Molecular cloning and characterization of the promoter region of the porcine apolipoprotein E gene.
Xia, Jihan; Hu, Bingjun; Mu, Yulian; Xin, Leilei; Yang, Shulin; Li, Kui
2014-05-01
Apolipoprotein E (APOE), a component of lipoproteins plays an important role in the transport and metabolism of cholesterol, and is associated with hyperlipoproteinemia and Alzheimer's disease. In order to further understand the characterization of APOE gene, the promoter of APOE gene of Landrace pigs was analyzed in the present study. The genomic structure and amino acid sequence in pigs were analyzed and found to share high similarity in those of human but low similarity in promoter region. Real-time PCR revealed the APOE gene expression pattern of pigs in diverse tissues. The highest expression level was observed in liver, relatively low expression in other tissues, especially in stomach and muscle. Furthermore, the promoter expressing in Hepa 1-6 was significantly better at driving luciferase expression compared with C2C12 cell. After analysis of porcine APOE gene promoter regions, potential transcription factor binding sites were predicted and two GC signals, a TATA box were indicated. Results of promoter activity analysis indicated that one of potential regulatory elements was located in the region -669 to -259, which was essential for a high expression of the APOE gene. Promoter mutation and deletion analysis further suggested that the C/EBPA binding site within the APOE promoter was responsible for the regulation of APOE transcription. Electrophoretic mobility shift assays also showed the binding site of the transcription factor C/EBPA. This study advances our knowledge of the promoter of the porcine APOE gene.
Dynamic interactions between the promoter and terminator regions of the mammalian BRCA1 gene.
Tan-Wong, Sue Mei; French, Juliet D; Proudfoot, Nicholas J; Brown, Melissa A
2008-04-01
The 85-kb breast cancer-associated gene BRCA1 is an established tumor suppressor gene, but its regulation is poorly understood. We demonstrate by gene conformation analysis in both human cell lines and mouse mammary tissue that gene loops are imposed on BRCA1 between the promoter, introns, and terminator region. Significantly, association between the BRCA1 promoter and terminator regions change upon estrogen stimulation and during lactational development. Loop formation is transcription-dependent, suggesting that transcriptional elongation plays an active role in BRCA1 loop formation. We show that the BRCA1 terminator region can suppress estrogen-induced transcription and so may regulate BRCA1 expression. Significantly, BRCA1 promoter and terminator interactions vary in different breast cancer cell lines, indicating that defects in BRCA1 chromatin structure may contribute to dysregulated expression of BRCA1 seen in breast tumors.
Yang, Xiao-Hui; Feng, Shi-Ya; Yu, Yang; Liang, Zhou
2018-01-01
This study aims to explore the relationship between the methylation of matrix metalloproteinase (MMP)-9 gene promoter region and diabetic nephropathy (DN) through the detection of the methylation level of MMP-9 gene promoter region in the peripheral blood of patients with DN in different periods and serum MMP-9 concentration. The methylation level of the MMP-9 gene promoter region was detected by methylation-specific polymerase chain reaction (MSP), and the content of MMP-9 in serum was determined by enzyme-linked immunosorbent assay (ELISA). Results of the statistical analysis revealed that serum MMP-9 protein expression levels gradually increased in patients in the simple diabetic group, early diabetic nephropathy group and clinical diabetic nephropathy group, compared with the control group; and the difference was statistically significant (P < 0.05). Compared with the control group, the methylation levels of MMP-9 gene promoter regions gradually decreased in patients in the simple diabetic group, early diabetic nephropathy group, and clinical diabetic nephropathy group; and the difference was statistically significant (P < 0.05). Furthermore, correlation analysis results indicated that the demethylation levels of the MMP-9 gene promoter region was positively correlated with serum protein levels, urinary albumin to creatinine ratio (UACR), urea and creatinine; and was negatively correlated with GFR. The demethylation of the MMP-9 gene promoter region may be involved in the occurrence and development of diabetic nephropathy by regulating the expression of MMP-9 protein in serum.
Determination of the core promoter regions of the Saccharomyces cerevisiae RPS3 gene.
Joo, Yoo Jin; Kim, Jin-Ha; Baek, Joung Hee; Seong, Ki Moon; Lee, Jae Yung; Kim, Joon
2009-01-01
Ribosomal protein genes (RPG), which are scattered throughout the genomes of all eukaryotes, are subjected to coordinated expression. In yeast, the expression of RPGs is highly regulated, mainly at the transcriptional level. Recent research has found that many ribosomal proteins (RPs) function in multiple processes in addition to protein synthesis. Therefore, detailed knowledge of promoter architecture as well as gene regulation is important in understanding the multiple cellular processes mediated by RPGs. In this study, we investigated the functional architecture of the yeast RPS3 promoter and identified many putative cis-elements. Using beta-galactosidase reporter analysis and EMSA, the core promoter of RPS3 containing UASrpg and T-rich regions was corroborated. Moreover, the promoter occupancy of RPS3 by three transcription factors was confirmed. Taken together, our results further the current understanding of the promoter architecture and trans-elements of the Saccharomyces cerevisiae RPS3 gene.
Denz, Christopher R; Zhang, Chi; Jia, Pingping; Du, Jianfeng; Huang, Xupei; Dube, Syamalima; Thomas, Anish; Poiesz, Bernard J; Dube, Dipak K
2011-09-01
Tropomyosins are a family of actin-binding proteins that show cell-specific diversity by a combination of multiple genes and alternative RNA splicing. Of the 4 different tropomyosin genes, TPM4 plays a pivotal role in myofibrillogenesis as well as cardiac contractility in amphibians. In this study, we amplified and sequenced the upstream regulatory region of the TPM4 gene from both normal and mutant axolotl hearts. To identify the cis-elements that are essential for the expression of the TPM4, we created various deletion mutants of the TPM4 promoter DNA, inserted the deleted segments into PGL3 vector, and performed promoter-reporter assay using luciferase as the reporter gene. Comparison of sequences of the promoter region of the TPM4 gene from normal and mutant axolotl revealed no mutations in the promoter sequence of the mutant TPM4 gene. CArG box elements that are generally involved in controlling the expression of several other muscle-specific gene promoters were not found in the upstream regulatory region of the TPM4 gene. In deletion experiments, loss of activity of the reporter gene was noted upon deletion which was then restored upon further deletion suggesting the presence of both positive and negative cis-elements in the upstream regulatory region of the TPM4 gene. We believe that this is the first axolotl promoter that has ever been cloned and studied with clear evidence that it functions in mammalian cell lines. Although striated muscle-specific cis-acting elements are absent from the promoter region of TPM4 gene, our results suggest the presence of positive and negative cis-elements in the promoter region, which in conjunction with positive and negative trans-elements may be involved in regulating the expression of TPM4 gene in a tissue-specific manner.
Pousada, Guillermo; Baloira, Adolfo; Valverde, Diana
2016-06-01
Pulmonary arterial hypertension is characterizated by obstruction of the pulmonary arteries. The gene mainly related to pathology is the bone morphogenetic protein receptor type II (BMPR2). The aim of this study was to analyze the methylation pattern of the BMPR2 promoter region in patients and controls. We used Methyl Primer Express(®) v.1.0 and MatInspector softwares to analyze this region. Genomic DNA obtained from the peripheral blood of patients and controls was modified with sodium bisulphite. Methylation was analyzed using methylation-specific PCR. DNA treated with CpG methyltransferase was used as a positive control for methylation and H1299 cell culture DNA was used as positive control for gene expression. We identified a CpG island, which may have been methylated, in the BMPR2 promoter region, in addition to NIT-2 (global-acting regulatory protein), sex-determining region Y) and heat shock factor transcription factor binding sites. We found no evidence of methylation in patients and controls. No methylated CpG sites were identified in H1299 cells expressing the BMPR2 gene. The BMPR2 promoter region is the most suitable for study because of the high number of transcription factor binding sites that could alter gene function. No evidence of methylation was detected in this region in patients and controls. Copyright © 2015 SEPAR. Published by Elsevier Espana. All rights reserved.
Stott-Miller, Marni; Zhao, Shanshan; Wright, Jonathan L.; Kolb, Suzanne; Bibikova, Marina; Klotzle, Brandy; Ostrander, Elaine A.; Fan, Jian-Bing; Feng, Ziding; Stanford, Janet L.
2014-01-01
Background One challenge in prostate cancer (PCa) is distinguishing indolent from aggressive disease at diagnosis. DNA promoter hypermethylation is a frequent epigenetic event in PCa, but few studies of DNA methylation in relation to features of more aggressive tumors or PCa recurrence have been completed. Methods We used the Infinium® HumanMethylation450 BeadChip to assess DNA methylation in tumor tissue from 407 patients with clinically localized PCa who underwent radical prostatectomy. Recurrence status was determined by follow-up patient surveys, medical record review, and linkage with the SEER registry. The methylation status of 14 genes for which promoter hypermethylation was previously correlated with advanced disease or biochemical recurrence was evaluated. Average methylation level for promoter region CpGs in patients who recurred compared to those with no evidence of recurrence was analyzed. For two genes with differential methylation, time to recurrence was examined. Results During an average follow-up of 11.7 years, 104 (26%) patients recurred. Significant promoter hypermethylation in at least 50% of CpG sites in two genes, ABHD9 and HOXD3, was found in tumors from patients who recurred compared to those without recurrence. Evidence was strongest for HOXD3 (lowest P = 9.46x10−6), with higher average methylation across promoter region CpGs associated with reduced recurrence-free survival (P = 2×10−4). DNA methylation profiles did not differ by recurrence status for the other genes. Conclusions These results validate the association between promoter hypermethylation of ADHB9 and HOXD3 and PCa recurrence. Impact Tumor DNA methylation profiling may help distinguish PCa patients at higher risk for disease recurrence. PMID:24718283
Tu, N; Chen, H; Winnikes, U; Reinert, I; Marmann, G; Pirke, K M; Lentes, K U
1999-11-19
As a member of the uncoupling protein family, UCP2 is ubiquitously expressed in rodents and humans, implicating a major role in thermogenesis. To analyze promoter function and regulatory motifs involved in the transcriptional regulation of UCP2 gene expression, 3.3 kb of 5'-flanking region of the human UCP2 (hUCP2) gene have been cloned. Sequence analysis showed that the promoter region of hUCP2 lacks a classical TATA or CAAT box, however, appeared GC-rich resulting in the presence of several Sp-1 motifs and Ap-1/-2 binding sites near the transcription initiation site. Functional characterization of human UCP2 promoter-CAT fusion constructs in transient expression assays showed that minimal promoter activity was observed within 65 bp upstream of the transcriptional start site (+1). 75 bp further upstream (from nt -141 to -66) a strong cis-acting regulatory element (or enhancer) was identified, which significantly enhanced basal promoter activity. The regulation of human UCP2 gene expression involves complex interactions among positive and negative regulatory elements distributed over a minimum of 3.3 kb of the promoter region. Copyright 1999 Academic Press.
