi; Chen, Xue-Xia; Xian, Wen-Feng; Tu, Wei-Feng; Li, Hong-Yan

    2015-12-01

    The relationship between the angiotensin-converting enzyme (ACE) insertion/deletion (I/D) gene polymorphism and renal allograft survival after renal transplantation from the published reports are still debatable. This study was performed to evaluate the relationship between the ACE I/D gene polymorphism and renal allograft survival after renal transplantation using meta-analysis. Eligible studies were identified from PubMed and Cochrane Library on 1 November 2014, and eligible studies were recruited and synthesized using a meta-analysis methodology. Twelve investigations were included in this meta-analysis for the assessment of the relationship between the ACE I/D gene polymorphism and renal allograft survival. In this meta-analysis, the ACE I/D gene polymorphism was not associated with renal allograft survival after renal transplantation for overall populations, Caucasians, Brazilians and Africans. Interestingly, the ACE D allele and DD genotype were associated with renal allograft survival after renal transplantation in the Asian population. ACE D allele and DD genotype were associated with renal allograft survival after renal transplantation in the Asian population. However, more studies should be performed to confirm this association. © The Author(s) 2015.

  10. Apolipoprotein C3 Gene Polymorphisms Are Not a Risk Factor for Developing Non-Alcoholic Fatty Liver Disease: A Meta-Analysis

    PubMed Central

    Zhang, Haiying; Chen, Lizhen; Xin, Yongning; Lou, Yuangui; Liu, Yang; Xuan, Shiying

    2014-01-01

    Context: Our objective was to evaluate the effect of gene polymorphisms of apolipoprotein C3 (APOC3) on the development of non-alcoholic fatty liver disease (NAFLD) in different populations. Evidence Acquisition: We performed a meta-analysis of all relevant studies published in the literature. A total of 115 clinical trials or reports were identified, but only seven trials met our inclusion criteria. A meta-analysis was performed according to the Cochrane Reviewers’ Handbook recommendations. Results: Five hospital-based and two population-based case-control studies were included in the final analysis. The overall frequency of APOC3 gene polymorphisms was 67.5% (1177/1745) in NAFLD and 68.8% (988/1437) in controls. The summary odds ratio for the association of gene polymorphisms of APOC3 and the risk of NAFLD was 1.03 (95% CI: 0.89-1.22),which was not statistically significant (P > 0.05). Conclusions: Our meta-analysis, while not ruling out possible publication bias, showed no association between gene polymorphisms of APOC3 and the risk of NAFLD development in different populations in the world. PMID:25477977

  11. Association between FokI, ApaI and TaqI RFLP polymorphisms in VDR gene and Hashimoto's thyroiditis: preliminary data from female patients in Serbia.

    PubMed

    Djurovic, J; Stojkovic, O; Ozdemir, O; Silan, F; Akurut, C; Todorovic, J; Savic, K; Stamenkovic, G

    2015-06-01

    Hashimoto's thyroiditis (HT) is the most prevalent autoimmune thyroid disorder caused by an interaction between genes and environmental triggers. Intrathyroid lymphocytic infiltration may lead to progressive destruction of thyroid tissue and consequently to hypothyroidism. Many studies in different populations have shown association between vitamin D receptor (VDR) gene polymorphisms and various autoimmune diseases, including HT. The study included 44 female patients (mean age ± standard deviation 38 ± 5.4) with Hashimoto's thyroiditis and 32 healthy age-matched, sex-matched and geographically matched controls without personal history of autoimmune and endocrine diseases. Genomic DNA was isolated from peripheral blood-EDTA, and the target VDR gene was genotyped by PCR-RFLP technique after VDR-FokI (rs2228570), VDR-ApaI (rs7975232) and VDR-TaqI (rs731236) restriction enzymes digestion. We used spss 20.0 integrated software for data analysis and found a significant difference in the genotype distribution of VDR-FokI polymorphism between patients with HT and controls (P = 0.009). For ApaI and TaqI, we observed a higher frequency of variant allele in patients with HT, which was not significantly different compared to control women (P > 0.05). The current first and preliminary results identified the association between VDR-FokI gene polymorphism and Hashimoto's thyroiditis in Serbian population. Results need to be supported by further investigations that define haplotype patterns for VDR gene polymorphisms in a larger group of HT patients of both sexes. © 2015 John Wiley & Sons Ltd.

  12. Polymorphism in ovine ANXA9 gene and physic-chemical properties and the fraction of protein in milk.

    PubMed

    Pecka-Kiełb, Ewa; Czerniawska-Piątkowska, Ewa; Kowalewska-Łuczak, Inga; Vasil, Milan

    2018-04-16

    Annexin A9 (ANXA9) is a specific fatty acid transport protein. ANXA9 gene is expressed in various tissues, including secretory tissue and mammary glands. The association between three SNPs of the ANXA9 gene and sheep's milk compositions was assessed. Genotype analysis was performed with the use of PCR-RFLP method. The studied ANXA9 polymorphisms had the following MAF (Major Allele Frequency): SNP1: allele G 0,66; SNP2: allele G 0,54; SNP3: allele C 0,57. The study found the most desired profile of protein fractions, namely an increased kappa-casein fractions and a decreased level of whey protein in sheep's milk for SNP1 and SNP3 polymorphisms. Sheep with the SNP1 GA genotype had the highest (P <0.05) content of fat and dry matter in milk. AXNA9 gene polymorphism did not influence the levels of protein, lactose or urea in sheep's milk. The information contained in this study may be useful for determining the impact of the ANXA9 gene on sheep's milk. The ANXA9 SNP1 and SNP3 polymorphisms results could be included in the breeding programs to select the sheep with the genotypes ensuring the highest kappa-casein levels in milk. However, it is worth conducting further research on ANXA9 and milk composition in larger herds of animals and various breeds of sheep. This article is protected by copyright. All rights reserved.

  13. Human C-reactive protein gene polymorphism and metabolic syndrome are associated with premature coronary artery disease.

    PubMed

    Abd El-Aziz, Tarek A; Mohamed, Rasha H

    2013-12-15

    The aim of this study was to investigate the association between C-reactive protein (CRP) gene polymorphism and metabolic syndrome (MetS) with premature coronary artery disease (PCAD). 116 patients with PCAD (58 with MetS and 58 without MetS) and 119 controls were included in the study. CRP gene +1059 G>C polymorphism was analyzed by polymerase chain reaction. Serum hs-CRP was measured using high-sensitivity enzyme-linked immunosorbent assay. Carriers of C allele of the CRP +1059 G>C polymorphism had 3.37 fold increased risk to develop MetS in patients with PCAD. In addition CRP gene and hs-CRP levels were independent risk factors for PCAD and MetS. The present study provides new evidence that the presence of CRP +1059 G>C polymorphism and hs-CRP levels are independent determinants of PCAD and MetS in Egyptians. The results of our study suggest a synergistic effect of CRP C allele with classical risk factors such as hypertension, obesity, dyslipidemia and MetS. © 2013 Elsevier B.V. All rights reserved.

  14. Genetic basis of inter-individual variability in the effects of exercise on the alleviation of lifestyle-related diseases

    PubMed Central

    Mori, Masayuki; Higuchi, Keiichi; Sakurai, Akihiro; Tabara, Yasuharu; Miki, Tetsuro; Nose, Hiroshi

    2009-01-01

    Habitual exercise training, including a high-intensity interval walking programme, improves cardiorespiratory fitness and alleviates lifestyle-related diseases, such as obesity, hypertension and dyslipidaemia. However, the extent of improvement has been shown to differ substantially among individuals for various exercise regimens. A body of literature has demonstrated that gene polymorphisms could account for the inter-individual variability in the improvement of risk factors for lifestyle-related diseases following exercise training. However, the fractions of the variability explained by the polymorphisms are small (∼5%). Also, it is likely that the effects of gene polymorphisms differ with exercise regimens and subject characteristics. These observations suggest the necessity for further studies to exhaustively identify such gene polymorphisms. More importantly, the physiological and molecular genetic mechanisms by which gene polymorphisms interact with exercise to influence the improvements of risk factors for lifestyle-related diseases differentially remain to be clarified. A better understanding of these issues should lead to more effective integration of exercise to optimize the treatment and management of individuals with lifestyle-related diseases. PMID:19736300

  15. The rs4846049 polymorphism in the 3'UTR region of the MTHFR gene increases the migraine susceptibility in an Iranian population.

    PubMed

    Salehi, Mohaddeseh; Amin-Beidokhti, Mona; Safarpour Lima, Behnam; Gholami, Milad; Javadi, Gholam-Reza; Mirfakhraie, Reza

    2018-01-01

    Migraine is a painful complex neurovascular disease characterized by recurrent moderate-to-severe headaches. Increased level of homocysteine is related to dilation of cerebral vessels and endothelial injury that could trigger migraine attacks. Functional polymorphisms in the MTHFR gene affect homocysteine metabolism and, therefore, play an important role in the etiology of the disease. We aimed to investigate the possible association between MTHFR gene rs4846049, C677T, and A1298C polymorphisms and the risk of migraine in Iranian population. In this genetic association study, 498 individuals were enrolled, including 223 migraine patients and 275 healthy controls. Genotyping was performed using tetra-primer ARMS-PCR for rs4846049 and PCR-restriction fragment length polymorphism for C677T and A1298C polymorphisms. The association between rs4846049 and C677T polymorphisms and migraine was observed. For the rs4846049 polymorphism, the association was detected under a dominant model ( P =0.007; odds ratio [OR] =0.60; 95% confidence interval [CI], 0.41-0.87), and for the C677T polymorphism, the TT genotype frequency was significantly different in the studied groups ( P =0.009; OR =2.48; 95% CI, 1.25-4.92). No significant differences in the genotype or allele frequencies were found for the A1298C polymorphism between the migraineurs and controls. Present data provide evidence for the association of rs4846049 and C677T polymorphisms in the MTHFR gene and migraine. Further studies are required to validate the significance of the studied genetic variations in diverse ethnic populations.

  16. Depressive symptoms in schizophrenia and dopamine and serotonin gene polymorphisms.

    PubMed

    Peitl, Vjekoslav; Štefanović, Mario; Karlović, Dalibor

    2017-07-03

    Although depressive symptoms seem to be frequent in schizophrenia they have received significantly less attention than other symptom domains. As impaired serotonergic and dopaminergic neurotransmission is implicated in the pathogenesis of depression and schizophrenia this study sought to investigate the putative association between several functional gene polymorphisms (SERT 5-HTTLPR, MAO-A VNTR, COMT Val158Met and DAT VNTR) and schizophrenia. Other objectives of this study were to closely examine schizophrenia symptom domains by performing factor analysis of the two most used instruments in this setting (Positive and negative syndrome scale - PANSS and Calgary depression rating scale - CDSS) and to examine the influence of investigated gene polymorphisms on the schizophrenia symptom domains, focusing on depressive scores. A total of 591 participants were included in the study (300 schizophrenic patients and 291 healthy volunteers). 192 (64%) of schizophrenic patients had significant depressive symptoms. Genotype distribution revealed no significant differences regarding all investigated polymorphisms except the separate gender analysis for MAO-A gene polymorphism which revealed significantly more allele 3 carriers in schizophrenic males. Factor analysis of the PANSS scale revealed the existence of five separate factors (symptom domains), while the CDSS scale revealed two distinct factors. Several investigated gene polymorphisms (mostly SERT and MAO-A, but also COMT) significantly influenced two factors from the PANSS (aggressive/impulsive and negative symptoms) and one from the CDSS scale (suicidality), respectively. Depressive symptoms in schizophrenic patients may be influenced by functional gene polymorphisms, especially those implicated in serotonergic neurotransmission. Copyright © 2017 Elsevier Inc. All rights reserved.

  17. Genetic polymorphism in three glutathione s-transferase genes and breast cancer risk

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Woldegiorgis, S.; Ahmed, R.C.; Zhen, Y.

    The role of the glutathione S-transferase (GST) enzyme family is to detoxify environmental toxins and carcinogens and to protect organisms from their adverse effects, including cancer. The genes GSTM1, GSTP1, and GSTT1 code for three GSTs involved in the detoxification of carcinogens, such as polycyclic aromatic hydrocarbons (PAHs) and benzene. In humans, GSTM1 is deleted in about 50% of the population, GSTT1 is absent in about 20%, whereas the GSTP1 gene has a single base polymorphism resulting in an enzyme with reduced activity. Epidemiological studies indicate that GST polymorphisms increase the level of carcinogen-induced DNA damage and several studies havemore » found a correlation of polymorphisms in one of the GST genes and an increased risk for certain cancers. We examined the role of polymorphisms in genes coding for these three GST enzymes in breast cancer. A breast tissue collection consisting of specimens of breast cancer patients and non-cancer controls was analyzed by polymerase chain reaction (PCR) for the presence or absence of the GSTM1 and GSTT1 genes and for GSTP1 single base polymorphism by PCR/RFLP. We found that GSTM1 and GSTT1 deletions occurred more frequently in cases than in controls, and GSTP1 polymorphism was more frequent in controls. The effective detoxifier (putative low-risk) genotype (defined as presence of both GSTM1 and GSTT1 genes and GSTP1 wild type) was less frequent in cases than controls (16% vs. 23%, respectively). The poor detoxifier (putative high-risk) genotype was more frequent in cases than controls. However, the sample size of this study was too small to provide conclusive results.« less

  18. No association of apolipoprotein B gene polymorphism and blood lipids in obese Egyptian subjects.

    PubMed

    Bogari, Neda M; Abdel-Latif, Azza M; Hassan, Maha A; Ramadan, Abeer; Fawzy, Ahmed

    2015-03-18

    Several environmental and genetic factors are associated with high levels of lipids in obese patients. Apolipoprotein B (ApoB) is the major protein component of low-density lipoproteins (LDL), very-low density lipoproteins (VLDL) and chylomicrons and plays a central role in lipid metabolism. Several apoB restriction fragment length polymorphisms (XbaI, EcoRI, MspI) have been reported to be associated with variation in lipid levels and obesity. To date, no data are available on the relationship between XbaI polymorphism and lipid levels in Egyptian populations. Following clinical profiling, 178 obese (body mass index [BMI] >25 kg/m(2)) and 178 age-matched non-obese (BMI ≤ 25 kg/m(2)) subjects were included in this case-control study. All samples were analysed for total cholesterol, triglycerides and HDL-cholesterol. Genetic analysis of apoB XbaI (X) was performed using Polymerase Chain Reaction-Restriction Fragment Length polymorphism (PCR-RFLP). The aim of this study was to assess the association of apoB XbaI gene polymorphism (X) and lipid profiles in obese and non-obese Egyptian populations. Obese subjects demonstrated significantly higher values of waist-to-hip ratio, blood pressure, and total lipid. However, in our sample we did not find significant differences in apoB XbaI gene polymorphism (X) genotype or allele frequencies. Moreover, none of the studied lipid parameters showed any association with the gene polymorphism. This study reveals no significant association of apoB XbaI gene polymorphism (X) with obesity or lipid profiles in an Egyptian population.

  19. Sudden infant death syndrome (SIDS) and polymorphisms in Monoamine oxidase A gene (MAOA): a revisit.

    PubMed

    Groß, Maximilian; Bajanowski, Thomas; Vennemann, Mechtild; Poetsch, Micaela

    2014-01-01

    Literature describes multiple possible links between genetic variations in the neuroadrenergic system and the occurrence of sudden infant death syndrome. The X-chromosomal Monoamine oxidase A (MAOA) is one of the genes with regulatory activity in the noradrenergic and serotonergic neuronal systems and a polymorphism of the promoter which affects the activity of this gene has been proclaimed to contribute significantly to the prevalence of sudden infant death syndrome (SIDS) in three studies from 2009, 2012 and 2013. However, these studies described different significant correlations regarding gender or age of children. Since several studies, suggesting associations between genetic variations and SIDS, were disproved by follow-up analysis, this study was conducted to take a closer look at the MAOA gene and its polymorphisms. The functional MAOA promoter length polymorphism was investigated in 261 SIDS cases and 93 control subjects. Moreover, the allele distribution of 12 coding and non-coding single nucleotide polymorphisms (SNPs) of the MAOA gene was examined in 285 SIDS cases and 93 controls by a minisequencing technique. In contrast to prior studies with fewer individuals, no significant correlations between the occurrence of SIDS and the frequency of allele variants of the promoter polymorphism could be demonstrated, even including the results from the abovementioned previous studies. Regarding the SNPs, three statistically significant associations were observed which had not been described before. This study clearly disproves interactions between MAOA promoter polymorphisms and SIDS, even if variations in single nucleotide polymorphisms of MAOA should be subjected to further analysis to clarify their impact on SIDS.

  20. Polymorphism of the ACE gene and the risk of obstructive sleep apnoea.

    PubMed

    Chmielewska, Izabela; Mlak, Radosław; Krawczyk, Paweł; Czukiewska, Ewa; Milanowski, Janusz

    2013-01-01

    Obstructive sleep apnoea/hypopnea syndrome (OSA) is characterized by obstruction of the upper airway during sleep, resulting in repetitive breathing pauses accompanied by oxygen desaturation and arousal from sleep. Among the candidate genes affecting the risk of OSA, genes whose polymorphisms influence the development of diseases with similar pathogenesis such as OSA could be listed: APOE, genes for leptin and leptin receptor, TNFA1, ADRB2 and ACE (gene for angiotensin-converting enzyme). Until now there has been a confirmed relationship between ACE gene polymorphism and cardiovascular diseases, but its effect on the incidence of OSA is debatable. The aim of this study was to investigate the effect of ACE gene insertion/deletion (I/D) polymorphism on the risk of OSA. Fifty-five patients with confirmed diagnose of OSA and qualified to CPAP therapy entered the study. The control group included 50 subjects who did not complain of any sleep related symptoms. Diagnose of OSA was set on the basis of full overnight polysomnography together with Epworth Sleepiness Scale according to American Academy of Sleep Medicine guidelines. DNA was isolated from peripheral blood leukocytes with Qiagen DNA mini Kit. ACE gene polymorphism was determined in genomic DNA using allele specific polymerase chain reaction. Different sizes of PCR products were observed on agarose gel electrophoresis. There were non-significant differences in the frequency of ACE genotypes. However, allele D had significantly lower prevalence in the study group than in the control group. (χ(2) = 4.25 p = 0.04). Moreover, I allele carriers had a threefold greater risk of developing OSA (HR = 2.748, 95% CI = 1.029-7.340, p < 0.05). Analysis of ACE gene polymorphism might be useful to determine the risk of developing OSA in clinically predisposed patients.

  1. Evaluation of 5-HTTLPR Gene Polymorphism and Resilience Components on the Development of Psychopathology in Adolescent Sexual Abuse Cases.

    PubMed

    Çarkaxhiu Bulut, Gresa; Rodopman Arman, Ayşe; Güney, İlter; Gültepe, Pınar

    2017-09-01

    More than one-fourth adolescents are exposed to unexpected frightening experiences and traumas until adulthood. In this study, we aimed to determine the potential role of serotonin transporter (5-HTT) gene polymorphism regarding resilience factors in the symptom variability of individuals exposed to sexual abuse. Adolescents aged 11-17 years, who were admitted to the Marmara University Child Psychiatry Outpatient Clinic Forensic division with sexual abuse experience history, were informed about the research, and volunteers were included in the study. Turkish versions of "Kiddie-Schedule for Affective Disorders and Schizophrenia-Present and Lifetime (K-SADS-PL)" was used to assess the psychopathology and functionality. The evaluation of participants also included self-reports based on "Eysenck Personality Inventory" and "Ways of Coping Inventory" for reflecting the resilience domain. The sample included 16 girls (88.9%) and 2 boys (11.1%), and the mean (±standard deviation) age was 14.58±1.97 years. Genotyping of the insertion/deletion polymorphism (5-HTTLPR) in the 5-HTT gene's transcriptional control zone was established, and 8 participants (44.4%) were determined to be of the LL genotype, while 7 (38.8%) were LS and 3 (16.6%) were SS carriers. Considering the relationship between coping styles regarding resilience and genetic variants, 87.5% of participants (n=7) exhibiting problem-focused coping style were determined found to carry the LL allele, while 90% (n=9) who exhibited emotion-focused coping styles were the SS-LS allele carriers (p=0.003). Our findings suggest that 5-HTTLPR gene polymorphism has a significant impact on the formation of coping styles. More studies are needed to determine other factors involved in the complex relationship between 5-HTTLPR gene polymorphism and development of psychopathology.

  2. Are the methylenetetrahydrofolate reductase 1298 and 677 gene polymorphisms related to optic glioma and hamartoma risk in neurofibromatosis type 1 patients?

    PubMed

    Tanyıldız, Hikmet Gülşah; Yeşil, Şule; Bozkurt, Ceyhun; Çandır, Mehmet Onur; Akpınar-Tekgündüz, Sibel; Toprak, Şule; Yüksel, Deniz; Şahin, Gürses

    2016-01-01

    The methylenetetrahydrofolate reductase (MTHFR) gene plays a key role in carcinogenesis through its effects on DNA synthesis and methylation and also has a significant role in the etiology of many disorders, such as diabetes, migraine, and cardiovascular disease. Neurofibromatoses (NF) are autosomal dominant inherited diseases that can affect tissues such as bone and skin and predispose individuals to tumor development in various parts of the nervous system or body. Optic nerve glioma and brain tumors are common in children with NF, and leukemia and lymphoma incidence is also higher than normal. We therefore aimed to investigate the possible relationship between the MTHFR gene polymorphism and accompanying tumors such as neurofibroma, hamartoma, and optic glioma in children with NF1 found to have the MTHFR 677 and MTHFR 1298 gene polymorphism in this study. We included 55 pediatric patients diagnosed with NF1 between 2005 and 2014 in the study group. The control group included 44 healthy subjects without acute or chronic disease findings. A significant relationship was found between the MTHFR A1298C polymorphism and the incidence of optic glioma (p=0.014) (AA vs. AC: OR 11, 95% CI 1.27-95.17; AA vs. CC: OR 7.33, 95% CI 0.35-150.70). We also found a significant relationship between the MTHFR C1298C polymorphism and the incidence of hamartoma (p=0.019) (AA vs. AC: OR 2.12, 95% CI 0.662-6.809; p=0.203). Epilepsy incidence was high in subjects with MTHFR C677C. The MTHFR A1298C, C1298C, and C677C gene polymorphisms can be associated with a higher optic glioma, hamartoma, and epilepsy incidence, respectively, in patients diagnosed with neurofibromatosis type 1.

  3. Clinical relevance of IL-6 gene polymorphism in severely injured patients

    PubMed Central

    Jeremić, Vasilije; Alempijević, Tamara; Mijatović, Srđan; Šijački, Ana; Dragašević, Sanja; Pavlović, Sonja; Miličić, Biljana; Krstić, Slobodan

    2014-01-01

    In polytrauma, injuries that may be surgically treated under regular circumstances due to a systemic inflammatory response become life-threatening. The inflammatory response involves a complex pattern of humoral and cellular responses and the expression of related factors is thought to be governed by genetic variations. This aim of this paper is to examine the influence of interleukin (IL) 6 single nucleotide polymorphism (SNP) -174C/G and -596G/A on the treatment outcome in severely injured patients. Forty-seven severely injured patients were included in this study. Patients were assigned an Injury Severity Score. Blood samples were drawn within 24 h after admission (designated day 1) and on subsequent days (24, 48, 72 hours and 7days) of hospitalization. The IL-6 levels were determined through ELISA technique. Polymorphisms were analyzed by a method of Polymerase Chain Reaction-Restriction Fragment Length Polymorphism (PCR). Among subjects with different outcomes, no statistically relevant difference was found with regards to the gene IL-6 SNP-174G/C polymorphism. More than a half of subjects who died had the SNP-174G/C polymorphism, while this polymorphism was represented in a slightly lower number in survivors. The incidence of subjects without polymorphism and those with heterozygous and homozygous gene IL-6 SNP-596G/A polymorphism did not present statistically significant variations between survivors and those who died. The levels of IL-6 over the observation period did not present any statistically relevant difference among subjects without the IL-6 SNP-174 or IL-6 SNP -596 gene polymorphism and those who had either a heterozygous or a homozygous polymorphism. PMID:24856384

  4. Polymorphism in and localization of the gene LCP2 (SLP-76) to chromosome 5q33.1-qter

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Sunden, S.L.F.; Carr, L.L.; Clements, J.L.

    This report describes the localization of the human LCP2 gene to human chromosome 5q33.1-qter using single-stranded conformation polymorphisms analysis. This gene encodes an SH2 domain containing leukocyte protein of 76 kDa (SLP-76), which plays a functional role in T-cell activation. It remains to be determined whether mutations in this gene or translocations at this chromosome location are the genetic basis for various diseases, including lymphoblastic leukemia. 12 refs., 1 fig.

  5. Gene polymorphisms of fibrinolytic enzymes in coal workers' pneumoconiosis

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Chang, L.C.; Tseng, J.C.; Hua, C.C.

    2006-03-15

    The authors assessed the gene polymorphisms of missense C/T polymorphism in exon 6 of the urokinase-plasminogen activator (PLAU) gene (PLAU P141L), A/u-repeat in intron 8 of the tissue-type plasminogen activator (PLAT) gene (PLAT TPA25 Alu insertion), and 4G/5G in the promoter region of the serine proteinase inhibitor, clade E (SERPINE) or plasminogen activator inhibitor type 1 gene (SERPINE1 -675 4G/5G) in 153 healthy volunteers and 154 retired coal miners with coal miners' pneumoconiosis (CWP). The CWP subjects included 94 individuals with simple pneumoconiosis and 60 individuals with progressive massive fibrosis presenting with worse pulmonary function. The distributions of genotypes ofmore » these three genes did not differ between the control and CWP subjects or between subjects with simple pneumoconiosis and those with progressive massive fibrosis. However, by assessing duration of work and its interaction with genotypes by means of logistic regression, the authors found the missense C/T polymorphism in exon 6 of the PLAU gene to be an effect modifier of the association between work duration and the development of progressive massive fibrosis.« less

  6. Androgen receptor repeat length polymorphism associated with male-to-female transsexualism.

    PubMed

    Hare, Lauren; Bernard, Pascal; Sánchez, Francisco J; Baird, Paul N; Vilain, Eric; Kennedy, Trudy; Harley, Vincent R

    2009-01-01

    There is a likely genetic component to transsexualism, and genes involved in sex steroidogenesis are good candidates. We explored the specific hypothesis that male-to-female transsexualism is associated with gene variants responsible for undermasculinization and/or feminization. Specifically, we assessed the role of disease-associated repeat length polymorphisms in the androgen receptor (AR), estrogen receptor beta (ERbeta), and aromatase (CYP19) genes. Subject-control analysis included 112 male-to-female transsexuals and 258 non-transsexual males. Associations and interactions were investigated between CAG repeat length in the AR gene, CA repeat length in the ERbeta gene, and TTTA repeat length in the CYP19 gene and male-to-female transsexualism. A significant association was identified between transsexualism and the AR allele, with transsexuals having longer AR repeat lengths than non-transsexual male control subjects (p=.04). No associations for transsexualism were evident in repeat lengths for CYP19 or ERbeta genes. Individuals were then classified as short or long for each gene polymorphism on the basis of control median polymorphism lengths in order to further elucidate possible combined effects. No interaction associations between the three genes and transsexualism were identified. This study provides evidence that male gender identity might be partly mediated through the androgen receptor.

  7. Androgen Receptor Repeat Length Polymorphism Associated with Male-to-Female Transsexualism

    PubMed Central

    Hare, Lauren; Bernard, Pascal; Sánchez, Francisco J.; Baird, Paul N.; Vilain, Eric; Kennedy, Trudy; Harley, Vincent R.

    2012-01-01

    Background There is a likely genetic component to transsexualism, and genes involved in sex steroidogenesis are good candidates. We explored the specific hypothesis that male-to-female transsexualism is associated with gene variants responsible for undermasculinization and/or feminization. Specifically, we assessed the role of disease-associated repeat length polymorphisms in the androgen receptor (AR), estrogen receptor β (ERβ), and aromatase (CYP19) genes. Methods Subject-control analysis included 112 male-to-female transsexuals and 258 non-transsexual males. Associations and interactions were investigated between CAG repeat length in the AR gene, CA repeat length in the ERβ gene, and TTTA repeat length in the CYP19 gene and male-to-female transsexualism. Results A significant association was identified between transsexualism and the AR allele, with transsexuals having longer AR repeat lengths than non-transsexual male control subjects (p = .04). No associations for transsexualism were evident in repeat lengths for CYP19 or ERβ genes. Individuals were then classified as short or long for each gene polymorphism on the basis of control median polymorphism lengths in order to further elucidate possible combined effects. No interaction associations between the three genes and transsexualism were identified. Conclusions This study provides evidence that male gender identity might be partly mediated through the androgen receptor. PMID:18962445

  8. Relationship between ADD1 Gly460Trp gene polymorphism and essential hypertension in Madeira Island.

    PubMed

    Sousa, Ana Célia; Palma Dos Reis, Roberto; Pereira, Andreia; Borges, Sofia; Freitas, Ana Isabel; Guerra, Graça; Góis, Teresa; Rodrigues, Mariana; Henriques, Eva; Freitas, Sónia; Ornelas, Ilídio; Pereira, Décio; Brehm, António; Mendonça, Maria Isabel

    2017-10-01

    Essential hypertension (EH) is a complex disease in which physiological, environmental, and genetic factors are involved in its genesis. The genetic variant of the alpha-adducin gene (ADD1) has been described as a risk factor for EH, but with controversial results.The objective of this study was to evaluate the association of ADD1 (Gly460Trp) gene polymorphism with the EH risk in a population from Madeira Island.A case-control study with 1614 individuals of Caucasian origin was performed, including 817 individuals with EH and 797 controls. Cases and controls were matched for sex and age, by frequency-matching method. All participants collected blood for biochemical and genotypic analysis for the Gly460Trp polymorphism. We further investigated which variables were independently associated to EH, and, consequently, analyzed their interactions.In our study, we found a significant association between the ADD1 gene polymorphism and EH (odds ratio 2.484, P = .01). This association remained statistically significant after the multivariate analysis (odds ratio 2.548, P = .02).The ADD1 Gly460Trp gene polymorphism is significantly and independently associated with EH risk in our population. The knowledge of genetic polymorphisms associated with EH is of paramount importance because it leads to a better understanding of the etiology and pathophysiology of this pathology.

  9. Relationship between ADD1 Gly460Trp gene polymorphism and essential hypertension in Madeira Island

    PubMed Central

    Sousa, Ana Célia; Palma dos Reis, Roberto; Pereira, Andreia; Borges, Sofia; Freitas, Ana Isabel; Guerra, Graça; Góis, Teresa; Rodrigues, Mariana; Henriques, Eva; Freitas, Sónia; Ornelas, Ilídio; Pereira, Décio; Brehm, António; Mendonça, Maria Isabel

    2017-01-01

    Abstract Essential hypertension (EH) is a complex disease in which physiological, environmental, and genetic factors are involved in its genesis. The genetic variant of the alpha-adducin gene (ADD1) has been described as a risk factor for EH, but with controversial results. The objective of this study was to evaluate the association of ADD1 (Gly460Trp) gene polymorphism with the EH risk in a population from Madeira Island. A case-control study with 1614 individuals of Caucasian origin was performed, including 817 individuals with EH and 797 controls. Cases and controls were matched for sex and age, by frequency-matching method. All participants collected blood for biochemical and genotypic analysis for the Gly460Trp polymorphism. We further investigated which variables were independently associated to EH, and, consequently, analyzed their interactions. In our study, we found a significant association between the ADD1 gene polymorphism and EH (odds ratio 2.484, P = .01). This association remained statistically significant after the multivariate analysis (odds ratio 2.548, P = .02). The ADD1 Gly460Trp gene polymorphism is significantly and independently associated with EH risk in our population. The knowledge of genetic polymorphisms associated with EH is of paramount importance because it leads to a better understanding of the etiology and pathophysiology of this pathology. PMID:29049185

  10. Addictive genes and the relationship to obesity and inflammation.

    PubMed

    Heber, David; Carpenter, Catherine L

    2011-10-01

    There is increasing evidence that the same brain reward circuits involved in perpetuating drug abuse are involved in the hedonic urges and food cravings observed clinically in overweight and obese subjects. A polymorphism of the D2 dopamine receptor which renders it less sensitive to dopamine stimulation has been proposed to promote self-stimulatory behavior such as consuming alcohol, abusing drugs, or binging on foods. It is important to determine how this polymorphism may interact with other well-known candidate genes for obesity including polymorphisms of the leptin receptor gene and the opiomelanocortin gene. Leptin is a proinflammatory cytokine as well as a long-term signal maintaining body fat. Upper-body obesity stimulates systemic inflammation through the action of multiple cytokines including leptin throughout many organs including the brain. The association of numerous diseases including diabetes mellitus, heart disease, as well as depression with chronic low-grade inflammation due to abdominal obesity has raised the possibility that obesity-associated inflammation affecting the brain may promote addictive behaviors leading to a self-perpetuating cycle that may affect not only foods but addictions to drugs, alcohol, and gambling. This new area of interdisciplinary research holds the promise of developing new approaches to treating drug abuse and obesity.

  11. Is There a Genetic Predisposition to Anterior Cruciate Ligament Tear? A Systematic Review.

    PubMed

    John, Rakesh; Dhillon, Mandeep Singh; Sharma, Siddhartha; Prabhakar, Sharad; Bhandari, Mohit

    2016-12-01

    Injuries to the anterior cruciate ligament (ACL) are among the most common knee ligament injuries and frequently warrant reconstruction. The etiopathogenesis of these injuries has focused mainly on mechanism of trauma, patient sex, and anatomic factors as predisposing causes. Several genetic factors that could predispose to an ACL tear have recently been reported. This systematic review summarizes the current evidence for a genetic predisposition to ACL tears. The principal research question was to identify genetic factors, based on the available literature, that could predispose an individual to an ACL tear. Systematic review. The PubMed, EMBASE, Cochrane, and HuGE databases were searched; the search was run from the period of inception until June 21, 2015. A secondary search was performed by screening the references of full-text articles obtained and by manually searching selected journals. Articles were screened with prespecified inclusion criteria. The quality of studies included in the review was assessed for risk of bias by 2 reviewers using the Newcastle-Ottawa Scale. A total of 994 records were identified by the search, out of which 17 studies (16 case-control studies and 1 cross-sectional study) were included in the final review. Two studies observed a familial predisposition to an ACL tear. Fourteen studies looked at specific gene polymorphisms in 20 genes, from which different polymorphisms in 10 genes were positively associated with an ACL tear. In addition to these polymorphisms, 8 haplotypes were associated with ACL tear. One study looked at gene expression analysis. Although specific gene polymorphisms and haplotypes have been identified, it is difficult to come to a conclusion on the basis of the existing literature. Several sources of bias have been identified in these studies, and the results cannot be extrapolated to the general population. More studies are needed in larger populations of different ethnicities. Gene-gene interactions and gene expression studies in the future may delineate the exact role of these gene polymorphisms in ACL tears. © 2016 The Author(s).

  12. The first report of prion-related protein gene (PRNT) polymorphisms in goat.

    PubMed

    Kim, Yong-Chan; Jeong, Byung-Hoon

    2017-06-01

    Prion protein is encoded by the prion protein gene (PRNP). Polymorphisms of several members of the prion gene family have shown association with prion diseases in several species. Recent studies on a novel member of the prion gene family in rams have shown that prion-related protein gene (PRNT) has a linkage with codon 26 of prion-like protein (PRND). In a previous study, codon 26 polymorphism of PRND has shown connection with PRNP haplotype which is strongly associated with scrapie vulnerability. In addition, the genotype of a single nucleotide polymorphism (SNP) at codon 26 of PRND is related to fertilisation capacity. These findings necessitate studies on the SNP of PRNT gene which is connected with PRND. In goat, several polymorphism studies have been performed for PRNP, PRND, and shadow of prion protein gene (SPRN). However, polymorphism on PRNT has not been reported. Hence, the objective of this study was to determine the genotype and allelic distribution of SNPs of PRNT in 238 Korean native goats and compare PRNT DNA sequences between Korean native goats and several ruminant species. A total of five SNPs, including PRNT c.-114G > T, PRNT c.-58A > G in the upstream of PRNT gene, PRNT c.71C > T (p.Ala24Val) and PRNT c.102G > A in the open reading frame (ORF) and c.321C > T in the downstream of PRNT gene, were found in this study. All five SNPs of caprine PRNT gene in Korean native goat are in complete linkage disequilibrium (LD) with a D' value of 1.0. Interestingly, comparative sequence analysis of the PRNT gene revealed five mismatches between DNA sequences of Korean native goats and those of goats deposited in the GenBank. Korean native black goats also showed 5 mismatches in PRNT ORF with cattle. To the best of our knowledge, this is the first genetic research of the PRNT gene in goat.

  13. Methylenetetrahydrofolate Reductase Gene Polymorphisms (C677T and A1298C) and Hemorrhagic Stroke in Moroccan Patients.

    PubMed

    Abidi, Omar; Haissam, Mohammed; Nahili, Halima; El Azhari, Abdessamad; Hilmani, Said; Barakat, Abdelhamid

    2018-07-01

    The number of deaths from hemorrhagic strokes is about twice as high than the number of deaths from ischemic strokes. Genetic risk assessment could play important roles in preventive and therapeutic strategies. The present study was aimed to evaluate whether the MTHFR gene polymorphisms could increase the risk of cerebral hemorrhage in Moroccan patients. A total of 113 patients with hemorrhagic stroke and 323 healthy controls were included in this case-control study. The C677T (rs1801133) and A1298C (rs1801131) MTHFR gene polymorphisms were genotyped by Polymerase Chain Reaction-Restriction Fragment Length Polymorphism (PCR-RFLP) method in all patients and controls. The genotype and allele frequencies were compared between groups using appropriate statistical analyses. Both groups, patients and controls, were in accordance with the Hardy-Weinberg Equilibrium. For the C677T polymorphism, the frequencies of the CC, CT, and TT genotypes were 50.44% versus 46.13%, 39.82% versus 43.03, and 9.73% versus 10.84% in controls versus patients, respectively, whereas for the A1298C polymorphism, the frequencies of the AA, AC, and CC genotypes were 56.64% versus 57.59%, 40.71% versus 37.15, and 2.65% versus 5.26% in controls versus patients, respectively. No statistically significant difference has been proved between patients and controls frequencies (P >.05) for all additive, recessive, and dominant models. Additional analyses including genotypes combination, allelic frequencies, and hemorrhagic stroke patient subtypes did not show any statistically significant difference between controls and patients/subgroup patients. Our findings suggested no association between MTHFR gene polymorphisms and susceptibility to hemorrhagic strokes in Moroccan patients. Further investigations should be conducted to elucidate the roles of other gene variants in the pathogenesis of this condition. Copyright © 2018 National Stroke Association. Published by Elsevier Inc. All rights reserved.

  14. TNF -308 G/A Polymorphism and Risk of Acne Vulgaris: A Meta-Analysis

    PubMed Central

    Yang, Jian-Kang; Wu, Wen-Juan; Qi, Jue; He, Li; Zhang, Ya-Ping

    2014-01-01

    Background The -308 G/A polymorphism in the tumor necrosis factor (TNF) gene has been implicated in the risk of acne vulgaris, but the results are inconclusive. The present meta-analysis aimed to investigate the overall association between the -308 G/A polymorphism and acne vulgaris risk. Methods We searched in Pubmed, Embase, Web of Science and CNKI for studies evaluating the association between the -308 G/A gene polymorphism and acne vulgaris risk. Data were extracted and statistical analysis was performed using STATA 12.0 software. Results A total of five publications involving 1553 subjects (728 acne vulgaris cases and 825 controls) were included in this meta-analysis. Combined analysis revealed a significant association between this polymorphism and acne vulgaris risk under recessive model (OR = 2.73, 95% CI: 1.37–5.44, p = 0.004 for AA vs. AG + GG). Subgroup analysis by ethnicity showed that the acne vulgaris risk associated with the -308 G/A gene polymorphism was significantly elevated among Caucasians under recessive model (OR = 2.34, 95% CI: 1.13–4.86, p = 0.023). Conclusion This meta-analysis suggests that the -308 G/A polymorphism in the TNF gene contributes to acne vulgaris risk, especially in Caucasian populations. Further studies among different ethnicity populations are needed to validate these findings. PMID:24498378

  15. Association of HMOX1 and NQO1 Polymorphisms with Metabolic Syndrome Components

    PubMed Central

    Martínez-Hernández, Angélica; Córdova, Emilio J.; Rosillo-Salazar, Oscar; García-Ortíz, Humberto; Contreras-Cubas, Cecilia; Islas-Andrade, Sergio; Revilla-Monsalve, Cristina; Salas-Labadía, Consuelo; Orozco, Lorena

    2015-01-01

    Metabolic syndrome (MetS) is among the most important public health problems worldwide, and is recognized as a major risk factor for various illnesses, including type 2 diabetes mellitus, obesity, and cardiovascular diseases. Recently, oxidative stress has been suggested as part of MetS aetiology. The heme oxygenase 1 (HMOX1) and NADH:quinone oxidoreductase 1 (NQO1) genes are crucial mediators of cellular defence against oxidative stress. In the present study, we analysed the associations of HMOX1 (GT)n and NQO1 C609T polymorphisms with MetS and its components. Our study population comprised 735 Mexican Mestizos unrelated volunteers recruited from different tertiary health institutions from Mexico City. In order to know the HMOX1 (GT)n and NQO1 C609T allele frequencies in Amerindians, we included a population of 241 Amerindian native speakers. Their clinical and demographic data were recorded. The HMOX1 (GT)n polymorphism was genotyped using PCR and fluorescence technology. NQO1 C609T polymorphism genotyping was performed using TaqMan probes. Short allele (<25 GT repeats) of the HMOX1 polymorphism was associated with high systolic and diastolic blood pressure, and the T allele of the NQO1 C609T polymorphism was associated with increased triglyceride levels and decreased HDL-c levels, but only in individuals with MetS. This is the first study to analyse the association between MetS and genes involved in oxidative stress among Mexican Mestizos. Our data suggest that polymorphisms of HMOX1 and NQO1 genes are associated with a high risk of metabolic disorders, including high systolic and diastolic blood pressure, hypertriglyceridemia, and low HDL-c levels in Mexican Mestizo individuals. PMID:25933176

  16. Association of HMOX1 and NQO1 Polymorphisms with Metabolic Syndrome Components.

    PubMed

    Martínez-Hernández, Angélica; Córdova, Emilio J; Rosillo-Salazar, Oscar; García-Ortíz, Humberto; Contreras-Cubas, Cecilia; Islas-Andrade, Sergio; Revilla-Monsalve, Cristina; Salas-Labadía, Consuelo; Orozco, Lorena

    2015-01-01

    Metabolic syndrome (MetS) is among the most important public health problems worldwide, and is recognized as a major risk factor for various illnesses, including type 2 diabetes mellitus, obesity, and cardiovascular diseases. Recently, oxidative stress has been suggested as part of MetS aetiology. The heme oxygenase 1 (HMOX1) and NADH:quinone oxidoreductase 1 (NQO1) genes are crucial mediators of cellular defence against oxidative stress. In the present study, we analysed the associations of HMOX1 (GT)n and NQO1 C609T polymorphisms with MetS and its components. Our study population comprised 735 Mexican Mestizos unrelated volunteers recruited from different tertiary health institutions from Mexico City. In order to know the HMOX1 (GT)n and NQO1 C609T allele frequencies in Amerindians, we included a population of 241 Amerindian native speakers. Their clinical and demographic data were recorded. The HMOX1 (GT)n polymorphism was genotyped using PCR and fluorescence technology. NQO1 C609T polymorphism genotyping was performed using TaqMan probes. Short allele (<25 GT repeats) of the HMOX1 polymorphism was associated with high systolic and diastolic blood pressure, and the T allele of the NQO1 C609T polymorphism was associated with increased triglyceride levels and decreased HDL-c levels, but only in individuals with MetS. This is the first study to analyse the association between MetS and genes involved in oxidative stress among Mexican Mestizos. Our data suggest that polymorphisms of HMOX1 and NQO1 genes are associated with a high risk of metabolic disorders, including high systolic and diastolic blood pressure, hypertriglyceridemia, and low HDL-c levels in Mexican Mestizo individuals.

  17. Polymorphism and genetic mapping of the human oxytocin receptor gene on chromosome 3

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Michelini, S.; Urbanek, M.; Goldman, D.

    1995-06-19

    Centrally administered oxytocin has been reported to facilitate affiliative and social behaviors, in functional harmony with its well-known peripheral effects on uterine contraction and milk ejection. The biological effects of oxytocin could be perturbed by mutations occurring in the sequence of the oxytocin receptor gene, and it would be of interest to establish the position of this gene on the human linkage map. Therefore we identified a polymorphism at the human oxytocin receptor gene. A portion of the 3{prime} untranslated region containing a 30 bp CA repeat was amplified by polymerase chain reaction (PCR), revealing a polymorphism with two allelesmore » occurring with frequencies of 0.77 and 0.23 in a sample of Caucasian CEPH parents (n = 70). The CA repeat polymorphism we detected was used to map the human oxytocin receptor to chromosome 3p25-3p26, in a region which contains several important genes, including loci for Von Hippel-Lindau disease (VHL) and renal cell carcinoma. 53 refs., 2 figs., 1 tab.« less

  18. One novel SNP of growth hormone gene and its associations with growth and carcass traits in ducks.

    PubMed

    Wu, Y; Pan, A L; Pi, J S; Pu, Y J; Du, J P; Liang, Z H; Shen, J

    2012-08-01

    In this study, the growth hormone (GH) gene was studied as a candidate gene for growth and carcass traits of three duck populations (Cherry Valley duck, Muscovy duck and Jingjiang duck). Three pairs of primers were designed to detect single nucleotide polymorphisms of introns 2, 3 and 4 of the GH gene by polymerase chain reaction-restriction fragment length polymorphism and sequencing methods. Only the products amplified from intron 2 displayed polymorphism. The results showed one novel polymorphism: a variation in intron 2 of GH gene (C172T, JN408701 and JN408702). It was associated with some growth and carcass traits in three duck populations including birth weight, 8-week weight, carcass weight, breast muscle weight, leg muscle weight, eviscerated weight, lean meat rate, dressing percentage, etc. And the TT and CT genotypes were associated with superior growth and carcass traits in carcass weight, dressing percentage and percentage of eviscerated weight. Therefore, the variation in intron 2 of GH may be a molecular marker for superior growth and carcass traits in above duck populations.

  19. The search for mutations in the gene for the beta subunit of the cGMP phosphodiesterase (PDEB) in patients with autosomal recessive retinitis pigmentosa

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Riess, O.; Weber, B.; Hayden, M.R.

    1992-10-01

    The finding of a mutation in the beta subunit of the cyclic GMP (cGMP) phosphodiesterase gene causing retinal degeneration in mice (the Pdeb gene) prompted a search for disease-causing mutations in the human phosphodiesterase gene (PDEB gene) in patients with retinitis pigmentosa. All 22 exons including 196 bp of the 5[prime] region of the PDEB gene have been assessed for mutations by using single-strand conformational polymorphism analysis in 14 patients from 13 unrelated families with autosomal recessive retinitis pigmentosa (ARRP). No disease-causing mutations were found in this group of affected individuals of seven different ancestries. However, a frequent intronic andmore » two exonic polymorphisms (Leu[sup 489][yields]Gln and Gly[sup 842][yields]Gly) were identified. Segregation analysis using these polymorphic sites excludes linkage of ARRP to the PDEB gene in a family with two affected children. 43 refs., 3 figs., 2 tabs.« less

  20. Candidate gene association study conditioning on individual ancestry in patients with type 2 diabetes and metabolic syndrome from Mexico City.

    PubMed

    Cruz, M; Valladares-Salgado, A; Garcia-Mena, J; Ross, K; Edwards, M; Angeles-Martinez, J; Ortega-Camarillo, C; de la Peña, J Escobedo; Burguete-Garcia, A I; Wacher-Rodarte, N; Ambriz, R; Rivera, R; D'artote, A L; Peralta, J; Parra, Esteban J; Kumate, J

    2010-05-01

    Type 2 diabetes (T2D) is influenced by diverse environmental and genetic risk factors. Metabolic syndrome (MS) increases the risk of cardiovascular disease and diabetes. We analysed 14 cases of polymorphisms located in 10 candidate loci, in a sample of patients with T2D and controls from Mexico City. We analysed the association of 14 polymorphisms located within 10 genes (TCF7L2, ENPP1, ADRB3, KCNJ11, LEPR, PPARgamma, FTO, CDKAL1, SIRT1 and HHEX) with T2D and MS. The analysis included 519 subjects with T2D defined according to the ADA criteria, 389 with MS defined according to the AHA/NHLBI criteria and 547 controls. Association was tested with the program ADMIXMAP including individual ancestry, age, sex, education and in some cases body mass index (BMI), in a logistic regression model. The two markers located within the TCF7L2 gene showed strong associations with T2D (rs7903146, T allele, odd ratio (OR) = 1.76, p = 0.001 and rs12255372, T allele, OR = 1.78, p = 0.002), but did not show significant association with MS. The non-synonymous rs4994 polymorphism of the ADRB3 gene was associated with T2D (Trp allele, OR = 0.62, p = 0.001) and MS (Trp allele, OR = 0.74, p = 0.018). Nominally significant associations were also observed between T2D and the SIRT1 rs3758391 SNP and MS and the HHEX rs5015480 polymorphism. Variants located within the gene TCF7L2 are strongly associated with T2D but not with MS, providing support to previous evidence indicating that polymorphisms at the TCF7L2 gene increase T2D risk. In contrast, the non-synonymous ADRB3 rs4994 polymorphism is associated with T2D and MS.

  1. Association of Interleukin-10 gene promoter polymorphisms with obstructive sleep apnea.

    PubMed

    Özdaş, Sibel; Özdaş, Talih; Acar, Mustafa; Erbek, Selim S; Köseoğlu, Sabri; Göktürk, Gökhan; Izbirak, Afife

    2016-05-01

    Interleukin-10 (IL) is an anti-inflammatory cytokine that regulates normal sleep patterns, and recent studies have reported that it is a potential useful biomarker to identify presence and severity of sleep apnea syndrome (OSAS). Promoter polymorphisms of IL-10 gene have been associated with altered expression levels, which contributes to OSAS. The aim of this study was to determine the prevalence of -1082 G/A, -819 C/T, and -592 C/A promoter polymorphisms of IL-10 gene in individuals with OSAS and controls. An open-label study was performed in the Otorhinolaryngology and Sleep Disorders Outpatient Clinics. One hundred four cases with OSAS were included as the study group, and 78 individuals without OSAS were included as the controls. DNAs were extracted from peripheral blood leukocytes, and the sites that encompassed those polymorphisms were identified by DNA sequencing analyses. Data were analyzed with SNPStats and multifactor dimensionality reduction (MDR) software. The prevalence of OSAS was higher in males in the study group when compared to controls (P = 0.0003). The IL-10-1082 G/A, -819 C/T, and -592 C/A SNPs, and their minor alleles were associated with a significantly increased risk for OSAS compared to the controls (P ˂ 0.05 for all). Furthermore, ATA haplotype frequency was significantly higher in the study group compared to the control group, but the GCC haplotype frequency was lower (P = 0.0001 and P = 0.0001). As indicated in MDR analysis, combinations of IL-10 gene were associated with OSAS in single-, double-, and triple-locus analyses. The prevalences of the IL-10 gene promoter polymorphisms were different in OSAS patients and the controls in Turkish population. IL-10 gene polymorphisms may lead to altered inflammatory cascade, which might contribute to OSAS. Further studies on larger cohorts are needed to validate our findings.

  2. Impact of vitamin D receptor gene polymorphisms in pathogenesis of Type-1 diabetes mellitus

    PubMed Central

    Kamel, Mahmoud M; Fouad, Shawky A; Salaheldin, Omina; El-Razek, Abd El-Rahman A Abd; El-Fatah, Abeer I Abd

    2014-01-01

    Background: Type 1 diabetes mellitus (TIDM) results from an immune-mediated destruction of insulin-producing-cells in the pancreatic islets of Langerhans. There are clear differences in immunogenetic predisposition to type1 diabetes among countries. Studies have indicated that vitamin D supplementation in early childhood decreases the risk of TIDM. Vitamin D exerts its action via the nuclear vitamin D receptor (VDR), which shows an extensive polymorphism. VDR gene polymorphisms have been associated with altered gene expression or gene function. Four single nucleotide polymorphisms (SNPs) in the VDR gene produce variation in four recognition sites. These recognition sites variants include Fok I, Bsm I, Apa I and Taq I. Aim of the study: TO investigate the relationship between VDR gene polymorphisms (at positions Taq I and Apa I) and the incidence of TIDM in Egyptian peoples. Subjects and methods: This study included 74 patients with type 1 DM in addition to 28 healthy age and sex matched control subjects. All of them were subjected to full history taking and clinical examination. Three ml of venous blood were withdrawn from each patient at fasting and postprandial times and used for genomic DNA extraction, estimation of Hb A1C, as well as, fasting and postprandial C-peptide and blood glucose levels. Results: Apa I recognition site was found in low frequency in diabetic patients (14/74) 18.9% while, its frequency was high (16/28) 57.1% among normal subjects. Taq I has two recognition sites. The first was found at nucleotide number 293 that was found in a frequency of (2/28) 7.1% in normal non-diabetic individuals while it was detected in (14/74) 18.9% in diabetic patients. The second Taq I recognition site was found at nucleotide number 494 without any differences between diabetic and normal individuals. Conclusion: This study indicates that there is an association between VDR genetic polymorphism and incidence of TIDM in Egyptian patients. PMID:25664062

  3. Tetra primer ARMS-PCR relates folate/homocysteine pathway genes and ACE gene polymorphism with coronary artery disease.

    PubMed

    Masud, Rizwan; Qureshi, Irfan Zia

    2011-09-01

    Cardiovascular disorders and coronary artery disease (CAD) are significant contributors to morbidity and mortality in heart patients. As genes of the folate/homocysteine pathway have been linked with the vascular disease, we investigated association of these gene polymorphisms with CAD/myocardial infarction (MI) using the novel approach of tetraprimer ARMS-PCR. A total of 230 participants (129 MI cases, 101 normal subjects) were recruited. We genotyped rs1801133 and rs1801131 SNPs in 5'10' methylenetetrahydrofolate reductase (MTHFR), rs1805087 SNP in 5' methyltetrahydrofolate homocysteine methyltransferase (MTR), rs662 SNP in paroxanse1 (PON1), and rs5742905 polymorphism in cystathionine beta synthase (CBS). Angiotensin converting enzyme (ACE) insertion/deletion polymorphism was detected through conventional PCR. Covariates included blood pressure, fasting blood sugar, serum cholesterol, and creatinine concentrations. Our results showed allele frequencies at rs1801133, rs1801131, rs1805087 and the ACE insertion/deletion (I/D) polymorphism varied between cases and controls. Logistic regression, after adjusting for covariates, demonstrated significant associations of rs1801133 and rs1805087 with CAD in the additive, dominant, and genotype model. In contrast, ACE I/D polymorphism was significantly related with CAD where recessive model was applied. Gene-gene interaction against the disease status revealed two polymorphism groups: rs1801133, rs662, and rs1805087; and rs1801131, rs662, and ACE I/D. Only the latter interaction maintained significance after adjusted for covariates. Our study concludes that folate pathway variants exert contributory influence on susceptibility to CAD. We further suggest that tetraprimer ARMS-PCR successfully resolves the genotypes in selected samples and might prove to be a superior technique compared to the conventional approach.

  4. Changes in Physiological Parameters after Combined Exercise according to the I/D Polymorphism of hUCP2 Gene in Middle-Aged Obese Females

    PubMed Central

    DUK OH, Sang

    2014-01-01

    Abstract Background The purpose of this study was to determine whether a 45 bp insertion/deletion (I/D) polymorphism in human uncoupling protein 2 (hUCP2) gene was associated with changes in several cardiovascular risk and physical fitness factors in response to combined exercise during 12 weeks in Korean middle-aged women. The changes in physiological parameters after combined exercise during 12 weeks were compared between each genotype subgroups of hUCP2 gene to clarify the inter-individual differences in exercised-induced changes according to genetic predisposition. Methods A total of 185 women aged over 40 years living in Seoul, Korea were participated in this study, and analyzed before and after 12 weeks on combined exercise including aerobic exercise and strength training for body composition, hemodynamic parameters, physical fitness and metabolic variables. A 45 bp I/D polymorphism in hUCP2 gene was genotyped by polymerase chain reaction (PCR) amplification and agarose gel electrophoresis method. Results Combined exercise program during 12 weeks indicated the significant health-promoting effects for our participants on multiple body composition, hemodynamic parameters, physical fitness factors and metabolic parameters, respectively. With respect to a 45 bp I/D polymorphism in hUCP2 gene, this polymorphism was significantly associated with baseline %body fat of our participants (P <.05). Moreover, this polymorphism was significantly associated with the changes in %body fat and serum triglyceride(TG) level after combined exercise program during 12 weeks(P <.05). Conclusion Our data suggest that a 45 bp I/D polymorphism in hUCP2 gene may at least in part contribute to the inter-individual differences on the changes in some clinical and metabolic parameters following combined exercise in middle-aged women. PMID:25909061

  5. MAOA and TNF-β gene polymorphisms are associated with photophobia but not osmophobia in patients with migraine.

    PubMed

    Ishii, Masakazu; Usami, Shino; Hara, Hajime; Imagawa, Atsuko; Masuda, Yutaka; Shimizu, Shuniichi

    2014-06-01

    Photophobia and osmophobia are typical symptoms associated with migraine, but the contributions of gene polymorphisms to these symptoms are not fully elucidated. We investigated whether the gene polymorphisms are involved in photophobia and osmophobia in patients with migraine. Ninety-one migraine patients and 119 non-headache healthy volunteers were enrolled. The 12 gene polymorphisms were determined by polymerase-chain-reaction (PCR) and PCR restriction-fragment-length polymorphism analysis. Photophobia and osmophobia were observed in 49 (54%) and 31 patients (34%), respectively. Distributions of monoamine oxidase A (MAOA) T941G and tumour necrosis factor-β (TNF-β) G252A polymorphisms were significantly different between patients with photophobia and controls. However, no gene polymorphism differences were observed between patients with osmophobia and controls. The MAOA T941G and TNF-β G252A gene polymorphisms appear to contribute to photophobia but not to osmophobia. We propose that different gene polymorphisms are responsible for photophobia and osmophobia symptoms during migraine.

  6. Association between maternal, fetal and paternal MTHFR gene C677T and A1298C polymorphisms and risk of recurrent pregnancy loss: a comprehensive evaluation.

    PubMed

    Yang, Yi; Luo, Yunyao; Yuan, Jing; Tang, Yidan; Xiong, Lang; Xu, MangMang; Rao, XuDong; Liu, Hao

    2016-06-01

    Numerous studies have investigated the associations between methylenetetrahydrofolate reductase (MTHFR) gene C677T and A1298C polymorphisms and risk of recurrent pregnancy loss (RPL); however, the results remain controversial. The aim of this study is to drive a more precise estimation of association between MTHFR gene polymorphisms and risk of RPL. We searched PubMed, EMBASE, Cochrane library, Web of Science and China Knowledge Resource Integrated Database for papers on MTHFR gene C677T and A1298C polymorphisms and RPL risk. The pooled odds ratios (ORs) with 95 % confidence intervals (CIs) were used to assess the strength of association in the homozygous model, heterozygous model, dominant model, recessive model and an additive model. The software STATA (Version 13.0) was used for statistical analysis. Overall, 57 articles were included in the final meta-analysis. In maternal group the MTHFR C677T polymorphism showed pooled odds ratios for the homozygous comparison [OR = 2.285, 95 % CI (1.702, 3.067)] and the MTHFR A1298C polymorphism showed pooled odds ratios for recessive model [OR = 1.594, 95 % CI (1.136, 2.238)]. In fetal group the MTHFR C677T polymorphism showed pooled odds ratios for dominant model [OR = 1.037, 95 % CI (0.567, 1.894)] and the MTHFR A1298C polymorphism showed pooled odds ratios for dominant model [OR = 1.495, 95 % CI (1.102, 2.026)]. In summary, the results of our meta-analysis indicate that maternal and paternal MTHFR gene C677T and A1298C polymorphisms are associated with RPL. We also observed a significant association between fetal MTHFR A1298C polymorphism and RPL but not C677T.

  7. Association of ACE, VEGF and CCL2 gene polymorphisms with Henoch-Schönlein purpura and an evaluation of the possible interaction effects of these loci in HSP patients.

    PubMed

    Mohammadian, Tahereh; Bonyadi, Mortaza; Nabat, Elahe; Rafeey, Mandana

    2017-07-01

    Henoch-Schönlein purpura (HSP) is a multisystem, small vessel, leucocytoclastic vasculitis. It is predominantly a childhood vasculitis, rarely reported in adults. Studies have shown that several different genetic factors such as genes involved in inflammatory system and renin-angiotensin system (RAS) are important in the pathogenesis of Henoch-Schönlein purpura. The purpose of this study was to evaluate the independent effect of 3 gene polymorphisms including CCL2-2518 C/T, VEGF-634G/C and ACE(I/D) with HSP disease and their possible joint interactions in developing the disease. In this case-control study 47 HSP cases and 74 unrelated healthy controls were enrolled for evaluation. All individuals were genotyped for CCL2-2518C/T, VEGF-634G/C and ACE(I/D) gene polymorphisms. The possible association of these polymorphisms with susceptibility to develop HSP disease independently and in different joint combinations was evaluated. The frequencies of TT genotype and T allele of CCL2-2518C/T gene polymorphism and CC genotype and C allele of VEGF-634G/C gene polymorphism were significantly high in HSP children (p-values = 0.005 and = 0.007 respectively). Interestingly, studying the joint interaction of these 2 genotypes (CC genotype of VEGF G-634C and TT genotype of CCL2 C-2518T) in this cohort showed a more significant effect in the development of the disease (p < 0.000, OR = 6.009). The frequency of TT genotype of CCL2 gene when combined with II genotype of ACE gene in HSP children was significantly higher (p < 0.000, OR = 4.213). The results of this pilot study provide evidence of the possible gene-gene interaction effects of CCL2, VEGF and ACE genes in developing HSP disease.

  8. Role of Renin-Angiotensin-converting Enzyme Level and ACE Gene Polymorphism in Patients with Nonalcoholic Fatty Liver Disease.

    PubMed

    Tekatas, Demet D; Bahcecioglu, Ibrahim H; Ispiroglu, Murat; Sahin, Abdurrahman; Ilhan, Necip; Yalniz, Mehmet; Demirel, Ulvi

    2016-01-01

    In this study, we aimed to investigate the histological and clinical effect of angiotensin-converting enzyme (ACE) and ACE gene polymorphism in nonalcoholic fatty liver disease (NAFLD) and their roles in the progression of the disease. Liver function tests, body mass index, waist circumference, lipid parameters, fasting blood glucose (FBG), hemoglobin A1c (HbA1c), homeostasis model assessment-IR (HOMA-IR), ACE, and ACE gene polymorphism were evaluated in the NAFLD group and control group. The study group was evaluated by dividing the group into four subgroups by ACE gene polymorphism (D/D homozygous, I/I homozygous, D/I heterozygous, I/D heterozygous). Liver biopsies were evaluated according to Brunt Classification. A total of 31 patients who were diagnosed with NAFLD and 40 healthy individuals were included in the study. The ACE level was found to be 11.69 ± 1.99 in the NAFLD group and 11.52 ± 1.72 in the control group (p = 0.70). There was a negative correlation between ACE levels and HOMA-IR levels (p = 0.008, r= -0.512). Biochemical parameters were not different among ACE gene polimorphism subgroups, except FBG (between D/D, I/D and D/I, I/D; p = 0.02). When the ACE levels were compared in terms of grade and stage, no significant difference was found (for stage and grade p = 0.68). The ACE gene polymorphism subgroups did not differ by histopathologic findings; grade and stage (for grade p = 0.42, for stage p = 0.92). In this study, we could not find a correlation of ACE and ACE gene polymorphism with metabolic risk factors and the disease severity in NAFLD. Tekatas DD, Bahcecioglu IH, Ispiroglu M, Sahin A, Ilhan N, Yalniz M, Demirel U. Role of Renin-Angiotensin-converting Enzyme Level and ACE Gene Polymorphism in Patients with Nonalcoholic Fatty Liver Disease. Euroasian J Hepato-Gastroenterol 2016;6(2):137-142.

  9. Effects of bovine SMO gene polymorphisms on the body measurement and meat quality traits of Qinchuan cattle.

    PubMed

    Zhang, Y R; Li, Y K; Fu, C Z; Wang, J L; Wang, H B; Zan, L S

    2014-10-07

    Beef cattle breeding programs focus on improving important economic traits, including growth rates, and meat quantity and quality. Molecular marker-assisted selection based on genetic variation represents a potential method for breeding genetically improved livestock with better economic traits. Smoothened (SMO) protein is a signal transducer that contributes to the regulation of both osteogenesis and adipogenesis through the hedgehog pathway. In this study, we detected polymorphisms in the bovine SMO gene of Qinchuan cattle, and we analyzed their associations with body measurement traits (BMTs) and meat quality traits (MQTs). Using DNA sequencing and polymerase chain reaction-restriction fragment length polymorphism, 3 novel single nucleotide polymorphisms were identified in the SMO gene of 562 cattle: 1 G > C mutation on exon 9 (G21234C) and 2 C > T mutations on exon 11 (C22424T and C22481T). Association analysis showed that polymorphisms on both the G21234C and C22424T loci significantly affected certain BMTs and MQTs (P < 0.05 or P < 0.01), whereas those on the C22481T locus did not (P > 0.05). Therefore, the SMO gene could be used as a candidate gene to alter BMTs and MQTs in Qinchuan cattle or for marker-assisted selection to breed cattle with superior BMTs and MQTs.

  10. Polymorphisms and allele frequencies of the ABO blood group gene among the Jomon, Epi-Jomon and Okhotsk people in Hokkaido, northern Japan, revealed by ancient DNA analysis.

    PubMed

    Sato, Takehiro; Kazuta, Hisako; Amano, Tetsuya; Ono, Hiroko; Ishida, Hajime; Kodera, Haruto; Matsumura, Hirofumi; Yoneda, Minoru; Dodo, Yukio; Masuda, Ryuichi

    2010-10-01

    To investigate the genetic characteristics of the ancient populations of Hokkaido, northern Japan, polymorphisms of the ABO blood group gene were analyzed for 17 Jomon/Epi-Jomon specimens and 15 Okhotsk specimens using amplified product-length polymorphism and restriction fragment length polymorphism analyses. Five ABO alleles were identified from the Jomon/ Epi-Jomon and Okhotsk people. Allele frequencies of the Jomon/Epi-Jomon and Okhotsk people were compared with those of the modern Asian, European and Oceanic populations. The genetic relationships inferred from principal component analyses indicated that both Jomon/Epi-Jomon and Okhotsk people are included in the same group as modern Asian populations. However, the genetic characteristics of these ancient populations in Hokkaido were significantly different from each other, which is in agreement with the conclusions from mitochondrial DNA and ABCC11 gene analyses that were previously reported.

  11. [Correlation analysis of G870A CCND1 gene polymorphism with digestive system tumors].

    PubMed

    Yang, Shu-Min; Shi, Ya-Lin

    2016-11-20

    To study the correlation of G870A CCND1 gene polymorphism and digestive system tumors. From August 2010 to August 2014, 164 digestive system cancer patients (including 82 patients with gastric cancer and 82 with colorectal cancer) and 82 healthy subjects (control group) were examined with PCR-restriction fragment length polymorphism (PCR-RFLP). The distribution of CCND1 gene G870A frequency in the 3 groups and its association with tumor staging and grading were analyzed. The frequencies of the GG, GA and AA genotypes in G870A CCND1 gene loci in patients with gastric cancer and colorectal cancer differed significantly from those in the control group (P<0.05). G870A CCND1 gene polymorphism was closely associated with an increased risk of digestive system tumors (P<0.05). The GA and AA genotypes were associated with a significantly higher risk of digestive system cancer risk than the GG genotype (P<0.05), and their frequencies were significantly higher in patients with tumors of higher pathological grade and in those in advanced tumor stages (P<0.05). G870A CCND1 gene polymorphism is associated with the risk of digestive system tumors. The allele A is associated with an increased risk of digestive system tumors and correlated with the tumor differentiation and staging of the tumor.

  12. Combinations of SERPINB5 gene polymorphisms and environmental factors are associated with oral cancer risks.

    PubMed

    Tsai, Hsiu-Ting; Hsieh, Ming-Ju; Lin, Chiao-Wen; Su, Shih-Chi; Miao, Nae-Fang; Yang, Shun-Fa; Huang, Hui-Chuan; Lai, Fu-Chih; Liu, Yu-Fan

    2017-01-01

    We identified rs17071138 T/C, rs3744941 C/T, and rs8089104 T/C gene polymorphisms of SERPINB5 (mammary serine protease inhibitor) that are specific to patients with oral cancer susceptibility and their clinicopathological status. In total, 1342 participants, including 601 healthy controls and 741 patients with oral cancer, were recruited for this study. Allelic discrimination of rs17071138 T/C, rs3744941 C/T, and rs8089104 T/C of the SERPINB5 gene was assessed by a real-time PCR with a TaqMan assay. We found that individuals carrying the polymorphic rs17071138 and rs8089104 are more susceptible to oral cancer (OR, 1.57; 95% CI, 1.07~2.31 and OR, 1.58; 95% CI, 1.04~2.39, respectively). Among oral cancer-related risk factor exposures, the individuals carrying the polymorphic rs17071138 had 4.26- (95% CI: 1.65~11.01; p = 0.002), 2.34- (95% CI: 1.19~4.61; p = 0.01), and 2.34-fold (95% CI: 1.38~3.96; p = 0.001) higher risks of developing oral cancer. Heterozygous TC of the SERPINB5 rs17071138 polymorphism may be a factor that increases susceptibility to oral cancer. Interactions of gene-to-gene and gene-to-oral cancer-related environmental risk factors have a synergetic effect that can further enhance oral cancer development.

  13. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Gilchrist, Michael J.; Sobral, Daniel; Khoueiry, Pierre

    Genome-wide resources, such as collections of cDNA clones encoding for complete proteins (full-ORF clones), are crucial tools for studying the evolution of gene function and genetic interactions. Non-model organisms, in particular marine organisms, provide a rich source of functional diversity. Marine organism genomes are, however, frequently highly polymorphic and encode proteins that diverge significantly from those of well-annotated model genomes. The construction of full-ORF clone collections from non-model organisms is hindered by the difficulty of predicting accurately the N-terminal ends of proteins, and distinguishing recent paralogs from highly polymorphic alleles. We also report a computational strategy that overcomes these difficulties,more » and allows for accurate gene level clustering of transcript data followed by the automated identification of full-ORFs with correct 5'- and 3'-ends. It is robust to polymorphism, includes paralog calling and does not require evolutionary proximity to well annotated model organisms. Here, we developed this pipeline for the ascidian Ciona intestinalis, a highly polymorphic member of the divergent sister group of the vertebrates, emerging as a powerful model organism to study chordate gene function, Gene Regulatory Networks and molecular mechanisms underlying human pathologies. Furthermore, using this pipeline we have generated the first full-ORF collection for a highly polymorphic marine invertebrate. It contains 19,163 full-ORF cDNA clones covering 60% of Ciona coding genes, and full-ORF orthologs for approximately half of curated human disease-associated genes.« less

  14. Single-nucleotide polymorphisms and mRNA expression for melatonin synthesis rate-limiting enzyme in recurrent depressive disorder.

    PubMed

    Gałecki, Piotr; Szemraj, Janusz; Bartosz, Grzegorz; Bieńkiewicz, Małgorzata; Gałecka, Elzbieta; Florkowski, Antoni; Lewiński, Andrzej; Karbownik-Lewińska, Małgorzata

    2010-05-01

    Depressive disorder (DD) is characterised by disturbances in blood melatonin concentration. It is well known that melatonin is involved in the control of circadian rhythms, sleep included. The use of melatonin and its analogues has been found to be effective in depression therapy. Melatonin synthesis is a multistage process, where the last stage is catalysed by acetylserotonin methyltransferase (ASMT), the reported rate-limiting melatonin synthesis enzyme. Taking into account the significance of genetic factors in depression development, the gene for ASMT may become an interesting focus for studies in patients with recurrent DD. The goal of the study was to evaluate two single-nucleotide polymorphisms (SNPs) (rs4446909; rs5989681) of the ASMT gene, as well as mRNA expression for ASMT in recurrent DD-affected patients. We genotyped two polymorphisms in a group of 181 recurrent DD patients and in 149 control subjects. The study was performed using the polymerase chain reaction/restriction fragment length polymorphism method. The distribution of genotypes in both studied SNPs in the ASMT gene differed significantly between DD and healthy subjects. The presence of AA genotype of rs4446909 polymorphism and of GG genotype of rs5989681 polymorphism was associated with lower risk for having recurrent DD. In turn, patients with depression were characterised by reduced mRNA expression for ASMT. In addition, ASMT transcript level in both recurrent DD patients and in healthy subjects depended significantly on genotype distributions in both polymorphisms. In conclusion, our results suggest the ASMT gene as a susceptibility gene for recurrent DD.

  15. Interleukin-10 gene -1082 G/A polymorphism in cervical cancer and cervical intraepithelial neoplasia: meta-analysis.

    PubMed

    Zhang, Shuo; Kong, Ya-Lin; Li, Ya-Li; Yin, Yan-Wei

    2014-12-01

    To assess the association between polymorphism in the interleukin (IL)-10 promoter region of 1082 G/A and the risk of cervical cancer and/or cervical intraepithelial neoplasia (CIN), using meta-analysis. The electronic literature databases PubMed®, Embase®, Web of Science, CBMdisc and CNKI were searched for relevant studies. The strength of association between IL-10 gene -1082 G/A polymorphism and cervical cancer and/or CIN was measured using pooled odds ratios with 95% confidence intervals in four genetic models: allelic model (A allele versus G allele); additive model (A/A versus G/G); recessive model (A/A versus G/A+G/G); dominant model (A/A+G/A versus G/G). Eight studies involving 1983 cases and 1618 controls were identified and included in the meta-analysis. No significant associations were found between IL-10 gene -1082 G/A polymorphism and cervical cancer and/or CIN in any of the genetic models. IL-10 gene -1082 G/A polymorphism does not appear to be associated with the risk of cervical cancer and/or CIN. © The Author(s) 2014 Reprints and permissions: sagepub.co.uk/journalsPermissions.nav.

  16. Association of MTHFR polymorphisms and chromosomal abnormalities in leukemia.

    PubMed

    Sinthuwiwat, Thivaratana; Poowasanpetch, Phanasit; Wongngamrungroj, Angsana; Soonklang, Kamonwan; Promso, Somying; Auewarakul, Chirayu; Tocharoentanaphol, Chintana

    2012-01-01

    Genetic variation in MTHFR gene might explain the interindividual differences in the reduction of DNA repaired and the increase of chromosome breakage and damage. Nowadays, chromosomal rearrangement is recognized as a major cause of lymphoid malignancies. In addition, the association of MTHFR polymorphisms with aneuploidy was found in several studies, making the MTHFR gene as a good candidate for leukemia etiology. Therefore, in this study, we investigated the common sequence variation, 677C>T and 1298A>C in the MTHFR gene of 350 fixed cell specimens archived after chromosome analysis. The distribution of the MTHFR polymorphisms frequency was compared in leukemic patients with structural chromosome abnormality and chromosome aneuploidy, as well as in those with no evidence of chromosome abnormalities. We observed a significant decrease in the distribution of T allele in 677C>T polymorphisms among patients with chromosomal abnormalities including both structural aberration and aneuploidy. The same significance result also found in patients with structural aberration when compare with the normal karyotype patients. Suggesting that polymorphism in the MTHFR gene was involved in chromosome abnormalities of leukemia. However, further investigation on the correlation with the specific types of chromosomal aberrations is needed.

  17. [A meta-analysis on the association between genetic polymorphisms of osteoprotegerin and cardiovascular disease].

    PubMed

    Xin, J Y; Cong, H L

    2018-06-24

    Objective: To explore the association between genetic polymorphisms of rs2073617T/C (950T/C) and rs2073618G/C(1181G/C) in the osteoprotegerin gene and cardiovascular disease with meta-analysis. Methods: A computer-based search for the study of relationship between genetic polymorphisms of rs2073617T/C and rs2073618G/C in the osteoprotegerin gene and cardiovascular disease were performed in electronic databases including China National Knowledge Infrastructure(CNKI), China Biomedical Literature Database, Wanfang Database, Chinese Journal Full-text Database, Embase, PubMed, and Cochrane Library, supplemented by manual search, from the beginning of library to February 28, 2017. The quality of the included studies were assessed by the Newcastle-Ottawa Scale (NOS) scoring system. Data were analyzed using STATA 12.0 software. Results: Eleven clinical case-control studies that enrolled 2 115 patients with cardiovascular disease and 1 467 healthy subjects were included.The results indicated that osteoprotegerin gene polymorphisms of rs2073617T/C and rs2073618G/C might be closely associated with the susceptibility to cardiovascular disease(rs2073617T/C allele model: OR= 0.79, 95% CI 0.73-0.87, P= 0.001;rs2073618G/C M allele and W allele: OR= 0.83, 95% CI 0.74-0.92, P= 0.001). The osteoprotegerin gene polymorphisms of rs2073617T/C and rs2073618G/C were significantly related to the incidence of coronary artery disease and acute coronary syndrome(coronary artery disease allele model: OR= 0.83, 95% CI 0.75-0.92, P= 0.001; acute coronary syndrome allele model: OR= 0.73, 95% CI 0.62-0.85, P< 0.001). However, there was no significant correlation between the genetic polymorphisms of these two sites and the lesion vessel number of coronary artery (rs2073617T/C allele model: OR= 1.00, 95% CI 0.81-1.24, P= 0.985;rs2073618G/C allele model: OR= 0.98, 95% CI 0.80-1.21, P= 0.626). Polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) and polymerase chain reaction-ligase detection reaction(PCR-LDR) evidenced the association between osteoprotegerin gene polymorphisms and cardiovascular disease(allele model: OR= 0.79, 95% CI 0.72-0.86, P< 0.001), but no obvious relationship was found with fluorogenic quantitative detection and molecularprobe(allele model: OR= 0.86, 95% CI 0.65-1.12, P= 0.263). Conclusion: This meta-analysis indicates that the osteoprotegerin gene polymorphisms of rs2073617T/C and rs2073618G/C may be closely related to the increased risk of cardiovascular disease.

  18. Environmental Adaptation Contributes to Gene Polymorphism across the Arabidopsis thaliana Genome

    PubMed Central

    Lee, Cheng-Ruei

    2012-01-01

    The level of within-species polymorphism differs greatly among genes in a genome. Many genomic studies have investigated the relationship between gene polymorphism and factors such as recombination rate or expression pattern. However, the polymorphism of a gene is affected not only by its physical properties or functional constraints but also by natural selection on organisms in their environments. Specifically, if functionally divergent alleles enable adaptation to different environments, locus-specific polymorphism may be maintained by spatially heterogeneous natural selection. To test this hypothesis and estimate the extent to which environmental selection shapes the pattern of genome-wide polymorphism, we define the "environmental relevance" of a gene as the proportion of genetic variation explained by environmental factors, after controlling for population structure. We found substantial effects of environmental relevance on patterns of polymorphism among genes. In addition, the correlation between environmental relevance and gene polymorphism is positive, consistent with the expectation that balancing selection among heterogeneous environments maintains genetic variation at ecologically important genes. Comparison of the gene ontology annotations shows that genes with high environmental relevance are enriched in unknown function categories. These results suggest an important role for environmental factors in shaping genome-wide patterns of polymorphism and indicate another direction of genomic study. PMID:22798389

  19. A pipeline for the systematic identification of non-redundant full-ORF cDNAs for polymorphic and evolutionary divergent genomes: Application to the ascidian Ciona intestinalis

    DOE PAGES

    Gilchrist, Michael J.; Sobral, Daniel; Khoueiry, Pierre; ...

    2015-05-27

    Genome-wide resources, such as collections of cDNA clones encoding for complete proteins (full-ORF clones), are crucial tools for studying the evolution of gene function and genetic interactions. Non-model organisms, in particular marine organisms, provide a rich source of functional diversity. Marine organism genomes are, however, frequently highly polymorphic and encode proteins that diverge significantly from those of well-annotated model genomes. The construction of full-ORF clone collections from non-model organisms is hindered by the difficulty of predicting accurately the N-terminal ends of proteins, and distinguishing recent paralogs from highly polymorphic alleles. We also report a computational strategy that overcomes these difficulties,more » and allows for accurate gene level clustering of transcript data followed by the automated identification of full-ORFs with correct 5'- and 3'-ends. It is robust to polymorphism, includes paralog calling and does not require evolutionary proximity to well annotated model organisms. Here, we developed this pipeline for the ascidian Ciona intestinalis, a highly polymorphic member of the divergent sister group of the vertebrates, emerging as a powerful model organism to study chordate gene function, Gene Regulatory Networks and molecular mechanisms underlying human pathologies. Furthermore, using this pipeline we have generated the first full-ORF collection for a highly polymorphic marine invertebrate. It contains 19,163 full-ORF cDNA clones covering 60% of Ciona coding genes, and full-ORF orthologs for approximately half of curated human disease-associated genes.« less

  20. Serine/threonine kinase 15 gene polymorphism and risk of digestive system cancers: A meta-analysis.

    PubMed

    Luo, Jianfei; Yan, Ruicheng; Zou, Li

    2015-01-01

    Previous studies have reported an association between the two coding polymorphisms (91T>A and 169G>A) of the serine/threonine kinase 15 (STK15) gene and the risk of digestive system cancers; however, the results are inconsistent. In the present study, a meta-analysis was carried out to assess the association between the two STK15 polymorphisms and the risk of digestive system cancers. Relevant studies were identified using PubMed, Web of Science, China National Knowledge Infrastructure, WanFang and VIP databases up to February 18, 2014. The pooled odds ratio (OR) with a 95% confidence interval (CI) was calculated using the fixed or random effects model. A total of 15 case-control studies from 14 publications were included. Of these, 15 studies concerned the 91T>A polymorphism and included 7,619 cases and 7,196 controls and four studies concerned the 161G>A polymorphism and included 826 cases and 713 controls. A significantly increased risk of digestive system cancers was observed for the 91T>A polymorphism (recessive model: OR, 1.19; 95% CI, 1.07-1.31). In subgroup analysis by ethnicity, a significant association was detected in Asian populations (recessive model: OR, 1.21; 95% CI, 1.08-1.36) but not in Caucasian and mixed populations. Stratification by tumor type indicated that the 91T>A polymorphism was associated with an increased risk of esophageal and colorectal cancers under the recessive model (OR, 1.19; 95% CI, 1.03-1.38; and OR, 1.24; 95% CI, 1.04-1.46; respectively); however, no significant association was observed between the 169G>A polymorphism and the risk of digestive system cancers in any of the genetic models. Furthermore, in subgroup analysis by ethnicity, similar results were observed in the Asian and Caucasian populations. The present meta-analysis demonstrated that the STK15 gene 91T>A polymorphism, but not the 169G>A polymorphism, may be a risk factor for digestive system cancers, particularly for esophageal and colorectal cancers.

  1. [Observation on gene polymorphism of Rh blood group in Chinese Han nationality].

    PubMed

    Lan, Jiong-Cai; Wang, Cong-Rong; Wei, Ya-Ming; Zhou, Hua-You; Cao, Qiong; Zhang, Yin-Ze; Jiang, KuReXi; Wu, Da-Lin; Liu, Zhong

    2003-12-01

    To observe the gene polymorphism of Rh blood group in unrelated random individuals and families for Chinese Han nationality, polymerase chain reaction-sequence specific primer (PCR-SSP) was used to amplify the Rh C/E gene, RhD gene, exons, intron 2 and 10, insert and Rh Box in 160 blood samples of RhD positive unrelated individuals and 71 samples of RhD negative unrelated individuals and 7 samples of families whose probands were RhD-negative. The results showed that RhD genes of RhD-negative individuals with C antigens were polymorphism, three forms were found for D exon including intact, partial deletion and complete deletion exons. Insert fragments and Rh Box were found in most cases of families whose probands were RhD-negative and its inheritance accorded with the Mendel's Law, and it did not affect the expression of RhD gene. "Normal" RhD exon 4 amplifying product was not found in all of the samples. It was concluded that gene structure of the RhD-negative in Chinese was polymorphism, intact, partial deletion and complete deletion exons were found in the individuals with C antigen and probably existed specific D (nf) Ce haplotype. The function of insert was uncertain. The Rh gene sequences of Chinese Han nationality are different from those of Caucasian and the Rh gene library based on Han nationality should be established.

  2. Genetic polymorphisms of cytokine genes in type 2 diabetes mellitus

    PubMed Central

    Banerjee, Monisha; Saxena, Madhukar

    2014-01-01

    Diabetes mellitus is a combined metabolic disorder which includes hyperglycemia, dyslipidemia, stroke and several other complications. Various groups all over the world are relentlessly working out the possible role of a vast number of genes associated with type 2 diabetes (T2DM). Inflammation is an important outcome of any kind of imbalance in the body and is therefore an indicator of several diseases, including T2DM. Various ethnic populations around the world show different levels of variations in single nucleotide polymorphisms (SNPs). The present review was undertaken to explore the association of cytokine gene polymorphisms with T2DM in populations of different ethnicities. This will lead to the understanding of the role of cytokine genes in T2DM risk and development. Association studies of genotypes of SNPs present in cytokine genes will help to identify risk haplotype(s) for disease susceptibility by developing prognostic markers and alter treatment strategies for T2DM and related complications. This will enable individuals at risk to take prior precautionary measures and avoid or delay the onset of the disease. Future challenges will be to understand the genotypic interactions between SNPs in one cytokine gene or several genes at different loci and study their association with T2DM. PMID:25126395

  3. Identification and characterization of single nucleotide polymorphisms (SNPs) in Culex theileri (Diptera: Culicidae).

    PubMed

    Demirci, Berna; Lee, Yoosook; Lanzaro, Gregory C; Alten, Bulent

    2012-05-01

    Culex theileri Theobald (Diptera: Culicidae) is one of the most common mosquito species in northeastern Turkey and serves as a vector for various zoonotic diseases including West Nile virus. Although there have been some studies on the ecology of Cx. theileri, very little genetic data has been made available. We successfully sequenced 11 gene fragments from Cx. theileri specimens collected from the northeastern part of Turkey. On average, we found a Single nucleotide polymorphism every 45 bp. Transitions outnumbered transversions, at a ratio of 2:1. This is the first report of genetic polymorphisms in Cx. theileri and Single nucleotide polymorphism discovered from this study can be used to investigate population structure and gene-environmental interactions.

