Creatine kinase MM TaqI and methylenetetrahydrofolate reductase C677T and A1298C gene polymorphisms influence exercise-induced C-reactive protein levels.

PubMed

Miranda-Vilela, Ana Luisa; Akimoto, Arthur K; Lordelo, Graciana S; Pereira, Luiz C S; Grisolia, Cesar K; Klautau-Guimarães, Maria de Nazaré

2012-01-01

Physical training induces beneficial adaptations, but exhausting exercise increases reactive oxygen species, which can cause muscular injuries with consequent inflammatory processes, implying jeopardized performance and possibly overtraining. Acute strenuous exercise almost certainly exceeds the benefits of physical activity; it can compromise performance and may contribute to increased future risk of cardiovascular disease (CVD) in athletes. Polymorphisms in the muscle-type creatine kinase (CK-MM) gene may influence performance and adaptation to training, while many potentially significant genetic variants are reported as risk factors for CVD. Therefore, we investigated the influence of polymorphisms in CK-MM TaqI and NcoI, methylenetetrahydrofolate reductase (MTHFR C677T and A1298C) and C-reactive protein (CRP G1059C) genes on exercise-induced damage and inflammation markers. Blood samples were taken immediately after a race (of at least 4 km) that took place outdoors on flat tracks, and were submitted to genotyping and biochemical evaluation of aspartate aminotransferase (AST), CK, CRP and high-sensitivity CRP (hs-CRP). CK-MM TaqI polymorphism significantly influenced results of AST, CK and hs-CRP, and an association between MTHFR C677T and A1298C with CRP level was found, although these levels did not exceed reference values. Results indicate that these polymorphisms can indirectly influence performance, contribute to higher susceptibility to exercise-induced inflammation or protection against it, and perhaps affect future risks of CVD in athletes.

Creatine kinase MM TaqI and methylenetetrahydrofolate reductase C677T and A1298C gene polymorphisms influence exercise-induced C-reactive protein levels.

PubMed

Miranda-Vilela, Ana Luisa; Akimoto, Arthur K; Lordelo, Graciana S; Pereira, Luiz C S; Grisolia, Cesar K; Klautau-Guimarães, Maria de Nazaré

2012-03-01

Physical training induces beneficial adaptations, but exhausting exercise increases reactive oxygen species, which can cause muscular injuries with consequent inflammatory processes, implying jeopardized performance and possibly overtraining. Acute strenuous exercise almost certainly exceeds the benefits of physical activity; it can compromise performance and may contribute to increased future risk of cardiovascular disease (CVD) in athletes. Polymorphisms in the muscle-type creatine kinase (CK-MM) gene may influence performance and adaptation to training, while many potentially significant genetic variants are reported as risk factors for CVD. Therefore, we investigated the influence of polymorphisms in CK-MM TaqI and NcoI, methylenetetrahydrofolate reductase (MTHFR C677T and A1298C) and C-reactive protein (CRP G1059C) genes on exercise-induced damage and inflammation markers. Blood samples were taken immediately after a race (of at least 4 km) that took place outdoors on flat tracks, and were submitted to genotyping and biochemical evaluation of aspartate aminotransferase (AST), CK, CRP and high-sensitivity CRP (hs-CRP). CK-MM TaqI polymorphism significantly influenced results of AST, CK and hs-CRP, and an association between MTHFR C677T and A1298C with CRP level was found, although these levels did not exceed reference values. The results indicate that these polymorphisms can indirectly influence performance, contribute to higher susceptibility to exercise-induced inflammation or protection against it, and perhaps affect future risks of CVD in athletes.

The genetics of response to estrogen treatment

PubMed Central

Langdahl, Bente L

2009-01-01

It has been demonstrated that the response to estrogen treatment in postmenopausal women shows considerable variability. It has been speculated that this at least partly could be determined by heritable factors. The most obvious genes to investigate in this context are the estrogen receptor genes. It has been demonstrated that women with short alleles of the TA-repeat polymorphism in the estrogen receptor α gene respond to hormone treatment with greater increases in bone mass at the lumbar spine. Also the two polymorphisms in the first intron of the same gene have been found to be associated with the response to estrogen. Several studies have found that women carrying the Pand the X-alleles respond to hormone therapy with greater increases in bone mass and sustain fewer fractures. Polymorphisms in the collagen type Iα1 have been found to influence BMD. Conflicting results have been obtained with respect to the influence of these genetic variants on postmenopausal bone loss and response to hormone treatment. Furthermore, two polymorphisms in the promoter of the transforming growth factor β gene and one polymorphism in the first exon of the osteoprotegerin gene have been demonstrated to interact with the response to hormone treatment in early postmenopausal women. The above mentioned results are obtained from relatively small studies and needs confirmation before the information can be used in the clinic. PMID:22461097

Gene polymorphisms associated with functional dyspepsia.

PubMed

Kourikou, Anastasia; Karamanolis, George P; Dimitriadis, George D; Triantafyllou, Konstantinos

2015-07-07

Functional dyspepsia (FD) is a constellation of functional upper abdominal complaints with poorly elucidated pathophysiology. However, there is increasing evidence that susceptibility to FD is influenced by hereditary factors. Genetic association studies in FD have examined genotypes related to gastrointestinal motility or sensation, as well as those related to inflammation or immune response. G-protein b3 subunit gene polymorphisms were first reported as being associated with FD. Thereafter, several gene polymorphisms including serotonin transporter promoter, interlukin-17F, migration inhibitory factor, cholecystocynine-1 intron 1, cyclooxygenase-1, catechol-o-methyltransferase, transient receptor potential vanilloid 1 receptor, regulated upon activation normal T cell expressed and secreted, p22PHOX, Toll like receptor 2, SCN10A, CD14 and adrenoreceptors have been investigated in relation to FD; however, the results are contradictory. Several limitations underscore the value of current studies. Among others, inconsistencies in the definitions of FD and controls, subject composition differences regarding FD subtypes, inadequate samples, geographical and ethnical differences, as well as unadjusted environmental factors. Further well-designed studies are necessary to determine how targeted genes polymorphisms, influence the clinical manifestations and potentially the therapeutic response in FD.

Genetic basis of interindividual susceptibility to cancer cachexia: selection of potential candidate gene polymorphisms for association studies.

PubMed

Johns, N; Tan, B H; MacMillan, M; Solheim, T S; Ross, J A; Baracos, V E; Damaraju, S; Fearon, K C H

2014-12-01

Cancer cachexia is a complex and multifactorial disease. Evolving definitions highlight the fact that a diverse range of biological processes contribute to cancer cachexia. Part of the variation in who will and who will not develop cancer cachexia may be genetically determined. As new definitions, classifications and biological targets continue to evolve, there is a need for reappraisal of the literature for future candidate association studies. This review summarizes genes identified or implicated as well as putative candidate genes contributing to cachexia, identified through diverse technology platforms and model systems to further guide association studies. A systematic search covering 1986-2012 was performed for potential candidate genes / genetic polymorphisms relating to cancer cachexia. All candidate genes were reviewed for functional polymorphisms or clinically significant polymorphisms associated with cachexia using the OMIM and GeneRIF databases. Pathway analysis software was used to reveal possible network associations between genes. Functionality of SNPs/genes was explored based on published literature, algorithms for detecting putative deleterious SNPs and interrogating the database for expression of quantitative trait loci (eQTLs). A total of 154 genes associated with cancer cachexia were identified and explored for functional polymorphisms. Of these 154 genes, 119 had a combined total of 281 polymorphisms with functional and/or clinical significance in terms of cachexia associated with them. Of these, 80 polymorphisms (in 51 genes) were replicated in more than one study with 24 polymorphisms found to influence two or more hallmarks of cachexia (i.e., inflammation, loss of fat mass and/or lean mass and reduced survival). Selection of candidate genes and polymorphisms is a key element of multigene study design. The present study provides a contemporary basis to select genes and/or polymorphisms for further association studies in cancer cachexia, and to develop their potential as susceptibility biomarkers of cachexia.

Glutathione enzyme and selenoprotein polymorphisms associate with mercury biomarker levels in Michigan dental professionals

PubMed Central

Goodrich, Jaclyn M.; Wang, Yi; Gillespie, Brenda; Werner, Robert; Franzblau, Alfred; Basu, Niladri

2012-01-01

Mercury is a potent toxicant of concern to both the general public and occupationally exposed workers (e.g., dentists). Recent studies suggest that several genes mediating the toxicokinetics of mercury are polymorphic in humans and may influence inter-individual variability in mercury accumulation. This work hypothesizes that polymorphisms in key glutathione synthesizing enzyme, glutathione s-transferase, and selenoprotein genes underlie inter-individual differences in mercury body burden as assessed by analytical mercury measurement in urine and hair, biomarkers of elemental mercury and methylmercury, respectively. Urine and hair samples were collected from a population of dental professionals (n=515), and total mercury content was measured. Average urine (1.06±1.24 ug/L) and hair mercury levels (0.49±0.63 ug/g) were similar to national U.S. population averages. Taqman assays were used to genotype DNA from buccal swab samples at 15 polymorphic sites in genes implicated in mercury metabolism. Linear regression modeling assessed the ability of polymorphisms to modify the relationship between mercury biomarker levels and exposure sources (e.g., amalgams, fish consumption). Five polymorphisms were significantly associated with urine mercury levels (GSTT1 deletion), hair mercury levels (GSTP1-105, GSTP1-114, GSS 5’), or both (SEPP1 3’UTR). Overall, this study suggests that polymorphisms in selenoproteins and glutathione-related genes may influence elimination of mercury in the urine and hair or mercury retention following exposures to elemental mercury (via dental amalgams) and methylmercury (via fish consumption). PMID:21967774

Polymorphism in endothelin-related genes limits exercise-induced decreases in arterial stiffness in older subjects.

PubMed

Iemitsu, Motoyuki; Maeda, Seiji; Otsuki, Takeshi; Sugawara, Jun; Tanabe, Takumi; Jesmin, Subrina; Kuno, Shinya; Ajisaka, Ryuichi; Miyauchi, Takashi; Matsuda, Mitsuo

2006-05-01

Increase in arterial stiffness is associated with aging, which is improved by regular exercise. Endothelin (ET) system has crucial roles in regulating vascular tone and in the progression of atherosclerosis. We hypothesized that molecular variations (ie, gene polymorphisms) in ET-related gene might affect exercise-induced improvement in arterial stiffness with age in human subjects. The present study provides a cross-sectional investigation of 191 healthy middle-aged and older (65+/-1 years) human subjects to clarify the relationship between the regular exercise-induced improvement of arterial stiffness and the gene polymorphisms of ET converting enzyme (ECE)-1, ECE-2, ET-A receptor (ET-A), and ET-B receptor (ET-B). The study subjects were divided into active and inactive groups based on the median value (186 kcal/d) of energy expenditure. Brachial-ankle arterial pulse wave velocity (baPWV) was used to evaluate arterial stiffness. All individuals were genotyped for 4 different polymorphisms of the ET system: 2013(+289)A/G in intron 17 of ECE-1, 669(+17)T/C in intron 5 of ECE-2, 958A/G in exon 6 of ET-A, and 831A/G in exon 4 of ET-B. The baseline baPWV was significantly lower in the active group without any change in blood pressure. Polymorphisms in ECE-1 influenced basal blood pressure. Polymorphisms in ECE-1 and ECE-2 had no effect on baPWV between active and inactive groups. However, polymorphisms in both ET-A and ET-B affected baPWV in the 2 groups. The present results suggest that differences in ET-A and ET-B polymorphisms may influence the response of the vascular wall to exercise whereas ECE-1 polymorphisms may affect basal blood pressure.

Adiponectin gene polymorphisms: Association with childhood obesity

PubMed Central

Fraga, Vanêssa Gomes; Gomes, Karina Braga

2014-01-01

The current childhood obesity epidemic represents a particular challenge for public health. Understanding of the etiological mechanisms of obesity remains integral in treating this complex disorder. In recent years, studies have elucidated the influence of hormones secreted by adipose tissue named adipokines. Adiponectin is a adipokine that exhibits important anti-inflammatory, insulin-sensitizing and anti-atherogenic properties and it is strongly associated to obesity development. It is well known that adiponectin levels decrease with obesity. Furthermore, studies show that some single nucleotide polymorphisms in the gene encoding adiponectin, ADIPOQ, may influence the expression of this protein. The objective of this paper is to provide an up-to-date review of ADIPOQ polymorphisms in the context of childhood obesity. PMID:27625863

Polymorphisms in the hemagglutinin gene influenced the viral shedding of pandemic 2009 influenza virus in swine

USDA-ARS?s Scientific Manuscript database

The contribution of influenza virus quasi-species for transmission efficiency and replication is poorly understood. In the present study we show that naturally occurring polymorphisms present in the hemagglutinin (HA) gene of two 2009 pandemic H1N1 isolates, A/California/04/2009 (Ca/09) and A/Mexico...

Association study of interferon gamma (IFN-γ) +874T/A gene polymorphism in patients with paranoid schizophrenia.

PubMed

Paul-Samojedny, Monika; Owczarek, Aleksander; Suchanek, Renata; Kowalczyk, Malgorzata; Fila-Danilow, Anna; Borkowska, Paulina; Kucia, Krzysztof; Kowalski, Jan

2011-03-01

Schizophrenia is a multifactorial disease with changes affecting the immune system. Dysregulation of the cytokine network in schizophrenia has been well documented. Such changes may occur due to disturbances in cytokine levels that are linked to polymorphisms of cytokine genes. However, research in the role of cytokine gene polymorphisms in schizophrenia has been surprisingly scanty. The aim of this study was to identify, in a case control study, whether polymorphism of IFN-γ gene is a risk factor for the development of paranoid schizophrenia. To the best of our knowledge, this is the first study that examines the association between the IFN-γ gene polymorphism and psychopathological symptoms in patients with paranoid schizophrenia. Polymorphism of IFN-γ (+874T/A, rs 62559044) in schizophrenic patients (n=179), as well as healthy individuals (n=196), both Polish residents, was genotyped using AS-PCR method. Of note, when analyzing the results, we took into consideration the gender of studied individuals. Surprisingly, a single-nucleotide polymorphism in the first intron of the IFN-γ gene was found to be associated with paranoid schizophrenia in males, but not in females. The presence of allele A at position +874 in the IFN-γ gene correlates with 1.66-fold higher risk of paranoid schizophrenia development in males. Differences in the genotypes may have an important role in determining the level of I gene transcription. Because other polymorphisms have been demonstrated to influence IFN-γ transcription, further analysis is necessary to clarify the role of this gene in the pathogenesis of paranoid schizophrenia.

IL-10 and IL-12B gene polymorphisms in a multiethnic Malaysian population.

PubMed

Sam, S S; Teoh, B T; AbuBakar, S

2015-04-13

Inheritance of polymorphisms in the interleukin (IL)-10 promoter and IL-12B genes, which influence cytokine production and activities, may define the balance in T helper response in infection and autoimmune diseases. In the present study, we investigated the distribution of the IL-10 promoter and IL-12B gene polymorphisms in a multiethnic Malaysian population. Overall, our findings suggest that the IL-12B and IL-10 -592 genotypes were distributed homogenously across all major ethnic groups, including Malays, Chinese, and Indians, except for polymorphisms at IL-10 -1082. At this gene locus, the ethnic Chinese showed a significantly lower allele frequency of -1082G (2.1%) compared to the Malay (12.2%) and Indian (15.3%) populations. Results for the IL-12B and IL-10 gene polymorphisms were consistent with those reported for the Asian population, but markedly different from those of the African and Caucasian populations. Our findings suggest that there are specific genetic variations between different ethnic groups, which should be examined in all gene population-based association studies.

The effect of a promoter polymorphism on the transcription of nitric oxide synthase 1 and its relevance to Parkinson's disease.

PubMed

Rife, Terrie; Rasoul, Bareza; Pullen, Nicholas; Mitchell, David; Grathwol, Kristen; Kurth, Janice

2009-08-01

Transcriptional changes of the enzyme nitric oxide synthase I (NOS1) are believed to play a role in the development of many diseases. The gene for NOS1 has 12 alternative first exons (1A-1L). The 1F exon is one of the most highly utilized first exons in the brain and has a polymorphism ((TG)(m)TA(TG)(n)) located in its promoter region. The polymorphism's length has been suggested to affect NOS1 transcription and play a role in Parkinson's disease (PD); however, the actual influence of the polymorphism on NOS1 transcription has not been studied. To better characterize the links of the polymorphism with PD, a genotyping study was done comparing polymorphism length among 170 PD patients and 150 age-matched controls. The pattern of changes between the two group's allele frequencies shows statistical significance (P = 0.0359). The smallest polymorphism sizes are more predominant among PD patients than controls. To study the effects of this polymorphism on NOS1 gene transcription, reporter gene constructs were made by cloning the NOS1 1F promoter with polymorphism lengths of either 42, 54, or 62 bp in front of the luciferase gene and transfecting them into HeLa or Sk-N-MC cells. NOS1-directed reporter gene constructs with the 62-bp polymorphism increased transcription of luciferase 2.2-fold in HeLa and 1.8-fold in Sk-N-MC cells compared with reporter gene constructs with the 42-bp polymorphism. These data suggest that if smaller polymorphism size contributes to the higher NOS1 levels in PD patients, an as yet unknown transcriptional mechanism is required. Copyright 2009 Wiley-Liss, Inc.

Association of TLR1, TLR2, TLR4, TLR6, and TIRAP polymorphisms with disease susceptibility.

PubMed

Noreen, Mamoona; Arshad, Muhammad

2015-06-01

Toll like receptors (TLRs) play a crucial role in regulation of innate as well as adaptive immunity. TLRs recognize a distinct but limited repertoire of conserved microbial products. Ligand binding to TLRs activates the signaling cascade and results in activation of multiple inflammatory genes. Variation in this immune response is under genetic control. Polymorphisms in genes associated with inflammatory pathway especially influence the outcome of diseases. TLR2 makes heterodimer with TLR1 or TLR6 and recognizes a wide variety of microbial ligands. In this review, we summarize studies of polymorphisms in genes encoding TLR1, TLR2, TLR4, TLR6, and most polymorphic adaptor protein, Mal/TIRAP, revealing their effect on susceptibility to diseases.

Influence of the IL-1Ra gene polymorphism on in vivo synthesis of IL-1Ra and IL-1beta after live yellow fever vaccination.

PubMed

Hacker, U T; Erhardt, S; Tschöp, K; Jelinek, T; Endres, S

2001-09-01

The inflammatory response in infectious and autoimmune diseases is regulated by the balance between pro- and anti-inflammatory cytokines. The IL-1 complex contains polymorphic genes coding for IL-1alpha, IL-1beta and IL-1Ra. The IL-1Ra (variable number of tanden repeat) VNTR polymorphism has been shown to influence the capacity to produce IL-1beta and IL-1Ra after in vitro stimulation. Allele 2 of this polymorphism is associated with a number of inflammatory diseases. To determine the impact of the IL-1Ra polymorphism on in vivo human cytokine synthesis, we used a yellow fever vaccination model for the induction of cytokine synthesis in healthy volunteers. Two different yellow fever vaccines were used. After administration of the RKI vaccine (34 volunteers), plasma TNF-alpha concentration increased from 13.4 +/- 0.9 pg/ml to 23.3 +/- 1.1 pg/ml (P < 0.001), and plasma IL-1Ra concentration increased from 308 +/- 25 pg/ml to 1019 +/- 111 pg/ml (P < 0.001), on day 2. Using Stamaril vaccine, no increase in the plasma concentrations of either TNF-alpha or IL-1Ra could be detected (n = 17). Only the RKI vaccine induced TNF-alpha synthesis after in vitro stimulation of MNC. Carriers of allele 2 of the IL-1Ra polymorphism had increased baseline concentrations of IL-1Ra (350 +/- 32 pg/ml) compared with non-carriers (222 +/- 18 pg/ml, P < 0.001), and decreased concentrations of IL-1beta (0.9 +/- 0.2 pg/ml for carriers versus 2.8 +/- 0.7 pg/ml for non-carriers, P = 0.017). After yellow fever vaccination (RKI vaccine), no significant differences in the increase of IL-1Ra plasma levels were detected between carriers and non-carriers of allele 2 of the IL-1Ra gene polymorphism. This is the first study to examine the influence of this genetic polymorphism on in vivo-induced human IL-1beta and IL-1Ra synthesis. Baseline concentrations of IL-1Ra and IL-1beta were significantly influenced by the IL-1Ra polymorphism. No influence of the IL-1Ra polymorphism on the in vivo-induced production of IL-1Ra and IL-1beta could be detected.

Glutathione S-transferase (GSTM1, GSTT1) gene polymorphisms, maternal gestational weight gain, bioimpedance factors and their relationship with birth weight: a cross-sectional study in Romanian mothers and their newborns.

PubMed

Mărginean, Claudiu; Bănescu, Claudia Violeta; Mărginean, Cristina Oana; Tripon, Florin; Meliţ, Lorena Elena; Iancu, Mihaela

2017-01-01

The aim of this study was to assess the relationship between mother-child GSTM1, GSTT1 gene polymorphisms, maternal weight gain, maternal bioimpedance parameters and newborn's weight, in order to identify the factors that influence birth weight. We performed a cross-sectional study on 405 mothers and their newborns, evaluated in an Obstetrics and Gynecology Tertiary Hospital from Romania. Newborns whose mothers had the null genotype of GSTT1 gene polymorphism were more likely to gain a birth weight of >3 kg, compared to newborns whose mothers had the T1 genotype (odds ratio - OR: 2.14, 95% confidence interval - CI: [1.03; 4.44]). Also, the null genotype of GSTM1 gene polymorphism in both mothers and newborns was associated with a higher birth weight. Gestational weight gain was positively associated with newborn's birth weight (p<0.001). The increased mother's fat mass (%) and basal metabolism rate were also independent factors for a birth weight of more than 3 kg (p=0.006 and p=0.037). The null genotype of GSTT1 gene polymorphism in mothers and the null genotype of GSTM1 in mothers and newborns had a positive effect on birth weight. Also, increased maternal fat mass and basal metabolism rate were associated with increased birth weight. We conclude that maternal GSTM1÷GSTT1 gene polymorphisms present an impact on birth weight, being involved in the neonatal nutritional status. The clinical relevance of our study is sustained by the importance of identifying the factors that influence birth weight, which can be triggers for childhood obesity.

Influence of melatonin receptor 1A gene polymorphisms on seasonal reproduction in Sarda ewes with different body condition scores and ages.

PubMed

Mura, M C; Luridiana, S; Bodano, S; Daga, C; Cosso, G; Diaz, M L; Bini, P P; Carcangiu, V

2014-10-01

In several species, circadian changes in melatonin concentrations play a key role in the photoperiodic control of seasonality. In sheep, two silent mutations in the melatonin receptor 1A gene (MTNR1A) at positions 606 and 612 of the exon II are associated with seasonal reproduction. However, in some sheep breeds, no relationships have been found between MTNR1A polymorphisms and reproductive seasonality. This lack of relationship could be due to effects of breed, body condition, age, and/or environmental conditions. Thus, the present study was conducted with the Sarda sheep breed with the aim of documenting the effect of MTNR1A gene polymorphisms on reproductive resumption and to evaluate whether such this effect was modified by differences in body condition score (BCS) and age. Six hundred three- to six-year-old multiparous ewes with BCSs between 2.5 and 3.5 were selected. Genomic DNA was extracted and subjected to PCR to amplify the ovine exon II of the MTNR1A gene. The amplicons were subjected to digestion with the restriction enzymes RsaI and MnlI to detect the T606C and A612G polymorphisms, respectively. Ewes carrying the G/G, G/A, C/C, and C/T genotypes exhibited higher fertility rates (P<0.05) and fewer numbers of days between the introduction of rams and parturition (P<0.05) than did the A/A and T/T genotypes. The data revealed that the MTNR1A gene polymorphisms influenced spring reproductive resumption in the Sarda sheep breed. Moreover, the data also indicated that, over the limited ranges evaluated in this study, BCS and age had no significant influence on reproductive activity. Copyright © 2014 Elsevier B.V. All rights reserved.

The role of histamine degradation gene polymorphisms in moderating the effects of food additives on children's ADHD symptoms.

PubMed

Stevenson, Jim; Sonuga-Barke, Edmund; McCann, Donna; Grimshaw, Kate; Parker, Karen M; Rose-Zerilli, Matthew J; Holloway, John W; Warner, John O

2010-09-01

Food additives can exacerbate ADHD symptoms and cause non-immunoglobulin E-dependent histamine release from circulating basophils. However, children vary in the extent to which their ADHD symptoms are exacerbated by the ingestion of food additives. The authors hypothesized that genetic polymorphisms affecting histamine degradation would explain the diversity of responses to additives. In a double-blind, placebo-controlled crossover trial, challenges involving two food color additive and sodium benzoate (preservative) mixtures in a fruit drink were administered to a general community sample of 3-year-old children (N = 153) and 8/9-year-old children (N = 144). An aggregate ADHD symptom measure (based on teacher and parent blind ratings of behavior, blind direct observation of behavior in the classroom, and--for 8/9-year-old children only--a computerized measure of attention) was the main outcome variable. The adverse effect of food additives on ADHD symptoms was moderated by histamine degradation gene polymorphisms HNMT T939C and HNMT Thr105Ile in 3- and 8/9-year-old children and by a DAT1 polymorphism (short versus long) in 8/9-year-old children only. There was no evidence that polymorphisms in catecholamine genes COMT Val108Met, ADRA2A C1291G, and DRD4-rs7403703 moderated the effect on ADHD symptoms. Histamine may mediate the effects of food additives on ADHD symptoms, and variations in genes influencing the action of histamine may explain the inconsistency between previous studies. Genes influencing a range of neurotransmitter systems and their interplay with environmental factors, such as diet, need to be examined to understand genetic influences on ADHD symptoms.

[Influence of interleukin-1 beta gene polymorphism and childhood maltreatment on antidepressant treatment].

PubMed

Chen, Ying; Zhang, Zhijun; Xu, Zhi; Pu, Mengjia; Geng, Leiyu

2015-12-01

To explore the influence of interleukin-1 beta (IL1B) gene polymorphism and childhood maltreatment on antidepressant treatment. Two hundred and four patients with major depressive disorder (MDD) have received treatment with single antidepressant drugs and were followed up for 8 weeks. Hamilton depression scale-17 (HAMD-17) was used to evaluate the severity of depressive symptoms and therapeutic effect. Childhood maltreatment was assessed using Childhood Trauma Questionnaire, a 28-item Short Form (CTQ-SF). Single nucleotide polymorphism (SNP) of the IL1B gene was determined using a SNaPshot method. Correlation of rs16944 gene polymorphism with response to treatment was analyzed using Unphased 3.0.13 software. The main and interactive effects of SNP and childhood maltreatment on the antidepressant treatment were analyzed using Logistic regression analysis. No significant difference of gender, age, year of education, family history, episode time, and antidepressant agents was detected between the remitters and non-remitters. Association analysis has found that the SNP rs16944 in the IL1B AA genotype carriers antidepressant response was poorer (χ2=3.931, P=0.047). No significant difference was detected in the CTQ scores between the two groups. Genetic and environmental interaction analysis has demonstrated a significant correlation between rs16944 AA genotype and childhood maltreatment and poorer response to antidepressant treatment. The SNP rs16944 in the IL1B gene and its interaction with childhood maltreatment may influence the effect of antidepressant treatment for patients with MDD.

Allele frequency and genotype distribution of polymorphisms within disease-related genes is influenced by ethnic population sub-structuring in Sudan.

PubMed

Bereir, R E H; Mohamed, H S; Seielstad, M; El Hassani, A M; Khalil, E A G; Peacock, C S; Blackwell, J M; Ibrahim, M E

2003-09-01

Four single nucleotide polymorphisms (SNPs) and a variable number of tandem repeats (VNTR) polymorphism located within disease associated/causing genes were typed in four populations of different tribal and ethnic affiliation from the Sudan. The genotype and allele frequencies were compared with those of other groups from published and unpublished data of world populations. The combined Sudanese sample conformed with Hardy-Weinberg equilibrium (HWE) expectation. However, population sub-structuring according to ethnic/linguistic group indicated at least two SNPs in departure from HWE. Differences in allele frequencies and genotype distribution between groups was also noted in three of the four SNPs. The other loci were distributed homogeneously within the populations studied with genotype frequencies in agreement with HWE expectation. These results highlight the importance of inter-population stratification for polymorphic markers, as well as the potential influence of evolutionary history and ethnic variation of loci, in the general distribution of SNPs and other polymorphisms.

[Antipsychotic-induced weight gain--pharmacogenetic studies].

PubMed

Olajossy-Hilkesberger, Luiza; Godlewska, Beata; Marmurowska-Michałowskal, Halina; Olajossy, Marcin; Landowski, Jerzy

2006-01-01

Drug-naive patients with schizophrenia often present metabolic abnormalities and obesity. Weight gain may be the side effect of treatment with many antipsychotic drugs. Genetic effects, besides many other factors, are known to influence obesity in patients with schizophrenia treated with antipsychotics. Numerous studies of several genes' polymorphisms have been performed. -759C/T polymorphism of 5HT2C gene attracted most attention. In 5 independent studies of this polymorphism the association between T allele with the lower AP-induced weight gain was detected. No associations could be detected between weight gain and other polymorphisms of serotonergic system genes as well as histaminergic system genes. Studies of adrenergic and dopaminergic system have neither produced any unambiguous results. Analysis of the newest candidate genes (SAP-25, leptin gene) confirmed the role of genetic factors in AP-induced weight gain. It is worth emphasising, that the studies have been conducted in relatively small and heterogenic groups and that various treatment strategies were used.

APOE polymorphism as a potential determinant of functional fitness in the elderly regardless of nutritional status.

PubMed

Snejdrlova, Michaela; Kalvach, Zdenek; Topinkova, Eva; Vrablik, Michal; Prochazkova, Renata; Kvasilova, Marie; Lanska, Vera; Zlatohlavek, Lukas; Prusikova, Martina; Ceska, Richard

2011-01-01

Life expectancy is determined by a combination of genetic predisposition (~25%) and environmental influences (~75%). Nevertheless a stronger genetic influence is anticipated in long-living individuals. Apolipoprotein E (APOE) gene belongs among the most studied candidate genes of longevity. We evaluated the relation of APOE polymorphism and fitness status in the elderly. We examined a total number of 128 subjects, over 80 years of age. Using a battery of functional tests their fitness status was assessed and the subjects were stratified into 5 functional categories according to Spirduso´s classification. Biochemistry analysis was performed by enzymatic method using automated analyzers. APOE gene polymorphism was analysed performed using PCR-RFLP. APOE4 allele carriers had significantly worse fitness status compared to non-carriers (p=0.025). Multiple logistic regression analysis showed the APOE4 carriers had higher risk (p=0.05) of functional unfitness compared to APOE2/E3 individuals. APOE gene polymorphism seems be an important genetic contributor to frailty development in the elderly. While APOE2 carriers tend to remain functionally fit till higher age, the functional status of APOE4 carriers deteriorates more rapidly. © 2011 Neuroendocrinology Letters

[Prevalence of dyslipidemia in middle-aged adults with NOS3 gene polymorphism and low cardiorespiratory fitness].

PubMed

Malagrino, Pamella A; Sponton, Carlos H G; Esposti, Rodrigo D; Franco-Penteado, Carla F; Fernandes, Romulo A; Bezerra, Marcos André C; Albuquerque, Dulcinéia M; Rodovalho, Cynara M; Bacci, Maurício; Zanesco, Angelina

2013-02-01

To evaluate the influence of the interaction between endothelial nitric oxide synthase gene (NOS3) polymorphisms at positions -786T>C, Glu298Asp and intron 4b/a, and cardiorespiratory fitness on plasma nitrite/nitrate levels, blood pressure, lipid profile, and prevalence of cardiometabolic disorders. Ninety-two volunteers were genotyped for NOS3 polymorphisms at positions (-786T>C and Glu298Asp) and (intron 4b/a) and divided according to the genotype: non-polymorphic (NP) and polymorphic (P). After that, they were subdivided according to the cardiorespiratory fitness associated with genotype: high (HNP and HP) and low (LNP and LP). The subjects with polymorphism for the interactions at positions Glu298Asp + intron 4b/a, and Glu298Asp+-786T>C showed the highest values in total cholesterol, as well as dyslipidemia. Our findings show that NOS3 gene polymorphisms at positions -786T>C, Glu298Asp, and intron 4b/a exert negative effects on the lipid profile compared with those who do not carry polymorphisms.

Potassium channel KCNH2 K897T polymorphism and cardiac repolarization during exercise test: The Finnish Cardiovascular Study.

PubMed

Koskela, J; Laiho, J; KäHönen, M; Rontu, R; Lehtinen, R; Viik, J; Niemi, M; Niemelä, K; Kööbi, T; Turjanmaa, V; Pörsti, I; Lehtimäki, T; Nieminen, T

2008-01-01

Cardiac repolarization is regulated, in part, by the KCNH2 gene, which encodes a rapidly activating component of the delayed rectifier potassium channel. The gene expresses a functional single nucleotide polymorphism, K897T, which changes the biophysical properties of the channel. The objective of this study was to evaluate whether this polymorphism influences two indices of repolarization--the QT interval and T-wave alternans (TWA)--during different phases of a physical exercise test. The cohort consisted of 1,975 patients undergoing an exercise test during which on-line electrocardiographic data were registered. Information on coronary risk factors and medication was recorded. The 2690A>C nucleotide variation in the KCNH2 gene corresponding to the K897T amino acid change was analysed after polymerase chain reaction with allele-specific TaqMan probes. Among all subjects, the QTc intervals did not differ between the three genotype groups (p> or =0.31, RANOVA). Women with the CC genotype tended to have longer QT intervals during the exercise test, but the difference was statistically significant only at rest (p = 0.011, ANOVA). This difference was also detected when the analysis was adjusted for several factors influencing the QT interval. No statistically significant effects of the K897T polymorphism on TWA were observed among all subjects (p = 0.16, RANOVA), nor in men and women separately. The K897T polymorphism of the KCNH2 gene may not be a major genetic determinant for the TWA, but the influence of the CC genotype on QT interval deserves further research among women.

Polymorphisms of genes related to the hypothalamic-pituitary-adrenal axis influence the cortisol awakening response as well as self-perceived stress.

PubMed

Li-Tempel, Ting; Larra, Mauro F; Winnikes, Ulrike; Tempel, Tobias; DeRijk, Roel H; Schulz, André; Schächinger, Hartmut; Meyer, Jobst; Schote, Andrea B

2016-09-01

The hypothalamus-pituitary-adrenal (HPA) axis is a crucial endocrine system for coping with stress. A reliable and stable marker for the basal state of that system is the cortisol awakening response (CAR). We examined the influence of variants of four relevant candidate genes; the mineralocorticoid receptor gene (MR), the glucocorticoid receptor gene (GR), the serotonin transporter gene (5-HTT) and the gene encoding the brain-derived neurotrophic factor (BDNF) on CAR and self-perceived stress in 217 healthy subjects. We found that polymorphisms of GR influenced both, the basal state of the HPA axis as well as self-perceived stress. MR only associated with self-perceived stress and 5-HTT only with CAR. BDNF did not affected any of the investigated indices. In summary, we suggest that GR variants together with the CAR and supplemented with self reports on perceived stress might be useful indicators for the basal HPA axis activity. Copyright © 2016 Elsevier B.V. All rights reserved.

Meta-analysis of genome-wide association studies identifies common susceptibility polymorphisms for colorectal and endometrial cancer near SH2B3 and TSHZ1.

PubMed

Cheng, Timothy H T; Thompson, Deborah; Painter, Jodie; O'Mara, Tracy; Gorman, Maggie; Martin, Lynn; Palles, Claire; Jones, Angela; Buchanan, Daniel D; Win, Aung Ko; Hopper, John; Jenkins, Mark; Lindor, Noralane M; Newcomb, Polly A; Gallinger, Steve; Conti, David; Schumacher, Fred; Casey, Graham; Giles, Graham G; Pharoah, Paul; Peto, Julian; Cox, Angela; Swerdlow, Anthony; Couch, Fergus; Cunningham, Julie M; Goode, Ellen L; Winham, Stacey J; Lambrechts, Diether; Fasching, Peter; Burwinkel, Barbara; Brenner, Hermann; Brauch, Hiltrud; Chang-Claude, Jenny; Salvesen, Helga B; Kristensen, Vessela; Darabi, Hatef; Li, Jingmei; Liu, Tao; Lindblom, Annika; Hall, Per; de Polanco, Magdalena Echeverry; Sans, Monica; Carracedo, Angel; Castellvi-Bel, Sergi; Rojas-Martinez, Augusto; Aguiar Jnr, Samuel; Teixeira, Manuel R; Dunning, Alison M; Dennis, Joe; Otton, Geoffrey; Proietto, Tony; Holliday, Elizabeth; Attia, John; Ashton, Katie; Scott, Rodney J; McEvoy, Mark; Dowdy, Sean C; Fridley, Brooke L; Werner, Henrica M J; Trovik, Jone; Njolstad, Tormund S; Tham, Emma; Mints, Miriam; Runnebaum, Ingo; Hillemanns, Peter; Dörk, Thilo; Amant, Frederic; Schrauwen, Stefanie; Hein, Alexander; Beckmann, Matthias W; Ekici, Arif; Czene, Kamila; Meindl, Alfons; Bolla, Manjeet K; Michailidou, Kyriaki; Tyrer, Jonathan P; Wang, Qin; Ahmed, Shahana; Healey, Catherine S; Shah, Mitul; Annibali, Daniela; Depreeuw, Jeroen; Al-Tassan, Nada A; Harris, Rebecca; Meyer, Brian F; Whiffin, Nicola; Hosking, Fay J; Kinnersley, Ben; Farrington, Susan M; Timofeeva, Maria; Tenesa, Albert; Campbell, Harry; Haile, Robert W; Hodgson, Shirley; Carvajal-Carmona, Luis; Cheadle, Jeremy P; Easton, Douglas; Dunlop, Malcolm; Houlston, Richard; Spurdle, Amanda; Tomlinson, Ian

2015-12-01

High-risk mutations in several genes predispose to both colorectal cancer (CRC) and endometrial cancer (EC). We therefore hypothesised that some lower-risk genetic variants might also predispose to both CRC and EC. Using CRC and EC genome-wide association series, totalling 13,265 cancer cases and 40,245 controls, we found that the protective allele [G] at one previously-identified CRC polymorphism, rs2736100 near TERT, was associated with EC risk (odds ratio (OR) = 1.08, P = 0.000167); this polymorphism influences the risk of several other cancers. A further CRC polymorphism near TERC also showed evidence of association with EC (OR = 0.92; P = 0.03). Overall, however, there was no good evidence that the set of CRC polymorphisms was associated with EC risk, and neither of two previously-reported EC polymorphisms was associated with CRC risk. A combined analysis revealed one genome-wide significant polymorphism, rs3184504, on chromosome 12q24 (OR = 1.10, P = 7.23 × 10(-9)) with shared effects on CRC and EC risk. This polymorphism, a missense variant in the gene SH2B3, is also associated with haematological and autoimmune disorders, suggesting that it influences cancer risk through the immune response. Another polymorphism, rs12970291 near gene TSHZ1, was associated with both CRC and EC (OR = 1.26, P = 4.82 × 10(-8)), with the alleles showing opposite effects on the risks of the two cancers.

Correlation between facial morphology and gene polymorphisms in the Uygur youth population.

PubMed

He, Huiyu; Mi, Xue; Zhang, Jiayu; Zhang, Qin; Yao, Yuan; Zhang, Xu; Xiao, Feng; Zhao, Chunping; Zheng, Shutao

2017-04-25

Human facial morphology varies considerably among individuals and can be influenced by gene polymorphisms. We explored the effects of single nucleotide polymorphisms (SNPs) on facial features in the Uygur youth population of the Kashi area in Xinjiang, China. Saliva samples were collected from 578 volunteers, and 10 SNPs previously associated with variations in facial physiognomy were genotyped. In parallel, 3D images of the subjects' faces were obtained using grating facial scanning technology. After delimitation of 15 salient landmarks, the correlation between SNPs and the distances between facial landmark pairs was assessed. Analysis of variance revealed that ENPP1 rs7754561 polymorphism was significantly associated with RAla-RLipCn and RLipCn-Sbn linear distances (p = 0.044 and p = 0.012, respectively) as well as RLipCn-Stm curve distance (p = 0.042). The GHR rs6180 polymorphism correlated with RLipCn-Stm linear distance (p = 0.04), while the GHR rs6184 polymorphism correlated with RLipCn-ULipP curve distance (p = 0.047). The FGFR1 rs4647905 polymorphism was associated with LLipCn-Nsn linear distance (p = 0.042). These results reveal that ENPP1 and FGFR1 influence lower anterior face height, the distance from the upper lip to the nasal floor, and lip shape. FGFR1 also influences the lower anterior face height, while GHR is associated with the length and width of the lip.

Influence of XRCC1 Genetic Polymorphisms on Ionizing Radiation-Induced DNA Damage and Repair.

PubMed

Sterpone, Silvia; Cozzi, Renata

2010-07-25

It is well known that ionizing radiation (IR) can damage DNA through a direct action, producing single- and double-strand breaks on DNA double helix, as well as an indirect effect by generating oxygen reactive species in the cells. Mammals have evolved several and distinct DNA repair pathways in order to maintain genomic stability and avoid tumour cell transformation. This review reports important data showing a huge interindividual variability on sensitivity to IR and in susceptibility to developing cancer; this variability is principally represented by genetic polymorphisms, that is, DNA repair gene polymorphisms. In particular we have focussed on single nucleotide polymorphisms (SNPs) of XRCC1, a gene that encodes for a scaffold protein involved basically in Base Excision Repair (BER). In this paper we have reported and presented recent studies that show an influence of XRCC1 variants on DNA repair capacity and susceptibility to breast cancer.

Novel Association of WNK4 Gene, Ala589Ser Polymorphism in Essential Hypertension, and Type 2 Diabetes Mellitus in Malaysia.

PubMed

Ghodsian, Nooshin; Ismail, Patimah; Ahmadloo, Salma; Heidari, Farzad; Haghvirdizadeh, Polin; Ataollahi Eshkoor, Sima; Etemad, Ali

2016-01-01

With-no-lysine (K) Kinase-4 (WNK4) consisted of unique serine and threonine protein kinases, genetically associated with an autosomal dominant form of hypertension. Argumentative consequences have lately arisen on the association of specific single nucleotide polymorphisms of WNK4 gene and essential hypertension (EHT). The aim of this study was to determine the association of Ala589Ser polymorphism of WNK4 gene with essential hypertensive patients in Malaysia. WNK4 gene polymorphism was specified utilizing mutagenically separated polymerase chain reaction (PCR) and restriction fragment length polymorphism (RFLP) method in 320 subjects including 163 cases and 157 controls. Close relation between Ala589Ser polymorphism and elevated systolic and diastolic blood pressure (SBP and DBP) was recognized. Sociodemographic factors including body mass index (BMI), age, the level of fasting blood sugar (FBS), low density lipoprotein (LDL), and triglyceride (TG) in the cases and healthy subjects exhibited strong differences (p < 0.05). The distribution of allele frequency and genotype of WNK4 gene Ala589Ser polymorphism showed significant differences (p < 0.05) between EHT subjects with or without type 2 diabetes mellitus (T2DM) and normotensive subjects, statistically. The WNK4 gene variation influences significantly blood pressure increase. Ala589Ser probably has effects on the enzymic activity leading to enhanced predisposition to the disorder.

[THE INFLUENCE OF SEROTONIN TRANSPORTER AND MONOAMINE OXIDASE A GENES POLYMORPHISM ON PSYCHO-EMOTION AND KARYOLOGICAL STABILITY OF ATHLETES].

PubMed

Kalaev, V N; Nechaeva, M S; Korneeva, O S; Cherenkov, D A

2015-11-01

The influence of polymorphism of the serotonin transporter and monoamine oxidase A genes, associated with man's aggressiveness on the psycho-emotional state and karyological status of single combat athletes. It was revealed that the carriers of less active ("short"), monoamine oxidase A gene variant have a high motivation to succeed and less rigidity and frustrated, compared to the carriers of more active ("long") version of the gene. Heterozygote carriers of less active ("short") variant of the serotonin transporter gene 5-HTTL had more physical aggression, guilt and were less frustrated compared with carriers of two long alleles. It has been revealed the association of studied genes with the karyological status of athletes. So fighters who are carriers of the short and long alleles of the serotonin transporter gene had more cells with nuclear abnormalities in the buccal epithelium than single combat athletes which both alleles were long.

5' UTR polymorphism of dopamine receptor D1 (DRD1) associated with severity and temperament of alcoholism.

PubMed

Kim, Dai-Jin; Park, Byung Lae; Yoon, Sujung; Lee, Hae-Kook; Joe, Keun-Ho; Cheon, Young-Hoon; Gwon, Do-Hoon; Cho, Sung-Nam; Lee, Hye Won; NamGung, Suk; Shin, Hyoung Doo

2007-06-15

Multiple dopamine receptors in the dopaminergic system may be prime candidates for genetic influence on alcohol abuse and dependence due to their involvement in reward and reinforcing mechanisms. Genetic polymorphisms in dopamine receptor genes are believed to influence the development and/or severity of alcoholism. To examine the genetic effects of the Dopamine Receptor D1 (DRD) gene family (DRD1-DRD5) in the Korean population, 11 polymorphisms in the DRD gene family were genotyped and analyzed in 535 alcohol-dependent subjects and 273 population controls. Although none of the polymorphisms of DRD1-5 genes were found to be associated with the risk of alcoholism, one 5' UTR polymorphism in the DRD1 (DRD1-48A>G) gene was significantly associated with severity of alcohol-related problem, as measured by the Alcohol Use Disorders Identification Test (AUDIT) in a gene dose-dependent manner, i.e., 24.37 (+/-8.19) among patients with -48A/A genotype, 22.37 (+/-9.49) among those with -48A/G genotype, and 17.38 (+/-8.28) among those with -48G/G genotype (P=0.002). The genetic effects of DRD1-48A>G were further analyzed with other phenotypes among alcohol-dependent subjects. Interestingly, the DRD1-48A>A genotype was also found to be associated with novelty seeking (NC), harm avoidance (HA), and persistence (P) (P =0.01, 0.02, and 0.003, respectively). The information derived from this study could be valuable for understanding the genetic factors involved in alcoholic phenotypes and genetic distribution of the DRD gene family, and could facilitate further investigation in other ethnic groups.

A polymorphism in a conserved posttranscriptional regulatory motif alters bone morphogenetic protein 2 (BMP2) RNA:protein interactions.

PubMed

Fritz, David T; Jiang, Shan; Xu, Junwang; Rogers, Melissa B

2006-07-01

The bone morphogenetic protein (BMP)2 gene has been genetically linked to osteoporosis and osteoarthritis. We have shown that the 3'-untranslated regions (UTR) of BMP2 genes from mammals to fishes are extraordinarily conserved. This indicates that the BMP2 3'-UTR is under stringent selective pressure. We present evidence that the conserved region is a strong posttranscriptional regulator of BMP2 expression. Polymorphisms in cis-regulatory elements have been proven to influence susceptibility to a growing number of diseases. A common single nucleotide polymorphism (SNP) disrupts a putative posttranscriptional regulatory motif, an AU-rich element, within the BMP2 3'-UTR. The affinity of specific proteins for the rs15705 SNP sequence differs from their affinity for the normal human sequence. More importantly, the in vitro decay rate of RNAs with the SNP is higher than that of RNAs with the normal sequence. Such changes in mRNA:protein interactions may influence the posttranscriptional mechanisms that control BMP2 gene expression. The consequent alterations in BMP2 protein levels may influence the development or physiology of bone or other BMP2-influenced tissues.

Moderator Effects of Working Memory on the Stability of ADHD Symptoms by Dopamine Receptor Gene Polymorphisms during Development

ERIC Educational Resources Information Center

Trampush, Joey W.; Jacobs, Michelle M.; Hurd, Yasmin L.; Newcorn, Jeffrey H.; Halperin, Jeffrey M.

2014-01-01

We tested the hypothesis that dopamine D1 and D2 receptor gene (DRD1 and DRD2, respectively) polymorphisms and the development of working memory skills can interact to influence symptom change over 10 years in children with attention-deficit/hyperactivity disorder (ADHD). Specifically, we examined whether improvements in working memory maintenance…

Association between UGT2B7 gene polymorphisms and fentanyl sensitivity in patients undergoing painful orthognathic surgery

PubMed Central

Muraoka, Wataru; Nishizawa, Daisuke; Fukuda, Kenichi; Kasai, Shinya; Hasegawa, Junko; Wajima, Koichi; Nakagawa, Taneaki

2016-01-01

Background Fentanyl is often used instead of morphine for the treatment of pain because it has fewer side effects. The metabolism of morphine by glucuronidation is known to be influenced by polymorphisms of the UGT2B7 gene. Some metabolic products of fentanyl are reportedly metabolized by glucuronate conjugation. The genes that are involved in the metabolic pathway of fentanyl may also influence fentanyl sensitivity. We analyzed associations between fentanyl sensitivity and polymorphisms of the UGT2B7 gene to clarify the hereditary determinants of individual differences in fentanyl sensitivity. Results This study examined whether single-nucleotide polymorphisms (SNPs) of the UGT2B7 gene affect cold pain sensitivity and the analgesic effects of fentanyl, evaluated by a standardized pain test and fentanyl requirements in healthy Japanese subjects who underwent uniform surgical procedures. The rs7439366 SNP of UGT2B7 is reportedly associated with the metabolism and analgesic effects of morphine. We found that this SNP is also associated with the analgesic effects of fentanyl in the cold pressor-induced pain test. It suggested that the C allele of the rs7439366 SNP may enhance analgesic efficacy. Two SNPs of UGT2B7, rs4587017 and rs1002849, were also found to be novel SNPs that may influence the analgesic effects of fentanyl in the cold pressor-induced pain test. Conclusions Fentanyl sensitivity for cold pressor-induced pain was associated with the rs7439366, rs4587017, and rs1002849 SNPs of the UGT2B7 gene. Our findings may provide valuable information for achieving satisfactory pain control and open to new avenues for personalized pain treatment. PMID:28256933

Impact of I/D polymorphism of ACE gene on risk of development and course of chronic obstructive pulmonary disease.

PubMed

Mlak, Radosław; Homa-Mlak, Iwona; Powrózek, Tomasz; Mackiewicz, Barbara; Michnar, Marek; Krawczyk, Paweł; Dziedzic, Marcin; Rubinsztajn, Renata; Chazan, Ryszarda; Milanowski, Janusz; Małecka-Massalska, Teresa

2016-04-01

Chronic obstructive pulmonary disease (COPD) affects more than 10% of the world's population over 40 years of age. The main exogenous risk factor is cigarette smoking; however, only 20% of smokers develop COPD, indicating that some other factors, e.g. genetic, may play an important role in the disease pathogenesis. Recent research indicates that ACE (angiotensin-converting enzyme) may be a susceptibility gene for asthma or COPD. The aim of our study was to determine the influence of I/D (insertion/deletion) polymorphism of the ACE gene (AluYa5, rs4646994) on the risk and course of COPD. We investigated ACE I/D polymorphism in 206 COPD and 165 healthy Caucasian subjects. In the generalized linear model (GLZ) analysis of the influence of selected factors on presence of COPD we found a significant independent effect for male sex (repeatedly increases the risk of COPD, OR = 7.7, p = 0.049), as well as smoking or lower body mass index, but only in combination with older age (OR = 0.96, p = 0.003 and OR = 1.005, p = 0.04 respectively). Interestingly, analysis of factors which may influence the risk of a higher number of exacerbations demonstrated that occurrence of DD genotype, but only in men, is associated with a lower risk (OR = 0.7, p = 0.03) of this complication. We suggest that ACE may not be a susceptibility gene for the origin of COPD but a disease-modifying gene. Since the impact of I/D polymorphism of the ACE gene on COPD risk is moderate or negligible, other molecular changes, that will help predict the development of this disease, should still be sought.

Further mapping of 10q26 supports strong association of HTRA1 polymorphisms with age-related macular degeneration.

PubMed

Gibbs, Daniel; Yang, Zhenglin; Constantine, Ryan; Ma, Xiang; Camp, Nicola J; Yang, Xian; Chen, Hayou; Jorgenson, Adam; Hau, Vincent; Dewan, Andrew; Zeng, Jiexi; Harmon, Jennifer; Buehler, Jeanette; Brand, John M; Hoh, Josephine; Cameron, D Joshua; Dixit, Manjusha; Tong, Zongzhong; Zhang, Kang

2008-02-01

Age-related macular degeneration (AMD) is a complex disorder with genetic and environmental influences. The genetic influences affecting AMD are not well understood and few genes have been consistently implicated and replicated for this disease. A polymorphism (rs11200638) in a transcription factor binding site of the HTRA1 gene has been described, in previous reports, as being most significantly associated with AMD. In this paper, we investigate haplotype association and individual polymorphic association by genotyping additional variants in the AMD risk-associated region of chromosome 10q26. We demonstrate that rs11200638 in the promoter region and rs2293870 in exon 1 of HTRA1, are among the most significantly associated variants for advanced forms of AMD.

Meta-analysis of genome-wide association studies identifies common susceptibility polymorphisms for colorectal and endometrial cancer near SH2B3 and TSHZ1

PubMed Central

Cheng, Timothy HT; Thompson, Deborah; Painter, Jodie; O’Mara, Tracy; Gorman, Maggie; Martin, Lynn; Palles, Claire; Jones, Angela; Buchanan, Daniel D.; Ko Win, Aung; Hopper, John; Jenkins, Mark; Lindor, Noralane M.; Newcomb, Polly A.; Gallinger, Steve; Conti, David; Schumacher, Fred; Casey, Graham; Giles, Graham G; Pharoah, Paul; Peto, Julian; Cox, Angela; Swerdlow, Anthony; Couch, Fergus; Cunningham, Julie M; Goode, Ellen L; Winham, Stacey J; Lambrechts, Diether; Fasching, Peter; Burwinkel, Barbara; Brenner, Hermann; Brauch, Hiltrud; Chang-Claude, Jenny; Salvesen, Helga B.; Kristensen, Vessela; Darabi, Hatef; Li, Jingmei; Liu, Tao; Lindblom, Annika; Hall, Per; de Polanco, Magdalena Echeverry; Sans, Monica; Carracedo, Angel; Castellvi-Bel, Sergi; Rojas-Martinez, Augusto; Aguiar Jnr, Samuel; Teixeira, Manuel R.; Dunning, Alison M; Dennis, Joe; Otton, Geoffrey; Proietto, Tony; Holliday, Elizabeth; Attia, John; Ashton, Katie; Scott, Rodney J; McEvoy, Mark; Dowdy, Sean C; Fridley, Brooke L; Werner, Henrica MJ; Trovik, Jone; Njolstad, Tormund S; Tham, Emma; Mints, Miriam; Runnebaum, Ingo; Hillemanns, Peter; Dörk, Thilo; Amant, Frederic; Schrauwen, Stefanie; Hein, Alexander; Beckmann, Matthias W; Ekici, Arif; Czene, Kamila; Meindl, Alfons; Bolla, Manjeet K; Michailidou, Kyriaki; Tyrer, Jonathan P; Wang, Qin; Ahmed, Shahana; Healey, Catherine S; Shah, Mitul; Annibali, Daniela; Depreeuw, Jeroen; Al-Tassan, Nada A.; Harris, Rebecca; Meyer, Brian F.; Whiffin, Nicola; Hosking, Fay J; Kinnersley, Ben; Farrington, Susan M.; Timofeeva, Maria; Tenesa, Albert; Campbell, Harry; Haile, Robert W.; Hodgson, Shirley; Carvajal-Carmona, Luis; Cheadle, Jeremy P.; Easton, Douglas; Dunlop, Malcolm; Houlston, Richard; Spurdle, Amanda; Tomlinson, Ian

2015-01-01

High-risk mutations in several genes predispose to both colorectal cancer (CRC) and endometrial cancer (EC). We therefore hypothesised that some lower-risk genetic variants might also predispose to both CRC and EC. Using CRC and EC genome-wide association series, totalling 13,265 cancer cases and 40,245 controls, we found that the protective allele [G] at one previously-identified CRC polymorphism, rs2736100 near TERT, was associated with EC risk (odds ratio (OR) = 1.08, P = 0.000167); this polymorphism influences the risk of several other cancers. A further CRC polymorphism near TERC also showed evidence of association with EC (OR = 0.92; P = 0.03). Overall, however, there was no good evidence that the set of CRC polymorphisms was associated with EC risk, and neither of two previously-reported EC polymorphisms was associated with CRC risk. A combined analysis revealed one genome-wide significant polymorphism, rs3184504, on chromosome 12q24 (OR = 1.10, P = 7.23 × 10−9) with shared effects on CRC and EC risk. This polymorphism, a missense variant in the gene SH2B3, is also associated with haematological and autoimmune disorders, suggesting that it influences cancer risk through the immune response. Another polymorphism, rs12970291 near gene TSHZ1, was associated with both CRC and EC (OR = 1.26, P = 4.82 × 10−8), with the alleles showing opposite effects on the risks of the two cancers. PMID:26621817

Vitamin D Receptor Gene Polymorphisms Associated with Childhood Autism

PubMed Central

Cieślińska, Anna; Kostyra, Elżbieta; Chwała, Barbara; Moszyńska-Dumara, Małgorzata; Fiedorowicz, Ewa; Teodorowicz, Małgorzata

2017-01-01

Background: Autism spectrum disorder (ASD) is a group of heterogeneous, behaviorally defined disorders whereby currently no biological markers are common to all affected individuals. A deregulated immune response may be contributing to the etiology of ASD. The active metabolite of vitamin D3 has an immunoregulatory role mediated by binding to the vitamin D receptor (VDR) in monocyte, macrophages, and lymphocytes. The effects of vitamin D and interaction with the VDR may be influenced by polymorphism in the VDR gene. Methods: Genetic association of four different VDR polymorphisms (Apa-I, Bsm-I, Taq-I, Fok-I) associated with susceptibility to the development of autism in children was investigated. Results: We uniquely found an association between the presence of the T allele at position Taq-I and presence of the a allele at position Apa-I of the VDR gene with decreased ASD incidence. There was also an association between female gender and the presence of the T allele. We found no statistical significant correlation between VDR single nucleotide polymorphisms (SNPs) and vitamin D3 concentration in serum of ASD children. Conclusion: Genetic polymorphism in two SNP in VDR may be correlated with development of ASD symptoms by influencing functionality of vitamin D3 metabolism, while vitamin D3 levels were not significantly different between ASD and non-ASD children. PMID:28891930

Vitamin D Receptor Gene Polymorphisms Associated with Childhood Autism.

PubMed

Cieślińska, Anna; Kostyra, Elżbieta; Chwała, Barbara; Moszyńska-Dumara, Małgorzata; Fiedorowicz, Ewa; Teodorowicz, Małgorzata; Savelkoul, Huub F J

2017-09-09

Autism spectrum disorder (ASD) is a group of heterogeneous, behaviorally defined disorders whereby currently no biological markers are common to all affected individuals. A deregulated immune response may be contributing to the etiology of ASD. The active metabolite of vitamin D₃ has an immunoregulatory role mediated by binding to the vitamin D receptor (VDR) in monocyte, macrophages, and lymphocytes. The effects of vitamin D and interaction with the VDR may be influenced by polymorphism in the VDR gene. Genetic association of four different VDR polymorphisms (Apa-I, Bsm-I, Taq-I, Fok-I) associated with susceptibility to the development of autism in children was investigated. We uniquely found an association between the presence of the T allele at position Taq-I and presence of the a allele at position Apa-I of the VDR gene with decreased ASD incidence. There was also an association between female gender and the presence of the T allele. We found no statistical significant correlation between VDR single nucleotide polymorphisms (SNPs) and vitamin D₃ concentration in serum of ASD children. Genetic polymorphism in two SNP in VDR may be correlated with development of ASD symptoms by influencing functionality of vitamin D₃ metabolism, while vitamin D₃ levels were not significantly different between ASD and non-ASD children.

A critical analysis of disease-associated DNA polymorphisms in the genes of cattle, goat, sheep, and pig

PubMed Central

Ibeagha-Awemu, Eveline M.; Kgwatalala, Patrick; Ibeagha, Aloysius E.

2008-01-01

Genetic variations through their effects on gene expression and protein function underlie disease susceptibility in farm animal species. The variations are in the form of single nucleotide polymorphisms, deletions/insertions of nucleotides or whole genes, gene or whole chromosomal rearrangements, gene duplications, and copy number polymorphisms or variants. They exert varying degrees of effects on gene action, such as substitution of an amino acid for another, shift in reading frame and premature termination of translation, and complete deletion of entire exon(s) or gene(s) in diseased individuals. These factors influence gene function by affecting mRNA splicing pattern or by altering/eliminating protein function. Elucidating the genetic bases of diseases under the control of many genes is very challenging, and it is compounded by several factors, including host × pathogen × environment interactions. In this review, the genetic variations that underlie several diseases of livestock (under monogenic and polygenic control) are analyzed. Also, factors hampering research efforts toward identification of genetic influences on animal disease identification and control are highlighted. A better understanding of the factors analyzed could be better harnessed to effectively identify and control, genetically, livestock diseases. Finally, genetic control of animal diseases can reduce the costs associated with diseases, improve animal welfare, and provide healthy animal products to consumers, and should be given more attention. PMID:18350334

Genetic influences in sport and physical performance.

PubMed

Puthucheary, Zudin; Skipworth, James R A; Rawal, Jai; Loosemore, Mike; Van Someren, Ken; Montgomery, Hugh E

2011-10-01

The common inheritance of approximately 20 000 genes defines each of us as human. However, substantial variation exists between individual human genomes, including 'replication' of gene sequences (copy number variation, tandem repeats), or changes in individual base pairs (mutations if <1% frequency and single nucleotide polymorphisms if >1% frequency). A vast array of human phenotypes (e.g. muscle strength, skeletal structure, tendon elasticity, and heart and lung size) influences sports performance, each itself the result of a complex interaction between a myriad of anatomical, biochemical and physiological systems. This article discusses the role for genetic influences in influencing sporting performance and injury, offering specific exemplars where these are known. Many of these preferable genotypes are uncommon, and their combination even rarer. In theory, the chances of an individual having a perfect sporting genotype are much lower than 1 in 20 million - as the number of associated polymorphisms increase, the odds decrease correspondingly. Many recently discovered polymorphisms that may affect sports performance have been described in animal or other human based models, and have been included in this review if they may apply to athletic populations. Muscle performance is heavily influenced by basal muscle mass and its dynamic response to training. Genetic factors account for approximately 50-80% of inter-individual variation in lean body mass, with impacts detected on both 'training-naive' muscle mass and its growth response. Several cytokines such as interleukin-6 and -15, cilliary neurotrophic factor and insulin-like growth factor (IGF) have myoanabolic effects. Genotype-associated differences in endocrine function, necessary for normal skeletal muscle growth and function, may also be of significance, with complex interactions existing between thyroxine, growth hormone and the downstream regulators of the anabolic pathways (such as IGF-1 and IGF-2). Almost 200 polymorphisms are known to exist in the vitamin D receptor (VDR) gene. VDR genotype is associated with differences in strength in premenopausal women. VDR expression decreases with age and VDR genotype is associated with fat-free mass and strength in elderly men and women. Muscle fibre type determination is complex. Whilst initial composition is likely to be strongly influenced by genetic factors, training has significant effects on fibre shifts. Polymorphisms of the peroxisome proliferator-activated receptor α (PPARα) gene and R577x polymorphism of the ACTN3 gene are both associated with specific fibre compositions. Alterations in cardiac size have been associated with both increased performance and excess cardiovascular mortality. PPARα is a ligand-activated transcription factor that regulates genes involved in fatty acid uptake and oxidation, lipid metabolism and inflammation. Psychology plays an important role in training, competition, tolerance of pain and motivation. However, the role of genetic variation in determining psychological state and responses remains poorly understood; only recently have specific genes been implicated in motivational behaviour and maintenance of exercise. Thyroid hormone receptors exist within the brain and influence both neurogenesis and behaviour. With the current state of knowledge, the field of genetic influences on sports performance remains in its infancy, despite over a decade of research.

Sex steroid-related genes and male-to-female transsexualism.

PubMed

Henningsson, Susanne; Westberg, Lars; Nilsson, Staffan; Lundström, Bengt; Ekselius, Lisa; Bodlund, Owe; Lindström, Eva; Hellstrand, Monika; Rosmond, Roland; Eriksson, Elias; Landén, Mikael

2005-08-01

Transsexualism is characterised by lifelong discomfort with the assigned sex and a strong identification with the opposite sex. The cause of transsexualism is unknown, but it has been suggested that an aberration in the early sexual differentiation of various brain structures may be involved. Animal experiments have revealed that the sexual differentiation of the brain is mainly due to an influence of testosterone, acting both via androgen receptors (ARs) and--after aromatase-catalyzed conversion to estradiol--via estrogen receptors (ERs). The present study examined the possible importance of three polymorphisms and their pairwise interactions for the development of male-to-female transsexualism: a CAG repeat sequence in the first exon of the AR gene, a tetra nucleotide repeat polymorphism in intron 4 of the aromatase gene, and a CA repeat polymorphism in intron 5 of the ERbeta gene. Subjects were 29 Caucasian male-to-female transsexuals and 229 healthy male controls. Transsexuals differed from controls with respect to the mean length of the ERbeta repeat polymorphism, but not with respect to the length of the other two studied polymorphisms. However, binary logistic regression analysis revealed significant partial effects for all three polymorphisms, as well as for the interaction between the AR and aromatase gene polymorphisms, on the risk of developing transsexualism. Given the small number of transsexuals in the study, the results should be interpreted with the utmost caution. Further study of the putative role of these and other sex steroid-related genes for the development of transsexualism may, however, be worthwhile.

An improved in silico selection of phenotype affecting polymorphisms in SLC6A4, HTR1A and HTR2A genes.

PubMed

Piva, Francesco; Giulietti, Matteo; Nardi, Bernardo; Bellantuono, Cesario; Principato, Giovanni

2010-03-01

Among the experimentally assessed DNA variations in serotonin related genes, some influence physiological expression of personality and mental disorders, others alter the responses to pharmacological and/or psychotherapeutic treatments. Because of the huge number of polymorphisms lying in genes and of the great length of time necessary to perform association studies, a selection of the variations being studied is a necessary and crucial step. In this work we used the most updated and assessed bioinformatic tools to predict the phenotype affecting polymorphisms of the human HTR1A, HTR2A and SLC6A4 serotonin related genes. Moreover, we carried out a literature search to collect information about the recent association studies to compare it versus our prediction data. Gene polymorphism analysis indicated the variations that are worth considering in the association studies in the field of psychiatry, psychology and pharmacogenomics. The literature revision allowed to show both the few well and the most not enough investigated polymorphisms. Our data can be useful to select polymorphisms for new association studies, especially those not yet investigated that can be related to behaviour, mental disorders and individual treatment response. Copyright 2010 John Wiley & Sons, Ltd.

[Changes of focal and brainstem neurologic signs in patients with traumatic brain injury and their dependence on the -675 4G/5G polymorphism in the PAI-1 gene].

PubMed

Potapov, O; Kmyta, O

2014-09-01

Regressive course of neurological signs and symptoms is an important factor of evaluating the clinical course and treatment efficacy of traumatic brain injury. This article presents changes evaluation of focal and brainstem symptoms in 200 patients with traumatic brain injury, and determines the association between these changes and the -675 4G/5G polymorphism in the PAI-1 gene. We have found a connection between 4G/4G and 4G/5G genotypes for the studied polymorphism and the changes of focal and brainstem symptoms in patients with traumatic brain injury. Thus, we have demonstrated that the clinical course of traumatic brain injury is influenced by the -675 4G/5G polymorphism in the PAI-1 gene.

Vasospastic angina and microvascular angina are differentially influenced by PON1 A632G polymorphism in the Japanese.

PubMed

Mashiba, Junko; Koike, George; Kamiunten, Hitoshi; Ikeda, Manami; Sunagawa, Kenji

2005-12-01

Ethnicity and smoking are well-known risk factors for the pathogenesis of coronary vasospasm. Oxidative stress induced by smoking plays a crucial role in coronary vasospasm, but is not enough to account for the pathogenesis of coronary vasospasm, indicating that genetic factors are strongly involved. The study group comprised 162 vasospastic angina patients (VSAs), 61 microvascular angina patients (MVAs) and 61 non-responders (NRs) diagnosed by acetylcholine provocation test. Four polymorphisms of the oxidative stress related genes, cytochrome b-245, alpha polypeptide gene (CYBA) C242T and A640G, paraoxonase 1 gene (PON1) A632G, phospholipase A2 group VII gene (PLA2G7) G994T were genotyped. Allele frequency of PON1 632-G was significantly higher in both the VSA with dominant fashion and the MVA with recessive fashion compared with NR. This association was strongly influenced by gender in the MVA only. There were no significant associations between the other polymorphisms and coronary vasospasm. In addition, the allele frequency of PON1 632-G in the Japanese was higher than in Caucasians. There was a significant association between PON1 A632G polymorphism and MVA as well as VSA, but the impact of this on VSA and MVA is different in the Japanese.

Cytokine gene polymorphisms in bullous pemphigoid in a Chinese population.

PubMed

Chang, Y T; Liu, H N; Yu, C W; Lin, M W; Huang, C H; Chen, C C; Liu, M T; Lee, D D; Wang, W J; Tsai, S F

2006-01-01

Bullous pemphigoid (BP) is an autoimmune bullous disease mostly associated with autoantibodies to the hemidesmosomal BP autoantigens BP180 and BP230. High levels of interleukin (IL)-1beta, IL-4, IL-5, IL-6, IL-8, IL-10, IL-13, tumour necrosis factor (TNF)-alpha and interferon (IFN)-gamma have been detected in skin lesions or sera of patients with BP. Cytokine gene polymorphisms may affect cytokine production and contribute to susceptibility to autoimmune diseases. Until now, no cytokine gene polymorphism study has been conducted on patients with BP. We aimed to determine whether the genetic polymorphisms of the cytokine genes might influence the development of BP. DNA samples were obtained from 96 BP patients and 174 control subjects. Using direct sequencing and microsatellite genotyping, we examined 23 polymorphisms in 11 cytokine genes including the IL-1alpha, IL-1beta, IL-1 receptor antagonist, IL-4, IL-6, IL-8, IL-10, IL-13, IL-4 receptor, TNF-alpha and IFN-gamma genes. Although the BP patients were more likely to carry the -511T and -31C alleles of the IL-1beta gene (P = 0.04), the significance disappeared after correction for multiple testing (Pc). There was complete linkage disequilibrium between the -511T and -31C alleles of the IL-1beta gene. In female patients with BP, the associations with IL-1beta (-511T) and (-31C) alleles were much stronger (68% vs. 40.6%, odds ratio = 3.11, Pc = 0.006). No significantly different allelic and genotypic distributions of other cytokine gene polymorphisms could be found between the patients with BP and controls. Moreover, no association with the extent of disease involvement (localized or generalized) was observed. The IL-1beta (-511) and (-31) polymorphisms were significantly associated with BP in women. The other genetic polymorphisms of cytokine genes that we analysed do not appear to be associated with BP susceptibility in our Chinese population.

Association of I-FABP gene polymorphism and the risk of coronary heart disease.

PubMed

Yuan, Dong; Yu, Changqing; Zeng, Chunyu

2015-01-01

The study aimed to investigate the association between polymorphism of I-FABP gene and coronary heart disease (CHD). 225 patients with CHD were randomly recruited into the case group, and 196 healthy elderly volunteers were recruited from Medical Examination Center of our hospital as control. General clinical data were collected and plasma TC, TG, LDL-C, HDL-C levels were measured. Besides, polymerase chain reaction (PCR) and Restriction Fragment Length Polymorphism (RFLP) technology were used to detect the polymorphism of Hha-I enzyme cleavage sites in I-FABP gene in the study population. Hha-I cleavage sites occurred at codon 54 in exon in the coding sequencing of I-FABP gene in all participants. After cleavage with Hha-I enzyme, the genotypes were identified as wild-type A/A, heterozygous mutant A/T and homozygous mutant T/T. In case group, A/T and T/T genetic carriers had significantly higher levels of TC, TG and LDL-C than A/A carriers (P<0.05). However, in control group, similar differences were not observed (P>0.05). BMI, dietary habits and I-FABP alleles were independent risk factors of CHD. The polymorphism of I-FABP gene existed in the study population. And this genetic variation had influence on lipid metabolism, which was associated with the risk of developing CHD. I-FABP gene polymorphism may contribute to the increased genetic susceptibility to CHD.

A High Proportion of Chromosome 21 Promoter Polymorphisms Influence Transcriptional Activity

PubMed Central

Buckland, Paul R.; Coleman, Sharol L.; Hoogendoorn, Bastiaan; Guy, Carol; Smith, S. Kaye; O’Donovan, Michael C.

2004-01-01

We have sought to obtain an unbiased estimate of the proportion of polymorphisms in promoters of human genes that have functional effects. We carried out polymorphism discovery on a randomly selected group of 51 gene promoters mapping to human chromosome 21 and successfully analyzed the effect on transcription of 38 of the sequence variants. To achieve this, a total of 53 different haplotypes from 20 promoters were cloned into a modified pGL3 luciferase reporter gene vector and were tested for their abilities to promote transcription in HEK293t and JEG-3 cells. Up to seven (18%) of the 38 tested variants altered transcription by 1.5-fold, confirming that a surprisingly high proportion of promoter region polymorphisms are likely to be functionally important. The functional variants were distributed across the promoters of CRYAA, IFNAR1, KCNJ15, NCAM2, IGSF5, and B3GALT5. Three of the genes (NCAM2, IFNAR1, and CRYAA) have been previously associated with human phenotypes and the polymorphisms we describe here may therefore play a role in those phenotypes. PMID:15200235

Genetic basis of inter-individual variability in the effects of exercise on the alleviation of lifestyle-related diseases

PubMed Central

Mori, Masayuki; Higuchi, Keiichi; Sakurai, Akihiro; Tabara, Yasuharu; Miki, Tetsuro; Nose, Hiroshi

2009-01-01

Habitual exercise training, including a high-intensity interval walking programme, improves cardiorespiratory fitness and alleviates lifestyle-related diseases, such as obesity, hypertension and dyslipidaemia. However, the extent of improvement has been shown to differ substantially among individuals for various exercise regimens. A body of literature has demonstrated that gene polymorphisms could account for the inter-individual variability in the improvement of risk factors for lifestyle-related diseases following exercise training. However, the fractions of the variability explained by the polymorphisms are small (∼5%). Also, it is likely that the effects of gene polymorphisms differ with exercise regimens and subject characteristics. These observations suggest the necessity for further studies to exhaustively identify such gene polymorphisms. More importantly, the physiological and molecular genetic mechanisms by which gene polymorphisms interact with exercise to influence the improvements of risk factors for lifestyle-related diseases differentially remain to be clarified. A better understanding of these issues should lead to more effective integration of exercise to optimize the treatment and management of individuals with lifestyle-related diseases. PMID:19736300

Association Between IL-10 Gene Promoter Polymorphisms (-592 A/C, -819 T/C, -1082 A/G) and Susceptibility to HBV Infection in an Iranian Population.

PubMed

Moudi, Bita; Heidari, Zahra; Mahmoudzadeh-Sagheb, Hamidreza; Hashemi, Mohammad; Metanat, Malihe; Khosravi, Soheila; Farrokh, Parisa

2016-02-01

IL-10 can play a vital role in immune response against HBV. Three biallelic SNPs from the transcription start site control the transcription of the IL-10 gene. An association between susceptibility to HBV and IL-10 polymorphisms has been suggested in patients with HBV infection. The present study was designed to study the association between polymorphisms in interleukin-10 (-1082 A/G, -819 T/C and -592 A/C) promoter gene and chronic hepatitis B virus (HBV) infection. 221 chronically infected patients and 200 healthy control subjects were enrolled in the study. Three biallelic (-1082 A/G, -819 T/C and -592 A/C) polymorphisms in the IL-10 promoter gene were determined by PCR-RFLP method. Persistent HBV infection was associated with IL-10-1082 AG (P = 0.001) and GG (P = 0.004) genotypes and G (P = 0.000) allele. IL-10-819 T/C and -592 A/C genotype and allele frequencies did not show any correlation with the risk of chronic hepatitis B infection. These results suggest that polymorphisms in interleukin-10 gene promoter influence clinical outcome of HBV infection and susceptibility to HBV infection.

A Polymorphic p53 Response Element in KIT Ligand Influences Cancer Risk and Has Undergone Natural Selection

PubMed Central

Zeron-Medina, Jorge; Wang, Xuting; Repapi, Emmanouela; Campbell, Michelle R.; Su, Dan; Castro-Giner, Francesc; Davies, Benjamin; Peterse, Elisabeth F.P.; Sacilotto, Natalia; Walker, Graeme J.; Terzian, Tamara; Tomlinson, Ian P.; Box, Neil F.; Meinshausen, Nicolai; De Val, Sarah; Bell, Douglas A.; Bond, Gareth L.

2014-01-01

SUMMARY The ability of p53 to regulate transcription is crucial for tumor suppression and implies that inherited polymorphisms in functional p53-binding sites could influence cancer. Here, we identify a polymorphic p53 responsive element and demonstrate its influence on cancer risk using genome-wide data sets of cancer susceptibility loci, genetic variation, p53 occupancy, and p53-binding sites. We uncover a single-nucleotide polymorphism (SNP) in a functional p53-binding site and establish its influence on the ability of p53 to bind to and regulate transcription of the KITLG gene. The SNP resides in KITLG and associates with one of the largest risks identified among cancer genome-wide association studies. We establish that the SNP has undergone positive selection throughout evolution, signifying a selective benefit, but go on to show that similar SNPs are rare in the genome due to negative selection, indicating that polymorphisms in p53-binding sites are primarily detrimental to humans. PMID:24120139

Evaluation of the adenosine deaminase (ADA) G22A gene polymorphism with recurrent spontaneous abortion among Egyptian patients.

PubMed

Farhan, Hanan Mohamed; Abu-Gabal, Khadiga; Katta, Maha; Ibrahim, Raghda

2017-01-01

Adenosine and deoxyadenosine metabolism is influenced by adenosine deaminase (ADA) enzyme. ADA increases in different diseases and is considered as one of the markers for cell-mediated immunity. Pregnancy is associated with depressed cell-mediated immunity. The level of ADA expression, which seems to play a key role in maintaining pregnancy, is influenced by adenosine deaminase G22A gene polymorphism. We aimed in our study to evaluate the association of ADA G22A gene polymorphism with recurrent spontaneous abortion (RSA) in Egyptian women. Adenosine deaminase G22A gene polymorphism was genotyped in 40 patients (age range 22-39 years) with a history of RSA, selected from those attending the Gynaecology and Obstetrics Clinic of Beni-Suef University Hospital, and 20 age-matched healthy women as a control group, using polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) analysis. In our study, no statistically significant difference was found between RSA patients and control group as regards ADA G22A genotypes (p = 0.653) and alleles (p = 0.697). A comparison of the frequencies of ADA alleles in RSA patients as regards the below-35-years-old age group revealed that ADA 2(A) allele was associated with a low risk for RSA in patients aged 35 years old or younger (p = 0.008). In conclusion, our study revealed an age-dependent protective value of ADA 2(A) allele in recurrent spontaneous abortions among the Egyptian population.

β3 Integrin Haplotype Influences Gene Regulation and Plasma von Willebrand Factor Activity

PubMed Central

Payne, Katie E; Bray, Paul F; Grant, Peter J; Carter, Angela M

2008-01-01

The Leu33Pro polymorphism of the gene encoding β3 integrin (ITGB3) is associated with acute coronary syndromes and influences platelet aggregation. Three common promoter polymorphisms have also been identified. The aims of this study were to (1) investigate the influence of the ITGB3 −400C/A, −425A/C and −468G/A promoter polymorphisms on reporter gene expression and nuclear protein binding and (2) determine genotype and haplotype associations with platelet αIIbβ3 receptor density. Promoter haplotypes were introduced into an ITGB3 promoter-pGL3 construct by site directed mutagenesis and luciferase reporter gene expression analysed in HEL and HMEC-1 cells. Binding of nuclear proteins was assessed by electrophoretic mobility shift assay. The association of ITGB3 haplotype with platelet αIIbβ3 receptor density was determined in 223 subjects. Species conserved motifs were identified in the ITGB3 promoter in the vicinity of the 3 polymorphisms. The GAA, GCC, AAC, AAA and ACC constructs induced ~50% increased luciferase expression relative to the GAC construct in both cell types. Haplotype analysis including Leu33Pro indicated 5 common haplotypes; no associations between ITGB3 haplotypes and receptor density were found. However, the GCC-Pro33 haplotype was associated with significantly higher vWF activity (128.6 [112.1–145.1]%) compared with all other haplotypes (107.1 [101.2–113.0]%, p=0.02). In conclusion, the GCC-Pro33 haplotype was associated with increased vWF activity but not with platelet αIIbβ3 receptor density, which may indicate ITGB3 haplotype influences endothelial function. PMID:18045606

[Polymorphism of genes encoding proteins of DNA repair vs. occupational and environmental exposure to lead, arsenic and pesticides].

PubMed

Bukowski, Karol; Woźniak, Katarzyna

2018-03-09

Genetic polymorphism is associated with the occurrence of at least 2 different alleles in the locus with a frequency higher than 1% in the population. Among polymorphisms we can find single nucleotide polymorphism (SNP) and polymorphism of variable number of tandem repeats. The presence of certain polymorphisms in genes encoding DNA repair enzymes is associated with the speed and efficiency of DNA repair and can protect or expose humans to the effects provoked by xenobiotics. Chemicals, such as lead, arsenic pesticides are considered to exhibit strong toxicity. There are many different polymorphisms in genes encoding DNA repair enzymes, which determine the speed and efficiency of DNA damage repair induced by these xenobiotics. In the case of lead, the influence of various polymorphisms, such as APE1 (apurinic/apyrimidinic endonuclease 1) (rs1130409), hOGG1 (human 8-oxoguanine glycosylase) (rs1052133), XRCC1 (X-ray repair cross-complementing protein group 1) (rs25487), XRCC1 (rs1799782) and XRCC3 (X-ray repair cross-complementing protein group 3) (rs861539) were described. For arsenic polymorphisms, such as ERCC2 (excision repair cross-complementing) (rs13181), XRCC3 (rs861539), APE1 (rs1130409) and hOGG1 (rs1052133) were examined. As to pesticides, separate and combined effects of polymorphisms in genes encoding DNA repair enzymes, such as XRCC1 (rs1799782), hOGG1 (rs1052133), XRCC4 (X-ray repair cross-complementing protein group 4) (rs28360135) and the gene encoding the detoxification enzyme PON1 paraoxonase (rs662) were reported. Med Pr 2018;69(2):225-235. This work is available in Open Access model and licensed under a CC BY-NC 3.0 PL license.

Relationship of interleukin-1B gene promoter region polymorphism with Helicobacter pylori infection and gastritis.

PubMed

Ramis, Ivy Bastos; Vianna, Júlia Silveira; Halicki, Priscila Cristina Bartolomeu; Lara, Caroline; Tadiotto, Thássia Fernanda; da Silva Maciel, João Batista; Gonçalves, Carla Vitola; von Groll, Andrea; Dellagostin, Odir Antônio; da Silva, Pedro Eduardo Almeida

2015-09-29

Helicobacter pylori infection is associated with gastritis, peptic ulcer disease and gastric carcinoma. The severity of damage is determined by the interplay between environmental/behavioral factors, bacterial pathogenicity genes and host genetic polymorphisms that can influence the secretion levels of inflammatory cytokines. Accordingly, this study aimed to identify polymorphisms in the IL-1B and IL-1RN genes and their associations with H. pylori infection, cagA gene of H. pylori, and gastroduodenal diseases. Gastric biopsy samples from 151 patients infected with H. pylori and 76 uninfected individuals were analyzed. H. pylori infection was diagnosed by histology and PCR. Polymorphisms at positions -511, -31 and +3954 of the IL-1B gene were detected by PCR-RFLP, and an analysis of the VNTR polymorphism of the IL-1RN gene was performed by PCR. It was observed that the presence of the T/T genotype at position -511 and the C/C genotype at position -31 were associated with H. pylori infection and with an increased risk of gastritis in H. pylori-positive patients. Additionally, strains from patients H. pylori-positive carrying the cagA gene was significantly related with the T/T genotype at position -511 of IL-1B.  No association of polymorphisms at position +3954 of IL-1B and in the IL-1RN with H. pylori infection and with risk of severe gastric diseases was found. We demonstrated that polymorphisms in the promoter region of the IL-1B gene (at positions -511 and -31) are associated with an enhanced risk of H. pylori infection as well as gastritis in H. pylori-positive patients.

Androgen receptor and monoamine oxidase polymorphism in wild bonobos

PubMed Central

Garai, Cintia; Furuichi, Takeshi; Kawamoto, Yoshi; Ryu, Heungjin; Inoue-Murayama, Miho

2014-01-01

Androgen receptor gene (AR), monoamine oxidase A gene (MAOA) and monoamine oxidase B gene (MAOB) have been found to have associations with behavioral traits, such as aggressiveness, and disorders in humans. However, the extent to which similar genetic effects might influence the behavior of wild apes is unclear. We examined the loci AR glutamine repeat (ARQ), AR glycine repeat (ARG), MAOA intron 2 dinucleotide repeat (MAin2) and MAOB intron 2 dinucleotide repeat (MBin2) in 32 wild bonobos, Pan paniscus, and compared them with those of chimpanzees, Pan troglodytes, and humans. We found that bonobos were polymorphic on the four loci examined. Both loci MAin2 and MBin2 in bonobos showed a higher diversity than in chimpanzees. Because monoamine oxidase influences aggressiveness, the differences between the polymorphisms of MAin2 and MBin2 in bonobos and chimpanzees may be associated with the differences in aggression between the two species. In order to understand the evolution of these loci and AR, MAOA and MAOB in humans and non-human primates, it would be useful to conduct future studies focusing on the potential association between aggressiveness, and other personality traits, and polymorphisms documented in bonobos. PMID:25606465

No association between LRP5 gene polymorphisms and bone and obesity phenotypes in Chinese male-offspring nuclear families.

PubMed

Yu, Jin-bo; Ke, Yao-hua; He, Jin-wei; Zhang, Hao; Hu, Wei-wei; Hu, Yun-qiu; Li, Miao; Liu, Yu-juan; Gu, Jie-mei; Fu, Wen-zhen; Gao, Gao; Yue, Hua; Xiao, Wen-jin; Zhang, Zhen-lin

2010-11-01

To investigate the effect of low-density lipoprotein receptor-related protein 5 (LRP5) gene polymorphisms on bone and obesity phenotypes in young Chinese men. A total of 1244 subjects from 411 Chinese nuclear families were genotyped by using the polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) technique at the Q89R, N740N, and A1330V sites in the LRP5 gene. Bone mineral density (BMD) in the lumbar spine and the hip, total fat mass and total lean mass were measured using dual-energy X-ray absorptiometry. The association between LRP5 gene polymorphisms and peak BMD, body mass index (BMI), total fat mass, total lean mass and percentage of fat mass was assessed using a quantitative transmission disequilibrium test (QTDT). No significant within-family associations were found between genotypes or haplotypes of the LRP5 gene and peak BMD, BMI, total fat mass, total lean mass and percentage of fat mass. The 1000 permutations that were subsequently simulated were in agreement with these within-family association results. Our results suggest that common polymorphic variations of the LRP5 gene do not influence peak bone mass acquisition and obesity phenotypes in young Chinese men.

Genetic influences on insight problem solving: the role of catechol-O-methyltransferase (COMT) gene polymorphisms

PubMed Central

Jiang, Weili; Shang, Siyuan; Su, Yanjie

2015-01-01

People may experience an “aha” moment, when suddenly realizing a solution of a puzzling problem. This experience is called insight problem solving. Several findings suggest that catecholamine-related genes may contribute to insight problem solving, among which the catechol-O-methyltransferase (COMT) gene is the most promising candidate. The current study examined 753 healthy individuals to determine the associations between 7 candidate single nucleotide polymorphisms on the COMT gene and insight problem-solving performance, while considering gender differences. The results showed that individuals carrying A allele of rs4680 or T allele of rs4633 scored significantly higher on insight problem-solving tasks, and the COMT gene rs5993883 combined with gender interacted with correct solutions of insight problems, specifically showing that this gene only influenced insight problem-solving performance in males. This study presents the first investigation of the genetic impact on insight problem solving and provides evidence that highlights the role that the COMT gene plays in insight problem solving. PMID:26528222

Genetic influences on insight problem solving: the role of catechol-O-methyltransferase (COMT) gene polymorphisms.

PubMed

Jiang, Weili; Shang, Siyuan; Su, Yanjie

2015-01-01

People may experience an "aha" moment, when suddenly realizing a solution of a puzzling problem. This experience is called insight problem solving. Several findings suggest that catecholamine-related genes may contribute to insight problem solving, among which the catechol-O-methyltransferase (COMT) gene is the most promising candidate. The current study examined 753 healthy individuals to determine the associations between 7 candidate single nucleotide polymorphisms on the COMT gene and insight problem-solving performance, while considering gender differences. The results showed that individuals carrying A allele of rs4680 or T allele of rs4633 scored significantly higher on insight problem-solving tasks, and the COMT gene rs5993883 combined with gender interacted with correct solutions of insight problems, specifically showing that this gene only influenced insight problem-solving performance in males. This study presents the first investigation of the genetic impact on insight problem solving and provides evidence that highlights the role that the COMT gene plays in insight problem solving.

Paraoxonase 1 (PON1) gene-108C>T and p.Q192R polymorphisms and arylesterase activity of the enzyme in patients with dementia.

PubMed

Bednarska-Makaruk, Małgorzata Ewa; Krzywkowski, Tomasz; Graban, Alla; Lipczyńska-Łojkowska, Wanda; Bochyńska, Anna; Rodo, Maria; Wehr, Hanna; Ryglewicz, Danuta Krystyna

2013-01-01

Paraoxonase 1 (PON1) activity was determined using phenylacetate as substrate (arylesterase activity) in 304 individuals with dementia--136 recognised as probable Alzheimer's disease (AD), 64 as dementia of vascular origin (VaD) and 104 as mixed dementia (MD) and in 129 persons without symptoms of dementia and in a good general health. -108C>T polymorphism in the PON1 gene promoter and p.Q192R polymorphism in the coding region were identified. PON1 activity was significantly lower in demented patients as compared with controls particularly in dementia of a neurodegenerative character (AD and MD). The prevalence of PON1-108T allele carriers was significantly higher in the AD group than in controls. The frequencies of the p.Q192R genotypes did not differ significantly between the investigated groups. An association of the rare T-R haplotype with dementia, particularly with dementia of the neurodegenerative type, was found. Multivariate regression analysis showed a significant association of PON1 activity with PON1 -108C>T and p.Q192R polymorphisms. The influence not only of promoter -108C>T, but also of p.Q192R polymorphism on PON1 arylesterase activity was observed. One has to admit that this kind of polymorphism does not preclude interference with the enzyme activity. It could be concluded that the PON1 gene promoter polymorphism plays an additional role in Alzheimer's disease development. It seems however that PON1 activity has a dominating influence on the dementia risk.

Using Single-nucleotide Polymorphisms and Genetic Mapping to find Candidate Genes that Influence Varroa-Specific Hygiene

USDA-ARS?s Scientific Manuscript database

Varroa-sensitive hygienic (VSH) behavior is one of two behaviors identified that are most important for controlling the growth of Varroa mite populations in bee hives. A study was conducted to map quantitative trait loci (QTL) that influence VSH so that resistance genes could be identified. Crosses ...

Reading and Generalist Genes

ERIC Educational Resources Information Center

Haworth, Claire M. A.; Meaburn, Emma L.; Harlaar, Nicole; Plomin, Robert

2007-01-01

Twin-study research suggests that many (but not all) of the same genes contribute to genetic influence on diverse learning abilities and disabilities, a hypothesis called "generalist genes". This generalist genes hypothesis was tested using a set of 10 DNA markers (single nucleotide polymorphisms [SNPs]) found to be associated with early reading…

Association between norepinephrine transporter gene (SLC6A2) polymorphisms and suicide in patients with major depressive disorder.

PubMed

Kim, Yong-Ku; Hwang, Jung-A; Lee, Heon-Jeong; Yoon, Ho-Kyoung; Ko, Young-Hoon; Lee, Bun-Hee; Jung, Han-Yong; Hahn, Sang-Woo; Na, Kyoung-Sae

2014-04-01

Although several studies have investigated possible associations between norepinephrine neurotransmitter transporter gene (SLC6A2) polymorphisms and depression, few studies have examined associations between SLC6A2 polymorphisms and suicide. Three single-nucleotide polymorphisms (rs2242446, rs28386840, and rs5569) were measured in 550 patients: 201 with major depressive disorder (MDD) and suicide attempt/s, 160 with MDD without suicide attempts, and 189 healthy controls. Analysis of single-nucleotide polymorphisms (SNPs) and haplotype was conducted for the three groups. Subsequently, multivariate logistic regression analysis adjusting for age and gender was conducted to identify independent influences of each SNP. A possible association between suicide lethality and SLC6A2 polymorphisms was also investigated. In the genotype and allele frequency analysis, there were significant differences in rs28386840 between suicidal MDD patients and healthy controls. In the haplotype analysis, TAA (rs2242446-rs28386840-rs5569, from left to right) was associated with suicide attempts in MDD, although the significance (p=0.043) disappeared after Bonferroni correction. There were no relationships between lethality scores and SLC6A2 polymorphisms in suicidal MDD. Modest sample size and a single type of neurotransmitter analyzed (norepinephrine) are the primary limitations. Our results suggest that SLC6A2 polymorphisms were associated with suicide risk in patients with MDD. Future studies are warranted to elucidate possible mechanisms by which SLC6A2 polymorphisms influence suicide risk. Copyright © 2014 Elsevier B.V. All rights reserved.

An analysis of Methylenetetrahydrofolate reductase and Glutathione S-transferase omega-1 genes as modifiers of the cerebral response to ischemia

PubMed Central

Peddareddygari, Leema Reddy; Dutra, Ana Virginia; Levenstien, Mark A; Sen, Souvik; Grewal, Raji P

2009-01-01

Background Cerebral ischemia involves a series of reactions which ultimately influence the final volume of a brain infarction. We hypothesize that polymorphisms in genes encoding proteins involved in these reactions could act as modifiers of the cerebral response to ischemia and impact the resultant stroke volume. The final volume of a cerebral infarct is important as it correlates with the morbidity and mortality associated with non-lacunar ischemic strokes. Methods The proteins encoded by the methylenetetrahydrofolate reductase (MTHFR) and glutathione S-transferase omega-1 (GSTO-1) genes are, through oxidative mechanisms, key participants in the cerebral response to ischemia. On the basis of these biological activities, they were selected as candidate genes for further investigation. We analyzed the C677T polymorphism in the MTHFR gene and the C419A polymorphism in the GSTO-1 gene in 128 patients with non-lacunar ischemic strokes. Results We found no significant association of either the MTHFR (p = 0.72) or GSTO-1 (p = 0.58) polymorphisms with cerebral infarct volume. Conclusion Our study shows no major gene effect of either the MTHFR or GSTO-1 genes as a modifier of ischemic stroke volume. However, given the relatively small sample size, a minor gene effect is not excluded by this investigation. PMID:19624857

Variants in toll-like receptor 9 gene influence susceptibility to tuberculosis in a Mexican population.

PubMed

Torres-García, Diana; Cruz-Lagunas, Alfredo; García-Sancho Figueroa, Ma Cecilia; Fernández-Plata, Rosario; Baez-Saldaña, Renata; Mendoza-Milla, Criselda; Barquera, Rodrigo; Carrera-Eusebio, Aida; Ramírez-Bravo, Salomón; Campos, Lizeth; Angeles, Javier; Vargas-Alarcón, Gilberto; Granados, Julio; Gopal, Radha; Khader, Shabaana A; Yunis, Edmond J; Zuñiga, Joaquin

2013-09-21

The control of Mycobacterium tuberculosis (Mtb) infection begins with the recognition of mycobacterial structural components by toll like receptors (TLRs) and other pattern recognition receptors. Our objective was to determine the influence of TLRs polymorphisms in the susceptibility to develop tuberculosis (TB) in Amerindian individuals from a rural area of Oaxaca, Mexico with high TB incidence. We carried out a case-control association community based study, genotyping 12 polymorphisms of TLR2, TLR4, TLR6 and TLR9 genes in 90 patients with confirmed pulmonary TB and 90 unrelated exposed but asymptomatic household contacts. We found a significant increase in the frequency of the allele A of the TLR9 gene polymorphism rs352139 (A>G) in the group of TB patients (g.f. = 0.522) when compared with controls (g.f. = 0.383), (Pcorr = 0.01, OR = 1.75). Under the recessive model (A/G + A/A vs G/G) this polymorphism was also significantly associated with TB (Pcorr = 0.01, OR= 2.37). The association of the SNP rs352139 was statistically significant after adjustment by age, gender and comorbidities by regression logistic analysis (Dominant model: p value = 0.016, OR = 2.31; Additive model: p value = 0.023, OR = 1.68). The haplotype GAA of TLR9 SNPs was also associated with TB susceptibility (Pcorr = 0.02). Differences in the genotype or allele frequencies of TLR2, TLR4 and TLR6 polymorphisms between TB patients and healthy contacts were not detected. Our study suggests that the allele A of the intronic polymorphism rs352139 on TLR9 gene might contribute to the risk of developing TB in Mexican Amerindians.