López-Estraño, Carlos; Gopalakrishnan, Anusha M.; Semblat, Jean-Philippe; Fergus, M. Ross; Mazier, Dominique; Haldar, Kasturi
2008-01-01
The asexual blood stage of Plasmodium falciparum is comprised of morphologically distinct ring, trophozoite and schizont stages. Each of these developmental stages possesses a distinct pattern of gene expression. Regulation of P. falciparum gene expression is thought to occur, at least in part, at the promoter level. Previously, we have found that although the RNA of the P. falciparum hrp3 gene is only seen in ring-stage parasites, deletion of a specific sequensce in the 5’ end of the promoter region decreased ring-stage expression of hrp3 and enabled detection of its transcripts in trophozoite-stage parasites. In order to investigate this stage specific regulation of gene expression, we employed a series of nested deletions of the 1.7-kb hrp3 promoter. Firefly luciferase gene was used as a reporter to evaluate the role of promoter sequences in gene regulation. Using this approach, we identified a ring-stage specific regulatory region on the hrp3 promoter located between -1.7-kb and -1.1-kb from the ATG initiation codon. Small 100–150 bp truncations on this enhancer-like region failed to uncover discrete regulatory sequences, suggesting the multipartite nature of this element. The data presented in this study demonstrates that stage specific promoter activity of the hrp3 gene in P. falciparum blood stage parasites is supported, at least in-part, by a small promoter region that can function in the absence of a larger chromosomal context. PMID:17570541
Analysis of tissue-specific region in sericin 1 gene promoter of Bombyx mori
DOE Office of Scientific and Technical Information (OSTI.GOV)
Liu Yan; Institute of Biochemistry and Cell Biology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences, Shanghai 200031; Yu Lian
The gene encoding sericin 1 (Ser1) of silkworm (Bombyx mori) is specifically expressed in the middle silk gland cells. To identify element involved in this transcription-dependent spatial restriction, truncation of the 5' terminal from the sericin 1 (Ser1) promoter is studied in vivo. A 209 bp DNA sequence upstream of the transcriptional start site (-586 to -378) is found to be responsible for promoting tissue-specific transcription. Analysis of this 209 bp region by overlapping deletion studies showed that a 25 bp region (-500 to -476) suppresses the ectopic expression of the Ser1 promoter. An unknown factor abundant in fat bodymore » nuclear extracts is shown to bind to this 25 bp fragment. These results suggest that this 25 bp region and the unknown factor are necessary for determining the tissue-specificity of the Ser1 promoter.« less
Zheng, Zhaoqing; Keifer, Joyce
2014-01-01
Brain-derived neurotrophic factor (BDNF) is an important regulator of neuronal development and synaptic function. The BDNF gene undergoes significant activity-dependent regulation during learning. Here, we identified the BDNF promoter regions, transcription start sites, and potential regulatory sequences for BDNF exons I–III that may contribute to activity-dependent gene and protein expression in the pond turtle Trachemys scripta elegans (tBDNF). By using transfection of BDNF promoter/luciferase plasmid constructs into human neuroblastoma SHSY5Y cells and mouse embryonic fibroblast NIH3T3 cells, we identified the basal regulatory activity of promoter sequences located upstream of each tBDNF exon, designated as pBDNFI–III. Further, through chromatin immunoprecipitation (ChIP) assays, we detected CREB binding directly to exon I and exon III promoters, while BHLHB2, but not CREB, binds within the exon II promoter. Elucidation of the promoter regions and regulatory protein binding sites in the tBDNF gene is essential for understanding the regulatory mechanisms that control tBDNF gene expression. PMID:24443176
Ambigapathy, Ganesh; Zheng, Zhaoqing; Keifer, Joyce
2014-08-01
Brain-derived neurotrophic factor (BDNF) is an important regulator of neuronal development and synaptic function. The BDNF gene undergoes significant activity-dependent regulation during learning. Here, we identified the BDNF promoter regions, transcription start sites, and potential regulatory sequences for BDNF exons I-III that may contribute to activity-dependent gene and protein expression in the pond turtle Trachemys scripta elegans (tBDNF). By using transfection of BDNF promoter/luciferase plasmid constructs into human neuroblastoma SHSY5Y cells and mouse embryonic fibroblast NIH3T3 cells, we identified the basal regulatory activity of promoter sequences located upstream of each tBDNF exon, designated as pBDNFI-III. Further, through chromatin immunoprecipitation (ChIP) assays, we detected CREB binding directly to exon I and exon III promoters, while BHLHB2, but not CREB, binds within the exon II promoter. Elucidation of the promoter regions and regulatory protein binding sites in the tBDNF gene is essential for understanding the regulatory mechanisms that control tBDNF gene expression.
Genetic recombination is targeted towards gene promoter regions in dogs.
Auton, Adam; Rui Li, Ying; Kidd, Jeffrey; Oliveira, Kyle; Nadel, Julie; Holloway, J Kim; Hayward, Jessica J; Cohen, Paula E; Greally, John M; Wang, Jun; Bustamante, Carlos D; Boyko, Adam R
2013-01-01
The identification of the H3K4 trimethylase, PRDM9, as the gene responsible for recombination hotspot localization has provided considerable insight into the mechanisms by which recombination is initiated in mammals. However, uniquely amongst mammals, canids appear to lack a functional version of PRDM9 and may therefore provide a model for understanding recombination that occurs in the absence of PRDM9, and thus how PRDM9 functions to shape the recombination landscape. We have constructed a fine-scale genetic map from patterns of linkage disequilibrium assessed using high-throughput sequence data from 51 free-ranging dogs, Canis lupus familiaris. While broad-scale properties of recombination appear similar to other mammalian species, our fine-scale estimates indicate that canine highly elevated recombination rates are observed in the vicinity of CpG rich regions including gene promoter regions, but show little association with H3K4 trimethylation marks identified in spermatocytes. By comparison to genomic data from the Andean fox, Lycalopex culpaeus, we show that biased gene conversion is a plausible mechanism by which the high CpG content of the dog genome could have occurred.
Genetic Recombination Is Targeted towards Gene Promoter Regions in Dogs
Auton, Adam; Rui Li, Ying; Kidd, Jeffrey; Oliveira, Kyle; Nadel, Julie; Holloway, J. Kim; Hayward, Jessica J.; Cohen, Paula E.; Greally, John M.; Wang, Jun; Bustamante, Carlos D.; Boyko, Adam R.
2013-01-01
The identification of the H3K4 trimethylase, PRDM9, as the gene responsible for recombination hotspot localization has provided considerable insight into the mechanisms by which recombination is initiated in mammals. However, uniquely amongst mammals, canids appear to lack a functional version of PRDM9 and may therefore provide a model for understanding recombination that occurs in the absence of PRDM9, and thus how PRDM9 functions to shape the recombination landscape. We have constructed a fine-scale genetic map from patterns of linkage disequilibrium assessed using high-throughput sequence data from 51 free-ranging dogs, Canis lupus familiaris. While broad-scale properties of recombination appear similar to other mammalian species, our fine-scale estimates indicate that canine highly elevated recombination rates are observed in the vicinity of CpG rich regions including gene promoter regions, but show little association with H3K4 trimethylation marks identified in spermatocytes. By comparison to genomic data from the Andean fox, Lycalopex culpaeus, we show that biased gene conversion is a plausible mechanism by which the high CpG content of the dog genome could have occurred. PMID:24348265
New PAH gene promoter KLF1 and 3'-region C/EBPalpha motifs influence transcription in vitro.
Klaassen, Kristel; Stankovic, Biljana; Kotur, Nikola; Djordjevic, Maja; Zukic, Branka; Nikcevic, Gordana; Ugrin, Milena; Spasovski, Vesna; Srzentic, Sanja; Pavlovic, Sonja; Stojiljkovic, Maja
2017-02-01
Phenylketonuria (PKU) is a metabolic disease caused by mutations in the phenylalanine hydroxylase (PAH) gene. Although the PAH genotype remains the main determinant of PKU phenotype severity, genotype-phenotype inconsistencies have been reported. In this study, we focused on unanalysed sequences in non-coding PAH gene regions to assess their possible influence on the PKU phenotype. We transiently transfected HepG2 cells with various chloramphenicol acetyl transferase (CAT) reporter constructs which included PAH gene non-coding regions. Selected non-coding regions were indicated by in silico prediction to contain transcription factor binding sites. Furthermore, electrophoretic mobility shift assay (EMSA) and supershift assays were performed to identify which transcriptional factors were engaged in the interaction. We found novel KLF1 motif in the PAH promoter, which decreases CAT activity by 50 % in comparison to basal transcription in vitro. The cytosine at the c.-170 promoter position creates an additional binding site for the protein complex involving KLF1 transcription factor. Moreover, we assessed for the first time the role of a multivariant variable number tandem repeat (VNTR) region located in the 3'-region of the PAH gene. We found that the VNTR3, VNTR7 and VNTR8 constructs had approximately 60 % of CAT activity. The regulation is mediated by the C/EBPalpha transcription factor, present in protein complex binding to VNTR3. Our study highlighted two novel promoter KLF1 and 3'-region C/EBPalpha motifs in the PAH gene which decrease transcription in vitro and, thus, could be considered as PAH expression modifiers. New transcription motifs in non-coding regions will contribute to better understanding of the PKU phenotype complexity and may become important for the optimisation of PKU treatment.
The advantages of haplotype analysis of the promoter region of the human apolipoprotein E gene.
McLaughlin, D P; Sharma, A; McGinley, A; Samra, G S
2001-12-15
Polymorphisms in the regulatory region of the human apolipoprotein E gene (gene, APOE; protein, apoE) have been implicated in Alzheimer's disease. Here we describe in detail the advantages of a simple method for haplotype analysis of this region (at -491 and -427 bases relative to the transcription start site of the gene). The promoter region of the APOE gene was amplified by polymerase chain reaction (PCR) and this fragment was then used as a template for PCR with "nested" primers to generate a 228-bp product incorporating both the -491 and the -427 loci. PCR products were then digested with DraI and AluI together and subjected to polyacrylamide gel electrophoresis. The distinct pattern of bands appearing on the gel was then used to ascribe [-491,-427] haplotypes to each subject, from which -491 and -427 genotypes were inferred. -491 and -427 genotypes were also confirmed by digestion with DraI alone or AluI alone. Haplotype analysis was successful in all 20 samples analyzed and was 100% consistent with genotyping. We suggest that this is a reliable, time-saving method that the will be useful in large-scale APOE promoter genotyping studies. (c)2001 Elsevier Science.
Novel polymorphisms of the APOA2 gene and its promoter region affect body traits in cattle.
Zhou, Yang; Li, Caixia; Cai, Hanfang; Xu, Yao; Lan, Xianyong; Lei, Chuzhao; Chen, Hong
2013-12-01
Apolipoprotein A-II (APOA2) is one of the major constituents of high-density lipoprotein and plays a critical role in lipid metabolism and obesity. However, similar research for the bovine APOA2 gene is lacking. In this study, polymorphisms of the bovine APOA2 gene and its promoter region were detected in 1021 cows from four breeds by sequencing and PCR-RFLP methods. Totally, we detected six novel mutations which included one mutation in the promoter region, two mutations in the exons and three mutations in the introns. There were four polymorphisms within APOA2 gene were analyzed. The allele A, T, T and G frequencies of the four loci were predominant in the four breeds when in separate or combinations analysis which suggested cows with those alleles to be more adapted to the steppe environment. The association analysis indicated three SVs in Nangyang cows, two SVs in Qinchun cows and the 9 haplotypes in Nangyang cows were significantly associated with body traits (P<0.05 or P<0.01). The results of this study suggested the bovine APOA2 gene may be a strong candidate gene for body traits in the cattle breeding program. © 2013.