  4. A Polymorphism in the Retinol Binding Protein 4 Gene is Not Associated with Gestational Diabetes Mellitus in Several Different Ethnic Groups

    PubMed Central

    Urschitz, Johann; Sultan, Omar; Ward, Kenneth

    2011-01-01

    Objective Various Asian and Pacifific Islander groups have higher prevalence rates of type 2 diabetes and gestational diabetes. This increased incidence is likely to include genetic factors. Single nucleotide polymorphisms in the retinol binding protein 4 gene have been linked to the occurrence of type 2 diabetes. Hypothesizing a link between retinol binding protein 4 and gestational diabetes, we performed a candidate gene study to look for an association between an important retinol binding protein gene polymorphism (rs3758539) and gestational diabetes. Study Design Blood was collected from Caucasian, Asian, and Pacific Islander women diagnosed with gestational diabetes and from ethnically matched non-diabetic controls. DNA was extracted and real time PCR technology (TaqMan, Applied Biosystems) used to screen for the rs3758539 single nucleotide polymorphism located 5′ of exon 1 of the retinol binding protein 4 gene. Results Genotype and allele frequencies in the controls and gestational diabetes cases were tested using chi-square contingency tests. Genotype frequencies were in Hardy-Weinberg equilibrium. There was no association between the rs3758539 retinol binding protein 4 single nucleotide polymorphism and gestational diabetes in the Caucasian, Filipino, or Pacific Islander groups. Conclusion Interestingly, the rs3758539 retinol binding protein 4 single nucleotide polymorphism was not found to be associated with gestational diabetes. The absence of association suggests that gestational and type 2 diabetes may have more divergent molecular pathophysiology than previously suspected. PMID:21886308

  5. Characterization of the equine 2'-5' oligoadenylate synthetase 1 (OAS1) and ribonuclease L (RNASEL) innate immunity genes

    PubMed Central

    Rios, Jonathan J; Perelygin, Andrey A; Long, Maureen T; Lear, Teri L; Zharkikh, Andrey A; Brinton, Margo A; Adelson, David L

    2007-01-01

    Background The mammalian OAS/RNASEL pathway plays an important role in antiviral host defense. A premature stop-codon within the murine Oas1b gene results in the increased susceptibility of mice to a number of flaviviruses, including West Nile virus (WNV). Mutations in either the OAS1 or RNASEL genes may also modulate the outcome of WNV-induced disease or other viral infections in horses. Polymorphisms in the human OAS gene cluster have been previously utilized for case-control analysis of virus-induced disease in humans. No polymorphisms have yet been identified in either the equine OAS1 or RNASEL genes for use in similar case-control studies. Results Genomic sequence for equine OAS1 was obtained from a contig assembly generated from a shotgun subclone library of CHORI-241 BAC 100I10. Specific amplification of regions of the OAS1 gene from 13 horses of various breeds identified 33 single nucleotide polymorphisms (SNP) and two microsatellites. RNASEL cDNA sequences were determined for 8 mammals and utilized in a phylogenetic analysis. The chromosomal location of the RNASEL gene was assigned by FISH to ECA5p17-p16 using two selected CHORI-241 BAC clones. The horse genomic RNASEL sequence was assembled. Specific amplification of regions of the RNASEL gene from 13 horses identified 31 SNPs. Conclusion In this report, two dinucleotide microsatellites and 64 single nucleotide polymorphisms within the equine OAS1 and RNASEL genes were identified. These polymorphisms are the first to be reported for these genes and will facilitate future case-control studies of horse susceptibility to infectious diseases. PMID:17822564

  6. The association of RANK gene C421T and C575T polymorphisms with bone mineral density in postmenopausal Turkish women.

    PubMed

    Işleten, Banu; Durmaz, Burak; Durmaz, Berrin; Onay, Hüseyin; Ozkınay, Ferda; Durmaz, Asude; Turan, Volkan; Oztekin, Kemal

    2013-10-01

    To investigate the association between C421T polymorphism within exon 4, C575T polymorphism within exon 6 of the RANK gene and bone mineral density (BMD) variations in postmenopausal Turkish women. One hundred seventy-eight postmenopausal women (patients = 100 and controls = 78) who applied to Ege University Faculty of Medicine, Department of Physical Medicine and Rehabilitation, for osteoporosis examination were analyzed. BMDs of the lumbar spine and femoral sites were measured. Patient and control groups were established based on their T-score values being above and/or below -1. After venous blood sampling, C421T and C575T polymorphisms of the RANK gene were assessed through PCR process following DNA extraction. Genotype frequencies for the C421T and C575T polymorphisms were compared between the control group and the patient group. No significant difference was detected between the two groups for both polymorphisms. There was also no significant difference between the control and patient groups in terms of the combined genotype (p = 0.752) and the combined haplotype analysis of the C421T and C575T polymorphisms (p = 0.723). In the control and patient groups separately, no significant differences in BMD values either at the femoral sites or at the lumbar spine were detected between the combined genotypes of the two polymorphisms. The genotypes, combined genotypes and allele frequencies of C421T and C575T polymorphisms of the RANK gene have not been found to be associated with BMD in Turkish women. Further studies including both sexes and more cases are required.

  7. Evaluation of the Role of -137G/C Single Nucleotide Polymorphism (rs187238) and Gene Expression Levels of the IL-18 in Patients with Coronary Artery Disease.

    PubMed

    Hoseini, Fatemeh; Mahmazi, Sanaz; Mahmoodi, Khalil; Jafari, Gholam Ali; Soltanpour, Mohammad Soleiman

    2018-03-01

    Interleukin-18 (IL-18) is a proinflammatory and proatherogenic cytokine, and its genetic variations may contribute to the development of coronary artery disease (CAD). We sought to investigate the role of -137G/C polymorphism and gene expression levels of IL-18 in patients with CAD. The study population included 100 patients with angiographically proven CAD and 100 matched controls. Total RNA and DNA were extracted from leukocytes using appropriate kits. The genotype of -137G/C polymorphism and gene expression level of IL-18 was determined using allele-specific polymerase chain reaction (PCR) and real-time (RT)-PCR assay, respectively. The genotypic and allelic distribution of IL-18 -137G/C polymorphism was not significantly different between the two groups ( p > 0.050). Moreover, the -137G/C polymorphism did not increase the risk of CAD in dominant and recessive genetic models ( p > 0.050). However, subgroup analysis of CAD patients revealed that the IL-18 -137G/C polymorphism was significantly associated with increased risk of CAD in hypertensive patients (odds ratio (OR) = 7.51; 95% confidence interval (CI): 1.24-25.17; p = 0.019) and smokers (OR = 4.90; 95% CI: 1.21-19.70; p = 0.031) but not in the diabetic subpopulation ( p = 0.261). The genotype distribution of IL-18 -137G/C genetic polymorphism was significantly different among patients with one, two, and three stenotic vessels ( p < 0.050). The gene expression level of IL-18 was significantly higher in the CAD group than the control group ( p < 0.001). Moreover, the carriers of CC genotype had significantly lower gene expression levels of IL-18 than carriers of GG genotype ( p < 0.050). The -137G/C polymorphism of IL-18 may be associated with the CAD risk in hypertensive and smoker subgroup of CAD patients. The -137G/C polymorphism seems to play an important role in determining the severity of CAD. Increased IL-18 gene expression level is a significant risk factor for the development of CAD. The CC genotype of -137G/C polymorphism is associated with lower IL-18 gene expression levels.

  8. TGF-β Polymorphisms Are a Risk Factor for Chagas Disease

    PubMed Central

    Ferreira, Roberto Rodrigues; Madeira, Fabiana da Silva; Alves, Gabriel Farias; Chambela, Mayara da Costa; Curvo, Eduardo de Oliveira Vaz; Moreira, Aline dos Santos; Almeida de Sá, Renata; Cabello, Pedro Hernan; Bailly, Sabine; Araujo-Jorge, Tania Cremonini; Saraiva, Roberto Magalhães

    2018-01-01

    Transforming growth factor β1 (TGF-β1) is an important mediator in Chagas disease. Furthermore, patients with higher TGF-β1 serum levels show a worse clinical outcome. Gene polymorphism may account for differences in cytokine production during infectious diseases. We tested whether TGFB1 polymorphisms could be associated with Chagas disease susceptibility and severity in a Brazilian population. We investigated five single-nucleotide polymorphisms (−800 G>A, −509 C>T, +10 T>C, +25 G>C, and +263 C>T). 152 patients with Chagas disease (53 with the indeterminate form and 99 with the cardiac form) and 48 noninfected subjects were included. Genotypes CT and TT at position −509 of the TGFB1 gene were more frequent in Chagas disease patients than in noninfected subjects. Genotypes TC and CC at codon +10 of the TGFB1 gene were also more frequent in Chagas disease patients than in noninfected subjects. We found no significant differences in the distribution of the studied TGFB1 polymorphisms between patients with the indeterminate or cardiac form of Chagas disease. Therefore, −509 C>T and +10 T>C TGFB1 polymorphisms are associated with Chagas disease susceptibility in a Brazilian population. PMID:29670670

  9. TGF-β Polymorphisms Are a Risk Factor for Chagas Disease.

    PubMed

    Ferreira, Roberto Rodrigues; Madeira, Fabiana da Silva; Alves, Gabriel Farias; Chambela, Mayara da Costa; Curvo, Eduardo de Oliveira Vaz; Moreira, Aline Dos Santos; Almeida de Sá, Renata; Mendonça-Lima, Leila; Cabello, Pedro Hernan; Bailly, Sabine; Feige, Jean-Jacques; Araujo-Jorge, Tania Cremonini; Saraiva, Roberto Magalhães; Waghabi, Mariana Caldas

    2018-01-01

    Transforming growth factor β 1 (TGF- β 1) is an important mediator in Chagas disease. Furthermore, patients with higher TGF- β 1 serum levels show a worse clinical outcome. Gene polymorphism may account for differences in cytokine production during infectious diseases. We tested whether TGFB1 polymorphisms could be associated with Chagas disease susceptibility and severity in a Brazilian population. We investigated five single-nucleotide polymorphisms (-800 G>A, -509 C>T, +10 T>C, +25 G>C, and +263 C>T). 152 patients with Chagas disease (53 with the indeterminate form and 99 with the cardiac form) and 48 noninfected subjects were included. Genotypes CT and TT at position -509 of the TGFB1 gene were more frequent in Chagas disease patients than in noninfected subjects. Genotypes TC and CC at codon +10 of the TGFB1 gene were also more frequent in Chagas disease patients than in noninfected subjects. We found no significant differences in the distribution of the studied TGFB1 polymorphisms between patients with the indeterminate or cardiac form of Chagas disease. Therefore, -509 C>T and +10 T>C TGFB1 polymorphisms are associated with Chagas disease susceptibility in a Brazilian population.

  10. Predictors of response to intra-articular steroid injection in psoriatic arthritis.

    PubMed

    Eder, Lihi; Chandran, Vinod; Ueng, Joanna; Bhella, Sita; Lee, Ker-Ai; Rahman, Proton; Pope, Angela; Cook, Richard J; Gladman, Dafna D

    2010-07-01

    To assess the effectiveness of IA corticosteroid (IAS) injections in PsA and to determine the association between macrophage migration inhibition factor (MIF) gene polymorphism and response to IAS injections. A cohort analysis of PsA patients who were followed prospectively was performed. Clinical response was defined as no tenderness or effusion in the injected joint at 3 months. Relapse was defined as re-occurrence of joint pain or effusion. MIF 173C > G genotyping (rs755622) was performed. Two hundred and twenty patients with 245 IAS injections were included in the study. The probability of responding at 3 months was 41.6%. Within 12 months, 25.5% of the joints relapsed. Clinical factors that were associated with response included duration of psoriasis [Odds ratio (OR) 1.03] and the use of MTX or anti-TNF agents at the time of injection (OR 2.68). Factors that were associated with relapse included injection into large joints (OR 4.58) and elevated sedimentation rate (OR 15.0), whereas absence of clinical and/or radiographic damage (OR 0.23) and duration of PsA (OR 0.92) reduced risk of relapse. MIF polymorphism was not associated with clinical response, but was associated with relapse (OR 3.2). On multivariate analysis including clinical covariates, the association between MIF polymorphism and relapse was lost. IAS injections are effective in PsA. MIF gene polymorphism is associated with relapse. However, this effect is explained by clinical variables that reflect disease activity, suggesting that MIF gene polymorphism influences inflammatory activity.

  11. Genetic variants of estrogen beta and leptin receptors may cause gynecomastia in adolescent.

    PubMed

    Eren, Erdal; Edgunlu, Tuba; Korkmaz, Huseyin Anil; Cakir, Esra Deniz Papatya; Demir, Korcan; Cetin, Esin Sakalli; Celik, Sevim Karakas

    2014-05-15

    Gynecomastia is a benign breast enlargement in males that affects approximately one-third of adolescents. The exact mechanism is not fully understood; however, it has been proposed that estrogen receptors and aromatase enzyme activity may play important roles in the pathogenesis of gynecomastia. While many studies have reported that aromatase enzyme (CYP19) gene polymorphism is associated with gynecomastia, only one study has shown a relationship between estrogen receptor (ER) alpha and beta gene polymorphism and gynecomastia. Thus, the aim of this study was to evaluate the relationships between CYP19 (rs2414096), ER alpha (rs2234693), ER beta (rs4986938), leptin (rs7799039), and leptin receptor (rs1137101) gene polymorphisms and gynecomastia. This study included 107 male adolescents with gynecomastia and 97 controls. Total serum testosterone (T) and estradiol (E2) levels were measured, and DNA was extracted from whole blood using the PCR-RFLP technique. The polymorphic distributions of CYP19, ER alpha, ER beta, leptin and leptin receptor genes were compared. The median E2 level was 12.41 (5.00-65.40) pg/ml in the control group and 16.86 (2.58-78.47) pg/ml in the study group (p<0.001). The median T level was 2.19 (0.04-7.04) ng/ml in the control group and 1.46 (0.13-12.02) ng/ml in the study group (p=0.714). There was a significant relationship between gynecomastia and leptin receptor rs1137101 (p=0.002) and ER beta receptor rs4986938 gene polymorphisms (p=0.002). According to our results, increased E2 level and ER beta gene rs4986938 polymorphism might explain why some adolescents have gynecomastia. Leptin receptor gene rs1137101 polymorphism might affect susceptibility to gynecomastia. Copyright © 2014 Elsevier B.V. All rights reserved.

  12. Association Between Polymorphisms of VDR, COL1A1, and LCT genes and bone mineral density in Belarusian women with severe postmenopausal osteoporosis.

    PubMed

    Marozik, Pavel; Mosse, Irma; Alekna, Vidmantas; Rudenko, Ema; Tamulaitienė, Marija; Ramanau, Heorhi; Strazdienė, Vaidilė; Samokhovec, Volha; Ameliyanovich, Maxim; Byshnev, Nikita; Gonchar, Alexander; Kundas, Liubov; Zhur, Krystsina

    2013-01-01

    BACKGROUND AND OBJECTIVE. Variation of osteoporosis in the population is the result of an interaction between the genotype and the environment, and the genetic causes of osteoporosis are being widely investigated. The aim of this study was to analyze the association between the polymorphisms of the vitamin D receptor (VDR), type I collagen (COL1A1), and lactase (LCT) genes and severe postmenopausal osteoporosis as well as bone mineral density (BMD). MATERIAL AND METHODS. A total of 54 women with severe postmenopausal osteoporosis and 77 controls (mean age, 58.3 years [SD, 6.2] and 56.7 years [SD, 7.42], respectively) were included into the study. The subjects were recruited at the City Center for Osteoporosis Prevention (Minsk, Belarus). Dual-energy x-ray absorptiometry was used to measure bone mineral density at the lumbar spine and the femoral neck. Severe osteoporosis was diagnosed in the women with the clinical diagnosis of postmenopausal osteoporosis and at least 1 fragility fracture. The control group included women without osteoporosis. Polymorphic sites in osteoporosis predisposition genes (ApaI, BsmI, TaqI, and Cdx2 of the VDR gene, G2046T of the COL1A1 gene, and T-13910C of the LCT gene) were determined using the polymerase chain reaction on the deoxyribonucleic acid isolated from dried bloodspots. RESULTS. The data showed that the ApaI and BsmI polymorphisms of the VDR gene and T- 13910C of the LCT gene were associated with severe postmenopausal osteoporosis in the analyzed Belarusian women (P<0.01). A statistically significant positive correlation between the VDR risk genotypes ApaI and TaqI and bone mineral density was found (P<0.05). CONCLUSIONS. The findings of this study suggest that at least the ApaI and BsmI polymorphisms of the VDR gene and T-13910C of the LCT gene are associated with the risk of postmenopausal osteoporosis in our sample of the Belarusian women.

  13. The evaluation of angiotensin-converting enzyme (ACE) gene I/D and IL-4 gene intron 3 VNTR polymorphisms in coronary artery disease.

    PubMed

    Basol, Nursah; Celik, Atac; Karakus, Nevin; Ozturk, Sibel Demir; Ozsoy, Sibel Demir; Yigit, Serbulent

    2014-01-01

    Genetic polymorphism is a strong risk factor for coronary artery disease (CAD). In the present study, our aim was to evaluate angiotensin-converting enzyme (ACE) gene I/D polymorphism and interleukin-4 (IL-4) gene Intron 3 variable number of tandem repeat (VNTR) polymorphism in CAD. One hundred and twenty-four CAD patients and one hundred and twenty-three controls were enrolled. Genomic DNA was isolated and genotyped using polymerase chain reaction (PCR) analyses. The risk associated with inheriting the combined genotypes for the two polymorphisms were evaluated and it was found that the individuals who were P2P2-homozygous at IL-4 gene intron 3 VNTR and DD-homozygous at ACE gene I/D have a higher risk of developing CAD. Although, there is no correlation between IL4 VNTR polymorphism and ACE gene polymorphism and CAD, there is a strong association between CAD and co-existence of IL-4 VNTR and ACE gene polymorphisms in the Turkish population. Copyright © 2014 International Institute of Anticancer Research (Dr. John G. Delinassios), All rights reserved.

  14. Effects of BDNF polymorphisms on antidepressant action.

    PubMed

    Tsai, Shih-Jen; Hong, Chen-Jee; Liou, Ying-Jay

    2010-12-01

    Evidence suggests that the down-regulation of the signaling pathway involving brain-derived neurotrophic factor (BDNF), a molecular element known to regulate neuronal plasticity and survival, plays an important role in the pathogenesis of major depression. The restoration of BDNF activity induced by antidepressant treatment has been implicated in the antidepressant therapeutic mechanism. Because there is variability among patients with major depressive disorder in terms of response to antidepressant treatment and since genetic factors may contribute to this inter-individual variability in antidepressant response, pharmacogenetic studies have tested the associations between genetic polymorphisms in candidate genes related to antidepressant therapeutic action. In human BDNF gene, there is a common functional polymorphism (Val66Met) in the pro-region of BDNF, which affects the intracellular trafficking of proBDNF. Because of the potentially important role of BDNF in the antidepressant mechanism, many pharmacogenetic studies have tested the association between this polymorphism and the antidepressant therapeutic response, but they have produced inconsistent results. A recent meta-analysis of eight studies, which included data from 1,115 subjects, suggested that the Val/Met carriers have increased antidepressant response in comparison to Val/Val homozygotes, particularly in the Asian population. The positive molecular heterosis effect (subjects heterozygous for a specific genetic polymorphism show a significantly greater effect) is compatible with animal studies showing that, although BDNF exerts an antidepressant effect, too much BDNF may have a detrimental effect on mood. Several recommendations are proposed for future antidepressant pharmacogenetic studies of BDNF, including the consideration of multiple polymorphisms and a haplotype approach, gene-gene interaction, a single antidepressant regimen, controlling for age and gender interactions, and pharmacogenetic effects on specific depressive symptom-clusters.

  15. Analysis of polymorphisms in the promoter region and protein levels of interleukin-6 gene among gout patients.

    PubMed

    Tsai, P-C; Chen, C-J; Lai, H-M; Chang, S-J

    2008-01-01

    To explore the associations between the polymorphisms and protein levels of interleukin-6 (IL-6) gene and gout disease. A total of 120 male gout patients and 184 healthy controls were enrolled. Each patient was matched with 1-2 gout-free controls by age within three years. Four polymorphisms in the promoter of IL-6 gene, including -597G/A, -572C/G, -373A(m)T(n), and -174G/C, and the IL-6 levels were analyzed. The clinical characteristics and biochemical markers in plasma were measured, including age of gout onset, duration of gout history, tophus number, gout attack frequency, uric acid, total cholesterol, triglycerides and creatinine. The mean IL-6 level for gout patients was 9.80 (+/-11.76 pg/ml) which showed no significant difference from the controls (7.06+/-7.58 pg/ml, p=0.230). When the IL-6 levels were dichotomized according to the median value (5 pg/ml), there were significantly higher proportions of the gout patients (59.66%) than controls (44%) with high IL-6 levels (OR=1.88, 95% CI=1.17-3.02, p=0.008). Unique genotype was found at polymorphisms -174G/C and -597G/A. Neither the polymorphisms -572C/G nor -373A(m)T(n) in the genotype or allele distributions showed a significant association related to clinical characteristics, biochemical markers, IL-6 levels or gout disease (all p>0.05). Those with gout disease have greater proportions of high IL-6 levels in plasma than controls, and there is no significant association between the four polymorphisms in the promoter region of IL-6 gene and gout disease.

  16. Transforming growth factor-β and toll-like receptor-4 polymorphisms are not associated with fibrosis in haemochromatosis

    PubMed Central

    Wood, Marnie J; Powell, Lawrie W; Dixon, Jeannette L; Subramaniam, V Nathan; Ramm, Grant A

    2013-01-01

    AIM: To investigate the role of genetic polymorphisms in the progression of hepatic fibrosis in hereditary haemochromatosis. METHODS: A cohort of 245 well-characterised C282Y homozygous patients with haemochromatosis was studied, with all subjects having liver biopsy data and DNA available for testing. This study assessed the association of eight single nucleotide polymorphisms (SNPs) in a total of six genes including toll-like receptor 4 (TLR4), transforming growth factor-beta (TGF-β), oxoguanine DNA glycosylase, monocyte chemoattractant protein 1, chemokine C-C motif receptor 2 and interleukin-10 with liver disease severity. Genotyping was performed using high resolution melt analysis and sequencing. The results were analysed in relation to the stage of hepatic fibrosis in multivariate analysis incorporating other cofactors including alcohol consumption and hepatic iron concentration. RESULTS: There were significant associations between the cofactors of male gender (P = 0.0001), increasing age (P = 0.006), alcohol consumption (P = 0.0001), steatosis (P = 0.03), hepatic iron concentration (P < 0.0001) and the presence of hepatic fibrosis. Of the candidate gene polymorphisms studied, none showed a significant association with hepatic fibrosis in univariate or multivariate analysis incorporating cofactors. We also specifically studied patients with hepatic iron loading above threshold levels for cirrhosis and compared the genetic polymorphisms between those with no fibrosis vs cirrhosis however there was no significant effect from any of the candidate genes studied. Importantly, in this large, well characterised cohort of patients there was no association between SNPs for TGF-β or TLR4 and the presence of fibrosis, cirrhosis or increasing fibrosis stage in multivariate analysis. CONCLUSION: In our large, well characterised group of haemochromatosis subjects we did not demonstrate any relationship between candidate gene polymorphisms and hepatic fibrosis or cirrhosis. PMID:24409064

  17. Transforming growth factor-β and toll-like receptor-4 polymorphisms are not associated with fibrosis in haemochromatosis.

    PubMed

    Wood, Marnie J; Powell, Lawrie W; Dixon, Jeannette L; Subramaniam, V Nathan; Ramm, Grant A

    2013-12-28

    To investigate the role of genetic polymorphisms in the progression of hepatic fibrosis in hereditary haemochromatosis. A cohort of 245 well-characterised C282Y homozygous patients with haemochromatosis was studied, with all subjects having liver biopsy data and DNA available for testing. This study assessed the association of eight single nucleotide polymorphisms (SNPs) in a total of six genes including toll-like receptor 4 (TLR4), transforming growth factor-beta (TGF-β), oxoguanine DNA glycosylase, monocyte chemoattractant protein 1, chemokine C-C motif receptor 2 and interleukin-10 with liver disease severity. Genotyping was performed using high resolution melt analysis and sequencing. The results were analysed in relation to the stage of hepatic fibrosis in multivariate analysis incorporating other cofactors including alcohol consumption and hepatic iron concentration. There were significant associations between the cofactors of male gender (P = 0.0001), increasing age (P = 0.006), alcohol consumption (P = 0.0001), steatosis (P = 0.03), hepatic iron concentration (P < 0.0001) and the presence of hepatic fibrosis. Of the candidate gene polymorphisms studied, none showed a significant association with hepatic fibrosis in univariate or multivariate analysis incorporating cofactors. We also specifically studied patients with hepatic iron loading above threshold levels for cirrhosis and compared the genetic polymorphisms between those with no fibrosis vs cirrhosis however there was no significant effect from any of the candidate genes studied. Importantly, in this large, well characterised cohort of patients there was no association between SNPs for TGF-β or TLR4 and the presence of fibrosis, cirrhosis or increasing fibrosis stage in multivariate analysis. In our large, well characterised group of haemochromatosis subjects we did not demonstrate any relationship between candidate gene polymorphisms and hepatic fibrosis or cirrhosis.

  18. BDNF Val66Met polymorphism, life stress and depression: A meta-analysis of gene-environment interaction.

    PubMed

    Zhao, Mingzhe; Chen, Lu; Yang, Jiarun; Han, Dong; Fang, Deyu; Qiu, Xiaohui; Yang, Xiuxian; Qiao, Zhengxue; Ma, Jingsong; Wang, Lin; Jiang, Shixiang; Song, Xuejia; Zhou, Jiawei; Zhang, Jian; Chen, Mingqi; Qi, Dong; Yang, Yanjie; Pan, Hui

    2018-02-01

    Depression is thought to be multifactorial in etiology, including genetic and environmental components. While a number of gene-environment interaction studies have been carried out, meta-analyses are scarce. The present meta-analysis aimed to quantify evidence on the interaction between brain-derived neurotrophic factor (BDNF) Val66Met polymorphism and stress in depression. Included were 31 peer-reviewed with a pooled total of 21060 participants published before October 2016 and literature searches were conducted using PubMed, Wolters Kluwer, Web of Science, EBSCO, Elsevier Science Direct and Baidu Scholar databases. The results indicated that the Met allele of BDNF Val66Met polymorphism significantly moderated the relationship between stress and depression (Z=2.666, p = 0.003). The results of subgroup analysis concluded that stressful life events and childhood adversity separately interacted with the Met allele of BDNF Val66Met polymorphism in depression (Z = 2.552, p = 0.005; Z = 1.775, p = 0.03). The results could be affected by errors or bias in primary studies which had small sample sizes with relatively lower statistic power. We could not estimate how strong the interaction effect between gene and environment was. We found evidence that supported the hypothesis that BDNF Val66Met polymorphism moderated the relationship between stress and depression, despite the fact that many included individual studies did not show this effect. Copyright © 2017 Elsevier B.V. All rights reserved.

  19. Folate and Breast Cancer: Role of Intake, Blood Levels, and Metabolic Gene Polymorphisms

    DTIC Science & Technology

    2006-06-01

    polymorphisms . The specific aims are 1) methodological training in the analysis of gene - gene and gene -environment interactions by studying folate...evaluation of folate intake, plasma folate, and metabolic gene polymorphisms in relation to breast cancer risk: Months 1-19. b. Prepare blood samples...isolated for the folate and gene polymorphism assays among the 184 cases and matched controls. The folate assays are on-going at this time and over

  20. [CCR5, CCR2, apoe, p53, ITGB3 and HFE gene polymorphism in Western Siberia long-livers].

    PubMed

    Ivanoshchuk, D E; Mikhaĭlova, S V; Kulikov, I V; Maksimov, V N; Voevoda, M I; Romashchenko, A G

    2012-01-01

    In order to estimate the distribution of some polymorphisms for the CCR5, CCR2, apoE, p53, ITGB3, and HFE genes in Russian long-livers from Western Siberia, a sample of 271 individuals (range 90-105 years) was examined. It was demonstrated that carriage of the delta32 polymorphism for the CCR5 gene, V64/polymorphism for the CCR2 gene, e2/e3/e4 for the apoE gene, L33P for the ITGB3 gene, as well as H63D and S65C polymorphisms for the HFE gene does not influence on predisposition to the longevity; carriage of the 282 Y allele for the HFE gene negatively influences on the longevity; carriage of the heterozygous genotype for the R72P polymorphism for the p53 gene correlates with the longevity of elderly people.

  1. Gene Environment Interactions and Predictors of Colorectal Cancer in Family-Based, Multi-Ethnic Groups.

    PubMed

    Shiao, S Pamela K; Grayson, James; Yu, Chong Ho; Wasek, Brandi; Bottiglieri, Teodoro

    2018-02-16

    For the personalization of polygenic/omics-based health care, the purpose of this study was to examine the gene-environment interactions and predictors of colorectal cancer (CRC) by including five key genes in the one-carbon metabolism pathways. In this proof-of-concept study, we included a total of 54 families and 108 participants, 54 CRC cases and 54 matched family friends representing four major racial ethnic groups in southern California (White, Asian, Hispanics, and Black). We used three phases of data analytics, including exploratory, family-based analyses adjusting for the dependence within the family for sharing genetic heritage, the ensemble method, and generalized regression models for predictive modeling with a machine learning validation procedure to validate the results for enhanced prediction and reproducibility. The results revealed that despite the family members sharing genetic heritage, the CRC group had greater combined gene polymorphism rates than the family controls ( p < 0.05), on MTHFR C677T , MTR A2756G , MTRR A66G, and DHFR 19 bp except MTHFR A1298C. Four racial groups presented different polymorphism rates for four genes (all p < 0.05) except MTHFR A1298C. Following the ensemble method, the most influential factors were identified, and the best predictive models were generated by using the generalized regression models, with Akaike's information criterion and leave-one-out cross validation methods. Body mass index (BMI) and gender were consistent predictors of CRC for both models when individual genes versus total polymorphism counts were used, and alcohol use was interactive with BMI status. Body mass index status was also interactive with both gender and MTHFR C677T gene polymorphism, and the exposure to environmental pollutants was an additional predictor. These results point to the important roles of environmental and modifiable factors in relation to gene-environment interactions in the prevention of CRC.

  2. New findings in pharmacogenetics of schizophrenia.

    PubMed

    Zai, Clement C; Tiwari, Arun K; Zai, Gwyneth C; Maes, Miriam S; Kennedy, James L

    2018-05-01

    This review highlights recent advances in the investigation of genetic factors for antipsychotic response and side effects. Antipsychotics prescribed to treat psychotic symptoms are variable in efficacy and propensity for causing side effects. The major side effects include tardive dyskinesia, antipsychotic-induced weight gain (AIWG), and clozapine-induced agranulocytosis (CIA). Several promising associations of polymorphisms in genes including HSPG2, CNR1, and DPP6 with tardive dyskinesia have been reported. In particular, a functional genetic polymorphism in SLC18A2, which is a target of recently approved tardive dyskinesia medication valbenazine, was associated with tardive dyskinesia. Similarly, several consistent findings primarily from genes modulating energy homeostasis have also been reported (e.g. MC4R, HTR2C). CIA has been consistently associated with polymorphisms in the HLA genes (HLA-DQB1 and HLA-B). The association findings between glutamate system genes and antipsychotic response require additional replications. The findings to date are promising and provide us a better understanding of the development of side effects and response to antipsychotics. However, more comprehensive investigations in large, well characterized samples will bring us closer to clinically actionable findings.

  3. Association of Leukotrichia in Vitiligo and Asp148Glu Polymorphism of Apurinic/Apyrimidinic Endonuclease 1.

    PubMed

    Aydin, A Fatih; Aydıngöz, İkbal Esen; Doğru-Abbasoğlu, Semra; Vural, Pervin; Uysal, Müjdat

    2017-01-01

    Oxidative stress and increased DNA damage have been implicated in the etiopathogenesis of vitiligo. Oxidative DNA damage is mainly repaired by the base excision repair (BER) pathway. We sought to determine whether polymorphisms in DNA repair genes may have a role in the pathogenesis of vitiligo. We conducted a study including 100 patients with vitiligo and age- and sex-matched 193 control subjects to examine the role of single-nucleotide polymorphisms of BER genes, human 8-oxoG DNA N-glycosylase 1 (codon 326), apurinic/apyrimidinic endonuclease 1 (APE1) (codon 148), and X-ray repair cross-complementing group 1 (codon 399) as risk factors for vitiligo. These polymorphisms were determined by quantitative real-time polymerase chain reaction and melting curve analysis. No significant association was observed between the variant alleles of studied genes and vitiligo. However, we showed that the presence of APE1 148Glu variant allele is associated with leukotrichia. This preliminary study suggests that APE1 (codon 148) polymorphism may play a role in vitiligo pathogenesis.

  4. Impact of the Ile105Val Polymorphism of the Glutathione S-transferase P1 (GSTP1) Gene on Obesity and Markers of Cardiometabolic Risk in Young Adult Population.

    PubMed

    Chielle, E O; Trott, A; da Silva Rosa, B; Casarin, J N; Fortuna, P C; da Cruz, I B M; Moretto, M B; Moresco, R N

    2017-05-01

    The aim of the study was to investigate the association between Glutathione S-transferase P1 (GSTP1) gene polymorphism with obesity and markers of cardiometabolic risk. A cross-sectional study was carried out in individuals aged≥18 and ≤30 years. The study included 54 normal weight, 27 overweight and 68 obese volunteers. Anthropometric measurements and biochemical parameters were evaluated, the DNA was extracted from blood samples and polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) was used to measure GSTP1 Ile 105 Val gene polymorphism of the study participants. Also, biochemical analysis and hormone assays were carried out. A positive association between GSTP1 polymorphism and obesity was observed on subjects carrying at least one G allele (AG and GG). GG genotype was found only in the obese group. The G allele carriers presented 2.4 times higher chance of obesity when compared to those with the AA genotype. These results were independent of sex and age. We suggest that despite a study in population regional (south of Brazil), the GSTP1 gene polymorphism may play a significant role in the increase of susceptibility of obesity and contribute to identify the cardiovascular risk in young adults. © Georg Thieme Verlag KG Stuttgart · New York.

  5. Polymorphisms of APLN-APLNR system are associated with essential hypertension in Mexican-Mestizo individuals.

    PubMed

    Esteban-Martínez, Rosa Lilia; Pérez-Razo, Juan Carlos; Vargas-Alarcón, Gilberto; Martínez-Rodríguez, Nancy; Cano-Martínez, Luis Javier; López-Hernández, Luz Berenice; Rojano-Mejía, David; Canto, Patricia; Coral-Vazquez, Ramón Mauricio

    2016-08-01

    The aim of this study was to evaluate if polymorphisms of APLN and APLNR genes may play a role as susceptibility markers for hypertension in a group of Mexican-Mestizo patients. A case-control study was carried out including normotensive and hypertensive individuals. For these, two polymorphisms of APLN (rs3761581 and rs56204867) and two of APLNR () genes were genotyped by 5' exonuclease TaqMan assay in 400 normotensive individuals and 383 patients. The results showed that, under an additive model adjusted by BMI, HDL, triglycerides, glucose and family history of essential hypertension, the rs7119375 and rs10501367 polymorphisms of APLNR gene were associated significantly with a decreased risk of essential hypertension (P=0.039 and P=0.029, respectively). Besides, the haplotypes analysis of these polymorphisms showed that H1 haplotype was associated with an increased risk of essential hypertension (P=0.026), while the H2 haplotype was associated with a decreased risk (P=0.032). Contrary, the rs3761581 and rs56204867 polymorphisms of APLN gene were not associated with essential hypertension (P=0.1707 and P=0.0769, respectively). The data suggest that APLNR rs7119375 and rs10501367 are associated with a decreased risk of essential hypertension in our Mexican-Mestizo studied group, but further studies are warranted. Copyright © 2016 Elsevier Inc. All rights reserved.

  6. MYO9B gene polymorphisms are associated with the risk of inflammatory bowel diseases

    PubMed Central

    Yu, Qiang; Zhu, Chun-Fu; Kong, Zhi-Jun; Zhao, Hui; Tang, Li-Ming; Qin, Xi-Hu

    2016-01-01

    Myosin IXB (MYO9B) gene polymorphisms have been extensively investigated in terms of their associations with inflammatory bowel disease (IBD), with contradictory results. The aim of this meta-analysis was to evaluate associations between MY09B gene polymorphisms and the risk of IBD, Crohn's disease (CD) and ulcerative colitis (UC). Eligible studies from PubMed, Embase, and CNKI databases were identified. Pooled odds ratios (ORs) and 95% confidence intervals (95% CIs) were calculated. Ten studies published in eight papers reporting 8,975 cases and 9,482 controls were included in this meta-analysis. Five MY09B gene polymorphisms were evaluated: rs1545620, rs962917, rs1457092, rs2305764, and rs2305767. Our data suggested that the rs1545620 polymorphism was associated with a decreased risk of IBD. A similar result was found for rs2305767 and UC. The rs962917 single nucleotide polymorphism (SNP) increased the risk of IBD, CD and UC. Moreover, rs1457092 increased the risk of IBD and UC. Rs2305764 was also associated with an increased risk of IBD. Furthermore, stratification analyses indicated that rs1545620 decreased the risk of IBD, while rs962917 increased the risk of IBD, CD and UC in Caucasian populations. To sum up, our data indicate that these five SNPs in MY09B are significantly associated with the risk of IBD. PMID:27556856

  7. A genetic polymorphism in the sex-linked ATP5A1 gene is associated with individual fitness in Ovenbirds (Seiurus aurocapilla)

    Treesearch

    Judith D. Toms; Lori S. Eggert; Wayne J. Arendt; John Faaborg

    2012-01-01

    While testing genetic sexing techniques in Ovenbirds (Seiurus aurocapilla),we found a genetic polymorphism in the ATP5A1 gene in 38% of individuals. The Z ' allele included changes in both intronic and exonic portions of the sequenced region, but there was no evidence that this changed the resulting ATP synthase product. Males that had one or more copies of...

  8. Concept mapping One-Carbon Metabolism to model future ontologies for nutrient-gene-phenotype interactions.

    PubMed

    Joslin, A C; Green, R; German, J B; Lange, M C

    2014-09-01

    Advances in the development of bioinformatic tools continue to improve investigators' ability to interrogate, organize, and derive knowledge from large amounts of heterogeneous information. These tools often require advanced technical skills not possessed by life scientists. User-friendly, low-barrier-to-entry methods of visualizing nutrigenomics information are yet to be developed. We utilized concept mapping software from the Institute for Human and Machine Cognition to create a conceptual model of diet and health-related data that provides a foundation for future nutrigenomics ontologies describing published nutrient-gene/polymorphism-phenotype data. In this model, maps containing phenotype, nutrient, gene product, and genetic polymorphism interactions are visualized as triples of two concepts linked together by a linking phrase. These triples, or "knowledge propositions," contextualize aggregated data and information into easy-to-read knowledge maps. Maps of these triples enable visualization of genes spanning the One-Carbon Metabolism (OCM) pathway, their sequence variants, and multiple literature-mined associations including concepts relevant to nutrition, phenotypes, and health. The concept map development process documents the incongruity of information derived from pathway databases versus literature resources. This conceptual model highlights the importance of incorporating information about genes in upstream pathways that provide substrates, as well as downstream pathways that utilize products of the pathway under investigation, in this case OCM. Other genes and their polymorphisms, such as TCN2 and FUT2, although not directly involved in OCM, potentially alter OCM pathway functionality. These upstream gene products regulate substrates such as B12. Constellations of polymorphisms affecting the functionality of genes along OCM, together with substrate and cofactor availability, may impact resultant phenotypes. These conceptual maps provide a foundational framework for development of nutrient-gene/polymorphism-phenotype ontologies and systems visualization.

  9. Interleukin-10-1082 promoter polymorphism and ischemic stroke risk in a South Indian population.

    PubMed

    Munshi, Anjana; Rajeshwar, K; Kaul, Subhash; Al-Hazzani, Amal; Alshatwi, Ali A; Sai Babu, M; Usha, A; Jyothy, A

    2010-12-01

    Within the past few years there has been increasing evidence that the genetic variation in the genes coding pro- and anti-inflammatory markers may play an important role in the pathogenesis of various human diseases, including stroke. The aim of the study was to evaluate the association of Interleukin-10 (IL-10)-1082 G/A, promoter polymorphism (rs1800896) with ischemic stroke in a South Indian population from Andhra Pradesh. In this study 480 ischemic stroke patients and 470 age and sex matched healthy controls were included. The ischemic stroke patients were classified according to TOAST classification. The region of interest in the IL-10 gene was amplified by polymerase chain reaction with the use of allele specific oligonucleotide primers flanking the polymorphic region. Association between genotypes and stroke was examined by Odds Ratio (OR) with 95% confidence interval (CI) and Chi-square analysis. Significant difference was observed between the patients and healthy controls, in genotypic distribution as well as allelic frequency (p<0.05). Multiple logistic regression analysis with forward stepwise selection using the potential confounders (sex, age, diabetes, hypertension, smoking and alcoholism) and IL-10 gene variant revealed that -1082 G/A polymorphism in the promoter region of IL-10 gene is significantly [adjusted OR=2.26; 95% C.I. (1.24-4.15), p<0.001] associated with ischemic stroke in the South Indian population from Andhra Pradesh. We found significant association of this polymorphism with stroke of undetermined etiology (p<0.001). Moreover, hypertensive and diabetic individuals bearing A allele of IL-10 gene in high frequency were found to be more predisposed to stroke. Copyright © 2010 Elsevier Ltd. All rights reserved.

  10. A meta-analysis of association between glutathione S-transferase M1 gene polymorphism and Parkinson's disease susceptibility.

    PubMed

    Weikang, Chen; Jie, Li; Likang, Lan; Weiwen, Qiu; Liping, Lu

    2016-01-01

    The aim of this meta-analysis was to evaluate whether there was an association between glutathione S-transferase M1(GSTM1)gene polymorphism and Parkinson's disease (PD) susceptibility by pooling published data. We performed comprehensive electronic database search for articles published between February12,2015 and April30 2016. The published case-control or cohort studies related to GSTM1 gene polymorphism and Parkinson's disease susceptibility were screened, reviewed, and included in this meta-analysis. The correlation between GSTM1 gene polymorphism and PD susceptibility was expressed by odds ratio (OR) and its corresponding 95% confidence interval (95%CI). Publication bias was evaluated by Begg's funnel plot and Egger's line regression test. All analysis was done by stata11.0 software. After searching the PubMed, EMBASE, and CNKI databases, seventeen case-control studies with 3,538 PD and 5,180 controls were included in the final meta-analysis. The data was pooled by a fixed-effect model for lack of statistical heterogeneity across the studies; the results showed GSTM1 null expression can significant increase the susceptibility of PD (OR=1.11, 95% CI:1.01-1.21, P<0.05). Subgroup analysis indicated GSTM1 gene polymorphism was associated with PD susceptibility in the Caucasian ethnic group (OR=1.15, 95% CI:1.05-1.27, P<0.05) but not in the Asian ethnic group (OR=0.89, 95% CI:0.70-1.12, P>0.05). Begg's funnel plot and Egger's line regression test showed no significant publication bias. Based on the present evidence, GSTM1 null expression can significant increase the susceptibility of PD in persons of Caucasian ethnicity.

  11. Gene-gene, gene-environment, gene-nutrient interactions and single nucleotide polymorphisms of inflammatory cytokines.

    PubMed

    Nadeem, Amina; Mumtaz, Sadaf; Naveed, Abdul Khaliq; Aslam, Muhammad; Siddiqui, Arif; Lodhi, Ghulam Mustafa; Ahmad, Tausif

    2015-05-15

    Inflammation plays a significant role in the etiology of type 2 diabetes mellitus (T2DM). The rise in the pro-inflammatory cytokines is the essential step in glucotoxicity and lipotoxicity induced mitochondrial injury, oxidative stress and beta cell apoptosis in T2DM. Among the recognized markers are interleukin (IL)-6, IL-1, IL-10, IL-18, tissue necrosis factor-alpha (TNF-α), C-reactive protein, resistin, adiponectin, tissue plasminogen activator, fibrinogen and heptoglobins. Diabetes mellitus has firm genetic and very strong environmental influence; exhibiting a polygenic mode of inheritance. Many single nucleotide polymorphisms (SNPs) in various genes including those of pro and anti-inflammatory cytokines have been reported as a risk for T2DM. Not all the SNPs have been confirmed by unifying results in different studies and wide variations have been reported in various ethnic groups. The inter-ethnic variations can be explained by the fact that gene expression may be regulated by gene-gene, gene-environment and gene-nutrient interactions. This review highlights the impact of these interactions on determining the role of single nucleotide polymorphism of IL-6, TNF-α, resistin and adiponectin in pathogenesis of T2DM.

  12. Gene polymorphisms associated with functional dyspepsia.

    PubMed

    Kourikou, Anastasia; Karamanolis, George P; Dimitriadis, George D; Triantafyllou, Konstantinos

    2015-07-07

    Functional dyspepsia (FD) is a constellation of functional upper abdominal complaints with poorly elucidated pathophysiology. However, there is increasing evidence that susceptibility to FD is influenced by hereditary factors. Genetic association studies in FD have examined genotypes related to gastrointestinal motility or sensation, as well as those related to inflammation or immune response. G-protein b3 subunit gene polymorphisms were first reported as being associated with FD. Thereafter, several gene polymorphisms including serotonin transporter promoter, interlukin-17F, migration inhibitory factor, cholecystocynine-1 intron 1, cyclooxygenase-1, catechol-o-methyltransferase, transient receptor potential vanilloid 1 receptor, regulated upon activation normal T cell expressed and secreted, p22PHOX, Toll like receptor 2, SCN10A, CD14 and adrenoreceptors have been investigated in relation to FD; however, the results are contradictory. Several limitations underscore the value of current studies. Among others, inconsistencies in the definitions of FD and controls, subject composition differences regarding FD subtypes, inadequate samples, geographical and ethnical differences, as well as unadjusted environmental factors. Further well-designed studies are necessary to determine how targeted genes polymorphisms, influence the clinical manifestations and potentially the therapeutic response in FD.

  13. Polymorphisms in dopaminergic system genes; association with criminal behavior and self-reported aggression in violent prison inmates from Pakistan.

    PubMed

    Qadeer, Muhammad Imran; Amar, Ali; Mann, J John; Hasnain, Shahida

    2017-01-01

    Genetic factors contribute to antisocial and criminal behavior. Dopamine transporter DAT-1 (SLC6A3) and DRD2 gene for the dopamine-2 receptor are dopaminergic system genes that regulate dopamine reuptake and signaling, and may be part of the pathogenesis of psychiatric disorders including antisocial behaviors and traits. No previous studies have analyzed DAT-1 and DRD2 polymorphisms in convicted murderers, particularly from Indian subcontinent. In this study we investigated the association of 40 bp VNTR polymorphism of DAT-1 and Taq1 variant of DRD2 gene (rs1800479) with criminal behavior and self-reported aggression in 729 subjects, including 370 men in Pakistani prisons convicted of first degree murder(s) and 359 control men without any history of violence or criminal tendency. The 9R allele of DAT-1 VNTR polymorphism was more prevalent in convicted murderers compared with control samples, for either one or two risk alleles (OR = 1.49 and 3.99 respectively, P = 0.003). This potential association of DAT-1 9R allele polymorphism with murderer phenotype was confirmed assuming different genetic models of inheritance. However, no genetic association was found for DRD2 Taq1 polymorphism. In addition, a combined haplotype (9R-A2) of DAT-1 and DRD2 genes was associated with this murderer phenotype. Further, 9R allele of DAT-1 was also associated with response to verbal abuse and parental marital complications, but not with other measures pertinent to self-reported aggression. These results suggest that 9R allele, which may influence levels of intra-synaptic dopamine in the brain, may contribute to criminal tendency in this sample of violent murderers of Pakistani origin. Future studies are needed to replicate this finding in other populations of murderers and see if this finding extends to other forms of violence and lesser degrees of aggression.

  14. Polymorphisms in dopaminergic system genes; association with criminal behavior and self-reported aggression in violent prison inmates from Pakistan

    PubMed Central

    Qadeer, Muhammad Imran; Amar, Ali; Mann, J. John; Hasnain, Shahida

    2017-01-01

    Genetic factors contribute to antisocial and criminal behavior. Dopamine transporter DAT-1 (SLC6A3) and DRD2 gene for the dopamine-2 receptor are dopaminergic system genes that regulate dopamine reuptake and signaling, and may be part of the pathogenesis of psychiatric disorders including antisocial behaviors and traits. No previous studies have analyzed DAT-1 and DRD2 polymorphisms in convicted murderers, particularly from Indian subcontinent. In this study we investigated the association of 40 bp VNTR polymorphism of DAT-1 and Taq1 variant of DRD2 gene (rs1800479) with criminal behavior and self-reported aggression in 729 subjects, including 370 men in Pakistani prisons convicted of first degree murder(s) and 359 control men without any history of violence or criminal tendency. The 9R allele of DAT-1 VNTR polymorphism was more prevalent in convicted murderers compared with control samples, for either one or two risk alleles (OR = 1.49 and 3.99 respectively, P = 0.003). This potential association of DAT-1 9R allele polymorphism with murderer phenotype was confirmed assuming different genetic models of inheritance. However, no genetic association was found for DRD2 Taq1 polymorphism. In addition, a combined haplotype (9R-A2) of DAT-1 and DRD2 genes was associated with this murderer phenotype. Further, 9R allele of DAT-1 was also associated with response to verbal abuse and parental marital complications, but not with other measures pertinent to self-reported aggression. These results suggest that 9R allele, which may influence levels of intra-synaptic dopamine in the brain, may contribute to criminal tendency in this sample of violent murderers of Pakistani origin. Future studies are needed to replicate this finding in other populations of murderers and see if this finding extends to other forms of violence and lesser degrees of aggression. PMID:28582390

  15. Polymorphic human somatostatin gene is located on chromosome 3.

    PubMed Central

    Naylor, S L; Sakaguchi, A Y; Shen, L P; Bell, G I; Rutter, W J; Shows, T B

    1983-01-01

    Somatostatin is a 14-amino-acid neuropeptide and hormone that inhibits the secretion of several peptide hormones. The human gene for somatostatin SST has been cloned, and the sequence has been determined. This clone was used as a probe in chromosome mapping studies to detect the human somatostatin sequence in human-rodent hybrids. Southern blot analysis of 41 hybrids, including some containing translocations of human chromosomes, placed SST in the q21 leads to qter region of chromosome 3. Human DNAs from unrelated individuals were screened for restriction fragment polymorphisms detectable by the somatostatin gene probe. Two polymorphisms were found: (i) an EcoRI variant located at the 3' end of the gene, found in Caucasian, U.S. Black, and Asian populations with a frequency of approximately 0.10 and (ii) a BamHI variant in the intron, which occurs in Caucasians at a frequency of 0.13. Images PMID:6133281

  16. Investigation on the association between NLRP3 gene polymorphisms and susceptibility to primary gout.

    PubMed

    Wang, L F; Ding, Y J; Zhao, Q; Zhang, X L

    2015-12-09

    We conducted a case-control study to investigate the association between 3 common NALP3 polymorphisms (rs10754558, rs7512998, and rs12137901) and the susceptibility to primary gout. A total of 320 patients with primary gout and 320 controls were included in this study. The genotyping of NALP3 rs10754558, rs7512998, and rs12137901 were conducted by polymerase chain reaction-restriction fragment length polymorphism. Comparison analysis showed that primary gout patients were more likely to have higher body mass index, prevalence of hypertension, blood glucose, triglycerides, urea nitrogen, and uric acid (P < 0.05). Logistic regression analysis revealed no significant association between the NALP3 rs10754558, rs7512998, and rs12137901 polymorphisms and the risk of gouty arthritis. In conclusion, we found no significant association between NALP3 gene polymorphisms and the risk of primary gout.

  17. Lack of associations between AURKA gene polymorphisms and neuroblastoma susceptibility in Chinese children.

    PubMed

    Tang, Jue; Qian, Yuanmin; Zhu, Jinhong; Zhang, Jiao; Wang, Feng-Hua; Zeng, Jia-Hang; Liang, Jiang-Hua; Wang, Hui; Xia, Huimin; He, Jing; Liu, Wei

    2018-05-29

    Previous studies have demonstrated that polymorphisms in the AURKA gene are associated with various types of cancer. In neuroblastoma, AURKA protein product regulates N-myc protein levels and plays a critical role in tumorigenesis. To investigate the association between three AURKA polymorphisms (rs1047972 C>T, rs2273535 T>A, and rs8173 G>C) and neuroblastoma susceptibility in Chinese populations, we performed this two-center case-control study including 393 neuroblastoma cases and 812 controls. Two study populations were recruited from two different regions in China. No significant associations were identified amongst any of the three AURKA polymorphisms and the risk of neuroblastoma. Similar observations were found in the stratified analysis. In conclusion, our results indicate that none of the AURKA polymorphisms are associated with neuroblastoma susceptibility in two distinct Chinese populations. Further studies with larger sample sizes and different ethnicities are warranted to validate our results. © 2018 The Author(s).

  18. The SPO11-C631T gene polymorphism and male infertility risk: a meta-analysis.

    PubMed

    Ren, Zheng-Ju; Ren, Peng-Wei; Yang, Bo; Liao, Jian; Liu, Sheng-Zhuo; Fang, Kun; Ren, Shang-Qing; Liu, Liang-Ren; Dong, Qiang

    2017-11-01

    To evaluate the association between the SPO11 gene C631T polymorphism and the risk of male infertility. We conducted a search on PubMed, Embase, Web of Science, Chinese National Knowledge Infrastructure (CNKI), China biology medical literature database (CBM), VIP, and Chinese literature database (Wan Fang) on 31 March 2016. Odds ratio (OR) and 95% confidence interval (95%CI) were used to assess the strength of associations. A total of five studies including 542 cases and 510 controls were involved in this meta-analysis. The pooled results indicated that the SPO11 gene C631T polymorphism was significantly associated with increased risk of male infertility (TT + CT vs. CC: OR = 4.14, 95%CI = 2.48-6.89; CT vs. CC: OR = 4.34, 95%CI = 2.56-7.34; T vs. C: OR = 4.35, 95%CI = 2.58-7.34). Subgroup analysis of different countries proved the relationship between SPO11 gene C631T polymorphism and male infertility risk in Chinese, but not in Iranian peoples. In conclusion, this study suggested that SPO11 gene C631T polymorphism may contribute as a genetic factor susceptible to cause male infertility. Furthermore, more large sample and representative population-based cases and well-matched controls are needed to validate our results.

  19. The relationship between ACE/AGT gene polymorphisms and the risk of diabetic retinopathy in Chinese patients with type 2 diabetes.

    PubMed

    Qiao, Yong-Chao; Wang, Min; Pan, Yan-Hong; Zhang, Xiao-Xi; Tian, Fang; Chen, Yin-Ling; Zhao, Hai-Lu

    2018-01-01

    This study aims to investigate the association between renin-angiotensin system gene polymorphism and diabetic retinopathy (DR) in Chinese patients with type 2 diabetes. We consecutively included 1491 patients for the assessment of ACE I/D and AGT M/T gene polymorphisms in 345 DR cases and 1146 patients without retinopathy (DNR). Albuminuria was defined by urine albumin creatinine ratio and albumin excretion rate. Compared with the NDR patients, the DR cases displayed a higher proportion of diabetic nephropathy (32.68% vs. 6.52%, χ 2 = 150.713, p < 0.001). The DR cases and DNR individuals did not differ in the frequency of genotypes and alleles of ACE I/D and AGT M/T (all p > 0.05). Intriguingly, DR patients with obesity showed higher frequency of DD (χ 2 = 4.181, p = 0.041), but no significant difference exists in the other stratified BMI and hypertension analyses (all p > 0.05). Binary logistic regression displays that the association of the ACE and AGT gene polymorphisms in DR patients is not significant after adjusting for confounding covariates in all the comparisons. The ACE and AGT gene polymorphisms are not associated with the progress of diabetes developing into retinopathy in Chinese patients with type 2 diabetes. However, more investigations are needed to further prove the association.

  20. Relation of fat-mass and obesity-associated gene polymorphism to fat mass content and body mass index in obese children.

    PubMed

    Pyrzak, Beata; Wisniewska, Alicja; Majcher, Anna; Tysarowski, Andrzej; Demkow, Urszula

    2013-01-01

    Fat mass content, fat distribution, and fat-mass and obesity associated (FTO) gene have been reported among a broad spectrum of genetic variation connected with body weight. The aim of our study was to investigate whether the T/A rs9939609 polymorphism of the FTO gene may influence obesity and metabolic indices in children. A 160 children were examined (136 obese and 24 non-obese). The anthropometric measurements and calculations included: height, weight, waist and hip circumference, sum of the thickness of 3 and 10 skin folds, % of fat content, % FAT- BIA , % LBM-BIA. BMI, SDS of BMI, WHR, and WHtR. Fasting plasma total cholesterol (TC), HDL and LDL-cholesterol, triglycerides (TG), oral glucose tolerance test (OGTT), and HOMA-IR were analyzed and the blood pressure were measured. The rs9939609 polymorphism of FTO gene was genotyped by allele-specific real-time polymerase chain- reaction (RT-PCR). We found that the mean concentrations of TC, TG, LDLC, and HOMA-IR were significantly higher, and HDL was lower in the obese than in non-obese children. The presence of TT, but not AA alleles, related to the percentage of fat content, BMI, and z-score of BMI. None of the other anthropometric indices did differ between the children with gene polymorphism and wild homozygous. In conclusion, rs9939609 polymorphism in the fat-mass and obesity-associated gene is associated with BMI and the percent of fat content in children.

  1. Polymorphisms of Leptin-b Gene Associated with Growth Traits in Orange-Spotted Grouper (Epinephelus coioides)

    PubMed Central

    Huang, Hai; Wei, Yun; Meng, Zining; Zhang, Yong; Liu, Xiaochun; Guo, Liang; Luo, Jian; Chen, Guohua; Lin, Haoran

    2014-01-01

    In mammals, leptin has been demonstrated to perform important roles in many physiological activities and to influence development, growth, metabolism and reproduction. However, in fish, its function is still unclear. Duplicate leptin genes, leptin-a and leptin-b, have been identified in the orange-spotted grouper. In the present study, the polymorphisms in the leptin-b gene of the orange-spotted grouper were detected, and the relation between these polymorphisms and 12 growth traits were analyzed. Six polymorphisms (including 3 single nucleotide polymorphisms (c.14G>A, c.93A>G, c.149G>A) in exon 1, 2 SNPs (c.181A>G, c.193G>A) in intron 1, and 1 SNP (c.360C>T) in exon 2) were identified and genotyped from 200 different individuals. The results revealed that the SNP c.149G>A was significantly associated with growth traits, that the heterozygous mutation genotype GA having negative effects on growth traits. However, the other five SNPs (c.14G>A, c.93A>G, c.181A>G, c.193G>A, c.360C>T) did not show significant associations with all the growth traits. Compared with our findings in leptin-a gene, the results suggested that the leptin-a hormone has more important physiological effects in fish bodies than the leptin-b type. Moreover, leptin genes were supposed to be one class of major candidate genes of regulating growth traits in the orange-spotted grouper. PMID:25003640

  2. Genetic differences in human circadian clock genes among worldwide populations.

    PubMed

    Ciarleglio, Christopher M; Ryckman, Kelli K; Servick, Stein V; Hida, Akiko; Robbins, Sam; Wells, Nancy; Hicks, Jennifer; Larson, Sydney A; Wiedermann, Joshua P; Carver, Krista; Hamilton, Nalo; Kidd, Kenneth K; Kidd, Judith R; Smith, Jeffrey R; Friedlaender, Jonathan; McMahon, Douglas G; Williams, Scott M; Summar, Marshall L; Johnson, Carl Hirschie

    2008-08-01

    The daily biological clock regulates the timing of sleep and physiological processes that are of fundamental importance to human health, performance, and well-being. Environmental parameters of relevance to biological clocks include (1) daily fluctuations in light intensity and temperature, and (2) seasonal changes in photoperiod (day length) and temperature; these parameters vary dramatically as a function of latitude and locale. In wide-ranging species other than humans, natural selection has genetically optimized adaptiveness along latitudinal clines. Is there evidence for selection of clock gene alleles along latitudinal/photoperiod clines in humans? A number of polymorphisms in the human clock genes Per2, Per3, Clock, and AANAT have been reported as alleles that could be subject to selection. In addition, this investigation discovered several novel polymorphisms in the human Arntl and Arntl2 genes that may have functional impact upon the expression of these clock transcriptional factors. The frequency distribution of these clock gene polymorphisms is reported for diverse populations of African Americans, European Americans, Ghanaians, Han Chinese, and Papua New Guineans (including 5 subpopulations within Papua New Guinea). There are significant differences in the frequency distribution of clock gene alleles among these populations. Population genetic analyses indicate that these differences are likely to arise from genetic drift rather than from natural selection.

  3. Associations between CD24 gene polymorphisms and inflammatory bowel disease: A meta-analysis.

    PubMed

    Huang, Xiao-Li; Xu, Dong-Hua; Wang, Guo-Pin; Zhang, Shu; Yu, Cheng-Gong

    2015-05-21

    To evaluate the relationships between CD24 gene polymorphisms and the risk of inflammatory bowel disease (IBD), including ulcerative colitis (UC) and Crohn's disease (CD). The PubMed, Web of Science and Cochrane Library databases were searched (up to May 30, 2014). The search terms "CD24", "inflammatory bowel disease", "Crohn's disease", "Ulcerative colitis", "IBD", "CD" or "UC"; and "polymorphism", "mutation" or "variant" were used. Association studies were limited to the English language, but no limitations in terms of race, ethnicity or geographic area were employed. Stata SE12 software was used to calculate the pooled odds ratios (ORs) with 95% confidence intervals (CIs). P < 0.05 was considered statistically significant. The information was independently extracted from each eligible study by two investigators. Two common polymorphisms, C170T (rs8734) and TG1527del (rs3838646), in the CD24 gene were assessed. A total of three case-control studies including 2342 IBD patients and 1965 healthy controls were involved in this meta-analysis. The patients and controls were from Caucasian cohorts. The three articles included in this meta-analysis all conformed to Hardy-Weinberg equilibrium. This meta-analysis revealed that there were no significant associations between the two CD24 polymorphisms and the risk for IBD (all P > 0.05). However, in a disease subgroup analysis, we found that the CD24 C170T polymorphism was associated with an increased risk of UC in a dominant model (OR = 1.79, 95%CI: 1.15-2.77, P = 0.009) and an additive model (OR = 1.87, 95%CI: 1.19-2.93, P = 0.007), but this relationship was not present for CD. The CD24 TG1570del polymorphism was significantly associated with CD in the additive model (OR = 1.24, 95%CI: 1.01-1.52, P = 0.037). Our findings provide evidence that the CD24 C170T polymorphism might contribute to the susceptibility to UC, and the CD24 TG1527del polymorphism might be associated with the risk of CD.

  4. Genetics of leptin and obesity: a HuGE review.

    PubMed

    Paracchini, Valentina; Pedotti, Paola; Taioli, Emanuela

    2005-07-15

    Leptin is an important regulator of the mass of adipose tissue and of body weight; it operates by inhibiting food intake and stimulating energy expenditure. Some polymorphic genes involved in the regulation of leptin-the leptin gene (LEP A19G), the leptin receptor gene (LEPR Q223R, K109R, and K656N), and the peroxisome proliferator-activated receptor-gamma gene (PPARG P12A and C161T)--have been investigated as possible factors associated with obesity. Allelic frequencies of these polymorphisms show ethnic variation. The authors performed a meta-analysis of the available data on the association between these polymorphisms and obesity based on case-control studies. Odds ratios and 95% confidence intervals for obesity associated with leptin polymorphisms were calculated by using both fixed- and random-effects models. Results suggest no evidence of association between the genes under study and obesity. The lack of association could be due to the complex pathogenesis of obesity, which involves a number of genetic and environmental factors. Large studies including testing of multiple genes in both obese and lean subjects, with epidemiologic data on dietary habits in different ethnic groups, are necessary to better understand the role of leptin in regulating weight in human populations.

  5. Polymorphisms of genes involved in polycyclic aromatic hydrocarbons’ biotransformation and atherosclerosis

    PubMed Central

    Marinković, Natalija; Pašalić, Daria; Potočki, Slavica

    2013-01-01

    Polycyclic aromatic hydrocarbons (PAHs) are among the most prevalent environmental pollutants and result from the incomplete combustion of hydrocarbons (coal and gasoline, fossil fuel combustion, byproducts of industrial processing, natural emission, cigarette smoking, etc.). The first phase of xenobiotic biotransformation in the PAH metabolism includes activities of cytochrome P450 from the CYP1 family and microsomal epoxide hydrolase. The products of this biotransformation are reactive oxygen species that are transformed in the second phase through the formation of conjugates with glutathione, glucuronate or sulphates. PAH exposure may lead to PAH-DNA adduct formation or induce an inflammatory atherosclerotic plaque phenotype. Several genetic polymorphisms of genes encoded for enzymes involved in PAH biotransformation have been proven to lead to the development of diseases. Enzyme CYP P450 1A1, which is encoded by the CYP1A1 gene, is vital in the monooxygenation of lipofilic substrates, while GSTM1 and GSTT1 are the most abundant isophorms that conjugate and neutralize oxygen products. Some single nucleotide polymorphisms of the CYP1A1 gene as well as the deletion polymorphisms of GSTT1 and GSTM1 may alter the final specific cellular inflammatory respond. Occupational exposure or conditions from the living environment can contribute to the production of PAH metabolites with adverse effects on human health. The aim of this study was to obtain data on biotransformation and atherosclerosis, as well as data on the gene polymorphisms involved in biotransformation, in order to better study gene expression and further elucidate the interaction between genes and the environment. PMID:24266295

  6. Genetic polymorphisms in nitric oxide synthase genes modify the relationship between vegetable and fruit intake and risk of non-Hodgkin lymphoma

    PubMed Central

    Han, Xuesong; Zheng, Tongzhang; Lan, Qing; Zhang, Yaqun; Kilfoy, Briseis A.; Qin, Qin; Rothman, Nathaniel; Zahm, Shelia H.; Holford, Theodore R.; Leaderer, Brian; Zhang, Yawei

    2010-01-01

    Oxidative damage caused by reactive oxygen species (ROS) and other free radicals is involved in carcinogenesis. It has been suggested that high vegetable and fruit intake may reduce the risk of non-Hodgkin lymphoma (NHL) as vegetables and fruit are rich in antioxidants. The aim of this study is to evaluate the interaction of vegetable and fruit intake with genetic polymorphisms in oxidative stress pathway genes and NHL risk. This hypothesis was investigated in a population-based case-control study of NHL and NHL histological subtype in Connecticut women including 513 histologically confirmed incident cases and 591 randomly selected controls. Gene-vegetable/fruit joint effects were estimated using unconditional logistic regression model. The false discovery rate method was applied to adjust for multiple comparisons. Significant interactions with vegetable and fruit intake were mainly found for genetic polymorphisms on nitric oxide synthase (NOS) genes among those with diffuse large B-cell lymphoma (DLBCL) and Follicular lymphoma (FL). Two single nucleotide polymorphisms (SNPs) in the NOS1 gene were found to significantly modify the association between total vegetable and fruit intake and risk of NHL overall, as well as the risk of follicular lymphoma (FL). When vegetables, bean vegetables, cruciferous vegetables, green leafy vegetables, red vegetables, yellow/orange vegetables, fruit, and citrus fruit were examined separately, strong interaction effects were narrowed to vegetable intake among DLBCL patients. Our results suggest that genetic polymorphisms in oxidative stress pathway genes, especially in the nitric oxide synthase genes, modify the association between vegetable and fruit intake and risk of NHL. PMID:19423521

  7. Folate and One-Carbon Metabolism Gene Polymorphisms and Their Associations With Oral Facial Clefts

    PubMed Central

    Boyles, Abee L.; Wilcox, Allen J.; Taylor, Jack A.; Meyer, Klaus; Fredriksen, Åse; Ueland, Per Magne; Drevon, Christian A.; Vollset, Stein Emil; Lie, Rolv Terje

    2008-01-01

    Folate metabolism plays a critical role in embryonic development. Prenatal folate supplementation reduces the risk of neural tube defects and probably oral facial clefts. Previous studies of related metabolic genes have associated polymorphisms in cystathionine-beta-synthase (CBS) and 5,10-methylenetetrahydrofolate reductase (MTHFR) with cleft risk. We explored associations between genes related to one-carbon metabolism and clefts in a Norwegian population-based study that included 362 families with cleft lip with or without cleft palate (CL/P) and 191 families with cleft palate only (CPO). We previously showed a 39% reduction in risk of CL/P with folic acid supplementation in this population. In the present study we genotyped 12 polymorphisms in nine genes related to one-carbon metabolism and looked for associations of clefting risk with fetal polymorphisms, maternal polymorphisms, as well as parent-of-origin effects, using combined likelihood-ratio tests (LRT). We also stratified by maternal periconceptional intake of folic acid (>400 μg) to explore gene-exposure interactions. We found a reduced risk of CL/P with mothers who carried the CBS C699T variant (rs234706); relative risk was 0.94 with one copy of the T allele (95% CI 0.63-1.4) and 0.50 (95% CI 0.26-0.96) with two copies (P = 0.008). We found no evidence of interaction of this variant with folate status. We saw no evidence of risk from the MTHFR C677T variant (rs1801133) either overall or after stratifying by maternal folate intake. No associations were found between any of the polymorphisms and CPO. Genetic variations in the nine metabolic genes examined here do not confer a substantial degree of risk for clefts. Published 2008 Wiley-Liss, Inc.† PMID:18203168

  8. Tumor necrosis factor-alpha gene polymorphisms and susceptibility to ischemic heart disease

    PubMed Central

    Zhang, Peng; Wu, Xiaomei; Li, Guangxiao; He, Qiao; Dai, Huixu; Ai, Cong; Shi, Jingpu

    2017-01-01

    Abstract Background: A number of studies had reported the association between tumor necrosis factor-alpha (TNF-α) gene polymorphisms and ischemic heart disease (IHD) risk. However, the results remained controversial. Therefore, we performed a systematic review with multiple meta-analyses to provide the more precise estimations of the relationship. Methods: We systematically searched electronic databases (PubMed, the Web of Science, EMBASE, Medline, Chinese National Knowledge Infrastructure, WanFang and ChongQing VIP Database) for relevant studies published up to February 2017. The odds ratios (ORs) and 95% confidence intervals (CIs) were estimated for assessing the association. The present meta-analysis was performed using STATA 12.0 software. Results: In total, 45 articles with 17,375 cases and 15,375 controls involved were included. Pooled ORs revealed a significant association between TNF-α −308G/A gene polymorphism and IHD (A vs. G: OR = 1.22, 95% CI = 1.10–1.35; (AA + GA) vs. GG: OR = 1.18, 95% CI = 1.03–1.36; (AA vs. (GA+GG): OR = 1.37, 95% CI = 1.08–1.75)), indicating that the TNF-α −308A allele might be an important risk factor for IHD. No association between other TNF-α gene polymorphisms and susceptibility to IHD were observed. No publication bias were found. Sensitivity analyses indicated that our results were stable. Conclusion: The present study indicated a possible association between the TNF-α −308G/A gene polymorphism and IHD risk. However, evidence was limited to confirm the role of TNF-α −238G/A, −857C/T, −863C/A, −1031T/C and other TNF-α gene polymorphisms in the risk of IHD. PMID:28383437

  9. Clinical differences between patients with MODY-3, MODY-2 and type 2 diabetes mellitus with I27L polymorphism in the HNF1alpha gene.

    PubMed

    Pinés Corrales, Pedro José; López Garrido, María P; Aznar Rodríguez, Silvia; Louhibi Rubio, Lynda; López Jiménez, Luz M; Lamas Oliveira, Cristina; Alfaro Martínez, Jose J; Lozano García, Jose J; Hernández López, Antonio; Requejo Castillo, Ramón; Escribano Martínez, Julio; Botella Romero, Francisco

    2010-01-01

    The aim of our study was to describe and evaluate the clinical and metabolic characteristics of patients with MODY-3, MODY-2 or type 2 diabetes who presented I27L polymorphism in the HNF1alpha gene. The study included 31 previously diagnosed subjects under follow-up for MODY-3 (10 subjects from 5 families), MODY-2 (15 subjects from 9 families), or type 2 diabetes (6 subjects) with I27L polymorphism in the HNF1alpha gene. The demographic, clinical, metabolic, and genetic characteristics of all patients were analyzed. No differences were observed in distribution according to sex, age of onset, or form of diagnosis. All patients with MODY-2 or MODY-3 had a family history of diabetes. In contrast, 33.3% of patients with type 2 diabetes mellitus and I27L polymorphism in the HNF1alpha gene had no family history of diabetes (p < 0.05). No differences were observed in body mass index, prevalence of hypertension, or microvascular or macrovascular complications. Drug therapy was required by 100% of MODY-3 patients, but not required by 100% of MODY-2 patients or 16.7% of patients with type 2 diabetes mellitus and I27L polymorphism in the HNF1alpha gene (p < 0.05). Occasional difficulties may be encountered when classifying patients with MODY-2, MODY-3 or type 2 diabetes of atypical characteristics, in this case patients who present I27L polymorphism in the HNF1alpha gene. Copyright 2010 Sociedad Española de Endocrinología y Nutrición. Published by Elsevier Espana. All rights reserved.

  10. Identification of possible genetic polymorphisms involved in cancer cachexia: a systematic review.

    PubMed

    Tan, Benjamin H L; Ross, James A; Kaasa, Stein; Skorpen, Frank; Fearon, Kenneth C H

    2011-04-01

    Cancer cachexia is a polygenic and complex syndrome. Genetic variations in regulation of the inflammatory response, muscle and fat metabolic pathways, and pathways in appetite regulation are likely to contribute to the susceptibility or resistance to developing cancer cachexia. A systematic search of Medline and EmBase databases, covering 1986-2008 was performed for potential candidate genes/genetic polymorphisms relating to cancer cachexia. Related genes were then identified using pathway functional analysis software. All candidate genes were reviewed for functional polymorphisms or clinically significant polymorphisms associated with cachexia using the OMIM and GeneRIF databases. Genes with variants which had functional or clinical associations with cachexia and replicated in at least one study were entered into pathway analysis software to reveal possible network associations between genes. A total of 184 polymorphisms with functional or clinical relevance to cancer cachexia were identified in 92 candidate genes. Of these, 42 polymorphisms (in 33 genes) were replicated in more than one study with 13 polymorphisms found to influence two or more hallmarks of cachexia (i.e. inflammation, loss of fat mass and/or lean mass and reduced survival). Thirty-three genes were found to be significantly interconnected in two major networks with four genes (ADIPOQ, IL6, NFKB1 and TLR4) interlinking both networks. Selection of candidate genes and polymorphisms is a key element of multigene study design. The present study provides an initial framework to select genes/polymorphisms for further study in cancer cachexia, and to develop their potential as susceptibility biomarkers of developing cachexia.

  11. Adolescent idiopathic scoliosis and the single-nucleotide polymorphism of the growth hormone receptor and IGF-1 genes.

    PubMed

    Yang, Yong; Wu, Zhihong; Zhao, Taimao; Wang, Hai; Zhao, Dong; Zhang, Jianguo; Wang, Yipeng; Ding, Yaozhong; Qiu, Guixing

    2009-06-01

    The etiology of adolescent idiopathic scoliosis is undetermined despite years of research. A number of hypotheses have been postulated to explain its development, including growth abnormalities. The irregular expression of growth hormone and insulin-like growth factor-1 (IGF-1) may disturb hormone metabolism, result in a gross asymmetry, and promote the progress of adolescent idiopathic scoliosis. Initial association studies in complex diseases have demonstrated the power of candidate gene association. Prior to our study, 1 study in this field had a negative result. A replicable study is vital for reliability. To determine the relationship of growth hormone receptor and IGF-1 genes with adolescent idiopathic scoliosis, a population-based association study was performed. Single nucleotide polymorphisms with potential function were selected from candidate genes and a distribution analysis was performed. A conclusion was made confirming the insufficiency of an association between adolescent idiopathic scoliosis and the single-nucleotide polymorphism of the growth hormone receptor and IGF-1 genes in Han Chinese.

  12. Opioid system genes in alcoholism: a case-control study in Croatian population.

    PubMed

    Cupic, B; Stefulj, J; Zapletal, E; Matosic, A; Bordukalo-Niksic, T; Cicin-Sain, L; Gabrilovac, J

    2013-10-01

    Due to their involvement in dependence pathways, opioid system genes represent strong candidates for association studies investigating alcoholism. In this study, single nucleotide polymorphisms within the genes for mu (OPRM1) and kappa (OPRK1) opioid receptors and precursors of their ligands - proopiomelanocortin (POMC), coding for beta-endorphin and prodynorphin (PDYN) coding for dynorphins, were analyzed in a case-control study that included 354 male alcohol-dependent and 357 male control subjects from Croatian population. Analysis of allele and genotype frequencies of the selected polymorphisms of the genes OPRM1/POMC and OPRK1/PDYN revealed no differences between the tested groups. The same was true when alcohol-dependent persons were subdivided according to the Cloninger's criteria into type-1 and type-2 groups, known to differ in the extent of genetic control. Thus, the data obtained suggest no association of the selected polymorphisms of the genes OPRM1/POMC and OPRK1/PDYN with alcoholism in Croatian population. Copyright © 2013 Elsevier Ltd. All rights reserved.

  13. Leptin gene and leptin receptor gene polymorphisms are associated with sweet preference and obesity.

    PubMed

    Mizuta, Einosuke; Kokubo, Yoshihiro; Yamanaka, Itaru; Miyamoto, Yoshihiro; Okayama, Akira; Yoshimasa, Yasunao; Tomoike, Hitonobu; Morisaki, Hiroko; Morisaki, Takayuki

    2008-06-01

    Leptin is an adipocyte-secreted hormone that regulates food intake and body weight, and that was recently reported to suppress sweet sensitivity in an animal model. We investigated the associations among sweet preference, obesity, and polymorphisms of the leptin gene (LEP) or leptin receptor gene (LEPR). A total of 3,653 residents randomly selected from among the citizens of Suita City, Osaka, Japan were enlisted as subjects, in whom we investigated sweet preference, clinical characteristics, including obesity and serum leptin level, and the polymorphisms of LEP and LEPR (G-2548A and A19G for LEP; R109K, R223Q, and rs3790439 for LEPR). We determined the associations among the parameters using logistic regression analysis, in order to consider potential confounding factors for sweet preference and/or obesity. The LEP A19G and LEPR R109K polymorphisms were associated with sweet preference, whereas the serum leptin level was not. Further, the LEPR 109KK genotype was found to be associated with obesity along with sweet preference. In conclusion, our results are the first to show associations of LEP and LEPR polymorphisms with sweet preference, and may provide useful information for diagnosis and treatment of lifestyle-related diseases.

  14. Contrasting Histories of Three Gene Regions Associated with In(3l)payne of Drosophila Melanogaster

    PubMed Central

    Hasson, E.; Eanes, W. F.

    1996-01-01

    In the present report, we studied nucleotide variation in three gene regions of Drosophila melanogaster, spanning >5 kb and showing different degrees of association with the cosmopolitan inversion In(3-L)Payne. The analysis of sequence variation in the regions surrounding the breakpoints and the heat shock 83 (Hsp83) gene locus, located close to the distal breakpoint, revealed the absence of shared polymorphisms and the presence of a number of fixed differences between arrangements, indicating absence of genetic exchange. In contrast, for the esterase-6 gene region, located in the center of the inversion, we observed the presence of shared polymorphisms between arrangements suggesting genetic exchange. In the regions close to the breakpoints, the common St arrangement is 10 times more polymorphic than inverted chromosomes. We propose that the lack of recombination between arrangements in these regions coupled with genetic hitchhiking is the best explanation for the low heterozygosity observed in inverted lines. Using the data for the breakpoints, we estimate that this inversion polymorphism is around 0.36 million yr old. Although it is widely accepted that inversions are examples of balanced polymorphisms, none of the current neutrality tests including our Monte Carlo simulations showed significant departure from neutral expectations. PMID:8978045

  15. Evaluation of androgen receptor gene as a candidate gene in female androgenetic alopecia.

    PubMed

    el-Samahy, May H; Shaheen, Maha A; Saddik, Dina E B; Abdel-Fattah, Nermeen S A; el-Sawi, Mohammad A; Mahran, Manal Z; Shehab, Abeer A A

    2009-06-01

    Genetic polymorphisms of the androgen receptor (AR) gene have been studied in male androgenetic alopecia (AGA); however, little is known about gene polymorphism and female AGA. To evaluate the AR gene as a candidate gene for female AGA. Thirty premenopausal Egyptian female patients with AGA (mean age, 32.3 +/- 7 years) and 11 age- and sex-matched controls were included. All subjects underwent laboratory and pelvic ultrasound evaluation to exclude other precipitating cause(s) of hair loss. Scalp biopsy was taken and the AR gene was evaluated using polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP). According to Ludwig's classification, all patients had type II AGA. Statistical analysis showed no statistically significant difference in genotype (chi(2) = 5.513, P > or = 0.05) or allele frequency (chi(2) = 1.312, P > or = 0.05) between patients and controls. There was also no statistically significant difference between the genotype and allele frequency with disease duration. In contrast with male AGA, no association was found between type II AGA in Egyptian women and the AR gene. Therefore, the genetic study of this gene does not serve as a biomarker for the identification of women with a predisposition to AGA.

  16. Polymorphisms at the Ligand Binding Site of the Vitamin D Receptor Gene and Osteomalacia

    PubMed Central

    Ak, Duygu Gezen; Kahraman, Hakkí; Dursun, Erdinç; Duman, Belgin Süsleyici; Erensoy, Nevin; Alagöl, Faruk; Tanakol, Refik; Yılmazer, Selma

    2005-01-01

    Vitamin D receptor (VDR) gene polymorphisms have been suggested as possible determinants of bone mineral density (BMD) and calcium metabolism. In this study, our aim was to determine whether there is an association between VDR gene polymorphism and osteomalacia or not. We determined ApaI and TaqI polymorphisms in the vitamin D receptor gene in 24 patients with osteomalacia and 25 age-matched healthy controls. Serum calcium, phosphorus, ALP, PTH, 25OHD levels were also examined. We used PCR and RFLP methods to test for an association between osteomalacia and polymorphisms within, intron 8 and exon 9 of the VDR gene. When the control and patients were compared for their ApaI and TaqI genotypes there was no relationship between VDR gene allelic polymorphisms and osteomalacia. Whereas a nearly significant difference for A allele was found in the allellic distribution of the patients (p = 0.08). Also no association between biochemical data and VDR gene polymorphisms was observed. PMID:16403954

  17. Genetic variation: effect on prostate cancer

    PubMed Central

    Sissung, Tristan M.; Price, Douglas K.; Del Re, Marzia; Ley, Ariel M.; Giovannetti, Elisa; Danesi, Romano

    2014-01-01

    Summary The crucial role of androgens in the development of prostate cancer is well established. The aim of this review is to examine the role of constitutional (germline) and tumor-specific (somatic) polymorphisms within important regulatory genes of prostate cancer. These include genes encoding enzymes of the androgen biosynthetic pathway, the androgen receptor gene, genes that encode proteins of the signal transduction pathways that may have a role in disease progression and survival, and genes involved in prostate cancer angiogenesis. Characterization of deregulated pathways critical to cancer cell growth have lead to the development of new treatments, including the CYP17 inhibitor abiraterone and clinical trials using novel drugs that are ongoing or recently completed [1]. The pharmacogenetics of the drugs used to treat prostate cancer will also be addressed. This review will define how germline polymorphisms are known affect a multitude of pathways, and therefore phenotypes, in prostate cancer etiology, progression, and treatment. PMID:25199985

  18. Evaluation of ACE gene I/D polymorphism in Iranian elite athletes.

    PubMed

    Shahmoradi, Somayeh; Ahmadalipour, Ali; Salehi, Mansoor

    2014-01-01

    Angiotensin converting enzyme (ACE) is an important gene, which is associated with the successful physical activity. The ACE gene has a major polymorphism (I/D) in intron 16 that determines its plasma and tissue levels. In this study, we aimed to determine whether there is an association between this polymorphism and sports performance in our studied population including elite athletes of different sports disciplines. We investigated allele frequency and genotype distribution of the ACE gene in 156 Iranian elite athletes compared to 163 healthy individuals. We also investigated this allele frequency between elite athletes in three functional groups of endurance, power, and mixed sports performances. DNA was extracted from peripheral blood, and polymerase chain reaction (PCR) method was performed on intron 16 of the ACE gene. The ACE genotype was determined for each subject. Statistical analysis was performed by SPSS 15, and results were analyzed by Chi-Square test. There was a significant difference in genotype distribution and allele frequency of the ACE gene in athletes and control group (P = 0.05, P = 0.03, respectively). There was also a significant difference in allele frequency of the ACE gene in 3 groups of athletes with different sports disciplines (P = 0.045). Proportion of the ACE gene D allele was greater in elite endurance athletes (37 high-distance cyclists) than two other groups. Findings of the present study demonstrated that there is an association between the ACE gene I/D polymorphism and sports performance in Iranian elite athletes.

  19. Associations between period 3 gene polymorphisms and sleep- /chronotype-related variables in patients with late-life insomnia.

    PubMed

    Mansour, Hader A; Wood, Joel; Chowdari, Kodavali V; Tumuluru, Divya; Bamne, Mikhil; Monk, Timothy H; Hall, Martica H; Buysse, Daniel J; Nimgaonkar, Vishwajit L

    2017-01-01

    A variable number tandem repeat polymorphism (VNTR) in the period 3 (PER3) gene has been associated with heritable sleep and circadian variables, including self-rated chronotypes, polysomnographic (PSG) variables, insomnia and circadian sleep-wake disorders. This report describes novel molecular and clinical analyses of PER3 VNTR polymorphisms to better define their functional consequences. As the PER3 VNTR is located in the exonic (protein coding) region of PER3, we initially investigated whether both alleles (variants) are transcribed into messenger RNA in human fibroblasts. The VNTR showed bi-allelic gene expression. We next investigated genetic associations in relation to clinical variables in 274 older adult Caucasian individuals. Independent variables included genotypes for the PER3 VNTR as well as a representative set of single nucleotide polymorphisms (SNPs) that tag common variants at the PER3 locus (linkage disequilibrium (LD) between genetic variants < 0.5). In order to comprehensively evaluate variables analyzed individually in prior analyses, dependent measures included PSG total sleep time and sleep latency, self-rated chronotype, estimated with the Composite Scale (CS), and lifestyle regularity, estimated using the social rhythm metric (SRM). Initially, genetic polymorphisms were individually analyzed in relation to each outcome variable using analysis of variance (ANOVA). Nominally significant associations were further tested using regression analyses that incorporated individual ANOVA-associated DNA variants as potential predictors and each of the selected sleep/circadian variables as outcomes. The covariates included age, gender, body mass index and an index of medical co-morbidity. Significant genetic associations with the VNTR were not detected with the sleep or circadian variables. Nominally significant associations were detected between SNP rs1012477 and CS scores (p = 0.003) and between rs10462021 and SRM (p = 0.047); rs11579477 and average delta power (p = 0.043) (analyses uncorrected for multiple comparisons). In conclusion, alleles of the VNTR are expressed at the transcript level and may have a functional effect in cells expressing the PER3 gene. PER3 polymorphisms had a modest impact on selected sleep/circadian variables in our sample, suggesting that PER3 is associated with sleep and circadian function beyond VNTR polymorphisms. Further replicate analyses in larger, independent samples are recommended.

  20. The Influence of DAT1, COMT, and BDNF Genetic Polymorphisms on Total and Subregional Hippocampal Volumes in Early Onset Heavy Cannabis Users

    PubMed Central

    Batalla, Albert; Lorenzetti, Valentina; Chye, Yann; Yücel, Murat; Soriano-Mas, Carles; Bhattacharyya, Sagnik; Torrens, Marta; Crippa, José A.S.; Martín-Santos, Rocío

    2018-01-01

    Abstract Introduction: Hippocampal neuroanatomy is affected by genetic variations in dopaminergic candidate genes and environmental insults, such as early onset of chronic cannabis exposure. Here, we examine how hippocampal total and subregional volumes are affected by cannabis use and functional polymorphisms of dopamine-relevant genes, including the catechol-O-methyltransferase (COMT), dopamine transporter (DAT1), and the brain-derived neurotrophic factor (BDNF) genes. Material and Methods: We manually traced total hippocampal volumes and automatically segmented hippocampal subregions using high-resolution MRI images, and performed COMT, DAT1, and BDNF genotyping in 59 male Caucasian young adults aged 18–30 years. These included 30 chronic cannabis users with early-onset (regular use at <16 years) and 29 age-, education-, and intelligence-matched controls. Results: Cannabis use and dopaminergic gene polymorphism had both distinct and interactive effects on the hippocampus. We found emerging alterations of hippocampal total and specific subregional volumes in cannabis users relative to controls (i.e., CA1, CA2/3, and CA4), and associations between cannabis use levels and total and specific subregional volumes. Furthermore, total hippocampal volume and the fissure subregion were affected by cannabis×DAT1 polymorphism (i.e., 9/9R and in 10/10R alleles), reflecting high and low levels of dopamine availability. Conclusion: These findings suggest that cannabis exposure alters the normal relationship between DAT1 polymorphism and the anatomy of total and subregional hippocampal volumes, and that specific hippocampal subregions may be particularly affected. PMID:29404409

  1. The Influence of DAT1, COMT, and BDNF Genetic Polymorphisms on Total and Subregional Hippocampal Volumes in Early Onset Heavy Cannabis Users.