Variants in toll-like receptor 9 gene influence susceptibility to tuberculosis in a Mexican population

PubMed Central

2013-01-01

Background The control of Mycobacterium tuberculosis (Mtb) infection begins with the recognition of mycobacterial structural components by toll like receptors (TLRs) and other pattern recognition receptors. Our objective was to determine the influence of TLRs polymorphisms in the susceptibility to develop tuberculosis (TB) in Amerindian individuals from a rural area of Oaxaca, Mexico with high TB incidence. Methods We carried out a case–control association community based study, genotyping 12 polymorphisms of TLR2, TLR4, TLR6 and TLR9 genes in 90 patients with confirmed pulmonary TB and 90 unrelated exposed but asymptomatic household contacts. Results We found a significant increase in the frequency of the allele A of the TLR9 gene polymorphism rs352139 (A>G) in the group of TB patients (g.f. = 0.522) when compared with controls (g.f. = 0.383), (Pcorr = 0.01, OR = 1.75). Under the recessive model (A/G + A/A vs G/G) this polymorphism was also significantly associated with TB (Pcorr = 0.01, OR= 2.37). The association of the SNP rs352139 was statistically significant after adjustment by age, gender and comorbidities by regression logistic analysis (Dominant model: p value = 0.016, OR = 2.31; Additive model: p value = 0.023, OR = 1.68). The haplotype GAA of TLR9 SNPs was also associated with TB susceptibility (Pcorr = 0.02). Differences in the genotype or allele frequencies of TLR2, TLR4 and TLR6 polymorphisms between TB patients and healthy contacts were not detected. Conclusions Our study suggests that the allele A of the intronic polymorphism rs352139 on TLR9 gene might contribute to the risk of developing TB in Mexican Amerindians. PMID:24053111

Residual vein thrombosis and onset of post-thrombotic syndrome: influence of the 4G/5G polymorphism of plasminogen activator inhibitor-1 gene.

PubMed

Incalcaterra, Egle; Meli, Francesco; Muratori, Ida; Corrado, Egle; Amato, Corrado; Canino, Baldassare; Ferrara, Filippo

2014-03-01

Plasminogen activator inhibitor-1 (PAI-1) is the most important inhibitor of plasminogen activator. The functional 4G/5G polymorphism of the gene coding for PAI-1 may affect PAI-1 plasmatic activity, influencing the imbalance between coagulation and fibrinolysis cascades. In this prospective cohort analytic study, we investigated the role of this single nucleotide polymorphism in the persistence of thrombotic lesion and the occurrence of post-thrombotic syndrome. In a group of 168 patients with post-surgical deep vein thrombosis of the legs, we analyzed the 4G/5G polymorphism in the promoter of PAI-1 gene and plasmatic PAI-1 activity. Enrolled patients were divided in two groups: patients with 4G/5G polymorphism and increased PAI-1 activity (n=85) and patients without 4G/5G polymorphism and normal PAI-1 activity (n=83). All patients were treated according to current protocols and re-examined after 3, 12 and 36 months in order to evaluate the persistence of thrombotic lesion and the occurrence of post-thrombotic syndrome. We found a significantly increased PAI activity in carrier of the 4G allele, who experienced much more frequently a persistence of thrombosis after 3, 12 and 36 months and/or the development of post-thrombosis syndrome, in spite of the anticoagulant treatment. These data not only confirm the role played by PAI-1 activity and by the 4G/5G SNP of the PAI-1 gene, but also suggest that current therapeutic protocols, recommending the administration of low weight molecular heparin and oral anticoagulant for the treatment of deep vein thrombosis, could be non sufficient for patients genetically predisposed to a less efficient clot lysis. Copyright © 2013. Published by Elsevier Ltd.

Interleukin gene polymorphisms in Chinese Han population with breast cancer, a case-control study.

PubMed

Zuo, Xiaoxiao; Li, Miao; Yang, Ya; Liang, Tiansong; Yang, Hongyao; Zhao, Xinhan; Yang, Daoke

2018-04-06

Cytokines are known as important regulators of the cancer involved in inflammatory and immunological responses. This fact and plethora of gene polymorphism data prompted us to investigate IL1 gene polymorphisms in breast cancer (BC) patients. Totally, 530 patients with BC and 628 healthy control women were studied. The genetic polymorphisms for IL1 were analyzed by Massarray Sequencing method. Three single nucleotide polymorphisms (SNPs) identified in IL1B, IL1R1 gene are thought to influence breast cancer risk. The results of the association between IL-1B, IL1R1 polymorphisms and breast cancer risk have significant. We found that the variant TT genotype of rs10490571 was associated with a significantly increased breast cancer risk (TT vs. CC: OR = 2.82, 95% CI = 1.12-7.08, P = 0.047 for the codominant model). For rs16944 (AG vs. GG: OR = 0.60, 95% CI = 0.41-0.90, P = 0.034 for the codominant model) and rs1143623 (CG vs. CC: OR = 0.65, 95% CI = 0.45-0.94, P = 0.023 for the codominant model) have significant associations were found in genetic models. In conclusion, the present analysis suggests a correlation of polymorphic markers within the IL-1 gene locus with the risk in developing breast cancer. Taken together with our finding that IL1B, IL1R1 gene three SNP are also associated with the risk for the disease, we suggest that inflammation via innate and adaptive immunity contributes to multifactorial hereditary predisposition to pathogenesis of the breast cancer.

[Influence of chronic alcohol treatment on the expression of the Bdnf, Bax, Bcl-xL, and CASP3 genes in the mouse brain: Role of the C1473G polymorphism in the gene encoding tryptophan hydroxylase 2].

PubMed

Bazovkina, D V; Tsybko, A S; Filimonova, E A; Ilchibaeva, T V; Naumenko, V S

2016-01-01

Tryptophan hydroxylase 2 (Tph-2) is the key enzyme in serotonin biosynthesis. Serotonin is one of the main neurotransmitters involved in the regulation of various physiological functions and behavior patterns. The influence of chronic ethanol consumption on the expression of the Bdnf, Bax, Bcl-xL, and CASP3 genes was studied in the brain structures of B6-1473C (C/C) and B6-1473G (G/G) mice that had been obtained on the base of the C57BL/6 strain. The strains differed in the genotype for the C1473G single nucleotide polymorphism in the Tph-2 gene and in Tph-2 enzyme activity. It was found that chronic alcohol treatment led to a significant increase in the expression of the Bdnf gene in the midbrain of B6-1473G mice, but not in B6-1473С. Chronic alcohol treatment considerably decreased the expression of the ultimate brain apoptosis effector, caspase 3, in the frontal cortex, but increased it in the hippocampus of B6-1473G mice. At the same time, chronic ethanol administration reduced the level of the antiapoptotic Bcl-xL mRNA in the midbrain of B6-1473C mice. Thus, the C1473G polymorphism in the Tph-2 gene considerably influenced the changes in the expression patterns of genes involved in the regulation of neurogenesis and neural apoptosis induced by chronic ethanol treatment.

Aromatase gene polymorphism does not influence clinical phenotype and response to oral contraceptive pills in polycystic ovary syndrome women.

PubMed

Maier, Polyana S; Spritzer, Poli Mara

2012-01-01

To assess whether a single nucleotide polymorphism (SNP50) of the aromatase gene (CYP19) is associated with polycystic ovary syndrome (PCOS) phenotypes and to investigate the influence of this polymorphism on the response of PCOS to treatment with oral contraceptive pills (OCP). 162 hirsute women were stratified into a classic PCOS group (hyperandrogenism, ovulatory dysfunction, c-PCOS) and an ovulatory PCOS group (hyperandrogenism, ovulatory cycles, polycystic ovaries, ov-PCOS). 51 women completed a 6-month OCP trial (20 µg ethinyl estradiol + 75 µg gestodene, 21/28 days per cycle, plus 100 mg spironolactone in 32 women with moderate to severe hirsutism). We considered the presence of the polymorphic allele A (AG+AA) in comparison to the absence of the polymorphism (GG) to express results and to perform the comparisons regarding clinical variables. Mean age was 23.3 ± 6.9 years. Hirsutism score was similar in c-PCOS and ov-PCOS (15 (11-20) vs. 13 (11-20)). The differences in hormone and metabolic variables between phenotypes were independent of the presence of allele A. In the OCP trial subsample, no differences were observed between genotypes after 6 months' treatment. The differences between c-PCOS and ov-PCOS cannot be explained by the genetic variation at SNP50 in the CYP19 gene. Copyright © 2012 S. Karger AG, Basel.

Methylene tetrahydrofolate reductase (MTHFR) gene polymorphisms in chronic myeloid leukemia: an Egyptian study.

PubMed

Khorshied, Mervat Mamdooh; Shaheen, Iman Abdel Mohsen; Abu Khalil, Reham E; Sheir, Rania Elsayed

2014-01-01

Methylenetetrahydrofolate reductase (MTHFR) gene plays a pivotal role in folate metabolism. Several genetic variations in MTHFR gene as MTHFR-C677T and MTHFR-A1298C result in decreased MTHFR activity, which could influence efficient DNA methylation and explain susceptibility to different cancers. The etiology of chronic myeloid leukemia (CML) is obscure and little is known about individual's susceptibility to CML. In order to assess the influence of these genetic polymorphisms on the susceptibility to CML and its effect on the course of the disease among Egyptians, we performed an age-gender-ethnic matched case-control study. The study included 97 CML patients and 130 healthy controls. Genotyping of MTHFR-C677T and -A1298C was performed by polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) technique. The results showed no statistical difference in the distribution of MTHFR-C677T and -A1298C polymorphic genotypes between CML patients and controls. The frequency of MTHFR 677-TT homozygous variant was significantly higher in patients with accelerated/blastic transformation phase when compared to those in the chronic phase of the disease. In conclusion, our study revealed that MTHFR-C677T and -A1298C polymorphisms could not be considered as genetic risk factors for CML in Egyptians. However, MTHFR 677-TT homozygous variant might be considered as a molecular predictor for disease progression.

Interleukin gene polymorphisms and breast cancer: a case control study and systematic literature review

PubMed Central

Balasubramanian, SP; Azmy, IAF; Higham, SE; Wilson, AG; Cross, SS; Cox, A; Brown, NJ; Reed, MW

2006-01-01

Background Interleukins and cytokines play an important role in the pathogenesis of many solid cancers. Several single nucleotide polymorphisms (SNPs) identified in cytokine genes are thought to influence the expression or function of these proteins and many have been evaluated for their role in inflammatory disease and cancer predisposition. The aim of this study was to evaluate any role of specific SNPs in the interleukin genes IL1A, IL1B, IL1RN, IL4R, IL6 and IL10 in predisposition to breast cancer susceptibility and severity. Methods Candidate single nucleotide polymorphisms (SNPs) in key cytokine genes were genotyped in breast cancer patients and in appropriate healthy volunteers who were similar in age, race and sex. Genotyping was performed using a high throughput allelic discrimination method. Data on clinico-pathological details and survival were collected. A systematic review of Medline English literature was done to retrieve previous studies of these polymorphisms in breast cancer. Results None of the polymorphisms studied showed any overall predisposition to breast cancer susceptibility, severity or to time to death or occurrence of distant metastases. The results of the systematic review are summarised. Conclusion Polymorphisms within key interleukin genes (IL1A, IL1B, IL1RN, IL4R, IL6 and IL10 do not appear to play a significant overall role in breast cancer susceptibility or severity. PMID:16842617

Mismatch repair gene MSH3 polymorphism is associated with the risk of sporadic prostate cancer.

PubMed

Hirata, Hiroshi; Hinoda, Yuji; Kawamoto, Ken; Kikuno, Nobuyuki; Suehiro, Yutaka; Okayama, Naoko; Tanaka, Yuichiro; Dahiya, Rajvir

2008-05-01

The mismatch repair system is a DNA repair mechanism that corrects mispaired bases during DNA replication errors. Cancer cells deficient in MMR proteins have a 10(2) to 10(3)-fold increase in the mutation rate. Single nucleotide polymorphisms of mismatch repair genes have been shown to cause a decrease in DNA repair activity. We hypothesized that mismatch repair gene polymorphism could be a risk factor for prostate cancer and p53 Pro/Pro genotype carriers could influence MSH3 and MSH6 polymorphisms. DNA samples from 110 patients with prostate cancer and 110 healthy controls were analyzed by single strand conformational polymorphism and polymerase chain reaction-restriction fragment length polymorphism to determine the genotypic frequency of 5 polymorphic loci on 2 MMR genes (MSH3 and MSH6) and p53 codon72. The chi-square test was applied to compare genotype frequency between patients and controls. A significant increase in the G/A+A/A genotype of MSH3 Pro222Pro was observed in patients compared to controls (OR 1.87, 95% CI 1.0-3.5). The frequency of A/G + G/G genotypes of MSH3 exon23 Thr1036Ala also tended to increase in patients (OR 1.57, 95% CI 0.92-2.72). In p53 codon72 Arg/Pro + Pro/Pro carriers the frequency of the AG + GG genotype of MSH3 exon23 was significantly increased in patients compared to controls (OR 2.1, 95% CI 1.05-4.34). To our knowledge this is the first report of the association of MSH3 gene polymorphisms in prostate cancer. These results suggest that the MSH3 polymorphism may be a risk factor for prostate cancer.

Environmental factors and beta2-adrenergic receptor polymorphism: influence on the energy expenditure and nutritional status of obese women.

PubMed

Rosado, Eliane Lopes; Bressan, Josefina; Martínez, J Alfredo

2015-05-01

Our aim was to evaluate the influence of the Gln27Glu polymorphism of the β2-adrenergic receptor (ADRβ2) gene, fat intake and physical activity on the energy expenditure (EE) and nutritional status of obese women. Sixty obese women (30-46 years) participated in the study and were assigned to three groups depending on the genotypes: Gln27Gln, Gln27Glu and Glu27Glu. At baseline and after nutritional intervention, the anthropometric and body composition (bioelectrical impedance), dietary, EE (indirect calorimetry) and biochemical variables were measured. All women received a high-fat test meal to determine the postprandial EE (short-term) and an energy-restricted diet for 10 weeks (long term). The frequencies of Gln27Gln, Gln27Glu and Glu27Glu were 36.67, 40.0 and 23.33 %, respectively. Anthropometric and biochemical variables and EE did not differ between groups, although women who had no polymorphism demonstrated decreased carbohydrate oxidation. On the other hand, the Glu27Glu genotype showed a positive relation with EE in physical activity and fat oxidation. The environmental factors and Gln27Glu polymorphism did not influence the nutritional status and EE of obese women, but physical activity in obese women with the polymorphism in the ADRβ2 gene can promote fat oxidation. The results suggest that encouraging the practice of physical exercise is important considering the high frequency of this polymorphism in obese subjects.

The ACE gene and human performance: 12 years on.

PubMed

Puthucheary, Zudin; Skipworth, James R A; Rawal, Jai; Loosemore, Mike; Van Someren, Ken; Montgomery, Hugh E

2011-06-01

Some 12 years ago, a polymorphism of the angiotensin I-converting enzyme (ACE) gene became the first genetic element shown to impact substantially on human physical performance. The renin-angiotensin system (RAS) exists not just as an endocrine regulator, but also within local tissue and cells, where it serves a variety of functions. Functional genetic polymorphic variants have been identified for most components of RAS, of which the best known and studied is a polymorphism of the ACE gene. The ACE insertion/deletion (I/D) polymorphism has been associated with improvements in performance and exercise duration in a variety of populations. The I allele has been consistently demonstrated to be associated with endurance-orientated events, notably, in triathlons. Meanwhile, the D allele is associated with strength- and power-orientated performance, and has been found in significant excess among elite swimmers. Exceptions to these associations do exist, and are discussed. In theory, associations with ACE genotype may be due to functional variants in nearby loci, and/or related genetic polymorphism such as the angiotensin receptor, growth hormone and bradykinin genes. Studies of growth hormone gene variants have not shown significant associations with performance in studies involving both triathletes and military recruits. The angiotensin type-1 receptor has two functional polymorphisms that have not been shown to be associated with performance, although studies of hypoxic ascent have yielded conflicting results. ACE genotype influences bradykinin levels, and a common gene variant in the bradykinin 2 receptor exists. The high kinin activity haplotye has been associated with increased endurance performance at an Olympic level, and similar results of metabolic efficiency have been demonstrated in triathletes. Whilst the ACE genotype is associated with overall performance ability, at a single organ level, the ACE genotype and related polymorphism have significant associations. In cardiac muscle, ACE genotype has associations with left ventricular mass changes in response to stimulus, in both the health and diseased states. The D allele is associated with an exaggerated response to training, and the I allele with the lowest cardiac growth response. In light of the I-allele association with endurance performance, it seems likely that other regulatory mechanisms exist. Similarly in skeletal muscle, the D allele is associated with greater strength gains in response to training, in both healthy individuals and chronic disease states. As in overall performance, those genetic polymorphisms related to the ACE genotype, such as the bradykinin 2 gene, also influence skeletal muscle strength. Finally, the ACE genotype may influence metabolic efficiency, and elite mountaineers have demonstrated an excess of I alleles and I/I genotype frequency in comparison to controls. Interestingly, this was not seen in amateur climbers. Corroboratory evidence exists among high-altitude settlements in both South America and India, where the I allele exists in greater frequency in those who migrated from the lowlands. Unfortunately, if the ACE genotype does influence metabolic efficiency, associations with peak maximal oxygen consumption have yet to be rigorously demonstrated. The ACE genotype is an important but single factor in the determinant of sporting phenotype. Much of the mechanisms underlying this remain unexplored despite 12 years of research.

Polymorphism of the ACE gene and the risk of obstructive sleep apnoea.

PubMed

Chmielewska, Izabela; Mlak, Radosław; Krawczyk, Paweł; Czukiewska, Ewa; Milanowski, Janusz

2013-01-01

Obstructive sleep apnoea/hypopnea syndrome (OSA) is characterized by obstruction of the upper airway during sleep, resulting in repetitive breathing pauses accompanied by oxygen desaturation and arousal from sleep. Among the candidate genes affecting the risk of OSA, genes whose polymorphisms influence the development of diseases with similar pathogenesis such as OSA could be listed: APOE, genes for leptin and leptin receptor, TNFA1, ADRB2 and ACE (gene for angiotensin-converting enzyme). Until now there has been a confirmed relationship between ACE gene polymorphism and cardiovascular diseases, but its effect on the incidence of OSA is debatable. The aim of this study was to investigate the effect of ACE gene insertion/deletion (I/D) polymorphism on the risk of OSA. Fifty-five patients with confirmed diagnose of OSA and qualified to CPAP therapy entered the study. The control group included 50 subjects who did not complain of any sleep related symptoms. Diagnose of OSA was set on the basis of full overnight polysomnography together with Epworth Sleepiness Scale according to American Academy of Sleep Medicine guidelines. DNA was isolated from peripheral blood leukocytes with Qiagen DNA mini Kit. ACE gene polymorphism was determined in genomic DNA using allele specific polymerase chain reaction. Different sizes of PCR products were observed on agarose gel electrophoresis. There were non-significant differences in the frequency of ACE genotypes. However, allele D had significantly lower prevalence in the study group than in the control group. (χ(2) = 4.25 p = 0.04). Moreover, I allele carriers had a threefold greater risk of developing OSA (HR = 2.748, 95% CI = 1.029-7.340, p < 0.05). Analysis of ACE gene polymorphism might be useful to determine the risk of developing OSA in clinically predisposed patients.

Genes determining the severity of cerebral palsy: the role of single nucleotide polymorphisms on the amount and structure of apolipoprotein E

PubMed Central

Lien, Espen; Andersen, Guro; Bao, Yongde; Gordish-Dressman, Heather; Skranes, Jon S.; Blackman, James A.; Vik, Torstein

2015-01-01

Aim ApolipoproteinE (apoE) influences repair and other processes in the brain and the apoE4 variant is a risk factor for Alzheimer's disease and for prolonged recovery following traumatic brain injury. We previously reported that specific single nucleotide polymorphisms in the APOE or TOMM40 genes affecting the structure and production of apoE were associated with epilepsy, more impaired hand function and gastrostomy tube feeding in children with cerebral palsy (CP). This study explored how various combinations of the same polymorphisms may affect these clinical manifestations. Methods Successful DNA analyses of APOE and TOMM40 were carried out on 227 children. The CP Register of Norway provided details of gross and fine motor function, epilepsy and gastrostomy tube feeding. Possible associations between these clinical manifestations and various combinations of the APOEε2, ε3 or ε4 alleles and of the rs59007384 polymorphism in the TOMM40 gene were explored. Results Epilepsy, impaired fine motor function and gastrostomy tube feeding were less common in children carrying the combination of rs59007384 GG and APOEε2 or ε3 than in children with other combinations. Conclusion Our findings suggest that specific combinations of genes influence the structure and production of apoE differently and affect the clinical manifestations of CP. PMID:25703783

Clinical relevance of IL-6 gene polymorphism in severely injured patients

PubMed Central

Jeremić, Vasilije; Alempijević, Tamara; Mijatović, Srđan; Šijački, Ana; Dragašević, Sanja; Pavlović, Sonja; Miličić, Biljana; Krstić, Slobodan

2014-01-01

In polytrauma, injuries that may be surgically treated under regular circumstances due to a systemic inflammatory response become life-threatening. The inflammatory response involves a complex pattern of humoral and cellular responses and the expression of related factors is thought to be governed by genetic variations. This aim of this paper is to examine the influence of interleukin (IL) 6 single nucleotide polymorphism (SNP) -174C/G and -596G/A on the treatment outcome in severely injured patients. Forty-seven severely injured patients were included in this study. Patients were assigned an Injury Severity Score. Blood samples were drawn within 24 h after admission (designated day 1) and on subsequent days (24, 48, 72 hours and 7days) of hospitalization. The IL-6 levels were determined through ELISA technique. Polymorphisms were analyzed by a method of Polymerase Chain Reaction-Restriction Fragment Length Polymorphism (PCR). Among subjects with different outcomes, no statistically relevant difference was found with regards to the gene IL-6 SNP-174G/C polymorphism. More than a half of subjects who died had the SNP-174G/C polymorphism, while this polymorphism was represented in a slightly lower number in survivors. The incidence of subjects without polymorphism and those with heterozygous and homozygous gene IL-6 SNP-596G/A polymorphism did not present statistically significant variations between survivors and those who died. The levels of IL-6 over the observation period did not present any statistically relevant difference among subjects without the IL-6 SNP-174 or IL-6 SNP -596 gene polymorphism and those who had either a heterozygous or a homozygous polymorphism. PMID:24856384

A common polymorphism in the brain-derived neurotrophic factor gene (BDNF) modulates human cortical plasticity and the response to rTMS.

PubMed

Cheeran, Binith; Talelli, Penelope; Mori, Francesco; Koch, Giacomo; Suppa, Antonio; Edwards, Mark; Houlden, Henry; Bhatia, Kailash; Greenwood, Richard; Rothwell, John C

2008-12-01

The brain-derived neurotrophic factor gene (BDNF) is one of many genes thought to influence synaptic plasticity in the adult brain and shows a common single nucleotide polymorphism (BDNF Val66Met) in the normal population that is associated with differences in hippocampal volume and episodic memory. It is also thought to influence possible synaptic changes in motor cortex following a simple motor learning task. Here we extend these studies by using new non-invasive transcranial magnetic stimulation (TMS) and transcranial direct current stimulation (TDCS) techniques that directly test the excitability and plasticity of neuronal circuits in human motor cortex in subjects at rest. We investigated whether the susceptibility to TMS probes of plasticity is significantly influenced by the BDNF polymorphism. Val66Met carriers were matched with Val66Val individuals and tested on the following protocols: continuous and intermittent theta burst TMS; median nerve paired associative stimulation; and homeostatic plasticity in the TDCS/1 Hz rTMS model. The response of Met allele carriers differed significantly in all protocols compared with the response of Val66Val individuals. We suggest that this is due to the effect of BNDF on the susceptibility of synapses to undergo LTP/LTD. The circuits tested here are implicated in the pathophysiology of movement disorders such as dystonia and are being assessed as potential new targets in the treatment of stroke. Thus the polymorphism may be one factor that influences the natural response of the brain to injury and disease.

Gene-environment interaction between adiponectin gene polymorphisms and environmental factors on the risk of diabetic retinopathy.

PubMed

Li, Yuan; Wu, Qun Hong; Jiao, Ming Li; Fan, Xiao Hong; Hu, Quan; Hao, Yan Hua; Liu, Ruo Hong; Zhang, Wei; Cui, Yu; Han, Li Yuan

2015-01-01

To evaluate whether the adiponectin gene is associated with diabetic retinopathy (DR) risk and interaction with environmental factors modifies the DR risk, and to investigate the relationship between serum adiponectin levels and DR. Four adiponectin polymorphisms were evaluated in 372 DR cases and 145 controls. Differences in environmental factors between cases and controls were evaluated by unconditional logistic regression analysis. The model-free multifactor dimensionality reduction method and traditional multiple regression models were applied to explore interactions between the polymorphisms and environmental factors. Using the Bonferroni method, we found no significant associations between four adiponectin polymorphisms and DR susceptibility. Multivariate logistic regression found that physical activity played a protective role in the progress of DR, whereas family history of diabetes (odds ratio 1.75) and insulin therapy (odds ratio 1.78) were associated with an increased risk for DR. The interaction between the C-11377 G (rs266729) polymorphism and insulin therapy might be associated with DR risk. Family history of diabetes combined with insulin therapy also increased the risk of DR. No adiponectin gene polymorphisms influenced the serum adiponectin levels. Serum adiponectin levels did not differ between the DR group and non-DR group. No significant association was identified between four adiponectin polymorphisms and DR susceptibility after stringent Bonferroni correction. The interaction between C-11377G (rs266729) polymorphism and insulin therapy, as well as the interaction between family history of diabetes and insulin therapy, might be associated with DR susceptibility.

Genetic variation in genes for the xenobiotic-metabolizing enzymes CYP1A1, EPHX1, GSTM1, GSTT1 and GSTP1 and susceptibility to colorectal cancer in Lynch syndrome

PubMed Central

Pande, Mala; Amos, Christopher I.; Osterwisch, Daniel R.; Chen, Jinyun; Lynch, Patrick M.; Broaddus, Russell; Frazier, Marsha L.

2011-01-01

Individuals with Lynch syndrome are predisposed to cancer due to an inherited DNA mismatch repair gene mutation. However, there is significant variability observed in disease expression, likely due to the influence of other environmental, lifestyle, or genetic factors. Polymorphisms in genes encoding xenobiotic-metabolizing enzymes may modify cancer risk by influencing the metabolism and clearance of potential carcinogens from the body. In this retrospective analysis, we examined key candidate gene polymorphisms in CYP1A1, EPHX1, GSTT1, GSTM1, and GSTP1 as modifiers of age at onset of colorectal cancer among 257 individuals with Lynch syndrome. We found that subjects heterozygous for CYP1A1 I462V (c.1384A>G) developed colorectal cancer 4 years earlier than those with the homozygous wild-type genotype (median ages 39 and 43 years, respectively; log-rank test P = 0.018). Furthermore, being heterozygous for the CYP1A1 polymorphisms, I462V and Msp1 (g.6235T>C), was associated with an increased risk for developing colorectal cancer [adjusted hazard ratio for AG relative to AA = 1.78, 95% CI = 1.16–2.74, P = 0.008; and hazard ratio for TC relative to TT = 1.53, 95% CI = 1.06–2.22, P = 0.02]. Since homozygous variants for both CYP1A1 polymorphisms were rare, risk estimates were imprecise. None of the other gene polymorphisms examined were associated with an earlier onset age for colorectal cancer. Our results suggest that the I462V and Msp1 polymorphisms in CYP1A1 may be an additional susceptibility factor for disease expression in Lynch syndrome since they modify the age of colorectal cancer onset by up to 4 years. PMID:18768509

Inflammatory Gene Polymorphisms in Lung Cancer Susceptibility.

PubMed

Eaton, Keith D; Romine, Perrin E; Goodman, Gary E; Thornquist, Mark D; Barnett, Matt J; Petersdorf, Effie W

2018-05-01

Chronic inflammation has been implicated in carcinogenesis, with increasing evidence of its role in lung cancer. We aimed to evaluate the role of genetic polymorphisms in inflammation-related genes in the risk for development of lung cancer. A nested case-control study design was used, and 625 cases and 625 well-matched controls were selected from participants in the β-Carotene and Retinol Efficacy Trial, which is a large, prospective lung cancer chemoprevention trial. The association between lung cancer incidence and survival and 23 polymorphisms descriptive of 11 inflammation-related genes (interferon gamma gene [IFNG], interleukin 10 gene [IL10], interleukin 1 alpha gene [IL1A], interleukin 1 beta gene [IL1B], interleukin 2 gene [IL2], interleukin 4 receptor gene [IL4R], interleukin 4 gene [IL4], interleukin 6 gene [IL6], prostaglandin-endoperoxide synthase 2 gene [PTGS2] (also known as COX2), transforming growth factor beta 1 gene [TGFB1], and tumor necrosis factor alpha gene [TNFA]) was evaluated. Of the 23 polymorphisms, two were associated with risk for lung cancer. Compared with individuals with the wild-type (CC) variant, individuals carrying the minor allele variants of the IL-1β-511C>T promoter polymorphism (rs16944) (CT and TT) had decreased odds of lung cancer (OR = 0.74, [95% confidence interval (CI): 0.58-0.94] and OR = 0.71 [95% CI: 0.50-1.01], respectively, p = 0.03). Similar results were observed for the IL-1β-1464 C>G promoter polymorphism (rs1143623), with presence of the minor variants CG and CC having decreased odds of lung cancer (OR = 0.75 [95% CI: 0.59-0.95] and OR = 0.69 [95% CI: 0.46-1.03], respectively, p = 0.03). Survival was not influenced by genotype. This study provides further evidence that IL1B promoter polymorphisms may modulate the risk for development of lung cancer. Copyright © 2018 International Association for the Study of Lung Cancer. Published by Elsevier Inc. All rights reserved.

Evaluation of the adenosine deaminase (ADA) G22A gene polymorphism with recurrent spontaneous abortion among Egyptian patients

PubMed Central

Abu-Gabal, Khadiga; Katta, Maha; Ibrahim, Raghda

2017-01-01

Introduction Adenosine and deoxyadenosine metabolism is influenced by adenosine deaminase (ADA) enzyme. ADA increases in different diseases and is considered as one of the markers for cell-mediated immunity. Pregnancy is associated with depressed cell-mediated immunity. The level of ADA expression, which seems to play a key role in maintaining pregnancy, is influenced by adenosine deaminase G22A gene polymorphism. We aimed in our study to evaluate the association of ADA G22A gene polymorphism with recurrent spontaneous abortion (RSA) in Egyptian women. Material and methods Adenosine deaminase G22A gene polymorphism was genotyped in 40 patients (age range 22-39 years) with a history of RSA, selected from those attending the Gynaecology and Obstetrics Clinic of Beni-Suef University Hospital, and 20 age-matched healthy women as a control group, using polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) analysis. Results In our study, no statistically significant difference was found between RSA patients and control group as regards ADA G22A genotypes (p = 0.653) and alleles (p = 0.697). A comparison of the frequencies of ADA alleles in RSA patients as regards the below-35-years-old age group revealed that ADA 2(A) allele was associated with a low risk for RSA in patients aged 35 years old or younger (p = 0.008). Conclusions In conclusion, our study revealed an age-dependent protective value of ADA 2(A) allele in recurrent spontaneous abortions among the Egyptian population. PMID:29204093

Association Between IL-10 Gene Promoter Polymorphisms (-592 A/C, -819 T/C, -1082 A/G) and Susceptibility to HBV Infection in an Iranian Population

PubMed Central

Moudi, Bita; Heidari, Zahra; Mahmoudzadeh-Sagheb, Hamidreza; Hashemi, Mohammad; Metanat, Malihe; Khosravi, Soheila; Farrokh, Parisa

2016-01-01

Background IL-10 can play a vital role in immune response against HBV. Three biallelic SNPs from the transcription start site control the transcription of the IL-10 gene. An association between susceptibility to HBV and IL-10 polymorphisms has been suggested in patients with HBV infection. Objectives The present study was designed to study the association between polymorphisms in interleukin-10 (-1082 A/G, -819 T/C and -592 A/C) promoter gene and chronic hepatitis B virus (HBV) infection. Patients and Methods 221 chronically infected patients and 200 healthy control subjects were enrolled in the study. Three biallelic (-1082 A/G, -819 T/C and -592 A/C) polymorphisms in the IL-10 promoter gene were determined by PCR-RFLP method. Results Persistent HBV infection was associated with IL-10-1082 AG (P = 0.001) and GG (P = 0.004) genotypes and G (P = 0.000) allele. IL-10-819 T/C and -592 A/C genotype and allele frequencies did not show any correlation with the risk of chronic hepatitis B infection. Conclusions These results suggest that polymorphisms in interleukin-10 gene promoter influence clinical outcome of HBV infection and susceptibility to HBV infection. PMID:27148384

Recent developments in the study of opioid receptors.

PubMed

Cox, Brian M

2013-04-01

It is now about 40 years since Avram Goldstein proposed the use of the stereoselectivity of opioid receptors to identify these receptors in neural membranes. In 2012, the crystal structures of the four members of the opioid receptor family were reported, providing a structural basis for understanding of critical features affecting the actions of opiate drugs. This minireview summarizes these recent developments in our understanding of opiate receptors. Receptor function is also influenced by amino acid substitutions in the protein sequence. Among opioid receptor genes, one polymorphism is much more frequent in human populations than the many others that have been found, but the functional significance of this single nucleotide polymorphism (SNP) has been unclear. Recent studies have shed new light on how this SNP might influence opioid receptor function. In this minireview, the functional significance of the most prevalent genetic polymorphism among the opioid receptor genes is also considered.

Obesity-related gene ADRB2, ADRB3 and GHRL polymorphisms and the response to a weight loss diet intervention in adult women.

PubMed

Saliba, Louise F; Reis, Rodrigo S; Brownson, Ross C; Hino, Adriano A; Tureck, Luciane V; Valko, Cheryl; de Souza, Ricardo L R; Furtado-Alle, Lupe

2014-03-01

The individual response to diet may be influenced by gene polymorphisms. This study hypothesized that ADRB2 (Gln27Glu, rs1042714 and Arg16Gly, rs1042713), ADRB3 (Trp64Arg, rs4994) and GHRL (Leu72Met, rs696217) polymorphisms moderate weight loss. The study was a seven weeks dietary weight loss intervention with Brazilian adult obese women (n = 109). The body mass index (BMI) was calculated and polymorphisms in these genes were assessed by real-time PCR assays. Two-way repeated-measures ANOVA (2 × 2) were used to analyze the intervention effect between polymorphisms and BMI over the period and after stratification for age and socioeconomic status (SES). The weight loss intervention resulted in decreased BMI over the seven-week period (p < 0.001), for high and low SES (p < 0.05) and mainly for participants with 30-49 y. The intervention did not result in a statistically significant difference in weight loss between polymorphism carriers and non-carriers, and although, the ADRB2, ADRB3 and GHRL polymorphisms did not moderate weight loss, the Gln27Glu polymorphism carriers showed a lower BMI compared to non-carriers in the low SES (p = 0.018) and the 30-39 y (p = 0.036) groups, suggesting a role for this polymorphism related to BMI control.

Obesity-related gene ADRB2, ADRB3 and GHRL polymorphisms and the response to a weight loss diet intervention in adult women

PubMed Central

Saliba, Louise F.; Reis, Rodrigo S.; Brownson, Ross C.; Hino, Adriano A.; Tureck, Luciane V.; Valko, Cheryl; de Souza, Ricardo L.R.; Furtado-Alle, Lupe

2014-01-01

The individual response to diet may be influenced by gene polymorphisms. This study hypothesized that ADRB2 (Gln27Glu, rs1042714 and Arg16Gly, rs1042713), ADRB3 (Trp64Arg, rs4994) and GHRL (Leu72Met, rs696217) polymorphisms moderate weight loss. The study was a seven weeks dietary weight loss intervention with Brazilian adult obese women (n = 109). The body mass index (BMI) was calculated and polymorphisms in these genes were assessed by real-time PCR assays. Two-way repeated-measures ANOVA (2 × 2) were used to analyze the intervention effect between polymorphisms and BMI over the period and after stratification for age and socioeconomic status (SES). The weight loss intervention resulted in decreased BMI over the seven-week period (p < 0.001), for high and low SES (p < 0.05) and mainly for participants with 30–49 y. The intervention did not result in a statistically significant difference in weight loss between polymorphism carriers and non-carriers, and although, the ADRB2, ADRB3 and GHRL polymorphisms did not moderate weight loss, the Gln27Glu polymorphism carriers showed a lower BMI compared to non-carriers in the low SES (p = 0.018) and the 30–39 y (p = 0.036) groups, suggesting a role for this polymorphism related to BMI control. PMID:24688286

Effects of Lead Exposure and Genetic Polymorphisms on ALAD and GPx Activities in Brazilian Battery Workers.

PubMed

da Cunha Martins, Airton; Mazzaron Barcelos, Gustavo Rafael; Jacob Ferreira, Anna Laura Bechara; de Souza, Marilesia Ferreira; de Syllos Cólus, Ilce Mara; Antunes, Lusânia Maria Greggi; Bastos Paoliello, Monica Maria; Adeyemi, Joseph A; Barbosa, Fernando

2015-01-01

Lead (Pb) is a toxic metal that is widely used by metallurgical industries such as car battery recycling. Exposure to the metal may modify the redox status of the cells and consequently result in changes in activities of important enzymes such as delta-aminolevulinic acid dehydratase (ALAD) and glutathione peroxidase (GPx). Similarly, genetic polymorphisms may modulate the activities of enzymes related to detoxification processes of the metal and may modify Pb body burden. Therefore, the aims of the present study were (i) to evaluate the correlation between blood lead levels (BLL) and activities of the enzymes ALAD and GPx, and (ii) to determine whether activities of these enzymes may be influenced by polymorphisms in ALAD and GPx genes in Brazilian automotive battery workers chronically exposed to Pb, as well as the effects of these polymorphisms on BLL. Our study included 257 participants; BLL were determined by inductively couple plasma-mass spectrometry (ICP-MS), and the activities of the enzymes ALAD and GPx were quantified spectrophotometrically; and genotyping of ALAD (rs1800435) and GPx-1 (rs1800668) polymorphisms was performed by TaqMan assays (real-time polymerase chain reaction, RT-PCR). Significant negative correlations were found between BLL and ALAD activity. Subjects who carried at least one polymorphic allele for ALAD gene displayed markedly lower ALAD activities, while no significant effect was observed regarding GPx-1 polymorphism and activity of the same enzyme. Further, ALAD and GPx-1 polymorphisms exerted no marked influence on BLL. Taken together, our results showed that BLL affected ALAD but not GPx activities, and these were not modulated by polymorphisms in ALAD and GPx gene. Further, the rs1800435 SNP showed a tendency to modulate ALAD activity, while the rs1800668 SNP did not modulate GPx activity in Brazilian automotive battery workers exposed to Pb.

Association of Genetic Polymorphism in the Interleukin-8 Gene with Risk of Oral Cancer and Its Correlation with Pain.

PubMed

Singh, Prithvi Kumar; Chandra, Girish; Bogra, Jaishri; Gupta, Rajni; Kumar, Vijay; Hussain, Syed Rizwan; Jain, Amita; Mahdi, Abbas Ali; Ahmad, Mohammad Kaleem

2016-02-01

Oral cancer is a multifactorial disease process and involves complex interactions between gene to gene and gene to environmental factors. Interleukin 8 (IL-8), a pro-inflammatory cytokine, having angiogenic activity with elevated expression in tumor cells, is reported to play an essential role in oral cancer development. This study was conducted with the aim to investigate the role of IL-8 (-A251T) gene polymorphism in susceptibility, progression, and self-reporting pain in oral cancer. The single nucleotide polymorphisms of the IL-8 (-A251T) gene were screened in 300 patients with oral cancer and 300 healthy controls, by polymerase chain reaction-restriction fragment length polymorphism. Genotype and allele frequencies were evaluated by chi-square test and odds ratio (OR) with 95% confidence intervals (CIs) were used to evaluate the strength of associations. The results of the study demonstrated that IL-8 (-A251T) gene polymorphism was significantly associated with susceptibility of oral cancer, whereas its correlation with clinico-pathological status or pain due to oral cancer could not be established. The AT heterozygous (OR 5.31; CI 3.38-8.34; p 0.0001) and AA homozygous (OR 2.89; CI 1.76-4.75; p 0.0001) had a greater risk for oral cancer compared to TT homozygous. Furthermore, significantly increased values of A allele frequencies compared to T allele were observed in all patients (OR 1.56; CI 1.24-1.96; p 0.0002). Tobacco chewing and smoking were also found to influence the development of oral cancer and increased the incidence of pain in oral cancer patients. The findings of this study suggest that the IL-8 (-A251T) gene polymorphism may be associated with increased risk of oral cancer.

Gene-gene interactions of CYP2A6 and MAOA polymorphisms on smoking behavior in Chinese male population.

PubMed

Tang, Xun; Guo, Song; Sun, Hongqiang; Song, Xuemei; Jiang, Zuonin; Sheng, Lixiang; Zhou, Dongfeng; Hu, Yonghua; Chen, Dafang

2009-05-01

Nicotine is the major psychoactive ingredient in tobacco, and is responsible for dependence through the nicotine-stimulated reward pathway mediated by the central dopaminergic system. Consequently, genetic polymorphisms in both nicotine metabolism and dopamine catabolism genes may influence smoking behavior, and interact with each other resulting in risk modulation. In this study, we investigated the association and multilocus gene-gene interactions of cytochrome P450 2A6 (CYP2A6), dopamine beta-hydroxylase (DBH), catechol O-methyl transferase (COMT), and monoamine oxidase A (MAOA) polymorphisms with smoking behavior in a community-based Chinese male population. The polymorphisms were genotyped in 203 current smokers, 66 former smokers, and 102 never smokers. Multivariate logistic regression models and the multifactor dimensionality reduction method were used to analyze the association and multilocus gene-gene interactions. Statistically significant trends were shown for increased risk of smoking initiation in participants with CYP2A6*1B/CYP2A6*1B genotypes compared with those with CYP2A6*1A/CYP2A6*1A genotypes [odds ratio (OR)=3.5, 95% confidence interval (CI)= 1.5-8.1], and participants with CYP2A6*1/CYP2A6*1 genotypes were at higher risk of smoking initiation (OR=2.4, 95% CI=1.2-4.5) and smoking persistence (OR=4.0, 95% CI=1.5-10.3) than those who have CYP2A6*4C genotypes. Moreover, the best model involved a gene-gene interaction between MAOA and CYP2A6 was characterized by the multifactor dimensionality reduction method (64.11% accuracy, P<0.001), and indicated that carriers of the combined 1460 T/O genotype for MAOA EcoRV and CYP2A6*1/CYP2A6*1 genotypes were at higher risk of smoking (OR=15.4, 95% CI=4.5-52.5). These findings suggested a substantial influence of CYP2A6 polymorphism as well as the interaction with MAOA resulting in risk modulation on smoking behavior in Chinese male population.

Combination of polymorphic variants in serotonin transporter and monoamine oxidase-A genes may influence the risk for early-onset alcoholism.

PubMed

Bordukalo-Niksic, Tatjana; Stefulj, Jasminka; Matosic, Ana; Mokrovic, Gordana; Cicin-Sain, Lipa

2012-12-30

The combinatory effect of polymorphisms in serotonin transporter and monoamine oxidase-A genes on the aetiopathogenesis of alcoholism was investigated in a sample of 714 individuals. Increased frequency of subjects having three 'suspected' genotypes (5-HTTLPR-LL, STin2-1010 and MAO-A 3-repeat allele) was found among type-2 alcoholic patients (P=0.0189). Results highlight serotonergic/genetic contribution to early-onset alcoholism. Copyright © 2012 Elsevier Ireland Ltd. All rights reserved.

A common FADS2 promoter polymorphism increases promoter activity and facilitates binding of transcription factor ELK1

PubMed Central

Lattka, E.; Eggers, S.; Moeller, G.; Heim, K.; Weber, M.; Mehta, D.; Prokisch, H.; Illig, T.; Adamski, J.

2010-01-01

Fatty acid desaturases (FADS) play an important role in the formation of omega-6 and omega-3 highly unsaturated fatty acids (HUFAs). The composition of HUFAs in the human metabolome is important for membrane fluidity and for the modulation of essential physiological functions such as inflammation processes and brain development. Several recent studies reported significant associations of single nucleotide polymorphisms (SNPs) in the human FADS gene cluster with HUFA levels and composition. The presence of the minor allele correlated with a decrease of desaturase reaction products and an accumulation of substrates. We performed functional studies with two of the associated polymorphisms (rs3834458 and rs968567) and showed an influence of polymorphism rs968567 on FADS2 promoter activity by luciferase reporter gene assays. Electrophoretic mobility shift assays proved allele-dependent DNA-binding ability of at least two protein complexes to the region containing SNP rs968567. One of the proteins binding to this region in an allele-specific manner was shown to be the transcription factor ELK1 (a member of ETS domain transcription factor family). These results indicate that rs968567 influences FADS2 transcription and offer first insights into the modulation of complex regulation mechanisms of FADS2 gene transcription by SNPs. PMID:19546342

A common FADS2 promoter polymorphism increases promoter activity and facilitates binding of transcription factor ELK1.

PubMed

Lattka, E; Eggers, S; Moeller, G; Heim, K; Weber, M; Mehta, D; Prokisch, H; Illig, T; Adamski, J

2010-01-01

Fatty acid desaturases (FADS) play an important role in the formation of omega-6 and omega-3 highly unsaturated fatty acids (HUFAs). The composition of HUFAs in the human metabolome is important for membrane fluidity and for the modulation of essential physiological functions such as inflammation processes and brain development. Several recent studies reported significant associations of single nucleotide polymorphisms (SNPs) in the human FADS gene cluster with HUFA levels and composition. The presence of the minor allele correlated with a decrease of desaturase reaction products and an accumulation of substrates. We performed functional studies with two of the associated polymorphisms (rs3834458 and rs968567) and showed an influence of polymorphism rs968567 on FADS2 promoter activity by luciferase reporter gene assays. Electrophoretic mobility shift assays proved allele-dependent DNA-binding ability of at least two protein complexes to the region containing SNP rs968567. One of the proteins binding to this region in an allele-specific manner was shown to be the transcription factor ELK1 (a member of ETS domain transcription factor family). These results indicate that rs968567 influences FADS2 transcription and offer first insights into the modulation of complex regulation mechanisms of FADS2 gene transcription by SNPs.

Effect of the g.-723G-->T polymorphism in the bovine myogenic factor 5 (Myf5) gene promoter region on gene transcript level in the longissimus dorsi muscle and on meat traits of Polish Holstein-Friesian cattle.

PubMed

Robakowska-Hyzorek, Dagmara; Oprzadek, Jolanta; Zelazowska, Beata; Olbromski, Rafał; Zwierzchowski, Lech

2010-06-01

Myogenic factor 5 (Myf5), a product of the Myf5 gene, belongs to the MRF family of basic helix-loop-helix transcription factors that regulate myogenesis. Their roles in muscle growth and development make their genes candidates for molecular markers of meat production in livestock, but nucleotide sequence polymorphism has not been thoroughly studied in MRF genes. We detected four single nucleotide polymorphisms (SNPs) within exon 1 of the Myf5 gene, encoding the NH-terminal transactivation domain of the Myf5 protein. Three of these mutations change the amino acid sequence. The distribution of these SNPs was highly skewed in cattle populations; most of the mutations were found in only a few or even single individuals. Of the nine SNPs found in the promoter region of Myf5, one (transversion g.-723G-->T) was represented by all three genotypes distributed in the cattle populations studied. This polymorphism showed an influence on Myf5 gene expression in the longissimus dorsi muscle and was associated with sirloin weight and fat weight in sirloin in carcasses of Holstein-Friesian cattle.

TNFalpha and IL-10 gene polymorphisms in inflammatory bowel disease. Association of -1082 AA low producer IL-10 genotype with steroid dependency.

PubMed

Castro-Santos, Patricia; Suarez, Ana; López-Rivas, Laureano; Mozo, Lourdes; Gutierrez, Carmen

2006-05-01

An altered production of cytokines underlies inflammatory bowel disease (IBD) susceptibility. Various polymorphisms at the IL-10 and TNFalpha gene promoters control cytokine production levels. The influence of these polymorphisms on susceptibility to ulcerative colitis (UC) and Crohn's disease (CD) and their association with clinical features were analyzed. Genetic polymorphisms of TNFalpha (-308 G/A) and IL-10 (-1082 G/A, -812 C/T, and -592 C/A) were determined using the LightCycler system with hybridization probes matched with one sequence variant. The study population included 99 UC patients, 146 CD patients, and 343 matched controls. We did not find association between TNFalpha or IL-10 gene polymorphisms and UC or CD susceptibility, though a slight influence of -1082*G allele in UC appearance was observed. In a stratified analysis, a highly significant association between the -1082 AA IL-10 genotype and the steroid dependency was observed in IBD (p < 0.0001), contributing both UC (p = 0.004) and CD (p = 0.003) to this association. In contrast, TNFalpha genotypes did not influence steroid dependency in IBD. Further, the contribution of cytokine genotypes and of clinical features to the appearance of steroid-dependent status (dependent variable) was studied by multivariate analysis. The steroid-dependent phenotype correlated in UC with extensive disease (p = 0.010) and with the low producer -1082 AA IL-10 genotype (p = 0.002) and in CD with penetrating disease (p = 0.010), arthritis (p = 0.011), and the -1082 AA IL-10 genotype (p = 0.006). The main conclusion is that carriage of the -1082 AA IL-10 genotype (low producer) is a relevant risk factor for developing steroid-dependent IBD.

Interleukin gene polymorphisms in Chinese Han population with breast cancer, a case-control study

PubMed Central

Yang, Ya; Liang, Tiansong; Yang, Hongyao; Zhao, Xinhan; Yang, Daoke

2018-01-01

Cytokines are known as important regulators of the cancer involved in inflammatory and immunological responses. This fact and plethora of gene polymorphism data prompted us to investigate IL1 gene polymorphisms in breast cancer (BC) patients. Totally, 530 patients with BC and 628 healthy control women were studied. The genetic polymorphisms for IL1 were analyzed by Massarray Sequencing method. Three single nucleotide polymorphisms (SNPs) identified in IL1B, IL1R1 gene are thought to influence breast cancer risk. The results of the association between IL-1B, IL1R1 polymorphisms and breast cancer risk have significant. We found that the variant TT genotype of rs10490571 was associated with a significantly increased breast cancer risk (TT vs. CC: OR = 2.82, 95% CI = 1.12–7.08, P = 0.047 for the codominant model). For rs16944 (AG vs. GG: OR = 0.60, 95% CI = 0.41–0.90, P = 0.034 for the codominant model) and rs1143623 (CG vs. CC: OR = 0.65, 95% CI = 0.45–0.94, P = 0.023 for the codominant model) have significant associations were found in genetic models. In conclusion, the present analysis suggests a correlation of polymorphic markers within the IL-1 gene locus with the risk in developing breast cancer. Taken together with our finding that IL1B, IL1R1 gene three SNP are also associated with the risk for the disease, we suggest that inflammation via innate and adaptive immunity contributes to multifactorial hereditary predisposition to pathogenesis of the breast cancer. PMID:29719585

Tetra primer ARMS-PCR relates folate/homocysteine pathway genes and ACE gene polymorphism with coronary artery disease.

PubMed

Masud, Rizwan; Qureshi, Irfan Zia

2011-09-01

Cardiovascular disorders and coronary artery disease (CAD) are significant contributors to morbidity and mortality in heart patients. As genes of the folate/homocysteine pathway have been linked with the vascular disease, we investigated association of these gene polymorphisms with CAD/myocardial infarction (MI) using the novel approach of tetraprimer ARMS-PCR. A total of 230 participants (129 MI cases, 101 normal subjects) were recruited. We genotyped rs1801133 and rs1801131 SNPs in 5'10' methylenetetrahydrofolate reductase (MTHFR), rs1805087 SNP in 5' methyltetrahydrofolate homocysteine methyltransferase (MTR), rs662 SNP in paroxanse1 (PON1), and rs5742905 polymorphism in cystathionine beta synthase (CBS). Angiotensin converting enzyme (ACE) insertion/deletion polymorphism was detected through conventional PCR. Covariates included blood pressure, fasting blood sugar, serum cholesterol, and creatinine concentrations. Our results showed allele frequencies at rs1801133, rs1801131, rs1805087 and the ACE insertion/deletion (I/D) polymorphism varied between cases and controls. Logistic regression, after adjusting for covariates, demonstrated significant associations of rs1801133 and rs1805087 with CAD in the additive, dominant, and genotype model. In contrast, ACE I/D polymorphism was significantly related with CAD where recessive model was applied. Gene-gene interaction against the disease status revealed two polymorphism groups: rs1801133, rs662, and rs1805087; and rs1801131, rs662, and ACE I/D. Only the latter interaction maintained significance after adjusted for covariates. Our study concludes that folate pathway variants exert contributory influence on susceptibility to CAD. We further suggest that tetraprimer ARMS-PCR successfully resolves the genotypes in selected samples and might prove to be a superior technique compared to the conventional approach.

Polymorphisms of apolipoprotein E and angiotensin-converting enzyme genes and carotid atherosclerosis in heavy drinkers.

PubMed

Bednarska-Makaruk, Małgorzata; Rodo, Maria; Markuszewski, Cezary; Rozenfeld, Anna; Swiderska, Malgorzata; Habrat, Bogusław; Wehr, Hanna

2005-01-01

To investigate the influence of apolipoprotein E (APOE) and angiotensin-converting enzyme (ACE) gene polymorphisms on carotid artery atherosclerosis in alcoholism. Polymorphism of both genes was identified by DNA analysis in 130 male alcohol-dependent patients. Intima-media thickness (IMT) was measured ultrasonographically. Multivariate regression analysis showed that of all the known risk factors the greatest impact on carotid atherosclerosis in alcoholics was exerted by age, hypertension, LDL cholesterol and fasting plasma glucose levels. Subjects carrying the APO E epsilon4 allele were more liable to develop atherosclerotic changes in carotid arteries compared with subjects with the epsilon3/3 genotype, which showed statistical significance in patients under 50 years of age. No association was shown between ACE I/D polymorphism and carotid atherosclerosis. APO E polymorphism can increase the risk of carotid atherosclerosis development in an alcoholic subject. The association of the APO E epsilon4 allele with carotid atherosclerosis was significant in younger patients. Since the elevated carotid IMT is considered to be a good marker of increased risk of generalized atherosclerosis the consequences could involve both cardiac and cerebrovascular events.

Polymorphisms in monolignol biosynthetic genes are associated with biomass yield and agronomic traits in European maize (Zea mays L.).

PubMed

Chen, Yongsheng; Zein, Imad; Brenner, Everton Alen; Andersen, Jeppe Reitan; Landbeck, Mathias; Ouzunova, Milena; Lübberstedt, Thomas

2010-01-15

Reduced lignin content leads to higher cell wall digestibility and, therefore, better forage quality and increased conversion of lignocellulosic biomass into ethanol. However, reduced lignin content might lead to weaker stalks, lodging, and reduced biomass yield. Genes encoding enzymes involved in cell wall lignification have been shown to influence both cell wall digestibility and yield traits. In this study, associations between monolignol biosynthetic genes and plant height (PHT), days to silking (DTS), dry matter content (DMC), and dry matter yield (DMY) were identified by using a panel of 39 European elite maize lines. In total, 10 associations were detected between polymorphisms or tight linkage disequilibrium (LD) groups within the COMT, CCoAOMT2, 4CL1, 4CL2, F5H, and PAL genomic fragments, respectively, and the above mentioned traits. The phenotypic variation explained by these polymorphisms or tight LD groups ranged from 6% to 25.8% in our line collection. Only 4CL1 and F5H were found to have polymorphisms associated with both yield and forage quality related characters. However, no pleiotropic polymorphisms affecting both digestibility of neutral detergent fiber (DNDF), and PHT or DMY were discovered, even under less stringent statistical conditions. Due to absence of pleiotropic polymorphisms affecting both forage yield and quality traits, identification of optimal monolignol biosynthetic gene haplotype(s) combining beneficial quantitative trait polymorphism (QTP) alleles for both quality and yield traits appears possible within monolignol biosynthetic genes. This is beneficial to maximize forage and bioethanol yield per unit land area.

Impact of estrogen receptor α gene and oxytocin receptor gene polymorphisms on female sexuality

PubMed Central

Armeni, Anastasia K; Assimakopoulos, Konstantinos; Marioli, Dimitra; Koika, Vassiliki; Michaelidou, Euthychia; Mourtzi, Niki; Iconomou, Gregoris

2017-01-01

Over the past decades, research attention has increasingly been paid to the neurobiological component of sexual behavior. The aim of the present study was to investigate the correlation of estrogen receptor α (ERA) gene polymorphism (rs2234693-PvuII) (T→C substitution) and oxytocin receptor gene polymorphism (rs53576) (G→A substitution) with sexuality parameters of young, healthy women. One hundred thirty-three Greek heterosexual women, students in higher education institutions, 20–25 years of age, sexually active, with normal menstrual cycles (28–35 days), were recruited in the study. Exclusion criteria were chronic and/or major psychiatric diseases, use of oral contraceptive pills (OCs), polycystic ovary syndrome (PCOS), thyroid diseases as well as drugs that are implicated in hypothalamus–pituitary–gonadal axis. T allele (wildtype) of rs2234693 (PvuII) polymorphism of ERA gene was correlated with increased levels of arousal and lubrication, whereas A allele (polymorphic) of rs53576 (OXTR) polymorphism was correlated with increased arousal levels. The simultaneous presence of both T allele of rs2234693 (PvuII) and A allele of rs53576 (OXTR) polymorphisms (T + A group) was correlated with increased arousal, orgasm levels as well as female sexual function index full score. To our knowledge, this is the first study to investigate the interaction between ERA and OXTR with regard to sexual function in women. Female sexuality is a complex behavioral trait that encompasses both biological and psychological components. It seems that variability in female sexual response stems from genetic variability that characterizes endocrine, neurotransmitter and central nervous system influences. PMID:28069897

Polymorphisms in monolignol biosynthetic genes are associated with biomass yield and agronomic traits in European maize (Zea mays L.)

PubMed Central

2010-01-01

Background Reduced lignin content leads to higher cell wall digestibility and, therefore, better forage quality and increased conversion of lignocellulosic biomass into ethanol. However, reduced lignin content might lead to weaker stalks, lodging, and reduced biomass yield. Genes encoding enzymes involved in cell wall lignification have been shown to influence both cell wall digestibility and yield traits. Results In this study, associations between monolignol biosynthetic genes and plant height (PHT), days to silking (DTS), dry matter content (DMC), and dry matter yield (DMY) were identified by using a panel of 39 European elite maize lines. In total, 10 associations were detected between polymorphisms or tight linkage disequilibrium (LD) groups within the COMT, CCoAOMT2, 4CL1, 4CL2, F5H, and PAL genomic fragments, respectively, and the above mentioned traits. The phenotypic variation explained by these polymorphisms or tight LD groups ranged from 6% to 25.8% in our line collection. Only 4CL1 and F5H were found to have polymorphisms associated with both yield and forage quality related characters. However, no pleiotropic polymorphisms affecting both digestibility of neutral detergent fiber (DNDF), and PHT or DMY were discovered, even under less stringent statistical conditions. Conclusion Due to absence of pleiotropic polymorphisms affecting both forage yield and quality traits, identification of optimal monolignol biosynthetic gene haplotype(s) combining beneficial quantitative trait polymorphism (QTP) alleles for both quality and yield traits appears possible within monolignol biosynthetic genes. This is beneficial to maximize forage and bioethanol yield per unit land area. PMID:20078869

Calving traits of crossbred Brahman Cows are Associated with Heat Shock Protein 70 Genetic Polymorphisms

USDA-ARS?s Scientific Manuscript database

Objectives were to: 1) identify single nucleotide polymorphisms (SNP) located in the promoter region of the bovine heat shock protein 70 gene, and 2) evaluate associations between Hsp70 SNP and calving rates of Brahman-influenced cows. Specific primers were designed for PCR amplification of a 539 b...

avpr1a length polymorphism is not associated with either social or genetic monogamy in free-living prairie voles.

PubMed

Mabry, Karen E; Streatfeild, Craig A; Keane, Brian; Solomon, Nancy G

2011-01-01

Recent discoveries of single-gene influences on social behaviour have generated a great deal of interest in the proximate mechanisms underlying the expression of complex behaviours. Length polymorphism in a microsatellite in the regulatory region of the gene encoding the vasopressin 1a receptor (avpr1a) has been associated with both inter- and intra-specific variation in socially monogamous behaviour in voles (genus Microtus) under laboratory conditions. Here, we evaluate the relationship between avpr1a length polymorphism and social associations, genetic monogamy, and reproductive success in free-living prairie vole (M. ochrogaster) populations. We found no evidence of a relationship between avpr1a microsatellite length and any of our correlates of either social or genetic monogamy in the field. Our results, especially when taken in conjunction with those of recent experimental studies in semi-natural enclosures, suggest that avpr1a polymorphism is unlikely to have been a major influence in the evolution or maintenance of social monogamy in prairie voles under natural conditions.

avpr1a length polymorphism is not associated with either social or genetic monogamy in free-living prairie voles

PubMed Central

Mabry, Karen E.; Streatfeild, Craig A.; Keane, Brian; Solomon, Nancy G.

2010-01-01

Recent discoveries of single-gene influences on social behaviour have generated a great deal of interest in the proximate mechanisms underlying the expression of complex behaviours. Length polymorphism in a microsatellite in the regulatory region of the gene encoding the vasopressin 1a receptor (avpr1a) has been associated with both inter- and intra-specific variation in socially monogamous behaviour in voles (genus Microtus) under laboratory conditions. Here, we evaluate the relationship between avpr1a length polymorphism and social associations, genetic monogamy, and reproductive success in free-living prairie vole (M. ochrogaster) populations. We found no evidence of a relationship between avpr1a microsatellite length and any of our correlates of either social or genetic monogamy in the field. Our results, especially when taken in conjunction with those of recent experimental studies in semi-natural enclosures, suggest that avpr1a polymorphism is unlikely to have been a major influence in the evolution or maintenance of social monogamy in prairie voles under natural conditions. PMID:21442019

Angiotensin-converting enzyme (ACE) gene insertion/deletion polymorphism is not a risk factor for hypertension in SLE nephritis.

PubMed

Negi, Vir S; Devaraju, Panneer; Gulati, Reena

2015-09-01

SLE is a systemic autoimmune disease with high prevalence of hypertension. Around 40-75 % of SLE patients develop nephritis, a major cause of hypertension and mortality. Angiotensin-converting enzyme (ACE) maintains the blood pressure and blood volume homeostasis. An insertion/deletion (I/D) polymorphism in intron 16 of ACE gene was reported to influence the development of hypertension, nephritis, and cardiovascular diseases in different ethnic populations. Despite compelling evidence for the high prevalence of hypertension in individuals with SLE, underlying factors for its development are not well studied. With this background, we analyzed the influence of ACE insertion/deletion polymorphism on susceptibility to SLE, development of nephritis and hypertension, other clinical features and autoantibody phenotype in South Indian SLE patients. Three hundred patients with SLE and 460 age and sex similar ethnicity matched individuals were included as patients and healthy controls, respectively. The ACE gene insertion/deletion polymorphism was analyzed by PCR. Insertion (I) and deletion (D) alleles were observed to be equally distributed among patients (57 and 43 %) and controls (59 and 41 %), respectively. The mutant (D) allele did not confer significant risk for SLE (II vs. ID: p = 0.4, OR 1.15, 95 % CI 0.8-1.6; II vs. DD: p = 0.34, OR 1.22, 95 % CI 0.8-1.85). There was no association of the ACE genotype or the allele with development of lupus nephritis (II vs. ID: p = 0.19, OR 1.41, 95 % CI 0.84-2.36; II vs. DD: p = 0.41, OR 0.74, 95 % CI 0.38-1.41) or hypertension (II vs. ID: p = 0.85, OR 0.9, 95 % CI 0.43-1.8; II vs. DD: p = 0.66, OR 1.217, 95 % CI 0.5-2.8). The presence of mutant allele (D) was not found to influence any clinical features or autoantibody phenotype. The insertion/deletion polymorphism of the ACE gene is not a genetic risk factor for SLE and does not influence development of hypertension or lupus nephritis in South Indian Tamils.

Association of Angiotensin Converting Enzyme I/D and α-actinin-3 R577X Genotypes with Growth Factors and Physical Fitness in Korean Children

PubMed Central

Ahn, Nayoung; Cheun, Wookwang; Byun, Jayoung; Joo, Youngsik

2015-01-01

This study analyzed the differences in aerobic and anaerobic exercise ability and growth-related indicators, depending on the polymorphism of the ACE and the ACTN3 genes, to understand the genetic influence of exercise ability in the growth process of children. The subjects of the study consisted of elementary school students (n=856, age 10.32±0.07 yr). The anthropometric parameters, physical fitness and growth factors were compared among groups of the ACE I/D or the ACTN3 R577X polymorphisms. There were no significant differences between the anthropometric parameters, physical fitness and growth factors for the ACE gene ID or the ACTN3 gene R577X polymorphism. However, the DD type of ACE gene was highest in the side step test (p<0.05), and the DD type was significantly higher than the II+ID type (p<0.05) in the early bone age. The combined group of the ACE gene II+ID and the ACTN3 gene XX type significantly showed lower early bone age (p< 0.05). This study did not find any individual or compounding effects of the polymorphism in the ACE I/D or the ACTN3 R577X polymorphisms on the anthropometric parameters, physical fitness and growth factors of Korean children. However, the exercise experience and the DD type of the ACE gene may affect the early maturity of the bones. PMID:25729275

The dopamine transporter gene may not contribute to susceptibility and the specific personality traits of amphetamine dependence.

PubMed

Tzeng, Nian-Sheng; Lu, Ru-Band; Yeh, Hui-Wen; Yeh, Yi-Wei; Huang, Chang-Chih; Yen, Che-Hung; Kuo, Shin-Chang; Chen, Chun-Yen; Chang, Hsin-An; Ho, Pei-Shen; Cheng, Serena; Shih, Mei-Chen; Huang, San-Yuan

2015-04-01

A substantial amount of evidence suggests that dysfunction of the dopamine transporter may be involved in the pathophysiology of amphetamine dependence (AD). The aim of this study was to examine whether the dopamine transporter gene (DAT1, SLC6A3) is associated with development of AD and whether this gene influences personality traits in patients with AD. Eighteen polymorphisms of the DAT1 gene were analyzed in a case-control study that included 909 Han Chinese men (568 patients with AD and 341 control subjects). The patients fulfilled the DSM-IV-TR criteria for AD. The Tridimensional Personality Questionnaire (TPQ) was used to assess personality traits and to examine the association between these traits and DAT1 gene variants. A weak association was found between the rs27072 polymorphism and development of AD, but these borderline associations were unconfirmed by logistic regression and haplotype analysis. Although harm avoidance and novelty seeking scores were significantly higher in patients than in controls, DAT1 polymorphisms did not influence these scores. This study suggests that high harm avoidance and novelty seeking personality traits may be a risk factor for the development of AD. However, the DAT1 gene may not contribute to AD susceptibility and specific personality traits observed in AD among Han Chinese men. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

Development of gene polymorphisms in meditators of nonalcoholic fatty liver disease

PubMed Central

Wang, Chun; Gong, Jianping; Wu, Hao

2017-01-01

Nonalcoholic fatty liver disease (NAFLD) is the most prevalent liver disease worldwide, the morbidity of which closely correlates with diversity of ethnicity, minority, family and location. Its histology spans from simple steatosis, to nonalcoholic steatohepatitis, which ultimately results in fibrosis, cirrhosis and hepatocellular carcinoma. The accelerating prevalence of NAFLD is due to an incremental incidence of metabolic syndrome that is distinguished by dyslipidemia, glucose impairment, obesity, excessive oxidative stress and adipocytokine impairment. Additionally, the pathogenesis of NAFLD is thought to be a multifactorial and complicated disease associated with lifestyle habits, nutritional factors and genetics. However, the pathogenesis and underlying mechanism in the development of NAFLD caused by genetics remains unclear. People have been increasingly emphasizing on the relationship between NAFLD and gene polymorphisms in recent years, with the aim of having a comprehensive elucidation of associated gene polymorphisms influencing the pathogenesis of the disease. In the current article, the authors attempted to critically summarize the most recently identified gene polymorphisms from the facets of glucose metabolism, fatty acid metabolism, oxidative stress and related cytokines in NAFLD that contribute to promoting the progression of the disease. PMID:28804621

[T(-786) --> C-polymorphism of the endothelial nitric oxide synthase promoter gene (eNOS) and exercise performance in sport].

PubMed

Drozdovs'ka, S B; Lysenko, O M; Dosenko, V Ie; Il'ïn, V M; Moĭbenko, O O

2013-01-01

Given the significant impact of the T(-786) --> C-polymorphism of the eNOS gene in the process of adaptation to physical stress, we aimed to investigate the effect of this polymorphism on physical performance in sportsmen and establish the possibility of its use as a marker of predisposition to the sport. DNA of 516 people, of which 195 qualified athletes and 321 people who had no experience of regular exercise was investigated. The frequency of genotypes and alleles of the T(-786) --> C-polymorphism of the eNOS gene in groups of athletes of different sports, the distribution of genotypes and alleles among athletes and those who are not involved in sports were studied. T allele frequency in a group of athletes on 6.4% (r(chi)2 = 0.03) than in control group. The association of the T allele of the T(-786) --> C-polymorphism of the eNOS gene with a predisposition for speed and power was established. In the group of athletes in speed and power sports, the T-allele frequency was higher than that in the control group by 12% (r(chi)2 = 0.002) and than in group endurance sports by 10% (r(chi)2 = 0.004). We found that the T(-786) --> C-polymorphism of the eNOS gene influence the power and efficiency ofthe functioning of the cardiorespiratory system of athletes during exercise.

No association of the Arg51Gln and Leu72Met polymorphisms of the ghrelin gene and polycystic ovary syndrome.

PubMed

Wang, Kehua; Wang, Leiguang; Zhao, Yueran; Shi, Yuhua; Wang, Laicheng; Chen, Zi-Jiang

2009-02-01

Ghrelin plays a role in regulating glucose metabolism and energy balance. Polymorphisms in preproghrelin and ghrelin gene could be responsible for obesity, insulin resistance and low ghrelin levels observed in some individuals. The objective of this study was to evaluate the influence of two single-nucleotide polymorphisms (SNPs) of ghrelin gene on the clinical, the hormonal and metabolic features in women with polycystic ovary syndrome (PCOS) in a Chinese population. A large sample of Chinese PCOS (n = 271) women and a control group (n = 296) of healthy women matched for age were studied. Hormone and metabolic profiles were measured and blood samples were collected for genotype and allelic frequency analysis. Non-synonymous SNPs in the coding region (exon 2) of the preproghrelin gene (Arg51Gln (346 G>A) and Leu72Met (408 C>A) were studied using PCR and restriction fragment length polymorphism analysis. The polymorphism Arg51Gln was not found in the cohorts studied. The distribution of Leu72Met was similar in PCOS group and in healthy controls. There was no significant difference in age, BMI, waist-hip-ratio and levels of FSH, LH, estradiol, testosterone and prolactin between PCOS patients with different genotypes, and the level of plasma glucose and insulin was also similar. No association was found between Leu72Met and Arg51Gln polymorphisms in the ghrelin gene and PCOS in Chinese population.

The relationship in Japanese infants between a genetic polymorphism in the promoter region of the insulin-like growth factor I gene and the plasma level.

PubMed

Kinoshita, Yumiko; Kizaki, Zenro; Ishihara, Yasunori; Nakajima, Hisakazu; Adachi, Shinsuke; Kosaka, Kitaro; Kinugasa, Akihiko; Sugimoto, Tohru

2007-01-01

Evidence is accumulating that the promoter region of the insulin-like growth factor I (IGF-I) gene polymorphism and low levels of IGF-I are associated with type 2 diabetes, cardiovascular disease and birth weight; however, the number of wild-type alleles is different in each country. This study aimed to examine the 737/738 marker, a cytosine-adenine repeat in the promoter region of the IGF-I gene polymorphism, and plasma IGF-I levels in Japanese infants and analyze the genetic background. Data were collected for 15 months in Kyoto Prefectural University of Medicine. The body composition parameters of all infants were determined at birth. At 5 days after birth, we took blood samples to measure the product size of the promoter region of the IGF-I gene polymorphism and plasma IGF-I. In a population-based sample of 160 subjects, 6 different alleles and 16 genotypes were identified in the promoter region of the IGF-I gene polymorphism. The existence of a 196-bp allele has proved to result in a low plasma IGF-I level, a small head and chest circumference (p < 0.05) and no significant for premature birth, short-birth height and low-birth weight. This is the first study showing the role of the promoter region of the IGF-I gene polymorphism and the level of plasma IGF-I and body composition parameters in Japanese infants. Our results suggest genetical influence on prenatal growth and serum IGF-I levels.

Gene-gene, gene-environment, gene-nutrient interactions and single nucleotide polymorphisms of inflammatory cytokines.

PubMed

Nadeem, Amina; Mumtaz, Sadaf; Naveed, Abdul Khaliq; Aslam, Muhammad; Siddiqui, Arif; Lodhi, Ghulam Mustafa; Ahmad, Tausif

2015-05-15

Inflammation plays a significant role in the etiology of type 2 diabetes mellitus (T2DM). The rise in the pro-inflammatory cytokines is the essential step in glucotoxicity and lipotoxicity induced mitochondrial injury, oxidative stress and beta cell apoptosis in T2DM. Among the recognized markers are interleukin (IL)-6, IL-1, IL-10, IL-18, tissue necrosis factor-alpha (TNF-α), C-reactive protein, resistin, adiponectin, tissue plasminogen activator, fibrinogen and heptoglobins. Diabetes mellitus has firm genetic and very strong environmental influence; exhibiting a polygenic mode of inheritance. Many single nucleotide polymorphisms (SNPs) in various genes including those of pro and anti-inflammatory cytokines have been reported as a risk for T2DM. Not all the SNPs have been confirmed by unifying results in different studies and wide variations have been reported in various ethnic groups. The inter-ethnic variations can be explained by the fact that gene expression may be regulated by gene-gene, gene-environment and gene-nutrient interactions. This review highlights the impact of these interactions on determining the role of single nucleotide polymorphism of IL-6, TNF-α, resistin and adiponectin in pathogenesis of T2DM.

Polymorphisms of the 5-HT2A receptor gene and clinical response to olanzapine in paranoid schizophrenia.

PubMed

Olajossy-Hilkesberger, Luiza; Godlewska, Beata; Schosser-Haupt, Alexandra; Olajossy, Marcin; Wojcierowski, Jacek; Landowski, Jerzy; Marmurowska-Michałowska, Halina; Kasper, Siegfried

2011-01-01

5-HT2A receptor is strongly implicated in the mode of action of atypical antipsychotic drugs. The aim of the study was to investigate whether the 5-HT2A receptor gene's polymorphisms (His452Tyr and T102C) have an influence on the response to olanzapine in patients with schizophrenia. We studied 99 Caucasian schizophrenia patients treated with olanzapine. Psychopathology was measured before and after 6 weeks of treatment. Clinical improvement was quantified as change in Positive and Negative Syndrome Scale (PANSS) total scores and subscores as shown by percentage improvement below the baseline score. The clinical response to antipsychotic treatment was defined as 30% improvement from baseline in PANSS scores. The His/Tyr polymorphism was significantly associated with a percentage improvement in PANSS positive symptom subscore (better response in His/His homozygotes; p<0.05) after treatment with olanzapine. As for the T102C polymorphism, a better response in terms of PANSS positive subscore improvement was observed for C/C homozygotes (p<0.01). A significant association of 5-HT2A genotype distribution of the T102C polymorphism with a categorical measure of response, but only in terms of PANSS positive symptom subscores, was observed (p<0.01). Variations in the 5-HT2A receptor gene may influence individual and particularly positive symptom response to olanzapine. Copyright © 2011 S. Karger AG, Basel.

Interleukin-10 -1082 gene polymorphism and susceptibility to cervical cancer among Japanese women.

PubMed

Matsumoto, Koji; Oki, Akinori; Satoh, Toyomi; Okada, Satoshi; Minaguchi, Takeo; Onuki, Mamiko; Ochi, Hiroyuki; Nakao, Sari; Sakurai, Manabu; Abe, Azusa; Hamada, Hiromi; Yoshikawa, Hiroyuki

2010-11-01

Polymorphisms in cytokine genes can influence immune responses to human papillomavirus infection, possibly modifying risks of cervical cancer. Using an amplification refractory mutation system-polymerase chain reaction method, we analyzed a single nucleotide polymorphism (A/G) at position -1082 in interleukin-10 promoter region in 440 Japanese women: 173 women with normal cytology, 163 women with cervical intraepithelial neoplasia and 104 women with invasive cervical cancer. The carrier frequency of interleukin-10 -1082 G alleles associated with higher interleukin-10 production increased with disease severity: 9.8% for normal cytology; 19.6% for cervical intraepithelial neoplasia; 29.8% for invasive cervical cancer (P for trend < 0.001). Among cytologically normal women, human papillomavirus infections were more common in those who were positive for an interleukin-10 -1082 G allele (P = 0.04). In conclusion, our data suggest that interleukin-10 -1082 gene polymorphism may serve as a marker of genetic susceptibility to cervical cancer among Japanese women.

A study of three polymorphic sites of ADA gene in colon cancer.

PubMed

Spina, C; Saccucci, P; Cozzoli, E; Bottini, E; Gloria-Bottini, F

2010-12-01

Adenosine inhibits the immune response in tumors. Adenosine deaminase (ADA) controls adenosine level and as ecto-enzyme acts as costimulatory molecule of adenosine receptors and/or CD26. We examined ADA₁, ADA₂, ADA₆ polymorphic sites of ADA gene in 109 subjects with colon cancer from Rome's population and in 246 blood donors as controls from the same population. In colon cancer ADA₁*2/ADA₂*1 haplotype is more represented, while ADA₁*2/ADA₂*2 is less represented than in controls. ADA₂*2/ADA₆*2 is less represented in patients than in controls. Polymorphic sites of ADA might influence cell-mediated anti-tumor immune responses controlling adenosine level and extraenzymatic protein functions.

PD-1 gene polymorphism in children with subacute sclerosing panencephalitis.

PubMed

Piskin, Ibrahim Etem; Calık, Mustafa; Abuhandan, Mahmut; Kolsal, Ebru; Celik, Sevim Karakas; Iscan, Akın

2013-08-01

Subacute sclerosing panencephalitis (SSPE) is a progressive inflammatory and degenerative disorder of the central nervous system. Several factors influence the risk of chronic brain infection with the mutant measles virus. However, to date, no pathogenic mechanism that may predispose to SSPE has been determined. Studies have indicated that specific polymorphisms in certain host genes are probably involved in impairing the ability of host immune cells to eradicate the measles virus in SSPE patients. Programmed cell death protein 1 (PD-1), a member of the CD28 family, is a negative regulator of the immune system. The purpose of our study was to investigate whether PD-1 gene polymorphisms affect susceptibility to the development of SSPE in Turkish children. In total, 109 subjects (54 SSPE patients and 55 healthy controls) were genotyped for the PD-1.9 C/T (rs2227982) single-nucleotide polymorphism (SNP). The distributions of T alleles in the PD-1.9 polymorphism in SSPE patients and healthy controls were 2.8 and 10.9%, respectively. There was a statistically significant difference between the groups; the 95% confidence interval (CI) was 0.06 to 0.85 and the odds ratio (OR) was 0.23 (χ(2) test). Thus, we identified an association between SSPE and the PD-1 rs2227982 gene polymorphism; the frequency of T alleles was higher in controls than in SSPE patients. Georg Thieme Verlag KG Stuttgart · New York.

Polymorphism in the ADRB2 gene explains a small portion of intersubject variability in pain relative to cervical dilation in the first stage of labor.

PubMed

Terkawi, Abdullah S; Jackson, William M; Hansoti, Shehnaz; Tabassum, Rabeena; Flood, Pamela

2014-07-01

Variability in labor pain has been associated with demographic, clinical, and psychological factors. Polymorphisms of the β2-adrenergic receptor gene (ADRB2) influence sensitivity to experimental pain in humans and are a risk factor for chronic pain. The authors hypothesized that polymorphisms in ADRB2 may influence labor pain. After Institutional Review Board approval and written informed consent, the authors prospectively obtained hourly pain reports from 233 nulliparous parturients during the first stage of labor, of which 199 were included in the current analysis. DNA from blood samples was genotyped at polymorphisms in the genes for the β2-adrenergic receptor, the μ opioid receptor subtype 1, catechol-O-methyltransferase, fatty acid amide hydrolase, and the oxytocin receptor. Labor pain as a function of cervical dilation was modeled with previously described methods. Patient covariates, ADRB2 genotype, and obstetrical and anesthesia treatment were evaluated as covariates in the model. Labor pain more rapidly became severe in parturients heterozygous or homozygous for the G allele at rs1042714 in the ADRB2 gene. Labor pain increased more rapidly after artificial rupture of membranes, augmentation with oxytocin, and in younger women. Inclusion of covariates explained approximately 10% of the variability between subjects. ADRB2 genotype explained less than 1% of the intersubject variability. ADRB2 genotype correlates with labor pain but explained less than 1% of the intersubject variance in the model.

The distribution of apolipoprotein E gene polymorphism in Chinese civil aircrews, and a possible risk factor to their overweight and dyslipidemia is cumulative flight time.

PubMed

Huang, He; Liu, Jing; Feng, Yingjin; Chen, Weiru

2013-02-01

The prevalence of dyslipidemia and overweight is significantly higher in aircrews than that in general population. The purpose of the study was to examine the distribution of APOE gene polymorphism and the influence of which as well as occupational environment on dyslipidemia and overweight in Chinese civil aircrews. APOE gene polymorphism was investigated using PCR-RFLP, plasma lipid parameters were measured by standard enzymatic kits and personal information of the aircrews was collected through questionnaires. The allele frequencies among aircrews were ε2: 17.0%, ε3: 80.9%, and ε4: 2.1%, APOE gene polymorphism was associated with significant differences in TC and LDL-C. E2 individuals had the lowest TC and LDL-C concentrations, and E4 participants had the highest levels (p<0.001). In addition, the TC and LDL-C concentrations, as well as BMI rose with the increasing cumulative flying hours (p<0.05). The further logistic regression analysis showed the significant associations of BMI and dyslipidemia (p<0.0001, OR=2.093), cumulative flight time and overweight (p<0.0001, OR=1.560). The distribution of APOE alleles among aircrews was provided for the first time, which is not fully identical with that among general population. These data also suggested the cumulative flight time influenced dyslipidemia and overweight as an environmental contributor. Copyright © 2012 Elsevier B.V. All rights reserved.

Association of polyunsaturated fatty acids in breast milk with fatty acid desaturase gene polymorphisms among Chinese lactating mothers.

PubMed

Ding, Zhen; Liu, Guo-Liang; Li, Xiang; Chen, Xue-Yan; Wu, Yi-Xia; Cui, Can-Can; Zhang, Xi; Yang, Guang; Xie, Lin

2016-06-01

The fatty acid desaturase (FADS) controls polyunsaturated fatty acid (PUFA) synthesis in human tissues and breast milk. Evaluate the influence of 10 single nucleotide polymorphisms (SNPs) and various haplotypes in the FADS gene cluster (FADS1, FADS2, FADS3) on PUFA concentration in the breast milk of 209 healthy Chinese women. PUFA concentrations were measured in breast milk using gas chromatography and genotyping was performed using the Sequenom Mass Array system. A SNP (rs1535) and 2-locus haplotypes (rs3834458-rs1535, rs1535-rs174575) in the FADS2 gene were associated with concentrations of γ-linoleic acid (GLA) and arachidonic acid (AA) in breast milk. Likewise, in the FADS1 gene, a 2-locus constructed haplotype (rs174547-rs174553) also affected GLA and AA concentration (P<0.05 for all). Minor allele carriers of the SNP and haplotypes described above had lower concentrations of GLA and AA. In the FADS2 gene, the 3-locus haplotype rs3834458-rs1535-rs174575, significantly affected concentrations of GLA but not AA. Pairwise comparison showed that individuals major homozygous for the SNP rs1000778 in the FADS3 gene had lower concentrations of ALA and linoleic acid (LA) in their breast milk. Polymorphisms in the FADS gene cluster influence PUFA concentrations in the breast milk of Chinese Han lactating women. Copyright © 2016 Elsevier Ltd. All rights reserved.

Moderation of the effect of adolescent-onset cannabis use on adult psychosis by a functional polymorphism in the catechol-O-methyltransferase gene: longitudinal evidence of a gene X environment interaction.

PubMed

Caspi, Avshalom; Moffitt, Terrie E; Cannon, Mary; McClay, Joseph; Murray, Robin; Harrington, HonaLee; Taylor, Alan; Arseneault, Louise; Williams, Ben; Braithwaite, Antony; Poulton, Richie; Craig, Ian W

2005-05-15

Recent evidence documents that cannabis use by young people is a modest statistical risk factor for psychotic symptoms in adulthood, such as hallucinations and delusions, as well as clinically significant schizophrenia. The vast majority of cannabis users do not develop psychosis, however, prompting us to hypothesize that some people are genetically vulnerable to the deleterious effects of cannabis. In a longitudinal study of a representative birth cohort followed to adulthood, we tested why cannabis use is associated with the emergence of psychosis in a minority of users, but not in others. A functional polymorphism in the catechol-O-methyltransferase (COMT) gene moderated the influence of adolescent cannabis use on developing adult psychosis. Carriers of the COMT valine158 allele were most likely to exhibit psychotic symptoms and to develop schizophreniform disorder if they used cannabis. Cannabis use had no such adverse influence on individuals with two copies of the methionine allele. These findings provide evidence of a gene x environment interaction and suggest that a role of some susceptibility genes is to influence vulnerability to environmental pathogens.

Association between methylenetetrahydrofolate reductase polymorphism C677T and risk of chronic myeloid leukemia in Serbian population.

PubMed

Jakovljevic, Ksenija; Malisic, Emina; Cavic, Milena; Radulovic, Sinisa; Jankovic, Radmila

2012-07-01

Methylenetetrahydrofolate reductase (MTHFR) is a key enzyme regulating the intracellular folate metabolism which plays an important role in carcinogenesis through DNA methylation and nucleotide synthesis. The common MTHFR single nucleotide polymorphism C677T has been reported to be associated with reduced enzymatic activity. In order to investigate the influence of this polymorphism on the risk of chronic myeloid leukemia (CML), we performed a case-control study in a Serbian population of 52 patients with CML and 53 healthy control subjects. MTHFR C677T polymorphism genotyping was assessed using the polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) method. The results demonstrated no statistical difference in MTHFR 677 frequency distribution between patient and control groups. Our findings suggest that MTHFR 677 gene variants have no significant influence on the susceptibility to CML in a Serbian population.

LPA gene: interaction between the apolipoprotein(a) size ('kringle IV' repeat) polymorphism and a pentanucleotide repeat polymorphism influences Lp(a) lipoprotein level.

PubMed

Røsby, O; Berg, K

2000-01-01

In order to search for factors influencing the Lp(a) lipoprotein level, we have examined the apolipoprotein(a) (apo(a)) size polymorphism as well as a pentanucleotide (TTTTA) repeat polymorphism in the 5' control region of the LPA gene. Lp(a) lipoprotein levels were compared between individuals with different genotypes as defined by pulsed field gel electrophoresis of DNA plugs, and PCR of DNA samples followed by polyacrylamide gel electrophoresis. DNA plugs and DNA were prepared from blood samples collected from blood donors. Twenty-seven different K IV repeat alleles were observed in the 71 women and 92 men from which apo(a) size polymorphism results were obtained. Alleles encoding 26-32 Kringle IV repeats were the most frequent. Alleles encoding seven to 11 TTTTA repeats were detected in the 84 women and 122 men included in the pentanucleotide polymorphism study, and homozygosity for eight TTTTA repeats was the most common genotype. The eight TTTTA repeat allele occurred with almost any apo(a) allele. An inverse relationship between number of K IV repeats and Lp(a) concentration was confirmed. The contributions of the apo(a) size polymorphism and the pentanucleotide repeat polymorphism to the interindividual variance of Lp(a) lipoprotein concentrations were 9.7 and 3.5%, respectively (type IV sum of squares). Nineteen per cent of the variance in Lp(a) lipoprotein level appeared to be the result of the multiplication product (interaction) between the apo(a) size polymorphism and the pentanucleotide repeat polymorphism. The contribution of the apo(a) size polymorphism alone to the variation in Lp(a) lipoprotein level was lower than previously reported. However, the multiplicative interaction effect between the K IV repeat polymorphism and the pentanucleotide repeat polymorphism may be an important factor explaining the variation in Lp(a) lipoprotein levels among the populations.

Interleukin-18 -607C/A gene polymorphism in Egyptian asthmatic children.

PubMed

Shaaban, Hala Hamdi; Mohy, Abeer Mohamed; Abdel-Razek, Abdel-Rahman Ahmed; Wahab, Amira Abdel

2014-08-01

Asthma is a multifactorial respiratory disease determined by interactions of multiple disease susceptibility genes and environmental factors. Interleukin (IL)-18 is an important cytokine for initiating and perpetuating the catabolic and inflammatory response in allergic asthma. A number of single nucleotide polymorphisms that influence IL-18 production are found in the gene promoter region. The aim of this study was to investigate the association of IL-18 -607C/A promoter polymorphism with asthma and whether this polymorphism influenced the severity of asthma in affected children. The influence of this promoter gene polymorphism on total serum IgE level in studied subjects was also investigated. This study was carried out at the Allergy Clinic of Abu El Reesh Children's Hospital at Cairo University, Egypt. This study included 40 asthmatic children, subdivided into four groups according to different degrees of asthma severity, and 20 apparently healthy subjects as the control group. All cases were subjected to history taking, clinical examination, and the following laboratory investigations: complete blood count, total serum IgE level assay by ELISA and genomic DNA extraction, and analysis for IL-18 -607C/A promoter gene polymorphism using the PCR-RFLP (restriction fragment length polymorphism) technique. In the present study the IL-18 -607AA genotype frequency was higher in cases (22.5 %) than in the control group (15 %); however, the difference was not statistically significant (p = 0.773). No statistically significant difference between the degree of asthma severity and IL-18 -607C/A polymorphism was found (p = 0.489). No significant association could be detected upon comparing the frequencies of C and A alleles among the two studied groups (p = 0.366). Also, no significant differences were demonstrated for the allele frequencies when the intermittent with mild [odds ratio (OR) = 2.72, 95 % CI 1.03-2.33, p = 0.067], intermittent with moderate, and severe (OR = 2.8, 95 % CI 1.01-8.5, p = 0.066) asthma groups were compared. The median value of the total serum IgE level in asthmatic cases with the mutant genotype (AA) was significantly higher [360 IU/L (96.6-1,340 IU/L)] than in the control group [119 IU/L (70.6-158.9 IU/L)] (p = 0.033). No significant statistical difference was encountered regarding the distribution of IL-18 -607C/A genotypes and allele frequencies in asthma patients and healthy controls. Also, there were no significant associations between asthma severity and different genotypes or alleles. The median value of the total serum IgE level in asthmatic cases with the mutant genotype (AA) was significantly higher than in the control group. Thus, IL-18 -607AA genotype frequency might be related to higher total serum IgE.

GENE-ENVIRONMENT INTERACTIONS: A REVIEW OF EFFECTS ON REPRODUCTION AND DEVELOPMENT

EPA Science Inventory

Polymorphisms in genes can lead to differences in the level of susceptibility of individuals to potentially adverse effects of environmental influences, such as chemical exposure, on prenatal development or male or female reproductive function. We have reviewed the literature in ...

Smoking has no impact on survival and it is not associated with ACE gene I/D polymorphism in hemodialysis patients.

PubMed

Kiss, István; Kiss, Zoltán; Kerkovits, Lóránt; Paksy, András; Ambrus, Csaba

2017-01-01

The relationship between smoking and mortality in patients on hemodialysis is controversial. Earlier studies showed that the insertion/deletion (I/D) polymorphism of the ACE gene might have an effect on mortality. The aim of this study was to test the impact of smoking on survival and whether this association was influenced by ACE gene I/D polymorphism in patients on maintenance hemodialysis. In this prospective, multicenter cohort study we analyzed 709 prevalent patients on maintenance hemodialysis. Patients were allocated into groups based on their smoking habit. Outcome data were collected during the 144-month follow-up period. Outcomes of current smokers and lifelong non-smokers were compared. In order to control for interactions between predictor variables, we also identified 160 matched pairs for further sub-analysis. The vast majority of patients (67%) were non-smokers, followed by current smokers (22.2%) and ex-smokers (9.8%). Smoking had no impact on survival in the matched pair analysis ( p = 0.99). After adjustment for ACE I/D polymorphism and other co-variates, smoking had no effect on survival. Our data suggest that smoking has no impact on survival; neither is it associated with ACE gene I/D polymorphism in hemodialysis patients.

Relation of fat-mass and obesity-associated gene polymorphism to fat mass content and body mass index in obese children.

PubMed

Pyrzak, Beata; Wisniewska, Alicja; Majcher, Anna; Tysarowski, Andrzej; Demkow, Urszula

2013-01-01

Fat mass content, fat distribution, and fat-mass and obesity associated (FTO) gene have been reported among a broad spectrum of genetic variation connected with body weight. The aim of our study was to investigate whether the T/A rs9939609 polymorphism of the FTO gene may influence obesity and metabolic indices in children. A 160 children were examined (136 obese and 24 non-obese). The anthropometric measurements and calculations included: height, weight, waist and hip circumference, sum of the thickness of 3 and 10 skin folds, % of fat content, % FAT- BIA , % LBM-BIA. BMI, SDS of BMI, WHR, and WHtR. Fasting plasma total cholesterol (TC), HDL and LDL-cholesterol, triglycerides (TG), oral glucose tolerance test (OGTT), and HOMA-IR were analyzed and the blood pressure were measured. The rs9939609 polymorphism of FTO gene was genotyped by allele-specific real-time polymerase chain- reaction (RT-PCR). We found that the mean concentrations of TC, TG, LDLC, and HOMA-IR were significantly higher, and HDL was lower in the obese than in non-obese children. The presence of TT, but not AA alleles, related to the percentage of fat content, BMI, and z-score of BMI. None of the other anthropometric indices did differ between the children with gene polymorphism and wild homozygous. In conclusion, rs9939609 polymorphism in the fat-mass and obesity-associated gene is associated with BMI and the percent of fat content in children.

Polymorphisms of Leptin-b Gene Associated with Growth Traits in Orange-Spotted Grouper (Epinephelus coioides)

PubMed Central

Huang, Hai; Wei, Yun; Meng, Zining; Zhang, Yong; Liu, Xiaochun; Guo, Liang; Luo, Jian; Chen, Guohua; Lin, Haoran

2014-01-01

In mammals, leptin has been demonstrated to perform important roles in many physiological activities and to influence development, growth, metabolism and reproduction. However, in fish, its function is still unclear. Duplicate leptin genes, leptin-a and leptin-b, have been identified in the orange-spotted grouper. In the present study, the polymorphisms in the leptin-b gene of the orange-spotted grouper were detected, and the relation between these polymorphisms and 12 growth traits were analyzed. Six polymorphisms (including 3 single nucleotide polymorphisms (c.14G>A, c.93A>G, c.149G>A) in exon 1, 2 SNPs (c.181A>G, c.193G>A) in intron 1, and 1 SNP (c.360C>T) in exon 2) were identified and genotyped from 200 different individuals. The results revealed that the SNP c.149G>A was significantly associated with growth traits, that the heterozygous mutation genotype GA having negative effects on growth traits. However, the other five SNPs (c.14G>A, c.93A>G, c.181A>G, c.193G>A, c.360C>T) did not show significant associations with all the growth traits. Compared with our findings in leptin-a gene, the results suggested that the leptin-a hormone has more important physiological effects in fish bodies than the leptin-b type. Moreover, leptin genes were supposed to be one class of major candidate genes of regulating growth traits in the orange-spotted grouper. PMID:25003640

Association of common polymorphisms in GLUT9 gene with gout but not with coronary artery disease in a large case-control study.

PubMed

Stark, Klaus; Reinhard, Wibke; Neureuther, Katharina; Wiedmann, Silke; Sedlacek, Kamil; Baessler, Andrea; Fischer, Marcus; Weber, Stefan; Kaess, Bernhard; Erdmann, Jeanette; Schunkert, Heribert; Hengstenberg, Christian

2008-04-09

Serum uric acid (UA) levels have recently been shown to be genetically influenced by common polymorphisms in the GLUT9 gene in two genome-wide association analyses of Italian and British populations. Elevated serum UA levels are often found in conjunction with the metabolic syndrome. Hyperuricemia is the major risk factor for gout and has been associated with increased cardiovascular morbidity and mortality. The aim of the present study was to further elucidate the association of polymorphisms in GLUT9 with gout and coronary artery disease (CAD) or myocardial infarction (MI). To test our hypotheses, we performed two large case-control association analyses of individuals from the German MI Family Study. First, 665 patients with gout and 665 healthy controls, which were carefully matched for age and gender, were genotyped for four single nucleotide polymorphisms (SNPs) within or near the GLUT9 gene. All four SNPs demonstrated highly significant association with gout. SNP rs6855911, located within intron 7 of GLUT9, showed the strongest signal with a protective effect of the minor allele with an allelic odds ratio of 0.62 (95% confidence interval 0.52-0.75; p = 3.2*10(-7)). Importantly, this finding was not influenced by adjustment for components of the metabolic syndrome or intake of diuretics. Secondly, 1,473 cases with severe CAD or MI and 1,241 healthy controls were tested for the same four GLUT9 SNPs. The analyses revealed, however, no significant association with CAD or with MI. Additional screening of genome-wide association data sets showed no signal for CAD or MI within the GLUT9 gene region. Thus, our results provide compelling evidence that common genetic variations within the GLUT9 gene strongly influence the risk for gout but are unlikely to have a major effect on CAD or MI in a German population.