Yoshino, M; Tsutsumi, K; Kanazawa, A
2015-01-01
β-Conglycinin, a major component of seed storage protein in soybean, comprises three subunits: α, α' and β. The expression of genes for these subunits is strictly controlled during embryogenesis. The proximal promoter region up to 245 bp upstream of the transcription start site of the α subunit gene sufficiently confers spatial and temporal control of transcription in embryos. Here, the binding profile of nuclear proteins in the proximal promoter region of the α subunit gene was analysed. DNase I footprinting analysis indicated binding of proteins to the RY element and DNA regions including box I, a region conserved in cognate gene promoters. An electrophoretic mobility shift assay (EMSA) using different portions of box I as a probe revealed that multiple portions of box I bind to nuclear proteins. In addition, an EMSA using nuclear proteins extracted from embryos at different developmental stages indicated that the levels of major DNA-protein complexes on box I increased during embryo maturation. These results are consistent with the notion that box I is important for the transcriptional control of seed storage protein genes. Furthermore, the present data suggest that nuclear proteins bind to novel motifs in box I including 5'-TCAATT-3' rather than to predicted cis-regulatory elements. © 2014 German Botanical Society and The Royal Botanical Society of the Netherlands.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Kalchman, M.; Lin, B.; Nasir, J.
1994-09-01
The mouse homologue of the Huntington disease gene (Hdh) has recently been cloned and mapped to a region of synteny with the human, on mouse chromosome 5. The two genes share a high degree of both coding (90% amino acid) and nucleotide (86.2%) identity. We have subsequently performed a detailed comparison of the genomic organization of the 5{prime} region of the two genes encompassing the promoter region and first five exons of both the human and mouse genes. The comparative sequence analysis of the promoter region between HD and Hdh reveals two highly conserved regions. One region (-56 to -118)more » (+1 is the ATG start codon), shared 84% nucleotide identity and another region (-130 to -206) had 81% nucleotide identity. Nine putative Sp1 sites appear in the human promoter region contrasted with only 3 in a similar region in the mouse. Furthermore, 17 and 20 base pair direct repeats present in the HD 5{prime} region are absent in the similar Hdh region. Although both the mouse and human intron/exon boundaries conform to the GT/AG rule, the intron sizes between HD and Hdh are markedly different. The first four introns in Hdh are 15, 7, 5 and 0.5 kb compared to sizes of 10, 15, 7 and 0.5 kb, respectively. Comparison between the mouse and human intronic sequences immediately adjacent to the first five exons (excluding exon 1) reveals only about 46 to 50% identity within the first 60 bp of intronic sequence. Furthermore, we have identified novel polymorphic di-, tri- and tetra-nucleotide repeats in Hdh introns of various mouse strains that are not present in the human. For example, polymorphic CT repeats are present in introns 2 and 4 of Hdh and a novel mouse 56 AAG trinucleotide repeat (interrupted by an AAGG) is also located within intron 2. This information concerning the promoter and genomic organization of both HD and Hdh is critical for designing appropriate gene targetting vectors for studying the normal function of the HD and Hdh genes in model systems.« less
Catteau, Aurélie; Rosewell, Ian; Solomon, Ellen; Taylor-Papadimitriou, Joyce
2004-07-01
The recently cloned gene PLU-1 shows restricted expression in adult tissues, with high expression being found in testis, and transiently in the pregnant mammary gland. However, both the gene and the protein product are specifically up-regulated in breast cancer. To investigate the control of expression of the PLU-1 gene, we have cloned and functionally characterised the 5' flanking region of the gene, which was found to contain another putative gene. Two transcription start sites of the PLU-1 gene were mapped by 5' RACE. A short proximal 249 bp region was defined using reporter gene assays, which encompasses the major transcription start site and exhibits a strong constitutive promoter activity in all cell lines tested. However, regions upstream of this sequence repress transcription more effectively in a non-malignant breast cell line as compared to breast cancer cell lines. The 249 bp region is GC-rich and includes consensus Sp1 sites, GC boxes, cAMP-responsive element (CRE) and other putative cis-elements. Mutational analysis showed that two intact conserved Sp1 binding sites (shown here to bind Sp1 and/or Sp3) are critical for constitutive promoter activity, while a negative role for a neighbouring GC box is indicated. The sequence of the core promoter is highly conserved in the mouse and Plu-1 expression in the mouse embryo has been documented. Using transgenesis, we therefore examined the ability of the 249 bp fragment to control expression of a reporter gene during embryogenesis. We found that not only is the core promoter sufficient to activate transcription in vivo, but that the expression of the reporter gene coincides both temporally and spatially with regions where endogenous Plu-1 is highly expressed. This suggests that tissue specific controlling elements are found within the short fragment and are functional in the embryonic environment.
Porcine MYF6 gene: sequence, homology analysis, and variation in the promoter region.
Wyszyńska-Koko, J; Kurył, J
2004-01-01
MYF6 gene codes for the bHLH transcription factor belonging to MyoD family. Its expression accompanies the processes of differentiation and maturation of myotubes during embriogenesis and continues on a relatively high level after birth, affecting the muscle phenotype. The porcine MYF6 gene was amplified and sequenced and compared with MYF6 gene sequences of other species. The amino acid sequence was deduced and an interspecies homology analysis was performed. Myf-6 protein shows a high conservation among species of 99 and 97% identity when comparing pig with cow and human, respectively, and of 93% when comparing pig with mouse and rat. The single nucleotide polymorphism (SNP) was revealed within the promoter region, which appeared to be T --> C transition recognized by a MspI restriction enzyme.
Anderson, Letícia; Gomes, Monete Rajão; daSilva, Lucas Ferreira; Pereira, Adriana da Silva Andrade; Mourão, Marina M.; Romier, Christophe; Pierce, Raymond
2017-01-01
Background Schistosomiasis is a parasitic disease infecting hundreds of millions of people worldwide. Treatment depends on a single drug, praziquantel, which kills the Schistosoma spp. parasite only at the adult stage. HDAC inhibitors (HDACi) such as Trichostatin A (TSA) induce parasite mortality in vitro (schistosomula and adult worms), however the downstream effects of histone hyperacetylation on the parasite are not known. Methodology/Principal findings TSA treatment of adult worms in vitro increased histone acetylation at H3K9ac and H3K14ac, which are transcription activation marks, not affecting the unrelated transcription repression mark H3K27me3. We investigated the effect of TSA HDACi on schistosomula gene expression at three different time points, finding a marked genome-wide change in the transcriptome profile. Gene transcription activity was correlated with changes on the chromatin acetylation mark at gene promoter regions. Moreover, combining expression data with ChIP-Seq public data for schistosomula, we found that differentially expressed genes having the H3K4me3 mark at their promoter region in general showed transcription activation upon HDACi treatment, compared with those without the mark, which showed transcription down-regulation. Affected genes are enriched for DNA replication processes, most of them being up-regulated. Twenty out of 22 genes encoding proteins involved in reducing reactive oxygen species accumulation were down-regulated. Dozens of genes encoding proteins with histone reader motifs were changed, including SmEED from the PRC2 complex. We targeted SmEZH2 methyltransferase PRC2 component with a new EZH2 inhibitor (GSK343) and showed a synergistic effect with TSA, significantly increasing schistosomula mortality. Conclusions/Significance Genome-wide gene expression analyses have identified important pathways and cellular functions that were affected and may explain the schistosomicidal effect of TSA HDACi. The change in expression
Sebestyén, Endre; Nagy, Tibor; Suhai, Sándor; Barta, Endre
2009-01-01
Background The comparative genomic analysis of a large number of orthologous promoter regions of the chordate and plant genes from the DoOP databases shows thousands of conserved motifs. Most of these motifs differ from any known transcription factor binding site (TFBS). To identify common conserved motifs, we need a specific tool to be able to search amongst them. Since conserved motifs from the DoOP databases are linked to genes, the result of such a search can give a list of genes that are potentially regulated by the same transcription factor(s). Results We have developed a new tool called DoOPSearch for the analysis of the conserved motifs in the promoter regions of chordate or plant genes. We used the orthologous promoters of the DoOP database to extract thousands of conserved motifs from different taxonomic groups. The advantage of this approach is that different sets of conserved motifs might be found depending on how broad the taxonomic coverage of the underlying orthologous promoter sequence collection is (consider e.g. primates vs. mammals or Brassicaceae vs. Viridiplantae). The DoOPSearch tool allows the users to search these motif collections or the promoter regions of DoOP with user supplied query sequences or any of the conserved motifs from the DoOP database. To find overrepresented gene ontologies, the gene lists obtained can be analysed further using a modified version of the GeneMerge program. Conclusion We present here a comparative genomics based promoter analysis tool. Our system is based on a unique collection of conserved promoter motifs characteristic of different taxonomic groups. We offer both a command line and a web-based tool for searching in these motif collections using user specified queries. These can be either short promoter sequences or consensus sequences of known transcription factor binding sites. The GeneMerge analysis of the search results allows the user to identify statistically overrepresented Gene Ontology terms that
Mishra, Sonal; Shukla, Aparna; Upadhyay, Swati; Sanchita; Sharma, Pooja; Singh, Seema; Phukan, Ujjal J; Meena, Abha; Khan, Feroz; Tripathi, Vineeta; Shukla, Rakesh Kumar; Shrama, Ashok
2014-04-01
Plants posses a complex co-regulatory network which helps them to elicit a response under diverse adverse conditions. We used an in silico approach to identify the genes with both DRE and ABRE motifs in their promoter regions in Arabidopsis thaliana. Our results showed that Arabidopsis contains a set of 2,052 genes with ABRE and DRE motifs in their promoter regions. Approximately 72% or more of the total predicted 2,052 genes had a gap distance of less than 400 bp between DRE and ABRE motifs. For positional orientation of the DRE and ABRE motifs, we found that the DR form (one in direct and the other one in reverse orientation) was more prevalent than other forms. These predicted 2,052 genes include 155 transcription factors. Using microarray data from The Arabidopsis Information Resource (TAIR) database, we present 44 transcription factors out of 155 which are upregulated by more than twofold in response to osmotic stress and ABA treatment. Fifty-one transcripts from the one predicted above were validated using semiquantitative expression analysis to support the microarray data in TAIR. Taken together, we report a set of genes containing both DRE and ABRE motifs in their promoter regions in A. thaliana, which can be useful to understand the role of ABA under osmotic stress condition. © 2013 Institute of Botany, Chinese Academy of Sciences.
Fanconi Anemia Core Complex Gene Promoters Harbor Conserved Transcription Regulatory Elements
Meier, Daniel; Schindler, Detlev
2011-01-01
The Fanconi anemia (FA) gene family is a recent addition to the complex network of proteins that respond to and repair certain types of DNA damage in the human genome. Since little is known about the regulation of this novel group of genes at the DNA level, we characterized the promoters of the eight genes (FANCA, B, C, E, F, G, L and M) that compose the FA core complex. The promoters of these genes show the characteristic attributes of housekeeping genes, such as a high GC content and CpG islands, a lack of TATA boxes and a low conservation. The promoters functioned in a monodirectional way and were, in their most active regions, comparable in strength to the SV40 promoter in our reporter plasmids. They were also marked by a distinctive transcriptional start site (TSS). In the 5′ region of each promoter, we identified a region that was able to negatively regulate the promoter activity in HeLa and HEK 293 cells in isolation. The central and 3′ regions of the promoter sequences harbor binding sites for several common and rare transcription factors, including STAT, SMAD, E2F, AP1 and YY1, which indicates that there may be cross-connections to several established regulatory pathways. Electrophoretic mobility shift assays and siRNA experiments confirmed the shared regulatory responses between the prominent members of the TGF-β and JAK/STAT pathways and members of the FA core complex. Although the promoters are not well conserved, they share region and sequence specific regulatory motifs and transcription factor binding sites (TBFs), and we identified a bi-partite nature to these promoters. These results support a hypothesis based on the co-evolution of the FA core complex genes that was expanded to include their promoters. PMID:21826217
Fanconi anemia core complex gene promoters harbor conserved transcription regulatory elements.