    PubMed

    Batalla, Albert; Lorenzetti, Valentina; Chye, Yann; Yücel, Murat; Soriano-Mas, Carles; Bhattacharyya, Sagnik; Torrens, Marta; Crippa, José A S; Martín-Santos, Rocío

    2018-01-01

    Introduction: Hippocampal neuroanatomy is affected by genetic variations in dopaminergic candidate genes and environmental insults, such as early onset of chronic cannabis exposure. Here, we examine how hippocampal total and subregional volumes are affected by cannabis use and functional polymorphisms of dopamine-relevant genes, including the catechol-O-methyltransferase (COMT), dopamine transporter (DAT1), and the brain-derived neurotrophic factor (BDNF) genes. Material and Methods: We manually traced total hippocampal volumes and automatically segmented hippocampal subregions using high-resolution MRI images, and performed COMT, DAT1, and BDNF genotyping in 59 male Caucasian young adults aged 18-30 years. These included 30 chronic cannabis users with early-onset (regular use at <16 years) and 29 age-, education-, and intelligence-matched controls. Results: Cannabis use and dopaminergic gene polymorphism had both distinct and interactive effects on the hippocampus. We found emerging alterations of hippocampal total and specific subregional volumes in cannabis users relative to controls (i.e., CA1, CA2/3, and CA4), and associations between cannabis use levels and total and specific subregional volumes. Furthermore, total hippocampal volume and the fissure subregion were affected by cannabis×DAT1 polymorphism (i.e., 9/9R and in 10/10R alleles), reflecting high and low levels of dopamine availability. Conclusion: These findings suggest that cannabis exposure alters the normal relationship between DAT1 polymorphism and the anatomy of total and subregional hippocampal volumes, and that specific hippocampal subregions may be particularly affected.

  2. Vitamin D pathway gene polymorphisms affecting daclatasvir plasma concentration at 2 weeks and 1 month of therapy.

    PubMed

    Cusato, Jessica; Nicolò, Amedeo De; Boglione, Lucio; Favata, Fabio; Ariaudo, Alessandra; Pinna, Simone Mornese; Carcieri, Chiara; Guido, Federica; Cariti, Giuseppe; Perri, Giovanni Di; D'Avolio, Antonio

    2018-06-01

    Vitamin D (VD) influences genetic expression through its receptor (VDR). VD pathway gene polymorphisms seem to influence antiviral drug pharmacokinetics and therapeutic outcome/toxicity. We investigated the association between daclatasvir (DCV) plasma concentrations and genetic variants (SNPs) associated with the VD pathway. Chronic hepatitis C patients treated with DCV from 2014 to 2016 were included. Genotypes were assessed through real-time PCR and plasma concentrations through liquid chromatography. A total of 52 patients were analyzed. DCV levels were influenced by CYP24A1 rs2248359T>C polymorphism at 2 weeks and VDR Cdx2 A>G at 1 month of treatment. Linear regression analysis showed baseline BMI, alanine aminotransferase and hematocrit as significant predictors of DCV concentrations at 2 weeks, BMI and hematocrit at baseline, VDR Cdx2 AG/GG and FokI TC/CC at 1 month. These results showed a possible role of VD pathway gene polymorphisms in influencing DCV plasma concentrations, but further studies are required.

  3. The Vitamin D Receptor (VDR) Gene Polymorphisms in Turkish Brain Cancer Patients

    PubMed Central

    Toptaş, Bahar; Kafadar, Ali Metin; Cacina, Canan; Turan, Saime; Yurdum, Leman Melis; Yiğitbaşı, Nihal; Gökçe, Muhammed Oğuz; Zeybek, Ümit; Yaylım, Ilhan

    2013-01-01

    Objective. It has been stated that brain cancers are an increasingly serious issue in many parts of the world. The aim of our study was to determine a possible relationship between Vitamin D receptor (VDR) gene polymorphisms and the risk of glioma and meningioma. Methods. We investigated the VDR Taq-I and VDR Fok-I gene polymorphisms in 100 brain cancer patients (including 44 meningioma cases and 56 glioma cases) and 122 age-matched healthy control subjects. This study was performed by polymerase chain reaction-based restriction fragment length polymorphism (RF LP). Results. VDR Fok-I ff genotype was significantly increased in meningioma patients (15.9%) compared with controls (2.5%), and carriers of Fok-I ff genotype had a 6.47-fold increased risk for meningioma cases. There was no significant difference between patients and controls for VDR Taq-I genotypes and alleles. Conclusions. We suggest that VDR Fok-I genotypes might affect the development of meningioma. PMID:23691496

  4. Meta-analysis of association between K469E polymorphism of the ICAM-1 gene and retinopathy in type 2 diabetes

    PubMed Central

    Fan, Wen-Ying; Liu, Ning-Pu

    2015-01-01

    AIM To collectively evaluate the association of intercellular adhesion molecule-1 (ICAM-1) gene K469E polymorphism (rs5498) with diabetic retinopathy (DR) in patients with type 2 diabetic mellitus (T2DM). METHODS Overall review of available literatures relating K469E polymorphism to the risk of DR was conducted on 4 electronic databases. Meta-analysis was performed by Stata 12.0 to calculate pooled odds ratios (ORs). Potential sources of heterogeneity and bias were explored. RESULTS Seven studies with genotype frequency data including 1120 cases with DR and 956 diabetic controls free of DR were included. Meta-analysis did not show significant association of K469E polymorphism with DR (P>0.05). A statistically significant association was detected between the K469E polymorphism and proliferative diabetic retinopathy (PDR) in Asians only in dominant model (GG+AG vs AA) with pooled OR of 0.729 (95%CI: 0.564-0.942, P=0.016, Pheterogeneity=0.143), however, this association was not detected in recessive model (GA+AA vs GG; OR=1.178, 95%CI: 0.898-1.545, P=0.236, Pheterogeneity=0.248) or allelic model (G vs A; OR=0.769, 95% CI: 0.576-1.026, P=0.074, Pheterogeneity=0.094). No publication bias was found by Funnel plot, Begg's and Egger's test. CONCLUSION This research found no statistically significant association between ICAM-1 gene K469E polymorphism and DR in patients with T2DM, but showed significant association of the K469E polymorphism with PDR in Asian diabetic patients only in dominant model. Further investigation would be required to consolidate the conclusion. PMID:26086016

  5. eNOS gene Glu298Asp and 4b/a polymorphisms are associated with renal function parameters in Mexican patients with Fabry disease.

    PubMed

    Marin-Medina, A; Brambila-Tapia, A J L; Picos-Cárdenas, V J; Gallegos-Arreola, M P; Figuera, L E

    2016-10-24

    Fabry disease (FD) is an inherited X-linked lysosomal disease that causes renal failure in a high percentage of affected individuals. The eNOS gene encodes for endothelial nitric oxide synthase, which plays an important role in glomerular hemodynamics. This gene has two main polymorphisms (Glu298Asp and 4b/a) that have been studied in the context of many different diseases, including those involving cardiovascular and renal alterations. Considering the lack of information regarding eNOS variants and FD, we investigated whether there were associations between eNOS genetic variants and renal function parameters in Mexican patients with FD and renal impairment. In total, 15 FD patients with renal alterations were included in the present study, and associations between eNOS polymorphisms and renal function parameters (urea, creatinine, and GFR) were evaluated. The Asp298 and 4a alleles of the eNOS gene were found to be significantly associated with increased levels of urea and creatinine, and a decreased glomerular filtration rate in FD patients, and this association behaved in a co-dominant fashion. Our results coincide with previous reports showing an association between these polymorphisms and kidney disease, and along with other studies regarding their role in the nitric oxide pathway, suggest that these variants affect the severity of nephropathy in patients with FD.

  6. Association of Adiponectin rs1501299 and rs266729 Gene Polymorphisms With Nonalcoholic Fatty Liver Disease

    PubMed Central

    Hashemi, Mohammad; Hanafi Bojd, Hamideh; Eskandari Nasab, Ebrahim; Bahari, Ali; Hashemzehi, Noor Allah; Shafieipour, Sara; Narouie, Behzad; Taheri, Mohsen; Ghavami, Saeid

    2013-01-01

    Background Genetic and environmental factors are important for the development of nonalcoholic fatty liver disease (NAFLD). Adiponectin is a white and brown adipose tissue hormone, and have been found to play essential roles in the regulation of energy homoeostasis. Recent reports have identified a possible role of adiponectin in NAFLD via PPARγ pathway. Objectives The present study was designed to find out the impact of adiponectin rs1501299 (276G/T) and rs266729 (-11377C/G) gene polymorphisms in NAFLD. Patients and Methods Eighty-three patients with diagnosis of NAFLD, and 93 healthy subjects were included in the study. Tetra ARMS-PCR was designed to detect single nucleotide polymorphisms. Results A significant difference was found between NAFLD and control group regarding the rs266729 polymorphism (χ2 = 7.35, P = 0.025). The rs266729 polymorphism increased the risk of NAFLD in codominant (CC vs. CG: OR = 2.18, 95% CI = 1.16 - 4.12, P = 0.016) and dominant (CC vs. CG/GG: OR = 2.31, 95% CI = 1.25 - 4.27; P = 0.008) inheritance tested models. The G allele increased the risk of NAFLD (OR = 1.63, 95% CI = 1.03 - 2.57, P = 0.037) in comparison with C allele. No significant difference was found between the groups concerning adiponectin rs1501299 gene polymorphism (χ2 = 0.70, P = 0.697). Conclusions adiponectin rs266729 polymorphism might be a candidate gene, which determines the susceptibility to NAFLD. Larger studies are necessary to confirm these findings in various populations. PMID:23922565

  7. PTCH1 gene haplotype association with basal cell carcinoma after transplantation.

    PubMed

    Begnini, A; Tessari, G; Turco, A; Malerba, G; Naldi, L; Gotti, E; Boschiero, L; Forni, A; Rugiu, C; Piaserico, S; Fortina, A B; Brunello, A; Cascone, C; Girolomoni, G; Gomez Lira, M

    2010-08-01

    Basal cell carcinoma (BCC) is 10 times more frequent in organ transplant recipients (OTRs) than in the general population. Factors in OTRs conferring increased susceptibility to BCC include ultraviolet radiation exposure, immunosuppression, viral infections such as human papillomavirus, phototype and genetic predisposition. The PTCH1 gene is a negative regulator of the hedgehog pathway, that provides mitogenic signals to basal cells in skin. PTCH1 gene mutations cause naevoid BCC syndrome, and contribute to the development of sporadic BCC and other types of cancers. Associations have been reported between PTCH1 polymorphisms and BCC susceptibility in nontransplanted individuals. To search for novel common polymorphisms in the proximal 5' regulatory region upstream of PTCH1 gene exon 1B, and to investigate the possible association of PTCH1 polymorphisms and haplotypes with BCC risk after organ transplantation. Three PTCH1 single nucleotide polymorphisms (rs2297086, rs2066836 and rs357564) were analysed by restriction fragment length polymorphism analysis in 161 northern Italian OTRs (56 BCC cases and 105 controls). Two regions of the PTCH1 gene promoter were screened by heteroduplex analysis in 30 cases and 30 controls. Single locus analysis showed no significant association. Haplotype T(1686)-T(3944) appeared to confer a significantly higher risk for BCC development (odds ratio 2.98, 95% confidence interval 2.55-3.48; P = 0.001). Two novel rare polymorphisms were identified at positions 176 and 179 of the 5'UTR. Two novel alleles of the -4 (CGG)(n) microsatellite were identified. No association of this microsatellite with BCC was observed. Haplotypes containing T(1686)-T(3944) alleles were shown to be associated with an increased BCC risk in our study population. These data appear to be of great interest for further investigations in a larger group of transplant individuals. Our results do not support the hypothesis that common polymorphisms in the proximal 5' regulatory region of the PTCH1 gene could represent an important risk factor for BCC after organ transplantation.

  8. Polymorphisms of Leptin (G2548A) and Leptin Receptor (Q223R and K109R) Genes and Blood Pressure During Pregnancy and the Postpartum Period: A Cohort.

    PubMed

    Farias, Dayana R; Franco-Sena, Ana B; Rebelo, Fernanda; Salles, Gil F; Struchiner, Cláudio J; Martins, Maisa C; Kac, Gilberto

    2017-02-01

    The genetic component related to blood pressure (BP) changes during pregnancy is still not elucidated. Thus, the aim of the study was to evaluate the association between leptin and leptin receptor polymorphisms and systolic (SBP) and diastolic BP (DBP) variation during pregnancy and the postpartum period. Prospective cohort of 146 women followed at a Public Health Center in Rio de Janeiro, Brazil, during pregnancy and the postpartum. SBP and DBP (mm Hg) were measured using an automatic sphygmomanometer. DNA was extracted by phenol-chloroform protocol and leptin (G2548A) and leptin receptor genes (Q223R and K109R) polymorphisms were genotyped using real-time PCR method. Statistical analyses included longitudinal linear mixed-effect models. Adjusted longitudinal models showed that women carrying the G-allele of leptin gene's polymorphism began pregnancy with higher BP levels compared to the AA genotype and their levels remained higher throughout pregnancy and the postpartum period (β SBP = 4.5; 95% confidence interval (CI) = 1.0-8.0; P = 0.012; β DBP = 2.9; 95% CI = 0.1-5.8; P = 0.040). There was a significant interaction between leptin gene polymorphism and body mass index (BMI), in which the effect of BMI on increasing BP was steeper in women homozygous for the A-allele, compared with those who had at least one G-allele (β G-allele#BMI = -0.8; 95% CI = -1.5 to -0.1; P = 0.022). We did not find significant associations between leptin receptor polymorphisms and BP changes. The G-allele of leptin gene polymorphism (G2548A) was associated with increased BP levels during pregnancy and the postpartum. Furthermore, leptin polymorphism genotypes seem to modify the well-known effect of BMI on BP. © American Journal of Hypertension, Ltd 2016. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  9. Role of selected polymorphisms in determining muscle fiber composition in Japanese men and women.

    PubMed

    Kumagai, Hiroshi; Tobina, Takuro; Ichinoseki-Sekine, Noriko; Kakigi, Ryo; Tsuzuki, Takamasa; Zempo, Hirofumi; Shiose, Keisuke; Yoshimura, Eiichi; Kumahara, Hideaki; Ayabe, Makoto; Higaki, Yasuki; Yamada, Ryo; Kobayashi, Hiroyuki; Kiyonaga, Akira; Naito, Hisashi; Tanaka, Hiroaki; Fuku, Noriyuki

    2018-05-01

    Genetic polymorphisms and sex differences are suggested to affect muscle fiber composition; however, no study has investigated the effects of genetic polymorphisms on muscle fiber composition with respect to sex differences. Therefore, the present study examined the effects of genetic polymorphisms on muscle fiber composition with respect to sex differences in the Japanese population. The present study included 211 healthy Japanese individuals (102 men and 109 women). Muscle biopsies were obtained from the vastus lateralis to determine the proportion of myosin heavy chain (MHC) isoforms (MHC-I, MHC-IIa, and MHC-IIx). Moreover, we analyzed polymorphisms in α-actinin-3 gene ( ACTN3; rs1815739 ), angiotensin-converting enzyme gene ( ACE; rs4341 ), hypoxia-inducible factor 1 α gene ( rs11549465 ), vascular endothelial growth factor receptor 2 gene ( rs1870377 ), and angiotensin II receptor, type 2 gene ( rs11091046 ), by TaqMan single-nucleotide polymorphism genotyping assays. The proportion of MHC-I was 9.8% lower in men than in women, whereas the proportion of MHC-IIa and MHC-IIx was higher in men than in women (5.0 and 4.6%, respectively). Men with the ACTN3 RR + RX genotype had a 4.8% higher proportion of MHC-IIx than those with the ACTN3 XX genotype. Moreover, men with the ACE ID + DD genotype had a 4.7% higher proportion of MHC-I than those with the ACE II genotype. Furthermore, a combined genotype of ACTN3 R577X and ACE insertion/deletion (I/D) was significantly correlated with the proportion of MHC-I ( r = -0.23) and MHC-IIx ( r = 0.27) in men. In contrast, no significant correlation was observed between the examined polymorphisms and muscle fiber composition in women. These results suggest that the ACTN3 R577X and ACE I/D polymorphisms independently affect the proportion of human skeletal muscle fibers MHC-I and MHC-IIx in men but not in women. NEW & NOTEWORTHY In men, the RR + RX genotype of the α-actinin-3 gene ( ACTN3) R577X polymorphism was associated with a higher proportion of myosin heavy chain (MHC)-IIx. The ID + DD genotype of the angiotensin-converting enzyme gene ( ACE) insertion/deletion (I/D) polymorphism, in contrast to a previous finding, was associated with a higher proportion of MHC-I in men. In addition, the combined genotype of these polymorphisms was correlated with the proportion of MHC-I and MHC-IIx in men. Thus ACTN3 R577X and ACE I/D polymorphisms influence the muscle fiber composition in Japanese men.

  10. The rs738409 polymorphism of the PNPLA3 gene is associated with hepatic steatosis and fibrosis in Brazilian patients with chronic hepatitis C.

    PubMed

    Manchiero, Caroline; Nunes, Arielle Karen da Silva; Magri, Mariana Carvalheiro; Dantas, Bianca Peixoto; Mazza, Celso Carmo; Barone, Antonio Alci; Tengan, Fátima Mitiko

    2017-12-19

    Prospective studies have shown that 80% of acute hepatitis C virus (HCV) cases progress to chronic infection; approximately 10-20% of patients with these conditions will develop liver cirrhosis within 2 to 3 decades, and 1-5% will develop liver cancer. Some studies have indicated that the rs738409 polymorphism of the PNPLA3 gene is associated with steatosis and the progression of advanced fibrosis. This study assessed the contribution of the PNPLA3 rs738409 polymorphism with regard to the steatosis and degree of liver fibrosis in Brazilian patients diagnosed with chronic hepatitis C. A total of 290 patients were evaluated at the Clinics Hospital of the School of Medicine, University of São Paulo, between 2010 and 2015. The inclusion criteria were age ≥ 18 years and positive anti-HCV antibody and HCV RNA tests. The participants were evaluated based on medical consultation, blood tests, and liver biopsies conducted before specific antiviral therapies were applied. The associations between the rs738409 PNPLA3 gene polymorphism and steatosis and advanced fibrosis were tested under a recessive inheritance model using logistic regression analysis, including age, gender, BMI, ethnicity/color, HOMA-IR, alcohol intake, HCV genotype 3, and the rs58542926 TM6SF2 gene polymorphism as covariates. The mean age of the patients was 54.9 years old (range, 28 to 82 years), and 124 (42.8%) patients were male; 226 (77.9%) were white, 43 (14.8%) were pardo, and 21 (7.2%) were black Brazilians. Of the patients included in this study, 133 (45.9%) presented with the CC genotype, 63 (21.7%) with the CG genotype, and 94 (32.4%) with the GG genotype of the PNPLA3 gene I148M variant. We observed that the associations between PNPLA3 rs738409 GG genotype and steatosis was significant (OR: 2.16; 95% CI 1.26-3.72). The same genotype was associated to advanced fibrosis too (OR:2.64; 95% CI 1.26-5.53). Associations between the rs738409 polymorphism of the PNPLA3 gene genotype GG and hepatic steatosis and advanced fibrosis were observed. Studies are still needed to clarify the influence of these polymorphisms on hepatic steatosis and degree of fibrosis among individuals diagnosed with chronic hepatitis C.

  11. [Polymorphic loci and polymorphism analysis of short tandem repeats within XNP gene].

    PubMed

    Liu, Qi-Ji; Gong, Yao-Qin; Guo, Chen-Hong; Chen, Bing-Xi; Li, Jiang-Xia; Guo, Yi-Shou

    2002-01-01

    To select polymorphic short tandem repeat markers within X-linked nuclear protein (XNP) gene, genomic clones which contain XNP gene were recognized by homologous analysis with XNP cDNA. By comparing the cDNA with genomic DNA, non-exonic sequences were identified, and short tandem repeats were selected from non-exonic sequences by using BCM search Launcher. Polymorphisms of the short tandem repeats in Chinese population were evaluated by PCR amplification and PAGE. Five short tandem repeats were identified from XNP gene, two of which were polymorphic. Four and 11 alleles were observed in Chinese population for XNPSTR1 and XNPSTR4, respectively. Heterozygosities were 47% for XNPSTR1 and 70% for XNPSTR4. XNPSTR1 and XNPSTR4 localized within 3' end and intron 10, respectively. Two polymorphic short tandem repeats have been identified within XNP gene and will be useful for linkage analysis and gene diagnosis of XNP gene.

  12. Lack of Association between Interleukin-10 Gene Polymorphisms and Graft Rejection Risk in Kidney Transplantation Recipients: A Meta-Analysis

    PubMed Central

    Xiong, Jiachuan; Wang, Yiqin; Zhang, Ying; Nie, Ling; Wang, Daihong; Huang, Yunjian; Feng, Bing; Zhang, Jingbo; Zhao, Jinghong

    2015-01-01

    Background Interleukin-10 (IL-10) is an important immunomodulatory cytokine. Several studies focused the association between IL-10 promoter gene polymorphisms and graft rejection risk in kidney transplantation recipients. However, the results of these studies remain inconclusive. The aim of this study was to conduct a meta-analysis to further assess the associations. Methods The PubMed, Embase, and Ovid Medline databases were searched. Two independent authors extracted data, and the effects were estimated from an odds ratio (OR) with 95% confidence intervals (CIs). Subgroup and sensitivity analyses identified sources of heterogeneity. Results A total of 16 studies including 595 rejection patients and 1239 stable graft patients were included in order to study the IL-10 -1082 (rs1800896 G/A), -819 (rs1800871 C/T), -592 (rs1800872 C/A) and IL-10 (-1082,-819,-592) polymorphisms. The -1082 G/A polymorphism was not associated with an increased graft rejection risk (OR = 1.03; 95%CI, 0.85–1.25, P = 0.74 for GA+AA vs. GG model). Moreover, all of the -819 C/T (OR = 1.06, 95%CI, 0.79–1.42, P = 0.70 for TA+TT vs. CC model), -592 C/A (OR = 1.10, 95% CI, 0.85–1.42, P = 0.47 for AC+AA vs. CC model) and IL-10 (-1082,-819,-592) polymorphisms (OR = 1.00, 95%CI, 0.79–1.27, P = 0.98 for I+L vs. H model) did not increase the graft rejection risk. In addition, we also performed subgroup analysis by ethnic group (mainly in Europeans or Asians) and rejection type (acute or chronic). There was also lack of evidence of a significant association between the IL-10 gene polymorphism and graft rejection risk. The present meta-analysis indicated that the IL-10 gene polymorphism was not associated with graft rejection risk in kidney transplantation recipients. Conclusion This meta-analysis found evidence that the IL-10 polymorphism does not increase the risk of graft rejection in kidney transplantation recipients. Further chronic rejection and other ethnic population studies are needed to confirm our results. PMID:26035439

  13. Genetic basis of interindividual susceptibility to cancer cachexia: selection of potential candidate gene polymorphisms for association studies.

    PubMed

    Johns, N; Tan, B H; MacMillan, M; Solheim, T S; Ross, J A; Baracos, V E; Damaraju, S; Fearon, K C H

    2014-12-01

    Cancer cachexia is a complex and multifactorial disease. Evolving definitions highlight the fact that a diverse range of biological processes contribute to cancer cachexia. Part of the variation in who will and who will not develop cancer cachexia may be genetically determined. As new definitions, classifications and biological targets continue to evolve, there is a need for reappraisal of the literature for future candidate association studies. This review summarizes genes identified or implicated as well as putative candidate genes contributing to cachexia, identified through diverse technology platforms and model systems to further guide association studies. A systematic search covering 1986-2012 was performed for potential candidate genes / genetic polymorphisms relating to cancer cachexia. All candidate genes were reviewed for functional polymorphisms or clinically significant polymorphisms associated with cachexia using the OMIM and GeneRIF databases. Pathway analysis software was used to reveal possible network associations between genes. Functionality of SNPs/genes was explored based on published literature, algorithms for detecting putative deleterious SNPs and interrogating the database for expression of quantitative trait loci (eQTLs). A total of 154 genes associated with cancer cachexia were identified and explored for functional polymorphisms. Of these 154 genes, 119 had a combined total of 281 polymorphisms with functional and/or clinical significance in terms of cachexia associated with them. Of these, 80 polymorphisms (in 51 genes) were replicated in more than one study with 24 polymorphisms found to influence two or more hallmarks of cachexia (i.e., inflammation, loss of fat mass and/or lean mass and reduced survival). Selection of candidate genes and polymorphisms is a key element of multigene study design. The present study provides a contemporary basis to select genes and/or polymorphisms for further association studies in cancer cachexia, and to develop their potential as susceptibility biomarkers of cachexia.

  14. Gene Presence-Absence Polymorphism in Castrating Anther-Smut Fungi: Recent Gene Gains and Phylogeographic Structure.

    PubMed

    Hartmann, Fanny E; Rodríguez de la Vega, Ricardo C; Brandenburg, Jean-Tristan; Carpentier, Fantin; Giraud, Tatiana

    2018-04-01

    Gene presence-absence polymorphisms segregating within species are a significant source of genetic variation but have been little investigated to date in natural populations. In plant pathogens, the gain or loss of genes encoding proteins interacting directly with the host, such as secreted proteins, probably plays an important role in coevolution and local adaptation. We investigated gene presence-absence polymorphism in populations of two closely related species of castrating anther-smut fungi, Microbotryum lychnidis-dioicae (MvSl) and M. silenes-dioicae (MvSd), from across Europe, on the basis of Illumina genome sequencing data and high-quality genome references. We observed presence-absence polymorphism for 186 autosomal genes (2% of all genes) in MvSl, and only 51 autosomal genes in MvSd. Distinct genes displayed presence-absence polymorphism in the two species. Genes displaying presence-absence polymorphism were frequently located in subtelomeric and centromeric regions and close to repetitive elements, and comparison with outgroups indicated that most were present in a single species, being recently acquired through duplications in multiple-gene families. Gene presence-absence polymorphism in MvSl showed a phylogeographic structure corresponding to clusters detected based on SNPs. In addition, gene absence alleles were rare within species and skewed toward low-frequency variants. These findings are consistent with a deleterious or neutral effect for most gene presence-absence polymorphism. Some of the observed gene loss and gain events may however be adaptive, as suggested by the putative functions of the corresponding encoded proteins (e.g., secreted proteins) or their localization within previously identified selective sweeps. The adaptive roles in plant and anther-smut fungi interactions of candidate genes however need to be experimentally tested in future studies.

  15. Gene Presence–Absence Polymorphism in Castrating Anther-Smut Fungi: Recent Gene Gains and Phylogeographic Structure

    PubMed Central

    Rodríguez de la Vega, Ricardo C; Brandenburg, Jean-Tristan; Carpentier, Fantin; Giraud, Tatiana

    2018-01-01

    Abstract Gene presence–absence polymorphisms segregating within species are a significant source of genetic variation but have been little investigated to date in natural populations. In plant pathogens, the gain or loss of genes encoding proteins interacting directly with the host, such as secreted proteins, probably plays an important role in coevolution and local adaptation. We investigated gene presence–absence polymorphism in populations of two closely related species of castrating anther-smut fungi, Microbotryum lychnidis-dioicae (MvSl) and M. silenes-dioicae (MvSd), from across Europe, on the basis of Illumina genome sequencing data and high-quality genome references. We observed presence–absence polymorphism for 186 autosomal genes (2% of all genes) in MvSl, and only 51 autosomal genes in MvSd. Distinct genes displayed presence–absence polymorphism in the two species. Genes displaying presence–absence polymorphism were frequently located in subtelomeric and centromeric regions and close to repetitive elements, and comparison with outgroups indicated that most were present in a single species, being recently acquired through duplications in multiple-gene families. Gene presence–absence polymorphism in MvSl showed a phylogeographic structure corresponding to clusters detected based on SNPs. In addition, gene absence alleles were rare within species and skewed toward low-frequency variants. These findings are consistent with a deleterious or neutral effect for most gene presence–absence polymorphism. Some of the observed gene loss and gain events may however be adaptive, as suggested by the putative functions of the corresponding encoded proteins (e.g., secreted proteins) or their localization within previously identified selective sweeps. The adaptive roles in plant and anther-smut fungi interactions of candidate genes however need to be experimentally tested in future studies. PMID:29722826

  16. Analysis of Oxidative Stress Status, Catalase and Catechol-O-Methyltransferase Polymorphisms in Egyptian Vitiligo Patients

    PubMed Central

    Mehaney, Dina A.; Darwish, Hebatallah A.; Hegazy, Rehab A.; Nooh, Mohammed M.; Tawdy, Amira M.; Gawdat, Heba I.; El-Sawalhi, Maha M.

    2014-01-01

    Vitiligo is the most common depigmentation disorder of the skin. Oxidative stress is implicated as one of the probable events involved in vitiligo pathogenesis possibly contributing to melanocyte destruction. Evidence indicates that certain genes including those involved in oxidative stress and melanin synthesis are crucial for development of vitiligo. This study evaluates the oxidative stress status, the role of catalase (CAT) and catechol-O-Methyltransferase (COMT) gene polymorphisms in the etiology of generalized vitiligo in Egyptians. Total antioxidant capacity (TAC) and malondialdehyde (MDA) levels as well as CAT exon 9 T/C and COMT 158 G/A polymorphisms were determined in 89 patients and 90 age and sex-matched controls. Our results showed significantly lower TAC along with higher MDA levels in vitiligo patients compared with controls. Meanwhile, genotype and allele distributions of CAT and COMT polymorphisms in cases were not significantly different from those of controls. Moreover, we found no association between both polymorphisms and vitiligo susceptibility. In conclusion, the enhanced oxidative stress with the lack of association between CAT and COMT polymorphisms and susceptibility to vitiligo in our patients suggest that mutations in other genes related to the oxidative pathway might contribute to the etiology of generalized vitiligo in Egyptian population. PMID:24915010

  17. Gene-Environment Interactions in Asthma: Genetic and Epigenetic Effects.

    PubMed

    Lee, Jong-Uk; Kim, Jeong Dong; Park, Choon-Sik

    2015-07-01

    Over the past three decades, a large number of genetic studies have been aimed at finding genetic variants associated with the risk of asthma, applying various genetic and genomic approaches including linkage analysis, candidate gene polymorphism studies, and genome-wide association studies (GWAS). However, contrary to general expectation, even single nucleotide polymorphisms (SNPs) discovered by GWAS failed to fully explain the heritability of asthma. Thus, application of rare allele polymorphisms in well defined phenotypes and clarification of environmental factors have been suggested to overcome the problem of 'missing' heritability. Such factors include allergens, cigarette smoke, air pollutants, and infectious agents during pre- and post-natal periods. The first and simplest interaction between a gene and the environment is a candidate interaction of both a well known gene and environmental factor in a direct physical or chemical interaction such as between CD14 and endotoxin or between HLA and allergens. Several GWAS have found environmental interactions with occupational asthma, aspirin exacerbated respiratory disease, tobacco smoke-related airway dysfunction, and farm-related atopic diseases. As one of the mechanisms behind gene-environment interaction is epigenetics, a few studies on DNA CpG methylation have been reported on subphenotypes of asthma, pitching the exciting idea that it may be possible to intervene at the junction between the genome and the environment. Epigenetic studies are starting to include data from clinical samples, which will make them another powerful tool for re-search on gene-environment interactions in asthma.

  18. The Evaluation of IL6 and ESR1 Gene Polymorphisms in Primary Dysmenorrhea.

    PubMed

    Ozsoy, Asker Zeki; Karakus, Nevin; Yigit, Serbulent; Cakmak, Bulent; Nacar, Mehmet Can; Yılmaz Dogru, Hatice

    2016-01-01

    Primary dysmenorrhea is the most common gynecological complaint with painful menstrual cramps in pelvis without any pathology. It affects about half of menstruating women, and it causes significant disruption in quality of life. We investigated the association between IL6 gene promoter and ESR1 gene XbaI and PvuII polymorphisms and primary dysmenorrhea. In this case-control study, 152 unrelated young women with primary dysmenorrhea and 150 unrelated healthy age-matched controls participated. Genomic DNA was isolated and IL6 and ESR1 gene polymorphisms were genotyped using PCR-based RFLP assay. The distribution of genotype and allele frequencies of IL6 gene promoter and ESR1 gene XbaI polymorphisms were not statistically different between patients and controls (p > 0.05). However, the genotype and allele frequencies of ESR1 gene PvuII polymorphism showed statistically significant differences between primary dysmenorrhea patients and controls (p = 0.009 and p = 0.021, respectively). Statistically significant associations were also observed between age and married status of primary dysmenorrhea patients and ESR1 gene PvuII polymorphism (p = 0.044 and p = 0.023, respectively). In combined genotype analyses, AG at ESR1 XbaI and TC at ESR1 PvuII loci encoded a p-value of 0.027. Thus, individuals who are heterozygote at both loci have a lower risk of developing primary dysmenorrhea. Our study suggests no strong association between IL6 gene promoter and ESR1 gene XbaI polymorphisms and primary dysmenorrhea in Turkish women. However, ESR1 gene PvuII polymorphism showed statistically significant differences between primary dysmenorrhea patients and controls. The potential association between ESR1 gene PvuII polymorphism and age and married status of dysmenorrhea patients deserves further consideration.

  19. Association of aldose reductase gene polymorphism (C-106T) in susceptibility of diabetic peripheral neuropathy among north Indian population.

    PubMed

    Gupta, Balram; Singh, S K

    2017-07-01

    Polymorphism in aldose reductase (ALR) gene at nucleotide C(-106)T (rs759853) in the promoter region is associated with susceptibility to development of diabetic peripheral neuropathy. The aim of this study was to detect the association of the C (-106)T polymorphism of ALR gene and its frequency among patients with type 2 diabetes mellitus with and without peripheral neuropathy. The study subjects were divided into three groups. Group I included 356 patients with diabetes having peripheral neuropathy. Group II included 294 patients with diabetes without peripheral neuropathy and group III included 181 healthy subjects. Genotyping of ALR C(-106)T SNPs was performed using polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) and direct sequencing methods. The genetic risk among the groups was compared and tested by calculating odds ratio with 95% class interval. ALR 106TT genotype was significantly higher in group I compared to group II with an odds ratio of 2.12 (95% CI: 1.22-3.67; p<0.01). Recessive model (CC+CT vs. TT), as well as T allele distribution also showed significant association to develop neuropathy with relative risk of 1.97 (95% CI: 1.16-3.35; p<0.01) and 1.36 (95% CI: 1.07-1.72; p=0.01) respectively. In conclusion, the ALR C-106T polymorphism was associated with higher risk of peripheral neuropathy in patients with type 2 diabetes mellitus. Copyright © 2017 Elsevier Inc. All rights reserved.

  20. Human 8-oxoguanine DNA glycosylase gene polymorphism (Ser326Cys) and cancer risk: updated meta-analysis

    PubMed Central

    Park, Hae Jeong; Chung, Joo-Ho; Ban, Ju Yeon

    2017-01-01

    Genetic polymorphism of human 8-oxoguanine glycosylase 1 (hOGG1) has been reported to have a relationship with the risk of the development of various cancers. Many studies have described the influence of Ser326Cys polymorphism of the hOGG1 gene on cancer susceptibility. However, the results have remained inconclusive and controversial. Therefore, we performed a meta-analysis to more precisely determine the relationship between the hOGG1 polymorphism and the development of cancer. Electronic databases including PubMed, Embase, Google Scholar, and the Korean Studies Information Service System (KISS) were searched. The odds ratio (OR), 95% confidence interval (CI), and p value were calculated to assess the strength of the association with the risk of cancer using Comprehensive Meta-analysis software (Corporation, NJ, USA). The 127 studies including 38,757 cancer patients and 50,177 control subjects were analyzed for the meta-analysis. Our meta-analysis revealed that G allele of Ser326Cys polymorphism of the hOGG1 gene statistically increased the susceptibility of cancer (all population, OR = 1.092, 95% CI = 1.051-1.134, p < 0.001; in Asian, OR = 1.095, 95% CI = 1.048-1.145, p < 0.001; in Caucasian, OR = 1.097, 95% CI = 1.033-1.179, p = 0.002). Also, other genotype models showed significant association with cancer (p < 0.05, respectively). The present meta-analysis concluded that the G allele was associated with an increased risk of cancer. It suggested that the hOGG1 polymorphism may be a candidate marker of cancer. PMID:28415770

  1. [Association of estrogen receptor gene polymorphism with cerebral infarction, a case-control study].

    PubMed

    Zhang, Yan; Xie, Ruping; Wang, Yinhua; Chen, Dafang; Wang, Guoying; Xu, Xiping

    2002-11-10

    To explore the association between estrogen receptor (ER) gene PvuII and XbaI polymorphisms and cerebral infarction among Chinese Han people. Samples of peripheral blood white cell were extracted among 234 patients with cerebral infarction, aged 63.9 +/- 10.3, and 259 controls without cerebrovascular disease, aged 59.2 +/- 9.2, all of Chinese Han nationality. PCR-RFLP and genotyping of ER PvuII and XbaI polymorphisms were performed. Multiple Logistic regression analysis was made to explore the risk factors for cerebral infarction. After adjustment for major confounders including age, gender, smoking, alcohol drinking, education, history of hypertension, diabetes mellitus, coronary artery disease and hyperlipoidemia, multiple Logistic regression analysis showed that: (1) The Pp genotype of ER PvuII polymorphism increased the risk of cerebral infarction significantly (OR = 1.97, 95% CI: 1.21 - 3.21); (2) The ER XbaI polymorphism was not in association with cerebral infarction significantly; (3) The PPXx/Ppxx genotypes increased the risk of cerebral infarction significantly (OR = 1.67, 2.52 and 2.18 respectively, P < 0.05) before or after all subjects were stratified by the history of hypertension or hyperlipoidemia; and (4) The positive interaction between the ER PvuII polymorphism and the presence of hypertension or diabetes or hyperlipoidemia could increase the risk of cerebral infarction significantly. ER gene may be one of the genetic candidate genes for cerebral infarction among Chinese Han population.

  2. Selection with Gene-Cytoplasm Interactions. I. Maintenance of Cytoplasm Polymorphisms

    PubMed Central

    Gregorius, H. R.; Ross, M. D.

    1984-01-01

    General conditions for the protectedness of gene-cytoplasm polymorphisms are considered for a biallelic model with two cytoplasm types and under the assumption that nuclear polymorphisms cannot be maintained in the presence of only one cytoplasm type. Analytical results involving male fertilities, female fertilities, viabilities and selfing rates are obtained, and numerical results show spiral and cyclic behavior of population trajectories. It is shown that a maternally inherited cytoplasmic polymorphism cannot be maintained in the absence of a nuclear polymorphism, and that a gene-cytoplasm polymorphism can only be maintained if the population shows sexual asymmetry, i.e. , if the ratio of male to female fertility varies among genotypes. Thus, the classical viability selection model does not allow gene-cytoplasm polymorphisms. PMID:17246213

  3. Genetic models of homosexuality: generating testable predictions

    PubMed Central

    Gavrilets, Sergey; Rice, William R

    2006-01-01

    Homosexuality is a common occurrence in humans and other species, yet its genetic and evolutionary basis is poorly understood. Here, we formulate and study a series of simple mathematical models for the purpose of predicting empirical patterns that can be used to determine the form of selection that leads to polymorphism of genes influencing homosexuality. Specifically, we develop theory to make contrasting predictions about the genetic characteristics of genes influencing homosexuality including: (i) chromosomal location, (ii) dominance among segregating alleles and (iii) effect sizes that distinguish between the two major models for their polymorphism: the overdominance and sexual antagonism models. We conclude that the measurement of the genetic characteristics of quantitative trait loci (QTLs) found in genomic screens for genes influencing homosexuality can be highly informative in resolving the form of natural selection maintaining their polymorphism. PMID:17015344

  4. Characterization of a Canine Tetranucleotide Microsatellite Marker Located in the First Intron of the Tumor Necrosis Factor Alpha Gene

    PubMed Central

    WATANABE, Masashi; TANAKA, Kazuaki; TAKIZAWA, Tatsuya; SEGAWA, Kazuhito; NEO, Sakurako; TSUCHIYA, Ryo; MURATA, Michiko; MURAKAMI, Masaru; HISASUE, Masaharu

    2013-01-01

    ABSTRACT A polymorphic tetranucleotide (GAAT)n microsatellite in the first intron of the canine tumor necrosis factor alpha (TNFA) gene was characterized in this study; 139 dogs were analyzed: 22 Beagles, 26 Chihuahuas, 20 Miniature Dachshunds, 24 Miniature Poodles, 22 Pembroke Welsh Corgis and 25 Shiba Inus. We detected the presence of the 4 alleles (GAAT)5, (GAAT)6, (GAAT)7 and (GAAT)8, including 9 of the 10 expected genotypes. The expected heterozygosity (He) and the polymorphic information content (PIC) value of this microsatellite locus varied from 0.389 to 0.749 and from 0.333 to 0.682, respectively, among the 6 breeds. The allelic frequency differed greatly among breeds, but this microsatellite marker was highly polymorphic and could be a useful marker for the canine TNFA gene. PMID:24042337

  5. Characterization of a canine tetranucleotide microsatellite marker located in the first intron of the tumor necrosis factor alpha gene.

    PubMed

    Watanabe, Masashi; Tanaka, Kazuaki; Takizawa, Tatsuya; Segawa, Kazuhito; Neo, Sakurako; Tsuchiya, Ryo; Murata, Michiko; Murakami, Masaru; Hisasue, Masaharu

    2014-01-01

    A polymorphic tetranucleotide (GAAT)n microsatellite in the first intron of the canine tumor necrosis factor alpha (TNFA) gene was characterized in this study; 139 dogs were analyzed: 22 Beagles, 26 Chihuahuas, 20 Miniature Dachshunds, 24 Miniature Poodles, 22 Pembroke Welsh Corgis and 25 Shiba Inus. We detected the presence of the 4 alleles (GAAT)5, (GAAT)6, (GAAT)7 and (GAAT)8, including 9 of the 10 expected genotypes. The expected heterozygosity (He) and the polymorphic information content (PIC) value of this microsatellite locus varied from 0.389 to 0.749 and from 0.333 to 0.682, respectively, among the 6 breeds. The allelic frequency differed greatly among breeds, but this microsatellite marker was highly polymorphic and could be a useful marker for the canine TNFA gene.

  6. Associations between oxytocin receptor gene (OXTR) polymorphisms and self-reported aggressive behavior and anger: Interactions with alcohol consumption.

    PubMed

    Johansson, Ada; Westberg, Lars; Sandnabba, Kenneth; Jern, Patrick; Salo, Benny; Santtila, Pekka

    2012-09-01

    Oxytocin has been implicated in the regulation of social as well as aggressive behaviors, and in a recent study we found that the effect of alcohol on aggressive behavior was moderated by the individual's genotype on an oxytocin receptor gene (OXTR) polymorphism (Johansson et al., 2012). In this study we wanted to deepen and expand the analysis by exploring associations between three (rs1488467, rs4564970, rs1042778) OXTR polymorphisms and aggressive behavior, trait anger as well as anger control in a population-based sample of Finnish men and women (N=3577) aged between 18 and 49 years (M=26.45 years, SD=5.02). A specific aim was to investigate if the polymorphisms would show interactive effects with alcohol consumption on aggressive behavior and trait anger, as well as to explore whether these polymorphisms affect differences in anger control between self-reported sober and intoxicated states. The results showed no main effects of the polymorphisms, however, three interactions between the polymorphisms and alcohol consumption were found. The effect of alcohol consumption on aggressive behavior was moderated by the genotype of the individual on the rs4564970 polymorphism, in line with previous results (Johansson et al., 2012). For trait anger, both the rs1488467 and the rs4564970 polymorphisms interacted with alcohol consumption. It appears that the region of the OXTR gene including both the rs4564970 and the rs1488467 polymorphisms may be involved in the regulation of the relationship between alcohol and aggressive behavior as well as between alcohol and the propensity to react to situations with elevated levels of anger. Copyright © 2012 Elsevier Ltd. All rights reserved.

  7. The Joint Effects of Body Mass Index and MAOA Gene Polymorphism on Depressive Symptoms.

    PubMed

    Liu, Yangyang

    2015-07-01

    The objective of the present study was to examine the joint effects of the body mass index and the MAOA gene polymorphism on depressive symptoms. In two independent Chinese samples, we measured adolescents' depressive symptoms and body mass index and collected their DNA. The results indicated that the main effects of the MAOA gene polymorphism on depressive symptoms were significant. However, the main effects of body mass index and the interaction of the MAOA gene polymorphism and body mass index on depressive symptoms were not significant. By using Chinese adolescents, this study confirmed that the MAOA gene polymorphism directly influenced adolescents' depressive symptoms.

  8. GSTT1 and GSTM1 gene polymorphisims in sarcoidosis.

    PubMed

    Coskun, Funda; Karkucak, Mutlu; Yilmaz, Dilber; Yakut, Tahsin; Uzaslan, Esra

    2016-10-07

    Sarcoidosis is a granulomatous disease of unknown cause, which affects all systems, especially the lungs and the lymphatic system. Genetic and environmental factors are held accountable for the etiology. Based on the general opinion, sarcoidosis develops after exposure to a specific environmental agent by genetically susceptible individuals.  The present study aimed to evaluate the disease susceptibility of the GSTT1 and GSTM1 gene polymorphisms in the patients with sarcoidosis. The present study included 78 patients; 38 patients with histopathologically verified sarcoidosis and 40 control subjects. Multiplex PCR method was used to determine the GSTT1 and GSTM1 gene polymorphisms. The genotype was determined based on the bands formed in the agarose gel electrophoresis. The statistical analysis was done using the chi-square test. The positive/negative genotype rates were 79%/21% and 53%/47%, respectively in the case group for the GSTT1 and GSTM1 gene polymorphisms, whereas the positive/negative genotype rates were 77%/23% and 55%/45% in the control group. There was no statistically significant difference in the positive and negative genotypes compared with the case group and the control group for the GSTT1 and GSTM1 gene polymorphisms (p > 0.05). The results from the present study suggest that there is not any association with the control group for the disease susceptibility of the GSTT1 and GSTM1 gene polymorphisms in patients with sarcoidosis, and this result should be supported by large-scale studies because of the limited number of cases in the present study.

  9. Interaction between serotonin transporter and serotonin receptor 1 B genes polymorphisms may be associated with antisocial alcoholism.

    PubMed

    Wang, Tzu-Yun; Lee, Sheng-Yu; Chen, Shiou-Lan; Chang, Yun-Hsuan; Chen, Shih-Heng; Chu, Chun-Hsien; Huang, San-Yuan; Tzeng, Nian-Sheng; Wang, Chen-Lin; Lee, I Hui; Yeh, Tzung Lieh; Yang, Yen Kuang; Lu, Ru-Band

    2012-07-11

    Several studies have hypothesized that genes regulating the components of the serotonin system, including serotonin transporter (5-HTTLPR) and serotonin 1 B receptor (5-HT1B), may be associated with alcoholism, but their results are contradictory because of alcoholism's heterogeneity. Therefore, we examined whether the 5-HTTLPR gene and 5-HT1B gene G861C polymorphism are susceptibility factors for a specific subtype of alcoholism, antisocial alcoholism in Han Chinese in Taiwan. We recruited 273 Han Chinese male inmates with antisocial personality disorder (ASPD) [antisocial alcoholism (AS-ALC) group (n=120) and antisocial non-alcoholism (AS-N-ALC) group (n=153)] and 191 healthy male controls from the community. Genotyping was done using PCR-RFLP. There were no significant differences in the genotypic frequency of the 5-HT1B G861C polymorphism between the 3 groups. Although AS-ALC group members more frequently carried the 5-HTTLPR S/S, S/LG, and LG/LG genotypes than controls, the difference became non-significant after controlling for the covarying effects of age. However, the 5-HTTLPR S/S, S/LG, and LG/LG genotypes may have interacted with the 5-HT1B G861C C/C polymorphism and increased the risk of becoming antisocial alcoholism. Our study suggests that neither the 5-HTTLPR gene nor the 5-HT1B G861C polymorphism alone is a risk factor for antisocial alcoholism in Taiwan's Han Chinese population, but that the interaction between both genes may increase susceptibility to antisocial alcoholism.

  10. Analysis of -1082 IL-10 gene polymorphism in Iranian patients with generalized aggressive periodontitis.

    PubMed

    Mellati, Ehsan; Arab, Hamid R; Tavakkol-Afshari, Jalil; Ebadian, Ahmad R; Radvar, Mehrdad

    2007-11-01

    Periodontitis is a multifactorial disease and its severe forms, such as aggressive periodontitis, are suggested to have a genetic basis. Among the genetic factors, polymorphisms in cytokine genes have recently been described in susceptibility to periodontitis. IL-10 is a multi-functional cytokine thought to play a role in the pathogenesis of periodontitis. A substitution G/A polymorphism in the promoter region of the IL-10 gene at position -1082 has been associated with different amounts of IL-10 production. The aim of the present study was to investigate the possible links between -1082(G/A) polymorphism of the IL-10 gene and the generalized form of aggressive periodontitis. This study included 52 Iranian Khorasanian (north-east province of Iran) subjects suffering from generalized aggressive periodontitis referred to the Periodontology Department of Mashhad Dental School. They were compared to 61 age and sex-matched healthy controls of the same race. DNA was isolated from peripheral blood cells and genotyping was performed by means of the amplification refractory mutation system polymerase chain reaction (ARMS-PCR) method. Data were analyzed using the chi-squared test. There was no marked difference in genotype frequencies between the controls and generalized aggressive periodontitis patients (p=0.585). Moreover, no association between patients and normal subjects was found in their allele frequency (p=0.329). We conclude that the polymorphic nucleotide A at position -1082 of the IL-10 gene is not associated with generalized aggressive periodontitis in the Iranian population.

  11. Tumor necrosis factor-alpha and interleukin-4 gene polymorphisms in Chinese patients with gout.

    PubMed

    Chen, M-L; Tsai, F-J; Tsai, C-H; Huang, C-M

    2007-01-01

    The purpose of this study was to examine whether polymorphisms of interleukin-4 (IL-4) (promoter-590 and intron 3) and tumor necrosis factor-alpha (TNF-alpha) promoter-308 genes are markers of susceptibility to or clinical manifestations of gout in Taiwanese patients. The study included 196 Taiwanese patients with gout and 103 unrelated healthy control subjects living in central Taiwan. Polymorphisms of the IL-4 (promoter-590 and intron 3) and TNF-alpha (promoter-308) genes were typed from genomic DNA. Allelic frequencies and carriage rates were then compared between gout patients and control subjects. The correlation between allelic frequencies, carriage rates and clinical manifestations of gout were evaluated. No significant differences were observed in the allelic frequencies and carriage rates of the IL-4 (promoter-590 and intron 3) and TNF-alpha gene polymorphisms between patients with gout and healthy control subjects. Furthermore, the IL-4 (promoter-590 and intron 3) and TNF-alpha genotypes were not found to be associated with the clinical and laboratory profiles in gout patients. However, there was a significant difference in the TNF-alphapolymorphism genotype between patients with and without hypertriglyceridemia (P=0.001, xi2=11.47, OR=10.3, 95%CI=3.57-29.7). The results of our study suggest that polymorphisms of the IL-4 (promoter-590 and intron 3) and TNF-alpha promoter-308 genes are not related to gout in Chinese patients in Taiwan.

  12. The effect of RFC G80A polymorphism in Cretan children with acute lymphoblastic leukemia and its interaction with MTHFR C677T and A1298C polymorphisms.

    PubMed

    Karathanasis, N V; Stiakaki, E; Goulielmos, G Ν; Kalmanti, M

    2014-08-01

    The association between the risk of acute lymphoblastic leukemia (ALL) in children and enzymes involved in the folate metabolism has been under investigation lately. The reduced folate carrier gene (RFC) encodes reduced folate carrier, a protein that transports into the cell both folate and methotrexate, a commonly used chemotherapeutic drug, has been proved polymorphic at position 80 (G→A). The role of this polymorphism in childhood ALL and its interaction with other enzymes of the folate metabolic pathway, including MTHFR, has been examined in different populations with diverse results. In the present case-control study, 35 children with ALL and 48 healthy adult blood donors, all originating from the island of Crete (Greece), were screened for the presence of the RFC G80A polymorphism, using PCR/RFLP techniques. The effect on ALL risk and methotrexate-induced toxicities, along with the role of gene-gene interactions in our population, were examined. No significant association was observed between the RFC G80A genotypes and either the development of ALL or the presence of adverse events. However, a significant association was detected between the MTHFR A1298C/ RFC G80A genotype and a nonpredisposition for ALL (P = 0.035). This study suggests that gene-gene interactions in childhood ALL may be of prognostic value in our population. © 2013 John Wiley & Sons Ltd.

  13. Clinical response to chemotherapy in locally advanced breast cancer was not associated with several polymorphisms in detoxification enzymes and DNA repair genes.

    PubMed

    Saadat, Mostafa; Khalili, Maryam; Nasiri, Meysam; Rajaei, Mehrdad; Omidvari, Shahpour; Saadat, Iraj

    2012-03-02

    The main aim of the present study was to investigate the association between several genetic polymorphisms (in glutathione S-transferase members and DNA repair genes) and clinical response to chemotherapy in locally advanced breast cancer. A sequential series of 101 patients were prospectively included in this study. Clinical assessment of treatment was accomplished by comparing initial tumor size with preoperative tumor size using revised RECIST guideline (version 1.1). Clinical response was regarded as a response or no response. There was no difference between non-responders and responders for the prevalence of genotypes of the study polymorphisms. Copyright © 2012 Elsevier Inc. All rights reserved.

  14. Processing and population genetic analysis of multigenic datasets with ProSeq3 software.

    PubMed

    Filatov, Dmitry A

    2009-12-01

    The current tendency in molecular population genetics is to use increasing numbers of genes in the analysis. Here I describe a program for handling and population genetic analysis of DNA polymorphism data collected from multiple genes. The program includes a sequence/alignment editor and an internal relational database that simplify the preparation and manipulation of multigenic DNA polymorphism datasets. The most commonly used DNA polymorphism analyses are implemented in ProSeq3, facilitating population genetic analysis of large multigenic datasets. Extensive input/output options make ProSeq3 a convenient hub for sequence data processing and analysis. The program is available free of charge from http://dps.plants.ox.ac.uk/sequencing/proseq.htm.

  15. Transposon Variants and Their Effects on Gene Expression in Arabidopsis

    PubMed Central

    Wang, Xi; Weigel, Detlef; Smith, Lisa M.

    2013-01-01

    Transposable elements (TEs) make up the majority of many plant genomes. Their transcription and transposition is controlled through siRNAs and epigenetic marks including DNA methylation. To dissect the interplay of siRNA–mediated regulation and TE evolution, and to examine how TE differences affect nearby gene expression, we investigated genome-wide differences in TEs, siRNAs, and gene expression among three Arabidopsis thaliana accessions. Both TE sequence polymorphisms and presence of linked TEs are positively correlated with intraspecific variation in gene expression. The expression of genes within 2 kb of conserved TEs is more stable than that of genes next to variant TEs harboring sequence polymorphisms. Polymorphism levels of TEs and closely linked adjacent genes are positively correlated as well. We also investigated the distribution of 24-nt-long siRNAs, which mediate TE repression. TEs targeted by uniquely mapping siRNAs are on average farther from coding genes, apparently because they more strongly suppress expression of adjacent genes. Furthermore, siRNAs, and especially uniquely mapping siRNAs, are enriched in TE regions missing in other accessions. Thus, targeting by uniquely mapping siRNAs appears to promote sequence deletions in TEs. Overall, our work indicates that siRNA–targeting of TEs may influence removal of sequences from the genome and hence evolution of gene expression in plants. PMID:23408902

  16. A Genomics-Based Model for Prediction of Severe Bioprosthetic Mitral Valve Calcification.

    PubMed

    Ponasenko, Anastasia V; Khutornaya, Maria V; Kutikhin, Anton G; Rutkovskaya, Natalia V; Tsepokina, Anna V; Kondyukova, Natalia V; Yuzhalin, Arseniy E; Barbarash, Leonid S

    2016-08-31

    Severe bioprosthetic mitral valve calcification is a significant problem in cardiovascular surgery. Unfortunately, clinical markers did not demonstrate efficacy in prediction of severe bioprosthetic mitral valve calcification. Here, we examined whether a genomics-based approach is efficient in predicting the risk of severe bioprosthetic mitral valve calcification. A total of 124 consecutive Russian patients who underwent mitral valve replacement surgery were recruited. We investigated the associations of the inherited variation in innate immunity, lipid metabolism and calcium metabolism genes with severe bioprosthetic mitral valve calcification. Genotyping was conducted utilizing the TaqMan assay. Eight gene polymorphisms were significantly associated with severe bioprosthetic mitral valve calcification and were therefore included into stepwise logistic regression which identified male gender, the T/T genotype of the rs3775073 polymorphism within the TLR6 gene, the C/T genotype of the rs2229238 polymorphism within the IL6R gene, and the A/A genotype of the rs10455872 polymorphism within the LPA gene as independent predictors of severe bioprosthetic mitral valve calcification. The developed genomics-based model had fair predictive value with area under the receiver operating characteristic (ROC) curve of 0.73. In conclusion, our genomics-based approach is efficient for the prediction of severe bioprosthetic mitral valve calcification.

  17. A Genomics-Based Model for Prediction of Severe Bioprosthetic Mitral Valve Calcification

    PubMed Central

    Ponasenko, Anastasia V.; Khutornaya, Maria V.; Kutikhin, Anton G.; Rutkovskaya, Natalia V.; Tsepokina, Anna V.; Kondyukova, Natalia V.; Yuzhalin, Arseniy E.; Barbarash, Leonid S.

    2016-01-01

    Severe bioprosthetic mitral valve calcification is a significant problem in cardiovascular surgery. Unfortunately, clinical markers did not demonstrate efficacy in prediction of severe bioprosthetic mitral valve calcification. Here, we examined whether a genomics-based approach is efficient in predicting the risk of severe bioprosthetic mitral valve calcification. A total of 124 consecutive Russian patients who underwent mitral valve replacement surgery were recruited. We investigated the associations of the inherited variation in innate immunity, lipid metabolism and calcium metabolism genes with severe bioprosthetic mitral valve calcification. Genotyping was conducted utilizing the TaqMan assay. Eight gene polymorphisms were significantly associated with severe bioprosthetic mitral valve calcification and were therefore included into stepwise logistic regression which identified male gender, the T/T genotype of the rs3775073 polymorphism within the TLR6 gene, the C/T genotype of the rs2229238 polymorphism within the IL6R gene, and the A/A genotype of the rs10455872 polymorphism within the LPA gene as independent predictors of severe bioprosthetic mitral valve calcification. The developed genomics-based model had fair predictive value with area under the receiver operating characteristic (ROC) curve of 0.73. In conclusion, our genomics-based approach is efficient for the prediction of severe bioprosthetic mitral valve calcification. PMID:27589735

  18. Lymphotoxin-Alpha Gene Polymorphism +252A/G (rs909253, A/G) Is Associated with Susceptibility to Chronic Periodontitis: A Pilot Study

    PubMed Central

    Vasconcelos, Daniel Fernando Pereira; da Silva, Marco Antônio Dias; Marques, Marcelo Rocha; de Brito Júnior, Rui Barbosa; Vasconcelos, Any Carolina Cardoso Guimarães; Barros, Silvana Pereira

    2012-01-01

    Background. Periodontal disease leading to clinical findings such as increased periodontal probing depth involves a complex interaction between invading pathogenic microorganisms and the patient's immune system. Lymphotoxin alpha (LT-α) is a potent multifunctional immune modulator that contributes toward susceptibility to immune regulation disorders, including periodontal disease. Objective. In this study, we tested the hypothesis that chronic periodontitis (CP) is associated with polymorphisms of the LT-α gene. Materials and Methods. A total of 126 subjects, 44 healthy subjects, and 82 subjects with CP, were evaluated for periodontal disease by measuring clinical attachment loss and separation. Samples of epithelial cells were obtained for DNA analysis by scraping of the buccal mucosa. The LT-α gene was analyzed by polymerase chain reaction followed by endonuclease digestion with NcoI to analyze restriction fragment length polymorphisms. Results. The LT-α gene (+252A/G) polymorphism was associated with CP. LT-α allele frequencies were significantly different (P = 0.0019) between patients with CP and healthy individuals, with an odds ratio of 2.67 for patients with CP with the G allele. Conclusions. These findings suggest the LT-α gene genotype is a risk indicator for susceptibility to chronic periodontal disease in the Brazilian population studied. PMID:23050158

  19. Partitioning of genetic variation between regulatory and coding gene segments: the predominance of software variation in genes encoding introvert proteins.

    PubMed

    Mitchison, A

    1997-01-01

    In considering genetic variation in eukaryotes, a fundamental distinction can be made between variation in regulatory (software) and coding (hardware) gene segments. For quantitative traits the bulk of variation, particularly that near the population mean, appears to reside in regulatory segments. The main exceptions to this rule concern proteins which handle extrinsic substances, here termed extrovert proteins. The immune system includes an unusually large proportion of this exceptional category, but even so its chief source of variation may well be polymorphism in regulatory gene segments. The main evidence for this view emerges from genome scanning for quantitative trait loci (QTL), which in the case of the immune system points to a major contribution of pro-inflammatory cytokine genes. Further support comes from sequencing of major histocompatibility complex (Mhc) class II promoters, where a high level of polymorphism has been detected. These Mhc promoters appear to act, in part at least, by gating the back-signal from T cells into antigen-presenting cells. Both these forms of polymorphism are likely to be sustained by the need for flexibility in the immune response. Future work on promoter polymorphism is likely to benefit from the input from genome informatics.

  20. Association of fatty acid-binding protein 2 and fat mass and obesity-associated gene polymorphism with primary open-angle glaucoma

    PubMed Central

    Abbas, Shania; Raza, Syed Tasleem; Chandra, Anu; Singh, Luxmi; Mahdi, Farzana

    2017-01-01

    PURPOSE: The present study was carried out to investigate the association of fatty acid-binding protein 2 (FABP2) and fat mass and obesity-associated (FTO) gene polymorphism with primary open-angle glaucoma (POAG) cases and controls. MATERIALS AND METHODS: This study includes 122 POAG cases and 112 controls. FABP2 and FTO gene polymorphisms in cases and controls were evaluated by polymerase chain reaction-restriction fragment length polymorphism method. RESULTS: The mean ages were 49.88 ± 12.34 and 53.74 ± 11.87 years in POAG cases and control groups, respectively. The FABP2 gene AA, AT, TT genotype frequencies were 12.90%, 62.40%, 24.80% in POAG cases and 20.60%, 64.70%, 14.70% in healthy controls, respectively. The frequencies of A and T allele in POAG cases were 44.06% and 55.94% as compared to 52.94% and 47.06% in the controls. The FTO gene AA, AT, TT genotype frequencies were 2.00%, 79.20%, 18.80% in cases and 0%, 75.50%, 24.50% in healthy controls, respectively. The frequencies of A and T allele in POAG cases were 41.58% and 58.42% as compared to 37.75% and 62.25% in the controls. No significant difference in the frequencies of FABP2 and FTO genotype was found between POAG cases and controls. CONCLUSION: We could not identify the possible association of FABP2 and FTO gene polymorphism with POAG; however, further studies with larger sample size in different population are require to clarify the role of FABP2 and FTO genes in susceptibility to POAG. PMID:29034152

  1. Association of Calpain (CAPN) 10 (UCSNP-43, rs3792267) gene polymorphism with elevated serum androgens in young women with the most severe phenotype of polycystic ovary syndrome (PCOS).

    PubMed

    Anastasia, Karela; Koika, Vasiliki; Roupas, Nikolaos D; Armeni, Anastasia; Marioli, Dimitra; Panidis, Dimitrios; George, Adonakis; Georgopoulos, Neoklis A

    2015-01-01

    To highlight a possible association of Calpain (CAPN 10) gene UCSNP-43 polymorphism with hormonal and metabolic traits of young women with different phenotypes of polycystic ovary syndrome (PCOS). PCOS women were genotyped for the CAPN 10 gene UCSNP-43 polymorphism. A comparison of clinical and biochemical features of women with PCOS stratified on the basis of the CAPN 10 gene UCSNP-43 variants was assessed. Anthropometric, hormonal and biochemical measurements were carried out in 668 PCOS women and 200 healthy controls. Subjects were also genotyped for the CAPN 10 gene UCSNP-43 polymorphism. The genotype frequency distributions between groups and controls were compared using the chi-square test. The association of the polymorphism with the clinical and biochemical features of the study cohort was estimated as well. No association of the frequency of CAPN 10 gene UCSNP-43 polymorphism with PCOS was detected. No association of the polymorphism with the anthropometric, biochemical and hormonal features was detected both in PCOS and control women. The polymorphism was associated with serum Δ4 androstenedione (p = 0.018), as well as with 17-OH progesterone (17-hydroxyprogesterone) among women with PCOS phenotype A (p = 0.012). CAPN 10 gene polymorphism UCSNP-43 is deprived of a metabolic contribution to cardiovascular disease (CVD). However, due to its association with androgen excess in phenotype A, CAPN 10 gene polymorphism UCSNP-43 could be used as a genetic marker for CVD in young PCOS women.

  2. Ménière's Disease: Molecular Analysis of Aquaporins 2, 3 and Potassium Channel KCNE1 Genes in Brazilian Patients.

    PubMed

    Lopes, Karen de Carvalho; Sartorato, Edi Lúcia; da Silva-Costa, Sueli M; de Macedo Adamov, Nadya Soares; Ganança, Fernando Freitas

    2016-09-01

    Ménière's disease (MD) is a complex disease of unknown etiology characterized by a symptomatic tetrad of vertigo, hearing loss, tinnitus, and aural fullness. In addition to factors related to homeostasis of the inner ear, genetic factors have been implicated in its pathophysiology, including genes related to the transport of water and ionic composition maintenance of the endolymph, such as the aquaporin genes AQP2 and AQP3, and the potassium channel gene KCNE1. The aim of this study was to identify polymorphisms of these genes and determine their association with clinical characteristics of patients with MD. A case-control genetic association study was carried out, including 30 patients with definite Ménière's disease and 30 healthy controls. The coding regions of the target genes were amplified from blood samples by polymerase chain reaction (PCR), followed by direct sequencing. The associations of polymorphisms with clinical characteristics were analyzed with logistic regression. Five polymorphisms were identified: rs426496 in AQP2; rs591810 in AQP3; and rs1805127, rs1805128, and rs17173510 in KCNE1. After adjustment, rs426496 was significantly associated with tinnitus during the initial crisis and with altered electronystagmography, and rs1805127 was significantly associated with nephropathy. The genetic variant rs426496 in AQP2; rs591810 in AQP3 and rs1805127, rs1805128, and rs17173510, in KCNE1 were found in patients with Ménière's disease. The polymorphism rs426496, in AQP2, is associated with tinnitus at the onset of Ménière's disease and altered electronystagmography. In addition, rs1805127, in KCNE1, is associated with the presence of nephropathy.

  3. Association of TNFα-308, IFNγ+874, and IL10-1082 gene polymorphisms and the risk of non-small cell lung cancer in the population of the South Indian state of Telangana.

    PubMed

    Peddireddy, Vidyullatha; Badabagni, Siva Prasad; Sulthana, Shehnaz; Kolla, Venkata Karunakar; Gundimeda, Sandhya Devi; Mundluru, Hemaprasad

    2016-10-01

    Cytokine-mediated inflammation is important in the pathogenesis of non-small cell lung cancer (NSCLC). Genetic polymorphisms in cytokine genes and their association with lung cancer in the Indian population have not been reported. For the first time, we analyzed genetic polymorphisms of TNFα -308 , IFNγ +874 , and IL10 -1082 genes in 246 NSCLC patients and 250 healthy controls in the South Indian population from Telangana using ARMS PCR. IFNγ +874 A/T and IL10 -1082 G/G gene polymorphisms were found to be significantly associated with NSCLC with 1.56- and 1.68-fold disease risk, respectively. There was no association between the risk of NSCLC and TNFα -308 polymorphism. Gene polymorphisms stratified according to smoking revealed that IFNγ +874 A/T polymorphisms in smokers increased the disease risk by 2.91 fold. IL10 -1082 G/G polymorphisms showed 2-fold increased risk among patients who were smokers when compared to the controls. However, there was no association between TNFα -308 , IFNγ +874 , and IL10 -1082 gene polymorphism and the stage of the NSCLC patients. The overall risk associated with the combination of these polymorphisms indicated that the TNFα -308 G/A + IFNγ +874 A/T + IL10 -1082 G/G genotype increased the risk by 1.5 fold. The results of our study indicate an association between cytokine gene polymorphisms and the risk of NSCLC in an Indian population.

  4. Are "functionally related polymorphisms" of renin-angiotensin-aldosterone system gene polymorphisms associated with hypertension?

    PubMed

    Hahntow, Ines N; Mairuhu, Gideon; van Valkengoed, Irene Gm; Koopmans, Richard P; Michel, Martin C

    2010-06-02

    Genotype-phenotype association studies are typically based upon polymorphisms or haplotypes comprised of multiple polymorphisms within a single gene. It has been proposed that combinations of polymorphisms in distinct genes, which functionally impact the same phenotype, may have stronger phenotype associations than those within a single gene. We have tested this hypothesis using genes encoding components of the renin-angiotensin-aldosterone system and the high blood pressure phenotype. Our analysis is based on 1379 participants of the cross-sectional SUNSET study randomly selected from the population register of Amsterdam. Each subject was genotyped for the angiotensinogen M235T, the angiotensin-converting enzyme insertion/deletion and the angiotensin II type 1 receptor A1166C polymorphism. The phenotype high blood pressure was defined either as a categorical variable comparing hypertension versus normotension as in most previous studies or as a continuous variable using systolic, diastolic and mean blood pressure in a multiple regression analysis with gender, ethnicity, age, body-mass-index and antihypertensive medication as covariates. Genotype-phenotype relationships were explored for each polymorphism in isolation and for double and triple polymorphism combinations. At the single polymorphism level, only the A allele of the angiotensin II type 1 receptor was associated with a high blood pressure phenotype. Using combinations of polymorphisms of two or all three genes did not yield stronger/more consistent associations. We conclude that combinations of physiologically related polymorphisms of multiple genes, at least with regard to the renin-angiotensin-aldosterone system and the hypertensive phenotype, do not necessarily offer additional benefit in analyzing genotype/phenotype associations.

  5. The IFN-gamma +874T/A gene polymorphism is associated with retinochoroiditis toxoplasmosis susceptibility.

    PubMed

    Albuquerque, Maíra Cavalcanti de; Aleixo, Ana Luisa Quintella do Couto; Benchimol, Eliezer Israel; Leandro, Ana Cristina Câmara S; das Neves, Leandro Batista; Vicente, Regiane Trigueiro; Bonecini-Almeida, Maria da Glória; Amendoeira, Maria Regina Reis

    2009-05-01

    Toxoplasmosis is a worldwide zoonosis that generally produces an asymptomatic infection. In some cases, however, toxoplasmosis infection can lead to ocular damage. The immune system has a crucial role in both the course of the infection and in the evolution of toxoplasmosis disease. In particular, IFN-gamma plays an important role in resistance to toxoplasmosis. Polymorphisms in genes encoding cytokines have been shown to have an association with susceptibility to parasitic diseases. The aim of this work was to analyse the occurrence of polymorphisms in the gene encoding IFN-gamma (+874T/A) among Toxoplasma gondii seropositive individuals, including those with ocular lesions caused by the parasite, from a rural population of Santa Rita de Cássia, Barra Mansa, state of Rio de Janeiro, Brazil. Further, we verified which of these polymorphisms could be related to susceptibility to the development of ocular toxoplasmosis. This study included 34 individuals with ocular toxoplasmosis (ocular group) and 134 without ocular lesions (control group). The differences between A and T allele distributions were not statistically significant between the two groups. However, we observed that a higher frequency of individuals from the ocular group possessed the A/A genotype, when compared with the control group, suggesting that homozygocity for the A allele could enhance susceptibility to ocular toxoplasmosis in T. gondii infection.

  6. Severity of eating disorder symptoms related to oxytocin receptor polymorphisms in anorexia nervosa.

    PubMed

    Acevedo, Summer F; Valencia, Celeste; Lutter, Michael; McAdams, Carrie J

    2015-08-30

    Oxytocin is a peptide hormone important for social behavior and differences in psychological traits have been associated with variants of the oxytocin receptor gene in healthy people. We examined whether single nucleotide polymorphisms (SNPs) of the oxytocin receptor gene (OXTR) correlated with clinical symptoms in women with anorexia nervosa, bulimia nervosa, and healthy comparison (HC) women. Subjects completed clinical assessments and provided DNA for analysis. Subjects were divided into four groups: HC, subjects currently with anorexia nervosa (AN-C), subjects with a history of anorexia nervosa but in long-term weight recovery (AN-WR), and subjects with bulimia nervosa (BN). Five SNPs of the oxytocin receptor were examined. Minor allele carriers showed greater severity in most of the psychiatric symptoms. Importantly, the combination of having had anorexia and carrying either of the A alleles for two SNPS in the OXTR gene (rs53576, rs2254298) was associated with increased severity specifically for ED symptoms including cognitions and behaviors associated both with eating and appearance. A review of psychosocial data related to the OXTR polymorphisms examined is included in the discussion. OXTR polymorphisms may be a useful intermediate endophenotype to consider in the treatment of patients with anorexia nervosa. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

  7. ACE, APOA5, and MTP Gene Polymorphisms Analysis in Relation to Triglyceride and Insulin Levels in Pediatric Patients.

    PubMed

    Carranza-González, Lilia; León-Cachón, Rafael B R; González-Zavala, María Antonia; Ríos-Ibarra, Clara; Morlett-Chávez, Jesús; Sánchez-Domínguez, Celia; Cepeda-Nieto, Ana; Salinas-Santander, Mauricio

    2018-04-25

    Obesity is a complex, chronic, and multifactorial disease that has become a major, and worldwide, public health problem contributing to an increased number of pathologies, including type 2 diabetes, cardiovascular disease, hyperlipidemia, and metabolic syndrome, thus suggesting a commolon origin. A diet high in sugar and fats coupled with a sedentary lifestyle has a major role in the development of obesity. However, the genetic background has also been associated with body fat accumulation. The aim of this study was to assess the effect ofACE-rs4646994, APOA5-rs662799, and MTP-rs1800591 gene polymorphisms on clinical and biochemical parameters and to evaluate the association with body phenotypes in children and adolescent population of Saltillo, Coahuila, Mexico. Anthropometric, clinical, biochemical parameters and BMI were obtained from 405 children and adolescents. The BMI was used to determine the body phenotype. The rs4646994 gene polymorphism was determined by PCR, whereas rs662799 and rs1800591 were determined by PCR-RFLP. The obtained results were analyzed to determine their association of these single nucleotide polymorphisms with body phenotype and biochemical parameters. TT genotype for APOA5-rs662799 was associated with increased levels of HDL-C in the analyzed population (p <0.05). The ACErs4646994gene polymorphism is associated with high Insulin levels, HOMAIR index, and triglyceride levels, mainly when presenting a I/I genotype (p <0.05). The polymorphic allele of the ACE gene is capable of modulating triglyceride levels, insulin levels and HOMA-IR index in the evaluated population; it must be highlighted that this has not been reported in other studied populations elsewhere. Copyright © 2018 IMSS. Published by Elsevier Inc. All rights reserved.

  8. Polymorphisms in the glutathione pathway modulate cystic fibrosis severity: a cross-sectional study

    PubMed Central

    2014-01-01

    Background Cystic fibrosis (CF) clinically manifests with various levels of severity, which are thought to be modulated by mutations in the cystic fibrosis transmembrane conductance regulator gene (CFTR), modifier genes, and the environment. This study verified whether polymorphisms in modifier genes associated with glutathione (GSH) metabolism influence CF severity. Methods A cross-sectional study of 180 CF patients was carried out from 2011 to 2012. We analyzed CFTR mutations, polymorphisms (GSTM1 and GSTT1 deletions, GSTP1 + 313A > G, GCLC-129C > T, and GCLC-3506A > G) in modifier genes and CF clinical severity as assessed by 28 clinical and laboratory variables. Results Significant associations were found between modifier gene polymorphisms and particular phenotypes or genotype changes. These included GCLC-129C > T with a higher frequency of the Pseudomonas aeruginosa mucoid to CC genotype (p = 0.044), and GCLC-3506A > G with a higher frequency of the no-mucoid P. aeruginosa (NMPA) to AA genotype (p = 0.012). The GSTT1 deletion was associated with a higher frequency of the NMPA to homozygous deletion (p = 0.008), GSTP1 + 313A > G with a minor risk of osteoporosis (p = 0.036), and patient age ≤ 154 months (p = 0.044) with the AA genotype. The Bhalla score was associated with GCLC-3506A > G (p = 0.044) and GSTM1/GSTT1 deletion polymorphisms (p = 0.02), while transcutaneous hemoglobin oxygen saturation levels were associated with GSTT1 deletions (p = 0.048). Conclusion CF severity is associated with polymorphisms in GSH pathways and CFTR mutations. PMID:24593045

  9. CCAAT/enhancer-binding protein alpha (CEBPA) polymorphisms and mutations in healthy individuals and in patients with peripheral artery disease, ischaemic heart disease and hyperlipidaemia.

    PubMed

    Fuchs, O; Kostecka, A; Provazníková, D; Krásná, B; Kotlín, R; Stanková, M; Kobylka, P; Dostálová, G; Zeman, M; Chochola, M

    2010-01-01

    The CCAAT/enhancer-binding protein alpha, encoded by the intronless CEBPA gene, is a transcription factor that induces expression of genes involved in differentiation of granulocytes, monocytes, adipocytes and hepatocytes. Both mono- and bi-allelic CEBPA mutations were detected in acute myeloid leukaemia and myelodysplastic syndrome. In this study we also identified CEBPA mutations in healthy individuals and in patients with peripheral artery disease, ischaemic heart disease and hyperlipidaemia. We found 16 various deletions with the presence of two direct repeats in CEBPA by analysis of 431 individuals. Three most frequent repeats included in these deletions in CEBPA gene are CGCGAG (493- 498_865-870), GG (486-487_885-886), and GCCAAGCAGC (508-517_907-916), all according to GenBank Accession No. NM_004364.2. In one case we identified that a father with ischaemic heart disease and his healthy son had two identical deletions (493_864del and 508_906del, both according to GenBank Accession No. NM_004364.2) in CEBPA. The occurrence of deletions between two repetitive sequences may be caused by recombination events in the repair process. A double-stranded cut in DNA may initiate these recombination events in adjacent DNA sequences. Four types of polymorphisms in the CEBPA gene were also detected in the screened individuals. Polymorphism in CEBPA gene 690 G>T according to GenBank Accession No. NM_004364.2 is the most frequent type in our analysis. Statistical analysis did not find significant differences in the frequency of polymorphisms in CEBPA in patients and in healthy individuals with the exception of P4 polymorphism (580_585dup according to GenBank Accesion No. NM_004364.2). P4 polymorphism was significantly increased in ischaemic heart disease patients.

  10. BRCA1 and TP53 Gene-Mutations: Family Predisposition and Radioecological Risk of Developing Breast Cancer.

    PubMed

    Apsalikov, Bakytbek; Manambaeva, Zukhra; Ospanov, Erlan; Massabayeva, Meruyert; Zhabagin, Kuantkan; Zhagiparova, Zhanar; Maximov, Vladymir; Voropaeva, Elena; Apsalikov, Kazbek; Belikhina, Tatiana; Abdrahmanov, Ramil; Cherepkova, Elena; Tanatarov, Sayat; Massadykov, Adilzhan; Urazalina, Naylia

    2016-01-01

    Frequencies of polymorphisms of genes BRCA1 and TP53 in breast cancer (BC) patients with a BC family history and radiation history were assessed and compared in the Semey region of Kazakhstan. The study included 60 women directly irradiated by the activities of the Semipalatinsk test site with a calculated effective equivalent dose of 500 mSv and their first generation descendants (group BC+Her+Exp); 65 women with family BC and absence of radiological history - the effective equivalent dose due to anthropogenic sources not exceeding 50 mSv (group BC+Her-Exp). The comparison group consisted of 65 women patients with breast cancer without family and radiological history (BC-Her-Exp). The control group comprised 60 women without breast cancer and without family and radiological history (nonBC). We carried out the genotyping of the polymorphisms c.2311T>C, c.4308T>C and 5382insC of the BRCA1 gene and rs1042522 of the TP53 gene. The frequency of the polymorphism c.2311T>C was significantly higher in patients of the group BC+Her+Exp than in healthy women, and of the polymorphism 5382insC in BC+Her+Exp compared to all other groups. The frequency of the rs1042522 polymorphism of TP53 was significantly higher in all groups of patients with breast cancer compared with the control group. Differences between groups of women with breast cancer were significant only in BC+Her+Exp vs. BC+Her-Exp. Combinations of polymorphisms of the genes BRCA1 and TP53 predominated in women with a family and radiological history.

  11. The C4280A (rs5705) gene polymorphism of the renin (REN) gene is associated with risk of developing coronary artery disease, but not with restenosis after coronary stenting.

    PubMed

    Fragoso, Jose Manuel; Alvarez-León, Edith; Delgadillo-Rodríguez, Hilda; Arellano-González, Marva; López-Pacheco, Filogonio Caín; Cruz-Robles, David; Peña-Duque, Marco Antonio; Pérez-Méndez, Oscar; Martínez-Ríos, Marco Antonio; Vargas-Alarcón, Gilberto

    2015-08-01

    The aim of the present study was to evaluate the role of AGT and REN gene polymorphisms as susceptibility markers for coronary artery disease (CAD) and/or restenosis after coronary stent placement in a group of Mexican patients. Five polymorphisms of the AGT (rs699, rs4762, rs5051, rs5049, rs5046) and two of the REN (rs5707, rs5705) genes were analyzed by 5' exonuclease TaqMan genotyping assays in 240 patients with CAD who underwent coronary artery stenting (76 with restenosis and 164 without restenosis). A group of 610 individuals without clinical and familial antecedents of cardiovascular diseases were included as controls. The results showed that the distribution of AGT and REN polymorphisms were similar in patients with and without restenosis. However, when the whole group of patients (with and without restenosis) was compared to healthy controls, under co-dominant, dominant, heterozygous and additive models, the REN A4280C (rs5705) polymorphism was associated with increased risk of CAD (OR=1.76, PCo-dom=0.006, OR=1.81, PDom=0.001, OR=1.75, PHet=0.003 and OR=1.59, PAdd=0.003, respectively). All models were adjusted for age, gender, diabetes, dyslipidemia, hypertension and smoking habit. The TC haplotype of the REN gene was associated with increased risk of CAD (OR=1.53, P=0.014). The data suggest that the REN C4280A (rs5705) polymorphism plays an important role in the risk of developing CAD with the highest risk for C allele, but do not support its role as a risk factor for developing restenosis after coronary stenting. Copyright © 2015. Published by Elsevier Inc.

  12. Effects of Pro12Ala polymorphism in peroxisome proliferator-activated receptor-γ2 gene on metabolic syndrome risk: a meta-analysis.

    PubMed

    Zhang, Ruyi; Wang, Jiao; Yang, Rui; Sun, Jia; Chen, Rongping; Luo, Haizhao; Liu, Duan; Cai, Dehong

    2014-02-01

    Associations between peroxisome proliferator-activated receptor γ2 (PPARγ2) gene polymorphism and metabolic syndrome risk remained controversial and ambiguous. Thus, we performed a meta-analysis to assess the association between Pro12Ala polymorphism in PPARγ2 gene and metabolic syndrome susceptibility. An electronic literature search was conducted on Medline, OVID, Cochrane Library database, and the China National Knowledge Internet up to March 2013. Odds ratios (ORs) with 95% confidence intervals (CIs) were used to calculate the strength of association in the fixed or random effects model. Ten studies involving a total of 4456 cases and 10343 controls were included in this meta-analysis. No statistical evidence of association was found between Pro12Ala polymorphism and metabolic syndrome risk in all genetic models (homozygote model: OR=0.83, 95% CI=0.62-1.12; heterozygote model: OR=1.04, 95% CI=0.94-1.14; dominant model: OR=1.02, 95% CI=0.93-1.12; recessive model: OR=0.83, 95% CI=0.62-1.11). No statistical evidence of significant association was observed when stratified by ethnicity, definition of metabolic syndrome, source of control groups and quality score of the selected articles. All in all, the results did not support a major role of the Pro12Ala variant of the PPARγ2 gene in metabolic syndrome risk. This meta-analysis suggested that the effect of Pro12Ala polymorphism in PPARγ2 gene may not be related to metabolic syndrome as an entity. However, Pro12Ala may affect the single component of metabolic syndrome. A large, well designed study is required to more adequately assess the role for Pro12Ala polymorphism on metabolic syndrome. © 2013 Elsevier B.V. All rights reserved.

  13. Susceptibility background for type 2 diabetes in eleven Mexican Indigenous populations: HNF4A gene analysis.

    PubMed

    Granados-Silvestre, M A; Ortiz-López, M G; Granados, J; Canizales-Quinteros, S; Peñaloza-Espinosa, Rosenda I; Lechuga, C; Acuña-Alonzo, V; Sánchez-Pozos, K; Menjivar, M

    2017-12-01

    The genetic risk of developing type 2 diabetes (T2D) increases in parallel with the proportion of Native American ancestry. Mestizo Mexicans have a 70% Native Amerindian genetic background. The T130I polymorphism in the HNF4A gene has been associated with early-onset T2D in mestizo Mexicans. Thus, the aim of the present study was to evaluate the frequency and relationship of the T130I variant in the HNF4A gene with risk factors for developing T2D in eleven indigenous groups from Mexico. In two groups, all exons of the HNF4A gene were directly sequenced; in the remaining the T130I polymorphism was analyzed by restriction fragment length polymorphism. Ancestry informative markers were assessed to confirm the Amerindian component. An additional analysis of EHH was carried out. Interestingly, HNF4A gene screening revealed only the presence of the T130I polymorphism. The range frequency of the risk allele (T) in the indigenous groups was from 2.7 to 16%. Genotypic frequencies (T130I/I130I) were higher and significantly different from those of all of the populations included in the HapMap Project (P < 0.005). EHH scores suggest a positive selection for T130I polymorphism. Metabolic traits indicate a relationship between the T130I/I130I genotypes with high triglyceride concentrations in the indigenous groups (P < 0.005). These results strongly suggest that the high frequency of the T130I polymorphism and its biological relationship with dysfunction in lipid metabolism in Mexican indigenous groups is a risk factor for the developing of T2D in Mexicans.

  14. Comparative study of polymorphism frequencies of the CYP2D6, CYP3A5, CYP2C8 and IL-10 genes in Mexican and Spanish women with breast cancer.