Analysis of the Functional Polymorphism in the Cytochrome P450 CYP2C8 Gene rs11572080 with Regard to Colorectal Cancer Risk

PubMed Central

Ladero, José M.; Agúndez, José A. G.; Martínez, Carmen; Amo, Gemma; Ayuso, Pedro; García-Martín, Elena

2012-01-01

In addition to the known effects on drug metabolism and response, functional polymorphisms of genes coding for xenobiotic-metabolizing enzymes (XME) play a role in cancer. Genes coding for XME act as low-penetrance genes and confer modest but consistent and significant risks for a variety of cancers related to the interaction of environmental and genetic factors. Consistent evidence supports a role for polymorphisms of the cytochrome P450 CYP2C9 gene as a protecting factor for colorectal cancer susceptibility. It has been shown that CYP2C8 and CYP2C9 overlap in substrate specificity. Because CYP2C8 has the common functional polymorphisms rs11572080 and rs10509681 (CYP2C8*3), it could be speculated that part of the findings attributed to CYP2C9 polymorphisms may actually be related to the presence of polymorphisms in the CYP2C8 gene. Nevertheless, little attention has been paid to the role of the CYP2C8 polymorphism in colorectal cancer. We analyzed the influence of the CYP2C8*3 allele in the risk of developing colorectal cancer in genomic DNA from 153 individuals suffering colorectal cancer and from 298 age- and gender-matched control subjects. Our findings do not support any effect of the CYP2C8*3 allele (OR for carriers of functional CYP2C8 alleles = 0.50 (95% CI = 0.16–1.59; p = 0.233). The absence of a relative risk related to CYP2C8*3 did not vary depending on the tumor site. We conclude that the risk of developing colorectal cancer does not seem to be related to the commonest functional genetic variation in the CYP2C8 gene. PMID:23420707

Influence of autoantibodies against AT1 receptor and AGTR1 polymorphisms on candesartan-based antihypertensive regimen: results from the study of optimal treatment in hypertensive patients with anti-AT1-receptor autoantibodies trial.

PubMed

Sun, Yanxiang; Liao, Yuhua; Yuan, Yong; Feng, Li; Ma, Shihui; Wei, Feng; Wang, Min; Zhu, Feng

2014-01-01

The autoantibodies against angiotensin AT1 receptors (AT1-AAs) in patients with essential hypertension exhibited an agonistic action like angiotensin II and maintained high blood pressure (BP). Angiotensin II receptor gene (AGTR1) polymorphisms were associated with BP response to RAS inhibition in the hypertensive population. Furthermore, the BP response to AT1 receptor blockers varied significantly among individuals with hypertension. We hypothesized that the polymorphisms of the AGTR1 and AT1-AAs might affect antihypertensive response to AT1 receptor blockers based in patients with primary hypertension. Patients who received a candesartan-based regimen came from the SOT-AT1 study (Study of Optimal Treatment in Hypertensive Patients with Anti-AT1-Receptor Autoantibodies). The established enzyme-labeled immunosorbent assay was used to detect AT1-AAs in the sera of the patients. Genotype 3 single nucleotide polymorphisms in AGTR1 gene was used by DNA sequencing. The correlations among AT1-AAs, AGTR1 gene polymorphisms or haplotypes, and the antihypertensive effect candesartan-based were analyzed using SPSS. The percentage of systolic BP reduction that was candesartan-based was greater in AT1-AA positive groups than in AT1-AA negative ones (21 ± 8 vs. 18 ± 9; P = .001). Meanwhile, systolic BP reduction that was candesartan-based was more significant in the group of rs5186 AC genotypes than AA homozygotes after adjusting for other confounding factors (37.55 ± 13.7 vs. 32.47 ± 17.27 mm Hg; adjusted P = .028). Furthermore, haplotypes (GCC) and (AAC) had impacts on the antihypertensive effect of candesartan therapy. The AT1-AAs, AGTR1 gene polymorphisms and haplotypes solely or jointly have influences on candesartan-based antihypertensive response in patients with primary hypertension. Copyright © 2014 American Society of Hypertension. Published by Elsevier Inc. All rights reserved.

The Influence of Family Structure, the TPH2 G-703T and the 5-HTTLPR Serotonergic Genes upon Affective Problems in Children Aged 10-14 Years

ERIC Educational Resources Information Center

Nobile, Maria; Rusconi, Marianna; Bellina, Monica; Marino, Cecilia; Giorda, Roberto; Carlet, Ombretta; Vanzin, Laura; Molteni, Massimo; Battaglia, Marco

2009-01-01

Background: Both genetic and psychosocial risk factors influence the risk for depression in development. While the impacts of family structure and of serotonergic polymorphisms upon individual differences for affective problems have been investigated separately, they have never been considered together in a gene-environment interplay perspective.…

Mismatch repair gene MSH3 polymorphism is associated with the risk of sporadic prostate cancer

PubMed Central

Hirata, Hiroshi; Hinoda, Yuji; Kawamoto, Ken; Kikuno, Nobuyuki; Suehiro, Yutaka; Okayama, Naoko; Tanaka, Yuichiro; Dahiya, Rajvir

2014-01-01

Purpose The mismatch repair (MMR) system is a DNA repair mechanism that corrects mispaired bases during DNA replication errors. Cancer cells deficient in the MMR proteins have a 102 –103-fold increase in the mutation rate. Single nucleotide polymorphisms (SNPs) of MMR genes have been shown to cause a reduction in DNA repair activity. We hypothesized that mismatch repair gene polymorphism could be a risk factor for prostate cancer (PC) and that p53 Pro/Pro genotype carriers could influence MSH3 and MSH6 polymorphisms. Material and Methods DNA samples from 110 cases of prostate cancer and healthy controls (n=110) were analyzed by SSCP and PCR-RFLP to determine the genotypic frequency of five different polymorphic loci on two MMR genes (MSH3 and MSH6) and p53 codon72. The chi-square test was applied to compare the genotype frequency between patients and controls. Results A significant increase in the G/A+A/A genotype of MSH3 Pro222Pro was observed in patients compared to controls (OR, 1.87; 95% CI, 1.0–3.5). The frequency of A/G + G/G genotypes of MSH3 exon23 Thr1036Ala also tended to increase in patients (OR, 1.57; 95% CI, 0.92–2.72). Among p53 codon72 Arg/Pro + Pro/Pro carriers, the frequency of the AG + GG genotype of MSH3 exon23 was significantly increased in patients compared to controls (OR = 2.1, 95% CI; 1.05–4.34). Conclusion This is the first report on the association of MSH3 gene polymorphisms in prostate cancer. These results suggest that the MSH3 polymorphism may be a risk factor for prostate cancer. PMID:18355840

Polymorphisms in the circadian expressed genes PER3 and ARNTL2 are associated with diurnal preference and GNβ3 with sleep measures

PubMed Central

Parsons, Michael J; Lester, Kathryn J; Barclay, Nicola L; Archer, Simon N; Nolan, Patrick M; Eley, Thalia C; Gregory, Alice M

2014-01-01

Sleep and circadian rhythms are intrinsically linked, with several sleep traits, including sleep timing and duration, influenced by both sleep homeostasis and the circadian phase. Genetic variation in several circadian genes has been associated with diurnal preference (preference in timing of sleep), although there has been limited research on whether they are associated with other sleep measurements. We investigated whether these genetic variations were associated with diurnal preference (Morningness–Eveningness Questionnaire) and various sleep measures, including: the global Pittsburgh Sleep Quality index score; sleep duration; and sleep latency and sleep quality. We genotyped 10 polymorphisms in genes with circadian expression in participants from the G1219 sample (n = 966), a British longitudinal population sample of young adults. We conducted linear regressions using dominant, additive and recessive models of inheritance to test for associations between these polymorphisms and the sleep measures. We found a significant association between diurnal preference and a polymorphism in period homologue 3 (PER3) (P < 0.005, recessive model) and a novel nominally significant association between diurnal preference and a polymorphism in aryl hydrocarbon receptor nuclear translocator-like 2 (ARNTL2) (P < 0.05, additive model). We found that a polymorphism in guanine nucleotide binding protein beta 3 (GNβ3) was associated significantly with global sleep quality (P < 0.005, recessive model), and that a rare polymorphism in period homologue 2 (PER2) was associated significantly with both sleep duration and quality (P < 0.0005, recessive model). These findings suggest that genes with circadian expression may play a role in regulating both the circadian clock and sleep homeostasis, and highlight the importance of further studies aimed at dissecting the specific roles that circadian genes play in these two interrelated but unique behaviours. PMID:24635757

Variation in the oxytocin receptor gene (OXTR) is associated with differences in moral judgment

PubMed Central

Chaponis, Jonathan; Siburian, Richie; Gallagher, Patience; Ransohoff, Katherine; Wikler, Daniel; Perlis, Roy H.; Greene, Joshua D.

2016-01-01

Moral judgments are produced through the coordinated interaction of multiple neural systems, each of which relies on a characteristic set of neurotransmitters. Genes that produce or regulate these neurotransmitters may have distinctive influences on moral judgment. Two studies examined potential genetic influences on moral judgment using dilemmas that reliably elicit competing automatic and controlled responses, generated by dissociable neural systems. Study 1 (N = 228) examined 49 common variants (SNPs) within 10 candidate genes and identified a nominal association between a polymorphism (rs237889) of the oxytocin receptor gene (OXTR) and variation in deontological vs utilitarian moral judgment (that is, judgments favoring individual rights vs the greater good). An association was likewise observed for rs1042615 of the arginine vasopressin receptor gene (AVPR1A). Study 2 (N = 322) aimed to replicate these findings using the aforementioned dilemmas as well as a new set of structurally similar medical dilemmas. Study 2 failed to replicate the association with AVPR1A, but replicated the OXTR finding using both the original and new dilemmas. Together, these findings suggest that moral judgment is influenced by variation in the oxytocin receptor gene and, more generally, that single genetic polymorphisms can have a detectable effect on complex decision processes. PMID:27497314

Variation in the oxytocin receptor gene (OXTR) is associated with differences in moral judgment.

PubMed

Bernhard, Regan M; Chaponis, Jonathan; Siburian, Richie; Gallagher, Patience; Ransohoff, Katherine; Wikler, Daniel; Perlis, Roy H; Greene, Joshua D

2016-12-01

Moral judgments are produced through the coordinated interaction of multiple neural systems, each of which relies on a characteristic set of neurotransmitters. Genes that produce or regulate these neurotransmitters may have distinctive influences on moral judgment. Two studies examined potential genetic influences on moral judgment using dilemmas that reliably elicit competing automatic and controlled responses, generated by dissociable neural systems. Study 1 (N = 228) examined 49 common variants (SNPs) within 10 candidate genes and identified a nominal association between a polymorphism (rs237889) of the oxytocin receptor gene (OXTR) and variation in deontological vs utilitarian moral judgment (that is, judgments favoring individual rights vs the greater good). An association was likewise observed for rs1042615 of the arginine vasopressin receptor gene (AVPR1A). Study 2 (N = 322) aimed to replicate these findings using the aforementioned dilemmas as well as a new set of structurally similar medical dilemmas. Study 2 failed to replicate the association with AVPR1A, but replicated the OXTR finding using both the original and new dilemmas. Together, these findings suggest that moral judgment is influenced by variation in the oxytocin receptor gene and, more generally, that single genetic polymorphisms can have a detectable effect on complex decision processes. © The Author (2016). Published by Oxford University Press.

Assessment of Tools for Marker-Assisted Selection in a Marine Commercial Species: Significant Association between MSTN-1 Gene Polymorphism and Growth Traits

PubMed Central

Sánchez-Ramos, Irma; Cross, Ismael; Mácha, Jaroslav; Martínez-Rodríguez, Gonzalo; Krylov, Vladimir; Rebordinos, Laureana

2012-01-01

Growth is a priority trait from the point of view of genetic improvement. Molecular markers linked to quantitative trait loci (QTL) have been regarded as useful for marker-assisted selection in complex traits as growth. Polymorphisms have been studied in five candidate genes influencing growth in gilthead seabream (Sparus aurata): the growth hormone (GH), insulin-like growth factor-1 (IGF-1), myostatin (MSTN-1), prolactin (PRL), and somatolactin (SL) genes. Specimens evaluated were from a commercial broodstock comprising 131 breeders (from which 36 males and 44 females contributed to the progeny). In all samples eleven gene fragments, covering more than 13,000 bp, generated by PCR-RFLP, were analyzed; tests were made for significant associations between these markers and growth traits. ANOVA results showed a significant association between MSTN-1 gene polymorphism and growth traits. Pairwise tests revealed several RFLPs in the MSTN-1 gene with significant heterogeneity of genotypes among size groups. PRL and MSTN-1 genes presented linkage disequilibrium. The MSTN-1 gene was mapped in the centromeric region of a medium-size acrocentric chromosome pair. PMID:22666112

Is the polymorphism at position -1082 of IL-10 gene associated with visceral leishmaniasis?

PubMed

Hajilooi, Mehrdad; Ahmadi, Alireza; Lotfi, Pegah; Matini, Mohammad; Jafari, Davood; Bazmani, Ahad; Momeni, Mohammad

2014-08-01

Immune responses play critical roles in the leishmaniasis eradication. IL-10 is a key regulator of immune responses, and the polymorphisms within its promoter region are associated with alteration in its expression. Therefore, this study was designed to examine the correlation between polymorphism at the -1082 position of the IL-10 gene and visceral leishmaniasis (VL). The IL-10 -1082 polymorphism and anti-Leishmania antibody titration were examined in 110 patients with clinical presentation of VL and seropositive for the Leishmania (group 1), 74 seropositive patients but without clinical presentation (group 2) and 113 healthy controls (group 3) using the PCR-RFLP and immunofluorescence techniques, respectively. The polymorphism at IL-10 -1082 (A/G) position was significantly associated with VL and A/G genotype was significantly higher in VL patients when compared to the groups 2 and 3 (P< 0.001). However, the results demonstrated that the A and G alleles were not associated with VL (P= 0.263). Previous investigations have shown that the polymorphism at the -1082 position of the IL-10 gene can influence its expression and also it has been proved that IL-10 level was increased during VL. Our results suggest that the A/G genotype may be considered as a risk factor for VL.

Is the Polymorphism at Position -1082 of IL-10 Gene Associated with Visceral Leishmaniasis?

PubMed Central

HAJILOOI, Mehrdad; AHMADI, Alireza; LOTFI, Pegah; MATINI, Mohammad; JAFARI, Davood; BAZMANI, Ahad; MOMENI, Mohammad

2014-01-01

Abstract Background Immune responses play critical roles in the leishmaniasis eradication. IL-10 is a key regulator of immune responses, and the polymorphisms within its promoter region are associated with alteration in its expression. Therefore, this study was designed to examine the correlation between polymorphism at the -1082 position of the IL-10 gene and visceral leishmaniasis (VL). Methods The IL-10 -1082 polymorphism and anti-Leishmania antibody titration were examined in 110 patients with clinical presentation of VL and seropositive for the Leishmania (group 1), 74 seropositive patients but without clinical presentation (group 2) and 113 healthy controls (group 3) using the PCR-RFLP and immunofluorescence techniques, respectively. Results The polymorphism at IL-10 -1082 (A/G) position was significantly associated with VL and A/G genotype was significantly higher in VL patients when compared to the groups 2 and 3 (P< 0.001). However, the results demonstrated that the A and G alleles were not associated with VL (P= 0.263). Conclusions Previous investigations have shown that the polymorphism at the -1082 position of the IL-10 gene can influence its expression and also it has been proved that IL-10 level was increased during VL. Our results suggest that the A/G genotype may be considered as a risk factor for VL. PMID:25927040

The combinations of TNFalpha-308 and IL-6 -174 or IL-10 -1082 genes polymorphisms suggest an association with susceptibility to sporadic late-onset Alzheimer's disease.

PubMed

Vural, P; Değirmencioğlu, S; Parildar-Karpuzoğlu, H; Doğru-Abbasoğlu, S; Hanagasi, H A; Karadağ, B; Gürvit, H; Emre, M; Uysal, M

2009-12-01

Single nucleotide polymorphisms in the regulatory regions of the cytokine genes for tumor necrosis factor alpha (TNFalpha), interleukin (IL)-6 and IL-10 have been suggested to influence the risk of Alzheimer's disease (AD) with conflicting results. To investigate the TNFalpha-308, IL-6 -174 and IL-10 -1082 gene polymorphisms as susceptibility factors for AD. We analyzed genotype and allele distributions of these polymorphisms in 101 sporadic AD patients and 138 healthy controls. Heterozygotes (AG) or combined genotype (AG+AA) for IL-10 -1082 were associated with approximately two-fold increase in the risk of AD. Carriers of A alleles of both TNFalpha-308 and IL-10 -1082 had 6.5 times higher risk for AD in comparison with non-carriers. Concomitant presence of both mutant TNFalpha-308 A and IL-6 -174 C alleles raised three-fold the AD risk, whereas there was no notable risk for AD afflicted by IL-6 -174 polymorphism alone. Our results suggest that TNFalpha and IL-10 promoter polymorphism might be a risk factor for AD. The combined effects of TNFalpha-308, IL-6 -174 and IL-10 -1082 variant alleles may be more decisive to induce functional differences and modify the risk for AD.

Vitamin E transport gene variants and prostate cancer

USDA-ARS?s Scientific Manuscript database

In the February 15, 2009 issue of Cancer Research, Wright et al. investigated whether polymorphisms in two vitamin E transport genes are associated with elevated prostate cancer risk resulting from altered plasma vitamin E concentrations. However, the circulating vitamin E level is influenced by man...

Association of vascular endothelial growth factor (VEGF) gene polymorphism and increased serum VEGF concentration with pancreatic adenocarcinoma.

PubMed

Sivaprasad, Siddapuram; Govardhan, Bale; Harithakrishna, Ramanujam; Venkat Rao, Guduru; Pradeep, Rebala; Kunal, Bharadhwaj; Ramakrishna, Nalla; Anuradha, Shekaran; Reddy, Duvvuru Nageshwar

2013-01-01

BACKGROUND &AIM: Pancreatic cancer is related to high mortality rate. The vascular endothelial growth factor (VEGF) has a strong influence in tumor-related angiogenesis having association with the grade of angiogenesis and the prognosis of different solid tumors including pancreatic cancer. The present study was aimed to analyze the genotype and haplotype distribution of VEGF gene single nucleotide polymorphisms (SNPs), -460T/C, +405G/C, +936C/T, in patients with pancreatic adenocarcinoma from South India, and the effect of these SNPs on serum VEGF level. Total 80 patients with pancreatic adenocarcinoma and 87 controls were recruited. The genotype of VEGF gene polymorphisms was determined in both patients and controls using polymerase chain reaction-restriction fragment length polymorphism method. The serum VEGF protein was estimated by standard enzyme-linked immunosorbent assay. The genotype, +405G/G of VEGF gene showed a significant association with the patients with pancreatic adenocarcinoma (P = 0.012, Odds ratio: 2.133), whereas no significant difference was found in the genotype distribution of SNPs, -460C/T and +936C/T between patient and control groups (P > 0.05). Serum VEGF level was found to be significantly high in patients (1315.10 pg/Ml, SD ± 230.79) when compared to controls (591.35 pg/mL, SD ± 92.48) (P < 0.0001), which showed a strong genotype-phenotype correlation between genotype +405G/G and serum VEGF level. Further, the haplotype C-G-T showed a strong association with the disease, and no specific haplotype was associated with increased serum VEGF level. The polymorphism, +405G/C but not -460T/C and +936C/T, of VEGF gene is strongly associated with pancreatic adenocarcinoma, and this SNP has significant influence on serum VEGF level. Copyright © 2013 IAP and EPC. Published by Elsevier B.V. All rights reserved.

MHC class I chain-related gene a diversity in patients with cutaneous malignant melanoma from southeastern Spain.

PubMed

Campillo, José Antonio; López-Hernández, Ruth; Martínez-Banaclocha, Helios; Bolarín, José Miguel; Gimeno, Lourdes; Mrowiec, Anna; López, Manuela; Las Heras, Beatriz; Minguela, Alfredo; Moya-Quiles, Maria Rosa; Legáz, Isabel; Frías-Iniesta, José Francisco; García-Alonso, Ana María; Álvarez-López, María Rocío; Martínez-Escribano, Jorge Antonio; Muro, Manuel

2015-01-01

A limited number of studies have been performed so far on the polymorphism in the transmembrane region (exon 5) of the major histocompatibility complex class I chain-related gene A (MICA) in patients with melanoma. However, the influence of MICA polymorphism in extracellular domains (exons 2, 3, and 4) has not been investigated on melanoma disease. This study aims to characterize the influence of extracellular MICA polymorphism, and its previously described linkage disequilibrium with HLA-B locus, on patients with cutaneous melanoma from southeastern Spain. For this purpose, MICA and HLA-B genotyping was performed in 233 patients and 200 ethnically matched controls by luminex technology. Patients were classified according to the presence of methionine or valine at codon 129 of MICA gene. We found a high frequency of MICA(*)009 in melanoma patients compared with controls (P = 0.002, Pc = 0.03). Our results also showed an association between MICA(*)009 and HLA-B(*)51 alleles in both patients and controls. This association was stronger in patients than controls (P = 0.015). However, a multivariate logistic regression model showed that neither MICA(*)009 nor the combination MICA(*)009/HLA-B(*)51 was associated with melanoma susceptibility. No relationship was observed between MICA-129 dimorphism and melanoma nor when MICA polymorphism was evaluated according to clinical findings at diagnosis.

Genetic Polymorphisms of Metastasis Suppressor Gene NME1 and Breast Cancer Survival

PubMed Central

Qu, Shimian; Long, Jirong; Cai, Qiuyin; Shu, Xiao-Ou; Cai, Hui; Gao, Yu-Tang; Zheng, Wei

2009-01-01

Purpose Ample evidence supports an important role of tumor metastasis suppressor genes in cancer metastatic processes. We evaluated the association of genetic polymorphisms of tumor metastasis suppressor gene NME1 with breast cancer prognosis in a follow-up study of patients with primary breast cancer and further investigated the functions of these polymorphisms. Experimental Design NME1 genotypes were analyzed in a cohort of 1134 breast cancer patients recruited as part of the Shanghai Breast Cancer Study who were followed for a median of 7.1 years. In vitro biochemical analyses were carried out to examine the function of NME1 gene polymorphisms. Results Single nucleotide polymorphisms (SNPs) in the promoter region of the NME1 gene were found to be associated with breast cancer prognosis. Patients carrying the C allele in rs16949649 were associated with higher breast cancer-specific mortality (HR =1.4, 95% CI =1.1–1.9) as compared to those carrying the wild-type allele, and the association was more evident in patients with an early stage cancer (HR=1.7, 95% CI =1.2–2.5). SNP rs2302254 was also associated with breast cancer prognosis, and the association was statistically significant for the risk of breast cancer relapse, metastasis, and death (HR=1.3, 95% CI, 1.0–1.6). In vitro biochemical analyses showed that minor alleles in rs2302254 and rs3760468, which is in strong linkage disequilibrium with rs16949646, altered nuclear proteins binding capacity and reduced NME1 promoter activity, supporting the results from an association study of these SNPs with breast cancer survival. Conclusion Promoter polymorphisms in the NME1 gene may alter its expression and influence breast cancer survival. PMID:18676749

Association of IRF5 polymorphisms with susceptibility to macrophage activation syndrome in patients with juvenile idiopathic arthritis.

PubMed

Yanagimachi, Masakatsu; Naruto, Takuya; Miyamae, Takako; Hara, Takuma; Kikuchi, Masako; Hara, Ryoki; Imagawa, Tomoyuki; Mori, Masaaki; Sato, Hidenori; Goto, Hiroaki; Yokota, Shumpei

2011-04-01

Systemic-onset juvenile idiopathic arthritis (systemic JIA) and macrophage activation syndrome (MAS), the most devastating complication of systemic JIA, are characterized by abnormal levels of proinflammatory cytokines. Interferon regulatory factor 5 (IRF5) is a member of the IRF family of transcription factors, and acts as a master transcription factor in the activation of genes encoding proinflammatory cytokines. Polymorphisms in the IRF5 gene have been associated with susceptibility to autoimmune diseases such as systemic lupus erythematosus (SLE) and rheumatoid arthritis. Our aim was to assess associations of IRF5 gene polymorphisms with susceptibility to systemic JIA and MAS. Three IRF5 single-nucleotide polymorphisms (rs729302, rs2004640, and rs2280714) were genotyped using TaqMan assays in 81 patients with systemic JIA (33 with MAS, 48 without) and 190 controls. There were no associations of the IRF5 gene polymorphisms or haplotypes under study with susceptibility to systemic JIA. There was a significant association of the rs2004640 T allele with MAS susceptibility (OR 4.11; 95% CI 1.84, 9.16; p = 0.001). The IRF5 haplotype (rs729302 A, rs2004640 T, and rs2280714 T), which was reported as conferring an increased risk of SLE, was significantly associated with MAS susceptibility in patients with systemic JIA (OR 4.61; 95% CI 1.73, 12.3; p < 0.001). IRF5 gene polymorphism is a genetic factor influencing susceptibility to MAS in patients with systemic JIA, and IRF5 contributes to the pathogenesis of MAS in these patients.

The development of peripartum depressive symptoms is associated with gene polymorphisms of MAOA, 5-HTT and COMT.

PubMed

Doornbos, Bennard; Dijck-Brouwer, D A Janneke; Kema, Ido P; Tanke, Marit A C; van Goor, Saskia A; Muskiet, Frits A J; Korf, Jakob

2009-10-01

Polymorphisms of monoamine-related genes have been associated with depression following life events. The peripartum is a physiologically and psychologically challenging period, characterized by fluctuations in depressive symptoms, therefore facilitating prospective investigations in this gene x environment (G x E) interaction. Eighty nine pregnant women filled in two Edinburgh Postpartum Depression Scale (EPDS) questionnaires during pregnancy and two in the postpartum period. MAOA, COMT and 5-HTT polymorphisms were analyzed. We found a significant interaction between the development of depressive symptoms in the course of pregnancy and polymorphisms in 5-HTT (p=0.019); MAOA (p=0.044) and COMT (p=0.026), and MAOA x COMT (p<0.001). Particularly, women carrying the combination of low activity variants of MAOA and COMT showed increased EPDS scores at week 36 of pregnancy and 6 weeks postpartum, but not during early pregnancy or 12 weeks postpartum. We found that MAOA in combination with COMT appears to regulate not only the stress response in laboratory experiments, but also seems to influence the stress-evoked onset of mood during normal, mild, stressful events, such as experienced in the peripartum period. These findings support the GxE concept for depression, but they underline the complexity of this concept, as the cumulating effects of these polymorphic genes (i.e. MAOA+COMT) might be needed and the effects of these polymorphic genes becomes apparent in special environmental or physiological conditions (i.e. the peripartum period). We therefore suggest that G x E interactions become especially noticeable from longitudinal study designs in specific physiological or social challenging periods.

Pregnane X Receptor Polymorphisms and Risk of Inflammatory Bowel Disease: A Meta-Analysis.

PubMed

Guo, Xiaolan; Yan, Ming

2017-08-01

Pregnane X receptor (PXR) gene polymorphisms have been widely studied in terms of the association with inflammatory bowel disease (IBD), with inconsistent results. The present meta-analysis was performed to assess the association between PXR gene polymorphisms and the susceptibility of IBD, Crohn's disease (CD), and ulcerative colitis (UC). PubMed, Wanfang, and CNKI databases were searched for eligible studies before November 1, 2016. Pooled odds ratios (ORs) and 95% confidence intervals (95% CIs) were used to calculate the various genetic models using either a fixed-effect or a random-effect model. The heterogeneity of the included studies was examined with Cochran Q and I 2 statistics. Begg's rank correlation test and Egger's linear regression test were used to assess the publication bias. A total of six studies with 4248 cases and 3853 controls were included in this meta-analysis. Three PXR gene polymorphisms were evaluated: rs1523127, rs2276707, and rs6785049. Our analyses of rs1523127, rs2276707, and rs6785049 suggested that PXR gene polymorphism had no obvious influence on the risk of IBD in Caucasians. Subgroup analyses based on disease type showed similar results. Our meta-analysis revealed that PXR gene polymorphism may not be significantly associated with IBD susceptibility. However, the number of original studies was limited and further studies with large samples are needed to verify the results. PXR = pregnane X receptor, IBD = inflammatory bowel disease, CD = Crohn's disease, UC = ulcerative colitis, ORs = pooled odds ratios, 95% CIs = 95% confidence intervals, NOS = Newcastle-Ottawa scale, HWE = Hardy-Weinberg equilibrium.

Screening for polymorphisms in the PXR gene in a Dutch population.

PubMed

Bosch, Tessa M; Deenen, Maarten; Pruntel, Roelof; Smits, Paul H M; Schellens, Jan H M; Beijnen, Jos H; Meijerman, Irma

2006-05-01

Cytochrome P450 3A4 (CYP3A4) is involved in the metabolism of over 50% of all drugs currently in use. However, CYP3A4 expression shows a large inter-individual variation that cannot only be explained by genetic polymorphisms identified in this gene. The pregnane X receptor (PXR) has been identified as a transcriptional regulator of CYP3A4. Single nucleotide polymorphisms (SNPs) in the PXR gene could influence PXR activity and thereby CYP3A4 expression. This study was therefore aimed at determining the frequencies of known SNPs and detecting yet unknown SNPs in the PXR gene in a Dutch population. Genomic DNA was isolated from blood samples obtained from 100 healthy volunteers and subjected to PCR amplification, followed by DNA sequencing. The population, of which the ethnicity was 93% Caucasian, consisted of 79 female individuals and 21 males. A total of 24 SNPs were found in the PXR gene, eight of which are previously unknown. The allelic frequencies found in this population varied from 0.5 to 73%. Most of the previously detected SNPs were located in introns. One new SNP, T8555G in exon 8, causes an amino acid change of C379G and is located in the Ligand Binding Domain of PXR. Several SNPs were detected in the PXR gene, one of which is located in the ligand binding domain (LBD). These SNPs may influence PXR-mediated CYP3A4 induction.

ACE insertion/deletion (I/D) polymorphism and diabetic nephropathy.

PubMed

Rahimi, Zohreh

2012-10-01

Angiotensin converting enzyme (ACE) gene encodes ACE, a key component of renin angiotensin system (RAS), plays an important role in blood pressure homeostasis by generating the vasoconstrictor peptide angiotensin II. Directory of Open Access Journals (DOAJ), Google Scholar, Pubmed (NLM), LISTA (EBSCO) and Web of Science have been searched. The presence of ACE insertion/deletion (I/D) polymorphism affects the plasma level of ACE. ACE DD genotype is associated with the highest systemic and renal ACE levels compared with the lowest ACE activity in carriers of II genotype. In this review focus has been performed on the study of ACE I/D polymorphism in various populations and its influence on the risk of onset and progression of diabetic nephropathy. Also, association between ACE I/D polymorphism and response to ACE inhibitor and angiotensin II receptor antagonists will be reviewed. Further, synergistic effect of this polymorphism and variants of some genes on the risk of development of diabetic nephropathy will be discussed.

Influence of TP53 Codon 72 Polymorphism Alone or in Combination with HDM2 SNP309 on Human Infertility and IVF Outcome.

PubMed

Chan, Ying; Zhu, Baosheng; Jiang, Hongguo; Zhang, Jinman; Luo, Ying; Tang, Wenru

2016-01-01

To evaluate the association of the TP53 codon 72 (rs 1042522) alone or in combination with HDM2 SNP309 (rs 2279744) polymorphisms with human infertility and IVF outcome, we collected 1450 infertility women undergoing their first controlled ovarian stimulation for IVF treatment and 250 fertile controls in the case-control study. Frequencies, distribution, interaction of genes, and correlation with infertility and IVF outcome of clinical pregnancy were analyzed. We found a statistically significant association between TP53 codon 72 polymorphism and IVF outcome (52.10% vs. 47.40%, OR = 0.83, 95%CI:0.71-0.96, p = 0.01). No significant difference was shown between TP53 codon 72, HDM2 SNP309 polymorphisms, human infertility, and between the combination of two genes polymorphisms and the clinical pregnancy outcome of IVF. The data support C allele as a protective factor for IVF pregnancy outcome. Further researches should be focused on the mechanism of these associations.

Vitamin D receptor gene polymorphisms and musculoskeletal injuries in professional football players

PubMed Central

MASSIDDA, MYOSOTIS; CORRIAS, LAURA; BACHIS, VALERIA; CUGIA, PAOLO; PIRAS, FRANCESCO; SCORCU, MARCO; CALÒ, CARLA M.

2015-01-01

The aim of the present study was to investigate the association between vitamin D receptor (VDR) gene polymorphisms and musculoskeletal injury (MI) in elite football players. In total, 54 male professional football players were recruited from an official Italian professional championship team between 2009 and 2013. The cohort was genotyped for the ApaI, BsmI and FokI polymorphisms and MI data were collected over four football seasons. No significant differences were identified among the genotypes in the incidence rates or severity of MI (P=0.254). In addition, no significant associations were observed between VDR polymorphisms and MI phenotypes (P=0.460). However, the results of the casewise multiple regression analysis indicated that the ApaI genotypes accounted for 18% of injury severity (P=0.002). Therefore, while the BsmI and FokI polymorphisms did not appear to be associated with the severity or incidence of MI, the ApaI genotypes may have influenced the severity of muscle injury in top-level football players. PMID:26161149

The 5-HT₁A receptor C(1019)G polymorphism influences the intravaginal ejaculation latency time in Dutch Caucasian men with lifelong premature ejaculation.

PubMed

Janssen, Paddy K C; van Schaik, R; Zwinderman, Aeilko H; Olivier, Berend; Waldinger, Marcel D

2014-06-01

Lifelong premature ejaculation (LPE) is characterized by persistent intravaginal ejaculation latency times (IELTs) of less than 1 min, and has been postulated as a neurobiological dysfunction related to diminished serotonergic neurotransmission with 5-HT₁A receptor hyperfunction and 5-HT₂C hypofunction. To investigate the relationship between 5-HT₁A receptor gene (HTR₁A)-C(1019)G promoter polymorphism and IELT in men with LPE. This polymorphism is known to increase 5-HT1A receptor expression. A prospective study was conducted in 54 Dutch Caucasian men with LPE. Baseline IELT during coitus was assessed by stopwatch over a 1-month period. All men were genotyped for HTR₁A gene polymorphism. Allele frequencies and genotypes of C and G variants of HTR₁A polymorphism were determined. Association between CC, CG, and GG genotypes and the IELT in men with LPE were investigated. IELT measured by stopwatch, HTR₁A polymorphism. In this cohort of men with LPE, the geometric mean IELT was 23.8 s. Of the 54 men, the CC, CG and GG genotype frequency for the C(1019)G polymorphism of the 5-HT₁A gene was 33%, 43% and 24%, respectively. The geometric mean IELT for the CC, CG and GG genotypes were 14.5, 27.7 and 36.0 s, respectively (p=0.019). Compared to GG and CG genotypes, men with CC genotype had a 250% and 190% shorter ejaculation time, respectively. HTR₁A gene polymorphism is associated with the IELT in men with LPE. Men with CC genotype have shorter IELTs than men with GG and CG genotypes. Copyright © 2014 Elsevier Inc. All rights reserved.

Genetic Polymorphisms in Cytokine Genes in Colombian Patients with Ocular Toxoplasmosis.

PubMed

Naranjo-Galvis, C A; de-la-Torre, A; Mantilla-Muriel, L E; Beltrán-Angarita, L; Elcoroaristizabal-Martín, X; McLeod, R; Alliey-Rodriguez, N; Begeman, I J; López de Mesa, C; Gómez-Marín, J E; Sepúlveda-Arias, J C

2018-04-01

Toxoplasmosis is caused by infection with the protozoan parasite Toxoplasma gondii , which has the capacity to infect all warm-blooded animals worldwide. Toxoplasmosis is a major cause of visual defects in the Colombian population; however, the association between genetic polymorphisms in cytokine genes and susceptibility to ocular toxoplasmosis has not been studied in this population. This work evaluates the associations between polymorphisms in genes coding for the cytokines tumor necrosis factor alpha (TNF-α) (rs1799964, rs1800629, rs1799724, rs1800630, and rs361525), interleukin 1β (IL-1β) (rs16944, rs1143634, and rs1143627), IL-1α (rs1800587), gamma interferon (IFN-γ) (rs2430561), and IL-10 (rs1800896 and rs1800871) and the presence of ocular toxoplasmosis (OT) in a sample of a Colombian population (61 patients with OT and 116 healthy controls). Genotyping was performed with the "dideoxynucleotide (ddNTP) primer extension" technique. Functional-effect predictions of single nucleotide polymorphisms (SNPs) were done by using FuncPred. A polymorphism in the IL-10 gene promoter (-1082G/A) was significantly more prevalent in OT patients than in controls ( P = 1.93e-08; odds ratio [OR] = 5.27e+03; 95% confidence interval [CI] = 3.18 to 8.739; Bonferroni correction [BONF] = 3.48e-07). In contrast, haplotype "AG" of the IL-10 gene promoter polymorphisms (rs1800896 and rs1800871) was present at a lower frequency in OT patients ( P = 7e-04; OR = 0.10; 95% CI = 0.03 to 0.35). The +874A/T polymorphism of IFN-γ was associated with OT ( P = 3.37e-05; OR = 4.2; 95% CI = 2.478 to 7.12; BONF = 6.07e-04). Haplotype "GAG" of the IL-1β gene promoter polymorphisms (rs1143634, rs1143627, and rs16944) appeared to be significantly associated with OT ( P = 0.0494). The IL-10, IFN-γ, and IL-1β polymorphisms influence the development of OT in the Colombian population. Copyright © 2018 American Society for Microbiology.

Aggression and 5HTT polymorphism in females: study of synchronized swimming and control groups.

PubMed

Sysoeva, Olga V; Maluchenko, Natalia V; Timofeeva, Marina A; Portnova, Galina V; Kulikova, Maria A; Tonevitsky, Alexandr G; Ivanitsky, Alexey M

2009-05-01

Aggression is a heterogeneous heritable psychological trait, also influenced by environmental factors. Previous studies, mostly conducted on male population, have found some associations of the aggression with the polymorphisms of genes, regulating the activity of serotonin (5-HT) in the brain. However, psychological as well as biochemical manifestations of the aggression are different in males and females. Our study aimed to investigate the association of 5-HTT gene polymorphism with different facets of aggression (BDHI) in females. Two groups: the synchronized swimming and non-athlete control, - were examined to study the possible modulation effect of sport on the association between 5-HTT gene polymorphism and aggression. It was found that in both groups the low-active 5-HTT polymorphism (SS) was associated with increased scores on Indirect Hostility scale and decreased scores on Negativism scale, compared to LL genotype. No interaction effect between sport and 5-HTT polymorphism was found. The higher percentage of LL-carriers and lower of LS-carriers in the synchronized swimming group compared to the control one was observed. This may be the sign of the importance of LL polymorphism of 5-HTT gene, previously associated with higher resistance to stress factors, for being an athlete, although this result has to be taken cautiously keeping in mind the stratification problem. Synchronized swimmers had lower scores on Assault, Negativism, Irritability and Verbal Hostility compared to age-matched control girls (in general and for each 5-HTT genotype separately), suggesting that they may have more matured emotional system (older control group has also lower scores on these scales).

The relationship between ACE polymorphism and panic disorder.

PubMed

Gulec-Yılmaz, Seda; Gulec, Huseyın; Dalan, Altay Burak; Cetın, Bugra; Tımırcı-Kahraman, Ozlem; Ogut, Dıcle Bılge; Atasoy, Hande; Dırımen, Gulız Arikan; Gultekın, Guldal Inal; Isbır, Turgay

2014-01-01

The angiotensin converting enzyme (ACE) gene, which has been found to have an insertion and deletion polymorphism (I/D), is of increasing interest in etiology and treatment of various psychiatric disorders such as panic disorder. The present study aimed to investigate the relationship between ACE polymorphism and panic disorder. In this study, 43 patients diagnosed with panic disorder at the Erenköy Mental and Neurological Diseases Training and Research Hospital, Istanbul and 41 healthy controls were enrolled. The ACE gene insertion/deletion polymorphism of exon 16 was evaluated using the polymerase chain reaction method. There was a significant association between I/D genotype and panic disorder (p=0.003). However, the frequency of the I allele was found to be significantly higher in patients compared to controls (p=0.002). In addition, we recognized a significant association between I/D polymorphism and respiratory-type panic disorder in patients. Carriers of the D allele also had an increased risk of respiratory type panic disorder patients (p=0.034). Moreover, the result of Spearman correlation analysis showed an association with ACE D allele and severity of panic disorder (p<0.001). We suggest that the I/D polymorphism of the ACE gene is associated with panic disorder and particularly respiratory-type panic disorder in patients. The I/D polymorphism of the ACE gene seems to influence therapeutic outcome in patients suffering from panic disorder. Our results indicate that ACE D allele is associated with the severity of panic disorder. Copyright © 2014 International Institute of Anticancer Research (Dr. John G. Delinassios), All rights reserved.

Neuropsychological correlates of transcription factor AP-2Beta, and its interaction with COMT and MAOA in healthy females.

PubMed

Schabram, Ina; Eggermann, Thomas; Siegel, Steven J; Gründer, Gerhard; Zerres, Klaus; Vernaleken, Ingo

2013-01-01

The transcription factor AP-2β has been shown to impact clinical and neuropsychological properties. Apparently, it regulates the transcription of genes that code for molecules which are part of the catecholaminergic transmission system. This investigation focuses on possible effects of the transcription factor AP-2β intron 2 polymorphism on cognitive performance parameters. This hypothesis-driven investigation examined the effects and interactions of the transcription factor AP-2β intron 2 polymorphism, the Val158Met catechol-O-methyltransferase (COMT) polymorphism, and the variable number of tandem repeat polymorphism of monoamine oxidase A (MAOA) on cognitive performance parameters within a group of 200 healthy women (age: mean ± SD, 23.93 ± 3.33 years). The AP-2β polymorphism significantly influenced cognitive performance (in particular, the Trail Making Test part B), whereas the MAOA and COMT polymorphisms did not. However, there was an interaction effect of the AP-2β × MAOA × COMT genotypes on the decision bias β of the degraded-stimulus version of the continuous performance task. Only the Val158Met COMT polymorphism showed an influence on personality questionnaires (openness and self-transcendence; NEO Five-Factor Inventory, Temperament and Character Inventory). The transcription factor AP-2β intron 2 polymorphism had more influence on cognition than the MAOA and COMT polymorphisms. Possibly, the AP-2β genotype might influence cognition through pathways other than those that regulate MAOA and COMT transcription. Interactions of transcription factor AP-2β, COMT, and MAOA polymorphisms suggest higher leverage effects of transcription factor AP-2β in subjects with high dopamine availability. Copyright © 2013 S. Karger AG, Basel.

Polymorphisms in TAS2R38 and the taste bud trophic factor, gustin gene co-operate in modulating PROP taste phenotype.

PubMed

Calò, Carla; Padiglia, Alessandra; Zonza, Andrea; Corrias, Laura; Contu, Paolo; Tepper, Beverly J; Barbarossa, Iole Tomassini

2011-10-24

The PROP taste phenotype varies greatly among individuals, influencing eating behavior and therefore may play a role in body composition. This variation is associated with polymorphisms in the bitter receptor gene TAS2R38 and the taste-bud trophic factor gustin gene. The aim of this study was to examine the relationship between TAS2R38 haplotypes and the gustin gene polymorphism rs2274333 in modulating PROP taste phenotype. PROP phenotype was determined in seventy-six volunteers (29 males, 47 females, age 25±3 y) by scaling methods and threshold measurements. TAS2R38 and gustin gene genotyping was performed using PCR techniques. The lowest responsiveness in PROP nontasters is strongly associated with the AVI nontasting TAS2R38 variant and the highest responsiveness in supertasters is strongly associated to allele A and genotype AA of the gustin gene. These data support the hypothesis that the greater sensitivity of supertasters could be mediated by a greater taste-bud density. Polymorphisms in TAS2R38 and gustin gene, together, accounted for up to 60% of the phenotypic variance in PROP bitterness and to 40% in threshold values. These data, suggest that other unidentified factors may be more relevant for detecting low concentrations of PROP. Moreover, the presence of the PAV variant receptor may be important for detecting high concentrations of PROP, whereas the presence of allele A in gustin polymorphism may be relevant for perceiving low concentrations. These data show how the combination of the TAS2R38 and gustin gene genotypes modulate PROP phenotype, providing an additional tool for the evaluation of human eating behavior and nutritional status. Copyright © 2011 Elsevier Inc. All rights reserved.

Androgen Receptor Gene Polymorphisms and Alterations in Prostate Cancer: Of Humanized Mice and Men

PubMed Central

Robins, Diane M.

2011-01-01

Germline polymorphisms and somatic mutations of the androgen receptor (AR) have been intensely investigated in prostate cancer but even with genomic approaches their impact remains controversial. To assess the functional significance of AR genetic variation, we converted the mouse gene to the human sequence by germline recombination and engineered alleles to query the role of a polymorphic glutamine (Q) tract implicated in cancer risk. In a prostate cancer model, AR Q tract length influences progression and castration response. Mutation profiling in mice provides direct evidence that somatic AR variants are selected by therapy, a finding validated in human metastases from distinct treatment groups. Mutant ARs exploit multiple mechanisms to resist hormone ablation, including alterations in ligand specificity, target gene selectivity, chaperone interaction and nuclear localization. Regardless of their frequency, these variants permute normal function to reveal novel means to target wild type AR and its key interacting partners. PMID:21689727

[Association between VDR gene polymorphisms and HOMA index for prediabetes in Ningxia].

PubMed

Liao, Sha; He, Jun; Li, Xiaoxia; Xu, Honexia; Liu, Xiuying; Zhao, Yi; Zhang, Yuhong

2016-03-01

To explore the association between the vitamin D receptor (VDR) gene polymorphisms and HOMA index in prediabetes. On the basis of a cross-sectional study which was conducted in Ningxia during 2008-2012, 339 controls and 468 subjects with prediabetes were selected according to ADA diabetes diagnosis standards. Anthropometric data and blood samples were collected in the field investigation. Blood biochemistry analyses and insulin determination were carried out in the laboratory. The whole blood DNA was extracted for genotyping. The BMI, WC, FPG and HOMA-IR of individuals with prediabetes were higher than those of the controls, while the HOMA-B and HOMA-S in cases were lower than those of the controls (P < 0.05). In BsmI, individuals with prediabetes carrying genotype BB/Bb showed lower HOMA-B than bb carrier, and they showed significantly higher HOMA-S than bb carriers (P < 0.05). After adjusting age, sex, BMI, TC, TG and SBP, low level HOMA-B index was the risk factor of prediabetes in individuals who carried genotype BB/Bb for BsmI and genotype FF/Ff/ff for FokI (OR > 1 , P < 0.05 ), and the genotype ff got the highest risk level (OR = 10.59). In FokI, the Ff carriers with low level HOMA-S and HOM-IR were also the risk factors of prediabetes (OR > 1, P < 0.05). The VDR gene polymorphisms appeared to be associated with HOMA index in prediabetes. The BsmI polymorphism seemed to influence HOMA-B, while the FokI polymorphism influence HOMA-B and HOMA-IR at different levels.

Cortisol responses to chronic stress in adult macaques: moderation by a polymorphism in the serotonin transporter gene.

PubMed

Qin, Dongdong; Rizak, Joshua; Feng, Xiaoli; Yang, Shangchuan; Yang, Lichuan; Fan, Xiaona; Lü, Longbao; Chen, Lin; Hu, Xintian

2015-02-01

Accumulating evidence has shown that a polymorphism in the promoter region of the serotonin transporter gene (5-HTTLPR) moderates the association between stress and depressive symptoms. However, the exact etiologies underlying this moderation are not well understood. Here it is reported that among adult female rhesus macaques, an orthologous polymorphism (rh5-HTTLPR) exerted an influence on cortisol responses to chronic stress. It was found that females with two copies of the short allele were associated with increased cortisol responses to chronic stress in comparison to their counterparts who have one or two copies of the long allele. In the absence of stress, no differences related to genotype were observed in these females. This genetic moderation was found without a genetic influence on exposure to stressful situations. Rather it was found to be a genetic modulation of cortisol responses to chronic stress. These findings indicate that the rh5-HTTLPR polymorphism is closely related to hypothalamus-pituitary-adrenal (HPA) axis reactivity, which may increase susceptibility to depression in females with low serotonin transporter efficiency and a history of stress. Copyright © 2014 Elsevier B.V. All rights reserved.

Influence of COMT Val158Met polymorphism on emotional decision-making: A sex-dependent relationship?

PubMed

Costa, Danielle de Souza; Bechara, Antoine; de Paula, Jonas Jardim; Romano-Silva, Marco Aurélio; Correa, Humberto; Lage, Guilherme Menezes; Miranda, Débora Marques de; Malloy-Diniz, Leandro Fernandes

2016-12-30

The biological underpinnings of sex-related differences in decision-making are still under-explored. The COMT gene is related to sexual dimorphism and with different choices made under uncertainty, albeit no study has specifically investigated a moderation effect of sex on the association between the COMT gene and the performance on decision-making paradigms. In this study, we investigated the influence of the COMT Val 158 Met polymorphism on Iowa Gambling Task (IGT) performance depending on sex in a healthy adult sample. Participants were 192 healthy adults (84 men and 108 women). The first 40 choices in the IGT were considered decisions under ambiguity and the last 60 choices decisions under risk. To test our moderation hypothesis we used a separate regressions approach. The results revealed a sex-dependent effect of COMT Va l 158 Met polymorphism on decision-making as measured by the IGT. Val/Val women showed the best performance in the last trials of the IGT. Therefore, the COMT Val 158 Met polymorphism may be considered a genetic marker underlying sex differences in decision-making. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

Association of interleukin-1β genetic polymorphisms with cognitive performance in elderly females without dementia.

PubMed

Sasayama, Daimei; Hori, Hiroaki; Teraishi, Toshiya; Hattori, Kotaro; Ota, Miho; Matsuo, Junko; Kawamoto, Yumiko; Kinoshita, Yukiko; Higuchi, Teruhiko; Amano, Naoji; Kunugi, Hiroshi

2011-08-01

Interleukin-1β (IL-1β) is considered to have a role in age-related cognitive decline. A recent study has shown that a promoter polymorphism of the IL-1β gene (rs16944) is associated with cognitive performance in elderly males without dementia. In this study, we examined whether polymorphisms of the IL-1β gene also influence cognitive functions in elderly females. Cognitive functions were assessed by the Wechsler adult intelligence scale-revised (WAIS-R) in 99 elderly (60 years) females without dementia. We selected five tagging polymorphisms from the IL-1β gene and examined the associations with the WAIS-R scores. Significant associations were found between verbal intelligence quotient (IQ) and the genotypes of rs1143634 and rs1143633 (P=0.0037 and P=0.010, respectively). No significant associations of rs16944 genotype were found with verbal or performance IQ. However, individuals homozygous for the G allele of rs16944 achieved higher scores in digit span compared with their counterpart, which is consistent with the previous findings in males. These results suggest that IL-1β gene variation may have a role in cognitive functions in aging females as well as males.

Investigation on the IL-18 -607A/C and -137C/G on the susceptibility of ischemic stroke.

PubMed

Shi, Jin-He; Niu, Li-Dan; Chen, Xi-Yan; Hou, Jing-Yu; Yang, Ping; Li, Guang-Peng

2015-01-01

We conducted a case-control study with 322 cases and 322 controls to assess the role of the two common SNPs in the promoter of IL-18 gene. Polymerase chain reaction restriction fragment length of polymorphism (PCR-RFLP) was taken to genotype -607A/C and -137C/G in the promoter of the IL-18 gene. By comparing cases and control subjects, we found that IS cases were more likely to have higher BMI, higher proportion of hypertension, and have higher proportion of smokers and drinkers. We found that IL-18 -607CC genotype (OR=1.70, 95% CI=1.03-2.81) and C allele (OR=1.26, 95% CI=1.01-1.58) were significantly more frequent in IS patients when compared with AA genotype. We did not find significant association between IL-18 -607A/C gene polymorphism and BMI, hypertension, smoking and drinking on the risk of IS. Our study suggests that polymorphisms in IL-18 -607A/C can influence the development of IS, and this gene polymorphism is associated with risk of IS in a Chinese population.

Transposon Variants and Their Effects on Gene Expression in Arabidopsis

PubMed Central

Wang, Xi; Weigel, Detlef; Smith, Lisa M.

2013-01-01

Transposable elements (TEs) make up the majority of many plant genomes. Their transcription and transposition is controlled through siRNAs and epigenetic marks including DNA methylation. To dissect the interplay of siRNA–mediated regulation and TE evolution, and to examine how TE differences affect nearby gene expression, we investigated genome-wide differences in TEs, siRNAs, and gene expression among three Arabidopsis thaliana accessions. Both TE sequence polymorphisms and presence of linked TEs are positively correlated with intraspecific variation in gene expression. The expression of genes within 2 kb of conserved TEs is more stable than that of genes next to variant TEs harboring sequence polymorphisms. Polymorphism levels of TEs and closely linked adjacent genes are positively correlated as well. We also investigated the distribution of 24-nt-long siRNAs, which mediate TE repression. TEs targeted by uniquely mapping siRNAs are on average farther from coding genes, apparently because they more strongly suppress expression of adjacent genes. Furthermore, siRNAs, and especially uniquely mapping siRNAs, are enriched in TE regions missing in other accessions. Thus, targeting by uniquely mapping siRNAs appears to promote sequence deletions in TEs. Overall, our work indicates that siRNA–targeting of TEs may influence removal of sequences from the genome and hence evolution of gene expression in plants. PMID:23408902

Genetic Diversity of Toll-Like Receptors and Immunity to M. leprae Infection

PubMed Central

Hart, Bryan E.; Tapping, Richard I.

2012-01-01

Genetic association studies of leprosy cohorts across the world have identified numerous polymorphisms which alter susceptibility and outcome to infection with Mycobacterium leprae. As expected, many of the polymorphisms reside within genes that encode components of the innate and adaptive immune system. Despite the preponderance of these studies, our understanding of the mechanisms that underlie these genetic associations remains sparse. Toll-like receptors (TLRs) have emerged as an essential family of innate immune pattern recognition receptors which play a pivotal role in host defense against microbes, including pathogenic strains of mycobacteria. This paper will highlight studies which have uncovered the association of specific TLR gene polymorphisms with leprosy or tuberculosis: two important diseases resulting from mycobacterial infection. This analysis will focus on the potential influence these polymorphic variants have on TLR expression and function and how altered TLR recognition or signaling may contribute to successful antimycobacterial immunity. PMID:22529866

The association of AKNA gene polymorphisms with knee osteoarthritis suggests the relevance of this immune response regulator in the disease genetic susceptibility.

PubMed

Martínez-Nava, Gabriela Angélica; Fernández-Torres, Javier; Martínez-Flores, Karina; Zamudio-Cuevas, Yessica; Clavijo-Cornejo, Denise; Espinosa-Morales, Rolando; Lozada, Carlos A; Gutierrez, Marwin; Granados, Julio; Pineda, Carlos; Madrid-Marina, Vicente; López-Reyes, Alberto

2018-04-01

Recent studies have identified AKNA as a potential susceptibility gene for several inflammatory diseases. Here, we aimed to assess the potential association of AKNA polymorphisms with knee osteoarthritis (KOA) susceptibility in a Mexican population, following STREGA recommendations. From a DNA bank of 181 KOA patients and 140 healthy controls, two AKNA SNPs were genotyped using TaqMan probes. The association between KOA susceptibility and AKNA polymorphisms genotypes was evaluated by multivariated logistic regression analysis. Information regarding patients' inflammatory biomarkers levels was obtained and their association with AKNA polymorphisms genotypes was assessed by lineal regression. We found a positive association with the recessive inheritance model of both AKNA polymorphisms (A/A genotype for both) and KOA susceptibility adjusting by age, body mass index (BMI), gender and place of birth (OR = 2.48, 95% CI 1.09-5.65 for rs10817595 polymorphism; and OR = 4.96; 95% CI 2.421-10.2 for rs3748176 polymorphism). Additionally these associations were also seen after stratifying patients by KOA severity and age. Furthermore the total leukocyte count was positively associated with rs10817595 AKNA polymorphism (β = 1.39; 95% CI 0.44-2.34) adjusting by age, BMI, gender, place of birth and disease severity. We suggest that regulatory and coding polymorphisms of the inflammatory modulator gene AKNA can influence the development of KOA. Further structural and functional studies might reveal the role of AKNA in OA and other rheumatic diseases.

Dog-Owner Attachment Is Associated With Oxytocin Receptor Gene Polymorphisms in Both Parties. A Comparative Study on Austrian and Hungarian Border Collies.

PubMed

Kovács, Krisztina; Virányi, Zsófia; Kis, Anna; Turcsán, Borbála; Hudecz, Ágnes; Marmota, Maria T; Koller, Dóra; Rónai, Zsolt; Gácsi, Márta; Topál, József

2018-01-01

Variations in human infants' attachment behavior are associated with single nucleotide polymorphisms (SNPs) in the oxytocin receptor (OXTR) gene, suggesting a genetic component to infant-mother attachment. However, due to the genetic relatedness of infants and their mothers, it is difficult to separate the genetic effects of infants' OXTR genotype from the environmental effects of mothers' genotype possibly affecting their parental behavior. The apparent functional analogy between child-parent and dog-owner relationship, however, offers a way to disentangle the effects of these factors because pet dogs are not genetically related to their caregivers. In the present study we investigated whether single nucleotide polymorphisms of pet dogs' OXTR gene (-213AG,-94TC,-74CG) and their owners' OXTR gene (rs53576, rs1042778, rs2254298) are associated with components of dog-owner attachment. In order to investigate whether social-environmental effects modulate the potential genetic influence on attachment, dogs and their owners from two different countries (Austria and Hungary, N = 135 in total) were tested in a modified version of the Ainsworth Strange Situation Test (SST) and questionnaires were also used to collect information about owner personality and attachment style. We coded variables related to three components of attachment behavior in dogs: their sensitivity to the separation from and interaction with the owner (Attachment), stress caused by the unfamiliar environment (Anxiety), and their responsiveness to the stranger (Acceptance). We found that (1) dogs' behavior was significantly associated with polymorphisms in both dogs' and owners' OXTR gene, (2) SNPs in dogs' and owners' OXTR gene interactively influenced dog-human relationship, (3) dogs' attachment behavior was affected by the country of origin, and (4) it was related to their owners' personality as well as attachment style. Thus, the present study provides evidence, for the first time, that both genetic variation in the OXTR gene and various aspects of pet dogs' environmental background are associated with their attachment to their human caregivers.

The influence of the S19W SNP of the APOA5 gene on triglyceride levels in southern Brazil: interactions with the APOE gene, sex and menopause status.

PubMed

De Andrade, F M; Maluf, S W; Schuch, J B; Voigt, F; Barros, A C; Lucatelli, J F; Hutz, M H

2011-08-01

Hypertriglyceridemia is an important independent risk factor for coronary artery diseases and is determined by a wide range of factors, both genetic and exogenous. The A5 apolipoprotein, which is associated with the synthesis and removal of triglycerides (TG), is encoded by the APOA5 gene. One of the polymorphisms of this gene that has been the focus of a large number of studies, and which appears to be associated with increased TG, is S19W (rs 3135506). In this study, we examined the influence of this single nucleotide polymorphism (SNP) on TG levels of a sample of southern Brazilians. Samples obtained from 567 people of European descent were genotyped; interactions between this variant and anthropometric variables were analyzed, and the effects of lifestyle, sex, menopause, and variations of the APOE gene were evaluated. We found that the 19W allele is associated with increased TG (p = 0.025) and that this influence was modulated by sex (p = 0.003), menopause (p = 0.022) and the presence of the E*4 allele (p = 0.027). Our data showed, for the first time, the importance and magnitude of the influence of the S19W variant in a southern Brazilian population. Copyright © 2010 Elsevier B.V. All rights reserved.

The Influence of Genetic and Environmental Factors among MDMA Users in Cognitive Performance

PubMed Central

Cuyàs, Elisabet; Verdejo-García, Antonio; Fagundo, Ana Beatriz; Khymenets, Olha; Rodríguez, Joan; Cuenca, Aida; de Sola Llopis, Susana; Langohr, Klaus; Peña-Casanova, Jordi; Torrens, Marta; Martín-Santos, Rocío; Farré, Magí; de la Torre, Rafael

2011-01-01

This study is aimed to clarify the association between MDMA cumulative use and cognitive dysfunction, and the potential role of candidate genetic polymorphisms in explaining individual differences in the cognitive effects of MDMA. Gene polymorphisms related to reduced serotonin function, poor competency of executive control and memory consolidation systems, and high enzymatic activity linked to bioactivation of MDMA to neurotoxic metabolites may contribute to explain variations in the cognitive impact of MDMA across regular users of this drug. Sixty ecstasy polydrug users, 110 cannabis users and 93 non-drug users were assessed using cognitive measures of Verbal Memory (California Verbal Learning Test, CVLT), Visual Memory (Rey-Osterrieth Complex Figure Test, ROCFT), Semantic Fluency, and Perceptual Attention (Symbol Digit Modalities Test, SDMT). Participants were also genotyped for polymorphisms within the 5HTT, 5HTR2A, COMT, CYP2D6, BDNF, and GRIN2B genes using polymerase chain reaction and TaqMan polymerase assays. Lifetime cumulative MDMA use was significantly associated with poorer performance on visuospatial memory and perceptual attention. Heavy MDMA users (>100 tablets lifetime use) interacted with candidate gene polymorphisms in explaining individual differences in cognitive performance between MDMA users and controls. MDMA users carrying COMT val/val and SERT s/s had poorer performance than paired controls on visuospatial attention and memory, and MDMA users with CYP2D6 ultra-rapid metabolizers performed worse than controls on semantic fluency. Both MDMA lifetime use and gene-related individual differences influence cognitive dysfunction in ecstasy users. PMID:22110616

RAAS gene polymorphisms influence progression of pediatric hypertrophic cardiomyopathy.

PubMed

Kaufman, Beth D; Auerbach, Scott; Reddy, Sushma; Manlhiot, Cedric; Deng, Liyong; Prakash, Ashwin; Printz, Beth F; Gruber, Dorota; Papavassiliou, Dimitrios P; Hsu, Daphne T; Sehnert, Amy J; Chung, Wendy K; Mital, Seema

2007-12-01

Hypertrophic Cardiomyopathy (HCM) is a disease with variable rate of progression. Young age is an independent risk factor for poor outcome in HCM. The influence of renin-angiotensin-aldosterone (RAAS) genotype on the progression of HCM in children is unknown. Children with HCM (n = 65) were enrolled prospectively across two centers (2001-2005). All subjects were genotyped for five RAAS gene polymorphisms previously associated with LV hypertrophy (pro-LVH): AGT M235T, ACE DD, CMA-1903 A/G, AGTR1 1666 A/C and CYP11B2-344 C/T. Linear regression models, based on maximum likelihood estimates, were created to assess the independent effect of RAAS genotype on LV hypertrophy (LVH). Forty-six subjects were homozygous for <2 and 19 were homozygous for > or =2 pro-LVH RAAS polymorphisms. Mean age at presentation was 9.6 +/- 6 years. Forty children had follow-up echocardiograms after a median of 1.5 years. Indexed LV mass (LVMI) and LV mass z-scores were higher at presentation and follow-up in subjects with > or =2 pro-LVH genotypes compared to those with <2 (P < 0.05). Subjects with > or =2 pro-LVH genotypes also demonstrated a greater increase in septal thickness (IVST) and in LV outflow tract (LVOT) obstruction on follow-up (P < 0.05). On multivariate analysis, a higher number of pro-LVH genotypes was associated with a larger effect size (P < 0.05). Pro-LVH RAAS gene polymorphisms are associated with progressive septal hypertrophy and LVOT obstruction in children with HCM. Identification of RAAS modifier genes may help to risk-stratify patients with HCM.

A model of ecological and evolutionary consequences of color polymorphism.

PubMed

Forsman, Anders; Ahnesjö, Jonas; Caesar, Sofia; Karlsson, Magnus

2008-01-01

We summarize direct and indirect effects on fitness components of animal color pattern and present a synthesis of theories concerning the ecological and evolutionary dynamics of chromatic multiple niche polymorphisms. Previous endeavors have aimed primarily at identifying conditions that promote the evolution and maintenance of polymorphisms. We consider in a conceptual model also the reciprocal influence of color polymorphism on population processes and propose that polymorphism entails selective advantages that may promote the ecological success of polymorphic species. The model begins with an evolutionary branching event from mono- to polymorphic condition that, under the influence of correlational selection, is predicted to promote the evolution of physical integration of coloration and other traits (cf. multi-trait coevolution and complex phenotypes). We propose that the coexistence within a population of alternative ecomorphs with coadapted gene complexes promotes utilization of diverse environmental resources, population stability and persistence, colonization success, and range expansions, and enhances the evolutionary potential and speciation. Conversely, we predict polymorphic populations to be less vulnerable to environmental change and at lower risk of range contractions and extinctions compared with monomorphic populations. We offer brief suggestions as to how these falsifiable predictions may be tested.

Alterations in cholesterol metabolism-related genes in sporadic Alzheimer's disease.

PubMed

Picard, Cynthia; Julien, Cédric; Frappier, Josée; Miron, Justin; Théroux, Louise; Dea, Doris; Breitner, John C S; Poirier, Judes

2018-06-01

Genome-wide association studies have identified several cholesterol metabolism-related genes as top risk factors for late-onset Alzheimer's disease (LOAD). We hypothesized that specific genetic variants could act as disease-modifying factors by altering the expression of those genes. Targeted association studies were conducted with available genomic, transcriptomic, proteomic, and histopathological data from 3 independent cohorts: the Alzheimer's Disease Neuroimaging Initiative (ADNI), the Quebec Founder Population (QFP), and the United Kingdom Brain Expression Consortium (UKBEC). First, a total of 273 polymorphisms located in 17 cholesterol metabolism-related loci were screened for associations with cerebrospinal fluid LOAD biomarkers beta amyloid, phosphorylated tau, and tau (from the ADNI) and with amyloid plaque and tangle densities (from the QFP). Top polymorphisms were then contrasted with gene expression levels measured in 134 autopsied healthy brains (from the UKBEC). In the end, only SREBF2 polymorphism rs2269657 showed significant dual associations with LOAD pathological biomarkers and gene expression levels. Furthermore, SREBF2 expression levels measured in LOAD frontal cortices inversely correlated with age at death; suggesting a possible influence on survival rate. Copyright © 2018 Elsevier Inc. All rights reserved.

Polymorphism in ovine ANXA9 gene and physic-chemical properties and the fraction of protein in milk.

PubMed

Pecka-Kiełb, Ewa; Czerniawska-Piątkowska, Ewa; Kowalewska-Łuczak, Inga; Vasil, Milan

2018-04-16

Annexin A9 (ANXA9) is a specific fatty acid transport protein. ANXA9 gene is expressed in various tissues, including secretory tissue and mammary glands. The association between three SNPs of the ANXA9 gene and sheep's milk compositions was assessed. Genotype analysis was performed with the use of PCR-RFLP method. The studied ANXA9 polymorphisms had the following MAF (Major Allele Frequency): SNP1: allele G 0,66; SNP2: allele G 0,54; SNP3: allele C 0,57. The study found the most desired profile of protein fractions, namely an increased kappa-casein fractions and a decreased level of whey protein in sheep's milk for SNP1 and SNP3 polymorphisms. Sheep with the SNP1 GA genotype had the highest (P <0.05) content of fat and dry matter in milk. AXNA9 gene polymorphism did not influence the levels of protein, lactose or urea in sheep's milk. The information contained in this study may be useful for determining the impact of the ANXA9 gene on sheep's milk. The ANXA9 SNP1 and SNP3 polymorphisms results could be included in the breeding programs to select the sheep with the genotypes ensuring the highest kappa-casein levels in milk. However, it is worth conducting further research on ANXA9 and milk composition in larger herds of animals and various breeds of sheep. This article is protected by copyright. All rights reserved.

Analysis of polymorphisms of the vitamin D receptor, estrogen receptor, and collagen Ialpha1 genes and their relationship with height in children with bone cancer.

PubMed

Ruza, Elena; Sotillo, Elena; Sierrasesúmaga, Luis; Azcona, Cristina; Patiño-García, Ana

2003-10-01

The authors' objectives were to compare height at diagnosis of children with bone tumors with that of Spanish reference children; to analyze the frequency of the genotypes for the polymorphisms of the vitamin D receptor (VDR), estrogen receptor (ER), and collagen Ialpha1 (COLIalpha1) genes in patients and in healthy controls; and to test the relationship between the genetic markers and height. Height and weight at diagnosis were measured in 58 osteosarcoma and 36 Ewing sarcoma patients and compared with standards published for Spanish reference children according to sex and age. For the molecular analysis, genetic polymorphisms of the VDR (Fok I, Apa I, and TaqI), ER (Pvu II and XbaI), and COLIalpha1 (Msc I) genes were characterized in 72 osteosarcoma and 53 Ewing sarcomas and in a group of 143 healthy matched children. Osteosarcoma and Ewing sarcoma patients were significantly taller than Spanish reference children. Osteosarcoma patients showed a significantly higher frequency of the Ff genotype for the Fok I polymorphism (VDR gene) than the control group. The odds ratio for this genotype was 1.78, with an increased relative risk of 78% for heterozygous Ff carriers. Among Ewing sarcoma patients, this same genotype was significantly associated with lower height than homozygotes (FF or ff). Children with bone cancer are significantly taller than the reference population, which may be influenced by the genotype for the Fok I polymorphism of the VDR gene.

C677T and A1298C polymorphisms of the methylenetetrahydrofolate reductase gene: effect on methotrexate-related toxicity in adult acute lymphoblastic leukaemia.

PubMed

Eissa, Deena Samir; Ahmed, Tamer Mohamed

2013-03-01

Methylenetetrahydrofolate reductase (MTHFR) is a key enzyme involved in folate metabolism. Two polymorphisms, C677T and A1298C, were described leading to reduced enzyme activity. Methotrexate (MTX) is an antifolate agent of consolidation and maintenance therapy of acute lymphoblastic leukaemia (ALL). Despite its clinical success, MTX can be associated with serious toxicities resulting in treatment interruption or discontinuation, impacting disease outcome. There is evidence that MTX toxicity can be affected by polymorphisms in genes encoding for drug-metabolizing enzymes such as MTHFR. Therefore, we aimed to investigate the influence of MTHFR C677T and A1298C polymorphisms on the frequency of MTX-related toxicity, disease outcome and patients' survival. MTHFR polymorphisms were assessed in 50 adult patients with de novo ALL using real-time PCR. Patients were followed-up for the development of haematologic and/or nonhaematologic toxicity and assessment of clinical outcome. Frequency of C677T polymorphisms was 42% for TT, 24% for CT and 34% for CC; A1298C polymorphisms were 28, 6 and 66% for CC, AC and AA, respectively. MTX therapy was significantly associated with neutropaenia, hepatic and gastrointestinal toxicities, unfavourable response at day 14 of induction therapy, increased relapse and mortality rates and shorter survival in patients with 677 TT genotype than in those with CC and CT, whereas 1298 CC genotype patients had lower frequency of neutropaenia, hepatic toxicity and relapse than in those with AA and AC. Our study suggests MTHFR polymorphism as an attractive predictor of MTX-related toxicity in adult ALL, considering it a potential prognostic factor influencing disease outcome.

An Association Study of the SLC19A1 Gene Polymorphisms/Haplotypes with Idiopathic Recurrent Pregnancy Loss in an Iranian Population.

PubMed

Mohtaram, Shirin; Sheikhha, Mohammad Hasan; Honarvar, Negar; Sazegari, Ali; Maraghechi, Neda; Feizollahi, Zahra; Ghasemi, Nasrin

2016-05-01

The genetics of folate metabolism is one of the most significant mechanisms influencing fetal growth and may underlie some cases of unexplained recurrent miscarriage. Reduced folate carrier 1, encoded by the SLC19A1 gene, is a transporter of folate. Folate deficiency and elevated levels of homocysteine could be disadvantageous for the female reproductive system health. Thus, the balance between homocysteine and folate status can be used to measure the risk of recurrent pregnancy loss. The purpose of this study was to determine the association between -43T>C, 80G>A, and 696C>T polymorphisms of the SLC19A1 gene in 147 women who had unexplained recurrent miscarriage in comparison with 150 healthy women. Amplification refractory mutation system-polymerase chain reaction was used to genotype the molecular polymorphisms of this gene. The results indicated that the -43T>C single nucleotide of the SLC19A1 gene was significantly associated with a risk of recurrent miscarriage in Iranian women (p < 0.05). No significant association was observed for the other two polymorphisms. The haplotype frequency distribution of -43C/80G/696C, -;43C/80G/696T, -43C/80G, and 80G/696T was significantly different in patients than controls, which may represent a novel risk factor for idiopathic recurrent pregnancy loss. Polymorphisms and haplotypes of the SLC19A1 gene can be considered risk factors for idiopathic recurrent pregnancy loss.

Association of A(313)G glutathione S-transferase P1 germline polymorphism with susceptibility to de novo myelodysplastic syndrome.

PubMed

Zachaki, Sophia; Stavropoulou, Chrysa; Kalomoiraki, Marina; Koromila, Theodora; Daraki, Aggeliki; Manola, Kalliopi N; Mavrou, Ariadni; Kanavakis, Emmanuel; Pantelias, Gabriel E; Sambani, Constantina

2013-08-01

Models for the pathogenesis of myelodysplastic syndrome (MDS) imply the role of individual genetic variations in genes involved in detoxification mechanisms. GSTP1 enzyme plays a key role in the biotransformation of a variety of carcinogens. The corresponding gene is subject to a single nucleotide polymorphism (A(313)G) leading to abolished enzyme activity. In order to evaluate whether the GSTP1 polymorphism influences MDS susceptibility, we conducted a case-control study comprising 310 de novo patients and 370 healthy controls using a real-time polymerase chain reaction (PCR) genotyping method. The GSTP1 gene status was also evaluated in relation to patients' characteristics and chromosomal abnormalities. A significantly higher incidence of the GSTP1 variant genotypes was observed in patients with MDS compared to controls (p < 0.0001). The results revealed increased frequencies of heterozygotes in patients younger than 60 years old and of homozygotes G/G in older patients (p = 0.007). Our results provide evidence for a pathogenetic role of the GSTP1 polymorphism in MDS risk, probably in an age-dependent manner.

Smoking and polymorphisms of fucosyltransferase gene Le affect success of H. pylori eradication with lansoprazole, amoxicillin, and clarithromycin.

PubMed Central

Matsuo, K.; Hamajima, N.; Ikehara, Y.; Suzuki, T.; Nakamura, T.; Matsuura, A.; Tajima, K.; Tominaga, S.

2003-01-01

Identification of factors influencing success of Helicobacter pylori (HP) eradication is important for clinical practice. We have prospectively conducted an HP eradication study in the Aichi Cancer Center with a total of 142 patients available for analysis. The overall success rate was 61.3% (95% confidence interval 52.7-69.3%). Smoking during the medication for eradication significantly decreased the success rate (42.9%), whereas smoking cessation during the treatment was associated with a similar rate as for non-smokers (66.7%). We also examined links between an eradication outcome and polymorphisms of Le, Se, IL1A, IL1B, IL1RN and MPO genes, but with one exception none showed any association. The non-functional le allele of Le polymorphisms, leading to decreased expression of Le(b) antigen to which HP attaches with adhesin, showed a beneficial effect for success. Although further clarification is necessary, our study indicated that smoking cessation and Le gene polymorphisms may affect the success rate of HP eradication. PMID:12729191

IL10A genotypic association with decreased IL-10 circulating levels in malaria infected individuals from endemic area of the Brazilian Amazon.

PubMed

Pereira, Virginia A; Sánchez-Arcila, Juan C; Teva, Antonio; Perce-da-Silva, Daiana S; Vasconcelos, Mariana P A; Lima, Cleoni A M; Aprígio, Cesarino J L; Rodrigues-da-Silva, Rodrigo N; Santos, Davi O; Banic, Dalma M; Bonecini-Almeida, Maria G; Lima-Júnior, Josué C; Oliveira-Ferreira, Joseli

2015-01-28

Cytokines play an important role in human immune responses to malaria and variation in their production may influence the course of infection and determine the outcome of the disease. The differential production of cytokines has been linked to single nucleotide polymorphisms in gene promoter regions, signal sequences, and gene introns. Although some polymorphisms play significant roles in susceptibility to malaria, gene polymorphism studies in Brazil are scarce. A population of 267 individuals from Brazilian Amazon exposed to malaria was genotyped for five single nucleotide polymorphisms (SNPs), IFNG + 874 T/A, IL10A-1082G/A, IL10A-592A/C, IL10A-819 T/C and NOS2A-954G/C. Specific DNA fragments were amplified by polymerase chain reaction, allowing the detection of the polymorphism genotypes. The polymorphisms IL10A-592A/C and IL10A-819 T/C were estimated by a single analysis due to the complete linkage disequilibrium between the two SNPs with D' = 0.99. Plasma was used to measure the levels of IFN-γ and IL-10 cytokines by Luminex and nitrogen radicals by Griess reaction. No differences were observed in genotype and allelic frequency of IFNG + 874 T/A and NOS2A-954G/C between positive and negative subjects for malaria infection. Interesting, the genotype NOS2A-954C/C was not identified in the study population. Significant differences were found in IL10A-592A/C and IL10A-819 T/C genotypes distribution, carriers of IL10A -592A/-819 T alleles (genotypes AA/TT + AC/TC) were more frequent among subjects with malaria than in negative subjects that presented a higher frequency of the variant C allele (p < 0.0001). The presence of the allele C was associated with low producer of IL-10 and low parasitaemia. In addition, the GTA haplotypes formed from combinations of investigated polymorphisms in IL10A were significantly associated with malaria (+) and the CCA haplotype with malaria (-) groups. The IL10A-1082G/A polymorphism showed high frequency of heterozygous AG genotype in the population, but it was not possible to infer any association of the polymorphism because their distribution was not in Hardy Weinberg equilibrium. This study shows that the IL10A-592A/C and IL10A-819 T/C polymorphisms were associated with malaria and decreased IL-10 levels and low parasite density suggesting that this polymorphism influence IL-10 levels and may influence in the susceptibility to clinical malaria.

Association of Polyaminergic Loci With Anxiety, Mood Disorders, and Attempted Suicide

PubMed Central

Fiori, Laura M.; Wanner, Brigitte; Jomphe, Valérie; Croteau, Jordie; Vitaro, Frank

2010-01-01

Background The polyamine system has been implicated in a number of psychiatric conditions, which display both alterations in polyamine levels and altered expression of genes related to polyamine metabolism. Studies have identified associations between genetic variants in spermidine/spermine N1-acetyltransferase (SAT1) and both anxiety and suicide, and several polymorphisms appear to play important roles in determining gene expression. Methodology/Principal Findings We genotyped 63 polymorphisms, spread across four polyaminergic genes (SAT1, spermine synthase (SMS), spermine oxidase (SMOX), and ornithine aminotransferase like-1 (OATL1)), in 1255 French-Canadian individuals who have been followed longitudinally for 22 years. We assessed univariate associations with anxiety, mood disorders, and attempted suicide, as assessed during early adulthood. We also investigated the involvement of gene-environment interactions in terms of childhood abuse, and assessed internalizing and externalizing symptoms as endophenotypes mediating these interactions. Overall, each gene was associated with at least one main outcome: anxiety (SAT1, SMS), mood disorders (SAT1, SMOX), and suicide attempts (SAT1, OATL1). Several SAT1 polymorphisms displayed disease-specific risk alleles, and polymorphisms in this gene were involved in gene-gene interactions with SMS to confer risk for anxiety disorders, as well as gene-environment interactions between childhood physical abuse and mood disorders. Externalizing behaviors demonstrated significant mediation with regards to the association between OATL1 and attempted suicide, however there was no evidence that externalizing or internalizing behaviors were appropriate endophenotypes to explain the associations with mood or anxiety disorders. Finally, childhood sexual abuse did not demonstrate mediating influences on any of our outcomes. Conclusions/Significance These results demonstrate that genetic variants in polyaminergic genes are associated with psychiatric conditions, each of which involves a set of separate and distinct risk alleles. As several of these polymorphisms are associated with gene expression, these findings may provide mechanisms to explain the alterations in polyamine metabolism which have been observed in psychiatric disorders. PMID:21152090

Association of polyaminergic loci with anxiety, mood disorders, and attempted suicide.

PubMed

Fiori, Laura M; Wanner, Brigitte; Jomphe, Valérie; Croteau, Jordie; Vitaro, Frank; Tremblay, Richard E; Bureau, Alexandre; Turecki, Gustavo

2010-11-30

The polyamine system has been implicated in a number of psychiatric conditions, which display both alterations in polyamine levels and altered expression of genes related to polyamine metabolism. Studies have identified associations between genetic variants in spermidine/spermine N1-acetyltransferase (SAT1) and both anxiety and suicide, and several polymorphisms appear to play important roles in determining gene expression. We genotyped 63 polymorphisms, spread across four polyaminergic genes (SAT1, spermine synthase (SMS), spermine oxidase (SMOX), and ornithine aminotransferase like-1 (OATL1)), in 1255 French-Canadian individuals who have been followed longitudinally for 22 years. We assessed univariate associations with anxiety, mood disorders, and attempted suicide, as assessed during early adulthood. We also investigated the involvement of gene-environment interactions in terms of childhood abuse, and assessed internalizing and externalizing symptoms as endophenotypes mediating these interactions. Overall, each gene was associated with at least one main outcome: anxiety (SAT1, SMS), mood disorders (SAT1, SMOX), and suicide attempts (SAT1, OATL1). Several SAT1 polymorphisms displayed disease-specific risk alleles, and polymorphisms in this gene were involved in gene-gene interactions with SMS to confer risk for anxiety disorders, as well as gene-environment interactions between childhood physical abuse and mood disorders. Externalizing behaviors demonstrated significant mediation with regards to the association between OATL1 and attempted suicide, however there was no evidence that externalizing or internalizing behaviors were appropriate endophenotypes to explain the associations with mood or anxiety disorders. Finally, childhood sexual abuse did not demonstrate mediating influences on any of our outcomes. These results demonstrate that genetic variants in polyaminergic genes are associated with psychiatric conditions, each of which involves a set of separate and distinct risk alleles. As several of these polymorphisms are associated with gene expression, these findings may provide mechanisms to explain the alterations in polyamine metabolism which have been observed in psychiatric disorders.

Distribution of the most common polymorphisms in TYMS gene in Slavic population of central Europe.

PubMed

Pastorakova, A; Chandogova, D; Chandoga, J; Luha, J; Bohmer, D; Malova, J; Braxatorisova, T; Juhosova, M; Reznakova, S; Petrovic, R

2017-01-01

Thymidylate synthetase (TS) plays a critical role in the de novo synthesis of dTMP inside the cell. Therefore, TS is a suitable target for cytotoxic drugs such as fluoropyrimidines. Drug efficacy and toxicity depend on the intracellular level of TS, which is significantly influenced by the polymorphisms in the 5'UTR (TSER - rs45445694, TSER*3G>C - rs2853542) and 3'UTR (1494del TTAAAG - rs151264360) of TYMS gene. Polymorphic variants of TYMS gene affect TS activity via gene expression and transcript stability. Patients who undergo fluoropyrimidine therapy may benefit from genetic testing prior to the administration of chemotherapy. At the 5' terminus of TYMS, there is a polymorphic region represented by a variable number of 28bp long tandem repeats (2-9 tandems) with the G or C nucleotide variant (SNP G>C). The 3'end of TYMS gene may decrease the stability of mRNA in the case of 6 base deletion (1494del6, D). In our study, we have focused on testing of TYMS gene polymorphisms, determination of TYMS variant frequencies in Western Slavic population and comparison of Slovak population with other populations.We performed identification of 5'UTR (rs45445694 - TSER*2 or TSER*3; rs2853542 - TSER*3G>C; TSER*3+ins6) and 3'UTR (rs151264360/1494del6/D) polymorphic regions of TYMS gene among 96 volunteers by PCR-RFLP and fragment analysis. Slovak frequencies of selected polymorphisms were established as follows: the frequency of TSER*2, TSER*3, TSER*3G>C, 1494del6/D and I to be 41%, 59%, 34%, 37.5% and 62.5% respectively. The high resolution of the capillary electrophoresis technique allowed among TSER*3 group identification of a subgroup of four individuals with rare 6bp insertion in 3R allele, id est 2.1% TSER*3+ins6 allele frequency. In our study, we have revealed individuals with rare G>C substitution in the first 28bp tandem repeat of TSER*2 promoter enhancer region (rs183205964) as well, the overall frequency of this polymorphic allele in Slovak population was 2.1%. Our results proved that Slovak population is in Hardy-Weinberg equilibrium and proportion of TYMS polymorphisms is in accordance with other published data.

Polymorphism of Trp64Arg in beta3-adrenergic receptor gene among Bolivian people in rural areas at high and low altitudes.

PubMed

Karasaki, Yuji; Kashiwazaki, Hiroshi

2004-01-01

To investigate whether population differences in food and/or lifestyle could affect the distribution frequencies of polymorphism in the gene for beta3-adrenergic receptor (beta3-AR), the frequency of Trp64Arg polymorphism was studied among Bolivian people living in rural areas of high (about 4000 m above sea level) and low (about 300 m above sea level) altitudes. Genomic DNA samples of Bolivian subjects (n=508) were amplified by polymerase chain reaction (PCR) for part of the beta3-AR gene. The amplified PCR products were digested with restriction enzyme NciI and analysed by agarose gel electrophoresis. We found no significant difference in the frequency of Arg allele in the beta3-AR gene between 331 native low-altitude Bolivian subjects (18.1%) and 177 native high-altitude Bolivian subjects (17.5%). Body mass index was not associated with Trp64Arg polymorphism among native Bolivian adults. The frequency of this allele in the complete Bolivian population (18%) was lower than that reported in Pima Indians (32%), is comparable to the Japanese (19%) and is higher than several ethnic groups, including Finns (12%) and French (4%). Our data indicate that the altitude-related lifestyle of a population has had little influence on the frequency of Trp64Arg polymorphism and obesity in Bolivian natives.

Maximal oxygen uptake is associated with allele -202 A of insulin-like growth factor binding protein-3 (IGFBP3) promoter polymorphism and (CA)n tandem repeats of insulin-like growth factor IGF1 in Caucasians from Poland.

PubMed

Gronek, Piotr; Holdys, Joanna; Kryściak, Jakub; Wieliński, Dariusz; Słomski, Ryszard

2014-01-01

Physical fitness is a trait determined by multiple genes, and its genetic basis is modified by numerous environmental factors. The present study examines the effects of the (CA)n tandem repeats polymorphism in IGFI gene and SNP Alw21I restriction site -202 A>C polymorphism in IGF1BP3 on VO2max--a physiological index of aerobic capacity of high heritability. The study sample consisted of 239 (154 male and 85 female) students of the University School of Physical Education in Poznań and athletes practicing various sports, including members of the Polish national team. An association was found between -202 A/C polymorphism of IGFBP3 gene with VO2max in men. Higher VO2max values were attained by men with CC genotype, especially male athletes practicing endurance sports and sports featuring energy metabolism of aerobic/anaerobic character. A statistically significant influence of allele 188 and genotype 188/188 of tandem repeats (CA)n polymorphism of IGF1 gene on VO2max was found in women. Also, lower values of maximal oxygen uptake were noted in individuals with allele 186 or genotype 186/186, and higher VO2max values in athletes with allele 194.

Beneficial effect of CETP gene polymorphism in combination with a Mediterranean diet influencing lipid metabolism in metabolic syndrome patients: CORDIOPREV study

USDA-ARS?s Scientific Manuscript database

The cholesteryl ester transfer protein (CETP) gene has been implicated in high-density lipoprotein (HDL-C) metabolism. However, little is known about the impact of this gene on metabolic syndrome (MetS) patients and its interaction with diet. Here, we evaluate whether the consumption of a Mediterran...

Genetic predictors of long-term response to growth hormone (GH) therapy in children with GH deficiency and Turner syndrome: the influence of a SOCS2 polymorphism.

PubMed

Braz, Adriana F; Costalonga, Everlayny F; Trarbach, Ericka B; Scalco, Renata C; Malaquias, Alexsandra C; Guerra-Junior, Gil; Antonini, Sonir R R; Mendonca, Berenice B; Arnhold, Ivo J P; Jorge, Alexander A L

2014-09-01

There is great interindividual variability in the response to GH therapy. Ascertaining genetic factors can improve the accuracy of growth response predictions. Suppressor of cytokine signaling (SOCS)-2 is an intracellular negative regulator of GH receptor (GHR) signaling. The objective of the study was to assess the influence of a SOCS2 polymorphism (rs3782415) and its interactive effect with GHR exon 3 and -202 A/C IGFBP3 (rs2854744) polymorphisms on adult height of patients treated with recombinant human GH (rhGH). Genotypes were correlated with adult height data of 65 Turner syndrome (TS) and 47 GH deficiency (GHD) patients treated with rhGH, by multiple linear regressions. Generalized multifactor dimensionality reduction was used to evaluate gene-gene interactions. Baseline clinical data were indistinguishable among patients with different genotypes. Adult height SD scores of patients with at least one SOCS2 single-nucleotide polymorphism rs3782415-C were 0.7 higher than those homozygous for the T allele (P < .001). SOCS2 (P = .003), GHR-exon 3 (P= .016) and -202 A/C IGFBP3 (P = .013) polymorphisms, together with clinical factors accounted for 58% of the variability in adult height and 82% of the total height SD score gain. Patients harboring any two negative genotypes in these three different loci (homozygosity for SOCS2 T allele; the GHR exon 3 full-length allele and/or the -202C-IGFBP3 allele) were more likely to achieve an adult height at the lower quartile (odds ratio of 13.3; 95% confidence interval of 3.2-54.2, P = .0001). The SOCS2 polymorphism (rs3782415) has an influence on the adult height of children with TS and GHD after long-term rhGH therapy. Polymorphisms located in GHR, IGFBP3, and SOCS2 loci have an influence on the growth outcomes of TS and GHD patients treated with rhGH. The use of these genetic markers could identify among rhGH-treated patients those who are genetically predisposed to have less favorable outcomes.

Influence of plasminogen activator inhibitor-1 (SERPINE1) 4G/5G polymorphism on circulating SERPINE-1 antigen expression in HCC associated with viral infection.

PubMed

Divella, Rosa; Mazzocca, Antonio; Gadaleta, Cosimo; Simone, Giovanni; Paradiso, Angelo; Quaranta, Michele; Daniele, Antonella

2012-01-01

Hepatocarcinogenesis is heavily influenced by chronic hepatitis B (HBV) and C (HCV) infection. Elevated levels of plasminogen activator inhibitor-1 (SERPINE1/PAI-1) have been reported in patients with hepatocellular carcinoma (HCC) associated with viral infection. The gene encoding SERPINE1 is highly polymorphic and the frequently associated 4/5 guanosine (4G/5G) polymorphism in the gene promoter may influence its expression. Here, we investigated the distribution of genotypes and the frequency of alleles of the 4G/5G polymorphism in patients with HCC, the influence of the 4G/5G polymorphism on plasma SERPINE1 levels and its association with viral infection. A total of 75 patients with HCC were enrolled: 32 (42.6%) were HBV(+)/HCV(+), 11 (14.6%) were only HCV(+), and 32 (42.6%) were negative for both viruses. A control group of healthy donors was also enrolled (n=50). SERPINE1 plasma concentrations were determined by ELISA and the detection of the promoter 4G/5G polymorphism was performed by an allele-specific PCR analysis. We found that the frequency of both the 4G/4G genotype (p=0.02) and the 4G allele (p=0.006) were significantly higher in patients with HCC compared to the control group, and particularly higher in patients with HCC co-infected with HBV(+)/HCV(+) than in those with no viral infection. We also found that patients with the 4G/4G genotype had significantly higher plasma SERPINE1 protein levels when compared with patients with the 4G/5G or 5G/5G genotype (p<0.001). Differences in frequency of 4G allele and genetic variability of 4G/5G SERPINE1 polymorphism with a higher level of SERPINE1 protein in patients with HCC with HBV(+)/HCV(+) than those without infection, suggest the presence of two distinct pathogenic mechanisms in hepatocarcinogenesis, depending on the etiology.

The influence of L-opsin gene polymorphisms and neural ageing on spatio-chromatic contrast sensitivity in 20-71 year olds.

PubMed

Dees, Elise W; Gilson, Stuart J; Neitz, Maureen; Baraas, Rigmor C

2015-11-01

Chromatic contrast sensitivity may be a more sensitive measure of an individual's visual function than achromatic contrast sensitivity. Here, the first aim was to quantify individual- and age-related variations in chromatic contrast sensitivity to a range of spatial frequencies for stimuli along two complementary directions in color space. The second aim was to examine whether polymorphisms at specific amino acid residues of the L- and M-opsin genes (OPN1LW and OPN1MW) known to affect spectral tuning of the photoreceptors could influence spatio-chromatic contrast sensitivity. Chromatic contrast sensitivity functions were measured in 50 healthy individuals (20-71 years) employing a novel pseudo-isochromatic grating stimulus. The spatio-chromatic contrast sensitivity functions were found to be low pass for all subjects, independent of age and color vision. The results revealed a senescent decline in spatio-chromatic contrast sensitivity. There were considerable between-individual differences in sensitivity within each age decade for individuals 49 years old or younger, and age did not predict sensitivity for these age decades alone. Forty-six subjects (including a color deficient male and eight female carriers) were genotyped for L- and M-opsin genes. The Ser180Ala polymorphisms on the L-opsin gene were found to influence the subject's color discrimination and their sensitivity to spatio-chromatic patterns. The results expose the significant role of neural and genetic factors in the deterioration of visual function with increasing age. Copyright © 2015 Elsevier Ltd. All rights reserved.

Tumor necrosis factor alpha (-308), interleukin-6 (-174) and interleukin-10 (-1082) gene polymorphisms in polycystic ovary syndrome.

PubMed

Vural, Pervin; Değirmencioğlu, Sevgin; Saral, Neslihan Y; Akgül, Cemil

2010-05-01

The imbalance between pro- and anti-inflammatory cytokines and polymorphism of cytokine genes may play a role in the etiology of the polycystic ovary syndrome (PCOS). The aim of this study was to investigate the association of polymorphisms of TNFalpha, IL-6 and IL-10 genes with the occurrence and the clinical/laboratory characteristics of PCOS in the Turkish population. Single nucleotide polymorphisms (SNPs) of TNFalpha (-308 G/A), IL-6 (-174 G/C), IL-10 (-1082 G/A) genes in DNA from peripheral blood leukocytes of 97 PCOS patients and 95 healthy control women were investigated. There is a tendency toward lower frequency of the IL-6 CC genotype and C allele among PCOS women compared with healthy controls although the difference did not reach a significant level. No notable differences were observed in allele or genotype frequencies for TNFalpha and IL-10 genes between groups. The concomitant presence of wild homozygous TNFalpha genotype together with mutant IL-6 C allele has a protective effect against PCOS with an OR=0.45 (95% CI=0.23-0.86). While TNFalpha (-308) and IL-10 (-1082) genotypes did not influence clinical/laboratory parameters in PCOS, IL-6 (-174) CC or pooled CG+CC genotypes have lower glucose, insulin, HOMA, cholesterol, triglyceride, and LDL-C, and higher GIR and HDL-C values than GG genotypes. We suggest that the IL-6 promoter region polymorphism may be related to occurrence and metabolic abnormalities seen in PCOS in the Turkish population. However, more studies with larger sample size are necessary to support our findings in other populations before any statement can be made about the relationship between PCOS and cytokine polymorphism. Copyright (c) 2010 Elsevier Ireland Ltd. All rights reserved.

Association of Methylenetetrahydrofolate Reductase C677T and A1298C Gene Polymorphisms With Recurrent Pregnancy Loss in Syrian Women.

PubMed

Al-Achkar, Walid; Wafa, Abdulsamad; Ammar, Samer; Moassass, Faten; Jarjour, Rami A

2017-09-01

C677T polymorphism of the methylenetetrahydrofolate reductase ( MTHFR) gene was a risk factor for recurrent pregnancy loss (RPL), but few studies have confirmed a possible role of MTHFR A1298C polymorphism in RPL risk. This study was carried out to determine the influence of the MTHFR gene polymorphisms in RPL Syrian women. A case-control study was performed on 2 groups (106 healthy and 100 RPL women). The frequency of the MTHFR gene polymorphisms was determined by polymerase chain reaction based on restriction fragment length gene polymorphism. In the RPL group, the genotype frequencies of MTHFR C677T were CC (41%), CT (41%), and TT (18%), and in the control group, the frequencies were CC (62.2%), CT (36.7%), and TT (1%). Statistical analysis showed a homozygous TT genotype and T allele were significantly different in the RPL group ( P = .000003 and P = .000019, respectively). The genotype frequencies of MTHFR A1298C were AA (53%), AC (44%), and CC (8%) in the RPL group, whereas in the control group, these were AA (61.3%), AC (37.8%), and CC (1%). A significant difference in the CC genotype and C allelic frequencies in the RPL women was observed ( P = .014 and P = .064, respectively). The patients having compound heterozygous (677 CT/1298AC) were associated with an estimated 4.86-fold increase in risk of pregnancy loss compared to individuals with a wild type ( P = .012). Our findings indicate that RPL women with homozygous genotype for (C677T and A1298C) either alone or compound heterozygous genotypes have a high risk of pregnancy loss in Syrian women.