Meier, Daniel; Schindler, Detlev
2011-01-01
The Fanconi anemia (FA) gene family is a recent addition to the complex network of proteins that respond to and repair certain types of DNA damage in the human genome. Since little is known about the regulation of this novel group of genes at the DNA level, we characterized the promoters of the eight genes (FANCA, B, C, E, F, G, L and M) that compose the FA core complex. The promoters of these genes show the characteristic attributes of housekeeping genes, such as a high GC content and CpG islands, a lack of TATA boxes and a low conservation. The promoters functioned in a monodirectional way and were, in their most active regions, comparable in strength to the SV40 promoter in our reporter plasmids. They were also marked by a distinctive transcriptional start site (TSS). In the 5' region of each promoter, we identified a region that was able to negatively regulate the promoter activity in HeLa and HEK 293 cells in isolation. The central and 3' regions of the promoter sequences harbor binding sites for several common and rare transcription factors, including STAT, SMAD, E2F, AP1 and YY1, which indicates that there may be cross-connections to several established regulatory pathways. Electrophoretic mobility shift assays and siRNA experiments confirmed the shared regulatory responses between the prominent members of the TGF-β and JAK/STAT pathways and members of the FA core complex. Although the promoters are not well conserved, they share region and sequence specific regulatory motifs and transcription factor binding sites (TBFs), and we identified a bi-partite nature to these promoters. These results support a hypothesis based on the co-evolution of the FA core complex genes that was expanded to include their promoters.
Dallol, Ashraf; Forgacs, Eva; Martinez, Alonso; Sekido, Yoshitaka; Walker, Rosemary; Kishida, Takeshi; Rabbitts, Pamela; Maher, Eamonn R; Minna, John D; Latif, Farida
2002-05-02
The human homologue of the Drosophila Roundabout gene DUTT1 (Deleted in U Twenty Twenty) or ROBO1 (Locus Link ID 6091), a member of the NCAM family of receptors, was recently cloned from the lung cancer tumour suppressor gene region 2 (LCTSGR2 or U2020 region) at 3p12. DUTT1 maps within a region of overlapping homozygous deletions characterized in both small cell lung cancer lines (SCLC) and in a breast cancer line. In this report we (a) defined the genomic organization of the DUTT1 gene, (b) performed mutation and expression analysis of DUTT1 in lung, breast and kidney cancers, (c) identified tumour specific promoter region methylation of DUTT1 in human cancers. The gene was found to contain 29 exons and spans at least 240 kb of genomic sequence. The 5' region contains a CpG island, and the poly(A)(+) tail has an atypical 5'-GATAAA-3' signal. We analysed DUTT1 for mutations in lung, breast and kidney cancers, no inactivating mutations were detected by PCR-SSCP. However, seven germline missense changes were found and characterized. DUTT1 expression was not detectable in one out of 18 breast tumour lines analysed by RT-PCR. Bisulfite sequencing of the promoter region of DUTT1 gene in the HTB-19 breast tumour cell line (not expressing DUTT1) showed complete hypermethylation of CpG sites within the promoter region of the DUTT1 gene (-244 to +27 relative to the translation start site). The expression of DUTT1 gene was reactivated in HTB-19 after treatment with the demethylating agent 5-aza-2'-deoxycytidine. The same region was also found to be hypermethylated in six out of 32 (19%) primary invasive breast carcinomas and eight out of 44 (18%) primary clear cell renal cell carcinomas (CC-RCC) and in one out of 26 (4%) primary NSCLC tumours. Furthermore 80% of breast and 75% of CC-RCC tumours showing DUTT1 methylation had allelic losses for 3p12 markers hence obeying Knudson's two hit hypothesis. Our findings suggest that DUTT1 warrants further analysis as a candidate for
ERIC Educational Resources Information Center
Zhang, Jian
2009-01-01
Gene expression in Archaea is less understood than those in Bacteria and Eucarya. In general, three steps are involved in gene expression--transcription, RNA processing, and translation. To expand our knowledge of these processes in Archaea, I have studied transcriptional promoters, messenger RNA processing, and 5'-untranslated regions in…
Priming affects the activity of a specific region of the promoter of the human beta interferon gene.
Dron, M; Lacasa, M; Tovey, M G
1990-01-01
Treatment of Daudi or HeLa cells with human interferon (IFN) alpha 8 before induction with either poly(I)-poly(C) or Sendai virus resulted in an 8- to 100-fold increase in IFN production. The extent of priming in Daudi cells paralleled the increase in the intracellular content of IFN-beta mRNA. IFN-alpha mRNA remained undetectable in poly(I)-poly(C)-treated Daudi cells either before or after priming. An IFN-resistant clone of Daudi cells was found to produce 4- to 20-fold more IFN after priming, indicating that priming was unrelated to the phenotype of IFN sensitivity. IFN treatment of either Daudi or HeLa cells transfected with the human IFN-beta promoter (-282 to -37) linked to the chloramphenicol acetyltransferase (CAT) gene resulted in an increase in CAT activity after induction with poly(I)-poly(C) or Sendai virus. A synthetic double-stranded oligonucleotide corresponding to an authentic 30-base-pair (bp) region of the human IFN-beta promoter between positions -91 and -62 was found to confer virus inducibility upon the reporter CAT gene in HeLa cells. IFN treatment of HeLa cells transfected with this 30-bp region of the IFN-beta promoter in either the correct or reversed orientation also increased CAT activity upon subsequent induction. IFN treatment alone had no detectable effect on the activity of either the 30-bp region or the complete human IFN promoter. Images PMID:2153928
Kotsaki, Antigoni; Raftogiannis, Maria; Routsi, Christina; Baziaka, Fotini; Kotanidou, Anastasia; Antonopoulou, Anastasia; Orfanos, Stylianos E; Katsenos, Chrisostomos; Koutoukas, Pantelis; Plachouras, Diamantis; Mandragos, Konstantinos; Giamarellos-Bourboulis, Evangelos J
2012-08-01
Debatable findings exist among various studies regarding the impact of single nucleotide polymorphisms (SNPs) within the promoter region of the tumor necrosis factor (TNF) gene for susceptibility to infections. Their impact was investigated in a cohort of mechanically ventilated patients who developed ventilator-associated pneumonia (VAP). Two-hundred and thirteen mechanically ventilated patients who developed VAP were enrolled. Genomic DNA was extracted and SNPs at the -376, -308 and -238 position of the promoter region of the TNF gene were assessed by restriction fragment length polymorphisms. Monocytes were isolated from 47 patients when they developed sepsis and stimulated by bacterial endotoxin for the production of TNFα and of interleukin-6 (IL-6). Patients were divided into two groups; 166 patients bearing only wild-type alleles of all three studied polymorphisms; and 47 patients carrying at least one A allele of the three studied SNPs. Time between start of mechanical ventilation and advent of VAP was significantly shorter in the second group than in the first group (log-rank: 4.416, p: 0.041). When VAP supervened, disease severity did not differ between groups. Stimulation of TNFα and of IL-6 was much greater by monocytes for patients carrying A alleles. Carriage of at least one A allele of the three studied SNPs at the promoter region of the TNF-gene is associated with shorter time to development of VAP but it is not associated with disease severity. Findings may be related with a role of the studied SNPs in the production of pro-inflammatory cytokines. Copyright © 2012 Elsevier Ltd. All rights reserved.
Kinoshita, Yumiko; Kizaki, Zenro; Ishihara, Yasunori; Nakajima, Hisakazu; Adachi, Shinsuke; Kosaka, Kitaro; Kinugasa, Akihiko; Sugimoto, Tohru
2007-01-01
Evidence is accumulating that the promoter region of the insulin-like growth factor I (IGF-I) gene polymorphism and low levels of IGF-I are associated with type 2 diabetes, cardiovascular disease and birth weight; however, the number of wild-type alleles is different in each country. This study aimed to examine the 737/738 marker, a cytosine-adenine repeat in the promoter region of the IGF-I gene polymorphism, and plasma IGF-I levels in Japanese infants and analyze the genetic background. Data were collected for 15 months in Kyoto Prefectural University of Medicine. The body composition parameters of all infants were determined at birth. At 5 days after birth, we took blood samples to measure the product size of the promoter region of the IGF-I gene polymorphism and plasma IGF-I. In a population-based sample of 160 subjects, 6 different alleles and 16 genotypes were identified in the promoter region of the IGF-I gene polymorphism. The existence of a 196-bp allele has proved to result in a low plasma IGF-I level, a small head and chest circumference (p < 0.05) and no significant for premature birth, short-birth height and low-birth weight. This is the first study showing the role of the promoter region of the IGF-I gene polymorphism and the level of plasma IGF-I and body composition parameters in Japanese infants. Our results suggest genetical influence on prenatal growth and serum IGF-I levels.
Transcription Factor Map Alignment of Promoter Regions
Blanco, Enrique; Messeguer, Xavier; Smith, Temple F; Guigó, Roderic
2006-01-01
We address the problem of comparing and characterizing the promoter regions of genes with similar expression patterns. This remains a challenging problem in sequence analysis, because often the promoter regions of co-expressed genes do not show discernible sequence conservation. In our approach, thus, we have not directly compared the nucleotide sequence of promoters. Instead, we have obtained predictions of transcription factor binding sites, annotated the predicted sites with the labels of the corresponding binding factors, and aligned the resulting sequences of labels—to which we refer here as transcription factor maps (TF-maps). To obtain the global pairwise alignment of two TF-maps, we have adapted an algorithm initially developed to align restriction enzyme maps. We have optimized the parameters of the algorithm in a small, but well-curated, collection of human–mouse orthologous gene pairs. Results in this dataset, as well as in an independent much larger dataset from the CISRED database, indicate that TF-map alignments are able to uncover conserved regulatory elements, which cannot be detected by the typical sequence alignments. PMID:16733547
Ndika, Joseph D T; Lusink, Vera; Beaubrun, Claudine; Kanhai, Warsha; Martinez-Munoz, Cristina; Jakobs, Cornelis; Salomons, Gajja S
2014-01-10
Interconversion between phosphocreatine and creatine, catalyzed by creatine kinase is crucial in the supply of ATP to tissues with high energy demand. Creatine's importance has been established by its use as an ergogenic aid in sport, as well as the development of intellectual disability in patients with congenital creatine deficiency. Creatine biosynthesis is complemented by dietary creatine uptake. Intracellular transport of creatine is carried out by a creatine transporter protein (CT1/CRT/CRTR) encoded by the SLC6A8 gene. Most tissues express this gene, with highest levels detected in skeletal muscle and kidney. There are lower levels of the gene detected in colon, brain, heart, testis and prostate. The mechanism(s) by which this regulation occurs is still poorly understood. A duplicated unprocessed pseudogene of SLC6A8-SLC6A10P has been mapped to chromosome 16p11.2 (contains the entire SLC6A8 gene, plus 2293 bp of 5'flanking sequence and its entire 3'UTR). Expression of SLC6A10P has so far only been shown in human testis and brain. It is still unclear as to what is the function of SLC6A10P. In a patient with autism, a chromosomal breakpoint that intersects the 5'flanking region of SLC6A10P was identified; suggesting that SLC6A10P is a non-coding RNA involved in autism. Our aim was to investigate the presence of cis-acting factor(s) that regulate expression of the creatine transporter, as well as to determine if these factors are functionally conserved upstream of the creatine transporter pseudogene. Via gene-specific PCR, cloning and functional luciferase assays we identified a 1104 bp sequence proximal to the mRNA start site of the SLC6A8 gene with promoter activity in five cell types. The corresponding 5'flanking sequence (1050 bp) on the pseudogene also had promoter activity in all 5 cell lines. Surprisingly the pseudogene promoter was stronger than that of its parent gene in 4 of the cell lines tested. To the best of our knowledge, this is the first
Moon, Dong Chan; Choi, Chul Hee; Lee, Su Man; Lee, Jung Hwa; Kim, Seung Il; Kim, Dong Sun; Lee, Je Chul
2012-01-01
Nuclear targeting of bacterial proteins has emerged as a pathogenic mechanism whereby bacterial proteins induce host cell pathology. In this study, we examined nuclear targeting of Acinetobacter baumannii transposase (Tnp) and subsequent epigenetic changes in host cells. Tnp of A. baumannii ATCC 17978 possesses nuclear localization signals (NLSs), (225)RKRKRK(230). Transient expression of A. baumannii Tnp fused with green fluorescent protein (GFP) resulted in the nuclear localization of these proteins in COS-7 cells, whereas the truncated Tnp without NLSs fused with GFP were exclusively localized in the cytoplasm. A. baumannii Tnp was found in outer membrane vesicles, which delivered this protein to the nucleus of host cells. Nuclear expression of A. baumannii Tnp fused with GFP in A549 cells induced DNA methylation of CpG regions in the promoters of E-cadherin (CDH1) gene, whereas the cytoplasmic localization of the truncated Tnp without NLSs fused with GFP did not induce DNA methylation. DNA methylation in the promoters of E-cadherin gene induced by nuclear targeting of A. baumannii Tnp resulted in down-regulation of gene expression. In conclusion, our data show that nuclear traffic of A. baumannii Tnp induces DNA methylation of CpG regions in the promoters of E-cadherin gene, which subsequently down-regulates gene expression. This study provides a new insight into the epigenetic control of host genes by bacterial proteins.