    PubMed

    Alcazar-González, Gregorio Antonio; Calderón-Garcidueñas, Ana Laura; Garza-Rodríguez, María Lourdes; Rubio-Hernández, Gabriela; Escorza-Treviño, Sergio; Olano-Martin, Estibaliz; Cerda-Flores, Ricardo Martín; Castruita-Avila, Ana Lilia; González-Guerrero, Juan Francisco; le Brun, Stéphane; Simon-Buela, Laureano; Barrera-Saldaña, Hugo Alberto

    2013-10-01

    Pharmacogenetic studies in breast cancer (BC) may predict the efficacy of tamoxifen and the toxicity of paclitaxel and capecitabine. We determined the frequency of polymorphisms in the CYP2D6 gene associated with activation of tamoxifen, and those of the genes CYP2C8, CYP3A5 and DPYD associated with toxicity of paclitaxel and capecitabine. We also included a IL-10 gene polymorphism associated with advanced tumor stage at diagnosis. Genomic DNAs from 241 BC patients from northeast Mexico were genotyped using DNA microarray technology. For tamoxifen processing, CYP2D6 genotyping predicted that 90.8% of patients were normal metabolizers, 4.2% ultrarapid, 2.1% intermediate and 2.9% poor metabolizers. For paclitaxel and the CYP2C8 gene, 75.3% were normal, 23.4% intermediate and 1.3% poor metabolizers. Regarding the DPYD gene, only one patient was a poor metabolizer. For the IL-10 gene, 47.1% were poor metabolizers. These results contribute valuable information towards personalizing BC chemotherapy in Mexican women.

  15. Significant association of APOA5 and APOC3 gene polymorphisms with meat quality traits in Kele pigs.

    PubMed

    Hui, Y T; Yang, Y Q; Liu, R Y; Zhang, Y Y; Xiang, C J; Liu, Z Z; Ding, Y H; Zhang, Y L; Wang, B R

    2013-09-13

    Apolipoprotein A5 (APOA5) and C3 (APOC3) genes are involved in the PPAR lipid metabolism pathway and thus associated with elevated triglyceride levels. However, whether APOA5 and APOC3 genetic polymorphisms affect intramuscular fat deposition and other meat quality traits remains unknown in pigs. One hundred and seventy-one Kele pigs were sampled to investigate genetic variants in the APOA5 and APOC3 genes and their association with seven pork quality traits. We identified 5 single nucleotide polymorphisms (SNPs) in the promoter region of the APOA5 gene and 17 SNPs in the APOC3 gene. Linkage disequilibrium analysis revealed 5 complete linkage disequilibria among these 22 SNPs. We found that 10 SNPs were significantly correlated with meat quality traits, including the mutation A5/-769 in the APOA5 gene, which was significantly associated with cooked weight percentage, and 9 SNPs in the APOC3 gene that were significantly associated with drip loss rate, meat color value of longissimus dorsi muscle and shear force. Therefore, these SNP markers will be useful for marker-assisted selection for improved pork quality.

  16. Microarray study of single nucleotide polymorphisms and expression of ATP-binding cassette genes in breast tumors

    NASA Astrophysics Data System (ADS)

    Tsyganov, M. M.; Ibragimova, M. K.; Karabut, I. V.; Freydin, M. B.; Choinzonov, E. L.; Litvyakov, N. V.

    2015-11-01

    Our previous research establishes that changes of expression of the ATP-binding cassette genes family is connected with the neoadjuvant chemotherapy effect. However, the mechanism of regulation of resistance gene expression remains unclear. As many researchers believe, single nucleotide polymorphisms can be involved in this process. Thereupon, microarray analysis is used to study polymorphisms in ATP-binding cassette genes. It is thus found that MDR gene expression is connected with 5 polymorphisms, i.e. rs241432, rs241429, rs241430, rs3784867, rs59409230, which participate in the regulation of expression of own genes.

  17. SNPing Away at Complex Diseases: Analysis of Single-Nucleotide Polymorphisms around APOE in Alzheimer Disease

    PubMed Central

    Martin, Eden R.; Lai, Eric H.; Gilbert, John R.; Rogala, Allison R.; Afshari, A. J.; Riley, John; Finch, K. L.; Stevens, J. F.; Livak, K. J.; Slotterbeck, Brandon D.; Slifer, Susan H.; Warren, Liling L.; Conneally, P. Michael; Schmechel, Donald E.; Purvis, Ian; Pericak-Vance, Margaret A.; Roses, Allen D.; Vance, Jeffery M.

    2000-01-01

    There has been great interest in the prospects of using single-nucleotide polymorphisms (SNPs) in the search for complex disease genes, and several initiatives devoted to the identification and mapping of SNPs throughout the human genome are currently underway. However, actual data investigating the use of SNPs for identification of complex disease genes are scarce. To begin to look at issues surrounding the use of SNPs in complex disease studies, we have initiated a collaborative SNP mapping study around APOE, the well-established susceptibility gene for late-onset Alzheimer disease (AD). Sixty SNPs in a 1.5-Mb region surrounding APOE were genotyped in samples of unrelated cases of AD, in controls, and in families with AD. Standard tests were conducted to look for association of SNP alleles with AD, in cases and controls. We also used family-based association analyses, including recently developed methods to look for haplotype association. Evidence of association (P⩽.05) was identified for 7 of 13 SNPs, including the APOE-4 polymorphism, spanning 40 kb on either side of APOE. As expected, very strong evidence for association with AD was seen for the APOE-4 polymorphism, as well as for two other SNPs that lie <16 kb from APOE. Haplotype analysis using family data increased significance over that seen in single-locus tests for some of the markers, and, for these data, improved localization of the gene. Our results demonstrate that associations can be detected at SNPs near a complex disease gene. We found that a high density of markers will be necessary in order to have a good chance of including SNPs with detectable levels of allelic association with the disease mutation, and statistical analysis based on haplotypes can provide additional information with respect to tests of significance and fine localization of complex disease genes. PMID:10869235

  18. SNPing away at complex diseases: analysis of single-nucleotide polymorphisms around APOE in Alzheimer disease.

    PubMed

    Martin, E R; Lai, E H; Gilbert, J R; Rogala, A R; Afshari, A J; Riley, J; Finch, K L; Stevens, J F; Livak, K J; Slotterbeck, B D; Slifer, S H; Warren, L L; Conneally, P M; Schmechel, D E; Purvis, I; Pericak-Vance, M A; Roses, A D; Vance, J M

    2000-08-01

    There has been great interest in the prospects of using single-nucleotide polymorphisms (SNPs) in the search for complex disease genes, and several initiatives devoted to the identification and mapping of SNPs throughout the human genome are currently underway. However, actual data investigating the use of SNPs for identification of complex disease genes are scarce. To begin to look at issues surrounding the use of SNPs in complex disease studies, we have initiated a collaborative SNP mapping study around APOE, the well-established susceptibility gene for late-onset Alzheimer disease (AD). Sixty SNPs in a 1.5-Mb region surrounding APOE were genotyped in samples of unrelated cases of AD, in controls, and in families with AD. Standard tests were conducted to look for association of SNP alleles with AD, in cases and controls. We also used family-based association analyses, including recently developed methods to look for haplotype association. Evidence of association (P

  19. Association of the serotonin transporter gene promoter region (5-HTTLPR) polymorphism with biased attention for emotional stimuli.

    PubMed

    Beevers, Christopher G; Wells, Tony T; Ellis, Alissa J; McGeary, John E

    2009-08-01

    A deletion polymorphism in the serotonin transporter-linked polymorphic region (5-HTTLPR) has been associated with vulnerability to affective disorders, yet the mechanism by which this gene confers vulnerability remains unclear. Two studies examined associations between the 5-HTTLPR polymorphism and attentional bias for emotional stimuli among nondepressed adults. Biased attention, attention engagement, and difficulty with attention disengagement were assessed with a spatial cuing task using emotional stimuli. Results from Study 1 (N = 38) indicated that short 5-HTTLPR allele carriers experienced greater difficulty disengaging their attention from sad and happy stimuli compared with long allele homozygotes. Study 2 participants (N = 144) were genotyped for the 5-HTTLPR polymorphism, including single nucleotide polymorphism rs25531 in the long allele of the 5-HTTLPR. Consistent with Study 1, individuals homozygous for the low-expressing 5-HTTLPR alleles (i.e., S and LG) experienced greater difficulty disengaging attention from sad, happy, and fear stimuli than high-expressing 5-HTTLPR homozygotes. Because this association exists in healthy adults, it may represent a susceptibility factor for affective disorders that becomes problematic during stressful life experiences.

  20. Polymorphism of Trp64Arg in beta3-adrenergic receptor gene among Bolivian people in rural areas at high and low altitudes.

    PubMed

    Karasaki, Yuji; Kashiwazaki, Hiroshi

    2004-01-01

    To investigate whether population differences in food and/or lifestyle could affect the distribution frequencies of polymorphism in the gene for beta3-adrenergic receptor (beta3-AR), the frequency of Trp64Arg polymorphism was studied among Bolivian people living in rural areas of high (about 4000 m above sea level) and low (about 300 m above sea level) altitudes. Genomic DNA samples of Bolivian subjects (n=508) were amplified by polymerase chain reaction (PCR) for part of the beta3-AR gene. The amplified PCR products were digested with restriction enzyme NciI and analysed by agarose gel electrophoresis. We found no significant difference in the frequency of Arg allele in the beta3-AR gene between 331 native low-altitude Bolivian subjects (18.1%) and 177 native high-altitude Bolivian subjects (17.5%). Body mass index was not associated with Trp64Arg polymorphism among native Bolivian adults. The frequency of this allele in the complete Bolivian population (18%) was lower than that reported in Pima Indians (32%), is comparable to the Japanese (19%) and is higher than several ethnic groups, including Finns (12%) and French (4%). Our data indicate that the altitude-related lifestyle of a population has had little influence on the frequency of Trp64Arg polymorphism and obesity in Bolivian natives.

  1. Genetic Polymorphism of Angiotensin-Converting Enzyme and Chronic Obstructive Pulmonary Disease Risk: An Updated Meta-Analysis

    PubMed Central

    Kang, Sang Wook; Kim, Su Kang; Jung, Hee-Jae; Kim, Kwan-Il; Kim, Jinju

    2016-01-01

    The relationship between polymorphism of the angiotensin I converting enzyme (ACE) gene and chronic obstructive pulmonary disease (COPD) has been examined in many previous studies. However, their results were controversial. Therefore, we performed a meta-analysis to evaluate the relationship between the ACE gene and the risk of COPD. Fourteen case-control studies were included in this meta-analysis. The pooled p value, odds ratio (OR), and 95% confidence interval (95% CI) were used to investigate the strength of the association. The meta-analysis was performed using comprehensive meta-analysis software. Our meta-analysis results revealed that ACE polymorphisms were not related to the risk of COPD (p > 0.05 in each model). In further analyses based on ethnicity, we observed an association between insertion/deletion polymorphism of the ACE gene and risk of COPD in the Asian population (codominant 2, OR = 3.126, 95% CI = 1.919–5.093, p < 0.001; recessive, OR = 3.326, 95% CI = 2.190–5.050, p < 0.001) but not in the Caucasian population (p > 0.05 in each model). In conclusion, the present meta-analysis indicated that the insertion/deletion polymorphism of the ACE gene may be associated with susceptibility to COPD in the Asian population but not in the Caucasian population. However, the results of the present meta-analysis need to be confirmed in a larger sample. PMID:27830153

  2. Angiotensin-converting enzyme gene polymorphism in arrhythmogenic right ventricular dysplasia: is DD genotype helpful in predicting syncope risk?

    PubMed

    Ozben, Beste; Altun, Ibrahim; Sabri Hancer, Veysel; Bilge, Ahmet Kaya; Tanrikulu, Azra Meryem; Diz-Kucukkaya, Reyhan; Fak, Ali Serdar; Yilmaz, Ercument; Adalet, Kamil

    2008-12-01

    Arrhythmogenic right ventricular dysplasia (ARVD) is a heritable disorder characterised by fibrofatty replacement of right ventricular myocytes and increased risk of ventricular arrhythmias and sudden cardiac death. Angiotensin-converting enzyme (ACE) gene insertion/deletion (I/D) polymorphism affects myocardial ACE levels. DD genotype favours myocardial fibrosis and is associated with malignant ventricular tachycardia. The aim of this study was to explore ACE gene polymorphism in ARVD patients. Twenty-nine patients with ARVD and 24 controls were included. All ARVD patients had documented sustained ventricular tachycardia. Thirteen patients had syncopal episodes. Six patients were resuscitated from sudden cardiac death. ACE gene polymorphism was identified by polymerase chain reaction technique. There was no significant difference in DD genotype frequency between ARVD patients and controls (44.8% vs. 45.8%, p=0.94). However, DD genotype frequency was significantly higher in ARVD patients with syncopal episodes compared to those without syncope (69.2% vs. 25.0%, p=0.017, odds ratio:6.750, 95% confidence interval: 1.318-34.565). DD genotype was detected in higher frequency also in patients with a family history of sudden cardiac death (66.7% vs. 39.1%,p=0.36). High prevalence of DD genotype in ARVD patients with syncope suggests that ACE I/D polymorphism might be useful in identifying high-risk patients for syncope.

  3. Maximal oxygen uptake is associated with allele -202 A of insulin-like growth factor binding protein-3 (IGFBP3) promoter polymorphism and (CA)n tandem repeats of insulin-like growth factor IGF1 in Caucasians from Poland.

    PubMed

    Gronek, Piotr; Holdys, Joanna; Kryściak, Jakub; Wieliński, Dariusz; Słomski, Ryszard

    2014-01-01

    Physical fitness is a trait determined by multiple genes, and its genetic basis is modified by numerous environmental factors. The present study examines the effects of the (CA)n tandem repeats polymorphism in IGFI gene and SNP Alw21I restriction site -202 A>C polymorphism in IGF1BP3 on VO2max--a physiological index of aerobic capacity of high heritability. The study sample consisted of 239 (154 male and 85 female) students of the University School of Physical Education in Poznań and athletes practicing various sports, including members of the Polish national team. An association was found between -202 A/C polymorphism of IGFBP3 gene with VO2max in men. Higher VO2max values were attained by men with CC genotype, especially male athletes practicing endurance sports and sports featuring energy metabolism of aerobic/anaerobic character. A statistically significant influence of allele 188 and genotype 188/188 of tandem repeats (CA)n polymorphism of IGF1 gene on VO2max was found in women. Also, lower values of maximal oxygen uptake were noted in individuals with allele 186 or genotype 186/186, and higher VO2max values in athletes with allele 194.

  4. The -675 4G/5G polymorphism in plasminogen activator inhibitor-1 gene is associated with risk of asthma: a meta-analysis.

    PubMed

    Nie, Wei; Li, Bing; Xiu, Qing-Yu

    2012-01-01

    A number of studies assessed the association of -675 4G/5G polymorphism in the promoter region of plasminogen activator inhibitor (PAI)-1 gene with asthma in different populations. However, most studies reported inconclusive results. A meta-analysis was conducted to investigate the association between polymorphism in the PAI-1 gene and asthma susceptibility. Databases including Pubmed, EMBASE, HuGE Literature Finder, Wanfang Database, China National Knowledge Infrastructure (CNKI) and Weipu Database were searched to find relevant studies. Odds ratios (ORs) with 95% confidence intervals (CIs) were used to assess the strength of association in the dominant model, recessive model, codominant model, and additive model. Eight studies involving 1817 cases and 2327 controls were included. Overall, significant association between 4G/5G polymorphism and asthma susceptibility was observed for 4G4G+4G5G vs. 5G5G (OR = 1.56, 95% CI 1.12-2.18, P = 0.008), 4G/4G vs. 4G/5G+5G/5G (OR = 1.38, 95% CI 1.06-1.80, P = 0.02), 4G/4G vs. 5G/5G (OR = 1.80, 95% CI 1.17-2.76, P = 0.007), 4G/5G vs. 5G/5G (OR = 1.40, 95% CI 1.07-1.84, P = 0.02), and 4G vs. 5G (OR = 1.35, 95% CI 1.08-1.68, P = 0.008). This meta-analysis suggested that the -675 4G/5G polymorphism of PAI-1 gene was a risk factor of asthma.

  5. The −675 4G/5G Polymorphism in Plasminogen Activator Inhibitor-1 Gene Is Associated with Risk of Asthma: A Meta-Analysis

    PubMed Central

    Xiu, Qing-yu

    2012-01-01

    Background A number of studies assessed the association of −675 4G/5G polymorphism in the promoter region of plasminogen activator inhibitor (PAI)-1 gene with asthma in different populations. However, most studies reported inconclusive results. A meta-analysis was conducted to investigate the association between polymorphism in the PAI-1 gene and asthma susceptibility. Methods Databases including Pubmed, EMBASE, HuGE Literature Finder, Wanfang Database, China National Knowledge Infrastructure (CNKI) and Weipu Database were searched to find relevant studies. Odds ratios (ORs) with 95% confidence intervals (CIs) were used to assess the strength of association in the dominant model, recessive model, codominant model, and additive model. Results Eight studies involving 1817 cases and 2327 controls were included. Overall, significant association between 4G/5G polymorphism and asthma susceptibility was observed for 4G4G+4G5G vs. 5G5G (OR = 1.56, 95% CI 1.12–2.18, P = 0.008), 4G/4G vs. 4G/5G+5G/5G (OR = 1.38, 95% CI 1.06–1.80, P = 0.02), 4G/4G vs. 5G/5G (OR = 1.80, 95% CI 1.17–2.76, P = 0.007), 4G/5G vs. 5G/5G (OR = 1.40, 95% CI 1.07–1.84, P = 0.02), and 4G vs. 5G (OR = 1.35, 95% CI 1.08–1.68, P = 0.008). Conclusions This meta-analysis suggested that the −675 4G/5G polymorphism of PAI-1 gene was a risk factor of asthma. PMID:22479620

  6. MAOA, MTHFR, and TNF-β genes polymorphisms and personality traits in the pathogenesis of migraine.

    PubMed

    Ishii, Masakazu; Shimizu, Shunichi; Sakairi, Yuki; Nagamine, Ayumu; Naito, Yuika; Hosaka, Yukiko; Naito, Yuko; Kurihara, Tatsuya; Onaya, Tomomi; Oyamada, Hideto; Imagawa, Atsuko; Shida, Kenji; Takahashi, Johji; Oguchi, Katsuji; Masuda, Yutaka; Hara, Hajime; Usami, Shino; Kiuchi, Yuji

    2012-04-01

    Migraine is a multifactorial disease with various factors, such as genetic polymorphisms and personality traits, but the contribution of those factors is not clear. To clarify the pathogenesis of migraine, the contributions of genetic polymorphisms and personality traits were simultaneously investigated using multivariate analysis. Ninety-one migraine patients and 119 non-headache healthy volunteers were enrolled. The 12 gene polymorphisms analysis and NEO-FFI personality test were performed. At first, the univariate analysis was performed to extract the contributing factors to pathogenesis of migraine. We then extracted the factors that independently contributed to the pathogenesis of migraine using multivariate stepwise logistic regression analysis. Using the multivariate analysis, three gene polymorphisms including monoamine oxidase A (MAOA) T941G, methylenetetrahydrofolate reductase (MTHFR) C677T, and tumor necrosis factor beta (TNF-β) G252Α, and the neuroticism and conscientiousness scores in NEO-FFI were selected as significant factors that independently contributed to the pathogenesis of migraine. Their odds ratios were 1.099 (per point of neuroticism score), 1.080 (per point of conscientiousness score), 2.272 (T and T/T or T/G vs G and G/G genotype of MAOA), 1.939 (C/T or T/T vs C/C genotype of MTHFR), and 2.748 (G/A or A/A vs G/G genotype of TNF-β), respectively. We suggested that multiple factors, such as gene polymorphisms and personality traits, contribute to the pathogenesis of migraine. The contribution of polymorphisms, such as MAOA T941G, MTHFR C677T, and TNF-β G252A, were more important than personality traits in the pathogenesis of migraine, a multifactorial disorder.

  7. Impact of CCL4 gene polymorphisms and environmental factors on oral cancer development and clinical characteristics

    PubMed Central

    Lien, Ming-Yu; Lin, Chiao-Wen; Tsai, Hsiao-Chi; Chen, Yng-Tay; Tsai, Ming-Hsui; Hua, Chun-Hung; Yang, Shun-Fa; Tang, Chih-Hsin

    2017-01-01

    In Taiwan, oral cancer has causally been associated with environmental carcinogens. CCL4 (C-C chemokine ligand 4), a macrophage inflammatory protein with a key role in inflammation and immune-regulation, was implicated in carcinogenesis by facilitating instability in the tumor environment. The purpose of this study was to identify gene polymorphisms of CCL4 specific to patients with oral squamous cell carcinoma (OSCC) susceptibility and clinicopathological characteristics. A total of 2,053 participants, including 1192 healthy people and 861 patients with oral cancer, were recruited for this study. Three single-nucleotide polymorphisms (SNPs) of the CCL4 gene were analyzed by a real-time PCR. We found that the T/T homozygotes of CCL4 rs1634507 G/T polymorphism and the GG haplotype of 2 CCL4 SNPs (rs1634507 and rs10491121) combined were associated with oral-cancer susceptibility. In addition, TA haplotype significantly decreased the risks for oral cancer by 0.118 fold. Among 1420 smokers, CCL4 polymorphisms carriers with the betel-nut chewing habit had a 15.476–20.247-fold greater risk of having oral cancer compared to CCL4 wild-type (WT) carriers without the betel-nut chewing habit. Finally, patients with oral cancer who had A/G heterozygotes of CCL4 rs10491121 A/G polymorphism showed a lower risk for an advanced tumor size (> T2) (p=0.046), compared to those patients with AA homozygotes. Our results suggest that the CCL4 rs1634507 SNP have potential predictive significance in oral carcinogenesis. Gene-environment interactions of CCL4 polymorphisms might influence oral-cancer susceptibility. CCL4 rs10491121 may be a factor to predict the tumor size in OSCC patients. PMID:28404909

  8. Impact of CCL4 gene polymorphisms and environmental factors on oral cancer development and clinical characteristics.

    PubMed

    Lien, Ming-Yu; Lin, Chiao-Wen; Tsai, Hsiao-Chi; Chen, Yng-Tay; Tsai, Ming-Hsui; Hua, Chun-Hung; Yang, Shun-Fa; Tang, Chih-Hsin

    2017-05-09

    In Taiwan, oral cancer has causally been associated with environmental carcinogens. CCL4 (C-C chemokine ligand 4), a macrophage inflammatory protein with a key role in inflammation and immune-regulation, was implicated in carcinogenesis by facilitating instability in the tumor environment. The purpose of this study was to identify gene polymorphisms of CCL4 specific to patients with oral squamous cell carcinoma (OSCC) susceptibility and clinicopathological characteristics. A total of 2,053 participants, including 1192 healthy people and 861 patients with oral cancer, were recruited for this study. Three single-nucleotide polymorphisms (SNPs) of the CCL4 gene were analyzed by a real-time PCR. We found that the T/T homozygotes of CCL4 rs1634507 G/T polymorphism and the GG haplotype of 2 CCL4 SNPs (rs1634507 and rs10491121) combined were associated with oral-cancer susceptibility. In addition, TA haplotype significantly decreased the risks for oral cancer by 0.118 fold. Among 1420 smokers, CCL4 polymorphisms carriers with the betel-nut chewing habit had a 15.476-20.247-fold greater risk of having oral cancer compared to CCL4 wild-type (WT) carriers without the betel-nut chewing habit. Finally, patients with oral cancer who had A/G heterozygotes of CCL4 rs10491121 A/G polymorphism showed a lower risk for an advanced tumor size (> T2) (p=0.046), compared to those patients with AA homozygotes. Our results suggest that the CCL4 rs1634507 SNP have potential predictive significance in oral carcinogenesis. Gene-environment interactions of CCL4 polymorphisms might influence oral-cancer susceptibility. CCL4 rs10491121 may be a factor to predict the tumor size in OSCC patients.

  9. Q192R polymorphism in the PON1 gene and familial hypercholesterolemia in a Saudi population.

    PubMed

    Alharbi, Khalid Khalaf; Alnbaheen, May Salem; Alharbi, Fawiziah Khalaf; Hasanato, Rana M; Khan, Imran Ali

    2017-01-01

    Familial hypercholesterolemia (FH) is an autosomal dominant condition characterized by abnormal levels of low-density lipoprotein (LDL) in the blood. FH is a risk factor for atherosclerosis and cardiovascular disease. The relationship between the paraoxonase 1 (PON1) gene, atherosclerosis and coronary artery disease has not been studied in Saudi patients. To investigate the genetic associations of the Q192R polymorphism in the PON1 gene with FH in Saudi patients. Case-control study. Tertiary care center, Riyadh. Two hundred Saudi patients were enrolled in this study, including 100 patients with FH and 100 healthy controls, during the period from January 2012 to March 2013. Serum was separated from coagulated blood (3 mL) and used for analysis of lipid profiles. Genomic DNA was isolated from anticoagulant-treated blood (2 mL). Genotyping for the Q192R polymorphism was performed by polymerase chain reaction-restriction fragment length polymorphism analysis, followed by 3% agarose gel electrophoresis. The strength of association between the Q192R polymorphism and FH in the Saudi population. We confirmed that QR versus QQ (odds ratio [OR]: 1.55; 95% confidence interval [CI]: 1.05-3.43; P=.03), QR+RR versus QQ (OR: 1.98; 95% CI: 1.13-3.49; P=.01), and R versus Q (OR: 1.68; 95% CI: 1.09- 2.59; P=.01) in the Q192R polymorphism were associated with FH in the Saudi population. In conclusion, the Q192R polymorphism in the PON1 gene is associated with FH in the Saudi population. Our results confirmed that the R allele, QR, and dominant model genotypes were associated with FH. Only a single variant (Q192R) was analyzed, and the medical and family histories of the patients were not known.

  10. An application of CART algorithm in genetics: IGFs and cGH polymorphisms in Japanese quail

    NASA Astrophysics Data System (ADS)

    Kaplan, Selçuk

    2017-04-01

    The avian insulin-like growth factor-1 (IGFs) and avian growth hormone (cGH) genes are the most important genes that can affect bird performance traits because of its important function in growth and metabolism. Understanding the molecular genetic basis of variation in growth-related traits is of importance for continued improvement and increased rates of genetic gain. The objective of the present study was to identify polymorphisms of cGH and IGFs genes in Japanese quail using conventional least square method (LSM) and CART algorithm. Therefore, this study was aimed to demonstrate at determining the polymorphisms of two genes related growth characteristics via CART algorithm. A simulated data set was generated to analyze by adhering the results of some poultry genetic studies which it includes live weights at 5 weeks of age, 3 alleles and 6 genotypes of cGH and 2 alleles and 3 genotypes of IGFs. As a result, it has been determined that the CART algorithm has some advantages as for that LSM.

  11. A meta-analysis of eNOS and ACE gene polymorphisms and risk of pre-eclampsia in women.

    PubMed

    Shaik, A P; Sultana, A; Bammidi, V K; Sampathirao, K; Jamil, K

    2011-10-01

    A meta-analyses of endothelial nitric oxide synthase (eNOS) and angiotensin-converting enzyme (ACE) gene polymorphisms in pre-eclampsia was performed. We shortlisted 33 studies (17 for ACE; 16 for eNOS gene polymorphisms), of which 29 articles (16 for ACE and 15 for eNOS) were analysed. Overall, 1,620 cases with pre-eclampsia and 2,158 controls were analysed for intron 16 insertion-deletion polymorphism in ACE gene. A total of 1,610 subjects with pre-eclampsia and 2,875 controls were analysed for the Glu298Asp in eNOS gene. Overall, the random-effects odds ratio (OR) with Glu298Asp in eNOS gene was 0.958 (95% confidence intervals, CI 0.747-1.228, p > 0.05), and for the insertion-deletion/ACE polymorphism was 0.987 (95% CI 0.698-1.395, p > 0.05). Significant heterogeneity was observed in the studies that evaluated polymorphisms in ACE (Q value = 55.6; I(2) = 73; p value = 0.000); and eNOS (Q value = 37.2; I(2) = 62.4; p value = 0.001) polymorphisms. No significant risk of pre-eclampsia was observed in both eNOS and ACE genes with these polymorphisms.

  12. Folate and Breast Cancer: Role of Intake, Blood Levels, and Metabolic Gene Polymorphisms

    DTIC Science & Technology

    2005-07-01

    folate, and metabolic gene polymorphisms in relation to breast cancer risk: Months 1-19. b. Prepare blood samples for relevant assays: Months 1-19... gene polymorphism assays among the 184 cases and matched controls. The folate assays are on-going at this time. DNA assays will commence in the... methotrexate . Ann Oncol 13: 1915–1918, 2002 13. Toffoli G, Veronesi A, Boiocchi M, Crivellari D: MTHFR gene polymorphism and severe toxicity during

  13. Geographical distribution of genetic polymorphism of the pathogen Histoplasma capsulatum isolated from infected bats, captured in a central zone of Mexico.

    PubMed

    Taylor, Maria Lucia; Chávez-Tapia, Catalina B; Rojas-Martínez, Alberto; del Rocio Reyes-Montes, Maria; del Valle, Mirian Bobadilla; Zúñiga, Gerardo

    2005-09-01

    Fourteen Histoplasma capsulatum isolates recovered from infected bats captured in Mexican caves and two human H. capsulatum reference strains were analyzed using random amplification of polymorphic DNA PCR-based and partial DNA sequences of four genes. Cluster analysis of random amplification of polymorphic DNA-patterns revealed differences for two H. capsulatum isolates of one migratory bat Tadarida brasiliensis. Three groups were identified by distance and maximum-parsimony analyses of arf, H-anti, ole, and tub1 H. capsulatum genes. Group I included most isolates from infected bats and one clinical strain from central Mexico; group II included the two isolates from T. brasiliensis; the human G-217B reference strain from USA formed an independent group III. Isolates from group II showed diversity in relation to groups I and III, suggesting a different H. capsulatum population.

  14. Lack of association between FokI polymorphism in vitamin D receptor gene (VDR) & type 2 diabetes mellitus in the Tunisian population

    PubMed Central

    Mahjoubi, Imen; Kallel, Amani; Sbaï, Mohamed Hédi; Ftouhi, Bochra; ben Halima, Meriam; Jemaa, Zeineb; Feki, Moncef; Slimane, Hedia; Jemaa, Riadh; Kaabachi, Naziha

    2016-01-01

    Background & objectives: The impact of several environmental and genetic factors on diabetes is well documented. Though the association between the vitamin D receptor (VDR) gene polymorphisms and type 2 diabetes mellitus (T2DM) has been analyzed in different ethnic groups, the results have been inconsistent. The aim of this study was to evaluate the possible association between VDR FokI polymorphism and genetic susceptibility to T2DM in Tunisian population. Methods: A total of 439 unrelated patients with T2DM and 302 healthy controls were included in the study. Genomic DNA was extracted from blood and genotyped for the single nucleotide polymorphism (SNP) of FokI (T/C: (rs2228570) by polymerase chain reaction and restriction fragment length polymorphism (PCR-RFLP) analysis. Results: The genotype distribution and the relative allelic frequencies for the FokI polymorphism were not significantly different between T2DM and controls: in T2DM patients the frequencies of the CC, CT, and TT genotypes were 52.6, 41.0, and 6.1 per cent, respectively, and in controls the genotype frequencies were 55.6, 38.7, and 5.6 per cent, respectively. In our study, the TT genotype of the FokI polymorphism was not associated with T2DM (OR =1.19, 95% CI 0.63 - 2.25, P=0.577). Interpretation & conclusions: Our study showed no significant association of the FokI polymorphism in the vitamin D receptor gene with type 2 diabetes mellitus in Tunisian population. PMID:27834325

  15. Genomic polymorphism, recombination, and linkage disequilibrium in human major histocompatibility complex-encoded antigen-processing genes.

    PubMed Central

    van Endert, P M; Lopez, M T; Patel, S D; Monaco, J J; McDevitt, H O

    1992-01-01

    Recently, two subunits of a large cytosolic protease and two putative peptide transporter proteins were found to be encoded by genes within the class II region of the major histocompatibility complex (MHC). These genes have been suggested to be involved in the processing of antigenic proteins for presentation by MHC class I molecules. Because of the high degree of polymorphism in MHC genes, and previous evidence for both functional and polypeptide sequence polymorphism in the proteins encoded by the antigen-processing genes, we tested DNA from 27 consanguineous human cell lines for genomic polymorphism by restriction fragment length polymorphism (RFLP) analysis. These studies demonstrate a strong linkage disequilibrium between TAP1 and LMP2 RFLPs. Moreover, RFLPs, as well as a polymorphic stop codon in the telomeric TAP2 gene, appear to be in linkage disequilibrium with HLA-DR alleles and RFLPs in the HLA-DO gene. A high rate of recombination, however, seems to occur in the center of the complex, between the TAP1 and TAP2 genes. Images PMID:1360671

  16. The polymorphism -863C/A in tumour necrosis factor-alpha gene contributes an independent association to gout.

    PubMed

    Chang, S-J; Tsai, P-C; Chen, C-J; Lai, H-M; Ko, Y-C

    2007-11-01

    To investigate the associations between polymorphisms in the promoter of the tumour necrosis factor-alpha (TNF-alpha) gene and gout. The polymorphisms -308G/A and -863C/A in the TNF-alpha gene were determined in 106 gout patients and 159 healthy controls among male Taiwanese using the Polymerase Chain Reaction-Restriction Fragment Length Polymorphism (PCR-RFLP) method. The biochemical markers, including Glutamic-oxaloacetic transaminase (GOT), Glutamic-pyruvic transaminase (GPT), uric acid, creatinine, total cholesterol (TC), triglycerides (TG), body mass index (BMI) and hypertension, as well as alcohol consumption were measured. The gout patients had 9.43% (10/106) with genotype AA at polymorphism -863C/A showing a significantly higher fraction than controls (0.63%; 1/159, P < 0.001). The crude results also showed that the gout patients had significantly higher portions of abnormal GOT, GPT, creatinine, TC, TG, alcohol consumption, hypertension and hyperuricaemia than controls (P < 0.05), but the -308G/A, BMI and genotype CA at -863C/A did not show the same significant difference (P > 0.05). After adjustment by a stepwise logistic regression method, the hyperuricaemia, creatinine, GPT, TG and alcohol consumption as well as genotype AA at polymorphism -863C/A were found to be significantly associated with gout. The genotype AA at polymorphism -863C/A in a recessive model showed a significant association with developing gout independent of hyperuricaemia, abnormal creatinine, higher TG, GPT and alcohol consumption.

  17. Associations between ghrelin and ghrelin receptor polymorphisms and cancer in Caucasian populations: a meta-analysis.

    PubMed

    Pabalan, Noel A; Seim, Inge; Jarjanazi, Hamdi; Chopin, Lisa K

    2014-11-07

    There is growing evidence that the ghrelin axis, including ghrelin (GHRL) and its receptor, the growth hormone secretagogue receptor (GHSR), play a role in cancer progression. Ghrelin gene and ghrelin receptor gene polymorphisms have been reported to have a range of effects in cancer, from increased risk, to protection from cancer, or having no association. In this study we aimed to clarify the role of ghrelin and ghrelin receptor polymorphisms in cancer by performing a meta-analysis of published case-control studies. In the overall analysis, homozygous and recessive associations indicated that the minor alleles of rs696217 and rs2075356 GHRL polymorphisms conferred reduced cancer risk (odds ratio [OR] 0.61-0.78). The risk was unchanged for breast cancer patients when analysed separately (OR 0.73-0.83). In contrast, the rs4684677 GHRL and the rs572169 GHSR polymorphisms conferred increased breast cancer risk (OR 1.97-1.98, p = 0.08 and OR 1.42-1.43, p = 0.08, respectively). All dominant and co-dominant effects showed null effects (OR 0.96-1.05), except for the rs572169 co-dominant effect, with borderline increased risk (OR 1.08, p = 0.05). This study suggests that the rs696217 and rs2075356 ghrelin gene (GHRL) polymorphisms may protect carriers against breast cancer, and the rs4684677 GHRL and rs572169 GHSR polymorphisms may increase the risk among carriers. In addition, larger studies are required to confirm these findings.

  18. Association of a neuronal nitric oxide synthase gene polymorphism with levodopa-induced dyskinesia in Parkinson's disease.

    PubMed

    Santos-Lobato, Bruno Lopes; Borges, Vanderci; Ferraz, Henrique Ballalai; Mata, Ignacio Fernandez; Zabetian, Cyrus P; Tumas, Vitor

    2018-04-01

    Levodopa-induced dyskinesia (LID) is a common complication of advanced Parkinson's disease (PD). PD physiopathology is associated with dopaminergic and non-dopaminergic pathways, including the nitric oxide system. The present study aims to examine the association of a neuronal nitric oxide synthase gene (NOS1) single nucleotide polymorphism (rs2682826) with LID in PD patients. We studied 186 PD patients using levodopa. The presence of LID was defined as a MDS-UPDRS Part IV score ≥1 on item 4.1. We tested for association between NOS1 rs2682826 and the presence, daily frequency, and functional impact of LID using regression models, adjusting for important covariates. There was no significant association between genotype and any of the LID-related variables examined. Our results suggest that this NOS1 polymorphism does not contribute to LID susceptibility or severity. However, additional studies that include a comprehensive set of NOS1 variants will be needed to fully define the role of this gene in LID. Copyright © 2017 Elsevier Inc. All rights reserved.

  19. Genetic polymorphisms in the ESR1 gene and cerebral infarction risk: a meta-analysis.

    PubMed

    Gao, Hong-Hua; Gao, Lian-Bo; Wen, Jia-Mei

    2014-09-01

    A number of studies have documented that estrogen receptor α (ESR1) may play an important role in the development and progression of cerebral infarction, but many existing studies have yielded inconclusive results. This meta-analysis was performed to evaluate the relationships between ESR1 genetic polymorphisms and cerebral infarction risk. The PubMed, CISCOM, CINAHL, Web of Science, Google Scholar, EBSCO, Cochrane Library, and CBM databases were searched for relevant articles published before October 1, 2013, without any language restrictions. Meta-analysis was conducted using the STATA 12.0 software. Seven case-control studies were included with a total of 1471 patients with cerebral infarction and 4688 healthy control subjects. Two common single-nucleotide polymorphisms (SNPs) in the ESR1 gene (rs2234693 T>C and rs9340799 A>G) were assessed. Our meta-analysis results revealed that ESR1 genetic polymorphisms might increase the risk of cerebral infarction. Subgroup analysis by SNP type indicated that both rs2234693 and rs9340799 polymorphisms in the ESR1 gene were strongly associated with an increased risk of cerebral infarction. Further subgroup analysis by ethnicity showed significant associations between ESR1 genetic polymorphisms and increased risk of cerebral infarction among both Asians and Caucasians. In the stratified subgroup analysis by gender, the results suggested that ESR1 genetic polymorphisms were associated with an increased risk of cerebral infarction in the female population. However, there were no statistically significant associations between ESR1 genetic polymorphisms and cerebral infarction risk in the male population. Meta-regression analyses also confirmed that gender might be a main source of heterogeneity. Our findings indicate that ESR1 genetic polymorphisms may contribute to the development of cerebral infarction, especially in the female population.

  20. Markers and mapping revisited: finding your gene.

    PubMed

    Jones, Neil; Ougham, Helen; Thomas, Howard; Pasakinskiene, Izolda

    2009-01-01

    This paper is an update of our earlier review (Jones et al., 1997, Markers and mapping: we are all geneticists now. New Phytologist 137: 165-177), which dealt with the genetics of mapping, in terms of recombination as the basis of the procedure, and covered some of the first generation of markers, including restriction fragment length polymorphisms (RFLPs), random amplified polymorphic DNA (RAPDs), simple sequence repeats (SSRs) and quantitative trait loci (QTLs). In the intervening decade there have been numerous developments in marker science with many new systems becoming available, which are herein described: cleavage amplification polymorphism (CAP), sequence-specific amplification polymorphism (S-SAP), inter-simple sequence repeat (ISSR), sequence tagged site (STS), sequence characterized amplification region (SCAR), selective amplification of microsatellite polymorphic loci (SAMPL), single nucleotide polymorphism (SNP), expressed sequence tag (EST), sequence-related amplified polymorphism (SRAP), target region amplification polymorphism (TRAP), microarrays, diversity arrays technology (DArT), single-strand conformation polymorphism (SSCP), denaturing gradient gel electrophoresis (DGGE), temperature gradient gel electrophoresis (TGGE) and methylation-sensitive PCR. In addition there has been an explosion of knowledge and databases in the area of genomics and bioinformatics. The number of flowering plant ESTs is c. 19 million and counting, with all the opportunity that this provides for gene-hunting, while the survey of bioinformatics and computer resources points to a rapid growth point for future activities in unravelling and applying the burst of new information on plant genomes. A case study is presented on tracking down a specific gene (stay-green (SGR), a post-transcriptional senescence regulator) using the full suite of mapping tools and comparative mapping resources. We end with a brief speculation on how genome analysis may progress into the future of this highly dynamic arena of plant science.

  1. Presence of the p.L456V polymorphism in Cuban patients clinically diagnosed with Wilson's disease.

    PubMed

    Clark-Feoktistova, Y; Ruenes-Domech, C; García-Bacallao, E F; Roblejo-Balbuena, H; Feoktistova, L; Clark-Feoktistova, I; Jay-Herrera, O; Collazo-Mesa, T

    2018-06-10

    Wilson's disease is characterized by the accumulation of copper in different organs, mainly affecting the liver, brain, and cornea, and is caused by mutations in the ATP7B gene. More than 120 polymorphisms in the ATP7B gene have been reported in the medical literature. The aim of the present study was to identify the conformational changes in the exon 3 region of the ATP7B gene and detect the p.L456V polymorphism in Cuban patients clinically diagnosed with Wilson's disease. A descriptive study was conducted at the Centro Nacional de Genética Médica and the Instituto Nacional de Gastroenterología within the time frame of 2007-2012 and included 105 patients with a clinical diagnosis of Wilson's disease. DNA extraction was performed through the salting-out method and the fragment of interest was amplified using the polymerase chain reaction technique. The conformational shift changes in the exon 3 region and the presence of the p.L456V polymorphism were identified through the Single-Strand Conformation Polymorphism analysis. The so-called b and c conformational shift changes, corresponding to the p.L456V polymorphism in the heterozygous and homozygous states, respectively, were identified. The allelic frequency of the p.L456V polymorphism in the 105 Cuban patients that had a clinical diagnosis of Wilson's disease was 41% and liver-related symptoms were the most frequent in the patients with that polymorphism. The p.L456V polymorphism was identified in 64 Cuban patients clinically diagnosed with Wilson's disease, making future molecular study through indirect methods possible. Copyright © 2018 Asociación Mexicana de Gastroenterología. Publicado por Masson Doyma México S.A. All rights reserved.

  2. Relationship of MTHFR gene polymorphisms with renal and cardiac disease

    PubMed Central

    Trovato, Francesca M; Catalano, Daniela; Ragusa, Angela; Martines, G Fabio; Pirri, Clara; Buccheri, Maria Antonietta; Di Nora, Concetta; Trovato, Guglielmo M

    2015-01-01

    AIM: To investigate the effects of different methylenetetrahydrofolate reductase (MTHFR) 677C>T gene polymorphism and hyperhomocysteinemia for the development of renal failure and cardiovascular events, which are controversial. METHODS: We challenged the relationship, if any, of MTHFR 677C>T and MTHFR 1298A>C polymorphisms with renal and heart function. The present article is a reappraisal of these concepts, investigating within a larger population, and including a subgroup of dialysis patients, if the two most common MTHFR polymorphisms, C677T and A1298C, as homozygous, heterozygous or with a compound heterozygous state, show different association with chronic renal failure requiring hemodialysis. MTHFR polymorphism could be a favorable evolutionary factor, i.e., a protective factor for many ominous conditions, like cancer and renal failure. A similar finding was reported in fatty liver disease in which it is suggested that MTHFR polymorphisms could have maintained and maintain their persistence by an heterozygosis advantage mechanism. We studied a total of 630 Italian Caucasian subject aged 54.60 ± 16.35 years, addressing to the increased hazard of hemodialysis, if any, according to the studied MTHFR genetic polymorphisms. RESULTS: A favorable association with normal renal function of MTHFR polymorphisms, and notably of MTHFR C677T is present independently of the negative effects of left ventricular hypertrophy, increased Intra-Renal arterial Resistance and hyperparathyroidism. CONCLUSION: MTHFR gene polymorphisms could have a protective role on renal function as suggested by their lower frequency among our dialysis patients in end-stage renal failure; differently, the association with left ventricular hypertrophy and reduced left ventricular relaxation suggest some type of indirect, or concurrent mechanism. PMID:25664255

  3. Genetic polymorphisms in adipokine genes and the risk of obesity: a systematic review and meta-analysis.

    PubMed

    Yu, Zhangbin; Han, Shuping; Cao, Xingguo; Zhu, Chun; Wang, Xuejie; Guo, Xirong

    2012-02-01

    Polymorphisms in adipokine genes, such as leptin (LEP), leptin receptor (LEPR), resistin (RETN), adiponectin (ADIPOQ), interleukin-1β (IL-1β), IL-6 (IL-6), and tumor necrosis factor-α (TNF-α) may be involved in the development of obesity. We conducted a systematic review of published evidence on the association between different adipokine genes and the risk of obesity. Librarian-designed searches of PubMed and HuGeNet, review of reference lists from published reviews and content expert advice identified potentially eligible studies. The genotyping information and polymorphisms of different adipokine genes, numbers of genotyped cases and controls and frequencies of genotypes were extracted from 48 eligible studies included in this review. Twenty-one polymorphisms each associated with obesity in at least one study were identified. Polymorphisms in the adipokine genes, LEP, LEPR, and RETN were not associated with obesity susceptibility, whereas ADIPOQ G276T (T vs. G: odds ratio (OR), 1.59; 95% confidence interval (CI), 1.39-1.81), IL-1β C3953T (CC vs. CT+TT: OR, 1.61; 95% CI, 1.18-2.20), and TNF-α G308A (GG vs. GA+AA: OR, 1.19; 95% CI, 1.02-1.39) polymorphisms were associated with an increased risk of obesity. The IL-6 G174C polymorphism was also associated obesity when using allelic comparisons, the recessive genetic model and the dominant genetic model with OR (95% CI) of 1.95 (1.37-2.77), 1.44 (1.15-1.80), and 1.36 (1.16-1.59), respectively. No significant evidence of publication bias was present. However, these "null" results were underpowered due to a small pooled sample size, and analysis of additional case-control studies with larger sample sizes should provide further clarifications.

  4. Genetic update on inflammatory factors in ulcerative colitis: Review of the current literature

    PubMed Central

    Sarlos, Patricia; Kovesdi, Erzsebet; Magyari, Lili; Banfai, Zsolt; Szabo, Andras; Javorhazy, Andras; Melegh, Bela

    2014-01-01

    Ulcerative colitis (UC) is one of the main types of inflammatory bowel disease, which is caused by dysregulated immune responses in genetically predisposed individuals. Several genetic factors, including interleukin and interleukin receptor gene polymorphisms and other inflammation-related genes play central role in mediating and modulating the inflammation in the human body, thereby these can be the main cause of development of the disease. It is clear these data are very important for understanding the base of the disease, especially in terms of clinical utility and validity, but summarized literature is exiguous for challenge health specialist that can used in the clinical practice nowadays. This review summarizes the current literature on inflammation-related genetic polymorphisms which are associated with UC. We performed an electronic search of Pubmed Database among publications of the last 10 years, using the following medical subject heading terms: UC, ulcerative colitis, inflammation, genes, polymorphisms, and susceptibility. PMID:25133031

  5. Androgen Receptor Gene Polymorphisms and Alterations in Prostate Cancer: Of Humanized Mice and Men

    PubMed Central

    Robins, Diane M.

    2011-01-01

    Germline polymorphisms and somatic mutations of the androgen receptor (AR) have been intensely investigated in prostate cancer but even with genomic approaches their impact remains controversial. To assess the functional significance of AR genetic variation, we converted the mouse gene to the human sequence by germline recombination and engineered alleles to query the role of a polymorphic glutamine (Q) tract implicated in cancer risk. In a prostate cancer model, AR Q tract length influences progression and castration response. Mutation profiling in mice provides direct evidence that somatic AR variants are selected by therapy, a finding validated in human metastases from distinct treatment groups. Mutant ARs exploit multiple mechanisms to resist hormone ablation, including alterations in ligand specificity, target gene selectivity, chaperone interaction and nuclear localization. Regardless of their frequency, these variants permute normal function to reveal novel means to target wild type AR and its key interacting partners. PMID:21689727

  6. No Association between Oxytocin Receptor (OXTR) Gene Polymorphisms and Experimentally Elicited Social Preferences

    PubMed Central

    Apicella, Coren L.; Cesarini, David; Johannesson, Magnus; Dawes, Christopher T.; Lichtenstein, Paul; Wallace, Björn; Beauchamp, Jonathan; Westberg, Lars

    2010-01-01

    Background Oxytocin (OXT) has been implicated in a suite of complex social behaviors including observed choices in economic laboratory experiments. However, actual studies of associations between oxytocin receptor (OXTR) gene variants and experimentally elicited social preferences are rare. Methodology/Principal Findings We test hypotheses of associations between social preferences, as measured by behavior in two economic games, and 9 single nucleotide polymorphisms (SNPs) of the OXTR gene in a sample of Swedish twins (n = 684). Two standard economic games, the dictator game and the trust game, both involving real monetary consequences, were used to elicit such preferences. After correction for multiple hypothesis testing, we found no significant associations between any of the 9 single nucleotide polymorphisms (SNPs) and behavior in either of the games. Conclusion We were unable to replicate the most significant association reported in previous research between the amount donated in a dictator game and an OXTR genetic variant. PMID:20585395

  7. No association between oxytocin receptor (OXTR) gene polymorphisms and experimentally elicited social preferences.

    PubMed

    Apicella, Coren L; Cesarini, David; Johannesson, Magnus; Dawes, Christopher T; Lichtenstein, Paul; Wallace, Björn; Beauchamp, Jonathan; Westberg, Lars

    2010-06-16

    Oxytocin (OXT) has been implicated in a suite of complex social behaviors including observed choices in economic laboratory experiments. However, actual studies of associations between oxytocin receptor (OXTR) gene variants and experimentally elicited social preferences are rare. We test hypotheses of associations between social preferences, as measured by behavior in two economic games, and 9 single nucleotide polymorphisms (SNPs) of the OXTR gene in a sample of Swedish twins (n = 684). Two standard economic games, the dictator game and the trust game, both involving real monetary consequences, were used to elicit such preferences. After correction for multiple hypothesis testing, we found no significant associations between any of the 9 single nucleotide polymorphisms (SNPs) and behavior in either of the games. We were unable to replicate the most significant association reported in previous research between the amount donated in a dictator game and an OXTR genetic variant.

  8. Immunogenetic Factors Affecting Susceptibility of Humans and Rodents to Hantaviruses and the Clinical Course of Hantaviral Disease in Humans

    PubMed Central

    Charbonnel, Nathalie; Pagès, Marie; Sironen, Tarja; Henttonen, Heikki; Vapalahti, Olli; Mustonen, Jukka; Vaheri, Antti

    2014-01-01

    We reviewed the associations of immunity-related genes with susceptibility of humans and rodents to hantaviruses, and with severity of hantaviral diseases in humans. Several class I and class II HLA haplotypes were linked with severe or benign hantavirus infections, and these haplotypes varied among localities and hantaviruses. The polymorphism of other immunity-related genes including the C4A gene and a high-producing genotype of TNF gene associated with severe PUUV infection. Additional genes that may contribute to disease or to PUUV infection severity include non-carriage of the interleukin-1 receptor antagonist (IL-1RA) allele 2 and IL-1β (-511) allele 2, polymorphisms of plasminogen activator inhibitor (PAI-1) and platelet GP1a. In addition, immunogenetic studies have been conducted to identify mechanisms that could be linked with the persistence/clearance of hantaviruses in reservoirs. Persistence was associated during experimental infections with an upregulation of anti-inflammatory responses. Using natural rodent population samples, polymorphisms and/or expression levels of several genes have been analyzed. These genes were selected based on the literature of rodent or human/hantavirus interactions (some Mhc class II genes, Tnf promoter, and genes encoding the proteins TLR4, TLR7, Mx2 and β3 integrin). The comparison of genetic differentiation estimated between bank vole populations sampled over Europe, at neutral and candidate genes, has allowed to evidence signatures of selection for Tnf, Mx2 and the Drb Mhc class II genes. Altogether, these results corroborated the hypothesis of an evolution of tolerance strategies in rodents. We finally discuss the importance of these results from the medical and epidemiological perspectives. PMID:24859344

  9. No evidence of association between NOD2/CARD15 gene polymorphism and atherosclerotic events after renal transplantation

    PubMed Central

    Courivaud, Cécile; Ferrand, Christophe; Deschamps, Marina; Tiberghien, Pierre; Chalopin, Jean-Marc; Duperrier, Anne; Saas, Philippe; Ducloux, Didier

    2006-01-01

    Stable renal transplant recipients (RTR) display high rates of atherosclerotic events (AE). Innate immunity and especially vascular inflammation play a role in the pathogenesis of atherosclerosis. It is illustrated both by an increased occurrence of post-renal transplant cardiovascular events in patients with elevated levels of C-reactive protein and by a correlation between post-transplant AE and Toll-like receptor-4 Asp299Gly polymorphism. Here, we analyze the influence NOD2/CARD15 gene polymorphism since NOD2 can modulate macrophage pro-inflammatory activity and macrophage is present in early atherosclerotic lesions. The incidence of single nucleotide polymorphism (SNP) in the three major polymorphic region of NOD2 gene (SNP8, SNP12 and SNP13) was assessed in 182 RTR and the correlation between such polymorphism and the development of AE was analyzed. No correlation was observed between NOD2 gene polymorphism and the occurrence of AE after renal transplantation. NOD2 gene polymorphism thus does not appear to influence cardiovascular complications in RTR. PMID:16641610

  10. Infraspecific DNA methylation polymorphism in cotton (Gossypium hirsutum L.).

    PubMed

    Keyte, Anna L; Percifield, Ryan; Liu, Bao; Wendel, Jonathan F

    2006-01-01

    Cytosine methylation is important in the epigenetic regulation of gene expression and development in plants and has been implicated in silencing duplicate genes after polyploid formation in several plant groups. Relatively little information exists, however, on levels and patterns of methylation polymorphism (MP) at homologous loci within species. Here we explored the levels and patterns of methylation-polymorphism diversity at CCGG sites within allotetraploid cotton, Gossypium hirsutum, using a methylation-sensitive amplified fragment length polymorphism screen and a selected set of 20 G. hirsutum accessions for which we have information on genetic polymorphism levels and relationships. Methylation and MP exist at high levels within G. hirsutum: of 150 HpaII/MspI sites surveyed, 48 were methylated at the inner cytosine (32%) and 32 of these were polymorphic (67%). Both these values are higher than comparable measures of genetic diversity using restriction fragment length polymorphisms. The high percentage of methylation-polymorphic sites and potential relationship to gene expression underscore the potential significance of MP within and among populations. We speculate that biased correlation of methylation-polymorphic sites and genes in cotton may be a consequence of polyploidy and the attendant doubling of all genes.

  11. A Family-Based Association Analysis and Meta-Analysis of the Reading Disabilities Candidate Gene DYX1C1

    PubMed Central

    Tran, C.; Gagnon, F.; Wigg, K.G.; Feng, Y.; Gomez, L.; Cate-Carter, T.D.; Kerr, E.N.; Field, L.L.; Kaplan, B.J.; Lovett, M.W.; Barr, C.L.

    2017-01-01

    Reading disabilities (RD) have a significant genetic basis and have shown linkage to multiple regions including chromosome 15q. Dyslexia susceptibility 1 candidate gene 1 (DYX1C1) on chromosome 15q21 was originally proposed as a candidate gene with two potentially functional polymorphisms at the −3G/A and 1249G/T positions showing association with RD. However, subsequent studies have yielded mixed results. We performed a literature review and meta-analysis of the −3G/A and 1249G/T polymorphisms, including new unpublished data from two family-based samples. Ten markers in DYX1C1 were genotyped in the two independently ascertained samples. Single marker and −3G/A:1249G/T haplotype analyses were performed for RD in both samples, and quantitative trait analyses using standardized reading-related measures was performed in one of the samples. For the meta-analysis, we used a random-effects model to summarize studies that tested for association between −3G/A or 1249G/T and RD. No significant association was found between the DYX1C1 SNPs and RD or any of the reading-related measures tested after correction for the number of tests performed. The previously reported risk haplotype (−3A:1249T) was not biased in transmission. A total of 9 and 10 study samples were included in the meta-analysis of the −3G/A and 1249G/T polymorphisms, respectively. Neither polymorphism reached statistical significance, but the heterogeneity for the 1249G/T polymorphism was high. The results of this study do not provide evidence for association between the putatively functional SNPs −3G/A and 1249G/T and RD. PMID:23341075

  12. Restriction fragment length polymorphisms in dairy and beef cattle at the growth hormone and prolactin loci.

    PubMed

    Hallerman, E M; Nave, A; Kashi, Y; Holzer, Z; Soller, M; Beckmann, J S

    1987-01-01

    Two bovine populations, a Holstein-Friesian dairy stock and a synthetic (Baladi X Hereford X Simmental X Charolais) beef stock, were screened for restriction fragment length polymorphisms (RFLPs) at the growth hormone and prolactin genes. Most RFLPs at the growth hormone gene are apparently the consequence of an insertion/deletion event which was localized to a region downstream of the structural gene. The restriction map for the genomic region including the growth hormone gene was extended. Two HindIII RFLPs at the growth hormone locus, as well as several RFLPs at the prolactin gene, seemed to be the consequence of a series of point mutations. The results are discussed in terms of the possibility that minor genomic variability underlies quantitative genetic variation.

  13. Polymorphisms in the leptin and leptin receptor genes in relation to resting metabolic rate and respiratory quotient in the Québec Family Study.

    PubMed

    Loos, R J F; Rankinen, T; Chagnon, Y; Tremblay, A; Pérusse, L; Bouchard, C

    2006-01-01

    Leptin (LEP) is an endocrine hormone that participates in many metabolic pathways, including those associated with the central regulation of energy homeostasis. We examined the associations between polymorphisms in the LEP and leptin receptor (LEPR) genes and resting metabolic rate (RMR) and respiratory quotient (RQ) in the Quebec Family Study. Three polymorphisms in LEPR (K109R, Q223R and K656N) and one in LEP (19A > G) were genotyped in 678 subjects. RMR, RQ at rest and RQ while sitting, standing and walking at 4.5 km/h (RQ45) were adjusted for age, sex, fat mass and fat-free mass. RQ45 was associated with the LEPR-K109R (P = 0.004) and Q223R (P = 0.03) polymorphisms, and RMR showed association with the LEPR-K656N polymorphism (P = 0.006). For the LEP-19A > G polymorphism, no significant associations were observed. However, LEP-A19A homozygotes who were carriers of the LEPR N656 allele had a significantly lower RQ45 compared to other genotype combinations (P for interaction=0.003). These findings suggest that DNA sequence variation in the LEPR gene contributes to human variation in RMR and in the relative rates of substrate oxidation during low-intensity exercise in steady state but not in a resting state.

  14. Lack of association between the Glu298Asp polymorphism of endothelial nitric oxide synthase and slow coronary flow in the Turkish population

    PubMed Central

    Caglayan, Ahmet Okay; Kalay, Nihat; Saatci, Cetin; Yalcın, Arif; Akalın, Hilal; Dundar, Munis

    2009-01-01

    BACKGROUND: Coronary endothelial dysfunction plays an important pathogenetic role in patients with slow coronary flow (SCF). No data exist regarding the possible contribution of the Glu298Asp polymorphism genotype of the endothelial nitric oxide synthase (eNOS) gene to human SCF in the literature. OBJECTIVE: To investigate the association between SCF and the Glu298Asp polymorphism of the eNOS gene. METHODS: The study population consisted of 85 consecutive patients. The patient group included 66 patients with angiographically proven normal coronary arteries with SCF, and 19 subjects with normal coronary arteries with no SCF. The thrombolysis in myocardial infarction frame count was used for the diagnosis of SCF. The Glu298Asp polymorphism was determined by polymerase chain reaction and restriction fragment length polymorphism. RESULTS: The baseline characteristics were similar between the two groups, except for high-density lipoprotein cholesterol, which was higher in the SCF group than in the controls. The genotype distribution of Glu298Asp was as follows: GG 26%, GT 56% and TT 12%, where G is guanine and T is thymine. There was no difference in the frequency of the various genotypes or the alleles in patients with SCF versus normal controls. CONCLUSIONS: The Glu298Asp polymorphism genotype of the eNOS gene is not a risk factor for SCF in the present study population. PMID:19279989

  15. Association of P53 gene polymorphism with gastric cancer in Northern Iran as a high-risk region.

    PubMed

    Hedayatizadeh-Omran, Akbar; Alizadeh-Navaei, Reza; Janbabaei, Ghasem; Omrani-Nava, Versa; Hasheminasab, Yahya; Amjadi, Omolbanin; Tehrani, Mohsen

    2018-05-01

    Gastric cancer has the fourth highest morbidity rate of all cancers worldwide. Genetic factors including alterations in oncogenes and tumor suppressor genes serve an important role in gastric cancer development and progression. The P53 gene acts as a tumor suppressor gene by regulating the cell cycle, DNA transcription and repair, apoptosis, senescence and genome stability. In addition to somatic P53 mutations in cancer development, germline polymorphisms are also involved in different malignancies. The polymorphism of P53 at codon 72 (Arg72Pro) is established as a common variant that increases susceptibility to various cancers. The present case-control study was conducted to evaluate the possible association between this P53 polymorphism and gastric cancer in the Iranian population. A total of 59 patients with gastric cancer and 59 healthy controls were enrolled in the present study. Genomic DNA was extracted from peripheral blood mononuclear cells and genotype analysis was performed using a polymerase chain reaction-based restriction fragment length polymorphism assay. Genotype frequencies did not differ significantly between the patients and controls (P=0.4); the frequencies of the three genotypes Arg/Arg, Arg/Pro and Pro/Pro in gastric cancer patients were 28.8, 49.2 and 22.0%, and in controls were 37.3, 49.2 and 13.6%. Additionally, there were no differences in genotype frequencies based on tumor location, histological differentiation or tumor stage. Based on these findings, it may be concluded that the P53 codon 72 polymorphism does not contribute to gastric cancer susceptibility in Northern Iran.

  16. Polymorphism of Cyp1a1 (T6235C) is not a significant risk factor of osteoporosis in postmenopausal Indonesian woman

    NASA Astrophysics Data System (ADS)

    Auerkari, EI; Budhy, LW; Kiranahayu, R.; Djamal, NZ; Kusdhany, LS; Rahardjo, TBW; Talbot, Christopher

    2018-05-01

    Osteoporosis is an increasingly common disease resulting in reduced bone mineral density (BMD) and elevated likelihood of bone fracture, and particularly affected are postmenopausal women with additional risk factors including genetic predisposition. The CYP1A1, is one of the candidate genes that have been suggested to be associated with the pathogenesis of osteoporosis. This work aimed to evaluate the distribution of a selected polymorphism of this gene (T6235C) with respect to the BMD status in postmenopausal Indonesian women. The results show that osteoporosis is associated with age and menopause, as expected, but not with the tested polymorphism of CYP1A1 in the Indonesian sample population. It is suggested that other P450 cytochrome enzymes and their polymorphisms could provide more significant indicators of the future health of postmenopausal women.

  17. The association between MTHFR gene C677T polymorphism and ALL risk based on a meta-analysis involving 17,469 subjects.

    PubMed

    Zhang, Beibei; Zhang, Weiming; Yan, Liang; Wang, Daogang

    2017-03-01

    The methylenetetrahydrofolate reductase (MTHFR) gene C677T polymorphism is closely related to the acute lymphoblastic leukaemia (ALL) indicated by many previous epidemiologic studies. However, their conclusions were still conflicting. Our aim is to evaluate their associations using a more comprehensive updated meta-analysis. Electronic searches were conducted to select published studies prior to February, 2016. Totally, 39 case-control studies including 6551 ALL cases and 10,918 controls were selected in current meta-analysis. The association was detected significantly between MTHFR C677T polymorphism and ALL reducing susceptibility. Our results indicate that the MTHFR C677T polymorphism may be a promising ALL biomarker and studies to explore the protein levels of the variants and their functional role are required for the definitive conclusions. Copyright © 2017 Elsevier B.V. All rights reserved.

  18. Genetic Diversity of Toll-Like Receptors and Immunity to M. leprae Infection

    PubMed Central

    Hart, Bryan E.; Tapping, Richard I.

    2012-01-01

    Genetic association studies of leprosy cohorts across the world have identified numerous polymorphisms which alter susceptibility and outcome to infection with Mycobacterium leprae. As expected, many of the polymorphisms reside within genes that encode components of the innate and adaptive immune system. Despite the preponderance of these studies, our understanding of the mechanisms that underlie these genetic associations remains sparse. Toll-like receptors (TLRs) have emerged as an essential family of innate immune pattern recognition receptors which play a pivotal role in host defense against microbes, including pathogenic strains of mycobacteria. This paper will highlight studies which have uncovered the association of specific TLR gene polymorphisms with leprosy or tuberculosis: two important diseases resulting from mycobacterial infection. This analysis will focus on the potential influence these polymorphic variants have on TLR expression and function and how altered TLR recognition or signaling may contribute to successful antimycobacterial immunity. PMID:22529866

  19. [Prevalence of gene polymorphisms associated with immune-dependent diseases in the populations of North Eurasia].

    PubMed

    Cherednichenko, A A; Trifonova, E A; Vagaitseva, K V; Bocharova, A V; Varzari, A M; Radzhabov, M O; Stepanov, V A

    2015-01-01

    The data on distribution of genetic diversity in gene polymorphisms associated with autoimmune and allergic diseases and with regulation of immunoglobulin E and cytokines levels in 26 populations of the Northern Eurasia is presented. Substantial correlation between the values of average expected heterozygosity by 44 gene polymorphisms with climatic and geographical factors has not been revealed. Clustering of population groups in correspondence with their geographic locations is observed. The degree of gene differentiation among populations and the selective neutrality of gene polymorphisms have been assessed. The results of our work evidence the substantial genetic diversity and differentiation of human populations by studied genes.

  20. Impact of Genetic Polymorphisms on the Smoking-related Risk of Periodontal Disease: the Population-based Study SHIP

    PubMed Central

    Meisel, P; Heins, G; Carlsson, LE; Giebel, J; John, U; Schwahn, C; Kocher, T

    2003-01-01

    Periodontitis is a bacterial inflammatory disease leading to attachment loss with the consequence of tooth loss. There exists a multifactorial risk pattern including bacterial challenge, smoking, age, sex, diabetes, socio-economic and genetic factors. Smoking has the highest impact on the course of the disease modulated by all the other factors. Here, we report the relationship between smoking and the polymorphisms of genetic polymorphisms inflicted in the pathogenesis. In a randomly selected population-based study, 1083 subjects were typed for the polymorphisms of the IL-1 genotype, Fcγ RIIIb receptor gene, myeloperoxidase and N-acetyltransferase (NAT2) and related to their periodontal state. Smoking behavior was assessed including present and past quality and quantity of smoking. There is a significant dose-effect relationship between the exposure to tobacco smoke and the extent of periodontal disease assessed as attachment loss and tooth loss. Moreover, there are gene-environmental interactions as subjects bearing variant genotypes show an enhanced smoking-associated risk of the disease modulated by these genotypes. In non-smokers, the impact of these genetic polymorphisms is mostly negligible. This study provides support for the hypothesis that subjects bearing genetic variants of polymorphically expressed phenotypes are at an increased risk of periodontitis when smoking. Mostly, this may be accomplished via the influence of smoking-related impairment on defense mechanisms rather than on the pathogenic pathways. PMID:19570260

  1. Impact of Genetic Polymorphisms on the Smoking-related Risk of Periodontal Disease: the Population-based Study SHIP

    PubMed Central

    Meisel, P; Heins, G; Carlsson, LE; Giebel, J; John, U; Schwahn, C; Kocher, T

    2003-01-01

    Periodontitis is a bacterial inflammatory disease leading to attachment loss with the consequence of tooth loss. There exists a multifactorial risk pattern including bacterial challenge, smoking, age, sex, diabetes, socio-economic and genetic factors. Smoking has the highest impact on the course of the disease modulated by all the other factors. Here, we report the relationship between smoking and the polymorphisms of genetic polymorphisms inflicted in the pathogenesis. In a randomly selected population-based study, 1083 subjects were typed for the polymorphisms of the IL-1 genotype, Fcγ RIIIb receptor gene, myeloperoxidase and N-acetyltransferase (NAT2) and related to their periodontal state. Smoking behavior was assessed including present and past quality and quantity of smoking. There is a significant dose-effect relationship between the exposure to tobacco smoke and the extent of periodontal disease assessed as attachment loss and tooth loss. Moreover, there are gene-environmental interactions as subjects bearing variant genotypes show an enhanced smoking-associated risk of the disease modulated by these genotypes. In non-smokers, the impact of these genetic polymorphisms is mostly negligible. This study provides support for the hypothesis that subjects bearing genetic variants of polymorphically expressed phenotypes are at an increased risk of periodontitis when smoking. Mostly, this may be accomplished via the influence of smoking-related impairment on defense mechanisms rather than on the pathogenic pathways.

  2. Association of polymorphic variants of IL-1β and IL-1RN genes in the development of Graves' disease in Kashmiri population (North India).

    PubMed

    Shehjar, Faheem; Afroze, Dil; Misgar, Raiz A; Malik, Sajad A; Laway, Bashir A

    2018-04-01

    Graves' disease (GD) is a multigenic, organ specific autoimmune disorder with a strong genetic predisposition and IL-1β has been shown to be involved in its pathogenesis. The present study was aimed to determine the genetic associations between polymorphisms of IL-1β gene promoter region (-511 T>C) (rs16944), exon 5 (+3954 C>T) (rs1143634) and IL-1RN gene VNTR (rs2234663) polymorphism in patients with GD in ethnic Kashmiri population. A total of 135 Graves' disease patients and 150 healthy individuals were included in the study. PCR and PCR-based restriction analysis methods were done for IL-1RN VNTR and IL-1β gene polymorphisms respectively. We found statistically significant increased frequencies of the C/C + CT genotype (P = 0.001; odds ratio (OR) = 5.04, 95% confidence interval (CI) = 3.02-8.42) and the C allele (P = 0.001; OR = 3.10, 95% CI = 2.14-4.50) in IL-1β gene promoter polymorphism (rs16944) with GD patients compared to normal controls. Also in the exon 5 (rs1143634), a significant increase in frequency of the C/C homozygous genotype (P = 0.001; OR = 0.18, 95% CI = 0.11-0.30) and C allele (P = 0.001; OR = 0.31, 95% CI = 0.20-0.48) was observed in GD cases as against controls. For IL-1RN VNTR (rs2234663), we didn't observe any significant difference in the allelic and genotypic frequencies between cases and controls. Our findings suggest that both promoter and exon polymorphisms of IL-1β gene have a significant role in the risk of developing GD, whereas IL-1RN VNTR has no association with GD. Copyright © 2018. Published by Elsevier Inc.

  3. A nuclear phylogenetic analysis: SNPs, indels and SSRs deliver new insights into the relationships in the ‘true citrus fruit trees’ group (Citrinae, Rutaceae) and the origin of cultivated species

    PubMed Central

    Garcia-Lor, Andres; Curk, Franck; Snoussi-Trifa, Hager; Morillon, Raphael; Ancillo, Gema; Luro, François; Navarro, Luis; Ollitrault, Patrick

    2013-01-01

    Background and Aims Despite differences in morphology, the genera representing ‘true citrus fruit trees’ are sexually compatible, and their phylogenetic relationships remain unclear. Most of the important commercial ‘species’ of Citrus are believed to be of interspecific origin. By studying polymorphisms of 27 nuclear genes, the average molecular differentiation between species was estimated and some phylogenetic relationships between ‘true citrus fruit trees’ were clarified. Methods Sanger sequencing of PCR-amplified fragments from 18 genes involved in metabolite biosynthesis pathways and nine putative genes for salt tolerance was performed for 45 genotypes of Citrus and relatives of Citrus to mine single nucleotide polymorphisms (SNPs) and indel polymorphisms. Fifty nuclear simple sequence repeats (SSRs) were also analysed. Key Results A total of 16 238 kb of DNA was sequenced for each genotype, and 1097 single nucleotide polymorphisms (SNPs) and 50 indels were identified. These polymorphisms were more valuable than SSRs for inter-taxon differentiation. Nuclear phylogenetic analysis revealed that Citrus reticulata and Fortunella form a cluster that is differentiated from the clade that includes three other basic taxa of cultivated citrus (C. maxima, C. medica and C. micrantha). These results confirm the taxonomic subdivision between the subgenera Metacitrus and Archicitrus. A few genes displayed positive selection patterns within or between species, but most of them displayed neutral patterns. The phylogenetic inheritance patterns of the analysed genes were inferred for commercial Citrus spp. Conclusions Numerous molecular polymorphisms (SNPs and indels), which are potentially useful for the analysis of interspecific genetic structures, have been identified. The nuclear phylogenetic network for Citrus and its sexually compatible relatives was consistent with the geographical origins of these genera. The positive selection observed for a few genes will help further works to analyse the molecular basis of the variability of the associated traits. This study presents new insights into the origin of C. sinensis. PMID:23104641

  4. A nuclear phylogenetic analysis: SNPs, indels and SSRs deliver new insights into the relationships in the 'true citrus fruit trees' group (Citrinae, Rutaceae) and the origin of cultivated species.

    PubMed

    Garcia-Lor, Andres; Curk, Franck; Snoussi-Trifa, Hager; Morillon, Raphael; Ancillo, Gema; Luro, François; Navarro, Luis; Ollitrault, Patrick

    2013-01-01

    Despite differences in morphology, the genera representing 'true citrus fruit trees' are sexually compatible, and their phylogenetic relationships remain unclear. Most of the important commercial 'species' of Citrus are believed to be of interspecific origin. By studying polymorphisms of 27 nuclear genes, the average molecular differentiation between species was estimated and some phylogenetic relationships between 'true citrus fruit trees' were clarified. Sanger sequencing of PCR-amplified fragments from 18 genes involved in metabolite biosynthesis pathways and nine putative genes for salt tolerance was performed for 45 genotypes of Citrus and relatives of Citrus to mine single nucleotide polymorphisms (SNPs) and indel polymorphisms. Fifty nuclear simple sequence repeats (SSRs) were also analysed. A total of 16 238 kb of DNA was sequenced for each genotype, and 1097 single nucleotide polymorphisms (SNPs) and 50 indels were identified. These polymorphisms were more valuable than SSRs for inter-taxon differentiation. Nuclear phylogenetic analysis revealed that Citrus reticulata and Fortunella form a cluster that is differentiated from the clade that includes three other basic taxa of cultivated citrus (C. maxima, C. medica and C. micrantha). These results confirm the taxonomic subdivision between the subgenera Metacitrus and Archicitrus. A few genes displayed positive selection patterns within or between species, but most of them displayed neutral patterns. The phylogenetic inheritance patterns of the analysed genes were inferred for commercial Citrus spp. Numerous molecular polymorphisms (SNPs and indels), which are potentially useful for the analysis of interspecific genetic structures, have been identified. The nuclear phylogenetic network for Citrus and its sexually compatible relatives was consistent with the geographical origins of these genera. The positive selection observed for a few genes will help further works to analyse the molecular basis of the variability of the associated traits. This study presents new insights into the origin of C. sinensis.

  5. Human leukocyte antigen and cytokine receptor gene polymorphisms associated with heterogeneous immune responses to mumps viral vaccine.

    PubMed

    Ovsyannikova, Inna G; Jacobson, Robert M; Dhiman, Neelam; Vierkant, Robert A; Pankratz, V Shane; Poland, Gregory A

    2008-05-01

    Mumps outbreaks continue to occur throughout the world, including in highly vaccinated populations. Vaccination against mumps has been successful; however, humoral and cellular immune responses to mumps vaccines vary significantly from person to person. We set out to assess whether HLA and cytokine gene polymorphisms are associated with variations in the immune response to mumps viral vaccine. To identify genetic factors that might contribute to variations in mumps vaccine-induced immune responses, we performed HLA genotyping in a group of 346 healthy schoolchildren (12-18 years of age) who previously received 2 doses of live mumps vaccine. Single-nucleotide polymorphisms (minor allele frequency of >5%) in cytokine and cytokine receptor genes were genotyped for a subset of 118 children. Median values for mumps-specific antibody titers and lymphoproliferative stimulation indices were 729 IU/mL and 4.8, respectively. Girls demonstrated significantly higher mumps antibody titers than boys, indicating gender-linked genetic differences in humoral immune response. Significant associations were found between the HLA-DQB1*0303 alleles and lower mumps-specific antibody titers. An interesting finding was the association of several HLA class II alleles with mumps-specific lymphoproliferation. Alleles of the DRB1 (*0101, *0301, *0801, *1001, *1201, and *1302), DQA1 (*0101, *0105, *0401, and *0501), and DQB1 (*0201, *0402, and *0501) loci were associated with significant variations in lymphoproliferative immune responses to mumps vaccine. Additional associations were observed with single-nucleotide polymorphisms in the interleukin-10RA, interleukin-12RB1, and interleukin-12RB2 cytokine receptor genes. Minor alleles for 4 single-nucleotide polymorphisms within interleukin-10RA and interleukin-12RB genes were associated with variations in humoral and cellular immune responses to mumps vaccination. These data suggest the important role of HLA and immunoregulatory cytokine receptor gene polymorphisms in explaining variations in mumps vaccine-induced immune responses.

  6. Human Leukocyte Antigen and Cytokine Receptor Gene Polymorphisms Associated With Heterogeneous Immune Responses to Mumps Viral Vaccine

    PubMed Central

    Ovsyannikova, Inna G.; Jacobson, Robert M.; Dhiman, Neelam; Vierkant, Robert A.; Pankratz, V. Shane; Poland, Gregory A.

    2009-01-01

    OBJECTIVES Mumps outbreaks continue to occur throughout the world, including in highly vaccinated populations. Vaccination against mumps has been successful; however, humoral and cellular immune responses to mumps vaccines vary significantly from person to person. We set out to assess whether HLA and cytokine gene polymorphisms are associated with variations in the immune response to mumps viral vaccine. METHODS To identify genetic factors that might contribute to variations in mumps vaccine–induced immune responses, we performed HLA genotyping in a group of 346 healthy schoolchildren (12–18 years of age) who previously received 2 doses of live mumps vaccine. Single-nucleotide polymorphisms (minor allele frequency of >5%) in cytokine and cytokine receptor genes were genotyped for a subset of 118 children. RESULTS Median values for mumps-specific antibody titers and lymphoproliferative stimulation indices were 729 IU/mL and 4.8, respectively. Girls demonstrated significantly higher mumps antibody titers than boys, indicating gender-linked genetic differences in humoral immune response. Significant associations were found between the HLA-DQB1*0303 alleles and lower mumps-specific antibody titers. An interesting finding was the association of several HLA class II alleles with mumps-specific lymphoproliferation. Alleles of the DRB1 (*0101, *0301, *0801, *1001, *1201, and *1302), DQA1 (*0101, *0105, *0401, and *0501), and DQB1 (*0201, *0402, and *0501) loci were associated with significant variations in lymphoproliferative immune responses to mumps vaccine. Additional associations were observed with single-nucleotide polymorphisms in the interleukin-10RA, interleukin-12RB1, and interleukin-12RB2 cytokine receptor genes. Minor alleles for 4 single-nucleotide polymorphisms within interleukin-10RA and interleukin-12RB genes were associated with variations in humoral and cellular immune responses to mumps vaccination. CONCLUSIONS These data suggest the important role of HLA and immunoregulatory cytokine receptor gene polymorphisms in explaining variations in mumps vaccine–induced immune responses. PMID:18450852

  7. A 40-bp VNTR polymorphism in the 3'-untranslated region of DAT1/SLC6A3 is associated with ADHD but not with alcoholism.

    PubMed

    Šerý, Omar; Paclt, Ivo; Drtílková, Ivana; Theiner, Pavel; Kopečková, Marta; Zvolský, Petr; Balcar, Vladimir J

    2015-06-11

    ADHD and alcoholism are psychiatric diseases with pathophysiology related to dopamine system. DAT1 belongs to the SLC6 family of transporters and is involved in the regulation of extracellular dopamine levels. A 40 bp variable number tandem repeat (VNTR) polymorphism in the 3'-untranslated region of DAT1/SLC6A3 gene was previously reported to be associated with various phenotypes involving disturbed regulation of dopaminergic neurotransmission. A total of 1312 subjects were included and genotyped for 40 bp VNTR polymorphism of DAT1/SLC6A3 gene in this study (441 alcoholics, 400 non-alcoholic controls, 218 ADHD children and 253 non ADHD children). Using miRBase software, we have performed a computer analysis of VNTR part of DAT1 gene for presence of miRNA binding sites. We have found significant relationships between ADHD and the 40 bp VNTR polymorphisms of DAT1/SLC6A3 gene (P < 0.01). The 9/9 genotype appeared to reduce the risk of ADHD about 0.4-fold (p < 0.04). We also noted an occurrence of rare genotypes in ADHD (frequency different from controls at p < 0.01). No association between alcoholism and genotype frequencies of 40 bp VNTR polymorphism of DAT1/SLC6A3 gene has been detected. We have found an association between 40 bp VNTR polymorphism of DAT1/SLC6A3 gene and ADHD in the Czech population; in a broad agreement with studies in other population samples. Furthermore, we detected rare genotypes 8/10, 7/10 and 10/11 present in ADHD boys only and identified miRNAs that should be looked at as potential novel targets in the research on ADHD.

  8. Oxytocin and Vasopressin Receptor Gene Polymorphisms: Role in Social and Psychiatric Traits

    PubMed Central

    Aspé-Sánchez, Mauricio; Moreno, Macarena; Rivera, Maria Ignacia; Rossi, Alejandra; Ewer, John

    2016-01-01

    Oxytocin (OXT) and arginine-vasopressin (AVP) are two phylogenetically conserved neuropeptides that have been implicated in a wide range of social behaviors. Although a large body of research, ranging from rodents to humans, has reported on the effects of OXT and AVP administration on affiliative and trust behaviors, and has highlighted the genetic contributions of OXT and AVP receptor polymorphisms to both social behaviors and to diseases related to social deficits, the consequences of peptide administration on psychiatric symptoms, and the impact of receptor polymorphisms on receptor function, are still unclear. Despite the exciting advances that these reports have brought to social neuroscience, they remain preliminary and suffer from the problems that are inherent to monogenetic linkage and association studies. As an alternative, some studies are using polygenic approaches, and consider the contributions of other genes and pathways, including those involving DA, 5-HT, and reelin, in addition to OXT and AVP; a handful of report are also using genome-wide association studies. This review summarizes findings on the associations between OXT and AVP receptor polymorphism, social behavior, and psychiatric diseases. In addition, we discuss reports on the interactions of OXT and AVP receptor genes and genes involved in other pathways (such as those of dopamine, serotonin, and reelin), as well as research that has shed some light on the impact of gene polymorphisms on the volume, connectivity, and activation of specific neural structures, differential receptor expression, and plasma levels of the OXT and AVP peptides. We hope that this effort will be helpful for understanding the studies performed so far, and for encouraging the inclusion of other candidate genes not explored to date. PMID:26858594

  9. N-acetyltransferase 2 (NAT2) gene polymorphism as a predisposing factor for phenytoin intoxication in tuberculous meningitis or tuberculoma patients having seizures - A pilot study.

    PubMed

    Adole, Prashant S; Kharbanda, Parampreet S; Sharma, Sadhna

    2016-05-01

    Simultaneous administration of phenytoin and isoniazid (INH) in tuberculous meningitis (TBM) or tuberculoma patients with seizures results in higher plasma phenytoin level and thus phenytoin intoxication. N-acetyltransferase 2 (NAT2) enzyme catalyses two acetylation reactions in INH metabolism and NAT2 gene polymorphism leads to slow and rapid acetylators. The present study was aimed to evaluate the effect of allelic variants of N-acetyltransferase 2 (NAT2) gene as a predisposing factor for phenytoin toxicity in patients with TBM or tuberculoma having seizures, and taking INH and phenytoin simultaneously. Sixty patients with TBM or tuberculoma with seizures and taking INH and phenytoin simultaneously for a minimum period of seven days were included in study. Plasma phenytoin was measured by high performance liquid chromatography. NAT2 gene polymorphism was studied using restriction fragment length polymorphism and allele specific PCR. The patients were grouped into those having phenytoin intoxication and those with normal phenytoin level, and also classified as rapid or slow acetylators by NAT2 genotyping. Genotypic analysis showed that of the seven SNPs (single nucleotide polymorphisms) of NAT2 gene studied, six mutations were found to be associated with phenytoin intoxication. For rs1041983 (C282T), rs1799929 (C481T), rs1799931 (G857A), rs1799930 (G590A), rs1208 (A803G) and rs1801280 (T341C) allelic variants, the proportion of homozygous mutant was higher in phenytoin intoxicated group than in phenytoin non-intoxicated group. Homozygous mutant allele of NAT2 gene at 481site may act as a predisposing factor for phenytoin intoxication among TBM or tuberculoma patients having seizures.

  10. GDNF Gene Is Associated With Tourette Syndrome in a Family Study

    PubMed Central

    Huertas-Fernández, Ismael; Gómez-Garre, Pilar; Madruga-Garrido, Marcos; Bernal-Bernal, Inmaculada; Bonilla-Toribio, Marta; Martín-Rodríguez, Juan Francisco; Cáceres-Redondo, María Teresa; Vargas-González, Laura; Carrillo, Fátima; Pascual, Alberto; Tischfield, Jay A.; King, Robert A.; Heiman, Gary A.; Mir, Pablo

    2016-01-01

    Background Tourette syndrome is a disorder characterized by persistent motor and vocal tics, and frequently accompanied by the comorbidities attention deficit hyperactivity disorder and obsessive-compulsive disorder. Impaired synaptic neurotransmission has been implicated in its pathogenesis. Our aim was to investigate the association of 28 candidate genes, including genes related to synaptic neurotransmission and neurotrophic factors, with Tourette syndrome. Methods We genotyped 506 polymorphisms in a discovery cohort from the United States composed of 112 families and 47 unrelated singletons with Tourette syndrome (201 cases and 253 controls). Genes containing significant polymorphisms were imputed to fine-map the signal(s) to potential causal variants. Allelic analyses in Tourette syndrome cases were performed to check the role in attention deficit hyperactivity disorder and obsessive-compulsive disorder comorbidities. Target polymorphisms were further studied in a replication cohort from southern Spain composed of 37 families and three unrelated singletons (44 cases and 73 controls). Results The polymorphism rs3096140 in glial cell line–derived neurotrophic factor gene (GDNF) was significant in the discovery cohort after correction (P = 1.5 × 10−4). No linkage disequilibrium was found between rs3096140 and other functional variants in the gene. We selected rs3096140 as target polymorphism, and the association was confirmed in the replication cohort (P = 0.01). No association with any comorbidity was found. Conclusions As a conclusion, a common genetic variant in GDNF is associated with Tourette syndrome. A defect in the production of GDNF could compromise the survival of parvalbumin interneurons, thus altering the excitatory/inhibitory balance in the corticostriatal circuitry. Validation of this variant in other family cohorts is necessary. PMID:26096985

  11. GDNF gene is associated with tourette syndrome in a family study.

    PubMed

    Huertas-Fernández, Ismael; Gómez-Garre, Pilar; Madruga-Garrido, Marcos; Bernal-Bernal, Inmaculada; Bonilla-Toribio, Marta; Martín-Rodríguez, Juan Francisco; Cáceres-Redondo, María Teresa; Vargas-González, Laura; Carrillo, Fátima; Pascual, Alberto; Tischfield, Jay A; King, Robert A; Heiman, Gary A; Mir, Pablo

    2015-07-01

    Tourette syndrome is a disorder characterized by persistent motor and vocal tics, and frequently accompanied by the comorbidities attention deficit hyperactivity disorder and obsessive-compulsive disorder. Impaired synaptic neurotransmission has been implicated in its pathogenesis. Our aim was to investigate the association of 28 candidate genes, including genes related to synaptic neurotransmission and neurotrophic factors, with Tourette syndrome. We genotyped 506 polymorphisms in a discovery cohort from the United States composed of 112 families and 47 unrelated singletons with Tourette syndrome (201 cases and 253 controls). Genes containing significant polymorphisms were imputed to fine-map the signal(s) to potential causal variants. Allelic analyses in Tourette syndrome cases were performed to check the role in attention deficit hyperactivity disorder and obsessive-compulsive disorder comorbidities. Target polymorphisms were further studied in a replication cohort from southern Spain composed of 37 families and three unrelated singletons (44 cases and 73 controls). The polymorphism rs3096140 in glial cell line-derived neurotrophic factor gene (GDNF) was significant in the discovery cohort after correction (P = 1.5 × 10(-4) ). No linkage disequilibrium was found between rs3096140 and other functional variants in the gene. We selected rs3096140 as target polymorphism, and the association was confirmed in the replication cohort (P = 0.01). No association with any comorbidity was found. As a conclusion, a common genetic variant in GDNF is associated with Tourette syndrome. A defect in the production of GDNF could compromise the survival of parvalbumin interneurons, thus altering the excitatory/inhibitory balance in the corticostriatal circuitry. Validation of this variant in other family cohorts is necessary. © 2015 International Parkinson and Movement Disorder Society.