Polymorphisms in the glutathione pathway modulate cystic fibrosis severity: a cross-sectional study

PubMed Central

2014-01-01

Background Cystic fibrosis (CF) clinically manifests with various levels of severity, which are thought to be modulated by mutations in the cystic fibrosis transmembrane conductance regulator gene (CFTR), modifier genes, and the environment. This study verified whether polymorphisms in modifier genes associated with glutathione (GSH) metabolism influence CF severity. Methods A cross-sectional study of 180 CF patients was carried out from 2011 to 2012. We analyzed CFTR mutations, polymorphisms (GSTM1 and GSTT1 deletions, GSTP1 + 313A > G, GCLC-129C > T, and GCLC-3506A > G) in modifier genes and CF clinical severity as assessed by 28 clinical and laboratory variables. Results Significant associations were found between modifier gene polymorphisms and particular phenotypes or genotype changes. These included GCLC-129C > T with a higher frequency of the Pseudomonas aeruginosa mucoid to CC genotype (p = 0.044), and GCLC-3506A > G with a higher frequency of the no-mucoid P. aeruginosa (NMPA) to AA genotype (p = 0.012). The GSTT1 deletion was associated with a higher frequency of the NMPA to homozygous deletion (p = 0.008), GSTP1 + 313A > G with a minor risk of osteoporosis (p = 0.036), and patient age ≤ 154 months (p = 0.044) with the AA genotype. The Bhalla score was associated with GCLC-3506A > G (p = 0.044) and GSTM1/GSTT1 deletion polymorphisms (p = 0.02), while transcutaneous hemoglobin oxygen saturation levels were associated with GSTT1 deletions (p = 0.048). Conclusion CF severity is associated with polymorphisms in GSH pathways and CFTR mutations. PMID:24593045

Polymorphism of serotonin receptor genes (5-HTR2A) and Dysbindin (DTNBP1) and individual components of short-term verbal memory processes in Schizophrenia.

PubMed

Alfimova, M V; Monakhov, M V; Abramova, L I; Golubev, S A; Golimbet, V E

2010-10-01

Associations between polymorphisms in the T102C and A-1438G loci of the 5-HTR2A and the P1763 and P1578 markers of the DTNBP1 gene with the overall productivity and individual subprocesses of shortterm verbal memory were studied in 4-5 patients with schizophrenia and 290 healthy subjects. Subjects were asked to reproduce immediately two lists of 10 words. The overall productivity of reproduction was assessed, along with the reproduction productivity of the first list (immediate memory or general attention), the effect of proactive interference, and the number of intrusions. Patients were significantly different from controls on all measures. Patients showed decreases in overall task performance productivity, in immediate memory productivity, and in the effect of proactive interference; fewer intrusions were seen. Both markers of the 5-HTR2A gene were associated with short-term memory productivity in the combined cohort: assessments were worse in T102C CC and A-1438G GG homozygotes. The P1763 marker of the DTNBP1 gene, conversely, had significant influences on the memory subprocesses reflected in the levels of interference and intrusions but had insignificant influence on overall productivity. Homozygotes for P1763G GG had the worst parameters. Overall, these data are consistent with the concept that these polymorphic genes are involved in different subprocesses of short-term memory both in normal subjects and in patients with schizophrenia.

Polymorphic variants of neurotransmitter receptor genes may affect sexual function in aging males: data from the HALS study.

PubMed

Jóźków, Paweł; Słowińska-Lisowska, Małgorzata; Łaczmański, Łukasz; Mędraś, Marek

2013-01-01

Human behavior is influenced by a number of brain neurotransmitters. Central dopamine, serotonin and melanocortin systems have special importance for male sexual function. We searched for associations between male aging symptoms and polymorphic sites of serotonin (5-HTR1B), melanocortin (MC4R) and dopamine (DRD2, DRD4) receptors. In a population-based sample, genotyping of 5-HTR1B (polymorphism: G861C), MC4R (polymorphisms: C-2745T, Val103Ile), DRD2 (polymorphism: C313T) and DRD4 (polymorphism: 48-bp VNTR) was performed in 387 healthy men. The Aging Males' Symptoms (AMS) scale was used to evaluate specific ailments of aging men. We analyzed answers to questions from the AMS scale. Five points of the questionnaire addressed sexual symptoms of the aging male: feeling of passing one's peak, decrease in beard growth, decrease in ability/frequency to perform sexually, decrease in the number of morning erections, and decrease in sexual desire/libido (lacking pleasure in sex, lacking desire for sexual intercourse). Relations between reported symptoms and variants of the polymorphic sites of the studied genes were assessed. After adjusting for confounding factors (education, arterial hypertension, physical activity, weight, waist circumference) an association between the sexual dimension of AMS and genetic variants of 5-HTR1B G861C (p = 0.04) was observed. Variability of neurotransmitter receptor genes may be associated with sexual symptoms of aging in men. Copyright © 2013 S. Karger AG, Basel.

Impact of CCL4 gene polymorphisms and environmental factors on oral cancer development and clinical characteristics

PubMed Central

Lien, Ming-Yu; Lin, Chiao-Wen; Tsai, Hsiao-Chi; Chen, Yng-Tay; Tsai, Ming-Hsui; Hua, Chun-Hung; Yang, Shun-Fa; Tang, Chih-Hsin

2017-01-01

In Taiwan, oral cancer has causally been associated with environmental carcinogens. CCL4 (C-C chemokine ligand 4), a macrophage inflammatory protein with a key role in inflammation and immune-regulation, was implicated in carcinogenesis by facilitating instability in the tumor environment. The purpose of this study was to identify gene polymorphisms of CCL4 specific to patients with oral squamous cell carcinoma (OSCC) susceptibility and clinicopathological characteristics. A total of 2,053 participants, including 1192 healthy people and 861 patients with oral cancer, were recruited for this study. Three single-nucleotide polymorphisms (SNPs) of the CCL4 gene were analyzed by a real-time PCR. We found that the T/T homozygotes of CCL4 rs1634507 G/T polymorphism and the GG haplotype of 2 CCL4 SNPs (rs1634507 and rs10491121) combined were associated with oral-cancer susceptibility. In addition, TA haplotype significantly decreased the risks for oral cancer by 0.118 fold. Among 1420 smokers, CCL4 polymorphisms carriers with the betel-nut chewing habit had a 15.476–20.247-fold greater risk of having oral cancer compared to CCL4 wild-type (WT) carriers without the betel-nut chewing habit. Finally, patients with oral cancer who had A/G heterozygotes of CCL4 rs10491121 A/G polymorphism showed a lower risk for an advanced tumor size (> T2) (p=0.046), compared to those patients with AA homozygotes. Our results suggest that the CCL4 rs1634507 SNP have potential predictive significance in oral carcinogenesis. Gene-environment interactions of CCL4 polymorphisms might influence oral-cancer susceptibility. CCL4 rs10491121 may be a factor to predict the tumor size in OSCC patients. PMID:28404909

Impact of CCL4 gene polymorphisms and environmental factors on oral cancer development and clinical characteristics.

PubMed

Lien, Ming-Yu; Lin, Chiao-Wen; Tsai, Hsiao-Chi; Chen, Yng-Tay; Tsai, Ming-Hsui; Hua, Chun-Hung; Yang, Shun-Fa; Tang, Chih-Hsin

2017-05-09

In Taiwan, oral cancer has causally been associated with environmental carcinogens. CCL4 (C-C chemokine ligand 4), a macrophage inflammatory protein with a key role in inflammation and immune-regulation, was implicated in carcinogenesis by facilitating instability in the tumor environment. The purpose of this study was to identify gene polymorphisms of CCL4 specific to patients with oral squamous cell carcinoma (OSCC) susceptibility and clinicopathological characteristics. A total of 2,053 participants, including 1192 healthy people and 861 patients with oral cancer, were recruited for this study. Three single-nucleotide polymorphisms (SNPs) of the CCL4 gene were analyzed by a real-time PCR. We found that the T/T homozygotes of CCL4 rs1634507 G/T polymorphism and the GG haplotype of 2 CCL4 SNPs (rs1634507 and rs10491121) combined were associated with oral-cancer susceptibility. In addition, TA haplotype significantly decreased the risks for oral cancer by 0.118 fold. Among 1420 smokers, CCL4 polymorphisms carriers with the betel-nut chewing habit had a 15.476-20.247-fold greater risk of having oral cancer compared to CCL4 wild-type (WT) carriers without the betel-nut chewing habit. Finally, patients with oral cancer who had A/G heterozygotes of CCL4 rs10491121 A/G polymorphism showed a lower risk for an advanced tumor size (> T2) (p=0.046), compared to those patients with AA homozygotes. Our results suggest that the CCL4 rs1634507 SNP have potential predictive significance in oral carcinogenesis. Gene-environment interactions of CCL4 polymorphisms might influence oral-cancer susceptibility. CCL4 rs10491121 may be a factor to predict the tumor size in OSCC patients.

Individual Differences in Cognitive-Flexibility: The Influence of Spontaneous Eyeblink Rate, Trait Psychoticism and Working Memory on Attentional Set-Shifting

ERIC Educational Resources Information Center

Tharp, Ian J.; Pickering, Alan D.

2011-01-01

Individual differences in psychophysiological function have been shown to influence the balance between flexibility and distractibility during attentional set-shifting [e.g., Dreisbach et al. (2005). Dopamine and cognitive control: The influence of spontaneous eyeblink rate and dopamine gene polymorphisms on perseveration and distractibility.…

Role of selected polymorphisms in determining muscle fiber composition in Japanese men and women.

PubMed

Kumagai, Hiroshi; Tobina, Takuro; Ichinoseki-Sekine, Noriko; Kakigi, Ryo; Tsuzuki, Takamasa; Zempo, Hirofumi; Shiose, Keisuke; Yoshimura, Eiichi; Kumahara, Hideaki; Ayabe, Makoto; Higaki, Yasuki; Yamada, Ryo; Kobayashi, Hiroyuki; Kiyonaga, Akira; Naito, Hisashi; Tanaka, Hiroaki; Fuku, Noriyuki

2018-05-01

Genetic polymorphisms and sex differences are suggested to affect muscle fiber composition; however, no study has investigated the effects of genetic polymorphisms on muscle fiber composition with respect to sex differences. Therefore, the present study examined the effects of genetic polymorphisms on muscle fiber composition with respect to sex differences in the Japanese population. The present study included 211 healthy Japanese individuals (102 men and 109 women). Muscle biopsies were obtained from the vastus lateralis to determine the proportion of myosin heavy chain (MHC) isoforms (MHC-I, MHC-IIa, and MHC-IIx). Moreover, we analyzed polymorphisms in α-actinin-3 gene ( ACTN3; rs1815739 ), angiotensin-converting enzyme gene ( ACE; rs4341 ), hypoxia-inducible factor 1 α gene ( rs11549465 ), vascular endothelial growth factor receptor 2 gene ( rs1870377 ), and angiotensin II receptor, type 2 gene ( rs11091046 ), by TaqMan single-nucleotide polymorphism genotyping assays. The proportion of MHC-I was 9.8% lower in men than in women, whereas the proportion of MHC-IIa and MHC-IIx was higher in men than in women (5.0 and 4.6%, respectively). Men with the ACTN3 RR + RX genotype had a 4.8% higher proportion of MHC-IIx than those with the ACTN3 XX genotype. Moreover, men with the ACE ID + DD genotype had a 4.7% higher proportion of MHC-I than those with the ACE II genotype. Furthermore, a combined genotype of ACTN3 R577X and ACE insertion/deletion (I/D) was significantly correlated with the proportion of MHC-I ( r = -0.23) and MHC-IIx ( r = 0.27) in men. In contrast, no significant correlation was observed between the examined polymorphisms and muscle fiber composition in women. These results suggest that the ACTN3 R577X and ACE I/D polymorphisms independently affect the proportion of human skeletal muscle fibers MHC-I and MHC-IIx in men but not in women. NEW & NOTEWORTHY In men, the RR + RX genotype of the α-actinin-3 gene ( ACTN3) R577X polymorphism was associated with a higher proportion of myosin heavy chain (MHC)-IIx. The ID + DD genotype of the angiotensin-converting enzyme gene ( ACE) insertion/deletion (I/D) polymorphism, in contrast to a previous finding, was associated with a higher proportion of MHC-I in men. In addition, the combined genotype of these polymorphisms was correlated with the proportion of MHC-I and MHC-IIx in men. Thus ACTN3 R577X and ACE I/D polymorphisms influence the muscle fiber composition in Japanese men.

Genetic polymorphisms of genes involved in DNA repair and metabolism influence micronucleus frequencies in human peripheral blood lymphocytes.

PubMed

Dhillon, Varinderpal S; Thomas, Philip; Iarmarcovai, G; Kirsch-Volders, Micheline; Bonassi, Stefano; Fenech, Michael

2011-01-01

The cytokinesis-block micronucleus cytome (CBMNCyt) assay is a widely used technique for measuring DNA damage in human populations. The formation of micronuclei (MN) in dividing cells can result from chromosome breakage due to unrepaired or mis-repaired DNA lesions or chromosome malsegregation due to mitotic malfunction. The sensitivity of the MN assay to polymorphisms in various genes involved in DNA repair, activation/deactivation of carcinogens/chemicals/drugs/alcohol, folate metabolism pathway and micronutrient transport has been extensively reported in the literature. MN frequency is also an important index for determining DNA repair efficiency phenotype (including mis-repair), response to environmental exposure and identifying various dietary factors required for optimal genome stability. The aim of the present study is to review the reported in vivo associations between genotype and MN frequency in humans taking into considerations the presence of interactions with nutrients levels and/or exposure to genotoxins. One hundred and eleven publications linking MN frequency in peripheral blood lymphocytes to gene polymorphism were retrieved from PubMed. After applying exclusion criteria, only 37 studies were evaluated in the present review. Polymorphisms in XRCC1 (Arg280His), ERCC2 (Lys751Gln), CYP2E1 (c1/c2) and MTR (A2756G) were consistently associated with the MN formation. These results contribute substantial evidence to the hypothesis that genotype may influence MN frequency in human cells.

Allelic Variation in TAS2R Bitter Receptor Genes Associates with Variation in Sensations from and Ingestive Behaviors toward Common Bitter Beverages in Adults

PubMed Central

Hayes, John E.; Wallace, Margaret R.; Knopik, Valerie S.; Herbstman, Deborah M.; Bartoshuk, Linda M.

2011-01-01

The 25 human bitter receptors and their respective genes (TAS2Rs) contain unusually high levels of allelic variation, which may influence response to bitter compounds in the food supply. Phenotypes based on the perceived bitterness of single bitter compounds were first linked to food preference over 50 years ago. The most studied phenotype is propylthiouracil bitterness, which is mediated primarily by the TAS2R38 gene and possibly others. In a laboratory-based study, we tested for associations between TAS2R variants and sensations, liking, or intake of bitter beverages among healthy adults who were primarily of European ancestry. A haploblock across TAS2R3, TAS2R4, and TAS2R5 explained some variability in the bitterness of espresso coffee. For grapefruit juice, variation at a TAS2R19 single nucleotide polymorphism (SNP) was associated with increased bitterness and decreased liking. An association between a TAS2R16 SNP and alcohol intake was identified, and the putative TAS2R38–alcohol relationship was confirmed, although these polymorphisms did not explain sensory or hedonic responses to sampled scotch whisky. In summary, TAS2R polymorphisms appear to influence the sensations, liking, or intake of common and nutritionally significant beverages. Studying perceptual and behavioral differences in vivo using real foods and beverages may potentially identify polymorphisms related to dietary behavior even in the absence of known ligands. PMID:21163912

Allelic variation in TAS2R bitter receptor genes associates with variation in sensations from and ingestive behaviors toward common bitter beverages in adults.

PubMed

Hayes, John E; Wallace, Margaret R; Knopik, Valerie S; Herbstman, Deborah M; Bartoshuk, Linda M; Duffy, Valerie B

2011-03-01

The 25 human bitter receptors and their respective genes (TAS2Rs) contain unusually high levels of allelic variation, which may influence response to bitter compounds in the food supply. Phenotypes based on the perceived bitterness of single bitter compounds were first linked to food preference over 50 years ago. The most studied phenotype is propylthiouracil bitterness, which is mediated primarily by the TAS2R38 gene and possibly others. In a laboratory-based study, we tested for associations between TAS2R variants and sensations, liking, or intake of bitter beverages among healthy adults who were primarily of European ancestry. A haploblock across TAS2R3, TAS2R4, and TAS2R5 explained some variability in the bitterness of espresso coffee. For grapefruit juice, variation at a TAS2R19 single nucleotide polymorphism (SNP) was associated with increased bitterness and decreased liking. An association between a TAS2R16 SNP and alcohol intake was identified, and the putative TAS2R38-alcohol relationship was confirmed, although these polymorphisms did not explain sensory or hedonic responses to sampled scotch whisky. In summary, TAS2R polymorphisms appear to influence the sensations, liking, or intake of common and nutritionally significant beverages. Studying perceptual and behavioral differences in vivo using real foods and beverages may potentially identify polymorphisms related to dietary behavior even in the absence of known ligands.

Interaction of TLR-IFN and HLA polymorphisms on susceptibility of chronic HBV infection in Southwest Han Chinese.

PubMed

He, Dengming; Tao, Shiqi; Guo, Shimin; Li, Maoshi; Wu, Junqiu; Huang, Hongfei; Guo, Xinwu; Yan, Guohua; Zhu, Peng; Wang, Yuming

2015-08-01

The toll-like receptor-interferon (TLR-IFN) signalling pathway plays a crucial role in HBV infection. Human leucocyte antigen (HLA) polymorphisms are associated with chronic HBV infection by genome wide association study (GWAS). We aimed to explore interaction between TLR-IFN and HLA gene polymorphisms in susceptibility of chronic HBV infection. In the Chinese Southwest Han population, 1191 chronic HBV infection patients and 273 HBV clearance were selected. A total of 39 single nucleotide polymorphism loci in 23 genes of the TLR-IFN pathway and four HLA polymorphism loci associated with chronic HBV infection identified by GWAS were selected for genotyping. SNPStats, QVALUE, and multifactor dimensionality reduction were used for statistical analysis. A significant association was seen in several of the TLR-IFN pathway genes, TLR9 rs352140 (OR = 0.70, P = 0.0088), IL1B rs16944 (OR = 0.67, P = 0.016), IL12B rs3212227 (OR = 1.38, P = 0.021), IFNGR1 rs3799488 (OR = 1.48, P = 0.0048), IFNGR2 rs1059293 (OR = 0.27, P = 0.011), MX1 rs467960 (OR = 0.68, P = 0.022), as well as four loci in HLA, rs3077 (OR = 0.55, P < 0.0001), rs2856718 (OR = 0.60, P = 4e-04), rs9277535 (OR = 0.54, P < 0.0001) and rs7453920 (OR = 0.43, P < 0.0001). A synergistic relationship was seen between rs9277535 and rs16944 (0.13%), rs1143623 and rs6613 (0.10%). The combination of rs9277535 in HLA and rs16944 in IL1B was the best model to predict chronic HBV infection (testing accuracy = 0.6040, P = 0.0010, cross-validation consistency = 10/10). TLR-IFN pathway gene polymorphisms are associated with chronic HBV infection. Interactions with polymorphisms in these genes may be one mechanism by which HLA polymorphisms influence susceptibility to chronic HBV infection, as specific single nucleotide polymorphism combinations are highly predictive of chronic HBV infection. © 2014 The Authors. Liver International Published by John Wiley & Sons Ltd.

Comparison of oxidative stress and the frequency of polymorphisms in the HFE gene between hemoglobin S trait blood donors and sickle cell disease patients.

PubMed

Viana-Baracioli, L M S; Tukamoto Junior, N C; Ricci Junior, O; Mattos, L C; Ângulo, I L; Bonini-Domingos, C R

2011-12-08

It is well documented that Hb S and iron affect blood cells, and trigger oxidative processes and generation of free radicals with potential for lipid peroxidation. We evaluated the frequency of polymorphisms in the HFE gene in Hb AS blood donors and how these polymorphisms influenced lipid peroxidation and antioxidant capacity. Blood samples were collected from 211 Hb AS blood donors, 119 Hb AA blood donors as a control group, and 28 sickle cell disease patients (Hb SS). The H63D allele was found at a frequency of 10.5% in the Hb AS samples, and the C282Y allele frequency was 0.7%. In the control group, the frequencies of the H63D and C282Y alleles were 13.4 and 2.1%, respectively. In the sickle-cell disease patients, the H63D and the C282Y allele frequencies were 10.7 and 3.5%, respectively. The frequencies of the C282Y and H63D polymorphisms in Hb AS blood donors are similar to those reported for the Brazilian population. Serum malondialdehyde values, indicative of lipid peroxidation, were highest in sickle cell patients, independent of the polymorphisms in the HFE gene, with significant differences, showing the influence of Hb S allele in the levels of lipid peroxidation. However, the trolox equivalent antioxidant capacity average levels, indicative of the antioxidant capacity, were reduced with significant differences, indicating that in spite of a lipid peroxidation raise, this is not followed by the increased of the antioxidant capacity, leading to oxidative stress.

Polymorphism at the avpr1a locus in male prairie voles correlated with genetic but not social monogamy in field populations.

PubMed

Solomon, N G; Richmond, A R; Harding, P A; Fries, A; Jacquemin, S; Schaefer, R L; Lucia, K E; Keane, B

2009-11-01

Integrative studies of genetics, neurobiology and behaviour indicate that polymorphism in specific genes contributes to variation observed in some complex social behaviours. The neuropeptide arginine vasopressin plays an important role in the regulation of a variety of social behaviours, including social attachment of males to females, through its action on the vasopressin 1a receptor (V1aR). In socially monogamous prairie voles (Microtus ochrogaster), polymorphism in the length of microsatellite DNA within the regulatory region of the gene (avpr1a) encoding the V1aR predicts differences among males in neural expression of V1aRs and partner preference under laboratory conditions. However, understanding the extent to which V1aR mediates variation in prairie vole social and reproductive behaviour observed in nature requires investigating the consequences of avpr1a polymorphism and environmental influences under ecologically relevant conditions. We examined the relationship between avpr1a length polymorphism and monogamy among male prairie voles living in 0.1 ha enclosures during a time similar to their natural lifespan. We found no evidence that avpr1a genotype of males predicts variation in social monogamy measured in the field but some indices of social monogamy were affected by population density. Parentage data indicated that a male's avpr1a genotype significantly influenced the number of females with which he sired offspring and the total number of offspring sired. Total brain concentrations of V1aR mRNA were not associated with either male behaviour or avpr1a genotype. These data show that melding ecological field studies with neurogenetics can substantially augment our understanding of the effects of genes and environment on social behaviours.

Strong Impact of TGF-β1 Gene Polymorphisms on Breast Cancer Risk in Indian Women: A Case-Control and Population-Based Study

PubMed Central

Rajender, Singh; Tamang, Rakesh; Rajkumar, Raja; Saini, Karan Singh; Megu, Kaling; Goel, Madhu Mati; Surekha, Daminani; Rao, Digumarthi Raghunatha; Rao, Lakshmi; Ramachandra, Lingadakai; Kumar, Sandeep; Kumar, Surender; Vishnupriya, Satti; Satyamoorthy, Kapaettu; Negi, Mahendra Pal Singh; Thangaraj, Kumarasamy; Konwar, Rituraj

2013-01-01

Introduction TGF-β1 is a multi-functional cytokine that plays an important role in breast carcinogenesis. Critical role of TGF-β1 signaling in breast cancer progression is well documented. Some TGF-β1 polymorphisms influence its expression; however, their impact on breast cancer risk is not clear. Methods We analyzed 1222 samples in a candidate gene-based genetic association study on two distantly located and ethnically divergent case-control groups of Indian women, followed by a population-based genetic epidemiology study analyzing these polymorphisms in other Indian populations. The c.29C>T (Pro10Leu, rs1982073 or rs1800470) and c.74G>C (Arg25Pro, rs1800471) polymorphisms in the TGF-β1 gene were analyzed using direct DNA sequencing, and peripheral level of TGF-β1 were measured by ELISA. Results c.29C>T substitution increased breast cancer risk, irrespective of ethnicity and menopausal status. On the other hand, c.74G>C substitution reduced breast cancer risk significantly in the north Indian group (p = 0.0005) and only in the pre-menopausal women. The protective effect of c.74G>C polymorphism may be ethnicity-specific, as no association was seen in south Indian group. The polymorphic status of c.29C>T was comparable among Indo-Europeans, Dravidians, and Tibeto-Burmans. Interestingly, we found that Tibeto-Burmans lack polymorphism at c.74G>C locus as true for the Chinese populations. However, the Brahmins of Nepal (Indo-Europeans) showed polymorphism in 2.08% of alleles. Mean TGF-β1 was significantly elevated in patients in comparison to controls (p<0.001). Conclusion c.29C>T and c.74G>C polymorphisms in the TGF-β1 gene significantly affect breast cancer risk, which correlates with elevated TGF-β1 level in the patients. The c.29C>T locus is polymorphic across ethnically different populations, but c.74G>C locus is monomorphic in Tibeto-Burmans and polymorphic in other Indian populations. PMID:24146803

Genetic Predisposition to Persistent Apical Periodontitis

PubMed Central

Morsani, Jussara M.; Aminoshariae, Anita; Han, Yiping Weng; Montagnese, Thomas A.; Mickel, Andre

2013-01-01

Introduction The proinflammatory cytokine interleukin (IL)-1 is a key regulator of host responses to microbial infection and a major modulator of extracellular matrix catabolism and bone resorption. Allele2 of IL-1b is associated with a four-fold increase in IL-1β production. The aim of this case-control study was to evaluate the gene polymorphism of IL-1β in the pathogenesis of endodontic failure. We hypothesized that the gene polymorphism (allele2 of IL-1β) would influence host response and enhance inflammatory reactions predisposing to persistent apical periodontitis (PAP). Materials and Methods Subjects with at least 1 year of follow-up after root canal therapy (RCT) were recalled. Inclusion and exclusion criteria were applied, and 34 subjects with signs/symptoms of PAP with otherwise acceptable RCT were included. Sixty-one controls showed healing with acceptable RCT. Genomic DNA from buccal mucosa was amplified by polymerase chain reaction followed by restriction fragment length polymorphism to distinguish the alleles of IL-1β gene polymorphism. Results A significant difference in the distribution of the polymorphic genotype among cases (70.6%) and controls (24.6%) (P < .001, Pearson χ2) was shown. Conclusions These findings suggest that specific genetic markers associated with increased IL-1β production may contribute to increased susceptibility to PAP. PMID:21419289

Genetic modification of the association between peripubertal dioxin exposure and pubertal onset in a cohort of Russian boys.

PubMed

Humblet, Olivier; Korrick, Susan A; Williams, Paige L; Sergeyev, Oleg; Emond, Claude; Birnbaum, Linda S; Burns, Jane S; Altshul, Larisa M; Patterson, Donald G; Turner, Wayman E; Lee, Mary M; Revich, Boris; Hauser, Russ

2013-01-01

Exposure to dioxins has been associated with delayed pubertal onset in both epidemiologic and animal studies. Whether genetic polymorphisms may modify this association is currently unknown. Identifying such genes could provide insight into mechanistic pathways. This is one of the first studies to assess genetic susceptibility to dioxins. We evaluated whether common polymorphisms in genes affecting either molecular responses to dioxin exposure or pubertal onset influence the association between peripubertal serum dioxin concentration and male pubertal onset. In this prospective cohort of Russian adolescent boys (n = 392), we assessed gene-environment interactions for 337 tagging single-nucleotide polymorphisms (SNPs) from 46 candidate genes and two intergenic regions. Dioxins were measured in the boys' serum at age 8-9 years. Pubertal onset was based on testicular volume and on genitalia staging. Statistical approaches for controlling for multiple testing were used, both with and without prescreening for marginal genetic associations. After accounting for multiple testing, two tag SNPs in the glucocorticoid receptor (GR/NR3C1) gene and one in the estrogen receptor-α (ESR1) gene were significant (q < 0.2) modifiers of the association between peripubertal serum dioxin concentration and male pubertal onset defined by genitalia staging, although not by testicular volume. The results were sensitive to whether multiple comparison adjustment was applied to all gene-environment tests or only to those with marginal genetic associations. Common genetic polymorphisms in the glucocorticoid receptor and estrogen receptor-α genes may modify the association between peripubertal serum dioxin concentration and pubertal onset. Further studies are warranted to confirm these findings.

LRP5 coding polymorphisms influence the variation of peak bone mass in a normal population of French-Canadian women.

PubMed

Giroux, Sylvie; Elfassihi, Latifa; Cardinal, Guy; Laflamme, Nathalie; Rousseau, François

2007-05-01

Bone mineral density has a strong genetic component but it is also influenced by environmental factors making it a complex trait to study. LRP5 gene was previously shown to be involved in rare diseases affecting bone mass. Mutations associated with gain-of-function were described as well as loss-of-function mutations. Following this discovery, many frequent LRP5 polymorphisms were tested against the variation of BMD in the normal population. Heel bone parameters (SOS, BUA) were measured by right calcaneal QUS in 5021 healthy French-Canadian women and for 2104 women, BMD evaluated by DXA at two sites was available (femoral neck (FN) and lumbar spine (LS)). Among women with QUS measures and those with DXA measures, 26.5% and 32.8% respectively were premenopausal, 9.2% and 10.7% were perimenopausal and 64.2% and 56.5% were postmenopausal. About a third of the peri- and postmenopausal women never received hormone therapy. Two single nucleotide coding polymorphisms (Val667Met and Ala1330Val) in LRP5 gene were genotyped by allele-specific PCR. All bone measures were tested individually for associations with each polymorphism by analysis of covariance with adjustment for non genetic risk factors. Furthermore, haplotype analysis was performed to take into account the strong linkage disequilibrium between the two polymorphisms. The two LRP5 polymorphisms were found to be associated with all five bone measures (L2L4 and femoral neck DXA as well as heel SOS, BUA and stiffness index) in the whole sample. Premenopausal women drove the association as expected from the proposed role of LRP5 in peak bone mass. Our results suggest that the Val667Met polymorphism is the causative variant but this remains to be functionally proven.

[Polymorphisms of the multiple drug resistance gene (MDR1) in Mapuche, Mestizo and Maori populations in Chile].

PubMed

Wielandt, Ana María; Vollrath, Valeska; Chianale, José

2004-09-01

There are significant differences in drug responses among different ethnic groups. The multidrug transporter P-gp, encoded by the MDR1 gene, plays a key role in determining drug bioavailability, and an association between a polymorphism in exon 26 (C3435T) and lower P-gp expression has been found. The co-segregation of this polymorphism with the polymorphism in exon 12 (C1236T) and in exon 21 (G2677T/A) determines several MDR1 haplotypes in humans. To characterize the polymorphisms of exons 26, 21 and 12 of the MDR1 gene in different Chilean populations. Using a polymerase chain reaction and restriction fragment length polymorphism technique, we studied the allelic frequencies and the distribution of MDR1 haplotypes in 3 Chilean populations: Mestizo (n=104), Mapuche (n=96, living in the National Reservation of the Huapi Island, Ranico Lake) and Maori (n=52, living in Eastern Island). The frequency of the normal MDR1*1 haplotype, without mutations, was lower in Mapuches than in Mestizos or Maoris (p<0.005) but similar to that reported in Asian population (p=0.739), probably due to the Asian origin of the Amerindian populations. In addition, the MDR1*l haplotype fequency hin Mestizos was similar to the frequency reported in Caucasians (p=0.49), in agreement with the origin of our population, with a strong influence of Caucasian genes from the Spanish conquerors. The MDR1*2 haplotype distribution, with the three polymoyphisms and probably lower multidrug transporter expression, was similar in the three Chilean populations studied (p>0.0.5), but lower than the frequencies reported in Caucasians or Asians (p<0.05). We found significant differences in the frequencies of genetic polymorphisms of the MDR1 gene in Chilean populations, related to the ethnic origins of our ancestors.

Genetic association of APOB polymorphisms with variation in serum lipid profile among the Kuwait population.

PubMed

Al-Bustan, Suzanne A; Alnaqeeb, Majed A; Annice, Babitha G; Ebrahim, Ghada A; Refai, Thanaa M

2014-10-08

Several studies have identified APOB as a candidate gene predisposing individuals to dyslipidemia. Polymorphisms including the signal peptide (rs11279109), codon 2488 XbaI (rs1042031), codon 3611 MspI (rs693), codon 4154 EcoRI (rs1801701) and the 3' variable number of tandem repeats have been reported to be associated with dyslipidemia in several populations. With limited studies on Arabs, this study aimed to investigate the genetic association of APOB polymorphisms and assess the potential influence of minor and rare alleles on serum lipid levels in the Kuwaiti population. A total of 795 Kuwaiti subjects, documented with phenotypic data and fasting serum lipid levels, were genotyped for the five polymorphisms using PCR, PCR-RFLP and gene fragment analysis. Genotype and allele association with variation in serum lipid levels as well as haplotypes were analyzed using chi-square test, univariate and logistic regression analysis. Analysis of the genotype and allele frequencies distribution revealed a significant positive association between the APOB signal peptide and 3611 MspI polymorphisms with increased levels of triglycerides (statistical power of 80%). Haplotype analysis further supported the findings by showing that carriers of haplotypes (IX-M-E+M) had significantly lower mean (SD) TG levels (0.86 ± 0.07) as compared to non-carriers (1.01 ± 0.02). Significance was also observed with regards to positive family history of hypercholesterolemia. The results imply a "protective role" for two alleles (rs11279109 and rs1801701) in which logistic regression analysis showed a significant half-fold decrease in the risk for heterozygotes of rs11279109 and an 8.8 fold decrease in the risk for homozygous M-M- of rs1801701 of having lower TG levels (<1.70 mmol/L) in individuals. This suggests that genetic interaction between various polymorphisms at different gene loci act in linkage disequilibrium to affect serum TG levels. Apo B genotyping may be a useful adjunct for the identification of individuals at risk of developing dyslipidemia in order to provide them with lifestyle modifications and/or pharmacological intervention to mitigate the effects of gene interaction and environmental influence.

Polymorphisms in genes involved in GH1 release and their association with breast cancer risk.

PubMed

Wagner, Kerstin; Hemminki, Kari; Grzybowska, Ewa; Klaes, Rüdiger; Burwinkel, Barbara; Bugert, Peter; Schmutzler, Rita K; Wappenschmidt, Barbara; Butkiewicz, Dorota; Pamula, Jolanta; Pekala, Wioletta; Försti, Asta

2006-09-01

The regulation of growth hormone 1 (GH1) and insulin-like-growth factor-1 (IGF-1) release is under the influence of three pituitary hormones [growth hormone releasing hormone (GHRH), ghrelin (GHRL) and somatostatin (SST)], which act in an autocrine/paracrine fashion in the breast. By binding to their respective receptors, they control cell proliferation, differentiation and apoptosis in a GH1/IGF-1-dependent manner. We investigated single nucleotide polymorphisms (SNPs) in the GHRH, GHRHR, GHRL, GHSR, SST and SSTR2 gene regions in a Polish and a German cohort of 798 breast cancer cases and 1011 controls. Our study revealed an association of a novel TC repeat polymorphism in the SST promoter with a decreased breast cancer risk in the Polish study population [odds ratio (OR), 0.65; 95% confidence interval (CI), 0.44-0.96]. The closely linked SNP IVS1 A+46G showed the same trend. For both polymorphisms the association was stronger in women above the age of 50 (OR, 0.33; 95% CI, 0.14-0.76 and OR, 0.39; 95% CI, 0.18-0.87, respectively). The protective effect of these polymorphisms was confirmed in a haplotype analysis among women above 50 years of age and carrying the two variant alleles (OR, 0.37; 95% CI, 0.17-0.80). In the independent German population, we observed slightly decreased ORs among women above the age of 50 years. In the SSTR2 gene, carriers of the promoter 21/21 TG repeat genotype were at a decreased breast cancer risk (OR, 0.62; 95% CI, 0.41-0.94) compared to carriers of the other genotypes in the Polish population. Furthermore, we identified a protective effect of the GHRHR C-261T SNP in both populations (joint analysis CT+TT versus CC: OR, 0.80; 95% CI, 0.65-0.99). This effect was carried by a haplotype containing the protective allele. Thus, our study concludes a possible protective influence of distinct polymorphisms in genes involved in GH1 release on breast cancer risk.

A novel TaqI polymorphism in the coding region of the ovine TNXB gene in the MHC class III region: morphostructural and physiological influences.

PubMed

Ajayi, Oyeyemi O; Adefenwa, Mufliat A; Agaviezor, Brilliant O; Ikeobi, Christian O N; Wheto, Matthew; Okpeku, Moses; Amusan, Samuel A; Yakubu, Abdulmojeed; De Donato, Marcos; Peters, Sunday O; Imumorin, Ikhide G

2014-02-01

The tenascin-XB (TNXB) gene has antiadhesive effects, functions in matrix maturation in connective tissues, and localizes to the major histocompatibility complex class III region. We hypothesized that it may influence adaptive physiological response through an effect on blood vessel function. We identified a novel g.1324 A→G polymorphism at a TaqI recognition site in a 454 bp fragment of ovine TNXB and genotyped it in 150 Nigerian sheep using PCR-RFLP. The missense mutation changes glutamic acid (GAA) to glycine (GGA). Among SNP genotypes, significant differences (P < 0.05) were observed in body weight and fore cannon bone length. Interaction effects of breed, SNP genotype, and geographic location had a significant effect (P < 0.05) on chest girth. The SNP genotype was significantly (P < 0.05) associated with physiological traits of pulse rate and skin temperature. The observed effect of this novel polymorphism may be mediated through its role in connective tissue biology, requiring further association and functional studies.

The influence of α-adducin gene polymorphism on response of blood pressure to exercise in patients with hypertension.

PubMed

Alioğlu, Emin; Ercan, Ertuğrul; Tengiz, Istemihan; Türk, Uğur Onsel; Ergün, Metin; Akgöz, Semra; Işlegen, Cetin; Berdeli, Afig

2010-10-01

Clinical studies have indicated that an excessive response of blood pressure (BP) to exercise predicts risk of cardiovascular mortality. Although the mechanism responsible for the excessive BP response to exercise has not been revealed, there are some plausible mechanisms linking with underlying structural abnormalities in the cardiovascular system. Carriers of the Trp460 allele of the α-adducin Gly460Trp polymorphism have an increased risk of hypertension. The aim of the present study was to examine the influence of α-adducin gene polymorphism on response of BP to exercise in patients with hypertension. The cross-sectional observational study consisted of 49 hypertensive patients (29 women and 20 men; mean age, 53.1±8.8 years). All participants underwent a multistage exercise treadmill test according to the Bruce protocol. Arterial BPs were compared at rest, peak exercise and end of the recovery phase. Patients were classified according to their α-adducin gene polymorphisms; Gly460Gly homozygotes - Group 1 (n=28) and Trp460Trp homozygotes and Gly460Trp heterozygotes - Group 2 (n=21). Statistical analysis was performed using Chi-square, unpaired t, Mann-Whitney U and ANCOVA tests. Mean exercise duration and mean exercise capacity in metabolic equivalents were not different between Group 1 and 2. The major finding of the study was that systolic BP responses at peak exercise and recovery period (3. min) were significantly higher (p=0.036) in hypertensive patients carrying at least one Trp460 allele of the α-adducin gene. Our results suggest that genetic variants that alter renal function and/or vasoreactivity are logical candidates to explain some of the individual variability in the BP response to exercise.

Prognostic Role of Host Cyclooxygenase and Cytokine Genotypes in a Caucasian Cohort of Patients with Gastric Adenocarcinoma

PubMed Central

García-González, María Asunción; Nicolás-Pérez, David; Lanas, Angel; Bujanda, Luis; Carrera, Patricia; Benito, Rafael; Strunk, Mark; Sopeña, Federico; Santolaria, Santos; Piazuelo, Elena; Jiménez, Pilar; Campo, Rafael; Espinel, Jesús; Manzano, Marisa; Geijo, Fernando; Pellisé, María; González-Huix, Ferrán; Espinós, Jorge; Zaballa, Manuel; Titó, Llúcia; Barranco, Luis; Pazo, Roberto; Quintero, Enrique

2012-01-01

Background Genetic factors influencing the prognosis of gastric adenocarcinoma (GAC) are not well known. Given the relevance of cytokines and other pro-inflammatory mediators in cancer progression and invasiveness, we aimed to assess the prognostic role of several functional cytokine and cyclooxygenase gene polymorphisms in patients with GAC. Methodology Genomic DNA from 380 Spanish Caucasian patients with primary GAC was genotyped for 23 polymorphisms in pro-inflammatory (IL1B, TNFA, LTA, IL6, IL12p40), anti-inflammatory (IL4, IL1RN, IL10, TGFB1) cytokine, and cyclooxygenase (PTGS1 and PTGS2) genes by PCR, RFLP and TaqMan assays. Clinical and histological information was collected prospectively. Survival curves were estimated by the Kaplan-Meier method and compared using the log rank test. Outcome was determined by analysis of Cox proportional hazards, adjusting for confounding factors. Results The median follow-up period and median overall survival (OS) time were 9.9 months (range 0.4–120.3) and 10.9 months (95% CI: 8.9–14.1), respectively. Multivariate analysis identified tumor stages III (HR, 3.23; 95% CI:2–5.22) and IV (HR, 5.5; 95% CI: 3.51–8.63) as independent factors associated with a significantly reduced OS, whereas surgical treatment (HR: 0.44; 95%CI: 0.3–0.6) was related to a better prognosis of the disease. Concerning genetic factors, none of the 23 polymorphisms evaluated in the current study did influence survival. Moreover, no gene-environment interactions on GAC prognosis were observed. Conclusions Our results show that, in our population, the panel of selected pro- and anti-inflammatory cytokine, and cyclooxygenase gene polymorphisms are not relevant in determining the prognosis of gastric adenocarcinoma. PMID:23029430

The (CA)n polymorphism of ERβ gene is associated with FtM transsexualism.

PubMed

Fernández, Rosa; Esteva, Isabel; Gómez-Gil, Esther; Rumbo, Teresa; Almaraz, Mari Cruz; Roda, Ester; Haro-Mora, Juan-Jesús; Guillamón, Antonio; Pásaro, Eduardo

2014-03-01

Transsexualism is a gender identity disorder with a multifactorial etiology. Neurodevelopmental processes and genetic factors seem to be implicated. The aim of this study was to investigate the possible influence of the sex hormone-related genes ERβ (estrogen receptor β), AR (androgen receptor), and CYP19A1 (aromatase) in the etiology of female-to-male (FtM) transsexualism. In 273 FtMs and 371 control females, we carried out a molecular analysis of three variable regions: the CA repeats in intron 5 of ERβ; the CAG repeats in exon 1 of AR, and the TTTA repeats in intron 4 of CYP19A1. We investigated the possible influence of genotype on transsexualism by performing a molecular analysis of the variable regions of genes ERβ, AR, and CYP19A1 in 644 individuals (FtMs and control females). FtMs differed significantly from control group with respect to the median repeat length polymorphism ERβ (P = 0.002) but not with respect to the length of the other two studied polymorphisms. The repeat numbers in ERβ were significantly higher in FtMs than in control group, and the likelihood of developing transsexualism was higher (odds ratio: 2.001 [1.15-3.46]) in the subjects with the genotype homozygous for long alleles. There is an association between the ERβ gene and FtM transsexualism. Our data support the finding that ERβ function is directly proportional to the size of the analyzed polymorphism, so a greater number of repeats implies greater transcription activation, possibly by increasing the function of the complex hormone ERβ receptor and thereby encouraging less feminization or a defeminization of the female brain and behavior. © 2013 International Society for Sexual Medicine.

Cortical NMDA receptor expression in human chronic alcoholism: influence of the TaqIA allele of ANKK1.

PubMed

Ridge, Justin P; Dodd, Peter R

2009-10-01

Real-time RT-PCR normalized to GAPDH was used to assay N-methyl-D-aspartate (NMDA) receptor NR1, NR2A and NR2B subunit mRNA in human autopsy cortex tissue from chronic alcoholics with and without comorbid cirrhosis of the liver and matched controls. Subunit expression was influenced by the subject's genotype. The TaqIA polymorphism selectively modulated NMDA receptor mean transcript expression in cirrhotic-alcoholic superior frontal cortex, in diametrically opposite ways in male and female subjects. Genetic make-up may differentially influence vulnerability to brain damage by altering the excitation: inhibition balance, particularly in alcoholics with comorbid cirrhosis of the liver. The TaqIA polymorphism occurs within the poorly characterised ankyrin-repeat containing kinase 1 (ANKK1) gene. Using PCR, ANKK1 mRNA transcript was detected in inferior temporal, occipital, superior frontal and primary motor cortex of control human brain. ANKK1 expression may mediate the influence of the TaqIA polymorphism on phenotype.

Association between MTHFR variant and diabetic neuropathy.

PubMed

Kakavand Hamidi, Armita; Radfar, Mania; Amoli, Mahsa M

2018-02-01

Methylene-tetrahydrofolate reductase (MTHFR) gene variant may play an important role in the pathophysiology of diabetes and its complications due to its influence on plasma homocysteine levels and also its effect on scavenging peroxynitrite radicals. Diabetic peripheral neuropathy (DPN) is one of the most common diabetic chronic complications. The aim of this study was to investigate the relationship between diabetic neuropathy and MTHFR gene C677T and 1298A ⁄C polymorphisms. Patients with type 2 diabetes N=248 were enrolled in the study, consisting of patients with neuropathy (N=141) and patients without neuropathy (N=107). MTHFR C677T polymorphism was analyzed using polymerase chain reaction followed by restriction fragment length polymorphism (PCR-RFLP) of genomic DNA for genotyping of samples. 1298A/C polymorphism was evaluated using ARMS-PCR. There was a significant difference in MTHFR polymorphism between the groups with and without neuropathy. Our results suggest that MTHFR 677 variant confer risk for diabetic neuropathy among Iranian patients with type 2 diabetes. Copyright © 2017 Institute of Pharmacology, Polish Academy of Sciences. Published by Elsevier B.V. All rights reserved.

Interleukin 17 receptor gene polymorphism in periimplantitis and chronic periodontitis.

PubMed

Kadkhodazadeh, Mahdi; Ebadian, Ahmad Reza; Amid, Reza; Youssefi, Navid; Mehdizadeh, Amir Reza

2013-07-13

Gene polymorphism of cytokines influencing their function has been known as a contributing factor in the pathogenesis of inflammatory diseases of the tooth and implant supporting tissues. The aim of this study was to investigate the association of IL-17R gene polymorphism (rs879576) with chronic periodontitis and periimplantitis in an Iranian population. 73 patients with chronic periodontitis, 37 patients with periimplantitis and 83 periodontally healthy patients were enrolled in this study. 5cc blood was obtained from each subject's arm vein and transferred to tubes containing EDTA. Genomic DNA was extracted using Miller's Salting Out technique. The DNA was transferred into 96 division plates, transported to Kbioscience Institute in United Kingdom and analyzed using the Kbioscience Competitive Allele Specific PCR (KASP) technique. Chi-square and Kruskal Wallis tests were used to analyze differences in the expression of genotypes and frequency of alleles in disease and control groups (P-Value less than 0.05 was considered statistically significant). There were no significant differences between periodontitis, periimplantitis with AA, GG, GA genotype of IL-17R gene (P=0.8239). Also comparison of frequency of alleles in SNP rs879576 of IL-17R gene between the chronic periodontitis group and periimplantitis group did not revealed statistically significant differences (P=0.8239). The enigma of IL-17 and its polymorphism-role in periodontitis and periimplantitis is yet to be investigated more carefully throughout further research but this article demonstrates that polymorphism of IL-17R plays no significant role in incidence of chronic periodontitis and Periimplantitis.

Functional polymorphisms associated with human muscle size and strength.

PubMed

Thompson, Paul D; Moyna, Niall; Seip, Richard; Price, Thomas; Clarkson, Priscilla; Angelopoulos, Theodore; Gordon, Paul; Pescatello, Linda; Visich, Paul; Zoeller, Robert; Devaney, Joseph M; Gordish, Heather; Bilbie, Stephen; Hoffman, Eric P

2004-07-01

Skeletal muscle is critically important to human performance and health, but little is known of the genetic factors influencing muscle size, strength, and its response to exercise training. The Functional single nucleotide polymorphisms (SNP) Associated with Muscle Size and Strength, or FAMuSS, Study is a multicenter, NIH-funded program to examine the influence of gene polymorphisms on skeletal muscle size and strength before and after resistance exercise training. One thousand men and women, age 18 - 40 yr, will train their nondominant arm for 12 wk. Skeletal muscle size (magnetic resonance imaging) and isometric and dynamic strength will be measured before and after training. Individuals whose baseline values or response to training deviate > or = 1.5 SD will be defined as outliers and examined for genetic variants. Initially candidate genes previously associated with muscle performance will be examined, but the study will ultimately attempt to identify genes associated with muscle performance. FAMuSS should help identify genetic factors associated with muscle performance and the response to exercise training. Such insight should contribute to our ability to predict the individual response to exercise training but may also contribute to understanding better muscle physiology, to identifying individuals who are susceptible to muscle loss with environmental challenge, and to developing pharmacologic agents capable of preserving muscle size and function.

The BDNF Val66Met Polymorphism Interacts with Maternal Parenting Influencing Adolescent Depressive Symptoms: Evidence of Differential Susceptibility Model.

PubMed

Zhang, Leilei; Li, Zhi; Chen, Jie; Li, Xinying; Zhang, Jianxin; Belsky, Jay

2016-03-01

Although depressive symptoms are common during adolescence, little research has examined gene-environment interaction on youth depression. This study chose the brain-derived neurotrophic factor (BDNF) gene, tested the interaction between a functional polymorphism resulting amino acid substitution of valine (Val) to methionine (Met) in the proBDNF protein at codon 66 (Val66Met), and maternal parenting on youth depressive symptoms in a sample of 780 community adolescents of Chinese Han ethnicity (aged 11-17, M = 13.6, 51.3 % females). Participants reported their depressive symptoms and perceived maternal parenting. Results indicated the BDNF Val66Met polymorphism significantly moderated the influence of maternal warmth-reasoning, but not harshness-hostility, on youth depressive symptoms. Confirmatory model evaluation indicated that the interaction effect involving warmth-reasoning conformed to the differential-susceptibility rather than diathesis-stress model of person-X-environment interaction. Thus, Val carriers experienced less depressive symptoms than Met homozygotes when mothering was more positive but more symptoms when mothering was less positive. The findings provided evidence in support of the differential susceptibility hypothesis of youth depressive symptoms and shed light on the importance of examining the gene-environment interaction from a developmental perspective.

Genetic polymorphisms in MDR1 and CYP3A4 genes in Asians and the influence of MDR1 haplotypes on cyclosporin disposition in heart transplant recipients.

PubMed

Chowbay, Balram; Cumaraswamy, Sivathasan; Cheung, Yin Bun; Zhou, Qingyu; Lee, Edmund J D

2003-02-01

Intestinal cytochrome P450 3A4 (CYP3A4) and P-glycoprotein (P-gp) both play a vital role in the metabolism of oral cyclosporine (CsA). We investigated the genetic polymorphisms in CYP3A4(promoter region and exons 5, 7 and 9) and MDR1 (exons 12, 21 and 26) genes and the impact of these polymorphisms on the pharmacokinetics of oral CsA in stable heart transplant patients (n = 14). CYP3A4 polymorphisms were rare in the Asian population and transplant patients. Haplotype analysis revealed 12 haplotypes in the Chinese, eight in the Malays and 10 in the Indians. T-T-T was the most common haplotype in all ethnic groups. The frequency of the homozygous mutant genotype at all three loci (TT-TT-TT) was highest in the Indians (31%) compared to 19% and 15% in the Chinese and Malays, respectively. In heart transplant patients, CsA exposure (AUC(0-4 h), AUC(0-12 h) and C(max)) was high in patients with the T-T-T haplotypes compared to those with C-G-C haplotypes. These findings suggest that haplotypes rather than genotypes influence CsA disposition in transplant patients.

Functional genetic variant in the Kozak sequence of WW domain-containing oxidoreductase (WWOX) gene is associated with oral cancer risk.

PubMed

Cheng, Hsin-Lin; Liu, Yu-Fan; Su, Chun-Wen; Su, Shih-Chi; Chen, Mu-Kuan; Yang, Shun-Fa; Lin, Chiao-Wen

2016-10-25

In Taiwan, oral cancer is the fourth leading cancer in males and is associated with exposure to environmental carcinogens. WW domain-containing oxidoreductase (WWOX), a tumor suppressor gene, is associated with the development of various cancers. We hypothesized that genetic variants of WWOX influence the susceptibility to oral cancer. Five polymorphisms of WWOX gene from 761 male patients with oral cancer and 1199 male cancer-free individuals were genotyped. We observed that individuals carrying the polymorphic allele of WWOX rs11545028 are more susceptible to oral cancer. Furthermore, patients with advanced-stage oral cancer were associated with a higher frequency of WWOX rs11545028 polymorphisms with the variant genotype TT than did patients with the wild-type gene. An additional integrated in silico analysis confirmed that rs11545028 affects WWOX expression, which significantly correlates with tumor expression and subsequently with tumor development and aggressiveness. In conclusion, genetic variants of WWOX contribute to the occurrence of oral cancer, and the findings regarding these biomarkers provided a prediction model for risk assessment.

Genetic polymorphisms and expression of minisatellite mutations in a 3-generation population around the Semipalatinsk nuclear explosion test-site, Kazakhstan.

PubMed

Bolegenova, N K; Bekmanov, B O; Djansugurova, L B; Bersimbaev, R I; Salama, S A; Au, W W

2009-11-01

We have reported previously that a population near the Semipalatinsk nuclear explosion test site had significantly increased minisatellite mutations (MM), suggesting increased germ-line mutation rates from the exposure in 3 generations. We hypothesize that the MM can be used as a surrogate biomarker for functional genetic alterations, e.g. gene mutations and chromosome aberrations. Therefore, we have investigated the influence of polymorphisms in genes on the expression of MM in the same two populations (247 and 172 individuals, for exposed and control, respectively, in 3 generations), and their relationships with radiation exposure. We have chosen the analyses of three polymorphic DNA - repair genes (XRCC1, XRCC1 and XRCC3) and two xenobiotic detoxification genes (GSTT1 and GSTM1). Among the exposed and in comparison with the wild-type gene, the functionally active XRCC1 Arg194Trp was significantly associated with low MM and over-represented in the exposed compared with the control populations. In a similar analysis, the functionally deficient XRCC1 Arg399Glu and XRCC3 Trp241Met were associated with increased and significantly reduced MM, respectively, but these variant genes were under-represented in the exposed population. Both GSTT1 and GSTM1 nulls were significantly associated with increased MM. The former was under-represented but the latter was significantly over-represented in the exposed compared with the control populations. In summary, the data indicate that the expected enzymatic functions of the polymorphic genes are consistent with the MM expression, except the XRCC1 Arg399Glu variant gene. In addition, the variant genes were retained in the three generations in association with their useful function, except for the GSTM1 null. However, the MM frequencies in the exposed were not consistently and significantly higher than those in the control populations, radiation exposure may therefore not have been the only cause for the high MM frequency among the exposed individuals. Since we studied three generations of citizens, the over- and under-representations of variant genes in the exposed population indicate their persistence and elimination, respectively, from the exposed individuals, suggesting their functional influence on survivability. The latter observation also indicates the complexity of gene and environmental interactions, e.g. the GSTM1 null was significantly over-represented in the exposed population.

The 5-HT2C receptor gene Cys23Ser polymorphism influences the intravaginal ejaculation latency time in Dutch Caucasian men with lifelong premature ejaculation

PubMed Central

Janssen, Paddy KC; van Schaik, Ron; Olivier, Berend; Waldinger, Marcel D

2014-01-01

It has been postulated that the persistent short intravaginal ejaculation latency time (IELT) of men with lifelong premature ejaculation (LPE) is related to 5-hydroxytryptamine (HT)2C receptor functioning. The aim of this study was to investigate the relationship of Cys23Ser 5-HT2C receptor gene polymorphism and the duration of IELT in men with LPE. Therefore, a prospective study was conducted in 64 Dutch Caucasian men with LPE. Baseline IELT during coitus was assessed by stopwatch over a 1-month period. All men were genotyped for Cys23Ser 5-HT2C receptor gene polymorphism. Allele frequencies and genotypes of Cys and Ser variants of 5-HT2C receptor gene polymorphism were determined. Association between Cys/Cys and Ser/Ser genotypes and the natural logarithm of the IELT in men with LPE were investigated. As a result, the geometric mean, median and natural mean IELT were 25.2, 27.0, 33.9 s, respectively. Of all men, 20.0%, 10.8%, 23.1% and 41.5% ejaculated within 10, 10–20, 20–30 and 30–60 s after vaginal penetration. Of the 64 men, the Cys/Cys and Ser/Ser genotype frequency for the Cys23Ser polymorphism of the 5-HT2C receptor gene was 81% and 19%, respectively. The geometric mean IELT of the wildtypes (Cys/Cys) is significantly lower (22.6 s; 95% CI 18.3–27.8 s) than in male homozygous mutants (Ser/Ser) (40.4 s; 95% CI 20.3–80.4 s) (P = 0.03). It is concluded that Cys23Ser 5-HT2C receptor gene polymorphism is associated with the IELT in men with LPE. Men with Cys/Cys genotype have shorter IELTs than men with Ser/Ser genotypes. PMID:24799636

The 5-HT2C receptor gene Cys23Ser polymorphism influences the intravaginal ejaculation latency time in Dutch Caucasian men with lifelong premature ejaculation.

PubMed

Janssen, Paddy Kc; Schaik, Ron van; Olivier, Berend; Waldinger, Marcel D

2014-01-01

It has been postulated that the persistent short intravaginal ejaculation latency time (IELT) of men with lifelong premature ejaculation (LPE) is related to 5-hydroxytryptamine (HT)2C receptor functioning. The aim of this study was to investigate the relationship of Cys23Ser 5-HT2C receptor gene polymorphism and the duration of IELT in men with LPE. Therefore, a prospective study was conducted in 64 Dutch Caucasian men with LPE. Baseline IELT during coitus was assessed by stopwatch over a 1-month period. All men were genotyped for Cys23Ser 5-HT2C receptor gene polymorphism. Allele frequencies and genotypes of Cys and Ser variants of 5-HT2C receptor gene polymorphism were determined. Association between Cys/Cys and Ser/Ser genotypes and the natural logarithm of the IELT in men with LPE were investigated. As a result, the geometric mean, median and natural mean IELT were 25.2, 27.0, 33.9 s, respectively. Of all men, 20.0%, 10.8%, 23.1% and 41.5% ejaculated within 10, 10-20, 20-30 and 30-60 s after vaginal penetration. Of the 64 men, the Cys/Cys and Ser/Ser genotype frequency for the Cys23Ser polymorphism of the 5-HT2C receptor gene was 81% and 19%, respectively. The geometric mean IELT of the wildtypes (Cys/Cys) is significantly lower (22.6 s; 95% CI 18.3-27.8 s) than in male homozygous mutants (Ser/Ser) (40.4 s; 95% CI 20.3-80.4 s) (P = 0.03). It is concluded that Cys23Ser 5-HT2C receptor gene polymorphism is associated with the IELT in men with LPE. Men with Cys/Cys genotype have shorter IELTs than men with Ser/Ser genotypes.

Candidate gene association study conditioning on individual ancestry in patients with type 2 diabetes and metabolic syndrome from Mexico City.

PubMed

Cruz, M; Valladares-Salgado, A; Garcia-Mena, J; Ross, K; Edwards, M; Angeles-Martinez, J; Ortega-Camarillo, C; de la Peña, J Escobedo; Burguete-Garcia, A I; Wacher-Rodarte, N; Ambriz, R; Rivera, R; D'artote, A L; Peralta, J; Parra, Esteban J; Kumate, J

2010-05-01

Type 2 diabetes (T2D) is influenced by diverse environmental and genetic risk factors. Metabolic syndrome (MS) increases the risk of cardiovascular disease and diabetes. We analysed 14 cases of polymorphisms located in 10 candidate loci, in a sample of patients with T2D and controls from Mexico City. We analysed the association of 14 polymorphisms located within 10 genes (TCF7L2, ENPP1, ADRB3, KCNJ11, LEPR, PPARgamma, FTO, CDKAL1, SIRT1 and HHEX) with T2D and MS. The analysis included 519 subjects with T2D defined according to the ADA criteria, 389 with MS defined according to the AHA/NHLBI criteria and 547 controls. Association was tested with the program ADMIXMAP including individual ancestry, age, sex, education and in some cases body mass index (BMI), in a logistic regression model. The two markers located within the TCF7L2 gene showed strong associations with T2D (rs7903146, T allele, odd ratio (OR) = 1.76, p = 0.001 and rs12255372, T allele, OR = 1.78, p = 0.002), but did not show significant association with MS. The non-synonymous rs4994 polymorphism of the ADRB3 gene was associated with T2D (Trp allele, OR = 0.62, p = 0.001) and MS (Trp allele, OR = 0.74, p = 0.018). Nominally significant associations were also observed between T2D and the SIRT1 rs3758391 SNP and MS and the HHEX rs5015480 polymorphism. Variants located within the gene TCF7L2 are strongly associated with T2D but not with MS, providing support to previous evidence indicating that polymorphisms at the TCF7L2 gene increase T2D risk. In contrast, the non-synonymous ADRB3 rs4994 polymorphism is associated with T2D and MS.

Music genetics research: Association with musicality of a polymorphism in the AVPR1A gene.

PubMed

Mariath, Luiza Monteavaro; Silva, Alexandre Mauat da; Kowalski, Thayne Woycinck; Gattino, Gustavo Schulz; Araujo, Gustavo Andrade de; Figueiredo, Felipe Grahl; Tagliani-Ribeiro, Alice; Roman, Tatiana; Vianna, Fernanda Sales Luiz; Schuler-Faccini, Lavínia; Schuch, Jaqueline Bohrer

2017-01-01

Musicality is defined as a natural tendency, sensibility, knowledge, or talent to create, perceive, and play music. Musical abilities involve a great range of social and cognitive behaviors, which are influenced by both environmental and genetic factors. Although a number of studies have yielded insights into music genetics research, genes and biological pathways related to these traits are not fully understood. Our hypothesis in the current study is that genes associated with different behaviors could also influence the musical phenotype. Our aim was to investigate whether polymorphisms in six genes (AVPR1A, SLC6A4, ITGB3, COMT, DRD2 and DRD4) related to social and cognitive traits are associated with musicality in a sample of children. Musicality was assessed through an individualized music therapy assessment profile (IMTAP) which has been validated in Brazil to measure musical ability. We show here that the RS1 microsatellite of the AVPR1A gene is nominally associated with musicality, corroborating previous results linking AVPR1A with musical activity. This study is one of the first to investigate musicality in a comprehensive way, and it contributes to better understand the genetic basis underlying musical ability.

Music genetics research: Association with musicality of a polymorphism in the AVPR1A gene

PubMed Central

Mariath, Luiza Monteavaro; da Silva, Alexandre Mauat; Kowalski, Thayne Woycinck; Gattino, Gustavo Schulz; de Araujo, Gustavo Andrade; Figueiredo, Felipe Grahl; Tagliani-Ribeiro, Alice; Roman, Tatiana; Vianna, Fernanda Sales Luiz; Schuler-Faccini, Lavínia; Schuch, Jaqueline Bohrer

2017-01-01

Abstract Musicality is defined as a natural tendency, sensibility, knowledge, or talent to create, perceive, and play music. Musical abilities involve a great range of social and cognitive behaviors, which are influenced by both environmental and genetic factors. Although a number of studies have yielded insights into music genetics research, genes and biological pathways related to these traits are not fully understood. Our hypothesis in the current study is that genes associated with different behaviors could also influence the musical phenotype. Our aim was to investigate whether polymorphisms in six genes (AVPR1A, SLC6A4, ITGB3, COMT, DRD2 and DRD4) related to social and cognitive traits are associated with musicality in a sample of children. Musicality was assessed through an individualized music therapy assessment profile (IMTAP) which has been validated in Brazil to measure musical ability. We show here that the RS1 microsatellite of the AVPR1A gene is nominally associated with musicality, corroborating previous results linking AVPR1A with musical activity. This study is one of the first to investigate musicality in a comprehensive way, and it contributes to better understand the genetic basis underlying musical ability. PMID:28534928

Common allelic variants of the vitamin receptor D gene rs7975232 (ApaI) do not influence bone mineral density figures in postmenopausal osteoporotic women.

PubMed

Pedrera-Canal, Maria; Moran, Jose M; Vera, Vicente; Roncero-Martin, Raul; Lavado-Garcia, Jesus M; Aliaga, Ignacio; Pedrera-Zamorano, Juan D

2015-01-01

This study examined the association between bone mineral density (BMD) and the rs7975232 (ApaI) polymorphism of the vitamin receptor D (VDR) gene. The polymorphism was detected using the real-time PCR TaqMan method. The rs7975232 genotype was determined in 274 postmenopausal osteoporotic Spanish women who were 60.53±8.02 years old. The observed genotype frequencies were in agreement with Hardy-Weinberg equilibrium (χ(2)=1.85, P=0.1736). There were no significant differences in the rs7975232 genotype groups in our total sample of osteoporotic women regarding age, years since menopause, height, weight, and BMD at femoral neck, femoral trochanter and lumbar spine. Significant differences were found in menarche age (aa vs Aa; P=0.008) and BMI (aa vs AA; P=0.029). We conclude that the VDR gene rs7975232 polymorphism is not related to figures of bone mineral density in postmenopausal osteoporotic Spanish women.

Nonassociation of homocysteine gene polymorphisms with treatment outcome in South Indian Tamil Rheumatoid Arthritis patients.

PubMed

Muralidharan, Niveditha; Gulati, Reena; Misra, Durga Prasanna; Negi, Vir S

2018-02-01

The aim of the study was to look for any association of MTR 2756A>G and MTRR 66A>G gene polymorphisms with clinical phenotype, methotrexate (MTX) treatment response, and MTX-induced adverse events in South Indian Tamil patients with rheumatoid arthritis (RA). A total of 335 patients with RA were investigated. MTR 2756A>G gene polymorphism was analyzed by PCR-RFLP, and MTRR 66A>G SNP was analyzed by TaqMan 5' nuclease assay. The allele frequencies were compared with HapMap groups. MTR 2756G allele was found to be associated with risk of developing RA. The allele frequencies of MTR 2756A>G and MTRR 66A>G SNPs in controls differed significantly when compared with HapMap groups. Neither of the SNPs influenced the MTX treatment outcome and adverse effects. Neither of the SNPs seems to be associated with MTX treatment outcome and adverse events in South Indian Tamil patients with RA.

Does Marriage Moderate Genetic Effects on Delinquency and Violence?

PubMed Central

Li, Yi; Liu, Hexuan; Guo, Guang

2015-01-01

Using data from the National Longitudinal Study of Adolescent to Adult Health (N = 1,254), the authors investigated whether marriage can foster desistance from delinquency and violence by moderating genetic effects. In contrast to existing gene–environment research that typically focuses on one or a few genetic polymorphisms, they extended a recently developed mixed linear model to consider the collective influence of 580 single nucleotide polymorphisms in 64 genes related to aggression and risky behavior. The mixed linear model estimates the proportion of variance in the phenotype that is explained by the single nucleotide polymorphisms. The authors found that the proportion of variance in delinquency/violence explained was smaller among married individuals than unmarried individuals. Because selection, confounding, and heterogeneity may bias the estimate of the Gene × Marriage interaction, they conducted a series of analyses to address these issues. The findings suggest that the Gene × Marriage interaction results were not seriously affected by these issues. PMID:26549892

Heme Oxygenase 1 and 2 Common Genetic Variants and Risk for Essential Tremor

PubMed Central

Ayuso, Pedro; Agúndez, José A.G.; Alonso-Navarro, Hortensia; Martínez, Carmen; Benito-León, Julián; Ortega-Cubero, Sara; Lorenzo-Betancor, Oswaldo; Pastor, Pau; López-Alburquerque, Tomás; García-Martín, Elena; Jiménez-Jiménez, Félix J.

2015-01-01

Abstract Several reports suggested a role of heme oxygenase genes 1 and 2 (HMOX1 and HMOX2) in modifying the risk to develop Parkinson disease (PD). Because essential tremor (ET) and PD share phenotypical and, probably, etiologic factors of the similarities, we analyzed whether such genes are related with the risk to develop ET. We analyzed the distribution of allelic and genotype frequencies of the HMOX1 rs2071746, HMOX1 rs2071747, HMOX2 rs2270363, and HMOX2 rs1051308 single nucleotide polymorphisms, as well as the presence of copy number variations of these genes in 202 subjects with familial ET and 747 healthy controls. Allelic frequencies of rs2071746T and rs1051308G were significantly lower in ET patients than in controls. None of the studied polymorphisms influenced the disease onset. The present study suggests a weak association between HMOX1 rs2071746 and HMOX2 rs1051308 polymorphisms and the risk to develop ET in the Spanish population. PMID:26091465

Heme Oxygenase 1 and 2 Common Genetic Variants and Risk for Essential Tremor.

PubMed

Ayuso, Pedro; Agúndez, José A G; Alonso-Navarro, Hortensia; Martínez, Carmen; Benito-León, Julián; Ortega-Cubero, Sara; Lorenzo-Betancor, Oswaldo; Pastor, Pau; López-Alburquerque, Tomás; García-Martín, Elena; Jiménez-Jiménez, Félix J

2015-06-01

Several reports suggested a role of heme oxygenase genes 1 and 2 (HMOX1 and HMOX2) in modifying the risk to develop Parkinson disease (PD). Because essential tremor (ET) and PD share phenotypical and, probably, etiologic factors of the similarities, we analyzed whether such genes are related with the risk to develop ET. We analyzed the distribution of allelic and genotype frequencies of the HMOX1 rs2071746, HMOX1 rs2071747, HMOX2 rs2270363, and HMOX2 rs1051308 single nucleotide polymorphisms, as well as the presence of copy number variations of these genes in 202 subjects with familial ET and 747 healthy controls. Allelic frequencies of rs2071746T and rs1051308G were significantly lower in ET patients than in controls. None of the studied polymorphisms influenced the disease onset. The present study suggests a weak association between HMOX1 rs2071746 and HMOX2 rs1051308 polymorphisms and the risk to develop ET in the Spanish population.

Biomarkers of susceptibility following benzene exposure: influence of genetic polymorphisms on benzene metabolism and health effects.

PubMed

Carbonari, Damiano; Chiarella, Pieranna; Mansi, Antonella; Pigini, Daniela; Iavicoli, Sergio; Tranfo, Giovanna

2016-01-01

Benzene is a ubiquitous occupational and environmental pollutant. Improved industrial hygiene allowed airborne concentrations close to the environmental context (1-1000 µg/m(3)). Conversely, new limits for benzene levels in urban air were set (5 µg/m(3)). The biomonitoring of exposure to such low benzene concentrations are performed measuring specific and sensitive biomarkers such as S-phenylmercapturic acid, trans, trans-muconic acid and urinary benzene: many studies referred high variability in the levels of these biomarkers, suggesting the involvement of polymorphic metabolic genes in the individual susceptibility to benzene toxicity. We reviewed the influence of metabolic polymorphisms on the biomarkers levels of benzene exposure and effect, in order to understand the real impact of benzene exposure on subjects with increased susceptibility.

Association between presenilin-1 polymorphism and maternal meiosis II errors in Down syndrome.

PubMed

Petersen, M B; Karadima, G; Samaritaki, M; Avramopoulos, D; Vassilopoulos, D; Mikkelsen, M

2000-08-28

Several lines of evidence suggest a shared genetic susceptibility to Down syndrome (DS) and Alzheimer disease (AD). Rare forms of autosomal-dominant AD are caused by mutations in the APP and presenilin genes (PS-1 and PS-2). The presenilin proteins have been localized to the nuclear membrane, kinetochores, and centrosomes, suggesting a function in chromosome segregation. A genetic association between a polymorphism in intron 8 of the PS-1 gene and AD has been described in some series, and an increased risk of AD has been reported in mothers of DS probands. We therefore studied 168 probands with free trisomy 21 of known parental and meiotic origin and their parents from a population-based material, by analyzing the intron 8 polymorphism in the PS-1 gene. An increased frequency of allele 1 in mothers with a meiosis II error (70.8%) was found compared with mothers with a meiosis I error (52.7%, P < 0.01), with an excess of the 11 genotype in the meiosis II mothers. The frequency of allele 1 in mothers carrying apolipoprotein E (APOE) epsilon4 allele (68.0%) was higher than in mothers without epsilon4 (52.2%, P < 0.01). We hypothesize that the PS-1 intronic polymorphism might be involved in chromosomal nondisjunction through an influence on the expression level of PS-1 or due to linkage disequilibrium with biologically relevant polymorphisms in or outside the PS-1 gene. Copyright 2000 Wiley-Liss, Inc.

Effects of energy expenditure gene polymorphisms on obesity-related traits in obese children.

PubMed

Csernus, Katalin; Pauler, Gábor; Erhardt, Éva; Lányi, Éva; Molnár, Dénes

2015-01-01

To assess the frequencies of common polymorphisms of genes associated with energy expenditure among Hungarian obese children and investigate their influences on obesity-related traits and metabolic complications of common childhood obesity. In a total of 528 obese children (age 13.2±2.6 years) an oral glucose tolerance test and determination of fasting serum lipid levels were carried out, blood pressure and resting energy expenditure were measured and the children were genotyped for the following gene polymorphisms: Trp64Arg of β3-adrenoreceptor (ADRB3), -3826 A/G of uncoupling protein (UCP)-1, exon 8 45 bp del/ins and -866 G/A of UCP-2, -55 C/T of UCP-3, and Pro12Ala of peroxisome-proliferator activated receptor gamma-2. Carriers of the ADRB3 Arg64 allele had a significantly higher relative body weight and relative body mass index compared with non-carriers. The UCP-2 exon 8 del/ins polymorphism was associated with higher degree of obesity, insulin resistance, dyslipideamia and lower adjusted metabolic rate. Children with UCP-3 -55 T/T genotype had a significantly lower adjusted metabolic rate than the C allele carriers. We found evidence for associations between common polymorphisms of the ADRB3, the UCP-2 and UCP-3 genes and basic metabolic rate as well as level and metabolic consequences of common obesity among Hungarian school-aged children. Copyright © 2014 Asian Oceanian Association for the Study of Obesity. Published by Elsevier Ltd. All rights reserved.

Cytokine single-nucleotide polymorphisms and risk of non-small-cell lung cancer.

PubMed

Pérez-Ramírez, Cristina; Alnatsha, Ahmed; Cañadas-Garre, Marisa; Villar, Eduardo; Valdivia-Bautista, Javier; Faus-Dáder, María J; Calleja-Hernández, Miguel Á

2017-12-01

Lung cancer, particularly the non-small-cell lung cancer (NSCLC) subtype, is the leading cause of cancer-related death worldwide. Several functional polymorphisms in inflammatory cytokine genes, such as IL1B, IL6, IL12A, IL13 and IL16, have been associated with the risk of NSCLC. The aim of this study was to evaluate the association between ILs gene polymorphisms and the risk of developing NSCLC. A retrospective case-control study was carried out, including 174 NSCLC cases and 298 controls of Spanish origin. IL1B (rs1143634), IL1B (rs12621220), IL1B (rs1143623), IL1B (rs16944), IL1B (rs1143627), IL12A (rs662959), IL13 (rs1881457), IL6 (rs1800795) and IL16 (rs7170924) gene polymorphisms were analysed by TaqMan. The genotypic logistic regression model adjusted by smoking status showed that the IL1B rs1143634-TT genotype was associated with a lower risk of NSCLC (P=0.04312; odds ratio=0.226; 95% confidence interval=0.044-0.840). No other gene polymorphisms showed an association with NSCLC in any of the models tested. In conclusion, IL1B rs1143634 was significantly associated with a higher risk of NSCLC. No influence of IL1B rs12621220, rs1143623, rs16944, rs1143627, IL12A rs662959, IL13 rs1881457 and IL16 rs7170924 on the risk of developing NSCLC was found in our study.

Amerindian genetic ancestry and INDEL polymorphisms associated with susceptibility of childhood B-cell Leukemia in an admixed population from the Brazilian Amazon.

PubMed

Carvalho, Darlen C; Wanderley, Alayde V; Amador, Marcos A T; Fernandes, Marianne R; Cavalcante, Giovanna C; Pantoja, Karla B C C; Mello, Fernando A R; de Assumpção, Paulo P; Khayat, André S; Ribeiro-Dos-Santos, Ândrea; Santos, Sidney; Dos Santos, Ney P C

2015-08-20

Acute lymphoblastic leukemia (ALL) is a malignant tumor common in children. Studies of genetic susceptibility to cancer using biallelic insertion/deletion (INDEL) type polymorphisms associated with cancer development pathways may help to clarify etymology of ALL. In this study, we investigate the role of eight functional INDEL polymorphisms and influence of genetic ancestry to B-cell ALL susceptibility in children of Brazilian Amazon population, which has a high degree of inter-ethnic admixture. Ancestry analysis was estimated using a panel of 48 autosomal ancestry informative markers. 130 B-cell ALL patients and 125 healthy controls were included in this study. The odds ratios and 95% confidence intervals were adjusted for confounders. The results indicated an association between the investigated INDEL polymorphisms in CASP8 (rs3834129), CYP19A1 (rs11575899) e XRCC1 (rs3213239) genes in the development of B-cell ALL. The carriers of Insertion/Insertion (Ins/Ins) genotype of the polymorphism in CASP8 gene presented reduced chances of developing B-cell ALL (P=0.001; OR=0.353; 95% CI=0.192-0.651). The Deletion/Deletion (Del/Del) genotype of the polymorphism in CYP19A1 gene was associated to a lower chance of developing B-cell ALL (P=3.35×10 -6 ; OR=0.121; 95% CI=0.050-0.295), while Del/Del genotype of the polymorphism in XRCC1 gene was associated to a higher chance of developing B-cell ALL (P=2.01×10 -4 ; OR=6.559; 95% CI=2.433-17.681). We also found that Amerindian ancestry correlates with the risk of B-cell ALL. For each increase of 10% in the Amerindian ancestry results in 1.4-fold chances of developing B-cell ALL (OR=1.406; 95% IC=1.123-1.761), while each increase of 10% in the European ancestry presents a protection effect in the development of B-cell ALL (OR=0.666; 95% IC=0.536-0.827). The results suggest that genetic factors influence leukemogenesis and might be explored in the stratification of B-cell ALL risk in admixed populations. Copyright © 2015 Z. Published by Elsevier Ltd.. All rights reserved.

Unique variation in genetic selection among Black North American women and its potential influence on pregnancy outcome.

PubMed

Jaffe, Shirlee; Normand, Neil; Jayaram, Aswathi; Orfanelli, Theofano; Doulaveris, Georgios; Passos, Mariana; Kanninen, Tomi T; Bongiovanni, Ann Marie; Linhares, Iara M; Witkin, Steven S

2013-11-01

We hypothesize that variations in the frequency of genetic polymorphisms, reflecting ancestral differences in living conditions and exposure to microorganisms, increase susceptibility to adverse pregnancy outcome among present day Black North American women. Striking differences were observed in the frequency of genetic variants between Black and White or Hispanic women in 5 genes (IL1RN, MBL2, PPARA, ATG16L1, CIAS1) associated with inflammation and anti-microbial immunity. The CIAS1 and IL1RN polymorphisms were associated with altered interleukin-1β serum levels; the MBL2 polymorphism resulted in a decreased serum mannose-binding lectin concentration. Gene polymorphisms associated with an alteration in innate immunity were most frequent in Black women. This may reflect an evolutionary selection in response to an ancient environment containing a high multitude of microorganisms, and may increase susceptibility of Black women to infection-associated preterm birth in the current North American environment. Copyright © 2013 Elsevier Ltd. All rights reserved.

CK-MM gene polymorphism does not influence the blood CK activity levels after exhaustive eccentric exercise.

PubMed

Yamin, C; Oliveira, J; Meckel, Y; Eynon, N; Sagiv, M; Ayalon, M; Alves, A J; Duarte, J A

2010-03-01

Gene variants, such as creatine kinase (CK) polymorphisms, have been suggested to explain the inter-individual blood CK response to eccentric exercise. However, since this association is still doubtful, the purpose of this study was to analyse the relationship between the magnitudes of the CK response to exercise with the occurrence of muscle CK-MM NcoI polymorphism in young healthy subjects. Blood CK activity was assessed in 70 subjects immediately before and 3, 24, 48, 72, 96, 120, 168 h after strenuous eccentric exercise. Based on the amount of CK release by each subject, the sample was distributed in quartiles and the genotype and allele frequency distribution was compared among quartiles. Despite the inter-individual variability of CK response observed between subjects, there were no differences in genotype and allele frequencies among quartiles. The results allowed us to conclude that CK response after exhaustive eccentric exercise is not associated with CK-MM Ncol polymorphism. Georg Thieme Verlag KG Stuttgart.New York.

Polymorphisms in Toll-like receptors 2 and 4 genes and their expression in chronic suppurative otitis media.

PubMed

Jotic, Ana; Jesic, Snezana; Zivkovic, Maja; Tomanovic, Nada; Kuveljic, Jovana; Stankovic, Aleksandra

2015-12-01

Toll-like receptors (TLRs) have a prominent role in inducing innate immune response. It has been suggested that regulation of TLRs is involved in the pathogenesis of chronic otitis media. TLR 2 and TLR 4 polymorphisms were connected with susceptibility to acute otitis and chronic otitis with effusion. The objective of this study was to establish expression of TLR 2 and 4 on middle ear mucosa in different types of chronic suppurative otitis media (CSOM), and the influence of gene polymorphisms TLR 2 Arg753Gln and TLR 4 Thr399Ile and Asp299Gly to susceptibility to CSOM. Middle ear mucosa and full blood samples were obtained from 85 patients with chronic suppurative otitis media with and without cholesteatoma. Control group for mucosal TLR expression consisted of 71 samples of middle ear mucosa taken from patients with otosclerosis, and control group for DNA polymorphism consisted of 100 full blood samples in healthy subjects. DNA polymorphism detection was done with restriction fragment length polymorphism in RT PCR. Expression of TLR 2 and 4 was determined with immunohistochemical staining. TLR 2 and TLR 4 expression on the middle ear mucosa was not influenced by age of the patients with chronic otitis media. Incidence of TLR 2 Arg753Gln polymorphism was significantly higher in patients with chronic otitis media, compared to control group. Significant association between TLR 2 Arg753Gln polymorphism and different types of mucosal changes in patients with chronic otitis media was established. TLR 2 and 4 expression on experimental group mucosa was significantly different compared to control group, where there was no expression (p=0.000). Strong dependence of TLR 2 and TLR 4 expression on middle ear mucosa with different mucosal changes and immunohistochemical activity after staining was detected. Certain polymorphisms in TLR genes could be indicative for susceptibility to chronic otitis media. Expression of TLR 2 and 4 on middle ear mucosa was more dependable on different types of mucosal changes and type of CSOM than on bacteria found in the specimens. This can indicate that the type of mucosal changes are closely correlated with TLRs activity in middle ear. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

The Role of the Asn40Asp Polymorphism of the Mu Opioid Receptor Gene (OPRM1) on Alcoholism Etiology and Treatment: A Critical Review

PubMed Central

Ray, Lara A.; Barr, Christina S.; Blendy, Julie A.; Oslin, David; Goldman, David; Anton, Raymond F.

2011-01-01

The endogenous opioid system has been implicated in the pathophysiology of alcoholism as it modulates the neurobehavioral effects of alcohol. A variant in the mu opioid receptor gene (OPRM1), the Asn40Asp polymorphism, has received attention as a functional variant that may influence a host of behavioral phenotypes for alcoholism as well as clinical response to opioid antagonists. This paper will review converging lines of evidence on the effect of the Asn40Asp SNP on alcoholism phenotypes, including: (i) genetic association studies; (ii) behavioral studies of alcoholism; (iii) neuroimaging studies; (iv) pharmacogenetic studies and clinical trials; and (v) preclinical animal studies. Together, these lines of research seek to elucidate the effects of this functional polymorphism on alcoholism etiology and treatment response. PMID:21895723

COMT and MAO-A Polymorphisms and Obsessive-Compulsive Disorder: A Family-Based Association Study

PubMed Central

Sampaio, Aline Santos; Hounie, Ana Gabriela; Petribú, Kátia; Cappi, Carolina; Morais, Ivanil; Vallada, Homero; do Rosário, Maria Conceição; Stewart, S. Evelyn; Fargeness, Jesen; Mathews, Carol; Arnold, Paul; Hanna, Gregory L.; Richter, Margaret; Kennedy, James; Fontenelle, Leonardo; de Bragança Pereira, Carlos Alberto; Pauls, David L.; Miguel, Eurípedes Constantino

2015-01-01

Objective Obsessive-compulsive disorder (OCD) is a common and debilitating psychiatric illness. Although a genetic component contributes to its etiology, no single gene or mechanism has been identified to the OCD susceptibility. The catechol-O-methyltransferase (COMT) and monoamine oxidase A (MAO-A) genes have been investigated in previous OCD studies, but the results are still unclear. More recently, Taylor (2013) in a comprehensive meta-analysis of genetic association studies has identified COMT and MAO-A polymorphisms involved with OCD. In an effort to clarify the role of these two genes in OCD vulnerability, a family-based association investigation was performed as an alternative strategy to the classical case-control design. Methods Transmission disequilibrium analyses were performed after genotyping 13 single-nucleotide polymorphisms (eight in COMT and five in MAO-A) in 783 OCD trios (probands and their parents). Four different OCD phenotypes (from narrow to broad OCD definitions) and a SNP x SNP epistasis were also analyzed. Results OCD, broad and narrow phenotypes,were not associated with any of the investigated COMT and MAO-A polymorphisms. In addition, the analyses of gene-gene interaction did not show significant epistatic influences on phenotype between COMT and MAO-A. Conclusions The findings do not support an association between DSM-IV OCD and the variants of COMT or MAO-A. However, results from this study cannot exclude the contribution of these genes in the manifestation of OCD. The evaluation of broader spectrum phenotypes could help to understand the role of these and other genes in the pathophysiology of OCD and its spectrum disorders. PMID:25793616

IL10 -1082, IL10 -819 and IL10 -592 polymorphisms are associated with chronic periodontitis in a Macedonian population.

PubMed

Atanasovska-Stojanovska, Aneta; Trajkov, Dejan; Popovska, Mirjana; Spiroski, Mirko

2012-07-01

Genetic polymorphisms in the interleukin 10 (IL10) gene have been reported to influence the host response to microbial challenge by altering levels of cytokine expression. We analyzed nucleotide polymorphisms in the promoter region of the IL10 gene and its relation with periodontal disease in a Macedonian population. The study population consisted of 111 unrelated subjects with chronic periodontitis and 299 healthy controls. DNA was isolated and IL10 genotyping performed by PCR-SSP (Heidelberg kit) for the alleles and genotypes of IL10 -1082, IL10 -819 and IL10 -592. Frequencies of IL10 haplotypes and the haplotype zygotes were also examined. Comparisons between groups were tested using the Pearson's p-value. After Bonferroni adjustment, significant associations were detected between subjects with chronic periodontitis and IL10 genotypes (IL10 -1082/A:G was negative or protective and IL10 -1082/G:G was positive or susceptible). Cytokine polymorphism on the IL10 gene appears to be associated with susceptibility to chronic periodontitis in Macedonians. Copyright © 2012 American Society for Histocompatibility and Immunogenetics. Published by Elsevier Inc. All rights reserved.

IFNL4 and IFNL3 Associated Polymorphisms Strongly Influence the Spontaneous IFN-Alpha Receptor-1 Expression in HCV-Infected Patients

PubMed Central

Bordi, Licia; Caglioti, Claudia; Garbuglia, Anna Rosa; Lapa, Daniele; Castilletti, Concetta; Taibi, Chiara; Capobianchi, Maria Rosaria; Lalle, Eleonora

2015-01-01

Single-nucleotide polymorphism in IFNL3 gene (rs12979860) predicts spontaneous and therapy-induced HCV clearance. In a previous study from our group PBMC from patients with favourable rs12979860 genotype showed higher levels of IFNAR-1 mRNA. Recently, a dinucleotide polymorphism, ss469415590 (TT or ΔG), has been discovered in the region upstream IFNL3 gene, which is in high linkage disequilibrium with rs12979860. ss469415590[ΔG] is a frameshift variant that creates a novel gene, designed IFNL4, encoding the interferon-lambda 4 protein (IFNL4). The aim of the present study was to extend the analysis of IFNAR-1 mRNA levels to the ss469415590 variants. Our results highlight that the difference of IFNAR-1 mRNA levels between favourable and unfavourable genotype combinations, at both rs12979860 and ss469415590 loci, is stronger than that observed for single polymorphisms at each locus. These findings suggest may represent the biological basis for the observed association between IFNL3 CC and IFNL4 TT/TT genotypes and favourable outcome of either natural HCV infection (clearance vs chronic evolution) or IFN-based therapy. PMID:25675103

Analysis of promoter polymorphism in monoamine oxidase A (MAOA) gene in completed suicide on Slovenian population.

PubMed

Uršič, Katarina; Zupanc, Tomaž; Paska, Alja Videtič

2018-04-23

Suicide is a well-defined public health problem and is a complex phenomenon influenced by a number of different risk factors, including genetic ones. Numerous studies have examined serotonin system genes. Monoamine oxidase A (MAO-A) is an outer mitochondrial membrane enzyme which is involved in the metabolic pathway of serotonin degradation. Upstream variable number of tandem repeats (uVNTR) in the promoter region of MAOA gene affects the activity of transcription. In the present study we genotyped MAOA-uVNTR polymorphism in 266 suicide victims and 191 control subjects of Slovenian population, which ranks among the European and world populations with the highest suicide rate. Genotyping was performed with polymerase chain reaction and agarose gel electrophoresis. Using a separate statistical analysis for female and male subjects we determined the differences in genotype distributions of MAOA-uVNTR polymorphism between the studied groups. Statistical analysis showed a trend towards 3R allele and suicide, and associated 3R allele with non-violent suicide method on stratified data (20 suicide victims). This is the first study associating highly suicidal Slovenian population with MAOA-uVNTR polymorphism. Copyright © 2018 Elsevier B.V. All rights reserved.

Influence of the genetic polymorphism in the 5'-noncoding region of the CYP1A2 gene on CYP1A2 phenotype and urinary mutagenicity in smokers.

PubMed

Pavanello, Sofia; Pulliero, Alessandra; Lupi, Silvia; Gregorio, Pasquale; Clonfero, Erminio

2005-11-10

The functional significance of genetic polymorphisms on tobacco smoke-induced CYP1A2 activity was examined. The influence of three polymorphisms of the cytochrome P450 1A2 gene (CYP1A2) (-3860 G-->A (allele *1C), -2467 T-->delT (allele *1D), -163C-->A (allele *1F)), located in the 5'-noncoding promoter region of the gene, on CYP1A2 activity (measured as caffeine metabolic ratio, CMR), was studied in Caucasian current smokers (n=95). Tobacco smoke intake was calculated from the number of cigarettes/day. Also, studied was the influence of these CYP1A2 genotypes on smoking-associated urinary mutagenicity, detected in Salmonella typhimurium strain YG1024 with S9 mix, considering the urinary excretion of nicotine plus its metabolites as an internal indicator of tobacco smoke exposure. Smokers with at least one of the variant alleles CYP1A2 -3860A and -2467 delT showed a significantly increased CYP1A2 CMR (-3860 G/A versus G/G, p<0.05; -2467 delT/delT versus T/delT and T/T, p<0.01). Multiple regression analysis showed that the increase in CYP1A2 CMR (ln values) was again significantly related to the presence of CYP1A2 variants -2467delT and also to variant -163A (p<0.05), but moderately to -3860A (p=0.084). No influence of the number of cigarettes smoked per day by each subject was found. Heavy smokers (n=48, with urinary nicotine plus its metabolites>or=0.69 mg/mmol creatinine) with variant allele -2467delT or -163A had significantly increased urinary mutagenicity (p<0.01 and <0.05). CYP1A2 genetic polymorphisms are shown to influence the CYP1A2 phenotype in smokers, -2467 T-->delT having the main effect. This information is of interest for future studies assessing the possible role of tobacco smoke-inducible CYP1A2 genotypes as individual susceptibility factors in exposure to carcinogens.

The role of the methylenetetrahydrofolate reductase 677 and 1298 polymorphisms in Cretan children with acute lymphoblastic leukemia.

PubMed

Karathanasis, Nikolaos V; Stiakaki, Eftichia; Goulielmos, George N; Kalmanti, Maria

2011-01-01

Acute lymphoblastic leukemia (ALL) is the most common form of malignancy in children. Recently, many studies have examined factors influencing both the susceptibility to ALL and the metabolism of widely used chemotherapeutic agents. These factors include, among others, single-nucleotide polymorphisms in various genes, such as the gene encoding for methylenetetrahydrofolate reductase (MTHFR), which has been proven polymorphic at the nucleotide positions 677 and 1298. Thirty-five children with ALL and 48 healthy adults of Cretan origin were genotyped for the presence of the MTHFR 677 and 1298 single-nucleotide polymorphisms. The possible correlation of the polymorphisms with the risk for ALL and the presence of methotrexate-induced toxicities were examined. No significant association between the MTHFR genotypes and the susceptibility to ALL was observed. A borderline statistically significant relationship was detected after methotrexate administration, between the C677T genotype (polymorphisms) and leukopenia (p = 0.050) and between the A1298C polymorphism and normal aspartate transaminase and alanine transaminase values (p = 0.065 and p = 0.053, respectively), which was strengthened for aspartate transaminase, after grouping the A1298A and A1298C genotypes together (p = 0.039). In our population the MTHFR C677T and A1298C polymorphisms are related with hematologic toxicity and hepatotoxicity, respectively, and could be suggested as prognostic factors for these adverse events.

Heat shock protein 70 gene polymorphisms' influence on the electrophysiology of long QT syndrome.

PubMed

Ali, Altaf; Qureshi, Sameera F; Medikare, Veronica; Venkateshwari, Ananthapur; Calambur, Narsimhan; Rao, Hygriv; Jayakrishnan, M P; Shenthar, Jayaprakash; Thangaraj, Kumarasamy; Nallari, Pratibha

2016-03-01

Long QT syndrome (LQTS) is a rare cardiac disorder caused due to mutations in genes encoding ion channels responsible for generation of electrical impulses. The heat shock protein (HSP)-70 gene, expressed under conditions of stress, plays a cardioprotective role when overexpressed and helps in the proper folding of the nascent proteins synthesized by the cellular machinery. We aimed to identify the role played by HSP-70 gene polymorphisms in the pathogenesis of LQTS. Study included 49 LQTS patients, 71 family members, and 219 healthy individuals recruited from an ethnically matched population. Genotyping of the single-nucleotide polymorphisms (SNPs) rs1043618 (HSP-70-1, +190G/C), rs1061581 (HSP-70-2, +1267A/G), and rs2227956 (HSP-70-hom, +2437T/C) was performed by PCR-RFLP analysis, and the results were analyzed statistically at 95 % confidence interval and p ≤ 0. 05. The "C" allele of HSP-70-1 (+190G/C) and "G" allele of HSP-70-2 (+1267A/G) showed strong association with LQTS phenotype. The haplotype group C-G-T consisting of two risk alleles was significantly associated with the disease condition. Multifactor dimensionality reduction analysis further substantiated that the three-allele model influences the outcome of the phenotype highlighting the effect of modifiers in the etiology of LQTS. As HSP-70 influences the channel assembly and maturation/trafficking of the ion channel proteins, the alleles C of the HSP-70-1 and G of the HSP-70-2 loci and the haplotype group C-G-T could be considered a diagnostic biomarker in the identification of the LQTS phenotype with a potential to affect the progression and modification of the disease phenotype.

Influence of decreased fibrinolytic activity and plasminogen activator inhibitor-1 4G/5G polymorphism on the risk of venous thrombosis.

PubMed

Vuckovic, Biljana A; Djeric, Mirjana J; Tomic, Branko V; Djordjevic, Valentina J; Bajkin, Branislav V; Mitic, Gorana P

2018-01-01

: Objective of our study is to determine whether decreased fibrinolytic activity or plasminogen activator inhibitor (PAI)-1 4G/5G polymorphism influence the risk of venous thrombosis.Our case-control study included 100 patients with venous thrombosis, and 100 random controls. When patients were compared with random controls, unconditional logistic regression was used to calculate odds ratios (ORs) with 95% confidence intervals (CIs).Decreased fibrinolytic activity yielded a 2.7-fold increase in risk for venous thrombosis than physiological fibrinolytic activity (OR 2.70; 95% CI 1.22-5.98), when comparing patients with random controls. Adjustment for several putative confounders did not change the estimate (OR 3.02; 95% CI 1.26-7.22). Analysis of venous thrombotic risk influenced by PAI-1 genotype, showed no influence of PAI-1 4G/5G gene variant in comparison with 5G/5G genotype (OR 0.57 95% CI; 0.27-1.20).Decreased fibrinolytic activity increased, whereas PAI-1 4G/5G polymorphism did not influence venous thrombosis risk in this study.

Polymorphisms in VDR gene in Tunisian postmenopausal women are associated with osteopenia phenotype.

PubMed

Sassi, R; Sahli, H; Souissi, C; Sellami, S; Ben Ammar El Gaaied, A

2015-01-01

Osteopenia is characterized by intermediate values of bone mineral density (BMD) as compared to normal and osteoporotic subjects. BMD, a surrogate phenotype for osteoporosis, is influenced in part by genetic factors. Among the genes associated with BMD, the vitamin D receptor (VDR) was the first gene studied as a potential candidate associated with BMD in adult and postmenopausal bone loss. However, results are controversial. To determine whether VDR polymorphisms ApaI and TaqI are associated with BMD, osteopenia, osteoporosis and low-impact fracture risk in North Africans, these genotypes were analyzed in 566 postmenopausal Tunisian women. In postmenopausal Tunisian women, the GT ApaI genotype seems to be protective against osteoporosis development (p = 0.02; odds ratio = 0.54). Moreover, the presence of the combined GT/TT genotype of ApaI and TaqI polymorphisms is more frequent in normal BMD women than in osteoporotic women (p = 0.00; odds ratio = 0.41). Interestingly, the GG ApaI genotype is associated with osteopenia development (p = 0.02; odds ratio = 1.86) and also the TT TaqI polymorphism (p = 0.02; odds ratio = 1.53). The GG ApaI genotype is associated with a three times risk of vertebral fracture. The ApaI polymorphism showed an association with osteopenia and low-impact vertebral fracture incidence but not with osteoporosis. The TaqI polymorphism is associated specifically with the osteopenia phenotype. The presence of the two polymorphisms increases the risk to develop osteopenia in postmenopausal Tunisian women. Osteopenia seems to be genetically determined. However, osteoporosis is the result of interaction between genetic and environmental factors.