Pannetier, Maëlle; Renault, Lauriane; Jolivet, Geneviève; Cotinot, Corinne; Pailhoux, Eric
2005-06-01
Studies on XX sex reversal in polled goats (PIS mutation: polled intersex syndrome) have led to the discovery of a female-specific locus crucial for ovarian differentiation. This genomic region is composed of at least two genes, FOXL2 and PISRT1, sharing a common transcriptional regulatory region, PIS. In this paper, we describe a third gene, PFOXic (promoter FOXL2 inverse complementary), located near FOXL2 in the opposite orientation. This gene composed of five exons encodes a 1723-bp cDNA, enclosing two repetitive elements in its 3' end. PFOXic mRNA encodes a putative protein of 163 amino acids with no homologies in any of the databases tested. The transcriptional expression of PFOXic is driven by a bidirectional promoter also enhancing FOXL2 transcription. In goats, PFOXic is expressed in developing ovaries, from 36 days postcoitum until adulthood. Ovarian-specific expression of PFOXic is regulated by the PIS region. PFOXic is found conserved only in Bovidae. But, a human gene located in the opposite orientation relative to FOXL2 can be considered a human PFOXic. Finally, we discuss evidence arguing for regulation of the level of FOXL2 transcription via the bidirectional promoter and the level of transcription of PFOXic.
KLF15 promotes transcription of KLF3 gene in bovine adipocytes.
Guo, Hongfang; Khan, Rajwali; Raza, Sayed Haidar Abbas; Ning, Yue; Wei, Dawei; Wu, Sen; Hosseini, Seyed Mahdi; Ullah, Irfan; Garcia, Matthew D; Zan, Linsen
2018-06-15
The Krüppel-like factors (KLF) family plays an important role in adipogenesis, which is subject to internal hierarchical regulation. KLF3 is a member of KLF family, mainly responsible for adipocyte differentiation and fat deposition. However, the transcriptional regulation of bovine KLF3 gene and its relationship with KLF15 gene remains unclear during bovine adipogenesis. Here, we report that the expression pattern of KLF3 and KLF15 genes during bovine adipogenesis, when KLF15 gene was overexpressed through adenoviral vector (Ad-KLF15) in bovine adipocytes the expression level of KLF3 gene was increased, similarly when KLF15 was down regulated through siRNA the expression level of KLF3 was also reduced. To explore the transcriptional regulation of bovine KLF3 gene and its relationship with KLF15, serial deletion constructs of the 5'flanking region of bovine KLF3gene revealed through dual-luciferase reporter assay that the core promoter is located in -264 to -76 regions. The most proximal GGGG element in the promoter of the bovine KLF3 gene (located in -264 to -76 regions) is required for promotion by KLF15. Electrophoretic mobility shift (EMSA) and chromatin immunoprecipitation (ChIP) assays further confirmed that KLF15 gene binds to the KLF3 gene core promoter region in bovine adipocytes. These findings conclude that KLF15 promotes the transcriptional activity of KLF3 in bovine adipocytes. This mechanism to provides a new direction for further study of adipogenesis by internal regulation of members within KLF family. Copyright © 2018 Elsevier B.V. All rights reserved.
Muhle, Rebecca A.; Adjalley, Sophie; Falkard, Brie; Nkrumah, Louis J.; Muhle, Michael E.; Fidock, David A.
2009-01-01
Questions surround the mechanism of mutually exclusive expression by which Plasmodium falciparum mediates activation and silencing of var genes. These encode PfEMP1 proteins, which function as cytoadherent and immunomodulatory molecules at the surface of parasitized erythrocytes. Current evidence suggests that promoter silencing by var introns might play a key role in var gene regulation. To evaluate the impact of cis-acting regulatory regions on var silencing, we generated P. falciparum lines in which luciferase was placed under the control of an UpsA var promoter. By utilizing the Bxb1 integrase system, these reporter cassettes were targeted to a genomic region that was not in apposition to var sub-telomeric domains. This eliminated possible effects from surrounding telomeric elements and removed the variability inherent in episomal systems. Studies with highly synchronized parasites revealed that the UpsA element possessed minimal activity in comparison with a heterologous (hrp3) promoter. This may well result from the integrated UpsA promoter being largely silenced by the neighboring cg6 promoter. Our analyses also revealed that the DownsA 3’ untranslated region further decreased the luciferase activity from both cassettes, whereas the var A intron repressed the UpsA promoter specifically. By applying multivariate analysis over the entire cell cycle, we confirmed the significance of these cis-elements and found the parasite stage to be the major factor regulating UpsA promoter activity. Additionally, we observed that the UpsA promoter was capable of nucleating reversible silencing that spread to a downstream promoter. We believe these studies are the first to analyze promoter activity of Group A var genes which have been implicated in severe malaria, and support the model that var introns can further suppress var expression. These data also suggest an important suppressive role for the DownsA terminator. Our findings imply the existence of multiple levels of
Masotti, Cibele; Armelin-Correa, Lucia M; Splendore, Alessandra; Lin, Chin J; Barbosa, Angela; Sogayar, Mari C; Passos-Bueno, Maria Rita
2005-10-10
Treacher Collins syndrome (TCS) is an autosomal dominant craniofacial malformation caused by null mutations in the TCOF1 gene. High inter and intra familial clinical variability, ranging from mild malar hypoplasia to perinatal death due to airway collapse is observed, but, to date, no genotype-phenotype correlation has been reported. Considering haploinsufficiency as the molecular mechanism underlying the disease, we have hypothesized that mutations in the promoter region of the gene, which has never been previously characterized, in trans with a pathogenic mutation, could modulate the phenotype. Therefore, the aims of the present study were to determine the TCOF1 gene's core promoter and to identify mutations in this region that could contribute to the phenotypic variation observed in this syndrome. We have delimitated the minimal promoter to a region of less than 150 bp, with 63% of identity among 5 different species. We screened 1.2 kbp of the TCOF1 5' flanking sequence in the DNA obtained from 21 patients and 51 controls and identified four new single nucleotide polymorphisms (SNPs), one of which (-346C>T), was proved to be functional, as it decreased the promoter activity by 38%. Electrophoretic mobility shift assay (EMSA) analysis demonstrated that the -346T allele impairs DNA-binding to the YY1 transcription factor. This promoter variant represents a candidate allele to explain the clinical variability in patients bearing TCS.
USDA-ARS?s Scientific Manuscript database
The ADIPOQ gene of cattle, is located in the vicinity of the quantitative trait locus (QTL) wich effects marbling, the rib eye muscle area and fat thickness on BTA1. In our study, a novel variable duplication (NW_003103812.1:g.9232067_9232133 dup) in the bovine ADIPOQ promoter region was identified ...
Menéndez, J; Gancedo, C
1998-07-15
We have identified regions in the promoters of the PYC1 and PYC2 genes from Saccharomyces cerevisiae involved in their regulation in different culture conditions. In the case of PYC1, a UAS in the region between -330/-297 and three repressing sequences with the common central core CCGCC at positions -457, -432 and -399 were identified. Specific binding of nuclear proteins to the -330/-214 DNA fragment was abolished in rtg mutants suggesting a role for the RTG genes in the control of PYC1 expression. In the case of the PYC2 promoter, elimination of a fragment from -417 to -291 brings about a two-fold decrease in the expression in repressed conditions and a similar increase in derepression.
Adorno, E V; Moura-Neto, J P; Lyra, I; Zanette, A; Santos, L F O; Seixas, M O; Reis, M G; Goncalves, M S
2008-02-01
The fetal hemoglobin (HbF) levels and betaS-globin gene haplotypes of 125 sickle cell anemia patients from Brazil were investigated. We sequenced the Ggamma- and Agamma-globin gene promoters and the DNase I-2 hypersensitive sites in the locus control regions (HS2-LCR) of patients with HbF level disparities as compared to their betaS haplotypes. Sixty-four (51.2%) patients had CAR/Ben genotype; 36 (28.8%) Ben/Ben; 18 (14.4%) CAR/CAR; 2 (1.6%) CAR/Atypical; 2 (1.6%) Ben/Cam; 1 (0.8%) CAR/Cam; 1 (0.8%) CAR/Arab-Indian, and 1 (0.8%) Sen/Atypical. The HS2-LCR sequence analyses demonstrated a c.-10.677G>A change in patients with the Ben haplotype and high HbF levels. The Gg gene promoter sequence analyses showed a c.-157T>C substitution shared by all patients, and a c.-222_-225del related to the Cam haplotype. These results identify new polymorphisms in the HS2-LCR and Gg-globin gene promoter. Further studies are required to determine the correlation between HbF synthesis and the clinical profile of sickle cell anemia patients.
DNA Methylation in Promoter Region as Biomarkers in Prostate Cancer
Yang, Mihi; Park, Jong Y.
2013-01-01
The prostate gland is the most common site of cancer and the second leading cause of cancer death in American men. Recent emerging molecular biological technologies help us to know that epigenetic alterations such as DNA methylation within the regulatory (promoter) regions of genes are associated with transcriptional silencing in cancer. Promoter hypermethylation of critical pathway genes could be potential biomarkers and therapeutic targets for prostate cancer. In this chapter, we updated current information on methylated genes associated with the development and progression of prostate cancer. Over 40 genes have been investigated for methylation in promoter region in prostate cancer. These methylated genes are involved in critical pathways, such as DNA repair, metabolism, and invasion/metastasis. The role of hypermethylated genes in regulation of critical pathways in prostate cancer is discussed. These findings may provide new information of the pathogenesis, the exciting potential to be predictive and to provide personalized treatment of prostate cancer. Indeed, some epigenetic alterations in prostate tumors are being translated into clinical practice for therapeutic use. PMID:22359288
DOE Office of Scientific and Technical Information (OSTI.GOV)
Lin, Biaoyang; Nasir, J.; Kalchman, M.A.