  12. Association of vitamin D receptor gene polymorphism (TaqI and Apa1) with bone mineral density in North Indian postmenopausal women.

    PubMed

    Ahmad, Israr; Jafar, Tabrez; Mahdi, Farzana; Ameta, Keerti; Arshad, Md; Das, Siddharth Kumar; Waliullah, Shah; Rizvi, Imran; Mahdi, Abbas Ali

    2018-06-15

    Vitamin D receptor (VDR) gene has an important role as a candidate gene for the regulation of bone mass in osteoporosis. However, its association with bone mineral density (BMD) is controversial and has not been established in different ethnic populations. To enhance the understanding of VDR gene polymorphism in the context of BMD, we investigated the plausible genetic association of TaqI and ApaI polymorphism with BMD in North Indian postmenopausal women with osteoporosis.254 osteoporotic women (Age 55.82 ± 6.91) and 254 postmenopausal non osteoporotic women (Age 54.76 ± 6.26) were included in the study. VDR TaqI and ApaI polymorphism were determined by PCR (polymerase chain reaction) and RFLP (restriction fragment length polymorphism). BMD was assessed by dual energy X-ray absorptiometry (DXA) at the lumbar spine (L 1 -L 4 ), hip, forearm and femoral neck. The average BMD with TT genotype was significantly lower at lumbar spine, hip and forearm. The Frequency of TT genotype and t allele was significantly high in osteoporotic women when compared with controls. The average BMD with Aa genotype was higher in ApaI. Furthermore, comparison of frequency distribution of genotype and allele for VDR ApaI between osteoporotic patients and controls did not show any significant difference. Our findings revealed that TaqI gene TT genotype was associated with low BMD in North Indian osteoporotic women. Moreover, TT genotype and t allele associated significantly with osteoporosis in postmenopausal women. Therefore, VDR TaqI gene is an important determinant of risk factor for osteoporosis. Copyright © 2018 Elsevier B.V. All rights reserved.

  13. N-acetyltransferase 2 (NAT2) gene polymorphism as a predisposing factor for phenytoin intoxication in tuberculous meningitis or tuberculoma patients having seizures - A pilot study

    PubMed Central

    Adole, Prashant S.; Kharbanda, Parampreet S.; Sharma, Sadhna

    2016-01-01

    Background & objectives: Simultaneous administration of phenytoin and isoniazid (INH) in tuberculous meningitis (TBM) or tuberculoma patients with seizures results in higher plasma phenytoin level and thus phenytoin intoxication. N-acetyltransferase 2 (NAT2) enzyme catalyses two acetylation reactions in INH metabolism and NAT2 gene polymorphism leads to slow and rapid acetylators. The present study was aimed to evaluate the effect of allelic variants of N-acetyltransferase 2 (NAT2) gene as a predisposing factor for phenytoin toxicity in patients with TBM or tuberculoma having seizures, and taking INH and phenytoin simultaneously. Methods: Sixty patients with TBM or tuberculoma with seizures and taking INH and phenytoin simultaneously for a minimum period of seven days were included in study. Plasma phenytoin was measured by high performance liquid chromatography. NAT2 gene polymorphism was studied using restriction fragment length polymorphism and allele specific PCR. Results: The patients were grouped into those having phenytoin intoxication and those with normal phenytoin level, and also classified as rapid or slow acetylators by NAT2 genotyping. Genotypic analysis showed that of the seven SNPs (single nucleotide polymorphisms) of NAT2 gene studied, six mutations were found to be associated with phenytoin intoxication. For rs1041983 (C282T), rs1799929 (C481T), rs1799931 (G857A), rs1799930 (G590A), rs1208 (A803G) and rs1801280 (T341C) allelic variants, the proportion of homozygous mutant was higher in phenytoin intoxicated group than in phenytoin non-intoxicated group. Interpretation & conclusions: Homozygous mutant allele of NAT2 gene at 481site may act as a predisposing factor for phenytoin intoxication among TBM or tuberculoma patients having seizures. PMID:27488001

  14. Role of Cannabinoid CB2 Receptor Gene (CNR2) Polymorphism in Children with Immune Thrombocytopenic Purpura in Beni-Suef Governorate in Egypt.

    PubMed

    Ezzat, Dina A; Hammam, Amira A; El-Malah, Waleed M; Khattab, Rasha A; Mangoud, Eman M

    2017-01-01

    The cannabinoid system is involved in the immune regulation by modulation of Th cells type 1 and 2. It is composed of the CB2 receptor which is expressed at 10 to 100 folds greater levels on immune cells than the CB1 receptors. The CB2 is encoded by the cannabinoid CB receptor gene (CNR2) gene. This study aims to investigate the polymorphism in CNR2 gene variation rs 35761398 (Q63R) in Egyptian children with immune thrombocytopenic purpura and to investigate the relation between this gene polymorphism and either the susceptibility to or the chronicity of the disease. Forty children diagnosed as ITP were included in this study and 20 healthy children as normal control. CNR2 gene was investigated in those children by PCR RFLP technique (restriction fragment length polymorphism). CNR2 genotyping revealed that 45% of ITP patients had the QR heterotype, 50% had the RR homotype and 5% had QQ, the wild type with significantly higher frequency of homomutant genotype in comparison to controls. The relative odds ratio suggested a double risk for developing ITP in RR homotype (OR 2.152). A significant overpresentation of the RR genotype and of R allele was observed in the chronic patients (P=0.002 and 0.003, respectively). The associated risk to develop chronic ITP increased more than two folds for the RR homotype (OR=2.854). In conclusion, this study confirms the role of CNR2 Q63R polymorphism in the susceptibility to ITP in children and chronicity of the disease. Copyright© by the Egyptian Association of Immunologists.

  15. Oxytocin and Vasopressin Receptor Gene Polymorphisms: Role in Social and Psychiatric Traits.

    PubMed

    Aspé-Sánchez, Mauricio; Moreno, Macarena; Rivera, Maria Ignacia; Rossi, Alejandra; Ewer, John

    2015-01-01

    Oxytocin (OXT) and arginine-vasopressin (AVP) are two phylogenetically conserved neuropeptides that have been implicated in a wide range of social behaviors. Although a large body of research, ranging from rodents to humans, has reported on the effects of OXT and AVP administration on affiliative and trust behaviors, and has highlighted the genetic contributions of OXT and AVP receptor polymorphisms to both social behaviors and to diseases related to social deficits, the consequences of peptide administration on psychiatric symptoms, and the impact of receptor polymorphisms on receptor function, are still unclear. Despite the exciting advances that these reports have brought to social neuroscience, they remain preliminary and suffer from the problems that are inherent to monogenetic linkage and association studies. As an alternative, some studies are using polygenic approaches, and consider the contributions of other genes and pathways, including those involving DA, 5-HT, and reelin, in addition to OXT and AVP; a handful of report are also using genome-wide association studies. This review summarizes findings on the associations between OXT and AVP receptor polymorphism, social behavior, and psychiatric diseases. In addition, we discuss reports on the interactions of OXT and AVP receptor genes and genes involved in other pathways (such as those of dopamine, serotonin, and reelin), as well as research that has shed some light on the impact of gene polymorphisms on the volume, connectivity, and activation of specific neural structures, differential receptor expression, and plasma levels of the OXT and AVP peptides. We hope that this effort will be helpful for understanding the studies performed so far, and for encouraging the inclusion of other candidate genes not explored to date.

  16. Evaluation of inflammation-related genes polymorphisms in Mexican with Alzheimer’s disease: a pilot study

    PubMed Central

    Toral-Rios, Danira; Franco-Bocanegra, Diana; Rosas-Carrasco, Oscar; Mena-Barranco, Francisco; Carvajal-García, Rosa; Meraz-Ríos, Marco Antonio; Campos-Peña, Victoria

    2015-01-01

    Amyloid peptide is able to promote the activation of microglia and astrocytes in Alzheimer’s disease (AD), and this stimulates the production of pro-inflammatory cytokines. Inflammation contributes to the process of neurodegeneration and therefore is a key factor in the development of AD. Some of the most important proteins involved in AD inflammation are: clusterin (CLU), complement receptor 1 (CR1), C reactive protein (CRP), tumor necrosis factor α (TNF-α), the interleukins 1α (IL-1α), 6 (IL-6), 10 (IL-10) and cyclooxygenase 2 (COX-2). In particular, COX-2 is encoded by the prostaglandin-endoperoxide synthase 2 gene (PTGS2). Since variations in the genes that encode these proteins may modify gene expression or function, it is important to investigate whether these variations may change the developing AD. The aim of this study was to determine whether the presence of polymorphisms in the genes encoding the aforementioned proteins is associated in Mexican patients with AD. Fourteen polymorphisms were genotyped in 96 subjects with AD and 100 controls; the differences in allele, genotype and haplotype frequencies were analyzed. Additionally, an ancestry analysis was conducted to exclude differences in genetic ancestry among groups as a confounding factor in the study. Significant differences in frequencies between AD and controls were found for the single-nucleotide polymorphism (SNP) rs20417 within the PTGS2 gene. Ancestry analysis revealed no significant differences in the ancestry of the compared groups, and the association was significant even after adjustment for ancestry and correction for multiple testing, which strengthens the validity of the results. We conclude that this polymorphism plays an important role in the development of the AD pathology and further studies are required, including their proteins. PMID:26041990

  17. Interaction between Serotonin Transporter and Serotonin Receptor 1 B genes polymorphisms may be associated with antisocial alcoholism

    PubMed Central

    2012-01-01

    Background Several studies have hypothesized that genes regulating the components of the serotonin system, including serotonin transporter (5-HTTLPR) and serotonin 1 B receptor (5-HT1B), may be associated with alcoholism, but their results are contradictory because of alcoholism’s heterogeneity. Therefore, we examined whether the 5-HTTLPR gene and 5-HT1B gene G861C polymorphism are susceptibility factors for a specific subtype of alcoholism, antisocial alcoholism in Han Chinese in Taiwan. Methods We recruited 273 Han Chinese male inmates with antisocial personality disorder (ASPD) [antisocial alcoholism (AS-ALC) group (n = 120) and antisocial non-alcoholism (AS-N-ALC) group (n = 153)] and 191 healthy male controls from the community. Genotyping was done using PCR-RFLP. Results There were no significant differences in the genotypic frequency of the 5-HT1B G861C polymorphism between the 3 groups. Although AS-ALC group members more frequently carried the 5-HTTLPR S/S, S/LG, and LG/LG genotypes than controls, the difference became non-significant after controlling for the covarying effects of age. However, the 5-HTTLPR S/S, S/LG, and LG/LG genotypes may have interacted with the 5-HT1B G861C C/C polymorphism and increased the risk of becoming antisocial alcoholism. Conclusion Our study suggests that neither the 5-HTTLPR gene nor the 5-HT1B G861C polymorphism alone is a risk factor for antisocial alcoholism in Taiwan’s Han Chinese population, but that the interaction between both genes may increase susceptibility to antisocial alcoholism. PMID:22550993

  18. Relationships between FTO rs9939609, MC4R rs17782313, and PPARγ rs1801282 polymorphisms and the occurrence of selected metabolic and hormonal disorders in middle-aged and elderly men - a preliminary study.

    PubMed

    Rotter, Iwona; Skonieczna-Żydecka, Karolina; Kosik-Bogacka, Danuta; Adler, Grażyna; Rył, Aleksandra; Laszczyńska, Maria

    2016-01-01

    Metabolic disorders, including MetS, obesity, and lipid disorders, may be related to genetic factors. Metabolic disorders are associated with decreased TS levels in aging men. The aim of this study was to evaluate the relationship between FTO rs9939609, MC4R rs17782313, and PPARγ rs1801282 polymorphisms and the presence of MetS and its components, the concurrent lipid disorders, as well as sex hormone concentrations. This study involved 272 men of Caucasian descent aged 50-75 years. Lipid profile, including TCh, LDL, HDL, and TG, was evaluated by spectrophotometric method. Anthropometric measurements concerned WC and blood pressure. MetS was diagnosed according to the criteria of the IDF. Sex hormone profile, including TST, FTS, E 2 , DHEAS, and SHBG, was examined using enzyme-linked immunosorbent assay. Polymorphisms within FTO , MC4R , and PPARγ genes were identified using polymerase chain reaction-restriction fragments length polymorphism. This study did not show links between the analyzed genetic polymorphisms and the presence of MetS, T2DM, HT, and obesity. However, higher concentrations of TCh and LDL were found in men with the FTO rs9939609 polymorphism in the recessive mode of inheritance ( P =0.03 and P =0.05, respectively). Lower WC was found to be associated with MC4R rs17782313 gene inherited in the same model ( P =0.005). FTO rs9939609, MC4R rs17782313, and PPARγ rs1801282 polymorphisms seem to have little effect on the incidence of metabolic malfunctions and no effect on androgen-related disorders in the examined middle-aged and elderly men.

  19. Novel polymorphisms of the APOA2 gene and its promoter region affect body traits in cattle.

    PubMed

    Zhou, Yang; Li, Caixia; Cai, Hanfang; Xu, Yao; Lan, Xianyong; Lei, Chuzhao; Chen, Hong

    2013-12-01

    Apolipoprotein A-II (APOA2) is one of the major constituents of high-density lipoprotein and plays a critical role in lipid metabolism and obesity. However, similar research for the bovine APOA2 gene is lacking. In this study, polymorphisms of the bovine APOA2 gene and its promoter region were detected in 1021 cows from four breeds by sequencing and PCR-RFLP methods. Totally, we detected six novel mutations which included one mutation in the promoter region, two mutations in the exons and three mutations in the introns. There were four polymorphisms within APOA2 gene were analyzed. The allele A, T, T and G frequencies of the four loci were predominant in the four breeds when in separate or combinations analysis which suggested cows with those alleles to be more adapted to the steppe environment. The association analysis indicated three SVs in Nangyang cows, two SVs in Qinchun cows and the 9 haplotypes in Nangyang cows were significantly associated with body traits (P<0.05 or P<0.01). The results of this study suggested the bovine APOA2 gene may be a strong candidate gene for body traits in the cattle breeding program. © 2013.

  20. No association of the neuropeptide Y (Leu7Pro) and ghrelin gene (Arg51Gln, Leu72Met, Gln90Leu) single nucleotide polymorphisms with eating disorders.

    PubMed

    Kindler, Jochen; Bailer, Ursula; de Zwaan, Martina; Fuchs, Karoline; Leisch, Friedrich; Grün, Bettina; Strnad, Alexandra; Stojanovic, Mirjana; Windisch, Julia; Lennkh-Wolfsberg, Claudia; El-Giamal, Nadja; Sieghart, Werner; Kasper, Siegfried; Aschauer, Harald

    2011-06-01

    Genetic factors likely contribute to the biological vulnerability of eating disorders. Case-control association study on one neuropeptide Y gene (Leu7Pro) polymorphism and three ghrelin gene (Arg51Gln, Leu72Met and Gln90Leu) polymorphisms. 114 eating disorder patients (46 with anorexia nervosa, 30 with bulimia nervosa, 38 with binge eating disorder) and 164 healthy controls were genotyped. No differences were detected between patients and controls for any of the four polymorphisms in allele frequency and genotype distribution (P > 0.05). Allele frequencies and genotypes had no significant influence on body mass index (P > 0.05) in eating disorder patients. Positive findings of former case-control studies of associations between ghrelin gene polymorphisms and eating disorders could not be replicated. Neuropeptide Y gene polymorphisms have not been investigated in eating disorders before.

  1. Association mapping of starch chain length distribution and amylose content in pea (Pisum sativum L.) using carbohydrate metabolism candidate genes.

    PubMed

    Carpenter, Margaret A; Shaw, Martin; Cooper, Rebecca D; Frew, Tonya J; Butler, Ruth C; Murray, Sarah R; Moya, Leire; Coyne, Clarice J; Timmerman-Vaughan, Gail M

    2017-08-01

    Although starch consists of large macromolecules composed of glucose units linked by α-1,4-glycosidic linkages with α-1,6-glycosidic branchpoints, variation in starch structural and functional properties is found both within and between species. Interest in starch genetics is based on the importance of starch in food and industrial processes, with the potential of genetics to provide novel starches. The starch metabolic pathway is complex but has been characterized in diverse plant species, including pea. To understand how allelic variation in the pea starch metabolic pathway affects starch structure and percent amylose, partial sequences of 25 candidate genes were characterized for polymorphisms using a panel of 92 diverse pea lines. Variation in the percent amylose composition of extracted seed starch and (amylopectin) chain length distribution, one measure of starch structure, were characterized for these lines. Association mapping was undertaken to identify polymorphisms associated with the variation in starch chain length distribution and percent amylose, using a mixed linear model that incorporated population structure and kinship. Associations were found for polymorphisms in seven candidate genes plus Mendel's r locus (which conditions the round versus wrinkled seed phenotype). The genes with associated polymorphisms are involved in the substrate supply, chain elongation and branching stages of the pea carbohydrate and starch metabolic pathways. The association of polymorphisms in carbohydrate and starch metabolic genes with variation in amylopectin chain length distribution and percent amylose may help to guide manipulation of pea seed starch structural and functional properties through plant breeding.

  2. Association between MASP-2 gene polymorphism and risk of infection diseases: A meta-analysis.

    PubMed

    Fu, Jie; Wang, Jingqiu; Luo, Yanping; Zhang, Lifeng; Zhang, Yuan; Dong, Xinfang; Yu, Hongjuan; Cao, Mingqiang; Ma, Xingming

    2016-11-01

    The role of MASP-2 is vital in the process of complement activation by the lectin pathway. It is generally considered that the functional activation of MASP-2 contribute to the infection disease development process. To analyze the association between MASP-2 functional gene (rs72550870) polymorphism and the infection disease risk by a meta-analysis. Relevant case-control studies were identified by searching Cochrane Library, PubMed, Emabase, DOAJ, CAB Abstracts, CSA, CINAHL, EBSCO, Scopus, Global Health, Index Copernicus, CA, China National Knowledge Infrastructure (CNKI) databases up to 10th January 2016. The data were extracted and the methodological quality of studies were evaluated. The STATA 12.0 software was used to perform statistical analysis. 9 studies were included. There was no significant association between masp-2 gene (p.D120G, rs72550870) polymorphism and the risk of infection disease under the allele model (G vs. A: OR = 0.89, 95%CI = 0.66-1.21)(P = 0.445>0.05) and the recessive model (AG + GG vs.AA: OR = 0.88, 95%CI = 0.65-1.20) (P = 0.428>0.05). This is the first comprehensive meta-analysis indicates that the MASP-2 functional gene (rs72550870) polymorphism is not associated with the infection diseases, and the key functional gene polymorphism of rs72550870 did not increase susceptibility to the infection diseases. Similarly, there were no obvious difference in subgroup analysis based on geographical areas and pathogenic microorganisms. Copyright © 2016 Elsevier Ltd. All rights reserved.

  3. Association of glutathione S-transferase P1 (GSTP1) polymorphism with Tourette syndrome in Taiwanese patients.

    PubMed

    Shen, Che-Piao; Chou, I-Ching; Liu, Hsin-Ping; Lee, Cheng-Chun; Tsai, Yuhsin; Wu, Bor-Tsang; Hsu, Ban-Dar; Lin, Wei-Yong; Tsai, Fuu-Jen

    2014-01-01

    The etiology of Tourette syndrome (TS) is multifactorial. TS vulnerability may be associated with genetic and environmental factors. From the genetic point of view, TS is heterogeneous. Previous studies showed that some single-nucleotide polymorphisms (SNPs) of the glutathione-S-transferase P1 (GSTP1) gene can affect cellular proliferation and apoptotic activity and TS is a neurodevelopmental disorder. We guessed that there was a relationship between TS and genetic variants of the GSTP1 gene. Therefore, in this study, we aimed to test the hypothesis that GSTP1 SNPs were associated with TS. We performed a case-control study. One hundred twenty-one TS children and 105 normal children were included in the study. Polymerase chain reaction was used to identify the GSTP1 gene polymorphism at position rs6591256 (A/G, promoter polymorphism) in TS patients and normal children. The polymorphism at position rs6591256 in the GSTP1 gene revealed significant differences in the allele (p=0.0135) and genotype (p=0.0159) distributions between the TS patients and the control group. The A allele was present at a higher frequency than the G allele in the TS patients compared with the control group (odds ratio [OR]=1.91, 95% confidence interval [CI]: 1.14-3.21). The AA genotype was associated with susceptibility to TS with an OR of 2.38 for the AA versus AG genotype (95% CI: 1.29-4.41). These findings suggest that variants in the GSTP1 gene may play a role in susceptibility to TS.

  4. Functional genetic polymorphisms and female reproductive disorders: Part I: polycystic ovary syndrome and ovarian response

    PubMed Central

    Simoni, M.; Tempfer, C.B.; Destenaves, B.; Fauser, B.C.J.M.

    2008-01-01

    BACKGROUND The identification of polymorphisms associated with a disease can help to elucidate its pathogenesis, and this knowledge can be used to improve prognosis for women with a particular disorder, such as polycystic ovary syndrome (PCOS). Since an altered response to ovarian stimulation is also a characteristic of the disease, further knowledge about its aetiology could help in defining the parameters that determine the response of an individual to ovarian stimulation. METHODS PubMed and EMBASE databases were systematically searched for gene association studies published until the end of August 2007, using search criteria relevant to PCOS and ovarian response to stimulation. Data from additional papers identified through hand searches were also included; 139 publications were reviewed. RESULTS Several genes involved in ovarian function and metabolism are associated with increased susceptibility to PCOS, but none is strong enough to correlate alone with susceptibility to the disease, or response to therapy. A single-nucleotide polymorphism in exon 10 of the FSH receptor (FSHR) gene, FSHR p.N680S, was consistently identified as having a significant association with ovarian response to FSH. CONCLUSIONS No consistent association between gene polymorphism and PCOS could be identified. The FSHR gene may play a significant role in the success of ovarian stimulation, and can be used as a marker to predict differences in FSHR function and ovarian response to FSH. Genotyping the FSHR p.N680S polymorphism may provide a means of identifying a population of poor responders before in vitro fertilization procedures are initiated. PMID:18603647

  5. Polymorphisms in the canine monoamine oxidase a (MAOA) gene: identification and variation among five broad dog breed groups.

    PubMed

    Sacco, James; Ruplin, Andrew; Skonieczny, Paul; Ohman, Michael

    2017-01-01

    In humans, reduced activity of the enzyme monoamine oxidase type A (MAOA) due to genetic polymorphisms within the MAOA gene leads to increased brain neurotransmitter levels associated with aggression. In order to study MAOA genetic diversity in dogs, we designed a preliminary study whose objectives were to identify novel alleles in functionally important regions of the canine MAOA gene, and to investigate whether the frequencies of these polymorphisms varied between five broad breed groups (ancient, herding, mastiff, modern European, and mountain). Fifty dogs representing these five breed groups were sequenced. A total of eleven polymorphisms were found. Seven were single nucleotide polymorphisms (SNPs; two exonic, two intronic and three in the promoter), while four were repeat intronic variations. The most polymorphic loci were repeat regions in introns 1, 2 (7 alleles) and 10 (3 alleles), while the exonic and the promoter regions were highly conserved. Comparison of the allele frequencies of certain microsatellite polymorphisms among the breed groups indicated a decreasing or increasing trend in the number of repeats at different microsatellite loci, as well as the highest genetic diversity for the ancient breeds and the lowest for the most recent mountain breeds, perhaps attributable to canine domestication and recent breed formation. While a specific promoter SNP (-212A > G) is rare in the dog, it is the major allele in wolves. Replacement of this ancestral allele in domestic dogs may lead to the deletion of heat shock factor binding sites on the MAOA promoter. Dogs exhibit significant variation in certain intronic regions of the MAOA gene, while the coding and promoter regions are well-conserved. Distinct genetic differences were observed between breed groups. Further studies are now required to establish whether such polymorphisms are associated in any way with MAOA level and canine behaviour including aggression.

  6. Cdx-2 polymorphism in Vitamin D Receptor gene was associated with serum 25-hydroxyvitamin D levels, bone mineral density and fracture in middle-aged and elderly Chinese women.

    PubMed

    Ling, Yan; Lin, Huandong; Aleteng, Qiqige; Ma, Hui; Pan, Baishen; Gao, Jian; Gao, Xin

    2016-05-15

    The aim of the current study was to examine the relationship between Cdx-2 polymorphism in the promoter region of the VDR gene and serum 25-hydroxyvitamin D (25(OH)D) levels, bone mineral density (BMD) and fracture in Chinese population. This was a cross-sectional study, which included 738 individuals (428 women and 310 men) aged 45 years or older. In women, the association of Cdx-2 polymorphism with serum 25(OH)D levels was significant adjusting for age, BMI, estimated glomerular filtration rate, menopausal status and season of blood collection (P = 0.002). Cdx-2 polymorphism was associated with lumbar spine BMD adjusted for age, BMI, menopausal status and serum 25(OH)D in women (P = 0.005). But it was not associated with femoral neck BMD or total hip BMD in women. In women, Cdx-2 polymorphism was also associated with fracture adjusted for age, BMI, menopausal status, serum 25(OH)D and total hip BMD (P = 0.03). Carriers of AA and AG genotypes was associated with a higher odds of fracture compared with the carriers of GG genotype (OR = 2.14, 95% CI 1.04-4.42 and OR = 1.90, 95% CI 1.03-3.51). In men, Cdx-2 polymorphism was not associated with serum 25(OH)D levels, BMD or fracture. Our results indicate that the association of Cdx-2 polymorphism in the VDR gene with serum 25(OH)D levels, BMD and fracture may have sex differences. Cdx-2 polymorphism in the VDR gene may affect the serum 25(OH)D concentrations and the risk of osteoporosis and fracture in middle-aged and elderly Chinese women. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

  7. The effect of a promoter polymorphism on the transcription of nitric oxide synthase 1 and its relevance to Parkinson's disease.

    PubMed

    Rife, Terrie; Rasoul, Bareza; Pullen, Nicholas; Mitchell, David; Grathwol, Kristen; Kurth, Janice

    2009-08-01

    Transcriptional changes of the enzyme nitric oxide synthase I (NOS1) are believed to play a role in the development of many diseases. The gene for NOS1 has 12 alternative first exons (1A-1L). The 1F exon is one of the most highly utilized first exons in the brain and has a polymorphism ((TG)(m)TA(TG)(n)) located in its promoter region. The polymorphism's length has been suggested to affect NOS1 transcription and play a role in Parkinson's disease (PD); however, the actual influence of the polymorphism on NOS1 transcription has not been studied. To better characterize the links of the polymorphism with PD, a genotyping study was done comparing polymorphism length among 170 PD patients and 150 age-matched controls. The pattern of changes between the two group's allele frequencies shows statistical significance (P = 0.0359). The smallest polymorphism sizes are more predominant among PD patients than controls. To study the effects of this polymorphism on NOS1 gene transcription, reporter gene constructs were made by cloning the NOS1 1F promoter with polymorphism lengths of either 42, 54, or 62 bp in front of the luciferase gene and transfecting them into HeLa or Sk-N-MC cells. NOS1-directed reporter gene constructs with the 62-bp polymorphism increased transcription of luciferase 2.2-fold in HeLa and 1.8-fold in Sk-N-MC cells compared with reporter gene constructs with the 42-bp polymorphism. These data suggest that if smaller polymorphism size contributes to the higher NOS1 levels in PD patients, an as yet unknown transcriptional mechanism is required. Copyright 2009 Wiley-Liss, Inc.

  8. Lack of association between the Pro12Ala polymorphism of the PPAR-gamma 2 gene and type 2 diabetes mellitus in the Qatari consanguineous population.

    PubMed

    Badii, Ramin; Bener, Abdulbari; Zirie, Mahmoud; Al-Rikabi, Ammar; Simsek, Mehmet; Al-Hamaq, Abdulla O A A; Ghoussaini, Maya; Froguel, Philippe; Wareham, Nick J

    2008-03-01

    Peroxisome proliferators-activated receptor gamma (PPAR gamma) is a nuclear hormone receptor that serves as a master regulator for adipocytes-specific genes contributing to adipocytes differentiation, insulin sensitivity and lipid metabolism. The substitution of proline to alanine at codon 12 of the PPAR gamma 2 gene (Pro12Ala polymorphism) is most widely studied, and the associations with diabetes, obesity, and other clinical parameters have been reported and discussed in several ethnic groups. Among native Qatar ethnicity, however, there is no report about this polymorphism. The aim of this study was to estimate the allele frequency of the Pro12Ala polymorphism of PPAR gamma 2 gene among Qatari population and investigate the association between this polymorphism and obesity or type 2 diabetes. This is a matched case-control study. It was carried out among diabetic patients and healthy subjects at the Primary Healthcare Clinics, and the survey was conducted from February 2003 to March 2006 in Qatari male and female nationals aged 35 to 60 years. The study was based on matched age, sex, and ethnicity of 400 cases (with diabetes) and 450 controls (without diabetes). Face-to-face interviews were based on a questionnaire that included variables such as age, sex, sociodemographic status, body mass index (BMI), and obesity. Their health status was assessed by medical conditions, family history, and blood pressure measurements. The allele frequency of Pro12Ala polymorphism in PPAR gamma 2 gene among Qataris is lower than that in many Caucasian ethnic groups. No association is seen between the Pro12Ala and type 2 Diabetes (0.055 vs 0.059, OR = 1.1311, P = 0.669). Nearly half of the diabetic type 2 patients (48.5%) were obese (BMI > 30) compared to nondiabetic subjects (29.8%) (P < 0.001). In this study, no association is seen between the Pro12Ala polymorphism in PPAR gamma 2 gene and the type 2 diabetes in Qatar.

  9. [Association of muscle segment homeobox gene 1 polymorphisms with nonsyndromic cleft lip with or without cleft palate].

    PubMed

    Zhang, Li; Tang, Jun-Ling; Liang, Shang-Zheng

    2008-06-01

    Muscle segment homeobox gene (MSX)1 has been proposed as a gene in which mutations may contribute to nonsyndromic cleft lip with or without cleft palate (NSCL/P). To study MSX1 polymorphisms in NSCL/ P by means of polymerase chain reaction-single-strand conformation polymorphism (PCR-SSCP), and investigate the association of MSX1 exons 1 polymorphisms with NSCL/P. DNA were extracted from blood samples from NSCL/P and unrelated normal subjects. Genome DNA from peripheral leukocyte with these blood samples were extracted, which was used as template to amplify desired gene fragment of MSX1 exons 1 by means of polymerase chain reaction (PCR). The PCR products were examined by single-strand conformation polymorphism (SSCP). The MSX1 exons 1 polymorphisms were examined by sequencing if mutations were found. MSX1 genes of exon 1 mutation was not been found in the NSCL/P and unrelated normal subjects by SSCP. No correlation between MSX1 exon 1 and NSCL/P was found. MSX1 exon 1 may not be a key gene (susceptibility gene) in NSCL/P.

  10. [ROLE OF GENETIC POLYMORPHISM AND DIFFERENCES IN THE DETOXIFICATION OF CHEMICAL SUBSTANCES IN THE HUMAN BODY].

    PubMed

    Mogilenkova, L A; Rembovskiy V R

    2016-01-01

    There are given modern views on the role of genetic polymorphism on the detoxification of chemical substances and individual sensitivity in workers to the development of diseases associated with xenobiotics metabolism disorders. In the search for genetic markers of occupationally caused diseases it is promising to study allelomorphs of genes responsible for the polyfunctional response of the human body, including genes involved in xenobiotic biotransformation. There is substantiated the expediency of compilation and introduction of genetic passports for stuff occupied at hazardous chemical enterprises.

  11. A critical analysis of disease-associated DNA polymorphisms in the genes of cattle, goat, sheep, and pig

    PubMed Central

    Ibeagha-Awemu, Eveline M.; Kgwatalala, Patrick; Ibeagha, Aloysius E.

    2008-01-01

    Genetic variations through their effects on gene expression and protein function underlie disease susceptibility in farm animal species. The variations are in the form of single nucleotide polymorphisms, deletions/insertions of nucleotides or whole genes, gene or whole chromosomal rearrangements, gene duplications, and copy number polymorphisms or variants. They exert varying degrees of effects on gene action, such as substitution of an amino acid for another, shift in reading frame and premature termination of translation, and complete deletion of entire exon(s) or gene(s) in diseased individuals. These factors influence gene function by affecting mRNA splicing pattern or by altering/eliminating protein function. Elucidating the genetic bases of diseases under the control of many genes is very challenging, and it is compounded by several factors, including host × pathogen × environment interactions. In this review, the genetic variations that underlie several diseases of livestock (under monogenic and polygenic control) are analyzed. Also, factors hampering research efforts toward identification of genetic influences on animal disease identification and control are highlighted. A better understanding of the factors analyzed could be better harnessed to effectively identify and control, genetically, livestock diseases. Finally, genetic control of animal diseases can reduce the costs associated with diseases, improve animal welfare, and provide healthy animal products to consumers, and should be given more attention. PMID:18350334

  12. Association of neonatal necrotizing enterocolitis with myeloid differentiation-2 and GM2 activator protein genetic polymorphisms.

    PubMed

    Zhou, Wei; Yuan, Weiming; Huang, Longguang; Wang, Ping; Rong, Xiao; Tang, Juan

    2015-07-01

    The aim of the present study was to investigate the association of neonatal necrotizing enterocolitis (NEC) with myeloid differentiation-(MD-2) and GM2 activator protein (GM2A) genetic polymorphisms. Gene resequencing of the MD-2 and GM2A gene exons was performed on 42 neonates, diagnosed with NEC (NEC group), as well as in the rs11465996 locus, located in the MD-2 gene promoter region. The aim was to detect the genetic polymorphisms present in the neonates with NEC and compare the functional polymorphic loci with 83 neonates without NEC (control group), who had been born during the same period. A polymorphic locus with abnormal frequency was detected in the exon region of the MD-2 gene. In the NEC group, the frequency of genotypes carrying the low frequency allele (G) in the rs11465996 locus (MD-2 promoter region) was significantly higher compared with the control group (χ(2)=4.388, P=0.036). Furthermore, the frequencies of genotypes carrying the low frequency A and C alleles in the rs1048719 (GM2A gene exon 1) and rs2075783 loci (GM2A intron), respectively, were significantly higher in the NEC group compared with the control group (χ(2)=4.316, P=0.038; and χ(2)=13.717, P=0.000, respectively). In addition, the rs11465996 polymorphism in the MD-2 gene promoter region was found to be associated with the severity of NEC. Furthermore, the rs2075783 polymorphism in the GM2A gene exon 1 and the rs1048719 polymorphism in the intron region of this gene, were associated with the occurrence of NEC. The present study demonstrated that gene polymorphisms of MD-2 and GM2A were associated with the occurrence or severity of NEC; however, further in-depth exploration is required to clarify the associations between genetic predispositions to polymorphisms, and NEC.

  13. Association study of interferon gamma (IFN-γ) +874T/A gene polymorphism in patients with paranoid schizophrenia.

    PubMed

    Paul-Samojedny, Monika; Owczarek, Aleksander; Suchanek, Renata; Kowalczyk, Malgorzata; Fila-Danilow, Anna; Borkowska, Paulina; Kucia, Krzysztof; Kowalski, Jan

    2011-03-01

    Schizophrenia is a multifactorial disease with changes affecting the immune system. Dysregulation of the cytokine network in schizophrenia has been well documented. Such changes may occur due to disturbances in cytokine levels that are linked to polymorphisms of cytokine genes. However, research in the role of cytokine gene polymorphisms in schizophrenia has been surprisingly scanty. The aim of this study was to identify, in a case control study, whether polymorphism of IFN-γ gene is a risk factor for the development of paranoid schizophrenia. To the best of our knowledge, this is the first study that examines the association between the IFN-γ gene polymorphism and psychopathological symptoms in patients with paranoid schizophrenia. Polymorphism of IFN-γ (+874T/A, rs 62559044) in schizophrenic patients (n=179), as well as healthy individuals (n=196), both Polish residents, was genotyped using AS-PCR method. Of note, when analyzing the results, we took into consideration the gender of studied individuals. Surprisingly, a single-nucleotide polymorphism in the first intron of the IFN-γ gene was found to be associated with paranoid schizophrenia in males, but not in females. The presence of allele A at position +874 in the IFN-γ gene correlates with 1.66-fold higher risk of paranoid schizophrenia development in males. Differences in the genotypes may have an important role in determining the level of I gene transcription. Because other polymorphisms have been demonstrated to influence IFN-γ transcription, further analysis is necessary to clarify the role of this gene in the pathogenesis of paranoid schizophrenia.

  14. Chasing Migration Genes: A Brain Expressed Sequence Tag Resource for Summer and Migratory Monarch Butterflies (Danaus plexippus)

    PubMed Central

    Zhu, Haisun; Casselman, Amy; Reppert, Steven M.

    2008-01-01

    North American monarch butterflies (Danaus plexippus) undergo a spectacular fall migration. In contrast to summer butterflies, migrants are juvenile hormone (JH) deficient, which leads to reproductive diapause and increased longevity. Migrants also utilize time-compensated sun compass orientation to help them navigate to their overwintering grounds. Here, we describe a brain expressed sequence tag (EST) resource to identify genes involved in migratory behaviors. A brain EST library was constructed from summer and migrating butterflies. Of 9,484 unique sequences, 6068 had positive hits with the non-redundant protein database; the EST database likely represents ∼52% of the gene-encoding potential of the monarch genome. The brain transcriptome was cataloged using Gene Ontology and compared to Drosophila. Monarch genes were well represented, including those implicated in behavior. Three genes involved in increased JH activity (allatotropin, juvenile hormone acid methyltransfersase, and takeout) were upregulated in summer butterflies, compared to migrants. The locomotion-relevant turtle gene was marginally upregulated in migrants, while the foraging and single-minded genes were not differentially regulated. Many of the genes important for the monarch circadian clock mechanism (involved in sun compass orientation) were in the EST resource, including the newly identified cryptochrome 2. The EST database also revealed a novel Na+/K+ ATPase allele predicted to be more resistant to the toxic effects of milkweed than that reported previously. Potential genetic markers were identified from 3,486 EST contigs and included 1599 double-hit single nucleotide polymorphisms (SNPs) and 98 microsatellite polymorphisms. These data provide a template of the brain transcriptome for the monarch butterfly. Our “snap-shot” analysis of the differential regulation of candidate genes between summer and migratory butterflies suggests that unbiased, comprehensive transcriptional profiling will inform the molecular basis of migration. The identified SNPs and microsatellite polymorphisms can be used as genetic markers to address questions of population and subspecies structure. PMID:18183285

  15. Interleukin-8 gene polymorphism -251T>A contributes to Alzheimer's disease susceptibility.

    PubMed

    Qin, Biyong; Li, Li; Wang, Shanshan; Wu, Jun; Huang, Yulan; Zhou, Ping; Bai, Jiao; Zheng, Yan

    2016-09-01

    Published association studies have investigated the correlation between interleukin-8 (IL-8) gene polymorphism -251T>A and susceptibility to Alzheimer's disease (AD); however, the results are conflicting. Thus, we conducted the meta-analysis to reassess the effect of IL-8 gene -251T>A variant on the risk of AD. Relevant studies regarding this association were electronically searched and identified from the PubMed, Embase, Cochrane Library, China National Knowledge Infrastructure, and the Chinese Biomedicine Database. The odds ratios (ORs) with the corresponding 95% confidence intervals (95% CIs) were pooled to calculate the strength of this association. Nine studies with a total of 1406 cases and 2152 controls were included in the meta-analysis. Overall, a significant association of IL-8 gene -251T>A polymorphism with increased risk of AD was observed in several genetic models (allele, A vs T: OR=1.32, 95%CI=1.16-1.50; homozygous, AA vs TT: OR=1.70, 95%CI=1.21-2.21; heterozygous, TA vs TT: OR=1.37, 95%CI=1.12-1.69; recessive, AA vs TA+TT: OR=1.40, 95%CI=1.12-1.75). Similarly, such association was also revealed both in Asian and European populations in the subgroup analysis by ethnicity. The current study suggested that IL-8 gene polymorphism -251T>A may contribute to the susceptibility to AD.

  16. Impact of Blood Type, Functional Polymorphism (T-1676C) of the COX-1 Gene Promoter and Clinical Factors on the Development of Peptic Ulcer during Cardiovascular Prophylaxis with Low-Dose Aspirin

    PubMed Central

    Wang, Pin-Yao; Chen, Hsiu-Ping; Chen, Angela; Tsay, Feng-Woei; Kao, Sung-Shuo; Peng, Nan-Jing; Tseng, Hui-Hwa; Hsu, Ping-I

    2014-01-01

    Aims. To investigate the impact of blood type, functional polymorphism (T-1676C) of the COX-1 gene promoter, and clinical factors on the development of peptic ulcer during cardiovascular prophylaxis with low-dose aspirin. Methods. In a case-control study including 111 low-dose aspirin users with peptic ulcers and 109 controls (asymptomatic aspirin users), the polymorphism (T-1676C) of the COX-1 gene promoter was genotyped, and blood type, H pylori status, and clinical factors were assessed. Results. Univariate analysis showed no significant differences in genotype frequencies of the COX-1 gene at position -1676 between the peptic ulcer group and control group. Multivariate analysis revealed that blood type O, advanced age, history of peptic ulcer, and concomitant use of NSAID were the independent risk factors for the development of peptic ulcer with the odds ratios of the 2.1, 3.1, 27.6, and 2.9, respectively. Conclusion. The C-1676T polymorphism in the COX-1 gene promoter is not a risk factor for ulcer formation during treatment with low-dose aspirin. Blood type O, advanced age, history of peptic ulcer, and concomitant use of NSAID are of independent significance in predicting peptic ulcer development during treatment with low-dose aspirin. PMID:25243161

  17. Polymorphisms of the tumor necrosis factor-alpha receptor 2 gene are associated with obesity phenotypes among 405 Caucasian nuclear families.

    PubMed

    Zhao, Lan-Juan; Xiong, Dong-Hai; Pan, Feng; Liu, Xiao-Gang; Recker, Robert R; Deng, Hong-Wen

    2008-09-01

    The plasma level of the tumor necrosis factor-alpha receptor 2 (TNFR2) is associated with obesity phenotypes. However, the genetic polymorphisms for such an association have rarely been explored and are generally unknown. In this study, by employing a large sample of 1,873 subjects from 405 Caucasian nuclear families, we explored the association of 12 SNPs of the TNFR2 gene and obesity-related phenotypes, including body mass index (BMI), fat mass, and percentage fat mass (PFM). The within-family quantitative transmission disequilibrium test, which is robust to sample stratification, was implemented to evaluate the association of TNFR2 gene with obesity phenotypes. Evidence of association was obtained at SNP9 (rs5746059) with fat mass (P = 0.0002), BMI (P = 0.002), and PFM (P = 0.0006). The contribution of this polymorphism to the variation of fat mass and PFM was 6.24 and 7.82%, respectively. Individuals carrying allele A at the SNP9 site had a 4.6% higher fat mass and a 2.5% increased PFM compared to noncarriers. The results remained significant even after correction for multiple testing. Evidence of association between the TNFR2 gene and obesity phenotypes are also found in 700 independent Chinese Han and 1,000 random Caucasians samples. The results suggest that the TNFR2 gene polymorphisms contribute to the variation of obesity phenotypes.

  18. Interleukin-1beta gene polymorphisms in Taiwanese patients with gout.

    PubMed

    Chen, Man-Ling; Huang, Chung-Ming; Tsai, Chang-Hai; Tsai, Fuu-Jen

    2005-04-01

    The purpose of this study was to examine whether interleukin-1 beta (IL-1beta) promoter and exon 5 gene polymorphisms are markers of susceptibility or clinical manifestations in Taiwanese patients with gout. The study included 196 patients in addition to 103 unrelated healthy control subjects living in central Taiwan. From genomic DNA, polymorphisms of the gene for IL-1beta promoter and IL-1beta exon 5 were typed. Allelic frequencies were compared between the two groups, and the relationship between allelic frequencies and clinical manifestations of gout was evaluated. No significant differences were observed in the allelic frequencies of the IL-1beta promoter between patients with gout and healthy control subjects. Additionally, we did not detect any association of the IL-1beta promoter genotype with the clinical and laboratory profiles of gout patients. However, there was a significant difference between the two groups in terms of hypertriglyceridemia (P=0.0004, chi(2)=12.52, OR 7.14, 95%CI 0.012-0.22). There was also a significant difference in the genotype of IL-1beta exon 5 polymorphism between patients with and without hypertriglyceridemia. Results of the present study suggest that polymorphisms of the IL-1beta promoter and IL-1beta exon 5 are not related to gout patients in central Taiwan.

  19. Genetic Predisposition to Persistent Apical Periodontitis

    PubMed Central

    Morsani, Jussara M.; Aminoshariae, Anita; Han, Yiping Weng; Montagnese, Thomas A.; Mickel, Andre

    2013-01-01

    Introduction The proinflammatory cytokine interleukin (IL)-1 is a key regulator of host responses to microbial infection and a major modulator of extracellular matrix catabolism and bone resorption. Allele2 of IL-1b is associated with a four-fold increase in IL-1β production. The aim of this case-control study was to evaluate the gene polymorphism of IL-1β in the pathogenesis of endodontic failure. We hypothesized that the gene polymorphism (allele2 of IL-1β) would influence host response and enhance inflammatory reactions predisposing to persistent apical periodontitis (PAP). Materials and Methods Subjects with at least 1 year of follow-up after root canal therapy (RCT) were recalled. Inclusion and exclusion criteria were applied, and 34 subjects with signs/symptoms of PAP with otherwise acceptable RCT were included. Sixty-one controls showed healing with acceptable RCT. Genomic DNA from buccal mucosa was amplified by polymerase chain reaction followed by restriction fragment length polymorphism to distinguish the alleles of IL-1β gene polymorphism. Results A significant difference in the distribution of the polymorphic genotype among cases (70.6%) and controls (24.6%) (P < .001, Pearson χ2) was shown. Conclusions These findings suggest that specific genetic markers associated with increased IL-1β production may contribute to increased susceptibility to PAP. PMID:21419289

  20. Phylogenetic reconstruction and polymorphism analysis of BK virus VP2 gene isolated from renal transplant recipients in China

    PubMed Central

    WANG, ZHANG-YANG; HONG, WEI-LONG; ZHU, ZHE-HUI; CHEN, YUN-HAO; YE, WEN-LE; CHU, GUANG-YU; LI, JIA-LIN; CHEN, BI-CHENG; XIA, PENG

    2015-01-01

    BK polyomavirus (BKV) is important pathogen for kidney transplant recipients, as it is frequently re-activated, leading to nephropathy. The aim of this study was to investigate the phylogenetic reconstruction and polymorphism of the VP2 gene in BKV isolated from Chinese kidney transplant recipients. Phylogenetic analysis was carried out in the VP2 region from 135 BKV-positive samples and 28 reference strains retrieved from GenBank. The unweighted pair-group method with arithmetic mean (UPGMA) grouped all strains into subtypes, but failed to subdivide strains into subgroups. Among the plasma and urine samples, all plasma (23/23) and 82 urine samples (82/95) were identified to contain subtype I; the other 10 urine samples contained subtype IV. A 86-bp fragment was identified as a highly conserved sequence. Following alignment with 36 published BKV sequences from China, 92 sites of polymorphism were identified, including 11 single nucleotide polymorphisms (SNPs) prevalent in Chinese individuals and 30 SNPs that were specific to the two predominant subtypes I and IV. The limitations of the VP2 gene segment in subgrouping were confirmed by phylogenetic analysis. The conserved sequence and polymorphism identified in this study may be helpful in the detection and genotyping of BKV. PMID:26640547

  1. Polymorphism of Glucokinase Gene in Non-Insulin Dependent Diabetes Mellitus

    PubMed Central

    Kim, Deog-Yoon; Choi, Jung-Hee; Woo, Jeong-Taek; Paeng, Jeong-Ryung; Yang, In-Myung; Kim, Sung-Woon; Kim, Jin-Woo; Kim, Young-Seol; Kim, Kwang-Won; Choi, Young-Kil

    1994-01-01

    Several lines of evidence suggest a strong genetic component to NIDDM. To clarify the role of glucokinase gene in the development of NIDDM, restriction fragment length polymorphism (RFLP) of glucokinase gene and 3′ microsatellite polymorphism analyses by polymerase chain reaction-single strand conformational polymorphism (PCR-SSCP) were performed in NIDDM and control subjects. Compared to NIDDM with 1.3 kb allele/Pvu I digestion of glucokinase, 10% of NIDDM did not demonstrate 1.3 kb allele and these patients were charcterized by increased insulin secretion. In 3′ microsatellite polymorphism analysis, autoradiography of PCR products revealed three different alleles, including Z, Z+2 and Z+4. Z was the most common allele in both NIDDM and nondiabetic controls. There was no significant allele associated with NIDDM. Frequency of the homozygote Z/Z genotype was significantly lower in NIDDM subjects (16.7%) compared to normal control (46.7%) (p<0.05). There was no difference in clinical findings according to 3′ microsatellite genotypes in NIDDM. These data suggest that there does not appear to be a significant glucokinase allele associated with NIDDM but Z/Z genotype may play a suppressive role in the pathogenesis of a certain type of NIDDM in Korea. Further studies may be required to identify the molecular basis of this association. PMID:7913622

  2. Polymorphisms in an obesity-related gene (PCSK1) are associated with fat deposition and production traits in Italian heavy pigs.

    PubMed

    Fontanesi, L; Bertolini, F; Scotti, E; Trevisi, P; Buttazzoni, L; Dall'olio, S; Davoli, R; Bosi, P; Russo, V

    2012-12-01

    The proprotein convertase subtilisin/kexin type 1 (PCSK1) gene encodes the prohormone convertase 1/3 enzyme that processes prohormones into functional hormones that, in turn, regulate central and peripheral energy metabolism. Mutations in the human PCSK1 gene cause severe monogenic obesity or confer risk of obesity. We herein investigated the porcine PCSK1 gene with the aim of identifying polymorphisms associated with fat deposition and production traits in Italian heavy pigs. By re-sequencing about 5.1 kb of this gene in 21 pigs of different breeds, we discovered 14 polymorphisms that were organized in nine haplotypes, clearly distributed in two clades of putative European and Asian origin. Then we re-mapped this gene on porcine chromosome 2 and analysed its expression in several tissues including gastric oxyntic mucosa of weanling pigs in which PCSK1 processes the pre-pro-ghrelin into ghrelin, which in turn is involved in the control of feed intake and energy metabolism. Association analyses between PCSK1 single-nucleotide polymorphisms (SNPs) and production, carcass and several other traits were conducted on five groups of pigs from three different experimental designs, for a total of 1221 animals. Results indicated that the analysed SNPs were associated (P < 0.01 or P < 0.05) with several traits including backfat thickness and visible intermuscular fat in Italian Duroc (ID) and growth performances in Italian Large White (ILW) and in ILW × Italian Landrace pigs. However, the effects estimated in the ILW were opposite to the effects reported in the ID pigs. Suggestive association (P < 0.10) was observed with muscle cathepsin B activity, opening, if confirmed, potential applications to reduce the excessive softness defect of the green hams that is of particular concern for the processing industry. The results obtained supported the need to further investigate the PCSK1 gene to fully exploit the value of its variability and apply this information in pig breeding programmes.

  3. A Study of the Impact of Death Receptor 4 (DR4) Gene Polymorphisms in Alzheimer's Disease.

    PubMed

    Edgünlü, Tuba Gökdoğan; Ozge, Aynur; Yalın, Osman Özgür; Kul, Seval; Erdal, Mehmet Emin

    2013-09-01

    Excessive apoptosis is believed to play a role in many degenerative and non-degenerative neurological diseases including Alzheimer's disease (AD). Much recent data suggest that apoptotic mechanisms may represent the missing link between Aβ deposition and proteolysis of tau protein. However, there is emerging evidence that apoptotic mechanisms may play a role in Alzheimer's Disease pathogenesis in the absence of overt apoptosis. TNF-related apoptosis inducing ligand receptor 1 (Death Receptor 4, DR4) might impair the apoptotic signal transduction and lead to dysregulation of the homeostasis between cell survival and cell death. The aim of our study was to further investigate the relationship between genetic variants of DR4 and Alzheimer's Disease. Case control study. Sixty-eight patients with AD were included in the study. The control group comprised 72 subjects without signs of neurodegenerative diseases, as evidenced by the examination.DNA was extracted from whole blood using the salting-out procedure. Genotypes were identified by restriction fragment length polymorphism analysis of polymerase chain reaction (PCR-RFLP) products. We observed significant differences in the genotypic distribution of the rs6557634 polymorphism in AD patients compared with controls (p<0.05); our data suggest that the GA genotype in rs6557634 could be protective against AD (p<0.05). However, there were no significant differences between AD patients and control groups in terms of the DR4 rs20575 polymorphism (p>0.05) and the DR4 rs20576 polymorphism (p>0.05). According to haplotype analysis of the DR4 gene for rs6557634, rs20575 and rs20576 polymorphisms, GCA and GCC haplotypes might be a risk factor for AD. Also, we have shown that ACA, GGC and GGA haplotypes might be protective factors against AD. The present results indicate for the first time the possible contribution of the DR4 gene rs6557634, rs20575, rs20576 polymorphisms in Alzheimer's Disease, which may influence susceptibility to Alzheimer's Disease.

  4. Identifying disease polymorphisms from case-control genetic association data.

    PubMed

    Park, L

    2010-12-01

    In case-control association studies, it is typical to observe several associated polymorphisms in a gene region. Often the most significantly associated polymorphism is considered to be the disease polymorphism; however, it is not clear whether it is the disease polymorphism or there is more than one disease polymorphism in the gene region. Currently, there is no method that can handle these problems based on the linkage disequilibrium (LD) relationship between polymorphisms. To distinguish real disease polymorphisms from markers in LD, a method that can detect disease polymorphisms in a gene region has been developed. Relying on the LD between polymorphisms in controls, the proposed method utilizes model-based likelihood ratio tests to find disease polymorphisms. This method shows reliable Type I and Type II error rates when sample sizes are large enough, and works better with re-sequenced data. Applying this method to fine mapping using re-sequencing or dense genotyping data would provide important information regarding the genetic architecture of complex traits.

  5. Frequency of mutations in PROP-1 gene in Turkish children with combined pituitary hormone deficiency.

    PubMed

    Kandemir, Nurgün; Vurallı, Doğuş; Taşkıran, Ekim; Gönç, Nazlı; Özön, Alev; Alikaşifoğlu, Ayfer; Yılmaz, Engin

    2012-01-01

    Mutations in the prophet of Pit-1 (PROP-1) gene are responsible for most of the cases of combined pituitary hormone deficiencies (CPHD). We performed this study to determine the prevalence of PROP-1 mutations in a group of Turkish children with CPHD. Fifty-three children with the diagnosis of CPHD were included in this study. Clinical data were obtained from medical files, and hormonal evaluation and genetic screening for PROP-1 mutations were performed. A homozygous S109X mutation was found in the second exon in two brothers, and they had growth hormone (GH) and thyroid-stimulating hormone (TSH) deficiencies and normal prolactin levels. In the third exon of the PROP-1 gene, a heterozygous A142T polymorphism was found in 14 patients and a homozygous A142T polymorphism was found in 3 patients. In the first exon, a homozygous A9A polymorphism was found in 7 patients and a heterozygous A9A polymorphism was found in 31 patients. We assumed that mutations in the PROP-1 gene in cases with CPHD were expected to be more prevalent in our population due to consanguinity, but it was found that these mutations were far less than expected and that it was rare in non-familial cases.

  6. Family-based association testing strongly implicates DRD2 as a risk gene for schizophrenia in Han Chinese from Taiwan

    PubMed Central

    Glatt, SJ; Faraone, SV; Lasky-Su, JA; Kanazawa, T; Hwu, H-G; Tsuang, MT

    2009-01-01

    The gene that codes for dopamine receptor D2 (DRD2 on chromosome 11q23) has long been a prime functional and positional candidate risk gene for schizophrenia. Collectively, prior case–control studies found a reliable effect of the Ser311Cys DRD2 polymorphism (rs1801028) on risk for schizophrenia, but few other polymorphisms in the gene had ever been evaluated and no adequately powered family-based association study has been performed to date. Our objective was to test 21 haplotype-tagging and all three known nonsynonymous single-nucleotide polymorphisms (SNPs) in DRD2 for association with schizophrenia in a family-based study of 2408 Han Chinese, including 1214 affected individuals from 616 families. We did not find a significant effect of rs1801028, but we did find significant evidence for association of schizophrenia with two multi-marker haplotypes spanning blocks of strong linkage disequilibrium (LD) and nine individual SNPs (Ps < 0.05). Importantly, two SNPs (rs1079727 and rs2283265) and both multi-marker haplotypes spanning entire LD blocks (including one that contained rs1801028) remained significant after correcting for multiple testing. These results further add to the body of data implicating DRD2 as a schizophrenia risk gene; however, a causal variant(s) in DRD2 remains to be elucidated by further fine mapping of the gene, with particular attention given to the area surrounding the third through fifth exons. PMID:18332877

  7. Functional analysis of regulatory single-nucleotide polymorphisms.

    PubMed

    Pampín, Sandra; Rodríguez-Rey, José C

    2007-04-01

    The identification of regulatory polymorphisms has become a key problem in human genetics. In the past few years there has been a conceptual change in the way in which regulatory single-nucleotide polymorphisms are studied. We revise the new approaches and discuss how gene expression studies can contribute to a better knowledge of the genetics of common diseases. New techniques for the association of single-nucleotide polymorphisms with changes in gene expression have been recently developed. This, together with a more comprehensive use of the old in-vitro methods, has produced a great amount of genetic information. When added to current databases, it will help to design better tools for the detection of regulatory single-nucleotide polymorphisms. The identification of functional regulatory single-nucleotide polymorphisms cannot be done by the simple inspection of DNA sequence. In-vivo techniques, based on primer-extension, and the more recently developed 'haploChIP' allow the association of gene variants to changes in gene expression. Gene expression analysis by conventional in-vitro techniques is the only way to identify the functional consequences of regulatory single-nucleotide polymorphisms. The amount of information produced in the last few years will help to refine the tools for the future analysis of regulatory gene variants.

  8. The ABCG2 gene Q141K polymorphism contributes to an increased risk of gout: a meta-analysis of 2185 cases.

    PubMed

    Qiu, Ya; Liu, Hua; Qing, Yufeng; Yang, Min; Tan, Xiaoyao; Zhao, Mingcai; Lin, Monica; Zhou, Jingguo

    2014-09-01

    Individual genetic association studies examining the relationship between the ABCG2 gene polymorphisms and gout have yielded inconsistent results. This study aims to evaluate the association between the ABCG2 gene variants and gout using meta-analysis. Relevant studies were identified by searching databases extensively. The odds ratio (OR) was calculated using a random-effect or fixed-effect model. A Q statistic was used to evaluate homogeneity, and Egger's test and funnel plot were used to assess publication bias. Subgroup analyses on ethnicities and sex were also performed. A total of 7 studies, including 2185 gout patients and 8028 controls from 5 countries or regions, were included and identified for the current meta-analysis. It was found that the A allele or AA genotype of the ABCG2 Q141K polymorphism (rs2231142) had an increased risk of gout in the general population (A allele, p < 0.00001 and AA genotype, p < 0.00001, respectively). On the contrary, CC homozygote played a protective role against the risk of gout (p < 0.00001). Similar results were found in subgroup analyses. However, there was a significant heterogeneity among studies. Existing evidence indicates that the Q141K polymorphism (rs2231142, the A allele and AA genotype) is associated with an increased risk of gout.

  9. Potential Positive Association between Cytochrome P450 1A1 Gene Polymorphisms and Recurrent Pregnancy Loss: a Meta-Analysis.

    PubMed

    Li, Jie; Chen, Yang; Mo, Sien; Nai, Donghong

    2017-07-01

    In order to discover the potential genetic risks associated with recurrent pregnancy loss (RPL), this meta-analysis was conducted to assess the association between CYP1A1 gene polymorphism and RPL. Studies were retrieved from the databases PubMed, Embase, HuGENet, and CNKI. Four models were then applied. Seven studies, including three datasets for the rs1048943 and five for the rs4646903 single-nucleotide polymorphism (SNP), were included in this analysis, involving 613 cases and 398 controls for the rs1048943; and 864 cases and 842 controls for the rs4646903 SNP. After comprehensive analysis, we found that rs4646903 was significantly associated with RPL [recessive (OR = 1.72, 95%CI: 1.13-2.61); codominant (CC vs TT; OR = 1.74, 95%CI: 1.12-2.71), (CC vs CT; OR = 1.67, 95%CI: 1.07-2.62) and allele analysis (OR = 1.27, 95%CI: 1.07-1.50)]. In the following subgroup analysis, a positive association was also discovered among people of Asian descent, especially South Asians. However, there was no obvious association between rs1048943 and RPL. In summary, our results suggest that CYP1A1 gene polymorphism (particularly for rs4646903) might be associated with RPL risk, especially among South Asians. Further studies are required to confirm this association. © 2017 John Wiley & Sons Ltd/University College London.

  10. Common Polymorphisms in the PKP3-SIGIRR-TMEM16J Gene Region Are Associated With Susceptibility to Tuberculosis

    PubMed Central

    Randhawa, April K.; Chau, Tran T. H.; Bang, Nguyen D.; Yen, Nguyen T. B.; Farrar, Jeremy J.; Dunstan, Sarah J.; Hawn, Thomas R.

    2012-01-01

    (See the editorial commentary by Wilkinson, on pages 525–7.) Background. Tuberculosis has been associated with genetic variation in host immunity. We hypothesized that single-nucleotide polymorphisms (SNPs) in SIGIRR, a negative regulator of Toll-like receptor/IL-1R signaling, are associated with susceptibility to tuberculosis. Methods. We used a case-population study design in Vietnam with cases that had either tuberculous meningitis or pulmonary tuberculosis. We genotyped 6 SNPs in the SIGIRR gene region (including the adjacent genes PKP3 and TMEM16J) in a discovery cohort of 352 patients with tuberculosis and 382 controls. Significant associations were genotyped in a validation cohort (339 patients with tuberculosis, 376 controls). Results. Three SNPs (rs10902158, rs7105848, rs7111432) were associated with tuberculosis in discovery and validation cohorts. The polymorphisms were associated with both tuberculous meningitis and pulmonary tuberculosis and were strongest with a recessive genetic model (odds ratios, 1.5–1.6; P = .0006–.001). Coinheritance of these polymorphisms with previously identified risk alleles in Toll-like receptor 2 and TIRAP was associated with an additive risk of tuberculosis susceptibility. Conclusions. These results demonstrate a strong association of SNPs in the PKP3-SIGIRR-TMEM16J gene region and tuberculosis in discovery and validation cohorts. To our knowledge, these are the first associations of polymorphisms in this region with any disease. PMID:22223854

  11. Cytokine single-nucleotide polymorphisms and risk of non-small-cell lung cancer.

    PubMed

    Pérez-Ramírez, Cristina; Alnatsha, Ahmed; Cañadas-Garre, Marisa; Villar, Eduardo; Valdivia-Bautista, Javier; Faus-Dáder, María J; Calleja-Hernández, Miguel Á

    2017-12-01

    Lung cancer, particularly the non-small-cell lung cancer (NSCLC) subtype, is the leading cause of cancer-related death worldwide. Several functional polymorphisms in inflammatory cytokine genes, such as IL1B, IL6, IL12A, IL13 and IL16, have been associated with the risk of NSCLC. The aim of this study was to evaluate the association between ILs gene polymorphisms and the risk of developing NSCLC. A retrospective case-control study was carried out, including 174 NSCLC cases and 298 controls of Spanish origin. IL1B (rs1143634), IL1B (rs12621220), IL1B (rs1143623), IL1B (rs16944), IL1B (rs1143627), IL12A (rs662959), IL13 (rs1881457), IL6 (rs1800795) and IL16 (rs7170924) gene polymorphisms were analysed by TaqMan. The genotypic logistic regression model adjusted by smoking status showed that the IL1B rs1143634-TT genotype was associated with a lower risk of NSCLC (P=0.04312; odds ratio=0.226; 95% confidence interval=0.044-0.840). No other gene polymorphisms showed an association with NSCLC in any of the models tested. In conclusion, IL1B rs1143634 was significantly associated with a higher risk of NSCLC. No influence of IL1B rs12621220, rs1143623, rs16944, rs1143627, IL12A rs662959, IL13 rs1881457 and IL16 rs7170924 on the risk of developing NSCLC was found in our study.

  12. Novel polymorphism in FADS1 gene and fish consumption on risk of oral cancer: A case-control study in southeast China.

    PubMed

    Chen, Fa; Lin, Tao; Yan, Lingjun; Liu, Fengqiong; Huang, Jiangfeng; Liu, Fangping; Wu, Junfeng; Qiu, Yu; Lin, Lisong; Cai, Lin; He, Baochang

    2017-02-28

    The aim of this study was to investigate the independent and combined effects of fatty acid desaturase 1 (FADS1) gene polymorphism and fish consumption on oral cancer. A hospital-based case-control study was performed including 305 oral cancer patients and 579 cancer-free controls. The genotypes were determined by TaqMan genotyping assay. Non-conditional logistic regression model was used to assess the effects of FADS1 rs174549 polymorphism and fish intake. Subjects carrying A allele of rs174549 significantly reduced the risk of oral cancer (AA VS GG, OR: 0.65, 95% CI: 0.42-0.99; AA VS AG+GG, OR: 0.67, 95% CI: 0.46-0.98). Moreover, the statistically significant reverse associations were especially evident in men, smokers, alcohol drinkers and those age ≤ 60 years. Additionally, fish intake ≥7 times/week showed a 73% reduction in risk for oral cancer compared to those who ate fish less than 2 times/week (OR: 0.27, 95% CI: 0.18-0.42). Furthermore, a significant gene-diet multiplicative interaction was observed between FADS1 rs174549 polymorphism and fish intake for oral cancer (P=0.028). This preliminary study suggests that FADS1 rs174549 polymorphism and fish consumption may be protective factors for oral cancer, with a gene-diet multiplicative interaction. Functional studies with larger samples are required to confirm our findings.

  13. Bovine GDF10 gene polymorphism analysis and its association with body measurement traits in Chinese indigenous cattle.

    PubMed

    Adoligbe, C; Zan, Linsen; Farougou, S; Wang, Hongbao; Ujjan, J A

    2012-04-01

    The objective of this research was to detect bovine GDF10 gene polymorphism and analyze its association with body measurement traits (BMT) of animals sampled from 6 different Chinese indigenous cattle populations. The populations included Xuelong (Xl), Luxi (Lx), Qinchuan (Qc), Jiaxian red (Jx), Xianang (Xn) and Nanyang (Ny). Blood samples were taken from a total of 417 female animals stratified into age categories of 12-36 months. Polymerase chain reaction-single strand conformation polymorphism (PCR-SSCP) was employed to find out GDF10 single polymorphism nucleotide (SNPs) and explore their possible association with BMT. Sequence analysis of GDF10 gene revealed 3 SNPs in total: 1 in exon1 (G142A) and 2 in exon3 (A11471G, and T12495C). G142A and T12495C SNPs are both synonymous mutation. They showed 2 genotypes namely respectively (GG, GA) and (PP and PB). A11471G SNP is a missense mutation leading to the change of Alanine to Threonine amino acid. It showed three genotypes namely AA, BB and AB. Analysis of association of polymorphism with body measurement traits at the three locus showed that there were significant effects on BMT in Qc, Jx and Ny cattle population. These results suggest that the GDF10 gene might have potential effects on body measurement traits in the above mentioned cattle populations and could be used for marker-assisted selection.

  14. The rs4285184 polymorphism of the MGAT1 gene as a risk factor for obesity in the Mexican population.

    PubMed

    Tapia-Rivera, José C; Baltazar-Rodríguez, Luz M; Cárdenas-Rojas, Martha I; Álvarez, Alan; Bustos-Saldaña, Rafael; Delgado-Enciso, Iván; Valdez-Velázquez, Laura L; Guzmán-Esquivel, José; Ramírez-Flores, Mario

    2017-02-23

    Obesity is a factor that contributes to the morbidity of certain diseases and to worldwide mortality. MGAT1 is a glycosyltransferase involved in the synthesis of protein-bound and lipid-bound oligosaccharides and its polymorphisms are possibly involved in the etiology of obesity. We investigated the association of the rs4285184 polymorphism of the MGAT1 gene with obesity in adults in the State of Colima, Mexico. A case-control study was conducted that included 244 subjects. All of them were grouped according to their percentage of body fat, determined through bioelectrical impedance, and they were genotyped for the rs4285184 polymorphism of the MGAT1 gene through PCR-RFLP. The results were analyzed for their association with the percentage of body fat. The G allele had a frequency of 49.19 and 38.75% for the cases and controls, respectively (P=.020) (OR 1.53; 95% CI 1.068-2.193). The frequency of the A/G+G/G genotype was 75% in the obese patients, which was significantly higher compared with the 57.5% of the control group (P=.004) (OR 2.217; 95% CI 1.287-3.821). The presence of the rs4285184 polymorphism of the MGAT1 gene increased the risk for developing body fat associated with obesity in the Mexican population. Copyright © 2016 Elsevier España, S.L.U. All rights reserved.

  15. A meta-analysis evaluating the relationship between IL-18 gene promoter polymorphisms and an individual's susceptibility to HCV infection.

    PubMed

    Chen, W; Jing, M; Zhang, Q; Yuan, R; Jing, S

    2018-01-01

    Several observational studies have investigated interleukin-18 (IL-18) gene polymorphisms with regard to susceptibility to hepatitis C virus (HCV) infection, but the results have been inconsistent. To evaluate the relationships between functional polymorphisms in the IL-18 gene and an individual's susceptibility to HCV infection, a meta-analysis was performed. Methods: A literature search was conducted using the PubMed, EMBASE, Web of Science and China BioMedicine databases to investigate the correlation between IL-18 gene polymorphisms and susceptibility to HCV infection. Crude odds ratios (ORs) with 95% confidence intervals (CIs) were calculated. The polymorphisms IL-18-607 C>A and -137 G>C were correlated with susceptibility to HCV infection in Asian populations. However, there was no evidence indicating a correlation between either of these polymorphisms and susceptibility to HCV infection in Caucasian populations. Our current meta-analysis suggests that the -607 C>A and -137 G>C polymorphisms in the IL-18 gene promoter play important roles in determining the response to HCV in Asian populations. More studies with larger sample sizes are needed to evaluate the associations between IL-18 genetic polymorphisms and HCV infection risk. © Acta Gastro-Enterologica Belgica.

  16. Genetic Polymorphisms in Host Antiviral Genes: Associations with Humoral and Cellular Immunity to Measles Vaccine

    PubMed Central

    Haralambieva, Iana H.; Ovsyannikova, Inna G.; Umlauf, Benjamin J.; Vierkant, Robert A.; Pankratz, V. Shane; Jacobson, Robert M.; Poland, Gregory A.

    2014-01-01

    Host antiviral genes are important regulators of antiviral immunity and plausible genetic determinants of immune response heterogeneity after vaccination. We genotyped and analyzed 307 common candidate tagSNPs from 12 antiviral genes in a cohort of 745 schoolchildren immunized with two doses of measles-mumps-rubella vaccine. Associations between SNPs/haplotypes and measles virus-specific immune outcomes were assessed using linear regression methodologies in Caucasians and African-Americans. Genetic variants within the DDX58/RIG-I gene, including a coding polymorphism (rs3205166/Val800Val), were associated as single-SNPs (p≤0.017; although these SNPs did not remain significant after correction for false discovery rate/FDR) and in haplotype-level analysis, with measles-specific antibody variations in Caucasians (haplotype allele p-value=0.021; haplotype global p-value=0.076). Four DDX58 polymorphisms, in high LD, demonstrated also associations (after correction for FDR) with variations in both measles-specific IFN-γ and IL-2 secretion in Caucasians (p≤0.001, q=0.193). Two intronic OAS1 polymorphisms, including the functional OAS1 SNP rs10774671 (p=0.003), demonstrated evidence of association with a significant allele-dose-related increase in neutralizing antibody levels in African-Americans. Genotype and haplotype-level associations demonstrated the role of ADAR genetic variants, including a non-synonymous SNP (rs2229857/Arg384Lys; p=0.01), in regulating measles virus-specific IFN-γ Elispot responses in Caucasians (haplotype global p-value=0.017). After correction FDR, 15 single-SNP associations (11 SNPs in Caucasians and 4 SNPs in African-Americans) still remained significant at the q-value<0.20. In conclusion, our findings strongly point to genetic variants/genes, involved in antiviral sensing and antiviral control, as critical determinants, differentially modulating the adaptive immune responses to live attenuated measles vaccine in Caucasians and African-Americans. PMID:21939710

  17. Association of interleukin-18 gene polymorphism and its protein expression with the lower extremity deep venous thrombosis in the chinese han population: A case-control study.

    PubMed

    Chen, Ye-Long; Shou, Li-Hong; Zhang, Zong-Xin

    2018-05-01

    We aim to explain the correlation among IL-18 gene polymorphism, its protein expression and LEDVT in the Chinese Han population. A total of 138 LEDVT patients and 150 healthy people volunteered as LEDVT and control groups. All the data, including the gender, age, BMI, levels of TG, LDL/HDL, TC, GLU, APTT, BUN, Cr, ALT, AST, ApoA1, ApoB, and Fg was detected. IL-18 level, IL-18 -137G/C and -607C/A polymorphism, and risk factors of LEDVT were detected using ELISA, PCR-RFLP and multivariate logistic regression analysis, respectively. Increased BMI, GLU, Fg, BUN, ApoB and IL-18 and decreased APTT were found in the LEDVT group. The GC + CC genotype and C allele in -137G/C polymorphism was elevated in the control group when compared to that in the LEDVT group. The IL-18 level was elevated in the case group when compared to the control group with respect to the same genotype in -607C/A and -137G/C polymorphisms, and in the LEDVT group, IL-18 level was higher in the GG genotype than that in the GC + CC genotype of -137G/C polymorphism. BUN, GG genotype and IL-18 level were independent risk factors, but APTT was a protective factor of LEDVT. On the basis of our results, we concluded that the GG genotype of -137G/C polymorphism and IL-18 level are independent risk factors of LEDVT, and IL-18 gene polymorphism affects the level of IL-18 in LEDVT patients. © 2017 Wiley Periodicals, Inc.

  18. Association of Polymorphisms in BDNF, MTHFR, and Genes Involved in the Dopaminergic Pathway with Memory in a Healthy Chinese Population

    ERIC Educational Resources Information Center

    Yeh, Ting-Kuang; Hu, Chung-Yi; Yeh, Ting-Chi; Lin, Pei-Jung; Wu, Chung-Hsin; Lee, Po-Lei; Chang, Chun-Yen

    2012-01-01

    The contribution of genetic factors to the memory is widely acknowledged. Research suggests that these factors include genes involved in the dopaminergic pathway, as well as the genes for brain-derived neurotrophic factor (BDNF) and methylenetetrahydrofolate reductase (MTHFR). The activity of the products of these genes is affected by single…

  19. Association between alcoholism and the genetic polymorphisms of the GABAA receptor genes on chromosome 5q33-34 in Korean population.

    PubMed

    Park, Chul-Soo; Park, So-Young; Lee, Chul-Soon; Sohn, Jin-Wook; Hahn, Gyu-Hee; Kim, Bong-Jo

    2006-06-01

    Family, twin, and adoption studies have demonstrated that genes play an important role in the development of alcoholism. We investigated the association between alcoholism and the genetic polymorphisms of the GABAA receptor genes on chromosome 5q33-34 in Korean population. The genotype of the GABAA receptor gene polymorphisms were determined by performing polymerase chain reaction genotyping for 172 normal controls and 162 male alcoholics who are hospitalized in alcoholism treatment institute. We found a significant association between the genetic polymorphisms of the GABAA alpha1 and GABAA alpha6 receptor gene and alcoholism. The GG genotype of the GABAA alpha1 receptor gene was associated with the onset age of alcoholism and alcohol withdrawal symptoms, and a high score on the Korean version of the ADS. However, there was no association between the genetic polymorphisms of the GABAA beta2 and gamma2 receptor gene and alcoholisms. Our finding suggest that genetic polymorphisms of the GABAA alpha1 and GABAA alpha6 receptor gene may be associated with the development of alcoholism and that the GG genotype of the GABAA alpha1 receptor gene play an important role in the development of the early onset and the severe type of alcoholism.

  20. A Gene-Oriented Haplotype Comparison Reveals Recently Selected Genomic Regions in Temperate and Tropical Maize Germplasm

    PubMed Central

    Zhang, Jie; Li, Yongxiang; Zheng, Jun; Zhang, Hongwei; Yang, Xiaohong; Wang, Jianhua; Wang, Guoying

    2017-01-01

    The extensive genetic variation present in maize (Zea mays) germplasm makes it possible to detect signatures of positive artificial selection that occurred during temperate and tropical maize improvement. Here we report an analysis of 532,815 polymorphisms from a maize association panel consisting of 368 diverse temperate and tropical inbred lines. We developed a gene-oriented approach adapting exonic polymorphisms to identify recently selected alleles by comparing haplotypes across the maize genome. This analysis revealed evidence of selection for more than 1100 genomic regions during recent improvement, and included regulatory genes and key genes with visible mutant phenotypes. We find that selected candidate target genes in temperate maize are enriched in biosynthetic processes, and further examination of these candidates highlights two cases, sucrose flux and oil storage, in which multiple genes in a common pathway can be cooperatively selected. Finally, based on available parallel gene expression data, we hypothesize that some genes were selected for regulatory variations, resulting in altered gene expression. PMID:28099470

  1. No association between catechol-O-methyltransferase polymorphisms and neurotic disorders among mainland Chinese university students.

    PubMed

    Kou, Changgui; Meng, Xiangfei; Xie, Bing; Shi, Jieping; Yu, Qiong; Yu, Yaqin; D'Arcy, Carl

    2012-07-30

    This study investigates the genetic association between catechol-O-methyltransferase (COMT) gene polymorphisms and neurotic disorders. Data were derived from a case-control association study of 255 undergraduates affected by neurotic disorders and 269 matched healthy undergraduate controls. The polymorphisms of eight tag single nucleotide polymorphisms (SNPs) on the COMT gene were tested using polymerase chain reaction (PCR)-based Ligase Detection Reaction (PCR-LDR). The eight tag SNPs on the COMT gene assessed were not associated with neurotic disorders. Our finding suggests that the COMT gene may not be a susceptibility gene for neurotic disorders. Copyright © 2012 Elsevier Ltd. All rights reserved.

  2. Polymorphisms in the methylene tetrahydrofolate reductase gene and their unique combinations are associated with an increased susceptibility to the renal cancers.

    PubMed

    Ajaz, Sadia; Khaliq, Shagufta; Hashmi, Altaf; Naqvi, Syed Ali Anwar; Rizvi, Syed Adib-ul-Hassan; Mehdi, Syed Qasim

    2012-05-01

    Two single nucleotide polymorphisms in the methylene tetrahydrofolate reductase (MTHFR) gene, 677C/T and 1298A/C, encode the thermolabile isoforms of the MTHFR enzyme that adversely affect the folic acid metabolic pathway. In the present study, these polymorphisms were investigated for their associations with the risk and prognosis of the renal cell carcinomas (RCCs) in Pakistani patients. The study included 168 RCC patients and 178 controls. The polymorphisms were analyzed by the polymerase chain reaction-restriction fragment length polymorphism method. Statistical analysis revealed that the C-allele and homozygous C genotype of the MTHFR 1298A/C polymorphism were significantly correlated with the risk of RCCs (odds ratio [OR]=1.60; 95% confidence interval [CI]=1.1-2.34 and OR=3.26; 95% CI=1.27-8.37, respectively). The combined genotype analysis showed that the 677CC+1298CC combination greatly increased the susceptibility to RCCs (OR=8.34; 95% CI=2.7-25.7). The 677CT+1298AA and 677CC+1298CA combinations were also associated with an increased risk of RCC (OR=3.21; 95% CI=1.3-7.8 and OR=2.45; 95% CI=1.3-4.6, respectively). The combined genotype effects were also evident in a semiparametric expectation-maximization-based haplotype analysis. The results presented here indicate that the two MTHFR gene polymorphisms are significantly associated with the risk of RCCs in a cohort of Pakistani patients and may be useful as susceptibility markers in other populations of the world as well.

  3. Relationship of obstructive sleep apnea syndrome with the 5-HT2A receptor gene in Brazilian patients.

    PubMed

    de Carvalho, Thiago Bittencourt Ottoni; Suman, Marcela; Molina, Fernando Drimel; Piatto, Vânia Belintani; Maniglia, José Victor

    2013-03-01

    Serotonin (5-HT) regulates a variety of visceral and physiological functions, including sleep. Polymorphisms in the 5-HT2A receptor gene can alter its transcription, affecting the number of receptors in the serotoninergic system, contributing to obstructive sleep apnea syndrome (OSAS). The aim of this study was to determine the prevalence of the 102T-C and -1438G-A polymorphisms in the 5-HTR2A gene in Brazilian patients with and without OSAS. A cross-sectional study performed at the Otorhinolaryngology and Sleep Disorder Out Clinics, São José do Rio Preto Medical School, FAMERP. One hundred patients were examined as index cases and 100 persons as controls, of both genders to both groups. DNA was extracted from peripheral blood leukocytes, and the sites that encompassed both polymorphisms were amplified by PCR-RFLP. There was a significant prevalence of the male gender in index cases compared with the control group gender (p < 0.0001). There was no significant genotypic difference in the 102T-C polymorphism between the case and control groups (p = 1.000). The AA genotype of the -1438G-A polymorphism was more prevalent in the patients with OSAS compared with the controls (OR, 2.3; CI 95% 1.20-4.38; p = 0.01). There was no difference in the prevalence of the 102T-C polymorphism between patients with OSAS and the control group. Serotoninergic system dysfunction appeared to be related to OSAS. The -1438G-A polymorphism and OSAS are related in this studied Brazilian population.

  4. Association of -604G/A and -501A/C Ghrelin and Obestatin Prepropeptide Gene Polymorphisms with Polycystic Ovary Syndrome.

    PubMed

    Ghaleh, Talaat Dabbaghi; Skandari, Somayeh Saadat; Najafipour, Reza; Rashvand, Zahra; Darabi, Masoud; Sahmani, Mehdi

    2018-04-01

    Ghrelin hormone has an important role in a wide range of metabolic and non-metabolic processes. Polymorphisms of ghrelin gene could be associated with a large number of diseases. The aim of this study was to evaluate the association of -604G/A and -501A/C polymorphisms in ghrelin and obestatin prepropeptide gene (GHRL) with polycystic ovary syndrome (PCOS) in a sample of Iranian women. One hundred and fifty-two women with PCOS and 162 age-matched apparently healthy women as control group were enrolled in this study. The study subjects were genotyped for polymorphisms in the ghrelin gene using polymerase chain reaction-restriction fragment length polymorphism-based methods. Biochemical parameters, serum prolactin, luteinizing hormone, follicle stimulating hormone, estradiol, and testosterone were estimated by chemiluminescence assay. Serum lipids and lipoproteins were determined by standard enzymatic methods. The association between the risk of PCOS and ghrelin gene polymorphisms was examined using Multivariate analysis. The frequency of the -604G/A and -501A/C polymorphisms was not statistically different between patients and the control group of women (p = 0.12 and p = 0.21, respectively). A significantly higher level of LDL-C was found in the wild-type AA genotype compared with CC genotype of -501A/C polymorphism (p = 0.02). Our findings indicate that neither -604G/A and nor -501A/C polymorphisms of ghrelin gene are associated with PCOS, but suggest a relation between the presence of polymorphic allele of -501A/C polymorphism and LDL-C level in a sample of Iranian women.

  5. Frequency distribution of polymorphisms of CYP2C19, CYP2C9, VKORC1 and SLCO1B1 genes in the Yakut population.

    PubMed

    Vasilyev, Filipp Filippovich; Danilova, Diana Aleksandrovna; Kaimonov, Vladimir Sergeevich; Chertovskih, Yana Valerievna; Maksimova, Nadezda Romanovna

    2016-01-01

    Allele frequencies of single nucleotide polymorphisms (SNPs) are variable among different populations; therefore the study of SNPs in ethnic groups is important for establishing the clinical significance of the screening of these polymorphisms. The main goal of the research is to study the polymorphisms of CYP2C9, CYP2C19, VKORC1, and SLCO1B1 in Yakuts. Genomic DNA from 229 Yakut subjects were analyzed by real-time polymerase chain reaction (PCR) (SLCO1B1 +521T > C, VKORC1 -1639G>A, CYP2C19 +681G>A, +636G>A, CYP2C9 +430С>T, +1075A>C). Genotype frequencies of polymorphisms in the population of the Yakuts were more characteristic of the Asian population. The results have been included in the software application "Lekgen" that we developed for the interpretation of pharmacogenetic testing. The data of our study obtained on frequency carriers of polymorphisms of genes SLCO1B1, CYP2C19, CYP2C9, VKORC1 among the Yakuts may be useful in developing recommendations for a personalized therapy.

  6. Frequency distribution of polymorphisms of CYP2C19, CYP2C9, VKORC1 and SLCO1B1 genes in the Yakut population

    PubMed Central

    Vasilyev, Filipp Filippovich; Danilova, Diana Aleksandrovna; Kaimonov, Vladimir Sergeevich; Chertovskih, Yana Valerievna; Maksimova, Nadezda Romanovna

    2016-01-01

    Allele frequencies of single nucleotide polymorphisms (SNPs) are variable among different populations; therefore the study of SNPs in ethnic groups is important for establishing the clinical significance of the screening of these polymorphisms. The main goal of the research is to study the polymorphisms of CYP2C9, CYP2C19, VKORC1, and SLCO1B1 in Yakuts. Genomic DNA from 229 Yakut subjects were analyzed by real-time polymerase chain reaction (PCR) (SLCO1B1 +521T > C, VKORC1 -1639G>A, CYP2C19 +681G>A, +636G>A, CYP2C9 +430С>T, +1075A>C). Genotype frequencies of polymorphisms in the population of the Yakuts were more characteristic of the Asian population. The results have been included in the software application “Lekgen” that we developed for the interpretation of pharmacogenetic testing. The data of our study obtained on frequency carriers of polymorphisms of genes SLCO1B1, CYP2C19, CYP2C9, VKORC1 among the Yakuts may be useful in developing recommendations for a personalized therapy. PMID:27499796

  7. A Delta-Sarcoglycan Gene Polymorphism as a Risk Factor for Hypertrophic Cardiomyopathy

    PubMed Central

    Garrido-Garduño, Martín H.; Pérez-Martínez, Ramón A.; Ruiz, Victor M.; Herrera-Tepatlán, Esteban; Rodríguez-Cruz, Maricela; Jiménez-Vaca, Ana L.; Minauro-Sanmiguel, Fernando; Salamanca-Gómez, Fabio A.