Analysis of CYP1A1 and COMT polymorphisms in women with cervical cancer.

PubMed

Kleine, J P; Camargo-Kosugi, C M; Carvalho, C V; Silva, F C; Silva, I D C G

2015-12-29

The aim of this case-control study was to obtain a comprehensive panel of genetic polymorphisms present only in genes (cytochrome P-450 1A1--CYP1A1 and catechol-O-methyl transferase--COMT) within the metabolic pathway of sex steroids and determine their possible associations with the presence or absence of cervical cancer. Genotypes of 222 women were analyzed: a) 81 with cancer of the cervix treated at the Cancer Hospital Alfredo Abram, between June 2012 and May 2013, with diagnosis confirmed surgically and/or through histomorphological examination; and b) 141 healthy women who assisted at the Endocrine Gynecology and Climacteric Ambulatory, Department of Gynecology, UNIFESP-EPM. These polymorphisms were detected by polymerase chain reaction amplification-restriction fragment length polymorphism analysis and visualized on 3% agarose gels stained with ethidium bromide. We found a significant association between the frequency of the CYP1A1 polymorphism and the development of cervical cancer. A statistical difference was observed between patient and control groups for CYP1A1 polymorphism genotype distributions (P < 0.05). However, no significant differences were found in the COMT gene polymorphism genotype distributions between the patient and control groups (P > 0.05) or between other risk variables analyzed. The CYP1A1 gene involved in the metabolic pathway of sex steroids might influence the emergence of pathological conditions such as cervical cancer in women who carry a mutated allele, and result in 1.80 and 13.46 times increased risk for women with heterozygous or homozygous mutated genotypes, respectively.

Association of Anxiety-Related Polymorphisms with Sports Performance in Chilean Long Distance Triathletes: A Pilot Study

PubMed Central

Sanhueza, Jorge A.; Zambrano, Tomás; Bahamondes-Avila, Carlos; Salazar, Luis A.

2016-01-01

Different factors affecting athletic performance are well established: intensity and type of training, anthropometric characteristics as well as an important psychological component. However, the contribution of the genetic background has been less investigated. The aim of the present study was to investigate the influence of polymorphisms within genes associated with stress and anxiety (5HTT, CRH2R, ACE, NK1R, 5HT1AR and CRF-BP) on the physical capability and sports performance in triathletes. One hundred and ninety two (192) unrelated Chilean triathletes who participated in the 2014 70.3 Pucón city triathlon were divided into opposite subgroups of sports performance according to their time results. We identified significant associations for five polymorphisms (5HTT 5-HTTLPR, ACE I/D, NK1R rs6715729, 5HT1AR -1019C>G and CRF-BP CRF-BPs11) with athletic performance. Our results indicate that these polymorphisms are associated with differential sports performance in Chilean triathletes, establishing an initial background for better understanding the relationship between physical performance, genetics and anxiety disorders. Key points Genetic factors influencing sports performance in the Chilean population are unknown. Differential outcomes from athletes who completed a triathlon competition were associated with five polymorphisms (5HTT 5-HTTLPR, ACE I/D, NK1R rs6715729, 5HT1AR -1019C>G and CRF-BP CRF-BPs11). We show that genetic variants within stress- and anxiety-related genes affect athletic performance. PMID:27928199

Polymorphism at the TNF-alpha gene interacts with Mediterranean diet to influence triglyceride metabolism and inflammation status in metabolic syndrome patients: From the CORDIOPREV clinical trial.

PubMed

Gomez-Delgado, Francisco; Alcala-Diaz, Juan Francisco; Garcia-Rios, Antonio; Delgado-Lista, Javier; Ortiz-Morales, Ana; Rangel-Zuñiga, Oriol; Tinahones, Francisco Jose; Gonzalez-Guardia, Lorena; Malagon, Maria M; Bellido-Muñoz, Enrique; Ordovas, Jose M; Perez-Jimenez, Francisco; Lopez-Miranda, Jose; Perez-Martinez, Pablo

2014-07-01

To examine whether the consumption of a Mediterranean diet (MedDiet), compared with a low-fat diet, interacts with two single nucleotide polymorphisms at the tumor necrosis factor alpha gene (rs1800629, rs1799964) in order to improve triglycerides (TG), glycemic control, and inflammation markers. Genotyping, biochemical measurements, dietary intervention, and oral fat load test meal were determined in 507 metabolic syndrome (MetS) patients selected from all the subjects included in CORDIOPREV clinical trial (n = 1002). At baseline, G/G subjects (n = 408) at the rs1800629 polymorphism, showed higher fasting and postprandial TG (p = 0.003 and p = 0.025, respectively), and high sensitivity C-reactive protein (hsCRP) (p = 0.003) plasma concentrations than carriers of the minor A-allele (G/A + A/A) (n = 99). After 12 months of MedDiet, baseline differences between genotypes disappeared. The decrease in TG and hsCRP was statistically significant in G/G subjects (n = 203) compared with carriers of the minor A-allele (p = 0.005 and p = 0.034, respectively) (n = 48). No other gene-diet interactions were observed in either diet. These results suggest that the rs1800629 at the tumor necrosis factor alpha gene interacts with MedDiet to influence TG metabolism and inflammation status in MetS subjects. Understanding the role of gene-diet interactions may be the best strategy for personalized treatment of MetS. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Differential allelic expression of IL13 and CSF2 genes associated with asthma.

PubMed

Burkhardt, Jana; Kirsten, Holger; Wolfram, Grit; Quente, Elfi; Ahnert, Peter

2012-07-01

An important area of genetic research is the identification of functional mechanisms in polymorphisms associated with diseases. A highly relevant functional mechanism is the influence of polymorphisms on gene expression levels (differential allelic expression, DAE). The coding single nucleotide polymorphisms (SNPs) CSF2(rs25882) and IL13(rs20541) have been associated with asthma. In this work, we investigated whether the mRNA expression levels of CSF2 or IL13 were correlated with these SNPs. Samples were analyzed by mass spectrometry-based quantification of gene expression. Both SNPs influenced gene expression levels (CSF2(rs25882): p(overall) = 0.008 and p(DAE samples) = 0.00006; IL13(rs20541): p(overall) = 0.059 and p(DAE samples) = 0.036). For CSF2, the expression level was increased by 27.4% (95% CI: 18.5%-35.4%) in samples with significant DAE in the presence of one copy of risk variant CSF2(rs25882-T). The average expression level of IL13 was increased by 29.8% (95% CI: 3.1%-63.4%) in samples with significant DAE in the presence of one copy of risk variant IL13(rs20541-A). Enhanced expression of CSF2 could stimulate macrophages and neutrophils during inflammation and may be related to the etiology of asthma. For IL-13, higher expression could enhance the functional activity of the asthma-associated isoform. Overall, the analysis of DAE provides an efficient approach for identifying possible functional mechanisms that link disease-associated variants with altered gene expression levels.

Single nucleotide polymorphisms/haplotypes associated with multiple rubella-specific immune response outcomes post-MMR immunization in healthy children.

PubMed

Ovsyannikova, Inna G; Salk, Hannah M; Larrabee, Beth R; Pankratz, V Shane; Poland, Gregory A

2015-10-01

The observed heterogeneity in rubella-specific immune response phenotypes post-MMR vaccination is thought to be explained, in part, by inter-individual genetic variation. In this study, single nucleotide polymorphisms (SNPs) and multiple haplotypes in several candidate genes were analyzed for associations with more than one rubella-specific immune response outcome, including secreted IFN-γ, secreted IL-6, and neutralizing antibody titers. Overall, we identified 23 SNPs in 10 different genes that were significantly associated with at least two rubella-specific immune responses. Of these SNPs, we detected eight in the PVRL3 gene, five in the PVRL1 gene, one in the TRIM22 gene, two in the IL10RB gene, two in the TLR4 gene, and five in other genes (PVR, ADAR, ZFP57, MX1, and BTN2A1/BTN3A3). The PVRL3 gene haplotype GACGGGGGCAGCAAAAAGAAGAGGAAAGAACAA was significantly associated with both higher IFN-γ secretion (t-statistic 4.43, p < 0.0001) and higher neutralizing antibody titers (t-statistic 3.14, p = 0.002). Our results suggest that there is evidence of multigenic associations among identified gene SNPs and that polymorphisms in these candidate genes contribute to the overall observed differences between individuals in response to live rubella virus vaccine. These results will aid our understanding of mechanisms behind rubella-specific immune response to MMR vaccine and influence the development of vaccines in the future.

Dog-Owner Attachment Is Associated With Oxytocin Receptor Gene Polymorphisms in Both Parties. A Comparative Study on Austrian and Hungarian Border Collies

PubMed Central

Kovács, Krisztina; Virányi, Zsófia; Kis, Anna; Turcsán, Borbála; Hudecz, Ágnes; Marmota, Maria T.; Koller, Dóra; Rónai, Zsolt; Gácsi, Márta; Topál, József

2018-01-01

Variations in human infants' attachment behavior are associated with single nucleotide polymorphisms (SNPs) in the oxytocin receptor (OXTR) gene, suggesting a genetic component to infant-mother attachment. However, due to the genetic relatedness of infants and their mothers, it is difficult to separate the genetic effects of infants' OXTR genotype from the environmental effects of mothers' genotype possibly affecting their parental behavior. The apparent functional analogy between child-parent and dog-owner relationship, however, offers a way to disentangle the effects of these factors because pet dogs are not genetically related to their caregivers. In the present study we investigated whether single nucleotide polymorphisms of pet dogs' OXTR gene (−213AG,−94TC,−74CG) and their owners' OXTR gene (rs53576, rs1042778, rs2254298) are associated with components of dog-owner attachment. In order to investigate whether social-environmental effects modulate the potential genetic influence on attachment, dogs and their owners from two different countries (Austria and Hungary, N = 135 in total) were tested in a modified version of the Ainsworth Strange Situation Test (SST) and questionnaires were also used to collect information about owner personality and attachment style. We coded variables related to three components of attachment behavior in dogs: their sensitivity to the separation from and interaction with the owner (Attachment), stress caused by the unfamiliar environment (Anxiety), and their responsiveness to the stranger (Acceptance). We found that (1) dogs' behavior was significantly associated with polymorphisms in both dogs' and owners' OXTR gene, (2) SNPs in dogs' and owners' OXTR gene interactively influenced dog-human relationship, (3) dogs' attachment behavior was affected by the country of origin, and (4) it was related to their owners' personality as well as attachment style. Thus, the present study provides evidence, for the first time, that both genetic variation in the OXTR gene and various aspects of pet dogs' environmental background are associated with their attachment to their human caregivers. PMID:29674985

Common variants of FUT2 are associated with plasma vitamin B12 levels

USDA-ARS?s Scientific Manuscript database

A genome-wide scan is a way to distinguish small differences in the genetic makeup of individuals. It is also a way which distinguishes if a mutation in any particular gene is widespread or it is "polymorphic." The value of these analyses lies in the identification of genes that could influence a th...

Predicting Outcomes Following Cognitive Behaviour Therapy in Child Anxiety Disorders: The Influence of Genetic, Demographic and Clinical Information

ERIC Educational Resources Information Center

Hudson, Jennifer L.; Lester, Kathryn J.; Lewis, Cathryn M.; Tropeano, Maria; Creswell, Cathy; Collier, David A.; Cooper, Peter; Lyneham, Heidi J.; Morris, Talia; Rapee, Ronald M.; Roberts, Susanna; Donald, Jennifer A.; Eley, Thalia C.

2013-01-01

Background: Within a therapeutic gene by environment (G × E) framework, we recently demonstrated that variation in the Serotonin Transporter Promoter Polymorphism; "5HTTLPR" and marker rs6330 in Nerve Growth Factor gene; "NGF" is associated with poorer outcomes following cognitive behaviour therapy (CBT) for child anxiety…

Apolipoprotein A2 polymorphism interacts with intakes of dairy foods to influence body weight in 2 U.S. populations

USDA-ARS?s Scientific Manuscript database

The interaction between a functional apolipoprotein A2 gene (APOA2) variant and saturated fatty acids (SFAs) for the outcome of body mass index (BMI) is among the most widely replicated gene-nutrient interactions. Whether this interaction can be extrapolated to food-based sources of SFAs, specifical...

Sleep homeostatic pressure and PER3 VNTR gene polymorphism influence antidepressant response to sleep deprivation in bipolar depression.

PubMed

Dallaspezia, Sara; Locatelli, Clara; Lorenzi, Cristina; Pirovano, Adele; Colombo, Cristina; Benedetti, Francesco

2016-03-01

Combined Total sleep deprivation (TSD) and light therapy (LT) cause a rapid improvement in bipolar depression which has been hypothesized to be paralleled by changes in sleep homeostasis. Recent studies showed that bipolar patients had lower changes of EEG theta power after sleep and responders to antidepressant TSD+LT slept less and showed a lower increase of EEG theta power then non-responders. A polymorphism in PER3 gene has been associated with diurnal preference, sleep structure and homeostatic response to sleep deprivation in healthy subjects. We hypothesized that the individual variability in the homeostatic response to TSD could be a correlate of antidepressant response and be influenced by genetic factors. We administered three TSD+LT cycles to bipolar depressed patients. Severity of depression was rated on Hamilton Depression Rating Scale. Actigraphic recordings were performed in a group of patients. PER3 polymorphism influenced changes in total sleep time (F=2.24; p=0.024): while PER3(4/4) and PER3(4/5) patients showed a reduction in it after treatment, PER3(5/5) subjects showed an increase of about 40min, suggesting a higher homeostatic pressure. The same polymorphism influenced the change of depressive symptomatology during treatment (F=3.72; p=0.028). Sleep information was recorded till the day after the end of treatment: a longer period of observation could give more information about the possible maintenance of allostatic adaptation. A higher sleep homeostatic pressure reduced the antidepressant response to TSD+LT, while an allostatic adaptation to sleep loss was associated with better response. This process seems to be under genetic control. Copyright © 2015 Elsevier B.V. All rights reserved.

Influence of CYP3A5 and ABCB1 gene polymorphisms and other factors on tacrolimus dosing in Caucasian liver and kidney transplant patients.

PubMed

Provenzani, Alessio; Notarbartolo, Monica; Labbozzetta, Manuela; Poma, Paola; Vizzini, Giovanni; Salis, Paola; Caccamo, Chiara; Bertani, Tullio; Palazzo, Ugo; Polidori, Piera; Gridelli, Bruno; D'Alessandro, Natale

2011-12-01

Tacrolimus is a substrate of cytochrome P4503A (CYP3A) enzymes as well as of the drug transporter ABCB1. We have investigated the possible influence of CYP3A5 and ABCB1 single nucleotide polymorphisms (SNPs) and other factors (e.g. albumin, hematocrit and steroids) on tacrolimus blood levels achieved in a population of Caucasian liver (n=51) and kidney (n=50) transplant recipients. At 1, 3 and 6 months after transplantation, tacrolimus doses (mg/kg/day) and trough blood levels (C0) were recorded and the weight-adjusted tacrolimus dosage (mg/kg/day) was calculated. Polymerase chain reaction followed by restriction fragment length polymorphism analysis was used for genotyping CYP3A5*1 and *3 [6986A>G] as well as ABCB1 at exons 21 [2677G>T/A] and 26 [3435C>T] in both liver transplant donors and recipients and in kidney transplant recipients. Of the 152 subjects studied, 84.9% showed a CYP3A5*3/*3 genotype. The total frequency of the allelic variant *3 was 93%. For the G2677T/A and C3435T polymorphisms the total frequencies of the allelic variants T/A and T were 44.7 and 46.7%, respectively. At 1, 3 and 6 months after transplantation the dose-adjusted C0 levels were significantly lower in patients with one copy of the *1 allele compared to those homozygous for the *3 allele. In the case of liver transplant patients the tacrolimus dose requirements were dominantly influenced by the polymorphisms of the CYP3A5 gene in the donors. With regard to the ABCB1 SNPs, in general they did not show any appreciable influence on tacrolimus dosing requirements; however, kidney transplant recipients carrying the 2677T/A allele required significantly higher daily tacrolimus doses than subjects homozygous for the wild-type allele. Identification of CYP3A5 single nucleotide polymorphisms prior to transplantation could contribute to evaluate the appropriate initial dosage of tacrolimus in the patients.

Positive transcriptional regulation of the human micro opioid receptor gene by poly(ADP-ribose) polymerase-1 and increase of its DNA binding affinity based on polymorphism of G-172 -> T.

PubMed

Ono, Takeshi; Kaneda, Toshio; Muto, Akihiro; Yoshida, Tadashi

2009-07-24

Micro opioid receptor (MOR) agonists such as morphine are applied widely in clinical practice as pain therapy. The effects of morphine through MOR, such as analgesia and development of tolerance and dependence, are influenced by individual specificity. Recently, we analyzed single nucleotide polymorphisms on the human MOR gene to investigate the factors that contribute to individual specificity. In process of single nucleotide polymorphisms analysis, we found that specific nuclear proteins bound to G(-172) --> T region in exon 1 in MOR gene, and its affinity to DNA was increased by base substitution from G(-172) to T(-172). The isolated protein was identified by mass spectrometry and was confirmed by Western blotting to be poly(ADP-ribose) polymerase-1 (PARP-1). The overexpressed PARP-1 bound to G(-172) --> T and enhanced the transcription of reporter vectors containing G(-172) and T(-172). Furthermore, PARP-1 inhibitor (benzamide) decreased PARP-1 binding to G(-172) --> T without affecting mRNA or protein expression level of PARP-1 and down-regulated the subsequent MOR gene expression in SH-SY5Y cells. Moreover, we found that tumor necrosis factor-alpha enhanced MOR gene expression as well as increased PARP-1 binding to the G(-172) --> T region and G(-172) --> T-dependent transcription in SH-SY5Y cells. These effects were also inhibited by benzamide. In this study, our data suggest that PARP-1 positively regulates MOR gene transcription via G(-172) --> T, which might influence individual specificity in therapeutic opioid effects.

Genetic Polymorphisms in RNA Binding Proteins Contribute to Breast Cancer Survival

PubMed Central

Upadhyay, Rohit; Sanduja, Sandhya; Kaza, Vimala; Dixon, Dan A.

2012-01-01

The RNA-binding proteins TTP and HuR control expression of numerous genes associated with breast cancer pathogenesis by regulating mRNA stability. However, the role of genetic variation in TTP (ZFP36) and HuR (ELAVL1) genes is unknown in breast cancer prognosis. A total of 251 breast cancer patients (170 Caucasians and 81 African-Americans) were enrolled and followed-up from 2001 to 2011 (or until death). Genotyping was performed for 10 SNPs in ZFP36 and 7 in ELAVL1 genes. On comparing both races with one another, significant differences were found for clinical and genetic variables. The influence of genetic polymorphisms on survival was analyzed by using Cox-regression, Kaplan-Meier analysis, and the log-rank test. Univariate (Kaplan-Meier/Cox-regression) and multivariate (Cox-regression) analysis showed that the TTP gene polymorphism ZFP36*2 A>G was significantly associated with poor prognosis of Caucasian patients (HR = 2.03; 95% CI = 1.09–3.76; P = 0.025; log-rank P = 0.022). None of the haplotypes, but presence of more than six risk genotypes in Caucasian patients, was significantly associated with poor prognosis (HR=2.42; 95% CI=1.17–4.99; P = 0.017; log-rank P = 0.007). The effect of ZFP36*2 A>G on gene expression was evaluated from patients' tissue samples. Both TTP mRNA and protein expression was significantly decreased in ZFP36*2 G allele carriers compared to A allele homozygotes. Conversely, upregulation of the TTP-target gene COX-2 was observed ZFP36*2 G allele carriers. Through its ability to attenuate TTP gene expression, the ZFP36*2 A>G gene polymorphism has appeared as a novel prognostic breast cancer marker in Caucasian patients. PMID:22907529

Diversity of killer cell immunoglobulin-like receptor genes in the Bengali population of northern West Bengal, India.

PubMed

Guha, P; Bhattacharjee, S; Chaudhuri, T K

2014-12-01

The Indian Subcontinent exhibits extensive diversity in its culture, religion, ethnicity and linguistic heritage, which symbolizes extensive genetic variations within the populations. The highly polymorphic Killer cell Immunoglobulin-like Receptor (KIR) family plays an important role in tracing genetic differentiation in human population. In this study, we aimed to analyse the KIR gene polymorphism in the Bengali population of northern West Bengal, India. To our knowledge, this is the first report on the KIR gene polymorphism in the Bengalis of West Bengal, India. Herein, we have studied the distribution of 14 KIR genes (KIR3DL1-3DL3, KIR2DL1-2DL5, KIR2DS1-2DS5 AND KIR3DS1) and two pseudogenes (KIR3DP1 and 2DP1) in the Bengalis. Apart from the framework genes (KIR2DL4, 3DL2, 3DL3 and 3DP1), which are present in all the individuals, the gene frequencies of other KIR genes varied between 0.34 and 0.88. Moreover, upon comparing the KIR polymorphism of the Bengalis with the available published data of other world populations, it has been found that the Indo-European-speaking Bengalis from the region share both Dravidian and Indo-Aryan gene pool with considerable influences of mongoloid and European descents. Furthermore, evidences from previously published data on human leucocyte antigen and Y-chromosome haplogroup diversity support the view. Our results will help to understand the genetic background of the Bengali population, in illustrating the population migration events in the eastern and north-eastern part of India, in explaining the extensive genetic admixture amongst the different linguistic groups of the region and also in KIR-related disease researches. © 2014 John Wiley & Sons Ltd.

The translocator protein gene is associated with symptom severity and cerebral pain processing in fibromyalgia.

PubMed

Kosek, Eva; Martinsen, Sofia; Gerdle, Björn; Mannerkorpi, Kaisa; Löfgren, Monika; Bileviciute-Ljungar, Indre; Fransson, Peter; Schalling, Martin; Ingvar, Martin; Ernberg, Malin; Jensen, Karin B

2016-11-01

The translocator protein (TSPO) is upregulated during glia activation in chronic pain patients. TSPO constitutes the rate-limiting step in neurosteroid synthesis, thus modulating synaptic transmission. Related serotonergic mechanisms influence if pro- or anti-nociceptive neurosteroids are produced. This study investigated the effects of a functional genetic polymorphism regulating the binding affinity to the TSPO, thus affecting symptom severity and cerebral pain processing in fibromyalgia patients. Gene-to-gene interactions with a functional polymorphism of the serotonin transporter gene were assessed. Fibromyalgia patients (n=126) were genotyped regarding the polymorphisms of the TSPO (rs6971) and the serotonin transporter (5-HTTLPR/rs25531). Functional magnetic resonance imaging (n=24) was used to study brain activation during individually calibrated pressure pain. Compared to mixed/low TSPO affinity binders, the high TSPO affinity binders rated more severe pain (p=0.016) and fibromyalgia symptoms (p=0.02). A significant interaction was found between the TSPO and the serotonin transporter polymorphisms regarding pain severity (p<0.0001). Functional connectivity analyses revealed that the TSPO high affinity binding group had more pronounced pain-evoked functional connectivity in the right frontoparietal network, between the dorsolateral prefrontal area and the parietal cortex. In conclusion, fibromyalgia patients with the TSPO high affinity binding genotype reported a higher pain intensity and more severe fibromyalgia symptoms compared to mixed/low affinity binders, and this was modulated by interaction with the serotonin transporter gene. To our knowledge this is the first evidence of functional genetic polymorphisms affecting pain severity in FM and our findings are in line with proposed glia-related mechanisms. Furthermore, the functional magnetic resonance findings indicated an effect of translocator protein on the affective-motivational components of pain perception. Copyright © 2016 The Authors. Published by Elsevier Inc. All rights reserved.

Association of MAOA and COMT gene polymorphisms with palatable food intake in children.

PubMed

Galvão, Ananda C S; Krüger, Raquel C; Campagnolo, Paula D B; Mattevi, Vanessa S; Vitolo, Márcia R; Almeida, Silvana

2012-03-01

Several studies have implicated dopamine (DA) in appetite regulation. The enzymes catechol-o-methyltransferase (COMT) and monoamine oxidase A (MAOA) control DA availability and their genes have well-characterized functional variants. In this study, we examined three polymorphisms in these genes, T941G and MAOAu-VNTR in the MAOA gene and Val158Met in the COMT gene, to investigate how heritable variations in enzymes that determine DA levels might influence food intake and nutritional status. This investigation was a cross-sectional examination of 354 Brazilian children of three to four years old. Polymorphisms were analyzed by PCR-based methods. Means of dietary and anthropometric data were compared among genotypes by one-way analyses of variance or Kruskal Wallis tests. The MAOAu-VNTR and COMT Val158Met polymorphisms were associated with the amount of palatable food intake in boys. Presence of the MAOAu-VNTR*long allele was associated with higher intake of lipid-dense foods (LDF) when compared with the *short allele (P=.009); the amount of sugar-dense foods (SDF) intake was also higher in males carriers of the MAOAu-VNTR *long allele than in carriers of the *short allele (P=.034). In the girls' sample, MAOAu-VNTR polymorphism was not associated with food intake and nutritional status. Carriers of the COMT Val158Met*Val allele presented higher intake of LDF when compared with Met/Met homozygotes (P=.008). This study provides the first indication that genetic variants of enzymes that control DA availability might be involved in determination of the amount of palatable food intake in children. Copyright © 2012 Elsevier Inc. All rights reserved.

Genotypic and phenotypic characteristics of aminoglycoside-resistant Mycobacterium tuberculosis isolates in Latvia.

PubMed

Bauskenieks, Matiss; Pole, Ilva; Skenders, Girts; Jansone, Inta; Broka, Lonija; Nodieva, Anda; Ozere, Iveta; Kalvisa, Adrija; Ranka, Renate; Baumanis, Viesturs

2015-03-01

Mutations causing resistance to aminoglycosides, such as kanamycin (KAN), amikacin (AMK), and streptomycin, are not completely understood. In this study, polymorphisms of aminoglycoside resistance influencing genes such as rrs, eis, rpsL, and gidB in 41 drug-resistant and 17 pan-sensitive Mycobacterium tuberculosis clinical isolates in Latvia were analyzed. Mutation A1400G in rrs gene was detected in 92% isolates with high resistance level to KAN and diverse MIC level to AMK. Mutations in promoter region of eis were detected in 80% isolates with low-level MIC of KAN. The association of K43R mutation in rpsL gene, a mutation in the rrs gene at position 513, and various polymorphisms in gidB gene with distinct genetic lineages of M. tuberculosis was observed. The results of this study suggest that association of different controversial mutations of M. tuberculosis genes to the drug resistance phenotype should be done in respect to genetic lineages. Copyright © 2015 Elsevier Inc. All rights reserved.

Oxidative Stress Genes, Antioxidants and Coronary Artery Disease in 
Type 2 Diabetes Mellitus

PubMed Central

Tibaut, Miha; Petrovič, Daniel

2016-01-01

The worldwide increasing prevalence of obesity and sedentary lifestyle is the main cause of the rising incidence of T2DM. Due to chronic macrovascular and microvascular complications, T2DM represent a huge socioeconomic burden in the world. Oxidative stress is a key pathogenic mechanism implicated in diabetic coronary artery disease (CAD). Polymorphisms of oxidative stress genes are known to influence oxidative stress levels and are therefore thought to impact CAD pathogenesis. Identifying higher risk groups would be rational, since it would allow better sample selection and thus better results in antioxidant trials. In this review, we summarize the evidence of oxidative stress gene polymorphisms related to the pathogenesis of CAD. Moreover, we provide a review of antioxidants tested in subjects with CAD. PMID:27052028

MAOA and TNF-β gene polymorphisms are associated with photophobia but not osmophobia in patients with migraine.

PubMed

Ishii, Masakazu; Usami, Shino; Hara, Hajime; Imagawa, Atsuko; Masuda, Yutaka; Shimizu, Shuniichi

2014-06-01

Photophobia and osmophobia are typical symptoms associated with migraine, but the contributions of gene polymorphisms to these symptoms are not fully elucidated. We investigated whether the gene polymorphisms are involved in photophobia and osmophobia in patients with migraine. Ninety-one migraine patients and 119 non-headache healthy volunteers were enrolled. The 12 gene polymorphisms were determined by polymerase-chain-reaction (PCR) and PCR restriction-fragment-length polymorphism analysis. Photophobia and osmophobia were observed in 49 (54%) and 31 patients (34%), respectively. Distributions of monoamine oxidase A (MAOA) T941G and tumour necrosis factor-β (TNF-β) G252A polymorphisms were significantly different between patients with photophobia and controls. However, no gene polymorphism differences were observed between patients with osmophobia and controls. The MAOA T941G and TNF-β G252A gene polymorphisms appear to contribute to photophobia but not to osmophobia. We propose that different gene polymorphisms are responsible for photophobia and osmophobia symptoms during migraine.

Lessons from the canine Oxtr gene: populations, variants and functional aspects.

PubMed

Bence, M; Marx, P; Szantai, E; Kubinyi, E; Ronai, Z; Banlaki, Z

2017-04-01

Oxytocin receptor (OXTR) acts as a key behavioral modulator of the central nervous system, affecting social behavior, stress, affiliation and cognitive functions. Variants of the Oxtr gene are known to influence behavior both in animals and humans; however, canine Oxtr polymorphisms are less characterized in terms of possible relevance to function, selection criteria in breeding and domestication. In this report, we provide a detailed characterization of common variants of the canine Oxtr gene. In particular (1) novel polymorphisms were identified by direct sequencing of wolf and dog samples, (2) allelic distributions and pairwise linkage disequilibrium patterns of several canine populations were compared, (3) neighbor joining (NJ) tree based on common single nucleotide polymorphisms (SNPs) was constructed, (4) mRNA expression features were assessed, (5) a novel splice variant was detected and (6) in vitro functional assays were performed. Results indicate marked differences regarding Oxtr variations between purebred dogs of different breeds, free-ranging dog populations, wolf subspecies and golden jackals. This, together with existence of explicitly dog-specific alleles and data obtained from the NJ tree implies that Oxtr could indeed have been a target gene during domestication and selection for human preferred aspects of temperament and social behavior. This assumption is further supported by the present observations on gene expression patterns within the brain and luciferase reporter experiments, providing a molecular level link between certain canine Oxtr polymorphisms and differences in nervous system function and behavior. © 2016 John Wiley & Sons Ltd and International Behavioural and Neural Genetics Society.

Neuropsychiatric Genetics of Happiness, Friendships, and Politics: Hypothesizing Homophily (“Birds of a Feather Flock Together”) as a Function of Reward Gene Polymorphisms

PubMed Central

Blum, Kenneth; Oscar-Berman, Marlene; Bowirrat, Abdalla; Giordano, John; Madigan, Margaret; Braverman, Eric R.; Barh, Debmayla; Hauser, Mary; Borsten, Joan; Simpatico, Thomas

2013-01-01

Mindful of the new evolutionary ideas related to an emerging scientific focus known as omics, we propose that spiritual, social, and political behaviors may be tied in part to inheritable reward gene polymorphisms, as has been demonstrated for the addictions. If so, analyses of gene polymorphisms may assist in predicting liberalism or conservatism in partisan attachments. For example, both drinking (alcohol) and obesity seem to cluster in large social networks and are influenced by friends having the same genotype, in particular the DRD2 A1 allele. Likewise, voting, voting turnout and attachment to a particular political ideology is differentially related to various reward genes (e.g., 5HTT, MOA, DRD2, and DRD4), possibly predicting liberalism or conservatism. Moreover, voters’ genetic information may predict presidential outcomes more than the actual issues at hand or the presidential candidates themselves. Thus, political discussions on TV, radio, or other media may be morphed by one’s reward gene polymorphisms and as such, may explain the prevalence of generations of die-hard republicans and equally entrenched democratic legacies. Indeed, even in politics, birds of a feather (homophily) flock together. We caution that our proposal should be viewed mindfully awaiting additional research before definitive statements or conclusions can be derived from the studies to date, and we encourage large scale studies to confirm these earlier reports. PMID:23336089

Association of heat shock protein70-2 (HSP70-2) gene polymorphism with coronary artery disease in an Iranian population.

PubMed

Mardan-Nik, Maryam; Pasdar, Alireza; Jamialahmadi, Khadijeh; Biabangard-Zak, Atefeh; Mirhafez, Seyed Reza; Ghalandari, Marzieh; Tajfard, Mohammad; Mohebati, Mohsen; Esmaily, Habibollah; Ferns, Gordon A; Ghayour-Mobarhan, Majid

2014-10-25

Coronary artery disease (CAD) is an inflammatory process and a major cause of mortality and morbidity. The (heat shock protein70-2) HSP70-2 gene is reported to be associated with coronary artery disease possibly by affecting the regulation of pro-inflammatory cytokines such as TNF-α. The association between CAD and the HSP70-2 gene +1267A>G polymorphism has been studied in some populations but there are no data about this association in the Iranian population. We have investigated the association between the HSP70-2 gene +1267A>G polymorphism and angiographically defined CAD within an Iranian population. We determined the presence of the HSP70-2 gene +1267A>G polymorphism in 628 patients with CAD and 307 healthy individuals using PCR-RFLP. Of the patients, 433 (68%) had >50% stenosis (CAD+) and the remaining 195 patients had <50% stenosis (CAD-), based on coronary angiography. Angiogram positive patients were subdivided into three groups: those with single (n=113), double (n=134), and triple vessels (n=186) disease. A significant higher frequency of AG+GG genotypes (G allele carriers) was observed in angiogram positive and angiogram negative groups compared to controls in a dominant analysis model of the HSP70-2 gene +1267A>G position (51.2 vs. 43.2, P=0.002, OR=1.37) (51.0 vs. 43.2, P=0.01, OR=1.37). The allele frequency of the HSP70-2 G was also significantly higher in angiogram positive and angiogram negative groups compared to the control group (51.2 vs. 43.2, P=0.002, OR=1.37) (51.0 vs. 43.2, P=0.01, OR=1.37). These results suggest that HSP70-2 +1267 polymorphism may influence the risk of CAD in Iranian population, however further studies are needed to clarify the role of other HSP70-2 gene polymorphisms in the pathogenesis of the CAD. Copyright © 2014 Elsevier B.V. All rights reserved.

Influence of haplotypes, gene expression and soluble levels of L-selectin on the risk of acute coronary syndrome.

PubMed

Sandoval-Pinto, Elena; Padilla-Gutiérrez, Jorge Ramón; Hernández-Bello, Jorge; Martínez-Fernández, Diana Emilia; Valdés-Alvarado, Emmanuel; Muñoz-Valle, José Francisco; Flores-Salinas, H E; Valle, Yeminia

2017-08-20

L-selectin gene (SELL) is a candidate gene for the development of acute coronary syndrome (ACS) that contributes to endothelial dysfunction. The -642C>T (rs2205849) and 725C>T (rs2229569) polymorphisms have been associated with changes in gene expression, ligand affinity and increased risk of cardiovascular disease. The aim of this study was to investigate the association between the haplotypes constructed with the -642C>T and 725C>T polymorphisms of the SELL gene, the expression levels of its mRNA and the serum levels of soluble L-selectin with ACS. We recruited 615 individuals of Mexican origin matched by age, including 342 patients with ACS and 273 individuals without personal history of ischemic cardiopathy as control group (CG). Genotyping was performed by PCR-RFLP. The qPCR technique was used to analyze the expression of mRNA using TaqMan® UPL probes. The levels of soluble L-selectin were measured with ELISA. The allele variants in both polymorphisms were over-represented in the CG compared to the ACS (OR range: 0.371-0.716, p<0.006). The CT and TT haplotypes had a protective effect against the development of ACS (OR=0.401, p<0.0001; OR=0.628, p<0.0001, respectively). SELL expression was 3.076 times higher in the ACS group compared to CG (p<0.001). The levels of soluble L-selectin were similar between ACS and CG. Both polymorphisms had no effect on mRNA expression and soluble protein levels. The polymorphisms -642C>T and 725C>T of the SELL gene are protective factors against the development of ACS. There is an increased gene expression of L-selectin in ACS compared to CG in the population of Western Mexico. Copyright © 2017 Elsevier B.V. All rights reserved.

Epistatic Effects of Polymorphisms in Genes from the Renin-Angiotensin, Bradykinin, and Fibrinolytic Systems on Plasma t-PA and PAI-1 Levels

PubMed Central

Asselbergs, Folkert W.; Williams, Scott M.; Hebert, Patricia R.; Coffey, Christopher S.; Hillege, Hans L.; Navis, Gerjan; Vaughan, Douglas E.; van Gilst, Wiek H.; Moore, Jason H.

2007-01-01

Tissue plasminogen activator (t-PA) and plasminogen activator inhibitor 1 (PAI-1) directly influence thrombus formation and degradation and thereby risk for arterial thrombosis. Activation of the renin-angiotensin system has been linked to the production of PAI-1 expression via the angiotensin II type 1 receptor (AT1R). In addition, bradykinin can induce the release of t-PA through a B2 receptor mechanism. In the present study, we aimed to investigate the epistatic effects of polymorphisms in genes from the renin-angiotensin, bradykinin and fibrinolytic systems on plasma t-PA and PAI-1 levels in a large population-based sample (n=2,527). We demonstrated a strong significant interaction within genetic variations of the bradykinin B2 gene (p=0.002) and between ACE and bradykinin B2 (p=0.003) polymorphisms on t-PA levels in females. In males, polymorphisms in the bradykinin B2 and AT1R gene showed the most strong effect on t-PA levels (p=0.006). In both females as well as males, the bradykinin B2 gene interacted with AT1R gene on plasma PAI-1 levels (p=0.026 and p=0.039, respectively). In addition, the current study found a borderline significant interaction between PAI 4G5G and ACE I/D on plasma t-PA and PAI-1 levels. These results support the idea that the interplay between the renin-angiotensin, bradykinin, and fibrinolytic systems might play an important role in t-PA and PAI-1 biology. PMID:17207964

Fas/FasL gene polymorphism in patients with Hashimoto's thyroiditis in Turkish population.

PubMed

Erdogan, M; Kulaksizoglu, M; Ganidagli, S; Berdeli, A

2017-01-01

Hashimoto's disease is a polygenic disorder with complex etiopathogenesis. Apoptosis is proposed as one of its mechanisms. The Fas/Fas ligand cascade represents a major pathway initiating apoptosis. This study aims to evaluate the influence of Fas and FasL gene polymorphism in Hashimoto's thyroiditis in Turkish population. A total of 112 patients with Hashimoto's thyroiditis and 112 cases of healthy control people were included in this study. The evaluation of genotype for Fas -670 A/G and FasL 843 C/T gene polymorphism was performed by using PCR-RFLP method. The FAS genotype and gene allele frequency distribution did differ between the control group (AA 36.6 %, AG 50.0 %, GG 13.4 %, A 61.6 %, G 38.4 %) and the Hashimoto's thyroiditis patients (AA 21.4 %, AG 50.9 %, GG 27.7 %, A 46.9 %, G 53.1 %) (p < 0.01). The evaluation of FasL genotype and gene allele frequency did not show statistically significant difference between the patient group (CC 27.7 %, CT 45.5 %, TT 26.8 %, C 50.4 %, T 49.6 %) and control group (CC 33.9 %, CT 44.6 %, TT 21,4 %, C 56.3 %, T 43.8 %) (p > 0.05). Gene polymorphism of Fas and G allele frequency may play a role in the regulation of apoptosis in thyroid autoimmune disorders. There is a need for further studies to clarify the genetic role of apoptosis in HT.

Red Blood Cell Polymorphism and Susceptibility to Plasmodium vivax

PubMed Central

Zimmerman, Peter A.; Ferreira, Marcelo U.; Howes, Rosalind E.; Mercereau-Puijalon, Odile

2013-01-01

Resistance to Plasmodium vivax blood-stage infection has been widely recognised to result from absence of the Duffy (Fy) blood group from the surface of red blood cells (RBCs) in individuals of African descent. Interestingly, recent studies from different malaria-endemic regions have begun to reveal new perspectives on the association between Duffy gene polymorphism and P. vivax malaria. In Papua New Guinea and the Americas, heterozygous carriers of a Duffy-negative allele are less susceptible to P. vivax infection than Duffy-positive homozygotes. In Brazil, studies show that the Fya antigen, compared to Fyb, is associated with lower binding to the P. vivax Duffy-binding protein and reduced susceptibility to vivax malaria. Additionally, it is interesting that numerous studies have now shown that P. vivax can infect RBCs and cause clinical disease in Duffy-negative people. This suggests that the relationship between P. vivax and the Duffy antigen is more complex than customarily described. Evidence of P. vivax Duffy-independent red cell invasion indicates that the parasite must be evolving alternative red cell invasion pathways. In this chapter, we review the evidence for P. vivax Duffy-dependent and Duffy-independent red cell invasion. We also consider the influence of further host gene polymorphism associated with malaria endemicity on susceptibility to vivax malaria. The interaction between the parasite and the RBC has significant potential to influence the effectiveness of P. vivax-specific vaccines and drug treatments. Ultimately, the relationships between red cell polymorphisms and P. vivax blood-stage infection will influence our estimates on the population at risk and efforts to eliminate vivax malaria. PMID:23384621

The influence of COMT Val158Met genotype on the character dimension cooperativeness in healthy females

PubMed Central

Baeken, Chris; Claes, Stephan; De Raedt, Rudi

2014-01-01

Objectives Although the Val158Met catechol-O-methyltransferase (COMT) gene has been linked with the temperament dimension Novelty Seeking (NS), new insights in this polymorphism might point to a major role for character features as well. Given that individual life experiences may influence Val158 and Met158 allele carriers differently it has been suggested that the character trait cooperativeness could be implicated. Case report A homogeneous group of eighty right-handed Caucasian healthy female university students were assessed with the TCI and genotyped for the COMT Val158Met polymorphism (rs4680). Gene determination showed that eighteen were Val158 homozygotes, forty-four Val/Met158 heterozygotes, and eighteen were Met158 homozygotes. All were within the same age range and never documented to have suffered from any neuropsychiatric illness. Bonferroni corrected non-parametric analyses showed that only for the character scale cooperativeness Val158 homozygotes displayed significant higher scores when compared to Met158 homozygotes. No significant differences on cooperativeness scores were found between Val158 and Val/Met158 carriers or between Met158 and Val/Met158 carriers. No differences were observed for the COMT Val158Met polymorphism and the other temperament and character scales. Conclusions Our findings support the assumption that the Val158Met single nucleotide polymorphism (SNP) influences character traits and not only temperament. Our results add to the notion that Val158 homozygotes are considered to be helpful and empathic and it suggest that these cooperativeness character traits are related to the dopaminergic system. PMID:25161818

The influence of COMT Val¹⁵⁸Met genotype on the character dimension cooperativeness in healthy females.

PubMed

Baeken, Chris; Claes, Stephan; De Raedt, Rudi

2014-07-01

Although the Val(158)Met catechol-O-methyltransferase (COMT) gene has been linked with the temperament dimension Novelty Seeking (NS), new insights in this polymorphism might point to a major role for character features as well. Given that individual life experiences may influence Val(158) and Met(158) allele carriers differently it has been suggested that the character trait cooperativeness could be implicated. A homogeneous group of eighty right-handed Caucasian healthy female university students were assessed with the TCI and genotyped for the COMT Val(158)Met polymorphism (rs4680). Gene determination showed that eighteen were Val(158) homozygotes, forty-four Val/Met(158) heterozygotes, and eighteen were Met(158) homozygotes. All were within the same age range and never documented to have suffered from any neuropsychiatric illness. Bonferroni corrected non-parametric analyses showed that only for the character scale cooperativeness Val(158) homozygotes displayed significant higher scores when compared to Met(158) homozygotes. No significant differences on cooperativeness scores were found between Val(158) and Val/Met(158) carriers or between Met(158) and Val/Met(158) carriers. No differences were observed for the COMT Val(158)Met polymorphism and the other temperament and character scales. Our findings support the assumption that the Val(158)Met single nucleotide polymorphism (SNP) influences character traits and not only temperament. Our results add to the notion that Val(158) homozygotes are considered to be helpful and empathic and it suggest that these cooperativeness character traits are related to the dopaminergic system.

Polymorphisms in dopaminergic system genes; association with criminal behavior and self-reported aggression in violent prison inmates from Pakistan.

PubMed

Qadeer, Muhammad Imran; Amar, Ali; Mann, J John; Hasnain, Shahida

2017-01-01

Genetic factors contribute to antisocial and criminal behavior. Dopamine transporter DAT-1 (SLC6A3) and DRD2 gene for the dopamine-2 receptor are dopaminergic system genes that regulate dopamine reuptake and signaling, and may be part of the pathogenesis of psychiatric disorders including antisocial behaviors and traits. No previous studies have analyzed DAT-1 and DRD2 polymorphisms in convicted murderers, particularly from Indian subcontinent. In this study we investigated the association of 40 bp VNTR polymorphism of DAT-1 and Taq1 variant of DRD2 gene (rs1800479) with criminal behavior and self-reported aggression in 729 subjects, including 370 men in Pakistani prisons convicted of first degree murder(s) and 359 control men without any history of violence or criminal tendency. The 9R allele of DAT-1 VNTR polymorphism was more prevalent in convicted murderers compared with control samples, for either one or two risk alleles (OR = 1.49 and 3.99 respectively, P = 0.003). This potential association of DAT-1 9R allele polymorphism with murderer phenotype was confirmed assuming different genetic models of inheritance. However, no genetic association was found for DRD2 Taq1 polymorphism. In addition, a combined haplotype (9R-A2) of DAT-1 and DRD2 genes was associated with this murderer phenotype. Further, 9R allele of DAT-1 was also associated with response to verbal abuse and parental marital complications, but not with other measures pertinent to self-reported aggression. These results suggest that 9R allele, which may influence levels of intra-synaptic dopamine in the brain, may contribute to criminal tendency in this sample of violent murderers of Pakistani origin. Future studies are needed to replicate this finding in other populations of murderers and see if this finding extends to other forms of violence and lesser degrees of aggression.

Polymorphisms in dopaminergic system genes; association with criminal behavior and self-reported aggression in violent prison inmates from Pakistan

PubMed Central

Qadeer, Muhammad Imran; Amar, Ali; Mann, J. John; Hasnain, Shahida

2017-01-01

Genetic factors contribute to antisocial and criminal behavior. Dopamine transporter DAT-1 (SLC6A3) and DRD2 gene for the dopamine-2 receptor are dopaminergic system genes that regulate dopamine reuptake and signaling, and may be part of the pathogenesis of psychiatric disorders including antisocial behaviors and traits. No previous studies have analyzed DAT-1 and DRD2 polymorphisms in convicted murderers, particularly from Indian subcontinent. In this study we investigated the association of 40 bp VNTR polymorphism of DAT-1 and Taq1 variant of DRD2 gene (rs1800479) with criminal behavior and self-reported aggression in 729 subjects, including 370 men in Pakistani prisons convicted of first degree murder(s) and 359 control men without any history of violence or criminal tendency. The 9R allele of DAT-1 VNTR polymorphism was more prevalent in convicted murderers compared with control samples, for either one or two risk alleles (OR = 1.49 and 3.99 respectively, P = 0.003). This potential association of DAT-1 9R allele polymorphism with murderer phenotype was confirmed assuming different genetic models of inheritance. However, no genetic association was found for DRD2 Taq1 polymorphism. In addition, a combined haplotype (9R-A2) of DAT-1 and DRD2 genes was associated with this murderer phenotype. Further, 9R allele of DAT-1 was also associated with response to verbal abuse and parental marital complications, but not with other measures pertinent to self-reported aggression. These results suggest that 9R allele, which may influence levels of intra-synaptic dopamine in the brain, may contribute to criminal tendency in this sample of violent murderers of Pakistani origin. Future studies are needed to replicate this finding in other populations of murderers and see if this finding extends to other forms of violence and lesser degrees of aggression. PMID:28582390

Serotonin transporter promoter polymorphism and monoamine oxidase type A VNTR allelic variants together influence alcohol binge drinking risk in young women.

PubMed

Herman, Aryeh I; Kaiss, Kristi M; Ma, Rui; Philbeck, John W; Hasan, Asfar; Dasti, Humza; DePetrillo, Paolo B

2005-02-05

The short allelic variant of the serotonin transporter protein promoter polymorphism (5HTTLPR) appears to influence binge drinking in college students. Both monoamine oxidase type A (MAOA) and the serotonin transporter protein are involved in the processing of serotonin, and allelic variants are both associated with differences in the efficiency of expression. We hypothesized that a significant gene x gene interaction would further stratify the risk of binge drinking in this population. Participants were college students (n = 412) who completed the College Alcohol Study, used to measure binge drinking behaviors. Genomic DNA was extracted from saliva for PCR based genotyping. The risk function for binge drinking was modeled using logistic regression, with final model fit P < 0.0005. This model was valid only for Caucasian females (n = 223), but the power to detect sex and ethnic effects was small. Young Caucasian women carrying higher expression MAOA VNTR alleles homozygous for the short allelic variant of the 5HTTLPR demonstrated the highest rate of binge drinking by self-report, odds ratio (genotype odds: population odds) and 95% confidence intervals, 3.11 (1.14-18.10). Individuals carrying higher expression MAOA VNTR alleles carrying at least one long 5HTTLPR allelic variant had the lowest risk of binge drinking 0.46 (0.28-0.71). These results support the hypothesis that binge drinking behavior in young adulthood may be influenced by neurobiological differences in serotonergic function conferred by functional polymorphisms in genes involved in serotonin processing. (c) 2004 Wiley-Liss, Inc.

Recipient But Not Donor Adiponectin Polymorphisms Are Associated With Early Posttransplant Hepatic Steatosis in Patients Transplanted for Non-Nonalcoholic Fatty Liver Disease Indications.

PubMed

John, Binu V; Aiken, Taylor; Garber, Ari; Thomas, Dawn; Lopez, Rocio; Patil, Deepa; Konjeti, Venkata Rajesh; Fung, John J; McCollough, Arthur J; Askar, Medhat

2018-06-01

De novo steatosis after liver transplant is common and can occur in up to one-third of patients who are transplanted for liver disease other than for nonalcoholic fatty liver disease. Genetic factors may influence posttransplant steatosis; in a posttransplant setting, donor or recipient genetic factors could also play roles. Genetic polymorphisms in the adiponectin gene have been associated with metabolic syndrome in the pretransplant setting. We aimed to assess the association between donor and recipient adiponectin polymorphisms and early posttransplant hepatic steatosis identified on liver biopsies. Clinical data were collected for 302 liver transplant patients who underwent protocol biopsies for hepatitis C. Of these, 111 patients had available biopsies and donor/recipient DNA. Patients with grade 1 steatosis or greater (35% of patients) were compared with patients without posttransplant steatosis with respect to clinical features and donor/recipient adiponectin polymorphism genotypes. Patients who developed posttransplant steatosis and those without steatosis were similar with respect to individual components of metabolic syndrome. The adiponectin polymorphisms rs1501299 G/G and rs17300539 G/G genotypes in recipients were associated with early posttransplant graft steatosis. We found no associations between graft steatosis and donor adiponectin polymorphisms. Genetic polymorphisms in the adiponectin gene of recipients (but not donors) are associated with early de novo posttransplant hepatic steatosis, independent of components of metabolic syndrome.

Population differentiation and behavioural association of the two 'personality' genes DRD4 and SERT in dunnocks (Prunella modularis).

PubMed

Holtmann, B; Grosser, S; Lagisz, M; Johnson, S L; Santos, E S A; Lara, C E; Robertson, B C; Nakagawa, S

2016-02-01

Quantifying the variation in behaviour-related genes within and between populations provides insight into how evolutionary processes shape consistent behavioural traits (i.e. personality). Deliberate introductions of non-native species offer opportunities to investigate how such genes differ between native and introduced populations and how polymorphisms in the genes are related to variation in behaviour. Here, we compared the genetic variation of the two 'personality' genes, DRD4 and SERT, between a native (United Kingdom, UK) and an introduced (New Zealand, NZ) population of dunnocks, Prunella modularis. The NZ population showed a significantly lower number of single nucleotide polymorphisms (SNPs) compared to the UK population. Standardized F'st estimates of the personality genes and neutral microsatellites indicate that selection (anthropogenic and natural) probably occurred during and post the introduction event. Notably, the largest genetic differentiation was found in the intronic regions of the genes. In the NZ population, we also examined the association between polymorphisms in DRD4 and SERT and two highly repeatable behavioural traits: flight-initiation distance and mating status (promiscuous females and cobreeding males). We found 38 significant associations (for different allele effect models) between the two behavioural traits and the studied genes. Further, 22 of the tested associations showed antagonistic allele effects for males and females. Our findings illustrate how introduction events and accompanying ecological changes could influence the genetic diversity of behaviour-related genes. © 2015 John Wiley & Sons Ltd.

Lack of Association of Estrogen Receptor Alpha Gene Polymorphisms with Cardiorespiratory and Metabolic Variables in Young Women

PubMed Central

Rebelo, Ana Cristina; Verlengia, Rozangela; Kunz, Vandeni; Tamburus, Nayara; Cerda, Alvaro; Hirata, Rosario; Hirata, Mario; Silva, Ester

2012-01-01

This study examined the association of estrogen receptor alpha gene (ESR1) polymorphisms with cardiorespiratory and metabolic parameters in young women. In total, 354 healthy women were selected for cardiopulmonary exercise testing and short-term heart rate (HR) variability (HRV) evaluation. The HRV analysis was determined by the temporal indices rMSSD (square root of the mean squared differences of successive R–R intervals (RRi) divided by the number of RRi minus one), SDNN (root mean square of differences from mean RRi, divided by the number of RRi) and power spectrum components by low frequency (LF), high frequency (HF) and LF/HF ratio. Blood samples were obtained for serum lipids, estradiol and DNA extraction. ESR1 rs2234693 and rs9340799 polymorphisms were analyzed by PCR and fragment restriction analysis. HR and oxygen uptake (VO2) values did not differ between the ESR1 polymorphisms with respect to autonomic modulation. We not find a relationship between ESR1 T–A, T–G, C–A and C–G haplotypes and cardiorespiratory and metabolic variables. Multiple linear regression analysis demonstrated that VO2, total cholesterol and triglycerides influence HRV (p < 0.05). The results suggest that ESR1 variants have no effect on cardiorespiratory and metabolic variables, while HRV indices are influenced by aerobic capacity and lipids in healthy women. PMID:23202974

The Influence of DAT1, COMT, and BDNF Genetic Polymorphisms on Total and Subregional Hippocampal Volumes in Early Onset Heavy Cannabis Users

PubMed Central

Batalla, Albert; Lorenzetti, Valentina; Chye, Yann; Yücel, Murat; Soriano-Mas, Carles; Bhattacharyya, Sagnik; Torrens, Marta; Crippa, José A.S.; Martín-Santos, Rocío

2018-01-01

Abstract Introduction: Hippocampal neuroanatomy is affected by genetic variations in dopaminergic candidate genes and environmental insults, such as early onset of chronic cannabis exposure. Here, we examine how hippocampal total and subregional volumes are affected by cannabis use and functional polymorphisms of dopamine-relevant genes, including the catechol-O-methyltransferase (COMT), dopamine transporter (DAT1), and the brain-derived neurotrophic factor (BDNF) genes. Material and Methods: We manually traced total hippocampal volumes and automatically segmented hippocampal subregions using high-resolution MRI images, and performed COMT, DAT1, and BDNF genotyping in 59 male Caucasian young adults aged 18–30 years. These included 30 chronic cannabis users with early-onset (regular use at <16 years) and 29 age-, education-, and intelligence-matched controls. Results: Cannabis use and dopaminergic gene polymorphism had both distinct and interactive effects on the hippocampus. We found emerging alterations of hippocampal total and specific subregional volumes in cannabis users relative to controls (i.e., CA1, CA2/3, and CA4), and associations between cannabis use levels and total and specific subregional volumes. Furthermore, total hippocampal volume and the fissure subregion were affected by cannabis×DAT1 polymorphism (i.e., 9/9R and in 10/10R alleles), reflecting high and low levels of dopamine availability. Conclusion: These findings suggest that cannabis exposure alters the normal relationship between DAT1 polymorphism and the anatomy of total and subregional hippocampal volumes, and that specific hippocampal subregions may be particularly affected. PMID:29404409

The Influence of DAT1, COMT, and BDNF Genetic Polymorphisms on Total and Subregional Hippocampal Volumes in Early Onset Heavy Cannabis Users.

PubMed

Batalla, Albert; Lorenzetti, Valentina; Chye, Yann; Yücel, Murat; Soriano-Mas, Carles; Bhattacharyya, Sagnik; Torrens, Marta; Crippa, José A S; Martín-Santos, Rocío

2018-01-01

Introduction: Hippocampal neuroanatomy is affected by genetic variations in dopaminergic candidate genes and environmental insults, such as early onset of chronic cannabis exposure. Here, we examine how hippocampal total and subregional volumes are affected by cannabis use and functional polymorphisms of dopamine-relevant genes, including the catechol-O-methyltransferase (COMT), dopamine transporter (DAT1), and the brain-derived neurotrophic factor (BDNF) genes. Material and Methods: We manually traced total hippocampal volumes and automatically segmented hippocampal subregions using high-resolution MRI images, and performed COMT, DAT1, and BDNF genotyping in 59 male Caucasian young adults aged 18-30 years. These included 30 chronic cannabis users with early-onset (regular use at <16 years) and 29 age-, education-, and intelligence-matched controls. Results: Cannabis use and dopaminergic gene polymorphism had both distinct and interactive effects on the hippocampus. We found emerging alterations of hippocampal total and specific subregional volumes in cannabis users relative to controls (i.e., CA1, CA2/3, and CA4), and associations between cannabis use levels and total and specific subregional volumes. Furthermore, total hippocampal volume and the fissure subregion were affected by cannabis×DAT1 polymorphism (i.e., 9/9R and in 10/10R alleles), reflecting high and low levels of dopamine availability. Conclusion: These findings suggest that cannabis exposure alters the normal relationship between DAT1 polymorphism and the anatomy of total and subregional hippocampal volumes, and that specific hippocampal subregions may be particularly affected.

Multilocus patterns of polymorphism and selection across the X chromosome of Caenorhabditis remanei.

PubMed

Cutter, Asher D

2008-03-01

Natural selection and neutral processes such as demography, mutation, and gene conversion all contribute to patterns of polymorphism within genomes. Identifying the relative importance of these varied components in evolution provides the principal challenge for population genetics. To address this issue in the nematode Caenorhabditis remanei, I sampled nucleotide polymorphism at 40 loci across the X chromosome. The site-frequency spectrum for these loci provides no evidence for population size change, and one locus presents a candidate for linkage to a target of balancing selection. Selection for codon usage bias leads to the non-neutrality of synonymous sites, and despite its weak magnitude of effect (N(e)s approximately 0.1), is responsible for profound patterns of diversity and divergence in the C. remanei genome. Although gene conversion is evident for many loci, biased gene conversion is not identified as a significant evolutionary process in this sample. No consistent association is observed between synonymous-site diversity and linkage-disequilibrium-based estimators of the population recombination parameter, despite theoretical predictions about background selection or widespread genetic hitchhiking, but genetic map-based estimates of recombination are needed to rigorously test for a diversity-recombination relationship. Coalescent simulations also illustrate how a spurious correlation between diversity and linkage-disequilibrium-based estimators of recombination can occur, due in part to the presence of unbiased gene conversion. These results illustrate the influence that subtle natural selection can exert on polymorphism and divergence, in the form of codon usage bias, and demonstrate the potential of C. remanei for detecting natural selection from genomic scans of polymorphism.

Functional characterization of naturally occurring melittin peptide isoforms in two honey bee species, Apis mellifera and Apis cerana.

PubMed

Park, Doori; Jung, Je Won; Lee, Mi Ok; Lee, Si Young; Kim, Boyun; Jin, Hye Jun; Kim, Jiyoung; Ahn, Young-Joon; Lee, Ki Won; Song, Yong Sang; Hong, Seunghun; Womack, James E; Kwon, Hyung Wook

2014-03-01

Insect-derived antimicrobial peptides (AMPs) have diverse effects on antimicrobial properties and pharmacological activities such as anti-inflammation and anticancer properties. Naturally occurring genetic polymorphism have a direct and/or indirect influence on pharmacological effect of AMPs, therefore information on single nucleotide polymorphism (SNP) occurring in natural AMPs provides an important clue to therapeutic applications. Here we identified nucleotide polymorphisms in melittin gene of honey bee populations, which is one of the potent AMP in bee venoms. We found that the novel SNP of melittin gene exists in these two honey bee species, Apis mellifera and Apis cerana. Nine polymorphisms were identified within the coding region of the melittin gene, of which one polymorphism that resulted in serine (Ser) to asparagine (Asp) substitution that can potentially effect on biological activities of melittin peptide. Serine-substituted melittin (Mel-S) showed more cytotoxic effect than asparagine-substituted melittin (Mel-N) against E. coli. Also, Mel-N and Mel-S had different inhibitory effects on the production of inflammatory factors such as IL-6 and TNF-α in BV-2 cells. Moreover, Mel-S showed stronger cytotoxic activities than Mel-N peptide against two human ovarian cancer cell lines. Using carbon nanotube-based transistor, we here characterized that Mel-S interacted with small unilamellar liposomes more strongly than Mel-N. Taken together, our present study demonstrates that there exist different characteristics of the gene frequency and the biological activities of the melittin peptide in two honey bee species, Apis mellifera and A. cerana. Copyright © 2014 Elsevier Inc. All rights reserved.

Common rs5918 (PlA1/A2) polymorphism in the ITGB3 gene and risk of coronary artery disease

PubMed Central

Heidari, Mohammad Mehdi; Soheilyfar, Sorour

2016-01-01

Introduction The T to C transition at nucleotide 1565 of the human glycoprotein IIIa (ITGB3) gene represents a genetic polymorphism (PlA1/A2) that can influence both platelet activation and aggregation and that has been associated with many types of disease. Here, we present a newly designed multiplex tetra-primer amplification refractory mutation system – polymerase chain reaction (T-ARMS-PCR) for genotyping a single nucleotide polymorphism (SNP) (dbSNP ID: rs5918) in the human ITGB3 gene. Material and methods We set up T-ARMS-PCR for the rs5918 SNP in a single-step PCR and the results were validated by the PCR-RFLP method in 132 coronary artery disease (CAD) patients and 122 unrelated healthy individuals. Results Full accordance was found for genotype determination by the PCR-RFLP method. The multiple logistic regression analysis showed a significant association of the rs5918 polymorphism and CAD according to dominant and recessive models (dominant model OR: 2.40, 95% CI: 1.33–4.35; p = 0.003, recessive model OR: 4.71, 95% CI: 1.32–16.80; p = 0.0067). Conclusions Our T-ARMS-PCR in comparison with RFLP and allele-specific PCR is more advantageous because this PCR method allows the evaluation of both the wild type and the mutant allele in the same tube. Our results suggest that the rs5918 (PlA1/A2) polymorphism in the ITGB3 gene may contribute to the susceptibility of sporadic Iranian coronary artery disease (CAD) patients. PMID:28905013

Impact of CYP2E1, GSTA1 and GSTP1 gene variants on serum alpha glutathione S-transferase level in patients undergoing anaesthesia.

PubMed

Mikstacki, Adam; Skrzypczak-Zielinska, Marzena; Zakerska-Banaszak, Oliwia; Tamowicz, Barbara; Skibinska, Maria; Molinska-Glura, Marta; Szalata, Marlena; Slomski, Ryszard

2016-05-14

The serum glutathione S-transferase alpha (α-GST) concentration has been used as a marker of hepatic condition. After sevoflurane anaesthesia a mild impairment of hepatocellular integrity was observed. Genetic polymorphisms in CYP2E1, GSTA1 and GSTP1 genes, affecting enzymes activity, may possibly influence the hepatotoxic effect of sevoflurane. The aim of this study was to assess the influence of genetic polymorphism of CYP2E1, GSTA1 and GSTP1 genes on serum α-GST level in 86 unrelated patients representing ASA physical status I-II, undergoing laryngological surgery under general anaesthesia with sevoflurane. The serum samples from three perioperative time points were analyzed using ELISA. Genetic variants were detected by pyrosequencing and sequencing. Finally, the statistical associations between serum α-GST concentration and analyzed alleles of CYP2E1, GSTP1 and GSTA1 genes were estimated. The allele GSTA1*B (-567G, -69T, -52A) frequency was 0.43, whereas the alleles c.313G and c.341T of GSTP1 were identified with frequencies of 0.28 and 0.1 respectively. The -1053T allele of the CYP2E1 gene was observed with 0.01 frequency. We found serum α-GST concentrations in homozygous changes c.313A>G and c.341C>T of the GSTP1 gene significantly higher at the end of anaesthesia as compared with the levels at pre-anaesthetic and 24 h post-anaesthetic time points. Moreover, GSTA1 wild type genotype was associated with increased α-GST concentration at 24 h after the end of anaesthesia. GSTP1 gene polymorphism has an impact on the perioperative serum α-GST concentration in patients undergoing sevoflurane anaesthesia. A similar association, although not statistically significant exists between GSTA1 gene variants and perioperative serum α-GST level.

IL-17 and IL-22 genetic polymorphisms in HBV vaccine non- and low-responders among healthcare workers

PubMed Central

Borzooy, Zohreh; Streinu-Cercel, Adrian; Mirshafiey, Abbass; Khamseh, Azam; Mahmoudie, Masoud Karkhaneh; Navabi, Shadi Sadat; Nosrati, Marjan; Najafi, Zahra; Hosseini, Mostafa; Jazayeri, Seyed Mohammad

2016-01-01

Background Healthcare workers constitute a population at high risk for HBV infection. Efficient vaccination options are available; however, the individual response to HBV vaccination may vary widely between subjects, potentially due to cytokine profiles and genetic variations. In the present study, we investigated the relationship between IL-17 and IL-22 gene polymorphisms versus non- and low-responsiveness to HBV vaccination in healthcare workers. Methods We selected the following IL-17 and IL-22 polymorphisms: rs4711998 (A/G) from IL-17 and rs2227501 (A/T), rs2227503 (A/G), rs1026786 (A/G) from IL-22 sequences genes. These were determined by polymerase chain reaction restriction fragment length polymorphisms. Results The IL-17 rs4711998 GG genotype had a significantly lower frequency in non-responders compared to low-responders (p=0.025). However, we did not identify a relationship between IL-22 rs1026780, rs2227501 and rs2227503 genotypes and the anti-HBs response following HBV vaccination. Conclusion These data suggest that genetic variation in rs4711998 polymorphisms in the IL-17 cytokine may influence vaccine-induced immune responses to HBV vaccine in healthcare workers. PMID:27019828

CYP3A5 and ABCB1 polymorphisms influence tacrolimus concentrations in peripheral blood mononuclear cells after renal transplantation.

PubMed

Capron, Arnaud; Mourad, Michel; De Meyer, Martine; De Pauw, Luc; Eddour, Djamila Chaib; Latinne, Dominique; Elens, Laure; Haufroid, Vincent; Wallemacq, Pierre

2010-05-01

This prospective study investigated the effect of genetic polymorphisms in a biotransformation enzyme (CYP3A5) and a transporter protein (ABCB1) on tacrolimus (Tac) whole blood concentrations in renal transplantation, and more specifically on peripheral blood mononuclear cell (PBMC) drug concentrations, after renal transplantation. A total of 96 renal transplant recipients were genotyped for the exon 11 (1199G>A), 21 (3435C>T) and 26 (2677G>T/A) polymorphisms in the ABCB1 gene and for the intron 3 polymorphism in the CYP3A5 gene. Tac blood and PBMC concentrations were determined at day 7 after transplantation and at steady state, and then compared with recipient genotypes. The ABCB1 1199G>A, 3435C>T and 2677G>T/A SNPs, appeared to reduce the activity of P-glycoprotein towards Tac, increasing Tac PBMC concentrations. The impact of ABCB1 genetic polymorphisms on Tac blood concentrations was negligible. As increased Tac intracellular concentrations might in turn enhance immunosuppressive status and prevention or rejection, ABCB1 recipient genotyping might be useful to better individualize the Tac immunosuppressive therapy in renal transplantation.

Genetic variants in the cell cycle control pathways contribute to early onset colorectal cancer in Lynch syndrome.

PubMed

Chen, Jinyun; Etzel, Carol J; Amos, Christopher I; Zhang, Qing; Viscofsky, Nancy; Lindor, Noralane M; Lynch, Patrick M; Frazier, Marsha L

2009-11-01

Lynch syndrome is an autosomal dominant syndrome of familial malignancies resulting from germ line mutations in DNA mismatch repair (MMR) genes. Our goal was to take a pathway-based approach to investigate the influence of polymorphisms in cell cycle-related genes on age of onset for Lynch syndrome using a tree model. We evaluated polymorphisms in a panel of cell cycle-related genes (AURKA, CDKN2A, TP53, E2F2, CCND1, TP73, MDM2, IGF1, and CDKN2B) in 220 MMR gene mutation carriers from 129 families. We applied a novel statistical approach, tree modeling (Classification and Regression Tree), to the analysis of data on patients with Lynch syndrome to identify individuals with a higher probability of developing colorectal cancer at an early age and explore the gene-gene interactions between polymorphisms in cell cycle genes. We found that the subgroup with CDKN2A C580T wild-type genotype, IGF1 CA-repeats >or=19, E2F2 variant genotype, AURKA wild-type genotype, and CCND1 variant genotype had the youngest age of onset, with a 45-year median onset age, while the subgroup with CDKN2A C580T wild-type genotype, IGF1 CA-repeats >or=19, E2F2 wild-type genotype, and AURKA variant genotype had the latest median age of onset, which was 70 years. Furthermore, we found evidence of a possible gene-gene interaction between E2F2 and AURKA genes related to CRC age of onset. Polymorphisms in these cell cycle-related genes work together to modify the age at the onset of CRC in patients with Lynch syndrome. These studies provide an important part of the foundation for development of a model for stratifying age of onset risk among those with Lynch syndrome.

Immunogenetic biomarkers in inflammatory bowel diseases: role of the IBD3 region.

PubMed

Muro, Manuel; López-Hernández, Ruth; Mrowiec, Anna

2014-11-07

Many studies have demonstrated the linkage between the IBD3 region (6p21.1-23), an area which encompasses the famous human leukocyte antigen (HLA) complex, and Crohn's disease (CD) or ulcerative colitis (UC). IBD3 is the only region that meets genome-wide significance, and provides stronger evidence of the linkage than 16p13.1-16q12.2 (IBD1), the locus that contains the susceptibility gene CARD15. However, despite these findings, IBD3 susceptibility genes remain elusive and unclear due to the strong linkage disequilibrium, extensive polymorphism, and high gene density that characterize this area and also due to varying allele frequencies in populations around the world. This area presents an extremely high abundance of genes, including the classical and non-classical major histocompatibility complex (MHC) class I and II genes, and other genes, namely MHC class III genes tumor necrosis factor (TNF)-α and -β, and Hsp, whose proteins play key functions in immunological processes. To date, it is not clear which genes within the MHC family contribute to the IBD pathogenesis, although certain HLA alleles have been associated with IBD. Recent insights into the biological function of other genes encoded within the IBD3 region, such as the MHC class I chain-related (MIC) genes, have led investigators to a more comprehensive exploration of this region. MHC class I chain-related molecule A (MICA) is highly polymorphic and interacts with NKG2D, its receptor on the surface of NK, Tγδ and T CD8(+) cells. Increased expression of MICA in intestinal epithelial cells and increased expression of NKG2D in CD4(+) T cells (lamina propria) in patients with CD have also been reported. MICA alleles have also been associated with IBD, and a variation at amino acid position 129 of the α2-heavy chain domain seems to categorize MICA alleles into strong and weak binders of NKG2D receptor, thereby influencing the effector cells' function. In this regard, a relevant role of MICA-129-Val/Met single nucleotide polymorphism has recently been implicated in the pathogenesis of IBD. TNF-α and -β also play an important role in inflammatory response. In fact, IBD is commonly treated with TNF-α inhibitors. Additionally, polymorphisms of TNF-α gene are known to affect the gene expression level and particular TNF-α genotypes may influence the response of IBD patients treated with TNF-α inhibitors.

Sequence divergence of the red and green visual pigments in great apes and humans.

PubMed Central

Deeb, S S; Jorgensen, A L; Battisti, L; Iwasaki, L; Motulsky, A G

1994-01-01

We have determined the coding sequences of red and green visual pigment genes of the chimpanzee, gorilla, and orangutan. The deduced amino acid sequences of these pigments are highly homologous to the equivalent human pigments. None of the amino acid differences occurred at sites that were previously shown to influence pigment absorption characteristics. Therefore, we predict the spectra of red and green pigments of the apes to have wavelengths of maximum absorption that differ by < 2 nm from the equivalent human pigments and that color vision in these nonhuman primates will be very similar, if not identical, to that in humans. A total of 14 within-species polymorphisms (6 involving silent substitutions) were observed in the coding sequences of the red and green pigment genes of the great apes. Remarkably, the polymorphisms at 6 of these sites had been observed in human populations, suggesting that they predated the evolution of higher primates. Alleles at polymorphic sites were often shared between the red and green pigment genes. The average synonymous rate of divergence of red from green sequences was approximately 1/10th that estimated for other proteins of higher primates, indicating the involvement of gene conversion in generating these polymorphisms. The high degree of homology and juxtaposition of these two genes on the X chromosome has promoted unequal recombination and/or gene conversion that led to sequence homogenization. However, natural selection operated to maintain the degree of separation in peak absorbance between the red and green pigments that resulted in optimal chromatic discrimination. This represents a unique case of molecular coevolution between two homologous genes that functionally interact at the behavioral level. PMID:8041777

Independent associations of polymorphisms in vitamin D binding protein (GC) and vitamin D receptor (VDR) genes with obesity and plasma 25OHD3 levels demonstrate sex dimorphism.

PubMed

Almesri, Norah; Das, Nagalla S; Ali, Muhallab E; Gumaa, Khalid; Giha, Hayder Ahmed

2016-04-01

We investigated a possible association between polymorphisms in vitamin D binding protein (GC) and vitamin D receptor (VDR) genes and obesity in Bahraini adults. For this purpose, 406 subjects with varying body mass indexes (BMIs) were selected. Plasma levels of 25-hydroxyvitamin D3 (25OHD3) were measured by chemiluminescence immunoassay. Six single nucleotide polymorphisms, 2 in the VDR gene (rs731236 TC and rs12721377 AG) and 4 in the GC gene (rs2282679 AC, rs4588 CA, rs7041 GT, and rs2298849 TC), were genotyped by real-time polymerase chain reaction. We found that the rs7041 minor allele (G) and rare genotype (GG) were associated with higher BMI (p = 0.007 and p = 0.012, respectively), but they did not influence 25OHD3 levels. However, the minor alleles of rs2282679 (A) and rs4588 (C) were associated with low 25OHD3 plasma levels (p = 0.039 and p = 0.021, respectively), but not with BMI. Having categorized the subjects based on their sex, we found that (i) rs7041 GG associated with high BMI in females (p = 0.003), (ii) rs4588 CC associated with high BMI in females (p = 0.034) and low 25OHD3 levels in males (p = 0.009), and (iii) rs12721377 AA associated with low 25OHD3 levels in females (p = 0.039). Notably, none of the common haplotypes (6 in the GC gene and 3 in the VDR gene) were associated with BMI. Therefore, polymorphisms in the GC (rs2282679, rs4588, rs7041) and VDR (rs12721377) genes were independently associated with obesity and 25OHD3 levels with a clear sex dimorphism.

Environmental Adaptation Contributes to Gene Polymorphism across the Arabidopsis thaliana Genome

PubMed Central

Lee, Cheng-Ruei

2012-01-01

The level of within-species polymorphism differs greatly among genes in a genome. Many genomic studies have investigated the relationship between gene polymorphism and factors such as recombination rate or expression pattern. However, the polymorphism of a gene is affected not only by its physical properties or functional constraints but also by natural selection on organisms in their environments. Specifically, if functionally divergent alleles enable adaptation to different environments, locus-specific polymorphism may be maintained by spatially heterogeneous natural selection. To test this hypothesis and estimate the extent to which environmental selection shapes the pattern of genome-wide polymorphism, we define the "environmental relevance" of a gene as the proportion of genetic variation explained by environmental factors, after controlling for population structure. We found substantial effects of environmental relevance on patterns of polymorphism among genes. In addition, the correlation between environmental relevance and gene polymorphism is positive, consistent with the expectation that balancing selection among heterogeneous environments maintains genetic variation at ecologically important genes. Comparison of the gene ontology annotations shows that genes with high environmental relevance are enriched in unknown function categories. These results suggest an important role for environmental factors in shaping genome-wide patterns of polymorphism and indicate another direction of genomic study. PMID:22798389

Interactions Among Polymorphisms of Susceptibility Loci for Alzheimer’s Disease or Depressive Disorder

PubMed Central

Kitzlerová, Eva; Lelková, Petra; Jirák, Roman; Zvěřová, Martina; Hroudová, Jana; Manukyan, Ada; Martásek, Pavel; Raboch, Jiří

2018-01-01

Background Several genetic susceptibility loci for major depressive disorder (MDD) or Alzheimer’s disease (AD) have been described. Interactions among polymorphisms are thought to explain the differences between low- and high-risk groups. We tested for the contribution of interactions between multiple functional polymorphisms in the risk of MDD or AD. Material/Methods A genetic association case-control study was performed in 68 MDD cases, 84 AD cases (35 of them with comorbid depression), and 90 controls. The contribution of 7 polymorphisms from 5 genes (APOE, HSPA1A, SLC6A4, HTR2A, and BDNF) related to risk of MDD or AD development was analyzed. Results Significant associations were found between MDD and interactions among polymorphisms in HSPA1A, SLC6A4, and BDNF or HSPA1A, BDNF, and APOE genes. For polymorphisms in the APOE gene in AD, significant differences were confirmed on the distributions of alleles and genotype rates compared to the control or MDD. Increased probability of comorbid depression was found in patients with AD who do not carry the ɛ4 allele of APOE. Conclusions Assessment of the interactions among polymorphisms of susceptibility loci in both MDD and AD confirmed a synergistic effect of genetic factors influencing inflammatory, serotonergic, and neurotrophic pathways at these heterogenous complex diseases. The effect of interactions was greater in MDD than in AD. A presence of the ɛ4 allele was confirmed as a genetic susceptibility factor in AD. Our findings indicate a role of APOE genotype in onset of comorbid depression in a subgroup of patients with AD who are not carriers of the APOE ɛ4 allele. PMID:29703883

CTLA-4 gene polymorphisms and their influence on predisposition to autoimmune thyroid diseases (Graves’ disease and Hashimoto's thyroiditis)

PubMed Central

Pastuszak-Lewandoska, Dorota; Sewerynek, Ewa; Domańska, Daria; Gładyś, Aleksandra; Skrzypczak, Renata

2012-01-01

Introduction Autoimmune thyroid disease (AITD) is associated with both genetic and environmental factors which lead to the overactivity of immune system. Cytotoxic T-Lymphocyte Antigen 4 (CTLA-4) gene polymorphisms belong to the main genetic factors determining the susceptibility to AITD (Hashimoto's thyroiditis, HT and Graves' disease, GD) development. The aim of the study was to evaluate the relationship between CTLA-4 polymorphisms (A49G, 1822 C/T and CT60 A/G) and HT and/or GD in Polish patients. Material and methods Molecular analysis involved AITD group, consisting of HT (n=28) and GD (n=14) patients, and a control group of healthy persons (n=20). Genomic DNA was isolated from peripheral blood and CTLA-4 polymorphisms were assessed by polymerase chain reaction-restriction fragment length polymorphism method, using three restriction enzymes: Fnu4HI (A49G), BsmAI (1822 C/T) and BsaAI (CT60 A/G). Results Statistical analysis (χ2 test) confirmed significant differences between the studied groups concerning CTLA-4 A49G genotypes. CTLA-4 A/G genotype was significantly more frequent in AITD group and OR analysis suggested that it might increase the susceptibility to HT. In GD patients, OR analysis revealed statistically significant relationship with the presence of G allele. In controls, CTLA-4 A/A genotype frequency was significantly increased suggesting a protective effect. There were no statistically significant differences regarding frequencies of other genotypes and polymorphic alleles of the CTLA-4 gene (1822 C/T and CT60 A/G) between the studied groups. Conclusions CTLA-4 A49G polymorphism seems to be an important genetic determinant of the risk of HT and GD in Polish patients. PMID:22851994

CTLA-4 gene polymorphisms and their influence on predisposition to autoimmune thyroid diseases (Graves' disease and Hashimoto's thyroiditis).

PubMed

Pastuszak-Lewandoska, Dorota; Sewerynek, Ewa; Domańska, Daria; Gładyś, Aleksandra; Skrzypczak, Renata; Brzeziańska, Ewa

2012-07-04

Autoimmune thyroid disease (AITD) is associated with both genetic and environmental factors which lead to the overactivity of immune system. Cytotoxic T-Lymphocyte Antigen 4 (CTLA-4) gene polymorphisms belong to the main genetic factors determining the susceptibility to AITD (Hashimoto's thyroiditis, HT and Graves' disease, GD) development. The aim of the study was to evaluate the relationship between CTLA-4 polymorphisms (A49G, 1822 C/T and CT60 A/G) and HT and/or GD in Polish patients. Molecular analysis involved AITD group, consisting of HT (n=28) and GD (n=14) patients, and a control group of healthy persons (n=20). Genomic DNA was isolated from peripheral blood and CTLA-4 polymorphisms were assessed by polymerase chain reaction-restriction fragment length polymorphism method, using three restriction enzymes: Fnu4HI (A49G), BsmAI (1822 C/T) and BsaAI (CT60 A/G). Statistical analysis (χ(2) test) confirmed significant differences between the studied groups concerning CTLA-4 A49G genotypes. CTLA-4 A/G genotype was significantly more frequent in AITD group and OR analysis suggested that it might increase the susceptibility to HT. In GD patients, OR analysis revealed statistically significant relationship with the presence of G allele. In controls, CTLA-4 A/A genotype frequency was significantly increased suggesting a protective effect. There were no statistically significant differences regarding frequencies of other genotypes and polymorphic alleles of the CTLA-4 gene (1822 C/T and CT60 A/G) between the studied groups. CTLA-4 A49G polymorphism seems to be an important genetic determinant of the risk of HT and GD in Polish patients.

Promoter polymorphisms in the ATP binding cassette transporter gene influence production of cell-derived microparticles and are highly associated with susceptibility to severe malaria in humans.

PubMed

Sahu, Upasana; Mohapatra, Biranchi N; Kar, Shantanu K; Ranjit, Manoranjan

2013-04-01

Microparticle (MP) efflux is known to be mediated by the ABCA1 protein, and the plasma level of these cell-derived MPs is elevated considerably during human malarial infection. Therefore, two polymorphisms at positions -477 and -320 in the promoter of the ABCA1 gene were genotyped and tested for association with the plasma MP level in four groups of malaria patients segregated according to the clinical severity, i.e., cerebral malaria (CM), multiorgan dysfunction (MOD), noncerebral severe malaria, and uncomplicated malaria (UM). The TruCount tube-based flow cytometric method was used for the exact quantification of different cell-derived MPs in patients. Polymorphisms in the ABCA1 gene promoter were analyzed by use of the PCR/two-primer-pair method, followed by restriction fragment length polymorphism, in 428 malaria patients. The level of circulating plasma MPs was significantly higher in febrile patients with Plasmodium falciparum infection, especially in CM patients compared to healthy individuals. The homozygous wild-type -477 and -320 genotype was observed to be significantly higher in patients with severe malaria. These patients also showed marked increases in the plasma MP numbers compared to UM patients. We report here for the first time an association of ABCA1 promoter polymorphisms with susceptibility to severe malaria, especially to CM and MOD, indicating the protective effect of the mutant variant of the polymorphism. We hypothesize that the -477T and -320G polymorphisms affect the downregulation of MP efflux and may be a predictor of organ complication during P. falciparum malarial infections.

Influence of A-21T and C-262T genetic polymorphisms at the promoter region of the catalase (CAT) on gene expression.

PubMed

Saify, Khyber; Saadat, Iraj; Saadat, Mostafa

2016-09-01

Catalase (CAT, OMIM: 115500) is one of the major antioxidant enzymes, which plays an important role in the clearance of reactive oxygen species. Three genetic polymorphisms of A-21T (rs7943316), C-262T (rs1001179), and C-844T (rs769214) in the promoter region of the CAT have been reported. It has been suggested that these polymorphisms may alter the recognition sites of transcriptional factors, therefore it might be concluded that these polymorphisms may alter the expression levels of the gene. The aim of the present study is to evaluate the associations between these genetic variations and the CAT mRNA levels in human peripheral blood cells. The present study consisted of 47 healthy students of Shiraz University (south-west Iran). Genotypes of the CAT polymorphisms were determined by PCR based method. The quantitative CAT mRNA expression levels were investigated using quantitative real-time PCR. Analysis of variance revealed significant differences between the study genotypes (For A-21T polymorphism: F = 7.45; df = 2, 44; P = 0.002; For C-262T polymorphism: F = 15.17; df = 2, 44; P < 0.001). The studied polymorphisms showed linkage disequilibrium (D' = 1.0, r 2  = 0.1813, χ 2  = 17.03, P < 0.0001). The mRNA levels of CAT in the AC/TT, TC/TC, TC/TT, and TC/TC diplotypes significantly were higher than the mRNA levels in AC/AC diplotype. There was a significant difference between the study genotypes (F = 9.24; df = 5, 41; P < 0.001). The TC/TC and TT/TT diplotypes showed about 2 and 4 folds CAT mRNA levels compared with the AC/AC diplotype. The present findings indicated that these polymorphisms were significantly associated with the gene expression.

Genetic polymorphisms in ESR1 and ESR2 genes, and risk of hypospadias in a multiethnic study population.

PubMed

Choudhry, Shweta; Baskin, Laurence S; Lammer, Edward J; Witte, John S; Dasgupta, Sudeshna; Ma, Chen; Surampalli, Abhilasha; Shen, Joel; Shaw, Gary M; Carmichael, Suzan L

2015-05-01

Estrogenic endocrine disruptors acting via estrogen receptors α (ESR1) and β (ESR2) have been implicated in the etiology of hypospadias, a common congenital malformation of the male external genitalia. We determined the association of single nucleotide polymorphisms in ESR1 and ESR2 genes with hypospadias in a racially/ethnically diverse study population of California births. We investigated the relationship between hypospadias and 108 ESR1 and 36 ESR2 single nucleotide polymorphisms in 647 cases and 877 population based nonmalformed controls among infants born in selected California counties from 1990 to 2003. Subgroup analyses were performed by race/ethnicity (nonHispanic white and Hispanic subjects) and by hypospadias severity (mild to moderate and severe). Odds ratios for 33 of the 108 ESR1 single nucleotide polymorphisms had p values less than 0.05 (p = 0.05 to 0.007) for risk of hypospadias. However, none of the 36 ESR2 single nucleotide polymorphisms was significantly associated. In stratified analyses the association results were consistent by disease severity but different sets of single nucleotide polymorphisms were significantly associated with hypospadias in nonHispanic white and Hispanic subjects. Due to high linkage disequilibrium across the single nucleotide polymorphisms, haplotype analyses were conducted and identified 6 haplotype blocks in ESR1 gene that had haplotypes significantly associated with an increased risk of hypospadias (OR 1.3 to 1.8, p = 0.04 to 0.00001). Similar to single nucleotide polymorphism analysis, different ESR1 haplotypes were associated with risk of hypospadias in nonHispanic white and Hispanic subjects. No significant haplotype association was observed for ESR2. The data provide evidence that ESR1 single nucleotide polymorphisms and haplotypes influence the risk of hypospadias in white and Hispanic subjects, and warrant further examination in other study populations. Copyright © 2015 American Urological Association Education and Research, Inc. Published by Elsevier Inc. All rights reserved.

Haptoglobin polymorphism among Saharian and West African groups. Haptoglobin phenotype determination by radioimmunoelectrophoresis on Hp O samples.

PubMed Central

Constans, J; Viau, M; Gouaillard, C; Clerc, A

1981-01-01

The haptoglobin (Hp) polymorphism is investigated in 11 African groups living in an area from the Algerian Sahara to Central Africa. More than 4,000 samples were examined. In the Saharian samples, the Hp1 gene frequency is higher than in any other African group. From north to south, a decrease in the Hp1 gene frequency is observed; in the Pygmy sample only, this frequency is lower than the frequency of the Hp2 gene. By means of a sensitive radioimmunoelectrophoresis, the presence of a residual Hp in Hp O sera in which the Hp polymorphism can also be determined can be revealed. Absence of Hp 1-1 and significant excess of Hp 2-2 individuals were observed. More Hp 2-1M phenotypes were detected in the Hp O population than in the non-Hp O population examined. In the Hp O samples, the influence of the phenotype distribution on the Hp gene frequencies is discussed. The heavy polymers of the Hp related to the presence of the alpha 2 chain (Hp2 gene product) are involved only in the biological mechanisms responsible for the presence of Hp O and Hp 2-1 M phenotypes among African groups. Images Fig. 1 PMID:7258189

Haplotypes in the APOA1-C3-A4-A5 gene cluster affect plasma lipids in both humans and baboons

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wang, Qian-fei; Liu, Xin; O'Connell, Jeff

2003-09-15

Genetic studies in non-human primates serve as a potential strategy for identifying genomic intervals where polymorphisms impact upon human disease-related phenotypes. It remains unclear, however, whether independently arising polymorphisms in orthologous regions of non-human primates leads to similar variation in a quantitative trait found in both species. To explore this paradigm, we studied a baboon apolipoprotein gene cluster (APOA1/C3/A4/A5) for which the human gene orthologs have well established roles in influencing plasma HDL-cholesterol and triglyceride concentrations. Our extensive polymorphism analysis of this 68 kb gene cluster in 96 pedigreed baboons identified several haplotype blocks each with limited diversity, consistent withmore » haplotype findings in humans. To determine whether baboons, like humans, also have particular haplotypes associated with lipid phenotypes, we genotyped 634 well characterized baboons using 16 haplotype tagging SNPs. Genetic analysis of single SNPs, as well as haplotypes, revealed an association of APOA5 and APOC3 variants with HDL cholesterol and triglyceride concentrations, respectively. Thus, independent variation in orthologous genomic intervals does associate with similar quantitative lipid traits in both species, supporting the possibility of uncovering human QTL genes in a highly controlled non-human primate model.« less

Androgenic correlates of genetic variation in the gene encoding 5alpha-reductase type 1.

PubMed

Ellis, Justine A; Panagiotopoulos, Sianna; Akdeniz, Aysel; Jerums, George; Harrap, Stephen B

2005-01-01

Androgens determine male secondary sexual characteristics and influence a variety of metabolic pathways. Circulating levels of androgens are highly heritable; however, the genes involved are largely unknown. The 5alpha-reductase enzymes types 1 and 2 responsible for converting testosterone to the more potent androgen dihydrotestosterone are encoded by the SRD5A1 and SRD5A2 genes, respectively. We performed indirect genetic association studies of SRD5A1 and SRD5A2 and the dihydrotestosterone/testosterone ratio that reflects the activity of 5alpha-reductase in 57 males with type 2 diabetes. We found evidence of significant association between a single nucleotide polymorphism in SRD5A1 and the dihydrotestosterone/testosterone ratio (median 0.10, interquartile range 0.08 vs. median 0.06, interquartile range 0.04, P = 0.009). The polymorphism was not associated with any diabetic phenotypes. These results suggest that functional genetic variants might exist in or around SRD5A1 that affect the activity of the 5alpha-reductase enzyme type 1 and influence androgen levels.

Association of glutathione S-transferase Ω 1-1 polymorphisms (A140D and E208K) with the expression of interleukin-8 (IL-8), transforming growth factor beta (TGF-β), and apoptotic protease-activating factor 1 (Apaf-1) in humans chronically exposed to arsenic in drinking water.

PubMed

Escobar-García, D M; Del Razo, L M; Sanchez-Peña, L C; Mandeville, P B; Lopez-Campos, C; Escudero-Lourdes, Claudia

2012-06-01

Human exposure to arsenicals is associated with inflammatory-related diseases including different kinds of cancer as well as non-cancerous diseases like neuro-degenerative diseases, atherosclerosis, hypertension, and diabetes. Interindividual susceptibility has been mainly addressed by evaluating the role of genetic polymorphism in metabolic enzymes in inorganic arsenic (iAs) metabolism. Glutathione S-transferase omega 1-1 (GSTO1-1), which had been associated with iAs metabolism, is also known to participate in inflammatory and apoptotic cellular responses. The polymorphism A140D of GSTO1-1 has been not only associated with distinct urinary profile of arsenic metabolites in populations chronically exposed to iAs in drinking water, but also with higher risk of childhood leukemia and lung disease in non-exposed populations, suggesting that GSTO1-1 involvement in other physiologic processes different from toxics metabolism could be more relevant than is thought. We evaluated the association of the presence of A140D and E208K polymorphisms of GSTO1-1 gene with the expression of genes codifying for proteins involved in the inflammatory and apoptotic response in a human population chronically exposed to iAs through drinking water. A140D polymorphism was associated with higher expression of genes codifying for IL-8 and Apaf-1 mainly in heterozygous individuals, while E208K was associated with higher expression of IL-8 and TGF- gene, in both cases, the association was independently of iAs exposure level; however, the exposure to iAs increased slightly but significantly the influence of A140D and E208K polymorphisms on such genes expression. These results suggest an important role of GSTO1-1 in the inflammatory response and the apoptotic process and indicate that A140D and E208K polymorphisms could increase the risk of developing inflammatory and apoptosis-related diseases in As-exposed populations.

Two functional serotonin polymorphisms moderate the effect of food reinforcement on BMI

PubMed Central

Carr, Katelyn A.; Lin, Henry; Fletcher, Kelly D.; Sucheston, Lara; Singh, Prashant K.; Salis, Robbert; Erbe, Richard; Faith, Myles; Allison, David; Stice, Eric; Epstein, Leonard H.

2014-01-01

Food reinforcement, or the motivation to eat, has been associated with increased energy intake, greater body weight and prospective weight gain. Much of the previous research on the reinforcing value of food has focused on the role of dopamine, but it may be worthwhile to examine genetic polymorphisms in the serotonin and opioid systems as these neurotransmitters have been shown to be related to reinforcement processes and to influence energy intake. We examined the relationship among 44 candidate genetic polymorphisms in the dopamine, serotonin and opioid systems, and food reinforcement and body mass index (BMI) in a sample of 245 individuals. Polymorphisms in the Monoamine oxidase A (MAOA-LPR) and serotonin receptor 2A genes (rs6314) moderated the effect of food reinforcement on BMI, accounting for an additional 5-10% variance and revealed a potential role of the single nucleotide polymorphism, rs6314 in the serotonin 2A receptor as a differential susceptibility factor for obesity. Differential susceptibility describes a factor that can confer either risk or protection depending on a second variable, such that rs6314 is predictive of both high and low BMI based on the level of food reinforcement, while the diathesis stress or dual-gain model influences only one end of the outcome measure. The interaction with MAOA-LPR better fit the dual-risk or diathesis stress model, with the 3.5R/4R allele conferring protection for individuals low in food reinforcement. These results provide new insight into genes theoretically involved in obesity and support the hypothesis that genetics moderate the association between food reinforcement on BMI. PMID:23544600

Human 8-oxoguanine DNA glycosylase gene polymorphism (Ser326Cys) and cancer risk: updated meta-analysis

PubMed Central

Park, Hae Jeong; Chung, Joo-Ho; Ban, Ju Yeon

2017-01-01

Genetic polymorphism of human 8-oxoguanine glycosylase 1 (hOGG1) has been reported to have a relationship with the risk of the development of various cancers. Many studies have described the influence of Ser326Cys polymorphism of the hOGG1 gene on cancer susceptibility. However, the results have remained inconclusive and controversial. Therefore, we performed a meta-analysis to more precisely determine the relationship between the hOGG1 polymorphism and the development of cancer. Electronic databases including PubMed, Embase, Google Scholar, and the Korean Studies Information Service System (KISS) were searched. The odds ratio (OR), 95% confidence interval (CI), and p value were calculated to assess the strength of the association with the risk of cancer using Comprehensive Meta-analysis software (Corporation, NJ, USA). The 127 studies including 38,757 cancer patients and 50,177 control subjects were analyzed for the meta-analysis. Our meta-analysis revealed that G allele of Ser326Cys polymorphism of the hOGG1 gene statistically increased the susceptibility of cancer (all population, OR = 1.092, 95% CI = 1.051-1.134, p < 0.001; in Asian, OR = 1.095, 95% CI = 1.048-1.145, p < 0.001; in Caucasian, OR = 1.097, 95% CI = 1.033-1.179, p = 0.002). Also, other genotype models showed significant association with cancer (p < 0.05, respectively). The present meta-analysis concluded that the G allele was associated with an increased risk of cancer. It suggested that the hOGG1 polymorphism may be a candidate marker of cancer. PMID:28415770

Prion gene haplotypes of U.S. cattle

PubMed Central

Clawson, Michael L; Heaton, Michael P; Keele, John W; Smith, Timothy PL; Harhay, Gregory P; Laegreid, William W

2006-01-01

Background Bovine spongiform encephalopathy (BSE) is a fatal neurological disorder characterized by abnormal deposits of a protease-resistant isoform of the prion protein. Characterizing linkage disequilibrium (LD) and haplotype networks within the bovine prion gene (PRNP) is important for 1) testing rare or common PRNP variation for an association with BSE and 2) interpreting any association of PRNP alleles with BSE susceptibility. The objective of this study was to identify polymorphisms and haplotypes within PRNP from the promoter region through the 3'UTR in a diverse sample of U.S. cattle genomes. Results A 25.2-kb genomic region containing PRNP was sequenced from 192 diverse U.S. beef and dairy cattle. Sequence analyses identified 388 total polymorphisms, of which 287 have not previously been reported. The polymorphism alleles define PRNP by regions of high and low LD. High LD is present between alleles in the promoter region through exon 2 (6.7 kb). PRNP alleles within the majority of intron 2, the entire coding sequence and the untranslated region of exon 3 are in low LD (18.0 kb). Two haplotype networks, one representing the region of high LD and the other the region of low LD yielded nineteen different combinations that represent haplotypes spanning PRNP. The haplotype combinations are tagged by 19 polymorphisms (htSNPS) which characterize variation within and across PRNP. Conclusion The number of polymorphisms in the prion gene region of U.S. cattle is nearly four times greater than previously described. These polymorphisms define PRNP haplotypes that may influence BSE susceptibility in cattle. PMID:17092337

Polymorphisms in endothelin system genes, arsenic levels and obesity risk.