1995-02-10
We have previously cloned and characterized the murine homologue of the Huntington disease (HD) gene and shown that it maps to mouse chromosome 5 within a region of conserved synteny with human chromosome 4p16.3. Here we present a detailed comparison of the sequence of the putative promoter and the organization of the 5{prime} genomic region of the murine (Hdh) and human HD genes encompassing the first five exons. We show that in this region these two genes share identical exon boundaries, but have different-size introns. Two dinucleotide (CT) and one trinucleotide intronic polymorphism in Hdh and an intronic CA polymorphismmore » in the HD gene were identified. Comparison of 940-bp sequence 5{prime} to the putative translation start site reveals a highly conserved region (78.8% nucleotide identity) between Hdh and the HD gene from nucleotide -56 to -206 (of Hdh). Neither Hdh nor the HD gene have typical TATA or CCAAT elements, but both show one putative AP2 binding site and numerous potential Sp1 binding sites. The high sequence identity between Hdh and the HD gene for approximately 200 bp 5{prime} to the putative translation start site indicates that these sequences may play a role in regulating expression of the Huntington disease gene. 30 refs., 4 figs., 2 tabs.« less
Gene Regions Responding to Skeletal Muscle Atrophy
NASA Technical Reports Server (NTRS)
Booth, Frank W.
1997-01-01
Our stated specific aims for this project were: 1) Identify the region(s) of the mouse IIb myosin heavy chain (MHC) promoter necessary for in vivo expression in mouse fast-twitch muscle, and 2) Identify the region(s) of the mouse IIb MHC promoter responsive to immobilization in mouse slow-twitch muscle in vivo. We sought to address these specific aims by introducing various MHC IIb promoter/reporter gene constructs directly into the tibialis anterior and gastrocnemius muscles of living mice. Although the method of somatic gene transfer into skeletal muscle by direct injection has been successfully used in our laboratory to study the regulation of the skeletal alpha actin gene in chicken skeletal muscle, we had many difficulties utilizing this procedure in the mouse. Because of the small size of the mouse soleus and the difficulty in obtaining consistent results, we elected not to study this muscle as first proposed. Rather, our MHC IIb promoter deletion experiments were performed in the gastrocnemius. Further, we decided to use hindlimb unloading via tail suspension to induce an upregulation of the MHC IIb gene, rather than immobilization of the hindlimbs via plaster casts. This change was made because tail suspension more closely mimics spaceflight, and this procedure in our lab results in a smaller loss of overall body mass than the mouse hindlimb immobilization procedure. This suggests that the stress level during tail suspension is less than during immobilization. This research has provided an important beginning point towards understanding the molecular regulation of the MHC lIb gene in response to unweighting of skeletal muscle Future work will focus on the regulation of MHC IIb mRNA stability in response to altered loading of skeletal muscle
Bongiorni, Silvia; Tilesi, Francesca; Bicorgna, Silvia; Iacoponi, Francesca; Willems, Daniela; Gargani, Maria; D'Andrea, MariaSilvia; Pilla, Fabio; Valentini, Alessio
2014-11-07
Success of meat production and selection for improvement of meat quality is among the primary aims in animal production. Meat quality traits are economically important in swine; however, the underlying genetic nature is very complex. Therefore, an improved pork production strongly depends on identifying and studying how genetic variations contribute to modulate gene expression. Promoters are key regions in gene modulation as they harbour several binding motifs to transcription regulatory factors. Therefore, polymorphisms in these regions are likely to deeply affect RNA levels and consequently protein synthesis. In this study, we report the identification of single nucleotide polymorphisms (SNPs) in promoter regions of candidate genes involved in development, cellular differentiation and muscle growth in Sus scrofa. We identified SNPs in the promoter regions of genes belonging to the Myogenic Regulatory Factors (MRF) gene family (the Myogenic Differentiation gene, MYOD1) and to Growth and Differentiation Factors (GDF) gene family (Myostatin gene, MSTN, GDF8), in Casertana and Large White breeds. The purpose of this study was to investigate if polymorphisms in the promoters could affect the transcriptional activity of these genes. With this aim, we evaluated in vitro the functional activity of the luciferase reporter gene luc2 activity, driven by two constructs carrying different promoter haplotypes. We tested the effects of the G302A (U12574) transition on the promoter efficiency in MYOD1 gene. We ascertained a difference in transcription efficiency for the two variants. A stronger activity of the A-carrying construct is more evident in C2C12. The luciferase expression driven by the MYOD1-A allelic variant displayed a 3.8-fold increased transcriptional activity. We investigated the activity of two haplotype variants (AY527152) in the promoter of GDF8 gene. The haploptype-1 (A435-A447-A879) up-regulated the expression of the reporter gene by a two-fold increase, and
Tu, N; Chen, H; Winnikes, U; Reinert, I; Pirke, K M; Lentes, K U
2000-09-22
Uncoupling protein-3 (UCP3) is considered as an important regulator of energy expenditure and thermogenesis in humans. To get insight into the mechanisms regulating its expression we have cloned and characterized about 5 kb of the 5'-flanking region of the human UCP3 (hUCP3) gene. 5'-RACE analysis suggested a single transcription initiation site 187 bp upstream from the translational start site. The promoter region contains both TATA and CAAT boxes as well as consensus motifs for PPRE, TRE, CRE and muscle-specific factors like MyoD and MEF2 sites. Functional characterization of a 3 kb hUCP3 promoter fragment in multiple cell lines using a CAT-ELISA identified a cis-acting negative regulatory element between -2983 and -982 while the region between -982 and -284 showed greatly increased basal promoter activity suggesting the presence of a strong enhancer element. Promoter activity was particularly enhanced in the murine skeletal muscle cell line C2C12 reflecting the tissue-selective expression pattern of UCP3.
Heterologous gene expression driven by carbonic anhydrase gene promoter in Dunaliella salina
NASA Astrophysics Data System (ADS)
Chai, Yurong; Lu, Yumin; Wang, Tianyun; Hou, Weihong; Xue, Lexun
2006-12-01
Dunaliella salina, a halotolerant unicellular green alga without a rigid cell wall, can live in salinities ranging from 0.05 to 5 mol/L NaCl. These features of D. salina make it an ideal host for the production of antibodies, oral vaccine, and commercially valuable polypeptides. To produce high level of heterologous proteins from D. salina, highly efficient promoters are required to drive expression of target genes under controlled condition. In the present study, we cloned a 5' franking region of 1.4 kb from the carbonic anhydrase ( CAH) gene of D. salina by genomic walking and PCR. The fragment was ligated to the pMD18-T vector and characterized. Sequence analysis indicated that this region contained conserved motifs, including a TATA- like box and CAAT-box. Tandem (GT)n repeats that had a potential role of transcriptional control, were also found in this region. The transcription start site (TSS) of the CAH gene was determined by 5' RACE and nested PCR method. Transformation assays showed that the 1.4 kb fragment was able to drive expression of the selectable bar (bialaphos resistance) gene when the fusion was transformed into D. salina by biolistics. Northern blotting hybridizations showed that the bar transcript was most abundant in cells grown in 2 mol/L NaCl, and less abundant in 0.5 mol/L NaCl, indicating that expression of the bar gene was induced at high salinity. These results suggest the potential use of the CAH gene promoter to induce the expression of heterologous genes in D. salina under varied salt condition.
Insulators form gene loops by interacting with promoters in Drosophila.
Erokhin, Maksim; Davydova, Anna; Kyrchanova, Olga; Parshikov, Alexander; Georgiev, Pavel; Chetverina, Darya
2011-09-01
Chromatin insulators are regulatory elements involved in the modulation of enhancer-promoter communication. The 1A2 and Wari insulators are located immediately downstream of the Drosophila yellow and white genes, respectively. Using an assay based on the yeast GAL4 activator, we have found that both insulators are able to interact with their target promoters in transgenic lines, forming gene loops. The existence of an insulator-promoter loop is confirmed by the fact that insulator proteins could be detected on the promoter only in the presence of an insulator in the transgene. The upstream promoter regions, which are required for long-distance stimulation by enhancers, are not essential for promoter-insulator interactions. Both insulators support basal activity of the yellow and white promoters in eyes. Thus, the ability of insulators to interact with promoters might play an important role in the regulation of basal gene transcription.
Analysis of an osmotically regulated pathogenesis-related osmotin gene promoter.
Raghothama, K G; Liu, D; Nelson, D E; Hasegawa, P M; Bressan, R A
1993-12-01
Osmotin is a small (24 kDa), basic, pathogenesis-related protein, that accumulates during adaptation of tobacco (Nicotiana tabacum) cells to osmotic stress. There are more than 10 inducers that activate the osmotin gene in various plant tissues. The osmotin promoter contains several sequences bearing a high degree of similarity to ABRE, as-1 and E-8 cis element sequences. Gel retardation studies indicated the presence of at least two regions in the osmotin promoter that show specific interactions with nuclear factors isolated from cultured cells or leaves. The abundance of these binding factors increased in response to salt, ABA and ethylene. Nuclear factors protected a 35 bp sequence of the promoter from DNase I digestion. Different 5' deletions of the osmotin promoter cloned into a promoter-less GUSNOS plasmid (pBI 201) were used in transient expression studies with a Biolistic gun. The transient expression studies revealed the presence of three distinct regions in the osmotin promoter. The promoter sequence from -108 to -248 bp is absolutely required for reporter gene activity, followed by a long stretch (up to -1052) of enhancer-like sequence and then a sequence upstream of -1052, which appears to contain negative elements. The responses to ABA, ethylene, salt, desiccation and wounding appear to be associated with the -248 bp sequence of the promoter. This region also contains a putative ABRE (CACTGTG) core element. Activation of the osmotin gene by various inducers is discussed in view of antifungal activity of the osmotin protein.
Guo, Hongfang; Raza, Sayed Haidar Abbas; Schreurs, Nicola M; Khan, Rajwali; Wei, Dawei; Wang, Li; Zhang, Song; Zhang, Le; Wu, Sen; Ullah, Irfan; Hosseini, Seyed Mahdi; Zan, Linsen
2018-06-08
Krüppel-like factor 3 (KLF3), a member of the Krüppel-like factor (KLF) family, plays an important role in adipogenesis and lipid metabolism. The aim of this study was to investigate whether KLF3 could be used as a candidate gene in the breeding of cattle. The expression pattern of bovine KLF3 gene revealed that it was highly expressed in abdominal fat and perirenal fat. Using DNA sequencing, three single nucleotide polymorphisms (SNPs) within the promoter regions of KLF3 gene were identified in 448 Qinchuan cattle, which are located in the recognition sequences of 11 transcription factors and the four haplotypes representing four potential different compositions of polymorphic potential cis-acting elements. Association analysis results indicated that individuals with the Hap7/7 diplotype showed higher (P < 0.05) intramuscular fat content (IFC) than those with H7/8. In addition, the H7 haplotype had much higher (P < 0.05) transcriptional activity than the H8 haplotype, consistent with the association analysis. We speculated that polymorphisms in transcription factor binding sites of the KLF3 promoter region affected transcriptional activity of KLF3, which subsequently influence intramuscular fat content in Qinchuan cattle and KLF3 gene could be used as molecular markers for fat deposition traits using early marker-assisted selection (MAS) of Qinchuan cattle breeding in the future. Copyright © 2017. Published by Elsevier B.V.
Tetramethylpyrazine-Inducible Promoter Region from Rhodococcus jostii TMP1.