    2012-01-01

    Background: The C allele of c.−94C>G polymorphism of the delta-sarcoglycan gene was associated as a risk factor for coronary spasm in Japanese patients with hypertrophic cardiomyopathy (HCM). Aim: We evaluated whether the c.−94C>G polymorphism can be a risk factor for HCM in Mexican patients. Methods: The polymorphism was genotyped and the risk was estimated in 35 HCM patients and 145 healthy unrelated individuals. Data of this polymorphism reported in Mexican Amerindian populations were included. Results: The C allele frequency in HCM patients was higher with an odds ratio (OR) of 2.37, and the risk for the CC genotype increased to 5.0. The analysis with Mexican Amerindian populations showed that the C allele frequency was significantly higher in HCM patients with an OR of 2.96 and for CC genotype the risk increased to 7.60. Conclusions: The C allele of the c.−94C>G polymorphism is a risk factor for HCM, which is increased by the Amerindian component and can play an important role in the etiology and progression of disease in Mexican patients. PMID:22524166

  8. Prevalence of combinatorial CYP2C9 and VKORC1 genotypes in Puerto Ricans: implications for warfarin management in Hispanics.

    PubMed

    Duconge, Jorge; Cadilla, Carmen L; Windemuth, Andreas; Kocherla, Mohan; Gorowski, Krystyna; Seip, Richard L; Bogaard, Kali; Renta, Jessica Y; Piovanetti, Paola; D'Agostino, Darrin; Santiago-Borrero, Pedro J; Ruaño, Gualberto

    2009-01-01

    Polymorphisms in the cytochrome P450 2C9 (CYP2C9) and vitamin K epoxide reductase complex subunit 1 (VKORC1) genes significantly alter the effective warfarin dose. We determined the frequencies of alleles, single carriers, and double carriers of single nucleotide polymorphisms (SNPs) in the CYP2C9 and VKORC1 genes in a Puerto Rican cohort and gauged the impact of these polymorphisms on warfarin dosage using a published algorithm. A total of 92 DNA samples were genotyped using Luminex x-MAP technology. The polymorphism frequencies were 6.52%, 5.43% and 28.8% for CYP2C9 *2, *3 and VKORC1-1639 C>A polymorphisms, respectively. The prevalence of combinatorial genotypes was 16% for carriers of both the CYP2C9 and VKORC1 polymorphisms, 9% for carriers of CYP2C9 polymorphisms, 35% for carriers of the VKORC1 polymorphism, and the remaining 40% were non-carriers for either gene. Based on a published warfarin dosing algorithm, single, double and triple carriers of functionally deficient polymorphisms predict reductions of 1.0-1.6, 2.0-2.9, and 2.9-3.7 mg/day, respectively, in warfarin dose. Overall, 60% of the population carried at least a single polymorphism predicting deficient warfarin metabolism or responsiveness and 13% were double carriers with polymorphisms in both genes studied. Combinatorial genotyping of CYP2C9 and VKORC1 can allow for individualized dosing of warfarin among patients with gene polymorphisms, potentially reducing the risk of stroke or bleeding.

  9. Single nucleotide polymorphisms in bone turnover-related genes in Koreans: ethnic differences in linkage disequilibrium and haplotype

    PubMed Central

    Kim, Kyung-Seon; Kim, Ghi-Su; Hwang, Joo-Yeon; Lee, Hye-Ja; Park, Mi-Hyun; Kim, Kwang-joong; Jung, Jongsun; Cha, Hyo-Soung; Shin, Hyoung Doo; Kang, Jong-Ho; Park, Eui Kyun; Kim, Tae-Ho; Hong, Jung-Min; Koh, Jung-Min; Oh, Bermseok; Kimm, Kuchan; Kim, Shin-Yoon; Lee, Jong-Young

    2007-01-01

    Background Osteoporosis is defined as the loss of bone mineral density that leads to bone fragility with aging. Population-based case-control studies have identified polymorphisms in many candidate genes that have been associated with bone mass maintenance or osteoporotic fracture. To investigate single nucleotide polymorphisms (SNPs) that are associated with osteoporosis, we examined the genetic variation among Koreans by analyzing 81 genes according to their function in bone formation and resorption during bone remodeling. Methods We resequenced all the exons, splice junctions and promoter regions of candidate osteoporosis genes using 24 unrelated Korean individuals. Using the common SNPs from our study and the HapMap database, a statistical analysis of deviation in heterozygosity depicted. Results We identified 942 variants, including 888 SNPs, 43 insertion/deletion polymorphisms, and 11 microsatellite markers. Of the SNPs, 557 (63%) had been previously identified and 331 (37%) were newly discovered in the Korean population. When compared SNPs in the Korean population with those in HapMap database, 1% (or less) of SNPs in the Japanese and Chinese subpopulations and 20% of those in Caucasian and African subpopulations were significantly differentiated from the Hardy-Weinberg expectations. In addition, an analysis of the genetic diversity showed that there were no significant differences among Korean, Han Chinese and Japanese populations, but African and Caucasian populations were significantly differentiated in selected genes. Nevertheless, in the detailed analysis of genetic properties, the LD and Haplotype block patterns among the five sub-populations were substantially different from one another. Conclusion Through the resequencing of 81 osteoporosis candidate genes, 118 unknown SNPs with a minor allele frequency (MAF) > 0.05 were discovered in the Korean population. In addition, using the common SNPs between our study and HapMap, an analysis of genetic diversity and deviation in heterozygosity was performed and the polymorphisms of the above genes among the five populations were substantially differentiated from one another. Further studies of osteoporosis could utilize the polymorphisms identified in our data since they may have important implications for the selection of highly informative SNPs for future association studies. PMID:18036257

  10. Interleukin-10 gene polymorphisms and hepatocellular carcinoma susceptibility: A meta-analysis

    PubMed Central

    Wei, Yong-Gang; Liu, Fei; Li, Bo; Chen, Xi; Ma, Yu; Yan, Lv-Nan; Wen, Tian-Fu; Xu, Ming-Qing; Wang, Wen-Tao; Yang, Jia-Yin

    2011-01-01

    AIM: To assess the association between Interleukin-10 (IL-10) gene IL-10-1082 (G/A), IL-10-592(C/A), IL-10-819 (T/C) polymorphisms and hepatocellular carcinoma (HCC) susceptibility. METHODS: Two investigators independently searched the Medline, Embase, China National Knowledge Infrastructure, and Chinese Biomedicine Database. Summary odds ratios (ORs) and 95% confidence intervals (95% CIs) for IL-10 polymorphisms and HCC were calculated in a fixed-effects model (the Mantel-Haenszel method) and a random-effects model (the DerSimonian and Laird method) when appropriate. RESULTS: This meta-analysis included seven eligible studies, which included 1012 HCC cases and 2308 controls. Overall, IL-10-1082 G/A polymorphism was not associated with the risk of HCC (AA vs AG + GG, OR = 1.11, 95% CI = 0.90-1.37). When stratifying for ethnicity, the results were similar (Asian, OR = 1.12, 95% CI = 0.87-1.44; non-Asian, OR = 1.10, 95% CI = 0.75-1.60). In the overall analysis, the IL-10 polymorphism at position -592 (C/A) was identified as a genetic risk factor for HCC among Asians; patients carrying the IL-10-592*C allele had an increased risk of HCC (OR = 1.29, 95% CI = 1.12-1.49). No association was observed between the IL-10-819 T/C polymorphism and HCC susceptibility (TT vs TC + CC, OR = 1.02, 95% CI = 0.79-1.32). CONCLUSION: This meta-analysis suggests that IL-10-592 A/C polymorphism may be associated with HCC among Asians. IL-10-1082 G/A and IL-10-819 T/C polymorphisms were not detected to be related to the risk for HCC. PMID:22025883

  11. Contribution of deletion in angiotensin-converting enzyme but not A1166C angiotensin II type-1 receptor gene polymorphisms to clinical outcomes in atherothrombotic disease.

    PubMed

    Le Hello, Claire; Fradin, Sabine; Morello, Rémy; Coffin, Olivier; Maïza, Dominique; Hamon, Martial

    2011-04-01

    Angiotensin-converting enzyme insertion/deletion (rs4340) and angiotensin II type 1 receptor A1166C (rs5186) gene polymorphisms may be involved in coronary heart disease (CHD). This study was designed to evaluate potential relationships between these polymorphisms and the risk of long-term all-cause mortality and major adverse cardiovascular events (MACE) in patients requiring revascularization for atherothrombotic disease (ATD) lesions. This prospective observational study concerned patients referred for supra-aortic vessel disease (SVD), CHD, peripheral artery occlusive disease (PAOD) or visceral artery disease (VAD). Collected data included ATD referral site, ATD symptoms, personal and familial medical histories, ATD extent, vascular risk factors, biological values, medication use and rs4340 and rs5186 polymorphisms. The primary end point was all-cause mortality. The secondary end point, MACE, included cardiovascular death, clinical ischemic event related to SVD, CHD, PAOD or VAD. The cohort comprised 956 patients of whom 872 (91.2%) were genotyped and followed for 21.1 ± 9.9 months. Patients were referred for SVD (25.9%), CHD (42.3%), PAOD (35.2%) or VAD (1.6%). All-cause mortality and MACE rates were 7.6 and 27.2%, respectively. When comparing I/D + D/D vs. I/I genotypes, rs4340 polymorphism was associated with higher all-cause mortality rates according to uni- and multivariate analyses (p=0.008 and 0.011, respectively). Other differences were not significant (rs4340 polymorphism and MACE, rs5186 polymorphism and all-cause mortality and MACE). No interaction was found between the polymorphisms. Other independent predictors of all-cause mortality included PAOD history, SVD history, body mass index <25 kg/m(2), HbA(1c) ≥6.5%, absence of dyslipidemia and no use of aspirin. rs4340 polymorphism is associated with long-term all-cause mortality in advanced ATD patients requiring revascularization, whereas rs5186 polymorphism does not. Copyright © 2011 IMSS. Published by Elsevier Inc. All rights reserved.

  12. P2Y12 Polymorphisms and the Risk of Adverse Clinical Events in Patients Treated with Clopidogrel: A Meta-Analysis.

    PubMed

    Zhao, Kun; Yang, Ming; Lu, Yanxia; Sun, Shusen; Li, Wei; Li, Xingang; Zhao, Zhigang

    2018-05-23

    Some studies have reported an association between P2Y12 gene polymorphisms and clopidogrel adverse outcomes with inconsistent results. We aimed to explore the relationship between P2Y12 polymorphisms and the risk of adverse clinical events in patients treated with clopidogrel through a meta-analysis. A systematic search of PubMed, Web of Science and the Cochrane Library was conducted. Retrieved articles were comprehensively reviewed and eligible studies were included, and the relevant data was extracted for this meta-analysis. All statistical tests were performed by the Review Manager 5.3 software. A total of 14 studies involving 8,698 patients were included. In the Han Chinese population, ischemic events were associated with P2Y12 T744C polymorphism in the CC vs TT+CT genetic model (OR=3.32, 95%CI=1.62-6.82, P =0.001), and the events were associated with P2Y12 C34T polymorphism in the TT+TC vs CC genetic model (OR=1.70, 95%CI=1.22-2.36, P =0.002). However, ischemic events were not related to P2Y12 G52T polymorphism (TT+TG vs GG: OR=1.13, 95%CI=0.76-1.68, P =0.56; TT vs GG+TG: OR=2.02, 95%CI=0.65-6.28, P =0.22). The associations between the P2Y12 polymorphism and ischemic events were not significant in T744C, G52T and C34T genotype for another subgroup of the Caucasian population ( P >0.05). Only two studies referring to bleeding events were included in this analysis of C34T polymorphism, and no significant association was found (TT+TC vs CC: OR=1.07, 95%CI=0.37-3.15, P =0.90). In the Caucasian population, P2Y12 gene polymorphisms are not associated with clinical events. However, in the Chinese Han population, P2Y12 T744C and C34T polymorphisms are significantly associated with adverse clinical events. © Georg Thieme Verlag KG Stuttgart · New York.

  13. Association study of interleukin-4 polymorphisms with paranoid schizophrenia in the Polish population: a critical approach.

    PubMed

    Fila-Danilow, Anna; Kucia, Krzysztof; Kowalczyk, Malgorzata; Owczarek, Aleksander; Paul-Samojedny, Monika; Borkowska, Paulina; Suchanek, Renata; Kowalski, Jan

    2012-08-01

    Changes in immunological system are one of dysfunctions reported in schizophrenia. Some changes based on an imbalance between Th1 and Th2 cytokines results from cytokine gene polymorphisms. Interleukin-4 gene (IL4) is considered as a potential candidate gene in schizophrenia association studies. The aim of the current case-control study was to examine whether the -590C/T (rs2243250) and -33C/T (rs2070874) IL4 gene polymorphisms are implicated in paranoid schizophrenia development in the Polish population. Genotyping of polymorphisms was performed by using PCR-RFLP technique. The genotypes and alleles distribution of both SNPs were analysed in patients (n = 182) and healthy individuals constituted the control group (n = 215). The connection between some clinical variables and studied polymorphisms has been examined as well. We did not revealed any association between the -590C/T and -33C/T polymorphisms and paranoid schizophrenia. In case of both SNPs the homozygous TT genotype was extremely rare. Both polymorphic sites of the IL4 gene were found to be in a very strong linkage disequilibrium. However we did not identify a haplotype predispose to paranoid schizophrenia. No associations were also observed between the clinical course and psychopathology of the disease and the genotypes of both analysed polymorphisms. Our results suggest that the polymorphisms -590C/T in IL4 gene promoter region and -33C/T in the 5'-UTR are not involved in the pathophysiology of paranoid schizophrenia in Polish residents.

  14. Interleukin-1 gene polymorphisms in chronic gastritis patients infected with Helicobacter pylori as risk factors of gastric cancer development.

    PubMed

    Hnatyszyn, Andrzej; Wielgus, Karolina; Kaczmarek-Rys, Marta; Skrzypczak-Zielinska, Marzena; Szalata, Marlena; Mikolajczyk-Stecyna, Joanna; Stanczyk, Jerzy; Dziuba, Ireneusz; Mikstacki, Adam; Slomski, Ryszard

    2013-12-01

    Epidemiological investigations indicated association of the Helicobacter pylori infections with the occurrence of inflammatory conditions of the gastric mucosa and development of chronic gastritis and intestinal type of gastric cancer. IL1A and IL1B genes have been proposed as key factors in determining risk of gastritis and malignant transformation. The aim of this paper was to evaluate association of interleukin-1 gene polymorphisms with chronic gastritis, atrophy, intestinal metaplasia, dysplasia and intestinal type of gastric cancer in H. pylori-infected patients. Patients subjected to analysis represent group of 144 consecutive cases that suffered from dyspepsia with coexisting infection of H. pylori and chronic gastritis, chronic atrophic gastritis, intestinal metaplasia, dysplasia or gastric cancer. Molecular studies involved analysis of -889C>T polymorphism of IL1A gene and +3954C>T polymorphism of IL1B gene. Statistical analysis of association of polymorphism -889C>T of gene IL1A with changes in gastric mucosa showed lack of significance, whereas +3954C>T polymorphism of IL1B gene showed significant association. Frequency of allele T of +3954C>T polymorphism of IL1B gene was higher in group of patients with chronic gastritis, atrophy, intestinal metaplasia, dysplasia or intestinal type of gastric cancer (32.1 %) as compared with population group (23 %), χ(2) = 4.61 and p = 0.03. This corresponds to odds ratio: 1.58, 95 % CI: 1.04-2.4. Our results indicate that +3954C>T polymorphism of IL1B gene increase susceptibility to inflammatory response of gastric mucosa H. pylori-infected patients and plays a significant role in the development of chronic gastritis, atrophy, intestinal metaplasia, dysplasia and the initiation of carcinogenesis.

  15. Association between the BRCA2 rs144848 polymorphism and cancer susceptibility: a meta-analysis.

    PubMed

    Li, Qiuyan; Guan, Rongwei; Qiao, Yuandong; Liu, Chang; He, Ning; Zhang, Xuelong; Jia, Xueyuan; Sun, Haiming; Yu, Jingcui; Xu, Lidan

    2017-06-13

    The BRCA2 gene plays an important role in cancer carcinogenesis, and polymorphisms in this gene have been associated with cancer risk. The BRCA2 rs144848 polymorphism has been associated with several cancers, but results have been inconsistent. In the present study, a meta-analysis was performed to assess the association between the rs144848 polymorphism and cancer risk. Literature was searched from the databases of PubMed, Embase and Google Scholar before April 2016. The fixed or random effects model was used to calculate pooled odd ratios on the basis of heterogeneity. Meta-regression, sensitivity analysis, subgroup analysis and publication bias assessment were also performed using STATA 11.0 software according to Preferred Reporting Items for Systematic Reviews and Meta-Analyses 2009. A total of 40 relevant studies from 30 publications including 34,911 cases and 48,329 controls were included in the final meta-analysis. Among them, 22 studies focused on breast cancer, seven on ovarian cancer, five on non-Hodgkin lymphoma, and the remaining six studies examined various other cancers. The meta-analysis results showed that there were significant associations between the rs144848 polymorphism and cancer risk in all genetic models. Stratified by cancer type, the rs144848 polymorphism was associated with non-Hodgkin lymphoma. Stratified by study design, the allele model was associated with breast cancer risk in population-based studies. The meta-analysis suggests that the BRCA2 rs144848 polymorphism may play a role in cancer risk. Further well-designed studies are warranted to confirm these results.

  16. ABCB1 genetic polymorphism and risk of upper aerodigestive tract cancers among smokers, tobacco chewers and alcoholics in an Indian population.

    PubMed

    Sam, Soya Sisy; Thomas, Vinod; Sivagnanam, Kumaran; Reddy, Kanipakapatanam Sathyanarayana; Surianarayanan, Gopalakrishnan; Chandrasekaran, Adithan

    2007-10-01

    Upper aerodigestive tract (UADT) cancers are associated with the tobacco use and alcohol consumption. Certain toxins and carcinogens causing UADT cancers are found to be substrates of polymorphic ABCB1 gene encoded P-glycoprotein efflux pump. This study investigates the association between ABCB1 gene polymorphism at exon 26 (3435C>T) and risk to UADT cancers in Tamilians, a population of south India. The study included 219 unrelated histopathologically confirmed cases and 210 population-based controls. Genomic DNA was extracted from peripheral leukocytes and genotyped for ABCB1 3435C>T polymorphism by PCR-restriction fragment length polymorphism method. The multivariate logistic regression analyses demonstrated that the homozygous ABCB1 TT genotype was significantly associated with an overall increased risk for developing UADT cancers [odds ratio (OR): 2.53; 95% confidence interval (CI): 1.28-5.02]. Further, the determination of gene-environment interaction by stratified analyses have revealed a significant interaction between the smoking and homozygous TT genotype [(OR: 7.52; CI: 1.50-37.70) and (OR: 16.89; CI: 3.87-73.79) for 11-20 and >20 pack-years, respectively]. The strongest interaction was observed among the regular tobacco chewers (OR: 45.29; CI: 8.94-130.56) homozygous for TT genotype. No suggestion, however, of an interaction between the genotypes and the alcohol consumption on the multiplicative scale was made. The ABCB1 gene polymorphism at exon 26 (3435C>T) may be one of the risk factors for susceptibility to UADT cancers. Furthermore, the significant interaction among habitual smokers and tobacco chewers, homozygous for TT genotype modulates the risk to UADT cancers in the Tamilian population of south India.

  17. Functional polymorphisms in cell death pathway genes FAS and FASL contribute to risk of lung cancer.

    PubMed

    Zhang, X; Miao, X; Sun, T; Tan, W; Qu, S; Xiong, P; Zhou, Y; Lin, D

    2005-06-01

    The FAS and FASL system plays a key role in regulating apoptotic cell death and corruption of this signalling pathway has been shown to participate in immune escape and tumorigenesis. There is reduced expression of FAS but elevated expression of FASL in many types of human cancers including lung cancer. We recently reported an association between functional polymorphisms in FAS (-1377G-->A) and FASL (-844T-->C) and risk of oesophageal cancer. To examine the contribution of these polymorphisms to risk of developing lung cancer. Genotypes of 1000 lung cancer patients and 1270 controls were analysed by PCR based restriction fragment length polymorphism. Associations with risk of lung cancer were estimated by logistic regression. Compared with non-carriers, there was a 1.6 fold excess risk of developing lung cancer for carriers of the FAS -1377AA genotype (odds ratio (OR) 1.59, 95% confidence interval (CI) 1.21 to 2.10; p = 0.001), and 1.8 fold excess risk (OR 1.79, 95% CI 1.26 to 2.52; p = 0.001) for carriers of FASL -844CC. Gene-gene interaction of FAS and FASL polymorphisms increased risk of lung cancer in a multiplicative manner (OR for the carriers of both FAS -1377AA and FASL -844CC genotypes 4.18, 95% CI 2.83 to 6.18). Gene-environment interaction of FAS or FASL polymorphism and smoking associated with increased risk of lung cancer was also found. These results are consistent with our initial findings in oesophageal cancer and further support the hypothesis that the FAS and FASL triggered apoptosis pathway plays an important role in human carcinogenesis.

  18. [Meta-analysis on relationship between single nucleotide polymorphism of rs2231142 in ABCG2 gene and gout in East Asian population].

    PubMed

    Wu, Lei; He, Yao; Zhang, Di

    2015-11-01

    To systematically evaluate the association between single nucleotide polymorphism of rs2231142 genetic susceptibility and gout in East Asian population. The literature retrieval was conducted by using English databases (Medline, EMbase), Chinese databases (CNKI, Vip, Wanfang, SinaMed) and others to collect the published papers on the association between single nucleotide polymorphism of rs2231142 genetic susceptibility and gout by the end of December 2014. Meta-analysis was performed with software Stata 12.0. Nine studies were included. There were significant associations between increased risk of gout and single nucleotide polymorphism of rs2231142, the combined OR was 2.04 (95%CI: 1.82-2.28) for A allele and C allele, 1.97 (95%CI: 1.57-2.48) for CA and CC, 3.71 (95%CI: 3.07-4.47) for AA and CC. Sex and region specific subgroup analysis showed less heterogeneity. There is significant association between gout and single nucleotide polymorphism of rs2231142 in East Asian population, and A allele is a high risk gene for gout.

  19. CNTNAP2 Is Significantly Associated With Speech Sound Disorder in the Chinese Han Population.

    PubMed

    Zhao, Yun-Jing; Wang, Yue-Ping; Yang, Wen-Zhu; Sun, Hong-Wei; Ma, Hong-Wei; Zhao, Ya-Ru

    2015-11-01

    Speech sound disorder is the most common communication disorder. Some investigations support the possibility that the CNTNAP2 gene might be involved in the pathogenesis of speech-related diseases. To investigate single-nucleotide polymorphisms in the CNTNAP2 gene, 300 unrelated speech sound disorder patients and 200 normal controls were included in the study. Five single-nucleotide polymorphisms were amplified and directly sequenced. Significant differences were found in the genotype (P = .0003) and allele (P = .0056) frequencies of rs2538976 between patients and controls. The excess frequency of the A allele in the patient group remained significant after Bonferroni correction (P = .0280). A significant haplotype association with rs2710102T/+rs17236239A/+2538976A/+2710117A (P = 4.10e-006) was identified. A neighboring single-nucleotide polymorphism, rs10608123, was found in complete linkage disequilibrium with rs2538976, and the genotypes exactly corresponded to each other. The authors propose that these CNTNAP2 variants increase the susceptibility to speech sound disorder. The single-nucleotide polymorphisms rs10608123 and rs2538976 may merge into one single-nucleotide polymorphism. © The Author(s) 2015.

  20. The role of the methylenetetrahydrofolate reductase 677 and 1298 polymorphisms in Cretan children with acute lymphoblastic leukemia.

    PubMed

    Karathanasis, Nikolaos V; Stiakaki, Eftichia; Goulielmos, George N; Kalmanti, Maria

    2011-01-01

    Acute lymphoblastic leukemia (ALL) is the most common form of malignancy in children. Recently, many studies have examined factors influencing both the susceptibility to ALL and the metabolism of widely used chemotherapeutic agents. These factors include, among others, single-nucleotide polymorphisms in various genes, such as the gene encoding for methylenetetrahydrofolate reductase (MTHFR), which has been proven polymorphic at the nucleotide positions 677 and 1298. Thirty-five children with ALL and 48 healthy adults of Cretan origin were genotyped for the presence of the MTHFR 677 and 1298 single-nucleotide polymorphisms. The possible correlation of the polymorphisms with the risk for ALL and the presence of methotrexate-induced toxicities were examined. No significant association between the MTHFR genotypes and the susceptibility to ALL was observed. A borderline statistically significant relationship was detected after methotrexate administration, between the C677T genotype (polymorphisms) and leukopenia (p = 0.050) and between the A1298C polymorphism and normal aspartate transaminase and alanine transaminase values (p = 0.065 and p = 0.053, respectively), which was strengthened for aspartate transaminase, after grouping the A1298A and A1298C genotypes together (p = 0.039). In our population the MTHFR C677T and A1298C polymorphisms are related with hematologic toxicity and hepatotoxicity, respectively, and could be suggested as prognostic factors for these adverse events.

  1. The effects of polymorphisms in IL-2, IFN-γ, TGF-β2, IgL, TLR-4, MD-2, and iNOS genes on resistance to Salmonella enteritidis in indigenous chickens.

    PubMed

    Tohidi, Reza; Idris, Ismail Bin; Panandam, Jothi Malar; Bejo, Mohd Hair

    2012-12-01

    Salmonella Enteritidis is a major cause of food poisoning worldwide, and poultry products are the main source of S. Enteritidis contamination for humans. Among the numerous strategies for disease control, improving genetic resistance to S. Enteritidis has been the most effective approach. We investigated the association between S. Enteritidis burden in the caecum, spleen, and liver of young indigenous chickens and seven candidate genes, selected on the basis of their critical roles in immunological functions. The genes included those encoding interleukin 2 (IL-2), interferon-γ (IFN-γ), transforming growth factor β2 (TGF-β2), immunoglobulin light chain (IgL), toll-like receptor 4 (TLR-4), myeloid differentiation protein 2 (MD-2), and inducible nitric oxide synthase (iNOS). Two Malaysian indigenous chicken breeds were used as sustainable genetic sources of alleles that are resistant to salmonellosis. The polymerase chain reaction restriction fragment-length polymorphism technique was used to genotype the candidate genes. Three different genotypes were observed in all of the candidate genes, except for MD-2. All of the candidate genes showed the Hardy-Weinberg equilibrium for the two populations. The IL-2-MnlI polymorphism was associated with S. Enteritidis burden in the caecum and spleen. The TGF-β2-RsaI, TLR-4-Sau 96I, and iNOS-AluI polymorphisms were associated with the caecum S. Enteritidis load. The other candidate genes were not associated with S. Enteritidis load in any organ. The results indicate that the IL-2, TGF-β2, TLR-4, and iNOS genes are potential candidates for use in selection programmes for increasing genetic resistance against S. Enteritidis in Malaysian indigenous chickens.

  2. Meta-Prediction of MTHFR Gene Polymorphism Mutations and Associated Risk for Colorectal Cancer

    PubMed Central

    Yu, C. H.

    2016-01-01

    The methylenetetrahydrofolate reductase (MTHFR) gene is one of the most investigated of the genes associated with chronic human diseases because of its associations with hyperhomocysteinemia and toxicity. It has been proposed as a prototype gene for the prevention of colorectal cancer (CRC). The major objectives of this meta-analysis were to examine the polymorphism-mutation patterns of MTHFR and their associations with risk for CRC as well as potential contributing factors for mutations and disease risks. This analysis included 33,626 CRC cases and 48,688 controls across 92 studies for MTHFR 677 and 16,367 cases and 24,874 controls across 54 studies for MTHFR 1298, comprising data for various racial and ethnic groups, both genders, and multiple cancer sites. MTHFR 677 homozygous TT genotype was protective (p < .05) for CRC for all included populations; however, with heterogeneity across various racial–ethnic groups and opposing findings, it was a risk genotype for the subgroup of Hispanics (p < .01). Additional countries for which subgroup analyses resulted in 677 TT as a risk genotype included Turkey, Romania, Croatia, Hungary, Portugal, Mexico, Brazil, U.S. Hawai’i, Taiwan, India, and Egypt. Countries with the highest mutation rates and risks for both MTHFR 677 and 1298 genotypes are presented using global maps to visualize the grouping patterns. Meta-predictive analyses revealed that air pollution levels were associated with gene polymorphisms for both genotypes. Future nursing research should be conducted to develop proactive measures to protect populations in cities where air pollution causes more deaths. PMID:26858257

  3. Polymorphisms of the lipoprotein lipase gene as genetic markers for stroke in colombian population: a case control study.

    PubMed

    Velásquez Pereira, Leydi Carolina; Vargas Castellanos, Clara Inés; Silva Sieger, Federico Arturo

    2016-12-30

    To analyze if there is an association between the presence of polymorphisms in the LPL gene (rs320, rs285 and rs328) with development of acute ischemic stroke in Colombian population. In a case control design, 133 acute ischemic stroke patients (clinical diagnosis and x-ray CT) and 269 subjects without stroke as controls were studied. PCR -RFLP technique was used to detect rs320, rs285 and rs328 polymorphisms in the LPL gene. In the present research was not found any association between any of the LPL gene polymorphism and acute ischemic stroke in the population studied; the allele and genotypic frequencies of the studied polymorphisms were similar in cases and controls and followed the Hardy-Weinberg equilibrium. The study was approved by the IRB and each subject signed the informed consent. LPL gene polymorphisms are not genetic markers for the development of stroke in the Colombian sample used.

  4. Single nucleotide polymorphisms/haplotypes associated with multiple rubella-specific immune response outcomes post-MMR immunization in healthy children.

    PubMed

    Ovsyannikova, Inna G; Salk, Hannah M; Larrabee, Beth R; Pankratz, V Shane; Poland, Gregory A

    2015-10-01

    The observed heterogeneity in rubella-specific immune response phenotypes post-MMR vaccination is thought to be explained, in part, by inter-individual genetic variation. In this study, single nucleotide polymorphisms (SNPs) and multiple haplotypes in several candidate genes were analyzed for associations with more than one rubella-specific immune response outcome, including secreted IFN-γ, secreted IL-6, and neutralizing antibody titers. Overall, we identified 23 SNPs in 10 different genes that were significantly associated with at least two rubella-specific immune responses. Of these SNPs, we detected eight in the PVRL3 gene, five in the PVRL1 gene, one in the TRIM22 gene, two in the IL10RB gene, two in the TLR4 gene, and five in other genes (PVR, ADAR, ZFP57, MX1, and BTN2A1/BTN3A3). The PVRL3 gene haplotype GACGGGGGCAGCAAAAAGAAGAGGAAAGAACAA was significantly associated with both higher IFN-γ secretion (t-statistic 4.43, p < 0.0001) and higher neutralizing antibody titers (t-statistic 3.14, p = 0.002). Our results suggest that there is evidence of multigenic associations among identified gene SNPs and that polymorphisms in these candidate genes contribute to the overall observed differences between individuals in response to live rubella virus vaccine. These results will aid our understanding of mechanisms behind rubella-specific immune response to MMR vaccine and influence the development of vaccines in the future.

  5. [High frequency of ancestral allele of the TJP1 polymorphism rs2291166 in Mexican population, conformational effect and applications in surgery and medicine].

    PubMed

    Ramirez-Garcia, Sergio Alberto; Flores-Alvarado, Luis Javier; Topete-González, Luz Rosalba; Charles-Niño, Claudia; Mazariegos-Rubi, Manuel; Dávalos-Rodríguez, Nory Omayra

    2016-01-01

    TJP1 gene encodes a ZO-1 protein that is required for the recruitment of occludins and claudins in tight junction, and is involved in cell polarisation. It has different variations, the frequency of which has been studied in different populations. In Mexico there are no studies of this gene. These are required because their polymorphisms can be used in studies associated with medicine and surgery. Therefore, the aim of this study was to estimate the frequency of alleles and genotypes of rs2291166 gene polymorphism TJP1 in Mexico Mestizos population, and to estimate the conformational effect of an amino acid change. A total of 473 individuals were included. The rs2291166 polymorphism was identified PASA PCR-7% PAGE, and stained with silver nitrate. The conformational effect of amino acid change was performed in silico, and was carried out with servers ProtPraram Tool and Search Database with Fasta. The most frequent allele in the two populations is the ancestral allele (T). A genotype distribution similar to other populations was found. The polymorphism is in Hardy-Weinberg, p>0.05. Changing aspartate to alanine produced a conformational change. The study reveals a high frequency of the ancestral allele at rs2291166 polymorphism in the Mexican population. Copyright © 2015 Academia Mexicana de Cirugía A.C. Published by Masson Doyma México S.A. All rights reserved.

  6. Polymorphism of the prion protein gene (PRNP) in two Chinese indigenous cattle breeds.

    PubMed

    Qin, L H; Zhao, Y M; Bao, Y H; Bai, W L; Chong, J; Zhang, G L; Zhang, J B; Zhao, Z H

    2011-08-01

    Prion protein (PRNP) gene has been located at position q17 of chromosome 13 in cattle. The polymorphisms of PRNP gene might be associated with BSE susceptibility. In the present work, we investigated the polymorphisms of PRNP gene, including SNP in exon 3, 23-bp indel in promoter region, 12-bp indel in intron 1 in 2 Chinese indigenous cattle breeds of northeast China. Eighty-six animals from Yanbian (34) and Chinese Red Steppes (52) were genotyped at PRNP locus by analyzing genomic DNA. A total of 4 single nucleotide polymorphism (SNP) sites were revealed in the PRNP gene exon 3 of the 2 cattle breeds investigated. Three of these SNPs were non-synonymous mutations that resulted in the amino acid exchanges (K119N, S154N, and M177V), and one is silent nucleotide substitutions (A234G). The two amino acid mutations of S154N and M177V were detected only in Yanbian with a very low frequency (0.0147), and they appears to be absent in Chinese Red Steppes. The average gene heterozygosity (He), effective allele numbers (Ne), Shannon's information index (I) and polymorphism information content (PIC) were 0.3088, 1.5013, 0.3814 and 0.2000 in Yanbian, respectively, being relatively higher than that of Chinese Red Steppes (0.2885, 1.4985, 0.3462 and 0.1873, respectively). In 23-bp indel and 12-bp indel loci, three different genotypes were identified in both Yanbian and Chinese Red Steppes breeds. Based 23- and 12-bp indels, four haplotypes was constructed in the 2 Chinese cattle breeds, of which the 23-bp (-)/12-bp (-) was main haplotypes accounting for more than 50% of the total in both Yanbian and Chinese Red Steppes breeds. These results might be useful in understanding the genetic characteristics of PRNP gene in Chinese indigenous cattle breeds.

  7. ACE I/D Gene Polymorphism Can't Predict the Steroid Responsiveness in Asian Children with Idiopathic Nephrotic Syndrome: A Meta-Analysis

    PubMed Central

    Su, Li-Na; Lei, Feng-Ying; Huang, Wei-Fang; Zhao, Yan-Jun

    2011-01-01

    Background The results from the published studies on the association between angiotensin-converting enzyme (ACE) insertion/deletion (I/D) gene polymorphism and the treatment response to steroid in Asian children with idiopathic nephrotic syndrome (INS) is still conflicting. This meta-analysis was performed to evaluate the relation between ACE I/D gene polymorphism and treatment response to steroid in Asian children and to explore whether ACE D allele or DD genotype could become a predictive marker for steroid responsiveness. Methodology/Principal Findings Association studies were identified from the databases of PubMed, Embase, Cochrane Library and CBM-disc (China Biological Medicine Database) as of September 1, 2010, and eligible investigations were synthesized using meta-analysis method. Five investigations were identified for the analysis of association between ACE I/D gene polymorphism and steroid-resistant nephrotic syndrome (SRNS) risk in Asian children and seven studies were included to explore the relationship between ACE I/D gene polymorphism and steroid-sensitive nephrotic syndrome (SSNS) susceptibility. Five investigations were recruited to explore the difference of ACE I/D gene distribution between SRNS and SSNS. There was no a markedly association between D allele or DD genotype and SRNS susceptibility or SSNS risk, and the gene distribution differences of ACE between SRNS and SSNS were not statistically significant. II genotype might play a positive role against SRNS onset but not for SSNS (OR = 0.51, P = 0.02; OR = 0.95, P = 0.85; respectively), however, the result for the association of II genotype with SRNS risk was not stable. Conclusions/Significance Our results indicate that D allele or DD homozygous can't become a significant genetic molecular marker to predict the treatment response to steroid in Asian children with INS. PMID:21611163

  8. Influence of haplotypes, gene expression and soluble levels of L-selectin on the risk of acute coronary syndrome.

    PubMed

    Sandoval-Pinto, Elena; Padilla-Gutiérrez, Jorge Ramón; Hernández-Bello, Jorge; Martínez-Fernández, Diana Emilia; Valdés-Alvarado, Emmanuel; Muñoz-Valle, José Francisco; Flores-Salinas, H E; Valle, Yeminia

    2017-08-20

    L-selectin gene (SELL) is a candidate gene for the development of acute coronary syndrome (ACS) that contributes to endothelial dysfunction. The -642C>T (rs2205849) and 725C>T (rs2229569) polymorphisms have been associated with changes in gene expression, ligand affinity and increased risk of cardiovascular disease. The aim of this study was to investigate the association between the haplotypes constructed with the -642C>T and 725C>T polymorphisms of the SELL gene, the expression levels of its mRNA and the serum levels of soluble L-selectin with ACS. We recruited 615 individuals of Mexican origin matched by age, including 342 patients with ACS and 273 individuals without personal history of ischemic cardiopathy as control group (CG). Genotyping was performed by PCR-RFLP. The qPCR technique was used to analyze the expression of mRNA using TaqMan® UPL probes. The levels of soluble L-selectin were measured with ELISA. The allele variants in both polymorphisms were over-represented in the CG compared to the ACS (OR range: 0.371-0.716, p<0.006). The CT and TT haplotypes had a protective effect against the development of ACS (OR=0.401, p<0.0001; OR=0.628, p<0.0001, respectively). SELL expression was 3.076 times higher in the ACS group compared to CG (p<0.001). The levels of soluble L-selectin were similar between ACS and CG. Both polymorphisms had no effect on mRNA expression and soluble protein levels. The polymorphisms -642C>T and 725C>T of the SELL gene are protective factors against the development of ACS. There is an increased gene expression of L-selectin in ACS compared to CG in the population of Western Mexico. Copyright © 2017 Elsevier B.V. All rights reserved.

  9. [Association of single nucleotide polymorphism of methylenetetrahydrofolate reductase gene with susceptibility to acute leukemia].

    PubMed

    Zheng, Miao-miao; Yue, Li-jie; Zhang, Hong-hong; Yang, Chun-lan; Xie, Cai

    2013-08-01

    To assess whether polymorphisms of methylenetetrahydrofolate reductase (MTHFR) gene is associated with susceptibility to acute lymphoblastic leukemia (ALL) or acute myeloid leukemia (AML) in Chinese Han children. The study has included 87 patients with ALL, 22 patients with AML and 120 healthy controls. All subjects were analyzed with reverse transcriptase-polymerase chain reaction-denaturing gradient gel electrophoresis and sequencing. A 677CT genotype of the MTHFR gene was associated with decreased risk of ALL (OR=0.23, 95%CI: 0.07-0.79). However, MTHFR A1298C genotypes were not associated with the risk of either disease. 677TT/1298AA and 677CC/1298AC genotypes were associated with increased risk of ALL(OR=3.78, 95% CI: 1.38-10.40; OR=3.17, 95% CI: 1.18-8.53, respectively), whereas the genotype 677CT/1298AA was associated with susceptibility to AML (OR=0.23, 95% CI: 0.06-0.97). Our data suggested that C677T polymorphism of MTHFR gene may increase the risk of childhood AML.

  10. Metabolism and gene polymorphisms of the folate pathway in Brazilian women with history of recurrent abortion.

    PubMed

    Boas, Wendell Vilas; Gonçalves, Rozana Oliveira; Costa, Olívia Lúcia Nunes; Goncalves, Marilda Souza

    2015-02-01

    To investigate the association between polymorphisms in genes that encode enzymes involved in folate- and vitamin B12-dependent homocysteine metabolism and recurrent spontaneous abortion (RSA). We investigated the C677T and A1298C polymorphisms of the methylenetetrahydrofalate reductase gene (MTHFR), the A2756G polymorphism of the methionine synthase gene (MS) and the 844ins68 insertion of the cystathionine beta synthetase gene (CBS). The PCR technique followed by RFLP was used to assess the polymorphisms; the serum levels of homocysteine, vitamin B12 and folate were investigated by chemiluminescence. The EPI Info Software version 6.04 was used for statistical analysis. Parametric variables were compared by Student's t-test and nonparametric variables by the Wilcoxon rank sum test. The frequencies of gene polymorphisms in 89 women with a history of idiopathic recurrent miscarriage and 150 controls were 19.1 and 19.6% for the C677T, insertion, 20.8 and 26% for the A1298C insertion, 14.2 and 21.9% for the A2756G insertion, and 16.4 and 18% for the 844ins68 insertion, respectively. There were no significant differences between case and control groups in any of the gene polymorphisms investigated. However, the frequency of the 844ins68 insertion in the CBS gene was higher among women with a history of loss during the third trimester of pregnancy (p=0.003). Serum homocysteine, vitamin B12 and folate levels id not differ between the polymorphisms studied in the case and control groups. However, linear regression analysis showed a dependence of serum folate levels on the maintenance of tHcy levels. The investigated gene polymorphisms and serum homocysteine, vitamin B12 and folate levels were not associated with idiopathic recurrent miscarriage in the present study. Further investigations are needed in order to confirm the role of the CBS 844ins68 insertion in recurrent miscarriage.

  11. Lack of association between deletion polymorphism of BIM gene and in vitro drug sensitivity in B-cell precursor acute lymphoblastic leukemia.

    PubMed

    Huang, Meixian; Miyake, Kunio; Kagami, Keiko; Abe, Masako; Shinohara, Tamao; Watanabe, Atsushi; Somazu, Shinpei; Oshiro, Hiroko; Goi, Kumiko; Goto, Hiroaki; Minegishi, Masayoshi; Iwamoto, Shotaro; Kiyokawa, Nobutaka; Sugita, Kanji; Inukai, Takeshi

    2017-09-01

    A deletion polymorphism in the BIM gene was identified as an intrinsic mechanism for resistance to tyrosine kinase inhibitor in chronic myeloid leukemia patients in East Asia. BIM is also involved in the responses to glucocorticoid and chemotherapy in acute lymphoblastic leukemia (ALL), suggesting a possible association between deletion polymorphism of BIM and the chemosensitivity of ALL. Thus, we analyzed 72 B-cell precursor (BCP)-ALL cell lines established from Japanese patients. Indeed, higher BIM gene expression was associated with good in vitro sensitivities to glucocorticoid and chemotherapeutic agents used in induction therapy. We also analyzed the methylation status of the BIM gene promoter by next generation sequencing of genome bisulfite PCR products, since genetic polymorphism could be insignificant when epigenetically inactivated. Hypermethylation of the BIM gene promoter was associated with lower BIM gene expression and poorer sensitivity to vincristine. Of note, however, the prevalence of a deletion polymorphism was not associated with the BIM gene expression level or drug sensitivities in BCP-ALL cell lines, in which the BIM gene was unmethylated. These observations suggest that an association of a deletion polymorphism of BIM and the response to induction therapy in BCP-ALL may be clinically minimal. Copyright © 2017. Published by Elsevier Ltd.

  12. Association Between ACE Gene Polymorphism and QT Dispersion in Patients with Acute Myocardial Infarction.

    PubMed

    Karahan, Zulkuf; Ugurlu, Murat; Ucaman, Berzal; Veysel Ulug, Ali; Kaya, Ilyas; Cevik, Kemal; Sahin Adiyaman, Mehmet; Oztürk, Onder; Iyem, Hikmet; Ozdemir, Ferit

    2016-01-01

    Angiotensin converting enzyme (ACE) gene polymorphism is associated with high renin-angiotensin system causing myocardial fibrosis and ventricular repolarization abnormality. Based on these findings, this study was designed to determine the association between ACE gene insertion/deletion (I/D) polymorphism and QT dispersion after acute myocardial infarction (MI). The study included 108 patients with acute MI. Blood samples were obtained from all the patients for genomic DNA analysis. ECGs were recorded at baseline and at the end of a 6-month follow up. The OT dispersion was manually calculated. The mean age of the patients was 57.5 ±9.9 years (ranging from 36 to 70). The patients with DD genotype showed longer QT dispersion than patients with II or DI genotype at the baseline, while at the end of the six-month follow up the patients with DI genotype showed longer QT dispersion than patients with DD or II genotypes. However, the magnitude of the QT dispersion prolongation was higher in patients carrying the ACE D allele than patients who were not carrying it, at baseline and at the end of six-month follow up (52.5 ±2.6 msn vs. 47.5±2.1 msn at baseline, 57±3.2 msn vs. 53±2.6 msn in months, P: 0.428 and P: 0.613, respectively). Carriers of the D allele of ACE gene I/D polymorphism may be associated with QT dispersion prolongation in patients with MI.An interaction of QT dispersion and ACE gene polymorphism may be associated with an elevation of serum type I-C terminal pro-collagen concentration, possibly leading to myocardial fibrosis, and increased action potential duration.

  13. Association of Angiotensin-Converting Enzyme (ACE) Gene Polymorphism with Inflammation and Cellular Cytotoxicity in Vitiligo Patients.

    PubMed

    Rashed, Laila; Abdel Hay, Rania; Mahmoud, Rania; Hasan, Nermeen; Zahra, Amr; Fayez, Salwa

    2015-01-01

    Vitiligo is a disorder with profound heterogeneity in its aetio-pathophysiology. Angiotensin converting enzyme (ACE) plays an important role in the physiology of the vasculature, blood pressure and inflammation. An insertion/deletion (I/D) polymorphism of the ACE gene was reported be associated with the development of vitiligo. Our aim was to evaluate the ACE I/D polymorphism in vitiligo patients and controls. Our second aim was to find a possible association between ACE gene polymorphism and inflammatory mediators (as interleukin (IL)-6) and/or cellular cytotoxicity induced by serum nitrite (as a breakdown product of the cytotoxic nitric oxide) in vitiligo patients. This case-control study included 74 vitiligo patients and 75 apparently healthy controls. The distribution of ACE gene I/D genotype was investigated using PCR. Serum ACE, IL-6 and nitrite were measured by colorimetric method, ELISA and Griess assay respectively. The ACE allele frequency was significantly different between vitiligo patients and healthy controls (P = 0.026). However there was no significant difference between the ACE genotyping frequency in both groups (P = 0.115). There were statistically significant higher VIDA score (P = 0.007), and serum IL-6 (P < 0.001) in patients with the DD genotype when compared to other genotypes. Serum nitrite in patients with the DD genotype was significantly higher (P = 0.007) when compared to patients with II genotype. Serum levels of ACE, IL-6 and nitrite in vitiligo patients were statistically significantly higher than those in controls. As a conclusion, ACE gene polymorphism might grant susceptibility to develop vitiligo. Serum IL-6 and nitrite levels might have an important role in the pathogenesis of vitiligo. Targeting these two factors might have an implication in the treatment of some resistant cases.

  14. RSCA genotyping of MHC for high-throughput evolutionary studies in the model organism three-spined stickleback Gasterosteus aculeatus

    PubMed Central

    Lenz, Tobias L; Eizaguirre, Christophe; Becker, Sven; Reusch, Thorsten BH

    2009-01-01

    Background In all jawed vertebrates, highly polymorphic genes of the major histocompatibility complex (MHC) encode antigen presenting molecules that play a key role in the adaptive immune response. Their polymorphism is composed of multiple copies of recently duplicated genes, each possessing many alleles within populations, as well as high nucleotide divergence between alleles of the same species. Experimental evidence is accumulating that MHC polymorphism is a result of balancing selection by parasites and pathogens. In order to describe MHC diversity and analyse the underlying mechanisms that maintain it, a reliable genotyping technique is required that is suitable for such highly variable genes. Results We present a genotyping protocol that uses Reference Strand-mediated Conformation Analysis (RSCA), optimised for recently duplicated MHC class IIB genes that are typical for many fish and bird species, including the three-spined stickleback, Gasterosteus aculeatus. In addition we use a comprehensive plasmid library of MHC class IIB alleles to determine the nucleotide sequence of alleles represented by RSCA allele peaks. Verification of the RSCA typing by cloning and sequencing demonstrates high congruency between both methods and provides new insight into the polymorphism of classical stickleback MHC genes. Analysis of the plasmid library additionally reveals the high resolution and reproducibility of the RSCA technique. Conclusion This new RSCA genotyping protocol offers a fast, but sensitive and reliable way to determine the MHC allele repertoire of three-spined sticklebacks. It therefore provides a valuable tool to employ this highly polymorphic and adaptive marker in future high-throughput studies of host-parasite co-evolution and ecological speciation in this emerging model organism. PMID:19291291

  15. Inherited Variation in Cytokine, Acute Phase Response, and Calcium Metabolism Genes Affects Susceptibility to Infective Endocarditis

    PubMed Central

    Rutkovskaya, Natalia V.; Kondyukova, Natalia V.; Odarenko, Yuri N.; Kazachek, Yana V.; Tsepokina, Anna V.; Barbarash, Leonid S.

    2017-01-01

    Infective endocarditis (IE) is a septic inflammation of the endocardium. Recognition of microbial patterns, cytokine and acute phase responses, hemostasis features, and alterations in plasma lipid and calcium profile all have been reported to affect pathogenesis and clinical course of IE. Having recruited 123 patients with IE and 300 age-, sex-, and ethnicity-matched healthy blood donors, we profiled their genomic DNA for 35 functionally significant polymorphisms within the 22 selected genes involved in the abovementioned pathways, with the further genetic association analysis. We found that the G/A genotype of the rs1143634 polymorphism within the IL1B gene, the G/T genotype of the rs3212227 polymorphism within the IL12B gene, the A/G genotype of the rs1130864 polymorphism within the CRP gene, and the G allele of the rs1801197 polymorphism within the CALCR gene were associated with a decreased risk of IE whereas the T/T genotype of the rs1205 polymorphism within the CRP gene was associated with a higher risk of IE. Furthermore, heterozygous genotypes of the rs1143634 and rs3212227 polymorphisms were associated with the higher plasma levels of IL-1β and IL-12, respectively. Our results indicate that inherited variation in the cytokine, acute phase response, and calcium metabolism pathways may be linked to IE. PMID:28659664

  16. Association of polymorphisms in nicotinic acetylcholine receptor alpha 4 subunit gene (CHRNA4), mu-opioid receptor gene (OPRM1), and ethanol-metabolizing enzyme genes with alcoholism in Korean patients.

    PubMed

    Kim, Soon Ae; Kim, Jong-Woo; Song, Ji-Young; Park, Sunny; Lee, Hee Jae; Chung, Joo-Ho

    2004-01-01

    Findings obtained from several studies indicate that ethanol enhances the activity of alpha4beta2 neuronal nicotinic acetylcholine receptor and support the possibility that a polymorphism of the nicotinic acetylcholine receptor alpha4 subunit gene (CHRNA4) modulates enhancement of nicotinic receptor function by ethanol. To identify the association between the CfoI polymorphism of the CHRNA4 and alcoholism, we examined distribution of genotypes and allele frequencies in Korean patients diagnosed with alcoholism (n = 127) and Korean control subjects without alcoholism (n = 185) with polymerase chain reaction-restriction fragment length polymorphism methods. We were able to detect the association between the CfoI polymorphism of the CHRNA4 and alcoholism in Korean patients (genotype P = .023; allele frequency P = .047). The genotypes and allele frequencies of known polymorphisms in other alcoholism candidate genes, such as alcohol metabolism-related genes [alcohol dehydrogenase 2 (ADH2), aldehyde dehydrogenase 2 (ALDH2), alcohol dehydrogenase 3 (ADH3), and cytochrome P450 2E1 (CYP2E1)] and mu-opioid receptor gene (OPRM1), were studied. The polymorphisms of ADH2, ALDH2, and CYP2E1 were significantly different in Korean patients with alcoholism and Korean control subjects without alcoholism, but ADH3 and OPRM1 did not differ between the two groups.

  17. Plasma urotensin-2 level and Thr21Met but not Ser89Asn polymorphisms of the urotensin-2 gene are associated with migraines.

    PubMed

    Geyik, Sırma; Ergun, Sercan; Kuzudişli, Samiye; Şensoy, Figen; Temiz, Ebru; Altunışık, Erman; Korkmaz, Murat; Dağlı, Hasan; Kul, Seval; Akçalı, Aylin; Neyal, Ayşe Münife

    2016-01-01

    Urotensin-II (U-II) is a peptide recognized by its potent vasoconstrictor activity in many vascular events, however the role of urotensin-II in migraine has not been considered yet. The molecular mechanisms and genetics of migraine have not been fully clarified yet, but it is well-known that vascular changes considerably contribute in pathophysiology of migraine and also its complications. The aim of this study was to analyze the plasma U-II levels along with genotype distributions and allele frequencies for UTS2 Thr21Met and Ser89Asn polymorphisms among the patients with migraine without aura (MWoA). One hundred eighty-six patients with MWoA and 171 healthy individuals were included in this study. Plasma U-II levels were measured in attack free period. The genotype and allele frequencies for the Thr21Met (T21M) and Ser89Asn (S89N) polymorphisms in the UTS2 gene were analyzed. Plasma U-II levels were significantly higher in MWoA patients (p = 0.002). We detected a significant association between the T21M polymorphism in the UTS2 gene and migraine (53.8 % in patients, 40.4 % in controls, p = 0.035), but not with S89N polymorphism (p = 0.620). A significant relationship was found between U-II levels and MIDAS score (β = 0.508, p = 0.001). Our study suggests that U-II may play a role in migraine pathogenesis; also Thr21Met polymorphism was associated with the risk of migraine disease. Further studies are needed for considering the role of U-II in migraine pathophysiology and for deciding if UTS2 gene may be a novel candidate gene in migraine cases.

  18. Association between glutathione S-transferase P1 Ile (105) Val gene polymorphism and chronic obstructive pulmonary disease: A meta-analysis based on seventeen case-control studies.

    PubMed

    Yang, Lingjing; Li, Xixia; Tong, Xiang; Fan, Hong

    2015-12-01

    Previous studies have shown that glutathione S-transferase P1 (GSTP1) was associated with chronic obstructive pulmonary disease (COPD). However, the association between GSTP1 Ile (105) Val gene polymorphism and COPD remains controversial. To drive a more precise estimation, we performed a meta-analysis based on published case-control studies. An electronic search of PubMed, EMBASE, Cochrane library, Web of Science and China Knowledge Resource Integrated (CNKI) Database for papers on GSTP1 Ile (105) Val gene polymorphism and COPD risk was performed. The pooled odds ratios (ORs) with 95% confidence intervals (CIs) were used to assess the strength of association in the homozygote model, heterozygote model, dominant model, recessive model and an additive mode. Statistical heterogeneity, test of publication bias and sensitivity analysis was performed. The software STATA (Version 13.0) was used data analysis. Overall, seventeen studies with 1892 cases and 2012 controls were included in this meta-analysis. The GSTP1 Ile (105) Val polymorphism showed pooled odds ratios for the homozygote comparison (OR = 1.501, 95%CI [0.862, 2.614]), heterozygote comparison (OR = 0.924, 95%CI [0.733, 1.165]), dominant model (OR = 1.003, 95%CI [0.756, 1.331]), recessive model (OR = 1.510, 95%CI [0.934, 2.439]), and an additive model (OR = 1.072, 95%CI [0.822, 1.398]). In conclusion, the current meta-analysis, based on the most updated information, showed no significant association between GSTP1 Ile (105) Val gene polymorphism and COPD risk in any genetic models. The results of subgroup analysis also showed no significant association between GSTP1 Ile (105) Val gene polymorphism and COPD risk in Asian population and Caucasian population. Further studies involving large populations and careful control with age, sex, ethnicity, and cigarette smoking are greatly needed.

  19. Association between glutathione S-transferase P1 Ile (105) Val gene polymorphism and chronic obstructive pulmonary disease: A meta-analysis based on seventeen case–control studies

    PubMed Central

    Yang, Lingjing; Li, Xixia; Tong, Xiang; Fan, Hong

    2015-01-01

    Introduction Previous studies have shown that glutathione S-transferase P1 (GSTP1) was associated with chronic obstructive pulmonary disease (COPD). However, the association between GSTP1 Ile (105) Val gene polymorphism and COPD remains controversial. To drive a more precise estimation, we performed a meta-analysis based on published case–control studies. Methods An electronic search of PubMed, EMBASE, Cochrane library, Web of Science and China Knowledge Resource Integrated (CNKI) Database for papers on GSTP1 Ile (105) Val gene polymorphism and COPD risk was performed. The pooled odds ratios (ORs) with 95% confidence intervals (CIs) were used to assess the strength of association in the homozygote model, heterozygote model, dominant model, recessive model and an additive mode. Statistical heterogeneity, test of publication bias and sensitivity analysis was performed. The software STATA (Version 13.0) was used data analysis. Results Overall, seventeen studies with 1892 cases and 2012 controls were included in this meta-analysis. The GSTP1 Ile (105) Val polymorphism showed pooled odds ratios for the homozygote comparison (OR = 1.501, 95%CI [0.862, 2.614]), heterozygote comparison (OR = 0.924, 95%CI [0.733, 1.165]), dominant model (OR = 1.003, 95%CI [0.756, 1.331]), recessive model (OR = 1.510, 95%CI [0.934, 2.439]), and an additive model (OR = 1.072, 95%CI [0.822, 1.398]). Conclusions In conclusion, the current meta-analysis, based on the most updated information, showed no significant association between GSTP1 Ile (105) Val gene polymorphism and COPD risk in any genetic models. The results of subgroup analysis also showed no significant association between GSTP1 Ile (105) Val gene polymorphism and COPD risk in Asian population and Caucasian population. Further studies involving large populations and careful control with age, sex, ethnicity, and cigarette smoking are greatly needed. PMID:26504746

  20. Genetic Variation in Iron Metabolism Is Associated with Neuropathic Pain and Pain Severity in HIV-Infected Patients on Antiretroviral Therapy

    PubMed Central

    Kallianpur, Asha R.; Jia, Peilin; Ellis, Ronald J.; Zhao, Zhongming; Bloss, Cinnamon; Wen, Wanqing; Marra, Christina M.; Hulgan, Todd; Simpson, David M.; Morgello, Susan; McArthur, Justin C.; Clifford, David B.; Collier, Ann C.; Gelman, Benjamin B.; McCutchan, J. Allen; Franklin, Donald; Samuels, David C.; Rosario, Debralee; Holzinger, Emily; Murdock, Deborah G.; Letendre, Scott; Grant, Igor

    2014-01-01

    HIV sensory neuropathy and distal neuropathic pain (DNP) are common, disabling complications associated with combination antiretroviral therapy (cART). We previously associated iron-regulatory genetic polymorphisms with a reduced risk of HIV sensory neuropathy during more neurotoxic types of cART. We here evaluated the impact of polymorphisms in 19 iron-regulatory genes on DNP in 560 HIV-infected subjects from a prospective, observational study, who underwent neurological examinations to ascertain peripheral neuropathy and structured interviews to ascertain DNP. Genotype-DNP associations were explored by logistic regression and permutation-based analytical methods. Among 559 evaluable subjects, 331 (59%) developed HIV-SN, and 168 (30%) reported DNP. Fifteen polymorphisms in 8 genes (p<0.05) and 5 variants in 4 genes (p<0.01) were nominally associated with DNP: polymorphisms in TF, TFRC, BMP6, ACO1, SLC11A2, and FXN conferred reduced risk (adjusted odds ratios [ORs] ranging from 0.2 to 0.7, all p<0.05); other variants in TF, CP, ACO1, BMP6, and B2M conferred increased risk (ORs ranging from 1.3 to 3.1, all p<0.05). Risks associated with some variants were statistically significant either in black or white subgroups but were consistent in direction. ACO1 rs2026739 remained significantly associated with DNP in whites (permutation p<0.0001) after correction for multiple tests. Several of the same iron-regulatory-gene polymorphisms, including ACO1 rs2026739, were also associated with severity of DNP (all p<0.05). Common polymorphisms in iron-management genes are associated with DNP and with DNP severity in HIV-infected persons receiving cART. Consistent risk estimates across population subgroups and persistence of the ACO1 rs2026739 association after adjustment for multiple testing suggest that genetic variation in iron-regulation and transport modulates susceptibility to DNP. PMID:25144566

  1. Modification of the association between early adversity and obsessive-compulsive disorder by polymorphisms in the MAOA, MAOB and COMT genes.

    PubMed

    McGregor, N W; Hemmings, S M J; Erdman, L; Calmarza-Font, I; Stein, D J; Lochner, C

    2016-12-30

    The monoamine oxidases (MAOA/B) and catechol-O-methyltransferase (COMT) enzymes break down regulatory components within serotonin and dopamine pathways, and polymorphisms within these genes are candidates for OCD susceptibility. Childhood trauma has been linked OCD psychopathology, but little attention has been paid to the interactions between genes and environment in OCD aetiology. This pilot study investigated gene-by-environment interactions between childhood trauma and polymorphisms in the MAOA, MAOB and COMT genes in OCD. Ten polymorphisms (MAOA: 3 variants, MAOB: 4 variants, COMT: 3 variants) were genotyped in a cohort of OCD patients and controls. Early-life trauma was assessed using the Childhood Trauma Questionnaire (CTQ). Gene-by-gene (GxG) and gene-by-environment interactions (GxE) of the variants and childhood trauma were assessed using logistic regression models. Significant GxG interactions were found between rs362204 (COMT) and two independent polymorphisms in the MAOB gene (rs1799836 and rs6651806). Haplotype associations for OCD susceptibility were found for MAOB. Investigation of GxE interactions indicated that the sexual abuse sub-category was significantly associated with all three genes in haplotype x environment interaction analyses. Preliminary findings indicate that polymorphisms within the MAOB and COMT genes interact resulting in risk for OCD. Childhood trauma interacts with haplotypes in COMT, MAOA and MAOB, increasing risk for OCD. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

  2. Association of ghrelin receptor gene polymorphism with bulimia nervosa in a Japanese population.

    PubMed

    Miyasaka, K; Hosoya, H; Sekime, A; Ohta, M; Amono, H; Matsushita, S; Suzuki, K; Higuchi, S; Funakoshi, A

    2006-09-01

    Eating disorders (EDs) have a highly heterogeneous etiology and multiple genetic factors might contribute to their pathogenesis. Ghrelin, a novel growth hormone-releasing peptide, enhances appetite and increases food intake, and human ghrelin plasma levels are inversely correlated with body mass index. In the present study, we examined the 171T/C polymorphism of the ghrelin receptor (growth hormone secretagogue receptor, GHSR) gene in patients diagnosed with EDs, because the subjects having ghrelin gene polymorphism (Leu72Met) was not detected in a Japanese population, previously. In addition, beta3 adrenergic receptor gene polymorphism (Try64Arg) and cholecystokinin (CCK)-A receptor (R) gene polymorphism (-81A/G, -128G/T), which are both associated with obesity, were investigated. The subjects consisted of 228 Japanese patients with EDs [96 anorexia nervosa (AN), 116 bulimia nervosa (BN) and 16 not otherwise specified (NOS)]. The age- and gender-matched control group consisted of 284 unrelated Japanese subjects. The frequency of the CC type of the GHSR gene was significantly higher in BN subjects than in control subjects (chi(2) = 4.47, p = 0.035, odds ratio = 2.05, Bonferroni correction: p = 0.070), while the frequency in AN subjects was not different from that in controls. The distribution of neither beta3 adrenergic receptor gene nor CCK-AR polymorphism differed between EDs and control subjects. Therefore, the CC type of GHSR gene polymorphism (171T/C) is a risk factor for BN, but not for AN.

  3. Genetic association of cyclooxygenase-2 gene polymorphisms with Parkinson's disease susceptibility in Chinese Han population.

    PubMed

    Dai, Yi; Wu, Yuquan; Li, Yansheng

    2015-01-01

    The aim of this study was to explore the genetic association of cyclooxygenase-2 (COX2) gene promoter region polymorphisms with Parkinson's disease (PD) susceptibility in Chinese Han population. The genotyping of COX2 gene polymorphisms was conducted by polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) in 122 patients with PD and 120 healthy persons. The association strength of gene polymorphism with disease was measured by odds ratio (OR) and 95% confidence interval (95% CI) calculated using χ(2) test which also evaluated the Hardy-Weinberg equilibrium (HWE) of gene polymorphism in controls. The linkage disequilibrium and haplotype were also analyzed as evidence in the analysis of association. On condition that the genotypes distributions of COX2 -1290A>G, -1195G>A, -765G>C in the control group all conformed to HWE, however, only the homozygous genotype AA of -1195G>A polymorphism showed an association with PD (OR=0.432, 95% CI=0.196-0.950). In addition, in haplotype analysis, G-A-C haplotype frequency in cases was significantly lower than the controls, compared with the common haplotype A-G-G (P=0.031, OR=0.375, 95% CI=0.149-0.940). COX2 -1195G>A polymorphism might play a protective role in the onset of PD and G-A-C haplotype in this three promoter region polymorphisms also showed a negative association.

  4. CLC-2 single nucleotide polymorphisms (SNPs) as potential modifiers of cystic fibrosis disease severity

    PubMed Central

    Blaisdell, Carol J; Howard, Timothy D; Stern, Augustus; Bamford, Penelope; Bleecker, Eugene R; Stine, O Colin

    2004-01-01

    Background Cystic fibrosis (CF) lung disease manifest by impaired chloride secretion leads to eventual respiratory failure. Candidate genes that may modify CF lung disease severity include alternative chloride channels. The objectives of this study are to identify single nucleotide polymorphisms (SNPs) in the airway epithelial chloride channel, CLC-2, and correlate these polymorphisms with CF lung disease. Methods The CLC-2 promoter, intron 1 and exon 20 were examined for SNPs in adult CF dF508/dF508 homozygotes with mild and severe lung disease (forced expiratory volume at one second (FEV1) > 70% and < 40%). Results PCR amplification of genomic CLC-2 and sequence analysis revealed 1 polymorphism in the hClC -2 promoter, 4 in intron 1, and none in exon 20. Fisher's analysis within this data set, did not demonstrate a significant relationship between the severity of lung disease and SNPs in the CLC-2 gene. Conclusions CLC-2 is not a key modifier gene of CF lung phenotype. Further studies evaluating other phenotypes associated with CF may be useful in the future to assess the ability of CLC-2 to modify CF disease severity. PMID:15507145

  5. Association study of estrogen receptor alpha gene polymorphisms with spontaneous abortion: is this a possible reason for unexplained spontaneous abortion?

    PubMed

    Anousha, Negin; Hossein-Nezhad, Arash; Biramijamal, Firouzeh; Rahmani, Ali; Maghbooli, Zhila; Aghababaei, Elahe; Nemati, Shahram

    2013-01-01

    Estrogen plays a crucial role in fetal and placental development through estrogen receptors. Association of estrogen receptor alpha gene (ESR1) polymorphisms with spontaneous abortion has been shown in some studies. Our main goal was to study the potential association of spontaneous abortion with the ESR1 gene variations (PvuII and XbaI) in fetal tissue. Totally, 161 samples were recruited including 80 samples of formalin-fixed paraffin-embedded fetal tissue from spontaneous abortion and 81 samples of normal term placental tissue. The restriction fragment length polymorphism (RFLP) method was performed for genotyping the rs2234693 (A/G XbaI) and rs9340799 (T/C PvuII) single nucleotide polymorphisms located in intron 1 of ESR1. The results have been confirmed by DNA sequencing analysis. The different genotypes distribution was detected in two study groups. Haplotype analysis indicated that ppxx is protective genotype against spontaneous abortion (P = 0.01). In conclusion, the potential role of ESR1 genetic variation in spontaneous abortion might be valuable in high-risk subjects, and that needs to be confirmed with future studies.

  6. Association Study of Estrogen Receptor Alpha Gene Polymorphisms with Spontaneous Abortion: Is This a Possible Reason for Unexplained Spontaneous Abortion?

    PubMed Central

    Anousha, Negin; Hossein-Nezhad, Arash; Biramijamal, Firouzeh; Rahmani, Ali; Maghbooli, Zhila; Aghababaei, Elahe; Nemati, Shahram

    2013-01-01

    Estrogen plays a crucial role in fetal and placental development through estrogen receptors. Association of estrogen receptor alpha gene (ESR1) polymorphisms with spontaneous abortion has been shown in some studies. Our main goal was to study the potential association of spontaneous abortion with the ESR1 gene variations (PvuII and XbaI) in fetal tissue. Totally, 161 samples were recruited including 80 samples of formalin-fixed paraffin-embedded fetal tissue from spontaneous abortion and 81 samples of normal term placental tissue. The restriction fragment length polymorphism (RFLP) method was performed for genotyping the rs2234693 (A/G XbaI) and rs9340799 (T/C PvuII) single nucleotide polymorphisms located in intron 1 of ESR1. The results have been confirmed by DNA sequencing analysis. The different genotypes distribution was detected in two study groups. Haplotype analysis indicated that ppxx is protective genotype against spontaneous abortion (P = 0.01). In conclusion, the potential role of ESR1 genetic variation in spontaneous abortion might be valuable in high-risk subjects, and that needs to be confirmed with future studies. PMID:24228243

  7. Impacts of ICAM-1 gene polymorphisms on urothelial cell carcinoma susceptibility and clinicopathologic characteristics in Taiwan.

    PubMed

    Wang, Shian-Shiang; Hsieh, Ming-Ju; Ou, Yen-Chuan; Chen, Chuan-Shu; Li, Jian-Ri; Hsiao, Pei-Ching; Yang, Shun-Fa

    2014-08-01

    Intercellular adhesion molecule (ICAM)-1, a cell adhesion molecule, is reportedly overexpressed in several cancers and may contribute to tumorgenesis and metastasis. The current study explored the effect of ICAM-1 gene polymorphisms on the susceptibility of developing urothelial cell carcinoma (UCC) and the clinicopathological status. A total of 558 participants, including 279 healthy people and 279 patients with UCC, were recruited for this study. Four single-nucleotide polymorphisms of the ICAM-1 gene were assessed by a real-time polymerase chain reaction with the TaqMan assay. After adjusting for other covariants, the individuals carrying at least one G allele at ICAM-1 rs5498 had a 1.603-fold risk of developing UCC than did wild-type (AA) carriers. Furthermore, UCC patients who carried at least one G allele at rs5498 had a higher invasive stage risk (p < 0.05) than did patients carrying the wild-type allele. In conclusion, the rs5498 polymorphic genotypes of ICAM-1 might contribute to the prediction of susceptibility to and pathological development of UCC. This is the first study to provide insight into risk factors associated with ICAM-1 variants in carcinogenesis of UCC in Taiwan.

  8. Olanzapine-induced weight gain is associated with the -759C/T and -697G/C polymorphisms of the HTR2C gene.

    PubMed

    Godlewska, B R; Olajossy-Hilkesberger, L; Ciwoniuk, M; Olajossy, M; Marmurowska-Michałowska, H; Limon, J; Landowski, J

    2009-08-01

    Weight gain, a serious problem associated with some antipsychotic drugs, notably olanzapine and clozapine, was suggested to be associated with -759C/T polymorphism of the 5-HT2C receptor gene. This study aimed to examine a potential association of two functional polymorphisms of the promoter region of this gene: -759C/T (rs3813929) and -697G/C (rs518147), with weight gain after 6 weeks of olanzapine monotherapy. It included 107 patients with schizophrenia; among them 36 are first-episode drug-naive patients. Analysis was carried out by PCR-restriction fragment length polymorphism. A protective effect of -759T and -697C alleles was found: significantly less patients with -697C (3/51) and no patient with -759T (0/28) alleles experienced body mass index increase >or=10% (P=0.0006 and 0.002, respectively). The same was true for drug-naive patients possessing any of the variant alleles. There was a significant association of haplotypes with a >or=10% body mass index increase (P=0.001). On the basis of the additional statistical analysis, the more important role of -697C allele was suggested.

  9. Analysis of promoter polymorphism in monoamine oxidase A (MAOA) gene in completed suicide on Slovenian population.

    PubMed

    Uršič, Katarina; Zupanc, Tomaž; Paska, Alja Videtič

    2018-04-23

    Suicide is a well-defined public health problem and is a complex phenomenon influenced by a number of different risk factors, including genetic ones. Numerous studies have examined serotonin system genes. Monoamine oxidase A (MAO-A) is an outer mitochondrial membrane enzyme which is involved in the metabolic pathway of serotonin degradation. Upstream variable number of tandem repeats (uVNTR) in the promoter region of MAOA gene affects the activity of transcription. In the present study we genotyped MAOA-uVNTR polymorphism in 266 suicide victims and 191 control subjects of Slovenian population, which ranks among the European and world populations with the highest suicide rate. Genotyping was performed with polymerase chain reaction and agarose gel electrophoresis. Using a separate statistical analysis for female and male subjects we determined the differences in genotype distributions of MAOA-uVNTR polymorphism between the studied groups. Statistical analysis showed a trend towards 3R allele and suicide, and associated 3R allele with non-violent suicide method on stratified data (20 suicide victims). This is the first study associating highly suicidal Slovenian population with MAOA-uVNTR polymorphism. Copyright © 2018 Elsevier B.V. All rights reserved.

  10. Interleukin and interleukin receptor gene polymorphisms in inflammatory bowel diseases susceptibility.

    PubMed

    Magyari, Lili; Kovesdi, Erzsebet; Sarlos, Patricia; Javorhazy, Andras; Sumegi, Katalin; Melegh, Bela

    2014-03-28

    Inflammatory bowel disease (IBD), which includes Crohn's disease (CD) and ulcerative colitis (UC), represents a group of chronic inflammatory disorders caused by dysregulated immune responses in genetically predisposed individuals. Genetic markers are associated with disease phenotype and long-term evolution, but their value in everyday clinical practice is limited at the moment. IBD has a clear immunological background and interleukins play key role in the process. Almost 130 original papers were revised including meta-analysis. It is clear these data are very important for understanding the base of the disease, especially in terms of clinical utility and validity, but text often do not available for the doctors use these in the clinical practice nowadays. We conducted a systematic review of the current literature on interleukin and interleukin receptor gene polymorphisms associated with IBD, performing an electronic search of PubMed Database from publications of the last 10 years, and used the following medical subject heading terms and/or text words: IBD, CD, UC, interleukins and polymorphisms.

  11. Interleukin and interleukin receptor gene polymorphisms in inflammatory bowel diseases susceptibility

    PubMed Central

    Magyari, Lili; Kovesdi, Erzsebet; Sarlos, Patricia; Javorhazy, Andras; Sumegi, Katalin; Melegh, Bela

    2014-01-01

    Inflammatory bowel disease (IBD), which includes Crohn’s disease (CD) and ulcerative colitis (UC), represents a group of chronic inflammatory disorders caused by dysregulated immune responses in genetically predisposed individuals. Genetic markers are associated with disease phenotype and long-term evolution, but their value in everyday clinical practice is limited at the moment. IBD has a clear immunological background and interleukins play key role in the process. Almost 130 original papers were revised including meta-analysis. It is clear these data are very important for understanding the base of the disease, especially in terms of clinical utility and validity, but text often do not available for the doctors use these in the clinical practice nowadays. We conducted a systematic review of the current literature on interleukin and interleukin receptor gene polymorphisms associated with IBD, performing an electronic search of PubMed Database from publications of the last 10 years, and used the following medical subject heading terms and/or text words: IBD, CD, UC, interleukins and polymorphisms. PMID:24695754

  12. SNP identification, genetic mapping and tissue expression of the rainbow trout TLR9 gene

    USDA-ARS?s Scientific Manuscript database

    Single nucleotide polymorphisms (SNPs) in Toll-like receptor (TLR) genes have been reported to be associated with disease resistance in human and livestock. A number of TLR genes have been identified in rainbow trout including TLR2, TLR3, TLR5, TLR20, TLR22 and TLR23. The rainbow trout (Oncorhynch...

  13. Associations of the interleukin-1 gene locus polymorphisms with risk to hip and knee osteoarthritis: gender and subpopulation differences.

    PubMed

    Kaarvatn, M H; Jotanovic, Z; Mihelic, R; Etokebe, G E; Mulac-Jericevic, B; Tijanic, T; Balen, S; Sestan, B; Dembic, Z

    2013-02-01

    Genetic predisposition to the complex hereditary disease like osteoarthritis (OA) of the large joints (hip and knee) includes the interleukin-1 gene (IL-1) cluster on chromosome 2. Using a case-control study with 500 OA patients (240 knee and 260 hip OA patients, all with joint replacement), we analysed frequencies of IL-1 gene cluster polymorphisms in Croatian Caucasian population. The control samples came from 531 healthy individuals including blood donors. We genotyped two single nucleotide polymorphisms in the IL-1 gene locus at IL-1A (-889, C>T, rs1800587) and IL-1B (+3594, C>T, rs1143634) and compared their frequencies between patients and controls. We predicted haplotypes by combining current data with our previous results on gene polymorphisms (IL-1B, rs16944 and the IL-1 receptor antagonist gene [IL-1RN] variable number tandem repeat [VNTR]) for the same population. Haplotype analyses revealed gender disparities and showed that women carriers of the 1-2-1-1 haplotype [IL-1A(rs1800587) - IL-1B(rs1143634) - IL-1B(rs16944) - IL-1RN(VNTR)] had sixfold lower risk to develop knee OA. However, carriers of the 1-1-1-2 haplotype of both sexes had over twofold higher predisposition to hip OA. Our results differ from some earlier studies in Caucasian subpopulations, which may be due to the fact that this is the first study to separate genders in assessing the IL-1-locus genetic risk of OA. The results suggest that inflammatory mediators like IL-1 might be implicated in the pathogenesis of primary OA in large joints and that as yet unidentified gender-specific factors exist in a Croatian Caucasian population. © 2012 The Authors. Scandinavian Journal of Immunology © 2012 Blackwell Publishing Ltd.

  14. Association of polymorphisms in growth hormone and leptin candidate genes with live weight traits of Brahman cattle.

    PubMed

    Hernández, N; Martínez-González, J C; Parra-Bracamonte, G M; Sifuentes-Rincón, A M; López-Villalobos, N; Morris, S T; Briones-Encinia, F; Ortega-Rivas, E; Pacheco-Contreras, V I; L A Meza-García, And

    2016-09-02

    Polymorphisms in candidate genes can produce significant and favorable changes in the phenotype, and therefore are useful for the identification of the best combination of favorable variants for marker-assisted selection. In the present study, an assessment to evaluate the effect of 11 single nucleotide polymorphisms (SNPs) in candidate genes on live weight traits of registered Brahman cattle was performed. Data from purebred bulls were used in this assessment. The dataset included birth (BW), weaning (WW), and yearling (YW) weights. A panel of 11 SNP markers, selected by their formerly reported or apparent direct and indirect association with live weight traits, was included in an assessment previously confirming their minimum allele frequency (<0.05). Live weights were adjusted BW (aBW), WW (aWW), and YW (aYW) using a generalized linear model, which included the fixed effects of herd and season of birth and the random effect of the sire and year of birth. An SNP in a growth hormone gene (GH4.1) was significantly related to aWW (P = 0.035) with an estimate substitution effect of 3.97 kg (P = 0.0210). In addition, a leptin SNP (LEPg.978) was significantly associated with aYW (P = 0.003) with an estimate substitution effect of 9.57 kg (P = 0.0007). The results suggest that markers GH4.1 and LEPg.978 can be considered as candidate loci for assisted genetic improvement programs in Mexican Brahman cattle.

  15. Investigation of the 5' flanking region and exon 3 polymorphisms of IGF-1 gene showed moderate association with semen quality in Sanjabi breed rams.

    PubMed

    Bakhtiar, R; Abdolmohammadi, A; Hajarian, H; Nikousefat, Z; Kalantar-Neyestanaki, D

    2017-12-01

    In this study, semen samples were collected from 96 Sanjabi rams in order to investigate the IGF-1 gene polymorphisms and their relationship with the characteristics of semen quality and testicular size. The dimensions of scrotal length, width and circumference were measured during autumn and spring over two years. Blood samples were simultaneously collected from jugular vein to extract DNA. PCR was performed using specific primers to amplify 294 and 272bp fragments including 5' regulatory region and exon 3 of IGF-1 gene, respectively. PCR products were digested by BFOI and Eco88l restriction enzymes, respectively. Two genotypes including AA (194 and 100bp), AB (294, 194 and 100bp) and all possible genotypes including CC (182 and 90bp), CT (272, 182, and 90bp) and TT (272bp) were observed for 5' flanking region and exon 3 of IGF-1 gene, respectively. The significant differences among IGF-1 genotypes for testicular dimensions were not observed. However, the polymorphism of 5' flanking region in the studied population had significant effect on individual motility and percent morphology traits. Animals with AB genotype had significantly higher individual motility compared with AA genotype (P < 0.05). Also, animals with AA genotype had significantly the highest percent morphology compared with AB genotype (P < 0.1). The exon 3 of IGF-1 gene had significant effect on individual motility, concentration, morphology and water test traits. Animals with CT genotype had the highest sperm concentration (P < 0.1) and water test (P < 0.05) compared to CC and TT genotypes. Moreover, animals with TT genotype had significantly the highest percent morphology compared with other genotypes (P < 0.05). Briefly, the results indicated that individual motility, concentration, percent morphology and water test traits could be in association with IGF-1 genotypes. It might be concluded that polymorphisms in IGF-1gene can be considered to develop male fertility in future and for using in selection process of better animals under masker assisted selection programs. Copyright © 2017 Elsevier Inc. All rights reserved.

  16. Association of GABA(B)R1 receptor gene polymorphism with obstructive sleep apnea syndrome.

    PubMed

    Bayazit, Yildirim A; Yilmaz, Metin; Kokturk, Oguz; Erdal, M Emin; Ciftci, Tansu; Gokdogan, Tuba; Kemaloglu, Yusuf; Ileri, Fikret

    2007-01-01

    GABA(B)R (gamma-amino butyric acid B receptor)-mediated neurotransmission has been implicated in the pathophysiology of a variety of neuropsychiatric disorders. GABA(B)R1 gene variants were identified by single-strand conformation analysis. The nucleotide exchanges cause a substitution of alanine to valine in exon 1a1 (Ala20Val), a substitution of glycine to serine in exon 7 (Gly489Ser) and a silent C to G nucleotide exchange encoding the amino acid phenylalanine in exon 11 (Phe658Phe). The significance of GABA(B)R1a gene polymorphism in obstructive sleep apnea syndrome (OSAS) as well as the association of these polymorphisms with the polysomnography findings in OSAS patients are not known. In this study, we aimed to assess the significance of 3 different GABA(B)R1 gene polymorphisms (Ala20Val, Gly489Ser and Phe658Phe) in OSAS. Seventy-five patients (23 female and 52 male) with OSAS and 99 healthy volunteers (51 female, 48 male) were included in the study to assess Ala20Val, Gly489Ser and Phe658Phe polymorphisms of the GABA(B)R1 gene. For the Ala20Val variants, there was no significant difference between the genotypes and allele frequencies of the patients and controls, nor between both genders (p > 0.05). For Phe658Phe polymorphism, there was no significant difference between genotypes and allele frequencies of the patients and controls (p > 0.05). However, the C/C genotype was overrepresented and the T/C genotype was less frequent in male than female patients (p = 0.03). The C/C genotype was overrepresented and the T/C genotype was less frequent in male patients than male controls (p = 0.01). For GABA(B)R1-Gly489Ser polymorphism, all of the patients and controls had G/G genotype. The apnea arousal index scores of the male patients with C/C genotype were significantly higher than in the patients with C/T genotype (p = 0.01). The percent total sleep time in non-REM 1 scores of the male patients with T/T genotype were significantly higher than in the patients with T/C genotype (p = 0.021). The percent total sleep time in non-REM 2 scores of the female patients with C/C genotype were significantly higher than in the patients with C/T genotype (p = 0.006). The Ala20Val polymorphism of the GABA(B)R1 gene may be associated with OSAS, whereas Gly489Ser polymorphism does not seem to be involved in OSAS. The C/C variant of the Phe658Phe polymorphism GABA(B)R1 gene seems associated with the occurrence of OSAS and is also associated with some sleep related parameters (apnea arousal index and percent total sleep time in non-REM) recorded by polysomnography. Copyright (c) 2007 S. Karger AG, Basel.

  17. PREVALENCE OF COMBINATORIAL CYP2C9 AND VKORC1 GENOTYPES IN PUERTO RICANS: IMPLICATIONS FOR WARFARIN MANAGEMENT IN HISPANICS

    PubMed Central

    Duconge, Jorge; Cadilla, Carmen L.; Windemuth, Andreas; Kocherla, Mohan; Gorowski, Krystyna; Seip, Richard L.; Bogaard, Kali; Renta, Jessica Y.; Piovanetti, Paola; D’Agostino, Darrin; Santiago-Borrero, Pedro J.; Ruaño, Gualberto

    2010-01-01

    Polymorphisms in the cytochrome P450 2C9 (CYP2C9) and vitamin K epoxide reductase complex subunit 1 (VKORC1) genes significantly alter the effective warfarin dose. We determined the frequencies of alleles, single carriers, and double carriers of single nucleotide polymorphisms (SNPs) in the CYP2C9 and VKORC1 genes in a Puerto Rican cohort and gauged the impact of these polymorphisms on warfarin dosage using a published algorithm. A total of 92 DNA samples were genotyped using Luminex® x-MAP technology. The polymorphism frequencies were 6.52%, 5.43% and 28.8% for CYP2C9 *2, *3 and VKORC1-1639 G>A polymorphisms, respectively. The prevalence of combinatorial genotypes was 16% for carriers of both the CYP2C9 and VKORC1 polymorphisms, 9% for carriers of CYP2C9 polymorphisms, 35% for carriers of the VKORC1 polymorphism, and the remaining 40% were non-carriers for either gene. Based on a published warfarin dosing algorithm, single, double and triple carriers of functionally deficient polymorphisms predict reductions of 1.0–1.6, 2.0–2.9, and 2.9–3.7 mg/day, respectively, in warfarin dose. Overall, 60% of the population carried at least a single polymorphism predicting deficient warfarin metabolism or responsiveness and 13% were double carriers with polymorphisms in both genes studied. Combinatorial genotyping of CYP2C9 and VKORC1 can allow for individualized dosing of warfarin among patients with gene polymorphisms, potentially reducing the risk of stroke or bleeding. PMID:20073138

  18. Frequency of CYP450 enzyme gene polymorphisms in the Greek population: review of the literature, original findings and clinical significance.

    PubMed

    Ragia, Georgia; Giannakopoulou, Efstathia; Karaglani, Makrina; Karantza, Ioanna-Maria; Tavridou, Anna; Manolopoulos, Vangelis G

    2014-01-01

    The cytochrome P450 (CYP450) enzyme family is involved in the oxidative metabolism of many therapeutic drugs and various endogenous substrates. These enzymes are highly polymorphic. Prevalence of CYP450 enzyme gene polymorphisms vary among different populations and substantial inter- and intra-ethnic variability in frequency of CYP450 enzyme gene polymorphisms has been reported. This paper provides an overview and investigation of CYP450 genotypic and phenotypic reports published in the Greek population.