PubMed

Martínez-Barquero, Vanesa; de Marco, Griselda; Martínez-Hervas, Sergio; Rentero, Pilar; Galan-Chilet, Inmaculada; Blesa, Sebastian; Morchon, David; Morcillo, Sonsoles; Rojo, Gemma; Ascaso, Juan Francisco; Real, José Tomás; Martín-Escudero, Juan Carlos; Chaves, Felipe Javier

2015-01-01

Obesity has been linked to morbidity and mortality through increased risk for many chronic diseases. Endothelin (EDN) system has been related to endothelial function but it can be involved in lipid metabolism regulation: Receptor type A (EDNRA) activates lipolysis in adipocytes, the two endothelin receptors mediate arsenic-stimulated adipocyte dysfunction, and endothelin system can regulate adiposity by modulating adiponectin activity in different situations and, therefore, influence obesity development. The aim of the present study was to analyze if single nucleotide polymorphisms (SNPs) in the EDN system could be associated with human obesity. We analyzed two samples of general-population-based studies from two different regions of Spain: the VALCAR Study, 468 subjects from the area of Valencia, and the Hortega Study, 1502 subjects from the area of Valladolid. Eighteen SNPs throughout five genes were analyzed using SNPlex. We found associations for two polymorphisms of the EDNRB gene which codifies for EDN receptor type B. Genotypes AG and AA of the rs5351 were associated with a lower risk for obesity in the VALCAR sample (p=0.048, OR=0.63) and in the Hortega sample (p=0.001, OR=0.62). Moreover, in the rs3759475 polymorphism, genotypes CT and TT were also associated with lower risk for obesity in the Hortega sample (p=0.0037, OR=0.66) and in the VALCAR sample we found the same tendency (p=0.12, OR=0.70). Furthermore, upon studying the pooled population, we found a stronger association with obesity (p=0.0001, OR=0.61 and p=0.0008, OR=0.66 for rs5351 and rs3759475, respectively). Regarding plasma arsenic levels, we have found a positive association for the two SNPs studied with obesity risk in individuals with higher arsenic levels in plasma: rs5351 (p=0.0054, OR=0.51) and rs3759475 (p=0.009, OR=0.53). Our results support the hypothesis that polymorphisms of the EDNRB gene may influence the susceptibility to obesity and can interact with plasma arsenic levels.

Interactions between environmental factors and maternal-fetal genetic variations: strategies to elucidate risks of preterm birth.

PubMed

Pereyra, Silvana; Bertoni, Bernardo; Sapiro, Rossana

2016-07-01

Preterm birth (PTB) is a complex disease in which medical, social, cultural, and hereditary factors contribute to the pathogenesis of this adverse event. Interactions between genes and environmental factors may complicate our understanding of the relative influence of both effects on PTB. To overcome this, we combined data obtained from a cohort of newborns and their mothers with multiplex analysis of inflammatory-related genes and several environmental risk factors of PTB to describe the environmental-genetic influence on PTB. The study aimed to investigate the association between maternal and fetal genetic variations in genes related to the inflammation pathway with PTB and to assess the interaction between environmental factors with these variations. We conducted a case-control study at the Pereira Rossell Hospital Center, Montevideo, Uruguay. The study included 143 mother-offspring dyads who delivered at preterm (gestational age<37 weeks) and 108 mother-offspring dyads who delivered at term. We used real-time PCR followed by a high-resolution melting analysis to simultaneously identify gene variations involved in inflammatory pathways in the context of environmental variables. The genes analyzed were: Toll-like receptor 4 (TLR4), Interleukin 6 (IL6), Interleukin 1 beta (IL1B) and Interleukin 12 receptor beta (IL12RB). We detected a significant interaction between IL1B rs16944 polymorphism in maternal samples and IL6 rs1800795 polymorphism in newborns, emphasizing the role of the interaction of maternal and fetal genomes in PTB. In addition, smoke exposure and premature rupture of membranes (PROM) were significantly different between the premature group and controls. IL1B and IL6 polymorphisms in mothers were significantly associated with PTB when controlling for smoke exposure. TLR4 polymorphism and PROM were significantly associated with PTB when controlling for PROM, but only in the case of severe PTB. Interactions between maternal and fetal genomes may influence the timing of birth. By incorporating environmental data, we revealed genetic associations with PTB, a finding not found when we analyzed genetic data alone. Our results stress the importance of studying the effect of genotype interactions between mothers and children in the context of environmental factors because they substantially contribute to phenotype variability. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

Beta 2-adrenergic receptor gene association with overweight and asthma in children and adolescents and its relationship with physical fitness

PubMed Central

Leite, Neiva; Lazarotto, Leilane; Milano, Gerusa Eisfeld; Titski, Ana Claudia Kapp; Consentino, Cássio Leandro Mühe; de Mattos, Fernanda; de Andrade, Fabiana Antunes; Furtado-Alle, Lupe

2015-01-01

Objective: To investigate the association of Arg16Gly and Gln27Glu polymorphisms of β2-adrenergic receptor gene (ADRB2) with the occurrence of asthma and overweight and the gene's influence on anthropometric, clinic, biochemical and physical fitness variables in children and adolescents. Methods: Subjects were evaluated for allelic frequencies of the β2-adrenergic receptor gene, height, weight, body mass index (BMI), BMI Z-score, waist circumference (WC), pubertal stage, resting heart rate (HRres), blood pressure (BP), total cholesterol (TC), glucose, insulin, high density lipoprotein (HDL-C), low density lipoprotein (LDL-C), triglyceride (TG), Homeostasis Metabolic Assessment (HOMA2-IR), Quantitative Insulin Sensitivity Check Index (QUICKI) and maximal oxygen uptake (VO2max). The participants were divided in four groups: overweight asthmatic (n=39), overweight non-asthmatic (n=115), normal weight asthmatic (n=12), and normal weight non-asthmatic (n=40). Results: Regarding the Gln27Glu polymorphism, higher total cholesterol was observed in usual genotype individuals than in genetic variant carriers (p=0.04). No evidence was found that the evaluated polymorphisms are influencing the physical fitness. The Arg16 allele was found more frequently among the normal weight asthmatic group when compared to the normal weight non-asthmatic group (p=0.02), and the Glu27 allele was more frequently found in the overweight asthmatics group when compared to the normal weight non-asthmatic group (p=0.03). Conclusions: The association of Arg16 allele with the occurrence of asthma and of the Glu27 allele with overweight asthmatic adolescents evidenced the contribution of the β2-adrenergic receptor gene to the development of obesity and asthma. PMID:26409918

Genetic variation may influence obesity only under conditions of diet: analysis of three candidate genes.

PubMed

Aberle, Jens; Flitsch, Jörg; Beck, Nicola Alessia; Mann, Oliver; Busch, Philipp; Peitsmeier, Philipp; Beil, Frank Ulrich

2008-11-01

Under the hypothesis of obesity as a polygenetic disease numerous genes have been associated with an obese phenotype and metabolic co-morbidities. The cannabinoid receptor 1 (CB 1) is part of an underinvestigated system that participates in appetite control. Previous publications suggest that the endocannabinoid systems interact with the better understood leptin-melanocortin axis. Neuropeptide Y (NPY) is a player in the latter. Finally resistin has been shown to influence NPY expression in the brain. In a cohort of 1721 caucasion men and women with a BMI of 25kg/m(2) or more we therefore investigated three candidate polymorphisms at baseline and following 3 months low fat caloric restriction diet by polymerase chain reaction and restriction digestion: the 1359 G/A variant of the cannabinoid receptor 1 (CB1), the L7P variation in neuropeptide Y (NPY) and the -420C>G polymorphism in resistin. Comparing groups according to genotype for each gene separately revealed significant results at baseline only for the CB1 gene. However, upon dieting significant data was found for all 3 genes. Carriers of at least one A allele in CB1 lost more weight and reduced LDL cholesterol more than wildtype patients. LL homocygotes in NPY had a greater reduction in glucose, triglycerides, and LDL cholesterol whereas in resistin carriers of the G allele had a greater reduction in weight and triglycerides. Creating two groups defined by NPY and resistin genotype, respectively, with similar BMI values resulted in significant differences concerning weight loss and metabolic improvement. In conclusion, genetic polymorphisms associated with obesity may become relevant only under the condition of a low calory diet. The presence of a certain genotype may then be beneficial for obesity treatment.

Lack of association of programmed cell death 1 gene (PDCD1) polymorphisms with susceptibility to chronic urticaria in patients with positive autologous serum skin test.

PubMed

Brzoza, Z; Grzeszczak, W; Trautsolt, W; Moczulski, D

2012-01-01

Autoimmune mechanisms play an important role in the pathophysiology of chronic urticaria (CU), and the autologous serum skin test (ASST) helps to identify patients with autoreactive CU. One of the factors involved in autoreactive mechanisms is the cell surface receptor programmed death-1 which is encoded by the programmed cell death 1 gene (PDCD1). To investigate whether PDCD1 polymorphisms influence susceptibility to CU. We enrolled 93 ASST-positive patients with CU and a control group consisting of 105 healthy volunteers. In all individuals, PD1.3 (7146 A/G; rs 11568821) and PD1.5 (7785 C/T; rs 2227981) polymorphisms were analyzed. No statistically significant differences were found between CU patients and controls for allele or genotype distribution. We also did not observe any association between PDCD1 genotypes and severity of urticaria or age of disease onset. PD1.3 and PD1.5 polymorphisms were not proven to be implicated in susceptibility to ASST-positive CU in the Polish population. A more comprehensive analysis of the 2q33-2q37 genomic region might reveal whether variants of 1 or more of the genes in this region are involved in susceptibility to CU.

The rs2516839 Polymorphism of the USF1 Gene May Modulate Serum Triglyceride Levels in Response to Cigarette Smoking

PubMed Central

Niemiec, Pawel; Nowak, Tomasz; Iwanicki, Tomasz; Gorczynska-Kosiorz, Sylwia; Balcerzyk, Anna; Krauze, Jolanta; Grzeszczak, Wladyslaw; Wiecha, Maria; Zak, Iwona

2015-01-01

Single nucleotide polymorphisms (SNPs) of the USF1 gene (upstream stimulatory factor 1) influence plasma lipid levels. This study aims to determine whether USF1 SNPs interact with traditional risk factors of atherosclerosis to increase coronary artery disease (CAD) risk. In the present study serum lipid levels and USF1 gene polymorphisms (rs2516839 and rs3737787) were determined in 470 subjects: 235 patients with premature CAD and 235 controls. A trend of increasing triglycerides (TG) levels in relation to the C allele dose of rs2516839 SNP was observed. The synergistic effect of cigarette smoking and C allele carrier state on CAD risk was also found (SIM = 2.69, p = 0.015). TG levels differentiated significantly particular genotypes in smokers (1.53 mmol/L for TT, 1.80 mmol/L for CT and 2.27 mmol/L for CC subjects). In contrast, these differences were not observed in the non-smokers subgroup (1.57 mmol/L for TT, 1.46 mmol/L for CT and 1.49 mmol/L for CC subjects). In conclusion, the rs2516839 polymorphism may modulate serum triglyceride levels in response to cigarette smoking. Carriers of the C allele seem to be particularly at risk of CAD, when exposed to cigarette smoking. PMID:26068452

Association of polymorphisms in 5-HTT (SLC6A4) and MAOA genes with measures of obesity in young adults of Portuguese origin.

PubMed

Dias, Helena; Muc, Magdalena; Padez, Cristina; Manco, Licínio

2016-01-01

To investigate the association of polymorphisms in SLC6A4 and MAOA genes with overweight (including obesity). Young adults (n = 535) of Portuguese origin were genotyped for the SLC6A4 polymorphisms 5-HTTLPR and STin2 and a MAOA VNTR. BMI and body fat percentage were measured and a questionnaire was used to assess individual's sport practicing habits. In whole study sample, haplotype-based analysis revealed significant association with overweight/obesity for the individual 5-HTTLPR/Stin2 haplotype L10 (p = 0.04). In men, the MAOA 3R genotype was nominally associated with body fat (p = 0.04). In inactive individuals, overweight/obesity was found significantly associated with 5-HTTLPR L-allele (p = 0.01) and nominally associated with STin2 10-allele (p = 0.03). A significant association was also found testing for all haplotype effects (χ(2 )= 8.7; p = 0.03). We found some evidences for the association of SLC6A4 and MAOA genes with measures of obesity. Our results suggest physical inactivity accentuates the influence of SLC6A4 polymorphisms on obesity risk.

The evaluation of angiotensin-converting enzyme (ACE) gene I/D and IL-4 gene intron 3 VNTR polymorphisms in coronary artery disease.

PubMed

Basol, Nursah; Celik, Atac; Karakus, Nevin; Ozturk, Sibel Demir; Ozsoy, Sibel Demir; Yigit, Serbulent

2014-01-01

Genetic polymorphism is a strong risk factor for coronary artery disease (CAD). In the present study, our aim was to evaluate angiotensin-converting enzyme (ACE) gene I/D polymorphism and interleukin-4 (IL-4) gene Intron 3 variable number of tandem repeat (VNTR) polymorphism in CAD. One hundred and twenty-four CAD patients and one hundred and twenty-three controls were enrolled. Genomic DNA was isolated and genotyped using polymerase chain reaction (PCR) analyses. The risk associated with inheriting the combined genotypes for the two polymorphisms were evaluated and it was found that the individuals who were P2P2-homozygous at IL-4 gene intron 3 VNTR and DD-homozygous at ACE gene I/D have a higher risk of developing CAD. Although, there is no correlation between IL4 VNTR polymorphism and ACE gene polymorphism and CAD, there is a strong association between CAD and co-existence of IL-4 VNTR and ACE gene polymorphisms in the Turkish population. Copyright © 2014 International Institute of Anticancer Research (Dr. John G. Delinassios), All rights reserved.

Pharmacogenetics of CYP1A2 activity and inducibility in smokers and exsmokers.

PubMed

Dobrinas, Maria; Cornuz, Jacques; Eap, Chin B

2013-05-01

There is a high interindividual variability in cytochrome P4501A2 (CYP1A2) activity and in its inducibility by smoking, only poorly explained by known CYP1A2 polymorphisms. We aimed to study the contribution of other regulatory pathways, including transcription factors and nuclear receptors, toward this variability. CYP1A2 activity was determined by the paraxanthine/caffeine ratio in 184 smokers and in 113 of them who were abstinent for 4 weeks. Participants were genotyped for 22 polymorphisms in 12 genes. A significant influence on CYP1A2 inducibility was observed for the NR1I3 rs2502815 (P=0.0026), rs4073054 (P=0.029), NR2B1 rs3818740 (P=0.0045), rs3132297 (P=0.036), AhR rs2282885 (P=0.040), rs2066853 (P=0.019), NR1I1 rs2228570 (P=0.037), and NR1I2 rs1523130 (P=0.044) polymorphisms. Among these, the NR1I3 rs2502815 (P=0.0045), rs4073054 (P=0.048), and NR2B1 rs3818740 (P=0.031) also influenced CYP1A2 basal activity. This is the first in-vivo demonstration of the influence of genes involved in CYP1A2 regulatory pathways on its basal activity and inducibility by smoking. These results need to be confirmed by other studies.

Implicit Association to Infant Faces: How Genetics, Early Care Experiences, and Cultural Factors Influence Caregiving Propensities

PubMed Central

Senese, Vincenzo Paolo; Shinohara, Kazuyuki; Esposito, Gianluca; Doi, Hirokazu; Venuti, Paola; Bornstein, Marc H.

2018-01-01

Genetics, early experience, and culture shape caregiving, but it is still not clear how genetics, early experiences, and cultural factors might interact to influence specific caregiving propensities, such as adult responsiveness to infant cues. To address this gap, 80 Italian adults (50% M; 18-25 years) were (1) genotyped for two oxytocin receptor gene polymorphisms (rs53576 and rs2254298) and the serotonin transporter gene polymorphism (5-HTTLPR), which are implicated in parenting behaviour, (2) completed the Adult Parental Acceptance/Rejection Questionnaire to evaluate their recollections of parental behaviours toward them in childhood, and (3) were administered a Single Category Implicit Association Test to evaluate their implicit responses to faces of Italian infants, Japanese infants, and Italian adults. Analysis of implicit associations revealed that Italian infant faces were evaluated as most positive; participants in the rs53576 GG group had the most positive implicit associations to Italian infant faces; the serotonin polymorphism moderated the effect of early care experiences on adults’ implicit association to both Italian infant and adult female faces. Finally, 5-HTTLPR S carriers showed less positive implicit responses to Japanese infant faces. We conclude that adult in-group preference extends to in-group infant faces and that implicit responses to social cues are influenced by interactions of genetics, early care experiences, and cultural factors. These findings have implications for understanding processes that regulate adult caregiving. PMID:27650102

Prostate cancer and polymorphism D85Y in gene for dihydrotestosterone degrading enzyme UGT2B15: Frequency of DD homozygotes increases with Gleason Score.

PubMed

Hajdinjak, Tine; Zagradisnik, Boris

2004-06-01

Although, a functional rationale for influence of polymorphism D85Y in gene UGT2B15 on prostate cancer (PCa) exists (different V(max) of enzyme), conflicting results have been reported. DNA from 178 controls and 206 PCa patients with known Gleason score were genotyped using a newly developed RFLP assay, which allowed the detection of both alleles in an individual after single PCR amplification. 16% DD, 52% DY; PCa patients: 23% DD, 49% DY. Subgroups of PCa: well differentiated: 11% DD, 37% DY; moderately differentiated: 22% DD, 50% DY; poorly differentiated: 34% DD, 50% DY. Correlation was confirmed between Gleason score and number of D alleles (P = 0.018) and persisted after age adjustment. When comparing controls to patients with a Gleason score of 7 or more, difference for the frequency of homozygosity DD was significant between the groups (P = 0.032, OR = 2.04). Polymorphism D85Y in gene UGT2B15 correlates with differentiation of PCa. Copyright 2004 Wiley-Liss, Inc.

Association of Cholesteryl Ester Transfer Protein and Endothelial Nitric Oxide Synthase Gene Polymorphisms With Coronary Artery Disease in the Multi-Ethnic Malaysian Population.

PubMed

Chu, Wern Cui; Aziz, Ahmad Fazli Abdul; Nordin, Abdul Jalil; Cheah, Yoke Kqueen

2016-09-01

Genetic variants of cholesteryl ester transfer protein (CETP) and endothelial nitric oxide synthase (eNOS) influence high-density lipoprotein cholesterol (HDL-C) metabolism and nitric oxide (NO) synthesis, respectively, and might increase the risk of coronary artery disease (CAD). This study is to investigate the relationship between genetic polymorphisms and the risk of CAD and to evaluate their potential interactions. A total of 237 patients with CAD and 101 controls were genotyped. The association of the polymorphism with the risk of CAD varied among the ethnic groups. Moreover, the concomitant presence of both CETP B1 and eNOS 4a alleles significantly increased the risk of CAD in the Malay group (OR = 33.8, P < .001) and the Indian group (OR = 10.9, P = .031) but not in the Chinese group. This study has identified a novel ethnic-specific gene-gene interaction and suggested that the combination of CETP B1 allele and eNOS 4a allele significantly increases the risk of CAD in Malays and Indians. © The Author(s) 2015.

Sequence polymorphisms at the growth hormone GH1/GH2-N and GH2-Z gene copies and their relationship with dairy traits in domestic sheep (Ovis aries).

PubMed

Vacca, G M; Dettori, M L; Balia, F; Luridiana, S; Mura, M C; Carcangiu, V; Pazzola, M

2013-09-01

The purpose was to analyze the growth hormone GH1/GH2-N and GH2-Z gene copies and to assess their possible association with milk traits in Sarda sheep. Two hundred multiparous lactating ewes were monitored. The two gene copies were amplified separately and each was used as template for a nested PCR, to investigate single strand conformation polymorphism (SSCP) of the 5'UTR, exon-1, exon-5 and 3'UTR DNA regions. SSCP analysis revealed marked differences in the number of polymorphic patterns between the two genes. Sequencing revealed five nucleotide changes at the GH1/GH2-N gene. Five nucleotide changes occurred at the GH2-Z gene: one was located in exon-5 (c.556G > A) and resulted in a putative amino acid substitution G186S. All the nucleotide changes were copy-specific, except c.*30delT, which was common to both GH1/GH2-N and GH2-Z. Variability in the promoter regions of each gene might have consequences on the expression level, due to the involvement in potential transcription factor binding sites. Both gene copies influenced milk yield. A correlation with milk protein and casein content was also evidenced. These results may have implications that make them useful for future breeding strategies in dairy sheep breeding.

Asthma-associated polymorphisms in 17q21 influence cord blood ORMDL3 and GSDMA gene expression and IL-17 secretion.

PubMed

Lluis, Anna; Schedel, Michaela; Liu, Jing; Illi, Sabina; Depner, Martin; von Mutius, Erika; Kabesch, Michael; Schaub, Bianca

2011-06-01

In a genome-wide association study, genetic variants on chromosome 17q21 were strongly associated with childhood asthma and orosomucoid 1-like 3 (ORMDL3) gene expression. Regulation of the 17q21 locus and its immunologic relevance early in life have not been well characterized. We investigated the relation between polymorphisms and mRNA expression of 17q21 locus genes and their influence on T-cell subsets in cord blood. In 200 children of our cord blood study, 17q21 polymorphisms were genotyped by matrix-assisted laser desorption ionization time-of-flight mass spectrometry. Gene expression was assessed for ORMDL3; gasdermin A (GSDMA, alias GSDM1); gasdermin B (GSDMB, alias GSDML); Ikaros family zinc finger 3 (ZNFN1A3), zona pellucida binding protein 2 (ZPBP2); and proteasome (prosome, macropain) 26S subunit, non-ATPase, 3 (PSMD3), in cord blood mononuclear cells (CBMCs) and for ORMDL3 in peripheral blood (real-time RT-PCR). Mononuclear cells were assessed before and after microbial (lipid A/peptidoglycan), phytohemagglutinin, or allergen (Der p 1) stimulation. Regulatory T-associated markers (forkhead box protein 3, glucocorticoid-induced TNF receptor, lymphocyte activation gene 3 mRNA expression) and T(h)2/T(h)1/T(h)17 cytokines were examined. In CBMCs, single genetic risk variants within 17q21 were associated with increased ORMDL3 (Der p 1 stimulation; P ≤ .01) and GSDMA expression (phytohemagglutinin/Der p 1 stimulation; P ≤ .05). Children homozygous for all 4 risk alleles for 17q21 tagging single nucleotide polymorphisms showed increased expression for ORMDL3 (Der p 1; P = .002) and GSDMA (phytohemagglutinin; P = .0009/Der p 1; P = .004). CBMC ORMDL3 expression was lower compared with PBMCs (P ≤ .0003) and increased in both CBMC and PBMC after stimulation (phytohemagglutinin/lipid A/peptidoglycan/Der p 1; P ≤ .006 and phytohemagglutinin/peptidoglycan; P < .05, respectively). No correlation between 17q21 polymorphisms and regulatory T/T(h)2/T(h)1 lineages was detectable. However, 17q21 risk allele carriers showed significantly increased IL-17 secretion (unstimulated, phytohemagglutinin-stimulated). Our results suggest an association of 17q21 polymorphisms with ORMDL3, GSDMA expression, and IL-17 secretion early in life. These observations may imply a functional role of the 17q21 locus affecting T-cell development during immune maturation. Copyright © 2011 American Academy of Allergy, Asthma & Immunology. Published by Mosby, Inc. All rights reserved.

Folate and Breast Cancer: Role of Intake, Blood Levels, and Metabolic Gene Polymorphisms

DTIC Science & Technology

2006-06-01

polymorphisms . The specific aims are 1) methodological training in the analysis of gene - gene and gene -environment interactions by studying folate...evaluation of folate intake, plasma folate, and metabolic gene polymorphisms in relation to breast cancer risk: Months 1-19. b. Prepare blood samples...isolated for the folate and gene polymorphism assays among the 184 cases and matched controls. The folate assays are on-going at this time and over

The role of methylenetetrahydrofolate reductase in acute lymphoblastic leukemia in a Brazilian mixed population.

PubMed

Zanrosso, Crisiane Wais; Hatagima, Ana; Emerenciano, Mariana; Ramos, Flávio; Figueiredo, Alexandre; Félix, Têmis Maria; Segal, Sandra L; Giugliani, Roberto; Guigliani, Roberto; Muniz, Maria Tereza Cartaxo; Pombo-de-Oliveira, Maria S

2006-04-01

The polymorphisms in the methylenetetrahydrofolate reductase (MTHFR) gene are associated with leukemogenesis. In order to investigate the influence of two polymorphisms in the MTHFR gene, 677C>T and 1298A>C, on the risk of acute lymphoblastic leukemia (ALL) we performed a case-control study in children from different Brazilians' regions. Genotyping of 176 ALL and 199 unselected healthy subjects was performed using PCR-RFLP assay. There was no association between the 677C>T or 1298A>C and risk of ALL in total case-control sample. However, 677T allele was linked to a decrease risk of ALL [odds ratio (OR), 0.43; 95% confidence interval (CI), 0.22-0.86], whereas the 1298A>C polymorphism presents an elevated risk factor [OR, 2.01; 95% CI, 1.01-3.99] in non-White children. Our investigation provides interesting data concerning the opposite effect of A1298C polymorphisms, particularly in the light of relatively scarce data regarding the MTHFR role in leukemia susceptibility in different populations.

Lack of Association between Polymorphisms of Hepatic Lipase with Lipid Profile in Young Jordanian Adults

PubMed Central

Khabour, Omar F; Alomari, Mahmoud A; Alzoubi, Karem H; Gharaibeh, Mohammad Y; Alhashimi, Farah H

2014-01-01

The human hepatic lipase (LIPC) gene encodes hepatic lipase, an enzyme involved in lipoprotein metabolism and regulation. Therefore, variants in LIPC gene may influence plasma lipoprotein levels. In this study, the association of LIPC C-514T and G-250A polymorphisms with plasma lipid profiles in 348 young Jordanians was investigated. Genotyping of C-514T and G-250A was performed by polymerase chain reaction and subsequent digestion with DraI and NiaIII restriction enzymes, respectively, while Roche analyzer was used to determine plasma total cholesterol, triglycerides, low-and high-density lipoprotein. The G-250 and C-514 alleles were most abundant in Jordanians with 79 and 80% frequencies, respectively. Additionally, no difference was found in the lipid–lipoprotein profile between the different genotype groups of C-514T or G-250A polymorphisms, even when males and females were examined separately (P > 0.05). In young Jordanian adults, the examined LIPC polymorphisms seem to play a limited role in determining the lipid profile. PMID:25278769

CXCR3/CCR5 pathways in metastatic melanoma patients treated with adoptive therapy and interleukin-2

PubMed Central

Bedognetti, D; Spivey, T L; Zhao, Y; Uccellini, L; Tomei, S; Dudley, M E; Ascierto, M L; De Giorgi, V; Liu, Q; Delogu, L G; Sommariva, M; Sertoli, M R; Simon, R; Wang, E; Rosenberg, S A; Marincola, F M

2013-01-01

Background: Adoptive therapy with tumour-infiltrating lymphocytes (TILs) induces durable complete responses (CR) in ∼20% of patients with metastatic melanoma. The recruitment of T cells through CXCR3/CCR5 chemokine ligands is critical for immune-mediated rejection. We postulated that polymorphisms and/or expression of CXCR3/CCR5 in TILs and the expression of their ligands in tumour influence the migration of TILs to tumours and tumour regression. Methods: Tumour-infiltrating lymphocytes from 142 metastatic melanoma patients enrolled in adoptive therapy trials were genotyped for CXCR3 rs2280964 and CCR5-Δ32 deletion, which encodes a protein not expressed on the cell surface. Expression of CXCR3/CCR5 in TILs and CXCR3/CCR5 and ligand genes in 113 available parental tumours was also assessed. Tumour-infiltrating lymphocyte data were validated by flow cytometry (N=50). Results: The full gene expression/polymorphism model, which includes CXCR3 and CCR5 expression data, CCR5-Δ32 polymorphism data and their interaction, was significantly associated with both CR and overall response (OR; P=0.0009, and P=0.007, respectively). More in detail, the predicted underexpression of both CXCR3 and CCR5 according to gene expression and polymorphism data (protein prediction model, PPM) was associated with response to therapy (odds ratio=6.16 and 2.32, for CR and OR, respectively). Flow cytometric analysis confirmed the PPM. Coordinate upregulation of CXCL9, CXCL10, CXCL11, and CCL5 in pretreatment tumour biopsies was associated with OR. Conclusion: Coordinate overexpression of CXCL9, CXCL10, CXCL11, and CCL5 in pretreatment tumours was associated with responsiveness to treatment. Conversely, CCR5-Δ32 polymorphism and CXCR3/CCR5 underexpression influence downregulation of the corresponding receptors in TILs and were associated with likelihood and degree of response. PMID:24129241

Effect of GSTM1, GSTT1, and GSTP1 IIe105Val polymorphisms on susceptiblity to gestational diabetes mellitus.

PubMed

Qiu, Y H; Xu, Y L; Zhang, W H

2016-06-03

We investigate the role of the GSTM1, GSTT1, and GSTP1 IIe105Val genetic polymorphisms in the susceptibility to gestational diabetes mellitus. A total of 223 pregnant women with gestational diabetes mellitus and 265 healthy pregnant women were examined at The Second Affiliated Hospital of Shaanxi University of Chinese Medicine from May 2013 to November 2013. Genotyping for detection of GSTM1, GSTT1, and GSTP1 IIe105Val polymorphisms was conducted using the restriction fragment length polymorphism-polymerase chain reaction. There were statistically significant differences between patients with gestational diabetes mellitus and control subjects in terms of age (χ(2) = 6.68, P = 0.01) and BMI (t = 7.56, P < 0.001) levels of HDL-C (t = 2.62, P = 0.005) and LDL-C (t = 3.98, P < 0.001). By the chi-square test, we found significant differences between the present and null genotype distributions of GSTM1 (χ(2) = 10.95, P = 0.0009). Null genotype of GSTM1 could influence the susceptibility to gestational diabetes mellitus compared to the present genotype [adjusted OR (95%CI) = 1.85 (1.26-2.72)]. However, the unconditional logistic analysis revealed that GSTT1 and GSTP1 IIe105Val polymorphisms could not influence the risk of gestational diabetes mellitus in a Chinese population. In summary, we suggest that the GSTM1 gene polymorphism could influence the susceptibility to gestational diabetes mellitus in a Chinese population.

Productive performance of the dairy cattle Girolando breed mediated by the fat-related genes DGAT1 and LEP and their polymorphisms.

PubMed

Cardoso, S R; Queiroz, L B; Goulart, V Alonso; Mourão, G B; Benedetti, E; Goulart, L R

2011-12-01

Candidate genes have been associated with milk production in bovines, such as the diacylglycerol O-acyltransferase 1 (DGAT1) and leptin (LEP); however, they have not been simultaneously investigated nor have been evaluated in the Brazilian Girolando breed (Gir×Holstein, backcrossed to Holstein). Our aim was to determine the influence of fat-related genes, DGAT1 and LEP, and their polymorphisms on performance traits of milk production in the Girolando breed. Results indicated that the K allele of the DGAT1 gene showed a significant association with total and average daily milk production with additive effect. The LEP gene showed that the A allele and its homozygote are highly prevalent and almost fixed in this population and may have been favorably selected during backcrossing for the origin of this breed. The important impact of the K allele of the DGAT1 gene on milk production corroborates the initiative of performing marker-assisted selections with this gene in breeding programs of the Girolando breed. Copyright © 2011 Elsevier Ltd. All rights reserved.

Interleukin-6 (IL-6) rs1800796 and cyclin dependent kinase inhibitor (CDKN2A/CDKN2B) rs2383207 are associated with ischemic stroke in indigenous West African Men.

PubMed

Akinyemi, Rufus; Arnett, Donna K; Tiwari, Hemant K; Ovbiagele, Bruce; Sarfo, Fred; Srinivasasainagendra, Vinodh; Irvin, Marguerite Ryan; Adeoye, Abiodun; Perry, Rodney T; Akpalu, Albert; Jenkins, Carolyn; Owolabi, Lukman; Obiako, Reginald; Wahab, Kolawole; Sanya, Emmanuel; Komolafe, Morenikeji; Fawale, Michael; Adebayo, Philip; Osaigbovo, Godwin; Sunmonu, Taofiki; Olowoyo, Paul; Chukwuonye, Innocent; Obiabo, Yahaya; Akpa, Onoja; Melikam, Sylvia; Saulson, Raelle; Kalaria, Raj; Ogunniyi, Adesola; Owolabi, Mayowa

2017-08-15

Inherited genetic variations offer a possible explanation for the observed peculiarities of stroke in sub - Saharan African populations. Interleukin-6 polymorphisms have been previously associated with ischemic stroke in some non-African populations. Herein we investigated, for the first time, the association of genetic polymorphisms of IL-6, CDKN2A- CDKN2B and other genes with ischemic stroke among indigenous West African participants in the Stroke Investigative Research and Education Network (SIREN) Study. Twenty-three previously identified single nucleotide polymorphisms (SNPs) in 14 genes of relevance to the neurobiology of ischemic stroke were investigated. Logistic regression models adjusting for known cardiovascular disease risk factors were constructed to assess the associations of the 23 SNPs in rigorously phenotyped cases (N=429) of ischemic stroke (Men=198; Women=231) and stroke- free (N=483) controls (Men=236; Women=247). Interleukin-6 (IL6) rs1800796 (C minor allele; frequency: West Africans=8.6%) was significantly associated with ischemic stroke in men (OR=2.006, 95% CI=[1.065, 3.777], p=0.031) with hypertension in the model but not in women. In addition, rs2383207 in CDKN2A/CDKN2B (minor allele A with frequency: West Africans=1.7%) was also associated with ischemic stroke in men (OR=2.550, 95% CI=[1.027, 6.331], p=0.044) with primary covariates in the model, but not in women. Polymorphisms in other genes did not show significant association with ischemic stroke. Polymorphisms rs1800796 in IL6 gene and rs2383207 in CDKN2A/CDKN2B gene have significant associations with ischemic stroke in indigenous West African men. CDKN2A/CDKN2B SNP rs2383207 is independently associated with ischemic stroke in indigenous West African men. Further research should focus on the contributions of inflammatory genes and other genetic polymorphisms, as well as the influence of sex on the neurobiology of stroke in people of African ancestry. Copyright © 2017 Elsevier B.V. All rights reserved.

Polymorphic Homoeolog of Key Gene of RdDM Pathway, ARGONAUTE4_9 class Is Associated with Pre-Harvest Sprouting in Wheat (Triticum aestivum L.)

PubMed Central

Singh, Manjit; Singh, Surinder; Randhawa, Harpinder; Singh, Jaswinder

2013-01-01

Resistance to pre-harvest sprouting (PHS) is an important objective for the genetic improvement of many cereal crops, including wheat. Resistance, or susceptibility, to PHS is mainly influenced by seed dormancy, a complex trait. Reduced seed dormancy is the most important aspect of seed germination on a spike prior to harvesting, but it is influenced by various environmental factors including light, temperature and abiotic stresses. The basic genetic framework of seed dormancy depends on the antagonistic action of abscisic acid (ABA) and gibberellic acid (GA) to promote dormancy and germination. Recent studies have revealed a role for epigenetic changes, predominantly histone modifications, in controlling seed dormancy. To investigate the role of DNA methylation in seed dormancy, we explored the role of ARGONAUTE4_9 class genes in seed development and dormancy in wheat. Our results indicate that the two wheat AGO4_9 class genes i.e. AGO802 and AGO804 map to chromosomes 3S and 1S are preferentially expressed in the embryos of developing seeds. Differential expressions of AGO802-B in the embryos of PHS resistant and susceptible varieties also relates with DNA polymorphism in various wheat varieties due to an insertion of a SINE-like element into this gene. DNA methylation patterns of the embryonic tissue from six PHS resistant and susceptible varieties demonstrate a correlation with this polymorphism. These results suggest a possible role for AGO802-B in seed dormancy and PHS resistance through the modulation of DNA methylation. PMID:24130825

The rs738409 polymorphism of the PNPLA3 gene is associated with hepatic steatosis and fibrosis in Brazilian patients with chronic hepatitis C.

PubMed

Manchiero, Caroline; Nunes, Arielle Karen da Silva; Magri, Mariana Carvalheiro; Dantas, Bianca Peixoto; Mazza, Celso Carmo; Barone, Antonio Alci; Tengan, Fátima Mitiko

2017-12-19

Prospective studies have shown that 80% of acute hepatitis C virus (HCV) cases progress to chronic infection; approximately 10-20% of patients with these conditions will develop liver cirrhosis within 2 to 3 decades, and 1-5% will develop liver cancer. Some studies have indicated that the rs738409 polymorphism of the PNPLA3 gene is associated with steatosis and the progression of advanced fibrosis. This study assessed the contribution of the PNPLA3 rs738409 polymorphism with regard to the steatosis and degree of liver fibrosis in Brazilian patients diagnosed with chronic hepatitis C. A total of 290 patients were evaluated at the Clinics Hospital of the School of Medicine, University of São Paulo, between 2010 and 2015. The inclusion criteria were age ≥ 18 years and positive anti-HCV antibody and HCV RNA tests. The participants were evaluated based on medical consultation, blood tests, and liver biopsies conducted before specific antiviral therapies were applied. The associations between the rs738409 PNPLA3 gene polymorphism and steatosis and advanced fibrosis were tested under a recessive inheritance model using logistic regression analysis, including age, gender, BMI, ethnicity/color, HOMA-IR, alcohol intake, HCV genotype 3, and the rs58542926 TM6SF2 gene polymorphism as covariates. The mean age of the patients was 54.9 years old (range, 28 to 82 years), and 124 (42.8%) patients were male; 226 (77.9%) were white, 43 (14.8%) were pardo, and 21 (7.2%) were black Brazilians. Of the patients included in this study, 133 (45.9%) presented with the CC genotype, 63 (21.7%) with the CG genotype, and 94 (32.4%) with the GG genotype of the PNPLA3 gene I148M variant. We observed that the associations between PNPLA3 rs738409 GG genotype and steatosis was significant (OR: 2.16; 95% CI 1.26-3.72). The same genotype was associated to advanced fibrosis too (OR:2.64; 95% CI 1.26-5.53). Associations between the rs738409 polymorphism of the PNPLA3 gene genotype GG and hepatic steatosis and advanced fibrosis were observed. Studies are still needed to clarify the influence of these polymorphisms on hepatic steatosis and degree of fibrosis among individuals diagnosed with chronic hepatitis C.

9β Polymorphism of the Glucocorticoid Receptor Gene Appears to Have Limited Impact in Patients with Addison’s Disease

PubMed Central

Ross, Ian Louis; Dandara, Collet; Swart, Marelize; Lacerda, Miguel; Schatz, Desmond; Blom, Dirk Jacobus

2014-01-01

Background Addison’s disease (AD) has been associated with an increased risk of cardiovascular disease. Glucocorticoid receptor polymorphisms that alter glucocorticoid sensitivity may influence metabolic and cardiovascular risk factors in patients with AD. The 9β polymorphism of the glucocorticoid receptor gene is associated with relative glucocorticoid resistance and has been reported to increase the risk of myocardial infarction in the elderly. We explored the impact of this polymorphism in patients with AD. Materials and Methods 147 patients with AD and 147 age, gender and ethnicity matched healthy controls were recruited. Blood was taken in a non-fasted state for plasma lipid determination, measurement of cardiovascular risk factors and DNA extraction. Results Genotype data for the 9β polymorphism was available for 139 patients and 146 controls. AD patients had a more atherogenic lipid profile characterized by an increase in the prevalence of small dense LDL (p = 0.003), increased triglycerides (p = 0.002), reduced HDLC (p<0.001) an elevated highly sensitive C-reactive protein (p = 0.01), compared with controls. The 9β polymorphism (at least one G allele) was found in 28% of patients and controls respectively. After adjusting for age, gender, ethnicity, BMI and hydrocortisone dose per metre square of body surface area in patients, there were no significant metabolic associations with this polymorphism and hydrocortisone doses were not higher in patients with the polymorphism. Conclusions This study did not identify any associations between the 9β polymorphism and cardiovascular risk factors or hydrocortisone dose and determination of this polymorphism is therefore unlikely to be of clinical benefit in the management of patients with AD. PMID:24466047

9β Polymorphism of the glucocorticoid receptor gene appears to have limited impact in patients with Addison's disease.

PubMed

Ross, Ian Louis; Dandara, Collet; Swart, Marelize; Lacerda, Miguel; Schatz, Desmond; Blom, Dirk Jacobus

2014-01-01

Addison's disease (AD) has been associated with an increased risk of cardiovascular disease. Glucocorticoid receptor polymorphisms that alter glucocorticoid sensitivity may influence metabolic and cardiovascular risk factors in patients with AD. The 9β polymorphism of the glucocorticoid receptor gene is associated with relative glucocorticoid resistance and has been reported to increase the risk of myocardial infarction in the elderly. We explored the impact of this polymorphism in patients with AD. 147 patients with AD and 147 age, gender and ethnicity matched healthy controls were recruited. Blood was taken in a non-fasted state for plasma lipid determination, measurement of cardiovascular risk factors and DNA extraction. Genotype data for the 9β polymorphism was available for 139 patients and 146 controls. AD patients had a more atherogenic lipid profile characterized by an increase in the prevalence of small dense LDL (p = 0.003), increased triglycerides (p = 0.002), reduced HDLC (p<0.001) an elevated highly sensitive C-reactive protein (p = 0.01), compared with controls. The 9β polymorphism (at least one G allele) was found in 28% of patients and controls respectively. After adjusting for age, gender, ethnicity, BMI and hydrocortisone dose per metre square of body surface area in patients, there were no significant metabolic associations with this polymorphism and hydrocortisone doses were not higher in patients with the polymorphism. This study did not identify any associations between the 9β polymorphism and cardiovascular risk factors or hydrocortisone dose and determination of this polymorphism is therefore unlikely to be of clinical benefit in the management of patients with AD.

The influence of PRNP polymorphisms on human prion disease susceptibility: an update.

PubMed

Kobayashi, Atsushi; Teruya, Kenta; Matsuura, Yuichi; Shirai, Tsuyoshi; Nakamura, Yoshikazu; Yamada, Masahito; Mizusawa, Hidehiro; Mohri, Shirou; Kitamoto, Tetsuyuki

2015-08-01

Two normally occurring polymorphisms of the human PRNP gene, methionine (M)/valine (V) at codon 129 and glutamic acid (E)/lysine (K) at codon 219, can affect the susceptibility to prion diseases. It has long been recognized that 129M/M homozygotes are overrepresented in sporadic Creutzfeldt-Jakob disease (CJD) patients and variant CJD patients, whereas 219E/K heterozygotes are absent in sporadic CJD patients. In addition to these pioneering findings, recent progress in experimental transmission studies and worldwide surveillance of prion diseases have identified novel relationships between the PRNP polymorphisms and the prion disease susceptibility. For example, although 219E/K heterozygosity confers resistance against the development of sporadic CJD, this genotype is not entirely protective against acquired forms (iatrogenic CJD and variant CJD) or genetic forms (genetic CJD and Gerstmann-Sträussler-Scheinker syndrome) of prion diseases. In addition, 129M/V heterozygotes predispose to genetic CJD caused by a pathogenic PRNP mutation at codon 180. These findings show that the effects of the PRNP polymorphisms may be more complicated than previously thought. This review aims to summarize recent advances in our knowledge about the influence of the PRNP polymorphisms on the prion disease susceptibility.

Oxytocin receptor gene polymorphisms are associated with human directed social behavior in dogs (Canis familiaris).

PubMed

Kis, Anna; Bence, Melinda; Lakatos, Gabriella; Pergel, Enikő; Turcsán, Borbála; Pluijmakers, Jolanda; Vas, Judit; Elek, Zsuzsanna; Brúder, Ildikó; Földi, Levente; Sasvári-Székely, Mária; Miklósi, Adám; Rónai, Zsolt; Kubinyi, Enikő

2014-01-01

The oxytocin system has a crucial role in human sociality; several results prove that polymorphisms of the oxytocin receptor gene are related to complex social behaviors in humans. Dogs' parallel evolution with humans and their adaptation to the human environment has made them a useful species to model human social interactions. Previous research indicates that dogs are eligible models for behavioral genetic research, as well. Based on these previous findings, our research investigated associations between human directed social behaviors and two newly described (-212AG, 19131AG) and one known (rs8679684) single nucleotide polymorphisms (SNPs) in the regulatory regions (5' and 3' UTR) of the oxytocin receptor gene in German Shepherd (N = 104) and Border Collie (N = 103) dogs. Dogs' behavior traits have been estimated in a newly developed test series consisting of five episodes: Greeting by a stranger, Separation from the owner, Problem solving, Threatening approach, Hiding of the owner. Buccal samples were collected and DNA was isolated using standard protocols. SNPs in the 3' and 5' UTR regions were analyzed by polymerase chain reaction based techniques followed by subsequent electrophoresis analysis. The gene-behavior association analysis suggests that oxytocin receptor gene polymorphisms have an impact in both breeds on (i) proximity seeking towards an unfamiliar person, as well as their owner, and on (ii) how friendly dogs behave towards strangers, although the mediating molecular regulatory mechanisms are yet unknown. Based on these results, we conclude that similarly to humans, the social behavior of dogs towards humans is influenced by the oxytocin system.

Single-nucleotide polymorphisms g.151435C>T and g.173057T>C in PRLR gene regulated by bta-miR-302a are associated with litter size in goats.

PubMed

An, Xiaopeng; Hou, Jinxing; Gao, Teyang; Lei, Yingnan; Li, Guang; Song, Yuxuan; Wang, Jiangang; Cao, Binyun

2015-06-01

Single-nucleotide polymorphisms (SNPs) located at microRNA-binding sites (miR-SNPs) can affect the expression of genes. This study aimed to identify the miR-SNPs associated with litter size. Guanzhong (n = 321) and Boer (n = 191) goat breeds were used to detect SNPs in the caprine prolactin receptor (PRLR) gene by DNA sequencing, primer-introduced restriction analysis-polymerase chain reaction, and polymerase chain reaction-restriction fragment length polymorphism. Three novel SNPs (g.151435C>T, g.151454A>G, and g.173057T>C) were identified in the caprine PRLR gene. Statistical results indicated that the g.151435C>T and g.173057T>C SNPs were significantly associated with litter size in Guanzhong and Boer goat breeds. Further analysis revealed that combinative genotype C6 (TTAACC) was better than the others for litter size in both goat breeds. Furthermore, the PRLR g.173057T>C polymorphism was predicted to regulate the binding activity of bta-miR-302a. Luciferase reporter gene assay confirmed that 173057C to T substitution disrupted the binding site for bta-miR-302a, resulting in the reduced levels of luciferase. Taken together, these findings suggested that bta-miR-302a can influence the expression of PRLR protein by binding with 3'untranslated region, resulting in that the g.173057T>C SNP had significant effects on litter size. Copyright © 2015 Elsevier Inc. All rights reserved.

The impact of ACE gene polymorphism on the incidence and phenotype of sarcoidosis in rural and urban settings.

PubMed

Kieszko, Robert; Krawczyk, Paweł; Powrózek, Tomasz; Szudy-Szczyrek, Aneta; Szczyrek, Michał; Homa, Iwona; Daniluk, Jadwiga; Milanowski, Janusz

2016-12-01

Sarcoidosis is a multisystem granulomatous disease of unknown etiology. Current theory on the etiology of this disease involves participation of genetic factors and unknown antigens present in the patients' environment. The aim of the study was to evaluate the prevalence of different polymorphic forms of the ACE gene in healthy individuals and sarcoidosis patients, and to estimate the risk of sarcoidosis in carriers of different ACE genotypes living in rural and urban settings. The study group included 180 patients with pulmonary sarcoidosis. Assessment of the disease was based on clinical features, laboratory and imaging examinations, as well as bronchoscopy with bronchoalveolar lavage (BAL). ACE gene polymorphism was examined in DNA isolated from peripheral blood or BAL fluid (BALF) leukocytes. Incidence of sarcoidosis was not influenced by gender, age or place of residence of the patients. There were no differences in the frequency of particular genotypes in patients with sarcoidosis and in healthy individuals. The risk of disease did not depend on the ACE gene polymorphism. There were no differences in the frequencies of the different genotypes and alleles of the ACE gene in patients with sarcoidosis divided by gender, age and place of residence or by clinical manifestation of sarcoidosis. Our results do not support the previous concept which suggested a higher incidence of sarcoidosis in individuals living in rural areas and in carriers of selected ACE genotypes. It is possible that this is related to the changing environment of rural areas, increasing urbanization and pollution.

Polymorphisms in NOS3, MTHFR, APOB and TNF-α Genes and Risk of Coronary Atherosclerotic Lesions in Iranian Patients

PubMed Central

Heidari, Mohammad Mehdi; Khatami, Mehri; Hadadzadeh, Mehdi; Kazemi, Mahbobeh; Mahamed, Sahar; Malekzadeh, Pegah; Mirjalili, Massomeh

2015-01-01

Background: Atherosclerosis is a complex multifocal arterial disease involving interactions between multiple genetic and environmental factors. Objectives: In the present study, we investigated the possible association between NOS3 (rs1799983), MTHFR (rs1801133), APOB (rs5742904) and TNF-α (rs361525) polymorphisms and the risk of coronary atherosclerotic lesions in Iranian patients. Patients and Methods: In the case-control study, 108 patients with coronary atherosclerosis disease and 95 control subjects with no family history of cardiovascular disease were enrolled. Genotypes for NOS3, MTHFR, APOB and TNF-α polymorphisms were identified using polymerase chain reaction (PCR)-restriction fragment length polymorphism (RFLP). Results: We specifically detected the NOS3 TT genotype in 12 patients (11.11%) and did not find the same genotype in any of the controls. The frequencies of T allele in patients and the controls were 24% and 17.8%, respectively. The prevalence of the MTHFR TT genotype was 16.7% in patients and 2.2% in control groups. The prevalence of the APOB-100 (R3500Q) mutation in this patient population was 0%. The frequency of the A allele in the TNF-α gene was 11.1% and 11% in patients and controls, respectively, and the AA genotype was undetected. Conclusions: Our results show a significant association of NOS3 and MTHFR gene polymorphisms with coronary atherosclerotic lesions. Therefore, these variants might influence the risk of coronary artery disease, specifically in the Iranian population. PMID:26878010

Influence of DAT1 and COMT variants on neural activation during response inhibition in adolescents with attention-deficit/hyperactivity disorder and healthy controls.

PubMed

van Rooij, D; Hoekstra, P J; Bralten, J; Hakobjan, M; Oosterlaan, J; Franke, B; Rommelse, N; Buitelaar, J K; Hartman, C A

2015-11-01

Impairment of response inhibition has been implicated in attention-deficit/hyperactivity disorder (ADHD). Dopamine neurotransmission has been linked to the behavioural and neural correlates of response inhibition. The current study aimed to investigate the relationship of polymorphisms in two dopamine-related genes, the catechol-O-methyltransferase gene (COMT) and the dopamine transporter gene (SLC6A3 or DAT1), with the neural and behavioural correlates of response inhibition. Behavioural and neural measures of response inhibition were obtained in 185 adolescents with ADHD, 111 of their unaffected siblings and 124 healthy controls (mean age 16.9 years). We investigated the association of DAT1 and COMT variants on task performance and whole-brain neural activation during response inhibition in a hypothesis-free manner. Additionally, we attempted to explain variance in previously found ADHD effects on neural activation during response inhibition using these DAT1 and COMT polymorphisms. The whole-brain analyses demonstrated large-scale neural activation changes in the medial and lateral prefrontal, subcortical and parietal regions of the response inhibition network in relation to DAT1 and COMT polymorphisms. Although these neural activation changes were associated with different task performance measures, no relationship was found between DAT1 or COMT variants and ADHD, nor did variants in these genes explain variance in the effects of ADHD on neural activation. These results suggest that dopamine-related genes play a role in the neurobiology of response inhibition. The limited associations between gene polymorphisms and task performance further indicate the added value of neural measures in linking genetic factors and behavioural measures.

Genetic variation in metallothionein and metal-regulatory transcription factor 1 in relation to urinary cadmium, copper, and zinc

DOE Office of Scientific and Technical Information (OSTI.GOV)

Adams, Scott V., E-mail: sadams@fhcrc.org; Barrick, Brian; Christopher, Emily P.

Background: Metallothionein (MT) proteins play critical roles in the physiological handling of both essential (Cu and Zn) and toxic (Cd) metals. MT expression is regulated by metal-regulatory transcription factor 1 (MTF1). Hence, genetic variation in the MT gene family and MTF1 might influence excretion of these metals. Methods: 321 women were recruited in Seattle, WA and Las Cruces, NM and provided demographic information, urine samples for measurement of metal concentrations by mass spectrometry and creatinine, and blood or saliva for extraction of DNA. Forty-one single nucleotide polymorphisms (SNPs) within the MTF1 gene region and the region of chromosome 16 encodingmore » the MT gene family were selected for genotyping in addition to an ancestry informative marker panel. Linear regression was used to estimate the association of SNPs with urinary Cd, Cu, and Zn, adjusted for age, urinary creatinine, smoking history, study site, and ancestry. Results: Minor alleles of rs28366003 and rs10636 near the MT2A gene were associated with lower urinary Cd, Cu, and Zn. Minor alleles of rs8044719 and rs1599823, near MT1A and MT1B, were associated with lower urinary Cd and Zn, respectively. Minor alleles of rs4653329 in MTF1 were associated with lower urinary Cd. Conclusions: These results suggest that genetic variation in the MT gene region and MTF1 influences urinary Cd, Cu, and Zn excretion. - Highlights: • Genetic variation in metallothionein (MT) genes was assessed in two diverse populations. • Single nucleotide polymorphisms (SNPs) in MT genes were associated with mean urinary Cd, Cu and Zn. • Genetic variation may influence biomarkers of exposure, and associations of exposure with health.« less

Serum apolipoprotein E concentration and polymorphism influence serum lipid levels in Chinese Shandong Han population.

PubMed

Han, ShuYi; Xu, YiHui; Gao, MeiHua; Wang, YunShan; Wang, Jun; Liu, YanYan; Wang, Min; Zhang, XiaoQian

2016-12-01

Apolipoprotein E (ApoE), which has been shown to influence serum lipid parameters, can bind to multiple types of lipids and plays an important role in the metabolism and homeostasis of lipids and lipoproteins. A previous study showed that ApoE concentration significantly affects serum lipid levels independently of ApoE polymorphism. The serum lipid levels were also closely correlated with dietary habits, and Shandong cuisine is famous for its high salt and oil contents, which widely differ among the different areas in China. Therefore, studying the effect of ApoE polymorphism on ApoE concentration and serum lipid levels in Shandong province is very important.A total of 815 subjects including 285 men and 530 women were randomly selected and studied from Jinan, Shandong province. In order to evaluate the association of ApoE polymorphism and serum level on lipid profiles, the ApoE genotypes, as well as levels of fasting serum ApoE and other lipid parameters, were detected in all subjects.The frequency of the ApoE E3 allele was highest (83.1%), while those of E2 and E4 were 9.4% and 7.5%, respectively, which are similar to those in other Asian populations. ApoE2 allele carriers showed significantly increased ApoE levels but lower levels of serum total cholesterol (TC), low-density lipoprotein cholesterol (LDL-C), and Apolipoprotein B (ApoB).We found that ApoE level is influenced by ApoE polymorphism in a gene-dependent manner. The ApoE polymorphism showed different influences on serum lipid parameters with increasing age and body mass index (BMI) in our Shandong Han population.

Serum apolipoprotein E concentration and polymorphism influence serum lipid levels in Chinese Shandong Han population

PubMed Central

Han, ShuYi; Xu, YiHui; Gao, MeiHua; Wang, YunShan; Wang, Jun; Liu, YanYan; Wang, Min; Zhang, XiaoQian

2016-01-01

Abstract Apolipoprotein E (ApoE), which has been shown to influence serum lipid parameters, can bind to multiple types of lipids and plays an important role in the metabolism and homeostasis of lipids and lipoproteins. A previous study showed that ApoE concentration significantly affects serum lipid levels independently of ApoE polymorphism. The serum lipid levels were also closely correlated with dietary habits, and Shandong cuisine is famous for its high salt and oil contents, which widely differ among the different areas in China. Therefore, studying the effect of ApoE polymorphism on ApoE concentration and serum lipid levels in Shandong province is very important. A total of 815 subjects including 285 men and 530 women were randomly selected and studied from Jinan, Shandong province. In order to evaluate the association of ApoE polymorphism and serum level on lipid profiles, the ApoE genotypes, as well as levels of fasting serum ApoE and other lipid parameters, were detected in all subjects. The frequency of the ApoE E3 allele was highest (83.1%), while those of E2 and E4 were 9.4% and 7.5%, respectively, which are similar to those in other Asian populations. ApoE2 allele carriers showed significantly increased ApoE levels but lower levels of serum total cholesterol (TC), low-density lipoprotein cholesterol (LDL-C), and Apolipoprotein B (ApoB). We found that ApoE level is influenced by ApoE polymorphism in a gene-dependent manner. The ApoE polymorphism showed different influences on serum lipid parameters with increasing age and body mass index (BMI) in our Shandong Han population. PMID:27977609

Methylation polymorphism influences practice effects in children during attention tasks1

PubMed Central

Voelker, Pascale; Sheese, Brad E.; Rothbart, Mary K.; Posner, Michael I.

2017-01-01

Epigenetic mechanisms mediate the influence of experience on gene expression. Methylation is a principal method for inducing epigenetic effects on DNA. In this paper, we examine alleles of the methylenetetrahydrofolate reductase (MTHFR) gene that vary enzyme activity, altering the availability of the methyl donor and thus changing the efficiency of methylation. We hypothesized that alleles of the MTHFR gene would influence behavior in an attention related task in conjunction with genes known to influence attention. We found that 7-year-old children homozygous for the C allele of MTHFR in interaction with the catechol O-methyltransferase (COMT) gene showed greater improvement in overall reaction time (RT) and in conflict resolution with practice on the Attention Network Test (ANT). This finding indicates that methylation may operate on or through genes that influence executive network operation. However, MTHFR T allele carriers showed faster overall RT and conflict resolution. Some children showed an initial improvement in ANT RT followed by a decline in performance, and we found that alleles of the dopamine beta-hydroxylase (DBH) gene were related to this performance decline. These results suggest a genetic dissociation between improvement while learning a skill and reduction in performance with continued practice. PMID:27050482

Genetic and environmental factors in human osteoporosis.

PubMed

Özbaş, Halil; Tutgun Onrat, Serap; Özdamar, Kazım

2012-12-01

Osteoporosis is a common disorder, with prolongation of the average life span it has become a major public health problem. On the formation of osteoporosis genetic factors and environmental influences could play a role then it is considered as multi-factorial. Because a variety of functions to affect susceptibility to the formation of osteoporosis VDR-F, VDR-B, COL1A1, ESR1X, ESR1P and CTR are thought to be candidate genes. In this study, the aim is to investigate the relationship between these genes polymorphism and bone mineral density (BMD) values of lumbar vertebra and femoral neck in 188 Turkish people. Lumbar spine and femoral neck BMD of the individuals included in the study were measured by the dual X-ray absorptiometry method. The genotyped polymorphisms by simultaneous amplification of five regions of the genome, containing six SNPs of interest and detecting the amplified product, using the kit MetaBone Clinical Arrays(®). Statistical analyses indicated that; VDR-B gene polymorphisms major (P = 0.013), VDR-F polymorphisms have minor (P = 0.082) effect on femur BMD. None of the other genes has any significant effect on spinal BMD. Patient age, body mass index and diet has significant effect on femoral and spinal BMD. Osteoporosis is a multi-factorial disease and many genetic and non-genetic risk factors contribute to the development of osteoporosis. Early detection of a genetic predisposition to osteoporosis should allow delay and/or limit unfavorable changes in the bone tissue.

Polymorphisms in the Vitamin A Receptor and Innate Immunity Genes Influence the Antibody Response to Rubella Vaccination

PubMed Central

Ovsyannikova, Inna G.; Haralambieva, Iana H.; Dhiman, Neelam; O’Byrne, Megan M.; Pankratz, V. Shane; Jacobson, Robert M.; Poland, Gregory A.

2009-01-01

Background Genetic polymorphisms play an important role in rubella vaccine-induced immunity. Methods We genotyped 714 healthy children after two age-appropriate doses of rubella-containing vaccine for 142 potential SNPs. Results Specific polymorphisms in the vitamin A receptor, RIG-I, TRIM5 and TRIM22 genes were significantly associated with rubella vaccine humoral immunity. The minor allele of the rs4416353 in the vitamin A receptor gene was associated with an allele dose-related decrease (P=.019) in rubella antibody response. The minor allele of rs6793694, in the vitamin A receptor gene, was associated with an allele dose-related antibody decrease (P=.039). The minor variant of nonsynonymous SNP rs10813831 (Arg7Cys) in the RIG-I gene was associated with an allele dose-related decrease in rubella antibody level from 37.4 IU/mL to 28.0 IU/mL (P=.035), while increased representation of the minor allele of the 5’UTR SNP (rs3824949, P=.015), in the antiretroviral TRIM5 gene, was associated with an allele dose-related increase in rubella antibody. It is of particular interest that the nonsynonymous SNP rs3740996 (His43Tyr) in the TRIM5 gene was associated with variations in rubella antibody response (P=.016) after having been previously found to have a significant functional role. Conclusions These findings further expand our immunogenetic understanding of mechanisms of rubella vaccine-induced immunity. PMID:20001730

PACSIN2 polymorphism influences TPMT activity and mercaptopurine-related gastrointestinal toxicity.

PubMed

Stocco, Gabriele; Yang, Wenjian; Crews, Kristine R; Thierfelder, William E; Decorti, Giuliana; Londero, Margherita; Franca, Raffaella; Rabusin, Marco; Valsecchi, Maria Grazia; Pei, Deqing; Cheng, Cheng; Paugh, Steven W; Ramsey, Laura B; Diouf, Barthelemy; McCorkle, Joseph Robert; Jones, Terreia S; Pui, Ching-Hon; Relling, Mary V; Evans, William E

2012-11-01

Treatment-related toxicity can be life-threatening and is the primary cause of interruption or discontinuation of chemotherapy for acute lymphoblastic leukemia (ALL), leading to an increased risk of relapse. Mercaptopurine is an essential component of continuation therapy in all ALL treatment protocols worldwide. Genetic polymorphisms in thiopurine S-methyltransferase (TPMT) are known to have a marked effect on mercaptopurine metabolism and toxicity; however, some patients with wild-type TPMT develop toxicity during mercaptopurine treatment for reasons that are not well understood. To identify additional genetic determinants of mercaptopurine toxicity, a genome-wide analysis was performed in a panel of human HapMap cell lines to identify trans-acting genes whose expression and/or single-nucleotide polymorphisms (SNPs) are related to TPMT activity, then validated in patients with ALL. The highest ranking gene with both mRNA expression and SNPs associated with TPMT activity in HapMap cell lines was protein kinase C and casein kinase substrate in neurons 2 (PACSIN2). The association of a PACSIN2 SNP (rs2413739) with TPMT activity was confirmed in patients and knock-down of PACSIN2 mRNA in human leukemia cells (NALM6) resulted in significantly lower TPMT activity. Moreover, this PACSIN2 SNP was significantly associated with the incidence of severe gastrointestinal (GI) toxicity during consolidation therapy containing mercaptopurine, and remained significant in a multivariate analysis including TPMT and SLCO1B1 as covariates, consistent with its influence on TPMT activity. The association with GI toxicity was also validated in a separate cohort of pediatric patients with ALL. These data indicate that polymorphism in PACSIN2 significantly modulates TPMT activity and influences the risk of GI toxicity associated with mercaptopurine therapy.

PACSIN2 polymorphism influences TPMT activity and mercaptopurine-related gastrointestinal toxicity

PubMed Central

Stocco, Gabriele; Yang, Wenjian; Crews, Kristine R.; Thierfelder, William E.; Decorti, Giuliana; Londero, Margherita; Franca, Raffaella; Rabusin, Marco; Valsecchi, Maria Grazia; Pei, Deqing; Cheng, Cheng; Paugh, Steven W.; Ramsey, Laura B.; Diouf, Barthelemy; McCorkle, Joseph Robert; Jones, Terreia S.; Pui, Ching-Hon; Relling, Mary V.; Evans, William E.

2012-01-01

Treatment-related toxicity can be life-threatening and is the primary cause of interruption or discontinuation of chemotherapy for acute lymphoblastic leukemia (ALL), leading to an increased risk of relapse. Mercaptopurine is an essential component of continuation therapy in all ALL treatment protocols worldwide. Genetic polymorphisms in thiopurine S-methyltransferase (TPMT) are known to have a marked effect on mercaptopurine metabolism and toxicity; however, some patients with wild-type TPMT develop toxicity during mercaptopurine treatment for reasons that are not well understood. To identify additional genetic determinants of mercaptopurine toxicity, a genome-wide analysis was performed in a panel of human HapMap cell lines to identify trans-acting genes whose expression and/or single-nucleotide polymorphisms (SNPs) are related to TPMT activity, then validated in patients with ALL. The highest ranking gene with both mRNA expression and SNPs associated with TPMT activity in HapMap cell lines was protein kinase C and casein kinase substrate in neurons 2 (PACSIN2). The association of a PACSIN2 SNP (rs2413739) with TPMT activity was confirmed in patients and knock-down of PACSIN2 mRNA in human leukemia cells (NALM6) resulted in significantly lower TPMT activity. Moreover, this PACSIN2 SNP was significantly associated with the incidence of severe gastrointestinal (GI) toxicity during consolidation therapy containing mercaptopurine, and remained significant in a multivariate analysis including TPMT and SLCO1B1 as covariates, consistent with its influence on TPMT activity. The association with GI toxicity was also validated in a separate cohort of pediatric patients with ALL. These data indicate that polymorphism in PACSIN2 significantly modulates TPMT activity and influences the risk of GI toxicity associated with mercaptopurine therapy. PMID:22846425

Influence of Folate-Related Gene Polymorphisms on High-Dose Methotrexate-Related Toxicity and Prognosis in Turkish Children with Acute Lymphoblastic Leukemia.

PubMed

Yazıcıoğlu, Burcu; Kaya, Zühre; Güntekin Ergun, Sezen; Perçin, Ferda; Koçak, Ülker; Yenicesu, İdil; Gürsel, Türkiz

2017-06-05

High-dose methotrexate (HD-MTX) is widely used in the consolidation phase of childhood acute lymphoblastic leukemia (ALL), but the roles that polymorphisms in folate-related genes (FRGs) play in HD-MTX toxicity and prognosis in children with ALL are not understood. The aims of this study were to investigate the frequencies of polymorphisms in the genes for thymidylate synthase (TS), methionine synthase reductase (MTRR), and methylene tetrahydrofolate reductase (MTHFR) in Turkish children with ALL and to assess associations between these polymorphisms and HD-MTX-related toxicity and leukemia prognosis in this patient group. FRG polymorphisms were assessed by real-time polymerase chain reaction. Survival status, MTX levels, and toxicity data were retrieved from 106 patients' charts. The allele frequencies for the FRG polymorphisms were as follows: TS 2R 41.0%, 3R 57.0%, and 4R 2.0%; MTRR 66A 42.4% and 66G 57.6%; MTHFR 677C 59.3% and 677T 40.7%; and MTHFR 1298A 58.1% and 1298C 41.9%. At the 48th hour of HD-MTX infusion, serum MTX was significantly higher in patients who had TS 2R/3R/4R variants as compared to those with wild-type TS (p<0.05). No significant differences were detected with respect to event-free survival or toxicity between wild-type and other FRG variants. The frequencies of FRG polymorphisms in Turkish children with ALL are similar to those reported in other Caucasian populations. This is the first published finding of the TS 3R/4R variant in the Turkish population. The results indicate that HD-MTX can be tolerated by leukemic children with some polymorphic variants of FRG; thus, it may prevent future risk of leukemic relapse.

Polymorphisms at the Ligand Binding Site of the Vitamin D Receptor Gene and Osteomalacia

PubMed Central

Ak, Duygu Gezen; Kahraman, Hakkí; Dursun, Erdinç; Duman, Belgin Süsleyici; Erensoy, Nevin; Alagöl, Faruk; Tanakol, Refik; Yılmazer, Selma

2005-01-01

Vitamin D receptor (VDR) gene polymorphisms have been suggested as possible determinants of bone mineral density (BMD) and calcium metabolism. In this study, our aim was to determine whether there is an association between VDR gene polymorphism and osteomalacia or not. We determined ApaI and TaqI polymorphisms in the vitamin D receptor gene in 24 patients with osteomalacia and 25 age-matched healthy controls. Serum calcium, phosphorus, ALP, PTH, 25OHD levels were also examined. We used PCR and RFLP methods to test for an association between osteomalacia and polymorphisms within, intron 8 and exon 9 of the VDR gene. When the control and patients were compared for their ApaI and TaqI genotypes there was no relationship between VDR gene allelic polymorphisms and osteomalacia. Whereas a nearly significant difference for A allele was found in the allellic distribution of the patients (p = 0.08). Also no association between biochemical data and VDR gene polymorphisms was observed. PMID:16403954

Office blood pressure, heart rate and A(-596)G interleukin-6 gene polymorphism in apparently healthy Czech middle-aged population.

PubMed

Vasků, A; Soucek, M; Goldbergová, M; Vácha, J

2003-01-01

The aim of the study was to assess the association between promoter polymorphism [A(-596)G] in interleukin-6 gene and office systolic and diastolic blood pressures, and the heart rate (HR) in apparently healthy Czech subjects. Furthermore, we evaluated the possible influence of gender, BMI and smoking on these supposed associations. An age-matched (40-50 years) and gender-matched (F/M=81/89) sample of apparently healthy Czech subjects (n=170, F/M=81/89) without hypertension, other cardiovascular diseases or diabetes was examined. The A(-596)G Il-6 gene polymorphism was detected by the PCR method. No differences in genotype distribution and/or allelic frequency was found between groups with lower systolic blood pressure (Ł 122 mm Hg) and higher systolic blood pressure (> 122 mm Hg). Similarly, no differences in the IL-6 polymorphism were found between lower (Ł 86 mm Hg) and higher (> 86 mm Hg) diastolic blood pressure groups. However, we proved a significant increase of genotypes AG+GG as well as the allele (-596)G in higher (>78 beats/min) heart rate group. The genotypes AG+GG represent significantly higher relative risk for higher HR frequency, especially in women. Among lean persons with a low heart rate frequency, fewer AG+GG genotypes were determined than among any other subjects. The genotypes AG+GG are more frequent in non-smoking persons with higher HR compared to non-smoking subjects with lower HR, especially in women. Gender, BMI and smoking substantially modify the distribution of A(-596)G Il-6 gene polymorphism in apparently healthy persons with lower or higher heart rate.

BClI polymorphism of the glucocorticoid receptor gene is associated with increased obesity, impaired glucose metabolism and dyslipidaemia in patients with Addison's disease.

PubMed

Giordano, Roberta; Marzotti, Stefania; Berardelli, Rita; Karamouzis, Ioannis; Brozzetti, Annalisa; D'Angelo, Valentina; Mengozzi, Giulio; Mandrile, Giorgia; Giachino, Daniela; Migliaretti, Giuseppe; Bini, Vittorio; Falorni, Alberto; Ghigo, Ezio; Arvat, Emanuela

2012-12-01

Although glucocorticoids are essential for health, several studies have shown that glucocorticoids replacement in Addison's disease might be involved in anthropometric and metabolic impairment, with increased cardiovascular risk, namely if conventional doses are used. As the effects of glucocorticoids are mediated by the glucocorticoid receptor, encoded by NR3C1 gene, different polymorphisms in the NR3C1 gene have been linked to altered glucocorticoid sensitivity in general population as well as in patients with obesity or metabolic syndrome. We investigated the impact of glucocorticoid receptor gene polymorphisms, including the BclI, N363S and ER22/23EK variants, on anthropometric parameters (BMI and waist circumference), metabolic profile (HOMA, OGTT and serum lipids) and ACTH levels in 50 patients with Addison's disease (34 women and 16 men, age 20-82 year) under glucocorticoids replacement. Neither N363S nor ER22/23EK variants were significantly associated with anthropometric, metabolic or hormonal parameters, while patients carrying the homozygous BclI polymorphism GG (n = 4) showed higher (P < 0·05) BMI, waist circumference, HOMA and 2-h glucose levels after OGTT, as well as total cholesterol and triglycerides than those with wild-type genotype CC (n = 28) or heterozygous CG (n = 18). The totality of GG patients was connoted by abdominal adiposity, impaired glucose tolerance/diabetes mellitus or dyslipidaemia, while a lower percentage of CC or CG patients showed some anthropometric and metabolic alterations. These results suggest that BclI polymorphism may influence the sensitivity to glucocorticoids in patients with Addison's disease and may contribute, along with other factors, to the increase in central adiposity, impaired glucose metabolism and dyslipidaemia. © 2012 Blackwell Publishing Ltd.

Apolipoprotein B and angiotensin-converting enzyme polymorphisms and aerobic interval training: randomized controlled trial in coronary artery disease patients.

PubMed

Tamburus, N Y; Verlengia, R; Kunz, V C; César, M C; Silva, E

2018-01-01

Physical training has been strongly recommended as a non-pharmacological treatment for coronary artery disease (CAD). Genetic polymorphisms have been studied to understand the biological variability in response to exercise among individuals. This study aimed to verify the possible influence of apolipoprotein B (ApoB: rs1042031 and rs693) and angiotensin-converting enzyme (ACE-ID: rs1799752) genotypes on the lipid profile and functional aerobic capacity, respectively, after an aerobic interval training (AIT) program in patients with CAD and/or cardiovascular risk factors. Sixty-six men were randomized and assigned to trained group (n=32) or control group (n=34). Cardiopulmonary exercise test was performed to determine the ventilatory anaerobic threshold (VAT) from cardiorespiratory variables. The AIT program, at an intensity equivalent to %VAT (70-110%), was conducted three times a week for 16 weeks. ApoB gene polymorphisms (-12669C>T (rs1042031) and -7673G>A (rs693)) were identified by real-time polymerase chain reaction (PCR). I/D polymorphism in the ACE gene (rs1799752) was identified through PCR and fragment size analysis. After 16 weeks, low-density lipoprotein (LDL) levels increased in the trained and control groups with the GA+AA genotype (-7673G>A) of the ApoB gene. Trained groups with ACE-II and ACE-ID genotypes presented an increase in oxygen consumption (VO2VAT) and power output after the AIT program. The presence of the ACE I-allele was associated with increased aerobic functional capacity after the AIT program. Increased LDL levels were observed over time in patients with the -7673G>A polymorphism of the ApoB gene. Trial Registration Information: ClinicalTrials.gov: NCT02313831.

Association of SNP and STR polymorphisms of insulin-like growth factor 2 receptor (IGF2R) gene with milk traits in Holstein-Friesian cows.

PubMed

Dux, Marta; Muranowicz, Magdalena; Siadkowska, Eulalia; Robakowska-Hyżorek, Dagmara; Flisikowski, Krzysztof; Bagnicka, Emilia; Zwierzchowski, Lech

2018-05-01

The objective of the study reported in this Research Communication was to investigate the association of polymorphisms in the insulin-like growth factor receptor 2 (IGF2R) gene with milk traits in 283 Polish Holstein-Friesian (PHF) cows from the IGAB PAS farm in Jastrzębiec. IGF2R regulates the availability of biologically active IGF2 which is considered as a genetic marker for milk or meat production in farm animals. Two novel genetic polymorphisms were identified in the bovine IGF2R gene: a polymorphic TG-repeat in intron 23 (g.72389 (TG)15-67), and a g.72479 G > A SNP RFLP-StyI in exon 24. The following milk traits were investigated: milk yield, protein and fat yield, SCC and lactose content. To determine the influence of the IGF2R STR and SNP genotypes on the milk traits, we used the AI-REML (average information restricted maximum likelihood) method with repeatability, multi-trait animal model based on test-day information using DMU package. Statistical analysis revealed that the G/A genotype (P ≤ 0·01) was associated with milk and protein yield, lactose content and somatic cell count (SCC) in Polish HF cows. TGn (29/22, 28/29, 28/22, 28/28) genotypes were associated with high values for milk, (28/22, 28/23) with protein and fat yield, (25/20) with lactose content, and (29/33, 28/28) with low SCC. We suggest that the IGF2R gene polymorphisms could be useful genetic markers for dairy production traits in cattle.

An ADAM33 polymorphism associates with progression of preschool wheeze into childhood asthma: a prospective case-control study with replication in a birth cohort study.

PubMed

Klaassen, Ester M M; Penders, John; Jöbsis, Quirijn; van de Kant, Kim D G; Thijs, Carel; Mommers, Monique; van Schayck, Constant P; van Eys, Guillaume; Koppelman, Gerard H; Dompeling, Edward

2015-01-01

The influence of asthma candidate genes on the development from wheeze to asthma in young children still needs to be defined. To link genetic variants in asthma candidate genes to progression of wheeze to persistent wheeze into childhood asthma. In a prospective study, children with recurrent wheeze from the ADEM (Asthma DEtection and Monitoring) study were followed until the age of six. At that age a classification (transient wheeze or asthma) was based on symptoms, lung function and medication use. In 198 children the relationship between this classification and 30 polymorphisms in 16 asthma candidate genes was assessed by logistic regression. In case of an association based on a p<0.10, replication analysis was performed in an independent birth cohort study (KOALA study, n = 248 included for the present analysis). In the ADEM study, the minor alleles of ADAM33 rs511898 and rs528557 and the ORMDL3/GSDMB rs7216389 polymorphisms were negatively associated, whereas the minor alleles of IL4 rs2243250 and rs2070874 polymorphisms were positively associated with childhood asthma. When replicated in the KOALA study, ADAM33 rs528557 showed a negative association of the CG/GG-genotype with progression of recurrent wheeze into childhood asthma (0.50 (0.26-0.97) p = 0.04) and no association with preschool wheeze. Polymorphisms in ADAM33, ORMDL3/GSDMB and IL4 were associated with childhood asthma in a group of children with recurrent wheeze. The replication of the negative association of the CG/GG-genotype of rs528557 ADAM33 with childhood asthma in an independent birth cohort study confirms that a compromised ADAM33 gene may be implicated in the progression of wheeze into childhood asthma.

Synaptosomal-associated protein 25 gene polymorphisms and antisocial personality disorder: association with temperament and psychopathy.

PubMed

Basoglu, Cengiz; Oner, Ozgur; Ates, Alpay; Algul, Ayhan; Bez, Yasin; Cetin, Mesut; Herken, Hasan; Erdal, Mehmet Emin; Munir, Kerim M

2011-06-01

The molecular genetic of personality disorders has been investigated in several studies; however, the association of antisocial behaviours with synaptosomal-associated protein 25 (SNAP25) gene polymorphisms has not. This association is of interest as SNAP25 gene polymorphism has been associated with attention-deficit hyperactivity disorder and personality. We compared the distribution of DdeI and MnII polymorphisms in 91 young male offenders and in 38 sex-matched healthy control subjects. We also investigated the association of SNAP25 gene polymorphisms with severity of psychopathy and with temperament traits: novelty seeking, harm avoidance, and reward dependence. The MnII T/T and DdeI T/T genotypes were more frequently present in male subjects with antisocial personality disorder (APD) than in sex-matched healthy control subjects. The association was stronger when the frequency of both DdeI and MnII T/T were taken into account. In the APD group, the genotype was not significantly associated with the Psychopathy Checklist-Revised scores, measuring the severity of psychopathy. However, the APD subjects with the MnII T/T genotype had higher novelty seeking scores; whereas, subjects with the DdeI T/T genotype had lower reward dependence scores. Again, the association between genotype and novelty seeking was stronger when both DdeI and MnII genotypes were taken into account. DdeI and MnII T/T genotypes may be a risk factor for antisocial behaviours. The association of the SNAP25 DdeI T/T and MnII T/T genotypes with lower reward dependence and higher novelty seeking suggested that SNAP25 genotype might influence other personality disorders, as well.

Synaptosomal-Associated Protein 25 Gene Polymorphisms and Antisocial Personality Disorder: Association With Temperament and Psychopathy

PubMed Central

Basoglu, Cengiz; Oner, Ozgur; Ates, Alpay; Algul, Ayhan; Bez, Yasin; Cetin, Mesut; Herken, Hasan; Erdal, Mehmet Emin; Munir, Kerim M

2011-01-01

Objective The molecular genetic of personality disorders has been investigated in several studies; however, the association of antisocial behaviours with synaptosomal-associated protein 25 (SNAP25) gene polymorphisms has not. This association is of interest as SNAP25 gene polymorphism has been associated with attention-deficit hyperactivity disorder and personality. Methods We compared the distribution of DdeI and MnlI polymorphisms in 91 young male offenders and in 38 sex-matched healthy control subjects. We also investigated the association of SNAP25 gene polymorphisms with severity of psychopathy and with temperament traits: novelty seeking, harm avoidance, and reward dependence. Results The MnlI T/T and DdeI T/T genotypes were more frequently present in male subjects with antisocial personality disorder (APD) than in sex-matched healthy control subjects. The association was stronger when the frequency of both DdeI and MnlI T/T were taken into account. In the APD group, the genotype was not significantly associated with the Psychopathy Checklist–Revised scores, measuring the severity of psychopathy. However, the APD subjects with the MnlI T/T genotype had higher novelty seeking scores; whereas, subjects with the DdeI T/T genotype had lower reward dependence scores. Again, the association between genotype and novelty seeking was stronger when both DdeI and MnlI genotypes were taken into account. Conclusion DdeI and MnlI T/T genotypes may be a risk factor for antisocial behaviours. The association of the SNAP25 DdeI T/T and MnlI T/T genotypes with lower reward dependence and higher novelty seeking suggested that SNAP25 genotype might influence other personality disorders, as well. PMID:21756448

Pronounced reduction in adenoma recurrence associated with aspirin use and a polymorphism in the ornithine decarboxylase gene

PubMed Central

Martínez, María Elena; O'Brien, Thomas G.; Fultz, Kimberly E.; Babbar, Naveen; Yerushalmi, Hagit; Qu, Ning; Guo, Yongjun; Boorman, David; Einspahr, Janine; Alberts, David S.; Gerner, Eugene W.

2003-01-01

Most sporadic colon adenomas acquire mutations in the adenomatous polyposis coli gene (APC) and show defects in APC-dependent signaling. APC influences the expression of several genes, including the c-myc oncogene and its antagonist Mad1. Ornithine decarboxylase (ODC), the first enzyme in polyamine synthesis, is a transcriptional target of c-myc and a modifier of APC-dependent tumorigenesis. A single-nucleotide polymorphism exists in intron 1 of the human ODC gene, which lies between two myc-binding domains. This region is known to affect ODC transcription, but no data exist on the relationship of this polymorphism to risk of colorectal neoplasia in humans. We show that individuals homozygous for the minor ODC A-allele who reported using aspirin are ≈0.10 times as likely to have an adenoma recurrence as non-aspirin users homozygous for the major G-allele. Mad1 selectively suppressed the activity of the ODC promoter containing the A-allele, but not the G-allele, in a human colon cancer-derived cell line (HT29). Aspirin (≥10 μM) did not affect ODC allele-specific promoter activity but did activate polyamine catabolism and lower polyamine content in HT29 cells. We propose that the ODC polymorphism and aspirin act independently to reduce the risk of adenoma recurrence by suppressing synthesis and activating catabolism, respectively, of colonic mucosal polyamines. These findings confirm the hypothesis that the ODC polymorphism is a genetic marker for colon cancer risk, and support the use of ODC inhibitors and aspirin, or other nonsteroidal antiinflammatory drugs (NSAIDs), in combination as a strategy for colon cancer prevention. PMID:12810952

Uncoupling protein 2 gene polymorphisms are associated with obesity

PubMed Central

2012-01-01

Background Uncoupling protein 2 (UCP2) gene polymorphisms have been reported as genetic risk factors for obesity and type 2 diabetes mellitus (T2DM). We examined the association of commonly observed UCP2 G(−866)A (rs659366) and Ala55Val (C > T) (rs660339) single nucleotide polymorphisms (SNPs) with obesity, high fasting plasma glucose, and serum lipids in a Balinese population. Methods A total of 603 participants (278 urban and 325 rural subjects) were recruited from Bali Island, Indonesia. Fasting plasma glucose (FPG), triglyceride (TG), high density lipoprotein cholesterol (HDL-C), low density lipoprotein cholesterol (LDL-C) and total cholesterol (TC) were measured. Obesity was determined based on WHO classifications for adult Asians. Participants were genotyped for G(−866)A and Ala55Val polymorphisms of the UCP2 gene. Results Obesity prevalence was higher in urban subjects (51%) as compared to rural subjects (23%). The genotype, minor allele (MAF), and heterozygosity frequencies were similar between urban and rural subjects for both SNPs. All genotype frequencies were in Hardy-Weinberg equilibrium. A combined analysis of genotypes and environment revealed that the urban subjects carrying the A/A genotype of the G(−866)A SNP have higher BMI than the rural subjects with the same genotype. Since the two SNPs showed strong linkage disequilibrium (D’ = 0.946, r2 = 0.657), a haplotype analysis was performed. We found that the AT haplotype was associated with high BMI only when the urban environment was taken into account. Conclusions We have demonstrated the importance of environmental settings in studying the influence of the common UCP2 gene polymorphisms in the development of obesity in a Balinese population. PMID:22533685

Influence of variation in the catechol-O-methyltransferase gene on the clinical outcome after lumbar spine surgery for one-level symptomatic disc disease: a report on 176 cases.

PubMed

Rut, Marcin; Machoy-Mokrzyńska, Anna; Ręcławowicz, Daniel; Słoniewski, Paweł; Kurzawski, Mateusz; Droździk, Marek; Safranow, Krzysztof; Morawska, Michalina; Białecka, Monika

2014-02-01

This study was aimed at the evaluation of the relationship between genetic polymorphisms of catechol-O-methyltransferase (COMT) (rs4680:A > G-Val158Met, rs6269:A > G, rs4633:C > T, rs4818:C > G) and pain sensitivity after lumbar discectomy. All patients had one-level symptomatic disc herniation from L3 to S1. The primary data recorded included visual analogue pain scales assessing back and leg pain, Oswestry Disability Questionnaire assessing quality of life and pain intensity, received/filled pre- and postoperatively. Each subject was genotyped for single-nucleotide polymorphism in the COMT gene. Clinical outcome was measured by difference between pre- and postoperative values and those results were analyzed with genetics findings. Pain intensity was associated with the COMT polymorphism. Carriers of rs6269 AA, rs4633 TT, rs4818 CC, and rs4680 AA genotypes were characterized by the lowest preoperative scores related to pain intensity and lower pain intensity at 1 year after the surgery. The rs4633 CC, rs4680 GG genotypes demonstrated significant clinical improvement in VASBACK score at 1 year after the surgery. Patients with COMT haplotype associated with low metabolic activity of enzyme (A_C_C_G) showed better clinical outcome measured by ODI score and VASBACK score 1 year after surgery. We did not observe any significant correlation between leg pain and single-nucleotide polymorphisms in the COMT gene. The results of our study indicate that polymorphism in the COMT gene may play an important role in the mechanism of pain perception, which may have a potential implication for clinical decision-making in the future.

Selection and Trans-Species Polymorphism of Major Histocompatibility Complex Class II Genes in the Order Crocodylia

PubMed Central

Jaratlerdsiri, Weerachai; Isberg, Sally R.; Higgins, Damien P.; Miles, Lee G.; Gongora, Jaime

2014-01-01

Major Histocompatibility Complex (MHC) class II genes encode for molecules that aid in the presentation of antigens to helper T cells. MHC characterisation within and between major vertebrate taxa has shed light on the evolutionary mechanisms shaping the diversity within this genomic region, though little characterisation has been performed within the Order Crocodylia. Here we investigate the extent and effect of selective pressures and trans-species polymorphism on MHC class II α and β evolution among 20 extant species of Crocodylia. Selection detection analyses showed that diversifying selection influenced MHC class II β diversity, whilst diversity within MHC class II α is the result of strong purifying selection. Comparison of translated sequences between species revealed the presence of twelve trans-species polymorphisms, some of which appear to be specific to the genera Crocodylus and Caiman. Phylogenetic reconstruction clustered MHC class II α sequences into two major clades representing the families Crocodilidae and Alligatoridae. However, no further subdivision within these clades was evident and, based on the observation that most MHC class II α sequences shared the same trans-species polymorphisms, it is possible that they correspond to the same gene lineage across species. In contrast, phylogenetic analyses of MHC class II β sequences showed a mixture of subclades containing sequences from Crocodilidae and/or Alligatoridae, illustrating orthologous relationships among those genes. Interestingly, two of the subclades containing sequences from both Crocodilidae and Alligatoridae shared specific trans-species polymorphisms, suggesting that they may belong to ancient lineages pre-dating the divergence of these two families from the common ancestor 85–90 million years ago. The results presented herein provide an immunogenetic resource that may be used to further assess MHC diversity and functionality in Crocodylia. PMID:24503938

Mutations in exons of the CYP17-II gene affect sex steroid concentration in male Japanese flounder ( Paralichthys olivaceus)

NASA Astrophysics Data System (ADS)

Ma, Ruiqin; He, Feng; Wen, Haishen; Li, Jifang; Shi, Bao; Shi, Dan; Liu, Miao; Mu, Weijie; Zhang, Yuanqing; Hu, Jian; Han, Weiguo; Zhang, Jianan; Wang, Qingqing; Yuan, Yuren; Liu, Qun

2012-03-01

As a specific gene of fish, cytochrome P450c17-II ( CYP17-II) gene plays a key role in the growth, development an reproduction level of fish. In this study, the single-stranded conformational polymorphism (SSCP) technique was used to characterize polymorphisms within the coding region of CYP17-II gene in a population of 75 male Japanese flounder ( Paralichthys olivaceus). Three single nucleotide polymorphisms (SNPs) were identified in CYP17-II gene of Japanese flounder. They were c.G594A (p.G188R), c.G939A and c.G1502A (p.G490D). SNP1 (c.G594A), located in exon 4 of CYP17-II gene, was significantly associated with gonadosomatic index (GSI). Individuals with genotype GG of SNP1 had significantly lower GSI ( P < 0.05) than those with genotype AA or AG. SNP2 (c.G939A) located at the CpG island of CYP17-II gene. The mutation changed the methylation of exon 6. Individuals with genotype AA of SNP2 had significantly lower serum testosterone (T) level and hepatosomatic index (HSI) compared to those with genotype GG. The results suggested that SNP2 could influence the reproductive endocrine of male Japanese flounder. However, the SNP3 (c.G1502A) located in exon 9 did not affect the four measured reproductive traits. This study showed that CYP17-II gene could be a potentially useful candidate gene for the research of genetic breeding and physiological aspects of Japanese flounder.

Impact of Genetic Polymorphisms on the Smoking-related Risk of Periodontal Disease: the Population-based Study SHIP

PubMed Central

Meisel, P; Heins, G; Carlsson, LE; Giebel, J; John, U; Schwahn, C; Kocher, T

2003-01-01

Periodontitis is a bacterial inflammatory disease leading to attachment loss with the consequence of tooth loss. There exists a multifactorial risk pattern including bacterial challenge, smoking, age, sex, diabetes, socio-economic and genetic factors. Smoking has the highest impact on the course of the disease modulated by all the other factors. Here, we report the relationship between smoking and the polymorphisms of genetic polymorphisms inflicted in the pathogenesis. In a randomly selected population-based study, 1083 subjects were typed for the polymorphisms of the IL-1 genotype, Fcγ RIIIb receptor gene, myeloperoxidase and N-acetyltransferase (NAT2) and related to their periodontal state. Smoking behavior was assessed including present and past quality and quantity of smoking. There is a significant dose-effect relationship between the exposure to tobacco smoke and the extent of periodontal disease assessed as attachment loss and tooth loss. Moreover, there are gene-environmental interactions as subjects bearing variant genotypes show an enhanced smoking-associated risk of the disease modulated by these genotypes. In non-smokers, the impact of these genetic polymorphisms is mostly negligible. This study provides support for the hypothesis that subjects bearing genetic variants of polymorphically expressed phenotypes are at an increased risk of periodontitis when smoking. Mostly, this may be accomplished via the influence of smoking-related impairment on defense mechanisms rather than on the pathogenic pathways. PMID:19570260

Impact of Genetic Polymorphisms on the Smoking-related Risk of Periodontal Disease: the Population-based Study SHIP

PubMed Central

Meisel, P; Heins, G; Carlsson, LE; Giebel, J; John, U; Schwahn, C; Kocher, T

2003-01-01

Periodontitis is a bacterial inflammatory disease leading to attachment loss with the consequence of tooth loss. There exists a multifactorial risk pattern including bacterial challenge, smoking, age, sex, diabetes, socio-economic and genetic factors. Smoking has the highest impact on the course of the disease modulated by all the other factors. Here, we report the relationship between smoking and the polymorphisms of genetic polymorphisms inflicted in the pathogenesis. In a randomly selected population-based study, 1083 subjects were typed for the polymorphisms of the IL-1 genotype, Fcγ RIIIb receptor gene, myeloperoxidase and N-acetyltransferase (NAT2) and related to their periodontal state. Smoking behavior was assessed including present and past quality and quantity of smoking. There is a significant dose-effect relationship between the exposure to tobacco smoke and the extent of periodontal disease assessed as attachment loss and tooth loss. Moreover, there are gene-environmental interactions as subjects bearing variant genotypes show an enhanced smoking-associated risk of the disease modulated by these genotypes. In non-smokers, the impact of these genetic polymorphisms is mostly negligible. This study provides support for the hypothesis that subjects bearing genetic variants of polymorphically expressed phenotypes are at an increased risk of periodontitis when smoking. Mostly, this may be accomplished via the influence of smoking-related impairment on defense mechanisms rather than on the pathogenic pathways.

Abdominal fat interacts with PNPLA3 I148M, but not with the APOC3 variant in the pathogenesis of liver steatosis in chronic hepatitis C.

PubMed

Zampino, R; Coppola, N; Cirillo, G; Boemio, A; Pisaturo, M; Marrone, A; Macera, M; Sagnelli, E; Perrone, L; Adinolfi, L E; Miraglia del Giudice, E

2013-08-01

The patatin-like phospholipase domain-containing 3 gene (PNPLA3) and the apolipoprotein C3 gene (APOC3) have been studied in relation to liver steatosis and liver disease outcome. The aim of this study was to evaluate the influence of PNPLA3 p.I148M and APOC3 rs2854116 and rs2854117 polymorphisms on the clinical and histological presentation of chronic hepatitis C in an Italian population and their relationship with viral and anthropometric parameters. Patients with hepatitis C (n = 166) entered the study receiving a clinical, histological, virological and biochemical evaluation. APOC3 (rs2854116 and rs2854117) and PNPLA3 (p.I148M) variants were genotyped. PNPLA3 polymorphisms were associated with liver steatosis, which was significantly higher in patients with p.148I/M (P = 0.034) and p.148M/M (P = 0.004) variants than those homozygous for the PNPLA3 wild type. Excluding patients with HCV genotype 3, the association with liver steatosis and PNPLA3 variants was more marked (p.148I/I genotype vs p.148I/M, P = 0.02, and vs p.148M/M, P = 0.005). The APOC3 polymorphism was not associated with any of the evaluated parameters. Among the interacting factors, BMI and waist circumference correlated with liver steatosis (P = 0.008 and 0.004, respectively). Relationship between waist circumference and liver steatosis was analysed for the different PNPLA3 genotypes. Homozygous 148M patients showed a stronger correlation between waist circumference and steatosis than those carrying the other genotypes (P = 0.0047). In our hepatitis C-infected population, the PNPLA3 polymorphism influenced the development of liver steatosis, but not fibrosis progression. APOC3 polymorphisms had no effect on the development of steatosis and no influence on the PNPLA3 polymorphism. The amount of abdominal fat can increase the association of PNPLA3 p.I148M with liver steatosis. © 2013 John Wiley & Sons Ltd.

Polymorphisms in adenosine receptor genes are associated with infarct size in patients with ischemic cardiomyopathy.