Stanislauskienė, Rūta; Kutanovas, Simonas; Kalinienė, Laura; Bratchikov, Maksim; Meškys, Rolandas
2018-06-25
An inducible promoter region, P TTMP (tetramethylpyrazine [TTMP]), has been identified upstream of the tpdABC operon, which contains the genes required for the initial degradation of 2,3,5,6-tetramethylpyrazine in Rhodococcus jostii TMP1 bacteria. In this work, the promoter region was fused with the gene for the enhanced green fluorescent protein (EGFP) to investigate the activity of P TTMP by measuring the fluorescence of bacteria. The highest promoter activity was observed when bacteria were grown in a nutrient broth (NB) medium supplemented with 5 mM 2,3,5,6-tetramethylpyrazine for 48 h. Using a primer extension reaction, two transcriptional start sites for tpdA were identified, and the putative −35 and −10 promoter motifs were determined. The minimal promoter along with two 15 bp long direct repeats and two 7 bp inverted sequences were identified. Also, the influence of the promoter elements on the activity of P TTMP were determined using site-directed mutagenesis. Furthermore, P TTMP was shown to be induced by pyrazine derivatives containing methyl groups in the 2- and 5-positions of the heterocyclic ring, in the presence of the LuxR family transcriptional activator TpdR.
Dunnick, Wesley A; Shi, Jian; Holden, Victoria; Fontaine, Clinton; Collins, John T
2011-01-01
Germline transcription precedes class switch recombination (CSR). The promoter regions and I exons of these germline transcripts include binding sites for activation- and cytokine-induced transcription factors, and the promoter regions/I exons are essential for CSR. Therefore, it is a strong hypothesis that the promoter/I exons regions are responsible for much of cytokine-regulated, gene-specific CSR. We tested this hypothesis by swapping the germline promoter and I exons for the murine γ1 and γ2a H chain genes in a transgene of the entire H chain C-region locus. We found that the promoter/I exon for γ1 germline transcripts can direct robust IL-4-induced recombination to the γ2a gene. In contrast, the promoter/I exon for the γ2a germline transcripts works poorly in the context of the γ1 H chain gene, resulting in expression of γ1 H chains that is <1% the wild-type level. Nevertheless, the small amount of recombination to the chimeric γ1 gene is induced by IFN-γ. These results suggest that cytokine regulation of CSR, but not the magnitude of CSR, is regulated by the promoter/I exons.
PUTATIVE GENE PROMOTER SEQUENCES IN THE CHLORELLA VIRUSES
Fitzgerald, Lisa A.; Boucher, Philip T.; Yanai-Balser, Giane; Suhre, Karsten; Graves, Michael V.; Van Etten, James L.
2008-01-01
Three short (7 to 9 nucleotides) highly conserved nucleotide sequences were identified in the putative promoter regions (150 bp upstream and 50 bp downstream of the ATG translation start site) of three members of the genus Chlorovirus, family Phycodnaviridae. Most of these sequences occurred in similar locations within the defined promoter regions. The sequence and location of the motifs were often conserved among homologous ORFs within the Chlorovirus family. One of these conserved sequences (AATGACA) is predominately associated with genes expressed early in virus replication. PMID:18768195
Rinder, H; Bayer, T A; Gertzen, E M; Hoffmann, W
1992-01-01
Ependymins are secretory products of meningeal cells and represent the predominant glycoproteins in the cerebrospinal fluid from various orders of teleost fish. In the zebrafish, their expression starts between 48 and 72 h post-fertilization. Generally, they share characteristics with proteins involved in cell-contact phenomena. Here, we characterize the ependymin gene from Brachydanio rerio and its flanking regions. The sequence was obtained from clones generated using the polymerase chain reaction (PCR), including a variation of an "anchored" PCR. Also, clones from a conventional phage library were analyzed. We found that the transcribed portion is arranged in six exons. Transient expression of an ependymin-promoter-lacZ gene fusion in zebrafish embryos revealed that the 2.0-kb upstream regulatory region used is sufficient to direct the ependymin-specific correct temporal and spatial expression pattern of the lacZ reporter gene.
Functional Analysis of Promoter Region from Eel Cytochrome P450 1A1 Gene in Transgenic Medaka.
Ogino; Itakura; Kato; Aoki; Sato
1999-07-01
: Transcription of the CYP1A1 genes in mammals and fish is stimulated by polyaromatic hydrocarbons. DNA sequencing analysis revealed that CYP1A1 gene in eel (Anguilla japonica) contains two kinds of putative cis-acting regulatory elements, XRE (xenobiotic-responsive element) and ERE (estrogen-responsive element). XRE is known as the enhancer that is responsible for the inducibility of the genes of CYP1A1 and some other drug-metabolizing enzymes. In the eel CYP1A1 gene, XRE motifs are distributed as follows: five times in the region from -2136 to -1125 bp, XRE(-6) to (-2); once in the proximal basal promoter region, XRE(-1); and once in the first intron, XRE(+1). The region between XRE(-2) and XRE(-1) contains three ERE motifs. To investigate the function of the cis-acting regulatory elements in the eel CYP1A1 gene, recombinant plasmids prepared with its 5' upstream sequence and the structural gene for luciferase were microinjected into fertilized eggs of medaka at the one-cell stage. Hatched fry were treated with 3-methylcholanthrene, and the transcription efficiency was assayed using competitive polymerase chain reaction analysis. Deletion of the region containing the five XREs, XRE(-6) to XRE(-2), and the point mutation of XRE(-1) reduced the inducible expressions by 75% and 56%, respectively, showing apparent dependency of the drug induction on the XREs. Constitutive expression, however, was not significantly affected by deletion or disruption of the XREs. When the region between XRE(-2) and XRE(-1) containing no XREs but three ERE motifs was internally deleted, the inducible expression and the constitutive expression were reduced by 88% and 75%, respectively. Replacement of this region with a partial fragment of eel CYP1A1 complementary DNA, with slight alteration of the distance between the five XREs and XRE(-1), reduced the inducible expression and the constitutive expression by 91% and 60%, respectively. These results strongly suggest that not only XRE but
Harada, S; Okubo, T; Tsutsumi, M; Takase, S; Muramatsu, T
1998-05-01
Neuropeptide cholecystokinin (CCK) and the CCK receptors in the central nervous system mediate actions on increasing firings, anxiety, and nociceptions. Furthermore, CCK modulates the release of dopamine and dopamine-related behaviors in the mesolimbic pathway. In our study, genetic variation in the promoter and coding regions of the prepro-CCK gene were analyzed among 66 Japanese, 66 American Whites, 54 Chinese, and 41 Colombian natives. Two nucleotide sequence variants were found: a frequent mutation at nucleotide position -45 C to T involved in core sequence of Sp1 binding cis-element of the promoter region, and a C to T substitution at the 1662 position in intron 2. Analysis for the segregation study in 10 families of twins confirmed codominant heredity of two alleles. Distribution of genotypes and gene frequencies of 66 controls and 108 alcoholics in Japan presented that allelic variant T type in alcoholics was found in higher frequencies than that of controls, and distribution of these genotypes was significantly different between the both groups.
Multiple mobile promoter regions for the rare carbapenem resistance gene of Bacteroides fragilis.
Podglajen, I; Breuil, J; Rohaut, A; Monsempes, C; Collatz, E
2001-06-01
Two novel insertion sequences (IS), IS1187 and IS1188, are described upstream from the carbapenem resistance gene cfiA in strains of Bacteroides fragilis. Mapping, with the RACE procedure, of transcription start sites of cfiA in these and two other previously reported IS showed that transcription of this rarely encountered gene is initiated close to a variety of B. fragilis consensus promoter sequences, as recently defined (D. P. Bayley, E. R. Rocha, and C. J. Smith, FEMS Microbiol. Lett. 193:149-154, 2000). In the cases of IS1186 and IS1188, these sequences overlap with putative Esigma(70) promoter sequences, while in IS942 and IS1187 such sequences can be observed either upstream or downstream of the B. fragilis promoters.
Identification of a set of genes showing regionally enriched expression in the mouse brain
D'Souza, Cletus A; Chopra, Vikramjit; Varhol, Richard; Xie, Yuan-Yun; Bohacec, Slavita; Zhao, Yongjun; Lee, Lisa LC; Bilenky, Mikhail; Portales-Casamar, Elodie; He, An; Wasserman, Wyeth W; Goldowitz, Daniel; Marra, Marco A; Holt, Robert A; Simpson, Elizabeth M; Jones, Steven JM
2008-01-01
Background The Pleiades Promoter Project aims to improve gene therapy by designing human mini-promoters (< 4 kb) that drive gene expression in specific brain regions or cell-types of therapeutic interest. Our goal was to first identify genes displaying regionally enriched expression in the mouse brain so that promoters designed from orthologous human genes can then be tested to drive reporter expression in a similar pattern in the mouse brain. Results We have utilized LongSAGE to identify regionally enriched transcripts in the adult mouse brain. As supplemental strategies, we also performed a meta-analysis of published literature and inspected the Allen Brain Atlas in situ hybridization data. From a set of approximately 30,000 mouse genes, 237 were identified as showing specific or enriched expression in 30 target regions of the mouse brain. GO term over-representation among these genes revealed co-involvement in various aspects of central nervous system development and physiology. Conclusion Using a multi-faceted expression validation approach, we have identified mouse genes whose human orthologs are good candidates for design of mini-promoters. These mouse genes represent molecular markers in several discrete brain regions/cell-types, which could potentially provide a mechanistic explanation of unique functions performed by each region. This set of markers may also serve as a resource for further studies of gene regulatory elements influencing brain expression. PMID:18625066
Identification of a set of genes showing regionally enriched expression in the mouse brain.
D'Souza, Cletus A; Chopra, Vikramjit; Varhol, Richard; Xie, Yuan-Yun; Bohacec, Slavita; Zhao, Yongjun; Lee, Lisa L C; Bilenky, Mikhail; Portales-Casamar, Elodie; He, An; Wasserman, Wyeth W; Goldowitz, Daniel; Marra, Marco A; Holt, Robert A; Simpson, Elizabeth M; Jones, Steven J M
2008-07-14
The Pleiades Promoter Project aims to improve gene therapy by designing human mini-promoters (< 4 kb) that drive gene expression in specific brain regions or cell-types of therapeutic interest. Our goal was to first identify genes displaying regionally enriched expression in the mouse brain so that promoters designed from orthologous human genes can then be tested to drive reporter expression in a similar pattern in the mouse brain. We have utilized LongSAGE to identify regionally enriched transcripts in the adult mouse brain. As supplemental strategies, we also performed a meta-analysis of published literature and inspected the Allen Brain Atlas in situ hybridization data. From a set of approximately 30,000 mouse genes, 237 were identified as showing specific or enriched expression in 30 target regions of the mouse brain. GO term over-representation among these genes revealed co-involvement in various aspects of central nervous system development and physiology. Using a multi-faceted expression validation approach, we have identified mouse genes whose human orthologs are good candidates for design of mini-promoters. These mouse genes represent molecular markers in several discrete brain regions/cell-types, which could potentially provide a mechanistic explanation of unique functions performed by each region. This set of markers may also serve as a resource for further studies of gene regulatory elements influencing brain expression.
Characterization of carotenoid hydroxylase gene promoter in Haematococcus pluvialis.