  19. Association between FOXO3A gene polymorphisms and human longevity: a meta-analysis.

    PubMed

    Bao, Ji-Ming; Song, Xian-Lu; Hong, Ying-Qia; Zhu, Hai-Li; Li, Cui; Zhang, Tao; Chen, Wei; Zhao, Shan-Chao; Chen, Qing

    2014-01-01

    Numerous studies have shown associations between the FOXO3A gene, encoding the forkhead box O3 transcription factor, and human or specifically male longevity. However, the associations of specific FOXO3A polymorphisms with longevity remain inconclusive. We performed a meta-analysis of existing studies to clarify these potential associations. A comprehensive search was conducted to identify studies of FOXO3A gene polymorphisms and longevity. Pooled odds ratios (ORs) and 95% confidence intervals (CIs) were calculated by comparing the minor and major alleles. A total of seven articles reporting associations of FOXO3A polymorphisms with longevity were identified and included in this meta-analysis. These comprised 11 independent studies with 5241 cases and 5724 controls from different ethnic groups. rs2802292, rs2764264, rs13217795, rs1935949 and rs2802288 polymorphisms were associated with human longevity (OR = 1.36, 95% CI = 1.10-1.69, P= 0.005; OR = 1.20, 95% CI = 1.04-1.37, P= 0.01; OR = 1.27, 95% CI = 1.10-1.46, P= 0.001; OR = 1.14, 95% CI = 1.01-1.27 and OR = 1.24, 95% CI = 1.07-1.43, P= 0.003, respectively). Analysis stratified by gender indicated significant associations between rs2802292, rs2764264 and rs13217795 and male longevity (OR = 1.54, 95% CI = 1.33-1.79, P < 0.001; OR = 1.38, 95% CI = 1.15-1.66, P= 0.001; and OR = 1.39, 95% CI = 1.15-1.67, P= 0.001), but rs2802292, rs2764264 and rs1935949 were not linked to female longevity. Moreover, our study showed no association between rs2153960, rs7762395 or rs13220810 polymorphisms and longevity. In conclusion, this meta-analysis indicates a significant association of five FOXO3A gene polymorphisms with longevity, with the effects of rs2802292 and rs2764264 being male-specific. Further investigations are required to confirm these findings.

  20. [The morphology, typical combinations of polymorphic genes of hemostasis, and specific features of the pathogenesis of retrochorial hematoma in missed abortion].

    PubMed

    Milovanov, A P; Kuznetsova, N B; Bushtyreva, I O

    to identify mutations and hemostatic gene polymorphisms typical for retrochorial hematoma (RCH) and to study its pathogenesis in missed abortion. A PCR assay was used to detect the genetic forms of thrombophilia in 270 patients with ultrasonographically verified RCH. Logistic regression analysis revealed that with the F7 (proconvertin, coagulation factor (CF) VII G10976A polymorphism or with the F13 (fibrinase, CF XIII) G>T, or FGB (fibrinogen β-chain) G455A polymorphism, the risk of RCH was 2.72, 2.16, and 1.92 times higher, respectively. First trimester missed abortion was found in 42 (15.5%) cases; among them there were 24 (8.8%) women with different polymorphism combinations: F7 (G10976A), F13 (fibrinase, G>T), FGB (G455A). A total of 18 cases of missed abortion due to morphologically verified endometritis, endocrinopathies, and antiphospholipid syndrome were excluded from the sample. Compared to the morphology of medical abortions of the same period (16 women), patients with polymorphic genes of hemostasis were found to have statistically significant incomplete endometrial decidualization, thinning or absence of a Rohr's fibrinoid layer, a smaller number and shortening of syncytiotrophoblast microvilli, and the maximum amount of dissecting hemorrhage and RCH in the utero-chorionic region. The stages of RCH pathogenesis were determined; these included penetration of maternal erythrocytes deep into the decidua ~ dissociation of a layer of decidual cells with impairment of a «hemostatic envelope» ~ formation of RCH with a dense network of fibrin threads ~ final necrosis of surrounding cells and tissues. The investigators identified for the first time the typical combinations of polymorphic genes of predisposition to a high risk for RCH; its complete formation requires additional changes in maternal and placental components that provide local hemostasis.

  1. Transcript level of the porcine ME1 gene is affected by SNP in its 3'UTR, which is also associated with subcutaneous fat thickness.

    PubMed

    Bartz, M; Kociucka, B; Mankowska, M; Switonski, M; Szydlowski, M

    2014-08-01

    Pork quality depends on multiple factors, including fatty acid composition in muscle and fat tissues. The ME1 gene is a strong candidate for fat accumulation, as it encodes the malic enzyme, which is required for fatty acid synthesis. We identified seven new polymorphisms in 3'UTR of the ME1 gene and moreover confirmed the presence of 4 polymorphisms detected previously. Interestingly, the studied Duroc pigs were monomorphic at all these polymorphic sites, while in 3 other breeds (Pietrain, Polish Landrace and Polish Large White), the polymorphisms were unevenly distributed. One of the novel SNPs (c.*488A>G) was found in the Polish Large White and the Polish Landrace only, and the association studies revealed that it was significantly associated with backfat thickness and average daily weight gain in the Polish Landrace (N = 207) and the Polish Large White (N = 157). This SNP was differently associated with ME1 transcript level in muscle and backfat. The in silico analysis of another novel SNP (c.*548C>T) indicated that it is located within a binding sequence conserved among vertebrates for the miR-30 family in 3'UTR of the ME1. It was shown that in the longissimus muscle, but not in adipose tissue, CT gilts compared with CC ones had significantly lower levels of the ME1 transcript. This polymorphism, however, was not associated with production traits. Additionally, we observed that transcript level of the ME1 was significantly higher in subcutaneous fat than in the longissimus muscle, as well as both investigated tissues of the Polish Landrace when compared to the other breeds. However, no association was found between this polymorphism and fatty acid profiles. We conclude that the ME1 gene polymorphism (c.*488A>G) is a potential marker for porcine backfat thickness. © 2013 Blackwell Verlag GmbH.

  2. Single Nucleotide Polymorphisms of the Angiotensin-Converting Enzyme (ACE) Gene Are Associated with Essential Hypertension and Increased ACE Enzyme Levels in Mexican Individuals

    PubMed Central

    Martínez-Rodríguez, Nancy; Posadas-Romero, Carlos; Villarreal-Molina, Teresa; Vallejo, Maite; Del-Valle-Mondragón, Leonardo; Ramírez-Bello, Julian; Valladares, Adan; Cruz-López, Miguel; Vargas-Alarcón, Gilberto

    2013-01-01

    Aim To explore the role of the ACE gene polymorphisms in the risk of essential hypertension in Mexican Mestizo individuals and evaluate the correlation between these polymorphisms and the serum ACE levels. Methods Nine ACE gene polymorphisms were genotyped by 5′ exonuclease TaqMan genotyping assays and polymerase chain reaction (PCR) in 239 hypertensive and 371 non- hypertensive Mexican individuals. Haplotypes were constructed after linkage disequilibrium analysis. ACE serum levels were determined in selected individuals according to different haplotypes. Results Under a dominant model, rs4291 rs4335, rs4344, rs4353, rs4362, and rs4363 polymorphisms were associated with an increased risk of hypertension after adjusting for age, gender, BMI, triglycerides, alcohol consumption, and smoking. Five polymorphisms (rs4335, rs4344, rs4353, rs4362 and rs4363) were in strong linkage disequilibrium and were included in four haplotypes: H1 (AAGCA), H2 (GGATG), H3 (AGATG), and H4 (AGACA). Haplotype H1 was associated with decreased risk of hypertension, while haplotype H2 was associated with an increased risk of hypertension (OR = 0.77, P = 0.023 and OR = 1.41, P = 0.004 respectively). According to the codominant model, the H2/H2 and H1/H2 haplotype combinations were significantly associated with risk of hypertension after adjusted by age, gender, BMI, triglycerides, alcohol consumption, and smoking (OR = 2.0; P = 0.002 and OR = 2.09; P = 0.011, respectively). Significant elevations in serum ACE concentrations were found in individuals with the H2 haplotype (H2/H2 and H2/H1) as compared to H1/H1 individuals (P = 0.0048). Conclusion The results suggest that single nucleotide polymorphisms and the “GGATG” haplotype of the ACE gene are associated with the development of hypertension and with increased ACE enzyme levels. PMID:23741507

  3. Single nucleotide polymorphisms of the angiotensin-converting enzyme (ACE) gene are associated with essential hypertension and increased ACE enzyme levels in Mexican individuals.

    PubMed

    Martínez-Rodríguez, Nancy; Posadas-Romero, Carlos; Villarreal-Molina, Teresa; Vallejo, Maite; Del-Valle-Mondragón, Leonardo; Ramírez-Bello, Julian; Valladares, Adan; Cruz-López, Miguel; Vargas-Alarcón, Gilberto

    2013-01-01

    To explore the role of the ACE gene polymorphisms in the risk of essential hypertension in Mexican Mestizo individuals and evaluate the correlation between these polymorphisms and the serum ACE levels. Nine ACE gene polymorphisms were genotyped by 5' exonuclease TaqMan genotyping assays and polymerase chain reaction (PCR) in 239 hypertensive and 371 non- hypertensive Mexican individuals. Haplotypes were constructed after linkage disequilibrium analysis. ACE serum levels were determined in selected individuals according to different haplotypes. Under a dominant model, rs4291 rs4335, rs4344, rs4353, rs4362, and rs4363 polymorphisms were associated with an increased risk of hypertension after adjusting for age, gender, BMI, triglycerides, alcohol consumption, and smoking. Five polymorphisms (rs4335, rs4344, rs4353, rs4362 and rs4363) were in strong linkage disequilibrium and were included in four haplotypes: H1 (AAGCA), H2 (GGATG), H3 (AGATG), and H4 (AGACA). Haplotype H1 was associated with decreased risk of hypertension, while haplotype H2 was associated with an increased risk of hypertension (OR = 0.77, P = 0.023 and OR = 1.41, P = 0.004 respectively). According to the codominant model, the H2/H2 and H1/H2 haplotype combinations were significantly associated with risk of hypertension after adjusted by age, gender, BMI, triglycerides, alcohol consumption, and smoking (OR = 2.0; P = 0.002 and OR = 2.09; P = 0.011, respectively). Significant elevations in serum ACE concentrations were found in individuals with the H2 haplotype (H2/H2 and H2/H1) as compared to H1/H1 individuals (P = 0.0048). The results suggest that single nucleotide polymorphisms and the "GGATG" haplotype of the ACE gene are associated with the development of hypertension and with increased ACE enzyme levels.

  4. Association of vitamin D binding protein polymorphism with long-term kidney allograft survival in Hispanic kidney transplant recipients.

    PubMed

    Vu, Don; Sakharkar, Prashant; Tellez-Corrales, Eglis; Shah, Tariq; Hutchinson, Ian; Min, David I

    2013-02-01

    Polymorphism of genes encoding components of the vitamin D pathway including vitamin D receptor (VDR) and vitamin D binding protein (VDBP), have been widely explored due to the complex role played by vitamin D in renal transplant outcomes. In this study, we investigated whether polymorphisms of genes encoding VDR and VDBP were associated with allograft survival or acute rejection (AR) among a Hispanic kidney transplant population. A total of 502 Hispanic renal allograft recipients at the St. Vincent Medical Center between 2001 and 2010 were genotyped for four different single nucleotide polymorphisms of VDR: FokI C>T (rs2228570), BsmI G>A (rs1544410), ApaI T>G (rs7975232), and TaqI T>C (rs731236). We also performed genotyping for one common polymorphism in the VDBP gene (rs4588). Survival was significantly improved for patients who were homozygous GG for the rs4588 G>T allele in the VDBP gene (GG vs. GT + TT, OR = 0.63, p = 0.02) while GT genotype was associated with a higher risk of graft loss (GT vs. GG + TT, OR = 1.67, p = 0.01). We found no association for polymorphic markers in VDR with allograft survival and AR. The frequency of the haplotype GTCG (in the order of VDR FokI C>T, BsmI G>A, ApaI T>G, and TaqI T>C), was significantly different in the patients with graft rejection compared to the control (p = 0.007) while ACCA haplotype was found to be associated with graft loss (p = 0.02). Hence, the VDBP G>T polymorphism (rs4588) and two haplotypes (GTCG and ACCA) of VDR appear to be associated with renal allograft outcomes among Hispanic allograft recipients.

  5. Application of pharmacogenomics to vaccines

    PubMed Central

    Poland, Gregory A; Ovsyannikova, Inna G; Jacobson, Robert M

    2009-01-01

    The field of pharmacogenomics and pharmacogenetics provides a promising science base for vaccine research and development. A broad range of phenotype/genotype data combined with high-throughput genetic sequencing and bioinformatics are increasingly being integrated into this emerging field of vaccinomics. This paper discusses the hypothesis of the ‘immune response gene network’ and genetic (and bioinformatic) strategies to study associations between immune response gene polymorphisms and variations in humoral and cellular immune responses to prophylactic viral vaccines, such as measles–mumps–rubella, influenza, HIV, hepatitis B and smallpox. Immunogenetic studies reveal promising new vaccine targets by providing a better understanding of the mechanisms by which gene polymorphisms may influence innate and adaptive immune responses to vaccines, including vaccine failure and vaccine-associated adverse events. Additional benefits from vaccinomic studies include the development of personalized vaccines, the development of novel vaccines and the development of novel vaccine adjuvants. PMID:19450131

  6. Gender, body mass index, and PPARγ polymorphism are good indicators in hyperuricemia prediction for Han Chinese.

    PubMed

    Lee, Ming-Fen; Liou, Tsan-Hon; Wang, Weu; Pan, Wen-Harn; Lee, Wei-Jei; Hsu, Chung-Tan; Wu, Suh-Fen; Chen, Hsin-Hung

    2013-01-01

    Hyperuricemia is closely associated with obesity and metabolic abnormalities, which is also an independent risk factor for cardiovascular diseases. The PPARγ gene, which is linked to obesity and metabolic abnormalities in Han Chinese, might be considered a top candidate gene that is involved in hyperuricemia. This study recruited 457 participants, aged 20-40 years old, to investigate the associations of the PPARγ gene and metabolic parameters with hyperuricemia. Three tag-single nucleotide polymorphisms, rs2292101, rs4684846, and rs1822825, of the PPARγ gene were selected to explore their association with hyperuricemia. Risk genotypes on rs1822825 of the PPARγ gene exhibited statistical significance with hyperuricemia (odds ratio: 1.9; 95% confidence interval: 1.05-3.57). Although gender, body mass index (BMI), serum total cholesterol concentration, or protein intake per day were statistically associated with hyperuricemia, the combination of BMI, gender, and rs1822825, rather than that of age, serum lipid profile, blood pressure, and protein intake per day, satisfied the predictability for hyperuricemia (sensitivity: 69.3%; specificity: 83.7%) in Taiwan-born obese Han Chinese. BMI, gender, and the rs1822825 polymorphism in the PPARγ gene appeared good biomarkers in hyperuricemia; therefore, these powerful indicators may be included in the prediction of hyperuricemia to increase the accuracy of the analysis.

  7. Prolactin receptor gene polymorphism and the risk of recurrent pregnancy loss: a case-control study.

    PubMed

    Kim, Jin Ju; Choi, Young Min; Lee, Sung Ki; Yang, Kwang Moon; Paik, Eun Chan; Jeong, Hyeon Jeong; Jun, Jong Kwan; Han, Ae Ra; Hwang, Kyu Ri; Hong, Min A

    2018-02-01

    Since the first study was published reporting the candidate association between the prolactin receptor gene intron C/T polymorphism (rs37389) and recurrent miscarriage, no replication study has been performed. In this study, we investigated the role of the prolactin receptor gene C/T polymorphism in 311 Korean women with recurrent pregnancy loss and 314 controls. Genotyping for prolactin receptor gene intron C/T polymorphism was performed using a TaqMan assay. The significance of difference in the genotype distribution was assessed using a chi-square test, and continuous variables were compared using a Student's t-test. The genotype distribution of the prolactin receptor gene C/T polymorphism in the recurrent pregnancy loss group did not differ from that in the control group (CC/CT/TT rates were 49.8%/41.5%/8.7% and 52.5%/37.6%/9.9% for the recurrent pregnancy loss patient and control groups, respectively, p = .587). When the analysis was restricted to patients with three or more consecutive spontaneous miscarriages or patients without prior live birth, there were also no differences in the genotype distribution between these subgroups and controls. In conclusion, the findings of the current study suggest that the prolactin receptor gene intron C/T polymorphism is not a major determinant of the development of recurrent pregnancy loss. Impact statement What is already known: Many studies have investigated whether there is a genetic component for the risk of recurrent pregnancy loss. Recently, one study investigated whether genetic polymorphisms involved in the regulation of the hypothalamic-pituitary-ovarian axis would be associated with recurrent miscarriage. Among 35 polymorphisms in 20 candidate genes, genotype distribution with regard to the prolactin receptor gene intron C/T polymorphism (rs37389) differed between the recurrent miscarriage and the control groups. Since this study reporting the candidate association between the prolactin receptor gene and recurrent miscarriage, no replication study has been performed. What the results of this study add: The genotype distribution of the prolactin receptor gene C/T polymorphism in the recurrent miscarriage group did not differ from that in the control group. What the implications are of these findings: Our study may be useful in that it is the first replication study since the initial report of the association of prolactin receptor gene polymorphism with recurrent miscarriage. Although no association was found, the potential role of prolactin in pregnancy loss needs to be further investigated because prolactin and its receptor have been postulated to play an important role in the maintenance of normal pregnancy.

  8. Associations between serotonin-related gene polymorphisms and panic disorder.

    PubMed

    Maron, Eduard; Lang, Aavo; Tasa, Gunnar; Liivlaid, Liivi; Tõru, Innar; Must, Anne; Vasar, Veiko; Shlik, Jakov

    2005-06-01

    Studies suggest that vulnerability to panic attacks and panic disorder (PD) may be related to a deficient serotonin (5-HT) neurotransmission. In the present case-control study we investigated possible associations between PD phenotype and five candidate polymorphisms including 5-HT transporter (5-HTTLPR and VNTR), monoamine oxidase A (MAOA promoter region), tryptophan hydroxylase 1 (TPH1 218A/C) and 5-HT1B receptor (5-HT1BR 861G/C) genes. The study sample consisted of 158 patients with PD and 215 healthy control subjects. The analysis showed higher frequencies of LL genotype (p = 0.016) and L allele variant (p = 0.007) of 5-HTTLPR in the patients. No significant associations were observed between PD and other candidate gene polymorphisms. However, a higher frequency of longer allele genotypes of the MAOA promoter region was observed in female PD patients with agoraphobia than in female controls (p = 0.016). These findings indicate that genetic variants conceivably related to lower 5-HT neurotransmission may be involved in the development of PD.

  9. 4G/5G polymorphism of plasminogen activator inhibitor-1 gene is associated with polycystic ovary syndrome in Chinese patients: a meta-analysis.

    PubMed

    Wang, Li-Hong; Wang, Li-Mei; Zhou, Na

    2015-09-01

    To date, case-control studies on the association between a single-nucleotide polymorphism (SNP) in the plasminogen activator inhibitor-1 (PAI-1) gene and polycystic ovary syndrome (PCOS) have provided controversial results. The electronic databases PubMed, Embase, Web of Science, and CNKI (China National Knowledge Infrastructure) were searched for studies to include in the present meta-analysis. The fixed effects and random effects models showed that the 4G allele was associated with a risk of PCOS compared with the 5G allele in Chinese patients (OR = 2.05; 95 % CI = 1.56-2.69), but not in Caucasian patients (OR = 1.05; 95 % CI = 0.81-1.37). The contrast of homozygotes and the recessive and dominant models produced the same pattern of results as the allele contrast. Our pooled data suggest evidence for a major role of PAI-1 gene 4G/5G polymorphism in the pathogenesis of PCOS among Chinese patients.

  10. Polymorphisms of genes coding for ghrelin and its receptor in relation to colorectal cancer risk: a two-step gene-wide case-control study

    PubMed Central

    2010-01-01

    Background Ghrelin, an endogenous ligand for the growth hormone secretagogue receptor (GHSR), has two major functions: the stimulation of the growth hormone production and the stimulation of food intake. Accumulating evidence also indicates a role of ghrelin in cancer development. Methods We conducted a case-control study to examine the association of common genetic variants in the genes coding for ghrelin (GHRL) and its receptor (GHSR) with colorectal cancer risk. Pairwise tagging was used to select the 11 polymorphisms included in the study. The selected polymorphisms were genotyped in 680 cases and 593 controls from the Czech Republic. Results We found two SNPs associated with lower risk of colorectal cancer, namely SNPs rs27647 and rs35683. We replicated the two hits, in additional 569 cases and 726 controls from Germany. Conclusion A joint analysis of the two populations indicated that the T allele of rs27647 SNP exerted a protective borderline effect (Ptrend = 0.004). PMID:20920174

  11. Polymorphisms of genes coding for ghrelin and its receptor in relation to colorectal cancer risk: a two-step gene-wide case-control study.

    PubMed

    Campa, Daniele; Pardini, Barbara; Naccarati, Alessio; Vodickova, Ludmila; Novotny, Jan; Steinke, Verena; Rahner, Nils; Holinski-Feder, Elke; Morak, Monika; Schackert, Hans K; Görgens, Heike; Kötting, Judith; Betz, Beate; Kloor, Matthias; Engel, Christoph; Büttner, Reinhard; Propping, Peter; Försti, Asta; Hemminki, Kari; Barale, Roberto; Vodicka, Pavel; Canzian, Federico

    2010-09-28

    Ghrelin, an endogenous ligand for the growth hormone secretagogue receptor (GHSR), has two major functions: the stimulation of the growth hormone production and the stimulation of food intake. Accumulating evidence also indicates a role of ghrelin in cancer development. We conducted a case-control study to examine the association of common genetic variants in the genes coding for ghrelin (GHRL) and its receptor (GHSR) with colorectal cancer risk. Pairwise tagging was used to select the 11 polymorphisms included in the study. The selected polymorphisms were genotyped in 680 cases and 593 controls from the Czech Republic. We found two SNPs associated with lower risk of colorectal cancer, namely SNPs rs27647 and rs35683. We replicated the two hits, in additional 569 cases and 726 controls from Germany. A joint analysis of the two populations indicated that the T allele of rs27647 SNP exerted a protective borderline effect (Ptrend = 0.004).

  12. Relationship between iris constitution analysis and TNF-alpha gene polymorphism in hypertensives.

    PubMed

    Yoo, Chun-Sang; Hwang, Woo-Jun; Hong, Seung-Heon; Lee, Hye-Jung; Jeong, Hyun-Ja; Kim, Su-Jin; Kim, Hyung-Min; Um, Jae-Young

    2007-01-01

    Iridology is a complementary and alternative medicine that involves the diagnosis of medical conditions by noting irregularities of the pigmentation in the iris. Iris constitution has a strong hereditary component. Tumor necrosis factor-alpha (TNFalpha), a pleiotropic cytokine, has been implicated in many pathological processes including hypertension. In this paper, the relationship between iris constitution and TNFalpha gene polymorphism in those with hypertension is investigated. Eighty seven hypertensive individuals and 79 controls were classified according to iris constitution and the TNFalpha genotype of each individual determined. Compared to the controls, the frequency of the TNFalpha GA heterozygote was lower in the hypertensive group, although the statistical significance was marginal (p = 0.08). This result implies an association with resistance to the disease. In addition, the frequency of the cardio-renal connective tissue weakness type was significantly higher in the hypertensive group with the TNFalpha GG genotype, as compared to the controls (p = 0.001). An association is demonstrated among TNFalpha gene polymorphism, Koreans with hypertension, and iris constitution.

  13. [Analysis of the frequencies of genotype combinations of 4 polymorphisms of genes acting on the folate cycle in the Spanish population].

    PubMed

    Martínez-Frías, María Luisa; Bermejo, Eva; Pérez, Belén; Desviat, Lourdes R; Castro, Margarita; Leal, Fátima; Mansilla, Elena; Martínez-Fernández, María Luisa; Rodríguez-Pinilla, Elvira; Rodríguez, Laura; Ugarte, Magdalena

    2008-06-21

    Studies on different populations have shown a great variability of the frequencies of different polymorphisms in genes acting in the folate cycle. The present study was aimed to analyze the frequency in the Spanish population of each genotype combination of four polymorphisms, one of them -1561C-T of the glutamate carboxypeptidase II (GCPII) gene- being the first time that is studied in Spain. The study included a meta-analysis of the published data. Using the Spanish Collaborative Study of Congenital Malformations (ECEMC) Network, blood samples of 190 mother-child couples with newborns without any congenital defect, were obtained from 15 Spanish autonomous regions. The study polymorphisms were the 677C-T and 1298A-C polymorphisms of the methylenetetrahydrofolate reductase (MTHFR), the 66A-G of the methionine synthase reductase (MTRR), and the 1561C-T polymorphism of the GCPII gene. To estimate the range for the population frequencies, 99% confidence intervals were calculated. The frequencies observed in our country were significantly different from others, being similar to those obtained in countries of the Mediterranean European area. The 1561C-T polymorphism of the GCPII gene has a frequency in Spain of 5.11%, which is also similar to the values observed in France (5%) and in Italy (6%). On the other hand, the frequency of the genotypes CTCC, TTAC is quite few, while the genotype TTCC was not observed in any mother or infants. A meta-analysis was performed for a big sample (23,612 individuals) and the results showed that with a 99% of probability the values for the genotype combinations CTCC, TTAC, and TTCC were within 0.10-0.24; 0.20-0.36; and 0.003-0.05, respectively. Our results are important to further analyze the relationship with some health problems and individual susceptibilities. Indeed, considering the published observations of the structure and function of the MTHFR enzyme, it is understandable that those genotype combinations that are quite little frequent, may be related to the embryo-fetal viability, and to the life style of each population.

  14. Association of glutathione S-transferase Ω 1-1 polymorphisms (A140D and E208K) with the expression of interleukin-8 (IL-8), transforming growth factor beta (TGF-β), and apoptotic protease-activating factor 1 (Apaf-1) in humans chronically exposed to arsenic in drinking water.

    PubMed

    Escobar-García, D M; Del Razo, L M; Sanchez-Peña, L C; Mandeville, P B; Lopez-Campos, C; Escudero-Lourdes, Claudia

    2012-06-01

    Human exposure to arsenicals is associated with inflammatory-related diseases including different kinds of cancer as well as non-cancerous diseases like neuro-degenerative diseases, atherosclerosis, hypertension, and diabetes. Interindividual susceptibility has been mainly addressed by evaluating the role of genetic polymorphism in metabolic enzymes in inorganic arsenic (iAs) metabolism. Glutathione S-transferase omega 1-1 (GSTO1-1), which had been associated with iAs metabolism, is also known to participate in inflammatory and apoptotic cellular responses. The polymorphism A140D of GSTO1-1 has been not only associated with distinct urinary profile of arsenic metabolites in populations chronically exposed to iAs in drinking water, but also with higher risk of childhood leukemia and lung disease in non-exposed populations, suggesting that GSTO1-1 involvement in other physiologic processes different from toxics metabolism could be more relevant than is thought. We evaluated the association of the presence of A140D and E208K polymorphisms of GSTO1-1 gene with the expression of genes codifying for proteins involved in the inflammatory and apoptotic response in a human population chronically exposed to iAs through drinking water. A140D polymorphism was associated with higher expression of genes codifying for IL-8 and Apaf-1 mainly in heterozygous individuals, while E208K was associated with higher expression of IL-8 and TGF- gene, in both cases, the association was independently of iAs exposure level; however, the exposure to iAs increased slightly but significantly the influence of A140D and E208K polymorphisms on such genes expression. These results suggest an important role of GSTO1-1 in the inflammatory response and the apoptotic process and indicate that A140D and E208K polymorphisms could increase the risk of developing inflammatory and apoptosis-related diseases in As-exposed populations.

  15. Polymorphism and methylation of the MC4R gene in obese and non-obese dogs.

    PubMed

    Mankowska, Monika; Nowacka-Woszuk, Joanna; Graczyk, Aneta; Ciazynska, Paulina; Stachowiak, Monika; Switonski, Marek

    2017-08-01

    The dog is considered to be a useful biomedical model for human diseases and disorders, including obesity. One of the numerous genes associated with human polygenic obesity is MC4R, encoding the melanocortin 4 receptor. The aim of our study was to analyze polymorphisms and methylation of the canine MC4R in relation to adiposity. Altogether 270 dogs representing four breeds predisposed to obesity: Labrador Retriever (n = 187), Golden Retriever (n = 38), Beagle (n = 28) and Cocker Spaniel (n = 17), were studied. The dogs were classified into three groups: lean, overweight and obese, according to the 5-point Body Condition Score (BCS) scale. In the cohort of Labradors a complete phenotypic data (age, sex, neutering status, body weight and BCS) were collected for 127 dogs. The entire coding sequence as well as 5' and 3'-flanking regions of the studied gene were sequenced and six polymorphic sites were reported. Genotype frequencies differed considerably between breeds and Labrador Retrievers appeared to be the less polymorphic. Moreover, distribution of some polymorphic variants differed significantly (P < 0.05) between small cohorts with diverse BCS in Golden Retrievers (c.777T>C, c.868C>T and c.*33C>G) and Beagles (c.-435T>C and c.637G>T). On the contrary, in Labradors no association between the studied polymorphisms and BCS or body weight was observed. Methylation analysis, using bisulfite DNA conversion followed by Sanger sequencing, was carried out for 12 dogs with BCS = 3 and 12 dogs with BCS = 5. Two intragenic CpG islands, containing 19 cytosines, were analyzed and the methylation profile did not differ significantly between lean and obese animals. We conclude that an association of the MC4R gene polymorphism with dog obesity or body weight is unlikely, in spite of the fact that some associations were found in small cohorts of Beagles and Golden Retrievers. Also methylation level of this gene is not related with dog adiposity.

  16. Association of polymorphisms in microRNA machinery genes (DROSHA, DICER1, RAN, and XPO5) with risk of idiopathic primary ovarian insufficiency in Korean women.

    PubMed

    Rah, HyungChul; Jeon, Young Joo; Lee, Bo Eun; Kim, Jung O; Shim, Sung Han; Lee, Woo Sik; Choi, Dong Hee; Kim, Ji Hyang; Kim, Nam Keun

    2013-10-01

    The aim of our study was to investigate whether polymorphisms in microRNA machinery genes are associated with the risk of primary ovarian insufficiency (POI). We genotyped 136 POI patients and 236 controls among Korean women for nine single nucleotide polymorphisms (SNPs; DROSHA rs6877842 and rs10719; DICER1 rs13078 and rs3742330; RAN rs14035; and XPO5 rs34324334, rs2257082, rs11544382, and rs11077) by polymerase chain reaction-restriction fragment length polymorphism analysis. Differences in genotype frequencies between patients and controls were compared, and odds ratios (ORs) and 95% CIs were determined as measures of the strength of the association between genotype and POI. Of the nine SNPs, XPO5 rs34324334 and rs11544382 were monomorphic and were not analyzed further. The XPO5 rs2257082 CT and CT + TT variant genotypes were more frequent in patients (OR, 2.097; 95% CI, 1.207-3.645) than in controls (OR, 2.030; 95% CI, 1.196-3.445). The combined frequencies of XPO5 rs2257082 CT + TT and rs11077 AC + CC genotypes were higher in patients than in controls (OR, 2.526; 95% CI, 1.088-5.865). An association of POI risk with other polymorphisms was not found. A haplotype-based analysis of seven polymorphisms of the microRNA machinery genes for gene-gene interactions suggests that ***ACTA, ***GCCA, ***G*C*, *T*ATTA, and ***ACT* haplotypes (asterisk indicates SNP locus not included; DROSHA rs6877842 and rs10719, DICER1 rs13078 and rs3742330, RAN rs14035, and XPO5 rs2257082 and rs11077 polymorphisms) are associated with higher POI prevalence, and that ***GCTA, ***ACCA, *C*ATTA, and *C*ATT* haplotypes are associated with lower POI prevalence. Our data demonstrate that the XPO5 rs2257082 T variant allele occurs more frequently in POI patients than in controls, suggesting that this allele may be associated with increased POI risk.

  17. Fas/FasL gene polymorphism in patients with Hashimoto's thyroiditis in Turkish population.

    PubMed

    Erdogan, M; Kulaksizoglu, M; Ganidagli, S; Berdeli, A

    2017-01-01

    Hashimoto's disease is a polygenic disorder with complex etiopathogenesis. Apoptosis is proposed as one of its mechanisms. The Fas/Fas ligand cascade represents a major pathway initiating apoptosis. This study aims to evaluate the influence of Fas and FasL gene polymorphism in Hashimoto's thyroiditis in Turkish population. A total of 112 patients with Hashimoto's thyroiditis and 112 cases of healthy control people were included in this study. The evaluation of genotype for Fas -670 A/G and FasL 843 C/T gene polymorphism was performed by using PCR-RFLP method. The FAS genotype and gene allele frequency distribution did differ between the control group (AA 36.6 %, AG 50.0 %, GG 13.4 %, A 61.6 %, G 38.4 %) and the Hashimoto's thyroiditis patients (AA 21.4 %, AG 50.9 %, GG 27.7 %, A 46.9 %, G 53.1 %) (p < 0.01). The evaluation of FasL genotype and gene allele frequency did not show statistically significant difference between the patient group (CC 27.7 %, CT 45.5 %, TT 26.8 %, C 50.4 %, T 49.6 %) and control group (CC 33.9 %, CT 44.6 %, TT 21,4 %, C 56.3 %, T 43.8 %) (p > 0.05). Gene polymorphism of Fas and G allele frequency may play a role in the regulation of apoptosis in thyroid autoimmune disorders. There is a need for further studies to clarify the genetic role of apoptosis in HT.

  18. A comparative analysis of MC4R gene sequence, polymorphism, and chromosomal localization in Chinese raccoon dog and Arctic fox.

    PubMed

    Skorczyk, Anna; Flisikowski, Krzysztof; Switonski, Marek

    2012-05-01

    Numerous mutations of the human melanocortin receptor type 4 (MC4R) gene are responsible for monogenic obesity, and some of them appear to be associated with predisposition or resistance to polygenic obesity. Thus, this gene is considered a functional candidate for fat tissue accumulation and body weight in domestic mammals. The aim of the study was comparative analysis of chromosome localization, nucleotide sequence, and polymorphism of the MC4R gene in two farmed species of the Canidae family, namely the Chinese raccoon dog (Nycterutes procyonoides procyonoides) and the arctic fox (Alopex lagopus). The whole coding sequence, including fragments of 3'UTR and 5'UTR, shows 89% similarity between the arctic fox (1276 bp) and Chinese raccoon dog (1213 bp). Altogether, 30 farmed Chinese raccoon dogs and 30 farmed arctic foxes were searched for polymorphisms. In the Chinese raccoon dog, only one silent substitution in the coding sequence was identified; whereas in the arctic fox, four InDels and two single-nucleotide polymorphisms (SNPs) in the 5'UTR and six silent SNPs in the exon were found. The studied gene was mapped by FISH to the Chinese raccoon dog chromosome 9 (NPP9q1.2) and arctic fox chromosome 24 (ALA24q1.2-1.3). The obtained results are discussed in terms of genome evolution of species belonging to the family Canidae and their potential use in animal breeding.

  19. WDR1 and CLNK gene polymorphisms correlate with serum glucose and high-density lipoprotein levels in Tibetan gout patients.

    PubMed

    Lan, Bing; Chen, Peng; Jiri, Mutu; He, Na; Feng, Tian; Liu, Kai; Jin, Tianbo; Kang, Longli

    2016-03-01

    Current evidence suggests heredity and metabolic syndrome contributes to gout progression. Specifically, the WDR1 and CLNK genes may play a role in gout progression in European ancestry populations. However, no studies have focused on Chinese populations, especially Tibetan individuals. This study aims to determine whether variations in these two genes correlate with gout-related indices in Chinese-Tibetan gout patients. Eleven single-nucleotide polymorphisms in the WDR1 and CLNK genes were detected in 319 Chinese-Tibetan gout patients and 318 controls. We used one-way analysis of variance to evaluate the polymorphisms' effects on gout based on mean serum levels of metabolism indicators, such as albumin, glucose (GLU), triglycerides, cholesterol, high-density lipoproteins (HDL-C), creatinine, and uric acid, from fasting venous blood samples. All p values were Bonferroni corrected. Polymorphisms of the WDR1 and CLNK genes affected multiple risk factors for gout development. Significant differences in serum GLU levels were detected between different genotypic groups with WDRI polymorphisms rs4604059 (p = 0.005) and rs12498927 (p = 0.005). In addition, significant differences in serum HDL-C levels were detected between different genotypic groups with the CLNK polymorphism rs2041215 (p = 0.001). Polymorphisms of CLNK also affected levels of albumin, triglycerides, and creatinine. This study is the first to investigate and identify positive correlations between WDR1 and CLNK gene polymorphisms in Chinese-Tibetan populations. Our findings provide significant evidence for the effect of genetic polymorphisms on gout-related factors in Chinese-Tibetan populations.

  20. Tumor Necrosis Factor-Alpha Gene Promoter Region Polymorphism and the Risk of Coronary Heart Disease

    PubMed Central

    Asifa, Gul Zareen; Kazmi, Syed Ali Raza; Javed, Qamar

    2013-01-01

    Background. Tumor necrosis factor-alpha (TNF-α) gene polymorphisms have been implicated in the manifestation of atherosclerosis. Controversy exists regarding the link between the cytokine's variant genotype and CHD among different ethnic groups. There have been fewer studies on the TNF-α gene −1031T>C and −863C>A polymorphisms in relation to CHD. Therefore, the current study was designed to investigate the association of the TNF-α gene −1031T>C and −863C>A polymorphisms with CHD in a Pakistani population. Methods. Patients with CHD (n = 310) and healthy individuals (n = 310) were enrolled in this study. Genotyping was performed by polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP). Results. A significant difference was observed in the −863C>A polymorphism between patients with CHD and control subjects (P < 0.0001). CHD risk was positively associated with the variant allele −863A (P < 0.0001) in the study subjects. There was no significant link between the −1031T>C polymorphism and CHD risk in the study population. Haplotypes A-T and A-C of the TNF-alpha gene loci at −863 and −1031 showed higher frequency in the patient group compared with controls (P < 0.05). Conclusion. The TNF-α  −863C>A gene polymorphism was associated with the pathogenesis of CHD while the −1031T>C polymorphism did not show any link with the disease in a Pakistani population. PMID:24381514

  1. Meta-analysis of the relationship between single nucleotide polymorphism of IL-10-1082G/A and rheumatic heart disease.

    PubMed

    Dai, Weiran; Ye, Ziliang; Lu, Haili; Su, Qiang; Li, Hui; Li, Lang

    2018-02-23

    The results showed that there was a certain correlation between the single nucleotide polymorphism of IL-10-1082G/A and rheumatic heart disease, but there was no systematic study to verify this conclusion. Systematic review of the association between single nucleotide polymorphism of IL-10-1082G/A locus and rheumatic heart disease. Computer retrieval PubMed, EMbase, Cochrane Library, CBM, CNKI, VIP and Data WanFang, the retrieval time limit from inception to June 2017. A case control study of single nucleotide polymorphisms and rheumatic heart disease in patients with rheumatic heart disease in the IL-10-1082G/A was collected. Two researchers independently screened the literature, extracted data and evaluated the risk of bias in the study, and using RevMan5.3 software for data analysis. A total of 3 case control studies were included, including 318 patients with rheumatic heart disease and 502 controls. Meta-analysis showed that there was no correlation between IL-10-1082G/A gene polymorphism and rheumatic heart disease [AA+AG VS GG: OR = 0.62, 95% CI (0.28, 1.39), P = 0.25; AA VS AG+GG: OR = 0.73, 95% CI (0.54, 1.00), P = 0.05; AA VS GG: OR = 0.70, 95% CI(0.47, 1.05), P = 0.08; AG VS GG: OR = 0.65, 95% CI (0.22, 1.92), P = 0.43; A VS G: OR = 0.87, 95% CI (0.71, 1.06), P = 0.17]. When AA is a recessive gene, the single nucleotide polymorphism of IL-10-1082G/A is associated with the presence of rheumatic heart disease. Due to the limitations of the quantity and quality of the included literatures, the further research results were still needed.

  2. [Divergence of paralogous growth-hormone-encoding genes and their promoters in Salmonidae].

    PubMed

    Kamenskaya, D N; Pankova, M V; Atopkin, D M; Brykov, V A

    2017-01-01

    In many fish species, including salmonids, the growth-hormone is encoded by two duplicated paralogous genes, gh1 and gh2. Both genes were already in place at the time of divergence of species in this group. A comparison of the entire sequence of these genes of salmonids has shown that their conserved regions are associated with exons, while their most variable regions correspond to introns. Introns C and D include putative regulatory elements (sites Pit-1, CRE, and ERE), that are also conserved. In chars, the degree of polymorphism of gh2 gene is 2-3 times as large as that in gh1 gene. However, a comparison across all Salmonidae species would not extent this observation to other species. In both these chars' genes, the promoters are conserved mainly because they correspond to putative regulatory sequences (TATA box, binding sites for the pituitary transcription factor Pit-1 (F1-F4), CRE, GRE and RAR/RXR elements). The promoter of gh2 gene has a greater degree of polymorphism compared with gh1 gene promoter in all investigated species of salmonids. The observed differences in the rates of accumulation of changes in growth hormone encoding paralogs could be explained by differences in the intensity of selection.

  3. Matrix-Gla Protein rs4236 [A/G] gene polymorphism and serum and GCF levels of MGP in patients with subgingival dental calculus.

    PubMed

    Doğan, Gülnihal Emrem; Demir, Turgut; Aksoy, Hülya; Sağlam, Ebru; Laloğlu, Esra; Yildirim, Abdulkadir

    2016-10-01

    Matrix-Gla Protein (MGP) is one of the major Gla-containing protein associated with calcification process. It also has a high affinity for Ca 2+ and hydroxyapatite. In this study we aimed to evaluate the MGP rs4236 [A/G] gene polymorphism in association with subgingival dental calculus. Also a possible relationship between MGP gene polymorphism and serum and GCF levels of MGP were examined. MGP rs4236 [A/G] gene polymorphism was investigated in 110 patients with or without subgingival dental calculus, using polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) techniques. Additionally, serum and GCF levels of MGP of the patients were compared according to subgingival dental calculus. Comparison of patients with and without subgingival dental calculus showed no statistically significant difference in MGP rs4236 [A/G] gene polymorphism (p=0.368). MGP concentrations in GCF of patients with subgingival dental calculus were statistically higher than those without subgingival dental calculus (p=0.032). However, a significant association was not observed between the genotypes of AA, AG and GG of the MGP rs4236 gene and the serum and GCF concentrations of MGP in subjects. In this study, it was found that MGP rs4236 [A/G] gene polymorphism was not to be associated with subgingival dental calculus. Also, that GCF MGP levels were detected higher in patients with subgingival dental calculus than those without subgingival dental calculus independently of polymorphism, may be the effect of adaptive mechanism to inhibit calculus formation. Copyright © 2016 Elsevier Ltd. All rights reserved.

  4. Maltreatment, MAOA, and delinquency: sex differences in gene-environment interaction in a large population-based cohort of adolescents.

    PubMed

    Aslund, C; Nordquist, N; Comasco, E; Leppert, J; Oreland, L; Nilsson, K W

    2011-03-01

    The present study investigated a possible interaction between a functional polymorphism in the MAOA gene promoter (MAOA-VNTR) and childhood maltreatment in the prediction of adolescent male and female delinquency. A cohort of 1,825 high school students, 17-18 years old, completed an anonymous questionnaire during class hours which included questions on childhood maltreatment, sexual abuse, and delinquency. Saliva samples were collected for DNA isolation, and analyzed for the MAOA-VNTR polymorphism. Self-reported maltreatment was a strong risk factor for adolescent delinquent behavior. The MAOA genotype also showed a significant main effect when controlled for maltreatment. Boys with a short variant and girls with one or two long variants of the polymorphism showed a higher risk for delinquency when exposed to maltreatment. Our results confirm previous findings of an interaction between the MAOA-VNTR polymorphism and self-reported maltreatment. Results for boys and girls differ according to MAOA-VNTR genotype and direction of phenotypic expression.

  5. Interleukin-10 gene polymorphisms are associated with Behcet's disease but not with Vogt-Koyanagi-Harada syndrome in the Chinese Han population.

    PubMed

    Hu, Jianmin; Hou, Shengping; Zhu, Xueping; Fang, Jing; Zhou, Yan; Liu, Yunjia; Bai, Lin; Kijlstra, Aize; Yang, Peizeng

    2015-01-01

    This study aimed to investigate the association of interleukin (IL)-10 gene polymorphisms with Behcet's disease (BD) and Vogt-Koyanagi-Harada (VKH) syndrome in the Chinese Han population. A two-stage association study was performed on 718 BD patients, 300 VKH patients, and 1,753 controls. Genotyping of the IL-10 gene was performed for six single nucleotide polymorphisms (SNPs), including rs1800871, rs1800872, rs1800896, rs3021094, rs3790622, and rs1554286 using PCR-restricted fragment length polymorphism or TaqMan SNP assays. Real-time PCR was performed to test the IL-10 mRNA expression of the associated polymorphisms. The first-stage result showed significantly increased frequencies of the rs1800871 T allele, rs1800872 A allele, and rs1554286 T allele in BD patients compared with controls (Pcorrected (Pcorr)=1.82×10(-5), OR=1.837; Pcorr=6.1×10(-5), OR=1.780; Pcorr=3.15×10(-5), OR=1.794, respectively). There was no association of the tested six SNPs with VKH syndrome. A second-stage study was therefore performed in BD patients to validate the result of the first stage, showing a significantly increased frequency of the rs1800871 T allele (Second stage, Pcorr=5.59×10(-5), OR=1.493; Combined data, Pcorr=3.65×10(-11), OR=1.632). Compared to the controls, an increased frequency of the rs1800871 T allele was observed in BD patients with extraocular findings, including genital ulcers, skin lesions, and a positive pathergy test. No difference was found among the mRNA expressions of IL-10 in the peripheral blood mononuclear cells (PBMCs) of controls with different genotypes of rs1800871 after stimulation of lipopolysaccharide (LPS) or anti-CD3/CD28 antibodies. The findings showed that IL-10 is a risk gene for BD but not for VKH syndrome.

  6. Evaluation of targeted exome sequencing for 28 protein-based blood group systems, including the homologous gene systems, for blood group genotyping.

    PubMed

    Schoeman, Elizna M; Lopez, Genghis H; McGowan, Eunike C; Millard, Glenda M; O'Brien, Helen; Roulis, Eileen V; Liew, Yew-Wah; Martin, Jacqueline R; McGrath, Kelli A; Powley, Tanya; Flower, Robert L; Hyland, Catherine A

    2017-04-01

    Blood group single nucleotide polymorphism genotyping probes for a limited range of polymorphisms. This study investigated whether massively parallel sequencing (also known as next-generation sequencing), with a targeted exome strategy, provides an extended blood group genotype and the extent to which massively parallel sequencing correctly genotypes in homologous gene systems, such as RH and MNS. Donor samples (n = 28) that were extensively phenotyped and genotyped using single nucleotide polymorphism typing, were analyzed using the TruSight One Sequencing Panel and MiSeq platform. Genes for 28 protein-based blood group systems, GATA1, and KLF1 were analyzed. Copy number variation analysis was used to characterize complex structural variants in the GYPC and RH systems. The average sequencing depth per target region was 66.2 ± 39.8. Each sample harbored on average 43 ± 9 variants, of which 10 ± 3 were used for genotyping. For the 28 samples, massively parallel sequencing variant sequences correctly matched expected sequences based on single nucleotide polymorphism genotyping data. Copy number variation analysis defined the Rh C/c alleles and complex RHD hybrids. Hybrid RHD*D-CE-D variants were correctly identified, but copy number variation analysis did not confidently distinguish between D and CE exon deletion versus rearrangement. The targeted exome sequencing strategy employed extended the range of blood group genotypes detected compared with single nucleotide polymorphism typing. This single-test format included detection of complex MNS hybrid cases and, with copy number variation analysis, defined RH hybrid genes along with the RHCE*C allele hitherto difficult to resolve by variant detection. The approach is economical compared with whole-genome sequencing and is suitable for a red blood cell reference laboratory setting. © 2017 AABB.

  7. Effects of Lead Exposure and Genetic Polymorphisms on ALAD and GPx Activities in Brazilian Battery Workers.

    PubMed

    da Cunha Martins, Airton; Mazzaron Barcelos, Gustavo Rafael; Jacob Ferreira, Anna Laura Bechara; de Souza, Marilesia Ferreira; de Syllos Cólus, Ilce Mara; Antunes, Lusânia Maria Greggi; Bastos Paoliello, Monica Maria; Adeyemi, Joseph A; Barbosa, Fernando

    2015-01-01

    Lead (Pb) is a toxic metal that is widely used by metallurgical industries such as car battery recycling. Exposure to the metal may modify the redox status of the cells and consequently result in changes in activities of important enzymes such as delta-aminolevulinic acid dehydratase (ALAD) and glutathione peroxidase (GPx). Similarly, genetic polymorphisms may modulate the activities of enzymes related to detoxification processes of the metal and may modify Pb body burden. Therefore, the aims of the present study were (i) to evaluate the correlation between blood lead levels (BLL) and activities of the enzymes ALAD and GPx, and (ii) to determine whether activities of these enzymes may be influenced by polymorphisms in ALAD and GPx genes in Brazilian automotive battery workers chronically exposed to Pb, as well as the effects of these polymorphisms on BLL. Our study included 257 participants; BLL were determined by inductively couple plasma-mass spectrometry (ICP-MS), and the activities of the enzymes ALAD and GPx were quantified spectrophotometrically; and genotyping of ALAD (rs1800435) and GPx-1 (rs1800668) polymorphisms was performed by TaqMan assays (real-time polymerase chain reaction, RT-PCR). Significant negative correlations were found between BLL and ALAD activity. Subjects who carried at least one polymorphic allele for ALAD gene displayed markedly lower ALAD activities, while no significant effect was observed regarding GPx-1 polymorphism and activity of the same enzyme. Further, ALAD and GPx-1 polymorphisms exerted no marked influence on BLL. Taken together, our results showed that BLL affected ALAD but not GPx activities, and these were not modulated by polymorphisms in ALAD and GPx gene. Further, the rs1800435 SNP showed a tendency to modulate ALAD activity, while the rs1800668 SNP did not modulate GPx activity in Brazilian automotive battery workers exposed to Pb.

  8. Association between estrogen receptora gene (ESR1) PvuII (T/C) and XbaI (A/G) polymorphisms and premature ovarian failure risk: evidence from a meta-analysis.

    PubMed

    He, Meirong; Shu, Jingcheng; Huang, Xing; Tang, Hui

    2015-02-01

    Genetic factors are important in the pathogenesis of Premature ovarian failure (POF). Notably, estrogen receptor-a (ESR1) has been suggested as a possible candidate gene for POF; however, published studies of ESR1 gene polymorphisms have been hampered by small sample sizes and inconclusive or ambiguous results. The aim of this meta analysis is to investigate the associations between two novel common ESR1 polymorphisms (intron 1 polymorphisms PvuII-rs2234693: T.C and XbaI-rs9340799: A.G) and POF. A comprehensive search was conducted to identify all studies on the association of ESR1 gene polymorphisms with POF up to August 2014. Pooled odds ratio (OR) and corresponding 95 % confidence interval (CI) were calculated using fixed-or random-effects model in the meta-analysis. Three studies covering 1396 subjects were identified. Pooled data showed significant association between ESR1 gene PvuII polymorphism and risk of POF: [allele model: Cvs. T, OR = 0.735, 95%CI: 0.624 ~ 0.865, p = 0.001; co-dominant models: CCvs.TT, OR = 0.540, 95%CI: 0.382 ~ 0.764, p = 0.001, CTvs.TT, OR = 0.735, 95%CI: 0.555 ~ 0.972, p = 0.031; dominant model: CT + CCvs.TT, OR = 0.618, 95%CI: 0.396 ~ 0.966, p = 0.035; recessive model: CCvs.TT + CT, OR = 0.659, 95%CI: 0.502 ~ 0.864, p = 0.003]. Subgroup analyses showed a significant association in all models in Asian population, but no significant association in any model in European population. For the XbaI polymorphism, overall, no significant association was observed under any genetic models. However, under dominant model, ESR1 gene XbaI polymorphism is significantly association with risk of POF in Asian population. The present meta-analysis suggests that ESR1gene PvuII polymorphism is significantly associated with an increased risk of POF. And ESR1gene XbaI polymorphism is not association with risk of POF overall. However, under dominant model, ESR1gene XbaI polymorphism is significantly association with risk of POF in Asian population. Further large and well-designed studies are needed to confirm the association.

  9. Impacts of CA9 gene polymorphisms on urothelial cell carcinoma susceptibility and clinicopathologic characteristics in Taiwan.

    PubMed

    Wang, Shian-Shiang; Liu, Yu-Fan; Ou, Yen-Chuan; Chen, Chuan-Shu; Li, Jian-Ri; Yang, Shun-Fa

    2013-01-01

    Carbonic anhydrase 9 (CA9) is reportedly overexpressed in several types of carcinomas and is generally considered a marker of malignancy. The current study explored the effect of CA9 gene polymorphisms on the susceptibility of developing urothelial cell carcinoma (UCC) and the clinicopathological status. A total of 442 participants, including 221 healthy people and 221 patients with UCC, were recruited for this study. Four single-nucleotide polymorphisms (SNPs) of the CA9 gene were assessed by a real-time PCR with the TaqMan assay. After adjusting for other co-variants, the individuals carrying at least one A allele at CA9 rs1048638 had a 2.303-fold risk of developing UCC than did wild-type (CC) carriers. Furthermore, UCC patients who carried at least one A allele at rs1048638 had a higher invasive stage risk (p< 0.05) than did patients carrying the wild-type allele. Moreover, among the UCC patients with smoker, people with at least one A allele of CA9 polymorphisms (rs1048638) had a 4.75-fold (95% CI = 1.204-18.746) increased risk of invasive cancer. The rs1048638 polymorphic genotypes of CA9 might contribute to the prediction of susceptibility to and pathological development of UCC. This is the first study to provide insight into risk factors associated with CA9 variants in carcinogenesis of UCC in Taiwan.

  10. Methylene tetrahydrofolate reductase (MTHFR) gene polymorphisms in chronic myeloid leukemia: an Egyptian study.

    PubMed

    Khorshied, Mervat Mamdooh; Shaheen, Iman Abdel Mohsen; Abu Khalil, Reham E; Sheir, Rania Elsayed

    2014-01-01

    Methylenetetrahydrofolate reductase (MTHFR) gene plays a pivotal role in folate metabolism. Several genetic variations in MTHFR gene as MTHFR-C677T and MTHFR-A1298C result in decreased MTHFR activity, which could influence efficient DNA methylation and explain susceptibility to different cancers. The etiology of chronic myeloid leukemia (CML) is obscure and little is known about individual's susceptibility to CML. In order to assess the influence of these genetic polymorphisms on the susceptibility to CML and its effect on the course of the disease among Egyptians, we performed an age-gender-ethnic matched case-control study. The study included 97 CML patients and 130 healthy controls. Genotyping of MTHFR-C677T and -A1298C was performed by polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) technique. The results showed no statistical difference in the distribution of MTHFR-C677T and -A1298C polymorphic genotypes between CML patients and controls. The frequency of MTHFR 677-TT homozygous variant was significantly higher in patients with accelerated/blastic transformation phase when compared to those in the chronic phase of the disease. In conclusion, our study revealed that MTHFR-C677T and -A1298C polymorphisms could not be considered as genetic risk factors for CML in Egyptians. However, MTHFR 677-TT homozygous variant might be considered as a molecular predictor for disease progression.

  11. Isolation and characterization of new highly polymorphic DNA markers from the Huntington disease region

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Weber, B.; Hedrick, A.; Andrew, S.

    1992-02-01

    The defect causing Huntington disease (HD) has been mapped to 4p16.3, distal to the DNA marker D4S10. Subsequently, additional polymorphic markers closer to the HD gene have been isolated, which has led to the establishment of predictive testing programs for individuals at risk for HD. Approximately 17% of persons presenting to the Canadian collaborative study for predictive testing for HD have not received any modification of risk, in part because of limited informativeness of currently available DNA markers. Therefore, more highly polymorphic DNA markers are needed, which well further increase the accuracy and availability of predictive testing, specifically for familiesmore » with complex or incomplete pedigree structures. In addition, new markers are urgently needed in order to refine the breakpoints in the few known recombinant HD chromosomes, which could allow a more accurate localization of the HD gene within 4p16.3 and, therefore, accelerate the cloning of the disease gene. In this study, the authors present the identification and characterization of nine new polymorphic DNA markers, including three markers which detect highly informative multiallelic VNTR-like polymorphisms with PIC values of up to .84. These markers have been isolated from a cloned region of DNA which has been previously mapped approximately 1,000 kb from the 4p telomere.« less

  12. The algorithm for Alzheimer risk assessment based on APOE promoter polymorphisms.

    PubMed

    Limon-Sztencel, Anna; Lipska-Ziętkiewicz, Beata S; Chmara, Magdalena; Wasag, Bartosz; Bidzan, Leszek; Godlewska, Beata R; Limon, Janusz

    2016-05-19

    Over the past two decades, the APOE gene and its polymorphisms have been among the most studied risk factors of Alzheimer disease (AD) development; yet, there are discrepancies between various studies regarding their impact. For this reason, the evaluation of the APOE genotype has not been included in the current European Federation of Neurological Societies guidelines for AD diagnosis and management. This aim of this study was to add to this discussion by assessing the possible influence of multiple polymorphisms in the promoter region of the APOE gene and genotypes of its allele E on the risk for dementia. We performed a comprehensive analysis of APOE gene polymorphisms, assessed the detected genotypes and correlated molecular findings with serum apolipoprotein E concentrations. The study comprised 110 patients with AD and 110 age-matched healthy individuals from the Polish population. Four polymorphisms of the APOE gene had minor allele frequency exceeding 5% and were included in the analysis: -491A/T (rs449647), -427T/C (rs769446), -219T/G (rs405509) in the promoter region and +113G/C (rs440446) in intron 1. A protective effect of the -219G allele on AD development was observed. Also, the -491T and -219G alleles were found to be underrepresented in the carriers of the APOE E4 variant. On the basis of the genotype and linkage disequilibrium studies, a relative score was attributed to given genotypes with respect to the estimated probability of their protective effects against AD, giving rise to the 'preventive score'. This 'preventive score', based on the total sums of the relative scores, expresses the protective effect deriving from the synergistic action of individual single-nucleotide polymorphisms. The 'preventive score' was identified as an independent predictive factor. We propose a novel, more complex approach to AD risk assessment based on the additive effect of multiple polymorphic loci within the APOE promoter region, which on their own may have too weak an impact to reach the level of significance. This has potentially practical implications, as it may help to improve the informative potential of APOE testing in a clinical setting. Subsequent studies of the proposed system in large, multi-ethnic cohorts are necessary for its validation and to assess its potential practical value for clinical applications.

  13. Gene Polymorphism Studies in a Teaching Laboratory

    NASA Astrophysics Data System (ADS)

    Shultz, Jeffry

    2009-02-01

    I present a laboratory procedure for illustrating transcription, post-transcriptional modification, gene conservation, and comparative genetics for use in undergraduate biology education. Students are individually assigned genes in a targeted biochemical pathway, for which they design and test polymerase chain reaction (PCR) primers. In this example, students used genes annotated for the steroid biosynthesis pathway in soybean. The authoritative Kyoto encyclopedia of genes and genomes (KEGG) interactive database and other online resources were used to design primers based first on soybean expressed sequence tags (ESTs), then on ESTs from an alternate organism if soybean sequence was unavailable. Students designed a total of 50 gene-based primer pairs (37 soybean, 13 alternative) and tested these for polymorphism state and similarity between two soybean and two pea lines. Student assessment was based on acquisition of laboratory skills and successful project completion. This simple procedure illustrates conservation of genes and is not limited to soybean or pea. Cost per student estimates are included, along with a detailed protocol and flow diagram of the procedure.

  14. PERB11 (MIC): a polymorphic MHC gene is expressed in skin and single nucleotide polymorphisms are associated with psoriasis

    PubMed Central

    Tay, G K; Hui, J; Gaudieri, S; Schmitt-Egenolf, M; Martinez, O P; Leelayuwat, C; Williamson, J F; Eiermann, T H; Dawkins, R L

    2000-01-01

    The susceptibility genes for psoriasis remain to be identified. At least one of these must be in the major histocompatibility complex (MHC) to explain associations with alleles at human leucocyte antigen (HLA)-A, -B, -C, -DR, -DQ and C4. In fact, most of these alleles are components of just two ancestral haplotypes (AHs) designated 13.1 and 57.1. Although relevant MHC gene(s) could be within a region of at least 4 Mb, most studies have favoured the area near HLA-B and -C. This region contains a large number of non-HLA genes, many of which are duplicated and polymorphic. Members of one such gene family, PERB11.1 and PERB11.2, are expressed in the skin and are encoded in the region between tumour necrosis factor and HLA-B. To investigate the relationship of PERB11.1 alleles to psoriasis, sequence based typing was performed on 97 patients classified according to age of onset and family history. The frequency of the PERB11.1*06 allele is 44% in type I psoriasis but only 7% in controls (Pc = 0.003 by Fisher's exact test, two-tailed). The major determinant of this association is a single nucleotide polymorphism (SNP) within intron 4. In normal and affected skin, expression of PERB11 is mainly in the basal layer of the epidermis including ducts and follicles. PERB11 is also present in the upper keratin layers but there is relative deficiency in the intermediate layers. These findings suggest a possible role for PERB11 and other MHC genes in the pathogenesis of psoriasis. PMID:10691930

  15. A genetic predisposition score for muscular endophenotypes predicts the increase in aerobic power after training: the CAREGENE study.

    PubMed

    Thomaes, Tom; Thomis, Martine; Onkelinx, Steven; Fagard, Robert; Matthijs, Gert; Buys, Roselien; Schepers, Dirk; Cornelissen, Véronique; Vanhees, Luc

    2011-10-03

    It is widely accepted that genetic variability might explain a large part of the observed heterogeneity in aerobic capacity and its response to training. Significant associations between polymorphisms of different genes with muscular strength, anaerobic phenotypes and body composition have been reported. Muscular endophenotypes are positively correlated with aerobic capacity, therefore, we tested the association of polymorphisms in twelve muscular related genes on aerobic capacity and its response to endurance training. 935 Coronary artery disease patients (CAD) who performed an incremental exercise test until exhaustion at baseline and after three months of training were included. Polymorphisms of the genes were detected using the invader assay. Genotype-phenotype association analyses were performed using ANCOVA. Different models for a genetic predisposition score (GPS) were constructed based on literature and own data and were related to baseline and response VO(2) scores. Carriers of the minor allele in the R23K polymorphism of the glucocorticoid receptor gene (GR) and the ciliary neurotrophic factor gene (CNTF) had a significantly higher increase in peakVO(2) after training (p < 0.05). Carriers of the minor allele (C34T) in the adenosine monophosphate deaminase (AMPD1) gene had a significantly lower relative increase (p < 0.05) in peakVO(2). GPS of data driven models were significantly associated with the increase in peakVO(2) after training. In CAD patients, suggestive associations were found in the GR, CNTF and the AMPD1 gene with an improved change in aerobic capacity after three months of training. Additionally data driven models with a genetic predisposition score (GPS) showed a significant predictive value for the increase in peakVO(2).

  16. A genetic predisposition score for muscular endophenotypes predicts the increase in aerobic power after training: the CAREGENE study

    PubMed Central

    2011-01-01

    Background It is widely accepted that genetic variability might explain a large part of the observed heterogeneity in aerobic capacity and its response to training. Significant associations between polymorphisms of different genes with muscular strength, anaerobic phenotypes and body composition have been reported. Muscular endophenotypes are positively correlated with aerobic capacity, therefore, we tested the association of polymorphisms in twelve muscular related genes on aerobic capacity and its response to endurance training. Methods 935 Coronary artery disease patients (CAD) who performed an incremental exercise test until exhaustion at baseline and after three months of training were included. Polymorphisms of the genes were detected using the invader assay. Genotype-phenotype association analyses were performed using ANCOVA. Different models for a genetic predisposition score (GPS) were constructed based on literature and own data and were related to baseline and response VO2 scores. Results Carriers of the minor allele in the R23K polymorphism of the glucocorticoid receptor gene (GR) and the ciliary neurotrophic factor gene (CNTF) had a significantly higher increase in peakVO2 after training (p < 0.05). Carriers of the minor allele (C34T) in the adenosine monophosphate deaminase (AMPD1) gene had a significantly lower relative increase (p < 0.05) in peakVO2. GPS of data driven models were significantly associated with the increase in peakVO2 after training. Conclusions In CAD patients, suggestive associations were found in the GR, CNTF and the AMPD1 gene with an improved change in aerobic capacity after three months of training. Additionally data driven models with a genetic predisposition score (GPS) showed a significant predictive value for the increase in peakVO2. PMID:21967077

  17. Single nucleotide polymorphism of CC chemokine ligand 5 promoter gene in recipients may predict the risk of chronic graft-versus-host disease and its severity after allogeneic transplantation.

    PubMed

    Kim, Dong Hwan; Jung, Hee Du; Lee, Nan Young; Sohn, Sang Kyun

    2007-10-15

    Leukocyte trafficking, regulated by chemokine ligands and their receptors, involves in the pathogenesis of graft-versus-host disease (GVHD) including CC ligand 5 (CCL5) or CC receptor 5 (CCR5). The current study analyzed the association of acute or chronic GVHD (cGVHD) with the CCR5/CCL5 gene single nucleotide polymorphisms (SNPs) of recipients and donors. We evaluated the SNPs of CCL5 promoter gene at position -28 (rs1800825)/-403 (rs2107538) and CCR5 gene at 59029 (rs1799987) in 72 recipients and donors using polymerase chain reaction/RFLP (Restriction Fragment Length Polymorphism) methods. With a median follow up of 924 days for survivors (range 48-2,360 days), the CG genotype of CCL5 gene at position -28 in recipients was significantly associated with a higher incidence of cGVHD (P=0.004), extensive cGVHD (P=0.038 by Seattle's criteria), and severe grade of cGVHD at presentation (P=0.017 by prognostic grading by Apkek et al.) compared to CC genotype. In terms of haplotype analysis, the recipients with AG haplotype of CCL5 gene also showed a higher incidence of cGVHD (P=0.003), extensive cGVHD (P=0.023), and more severe grade of cGVHD (P=0.020). However, there was no association of CCL5/CCR5 SNPs with acute GVHD. The donors' genotype of CCL5/CCR5 was not associated with the risk of cGVHD. The CCL5 promoter gene polymorphism of recipients was associated with the risk of cGVHD and its severity. The current study suggested an involvement of CCL5 in leukocyte trafficking for the development of cGVHD.

  18. Excess amino acid polymorphism in mitochondrial DNA: contrasts among genes from Drosophila, mice, and humans.

    PubMed

    Rand, D M; Kann, L M

    1996-07-01

    Recent studies of mitochondrial DNA (mtDNA) variation in mammals and Drosophila have shown an excess of amino acid variation within species (replacement polymorphism) relative to the number of silent and replacement differences fixed between species. To examine further this pattern of nonneutral mtDNA evolution, we present sequence data for the ND3 and ND5 genes from 59 lines of Drosophila melanogaster and 29 lines of D. simulans. Of interest are the frequency spectra of silent and replacement polymorphisms, and potential variation among genes and taxa in the departures from neutral expectations. The Drosophila ND3 and ND5 data show no significant excess of replacement polymorphism using the McDonald-Kreitman test. These data are in contrast to significant departures from neutrality for the ND3 gene in mammals and other genes in Drosophila mtDNA (cytochrome b and ATPase 6). Pooled across genes, however, both Drosophila and human mtDNA show very significant excesses of amino acid polymorphism. Silent polymorphisms at ND5 show a significantly higher variance in frequency than replacement polymorphisms, and the latter show a significant skew toward low frequencies (Tajima's D = -1.954). These patterns are interpreted in light of the nearly neutral theory where mildly deleterious amino acid haplotypes are observed as ephemeral variants within species but do not contribute to divergence. The patterns of polymorphism and divergence at charge-altering amino acid sites are presented for the Drosophila ND5 gene to examine the evolution of functionally distinct mutations. Excess charge-altering polymorphism is observed at the carboxyl terminal and excess charge-altering divergence is detected at the amino terminal. While the mildly deleterious model fits as a net effect in the evolution of nonrecombining mitochondrial genomes, these data suggest that opposing evolutionary pressures may act on different regions of mitochondrial genes and genomes.

  19. Aggressive behavior in schizophrenia is associated with the low enzyme activity COMT polymorphism: a replication study.

    PubMed

    Strous, Rael D; Nolan, Karen A; Lapidus, Raya; Diaz, Libna; Saito, Takuya; Lachman, Herbert M

    2003-07-01

    We have previously reported that increased aggressive behavior in schizophrenic patients may be associated with a polymorphism at codon 158 of the catechol O-methyltransferase (COMT) gene that encodes a low enzyme activity variant. The finding has been replicated by one group, but not others. The discordant findings could be due to statistical errors or methodological issues in the assessment of aggressive/violent behavior. Consequently, additional studies are needed. Patients with schizophrenia (SZ) were assessed for violent behavior using the Lifetime History of Aggression (LHA) scale, an 11-item questionnaire that includes Aggression, Self-Directed Aggression, and Consequences/Antisocial Behavior subscales. DNA was genotyped for the COMT 158 polymorphism, as well as a functional polymorphism in the monoamine oxidase A (MAOA) gene promoter. Similar to our previously reported findings, a statistically significant association was found between aggressive behavior in SZ and the COMT 158 polymorphism; mean LHA scores were higher in subjects homozygous for 158Met, the low enzyme activity COMT variant (F(2,105) = 5.616, P = 0.005). Analysis of the major LHA subscales revealed that the association with 158Met was due to high scores on the Aggression, and Self-Directed Aggression subscales, but not the Consequences/Antisocial Behavior subscale. No significant association was detected for the MAOA gene alone. Our findings provide further support that COMT is a modifying gene that plays a role in determining interindividual variability in the proclivity for outward and self-directed aggressive behavior found in some schizophrenic patients. Copyright 2003 Wiley-Liss, Inc.

  20. Association of Angiotensin-Converting Enzyme and Glutathione S-Transferase Gene Polymorphisms with Body Mass Index among Hypertensive North Indians

    PubMed Central

    Rizvi, Saliha; Raza, Syed T.; Siddiqi, Zeba; Abbas, Shania; Mahdi, Farzana

    2015-01-01

    Objectives: This study aimed to examine the association of angiotensin-converting enzyme (ACE) and glutathione S-transferase (GST) gene polymorphisms with body mass index (BMI) in hypertensive North Indians. Methods: This case-control study was carried out between May 2013 and November 2014 at the Era’s Lucknow Medical College & Hospital, Lucknow, India, and included 378 subjects divided into three groups. One group constituted 253 hypertensive individuals (sustained diastolic blood pressure of >90 mmHg and systolic blood pressure of >140 mmHg) who were subcategorised according to normal (<25 kg/m2) or high (≥25 kg/m2) BMI. The third group consisted of 125 age-, gender- and ethnically-matched normotensive controls with a normal BMI. Gene polymorphisms were evaluated by polymerase chain reaction. The genotypic and allelic frequency distribution among both groups were analysed. Results: A significant difference was found between GST theta 1-null and GST mu 1-positive genotype frequencies among the hypertensive overweight/obese individuals and controls (P = 0.014 and 0.033, respectively). However, no difference was observed in the frequency of ACE polymorphisms. ACE insertion/insertion genotype (P = 0.006), insertion and deletion alleles (P = 0.007 each) and GST theta 1-null and GST theta 1-positive genotypes (P = 0.006 each) were found to differ significantly between hypertensive cases and controls, regardless of BMI. Conclusion: ACE and GST gene polymorphisms were not associated with BMI but were significantly associated with hypertension among the studied group of North Indians. PMID:26629373

  1. 1236 C/T and 3435 C/T polymorphisms of the ABCB1 gene in Mexican breast cancer patients.

    PubMed

    Gutierrez-Rubio, S A; Quintero-Ramos, A; Durán-Cárdenas, A; Franco-Topete, R A; Castro-Cervantes, J M; Oceguera-Villanueva, A; Jiménez-Pérez, L M; Balderas-Peña, L M A; Morgan-Villela, G; Del-Toro-Arreola, A; Daneri-Navarro, A

    2015-02-13

    MDR1, which is encoded by the ABCB1 gene, is involved in multidrug resistance (hydrophobic), as well as the elimination of xenotoxic agents. The association between ABCB1 gene polymorphisms and breast cancer risk in different populations has been described previously; however, the results have been inconclusive. In this study, we examined the association between polymorphisms 3435 C/T and 1236 C/T in the ABCB1 gene and breast cancer development in Mexican women according to their menopausal status and molecular classification. Molecular subtypes as well as allele and genotype frequencies were analyzed. A total of 248 women with initial breast cancer diagnosis and 180 ethnically matched, healthy, unrelated individuals were enrolled. Polymerase chain reaction-restriction fragment length polymorphism was performed to detect polymorphisms 3435 C/T and 1236 C/T in the ABCB1 gene. Premenopausal T allele carriers of the 3435 C/T polymorphism showed a 2-fold increased risk of breast cancer with respect to the reference and postmenopausal groups, as well as triple-negative expression regarding the luminal A/B molecular subrogated subtypes. In contrast, the CT genotype of the 1236 polymorphism was a protective factor against breast cancer. We conclude that the T allele carrier of the 3435 C/T polymorphism in the ABCB1 gene in combination with an estrogen receptor-negative status may be an important risk factor for breast cancer development in premenopausal women.

  2. Association of transforming growth factor-beta1 gene polymorphism in the development of Epstein-Barr virus-related hematologic diseases.

    PubMed

    Hatta, Kanako; Morimoto, Akira; Ishii, Eiichi; Kimura, Hiroshi; Ueda, Ikuyo; Hibi, Shigeyoshi; Todo, Shinjiro; Sugimoto, Tohru; Imashuku, Shinsaku

    2007-11-01

    Epstein-Barr virus (EBV) is etiologically associated with various hematologic disorders, including primary acute infectious mononucleosis (IM), hemophagocytic lymphohistiocytosis (EBV-HLH), chronic active EBV infection (CAEBV) and malignant lymphomas. Although cytokines play a central role in EBV-related immune responses, the exact mechanisms causing different clinical responses remain unclear. In this study, the pattern of cytokine gene polymorphisms was comparatively analyzed in EBV-related diseases. Eighty-nine patients with EBV-related disease were analyzed; 30 with IM, 28 with EBV-HLH and 31 with CAEBV. Eighty-one EBV-seropositive healthy adults were also used as controls. Associations with polymorphisms of various cytokines, including interleukin (IL)-1 alpha and IL-1 beta were evaluated. The gene polymorphisms were typed by polymerase chain reaction with sequence-specific primers. A significant difference of polymorphisms was found for transforming growth factor (TGF)-beta1; the frequency of TGF-beta1 codon 10 C allele was significantly higher in patients with EBV-related diseases than in controls (p<0.001). The difference was significant in patients with IM or HLH (p<0.001), but not in those with CAEBV (p=0.127), compared with controls. As regards other cytokines, the frequency of the IL-1 alpha -889 C allele was significantly lower in patients with IM than in controls (p<0.05). Our results suggests that TGF-beta1 codon 10 C allele plays a role in the development of EBV-related diseases and that the IL-1 alpha -889 C allele may be involved in response failure and sequential progression into the development of HLH.

  3. Global fibrinolytic activity, PAI-1 level, and 4G/5G polymorphism in Thai children with arterial ischemic stroke.

    PubMed

    Natesirinilkul, Rungrote; Sasanakul, Werasak; Chuansumrit, Ampaiwan; Kadegasem, Praguywan; Visudtibhan, Anannit; Wongwerawattanakoon, Pakawan; Sirachainan, Nongnuch

    2014-01-01

    Prolonged euglobulin clot lysis time (ECLT) and increased level of plasminogen activator inhibitor-1 (PAI-1) were reported to be risk factors of arterial ischemic stroke (AIS) by some studies; however, these findings were not supported by other studies. The objective of this study was to determine the association of ECLT, PAI-1 level, and polymorphisms of 4G and 5G of PAI-1 gene to the development of AIS in Thai children. This study included patients aged 1-18 years old. Diagnosis of AIS was confirmed by imaging study. The control group was age- and sex-matched healthy subjects. Demographic data were recorded, and blood was tested for ECLT, PAI-1 level, lipid profiles, fasting blood sugar (FBS), and 4G and 5G polymorphisms of PAI-1 gene. There were 70 subjects participating in this study, consisting of 30 patients and 40 controls. Demographic data, lipid profiles, and FBS were similar between the 2 groups. Furthermore, ECLT and PAI-1 level did not differ between patient and control groups; however, both showed significant correlation (r = .352, P = .006). The 4G/5G polymorphism was the most common genotype in both patient and control groups (69.0% vs. 80.0%). However, 4G and 5G polymorphisms of PAI-1 gene did not correlate with PAI-1 level in this study (P = .797). The PAI-1 level and 4G/5G polymorphism may not be a risk factor of AIS in this population. It was also found that the 4G/5G polymorphism was the most common PAI-1 genotype in this study. Copyright © 2014 National Stroke Association. Published by Elsevier Inc. All rights reserved.

  4. The association between leptin receptor gene polymorphisms and type 2 diabetes mellitus: A systematic review and meta-analysis.

    PubMed

    Su, Shu; Zhang, Chunhua; Zhang, Fan; Li, Hui; Yang, Xuewei; Tang, Xiaojun

    2016-11-01

    Several case-control studies have demonstrated a relationship between leptin receptor (LEPR) gene polymorphism and type 2 diabetes mellitus (T2DM) risk, though the results have not always been consistent among diverse populations. This meta-analysis was designed to assess a more accurate association between LEPR polymorphism and T2DM. Eight electronic databases were consulted and researchers searched for Chinese and English peer-reviewed articles, published between 2000 and 2015, that referred to the association between LEPR polymorphism and T2DM. Pooled odds ratios (OR) with a 95% confidence interval (CI) were calculated in allele contrast, recessive, dominant and additive genetic models to assess this association. Four repeatedly reviewed polymorphisms, taken from 22 studies on Arg109Lys, Asn656Lys, Gln223Arg and Pro1019Pro with 31,260 controls and 25,560 cases, were included in the meta-analysis model. The meta-result demonstrated that only the Pro1019Pro polymorphism was substantially associated with T2DM risk-G vs. A: OR with 95% CI 0.58 (0.43-0.79), Z=3.51, p=0.0005; GG vs. AG+AA: 0.57 (0.42-0.77), Z=3.66, p=0.0002; GG+AG vs. AA: 0.55 (0.37-0.81), Z=3.01, p=0.003; GG vs. AA: 0.51 (0.37-0.69), Z=4.24, p<0.001. Our meta-analysis suggested a significant association between the LEPR Pro1019Pro polymorphism and T2DM risk. Thus, targeted healthcare should be strengthened with regard to this gene carrier in order to prevent T2DM. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

  5. The AGT Gene M235T Polymorphism and Response of Power-Related Variables to Aerobic Training

    PubMed Central

    Aleksandra, Zarębska; Zbigniew, Jastrzębski; Waldemar, Moska; Agata, Leońska-Duniec; Mariusz, Kaczmarczyk; Marek, Sawczuk; Agnieszka, Maciejewska-Skrendo; Piotr, Żmijewski; Krzysztof, Ficek; Grzegorz, Trybek; Ewelina, Lulińska-Kuklik; Semenova, Ekaterina A.; Ahmetov, Ildus I.; Paweł, Cięszczyk

    2016-01-01

    The C allele of the M235T (rs699) polymorphism of the AGT gene correlates with higher levels of angiotensin II and has been associated with power and strength sport performance. The aim of the study was to investigate whether or not selected power-related variables and their response to a 12-week program of aerobic dance training are modulated by the AGT M235T genotype in healthy participants. Two hundred and one Polish Caucasian women aged 21 ± 1 years met the inclusion criteria and were included in the study. All women completed a 12-week program of low and high impact aerobics. Wingate peak power and total work capacity, 5 m, 10 m, and 30 m running times and jump height and jump power were determined before and after the training programme. All power-related variables improved significantly in response to aerobic dance training. We found a significant association between the M235T polymorphism and jump-based variables (squat jump (SJ) height, p = 0.005; SJ power, p = 0.015; countermovement jump height, p = 0.025; average of 10 countermovement jumps with arm swing (ACMJ) height, p = 0.001; ACMJ power, p = 0.035). Specifically, greater improvements were observed in the C allele carriers in comparison with TT homozygotes. In conclusion, aerobic dance, one of the most commonly practiced adult fitness activities in the world, provides sufficient training stimuli for augmenting the explosive strength necessary to increase vertical jump performance. The AGT gene M235T polymorphism seems to be not only a candidate gene variant for power/strength related phenotypes, but also a genetic marker for predicting response to training. Key points Aerobic dance provides sufficient training stimuli for the improvement of explosive power. The AGT gene M235T polymorphism is associated with individual variation in the change of power-related phenotypes in response to aerobic dance training. The C allele carriers of the AGT gene M235T polymorphism show greater improvements of jump-based variables in comparison with TT homozygotes. PMID:27928207

  6. Interleukin-10 -1082 G/A gene polymorphisms in Egyptian children with CAP

    PubMed Central

    Azab, Seham F.; Abdalhady, Mohamed A.; Elsaadany, Hosam F.; Elkomi, Mohamed A.; Elhindawy, Eman M.; Sarhan, Dina T.; Salam, Mohamed M.A.; Allah, Mayy A.N.; Emam, Ahmed A.; Noah, Maha A.; Abdelsalam, Nasser I.; Abdellatif, Sawsan H.; Rass, Anwar A.; Ismail, Sanaa M.; Gheith, Tarek; Aziz, Khalid A.; Hamed, Mohammed E.; Abdelrahman, Hind M.; Ahmed, Ahmed R.; Nabil, Rehab M.; Abdulmaksoud, Rehab S.; Yousef, Hala Y.

    2016-01-01

    Abstract Community-acquired pneumonia (CAP) is one of the leading causes of death worldwide. Cytokines are involved in the pathogenesis of CAP. To date, only a few studies concerned the association of interleukin-10 (IL-10) gene polymorphisms with CAP. In this study, we aimed to investigate whether the -1082(G/A) polymorphism in the promoter region of the IL-10 gene is involved in susceptibility to and the outcome of CAP, and we also measured the serum level of IL-10 to assess its relation to such polymorphism. This was a case–control study included 100 patients with CAP, and matched with age, gender, and ethnicity of 100 healthy control children. IL-10 -1082(G/A) gene polymorphism was genotyped by polymerase chain reaction-restriction fragment length polymorphism, while the serum IL-10 levels were measured by ELISA method. Compared to the controls subjects, the frequencies of the IL-10 -1082 AA genotype and A allele were observed to be overrepresented in patients with CAP (51%; odds ratio [OR] = 2.8; 95% confidence interval [CI]: 1.5–5.3 for the AA genotype; P < 0.01) and (70%; OR: 1.95; 95% CI: 1.27–3.00 for the A allele; P < 0.01, respectively). We found that patients with the GG genotype had significantly higher serum IL-10 levels (46.7 ± 9.5 pg/mL) compared to those with AG genotype (21.8 ± 4.5 pg/mL) and AA genotype (11.5 ± 3.3 pg/mL); P < 0.01, respectively. Our data revealed a significant positive association between the -1082 GG genotype and susceptibility to severe sepsis, acute respiratory failure, and hospital mortality (OR: 3.8; 95% CI: 1.3–11.2; P < 0.01). We demonstrate for the first time, to the best of our knowledge, that IL-10 -1082 (G/A) gene polymorphism may contribute to susceptibility to CAP in Egyptian children. Moreover, we observed that the presence of a G allele or GG genotype at the -1082 position of the promoter region of the IL-10 gene constitute risk factors for developing severe sepsis, acute respiratory failure, and hospital mortality among patients with CAP. PMID:27368016

  7. Interleukin-10 -1082 G/A gene polymorphisms in Egyptian children with CAP: A case-control study.

    PubMed

    Azab, Seham F; Abdalhady, Mohamed A; Elsaadany, Hosam F; Elkomi, Mohamed A; Elhindawy, Eman M; Sarhan, Dina T; Salam, Mohamed M A; Allah, Mayy A N; Emam, Ahmed A; Noah, Maha A; Abdelsalam, Nasser I; Abdellatif, Sawsan H; Rass, Anwar A; Ismail, Sanaa M; Gheith, Tarek; Aziz, Khalid A; Hamed, Mohammed E; Abdelrahman, Hind M; Ahmed, Ahmed R; Nabil, Rehab M; Abdulmaksoud, Rehab S; Yousef, Hala Y

    2016-06-01

    Community-acquired pneumonia (CAP) is one of the leading causes of death worldwide. Cytokines are involved in the pathogenesis of CAP. To date, only a few studies concerned the association of interleukin-10 (IL-10) gene polymorphisms with CAP.In this study, we aimed to investigate whether the -1082(G/A) polymorphism in the promoter region of the IL-10 gene is involved in susceptibility to and the outcome of CAP, and we also measured the serum level of IL-10 to assess its relation to such polymorphism.This was a case-control study included 100 patients with CAP, and matched with age, gender, and ethnicity of 100 healthy control children. IL-10 -1082(G/A) gene polymorphism was genotyped by polymerase chain reaction-restriction fragment length polymorphism, while the serum IL-10 levels were measured by ELISA method.Compared to the controls subjects, the frequencies of the IL-10 -1082 AA genotype and A allele were observed to be overrepresented in patients with CAP (51%; odds ratio [OR] = 2.8; 95% confidence interval [CI]: 1.5-5.3 for the AA genotype; P < 0.01) and (70%; OR: 1.95; 95% CI: 1.27-3.00 for the A allele; P < 0.01, respectively). We found that patients with the GG genotype had significantly higher serum IL-10 levels (46.7 ± 9.5 pg/mL) compared to those with AG genotype (21.8 ± 4.5 pg/mL) and AA genotype (11.5 ± 3.3 pg/mL); P < 0.01, respectively. Our data revealed a significant positive association between the -1082 GG genotype and susceptibility to severe sepsis, acute respiratory failure, and hospital mortality (OR: 3.8; 95% CI: 1.3-11.2; P < 0.01).We demonstrate for the first time, to the best of our knowledge, that IL-10 -1082 (G/A) gene polymorphism may contribute to susceptibility to CAP in Egyptian children. Moreover, we observed that the presence of a G allele or GG genotype at the -1082 position of the promoter region of the IL-10 gene constitute risk factors for developing severe sepsis, acute respiratory failure, and hospital mortality among patients with CAP.