PubMed

Tang, Z; Diamond, M A; Chen, J-M; Holly, T A; Bonow, R O; Dasgupta, A; Hyslop, T; Purzycki, A; Wagner, J; McNamara, D M; Kukulski, T; Wos, S; Velazquez, E J; Ardlie, K; Feldman, A M

2007-10-01

The goal of this experiment was to identify the presence of genetic variants in the adenosine receptor genes and assess their relationship to infarct size in a population of patients with ischemic cardiomyopathy. Adenosine receptors play an important role in protecting the heart during ischemia and in mediating the effects of ischemic preconditioning. We sequenced DNA samples from 273 individuals with ischemic cardiomyopathy and from 203 normal controls to identify the presence of genetic variants in the adenosine receptor genes. Subsequently, we analyzed the relationship between the identified genetic variants and infarct size, left ventricular size, and left ventricular function. Three variants in the 3'-untranslated region of the A(1)-adenosine gene (nt 1689 C/A, nt 2206 Tdel, nt 2683del36) and an informative polymorphism in the coding region of the A3-adenosine gene (nt 1509 A/C I248L) were associated with changes in infarct size. These results suggest that genetic variants in the adenosine receptor genes may predict the heart's response to ischemia or injury and might also influence an individual's response to adenosine therapy.

Passive rGE or developmental gene-environment cascade? An investigation of the role of xenobiotic metabolism genes in the association between smoke exposure during pregnancy and child birth weight

PubMed Central

Marceau, Kristine; Palmer, Rohan H.C.; Neiderhiser, Jenae M.; Smith, Taylor F.; McGeary, John E.; Knopik, Valerie S.

2016-01-01

There is considerable evidence that smoke exposure during pregnancy (SDP) environmentally influences birth weight after controlling for genetic influences and maternal characteristics. However, maternal smoking during pregnancy – the behavior that leads to smoke exposure during pregnancy – is also genetically-influenced, indicating the potential role of passive gene-environment correlation. An alternative to passive gene-SDP correlation is a cascading effect whereby maternal and child genetic influences are causally linked to prenatal exposures, which then have an ‘environmental’ effect on the development of the child’s biology and behavior. We describe and demonstrate a conceptual framework for disentangling passive rGE from this cascading GE effect using a systems-based polygenic scoring approach comprised of genes shown to be important in the xenobiotic (substances foreign to the body) metabolism pathway. Data were drawn from 5,044 families from the Avon Longitudinal Study of Parents and Children with information on maternal SDP, birth weight, and genetic polymorphisms in the xenobiotic pathway. Within a k-fold cross-validation approach (k=5), we created weighted maternal and child polygenic scores using 18 polymorphisms from 10 genes that have been implicated in the xenobiotic metabolism pathway. Mothers and children shared variation in xenobiotic metabolism genes. Amongst mothers who smoked during pregnancy, neither maternal nor child xenobiotic metabolism polygenic scores were associated with a higher likelihood of smoke exposure during pregnancy, or the severity of smoke exposure during pregnancy (and therefore, neither proposed mechanism was supported), or with child birth weight. SDP was consistently associated with lower child birth weight controlling for the polygenic scores, maternal educational attainment, social class, psychiatric problems, and age. Limitations of the study design and the potential of the framework using other designs are discussed. PMID:26803317

Genetic association analysis of CNR1 and CNR2 polymorphisms with schizophrenia in a Korean population.

PubMed

Bae, Joon Seol; Kim, Jason Yongha; Park, Byung-Lae; Kim, Jeong-Hyun; Kim, Bomi; Park, Chul Soo; Kim, Bong-Jo; Lee, Cheol-Soon; Lee, Migyung; Choi, Woo Hyuk; Shin, Tae-Min; Hwang, Jaeuk; Shin, Hyoung Doo; Woo, Sung-Il

2014-10-01

Located on 6q15 and 1p36.11, cannabinoid receptor 1 (CNR1) and cannabinoid receptor 2 (CNR2) genes are considered to be a positional and functional candidate gene for the development of mental disorders such as schizophrenia because CNR1 is known as a regulator of dopamine signaling in the hippocampus and the cerebral cortex. However, few genetic studies have been carried out to investigate an association of CNR1 and CNR2 polymorphisms and the risk of schizophrenia. In this study, although the result indicates that CNR1 and CNR2 variations are unlikely to influence schizophrenia susceptibility in a Korean population, the findings would provide meaningful information for further genetic studies.

Association between methylenetetrahydrofolate reductase polymorphisms and the relapse of acute lymphoblastic leukemia: a meta-analysis.

PubMed

He, H-R; Chen, S-Y; You, H-S; Hu, S-S; Sun, J-Y; Dong, Y-L; Lu, J

2014-10-01

Relapse is a threat in patients treated for acute lymphoblastic leukemia (ALL). Methylenetetrahydrofolate reductase (MTHFR) activity may affect the sensitivity of patients to folate-based chemotherapeutic drugs, thus influencing the relapse risk. Two polymorphisms of the gene encoding MTHFR, C677T and A1298C, alter MTHFR enzyme activity and may be associated with ALL relapse. The aim of this meta-analysis was to clarify the correlation between the C677T and A1298C polymorphisms and ALL relapse. To this end, data were collected from studies of the association between these two polymorphisms and ALL relapse. Analysis of the data revealed a serious contradiction among the results. A recessive model demonstrated that the ALL relapse risk was significantly increased in carriers of the 677 TT genotype, especially for pediatric ALL, but was unaffected by the A1298C polymorphism. These findings confirm that the MTHFR C677T polymorphism could be considered as a good marker of the pediatric ALL relapse risk.

[Polymorphic loci and polymorphism analysis of short tandem repeats within XNP gene].

PubMed

Liu, Qi-Ji; Gong, Yao-Qin; Guo, Chen-Hong; Chen, Bing-Xi; Li, Jiang-Xia; Guo, Yi-Shou

2002-01-01

To select polymorphic short tandem repeat markers within X-linked nuclear protein (XNP) gene, genomic clones which contain XNP gene were recognized by homologous analysis with XNP cDNA. By comparing the cDNA with genomic DNA, non-exonic sequences were identified, and short tandem repeats were selected from non-exonic sequences by using BCM search Launcher. Polymorphisms of the short tandem repeats in Chinese population were evaluated by PCR amplification and PAGE. Five short tandem repeats were identified from XNP gene, two of which were polymorphic. Four and 11 alleles were observed in Chinese population for XNPSTR1 and XNPSTR4, respectively. Heterozygosities were 47% for XNPSTR1 and 70% for XNPSTR4. XNPSTR1 and XNPSTR4 localized within 3' end and intron 10, respectively. Two polymorphic short tandem repeats have been identified within XNP gene and will be useful for linkage analysis and gene diagnosis of XNP gene.

CTLA-4 and IL-6 gene polymorphisms: Risk factors for recurrent pregnancy loss.

PubMed

Nasiri, Mahboobeh; Rasti, Zarnegar

2016-12-01

The purpose of the present study was to evaluate the possible association between CTLA-4 +49A/G and IL-6 -634C/G polymorphisms, and the risk of recurrent pregnancy loss (RPL). 240 women (120 healthy controls and 120 with RPL) were enrolled in this case-control study. Genotyping was performed using a PCR-RFLP technique. In the case of polymorphic CTLA-4 +49A/G, the wild type allele G was associated with a decreased risk of RPL (OR: 0.42, 95%CI: 0.25-0.69, p=0.001). As to IL-6 -634C/G polymorphism, a highly significant difference was observed, and those women who carry at least one mutant G allele presented a probability of developing RPL about 5 times greater than controls (OR: 5.1, 95%CI: 1.04-25.3, p=0.04). The results indicate that polymorphisms of CTLA-4 and IL-6 genes may influence the risk of developing RPL among Iranian women, suggesting that more research on the immunogenetics of pregnancy should be conducted to confirm our results, and to declare the exact roles of studied molecules in RPL pathogenesis. Copyright © 2016 American Society for Histocompatibility and Immunogenetics. Published by Elsevier Inc. All rights reserved.

A case-based evaluation of SRD5A1, SRD5A2, AR, and ADRA1A as candidate genes for severity of BPH.

PubMed

Klotsman, M; Weinberg, C R; Davis, K; Binnie, C G; Hartmann, K E

2004-01-01

In men with a clinical diagnosis of benign prostatic hyperplasia (BPH), polytomous logistic regression analysis was conducted to evaluate associations between two silent polymorphisms in SRD5A1 (codon positions 30 and 116), two polymorphisms in SRD5A2 (Val89Leu substitution and C to T transition in intron 1), a trinucleotide (CAG)n repeat in androgen receptor (AR), and an Arg492Cys substitution in ADRA1A and clinical parameters that characterize severity of BPH. Candidate gene selection was based on two mechanistic pathways targeted by pharmacotherapy for BPH: (1) androgen metabolic loci contributing to prostate growth (static obstruction); and (2) factors affecting smooth muscle tone (dynamic obstruction). Polymorphisms in SRD5A2 were not associated with severity of BPH; however, SRD5A1 polymorphisms were associated with severity of BPH. The process(es) in which these silent single-nucleotide polymorphisms (SNPs) influence BPH phenotypes is unknown and additional studies will be needed to assess whether these SNPs have direct functional consequences. The characterization of additional molecular factors that contribute to static and dynamic obstruction may help predict response to pharmacotherapy and serve to identify novel drug targets for the clinical management of BPH.

Influence of candidate polymorphisms on the dipeptidyl peptidase IV and μ-opioid receptor genes expression in aspect of the β-casomorphin-7 modulation functions in autism.

PubMed

Cieślińska, Anna; Sienkiewicz-Szłapka, Edyta; Wasilewska, Jolanta; Fiedorowicz, Ewa; Chwała, Barbara; Moszyńska-Dumara, Małgorzata; Cieśliński, Tomasz; Bukało, Marta; Kostyra, Elżbieta

2015-03-01

Autism Spectrum Disorder (ASD) is a neurodevelopmental disorder with population prevalence of approximately 60-70 per 10,000. Data shows that both opioid system function enhancement and opiate administration can result in autistic-like symptoms. Cow milk opioid peptides, including β-casomorphin-7 (BCM7, Tyr-Pro-Phe-Pro-Gly-Pro-Ile), affect the μ-opioid receptor (MOR) and are subjected to degradation resulting from the proline dipeptidyl peptidase IV (DPPIV, EC 3.4.14.5) enzyme activity. The presence of MOR and DPPIV activity are crucial factors determining biological activity of BCM7 in the human body. Our study examined the effect of β-casomorphin-7 on the MOR and DPPIV genes expression according to specific point mutations in these genes. In addition, we investigated frequency of A118G SNP in the MOR gene and rs7608798 of the DPPIV (A/G) gene in healthy and autistic children. Our research indicated correlation in DPPIV gene expression under the influence of BCM7 and hydrolyzed milk between healthy and ASD-affected children with genotype GG (P<0.0001). We also observed increased MOR gene expression in healthy children with genotype AG at polymorphic site A118G under influence of BCM7 and hydrolyzed milk. The G allele frequency was 0.09 in MOR gene and 0.68 in the DPPIV gene. But our results suggest no association between presence of the alleles G and A at position rs7608798 in DPPIV gene nor alleles A and G at position A118G of the MOR and increased incidence of ASD. Our studies emphasize the compulsion for genetic analysis in correlation with genetic factors affecting development and enhancement of autism symptoms. Copyright © 2015 Elsevier Inc. All rights reserved.

The association between sex-related interleukin-6 gene polymorphisms and the risk for cerebral palsy.

PubMed

Bi, Dan; Chen, Mingjie; Zhang, Xiaoli; Wang, Honglian; Xia, Lei; Shang, Qing; Li, Tongchuan; Zhu, Dengna; Blomgren, Klas; He, Lin; Wang, Xiaoyang; Xing, Qinghe; Zhu, Changlian

2014-06-06

The relationship between genetic factors and the development of cerebral palsy (CP) has recently attracted much attention. Polymorphisms in the genes encoding proinflammatory cytokines have been shown to be associated with susceptibility to perinatal brain injury and development of CP. Interleukin-6 (IL-6) is a proinflammatory cytokine that plays a pivotal role in neonatal brain injury, but conflicting results have been reported regarding the association between IL-6 single nucleotide polymorphisms (SNPs) and CP. The purpose of this study was to analyze IL-6 gene polymorphisms and protein expression and to explore the role of IL-6 in the Chinese CP population. A total of 753 healthy controls and 713 CP patients were studied to detect the presence of five SNPs (rs1800796, rs2069837, rs2066992, rs2069840, and rs10242595) in the IL-6 locus. Of these, 77 healthy controls and 87 CP patients were selected for measurement of plasma IL-6 by Luminex assay. The SHEsis program was used to analyze the genotyping data. For all comparisons; multiple testing on each individual SNP was corrected by the SNPSpD program. There were no differences in allele or genotype frequencies between the overall CP patients and controls among the five genetic polymorphisms. However, subgroup analysis found significant sex-related differences in allele and genotype frequencies. Differences were found between spastic CP and controls in males for rs2069837; between CP with periventricular leukomalacia and controls in males for rs1800796 and rs2066992; and between term CP and controls in males for rs2069837. Plasma IL-6 levels were higher in CP patients than in the controls, and this difference was more robust in full-term male spastic CP patients. Furthermore, the genotype has an effect on IL-6 synthesis. The influence of IL-6 gene polymorphisms on IL-6 synthesis and the susceptibility to CP is related to sex and gestational age.

The association between sex-related interleukin-6 gene polymorphisms and the risk for cerebral palsy

PubMed Central

2014-01-01

Background The relationship between genetic factors and the development of cerebral palsy (CP) has recently attracted much attention. Polymorphisms in the genes encoding proinflammatory cytokines have been shown to be associated with susceptibility to perinatal brain injury and development of CP. Interleukin-6 (IL-6) is a proinflammatory cytokine that plays a pivotal role in neonatal brain injury, but conflicting results have been reported regarding the association between IL-6 single nucleotide polymorphisms (SNPs) and CP. The purpose of this study was to analyze IL-6 gene polymorphisms and protein expression and to explore the role of IL-6 in the Chinese CP population. Methods A total of 753 healthy controls and 713 CP patients were studied to detect the presence of five SNPs (rs1800796, rs2069837, rs2066992, rs2069840, and rs10242595) in the IL-6 locus. Of these, 77 healthy controls and 87 CP patients were selected for measurement of plasma IL-6 by Luminex assay. The SHEsis program was used to analyze the genotyping data. For all comparisons; multiple testing on each individual SNP was corrected by the SNPSpD program. Results There were no differences in allele or genotype frequencies between the overall CP patients and controls among the five genetic polymorphisms. However, subgroup analysis found significant sex-related differences in allele and genotype frequencies. Differences were found between spastic CP and controls in males for rs2069837; between CP with periventricular leukomalacia and controls in males for rs1800796 and rs2066992; and between term CP and controls in males for rs2069837. Plasma IL-6 levels were higher in CP patients than in the controls, and this difference was more robust in full-term male spastic CP patients. Furthermore, the genotype has an effect on IL-6 synthesis. Conclusions The influence of IL-6 gene polymorphisms on IL-6 synthesis and the susceptibility to CP is related to sex and gestational age. PMID:24903966

Gene Presence-Absence Polymorphism in Castrating Anther-Smut Fungi: Recent Gene Gains and Phylogeographic Structure.

PubMed

Hartmann, Fanny E; Rodríguez de la Vega, Ricardo C; Brandenburg, Jean-Tristan; Carpentier, Fantin; Giraud, Tatiana

2018-04-01

Gene presence-absence polymorphisms segregating within species are a significant source of genetic variation but have been little investigated to date in natural populations. In plant pathogens, the gain or loss of genes encoding proteins interacting directly with the host, such as secreted proteins, probably plays an important role in coevolution and local adaptation. We investigated gene presence-absence polymorphism in populations of two closely related species of castrating anther-smut fungi, Microbotryum lychnidis-dioicae (MvSl) and M. silenes-dioicae (MvSd), from across Europe, on the basis of Illumina genome sequencing data and high-quality genome references. We observed presence-absence polymorphism for 186 autosomal genes (2% of all genes) in MvSl, and only 51 autosomal genes in MvSd. Distinct genes displayed presence-absence polymorphism in the two species. Genes displaying presence-absence polymorphism were frequently located in subtelomeric and centromeric regions and close to repetitive elements, and comparison with outgroups indicated that most were present in a single species, being recently acquired through duplications in multiple-gene families. Gene presence-absence polymorphism in MvSl showed a phylogeographic structure corresponding to clusters detected based on SNPs. In addition, gene absence alleles were rare within species and skewed toward low-frequency variants. These findings are consistent with a deleterious or neutral effect for most gene presence-absence polymorphism. Some of the observed gene loss and gain events may however be adaptive, as suggested by the putative functions of the corresponding encoded proteins (e.g., secreted proteins) or their localization within previously identified selective sweeps. The adaptive roles in plant and anther-smut fungi interactions of candidate genes however need to be experimentally tested in future studies.

Gene Presence–Absence Polymorphism in Castrating Anther-Smut Fungi: Recent Gene Gains and Phylogeographic Structure

PubMed Central

Rodríguez de la Vega, Ricardo C; Brandenburg, Jean-Tristan; Carpentier, Fantin; Giraud, Tatiana

2018-01-01

Abstract Gene presence–absence polymorphisms segregating within species are a significant source of genetic variation but have been little investigated to date in natural populations. In plant pathogens, the gain or loss of genes encoding proteins interacting directly with the host, such as secreted proteins, probably plays an important role in coevolution and local adaptation. We investigated gene presence–absence polymorphism in populations of two closely related species of castrating anther-smut fungi, Microbotryum lychnidis-dioicae (MvSl) and M. silenes-dioicae (MvSd), from across Europe, on the basis of Illumina genome sequencing data and high-quality genome references. We observed presence–absence polymorphism for 186 autosomal genes (2% of all genes) in MvSl, and only 51 autosomal genes in MvSd. Distinct genes displayed presence–absence polymorphism in the two species. Genes displaying presence–absence polymorphism were frequently located in subtelomeric and centromeric regions and close to repetitive elements, and comparison with outgroups indicated that most were present in a single species, being recently acquired through duplications in multiple-gene families. Gene presence–absence polymorphism in MvSl showed a phylogeographic structure corresponding to clusters detected based on SNPs. In addition, gene absence alleles were rare within species and skewed toward low-frequency variants. These findings are consistent with a deleterious or neutral effect for most gene presence–absence polymorphism. Some of the observed gene loss and gain events may however be adaptive, as suggested by the putative functions of the corresponding encoded proteins (e.g., secreted proteins) or their localization within previously identified selective sweeps. The adaptive roles in plant and anther-smut fungi interactions of candidate genes however need to be experimentally tested in future studies. PMID:29722826

Interaction between MTHFR 677C>T and periconceptional folic acid supplementation in the risk of Hypospadias.

PubMed

Dokter, Elisabeth M J; van Rooij, Iris A L M; Wijers, Charlotte H W; Groothuismink, Johanne M; van der Biezen, Jan Jaap; Feitz, Wout F J; Roeleveld, Nel; van der Zanden, Loes F M

2016-04-01

Hypospadias is a congenital malformation with both environmental factors and genetic predisposition involved in the pathogenesis. The role of maternal periconceptional folic acid supplement use in the development of hypospadias is unclear. As folate levels may also be influenced by the C677T polymorphism in the methylenetetrahydrofolate reductase (MTHFR) gene, we hypothesize that a gene-environment interaction between this polymorphism and folic acid use is involved in the etiology of hypospadias. We conducted a case-control study among 855 hypospadias cases and 713 population-based controls from the AGORA data- and biobank. Folic acid supplement use was derived from maternal questionnaires and infant and maternal DNA was used to determine the MTHFR C677T polymorphism using Taqman assays. We performed separate analyses for different hypospadias phenotypes (anterior/middle/posterior). Hypospadias was neither associated with folic acid use or the MTHFR C677T polymorphism, nor with their interaction. However, we did find an association with middle hypospadias when no supplements were used (odds ratio = 1.6; 95% confidence interval, 1.1-2.4), especially in infants carrying the CT/TT genotype (odds ratio = 2.5; 95% confidence interval, 1.4-4.7). In addition, more infants with these genotypes seemed to have posterior hypospadias, regardless of folic acid use. Our study does not suggest a major role for folic acid supplements or the MTHFR C677T polymorphism in the etiology of hypospadias in general, but not using folic acid and/or carrying the MTHFR C677T polymorphism may be associated with middle and posterior hypospadias. Therefore, we stress the importance of studying gene-environment interactions preferably in stratified analyses for different hypospadias phenotypes. © 2016 Wiley Periodicals, Inc.

New frontiers in sport training: genetics and artistic gymnastics.

PubMed

Morucci, Gabriele; Punzi, Tiziana; Innocenti, Giovanni; Gulisano, Massimo; Ceroti, Marco; Pacini, Stefania

2014-02-01

The increasing understanding of the genetic influences in sport has prompted an association study between the athletic performances and the polymorphisms of the angiotensin-converting enzyme (ACE), the α-actinin-3 (ACTN3), and the vitamin D receptor genes. The details of these gene polymorphisms can provide useful information to improve and plan new modern training programs for elite athletes. Eighty Italian male high level gymnasts were trained and tested for gymnastic-specific exercises and tested in all the men's artistic gymnastic apparatus (floor, pommel horse, rings, vault, parallel bars, and horizontal bar), and then genotyped. The training parameters of volume, intensity, and density of each gymnast were periodically measured during the season in each apparatus from the tests performed, and the seasonal average values were calculated. Gene polymorphisms were determined by polymerase chain reaction restriction fragment length polymorphism assay and studied in association with the performance results. The performances of ACE II gymnasts were significantly lower than that of the ACE ID/DD gymnasts in the apparatus expressing power features, confirming the predisposition of these athletes toward power-oriented sport. Gymnasts with ACTN3 RR/RX genotypes did not show a predisposition to the power-oriented apparatus, having worse performances compared with that of the ACTN3 XX gymnasts. Similarly, gymnasts with ACE II + ACTN3 RR/RX combined genotypes showed lower performances in comparison with that of the other gymnasts. Vitamin D receptor polymorphisms showed no significant association with the athletic performances. Because ACE insertion/deletion (I/D) and ACTN3 R577X polymorphisms heavily affect the physical performance of elite male gymnasts, the Italian Gymnastic Federation trainers have started to customize the current high-level training programs.

Association of GSTM1, GSTT1, GSTP1-ILE105VAL and ACE I/D polymorphisms with ankylosing spondylitis.

PubMed

İnal, Esra Erkol; Görükmez, Orhan; Eroğlu, Selma; Görükmez, Özlem; Solak, Özlem; Topak, Ali; Yakut, Tahsin

2016-01-01

Ankylosing spondylitis (AS) is a chronic inflammatory disease of unknown origin. The aim of this study is to clarify the relationships between susceptibility and severity of AS and GST-mu1 (GSTM1), GST-theta1 (GSTT1), GST-pi1 (GSTP1)-Ile105Val and angiotensin-converting enzyme (ACE) I/D polymorphisms in AS patients. One hundred thirty-eight AS patients and seventy-one healthy controls were enrolled in this study. Erythrocyte sedimentation rate and C-reactive protein (CRP) levels of the AS patients were recorded. The scores of the numeric rating scale (NRS) pain, the Bath Ankylosing Spondylitis Activity Index, the Bath Ankylosing Spondylitis Metrology Index and the Bath Ankylosing Spondylitis Functional Index were calculated. The genotypes distributions and allele frequencies of GSTM1, GSTT1, GSTP1-Ile105Val and ACE I/D polymorphisms were compared between patients and healthy controls. The Multiplex polymerase chain reaction (PCR) and the PCR-restriction fragment length polymorphism methods were used to detect the polymorphisms of ACE I/D, the GSTT1 and GSTM1 genes and the GSTP1-Ile105Val polymorphism, respectively. There were significantly higher levels of the GSTT1 null and the ACE II genotypes in AS patients compared to those in healthy controls (p = 0.002 and 0.005, respectively). We found significantly higher levels of CRP and the NRS pain scores in the patients with ACE ID or DD genotypes compared to those in the patients with ACE II genotypes (p = 0.005 and 0.035, respectively). The present results showed that genes involved in protection from oxidative stress and ACE gene may influence disease development and course in AS.

Variability in response to nicotine in the LSxSS RI strains: potential role of polymorphisms in alpha4 and alpha6 nicotinic receptor genes.

PubMed

Tritto, Theresa; Stitzel, Jerry A; Marks, Michael J; Romm, Elena; Collins, Allan C

2002-04-01

Several studies have shown that genetic factors influence the effects of nicotine on respiration, acoustic startle, Y-maze crosses and rears, heart rate and body temperature in the mouse. Recently, we identified restriction fragment length polymorphisms (RFLPs) associated with the alpha4 (Chrna4) and alpha6 (Chrna6) nicotinic cholinergic receptor genes in the recombinant inbred (RI) strains derived from the Long-Sleep (LS) and Short-Sleep (SS) mouse lines. The alpha4 polymorphism has been identified as a point-mutation at position 529 (threonine to alanine) and the alpha6 polymorphism has not yet been identified. The studies described here evaluated the potential role of these polymorphisms in regulating sensitivity to nicotine by constructing dose-response curves for the effects of nicotine on six responses in the LSxSS RI strains. The results obtained suggest that both of the polymorphisms may play a role in regulating variability in sensitivity to nicotine. Those RI strains carrying the LS-like alpha4 RFLP were significantly more sensitive to the effects of nicotine on Y-maze crosses and rears, temperature and respiration and were less sensitive to the effects of nicotine on acoustic startle than those strains carrying the SS-like alpha4 RFLP. Those RI strains carrying the LS-like alpha6 RFLP were more sensitive to the effects of nicotine on respiration and acoustic startle, and less sensitive to the effects of nicotine on Y-maze crosses than those strains carrying the SS-like alpha6 RFLP. These results suggest that genetically determined differences in sensitivity to nicotine may be explained, in part, by variability associated with at least two of the neuronal nicotinic receptor genes, alpha4 and alpha6.

Associations between PTPN2 polymorphisms and susceptibility to ulcerative colitis and Crohn's disease: a meta-analysis.

PubMed

Zhang, Ji-Xiang; He, Jian-Hua; Wang, Jun; Song, Jia; Lei, Hong-Bo; Wang, Jing; Dong, Wei-Guo

2014-01-01

Ulcerative colitis (UC) and Crohn's disease (CD) result from an interaction between genetic and environmental factors. Though several polymorphisms have been identified in PTPN2, their roles in the incidence of UC and CD are conflicting. This meta-analysis was aimed to clarify the impact of these polymorphisms on UC and CD risk. PubMed, EMBASE, Cochrane Library and CBM were searched until 23 July 2013 for eligible studies on three PTPN2 polymorphisms: rs2542151, rs1893217 and rs7234029. Data were extracted, and pooled odd ratios (ORs) as well as 95 % confidence intervals (95 % CIs) were calculated. The meta-analysis indicated that rs2542151, rs1893217 and rs1893217 were associated with increased CD risk, while the former was associated with increased UC risk. The differences in age of onset and ethnic groups may influence the associations. Gene-gene and gene-environment interactions should be investigated in the future. Seventeen studies with 18,308 cases and 20,406 controls were included. Significant associations were found between rs2542151 polymorphism and CD susceptibility (OR = 1.22, 95 % CI, 1.15-1.30, I (2) = 32 %), as well as between rs2542151 and UC susceptibility (OR = 1.16, 95 % CI, 1.07-1.25, I (2) = 39 %). A similar result was found in Caucasians, but not in Asians. Moreover, a significant increase in CD risk for all carriers of the minor allele of rs1893217 (OR = 1.45, 95 % CI, 1.23-1.70, I (2) = 0 %) and rs7234029 (OR = 1.36, 95 % CI, 1.16-1.59, I (2) = 0 %) were found. For children, the rs1893217 polymorphism appeared to confer susceptibility to CD (OR = 1.56, 95 % CI, 1.28-1.89, I (2) = 0 %).

The Evaluation of IL6 and ESR1 Gene Polymorphisms in Primary Dysmenorrhea.

PubMed

Ozsoy, Asker Zeki; Karakus, Nevin; Yigit, Serbulent; Cakmak, Bulent; Nacar, Mehmet Can; Yılmaz Dogru, Hatice

2016-01-01

Primary dysmenorrhea is the most common gynecological complaint with painful menstrual cramps in pelvis without any pathology. It affects about half of menstruating women, and it causes significant disruption in quality of life. We investigated the association between IL6 gene promoter and ESR1 gene XbaI and PvuII polymorphisms and primary dysmenorrhea. In this case-control study, 152 unrelated young women with primary dysmenorrhea and 150 unrelated healthy age-matched controls participated. Genomic DNA was isolated and IL6 and ESR1 gene polymorphisms were genotyped using PCR-based RFLP assay. The distribution of genotype and allele frequencies of IL6 gene promoter and ESR1 gene XbaI polymorphisms were not statistically different between patients and controls (p > 0.05). However, the genotype and allele frequencies of ESR1 gene PvuII polymorphism showed statistically significant differences between primary dysmenorrhea patients and controls (p = 0.009 and p = 0.021, respectively). Statistically significant associations were also observed between age and married status of primary dysmenorrhea patients and ESR1 gene PvuII polymorphism (p = 0.044 and p = 0.023, respectively). In combined genotype analyses, AG at ESR1 XbaI and TC at ESR1 PvuII loci encoded a p-value of 0.027. Thus, individuals who are heterozygote at both loci have a lower risk of developing primary dysmenorrhea. Our study suggests no strong association between IL6 gene promoter and ESR1 gene XbaI polymorphisms and primary dysmenorrhea in Turkish women. However, ESR1 gene PvuII polymorphism showed statistically significant differences between primary dysmenorrhea patients and controls. The potential association between ESR1 gene PvuII polymorphism and age and married status of dysmenorrhea patients deserves further consideration.

Bitterness of the Non-nutritive Sweetener Acesulfame Potassium Varies With Polymorphisms in TAS2R9 and TAS2R31

PubMed Central

2013-01-01

Demand for nonnutritive sweeteners continues to increase due to their ability to provide desirable sweetness with minimal calories. Acesulfame potassium and saccharin are well-studied nonnutritive sweeteners commonly found in food products. Some individuals report aversive sensations from these sweeteners, such as bitter and metallic side tastes. Recent advances in molecular genetics have provided insight into the cause of perceptual differences across people. For example, common alleles for the genes TAS2R9 and TAS2R38 explain variable response to the bitter drugs ofloxacin in vitro and propylthiouracil in vivo. Here, we wanted to determine whether differences in the bitterness of acesulfame potassium could be predicted by common polymorphisms (genetic variants) in bitter taste receptor genes (TAS2Rs). We genotyped participants (n = 108) for putatively functional single nucleotide polymorphisms in 5 TAS2Rs and asked them to rate the bitterness of 25 mM acesulfame potassium on a general labeled magnitude scale. Consistent with prior reports, we found 2 single nucleotide polymorphisms in TAS2R31 were associated with acesulfame potassium bitterness. However, TAS2R9 alleles also predicted additional variation in acesulfame potassium bitterness. Conversely, single nucleotide polymorphisms in TAS2R4, TAS2R38, and near TAS2R16 were not significant predictors. Using 1 single nucleotide polymorphism each from TAS2R9 and TAS2R31, we modeled the simultaneous influence of these single nucleotide polymorphisms on acesulfame potassium bitterness; together, these 2 single nucleotide polymorphisms explained 13.4% of the variance in perceived bitterness. These data suggest multiple polymorphisms within TAS2Rs contribute to the ability to perceive the bitterness from acesulfame potassium. PMID:23599216

Association of the FGA and SLC6A4 genes with autistic spectrum disorder in a Korean population.

PubMed

Ro, Myungja; Won, Seongsik; Kang, Hyunjun; Kim, Su-Yeon; Lee, Seung Ku; Nam, Min; Bang, Hee Jung; Yang, Jae Won; Choi, Kyung-Sik; Kim, Su Kang; Chung, Joo-Ho; Kwack, Kyubum

2013-01-01

Autism spectrum disorder (ASD) is a neurobiological disorder characterized by distinctive impairments in cognitive function, language, and behavior. Linkage and population studies suggest a genetic association between solute carrier family 6 member 4 (SLC6A4) variants and ASD. Logistic regression was used to identify associations between single-nucleotide polymorphisms (SNPs) and ASD with 3 alternative models (additive, dominant, and recessive). Linear regression analysis was performed to determine the influence of SNPs on Childhood Autism Rating Scale (CARS) scores as a quantitative phenotype. In the present study, we examined the associations of SNPs in the SLC6A4 gene and the fibrinogen alpha chain (FGA) gene. Logistic regression analysis showed a significant association between the risk of ASD and rs2070025 and rs2070011 in the FGA gene. The gene-gene interaction between SLC6A4 and FGA was not significantly associated with ASD susceptibility. However, polymorphisms in both SLC6A4 and the FGA gene significantly affected the symptoms of ASD. Our findings indicate that FGA and SLC6A4 gene interactions may contribute to the phenotypes of ASD rather than the incidence of ASD. © 2013 S. Karger AG, Basel.

Is the COL5A1 rs12722 gene polymorphism associated with running economy?

PubMed

Bertuzzi, Rômulo; Pasqua, Leonardo A; Bueno, Salomão; Lima-Silva, Adriano Eduardo; Matsuda, Monique; Marquezini, Monica; Saldiva, Paulo H

2014-01-01

The COL5A1 rs12722 polymorphism is considered to be a novel genetic marker for endurance running performance. It has been postulated that COL5A1 rs12722 may influence the elasticity of tendons and the energetic cost of running. To date, there are no experimental data in the literature supporting the relationship between range of motion, running economy, and the COL5A1 rs12722 gene polymorphism. Therefore, the main purpose of the current study was to analyze the influence of the COL5A1rs12722 polymorphism on running economy and range of motion. One hundred and fifty (n = 150) physically active young men performed the following tests: a) a maximal incremental treadmill test, b) two constant-speed running tests (10 km · h(-1)) and 12 km · h(-1)) to determine the running economy, and c) a sit-and-reach test to determine the range of motion. All of the subjects were genotyped for the COL5A1 rs12722 single-nucleotide polymorphism. The genotype frequencies were TT = 27.9%, CT = 55.8%, and CC = 16.3%. There were no significant differences between COL5A1 genotypes for running economy measured at 10 km · h(-1) (p = 0.232) and 12 km · h(-1) (p = 0.259). Similarly, there were no significant differences between COL5A1 genotypes for range of motion (p = 0.337). These findings suggest that the previous relationship reported between COL5A1 rs12722 genotypes and running endurance performance might not be mediated by the energetic cost of running.

Is the COL5A1 rs12722 Gene Polymorphism Associated with Running Economy?

PubMed Central

Bertuzzi, Rômulo; Pasqua, Leonardo A.; Bueno, Salomão; Lima-Silva, Adriano Eduardo; Matsuda, Monique; Marquezini, Monica; Saldiva, Paulo H.

2014-01-01

The COL5A1 rs12722 polymorphism is considered to be a novel genetic marker for endurance running performance. It has been postulated that COL5A1 rs12722 may influence the elasticity of tendons and the energetic cost of running. To date, there are no experimental data in the literature supporting the relationship between range of motion, running economy, and the COL5A1 rs12722 gene polymorphism. Therefore, the main purpose of the current study was to analyze the influence of the COL5A1rs12722 polymorphism on running economy and range of motion. One hundred and fifty (n = 150) physically active young men performed the following tests: a) a maximal incremental treadmill test, b) two constant-speed running tests (10 km•h−1 and 12 km•h−1) to determine the running economy, and c) a sit-and-reach test to determine the range of motion. All of the subjects were genotyped for the COL5A1 rs12722 single-nucleotide polymorphism. The genotype frequencies were TT = 27.9%, CT = 55.8%, and CC = 16.3%. There were no significant differences between COL5A1 genotypes for running economy measured at 10 km•h−1 (p = 0.232) and 12 km•h−1 (p = 0.259). Similarly, there were no significant differences between COL5A1 genotypes for range of motion (p = 0.337). These findings suggest that the previous relationship reported between COL5A1 rs12722 genotypes and running endurance performance might not be mediated by the energetic cost of running. PMID:25188268

Two functional serotonin polymorphisms moderate the effect of food reinforcement on BMI.

PubMed

Carr, Katelyn A; Lin, Henry; Fletcher, Kelly D; Sucheston, Lara; Singh, Prashant K; Salis, Robbert J; Erbe, Richard W; Faith, Myles S; Allison, David B; Stice, Eric; Epstein, Leonard H

2013-06-01

Food reinforcement, or the motivation to eat, has been associated with increased energy intake, greater body weight, and prospective weight gain. Much of the previous research on the reinforcing value of food has focused on the role of dopamine, but it may be worthwhile to examine genetic polymorphisms in the serotonin and opioid systems as these neurotransmitters have been shown to be related to reinforcement processes and to influence energy intake. We examined the relationship among 44 candidate genetic polymorphisms in the dopamine, serotonin, and opioid systems, as well as food reinforcement and body mass index (BMI) in a sample of 245 individuals. Polymorphisms in the monoamine oxidase A (MAOA-LPR) and serotonin receptor 2A genes (rs6314) moderated the effect of food reinforcement on BMI, accounting for an additional 5-10% variance and revealed a potential role of the single nucleotide polymorphism, rs6314, in the serotonin 2A receptor as a differential susceptibility factor for obesity. Differential susceptibility describes a factor that can confer either risk or protection depending on a second variable, such that rs6314 is predictive of both high and low BMI based on the level of food reinforcement, while the diathesis stress or dual-gain model only influences one end of the outcome measure. The interaction with MAOA-LPR better fits the diathesis stress model, with the 3.5R/4R allele conferring protection for individuals low in food reinforcement. These results provide new insight into genes theoretically involved in obesity, and support the hypothesis that genetics moderate the association between food reinforcement and BMI. PsycINFO Database Record (c) 2013 APA, all rights reserved.

Interaction of methylation-related genetic variants with circulating fatty acids on plasma lipids: a meta-analysis of 7 studies & methylation analysis of 3 studies in the Cohorts for Heart & Aging Research

USDA-ARS?s Scientific Manuscript database

Background: DNA methylation is influenced by diet and single nucleotide polymorphisms (SNPs), and methylation modulates gene expression. Objective: We aimed to explore whether the gene-by-diet interactions on blood lipids act through DNA methylation. Design: We selected 7 SNPs on the basis of predic...

Pharmacogenetic analysis of the effects of polymorphisms in APOE, IDE and IL1B on a ketone body based therapeutic on cognition in mild to moderate Alzheimer's disease; a randomized, double-blind, placebo-controlled study

PubMed Central

2011-01-01

Background To examine the effect of genetic variation in APOE, IDE and IL1B on the response to induced ketosis in the Alzheimer's Disease Assessment Scale-Cognitive subscale (ADAS-Cog) in subjects with mild to moderate Alzheimer's disease (AD). Methods Genotype effects on ADAS-Cog scores from a randomized, double-blind, placebo-controlled study in mild to moderate AD were examined by an overall two way analysis of variance. In addition, interactions with the carriage status of the epsilon 4 allele of the APOE gene (APOE4) were examined. Results Significant differences in response to induced ketosis were found among non-carriers of putative gain-of-function polymorphisms in rs1143627 and rs16944 in the IL1B gene and among variants of the polymorphism rs2251101 in the IDE gene. Significant differences were found among non-carriers of the APOE4 gene, with notable improvement among the E3/E3 genotype group. Conclusions Variants in APOE, IL1B and IDE may influence the cognitive response to induced ketosis in patients with mild to moderate AD. Trial registration This trial was registered with ClinicalTrials.gov, registry number NCT00142805. PMID:21992747

Individual and combined influence of ACE and ACTN3 genes on muscle phenotypes in Polish athletes.

PubMed

Orysiak, Joanna; Mazur-Różycka, Joanna; Busko, Krzysztof; Gajewski, Jan; Szczepanska, Beata; Malczewska-Lenczowska, Jadwiga

2017-02-08

The aim of this study was to examine the association between ACE and ACTN3 genes, independently or in combination, and muscle strength and power in male and female athletes. The study involved 398 young male (n=266) and female (n=132) athletes representing various sport disciplines (ice hockey, canoeing, swimming, volleyball). All were Caucasians. The following measurements were taken: height of jump and mechanical power in countermovement jump (CMJ) and spike jump (SPJ), and muscle strength of 10 muscle groups (flexors and extensors of the elbow, shoulder, hip, knee and trunk). The ID polymorphism of ACE and the R577X polymorphism of ACTN3 were typed using PCR (polymerase chain reaction) and PCR-RFLP (polymerase chain reaction - restriction fragment length polymorphism), respectively. The genotype distribution of the ACE and ACTN3 genes did not differ significantly between groups of athletes for either sex. There was no association between ACE and ACTN3 genotypes (alone or in combination) and sum of muscle strength, height of jump or mechanical power in both jump tests (CMJ and SPJ) for male and female athletes. These findings do not support an influential role of the ACE and ACTN3 genes in determining power/strength performance of elite athletes.

HFE p.H63D polymorphism does not influence ALS phenotype and survival.

PubMed

Chiò, Adriano; Mora, Gabriele; Sabatelli, Mario; Caponnetto, Claudia; Lunetta, Christian; Traynor, Bryan J; Johnson, Janel O; Nalls, Mike A; Calvo, Andrea; Moglia, Cristina; Borghero, Giuseppe; Monsurrò, Maria Rosaria; La Bella, Vincenzo; Volanti, Paolo; Simone, Isabella; Salvi, Fabrizio; Logullo, Francesco O; Nilo, Riva; Giannini, Fabio; Mandrioli, Jessica; Tanel, Raffaella; Murru, Maria Rita; Mandich, Paola; Zollino, Marcella; Conforti, Francesca L; Penco, Silvana; Brunetti, Maura; Barberis, Marco; Restagno, Gabriella

2015-10-01

It has been recently reported that the p.His63Asp polymorphism of the HFE gene accelerates disease progression both in the SOD1 transgenic mouse and in amyotrophic lateral sclerosis (ALS) patients. We have evaluated the effect of HFE p.His63Asp polymorphism on the phenotype in 1351 Italian ALS patients (232 of Sardinian ancestry). Patients were genotyped for the HFE p.His63Asp polymorphism (CC, GC, and GG). All patients were also assessed for C9ORF72, TARDBP, SOD1, and FUS mutations. Of the 1351 ALS patients, 363 (29.2%) were heterozygous (GC) for the p.His63Asp polymorphism and 30 (2.2%) were homozygous for the minor allele (GG). Patients with CC, GC, and GG polymorphisms did not significantly differ by age at onset, site of onset of symptoms, and survival; however, in SOD1 patients with CG or GG polymorphism had a significantly longer survival than those with a CC polymorphism. Differently from what observed in the mouse model of ALS, the HFE p.His63Asp polymorphism has no effect on ALS phenotype in this large series of Italian ALS patients. Copyright © 2015 Elsevier Inc. All rights reserved.

Application of pharmacogenomics to vaccines

PubMed Central

Poland, Gregory A; Ovsyannikova, Inna G; Jacobson, Robert M

2009-01-01

The field of pharmacogenomics and pharmacogenetics provides a promising science base for vaccine research and development. A broad range of phenotype/genotype data combined with high-throughput genetic sequencing and bioinformatics are increasingly being integrated into this emerging field of vaccinomics. This paper discusses the hypothesis of the ‘immune response gene network’ and genetic (and bioinformatic) strategies to study associations between immune response gene polymorphisms and variations in humoral and cellular immune responses to prophylactic viral vaccines, such as measles–mumps–rubella, influenza, HIV, hepatitis B and smallpox. Immunogenetic studies reveal promising new vaccine targets by providing a better understanding of the mechanisms by which gene polymorphisms may influence innate and adaptive immune responses to vaccines, including vaccine failure and vaccine-associated adverse events. Additional benefits from vaccinomic studies include the development of personalized vaccines, the development of novel vaccines and the development of novel vaccine adjuvants. PMID:19450131

Gene-environment interaction: Does fluoride influence the reproductive hormones in male farmers modified by ERα gene polymorphisms?

PubMed

Ma, Qiang; Huang, Hui; Sun, Long; Zhou, Tong; Zhu, Jingyuan; Cheng, Xuemin; Duan, Lijv; Li, Zhiyuan; Cui, Liuxin; Ba, Yue

2017-12-01

The occurrence of endemic fluorosis is derived from high fluoride levels in drinking water and industrial fumes or dust. Reproductive disruption is also a major harm caused by fluoride exposure besides dental and skeletal lesions. However, few studies focus on the mechanism of fluoride exposure on male reproductive function, especially the possible interaction of fluoride exposure and gene polymorphism on male reproductive hormones. Therefore, we conducted a cross-sectional study in rural areas of Henan province in China to explore the interaction between the estrogen receptor alpha (ERα) gene and fluoride exposure on reproductive hormone levels in male farmers living in the endemic fluorosis villages. The results showed that fluoride exposure significantly increased the serum level of estradiol in the hypothalamic-pituitary-testicular (HPT) axis in male farmers. Moreover, the observations indicated that fluoride exposure and genetic markers had an interaction on serum concentration of follicle-stimulating hormone and estradiol, and the interaction among different loci of the ERα gene could impact the serum testosterone level. Findings in the present work suggest that chronic fluoride exposure in drinking water could modulate the levels of reproductive hormones in males living in endemic fluorosis areas, and the interaction between fluoride exposure and ERα polymorphisms might affect the serum levels of hormones in the HPT axis in male farmers. Copyright © 2017 Elsevier Ltd. All rights reserved.

Desaturase and elongase-limiting endogenous long-chain polyunsaturated fatty acid biosynthesis.

PubMed

Zhang, Ji Yao; Kothapalli, Kumar S D; Brenna, J Thomas

2016-03-01

Endogenous synthesis of the long-chain polyunsaturated fatty acids (LCPUFAs) is mediated by the fatty acid desaturase (FADS) gene cluster (11q12-13.1) and elongation of very long-chain fatty acids 2 (ELOVL2) (6p24.2) and ELOVL5 (6p12.1). Although older biochemical work identified the product of one gene, FADS2, rate limiting for LCPUFA synthesis, recent studies suggest that polymorphisms in any of these genes can limit accumulation of product LCPUFA. Genome-wide association study (GWAS) of Greenland Inuit shows strong adaptation signals within FADS gene cluster, attributed to high omega-3 fatty acid intake, while GWAS found ELOVL2 associated with sleep duration, age and DNA methylation. ELOVL5 coding mutations cause spinocerebellar ataxia 38, and epigenetic marks were associated with depression and suicide risk. Two sterol response element binding sites were found on ELOVL5, a SREBP-1c target gene. Minor allele carriers of a 3 single nucleotide polymorphism (SNP) haplotype in ELOVL2 have decreased 22 : 6n-3 levels. Unequivocal molecular evidence shows mammalian FADS2 catalyzes direct Δ4-desaturation to yield 22 : 6n-3 and 22 : 5n-6. An SNP near FADS1 influences the levels of 5-lipoxygenase products and epigenetic alteration. Genetic polymorphisms within FADS and ELOVL can limit LCPUFA product accumulation at any step of the biosynthetic pathway.

Polymorphisms in genes encoding leptin, ghrelin and their receptors in German multiple sclerosis patients.

PubMed

Rey, Linda K; Wieczorek, Stefan; Akkad, Denis A; Linker, Ralf A; Chan, Andrew; Hoffjan, Sabine

2011-01-01

Multiple sclerosis (MS) is a neuro-inflammatory, autoimmune disease influenced by environmental and polygenic components. There is growing evidence that the peptide hormone leptin, known to regulate energy homeostasis, as well as its antagonist ghrelin play an important role in inflammatory processes in autoimmune diseases, including MS. Recently, single nucleotide polymorphisms (SNPs) in the genes encoding leptin, ghrelin and their receptors were evaluated, amongst others, in Wegener's granulomatosis and Churg-Strauss syndrome. The Lys656Asn SNP in the LEPR gene showed a significant but contrasting association with these vasculitides. We therefore aimed at investigating these polymorphisms in a German MS case-control cohort. Twelve SNPs in the LEP, LEPR, GHRL and GHSR genes were genotyped in 776 MS patients and 878 control subjects. We found an association of a haplotype in the GHSR gene with MS that could not be replicated in a second cohort. Otherwise, no significant differences in allele or genotype frequencies were observed between patients and controls in this particular cohort. Thus, the present results do not support the hypothesis that genetic variation in the leptin/ghrelin system contributes substantially to the pathogenesis of MS. However, a modest effect of GHSR variation cannot be ruled out and needs to be further evaluated in future studies. Copyright © 2011 Elsevier Ltd. All rights reserved.

Selection with Gene-Cytoplasm Interactions. I. Maintenance of Cytoplasm Polymorphisms

PubMed Central

Gregorius, H. R.; Ross, M. D.

1984-01-01

General conditions for the protectedness of gene-cytoplasm polymorphisms are considered for a biallelic model with two cytoplasm types and under the assumption that nuclear polymorphisms cannot be maintained in the presence of only one cytoplasm type. Analytical results involving male fertilities, female fertilities, viabilities and selfing rates are obtained, and numerical results show spiral and cyclic behavior of population trajectories. It is shown that a maternally inherited cytoplasmic polymorphism cannot be maintained in the absence of a nuclear polymorphism, and that a gene-cytoplasm polymorphism can only be maintained if the population shows sexual asymmetry, i.e. , if the ratio of male to female fertility varies among genotypes. Thus, the classical viability selection model does not allow gene-cytoplasm polymorphisms. PMID:17246213

Identification of a New Single-nucleotide Polymorphism within the Apolipoprotein A5 Gene, Which is Associated with Metabolic Syndrome.

PubMed

Salehi, Samaneh; Emadi-Baygi, Modjtaba; Rezaei, Majdaddin; Kelishadi, Roya; Nikpour, Parvaneh

2017-01-01

Metabolic syndrome (MetS) is a common disorder which is a constellation of clinical features including abdominal obesity, increased level of serum triglycerides (TGs) and decrease of serum high-density lipoprotein-cholesterol (HDL-C), elevated blood pressure, and glucose intolerance. The apolipoprotein A5 (APOA5) is involved in lipid metabolism, influencing the level of plasma TG and HDL-C. In the present study, we aimed to investigate the associations between four INDEL variants of APOA5 gene and the MetS risk. In this case-control study, we genotyped 116 Iranian children and adolescents with/without MetS by using Sanger sequencing method for these INDELs. Then, we explored the association of INDELs with MetS risk and their clinical components by logistic regression and one-way analysis of variance analyses. We identified a novel insertion polymorphism, c. *282-283 insAG/c. *282-283 insG variant, which appears among case and control groups. rs72525532 showed a significant difference for TG levels between various genotype groups. In addition, there were significant associations between newly identified single-nucleotide polymorphism (SNP) and rs72525532 with MetS risk. These results show that rs72525532 and the newly identified SNP may influence the susceptibility of the individuals to MetS.

Executive control in schizophrenia: a preliminary study on the moderating role of COMT Val158Met for comorbid alcohol and substance use disorders.

PubMed

Carrà, Giuseppe; Nicolini, Gabriella; Crocamo, Cristina; Lax, Annamaria; Amidani, Francesca; Bartoli, Francesco; Castellano, Filippo; Chiorazzi, Alessia; Gamba, Giulia; Papagno, Costanza; Clerici, Massimo

2017-07-01

A functional polymorphism in the catechol-O-methyltransferase (COMT) gene (Val158Met) appears to influence cognition in people with alcohol/substance use disorders (AUD/SUD) and in those with psychosis. To explore the potential moderating effect of these factors, a cross-sectional study was conducted, randomly recruiting subjects with DSM-IV diagnosis of schizophrenia. AUD/SUD was rigorously assessed, as well as COMT Val158Met polymorphism. Executive control functioning was measured using the Intra-Extra Dimensional Set Shift (IED). The effect of a possible interaction between comorbid AUD/SUD and COMT Val158Met polymorphism on IED scores was explored. Subjects with schizophrenia, comorbid AUD/SUD, and MetMet carriers for SNP rs4680 of the COMT gene showed worse performance on IED completed stages scores, as compared with individuals with ValVal genotype. However, among subjects without AUD/SUD, those with the MetMet variant performed better than people carrying ValVal genotype. This study is the first to date examining the impact of COMT on cognition in a highly representative sample of people with schizophrenia and comorbid AUD/SUD. Differential moderating effects of COMT Val/Met genotype variations may similarly influence executive functions in people with schizophrenia and comorbid AUD/SUD.

Influence of androgen receptor repeat polymorphisms on personality traits in men

PubMed Central

Westberg, Lars; Henningsson, Susanne; Landén, Mikael; Annerbrink, Kristina; Melke, Jonas; Nilsson, Staffan; Rosmond, Roland; Holm, Göran; Anckarsäter, Henrik; Eriksson, Elias

2009-01-01

Background Testosterone has been attributed importance for various aspects of behaviour. The aim of our study was to investigate the potential influence of 2 functional polymorphisms in the amino terminal of the androgen receptor on personality traits in men. Methods We assessed and genotyped 141 men born in 1944 recruited from the general population. We used 2 different instruments: the Karolinska Scales of Personality and the Temperament and Character Inventory. For replication, we similarly assessed 63 men recruited from a forensic psychiatry study group. Results In the population-recruited sample, the lengths of the androgen receptor repeats were associated with neuroticism, extraversion and self-transcendence. The association with extraversion was replicated in the independent sample. Limitations Our 2 samples differed in size; sample 1 was of moderate size and sample 2 was small. In addition, the homogeneity of sample 1 probably enhanced our ability to detect significant associations between genotype and phenotype. Conclusion Our results suggest that the repeat polymorphisms in the androgen receptor gene may influence personality traits in men. PMID:19448851

Bidirectional genetic and environmental influences on mother and child behavior: the family system as the unit of analyses.

PubMed

Mills-Koonce, W Roger; Propper, Cathi B; Gariepy, Jean-Louis; Blair, Clancy; Garrett-Peters, Patricia; Cox, Martha J

2007-01-01

Family systems theory proposes that an individual's functioning depends on interactive processes within the self and within the context of dyadic family subsystems. Previous research on these processes has focused largely on behavioral, cognitive, and psychophysiological properties of the individual and the dyad. The goals of this study were to explore genetic and environmental interactions within the family system by examining how the dopamine receptor D2 gene (DRD2) A1+ polymorphism in mothers and children relates to maternal sensitivity, how maternal and child characteristics might mediate those effects, and whether maternal sensitivity moderates the association between DRD2 A1+ and child affective problems. Evidence is found for an evocative effect of child polymorphism on parenting behavior, and for a moderating effect of child polymorphism on the association between maternal sensitivity and later child affective problems. Findings are discussed from a family systems perspective, highlighting the role of the family as a context for gene expression in both mothers and children.

Interleukin10-1082 A/G polymorphism: Allele frequency, correlation with disease markers, messenger RNA and serum levels in North Indian rheumatoid arthritis patients.

PubMed

Jahid, Mohd; Rehan-Ul-Haq; Avasthi, Rajnish; Ahmed, Rafat Sultana

2018-05-01

Rheumatoid arthritis (RA) is an autoimmune inflammatory disorder of unknown etiology. IL-10 stimulates B cell survival and is involved in antibody isotype switching. The serum IL-10 levels are increased in RA patients. Ethnicity influences polymorphisms in cytokine genes. Therefore, this study was designed to explore possible association, if any, between polymorphism of IL10-1082 A/G, serum cytokine levels, inflammatory markers and gene expression in RA patients of North India. A total of 187 RA patients classified according to American college of rheumatology 2010 criteria and 214 controls were included in the study. Levels of serum IL-10 and inflammatory markers were estimated by ELISA. PCR-RFLP was used to analyze IL10-1082 A/G polymorphism. Quantitative real time PCR was used to measure the mRNA expression of IL-10 gene. The serum inflammatory markers were significantly higher in RA patients. Circulating IL-10 levels were positively and significantly correlated with RF (r = 0.28), anti-CCP (r = 0.26), CRP (r = 0.17) and mRNA expression levels (r = 0.59) among RA patients. Homozygous mutant variant (GG) and heterozygous mutant variant (AG) were associated with patients of RA (OR = 2.87 and 1.55, p < 0.05) as compared to controls. The association still persisted when the heterozygous and homozygous mutants (AG + GG) were clubbed together (OR = 1.67, p < 0.05). The mRNA expression of IL-10 was found to be 3.63 folds higher (housekeeping gene, β-actin) and 2.42 folds higher (housekeeping gene, 18S rRNA) in RA patients as compared to controls. The results indicate that IL10-1082 A/G polymorphism is associated with genetic susceptibility/predisposition to RA in North Indian population. Copyright © 2018 The Canadian Society of Clinical Chemists. Published by Elsevier Inc. All rights reserved.

Association of dopamine receptor D2 gene (DRD2) Taq1 polymorphisms with eating behaviors and obesity among Chinese and Indian Malaysian university students.

PubMed

Lek, Fang-Ying; Ong, Hing-Huat; Say, Yee-How

2018-01-01

This study investigated the association of DRD2 Taq1A, Taq1B and Taq1D gene polymorphisms with eating behavior, the preference/intake frequency/craving of high-fat foods and obesity in 394 Malaysian adults (161 males, 233 females; 308 Chinese, 86 Indians; 67 obese, 327 non-obese). Eating behaviors namely Cognitive Restraint, Uncontrolled Eating and Emotional Eating scores were assessed by the Three Factor Eating Questionnaire-R18. The preference/intake frequency/craving of 26 common high-fat Malaysian foods was assessed using a 7-point hedonic scale. Anthropometric measurements were taken and Taq1 gene polymorphisms were genotyped by PCR-Restriction Fragment Length Polymorphism using DNA extracted from mouthwash samples. The overall minor allele frequencies of Taq1A, Taq1B and Taq1D according to ethnicities (Chinese/Indian) were 0.37/0.29, 0.39/0.28, 0.06/0.30, respectively; genotype and allele distributions of Taq1B and Taq1D were significantly different between ethnicities. Eating behaviorscores were not significantly different between gender and ethnicities. Those with A1 or B1 allele had lower Cognitive Restraint score and higher Uncontrolled Eating score, while those with A1/A1 or B1/B1 genotype had higher fast food preference. D1 allele was associated with increased starchy food craving and mamak (Malaysian Indian-Muslim) food preference, but not eating behavior scores. All three gene variants were not associated with obesity and adiposity. Taken together, we posit that three DRD2 Taq1 gene polymorphisms influence the eating behavior and preference/intake frequency/craving of certain high-fat foods in Malaysian adults, but their role in obesity and adiposity is still inconclusive and needs further investigation.

Polymorphisms in DENND1B gene are associated with asthma and atopy phenotypes in Brazilian children.

PubMed

Fiuza, Bianca S D; Silva, Milca de J; Alcântara-Neves, Neuza M; Barreto, Maurício L; Costa, Ryan Dos S; Figueiredo, Camila A

2017-10-01

Asthma is a heterogeneous disease associated with a complex basis involving environmental factors and individual variabilities. The DENN Domain Containing 1B (DENND1B) gene has an important role on T cell receptor (TCR) down-regulation on Th2 cells and studies have shown that mutations or loss of this factor can be associated with increased Th2 responses and asthma. The aim of this work is to evaluate the association of polymorphisms in the DENND1B with asthma and allergy markers phenotypes in Brazilian children. Genotyping was performed using a commercial panel from Illumina (2.5 Human Omni bead chip) in 1309 participants of SCAALA (Social Change, Asthma, Allergy in Latin American) program. Logistic regressions for asthma and atopy markers were performed using PLINK software 1.9. The analyzes were adjusted for sex, age, helminth infections and ancestry markers. The DENND1B gene was associated with different phenotypes such as severe asthma and atopic markers (specific IgE production, skin prick test and IL-13 production). Among the 166 SNPs analyzed, 72 were associated with asthma and/or allergy markers. In conclusion, polymorphisms in the DENND1B are significantly associated with development of asthma and atopy and these polymorphisms can influence DENND1B expression and consequently, asthma. Copyright © 2017 Elsevier Ltd. All rights reserved.

Association of interleukins genes polymorphisms with multi-drug resistant tuberculosis in Ukrainian population.

PubMed

Butov, Dmytro O; Kuzhko, Mykhaylo M; Makeeva, Natalia I; Butova, Tetyana S; Stepanenko, Hanna L; Dudnyk, Andrii B

2016-01-01

Multi-drug resistant tuberculosis (MDR TB) is a significant health problem in some parts of the world. Three major cytokines involved in TB immunopathogenesis include IL-2, IL-4 and IL-10. The susceptibility to MDR TB may be genetically determined. The aim of the study was to assess the association of IL-2, IL-4, IL-10 gene polymorphisms with multi-drug resistant tuberculosis (MDR TB) in Ukrainian population. We observed 140 patients suffering from infiltrative pulmonary tuberculosis (PT) and 30 apparently healthy subjects. The patients were assigned to two groups whether they suffer or do not suffer from pulmonary MDR TB. Interleukin gene (IL) polymorphisms, particularly T330G polymorphism in the IL-2 gene, C589T polymorphism in the IL-4 gene and G1082A polymorphism in the IL-10 gene were studied through polymerase chain reaction. Circulating levels of IL-2, IL-4 and IL-10 in venous blood were estimated using ELISA. Prior to treatment, patients with PT showed significant increase of IL-2 levels and decrease of IL-4 and IL-10 levels compared to apparently healthy subjects. Circulating IL-4 and IL-10 levels were significantly decreased whilst serum IL-2 level was significantly increased in patients with MDR TB compared to non-MDR TB. Low IL-4 and IL-10 secretion and considerable IL-2 alterations were shown to be significantly associated with mutations of homozygous and heterozygous genotypes affecting C589T polymorphism in the IL-4 gene, G1082A polymorphism in the IL-10 gene and T330G polymorphism in the IL-2 gene in patients with PT. Heterozygous genotype and mutations homozygous genotypes gene in polymorphisms determining specified cytokines' production is a PT risk factor and may lead to disease progression into chronic phase. Heterozygous genotype of aforementioned cytokine genetic polymorphisms was significantly the most frequent in patients with MDR TB.

Biological variations in depression and anxiety between East and West.

PubMed

Chen, Po-Yu; Wang, Sheng-Chang; Poland, Russell E; Lin, Keh-Ming

2009-01-01

Ethnicity and culture represent important factors in shaping psychopathology as well as pharmacotherapeutic responses in psychiatric patients. A large body of literature, accumulated over the past several decades, demonstrates that these factors not only determine the metabolism and disposition of medications (pharmacokinetics), but also their interactions with therapeutic targets (pharmacodynamics). This article focuses on the impact of such variations on the diagnosis and treatment of depression and anxiety disorders between East and West. Genes controlling the expression of drug metabolizing enzymes as well as the function of the brain are highly polymorphic, and the patterns and distribution of these polymorphisms are typically divergent across ethnic groups. To the extent that these genetic patterns determine drug response, ethnic variations in these genetic dispositions will lead to differential responses in clinical settings. In addition, the expression of these genes is significantly influenced by environmental factors including diet as well as exposure to other natural products. Superimposed on these biological influences, culturally determined beliefs and behavioral patterns also profoundly influence patients' expectations of treatment response, adherence, and interactions with clinicians. In addition to pharmacotherapeutic responses, emerging data also indicate that significant ethnic variations exist in genetic polymorphisms and neurobiologic correlates (biomarkers) that may be associated with the vulnerability to psychiatric disorders. These considerations argue for the importance of examining biological variations across ethnic groups, especially in the clinical context, in terms of the assessment and treatment of psychiatric patients, and in our understanding of psychiatric phenomenology and nosology.

Relationship between Job Stress and 5-HT2A Receptor Polymorphisms on Self-Reported Sleep Quality in Physicians in Urumqi (Xinjiang, China): A Cross-Sectional Study

PubMed Central

Ge, Hua; Jiang, Yu; Zhang, Chen; Liu, Jiwen

2018-01-01

The serotonin receptor (5-HTR) plays a key role in sleep quality regulation. Job-related stress is an important factor that influences sleep quality. However, few reports on the interaction between 5-HTR2A polymorphisms and job stress, and how they may impact upon sleep quality are available. Therefore this study investigated the effects of job stress, 5-HTR2A polymorphisms, and their interaction on sleep quality, in physicians. Using a two-stage stratified sampling method, 918 participants were initially invited to participate in the study. After screening for study inclusion and exclusion criteria, 504 subjects were eventually included in the study. Job stress and sleep quality were assessed using the Job Stress Survey (JSS) and Pittsburgh Sleep Quality Index (PSQI), respectively. The 5-HTR2A receptor gene polymorphisms T102C and -1438G/A of were determined using polymerase chain reaction-restriction fragment length polymorphism. Job stress was significantly associated with sleep quality. High levels of job stress were linked to a higher risk of poor sleep quality compared to low or moderate levels [odds ratio (OR) = 2.909, 95% confidence interval (CI): 1.697–4.986]. High levels of stress may reduce subjects’ sleep quality, leading to an increase the likelihood of sleep disturbances and subsequent daytime dysfunction. The 5-HTR2A receptor gene polymorphism T102C was not significantly associated with sleep quality in this study, however, the -1438G/A polymorphism was significantly associated with sleep quality. The GG genotype of the -1438G/A polymorphism was linked to poorer sleep quality. When compared with subjects with low job-related stress levels×AG/AA genotype (OR = 2.106, 95% CI: 1.278–3.471), physicians with high job-related stress levels×GG genotype had a higher risk of experiencing poor sleep quality (OR = 13.400, 95% CI: 3.143–57.137). The findings of our study indicate that job stress and 5-HTR2A receptor gene polymorphisms are associated with sleep quality in physicians. Subjects with high job stress level or/and the -1438G/A GG genotype were more likely to report poor sleep quality, and furthermore, their combination effect on sleep quality was higher than their independent effects, so it may be suggested that job-related stress and genes have a cumulative effect on sleep quality; that is, stress can increase the risk of poor sleep quality, but this effect is worse in a group of people with specific gene polymorphisms. PMID:29883419

Relationship between Job Stress and 5-HT2A Receptor Polymorphisms on Self-Reported Sleep Quality in Physicians in Urumqi (Xinjiang, China): A Cross-Sectional Study.

PubMed

Gao, Xiaoyan; Ge, Hua; Jiang, Yu; Lian, Yulong; Zhang, Chen; Liu, Jiwen

2018-05-21

The serotonin receptor (5-HTR) plays a key role in sleep quality regulation. Job-related stress is an important factor that influences sleep quality. However, few reports on the interaction between 5-HTR2A polymorphisms and job stress, and how they may impact upon sleep quality are available. Therefore this study investigated the effects of job stress, 5-HTR2A polymorphisms, and their interaction on sleep quality, in physicians. Using a two-stage stratified sampling method, 918 participants were initially invited to participate in the study. After screening for study inclusion and exclusion criteria, 504 subjects were eventually included in the study. Job stress and sleep quality were assessed using the Job Stress Survey (JSS) and Pittsburgh Sleep Quality Index (PSQI), respectively. The 5-HTR2A receptor gene polymorphisms T102C and -1438G/A of were determined using polymerase chain reaction-restriction fragment length polymorphism. Job stress was significantly associated with sleep quality. High levels of job stress were linked to a higher risk of poor sleep quality compared to low or moderate levels [odds ratio (OR) = 2.909, 95% confidence interval (CI): 1.697⁻4.986]. High levels of stress may reduce subjects’ sleep quality, leading to an increase the likelihood of sleep disturbances and subsequent daytime dysfunction. The 5-HTR2A receptor gene polymorphism T102C was not significantly associated with sleep quality in this study, however, the -1438G/A polymorphism was significantly associated with sleep quality. The GG genotype of the -1438G/A polymorphism was linked to poorer sleep quality. When compared with subjects with low job-related stress levels×AG/AA genotype (OR = 2.106, 95% CI: 1.278⁻3.471), physicians with high job-related stress levels×GG genotype had a higher risk of experiencing poor sleep quality (OR = 13.400, 95% CI: 3.143⁻57.137). The findings of our study indicate that job stress and 5-HTR2A receptor gene polymorphisms are associated with sleep quality in physicians. Subjects with high job stress level or/and the -1438G/A GG genotype were more likely to report poor sleep quality, and furthermore, their combination effect on sleep quality was higher than their independent effects, so it may be suggested that job-related stress and genes have a cumulative effect on sleep quality; that is, stress can increase the risk of poor sleep quality, but this effect is worse in a group of people with specific gene polymorphisms.

Prion protein testis specific (PRNT) gene polymorphisms and transcript level in ovine spermatozoa: Implications in freezability, fertilization and embryo production.

PubMed

Pereira, R M; Mesquita, P; Pires, V M R; Baptista, M C; Barbas, J P; Pimenta, J; Horta, A E M; Prates, J A M; Marques, C C

2018-07-15

An essential role of prion protein testis specific (PRNT) and prion protein 2 dublet (PRND) genes in the male reproductive function has been highlighted, although a deeper knowledge for the mechanisms involved is still lacking. Our goal was to determine the importance of the PRNT haplotypic variants and mRNA expression levels in ovine spermatozoa freezability and ability for fertilization and embryo developmental processes. Their association with the PRND gene polymorphisms was also analyzed. DNA from rams belonging to three Portuguese sheep breeds (n = 28) was screened by single-strand conformation polymorphism (SSCP) analysis to identify the PRNT and PRND polymorphisms. Semen collected from these rams was cryopreserved and fertility traits evaluated. The SSCP analyses revealed polymorphisms in the codons 6, 38, 43 and 48 of the PRNT coding region - respectively c.17C > T (p.Ser6Phe, which disrupts a consensus arginine-X-X serine/threonine motif); c.112G > C (p.Gly38 > Arg); and synonymous c.129T > C and c.144A > G. The polymorphisms in codons 6, 38 and 48 occur simultaneously while the one in codon 43 occurs independently. Six haplotypes were identified in the PRNT coding region, resulting in three different amino acid polymorphic variants (6S-38G-43C-48V, S6F-G38R-43C-48V and 6F-38R-43C-48V). The PRNT gene mRNA transcript level in spermatozoa was related to the identified haplotypic variants, either considering the codons 6-38-48 (P ≤ 0.0001) or the codon 43 alone (P ≤ 0.0001) or altogether (P ≤ 0.0001). An interaction between PRNT haplotypes and PRND genotypes on PRNT transcript level was also identified (P = 0.0003). Rams carrying the 17C-112G-144A PRNT haplotype had sperm with the highest post-thawed individual motility (P ≤ 0.03). Combined PRNT and PRND polymorphic variation influenced the post-thawed individual motility (P = 0.01). The male PRNT haplotypic, either considering the codons 6-38-48 and 43 altogether or the codon 43 alone, interfered (P ≤ 0.04) in embryo production rates. In conclusion, our data confirm that the PRNT gene is highly polymorphic in sheep and that the PRNT and PRND genotypes are associated. The identified polymorphisms of PRNT coding region seems to interfere on the ram spermatozoa mRNA transcript level and on male fertility, specifically in sperm freezability and ability for embryo development. Copyright © 2018. Published by Elsevier Inc.

Association of MAOA, 5-HTT, and NET promoter polymorphisms with gene expression and protein activity in human placentas

PubMed Central

Zhang, Huiping; Smith, Graeme N.; Liu, Xudong

2010-01-01

Monoamine oxidase A (MAOA) and the transporters for serotonin (5-HTT) and norepinephrine (NET) may play important roles in regulating maternal monoamine neurotransmitters transferred across the placenta to the fetus. We investigated whether promoter polymorphisms in MAOA (uVNTR), 5-HTT (5-HTTLPR), and NET (NETpPR AAGG4) could influence gene expression and protein activity in human placentas. Normal term human placentas (n = 73) were collected, and placental MAOA, 5-HTT, and NET mRNA levels and protein activity were determined. The mRNA levels or protein activities were compared between different genotype groups. Placentas hemizygous (male fetus) or homozygous (female fetus) for MAOA uVNTR 4-repeat allele had significantly higher MAOA mRNA levels than those hemizygous or homozygous for the 3-repeat allele (P = 0.001). However, no significant difference in MAOA enzyme activity was found for these two groups of genotypes (P = 0.161). Placentas with the 5-HTTLPR short (S)-allele (S/S+S/L) had significantly lower 5-HTT mRNA levels and serotonin uptake rate than those homozygous for the long (L)-allele (L/L) (mRNA: P < 0.001; serotonin transporting activity: P < 0.001). Placentas homozygous for the NET AAGG4 L4 allele had significantly higher NET mRNA levels, as well as dopamine and norepinephrine uptake rates, than those with the S4/L4 genotype (mRNA: P < 0.001; dopamine transporting activity: P = 0.012; norepinephrine transporting activity: P = 0.011). These findings suggest that the three promoter polymorphisms of MAOA, 5-HTT, and NET influence gene expression levels and protein activity of these genes in human placentas, potentially leading to different fetal levels of maternal monoamine neurotransmitters, which may have an impact on fetal neurodevelopment. PMID:20332182

Polymorphisms of the GR and HSD11B1 genes influence body mass index and weight gain during hormone replacement treatment in patients with Addison's disease.

PubMed

Molnár, Ágnes; Kövesdi, Annamária; Szücs, Nikolette; Tóth, Miklós; Igaz, Péter; Rácz, Károly; Patócs, Attila

2016-08-01

Glucocorticoid substitution is essential in patients with chronic primary adrenocortical insufficiency (Addison's disease) and both over-treatment and inadequate dosage have deleterious effects. Individual sensitivity to glucocorticoids is partly genetically determined. To test the hypothesis whether the well-characterized SNPs of the GR and HSD11B1 genes may modulate the individual sensitivity to exogenous glucocorticoids and may influence clinical and/or laboratory parameters and the glucocorticoid substitution dosage in patients with Addison's disease. 68 patients with primary adrenocortical insufficiency were involved. Clinical and laboratory data, as well as the dosage of the hormone replacement therapy were collected. Peripheral blood DNA was isolated, and the GR and HSD11B1 SNPs were examined using allele-specific PCR or Taqman assay on Real Time PCR. The allele frequency of the GR N363S polymorphism was higher in patients compared to the control group and the disease appeared significantly earlier in patients harbouring the GR A3669G compared to noncarriers. These patients had higher ACTH level measured at the time of diagnosis. Homozygous BclI carriers had higher body mass index (BMI) and lower total hydrocortisone equivalent supplementation dose needed than heterozygous or noncarriers. The BMI and weight gain during hormone replacement therapy were also higher in carriers of the HSD11B1 rs4844880 treated with glucocorticoids other than dexamethasone. The BclI polymorphism of the GR gene and the rs4844880 of the HSD11B1 gene may contribute to weight gain and may affect the individual need of glucocorticoid substitution dose in these patients. © 2016 John Wiley & Sons Ltd.

Analysis of the influence of the T393C polymorphism of the GNAS gene on the clinical expression of primary hyperparathyroidism.

PubMed

Piedra, María; Berja, Ana; Ramos, Laura; García-Unzueta, María Teresa; Morán, Jesús Manuel; Ruiz, David; Amado, José Antonio

2017-12-01

The receptor of parathyroid hormone and parathyroid hormone-related-protein (PTH/PTHrp) is located in the cell membrane of target tissues - kidney and osteoblasts. It is a G protein-coupled-receptor whose G s α subunit is encoded by the GNAS gene. Our aim was to study whether the single nucleotide polymorphism (SNP) T393C of the GNAS gene is associated with renal stones, bone mineral density (BMD), or bone remodelling markers in primary hyperparathyroidism (PHPT). An analysis was made of clinical and biochemical parameters and densitometric values in three areas and their relationship with the T393C SNP of the GNAS gene in 261 patients with primary hyperparathyroidism and in 328 healthy controls. Genotyping was performed using the Custom Taqman ® SNP Genotyping assay. The genotype frequencies of GNAS T/C 393 were similar in the control and PHPT groups. No association was found between genotypes and clinical expression of PHPT (renal stones and bone fractures). A nonstatistically significant trend was seen to lower BMD in the lumbar spine, femoral neck, and total hip in both PHPT and control C homozygote subjects. Genetic susceptibility to PHPT related to the GNAS T393C polymorphism or a major influence in its development and clinical expression were found. A C allele-related susceptibility to lower BMD in trabecular bone in both PHPT and control subjects is not sufficient to suggest a more severe clinical expression of PHPT. This trend may be considered as a basis for further studies with larger sample sizes and complementary functional evaluation. Copyright © 2017 SEEN y SED. Publicado por Elsevier España, S.L.U. All rights reserved.

Interaction between the SLC19A1 gene and maternal first trimester fever on offspring neural tube defects.

PubMed

Pei, Lijun; Zhu, Huiping; Ye, Rongwei; Wu, Jilei; Liu, Jianmeng; Ren, Aiguo; Li, Zhiwen; Zheng, Xiaoying

2015-01-01

Many studies have indicated that the reduced folate carrier gene (SLC19A1) is associated with an increased risk of neural tube defects (NTDs). However, the interaction between the SLC19A1 gene variant and maternal fever exposure and NTD risk remains unknown. The aim of this study was to investigate whether the risk for NTDs was influenced by the interactions between the SLC19A1 (rs1051266) variant and maternal first trimester fever. We investigated the potential interaction between maternal first trimester fever and maternal or offspring SLC19A1 polymorphism through a population-based case-control study. One hundred and four nuclear families with NTDs and 100 control families with nonmal newborns were included in the study. SLC19A1 polymorphism was determined using polymerase chain reaction-restricted fragment length polymorphism. Mothers who had the GG/GA genotype and first trimester fever had an elevated risk of NTDs (adjusted odds ratio, 11.73; 95% confidence interval, 3.02-45.58) as compared to absence of maternal first trimester fever and AA genotype after adjusting for maternal education, paternal education, and age, and had a significant interactive coefficient (γ = 3.17) between maternal GG/GA genotype and first trimester fever. However, there was no interaction between offspring's GG/GA genotype and maternal first trimester fever (the interactive coefficient γ = 0.97) after adjusting for confounding factors. Our findings suggested that the risk of NTDs was potentially influenced by a gene-environment interaction between maternal SLC19A1 rs1051266 GG/GA genotype and first trimester fever. Maternal GG/GA genotype may strengthen the effect of maternal fever exposure on NTD risk in this Chinese population. © 2014 Wiley Periodicals, Inc.

Association of MAOA, 5-HTT, and NET promoter polymorphisms with gene expression and protein activity in human placentas.

PubMed

Zhang, Huiping; Smith, Graeme N; Liu, Xudong; Holden, Jeanette J A

2010-06-01

Monoamine oxidase A (MAOA) and the transporters for serotonin (5-HTT) and norepinephrine (NET) may play important roles in regulating maternal monoamine neurotransmitters transferred across the placenta to the fetus. We investigated whether promoter polymorphisms in MAOA (uVNTR), 5-HTT (5-HTTLPR), and NET (NETpPR AAGG(4)) could influence gene expression and protein activity in human placentas. Normal term human placentas (n = 73) were collected, and placental MAOA, 5-HTT, and NET mRNA levels and protein activity were determined. The mRNA levels or protein activities were compared between different genotype groups. Placentas hemizygous (male fetus) or homozygous (female fetus) for MAOA uVNTR 4-repeat allele had significantly higher MAOA mRNA levels than those hemizygous or homozygous for the 3-repeat allele (P = 0.001). However, no significant difference in MAOA enzyme activity was found for these two groups of genotypes (P = 0.161). Placentas with the 5-HTTLPR short (S)-allele (S/S+S/L) had significantly lower 5-HTT mRNA levels and serotonin uptake rate than those homozygous for the long (L)-allele (L/L) (mRNA: P < 0.001; serotonin transporting activity: P < 0.001). Placentas homozygous for the NET AAGG(4) L(4) allele had significantly higher NET mRNA levels, as well as dopamine and norepinephrine uptake rates, than those with the S(4)/L(4) genotype (mRNA: P < 0.001; dopamine transporting activity: P = 0.012; norepinephrine transporting activity: P = 0.011). These findings suggest that the three promoter polymorphisms of MAOA, 5-HTT, and NET influence gene expression levels and protein activity of these genes in human placentas, potentially leading to different fetal levels of maternal monoamine neurotransmitters, which may have an impact on fetal neurodevelopment.

Effects of methamphetamine abuse and serotonin transporter gene variants on aggression and emotion-processing neurocircuitry

PubMed Central

Payer, D E; Nurmi, E L; Wilson, S A; McCracken, J T; London, E D

2012-01-01

Individuals who abuse methamphetamine (MA) exhibit heightened aggression, but the neurobiological underpinnings are poorly understood. As variability in the serotonin transporter (SERT) gene can influence aggression, this study assessed possible contributions of this gene to MA-related aggression. In all, 53 MA-dependent and 47 control participants provided self-reports of aggression, and underwent functional magnetic resonance imaging while viewing pictures of faces. Participants were genotyped at two functional polymorphic loci in the SERT gene: the SERT-linked polymorphic region (SERT-LPR) and the intron 2 variable number tandem repeat polymorphism (STin2 VNTR); participants were then classified as having high or low risk for aggression according to individual SERT risk allele combinations. Comparison of SERT risk allele loads between groups showed no difference between MA-dependent and control participants. Comparison of self-report scores showed greater aggression in MA-dependent than control participants, and in high genetic risk than low-risk participants. Signal change in the amygdala was lower in high genetic risk than low-risk participants, but showed no main effect of MA abuse; however, signal change correlated negatively with MA use measures. Whole-brain differences in activation were observed between MA-dependent and control groups in the occipital and prefrontal cortex, and between genetic high- and low-risk groups in the occipital, fusiform, supramarginal and prefrontal cortex, with effects overlapping in a small region in the right ventrolateral prefrontal cortex. The findings suggest that the investigated SERT risk allele loads are comparable between MA-dependent and healthy individuals, and that MA and genetic risk influence aggression independently, with minimal overlap in associated neural substrates. PMID:22832817

Promoter polymorphisms in genes involved in porcine myogenesis influence their transcriptional activity.

PubMed

Bongiorni, Silvia; Tilesi, Francesca; Bicorgna, Silvia; Iacoponi, Francesca; Willems, Daniela; Gargani, Maria; D'Andrea, MariaSilvia; Pilla, Fabio; Valentini, Alessio

2014-11-07

Success of meat production and selection for improvement of meat quality is among the primary aims in animal production. Meat quality traits are economically important in swine; however, the underlying genetic nature is very complex. Therefore, an improved pork production strongly depends on identifying and studying how genetic variations contribute to modulate gene expression. Promoters are key regions in gene modulation as they harbour several binding motifs to transcription regulatory factors. Therefore, polymorphisms in these regions are likely to deeply affect RNA levels and consequently protein synthesis. In this study, we report the identification of single nucleotide polymorphisms (SNPs) in promoter regions of candidate genes involved in development, cellular differentiation and muscle growth in Sus scrofa. We identified SNPs in the promoter regions of genes belonging to the Myogenic Regulatory Factors (MRF) gene family (the Myogenic Differentiation gene, MYOD1) and to Growth and Differentiation Factors (GDF) gene family (Myostatin gene, MSTN, GDF8), in Casertana and Large White breeds. The purpose of this study was to investigate if polymorphisms in the promoters could affect the transcriptional activity of these genes. With this aim, we evaluated in vitro the functional activity of the luciferase reporter gene luc2 activity, driven by two constructs carrying different promoter haplotypes. We tested the effects of the G302A (U12574) transition on the promoter efficiency in MYOD1 gene. We ascertained a difference in transcription efficiency for the two variants. A stronger activity of the A-carrying construct is more evident in C2C12. The luciferase expression driven by the MYOD1-A allelic variant displayed a 3.8-fold increased transcriptional activity. We investigated the activity of two haplotype variants (AY527152) in the promoter of GDF8 gene. The haploptype-1 (A435-A447-A879) up-regulated the expression of the reporter gene by a two-fold increase, and hence presumably of the GDF8 gene, in both CHO and C2C12 cultured cells. In vitro the MYOD1-A allelic variant could up-regulate the expression of MYOD1 gene. Additionally, we could assess a different response of in vitro gene expression according to cell type used to transfect constructs, suggesting that MyoD activation is regulated by mechanisms that are specific of myoblasts.

Dopamine D2 receptor gene polymorphisms and externalizing behaviors in children and adolescents.

PubMed

Della Torre, Osmar Henrique; Paes, Lúcia Arisaka; Henriques, Taciane Barbosa; de Mello, Maricilda Palandi; Celeri, Eloisa Helena Rubello Valler; Dalgalarrondo, Paulo; Guerra-Júnior, Gil; Santos-Júnior, Amilton Dos

2018-05-02

Dopamine is involved in several cerebral physiological processes, and single nucleotide polymorphisms (SNP) in the dopamine D2 receptor gene (DRD2) have been associated with numerous neurological and mental disorders, including those involving alterations in cognitive and emotional processes. The aim of this study was to evaluate the association between the SNPs c.957C > T (rs6277) and c.-585A > G (rs1799978) in the DRD2 gene and behavioral characteristics of children and adolescents based on an inventory of the Child Behavior Checklist (CBCL). Children and adolescents between 8 and 20 years old who were clinically followed-up were genotyped for the SNPs c.957C > T and c.-585A > G, and related to data of the CBCL/6-18 scale assessment performed with the help of caregivers. The chi-squared test was used to assess the differences in the frequencies of the C and T alleles in the polymorphism c.957C > T and of the A and G alleles in the polymorphism c.-585A > G with respect to the grouped CBCL scores at a significance level of 5%. Multiple logistic regression models were performed, to control whether sex and/or ethnicity could influence the results. Eighty-five patients were assessed overall, and the presence of the T allele (C/T and T/T) of DRD2 c.957C > T polymorphism was found to be significantly associated with the occurrence of defiant and oppositional problems and with attention and hyperactivity problems. There were no associations detected with polymorphism DRD2 c.-585A > G polymorphism. Both SNPs were in Hardy-Weinberg-equilibrium. Although the findings of this study are preliminary, due to its small number of participants, the presence of T allele (C/T, T/T) in c.957C > T SNP was associated with difficulty in impulse control, self-control of emotions, and conduct adjustment, which can contribute to improving the identification of mental and behavioral phenotypes associated with gene expression.

Role of 2 common variants of 5HT2A gene in medication overuse headache.

PubMed

Terrazzino, Salvatore; Sances, Grazia; Balsamo, Francesca; Viana, Michele; Monaco, Francesco; Bellomo, Giorgio; Martignoni, Emilia; Tassorelli, Cristina; Nappi, Giuseppe; Canonico, Pier Luigi; Genazzani, Armando A

2010-11-01

The aim of the present study was to evaluate a possible involvement of 2 polymorphisms of the serotonin 5HT2A receptor gene (A-1438G and C516T) as risk factors for medication overuse headache (MOH) and whether the presence of these polymorphic variants might determine differences within MOH patients in monthly drug consumption. Despite a growing scientific interest in the mechanisms underlying the pathophysiology of MOH, few studies have focused on the role of genetics in the development of the disease, as well as on the genetic determinants of the inter-individual variability in the number of drug doses taken per month. Our study was performed by polymerase chain reaction (PCR) and PCR-restriction fragment length polymorphism on genomic DNA extracted from peripheral blood of 227 MOH patients and 312 control subjects. Genotype-specific risks were estimated as odds ratios with associated 95% confidence intervals by unconditional logistic regression and adjusted for age and gender. A stepwise multiple linear regression analysis was employed to identify significant predictors of the number of drug doses taken per month. No significant association was found between 5HT2A A and 1438G and C516T gene polymorphisms and MOH risk. In contrast, a higher consumption of monthly drug doses was observed among 516T 5HT2A carriers (median 50, range 13-120) compared to 516CC patients (median 30, range 12-128) (Mann-Whitney U-test, P = .018). In the stepwise multiple regression analysis, C516T 5HT2A polymorphism (P = .018) and class of overused drug (P = .047) emerged as significant, independent predictors of the monthly drug consumption in MOH patients. Although our results do not support a major role of the A-1438G and C516T polymorphic variants of the 5HT2A gene in the susceptibility of MOH, our findings support an influence of the C516T polymorphism on the number of symptomatic drug doses taken and, possibly, on the drug-seeking behavior in these patients. © 2010 American Headache Society.

Prolonged neutropenia after irinotecan-based chemotherapy in a child with polymorphisms of UGT1A1 and SLCO1B1.

PubMed

Sakaguchi, S; Garcia-Bournissen, F; Kim, R; Schwarz, U I; Nathan, P C; Ito, S

2009-12-01

Genetic polymorphisms of uridine diphosphate glucuronosyl transferase 1A1 (UGT1A1), and SLCO1B1 coding organic anion-transporter polypeptide 1B1, are independent risk factors known to increase irinotecan toxicity in adults. Although combined occurrence of polymorphisms in these 2 genes is likely to influence susceptibility to irinotecan toxicity, data are scarce, especially in children. We report an 11-year-old female with severe and prolonged neutropenia after irinotecan-based chemotherapy. The patient's genotyping revealed polymorphisms in both UGT1A1 and SLCO1B1. To our knowledge, this is the first case report of combined genotyping of both UGT1A1 and SLCO1B1 in a child with severe irinotecan toxicity.

Estimation of the relationship between the polymorphisms of selected genes: ACE, AGTR1, TGFβ1 and GNB3 with the occurrence of primary vesicoureteral reflux.

PubMed

Życzkowski, Marcin; Żywiec, Joanna; Nowakowski, Krzysztof; Paradysz, Andrzej; Grzeszczak, Władyslaw; Gumprecht, Janusz

2017-03-01

Etiopathogenesis of VUR is composite and not fully understood. Many data indicate the importance of genetic predisposition. The aim of this study was to establish the relationship of selected polymorphisms: 14094 polymorphism of the ACE, polymorphism rs1800469 of TGFβ-1, rs5443 gene polymorphism of the GNB3 and receptor gene polymorphism rs5186 type 1 AGTR1 with the occurrence of the primary vesicoureteral reflux. The study included 190 children: 90 with the primary VUR confirmed with the voiding cystourethrogram and excluded secondary VUR and a control group of 100 children without a history of the diseases of the genitourinary tract. The study was planned in the scheme: "tested case versus control." Genomic DNA was isolated from the leukocytes of peripheral blood samples. The results were statistically analyzed in the Statistica 10 using χ 2 test and analysis of the variance Anova. Any of the four studied polymorphisms showed no difference in the distribution of genotypes between patients with primary vesicoureteral reflux and the control group. In patients with VUR and TT genotype polymorphism rs5443 GNB3 gene, the glomerular filtration rate was significantly higher than in patients with genotype CC or CT. (1) No relationship was found between the studied polymorphisms (14094 ACE gene, rs1800469 gene TGFβ1, GNB3 gene rs5443, rs5186 AGTR1 gene) and the occurrence of primary vesicoureteral reflux. (2) TT genotype polymorphism rs5443 GNB3 gene may be a protective factor for the improved renal function in patients with primary vesicoureteral reflux in patients with genotype CC or CT.

Gene-gene interaction between PPAR gamma 2 and ADR beta 3 increases obesity risk in children and adolescents.

PubMed

Ochoa, M C; Marti, A; Azcona, C; Chueca, M; Oyarzábal, M; Pelach, R; Patiño, A; Moreno-Aliaga, M J; Martínez-González, M A; Martínez, J A

2004-11-01

Multiple genes are likely to be involved in obesity and these genes may interact with environmental factors to influence obesity risk. Our aim was to explore the synergistic contribution of the two polymorphisms: Pro12Ala of the PPAR gamma 2 gene and Trp64Arg of the ADR beta 3 gene to obesity risk in a Spanish children and adolescent population. We designed a sex- and age-matched case-control study. Participants were 185 obese and 185 control children (aged 5-18 y) from the Navarra region, recruited through Departments of Pediatrics (Hospital Virgen del Camino, Navarra University Clinic and several Primary Health Centers). The obesity criterion (case definition) was BMI above the 97th percentile according to Spanish BMI reference data for age and gender. Anthropometric parameters were measured by standard protocols. The genotype was assessed by PCR-RFLP after digestion with BstUI for PPAR gamma 2 mutation and BstNI for ADR beta 3 variants. Face-to-face interviews were conducted to assess the physical activity. Using a validated physical activity questionnaire, we computed an activity metabolic equivalent index (METs h/week), which represents the physical exercise during the week for each participant. Statistical analysis was performed by conditional logistic regression, taking into account the matching between cases and controls. Carriers of the polymorphism Pro12Ala of the PPAR gamma 2 gene had a significantly higher obesity risk than noncarriers (odds ratio (OR)=2.18, 95% CI=1.09-4.36) when we adjusted for sex, age and physical activity. Moreover, the risk of obesity was higher (OR=2.59, 95% CI=1.17-5.34) when family history of obesity was also taken into account in the model. The OR for obesity linked to both polymorphisms (PPAR gamma 2 and ADR beta 3) was 5.30 (95% CI=1.08-25.97) when we adjusted for sex, age and physical activity. After adjustment for family history of obesity, the OR for carriers of both polymorphisms was 19.5 (95% CI=2.43-146.8). A synergistic effect between polymorphism Pro12Ala of the PPAR gamma 2 gene and Trp64Arg of the ADR beta 3 gene for obesity risk was found in a case-control study including children and adolescents.

Association of Calpain (CAPN) 10 (UCSNP-43, rs3792267) gene polymorphism with elevated serum androgens in young women with the most severe phenotype of polycystic ovary syndrome (PCOS).

PubMed

Anastasia, Karela; Koika, Vasiliki; Roupas, Nikolaos D; Armeni, Anastasia; Marioli, Dimitra; Panidis, Dimitrios; George, Adonakis; Georgopoulos, Neoklis A

2015-01-01

To highlight a possible association of Calpain (CAPN 10) gene UCSNP-43 polymorphism with hormonal and metabolic traits of young women with different phenotypes of polycystic ovary syndrome (PCOS). PCOS women were genotyped for the CAPN 10 gene UCSNP-43 polymorphism. A comparison of clinical and biochemical features of women with PCOS stratified on the basis of the CAPN 10 gene UCSNP-43 variants was assessed. Anthropometric, hormonal and biochemical measurements were carried out in 668 PCOS women and 200 healthy controls. Subjects were also genotyped for the CAPN 10 gene UCSNP-43 polymorphism. The genotype frequency distributions between groups and controls were compared using the chi-square test. The association of the polymorphism with the clinical and biochemical features of the study cohort was estimated as well. No association of the frequency of CAPN 10 gene UCSNP-43 polymorphism with PCOS was detected. No association of the polymorphism with the anthropometric, biochemical and hormonal features was detected both in PCOS and control women. The polymorphism was associated with serum Δ4 androstenedione (p = 0.018), as well as with 17-OH progesterone (17-hydroxyprogesterone) among women with PCOS phenotype A (p = 0.012). CAPN 10 gene polymorphism UCSNP-43 is deprived of a metabolic contribution to cardiovascular disease (CVD). However, due to its association with androgen excess in phenotype A, CAPN 10 gene polymorphism UCSNP-43 could be used as a genetic marker for CVD in young PCOS women.

Polymorphisms of the Tissue Inhibitor of Metalloproteinase 3 Gene Are Associated with Resistance to High-Altitude Pulmonary Edema (HAPE) in a Japanese Population: A Case Control Study Using Polymorphic Microsatellite Markers

PubMed Central

Kobayashi, Nobumitsu; Hanaoka, Masayuki; Droma, Yunden; Ito, Michiko; Katsuyama, Yoshihiko; Kubo, Keishi; Ota, Masao

2013-01-01

Introduction High-altitude pulmonary edema (HAPE) is a hypoxia-induced, life-threatening, high permeability type of edema attributable to pulmonary capillary stress failure. Genome-wide association analysis is necessary to better understand how genetics influence the outcome of HAPE. Materials and Methods DNA samples were collected from 53 subjects susceptible to HAPE (HAPE-s) and 67 elite Alpinists resistant to HAPE (HAPE-r). The genome scan was carried out using 400 polymorphic microsatellite markers throughout the whole genome in all subjects. In addition, six single nucleotide polymorphisms (SNPs) of the gene encoding the tissue inhibitor of metalloproteinase 3 (TIMP3) were genotyped by Taqman® SNP Genotyping Assays. Results The results were analyzed using case-control comparisons. Whole genome scanning revealed that allele frequencies in nine markers were statistically different between HAPE-s and HAPE-r subjects. The SNP genotyping of the TIMP3 gene revealed that the derived allele C of rs130293 was associated with resistance to HAPE [odds ratio (OR) = 0.21, P = 0.0012) and recessive inheritance of the phenotype of HAPE-s (P = 0.0012). A haplotype CAC carrying allele C of rs130293 was associated with resistance to HAPE. Discussion This genome-wide association study revealed several novel candidate genes associated with susceptibility or resistance to HAPE in a Japanese population. Among those, the minor allele C of rs130293 (C/T) in the TIMP3 gene was linked to resistance to HAPE; while, the ancestral allele T was associated with susceptibility to HAPE. PMID:23991023

Effects of vertebral number variations on carcass traits and genotyping of Vertnin candidate gene in Kazakh sheep.

PubMed

Zhang, Zhifeng; Sun, Yawei; Du, Wei; He, Sangang; Liu, Mingjun; Tian, Changyan

2017-09-01

The vertebral number is associated with body length and carcass traits, which represents an economically important trait in farm animals. The variation of vertebral number has been observed in a few mammalian species. However, the variation of vertebral number and quantitative trait loci in sheep breeds have not been well addressed. In our investigation, the information including gender, age, carcass weight, carcass length and the number of thoracic and lumbar vertebrae from 624 China Kazakh sheep was collected. The effect of vertebral number variation on carcass weight and carcass length was estimated by general linear model. Further, the polymorphic sites of Vertnin ( VRTN ) gene were identified by sequencing, and the association of the genotype and vertebral number variation was analyzed by the one-way analysis of variance model. The variation of thoracolumbar vertebrae number in Kazakh sheep (18 to 20) was smaller than that in Texel sheep (17 to 21). The individuals with 19 thoracolumbar vertebrae (T13L6) were dominant in Kazakh sheep (79.2%). The association study showed that the numbers of thoracolumbar vertebrae were positively correlated with the carcass length and carcass weight, statistically significant with carcass length. To investigate the association of thoracolumbar vertebrae number with VRTN gene, we genotyped the VRTN gene. A total of 9 polymorphic sites were detected and only a single nucleotide polymorphism (SNP) (rs426367238) was suggested to associate with thoracic vertebral number statistically. The variation of thoracolumbar vertebrae number positively associated with the carcass length and carcass weight, especially with the carcass length. VRTN gene polymorphism of the SNP (rs426367238) with significant effect on thoracic vertebral number could be as a candidate marker to further evaluate its role in influence of thoracolumbar vertebral number.

Genetic variants within obesity-related genes are associated with tumor recurrence in patients with stages II/III colon cancer.

PubMed

Sebio, Ana; Gerger, Armin; Matsusaka, Satoshi; Yang, Dongyun; Zhang, Wu; Stremitzer, Stefan; Stintzing, Sebastian; Sunakawa, Yu; Yamauchi, Shinichi; Ning, Yan; Fujimoto, Yoshiya; Ueno, Masashi; Lenz, Heinz-Josef

2015-01-01

Obesity is an established risk factor for colorectal cancer (CRC) incidence and it is also linked to CRC recurrence and survival. Polymorphisms located in obesity-related genes are associated with an increased risk of developing several cancer types including CRC. We evaluated whether single-nucleotide polymorphisms in obesity-related genes may predict tumor recurrence in colon cancer patients. Genotypes were obtained from germline DNA from 207 patients with stage II or III colon cancer at the Norris Comprehensive Cancer Center. Nine polymorphisms in eight obesity-related genes (PPAR, LEP, NFKB, CD36, DRG1, NGAL, REGIA, and DSCR1) were evaluated. The primary endpoint of the study was the 3-year recurrence rate. Positive associations were also tested in an independent Japanese cohort of 350 stage III CRC patients. In univariate analysis, for PPARrs1801282, patients with a CC genotype had significantly lower recurrence probability (29 ± 4% SE) compared with patients with a CG genotype (48 ± 8% SE) [hazard ratio (HR): 1.77; 95% confidence interval (CI), 1.01-3.10; P = 0.040]. For DSCR1rs6517239, patients with an AA genotype had higher recurrence probability than patients carrying at least one allele G (37 ± 4% SE vs. 15 ± 6% SE) (HR: 0.51; 95% CI, 0.27-0.94; P = 0.027). This association was stronger in the patients bearing a left-sided tumor (HR: 0.34; 95% CI, 0.13-0.88; P = 0.018). In the Japanese cohort, no associations were found. This hypothesis-generating study suggests a potential influence of polymorphisms within obesity-related genes in the recurrence probability of colon cancer. These interesting results should be evaluated further.

Association of TNFα-308, IFNγ+874, and IL10-1082 gene polymorphisms and the risk of non-small cell lung cancer in the population of the South Indian state of Telangana.

PubMed

Peddireddy, Vidyullatha; Badabagni, Siva Prasad; Sulthana, Shehnaz; Kolla, Venkata Karunakar; Gundimeda, Sandhya Devi; Mundluru, Hemaprasad

2016-10-01

Cytokine-mediated inflammation is important in the pathogenesis of non-small cell lung cancer (NSCLC). Genetic polymorphisms in cytokine genes and their association with lung cancer in the Indian population have not been reported. For the first time, we analyzed genetic polymorphisms of TNFα -308 , IFNγ +874 , and IL10 -1082 genes in 246 NSCLC patients and 250 healthy controls in the South Indian population from Telangana using ARMS PCR. IFNγ +874 A/T and IL10 -1082 G/G gene polymorphisms were found to be significantly associated with NSCLC with 1.56- and 1.68-fold disease risk, respectively. There was no association between the risk of NSCLC and TNFα -308 polymorphism. Gene polymorphisms stratified according to smoking revealed that IFNγ +874 A/T polymorphisms in smokers increased the disease risk by 2.91 fold. IL10 -1082 G/G polymorphisms showed 2-fold increased risk among patients who were smokers when compared to the controls. However, there was no association between TNFα -308 , IFNγ +874 , and IL10 -1082 gene polymorphism and the stage of the NSCLC patients. The overall risk associated with the combination of these polymorphisms indicated that the TNFα -308 G/A + IFNγ +874 A/T + IL10 -1082 G/G genotype increased the risk by 1.5 fold. The results of our study indicate an association between cytokine gene polymorphisms and the risk of NSCLC in an Indian population.

Are "functionally related polymorphisms" of renin-angiotensin-aldosterone system gene polymorphisms associated with hypertension?

PubMed

Hahntow, Ines N; Mairuhu, Gideon; van Valkengoed, Irene Gm; Koopmans, Richard P; Michel, Martin C

2010-06-02

Genotype-phenotype association studies are typically based upon polymorphisms or haplotypes comprised of multiple polymorphisms within a single gene. It has been proposed that combinations of polymorphisms in distinct genes, which functionally impact the same phenotype, may have stronger phenotype associations than those within a single gene. We have tested this hypothesis using genes encoding components of the renin-angiotensin-aldosterone system and the high blood pressure phenotype. Our analysis is based on 1379 participants of the cross-sectional SUNSET study randomly selected from the population register of Amsterdam. Each subject was genotyped for the angiotensinogen M235T, the angiotensin-converting enzyme insertion/deletion and the angiotensin II type 1 receptor A1166C polymorphism. The phenotype high blood pressure was defined either as a categorical variable comparing hypertension versus normotension as in most previous studies or as a continuous variable using systolic, diastolic and mean blood pressure in a multiple regression analysis with gender, ethnicity, age, body-mass-index and antihypertensive medication as covariates. Genotype-phenotype relationships were explored for each polymorphism in isolation and for double and triple polymorphism combinations. At the single polymorphism level, only the A allele of the angiotensin II type 1 receptor was associated with a high blood pressure phenotype. Using combinations of polymorphisms of two or all three genes did not yield stronger/more consistent associations. We conclude that combinations of physiologically related polymorphisms of multiple genes, at least with regard to the renin-angiotensin-aldosterone system and the hypertensive phenotype, do not necessarily offer additional benefit in analyzing genotype/phenotype associations.

The Influence of Genetics on Cystic Fibrosis Phenotypes

PubMed Central

Knowles, Michael R.; Drumm, Mitchell

2012-01-01

Technological advances in genetics have made feasible and affordable large studies to identify genetic variants that cause or modify a trait. Genetic studies have been carried out to assess variants in candidate genes, as well as polymorphisms throughout the genome, for their associations with heritable clinical outcomes of cystic fibrosis (CF), such as lung disease, meconium ileus, and CF-related diabetes. The candidate gene approach has identified some predicted relationships, while genome-wide surveys have identified several genes that would not have been obvious disease-modifying candidates, such as a methionine sulfoxide transferase gene that influences intestinal obstruction, or a region on chromosome 11 proximate to genes encoding a transcription factor and an apoptosis controller that associates with lung function. These unforeseen associations thus provide novel insight into disease pathophysiology, as well as suggesting new therapeutic strategies for CF. PMID:23209180

Neuropsychological performance measures as intermediate phenotypes for attention-deficit/hyperactivity disorder: A multiple mediation analysis

PubMed Central

KAMRADT, JACLYN M.; NIGG, JOEL T.; FRIDERICI, KAREN H.; NIKOLAS, MOLLY A.

2016-01-01

Genetic influences on dopaminergic neurotransmission have been implicated in attention-deficit hyperactivity disorder (ADHD) and are theorized to impact cognitive functioning via alterations in frontal–striatal circuitry. Neuropsychological functioning has been proposed to account for the potential associations between dopamine candidate genes and ADHD. However, to date, this mediation hypothesis has not been directly tested. Participants were 498 youth ages 6–17 years (mean M = 10.8 years, SD = 2.4 years, 55.0% male). All youth completed a multistage, multiple-informant assessment procedure to identify ADHD and non-ADHD cases, as well as a comprehensive neuropsychological battery. Youth provided a saliva sample for DNA analyses; the 480 base pair variable number of tandem repeat polymorphism of the dopamine active transporter 1 gene (DAT1) and the 120 base pair promoter polymorphism of the dopamine receptor D4 gene (DRD4) were genotyped. Multiple mediation analysis revealed significant indirect associations between DAT1 genotype and inattention, hyperactivity–impulsivity, and oppositionality, with specific indirect effects through response inhibition. The results highlight the role of neurocognitive task performance, particularly response inhibition, as a potential intermediate phenotype for ADHD, further elucidating the relationship between genetic polymorphisms and externalizing psychopathology. PMID:27049476

Multigenic Control of Measles Vaccine Immunity Mediated by Polymorphisms in Measles Receptor, Innate Pathway, and Cytokine Genes

PubMed Central

Kennedy, Richard B.; Ovsyannikova, Inna G.; Haralambieva, Iana H.; O’Byrne, Megan; Jacobson, Robert M.; Pankratz, V. Shane; Poland, Gregory A.

2012-01-01

Measles infection and vaccine response are complex biological processes that involve both viral and host genetic factors. We have previously investigated the influence of genetic polymorphisms on vaccine immune response, including measles vaccines, and have shown that polymorphisms in HLA, cytokine, cytokine receptor, and innate immune response genes are associated with variation in vaccine response but do not account for all of the inter-individual variance seen in vaccinated populations. In the current study we report the findings of a multigenic analysis of measles vaccine immunity, indicating a role for the measles virus receptor CD46, innate pattern-recognition receptors (DDX58, TLR2, 4, 5,7 and 8) and intracellular signaling intermediates (MAP3K7, NFKBIA), and key antiviral molecules (VISA, OAS2, MX1, PKR) as well as cytokines (IFNA1, IL4, IL6, IL8, IL12B) and cytokine receptor genes (IL2RB, IL6R, IL8RA) in the genetic control of both humoral and cellular immune responses. This multivariate approach provided additional insights into the genetic control of measles vaccine responses over and above the information gained by our previous univariate SNP association analyses. PMID:22265947

Differential susceptibility effects of oxytocin gene (OXT) polymorphisms and perceived parenting on social anxiety among adolescents.

PubMed

Olofsdotter, Susanne; Åslund, Cecilia; Furmark, Tomas; Comasco, Erika; Nilsson, Kent W

2018-05-01

Social anxiety is one of the most commonly reported mental health problems among adolescents, and it has been suggested that parenting style influences an adolescent's level of anxiety. A context-dependent effect of oxytocin on human social behavior has been proposed; however, research on the oxytocin gene (OXT) has mostly been reported without considering contextual factors. This study investigated the interactions between parenting style and polymorphic variations in the OXT gene in association with social anxiety symptoms in a community sample of adolescents (n = 1,359). Two single nucleotide polymorphisms linked to OXT, rs4813625 and rs2770378, were genotyped. Social anxiety and perceived parenting style were assessed by behavioral questionnaires. In interaction models adjusted for sex, significant interaction effects with parenting style were observed for both variants in relation to social anxiety. The nature of the interactions was in line with the differential susceptibility framework for rs4813625, whereas for rs2770378 the results indicated a diathesis-stress type of interaction. The findings may be interpreted from the perspective of the social salience hypothesis of oxytocin, with rs4813625 affecting social anxiety levels along a perceived unsafe-safe social context dimension.

Association of a NOD2 Gene Polymorphism and T-Helper 17 Cells With Presumed Ocular Toxoplasmosis

PubMed Central

Dutra, Míriam S.; Béla, Samantha R.; Peixoto-Rangel, Alba L.; Fakiola, Michaela; Cruz, Ariane G.; Gazzinelli, Andrea; Quites, Humberto F.; Bahia-Oliveira, Lilian M. G.; Peixe, Ricardo G.; Campos, Wesley R.; Higino-Rocha, Anna C.; Miller, Nancy E.; Blackwell, Jenefer M.; Antonelli, Lis R.; Gazzinelli, Ricardo T.

2013-01-01

Retinochoroiditis manifests in patients infected with Toxoplasma gondii. Here, we assessed 30 sibships and 89 parent/case trios of presumed ocular toxoplasmosis (POT) to evaluate associations with polymorphisms in the NOD2 gene. Three haplotype-tagging single-nucleotide polymorphisms (tag-SNPs) within the NOD2 gene were genotyped. The family-based association test showed that the tag-SNP rs3135499 is associated with retinochoroiditis (P = .039). We then characterized the cellular immune response of 59 cases of POT and 4 cases of active ocular toxoplasmosis (AOT). We found no differences in levels of interferon γ (IFN-γ) and interleukin 2 produced by T-helper 1 cells when comparing patients with AOT or POT to asymptomatic individuals. Unexpectedly, we found an increased interleukin 17A (IL-17A) production in patients with POT or OAT. In patients with POT or AOT, the main cellular source of IL-17A was CD4+CD45RO+T-bet−IFN-γ− T-helper 17 cells. Altogether, our results suggest that NOD2 influences the production of IL-17A by CD4+ T lymphocytes and might contribute to the development of ocular toxoplasmosis. PMID:23100559

Association of a NOD2 gene polymorphism and T-helper 17 cells with presumed ocular toxoplasmosis.

PubMed

Dutra, Míriam S; Béla, Samantha R; Peixoto-Rangel, Alba L; Fakiola, Michaela; Cruz, Ariane G; Gazzinelli, Andrea; Quites, Humberto F; Bahia-Oliveira, Lilian M G; Peixe, Ricardo G; Campos, Wesley R; Higino-Rocha, Anna C; Miller, Nancy E; Blackwell, Jenefer M; Antonelli, Lis R; Gazzinelli, Ricardo T

2013-01-01

Retinochoroiditis manifests in patients infected with Toxoplasma gondii. Here, we assessed 30 sibships and 89 parent/case trios of presumed ocular toxoplasmosis (POT) to evaluate associations with polymorphisms in the NOD2 gene. Three haplotype-tagging single-nucleotide polymorphisms (tag-SNPs) within the NOD2 gene were genotyped. The family-based association test showed that the tag-SNP rs3135499 is associated with retinochoroiditis (P = .039). We then characterized the cellular immune response of 59 cases of POT and 4 cases of active ocular toxoplasmosis (AOT). We found no differences in levels of interferon γ (IFN-γ) and interleukin 2 produced by T-helper 1 cells when comparing patients with AOT or POT to asymptomatic individuals. Unexpectedly, we found an increased interleukin 17A (IL-17A) production in patients with POT or OAT. In patients with POT or AOT, the main cellular source of IL-17A was CD4(+)CD45RO(+)T-bet(-)IFN-γ(-) T-helper 17 cells. Altogether, our results suggest that NOD2 influences the production of IL-17A by CD4(+) T lymphocytes and might contribute to the development of ocular toxoplasmosis.

Cytokine polymorphisms have a synergistic effect on severity of the acute sickness response to infection.

PubMed

Vollmer-Conna, Uté; Piraino, Barbara F; Cameron, Barbara; Davenport, Tracey; Hickie, Ian; Wakefield, Denis; Lloyd, Andrew R

2008-12-01

Functional polymorphisms in immune response genes are increasingly recognized as important contributors to the marked individual differences in susceptibility to and outcomes of infectious disease. The acute sickness response is a stereotypical set of illness manifestations mediated by the proinflammatory cytokines induced by many different pathogens. The genetic determinants of severity of the acute sickness response have not previously been explored. We examined the impact of functional polymorphisms in cytokine genes with critical roles in the early immune response (tumor necrosis factor-alpha, interleukin-6, interleukin-10, and interferon-gamma) on the severity and duration of illness following acute infection with Epstein-Barr virus, Coxiella burnetii (the causative agent of Q fever), or Ross River virus. We found that the interferon-gamma +874T/A and the interleukin-10 -592C/A polymorphisms significantly affected illness severity, cytokine protein levels, and the duration of illness. These cytokine genotypes acted in synergy to potentiate their influence on disease outcomes. These findings suggest that genetically determined variations in the intensity of the inflammatory response underpin the severity of the acute sickness response and predict the recovery time across varied infections.

Predictors of response to intra-articular steroid injection in psoriatic arthritis.

PubMed

Eder, Lihi; Chandran, Vinod; Ueng, Joanna; Bhella, Sita; Lee, Ker-Ai; Rahman, Proton; Pope, Angela; Cook, Richard J; Gladman, Dafna D

2010-07-01

To assess the effectiveness of IA corticosteroid (IAS) injections in PsA and to determine the association between macrophage migration inhibition factor (MIF) gene polymorphism and response to IAS injections. A cohort analysis of PsA patients who were followed prospectively was performed. Clinical response was defined as no tenderness or effusion in the injected joint at 3 months. Relapse was defined as re-occurrence of joint pain or effusion. MIF 173C > G genotyping (rs755622) was performed. Two hundred and twenty patients with 245 IAS injections were included in the study. The probability of responding at 3 months was 41.6%. Within 12 months, 25.5% of the joints relapsed. Clinical factors that were associated with response included duration of psoriasis [Odds ratio (OR) 1.03] and the use of MTX or anti-TNF agents at the time of injection (OR 2.68). Factors that were associated with relapse included injection into large joints (OR 4.58) and elevated sedimentation rate (OR 15.0), whereas absence of clinical and/or radiographic damage (OR 0.23) and duration of PsA (OR 0.92) reduced risk of relapse. MIF polymorphism was not associated with clinical response, but was associated with relapse (OR 3.2). On multivariate analysis including clinical covariates, the association between MIF polymorphism and relapse was lost. IAS injections are effective in PsA. MIF gene polymorphism is associated with relapse. However, this effect is explained by clinical variables that reflect disease activity, suggesting that MIF gene polymorphism influences inflammatory activity.

Association between the rs1143634 polymorphism in interleukin-1B and chronic periodontitis: Results from a meta-analysis composed by 54 case/control studies.

PubMed

da Silva, Felipe Rodolfo Pereira; Vasconcelos, Any Carolina Cardoso Guimarães; de Carvalho França, Luiz Felipe; Di Lenardo, David; Nascimento, Hélio Mateus Silva; Vasconcelos, Daniel Fernando Pereira

2018-08-20

Several factors are involved in the periodontitis with host response through cytokines and as well as with influence of polymorphisms in cytokine genes, however the results remained contradictory. This study aimed at evaluating the rs1143634 polymorphism in interleukin-1B gene, a cytokine gene, and the risk of chronic periodontitis with conducting a meta-analysis focusing in ethnicity. A review in literature was performed in several databases to studies published before June 2017. Data extraction was performed by two calibrated investigators and the calculations of the meta-analysis were obtained through Review Manager version 5.2 statistical software with Odds Ratio (OR) calculation and Funnel plot (P < 0.05) to heterogeneity and the Comprehensive Meta-analysis version 3.3.070 to assessment publication bias by Egger's and Begg's tests. In overall, 54 case/control studies composed the meta-analysis. T allele was significantly associated with patients case (OR = 1.35, 95% CI: 1.24, 1.48, P < 0.00001) in the overall analysis. The stratified evaluation showed the rs1143634 polymorphism had significant association with disease in Caucasian, Asian and mixed population was excepted in African ethnicity (P > 0.05). No publication bias was found in allelic evaluation. This meta-analysis in 9376 participants with 54 case/control studies revealed the rs1143634 polymorphism was associated with elevated risk of chronic periodontitis in overall analysis as well as Caucasian and Asian ethnicities and Mixed population. Copyright © 2018 Elsevier B.V. All rights reserved.

MHC Class I Chain-Related Gene A Polymorphisms and Linkage Disequilibrium with HLA-B and HLA-C Alleles in Ocular Toxoplasmosis.

PubMed

Ayo, Christiane Maria; Camargo, Ana Vitória da Silveira; Frederico, Fábio Batista; Siqueira, Rubens Camargo; Previato, Mariana; Murata, Fernando Henrique Antunes; Silveira-Carvalho, Aparecida Perpétuo; Barbosa, Amanda Pires; Brandão de Mattos, Cinara de Cássia; de Mattos, Luiz Carlos

2015-01-01

This study investigated whether polymorphisms of the MICA (major histocompatibility complex class I chain-related gene A) gene are associated with eye lesions due to Toxoplasma gondii infection in a group of immunocompetent patients from southeastern Brazil. The study enrolled 297 patients with serological diagnosis of toxoplasmosis. Participants were classified into two distinct groups after conducting fundoscopic exams according to the presence (n = 148) or absence (n = 149) of ocular scars/lesions due to toxoplasmosis. The group of patients with scars/lesions was further subdivided into two groups according to the type of the ocular manifestation observed: primary (n = 120) or recurrent (n = 28). Genotyping of the MICA and HLA alleles was performed by the polymerase chain reaction-sequence specific oligonucleotide technique (PCR-SSO; One Lambda®) and the MICA-129 polymorphism (rs1051792) was identified by nested polymerase chain reaction (PCR-RFLP). Significant associations involving MICA polymorphisms were not found. Although the MICA*002~HLA-B*35 haplotype was associated with increased risk of developing ocular toxoplasmosis (P-value = 0.04; OR = 2.20; 95% CI = 1.05-4.60), and the MICA*008~HLA-C*07 haplotype was associated with protection against the development of manifestations of ocular toxoplasmosis (P-value = 0.009; OR: 0.44; 95% CI: 0.22-0.76), these associations were not statistically significant after adjusting for multiple comparisons. MICA polymorphisms do not appear to influence the development of ocular lesions in patients diagnosed with toxoplasmosis in this study population.

MHC Class I Chain-Related Gene A Polymorphisms and Linkage Disequilibrium with HLA-B and HLA-C Alleles in Ocular Toxoplasmosis

PubMed Central

Ayo, Christiane Maria; Camargo, Ana Vitória da Silveira; Frederico, Fábio Batista; Siqueira, Rubens Camargo; Previato, Mariana; Murata, Fernando Henrique Antunes; Silveira-Carvalho, Aparecida Perpétuo; Barbosa, Amanda Pires; Brandão de Mattos, Cinara de Cássia; de Mattos, Luiz Carlos

2015-01-01

This study investigated whether polymorphisms of the MICA (major histocompatibility complex class I chain-related gene A) gene are associated with eye lesions due to Toxoplasma gondii infection in a group of immunocompetent patients from southeastern Brazil. The study enrolled 297 patients with serological diagnosis of toxoplasmosis. Participants were classified into two distinct groups after conducting fundoscopic exams according to the presence (n = 148) or absence (n = 149) of ocular scars/lesions due to toxoplasmosis. The group of patients with scars/lesions was further subdivided into two groups according to the type of the ocular manifestation observed: primary (n = 120) or recurrent (n = 28). Genotyping of the MICA and HLA alleles was performed by the polymerase chain reaction-sequence specific oligonucleotide technique (PCR-SSO; One Lambda®) and the MICA-129 polymorphism (rs1051792) was identified by nested polymerase chain reaction (PCR-RFLP). Significant associations involving MICA polymorphisms were not found. Although the MICA*002~HLA-B*35 haplotype was associated with increased risk of developing ocular toxoplasmosis (P-value = 0.04; OR = 2.20; 95% CI = 1.05–4.60), and the MICA*008~HLA-C*07 haplotype was associated with protection against the development of manifestations of ocular toxoplasmosis (P-value = 0.009; OR: 0.44; 95% CI: 0.22–0.76), these associations were not statistically significant after adjusting for multiple comparisons. MICA polymorphisms do not appear to influence the development of ocular lesions in patients diagnosed with toxoplasmosis in this study population. PMID:26672749

Investigating the CFH Gene Polymorphisms as a Risk Factor for Age-related Macular Degeneration in an Iranian Population.

PubMed

Babanejad, Mojgan; Moein, Hamidreza; Akbari, Mohammad R; Badiei, Azadeh; Yaseri, Mehdi; Soheilian, Masoud; Najmabadi, Hossein

2016-06-01

Age-related macular degeneration (AMD) is a complex disorder which results in irreversible vision loss and progressive impairment of central vision. Disease susceptibility is influenced by multiple genetic and environmental factors. Single nucleotide polymorphisms (SNP) in the complement factor H gene are the most important genetic risk factors. We conducted a case-control study to investigate the association four SNPs (dbSNP ID: rs800292, rs1061170, rs2274700 and rs3753395) of CFH gene with AMD in the Iranian population. We recruited 100 AMD patients and 100 age- and sex-matched normal controls. Direct sequencing for three SNPs (rs800292, rs2274700 and rs3753395) and restriction fragment length polymorphism utilized for rs1061170. Allele and genotype frequencies of SNPs were calculated and tested for departure from Hardy-Weinberg equilibrium using the Chi-square test. An allelic and genotypic association was compared by logistic regression analysis using the SNPassoc. According to our results, the frequencies of risk allele for all SNPs (G, G, A, and C alleles of rs800292, rs2274700, rs3753395 and rs1061170, respectively) were significantly higher in AMD patients (p value < 0.001). AMD individuals who had at least one copy of the C allele of rs1061170 had an increased risk of disease compared with cases with the T allele. Other studied polymorphisms showed the same association. Our results suggest the contribution of all four predicted CFH polymorphisms in AMD susceptibility among the Iranian population. This association with CFH may lead to early detection and new strategies for prevention and treatment of AMD.

Analysis of the MdMYB1 gene sequence and development of new molecular markers related to apple skin color and fruit-bearing traits.

PubMed

Yuan, Kejun; Wang, Changjun; Wang, Jianghui; Xin, Li; Zhou, Guangfang; Li, Linguang; Shen, Guangning

2014-12-01

MdMYB1, a key transcription factor determining apple skin color, coordinately regulates genes in the anthocyanin pathway. In this study, we analyzed the MdMYB1 gene and its relationship to apple skin color and fruit-bearing traits to better understand this gene and its application to apple breeding. A previously reported MdMYB1 dCAPS marker failed to identify alleles of the MdMYB1 gene in 'Fuji', a very important apple cultivar. In this study, we revealed that the polymorphic site related to the MdMYB1 dCAPS marker is heterozygous in 'Fuji'. In addition, two new polymorphic sites related to apple skin color were identified in the MdMYB1 gene, with two new molecular markers accordingly developed. Testing of these markers in 'Fuji' and its progeny revealed that they could predict apple skin color and identify alleles of the MdMYB1 gene in this cultivar. Most interestingly, the allele MdMYB1-2 in 'Gala' apple and its hybrid plants was found to be related to the fruit-bearing trait, and the molecular marker Mb2 was able to identify the MdMYB1-2 allele. Our study is apparently the first to report a relationship between the MdMYB1 allele and the fruit-bearing trait in apple. More work is needed to determine whether and how the MdMYB1 gene or a gene linked to the MdMYB1-2 allele influences the flowering trait in perennial apple trees, and whether flowering in other plants is influenced by related genes.

Microarray study of single nucleotide polymorphisms and expression of ATP-binding cassette genes in breast tumors

NASA Astrophysics Data System (ADS)

Tsyganov, M. M.; Ibragimova, M. K.; Karabut, I. V.; Freydin, M. B.; Choinzonov, E. L.; Litvyakov, N. V.

2015-11-01

Our previous research establishes that changes of expression of the ATP-binding cassette genes family is connected with the neoadjuvant chemotherapy effect. However, the mechanism of regulation of resistance gene expression remains unclear. As many researchers believe, single nucleotide polymorphisms can be involved in this process. Thereupon, microarray analysis is used to study polymorphisms in ATP-binding cassette genes. It is thus found that MDR gene expression is connected with 5 polymorphisms, i.e. rs241432, rs241429, rs241430, rs3784867, rs59409230, which participate in the regulation of expression of own genes.

Population-based analysis of the frequency of HFE gene polymorphisms: Correlation with the susceptibility to develop hereditary hemochromatosis.

PubMed

Katsarou, Martha-Spyridoula; Latsi, Rosana; Papasavva, Maria; Demertzis, Nikolaos; Kalogridis, Thodoris; Tsatsakis, Aristides M; Spandidos, Demetrios A; Drakoulis, Nikolaos

2016-07-01

Hereditary hemochromatosis (HH) is an autosomal recessive genetic disease, characterized by increased dietary iron absorption. Due to the absence of an effective excretory mechanism, the excess iron in the body may accumulate resulting in toxic effects. The HFE gene also affects the activity of hepcidin, a hormone which acts as a negative regulator of iron metabolism. In this study, we performed a population-based analysis of the distribution of three hemochromatosis-related polymorphisms in the HFE gene (rs1800562, rs1799945 and rs1800730). DNA from 1,446 non‑related individuals of Greek ethnicity was collected and analyzed, either from whole blood or buccal swabs. The frequency distribution of these HFE gene polymorphisms was then determined. The results revealed that in our Greek population cohort (gr) the frequencies of each polymorphism were as follows: rs1800562: GG (wild‑type)=97.0%, GA=1.5%, AA=1.5%; rs1799945: CC (wild‑type)=74.4%, CG=23.4%, GG=2.2%; rs1800730: AA (wild‑type)=98.1%, AT=1.5% and TT=0.4%. No association between the HFE polymorphisms rs1800562, rs1799945 and rs1800730 and gender could be established. As regards the rs1800562 polymorphism, the A allele (mutant) was ~1.8‑fold more frequent in the European population (eur) than in the Greek population [(gr)=2,3%<(eur)=4%]. As for the rs1799945 polymorphism, the G allele (mutant) was 1.2‑fold more frequent in the European population than in the Greek population [(gr)=13,9%<(eur)=17%]. As regards the rs1800730 polymorphism, the T allele (mutant) was ~1.7‑fold more frequent in the European population than in the Greek population [(gr)=1.2%<(eur)=2%]. However, these pathogenic mutations were found more frequently in the Greek population compared to the global population (gl) [rs1800562: (gl)=1%<(gr)=2,3%; rs1799945: (gl)=7%<(gr)=13,9%; rs1800730: (gl)=<1%<(gr)=1.2%]. This suggests that the Greek population may differ genetically from the northern European population, due to influences from neighboring Asian and African populations. These findings also suggest that there is no gender-associated inheritance of these polymorphisms, and gender-specific symptoms appear as a result of independent biological processes. Thus, the early detection of the tendency towards iron accumulation may be achieved by the genotypic analysis of the polymorphisms that may contribute to the development of the hemochromatosis.

Paraoxonase 1 polymorphisms and haplotypes and the risk for having offspring affected with spina bifida in Southeast Mexico.

PubMed

Gonzalez-Herrera, Lizbeth; Martín Cerda-Flores, Ricardo; Luna-Rivero, Marianne; Canto-Herrera, Jorge; Pinto-Escalante, Doris; Perez-Herrera, Norma; Quintanilla-Vega, Betzabet

2010-11-01

Spina bifida (SB) is a common congenital malformation in Southeast Mexico. Parents of children with SB reside in areas with frequent pesticide spraying or have agriculture activities, suggesting potential exposure to pesticides. Paraoxonase 1 (PON1) is the responsible enzyme for deactivation of organophosphates (OP) in the central nervous system. Polymorphisms of PON1 genes influence the catalytic activity and plasma protein level of the enzyme, therefore, genotypic characterization of PON1 gene represents a potential predictor for susceptibility to OP-related effects. The frequency of PON1 haplotypes and polymorphisms (-108CT, L55M, and Q192R) were determined in this study. A case-control study was performed to evaluate the risk for having offspring affected by SB in 152 cases and 160 control parents. Polymorphisms were determined by PCR amplification and restriction fragment length polymorphism and Real Time-PCR. Odds ratios and confidence interval 95% were estimated. Genotype frequencies for the three PON1 polymorphisms were distributed according to Hardy-Weinberg expectations (p > 0.05) and were significantly different between cases and controls (p < 0.05). The heterozygous CT genotype of -108CT polymorphism, the RR genotype of Q192R polymorphism, both LM and MM genotypes of L55M polymorphism, and the haplotypes 221 and 222 (for -108CT, L55M, and Q192R) were associated with the risk for having a child affected by SB (p < 0.02). The heterozygous -108CT genotype was associated only maternally, whereas the heterozygous L55M genotype was relevant only in the fathers. The RR homozygous genotype was relevant both in mothers and fathers, suggesting the importance of this substrate-specific polymorphism. Results suggest that PON1 polymorphisms are relevant risk factors for having offspring affected with SB in this population from Southeast Mexico. © 2010 Wiley-Liss, Inc.

TGFB1 Functional Gene Polymorphisms (C-509T and T869C) in the Maternal Susceptibility to Pre-eclampsia in South Indian Women.

PubMed

Deepthi, Goske; Chaithri, Ponnaluri Kamakshi; Latha, Prasanna; Rani, Vital Usha; Rahman, Police Fazul; Jahan, Parveen

2015-10-01

Pre-eclampsia (PE), a pregnancy-specific vascular disorder characterized by hypertension and proteinuria, is hypothesized to be the result of inadequate placental angiogenesis with attendant systemic inflammation. The pleiotropic cytokine, Transforming Growth Factor-β1 (TGF-β1), is considered to be a key candidate gene in the molecular pathogenesis of PE by virtue of its ability to not only regulate angiogenesis and apoptosis of target cells, but also by acting as a master controller of Th1/Th2 cytokine balance and production of the anti-inflammatory peripheral regulatory T cells (FOXP3+ Tregs). Based on this presumption, we screened a total of 469 pregnant women from South India that include 239 patients with PE and 230 healthy controls for the two functional polymorphisms of TGFB1 gene (C-509T and T869C). The genotype frequencies of these two polymorphisms differed significantly between the PE and control groups (P = 0.01 and P = 0.002, for the TGFB1 C-509T and T869C polymorphisms, respectively). Under the over-dominant model, the CT genotype of the TGFB1 C509T polymorphism showed a high protective effect (P = 3e-04), while the TT genotype of the same variant appeared to be the predisposing genotype (P = 0.003). The T-T and C-C haplotypes were found to be the risk haplotypes blocks towards PE (OR = 4.72; P = 0.031, OR = 5.39; P = 0.03), respectively. Strong linkage disequilibrium was seen between the two polymorphisms. Our investigations revealed a significant influence of TGFB1 C-509T and T869C polymorphisms on the PE risk in South Indian women. The study represents one of the first of its kind from the Indian subcontinent. © 2015 The Foundation for the Scandinavian Journal of Immunology.

The Role of Genetic Polymorphisms as Related to One-Carbon Metabolism, Vitamin B6, and Gene-Nutrient Interactions in Maintaining Genomic Stability and Cell Viability in Chinese Breast Cancer Patients.

PubMed

Wu, Xiayu; Xu, Weijiang; Zhou, Tao; Cao, Neng; Ni, Juan; Zou, Tianning; Liang, Ziqing; Wang, Xu; Fenech, Michael

2016-06-24

Folate-mediated one-carbon metabolism (FMOCM) is linked to DNA synthesis, methylation, and cell proliferation. Vitamin B6 (B6) is a cofactor, and genetic polymorphisms of related key enzymes, such as serine hydroxymethyltransferase (SHMT), methionine synthase reductase (MTRR), and methionine synthase (MS), in FMOCM may govern the bioavailability of metabolites and play important roles in the maintenance of genomic stability and cell viability (GSACV). To evaluate the influences of B6, genetic polymorphisms of these enzymes, and gene-nutrient interactions on GSACV, we utilized the cytokinesis-block micronucleus assay (CBMN) and PCR-restriction fragment length polymorphism (PCR-RFLP) techniques in the lymphocytes from female breast cancer cases and controls. GSACV showed a significantly positive correlation with B6 concentration, and 48 nmol/L of B6 was the most suitable concentration for maintaining GSACV in vitro. The GSACV indexes showed significantly different sensitivity to B6 deficiency between cases and controls; the B6 effect on the GSACV variance contribution of each index was significantly higher than that of genetic polymorphisms and the sample state (tumor state). SHMT C1420T mutations may reduce breast cancer susceptibility, whereas MTRR A66G and MS A2756G mutations may increase breast cancer susceptibility. The role of SHMT, MS, and MTRR genotype polymorphisms in GSACV is reduced compared with that of B6. The results appear to suggest that the long-term lack of B6 under these conditions may increase genetic damage and cell injury and that individuals with various genotypes have different sensitivities to B6 deficiency. FMOCM metabolic enzyme gene polymorphism may be related to breast cancer susceptibility to a certain extent due to the effect of other factors such as stress, hormones, cancer therapies, psychological conditions, and diet. Adequate B6 intake may be good for maintaining genome health and preventing breast cancer.

A Study of the Impact of Death Receptor 4 (DR4) Gene Polymorphisms in Alzheimer's Disease.

PubMed

Edgünlü, Tuba Gökdoğan; Ozge, Aynur; Yalın, Osman Özgür; Kul, Seval; Erdal, Mehmet Emin

2013-09-01

Excessive apoptosis is believed to play a role in many degenerative and non-degenerative neurological diseases including Alzheimer's disease (AD). Much recent data suggest that apoptotic mechanisms may represent the missing link between Aβ deposition and proteolysis of tau protein. However, there is emerging evidence that apoptotic mechanisms may play a role in Alzheimer's Disease pathogenesis in the absence of overt apoptosis. TNF-related apoptosis inducing ligand receptor 1 (Death Receptor 4, DR4) might impair the apoptotic signal transduction and lead to dysregulation of the homeostasis between cell survival and cell death. The aim of our study was to further investigate the relationship between genetic variants of DR4 and Alzheimer's Disease. Case control study. Sixty-eight patients with AD were included in the study. The control group comprised 72 subjects without signs of neurodegenerative diseases, as evidenced by the examination.DNA was extracted from whole blood using the salting-out procedure. Genotypes were identified by restriction fragment length polymorphism analysis of polymerase chain reaction (PCR-RFLP) products. We observed significant differences in the genotypic distribution of the rs6557634 polymorphism in AD patients compared with controls (p<0.05); our data suggest that the GA genotype in rs6557634 could be protective against AD (p<0.05). However, there were no significant differences between AD patients and control groups in terms of the DR4 rs20575 polymorphism (p>0.05) and the DR4 rs20576 polymorphism (p>0.05). According to haplotype analysis of the DR4 gene for rs6557634, rs20575 and rs20576 polymorphisms, GCA and GCC haplotypes might be a risk factor for AD. Also, we have shown that ACA, GGC and GGA haplotypes might be protective factors against AD. The present results indicate for the first time the possible contribution of the DR4 gene rs6557634, rs20575, rs20576 polymorphisms in Alzheimer's Disease, which may influence susceptibility to Alzheimer's Disease.

A meta-analysis of eNOS and ACE gene polymorphisms and risk of pre-eclampsia in women.

PubMed

Shaik, A P; Sultana, A; Bammidi, V K; Sampathirao, K; Jamil, K

2011-10-01

A meta-analyses of endothelial nitric oxide synthase (eNOS) and angiotensin-converting enzyme (ACE) gene polymorphisms in pre-eclampsia was performed. We shortlisted 33 studies (17 for ACE; 16 for eNOS gene polymorphisms), of which 29 articles (16 for ACE and 15 for eNOS) were analysed. Overall, 1,620 cases with pre-eclampsia and 2,158 controls were analysed for intron 16 insertion-deletion polymorphism in ACE gene. A total of 1,610 subjects with pre-eclampsia and 2,875 controls were analysed for the Glu298Asp in eNOS gene. Overall, the random-effects odds ratio (OR) with Glu298Asp in eNOS gene was 0.958 (95% confidence intervals, CI 0.747-1.228, p > 0.05), and for the insertion-deletion/ACE polymorphism was 0.987 (95% CI 0.698-1.395, p > 0.05). Significant heterogeneity was observed in the studies that evaluated polymorphisms in ACE (Q value = 55.6; I(2) = 73; p value = 0.000); and eNOS (Q value = 37.2; I(2) = 62.4; p value = 0.001) polymorphisms. No significant risk of pre-eclampsia was observed in both eNOS and ACE genes with these polymorphisms.

Neurological toxicity after phenytoin infusion in a pediatric patient with epilepsy: influence of CYP2C9, CYP2C19 and ABCB1 genetic polymorphisms.

PubMed

Dorado, P; López-Torres, E; Peñas-Lledó, E M; Martínez-Antón, J; Llerena, A

2013-08-01

Pharmacogenetic studies have shown that genetic defects in drug-metabolizing enzymes encoded by CYP2C9, CYP2C19 genes and by the transporter ABCB1 gene can influence phenytoin (PTH) plasma levels and toxicity. The patient reported here is a 2-year-old girl with a medical history of cryptogenic (probably symptomatic) epilepsy, who had her first focal seizure with secondary generalization at 13 months of age. She initially received oral valproate treatment and three months later, she was prescribed an oral oxcarbazepine treatment. At 20 months of age, she was admitted to the Emergency Department because of generalized convulsive Status Epilepticus needing to be immediately treated with rectal diazepam (0.5 mg kg(-1)), intravenous diazepam (0.3 mg kg(-1)), and intravenous phenytoin with an initial-loading dose of 15 mg kg(-1). However, two hours after the initial-loading dose of PTH, the patient developed dizziness, nystagmus, ataxia and excessive sedation. Other potential causes of PTH toxicity were excluded such as drug interactions, decreased albumin or lab error. Therefore, to explain the neurological toxicity, PTH plasma levels and CYP2C9, CYP2C19 and ABCB1 genetic polymorphisms were analyzed. Initial plasma PTH levels were higher than expected (69 mg l(-1); normal range: 10-20 mg l(-1)), and the patient was homozygous for the CYP2C9*2 allele, heterozygous for the CYP2C19*4 allele and homozygous for the 3435C and 1236C ABCB1 alleles. Present findings support the previously established relationship between CYP2C9 and CYP2C19 genetic polymorphisms and the increased risk to develop PTH toxicity owing to high plasma concentrations. Nevertheless, although the association of these genes with PTH-induced adverse effects has been well-documented in adult populations, this is the first report examining the influence of these genetic polymorphisms on PTH plasma levels and toxicity in a pediatric patient.

Folate and Breast Cancer: Role of Intake, Blood Levels, and Metabolic Gene Polymorphisms

DTIC Science & Technology

2005-07-01

folate, and metabolic gene polymorphisms in relation to breast cancer risk: Months 1-19. b. Prepare blood samples for relevant assays: Months 1-19... gene polymorphism assays among the 184 cases and matched controls. The folate assays are on-going at this time. DNA assays will commence in the... methotrexate . Ann Oncol 13: 1915–1918, 2002 13. Toffoli G, Veronesi A, Boiocchi M, Crivellari D: MTHFR gene polymorphism and severe toxicity during

Polymorphisms of three genes (ACE, AGT and CYP11B2) in the renin-angiotensin-aldosterone system are not associated with blood pressure salt sensitivity: A systematic meta-analysis.

PubMed

Sun, Jiahong; Zhao, Min; Miao, Song; Xi, Bo

2016-01-01

Many studies have suggested that polymorphisms of three key genes (ACE, AGT and CYP11B2) in the renin-angiotensin-aldosterone system (RAAS) play important roles in the development of blood pressure (BP) salt sensitivity, but they have revealed inconsistent results. Thus, we performed a meta-analysis to clarify the association. PubMed and Embase databases were searched for eligible published articles. Fixed- or random-effect models were used to pool odds ratios and 95% confidence intervals based on whether there was significant heterogeneity between studies. In total, seven studies [237 salt-sensitive (SS) cases and 251 salt-resistant (SR) controls] for ACE gene I/D polymorphism, three studies (130 SS cases and 221 SR controls) for AGT gene M235T polymorphism and three studies (113 SS cases and 218 SR controls) for CYP11B2 gene C344T polymorphism were included in this meta-analysis. The results showed that there was no significant association between polymorphisms of these three polymorphisms in the RAAS and BP salt sensitivity under three genetic models (all p > 0.05). The meta-analysis suggested that three polymorphisms (ACE gene I/D, AGT gene M235T, CYP11B2 gene C344T) in the RAAS have no significant effect on BP salt sensitivity.

Oxytocin Receptor Gene Polymorphisms Are Associated with Human Directed Social Behavior in Dogs (Canis familiaris)

PubMed Central

Lakatos, Gabriella; Pergel, Enikő; Turcsán, Borbála; Pluijmakers, Jolanda; Vas, Judit; Elek, Zsuzsanna; Brúder, Ildikó; Földi, Levente; Sasvári-Székely, Mária; Miklósi, Ádám; Rónai, Zsolt; Kubinyi, Enikő

2014-01-01

The oxytocin system has a crucial role in human sociality; several results prove that polymorphisms of the oxytocin receptor gene are related to complex social behaviors in humans. Dogs' parallel evolution with humans and their adaptation to the human environment has made them a useful species to model human social interactions. Previous research indicates that dogs are eligible models for behavioral genetic research, as well. Based on these previous findings, our research investigated associations between human directed social behaviors and two newly described (−212AG, 19131AG) and one known (rs8679684) single nucleotide polymorphisms (SNPs) in the regulatory regions (5′ and 3′ UTR) of the oxytocin receptor gene in German Shepherd (N = 104) and Border Collie (N = 103) dogs. Dogs' behavior traits have been estimated in a newly developed test series consisting of five episodes: Greeting by a stranger, Separation from the owner, Problem solving, Threatening approach, Hiding of the owner. Buccal samples were collected and DNA was isolated using standard protocols. SNPs in the 3′ and 5′ UTR regions were analyzed by polymerase chain reaction based techniques followed by subsequent electrophoresis analysis. The gene–behavior association analysis suggests that oxytocin receptor gene polymorphisms have an impact in both breeds on (i) proximity seeking towards an unfamiliar person, as well as their owner, and on (ii) how friendly dogs behave towards strangers, although the mediating molecular regulatory mechanisms are yet unknown. Based on these results, we conclude that similarly to humans, the social behavior of dogs towards humans is influenced by the oxytocin system. PMID:24454713

Influence of matrix metalloproteinase gene polymorphisms in healthy North Indians compared to variations in other ethnic groups worldwide.

PubMed

Srivastava, Priyanka; Kapoor, Rakesh; Mittal, Rama Devi

2009-01-01

Matrix metalloproteinases have a range of biological functions, including the liberation of cytokines and membrane-bound receptors, with roles in promotion of tumor invasion and angiogenesis. Several polymorphisms in MMPs have been implicated in the development of cancer as well as other diseases. Since their frequency distributions in the general North Indian population is not known the present study was conducted with the focus on MMP-1(-519) Aandgt; G, MMP-1(-1607) 1Gandgt; 2G, and MMP-7(-181) Aandgt; G gene polymorphisms. PCR-based analysis was conducted for 200 normal healthy individuals of similar ethnicity. Allelic frequencies in wild type of MMP-1(-519) Aandgt; G were 71.2% A; MMP-1(-1607) 1Gandgt; 2G 48.2% 1G; MMP-7(-181) Aandgt; G 60.7% A. The variant allele frequencies were 29% A in MMP-1(-519) Aandgt; G; 52% 2G in MMP-1(-1607) 1Gandgt; 2G; and 39.3% G in MMP-7(-181) Aandgt; G respectively. We further compared frequency distribution for these genes with various published studies in different ethnicity globally. Our results suggest that frequency in these MMP genes exhibit distinctive patterns in India that could perhaps be attributed to ethnic variation. This study is important as it can form a baseline for screening individuals who are at high risk when exposed to environmental carcinogens. More emphasis is needed on evaluating polymorphisms, alone or in combination, as modifiers of risk from relevant environmental/lifestyle exposures.

4G/5G Polymorphism of the plasminogen activator inhibitor-1 gene is associated with multiple organ dysfunction in critically ill patients.

PubMed

Huq, Muhammad Aminul; Takeyama, Naoshi; Harada, Makoto; Miki, Yasuo; Takeuchi, Akinori; Inoue, Sousuke; Nakagawa, Takashi; Kanou, Hideki; Hirakawa, Akihiko; Noguchi, Hiroshi

2012-01-01

Impaired fibrinolysis is associated with a higher incidence of both multiple organ dysfunction and mortality in the intensive care unit (ICU). Plasminogen activator inhibitor (PAI)-1 is the chief inhibitor of fibrinolysis. We investigated the influence of the 4G/5G polymorphism (rs1799768) of the PAI-1 gene on the plasma PAI-1 level and the outcome of critically ill patients. In 41 consecutive patients admitted to the ICU, PAI-1 gene polymorphism was assessed, plasma PAI-1 and arterial lactate concentrations were measured and clinical severity scores were recorded. Homozygotes for the 4G allele had higher plasma levels of PAI-1 antigen. The mean ± SD PAI-1 antigen level was 193.31 ± 167.93 ng/ml for the 4G/4G genotype, 100.67 ± 114.16 ng/ml for the 4G/5G genotype and 0.43 ± 0.53 ng/ml for the 5G/5G genotype. There was a significant correlation between plasma PAI-1 and arterial lactate concentrations, as well as between PAI-1 and severity scores. The mortality rate was 63, 33 and 0% for patients with the 4G/4G, 4G/5G and 5G/5G genotypes, respectively. These results demonstrate that the 4G/5G polymorphism of the PAI-1 gene affects the plasma PAI-1 concentration, which could impair fibrinolysis and cause organ failure, and thus the presence of the 4G allele increases the risk of death. Copyright © 2011 S. Karger AG, Basel.

HOTAIR gene polymorphisms contribute to increased neuroblastoma susceptibility in Chinese children.

PubMed

Yang, Xu; He, Jing; Chang, Yitian; Luo, Annie; Luo, Ailing; Zhang, Jiao; Zhang, Ruizhong; Xia, Huimin; Xu, Ling

2018-06-15

Neuroblastoma is the most frequently diagnosed extracranial solid tumor in children. Previous studies have shown that single-nucleotide polymorphisms in some genes are associated with the risk of multiple cancers, including neuroblastoma. Although Hox transcript antisense intergenic RNA (HOTAIR) gene polymorphisms have been investigated in a variety of cancers, to the authors' knowledge the relationships between HOTAIR gene polymorphisms and neuroblastoma susceptibility have not been reported to date. The objective of the current study was to evaluate the correlation between HOTAIR gene polymorphisms and neuroblastoma risk in Chinese children. The authors genotyped 6 polymorphisms (rs920778 A>G, rs12826786 C>T, rs4759314 A>G, rs7958904 G>C, rs874945 C>T, and rs1899663 C>A) of the HOTAIR gene in 2 Chinese populations including 393 neuroblastoma cases and 812 healthy controls. The strength of the associations was evaluated using odds ratios and 95% confidence intervals. Further stratification analyses were conducted to explore the association between the HOTAIR gene polymorphisms rs12826786 C>T, rs874945 C>T, and rs1899663 C>A with neuroblastoma susceptibility in terms of age, sex, clinical stage of disease, and sites of origin. The authors found that the rs12826786 C>T (P =.013), rs874945 C>T (P =.020), and rs1899663 C>A (P =.029) polymorphisms were significantly associated with increased neuroblastoma risk. In stratification analyses, these associations were more predominant in females and among patients with tumor in the retroperitoneal region or mediastinum. The remaining 3 polymorphisms were not found to be related to neuroblastoma susceptibility. The results of the current study verified that HOTAIR gene polymorphisms are associated with increased neuroblastoma risk and suggest that HOTAIR gene polymorphisms might be a potential biomarker for neuroblastoma susceptibility. Cancer 2018;124:2599-606. © 2018 American Cancer Society. © 2018 American Cancer Society.

In silico screening of the chicken genome for overlaps between genomic regions: microRNA genes, coding and non-coding transcriptional units, QTL, and genetic variations.

PubMed

Zorc, Minja; Kunej, Tanja

2016-05-01

MicroRNAs (miRNAs) are a class of non-coding RNAs involved in posttranscriptional regulation of target genes. Regulation requires complementarity between target mRNA and the mature miRNA seed region, responsible for their recognition and binding. It has been estimated that each miRNA targets approximately 200 genes, and genetic variability of miRNA genes has been reported to affect phenotypic variability and disease susceptibility in humans, livestock species, and model organisms. Polymorphisms in miRNA genes could therefore represent biomarkers for phenotypic traits in livestock animals. In our previous study, we collected polymorphisms within miRNA genes in chicken. In the present study, we identified miRNA-related genomic overlaps to prioritize genomic regions of interest for further functional studies and biomarker discovery. Overlapping genomic regions in chicken were analyzed using the following bioinformatics tools and databases: miRNA SNiPer, Ensembl, miRBase, NCBI Blast, and QTLdb. Out of 740 known pre-miRNA genes, 263 (35.5 %) contain polymorphisms; among them, 35 contain more than three polymorphisms The most polymorphic miRNA genes in chicken are gga-miR-6662, containing 23 single nucleotide polymorphisms (SNPs) within the pre-miRNA region, including five consecutive SNPs, and gga-miR-6688, containing ten polymorphisms including three consecutive polymorphisms. Several miRNA-related genomic hotspots have been revealed in chicken genome; polymorphic miRNA genes are located within protein-coding and/or non-coding transcription units and quantitative trait loci (QTL) associated with production traits. The present study includes the first description of an exonic miRNA in a chicken genome, an overlap between the miRNA gene and the exon of the protein-coding gene (gga-miR-6578/HADHB), and the first report of a missense polymorphism located within a mature miRNA seed region. Identified miRNA-related genomic hotspots in chicken can serve researchers as a starting point for further functional studies and association studies with poultry production and health traits and the basis for systematic screening of exonic miRNAs and missense/miRNA seed polymorphisms in other genomes.

Association of ACE Gene I/D polymorphism with migraine in Kashmiri population.

PubMed

Wani, Irfan Yousuf; Sheikh, Saleem; Shah, Zafar Amin; Pandith, Arshid A; Wani, Mushtaq; Asimi, Ravouf; Wani, Maqbool; Sheikh, Shahnawaz; Mehraj, Iqra

2016-01-01

Migraine is a complex, recurrent headache disorder that is one of the most common complaints in neurology practice. The role of various genes in its pathogenesis is being studied. We did this study to see whether an association exists between ACE gene I/D polymorphism and migraine in our region. The study included 100 patients diagnosed with migraine and 121 healthy controls. The study subject were age and gender matched. The analysis was based on Polymerase Chain Reaction (PCR) and included following steps: DNA extraction from blood, PCR and Restriction Fragment Length Polymorphism (RFLP). Out of 100 cases, 69 were females and 31 were males. Fifty-seven were having migraine without aura and 43 had migraine with aura. 45 of the cases had II polymorphism, 40 had ID polymorphism and 15 had DD polymorphism in ACE gene. We were not able to find a statistically significant association between ACE gene I/D polymorphism with migraine. The reason for difference in results between our study and other studies could be because of different ethnicity in study populations. So a continuous research is needed in this regard in order to find the genes and different polymorphism that increase the susceptibility of Kashmiri population to migraine.

The 116G > A MSH6 and IVS1-1121C > T PMS2 Genes Polymorphisms Modulate the Risk of the Sporadic Colorectal Cancer Development in Polish Population.

PubMed

Zelga, Piotr; Przybyłowska-Sygut, Karolina; Zelga, Marta; Dziki, Adam; Majsterek, Ireneusz

2018-04-01

Colorectal cancer (CRC) is one of the most common cancers worldwide. DNA mismatch repair (MMR) is an evolutionarily conserved process that corrects mismatches generated during DNA replication. MMR defects were found to be associated with hereditary non-polyposis colorectal cancer (HNPCC) and a subset of sporadic colon cancers. The inheritance of common variations in MMR genes may influences individual susceptibility to the development of colorectal cancer. The purpose of the study was to evaluate the association between gene polymorphisms Glu39Gly (c.116G > A) of MSH6 gene and IVS1-1121C > T of PMS2 gene and sporadic colorectal cancer risk, in a case-control study comprising 200 patients and 200 controls origination from polish population. DNA was isolated from peripheral blood lymphocytes of enrolled patients, and gene polymorphisms were analysed by restriction fragment length polymorphism-polymerase chain reaction (RFLP-PCR) for MSH6 and TaqMan for PMS2. G/A variant of Glu39Gly (c.116G > A) genotype was associated with an increased risk of colorectal cancer (OR 1,65 95%CI:1,01-2,69 p = 0.44). Presence of A allele was also significantly higher in patient with CRC (OR 1,57 95% CI: 1,04-2,38 p = 0.032). Prevalence of this genotype was also markedly higher in females and patients above 60 years in CRC group (OR 2.25 95%CI: 1.22-4.14 p = 0.0098 and OR 2.74 95% CI: 1.27-5.93 p = 0.0097 respectively). None of such correlations was observed for genotype variants of IVS1-1121C > T PMS2. In conclusion, our data suggests thatMSH6 Glu39Gly polymorphism is associated with the risk of developing sporadic colorectal cancer in polish population. Linkage to the female gender, onset above 60 years old and further increase of risk when combined with wild-type allele of PMS2 IVS1-1121C > T polymorphism indicates defective mismatch repair system.

Genomic polymorphism, recombination, and linkage disequilibrium in human major histocompatibility complex-encoded antigen-processing genes.

PubMed Central

van Endert, P M; Lopez, M T; Patel, S D; Monaco, J J; McDevitt, H O

1992-01-01

Recently, two subunits of a large cytosolic protease and two putative peptide transporter proteins were found to be encoded by genes within the class II region of the major histocompatibility complex (MHC). These genes have been suggested to be involved in the processing of antigenic proteins for presentation by MHC class I molecules. Because of the high degree of polymorphism in MHC genes, and previous evidence for both functional and polypeptide sequence polymorphism in the proteins encoded by the antigen-processing genes, we tested DNA from 27 consanguineous human cell lines for genomic polymorphism by restriction fragment length polymorphism (RFLP) analysis. These studies demonstrate a strong linkage disequilibrium between TAP1 and LMP2 RFLPs. Moreover, RFLPs, as well as a polymorphic stop codon in the telomeric TAP2 gene, appear to be in linkage disequilibrium with HLA-DR alleles and RFLPs in the HLA-DO gene. A high rate of recombination, however, seems to occur in the center of the complex, between the TAP1 and TAP2 genes. Images PMID:1360671

The Paraoxonase 1 Gene c.-108C>T SNP in the Promoter Is Associated with Risk for Glioma in Mexican Patients, but Not the p.L55M or p.Q192R Polymorphisms in the Coding Region.

PubMed

González-Herrera, Lizbeth; Gamas-Trujillo, Pablo Alejandro; Medina-Escobedo, Gilberto; Oaxaca-Castillo, David; Pérez-Mendoza, Gerardo; Williams-Jacquez, Dayana; Canto-Cetina, Thelma; Vargas-García, Rubén Darío

2015-09-01

To evaluate the association of the paraoxonase 1 (PON1) gene polymorphisms c.-108C>T, p.L55M, and p.Q192R with the risk of glioma in Southeast Mexico. Decreased PON1 activity caused by polymorphisms has been observed in gliomas, thus supporting the theory that PON1 is involved in tumorigenesis in the brain. Sixty-seven glioma patients and 58 control individuals were included. Three PON1 polymorphisms were genotyped by real-time PCR allelic discrimination using TaqMan probes: c.-108C>T in the promoter region, p.Q192R and p.L55M, both of which were in the coding region. Allele, genotype, and haplotype frequencies were assessed in cases and controls to test for statistical associations (STATA 10.2 package). Significant differences were found for the PON1 c.-108C>T polymorphism between the cases and controls. Compared to the controls the cases were more likely to be CT heterozygous (p =  0.002) or TT homozygous (p = 0.036); similarly cases were more likely to possess a T allele (p = 0.032). In contrast, the p.L55M and p.Q192R polymorphisms did not show significant differences between the glioma cases and controls (p > 0.05). The PON1 c.-108C>T polymorphism in the promoter region is associated with genetic risk for glioma. Conversely, p.L55M and p.Q192R polymorphisms in the coding region do not seem to have an influence in this population.

In the nose of the beholder: are olfactory influences on human mate choice driven by variation in immune system genes or sex hormone levels?

PubMed

Roberts, Thomas; Roiser, Jonathan P

2010-11-01

The human leukocyte antigen (HLA) is the most polymorphic region of the genome, coding for proteins that mediate human immune response. This polymorphism may be maintained by balancing selection and certain populations show deviations from expected gene frequencies. Supporting this hypothesis, studies into olfactory preferences have suggested that females prefer the scent of males with dissimilar HLA to their own. However, it has also been proposed that androstenones play a role in female mate choice, and as these molecules inhibit the immune system, this has implications for the theory of HLA-driven mate preference. This review will critically analyze the findings of studies investigating olfactory preference in humans, and their implications for these two contrasting theories of mate choice.

Association between a polymorphism in the IL-12p40 gene and cytomegalovirus reactivation after kidney transplantation.

PubMed

Hoffmann, Thomas W; Halimi, Jean-Michel; Büchler, Mathias; Velge-Roussel, Florence; Goudeau, Alain; Al Najjar, Azmi; Boulanger, Marie-Denise; Houssaini, Tarik Sqalli; Marliere, Jean-Frédéric; Lebranchu, Yvon; Baron, Christophe

2008-05-27

Cytomegalovirus (CMV) infection is associated with a significant rate of morbidity after organ transplantation. The genetic factors influencing its occurrence have been little investigated. IL-12 plays a crucial role in anti-infectious immune responses, especially by stimulating IFNgamma production. An A-to-C single nucleotide polymorphism (SNP) within the 3'-untranslated region of the IL-12p40 gene has been characterized and was reported to be both functionally and clinically relevant. However, the impact of this single nucleotide polymorphism on events after organ transplantation has never been reported. In this study, we investigated the impact of the 3'-untranslated region polymorphism on the occurrence of CMV infection in 469 kidney recipients transplanted at the University Hospital of Tours between 1995 and 2005. The polymorphism was genotyped using the restriction fragment length polymorphism method and CMV infection was determined by pp65 antigenemia. Multifactorial Cox regression analysis demonstrated that the presence of the C allele was an independent risk factor for CMV infection (OR=1.52, P=0.043), the risk being even higher when study was restricted to patients with positive CMV serological status before the graft and who did not receive any CMV prophylaxis (OR=1.88, P=0.028). This study identified a new genetic risk factor for CMV reactivation after kidney transplantation. The results of our study suggest that C carriers might especially benefit from CMV prophylaxis.

Polymorphisms of methylenetetrahydrofolate reductase (MTHFR) and susceptibility to pediatric acute lymphoblastic leukemia in a German study population.

PubMed

Schnakenberg, Eckart; Mehles, Andrea; Cario, Gunnar; Rehe, Klaus; Seidemann, Kathrin; Schlegelberger, Brigitte; Elsner, Holger A; Welte, Karl H; Schrappe, Martin; Stanulla, Martin

2005-05-27

Methylenetetrahydrofolate reductase (MTHFR) has a major impact on the regulation of the folic acid pathway due to conversion of 5,10-methylenetetrahydrofolate (methylene-THF) to 5-methyl-THF. Two common polymorphisms (677C>T and 1298A>C) in the gene coding for MTHFR have been shown to reduce MTHFR enzyme activity and were associated with the susceptibility to different disorders, including vascular disease, neural tube defects and lymphoid malignancies. Studies on the role of these polymorphisms in the susceptibility to acute lymphoblastic leukemia (ALL) led to discrepant results. We retrospectively evaluated the association of the MTHFR 677C>T and 1298A>C polymorphisms with pediatric ALL by genotyping a study sample of 443 ALL patients consecutively enrolled onto the German multicenter trial ALL-BFM 2000 and 379 healthy controls. We calculated odds ratios of MTHFR genotypes based on the MTHFR 677C>T and 1298A>C polymorphisms to examine if one or both of these polymorphisms are associated with pediatric ALL. No significant associations between specific MTHFR variants or combinations of variants and risk of ALL were observed neither in the total patient group nor in analyses stratified by gender, age at diagnosis, DNA index, immunophenotype, or TEL/AML1 rearrangement. Our findings suggest that the MTHFR 677C>T and 1298A>C gene variants do not have a major influence on the susceptibility to pediatric ALL in the German population.

Polymorphisms of methylenetetrahydrofolate reductase (MTHFR) and susceptibility to pediatric acute lymphoblastic leukemia in a German study population

PubMed Central

Schnakenberg, Eckart; Mehles, Andrea; Cario, Gunnar; Rehe, Klaus; Seidemann, Kathrin; Schlegelberger, Brigitte; Elsner, Holger A; Welte, Karl H; Schrappe, Martin; Stanulla, Martin

2005-01-01

Background Methylenetetrahydrofolate reductase (MTHFR) has a major impact on the regulation of the folic acid pathway due to conversion of 5,10-methylenetetrahydrofolate (methylene-THF) to 5-methyl-THF. Two common polymorphisms (677C>T and 1298A>C) in the gene coding for MTHFR have been shown to reduce MTHFR enzyme activity and were associated with the susceptibility to different disorders, including vascular disease, neural tube defects and lymphoid malignancies. Studies on the role of these polymorphisms in the susceptibility to acute lymphoblastic leukemia (ALL) led to discrepant results. Methods We retrospectively evaluated the association of the MTHFR 677C>T and 1298A>C polymorphisms with pediatric ALL by genotyping a study sample of 443 ALL patients consecutively enrolled onto the German multicenter trial ALL-BFM 2000 and 379 healthy controls. We calculated odds ratios of MTHFR genotypes based on the MTHFR 677C>T and 1298A>C polymorphisms to examine if one or both of these polymorphisms are associated with pediatric ALL. Results No significant associations between specific MTHFR variants or combinations of variants and risk of ALL were observed neither in the total patient group nor in analyses stratified by gender, age at diagnosis, DNA index, immunophenotype, or TEL/AML1 rearrangement. Conclusion Our findings suggest that the MTHFR 677C>T and 1298A>C gene variants do not have a major influence on the susceptibility to pediatric ALL in the German population. PMID:15921520

Genetic polymorphism of interleukin-6 influences susceptibility to HBV-related hepatocellular carcinoma in a male Chinese Han population.

PubMed

Tang, Shengli; Yuan, Yufeng; He, Yueming; Pan, Dingyu; Zhang, Yongxi; Liu, Yuanyuan; Liu, Quanyan; Zhang, Zhonglin; Liu, Zhisu

2014-04-01

As a multifunctional cytokine, interleukin-6 (IL-6) plays a key role in chronic inflammation as well as tumor growth and progression of hepatitis B virus (HBV) infection. Recent studies have implicated that single nucleotide polymorphism (SNP) -572C>G (rs1800796) located within the promoter region of IL-6 gene was associated with susceptibility to several diseases. Here, a case-control study was undertaken to investigate the association between this polymorphism and HBV-related hepatocellular carcinoma (HCC) susceptibility in a Chinese Han population. A total of 900 patients with chronic HBV infection, including 505 HBV-related HCC patients and 395 HBV infected patients without HCC were enrolled, and rs1800796 polymorphism was genotyped by the TaqMan method and DNA sequencing technology. The results indicated no significant association between rs1800796 polymorphism and the risk of HBV-related HCC in all subjects; however, a significant difference was identified in male subjects. Under the dominant model, male subjects with the G allele (CG/GG) have higher susceptibility to HBV-related HCC than those with CC genotype after adjusting confounding factors (P=0.012, odds ratio [OR] 1.68, 95% confidence interval [95% CI] 1.15-2.42). Our results suggested that rs1800796 polymorphism of IL-6 gene was associated with susceptibility to HBV-related HCC in a male Chinese Han population. Copyright © 2014 American Society for Histocompatibility and Immunogenetics. Published by Elsevier Inc. All rights reserved.

The association of folate pathway and DNA repair polymorphisms with susceptibility to childhood acute lymphoblastic leukemia.

PubMed

Goričar, Katja; Erčulj, Nina; Faganel Kotnik, Barbara; Debeljak, Maruša; Hovnik, Tinka; Jazbec, Janez; Dolžan, Vita

2015-05-15

Genetic factors may play an important role in susceptibility to childhood acute lymphoblastic leukemia (ALL). The aim of our study was to evaluate the associations of genetic polymorphisms in folate pathway and DNA repair genes with susceptibility to ALL. In total, 121 children with ALL and 184 unrelated healthy controls of Slovenian origin were genotyped for 14 polymorphisms in seven genes of folate pathway, base excision repair and homologous recombination repair (TYMS, MTHFR, OGG1, XRCC1, NBN, RAD51, and XRCC3). In addition, the exon 6 of NBN was screened for the presence of mutations using denaturing high performance liquid chromatography. Twelve polymorphisms were in Hardy-Weinberg equilibrium in controls and their genotype frequencies were in agreement with those reported in other Caucasian populations. Among the investigated polymorphisms and mutations, NBN Glu185Gln significantly decreased susceptibility to B-cell ALL (p=0.037), while TYMS 3R allele decreased susceptibility to T-cell ALL (p=0.011). Moreover, significantly decreased susceptibility to ALL was observed for MTHFR TA (p=0.030) and RAD51 GTT haplotypes (p=0.016). Susceptibility to ALL increased with the increasing number of risk alleles (ptrend=0.007). We also observed significant influence of hOGG-RAD51 and NBN-RAD51 interactions on susceptibility to ALL. Our results suggest that combination of several polymorphisms in DNA repair and folate pathways may significantly affect susceptibility to childhood ALL. Copyright © 2015 Elsevier B.V. All rights reserved.

Association between melatonin receptor 1A (MTNR1A) gene single-nucleotide polymorphisms and the velvet antler yield of Sika deer.

PubMed

Yang, Fei-Fei; Huo, Li-Jun; Yang, Li-Guo; Riaz, Hasan; Xiong, Li-Rong; Chen, Jian-Guo; Zhang, Shu-Jun; Xiong, Jia-Jun

2014-01-01

Melatonin, a secretion from pineal gland is ambiguously considered as the key hormone involved in regulation of the antler cycle in Sika deer. To find out more about the roles of melatonin and its receptor gene, we carried out current study to investigate the association between polymorphisms in melatonin receptor 1A (MTNR1A) gene and the antler yield from Sika deer. A total of 251 Sika deer were analyzed in this study, of which consisted of Wusan Sika deer (n = 163) and Dongfeng Sika deer (n = 88). MTNRA gene was amplified by PCR and genotyped by Polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP). Three polymorphism loci (C518T, C629G and C635T) were detected in exon2 of MTNR1A gene. The restriction site Ecol881 was used for C518T while a C629G polymorphism locus was digested with Mval restriction endonucleases. In Wusan Sika deer the allele frequencies of C and T were 0.637 and 0.363 for C518T, Also C and G alleles in C629G locus were 0.206 and 0.794. Genotypic frequencies of allele CC, CT and TT were 33.7, 59.9 and 6.4 % respectively, It showed 1.8, 37.4 and 60.7 % for frequencies of genotypes CC, CG and GG. In Dongfeng Sika deer the allele frequencies of C and T were 0.518 and 0.482 for C518T, C and G alleles were 0.375 and 0.625 for C629G. Genotypic frequencies were 10.6, 82.4 and 7.1 % for genotypes CC, CT and TT respectively, and they were 1.1, 72.7 and 26.2 % for genotypes CC, CG and GG. Among three SNPs, only C629G showed significant association (P < 0.05) with average antler yield in Wusan Sika deer, while no SNP was significant in Dongfeng Sika deer. These preliminary results implied that the identified SNPs of MTNR1A gene might influence the antler yield in Wusan Sika deer.

Modulation of cortisol responses to the DEX/CRH test by polymorphisms of the interleukin-1beta gene in healthy adults.

PubMed

Sasayama, Daimei; Hori, Hiroaki; Iijima, Yoshimi; Teraishi, Toshiya; Hattori, Kotaro; Ota, Miho; Fujii, Takashi; Higuchi, Teruhiko; Amano, Naoji; Kunugi, Hiroshi

2011-07-05

Recently, hypothalamus-pituitary-adrenal (HPA) axis function assessed with the combined dexamethasone (DEX)/corticotropin releasing hormone (CRH) test has been shown to be associated with response to antidepressant treatment. A polymorphism (rs16944) in the interleukin-1beta (IL-1β) gene has also been reported to be associated with the medication response in depression. These findings prompted us to examine the possible association between IL-1β gene polymorphisms and HPA axis function assessed with the DEX/CRH test. DEX/CRH test was performed in 179 healthy volunteers (45 males: mean age 40.5 ± 15.8 years; 134 females: mean age 47.1 ± 13.2 years). Five tagging single nucleotide polymorphisms (SNPs) of IL-1β gene (rs2853550, rs1143634, rs1143633, rs1143630, rs16944) were selected at an r2 threshold of 0.80 with a minor allele frequency > 0.1. Genotyping was performed by the TaqMan allelic discrimination assay. A two-way factorial analysis of variance (ANOVA) was performed with the DEX/CRH test results as the dependent variable and genotype and gender as independent variables. To account for multiple testing, P values < 0.01 were considered statistically significant for associations between the genotypes and the cortisol levels. The cortisol levels after DEX administration (DST-Cortisol) showed significant associations with the genotypes of rs16944 (P = 0.00049) and rs1143633 (P = 0.0060), with no significant gender effect or genotype × gender interaction. On the other hand, cortisol levels after CRH administration (DEX/CRH-Cortisol) were affected by gender but were not significantly influenced by the genotype of the examined SNPs, with no significant genotype × gender interaction. Our results suggest that genetic variations in the IL-1β gene contribute to the HPA axis alteration assessed by DST-Cortisol in healthy subjects. On the other hand, no significant associations of the IL-1β gene polymorphisms with the DEX/CRH-Cortisol were observed. Confirmation of our findings in futures studies may add new insight into the communication between the immune system and the HPA axis.

Modulation of cortisol responses to the DEX/CRH test by polymorphisms of the interleukin-1beta gene in healthy adults

PubMed Central

2011-01-01

Background Recently, hypothalamus-pituitary-adrenal (HPA) axis function assessed with the combined dexamethasone (DEX)/corticotropin releasing hormone (CRH) test has been shown to be associated with response to antidepressant treatment. A polymorphism (rs16944) in the interleukin-1beta (IL-1β) gene has also been reported to be associated with the medication response in depression. These findings prompted us to examine the possible association between IL-1β gene polymorphisms and HPA axis function assessed with the DEX/CRH test. Methods DEX/CRH test was performed in 179 healthy volunteers (45 males: mean age 40.5 ± 15.8 years; 134 females: mean age 47.1 ± 13.2 years). Five tagging single nucleotide polymorphisms (SNPs) of IL-1β gene (rs2853550, rs1143634, rs1143633, rs1143630, rs16944) were selected at an r2 threshold of 0.80 with a minor allele frequency > 0.1. Genotyping was performed by the TaqMan allelic discrimination assay. A two-way factorial analysis of variance (ANOVA) was performed with the DEX/CRH test results as the dependent variable and genotype and gender as independent variables. To account for multiple testing, P values < 0.01 were considered statistically significant for associations between the genotypes and the cortisol levels. Results The cortisol levels after DEX administration (DST-Cortisol) showed significant associations with the genotypes of rs16944 (P = 0.00049) and rs1143633 (P = 0.0060), with no significant gender effect or genotype × gender interaction. On the other hand, cortisol levels after CRH administration (DEX/CRH-Cortisol) were affected by gender but were not significantly influenced by the genotype of the examined SNPs, with no significant genotype × gender interaction. Conclusions Our results suggest that genetic variations in the IL-1β gene contribute to the HPA axis alteration assessed by DST-Cortisol in healthy subjects. On the other hand, no significant associations of the IL-1β gene polymorphisms with the DEX/CRH-Cortisol were observed. Confirmation of our findings in futures studies may add new insight into the communication between the immune system and the HPA axis. PMID:21726461

Delimiting Allelic Imbalance of TYMS by Allele-Specific Analysis.

PubMed

Balboa-Beltrán, Emilia; Cruz, Raquel; Carracedo, Angel; Barros, Francisco

2015-07-01

Allelic imbalance of thymidylate synthase (TYMS) is attributed to polymorphisms in the 5'- and 3'-untranslated region (UTR). These polymorphisms have been related to the risk of suffering different cancers, for example leukemia, breast or gastric cancer, and response to different drugs, among which are methotrexate glutamates, stavudine, and specifically 5-fluorouracil (5-FU), as TYMS is its direct target. A vast literature has been published in relation to 5-FU, even suggesting the sole use of these polymorphisms to effectively manage 5-FU dosage. Estimates of the extent to which these polymorphisms influence in TYMS expression have in the past been based on functional analysis by luciferase assays and quantification of TYMS mRNA, but both these studies, as the association studies with cancer risk or with toxicity or response to 5-FU, are very contradictory. Regarding functional assays, the artificial genetic environment created in luciferase assay and the problems derived from quantitative polymerase chain reactions (qPCRs), for example the use of a reference gene, may have distorted the results. To avoid these sources of interference, we have analyzed the allelic imbalance of TYMS by allelic-specific analysis in peripheral blood mononuclear cells (PBMCs) from patients.Allelic imbalance in PBMCs, taken from 40 patients with suspected myeloproliferative haematological diseases, was determined by fluorescent fragment analysis (for the 3'-UTR polymorphism), Sanger sequencing and allelic-specific qPCR in multiplex (for the 5'-UTR polymorphisms).For neither the 3'- nor the 5'-UTR polymorphisms did the observed allelic imbalance exceed 1.5 fold. None of the TYMS polymorphisms is statistically associated with allelic imbalance.The results acquired allow us to deny the previously established assertion of an influence of 2 to 4 fold of the rs45445694 and rs2853542 polymorphisms in the expression of TYMS and narrow its allelic imbalance to 1.5 fold, in our population. These data circumscribe the influence of these polymorphisms in the clinical outcome of 5-FU and question their use for establishing 5-FU dosage, above all when additional genetic factors are not considered.

Effect of Aldehyde Dehydrogenase 2 Gene Polymorphism on Hemodynamics After Nitroglycerin Intervention in Northern Chinese Han Population

PubMed Central

Xia, Jia-Qi; Song, Jie; Zhang, Yi; An, Ni-Na; Ding, Lei; Zhang, Zheng

2015-01-01

Background: Nitroglycerin (NTG) is one of the few immediate treatments for acute angina. Aldehyde dehydrogenase 2 (ALDH2) is a key enzyme in the human body that facilitates the biological metabolism of NTG. The biological mechanism of NTG serves an important function in NTG efficacy. Some reports still contradict the results that the correlation between ALDH2 gene polymorphisms and NTG and its clinical efficacy is different. However, data on NTG measurement by pain relief are subjective. This study aimed to investigate the influence of ALDH2 gene polymorphism on intervention with sublingual NTG using noninvasive hemodynamic parameters of cardiac output (CO) and systemic vascular resistance (SVR) in Northern Chinese Han population. Methods: This study selected 559 patients from the Affiliated Hospital of Qingdao University. A total of 203 patients presented with coronary heart disease (CHD) and 356 had non-CHD (NCHD) cases. All patient ALDH2 genotypes (G504A) were detected and divided into two types: Wild (GG) and mutant (GA/AA). Among the CHD group, 103 were wild-type cases, and 100 were mutant-type cases. Moreover, 196 cases were wild-type, and 160 cases were mutant type among the NCHD volunteers. A noninvasive hemodynamic detector was used to monitor the CO and the SVR at the 0, 5, and 15 minute time points after medication with 0.5 mg sublingual NTG. Two CO and SVR indicators were used for a comparative analysis of all case genotypes. Results: Both CO and SVR indicators significantly differed between the wild and mutant genotypes at various time points after intervention with sublingual NTG at 5 and 15 minutes in the NCHD (F = 16.460, 15.003, P = 0.000, 0.000) and CHD groups (F = 194.482, 60.582, P = 0.000, 0.000). All CO values in the wild-type case of both NCHD and CHD groups increased, whereas those in the mutant type decreased. The CO and ΔCO differences were statistically significant (P < 0.05; P < 0.05). The SVR and ΔSVR changed between the wild- and mutant-type cases at all-time points in both NCHD and CHD groups had statistically significant differences (P < 0.05; P < 0.05). Conclusion: ALDH2 (G504A) gene polymorphism is associated with changes in noninvasive hemodynamic parameters (i.e. CO and SVR) after intervention with sublingual NTG. This gene polymorphism may influence the effect of NTG intervention on Northern Chinese Han population. PMID:25591559

- 174 G>C IL-6 polymorphism and primary iron overload in male patients.

PubMed

Tetzlaff, Walter F; Meroño, Tomás; Botta, Eliana E; Martín, Maximiliano E; Sorroche, Patricia B; Boero, Laura E; Castro, Marcelo; Frechtel, Gustavo D; Rey, Jorge; Daruich, Jorge; Cerrone, Gloria E; Brites, Fernando

2018-04-14

Primary iron overload (IO) is commonly associated with mutations in the hereditary hemochromatosis gene (HFE). Nonetheless, other genetic variants may influence the development of IO beyond HFE mutations. There is a single nucleotide polymorphism (SNP) at - 174 G>C of the interleukin (IL)-6 gene which might be associated with primary IO. Our aim was to study the association between the SNP - 174 G>C gene promoter of IL-6 and primary IO in middle-aged male patients. We studied 37 men with primary IO diagnosed by liver histology. Controls were age-matched male volunteers (n = 37). HFE mutations and the SNP - 174 G>C gene promoter of IL-6 were evaluated by PCR-RFLP. Logistic regression was used to evaluate the association between primary IO and SNP - 174 G>C gene promoter of IL-6. Patients and control subjects were in Hardy-Weinberg equilibrium for the SNP - 174 G>C gene promoter of IL-6 (p = 0.17). Significantly different genotype frequencies were observed between patients (43% CC, 43% CG, and 14% GG) and control subjects (10% CC, 41% CG, and 49% GG) (OR = 4.09, 95% CI = 2.06-8.13; p < 0.0001). The multiple logistic regression analysis showed that IO was significantly associated with CC homozygosis in the SNP - 174 G>C gene promoter of IL-6 (OR = 6.3, 95% CI = 1.9-21.4; p < 0.005) in a model adjusted by age and body mass index. In conclusion, CC homozygosis in the SNP - 174 G>C gene promoter of IL-6 can be proposed as one of the gene variants influencing iron accumulation in male adults with HFE mutations. Studies in larger cohorts are warranted.

Infraspecific DNA methylation polymorphism in cotton (Gossypium hirsutum L.).

PubMed

Keyte, Anna L; Percifield, Ryan; Liu, Bao; Wendel, Jonathan F

2006-01-01

Cytosine methylation is important in the epigenetic regulation of gene expression and development in plants and has been implicated in silencing duplicate genes after polyploid formation in several plant groups. Relatively little information exists, however, on levels and patterns of methylation polymorphism (MP) at homologous loci within species. Here we explored the levels and patterns of methylation-polymorphism diversity at CCGG sites within allotetraploid cotton, Gossypium hirsutum, using a methylation-sensitive amplified fragment length polymorphism screen and a selected set of 20 G. hirsutum accessions for which we have information on genetic polymorphism levels and relationships. Methylation and MP exist at high levels within G. hirsutum: of 150 HpaII/MspI sites surveyed, 48 were methylated at the inner cytosine (32%) and 32 of these were polymorphic (67%). Both these values are higher than comparable measures of genetic diversity using restriction fragment length polymorphisms. The high percentage of methylation-polymorphic sites and potential relationship to gene expression underscore the potential significance of MP within and among populations. We speculate that biased correlation of methylation-polymorphic sites and genes in cotton may be a consequence of polyploidy and the attendant doubling of all genes.

[Prevalence of gene polymorphisms associated with immune-dependent diseases in the populations of North Eurasia].

PubMed

Cherednichenko, A A; Trifonova, E A; Vagaitseva, K V; Bocharova, A V; Varzari, A M; Radzhabov, M O; Stepanov, V A

2015-01-01

The data on distribution of genetic diversity in gene polymorphisms associated with autoimmune and allergic diseases and with regulation of immunoglobulin E and cytokines levels in 26 populations of the Northern Eurasia is presented. Substantial correlation between the values of average expected heterozygosity by 44 gene polymorphisms with climatic and geographical factors has not been revealed. Clustering of population groups in correspondence with their geographic locations is observed. The degree of gene differentiation among populations and the selective neutrality of gene polymorphisms have been assessed. The results of our work evidence the substantial genetic diversity and differentiation of human populations by studied genes.

Pharmacogenetic study on risperidone long-acting injection: influence of cytochrome P450 2D6 and pregnane X receptor on risperidone exposure and drug-induced side-effects.

PubMed

Choong, Eva; Polari, Andrea; Kamdem, Rigobert Hervais; Gervasoni, Nicola; Spisla, Caesar; Jaquenoud Sirot, Eveline; Bickel, Graziella Giacometti; Bondolfi, Guido; Conus, Philippe; Eap, Chin B

2013-06-01

Risperidone is metabolized by polymorphic enzymes, and a large variability in plasma concentration and therapeutic response is observed. Risperidone long-acting injection (RLAI) avoids the first-pass effect, and little is known about the influence of gene polymorphisms involved in its pharmacokinetics. The influence on plasma concentrations of risperidone (RIS), its metabolite 9-hydroxy-risperidone, and on adverse effects were investigated for polymorphisms of cytochrome P450 2D6 (CYP2D6) (*3, *4, *5, *6), CYP3A (CYP3A4*1B, CYP3A4 rs4646437, CYP3A5*3, CYP3A7*1C), ABCB1 (1236C>T, 2677G>T, 3435C>T), NR1/2 coding for pregnane X receptor (rs1523130, rs2472677, rs7643645), and for CYP3A activity measured by a phenotyping test. Forty-two patients with at least 4 consecutive unchanged doses of RLAI were included in a multicenter cross-sectional study. A 55% lower dose-adjusted plasma levels of RIS were observed for CYP2D6 ultrarapid metabolizers (n = 5) as compared with CYP2D6 intermediate metabolizers (P < 0.007). NR1/2 polymorphism (rs7643645A>G) influenced RIS exposure with a 2.8-fold lower active moiety (P = 0.031) in GG compared with the AA genotype. This was confirmed in a second independent cohort (n = 16). Furthermore, high-density lipoprotein cholesterol was positively correlated with CYP3A activity (P = 0.01), and the NR1/2 (rs2472677) polymorphism was associated with different adverse effects including prolactin plasma levels adjusted for age and sex. In conclusion, our results confirmed the influence of CYP2D6 genotype on plasma levels of RIS. This is the first report on the influence of NR1/2 polymorphisms on RLAI exposure and on drug-induced adverse effects. These results should be validated in larger cohorts.

Microsatellite polymorphisms associated with human behavioural and psychological phenotypes including a gene-environment interaction.

PubMed

Bagshaw, Andrew T M; Horwood, L John; Fergusson, David M; Gemmell, Neil J; Kennedy, Martin A

2017-02-03

The genetic and environmental influences on human personality and behaviour are a complex matter of ongoing debate. Accumulating evidence indicates that short tandem repeats (STRs) in regulatory regions are good candidates to explain heritability not accessed by genome-wide association studies. We tested for associations between the genotypes of four selected repeats and 18 traits relating to personality, behaviour, cognitive ability and mental health in a well-studied longitudinal birth cohort (n = 458-589) using one way analysis of variance. The repeats were a highly conserved poly-AC microsatellite in the upstream promoter region of the T-box brain 1 (TBR1) gene and three previously studied STRs in the activating enhancer-binding protein 2-beta (AP2-β) and androgen receptor (AR) genes. Where significance was found we used multiple regression to assess the influence of confounding factors. Carriers of the shorter, most common, allele of the AR gene's GGN microsatellite polymorphism had fewer anxiety-related symptoms, which was consistent with previous studies, but in our study this was not significant following Bonferroni correction. No associations with two repeats in the AP2-β gene withstood this correction. A novel finding was that carriers of the minor allele of the TBR1 AC microsatellite were at higher risk of conduct problems in childhood at age 7-9 (p = 0.0007, which did pass Bonferroni correction). Including maternal smoking during pregnancy (MSDP) in models controlling for potentially confounding influences showed that an interaction between TBR1 genotype and MSDP was a significant predictor of conduct problems in childhood and adolescence (p < 0.001), and of self-reported criminal behaviour up to age 25 years (p ≤ 0.02). This interaction remained significant after controlling for possible confounders including maternal age at birth, socio-economic status and education, and offspring birth weight. The potential functional importance of the TBR1 gene's promoter microsatellite deserves further investigation. Our results suggest that it participates in a gene-environment interaction with MDSP and antisocial behaviour. However, previous evidence that mothers who smoke during pregnancy carry genes for antisocial behaviour suggests that epistasis may influence the interaction.

Genes for elite power and sprint performance: ACTN3 leads the way.

PubMed

Eynon, Nir; Hanson, Erik D; Lucia, Alejandro; Houweling, Peter J; Garton, Fleur; North, Kathryn N; Bishop, David J

2013-09-01

The ability of skeletal muscles to produce force at a high velocity, which is crucial for success in power and sprint performance, is strongly influenced by genetics and without the appropriate genetic make-up, an individual reduces his/her chances of becoming an exceptional power or sprinter athlete. Several genetic variants (i.e. polymorphisms) have been associated with elite power and sprint performance in the last few years and the current paradigm is that elite performance is a polygenic trait, with minor contributions of each variant to the unique athletic phenotype. The purpose of this review is to summarize the specific knowledge in the field of genetics and elite power performance, and to provide some future directions for research in this field. Of the polymorphisms associated with elite power and sprint performance, the α-actinin-3 R577X polymorphism provides the most consistent results. ACTN3 is the only gene that shows a genotype and performance association across multiple cohorts of elite power athletes, and this association is strongly supported by mechanistic data from an Actn3 knockout mouse model. The angiotensin-1 converting enzyme insertion/deletion polymorphism (ACE I/D, registered single nucleotide polymorphism [rs]4646994), angiotensinogen (AGT Met235Thr rs699), skeletal adenosine monophosphate deaminase (AMPD1) Gln(Q)12Ter(X) [also termed C34T, rs17602729], interleukin-6 (IL-6 -174 G/C, rs1800795), endothelial nitric oxide synthase 3 (NOS3 -786 T/C, rs2070744; and Glu298Asp, rs1799983), peroxisome proliferator-activated receptor-α (PPARA Intron 7 G/C, rs4253778), and mitochondrial uncoupling protein 2 (UCP2 Ala55Val, rs660339) polymorphisms have also been associated with elite power performance, but the findings are less consistent. In general, research into the genetics of athletic performance is limited by a small sample size in individual studies and the heterogeneity of study samples, often including athletes from multiple-difference sporting disciplines. In the future, large, homogeneous, strictly defined elite power athlete cohorts need to be established though multinational collaboration, so that meaningful genome-wide association studies can be performed. Such an approach would provide unbiased identification of potential genes that influence elite athletic performance.

The Role of Peroxisome Proliferator-Activated Receptors and Their Transcriptional Coactivators Gene Variations in Human Trainability: A Systematic Review

PubMed Central

Petr, Miroslav; Zajac, Adam; Maciejewska-Skrendo, Agnieszka

2018-01-01

Background: The peroxisome proliferator-activated receptors (PPARA, PPARG, PPARD) and their transcriptional coactivators’ (PPARGC1A, PPARGC1B) gene polymorphisms have been associated with muscle morphology, oxygen uptake, power output and endurance performance. The purpose of this review is to determine whether the PPARs and/or their coactivators’ polymorphisms can predict the training response to specific training stimuli. Methods: In accordance with the Preferred Reporting Items for Systematic Reviews and Meta Analyses, a literature review has been run for a combination of PPARs and physical activity key words. Results: All ten of the included studies were performed using aerobic training in general, sedentary or elderly populations from 21 to 75 years of age. The non-responders for aerobic training (VO2peak increase, slow muscle fiber increase and low-density lipoprotein decrease) are the carriers of PPARGC1A rs8192678 Ser/Ser. The negative responders for aerobic training (decrease in VO2peak) are carriers of the PPARD rs2267668 G allele. The negative responders for aerobic training (decreased glucose tolerance and insulin response) are subjects with the PPARG rs1801282 Pro/Pro genotype. The best responders to aerobic training are PPARGC1A rs8192678 Gly/Gly, PPARD rs1053049 TT, PPARD rs2267668 AA and PPARG rs1801282 Ala carriers. Conclusions: The human response for aerobic training is significantly influenced by PPARs’ gene polymorphism and their coactivators, where aerobic training can negatively influence glucose metabolism and VO2peak in some genetically-predisposed individuals. PMID:29762540

Peroxisome proliferator-activated receptor gamma (PPARG) rs1801282 C>G polymorphism is associated with cancer susceptibility in asians: an updated meta-analysis

PubMed Central

Wang, Yafeng; Chen, Yu; Jiang, Heping; Tang, Weifeng; Kang, Mingqiang; Liu, Tianyun; Guo, Zengqing; Ma, Zhiqiang

2015-01-01

Peroxisome proliferator-activated receptor gamma (PPARG) is related to inflammation and plays an important role in the development of cancer. PPARG rs1801282 C>G polymorphism might influence the risk of cancer by regulating production of PPARG gene. Hence, a comprehensive meta-analysis was conducted to explore the association of PPARG rs1801282 C>G polymorphism with cancer susceptibility. An extensive search of PubMed and Embase databases for all relevant publications was carried out. A total of 38 publications with 16,844 cancer cases and 23,736 controls for PPARG rs1801282 C>G polymorphism were recruited in our study. Our results indicated that PPARG rs1801282 C>G variants were associated with an increased cancer risk in Asian populations and gastric cancer. In summary, the findings suggest that PPARG rs1801282 C>G polymorphism may play a crucial role in malignant transformation and the development of cancer. PMID:26550180

Peroxisome proliferator-activated receptor gamma (PPARG) rs1801282 C>G polymorphism is associated with cancer susceptibility in asians: an updated meta-analysis.

PubMed

Wang, Yafeng; Chen, Yu; Jiang, Heping; Tang, Weifeng; Kang, Mingqiang; Liu, Tianyun; Guo, Zengqing; Ma, Zhiqiang

2015-01-01

Peroxisome proliferator-activated receptor gamma (PPARG) is related to inflammation and plays an important role in the development of cancer. PPARG rs1801282 C>G polymorphism might influence the risk of cancer by regulating production of PPARG gene. Hence, a comprehensive meta-analysis was conducted to explore the association of PPARG rs1801282 C>G polymorphism with cancer susceptibility. An extensive search of PubMed and Embase databases for all relevant publications was carried out. A total of 38 publications with 16,844 cancer cases and 23,736 controls for PPARG rs1801282 C>G polymorphism were recruited in our study. Our results indicated that PPARG rs1801282 C>G variants were associated with an increased cancer risk in Asian populations and gastric cancer. In summary, the findings suggest that PPARG rs1801282 C>G polymorphism may play a crucial role in malignant transformation and the development of cancer.

Identification of seven haplotypes of the caprine PrP gene at codons 127, 142, 154, 211, 222 and 240 in French Alpine and Saanen breeds and their association with classical scrapie.

PubMed

Barillet, F; Mariat, D; Amigues, Y; Faugeras, R; Caillat, H; Moazami-Goudarzi, K; Rupp, R; Babilliot, J M; Lacroux, C; Lugan, S; Schelcher, F; Chartier, C; Corbière, F; Andréoletti, O; Perrin-Chauvineau, C

2009-03-01

In sheep, susceptibility to scrapie is mainly influenced by polymorphisms of the PrP gene. In goats, there are to date few data related to scrapie susceptibility association with PrP gene polymorphisms. In this study, we first investigated PrP gene polymorphisms of the French Alpine and Saanen breeds. Based on PrP gene open reading frame sequencing of artificial insemination bucks (n=404), six encoding mutations were identified at codons 127, 142, 154, 211, 222 and 240. However, only seven haplotypes could be detected: four (GIH(154)RQS, GIRQ(211)QS, GIRRK(222)S and GIRRQP(240)) derived from the wild-type allele (G(127)I(142)R(154)R(211)Q(222)S(240)) by a single-codon mutation, and two (S(127)IRRQP(240) and GM(142)RRQP(240)) by a double-codon mutation. A case-control study was then implemented in a highly affected Alpine and Saanen breed herd (90 cases/164 controls). Mutations at codon 142 (I/M), 154 (R/H), 211 (R/Q) and 222 (Q/K) were found to induce a significant degree of protection towards natural scrapie infection. Compared with the baseline homozygote wild-type genotype I(142)R(154)R(211)Q(222)/IRRQ goats, the odds of scrapie cases in IRQ(211)Q/IRRQ and IRRK(222)/IRRQ heterozygous animals were significantly lower [odds ratio (OR)=0.133, P<0.0001; and OR=0.048, P<0.0001, respectively]. The heterozygote M(142)RRQ/IRRQ genotype was only protective (OR=0.243, P=0.0186) in goats also PP(240) homozygous at codon 240. However, mutated allele frequencies in French Alpine and Saanen breeds were low (0.5-18.5 %), which prevent us from assessing the influence of all the possible genotypes in natural exposure conditions.

Androgen receptor gene CAG repeat polymorphism independently influences recovery of male sexual function after testosterone replacement therapy in postsurgical hypogonadotropic hypogonadism.

PubMed

Tirabassi, Giacomo; Delli Muti, Nicola; Corona, Giovanni; Maggi, Mario; Balercia, Giancarlo

2014-05-01

Few and contradictory studies have evaluated the possible influence of androgen receptor (AR) gene CAG repeat polymorphism on male sexual function. In this study we evaluated the role of AR gene CAG repeat polymorphism in the recovery of sexual function after testosterone replacement therapy (TRT) in men affected by postsurgical hypogonadotropic hypogonadism, a condition which is often associated with hypopituitarism and in which the sexual benefits of TRT must be distinguished from those of pituitary-function replacement therapies. Fifteen men affected by postsurgical hypogonadotropic hypogonadism were retrospectively assessed before and after TRT. Main outcome measures included sexual parameters as assessed by the International Index of Erectile Function questionnaire, levels of pituitary dependent hormones (total testosterone, free T3, free T4, cortisol, insulin-like growth factor-1 [IGF-1], prolactin), and results of genetic analysis (AR gene CAG repeat number). Plasma concentrations of free T3, free T4, cortisol, and prolactin did not vary significantly between the two phases, while testosterone and IGF-1 increased significantly after TRT. A significant improvement in all sexual parameters studied was found. The number of CAG triplets was negatively and significantly correlated with changes in all the sexual parameters, while opposite correlations were found between changes in sexual parameters and changes in testosterone levels; no correlation of change in IGF1 with change in sexual parameters was reported. On multiple linear regression analysis, after correction for changes in testosterone, nearly all the associations between the number of CAG triplets and changes in sexual parameters were confirmed. Shorter length AR gene CAG repeat number is associated with the recovery of sexual function after TRT in postsurgical male hypogonadotropic hypogonadism, independently of the effects of concomitant pituitary-replacement therapies. © 2014 International Society for Sexual Medicine.