  8. Association Study of the β2-Adrenergic Receptor Gene Polymorphisms and Hypertension in the Northern Han Chinese

    PubMed Central

    Li, Yao; Liu, Ya; Wang, Zuoguang; Liu, Kuo; Wu, Hai; Niu, Qiuli; Gu, Wei; Guo, Yanhong; Li, Zhizhong; Wen, Shaojun

    2011-01-01

    Background The β2-adrenergic receptor (ADRB2) gene has been widely researched as a candidate gene for essential hypertension (EH), but no consensus has been reached in different ethnicities. The aim of the present study was to evaluate the possible association between the ADRB2 gene polymorphisms and the EH risk in the Northern Han Chinese population. Methodology/Principal Findings This study included 747 hypertensive subjects and 390 healthy volunteers as control subjects in the Northern Han Chinese. Genotyping was performed to identify the C-47T, A46G and C79G polymorphisms of the ADRB2 gene. G allelic frequency of A46G polymorphism was significantly higher in hypertensive subjects (P = 0.011, OR = 1.287, 95%CI [1.059–1.565]) than that in controls. Significant association could also be found in dominant genetic model (GG+AG vs. AA, P = 0.006, OR = 1.497, 95%CI [1.121–1.998]), in homozygote comparison (GG vs. AA, P = 0.025, OR = 1.568, 95%CI [1.059–2.322]), and in additive genetic model (GG vs. AG vs. AA, P = 0.012, OR = 1.282, 95%CI [1.056–1.555]). Subgroup analyses performed by gender suggested that this association could be found in male, but not in female. Stratification analyses by obesity showed that A46G polymorphism was related to the prevalence of hypertension in the obese population (GG vs. AG vs. AA, P<0.001, OR = 1.645, 95%CI [1.258–2.151]). Significant interaction was found between A46G genotypes and body mass index on EH risk. No significant association could be found between C-47T or C79G polymorphism and EH risk. Linkage disequilibrium was detected between the C-47T, A46G and C79G polymorphisms. Haplotype analyses observed that the T-47-A46-C79 haplotype was a protective haplotype for EH, while the T-47-G46-C79 haplotype increased the risk. Conclusions/Significances We revealed that the ADRB2 A46G polymorphism might increase the risk for EH in the Northern Han Chinese population. PMID:21483652

  9. Polymorphism of the insulin gene is associated with increased prostate cancer risk.

    PubMed

    Ho, G Y F; Melman, A; Liu, S-M; Li, M; Yu, H; Negassa, A; Burk, R D; Hsing, A W; Ghavamian, R; Chua, S C

    2003-01-27

    High insulin levels are linked with increased cancer risk, including prostate cancer. We examined the associations between prostate cancer with polymorphisms of the insulin gene (INS) and its neighbouring genes, tyrosine-hydroxylase and IGF-II (TH and IGF2). In this study, 126 case-control pairs matched on age, race, and countries of origin were genotyped for +1127 INS-PstI in INS, -4217 TH-PstI in TH, and +3580 IGF2-MspI in IGF2. The homozygous CC genotype of +1127 INS-PstI occurred in over 60% of the population. It was associated with an increased risk of prostate cancer in nondiabetic Blacks and Caucasians (OR=3.14, P=0.008). The CC genotype was also associated with a low Gleason score <7 (OR=2.60, P=0.022) and a late age of diagnosis (OR=2.10, P=0.046). Markers in the neighbouring genes of INS showed only null to modest associations with prostate cancer. The polymorphism of INS may play a role in the aetiology of prostate cancer. Given the high prevalence of the CC genotype and its association with late age of onset of low-grade tumours, this polymorphism may contribute to the unique characteristics of prostate cancer, namely a high prevalence of indolent cancers and the dramatic increase in incidence with age.

  10. Natural selection on marine carnivores elaborated a diverse family of classical MHC class I genes exhibiting haplotypic gene content variation and allelic polymorphism

    PubMed Central

    Norman, Paul J.; Parham, Peter

    2012-01-01

    Pinnipeds, marine carnivores, diverged from terrestrial carnivores ~45 million years ago, before their adaptation to marine environments. This lifestyle change exposed pinnipeds to different microbiota and pathogens, with probable impact on their MHC class I genes. Investigating this question, genomic sequences were determined for 71 MHC class I variants: 27 from harbor seal and 44 from gray seal. These variants form three MHC class I gene lineages, one comprising a pseudogene. The second, a candidate nonclassical MHC class I gene, comprises a nonpolymorphic transcribed gene related to dog DLA-79 and giant panda Aime-1906. The third is the diversity lineage, which includes 62 of the 71 seal MHC class I variants. All are transcribed, and they minimally represent six harbor and 12 gray seal MHC class I genes. Besides species-specific differences in gene number, seal MHC class I haplotypes exhibit gene content variation and allelic polymorphism. Patterns of sequence variation, and of positions for positively selected sites, indicate the diversity lineage genes are the seals’ classical MHC class I genes. Evidence that expansion of diversity lineage genes began before gray and harbor seals diverged is the presence in both species of two distinctive sublineages of diversity lineage genes. Pointing to further expansion following the divergence are the presence of species-specific genes and greater MHC class I diversity in gray seals than harbor seals. The elaboration of a complex variable family of classical MHC class I genes in pinnipeds contrasts with the single, highly polymorphic classical MHC class I gene of dog and giant panda, terrestrial carnivores. PMID:23001684

  11. Norepinephrine genes predict response time variability and methylphenidate-induced changes in neuropsychological function in attention deficit hyperactivity disorder.

    PubMed

    Kim, Bung-Nyun; Kim, Jae-Won; Cummins, Tarrant D R; Bellgrove, Mark A; Hawi, Ziarih; Hong, Soon-Beom; Yang, Young-Hui; Kim, Hyo-Jin; Shin, Min-Sup; Cho, Soo-Churl; Kim, Ji-Hoon; Son, Jung-Woo; Shin, Yun-Mi; Chung, Un-Sun; Han, Doug-Hyun

    2013-06-01

    Noradrenergic dysfunction may be associated with cognitive impairments in attention-deficit/hyperactivity disorder (ADHD), including increased response time variability, which has been proposed as a leading endophenotype for ADHD. The aim of this study was to examine the relationship between polymorphisms in the α-2A-adrenergic receptor (ADRA2A) and norepinephrine transporter (SLC6A2) genes and attentional performance in ADHD children before and after pharmacological treatment.One hundred one medication-naive ADHD children were included. All subjects were administered methylphenidate (MPH)-OROS for 12 weeks. The subjects underwent a computerized comprehensive attention test to measure the response time variability at baseline before MPH treatment and after 12 weeks. Additive regression analyses controlling for ADHD symptom severity, age, sex, IQ, and final dose of MPH examined the association between response time variability on the comprehensive attention test measures and allelic variations in single-nucleotide polymorphisms of the ADRA2A and SLC6A2 before and after MPH treatment.Increasing possession of an A allele at the G1287A polymorphism of SLC6A2 was significantly related to heightened response time variability at baseline in the sustained (P = 2.0 × 10) and auditory selective attention (P = 1.0 × 10) tasks. Response time variability at baseline increased additively with possession of the T allele at the DraI polymorphism of the ADRA2A gene in the auditory selective attention task (P = 2.0 × 10). After medication, increasing possession of a G allele at the MspI polymorphism of the ADRA2A gene was associated with increased MPH-related change in response time variability in the flanker task (P = 1.0 × 10).Our study suggested an association between norepinephrine gene variants and response time variability measured at baseline and after MPH treatment in children with ADHD. Our results add to a growing body of evidence, suggesting that response time variability is a viable endophenotype for ADHD and suggesting its utility as a surrogate end point for measuring stimulant response in pharmacogenetic studies.

  12. Association of MAP4K4 gene single nucleotide polymorphism with mastitis and milk traits in Chinese Holstein cattle.

    PubMed

    Bhattarai, Dinesh; Chen, Xing; Ur Rehman, Zia; Hao, Xingjie; Ullah, Farman; Dad, Rahim; Talpur, Hira Sajjad; Kadariya, Ishwari; Cui, Lu; Fan, Mingxia; Zhang, Shujun

    2017-02-01

    The objective of the studies presented in this Research Communication was to investigate the association of single nucleotide polymorphisms present in the MAP4K4 gene with different milk traits in dairy cows. Based on previous QTL fine mapping results on bovine chromosome 11, the MAP4K4 gene was selected as a candidate gene to evaluate its effect on somatic cell count and milk traits in ChineseHolstein cows. Milk production traits including milk yield, fat percentage, and protein percentage of each cow were collected using 305 d lactation records. Association between MAP4K4 genotype and different traits and Somatic Cell Score (SCS) was performed using General Linear Regression Model of R. Two SNPs at exon 18 (c.2061T > G and c.2196T > C) with genotype TT in both SNPs were found significantly higher for somatic SCS. We found the significant effect of exon 18 (c.2061T > G) on protein percentage, milk yield and SCS. We identified SNPs at different location of MAP4K4 gene of the cattle and several of them were significantly associated with the somatic cell score and other different milk traits. Thus, MAP4K4 gene could be a useful candidate gene for selection of dairy cattle against mastitis and the identified polymorphisms might potentially be strong genetic markers.

  13. [Patients with inherited trombophilia and recurrent pregnancy loss: incidence].

    PubMed

    Flores-Alatriste, José Daniel; Jacobo-Nájera, Sara; Segura-Rodríguez, Rubén; Stern-Colin y Nunes, Jorge Jaroslav

    2014-06-01

    Inherited thrombophilia is a genetic tendency to suffer thrombotic events clinically evident at an early age, with frequent re- currences without apparent cause. In recent years thrombophilia has earned a place as a primary risk factor for abnormal pregnancy. To determine the incidence of hereditary thrombophilia in patients with recurrent pregnancy loss. A retrospective, linear and descriptive study was conducted at Clinic of Reproduction IMMUNOREP with patients treated from January 2007 to December 2012. The study included patients with a diagnosis of recurrent pregnancy loss and inherited thrombophilia with laboratory studies of thrombophilia including different genes: G1619A (factor V Leiden), R2 H1299R (factor V polymorphism), C677T (methylenetetrahydrofolate reductase enzyme polymorphism), A1298C (methylenetetrahydrofolate reductase enzyme mutation), G20210A (mutation of the prothrombin gene), V34L (factor XIII polymorphism), 455G > A (fibrinogen gene mutation), 4G/5G (plasminogen activator inhibitor) and a/b L33P (ribosomal polymorphism of methylenetetrahydrofolate reductase enzyme). 211 files were reviewed and only 10.4% of patients were negative for hereditary thrombophilia, a percentage that is consistent with the results of different series of studies in patients with unexplained recurrent pregnancy loss. The most prevalent genetic condition was 4G/5G (plasminogen activator inhibitor, 85.5%) in homozygous and heterozygous with 63.4% (120) and 22.4% (42), respectively. It was demonstrated the direct relationship between thrombophilia and recurrent pregnancy loss depending on whether the patient is heterozygous or homozygous for the disease.

  14. The correlation of leptin/leptin receptor gene polymorphism and insulin-like growth factor-1 and their impact on childhood growth hormone deficiency.

    PubMed

    He, J-S; Lian, C-W; Zhou, H-W; Lin, X-F; Yang, H-C; Ye, X-L; Zhu, S-B

    2016-09-01

    Growth hormone deficiency (GHD) is the most common cause for childhood dwarfism. Currently, the significance of insulin-like growth factor-1 (IGF-1) in diagnosis of GHD is still debatable. Due to the possible correlation between leptin (LEP) and GHD pathogenesis, this study investigated the gene polymorphism of LEP and its receptor (LEPR) genes, along with serum IGF-1 and LEP levels in GHD patients. This study attempted to illustrate the correlation between gene polymorphism and GHD pathogenesis. A case-control study was performed using 180 GHD children in addition to 160 healthy controls. PCR-DNA sequencing method was employed for genotyping various polymorphism loci of LEP and LEPR genes in both GHD and healthy individuals. Serum IGF-1 and LEP levels were also determined. Results revealed a statistically significant difference between the levels of IGF-1 and LEP in the serum samples collected from patients in the GHD and the control groups. Both IGF-1 and LEP levels were found to be correlated with polymorphism at rs7799039 loci of LEP gene, in which GG and GA genotypes carriers had higher serum IGF-1 levels when compared to AA genotype carriers. GHD pathogenesis is well correlated with the LEP and IGF-1 levels in the both of which were mediated by the gene polymorphism at rs7799039 loci of LEP gene.

  15. Association analysis of the functional MAOA gene promoter and MAOB gene intron 13 polymorphisms in tension type headache patients.

    PubMed

    Edgnülü, Tuba G; Özge, Aynur; Erdal, Nurten; Kuru, Oktay; Erdal, Mehmet E

    2014-01-01

    Monoamine oxidase (MAO) enzymes play an important role in the etiology of many neurological diseases. Tension type headache (TTH) treatments contain inhibitors for selective re-uptake of serotonin and monoamine oxidase inhibitors. MAO (EC 1.4.3.4) has two isoenzymes known as MAOA and MAOB. A promoter polymorphism of a variable number of tandem repeats (VNTR) in the MAOA gene seems to affect MAOA transcriptional activity in vitro. Also, G/A polymorphism in intron 13 (rs1799836) of the MAOB gene have been previously found to be associated with the variability of MAOB enzyme activity. The aim of our study was to investigate a possible association of monoamine oxidase (MAOA and MAOB) gene polymorphisms in tension type headache. MAO gene polymorphisms were examined in a group of 120 TTH patients and in another 168 unrelated healthy volunteers (control group). MAOA promoter and MAOB intron 13 polymorphisms were genotyped using PCR-based methods. An overall comparison between the genotype of MAOA and MAOB genes and allele frequencies of the patients and the control group did not reveal any statistically significant difference between the patients and the control group (p=0.162). Factors like estrogen dosage, the limited number of male patients and other genes' neurotransmitters involved in the etiology of TTH could be responsible for our non-significant results.

  16. Association of single nucleotide polymorphisms in VDR and DBP genes with HBV-related hepatocellular carcinoma risk in a Chinese population.

    PubMed

    Peng, Qiliu; Yang, Shi; Lao, Xianjun; Li, Ruolin; Chen, Zhiping; Wang, Jian; Qin, Xue; Li, Shan

    2014-01-01

    Polymorphisms of genes encoding components of the vitamin D pathway including vitamin D receptor (VDR) and vitamin D binding protein (DBP) have been widely investigated because of the complex role played by vitamin D in cancer tumorogenesis. In this study, we investigated the association between VDR and DBP gene polymorphisms and HBV-related HCC risk in a Chinese population. Study subjects were divided into three groups: 184 HBV patients with HCC, 296 HBV patients without HCC, and 180 healthy controls. The VDR rs2228570, and rs3782905 and the DBP rs7041 polymorphisms were genotyped using PCR-RFLP and the VDR rs11568820 polymorphism was genotyped by PCR-SSP, respectively. DNA sequencing was performed to validate the genotype results. We found that there were significant differences in the genotype and allele frequencies of the VDR rs2228570 and DBP rs7041 polymorphisms between HBV patients with HCC and healthy controls. The rs2228570 T allele was associated with a significant increased HBV-related HCC risk as compared with the C allele. The rs2228570 TT and TT/TC genotypes were correlated with a significant increased HBV-related HCC risk when compared with the wild-type CC homozygote. Similarly, the rs7041 G allele was associated with a significant increased HBV-related HCC risk as compared with the T allele. The rs7041 GG and GG/TG genotypes were correlated with a significant increased HBV-related HCC risk when compared with the wild-type TT homozygote. However, we did not observe any significant effect of VDR rs11568820, and rs3782905 polymorphisms on HBV-related HCC risk in this population. In haplotype analysis, we also did not find any significant differences in haplotype frequencies of the VDR gene between HBV patients with HCC and the healthy controls. We conclude that the VDR rs2228570 and DBP rs7041 polymorphisms may contribute to increased susceptibility to HBV-related HCC in the Chinese population. Due to the marginal significance, further large and well-designed studies in diverse ethnic populations are needed to confirm our results.

  17. Association of RAGE gene polymorphism with circulating AGEs level and paraoxonase activity in relation to macro-vascular complications in Indian type 2 diabetes mellitus patients.

    PubMed

    Bansal, Savita; Chawla, Diwesh; Banerjee, Basu Dev; Madhu, Sri Venkata; Tripathi, Ashok Kumar

    2013-09-10

    Sustained interaction of advanced glycation end products (AGEs) with their receptor RAGE and subsequent signaling plays an important role in the development of diabetic complications. Genetic variation of RAGE gene may be associated with the development of vascular complications in type 2 diabetes mellitus (T2DM). The present study aimed to explore the possible association of RAGE gene polymorphisms namely -374T/A, -429T/C and G82S with serum level of AGEs, paraoxonase (PON1) activity and macro-vascular complications (MVC) in Indian type 2 diabetes mellitus patients (T2DM). A total of 265 diabetic patients, including DM without any complications (n=135), DM-MVC (n=130) and 171 healthy individuals were enrolled. Genotyping of RAGE variants were assessed by polymerase chain reaction-restriction fragment length polymorphism. Serum AGEs were estimated by ELISA and fluorometrically. and PON1 activity was assessed spectrophotometrically. Of the three examined SNPs, association of -429T/C polymorphism with MVC in T2DM was observed (OR=3.001, p=0.001) in the dominant model. Allele 'A' of -374T/A polymorphism seems to confer better cardiac outcome in T2DM. Patients carrying C allele (-429T/C) and S allele (G82S) had significantly higher AGEs levels. -429T/C polymorphism was also found to be associated with low PON1 activity. Interaction analysis revealed that the risk of development of MVC was higher in T2DM patients carrying both a CC genotype of -429T/C polymorphism and a higher level of AGEs (OR=1.343, p=0.040). RAGE gene polymorphism has a significant effect on AGEs level and PON1 activity in diabetic subjects compared to healthy individuals. Diabetic patients with a CC genotype of -429T/C are prone to develop MVC, more so if AGEs levels are high and PON1 activity is low. Copyright © 2013 Elsevier B.V. All rights reserved.

  18. Angiotensin converting enzyme DD genotype is associated with development of rheumatic heart disease in Egyptian children.

    PubMed

    Morsy, Mohamed-Mofeed Fawaz; Abdelaziz, Nada Abdelmohsen Mohamed; Boghdady, Ahmed Mohamed; Ahmed, Hydi; Abu Elfadl, Essam Mohamed; Ismail, Mohamed Ali

    2011-01-01

    Angiotensin converting enzyme (ACE) gene polymorphism was previously studied in some cardiovascular diseases. There are only few studies which investigated this polymorphism in patients with rheumatic heart disease (RHD). The results of these investigations are inconsistent. Furthermore, gene polymorphism distribution is different in various ethnic populations. We conducted this study to demonstrate this gene polymorphism in Egyptian children with RHD. Leukocytes DNA was extracted from 139 patients with RHD and 79 healthy control children. After amplification by the PCR, the products were separated by electrophoresis in 6% polyacrylamide gel and visualized after ethidium bromide staining with UV light. The PCR product is a 190-bp fragment in the absence of the insertion (D allele) and a 490-bp fragment in the presence of the insertion (I allele). Gene polymorphism was as follows: DD gene when lane contains only 190-bp fragment, II gene when lane contains only 490-bp fragment and ID gene when lane contains both fragments. We found that gene polymorphism in both control and patients groups followed the following order of distribution from highest to lowest: ID, II, DD gene. The frequency in control group was 49.4, 36.7, and 13.9%, respectively. In patients groups, the gene frequency was 42.5, 30.9, and 26.6%, respectively. DD gene frequency differs significantly between the two groups. We concluded that patients with RHD have a higher ACE-DD genotype than normal control. ACE-DD genotype may be a risk factor for RHD in Egyptian children.

  19. Association of -330 interleukin-2 gene polymorphism with oral cancer.

    PubMed

    Singh, Prithvi Kumar; Kumar, Vijay; Ahmad, Mohammad Kaleem; Gupta, Rajni; Mahdi, Abbas Ali; Jain, Amita; Bogra, Jaishri; Chandra, Girish

    2017-12-01

    Cytokines play an important role in the development of cancer. Several single-nucleotide polymorphisms (SNPs) of cytokine genes have been reported to be associated with the development and severity of inflammatory diseases and cancer predisposition. This study was undertaken to evaluate a possible association of interleukin 2 (IL-2) (- 330A>C) gene polymorphisms with the susceptibility to oral cancer. The SNP in IL-2 (-330A>C) gene was genotyped in 300 oral cancer patients and in similar number of healthy volunteers by polymerase chain reaction (PCR)-restriction fragment length polymorphism and the association of the gene with the disease was evaluated. IL-2 (-330A>C) gene polymorphism was significantly associated with oral cancer whereas it was neither associated with clinicopathological status nor with cancer pain. The AC heterozygous genotype was significantly associated with oral cancer patients as compared to controls [odds ratio (OR): 3.0; confidence interval (CI): 2.14-4.20; P<0.001]. The C allele frequency was also significantly associated with oral cancer (OR: 1.80; CI: 1.39-2.33; P<0.001). IL-2 (-330A>C) gene polymorphism was also associated with oral cancer in tobacco smokers and chewers. Our results showed that oral cancer patients had significantly higher frequency of AA genotype but significantly lower frequency of AC genotype and C allele compared to controls. The IL-2 AC genotype and C allele of IL-2 (-330A>C) gene polymorphisms could be potential protective factors and might reduce the risk of oral cancer in Indian population.

  20. Influences of the G2350A polymorphism in the ACE Gene on cardiac structure and function of ball game players

    PubMed Central

    2012-01-01

    Background Except for the I/D polymorphism in the angiotensin I-converting enzyme (ACE) gene, there were few reports about the relationship between other genetic polymorphisms in this gene and the changes in cardiac structure and function of athletes. Thus, we investigated whether the G2350A polymorphism in the ACE gene is associated with the changes in cardiac structure and function of ball game players. Total 85 healthy ball game players were recruited in this study, and they were composed of 35 controls and 50 ball game players, respectively. Cardiac structure and function were measured by 2-D echocardiography, and the G2350A polymorphism in the ACE gene analyzed by the SNaPshot method. Results There were significant differences in left ventricular mass index (LVmassI) value among each sporting discipline studied. Especially in the athletes of basketball disciplines, indicated the highest LVmassI value than those of other sporting disciplines studied (p < 0.05). However, there were no significant association between any echocardiographic data and the G2350A polymorphism in the ACE gene in the both controls and ball game players. Conclusions Our data suggests that the G2350A polymorphism in the ACE gene may not significantly contribute to the changes in cardiac structure and function of ball game players, although sporting disciplines of ball game players may influence the changes in LVmassI value of these athletes. Further studies using a larger sample size and other genetic markers in the ACE gene will be needed. PMID:22239999

  1. Extensive shared polymorphism at non-MHC immune genes in recently diverged North American prairie grouse

    USGS Publications Warehouse

    Minias, Piotr; Bateson, Zachary W.; Whittingham, Linda A.; Johnson, Jeff A.; Oyler-McCance, Sara J.; Dunn, Peter O.

    2018-01-01

    Gene polymorphisms shared between recently diverged species are thought to be widespread and most commonly reflect introgression from hybridization or retention of ancestral polymorphism through incomplete lineage sorting. Shared genetic diversity resulting from incomplete lineage sorting is usually maintained for a relatively short period of time, but under strong balancing selection it may persist for millions of years beyond species divergence (balanced trans-species polymorphism), as in the case of the major histocompatibility complex (MHC) genes. However, balancing selection is much less likely to act on non-MHC immune genes. The aim of this study was to investigate the patterns of shared polymorphism and selection at non-MHC immune genes in five grouse species from Centrocercus and Tympanuchus genera. For this purpose, we genotyped five non-MHC immune genes that do not interact directly with pathogens, but are involved in signaling and regulate immune cell growth. In contrast to previous studies with MHC, we found no evidence for balancing selection or balanced trans-species polymorphism among the non-MHC immune genes. No haplotypes were shared between genera and in most cases more similar allelic variants sorted by genus. Between species within genera, however, we found extensive shared polymorphism, which was most likely attributable to introgression or incomplete lineage sorting following recent divergence and large ancestral effective population size (i.e., weak genetic drift). Our study suggests that North American prairie grouse may have attained relatively low degree of reciprocal monophyly at nuclear loci and reinforces the rarity of balancing selection in non-MHC immune genes.

  2. Genomics of immune response to typhoid and cholera vaccines

    PubMed Central

    Majumder, Partha P.

    2015-01-01

    Considerable variation in antibody response (AR) was observed among recipients of an injectable typhoid vaccine and an oral cholera vaccine. We sought to find whether polymorphisms in genes of the immune system, both innate and adaptive, were associated with the observed variation in response. For both vaccines, we were able to discover and validate several polymorphisms that were significantly associated with immune response. For the typhoid vaccines, these polymorphisms were on genes that belonged to pathways of polysaccharide recognition, signal transduction, inhibition of T-cell proliferation, pro-inflammatory signalling and eventual production of antimicrobial peptides. For the cholera vaccine, the pathways included epithelial barrier integrity, intestinal homeostasis and leucocyte recruitment. Even though traditional wisdom indicates that both vaccines should act as T-cell-independent antigens, our findings reveal that the vaccines induce AR using different pathways. PMID:25964454

  3. The Role of the Asn40Asp Polymorphism of the Mu Opioid Receptor Gene (OPRM1) on Alcoholism Etiology and Treatment: A Critical Review

    PubMed Central

    Ray, Lara A.; Barr, Christina S.; Blendy, Julie A.; Oslin, David; Goldman, David; Anton, Raymond F.

    2011-01-01

    The endogenous opioid system has been implicated in the pathophysiology of alcoholism as it modulates the neurobehavioral effects of alcohol. A variant in the mu opioid receptor gene (OPRM1), the Asn40Asp polymorphism, has received attention as a functional variant that may influence a host of behavioral phenotypes for alcoholism as well as clinical response to opioid antagonists. This paper will review converging lines of evidence on the effect of the Asn40Asp SNP on alcoholism phenotypes, including: (i) genetic association studies; (ii) behavioral studies of alcoholism; (iii) neuroimaging studies; (iv) pharmacogenetic studies and clinical trials; and (v) preclinical animal studies. Together, these lines of research seek to elucidate the effects of this functional polymorphism on alcoholism etiology and treatment response. PMID:21895723

  4. Polymorphism and selection in the major histocompatibility complex DRA and DQA genes in the family Equidae.

    PubMed

    Janova, Eva; Matiasovic, Jan; Vahala, Jiri; Vodicka, Roman; Van Dyk, Enette; Horin, Petr

    2009-07-01

    The major histocompatibility complex genes coding for antigen binding and presenting molecules are the most polymorphic genes in the vertebrate genome. We studied the DRA and DQA gene polymorphism of the family Equidae. In addition to 11 previously reported DRA and 24 DQA alleles, six new DRA sequences and 13 new DQA alleles were identified in the genus Equus. Phylogenetic analysis of both DRA and DQA sequences provided evidence for trans-species polymorphism in the family Equidae. The phylogenetic trees differed from species relationships defined by standard taxonomy of Equidae and from trees based on mitochondrial or neutral gene sequence data. Analysis of selection showed differences between the less variable DRA and more variable DQA genes. DRA alleles were more often shared by more species. The DQA sequences analysed showed strong amongst-species positive selection; the selected amino acid positions mostly corresponded to selected positions in rodent and human DQA genes.

  5. Association of polymorphisms in microRNA-binding sites and colorectal cancer in an Iranian population.

    PubMed

    Azimzadeh, Pedram; Romani, Sara; Mohebbi, Seyed Reza; Mahmoudi, Touraj; Vahedi, Mohsen; Fatemi, Seyed Reza; Zali, Narges; Zali, Mohammad Reza

    2012-10-01

    MicroRNAs (miRNAs) are agents of post-transcriptional gene expression, and they can affect many functions of an individual cell or tissue from extracellular matrix production to inflammatory processes and tumor development. We aimed to determine the possible role of miRNA-binding site polymorphisms located in five cancer-related genes: IL-16, CDKN2A (p16), RAF1, PTGER4, and ITGB4 in colorectal cancer (CRC) risk modification in an Iranian population. This study was performed on 643 individuals (249 CRC cases and 394 healthy controls). We selected five cancer-related genes (IL-16, CDKN2A (p16), RAF1, PTGER4, and ITGB4) and investigated the genotypes of the 3' untranslated region miRNA-binding site polymorphisms in these genes in our study population. The restriction fragment length polymorphism results were confirmed by a direct sequencing method. We found a statistically significant difference between the rs1131445 polymorphism of the IL-16 gene and CRC. The frequencies of the genotypes TT, CT, and CC in controls were 51%, 40.4%, and 8.6%, respectively, and in cases were 41.4%, 44.1%, and 14.5%, respectively, which shows a significant association between the CC genotype of the rs1131445 polymorphism and CRC (P = 0.004). The frequency of the C allele in the CRC group was higher than in the controls, and the C allele of the rs1131445 polymorphism was found to be in association with CRC (P = 0.009). These associations remained significant after Bonferroni's correction for multiple testing. We found that the AA genotype of the rs743554 polymorphism in the ITGB4 gene and the T allele of the rs1051208 polymorphism of the RAF1 gene were associated with the risk of CRC in females; however, after Bonferroni's correction we found that they were non-significant. Finally, we can conclude that a significant relationship exists between the miRNA-binding site polymorphism of the IL-16 gene and CRC risk in the Iranian population. Copyright © 2012 Elsevier Inc. All rights reserved.

  6. Methylenetetrahydrofolate reductase gene polymorphisms contribute to acute myeloid leukemia and chronic myeloid leukemia susceptibilities: evidence from meta-analyses.

    PubMed

    He, Hairong; He, Gonghao; Wang, Taotao; Cai, Jiangxia; Wang, Yan; Zheng, Xiaowei; Dong, Yalin; Lu, Jun

    2014-10-01

    The expression of methylenetetrahydrofolate reductase (MTHFR) is associated with acute myeloid leukemia (AML) and chronic myeloid leukemia (CML). Most studies have linked the common functional C677T and A1298C polymorphisms of the MTHFR gene and susceptibility to AML and CML, but the results were not consistent. The aim of the present study was to derive a more precise estimation of the relationship. Meta-analyses assessing the association of MTHFR C677T and A1298C variations with AML and CML were conducted. Eligible articles were identified from the PubMed and EMBASE databases. All statistical analyses were conducted using Review Manager Software. 10 and 10 studies were included in the meta-analysis about the role of C677T polymorphism on the AML and CML risks, respectively; 6 and 4 studies were included about the role of A1298C polymorphism on the AML and CML risks, respectively. Overall, both the C677T and A1298C polymorphisms were significantly associated with CML risk under the recessive model (P=0.04, OR=1.35, 95% CI=1.02-1.79 for C677T and P=0.003, OR=2.17, 95% CI=1.29-3.63 for A1298C). In addition, the risk of CML was higher in 1298CC genotype carriers than in 1298AA genotype carriers (P=0.004, OR=2.17, 95%=1.28-3.69). Conversely, the overall data failed to indicate a significant association of C677T or A1298C polymorphisms with AML risk under any model. The findings provide evidence that C677T and A1298C polymorphisms are risk factors for CML risk. Copyright © 2014 Elsevier Ltd. All rights reserved.

  7. Role of TNF-α -308G/A gene polymorphism in gastric cancer risk: A case control study and meta-analysis.

    PubMed

    Du, Li Chuan; Gao, Ru

    2017-07-01

    In the Chinese population, gastric cancer (GC) is ranked as the third most common type of cancer. Although the exact etiology of GC development is unclear, several factors, including genetic and environmental, have been identified as risk factors. Variations in cytokine genes and their receptors have been related to a higher risk of GC. A single nucleotide polymorphism in the promoter region of tumor necrosis factor-α (TNF-α) (-308G>A) has been associated with a higher risk of GC and in the present study we evaluated its possible association with GC in a Chinese cohort. In addition, we performed a meta-analysis to draw a firm conclusion about the association between TNF-α gene polymorphisms and GC. We enrolled 400 Chinese GC patients and matched healthy controls hailing from similar geographical areas. The TNF-α -308G/A polymorphism was genotyped by allele-specific polymerase chain reaction (AS-PCR). For the meta-analysis, earlier published articles were searched and eligible studies were included. Prevalence of the heterozygous mutant (GA) and minor allele (A) were significantly higher in GC cases compared to healthy controls (GA: p<0.0001, odds ratio (OR)=4.90; A: p<0.0001, OR=2.84). A total of 36 eligible studies including the present report, encompassing of 8353 GC patients and 12099 controls, were analyzed for the meta-analysis. A significant association of the TNF-α polymorphism (-308G>A) with susceptibility to GC was only found in the Caucasian population (A vs G: p=0.001; AA vs GG: p=0.01; AG vs GG: p<0.0001; AA vs AG+GG: p=0.01; AA+AG vs p=0.003). The results of the present case control study and meta-analysis showed that associations between TNF-a variants with susceptibility to GC development is population and ethnic specific.

  8. Genetic susceptibility to renal scar formation after urinary tract infection: a systematic review and meta-analysis of candidate gene polymorphisms.

    PubMed

    Zaffanello, Marco; Tardivo, Stefano; Cataldi, Luigi; Fanos, Vassilios; Biban, Paolo; Malerba, Giovanni

    2011-07-01

    Identifying patients who may develop renal scarring after urinary tract infections (UTI) remains challenging, as clinical determinants explain only a portion of individual risk. An additional factor that likely affects risk is individual genetic variability. We searched for peer-reviewed articles from 1980 to December 2009 in electronic databases that reported results showing an association between gene polymorphims and renal scaring after UTI. Two independent researchers screened articles using predetermined criteria. Studies were assessed for methodological quality using an aggregate scoring system. The 18 studies ultimately included in the review had investigated 16 polymorphisms in nine genes in association with renal scarring formation after UTI. Based on the predetermined criteria for assessing the quality of the studies, 12 studies (67%) were identified as being of poor quality design. A meta-analysis of cumulative studies showed on association between renal scarring formation after UTI and the angiotensin converting enzyme insertion/deletion polymorphism [ACE I/D; recessive model for D allele; odds ratio (OR) 1.73, 95% confidence interval (CI) 1.09-2.74, P = 0.02] or transforming growth factor (TGF)-β1 c.-509 T > C polymorphism (dominant model for T allele; OR 2.24, 95% CI 1.34-3.76, P = 0.002). However, heterogeneity among studies was large, indicating a strong difference that cannot only be explained by differences in study design. The studies reviewed in this article support a modest involvement of the vasomotor and inflammatory genes in the development of renal scarring after UTIs. This review also shows that only few possible candidate genes have been investigated for an association with renal scarring, raising the hypothesis that some gene polymorphisms may exert their effects through an interaction with as yet uninvestigated factors that may be related to geographic and/or socio-economic differences.

  9. Cytokine gene polymorphisms in Italian preterm infants: association between interleukin-10 -1082 G/A polymorphism and respiratory distress syndrome.

    PubMed

    Capasso, Mario; Avvisati, Rosa Anna; Piscopo, Carmelo; Laforgia, Nicola; Raimondi, Francesco; de Angelis, Filomena; Iolascon, Achille

    2007-03-01

    In this study, we determined the genotype frequencies of polymorphisms of cytokine genes and investigated their association with the risk of respiratory distress syndrome (RDS) in preterm infants. Genetic polymorphisms in the cytokines interleukin (IL)-10, IL-8, and tumor necrosis factor (TNF) alpha, were studied in 342 white Italian newborns (112 without RDS, 66 prematurely born with RDS, and 164 infants born at term who were included as healthy controls). The polymorphisms were analyzed by polymerase chain reaction (PCR) restriction fragment length polymorphism (RFLP). The IL-10 mRNA levels were analyzed according to genotype by quantitative real-time PCR (QRT-PCR) in Epstein-Barr virus-transformed lymphoblastoid cell lines (EBV-LCLs) of 42 full-term healthy infants. Logistic regression analysis demonstrated the risk of RDS to be significantly lower in preterm infants with an IL-10 -1082 GG/GA genotype than in those with an AA genotype [odds ratio (OR) = 0.48, 95% confidence interval (CI): 0.24-0.95, p = 0.03]. QRT-PCR analyses showed that the IL-10 mRNA levels were significantly higher in 27 IL-10 -1082 GG/GA carriers compared with 15 IL-10 -1082 AA carriers (p = 0.03). We conclude that the IL-10 -1082 GG/GA polymorphism may have a role in RDS development in premature infants.

  10. Polymorphisms in the type I deiodinase gene and frontal function in recurrent depressive disorder.

    PubMed

    Gałecka, Elżbieta; Talarowska, Monika; Orzechowska, Agata; Górski, Paweł; Szemraj, Janusz

    2016-09-01

    Significant impairment of some psychological functions, including cognitive functioning, has been characteristically found in depressed patients. Memory disturbances may be related to the levels of thyroid hormones (TH) that are under the influence of different mechanisms and molecules, including deiodinase type 1(D1) - an important determinant of circulating triiodothyronine (T3). We investigated the relationship between two functionally known polymorphisms within the DIO1 gene, i.e. DIO1a-C/T and DIO1b-A/G, and cognitive functioning in patients diagnosed with recurrent depressive disorder (rDD). In the planned analysis we mainly concentrated on the frontal function: working memory, executive functions and verbal fluency. Genetic variants were genotyped in 128 patients using a method based on polymerase chain reaction (PCR). Cognitive functions were assessed by the Trail Making Test, the Stroop Test and the Verbal Fluency Test (VFT). No significant associations were found between DIO1 polymorphisms and cognitive functioning in rDD. Only the CT and TT genotypes of the DIO1a variant were significantly related to verbal fluency. There were no significant differences between the distribution of the genotypes and demographic/medical variables. Based on the study, the examined polymorphisms are not an important risk or protective factor for cognitive impairment in depressive patients. Functional variants within the DIO1 gene that affect triiodothyronine (T3) levels seem not to be associated with cognitive functions. Nevertheless, considering the fact that the DIO1 gene is related to the course and management of depression, further studies on a larger sample size might be suggested. Copyright © 2016 Medical University of Bialystok. Published by Elsevier Urban & Partner Sp. z o.o. All rights reserved.

  11. Association of Interleukin-1 gene clusters polymorphisms with primary open-angle glaucoma: a meta-analysis.

    PubMed

    Li, Junhua; Feng, Yifan; Sung, Mi Sun; Lee, Tae Hee; Park, Sang Woo

    2017-11-28

    Previous studies have associated the Interleukin-1 (IL-1) gene clusters polymorphisms with the risk of primary open-angle glaucoma (POAG). However, the results were not consistent. Here, we performed a meta-analysis to evaluate the role of IL-1 gene clusters polymorphisms in POAG susceptibility. PubMed, EMBASE and Cochrane Library (up to July 15, 2017) were searched by two independent investigators. All case-control studies investigating the association between single-nucleotide polymorphisms (SNPs) of IL-1 gene clusters and POAG risk were included. Odds ratios (ORs) with 95% confidence intervals (CIs) were calculated for quantifying the strength of association that has been involved in at least two studies. Five studies on IL-1β rs16944 (c. -511C > T) (1053 cases and 986 controls), 4 studies on IL-1α rs1800587 (c. -889C > T) (822 cases and 714 controls), and 4 studies on IL-1β rs1143634 (c. +3953C > T) (798 cases and 730 controls) were included. The results suggest that all three SNPs were not associated with POAG risk. Stratification analyses indicated that the rs1143634 has a suggestive associated with high tension glaucoma (HTG) under dominant (P = 0.03), heterozygote (P = 0.04) and allelic models (P = 0.02), however, the weak association was nullified after Bonferroni adjustments for multiple tests. Based on current meta-analysis, we indicated that there is lack of association between the three SNPs of IL-1 and POAG. However, this conclusion should be interpreted with caution and further well designed studies with large sample-size are required to validate the conclusion as low statistical powers.

  12. No association between the sigma receptor type 1 gene and schizophrenia: results of analysis and meta-analysis of case-control studies

    PubMed Central

    Uchida, Naohiko; Ujike, Hiroshi; Nakata, Kenji; Takaki, Manabu; Nomura, Akira; Katsu, Takeshi; Tanaka, Yuji; Imamura, Takaki; Sakai, Ayumu; Kuroda, Shigetoshi

    2003-01-01

    Background Several lines of evidence have supported possible roles of the sigma receptors in the etiology of schizophrenia and mechanisms of antipsychotic efficacy. An association study provided genetic evidence that the sigma receptor type 1 gene (SIGMAR1) was a possible susceptibility factor for schizophrenia, however, it was not replicated by a subsequent study. It is necessary to evaluate further the possibility that the SIGMAR1 gene is associated with susceptibility to schizophrenia. Methods A case-control association study between two polymorphisms of the SIGMAR1 gene, G-241T/C-240T and Gln2Pro, and schizophrenia in Japanese population, and meta-analysis including present and previous studies. Results There was no significant association of any allele or genotype of the polymorphisms with schizophrenia. Neither significant association was observed with hebephrenic or paranoid subtype of schizophrenia. Furthermore, a meta-analysis including the present and previous studies comprising 779 controls and 636 schizophrenics also revealed no significant association between the SIGMAR1 gene and schizophrenia. Conclusion In view of this evidence, it is likely that the SIGMAR1 gene does not confer susceptibility to schizophrenia. PMID:14567761

  13. No association between the sigma receptor type 1 gene and schizophrenia: results of analysis and meta-analysis of case-control studies.

    PubMed

    Uchida, Naohiko; Ujike, Hiroshi; Nakata, Kenji; Takaki, Manabu; Nomura, Akira; Katsu, Takeshi; Tanaka, Yuji; Imamura, Takaki; Sakai, Ayumu; Kuroda, Shigetoshi

    2003-10-21

    Several lines of evidence have supported possible roles of the sigma receptors in the etiology of schizophrenia and mechanisms of antipsychotic efficacy. An association study provided genetic evidence that the sigma receptor type 1 gene (SIGMAR1) was a possible susceptibility factor for schizophrenia, however, it was not replicated by a subsequent study. It is necessary to evaluate further the possibility that the SIGMAR1 gene is associated with susceptibility to schizophrenia. A case-control association study between two polymorphisms of the SIGMAR1 gene, G-241T/C-240T and Gln2Pro, and schizophrenia in Japanese population, and meta-analysis including present and previous studies. There was no significant association of any allele or genotype of the polymorphisms with schizophrenia. Neither significant association was observed with hebephrenic or paranoid subtype of schizophrenia. Furthermore, a meta-analysis including the present and previous studies comprising 779 controls and 636 schizophrenics also revealed no significant association between the SIGMAR1 gene and schizophrenia. In view of this evidence, it is likely that the SIGMAR1 gene does not confer susceptibility to schizophrenia.

  14. Systematic study of association of four GABAergic genes: glutamic acid decarboxylase 1 gene, glutamic acid decarboxylase 2 gene, GABA(B) receptor 1 gene and GABA(A) receptor subunit beta2 gene, with schizophrenia using a universal DNA microarray.

    PubMed

    Zhao, Xu; Qin, Shengying; Shi, Yongyong; Zhang, Aiping; Zhang, Jing; Bian, Li; Wan, Chunling; Feng, Guoyin; Gu, Niufan; Zhang, Guangqi; He, Guang; He, Lin

    2007-07-01

    Several studies have suggested the dysfunction of the GABAergic system as a risk factor in the pathogenesis of schizophrenia. In the present study, case-control association analysis was conducted in four GABAergic genes: two glutamic acid decarboxylase genes (GAD1 and GAD2), a GABA(A) receptor subunit beta2 gene (GABRB2) and a GABA(B) receptor 1 gene (GABBR1). Using a universal DNA microarray procedure we genotyped a total of 20 SNPs on the above four genes in a study involving 292 patients and 286 controls of Chinese descent. Statistically significant differences were observed in the allelic frequencies of the rs187269C/T polymorphism in the GABRB2 gene (P=0.0450, chi(2)=12.40, OR=1.65) and the -292A/C polymorphism in the GAD1 gene (P=0.0450, chi(2)=14.64 OR=1.77). In addition, using an electrophoretic mobility shift assay (EMSA), we discovered differences in the U251 nuclear protein binding to oligonucleotides representing the -292 SNP on the GAD1 gene, which suggests that the -292C allele has reduced transcription factor binding efficiency compared with the 292A allele. Using the multifactor-dimensionality reduction method (MDR), we found that the interactions among the rs187269C/T polymorphism in the GABRB2 gene, the -243A/G polymorphism in the GAD2 gene and the 27379C/T and 661C/T polymorphisms in the GAD1 gene revealed a significant association with schizophrenia (P<0.001). These findings suggest that the GABRB2 and GAD1 genes alone and the combined effects of the polymorphisms in the four GABAergic system genes may confer susceptibility to the development of schizophrenia in the Chinese population.

  15. C677T (RS1801133 ) MTHFR gene polymorphism frequency in a colombian population.

    PubMed

    Romero-Sánchez, Consuelo; Gómez-Gutierrez, Alberto; Gómez, Piedad Elena; Casas-Gomez, Maria Consuelo; Briceño, Ignacio

    2015-01-01

    Abnormal levels of the enzyme methylenetetrahydrofolate reductase (MTHFR) are associated with an increased risk of both cardiovascular and cerebrovascular disease and higher concentrations of homocysteine. Abnormal levels are also related to birth defects, pregnancy complications, cancer and toxicity to methotrexate (MTX). Polymorphisms of MTHFR affect the activity of the enzyme. Genetic associations have been related to treatment efficacy. To establish the frequency of the C> T polymorphism at nucleotide 677 of the MTHFR gene in a group of Colombian individuals. Data from pharmacogenetic microarrays that include MTX sensibility-associated polymorphisms were retrospectively collected (Pathway Genomics(®)). The frequency of the C> T MTHFR rs1801133 marker polymorphism was analyzed. Microarray data from 68 men and 84 women were analyzed. Comparisons of genotype C/C vs. C/T and T/T were statistically significantly different (p= 0.00, p= 0.026, respectively), as were C/T and T / T (p= 0.0001). Results for the C/C and C/T genotypes in a Colombian population are similar to other previously studied groups of healthy subjects. Subjects from our population might be at risk of developing diseases associated with MTHFR polymorphisms and might present toxicity and adverse effects if treated with MTX, which suggests the need to evaluate therapeutic alternatives based on individual pharmacogenetic studies.

  16. Plasminogen activator inhibitor-1 -675 4G/5G polymorphism and polycystic ovary syndrome risk: a meta analysis.

    PubMed

    Liu, Ying; Sun, Mei-Guo; Jiang, Rong; Ding, Rui; Che, Zhen; Chen, Yan-Yan; Yao, Ci-Jiang; Zhu, Xiao-Xia; Cao, Ji-Yu

    2014-03-01

    Several studies have reported that excessive amounts of plasminogen activator inhibitor-1(PAI-1) might increase the incidence of polycystic ovary syndrome(PCOS), but so far the published results were inconsistent. The aim of this study was to further investigate the association between PAI-1 gene polymorphism and the susceptibility to PCOS by performing a meta-analysis. A comprehensive literature search for relevant studies was conducted on google scholar, PubMed, the Chinese National Knowledge Infrastructure (CNKI) and the Chinese Biomedical Literature Database (CBM). This meta-analysis was performed using the STATA 11.0 software and the pooled odds ratio (OR) with 95% confidence interval (CI) was calculated. Ten case-control studies were included in this meta-analysis with a total of 2,079 cases and 1,556 controls. The results showed that PAI-1 -675 4G/5G polymorphism may increase the risk of PCOS, especially among Asian populations. However, there was no statistically significant association between the polymorphism and PCOS risk in Caucasians. Our meta-analysis suggests that PAI-1 -675 4G/5G polymorphism may contribute to increasing susceptibility to PCOS in Asians. Detection of the PAI-1 gene polymorphism might be a promising biomarker for the susceptibility of PCOS.

  17. Methods for detection of ataxia telangiectasia mutations

    DOEpatents

    Gatti, Richard A.

    2005-10-04

    The present invention is directed to a method of screening large, complex, polyexonic eukaryotic genes such as the ATM gene for mutations and polymorphisms by an improved version of single strand conformation polymorphism (SSCP) electrophoresis that allows electrophoresis of two or three amplified segments in a single lane. The present invention also is directed to new mutations and polymorphisms in the ATM gene that are useful in performing more accurate screening of human DNA samples for mutations and in distinguishing mutations from polymorphisms, thereby improving the efficiency of automated screening methods.

  18. Modified SSCP method using sequential electrophoresis of multiple nucleic acid segments

    DOEpatents

    Gatti, Richard A.

    2002-10-01

    The present invention is directed to a method of screening large, complex, polyexonic eukaryotic genes such as the ATM gene for mutations and polymorphisms by an improved version of single strand conformation polymorphism (SSCP) electrophoresis that allows electrophoresis of two or three amplified segments in a single lane. The present invention also is directed to new mutations and polymorphisms in the ATM gene that are useful in performing more accurate screening of human DNA samples for mutations and in distinguishing mutations from polymorphisms, thereby improving the efficiency of automated screening methods.

  19. Role of the VDR Bsm I and Apa I polymorphisms in the risk of colorectal cancer in Kashmir.

    PubMed

    Rasool, Sabha; Kadla, Showkat A; Rasool, Vamiq; Qazi, Falak; Khan, Tanzeela; Shah, Nisar A; Ganai, Bashir A

    2014-01-01

    A case-control study aiming to evaluate the relationship between Bsm I and Apa I restriction fragment gene polymorphisms and colorectal cancer (CRC) was carried out in Kashmir, including a total of 368 subjects (180 cases and 188 controls). DNA samples extracted from the blood of the subjects were analyzed for 3' untranslated region (3' UTR) Apa I and Bsm I polymorphisms using restriction fragment length polymorphism-polymerase chain reaction (RFLP-PCR). A statistically significant 2.7-fold increased risk was observed in individuals found homozygous for the presence of the 'b' allele, in comparison to subjects homozygous for the 'B' allele (odds ratio (OR) 2.7, 95% confidence interval (CI) 1.49-4.86 (Bsm I)), and a statistically insignificant 2-fold increased risk was found among individuals with the 'aa' genotype, as compared to subjects with the 'AA' genotype (OR 2.017, 95% CI 0.86-4.7). Our study also yielded statistically significant results when the Apa I polymorphism was stratified by age (≤ 50 years) and dwelling area (rural area), and the Bsm I polymorphism by gender (male gender), suggesting a possible role of Apa I and Bsm I polymorphisms in the etiology of CRC in Kashmir. We conclude that Apa I and Bsm I single-nucleotide polymorphisms (SNPs) in the vitamin D receptor gene (VDR) might be associated with susceptibility to CRC among Kashmiris. © 2014 S. Karger GmbH, Freiburg.

  20. Polymorphisms of interleukin-1β and MUC7 genes in burning mouth syndrome.

    PubMed

    Kim, Moon-Jong; Kim, Jihoon; Chang, Ji-Youn; Kim, Yoon-Young; Kho, Hong-Seop

    2017-04-01

    The objectives of the present study are to compare polymorphisms of the IL-1β and MUC7 genes between patients with burning mouth syndrome (BMS) and controls and to investigate relationships between these polymorphisms and clinical characteristics in BMS patients. Forty female BMS patients and 40 gender- and age-matched controls were included. Genomic DNA was extracted from saliva samples. Single-nucleotide polymorphisms of IL-1β -511 and +3954 and variation in number of tandem repeat (VNTR) polymorphism of MUC7 were analyzed. Relationships between genotypic polymorphism data and clinical characteristics in BMS patients were also analyzed. There were no significant differences in the genotypes of IL-1β -511 and +3954 and of MUC7 between the groups. There were no significant differences in symptom duration and intensity of BMS patients according to their IL-1β and MUC7 genotypes. The T allele of IL-1β -511 showed associations with psychometry results in BMS patients: paranoid ideation (P = 0.014), Global Severity Index (P = 0.025), and Positive Symptom Total (P = 0.008). The genotypic polymorphisms of IL-1β -511 and +3954, and of MUC7 VNTR, had no direct associations with the development of BMS. However, the T allele of IL-1β -511 may increase the risk of BMS by increasing psychological asthenia. The genotypic polymorphisms of IL-1β -511 may increase the risk for the development of BMS by increasing psychological asthenia.

  1. Glutathione S-transferase gene polymorphisms (GSTM1, GSTT1, and GSTP1) in Egyptian pediatric patients with sickle cell disease.

    PubMed

    Shiba, Hala Fathy; El-Ghamrawy, Mona Kamal; Shaheen, Iman Abd El-Mohsen; Ali, Rasha Abd El-Ghani; Mousa, Somaia Mohammed

    2014-01-01

    Sickle cell disease (SCD) complications are associated with oxidative stress. Glutathione S-transferases (GSTs) are a group of enzymes that protect against oxidative stress. The aims of this study was to evaluate the prevalence of GSTM1, GSTT1, and GSTP1 gene polymorphisms among homozygous sickle cell anemia patients and to investigate the possible association between the presence of these polymorphisms and SCD severity and complications. Genotyping the polymorphisms in GSTT1 and GSTM1 genes was performed using the multiplex polymerase chain reaction (PCR) method. The GSTP1 ILe105Val polymorphism was determined using PCR-restriction fragment length polymorphism. GSTM1 null genotype was significantly associated with increased risk of severe vaso-occlusive crises (VOC) (odds ratio  =  1.52, 95% confidence interval  =  0.42-5.56, P  =  0.005). We found no significant association between GST genotypes and frequency of sickle cell-related pain, transfusion frequency, disease severity, or hydroxyurea treatment. GSTM1 gene polymorphism may be associated with risk of severe VOC among Egyptian SCD patients.

  2. A polymorphism (rs1042522) in TP53 gene is a risk factor for Down Syndrome in Sicilian mothers.

    PubMed

    Salemi, Michele; Barone, Concetta; Salluzzo, Maria Grazia; Giambirtone, Mariaconcetta; Scillato, Francesco; Galati Rando, Rosanna; Romano, Carmelo; Morale, Maria Concetta; Ridolfo, Federico; Romano, Corrado

    2017-11-01

    Trisomy 21 is the most frequent genetic cause of intellectual disability. Tumor Protein 53 (TP53) gene down-regulation triggers chromosomal instability. A TP53 gene polymorphism c.215G > C (rs1042522) is associated with accumulation of aneuploid cells. We analyzed the TP53 c.215G > C (rs1042522) polymorphism in Sicilian mothers of subjects with Down Syndrome (DS) within a case-control study. Nucleotide polymorphism was detected by pyrosequencing technology. The distribution of TP53 c.215G > C polymorphism showed significant difference between mothers of subjects with DS and controls. Our data show that TP53 c.215G > C polymorphism is a risk factor for DS in Sicilian mothers.

  3. Relation between glutathione S-transferase genes (GSTM1, GSTT1, and GSTP1) polymorphisms and clinical manifestations of sickle cell disease in Egyptian patients.

    PubMed

    Ellithy, Hend N; Yousri, Sherif; Shahin, Gehan H

    2015-12-01

    Clinical manifestations of sickle cell disease (SCD) result from sickling of Hb S due to oxidation, which is augmented by accumulation of oxygen-free radicals. Deficiencies in normal antioxidant protective mechanism might lead to clinical manifestations of SCD like vaso-occlusive crisis (VOC) and acute chest syndrome (ACS). The glutathione system plays an important role in the removal of endogenous products of peroxidation of lipids, thus protecting cells and tissue against damage from oxidative stress. Impairment of the glutathione system due to genetic polymorphisms of glutathione S-transferase (GST) genes is expected to increase the severity of SCD manifestations. This report describes a case control study aimed at studying the ethnic-dependent variation in the frequency of GST gene polymorphisms among participants selected from the Egyptian population and to find out the association between GST gene polymorphisms and the severity of SCD manifestations. We measured the frequency distribution of the three GSTs gene polymorphisms in 100 Egyptian adult SCD patients and 80 corresponding controls. GSTM1 and GSTT1 genotypes were determined by multiplex polymerase chain reaction (PCR). GSTP1 genotyping was conducted with a PCR-restriction fragment length polymorphism assay. The GSTM1 null genotype was significantly associated with ACS and VOC (P = 0.03 and 0.01, respectively). The GSTT1 null genotype was associated with significantly increased requirement of blood transfusion (P = 0.01). Absence of both GSTM1 and GSTT1 genes was significantly associated with pulmonary hypertension (P = 0.04). The non-wild-type GSTP1 polymorphism was not associated with clinical manifestations of SCD. Some GST gene polymorphisms were significantly associated with the worsening of the clinical manifestations of SCD.

  4. Impact of DNA repair genes polymorphism (XPD and XRCC1) on the risk of breast cancer in Egyptian female patients.

    PubMed

    Hussien, Yousry Mostafa; Gharib, Amal F; Awad, Hanan A; Karam, Rehab A; Elsawy, Wael H

    2012-02-01

    The genes involved in DNA repair system play a crucial role in the protection against mutations. It has been hypothesized that functional deficiencies in highly conserved DNA repair processes resulting from polymorphic variation may increase genetic susceptibility to breast cancer (BC). The aim of the present study was to evaluate the association of genetic polymorphisms in 2 DNA repair genes, XPD (Asp312Asn) and XRCC1 (A399G), with BC susceptibility. We further investigated the potential combined effect of these DNA repair variants on BC risk. Both XPD (xeroderma pigmentosum group D) and XRCC1 (X-ray repair cross-complementing group 1) polymorphisms were characterized in 100 BC Egyptian females and 100 healthy women who had no history of any malignancy by amplification refractory mutation system-polymerase chain reaction (ARMS-PCR) method and PCR with confronting two-pair primers (PCR-CTPP), using DNA from peripheral blood in a case control study. Our results revealed that the frequencies of AA genotype of XPD codon 312 polymorphism were significantly higher in the BC patients than in the normal individuals (P ≤ 0.003), and did not observe any association between the XRCC1 Arg399Gln polymorphism and risk of developing BC. Also, no association between both XPD Asp312Asn and XRCC1 A399G polymorphisms and the clinical characteristics of disease. Finally, the combination of AA(XPD) + AG(XRCC1) were significantly associated with BC risk. Our results suggested that, XPD gene is an important candidate gene for susceptibility to BC. Also, gene-gene interaction between XPD(AA) + XRCC1(AG) polymorphism may be associated with increased risk of BC in Egyptian women.

  5. New polymorphisms of Xeroderma Pigmentosum DNA repair genes in myelodysplastic syndrome.

    PubMed

    Santiago, Sabrina Pinheiro; Junior, Howard Lopes Ribeiro; de Sousa, Juliana Cordeiro; de Paula Borges, Daniela; de Oliveira, Roberta Taiane Germano; Farias, Izabelle Rocha; Costa, Marília Braga; Maia, Allan Rodrigo Soares; da Nóbrega Ito, Mayumi; Magalhães, Silvia Maria Meira; Pinheiro, Ronald Feitosa

    2017-07-01

    The association between Xeroderma Pigmentosum DNA repair genes (XPA rs1800975, XPC rs2228000, XPD rs1799793 and XPF rs1800067) polymorphisms and myelodysplastic syndrome (MDS) have not been reported. To assess the functional role between these polymorphisms and MDS, we evaluated 189 samples stratified in two groups: 95 bone marrow samples from MDS patients and 94 from healthy elderly volunteers used as controls. Genotypes for all polymorphisms were identified in DNA samples in an allelic discrimination experiment by real-time polymerase chain reaction (qPCR). We also studied the mRNA expression of XPA and XPC genes to evaluate if its polymorphisms were functional in 53 RNAm MDS patients by qPCR methodologies. To the rs2228000 polymorphism, the CT and TT polymorphic genotype were associated with increased odds ratio (OR) of more profound cytopenia (hemoglobin and neutrophils count). To the rs1799793 polymorphism, we found that the GG homozygous wild-type genotype was associated with a decreased chance of developing MDS. We observed low expression of XPA in younger patients, in hypoplastic MDS and patients with abnormal karyotype when presented AG or AA polymorphic genotypes. We also found that there was a statistically significant interaction between the presence of micromegakaryocyte on down regulation of XPC regarding the CT heterozygous genotype of the rs1800975 polymorphism. Our results suggest that new functional polymorphisms of Xeroderma Pigmentosum DNA repair genes in MDS are related to its pathogenesis and prognosis. Copyright © 2017 Elsevier Ltd. All rights reserved.

  6. No association between polymorphisms in the DDC gene and paranoid schizophrenia in a northern Chinese population.

    PubMed

    Zhang, Boyu; Jia, Yanbin; Yuan, Yanbo; Yu, Xin; Xu, Qi; Shen, Yucun; Shen, Yan

    2004-09-01

    Several lines of evidence suggest that dysfunctions of neurotransmitters are associated with schizophrenia. DOPA decarboxylase (DDC) is an enzyme involved directly in the synthesis of dopamine and serotonin, and indirectly in the synthesis of noradrenaline. Therefore, the DDC gene can be considered a candidate gene for schizophrenia. We performed an association study between three single nucleotide polymorphisms in the DDC gene and paranoid schizophrenia. However, in our study no significant differences were found in the genotype distributions and allele frequencies between 80 paranoid schizophrenics and 108 controls for any of the polymorphisms. Neither did the haplotypes of the single nucleotide polymorphisms show any association with paranoid schizophrenia. Therefore, we conclude that the polymorphisms studied do not play a major role in paranoid schizophrenia pathogenesis in the population investigated.

  7. Systems Level Analysis of Systemic Sclerosis Shows a Network of Immune and Profibrotic Pathways Connected with Genetic Polymorphisms

    PubMed Central

    Mahoney, J. Matthew; Taroni, Jaclyn; Martyanov, Viktor; Wood, Tammara A.; Greene, Casey S.; Pioli, Patricia A.; Hinchcliff, Monique E.; Whitfield, Michael L.

    2015-01-01

    Systemic sclerosis (SSc) is a rare systemic autoimmune disease characterized by skin and organ fibrosis. The pathogenesis of SSc and its progression are poorly understood. The SSc intrinsic gene expression subsets (inflammatory, fibroproliferative, normal-like, and limited) are observed in multiple clinical cohorts of patients with SSc. Analysis of longitudinal skin biopsies suggests that a patient's subset assignment is stable over 6–12 months. Genetically, SSc is multi-factorial with many genetic risk loci for SSc generally and for specific clinical manifestations. Here we identify the genes consistently associated with the intrinsic subsets across three independent cohorts, show the relationship between these genes using a gene-gene interaction network, and place the genetic risk loci in the context of the intrinsic subsets. To identify gene expression modules common to three independent datasets from three different clinical centers, we developed a consensus clustering procedure based on mutual information of partitions, an information theory concept, and performed a meta-analysis of these genome-wide gene expression datasets. We created a gene-gene interaction network of the conserved molecular features across the intrinsic subsets and analyzed their connections with SSc-associated genetic polymorphisms. The network is composed of distinct, but interconnected, components related to interferon activation, M2 macrophages, adaptive immunity, extracellular matrix remodeling, and cell proliferation. The network shows extensive connections between the inflammatory- and fibroproliferative-specific genes. The network also shows connections between these subset-specific genes and 30 SSc-associated polymorphic genes including STAT4, BLK, IRF7, NOTCH4, PLAUR, CSK, IRAK1, and several human leukocyte antigen (HLA) genes. Our analyses suggest that the gene expression changes underlying the SSc subsets may be long-lived, but mechanistically interconnected and related to a patients underlying genetic risk. PMID:25569146

  8. The D allele of the angiotensin-converting enzyme (ACE) insertion/deletion (I/D) polymorphism is associated with worse functional outcome of ischaemic stroke.

    PubMed

    Malueka, Rusdy Ghazali; Dwianingsih, Ery Kus; Sutarni, Sri; Bawono, Rheza Gandi; Bayuangga, Halwan Fuad; Gofir, Abdul; Setyopranoto, Ismail

    2017-12-29

    Insertion/deletion polymorphism in ACE gene (ACE I/D) is known to be associated with the occurrence of ischaemic stroke through its effect on pathogenesis of atherosclerosis and hypertension. This study was aimed to examine the association between this polymorphism with functional outcome of ischaemic stroke. This was a cross-sectional study. The subjects were patients with ischaemic stroke in a reference hospital in Yogyakarta, Indonesia. Data on demographic characteristics, stroke risk factors, comorbidities and stroke severity were assessed on admission. The functional outcome, Barthel index (BI), was assessed when the patients were discharged from the hospital. ACE I/D genotypes of the patients were identified by polymerase chain reaction (PCR). In total, 61 patients were included. Of these, 38 patients (62.3%) had II polymorphism, 22 patients (36.1%) had ID polymorphism and 1 patient (1.6%) had DD polymorphism in the ACE gene. There were significant differences in the functional outcomes between patients without D allele (II polymorphisms) and patients with D allele (ID and DD polymorphism) (mean BI on discharge: 75 ± 23.57 and 60.65 ± 27.15, respectively; p = 0.034). Multiple linear regression model showed that the availability of D allele is an independent variable negatively associated with functional outcome as assessed by BI (β = -0.232, p = 0.024). This study showed that the D allele in ACE I/D polymorphism is associated with worse functional outcomes. This highlights the possibility of further research to improve functional outcomes of ischaemic stroke by inhibiting the ACE system.

  9. Pathogen-group specific association between CXCR1 polymorphisms and subclinical mastitis in dairy heifers.

    PubMed

    Verbeke, Joren; Piepers, Sofie; Peelman, Luc; Van Poucke, Mario; De Vliegher, Sarne

    2012-08-01

    The chemokine (C-X-C motif) receptor 1 (CXCR1) gene encodes the homonymous receptor for interleukin 8 (IL8) on polymorphonuclear neutrophilic leucocytes (PMNL). Binding causes migration from blood to milk, activation and prolonged survival of PMNL, a crucial process in the innate immune defence of the bovine mammary gland against invading mastitis-causing pathogens. The main objective of this study was to screen the entire coding region of the CXCR1 gene for polymorphisms and to analyse their association with udder health of dairy heifers. One-hundred-and-forty Belgian Holstein heifers originating from 20 commercial dairy farms were genotyped by DNA sequencing. Detailed phenotypic data on udder health was available including quarter bacteriological culture results and somatic cell count (SCC) in early lactation and composite milk SCC during first lactation. In total, 16 polymorphisms (including 8 missense mutations) were detected. Polymorphism c.980A>G was associated with pathogen-group specific IMI: heifers with genotype AG were less likely to have an IMI due to major mastitis pathogens compared with heifers with genotype GG but did not have less IMI by coagulase-negative staphylococci, so-called minor pathogens. CXCR1 genotype was neither associated with quarter SCC in early lactation nor with composite SCC during lactation. Although mastitis susceptibility is influenced by many factors, some genetic polymorphisms potentially have major effects on udder health of heifers, as was shown here. These results trigger us to further study the relationship between CXCR1 polymorphisms and mastitis susceptibility in both observational and experimental trials.

  10. Insights into the Indian Peanut Genotypes for ahFAD2 Gene Polymorphism Regulating Its Oleic and Linoleic Acid Fluxes

    PubMed Central

    Nawade, Bhagwat; Bosamia, Tejas C.; Thankappan, Radhakrishnan; Rathnakumar, Arulthambi L.; Kumar, Abhay; Dobaria, Jentilal R.; Kundu, Rahul; Mishra, Gyan P.

    2016-01-01

    In peanut (Arachis hypogaea L.), the customization of fatty acid profile is an evolving area to fulfill the nutritional needs in the modern market. A total of 174 peanut genotypes, including 167 Indian cultivars, 6 advanced breeding lines and “SunOleic95R”—a double mutant line, were investigated using AS-PCRs, CAPS and gene sequencing for the ahFAD2 allele polymorphism, along with its fatty acid compositions. Of these, 80 genotypes were found having substitution (448G>A) mutation only in ahFAD2A gene, while none recorded 1-bp insertion (441_442insA) mutation in ahFAD2B gene. Moreover, 22 wild peanut accessions found lacking both the mutations. Among botanical types, the ahFAD2A mutation was more frequent in ssp. hypogaea (89%) than in ssp. fastigiata (17%). This single allele mutation, found affecting not only oleic to linoleic acid fluxes, but also the composition of other fatty acids in the genotypes studied. Repeated use of a few selected genotypes in the Indian varietal development programs were also eminently reflected in its ahFAD2 allele polymorphism. Absence of known mutations in the wild-relatives indicated the possible origin of these mutations, after the allotetraploidization of cultivated peanut. The SNP analysis of both ahFAD2A and ahFAD2B genes, revealed haplotype diversity of 1.05% and 0.95%, while Ka/Ks ratio of 0.36 and 0.39, respectively, indicating strong purifying selection pressure on these genes. Cluster analysis, using ahFAD2 gene SNPs, showed presence of both mutant and non-mutant genotypes in the same cluster, which might be due the presence of ahFAD2 gene families. This investigation provided insights into the large number of Indian peanut genotypes, covering various aspects related to O/L flux regulation and ahFAD2 gene polymorphism. PMID:27610115

  11. Coupling Neurogenetics (GARS™) and a Nutrigenomic Based Dopaminergic Agonist to Treat Reward Deficiency Syndrome (RDS): Targeting Polymorphic Reward Genes for Carbohydrate Addiction Algorithms

    PubMed Central

    Blum, Kenneth; Simpatico, Thomas; Badgaiyan, Rajendra D.; Demetrovics, Zsolt; Fratantonio, James; Agan, Gozde; Febo, Marcelo; Gold, Mark S.

    2016-01-01

    Earlier work from our laboratory, showing anti-addiction activity of a nutraceutical consisting of amino-acid precursors and enkephalinase inhibition properties and our discovery of the first polymorphic gene (Dopamine D2 Receptor Gene [DRD2]) to associate with severe alcoholism serves as a blue-print for the development of “Personalized Medicine” in addiction. Prior to the later genetic finding, we developed the concept of Brain Reward Cascade, which continues to act as an important component for stratification of addiction risk through neurogenetics. In 1996 our laboratory also coined the term “Reward Deficiency Syndrome (RDS)” to define a common genetic rubric for both substance and non-substance related addictive behaviors. Following many reiterations we utilized polymorphic targets of a number of reward genes (serotonergic, Opioidergic, GABAergic and Dopaminergic) to customize KB220 [Neuroadaptogen- amino-acid therapy (NAAT)] by specific algorithms. Identifying 1,000 obese subjects in the Netherlands a subsequent small subset was administered various KB220Z formulae customized according to respective DNA polymorphisms individualized that translated to significant decreases in both Body Mass Index (BMI) and weight in pounds. Following these experiments, we have been successfully developing a panel of genes known as “Genetic Addiction Risk Score” (GARSpDX)™. Selection of 10 genes with appropriate variants, a statistically significant association between the ASI-Media Version-alcohol and drug severity scores and GARSpDx was found A variant of KB220Z in abstinent heroin addicts increased resting state functional connectivity in a putative network including: dorsal anterior cingulate, medial frontal gyrus, nucleus accumbens, posterior cingulate, occipital cortical areas, and cerebellum. In addition, we show that KB220Z significantly activates, above placebo, seed regions of interest including the left nucleus accumbens, cingulate gyrus, anterior thalamic nuclei, hippocampus, pre-limbic and infra-limbic loci. KB220Z demonstrates significant functional connectivity, increased brain volume recruitment and enhanced dopaminergic functionality across the brain reward circuitry. We propose a Reward Deficiency System Solution that promotes early identification and stratification of risk alleles by utilizing GARSDx, allowing for customized nutrigenomic targeting of these risk alleles by altering KB220Z ingredients as an algorithmic function of carrying these polymorphic DNA–SNPS, potentially yielding the first ever nutrigenomic solution for addiction and pain. PMID:27617300

  12. Arylamine N-acetyltransferases: from drug metabolism and pharmacogenetics to drug discovery

    PubMed Central

    Sim, E; Abuhammad, A; Ryan, A

    2014-01-01

    Arylamine N-acetyltransferases (NATs) are polymorphic drug-metabolizing enzymes, acetylating arylamine carcinogens and drugs including hydralazine and sulphonamides. The slow NAT phenotype increases susceptibility to hydralazine and isoniazid toxicity and to occupational bladder cancer. The two polymorphic human NAT loci show linkage disequilibrium. All mammalian Nat genes have an intronless open reading frame and non-coding exons. The human gene products NAT1 and NAT2 have distinct substrate specificities: NAT2 acetylates hydralazine and human NAT1 acetylates p-aminosalicylate (p-AS) and the folate catabolite para-aminobenzoylglutamate (p-abaglu). Human NAT2 is mainly in liver and gut. Human NAT1 and its murine homologue are in many adult tissues and in early embryos. Human NAT1 is strongly expressed in oestrogen receptor-positive breast cancer and may contribute to folate and acetyl CoA homeostasis. NAT enzymes act through a catalytic triad of Cys, His and Asp with the architecture of the active site-modulating specificity. Polymorphisms may cause unfolded protein. The C-terminus helps bind acetyl CoA and differs among NATs including prokaryotic homologues. NAT in Salmonella typhimurium supports carcinogen activation and NAT in mycobacteria metabolizes isoniazid with polymorphism a minor factor in isoniazid resistance. Importantly, nat is in a gene cluster essential for Mycobacterium tuberculosis survival inside macrophages. NAT inhibitors are a starting point for novel anti-tuberculosis drugs. Human NAT1-specific inhibitors may act in biomarker detection in breast cancer and in cancer therapy. NAT inhibitors for co-administration with 5-aminosalicylate (5-AS) in inflammatory bowel disease has prompted ongoing investigations of azoreductases in gut bacteria which release 5-AS from prodrugs including balsalazide. PMID:24467436

  13. Association of interleukin-6 gene polymorphisms with hand osteoarthritis and hand osteoporosis.

    PubMed

    Blumenfeld, Orit; Williams, Frances M K; Valdes, Ana; Hart, Deborah J; Malkin, Ida; Spector, Timothy D; Livshits, Gregory

    2014-09-01

    Several genes, including IL-6 encoding pro-inflammatory cytokines, are involved in development of osteoarthritis and osteoporosis. The association of radiographic hand osteoarthritis (RHOA) and osteoporosis related phenotypes (RHOP) with polymorphisms in IL-6 has been reported inconsistently. The aim of this study was to examine the association, between RHOA and RHOP and IL-6 polymorphisms in two independent samples. Two samples: UK females, including 1440 individuals assessed for RHOA and 3470 assessed for RHOP; Chuvash pedigree including 1499 females and males were assessed for RHOP and RHOA. SNPs were genotyped in the IL-6 genomic region, and used in association analysis with RHOA and RHOP phenotypes. RHOP phenotypes showed similar heritability estimates in both samples, ranging from 34.5 ± 5.5% to 61.0 ± 2.4%. RHOA in Chuvash had substantially lower heritability estimates compared to twins (e.g. OSP scores: 11.8 ± 2.3% vs. 39.2 ± 4.1%) with much higher prevalence and considerably stronger correlation with age (r = 0.811 vs. r = 0.505). RHOA in Chuvash sample may be traumatic in nature, caused by heavy and prolonged manual work related to their private farming. There were a number of statistically significant association results with both types of phenotypes. The most consistent result was obtained for JSN in both samples with SNP from the same haploblock. Their combined probability of no association was only p = 0.000003. Additionally, there were SNPs common for both RHOA and RHOP. We have shown polymorphisms in IL_6 are significantly associated with RHOA and hand RHOP in two samples having different ethnicity and lifestyle. Age × environment × genes interaction appears as an important factor of RHOA manifestation and progression. Copyright © 2014 Elsevier Ltd. All rights reserved.

  14. Association analysis of a polymorphism of the monoamine oxidase B gene with Parkinson`s disease in a Japanese population

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Morimoto, Yuji; Murayama, Nobuhiro; Kuwano, Akira

    1995-12-18

    The polymorphic allele of the monoamine oxidase B (MAO-B) gene detected by polymerase chain reaction (PCR) and single-stranded conformation polymorphism (SSCP) was associated with Parkinson`s disease (PD) in Caucasians. We characterized this polymorphic allele, allele 1, of the MAO-B gene using direct sequencing of PCR products. A single DNA substitution (G-A), resulting gain of Mae III restriction site was detected in intron 13 of the MAO-B gene. The allele associated with PD in Caucasians was twice as frequent as in healthy Japanese, but the association of the allele of the MAO-B gene was not observed in Japanese patients with PD.more » 7 refs., 2 figs., 1 tab.« less

  15. DNA Repair Mechanism Gene, XRCC1A ( Arg194Trp) but not XRCC3 ( Thr241Met) Polymorphism Increased the Risk of Breast Cancer in Premenopausal Females: A Case-Control Study in Northeastern Region of India.

    PubMed

    Devi, K Rekha; Ahmed, Jishan; Narain, Kanwar; Mukherjee, Kaustab; Majumdar, Gautam; Chenkual, Saia; Zonunmawia, Jason C

    2017-12-01

    X-ray repair cross complementary group gene is one of the most studied candidate gene involved in different types of cancers. Studies have shown that X-ray repair cross complementary genes are significantly associated with increased risk of breast cancer in females. Moreover, studies have revealed that X-ray repair cross complementary gene polymorphism significantly varies between and within different ethnic groups globally. The present case-control study was aimed to investigate the association of X-ray repair cross complementary 1A (Arg194Trp) and X-ray repair cross complementary 3 (Thr241Met) polymorphism with the risk of breast cancer in females from northeastern region of India. The present case-control study includes histopathologically confirmed and newly diagnosed 464 cases with breast cancer and 534 apparently healthy neighborhood community controls. Information on sociodemographic factors and putative risk factors were collected from each study participant by conducting face-to-face interviews. Genotyping of X-ray repair cross complementary 1A (Arg194Trp) and X-ray repair cross complementary 3 (Thr241Met) was carried out by polymerase chain reaction-restriction fragment length polymorphism. For statistical analysis, both univariate and multivariate logistic regression analyses were performed. We also performed stratified analysis to find out the association of X-ray repair cross complementary genes with the risk of breast cancer stratified based on menstrual status. This study revealed that tryptophan allele (R/W-W/W genotype) in X-ray repair cross complementary 1A (Arg194Trp) gene significantly increased the risk of breast cancer (adjusted odds ratio = 1.44, 95% confidence interval = 1.06-1.97, P < .05 for R/W-W/W genotype). Moreover, it was found that tryptophan allele (W/W genotype) at codon 194 of X-ray repair cross complementary 1A (Arg194Trp) gene significantly increased the risk of breast cancer in premenopausal females (crude odds ratio = 1.66, 95% confidence interval = 1.11-2.46, P < .05 for R/W-W/W genotype). The present study did not reveal any significant association of X-ray repair cross complementary 3 (Thr241Met) polymorphism with the risk of breast cancer. The present study has explored that X-ray repair cross complementary 1A (Arg194Trp) gene polymorphism is significantly associated with the increased risk of breast cancer in premenopausal females from northeastern region of India which may be beneficial for prognostic purposes.

  16. DNA Repair Mechanism Gene, XRCC1A (Arg194Trp) but not XRCC3 (Thr241Met) Polymorphism Increased the Risk of Breast Cancer in Premenopausal Females: A Case–Control Study in Northeastern Region of India

    PubMed Central

    Ahmed, Jishan; Narain, Kanwar; Mukherjee, Kaustab; Majumdar, Gautam; Chenkual, Saia; Zonunmawia, Jason C.

    2017-01-01

    X-ray repair cross complementary group gene is one of the most studied candidate gene involved in different types of cancers. Studies have shown that X-ray repair cross complementary genes are significantly associated with increased risk of breast cancer in females. Moreover, studies have revealed that X-ray repair cross complementary gene polymorphism significantly varies between and within different ethnic groups globally. The present case–control study was aimed to investigate the association of X-ray repair cross complementary 1A (Arg194Trp) and X-ray repair cross complementary 3 (Thr241Met) polymorphism with the risk of breast cancer in females from northeastern region of India. The present case–control study includes histopathologically confirmed and newly diagnosed 464 cases with breast cancer and 534 apparently healthy neighborhood community controls. Information on sociodemographic factors and putative risk factors were collected from each study participant by conducting face-to-face interviews. Genotyping of X-ray repair cross complementary 1A (Arg194Trp) and X-ray repair cross complementary 3 (Thr241Met) was carried out by polymerase chain reaction-restriction fragment length polymorphism. For statistical analysis, both univariate and multivariate logistic regression analyses were performed. We also performed stratified analysis to find out the association of X-ray repair cross complementary genes with the risk of breast cancer stratified based on menstrual status. This study revealed that tryptophan allele (R/W-W/W genotype) in X-ray repair cross complementary 1A (Arg194Trp) gene significantly increased the risk of breast cancer (adjusted odds ratio = 1.44, 95% confidence interval = 1.06-1.97, P < .05 for R/W-W/W genotype). Moreover, it was found that tryptophan allele (W/W genotype) at codon 194 of X-ray repair cross complementary 1A (Arg194Trp) gene significantly increased the risk of breast cancer in premenopausal females (crude odds ratio = 1.66, 95% confidence interval = 1.11-2.46, P < .05 for R/W-W/W genotype). The present study did not reveal any significant association of X-ray repair cross complementary 3 (Thr241Met) polymorphism with the risk of breast cancer. The present study has explored that X-ray repair cross complementary 1A (Arg194Trp) gene polymorphism is significantly associated with the increased risk of breast cancer in premenopausal females from northeastern region of India which may be beneficial for prognostic purposes. PMID:29332455

  17. Differential expression of heat shock protein (HSP) 70-2 gene polymorphism in benign and malignant pancreatic disorders and its relationship with disease severity and complications.

    PubMed

    Srivastava, Puja; Shafiq, Nusrat; Bhasin, Deepak Kumar; Rana, Surinder Singh; Pandhi, Promila; Behera, Arunanshu; Kapoor, Rakesh; Malhotra, Samir; Gupta, Rajesh

    2012-07-10

    The role of heat shock protein (HSP) 70-2 gene polymorphism (at position 1267, A to G transition) in patients with pancreatic disorders is not clear. To evaluate HSP 70-2 gene polymorphism (at position 1267, A to G transition) in patients with acute and chronic pancreatitis as well as pancreatic carcinoma, and to find any association of this polymorphism with disease complications and severity. One-hundred and fifty patients (50 each of acute, chronic pancreatitis, and pancreatic carcinoma) and 50 healthy blood donors as controls were prospectively studied. Three alleles (AA, AG and GG) of HSP 70-2 gene determined by PstI restriction fragment length polymorphism. There was a statistically significant difference in the distribution pattern of HSP 70-2 gene polymorphism in patients with acute pancreatitis (P=0.001) and pancreatic carcinoma (P<0.001) as compared to controls. The frequency of mutant allele (G allele) was significantly higher in diseased group as compared to control group (19% in control group, 40% in acute pancreatitis, 33% in chronic pancreatitis and 45% in pancreatic carcinoma). No association of this polymorphism was found with disease severity in patients with acute and chronic pancreatitis or pancreatic carcinoma. In our patient sample the frequency of mutant allele (G allele) of HSP 70-2 gene is significantly higher in patients with acute pancreatitis and pancreatic carcinoma compared to controls (50 healthy blood donors). However, this polymorphism was not associated with disease severity and complications.

  18. A novel, non-functional, COL1A1 polymorphism is not associated with lumbar disk disease in young male Greek subjects unlike that of the Sp1 site

    PubMed Central

    Bei, Thalia; Tilkeridis, Constantinos; Garantziotis, Stavros; Boikos, Sosipatros A.; Kazakos, Konstantinos; Simopoulos, Constantinos; Stratakis, Constantine A.

    2011-01-01

    OBJECTIVE We recently reported the association of the Sp1 site polymorphism of the COL1A1 gene with lumbar disk disease (LDD). In the present study we searched for a different polymorphism of the COL1A1 gene (which is usually not in linkage disequilibrium with the Sp1 site) in subjects with LDD. DESIGN Blood was collected from 24 Greek army recruits, aged 29±7.6 years, with LDD, and 66 healthy men, aged 26±4.38 years, matched for body mass index (BMI) and age, with normal BMD and with no history of trauma or fractures, who served as controls. DNA was extracted and the COL1A1 gene was sequenced. Of the control subjects, 12 were army recruits and 54 were selected from the general population. RESULTS The four base-pair insertion polymorphism in the COL1A1 gene analyzed by polymerase chain reaction amplification of DNA produces two different fragments (alleles A1 and A2): 14 patients (58.3%) were homozygous for A2A2, versus 35 controls (53%), while 3 patients (12.5%) were A1A1, and 8 of the control subjects (12%) had this genotype. There were no statistically significant differences in the presence of the two alleles of this polymorphism between patients with LDD and control subjects. CONCLUSIONS A four base-pair insertion polymorphism of the COL1A1 gene is not associated with the presence of LDD in young males, unlike the Sp1 site polymorphism of the same gene. These data reinforce the association between LDD and the functional polymorphisms of the Sp1 site by showing that other polymorphic sites of the of the COL1A1 gene in the same population of patients are not linked to the disease. PMID:18694864

  19. Inflammatory Gene Polymorphisms in Lung Cancer Susceptibility.

    PubMed

    Eaton, Keith D; Romine, Perrin E; Goodman, Gary E; Thornquist, Mark D; Barnett, Matt J; Petersdorf, Effie W

    2018-05-01

    Chronic inflammation has been implicated in carcinogenesis, with increasing evidence of its role in lung cancer. We aimed to evaluate the role of genetic polymorphisms in inflammation-related genes in the risk for development of lung cancer. A nested case-control study design was used, and 625 cases and 625 well-matched controls were selected from participants in the β-Carotene and Retinol Efficacy Trial, which is a large, prospective lung cancer chemoprevention trial. The association between lung cancer incidence and survival and 23 polymorphisms descriptive of 11 inflammation-related genes (interferon gamma gene [IFNG], interleukin 10 gene [IL10], interleukin 1 alpha gene [IL1A], interleukin 1 beta gene [IL1B], interleukin 2 gene [IL2], interleukin 4 receptor gene [IL4R], interleukin 4 gene [IL4], interleukin 6 gene [IL6], prostaglandin-endoperoxide synthase 2 gene [PTGS2] (also known as COX2), transforming growth factor beta 1 gene [TGFB1], and tumor necrosis factor alpha gene [TNFA]) was evaluated. Of the 23 polymorphisms, two were associated with risk for lung cancer. Compared with individuals with the wild-type (CC) variant, individuals carrying the minor allele variants of the IL-1β-511C>T promoter polymorphism (rs16944) (CT and TT) had decreased odds of lung cancer (OR = 0.74, [95% confidence interval (CI): 0.58-0.94] and OR = 0.71 [95% CI: 0.50-1.01], respectively, p = 0.03). Similar results were observed for the IL-1β-1464 C>G promoter polymorphism (rs1143623), with presence of the minor variants CG and CC having decreased odds of lung cancer (OR = 0.75 [95% CI: 0.59-0.95] and OR = 0.69 [95% CI: 0.46-1.03], respectively, p = 0.03). Survival was not influenced by genotype. This study provides further evidence that IL1B promoter polymorphisms may modulate the risk for development of lung cancer. Copyright © 2018 International Association for the Study of Lung Cancer. Published by Elsevier Inc. All rights reserved.

  20. The Role of Plasminogen Activator Inhibitor-1 and Angiotensin-Converting Enzyme Gene Polymorphisms in Bronchopulmonary Dysplasia

    PubMed Central

    Atac, Fatma Belgin; Ozkiraz, Servet; Dilmen, Ugur; Gulcan, Hande; Tarcan, Aylin; Ozbek, Namik

    2010-01-01

    Background: Bronchopulmonary dysplasia (BPD) is a multifactorial disease of preterm infants that is characterized by airway injury, inflammation, and parencymal remodeling. Activation of the coagulation cascade leads to intraalveolar fibrin deposition in many inflammatory pulmonary disorders. Increased fibrin formation or decreased fibrinolysis may cause extravascular fibrin deposition. Extravascular fibrin deposits in septae and alveoli due to the altered fibrin turnover are the pathological hallmarks of BPD, which strongly indicate the importance of the imbalance in the competing activities of coagulation and fibrinolysis. Objective: We investigated the predictive value of variations in plasminogen activator inhibitor-1 (PAI-1) and angiotensin-converting enzyme (ACE) genes as molecular determinants for BPD in neonates. Methods: The study group comprised 98 preterm infants with BPD and a control group including 94 preterm infants without BPD. Restriction fragment size analyses were performed by visualizing digested polymerase chain reaction products for ACE and PAI-1 genotypes. Results: No significant associations were found between ACE, PAI-1 gene polymorphisms, and BPD phenotype in our population. Conclusions: The two gene polymorphisms (PAI-1 and ACE) had no role in the development of BPD in our study. Further studies with other genes are required for the identification of molecular predisposing factors for BPD that may help in the development of new treatments. PMID:20818980

Top