Meng, C X; Wei, W; Su, Z- L; Qin, S
2006-10-01
Astaxanthin, a high-value ketocarotenoid is mainly used in fish aquaculture. It also has potential in human health due to its higher antioxidant capacity than beta-carotene and vitamin E. The unicellular green alga Haematococcus pluvialis is known to accumulate astaxanthin in response to environmental stresses, such as high light intensity and salt stress. Carotenoid hydroxylase plays a key role in astaxanthin biosynthesis in H. pluvialis. In this paper, we report the characterization of a promoter-like region (-378 to -22 bp) of carotenoid hydroxylase gene by cloning, sequence analysis and functional verification of its 919 bp 5'-flanking region in H. pluvialis. The 5'-flanking region was characterized using micro-particle bombardment method and transient expression of LacZ reporter gene. Results of sequence analysis showed that the 5'-flanking region might have putative cis-acting elements, such as ABA (abscisic acid)-responsive element (ABRE), C-repeat/dehydration responsive element (C-repeat/DRE), ethylene-responsive element (ERE), heat-shock element (HSE), wound-responsive element (WUN-motif), gibberellin-responsive element (P-box), MYB-binding site (MBS) etc., except for typical TATA and CCAAT boxes. Results of 5' deletions construct and beta-galactosidase assays revealed that a highest promoter-like region might exist from -378 to -22 bp and some negative regulatory elements might lie in the region from -919 to -378 bp. Results of site-directed mutagenesis of a putative C-repeat/DRE and an ABRE-like motif in the promoter-like region (-378 to -22 bp) indicated that the putative C-repeat/DRE and ABRE-like motif might be important for expression of carotenoid hydroxylase gene.
The human oxytocin gene promoter is regulated by estrogens.
Richard, S; Zingg, H H
1990-04-15
Gonadal steroids affect brain function primarily by altering the expression of specific genes, yet the specific mechanisms by which neuronal target genes undergo such regulation are unknown. Recent evidence suggests that the expression of the neuropeptide gene for oxytocin (OT) is modulated by estrogens. We therefore examined the possibility that this regulation occurred via a direct interaction of the estrogen-receptor complex with cis-acting elements flanking the OT gene. DNA-mediated gene transfer experiments were performed using Neuro-2a neuroblastoma cells and chimeric plasmids containing portions of the human OT gene 5'-glanking region linked to the chloramphenicol acetyltransferase gene. We identified a 19-base pair region located at -164 to -146 upstream of the transcription start site which is capable of conferring estrogen responsiveness to the homologous as well as to a heterologous promoter. The hormonal response is strictly dependent on the presence of intracellular estrogen receptors, since estrogen induced stimulation occurred only in Neuro-2a cells co-transfected with an expression vector for the human estrogen receptor. The identified region contains a novel imperfect palindrome (GGTGACCTTGACC) with sequence similarity to other estrogen response elements (EREs). To define cis-acting elements that function in synergism with the ERE, sequences 3' to the ERE were deleted, including the CCAAT box, two additional motifs corresponding to the right half of the ERE palindrome (TGACC), as well as a CTGCTAA heptamer similar to the "elegans box" found in Caenorhabditis elegans. Interestingly, optimal function of the identified ERE was fully independent of these elements and only required a short promoter region (-49 to +36). Our studies define a molecular mechanism by which estrogens can directly modulate OT gene expression. However, only a subset of OT neurons are capable of binding estrogens, therefore, direct action of estrogens on the OT gene may be
In vitro mapping of Myotonic Dystrophy (DM) gene promoter
DOE Office of Scientific and Technical Information (OSTI.GOV)
Storbeck, C.J.; Sabourin, L.; Baird, S.
1994-09-01
The Myotonic Dystrophy Kinase (DMK) gene has been cloned and shared homology to serine/threonine protein kinases. Overexpression of this gene in stably transfected mouse myoblasts has been shown to inhibit fusion into myotubes while myoblasts stably transfected with an antisense construct show increased fusion potential. These experiments, along with data showing that the DM gene is highly expressed in muscle have highlighted the possibility of DMK being involved in myogenesis. The promoter region of the DM gene lacks a consensus TATA box and CAAT box, but harbours numerous transcription binding sites. Clones containing extended 5{prime} upstream sequences (UPS) of DMKmore » only weakly drive the reporter gene chloramphenicol acetyl transferase (CAT) when transfected into C2C12 mouse myoblasts. However, four E-boxes are present in the first intron of the DM gene and transient assays show increased expression of the CAT gene when the first intron is present downstream of these 5{prime} UPS in an orientation dependent manner. Comparison between mouse and human sequence reveals that the regions in the first intron where the E-boxes are located are highly conserved. The mapping of the promoter and the importance of the first intron in the control of DMK expression will be presented.« less
Alternative splicing and promoter use in TFII-I genes
Makeyev, Aleksandr V.; Bayarsaihan, Dashzeveg
2008-01-01
TFII-I proteins are ubiquitously expressed transcriptional factors involved in both basal transcription and signal transduction activation or repression. TFII-I proteins are detected as early as at two-cell stage and exhibit distinct and dynamic expression patterns in developing embryos as well as mark regional variation in the adult mouse brain. Analysis of atypical small and rare chromosomal deletions at 7q11.23 points to TFII-I genes (GTF2I and GTF2IRD1) as the prime candidates responsible for craniofacial and cognitive abnormalities in the Williams-Beuren syndrome. TFII-I genes are often subjected to alternative splicing, which generates isoforms that that show different activities and play distinct biological roles. The coding regions of TFII-I genes are composed of more than 30 exons and are well conserved among vertebrates. However, their 5′ untranslated regions are not as well conserved and all poorly characterized. In the present work, we analyzed promoter regions of TFII-I genes and described their additional exons, as well as tested tissue specificity of both previously reported and novel alternatively spliced isoforms. Our comprehensive analysis leads to further elucidation of the functional heterogeneity of TFII-I proteins, provides hints on search for regulatory pathways governing their expression, and opens up possibilities for examining the effect of different haplotypes on their promoter functions. PMID:19111598
Alternative splicing and promoter use in TFII-I genes.
Makeyev, Aleksandr V; Bayarsaihan, Dashzeveg
2009-03-15
TFII-I proteins are ubiquitously expressed transcriptional factors involved in both basal transcription and signal transduction activation or repression. TFII-I proteins are detected as early as at two-cell stage and exhibit distinct and dynamic expression patterns in developing embryos as well as mark regional variation in the adult mouse brain. Analysis of atypical small and rare chromosomal deletions at 7q11.23 points to TFII-I genes (GTF2I and GTF2IRD1) as the prime candidates responsible for craniofacial and cognitive abnormalities in the Williams-Beuren syndrome. TFII-I genes are often subjected to alternative splicing, which generates isoforms that show different activities and play distinct biological roles. The coding regions of TFII-I genes are composed of more than 30 exons and are well conserved among vertebrates. However, their 5' untranslated regions are not as well conserved and all poorly characterized. In the present work, we analyzed promoter regions of TFII-I genes and described their additional exons, as well as tested tissue specificity of both previously reported and novel alternatively spliced isoforms. Our comprehensive analysis leads to further elucidation of the functional heterogeneity of TFII-I proteins, provides hints on search for regulatory pathways governing their expression, and opens up possibilities for examining the effect of different haplotypes on their promoter functions.
Degl'Innocenti, Andrea
2016-01-01
Background In vertebrates, several anatomical regions located within the nasal cavity mediate olfaction. Among these, the main olfactory epithelium detects most conventional odorants. Olfactory sensory neurons, provided with cilia exposed to the air, detect volatile chemicals via an extremely large family of seven-transmembrane chemoreceptors named odorant receptors. Their genes are expressed in a monogenic and monoallelic fashion: a single allele of a single odorant receptor gene is transcribed in a given mature neuron, through a still uncharacterized molecular mechanism known as odorant receptor gene choice. Aim Odorant receptor genes are typically arranged in genomic clusters, but a few are isolated (we call them solitary) from the others within a region broader than 1 Mb upstream and downstream with respect to their transcript's coordinates. The study of clustered genes is problematic, because of redundancy and ambiguities in their regulatory elements: we propose to use the solitary genes as simplified models to understand odorant receptor gene choice. Procedures Here we define number and identity of the solitary genes in the mouse genome (C57BL/6J), and assess the conservation of the solitary status in some mammalian orthologs. Furthermore, we locate their putative promoters, predict their homeodomain binding sites (commonly present in the promoters of odorant receptor genes) and compare candidate promoter sequences with those of wild-caught mice. We also provide expression data from histological sections. Results In the mouse genome there are eight intact solitary genes: Olfr19 (M12), Olfr49, Olfr266, Olfr267, Olfr370, Olfr371, Olfr466, Olfr1402; five are conserved as solitary in rat. These genes are all expressed in the main olfactory epithelium of three-day-old mice. The C57BL/6J candidate promoter of Olfr370 has considerably varied compared to its wild-type counterpart. Within the putative promoter for Olfr266 a homeodomain binding site is predicted. As a
Degl'Innocenti, Andrea; Parrilla, Marta; Harr, Bettina; Teschke, Meike
2016-01-01
In vertebrates, several anatomical regions located within the nasal cavity mediate olfaction. Among these, the main olfactory epithelium detects most conventional odorants. Olfactory sensory neurons, provided with cilia exposed to the air, detect volatile chemicals via an extremely large family of seven-transmembrane chemoreceptors named odorant receptors. Their genes are expressed in a monogenic and monoallelic fashion: a single allele of a single odorant receptor gene is transcribed in a given mature neuron, through a still uncharacterized molecular mechanism known as odorant receptor gene choice. Odorant receptor genes are typically arranged in genomic clusters, but a few are isolated (we call them solitary) from the others within a region broader than 1 Mb upstream and downstream with respect to their transcript's coordinates. The study of clustered genes is problematic, because of redundancy and ambiguities in their regulatory elements: we propose to use the solitary genes as simplified models to understand odorant receptor gene choice. Here we define number and identity of the solitary genes in the mouse genome (C57BL/6J), and assess the conservation of the solitary status in some mammalian orthologs. Furthermore, we locate their putative promoters, predict their homeodomain binding sites (commonly present in the promoters of odorant receptor genes) and compare candidate promoter sequences with those of wild-caught mice. We also provide expression data from histological sections. In the mouse genome there are eight intact solitary genes: Olfr19 (M12), Olfr49, Olfr266, Olfr267, Olfr370, Olfr371, Olfr466, Olfr1402; five are conserved as solitary in rat. These genes are all expressed in the main olfactory epithelium of three-day-old mice. The C57BL/6J candidate promoter of Olfr370 has considerably varied compared to its wild-type counterpart. Within the putative promoter for Olfr266 a homeodomain binding site is predicted. As a whole, our findings favor Olfr266
Zebrafish U6 small nuclear RNA gene promoters contain a SPH element in an unusual location.
Halbig, Kari M; Lekven, Arne C; Kunkel, Gary R
2008-09-15
Promoters for vertebrate small nuclear RNA (snRNA) genes contain a relatively simple array of transcriptional control elements, divided into proximal and distal regions. Most of these genes are transcribed by RNA polymerase II (e.g., U1, U2), whereas the U6 gene is transcribed by RNA polymerase III. Previously identified vertebrate U6 snRNA gene promoters consist of a proximal sequence element (PSE) and TATA element in the proximal region, plus a distal region with octamer (OCT) and SphI postoctamer homology (SPH) elements. We have found that zebrafish U6 snRNA promoters contain the SPH element in a novel proximal position immediately upstream of the TATA element. The zebrafish SPH element is recognized by SPH-binding factor/selenocysteine tRNA gene transcription activating factor/zinc finger protein 143 (SBF/Staf/ZNF143) in vitro. Furthermore, a zebrafish U6 promoter with a defective SPH element is inefficiently transcribed when injected into embryos.
The role of ghrelin and ghrelin-receptor gene variants and promoter activity in type 2 diabetes.
Garcia, Edwin A; King, Peter; Sidhu, Kally; Ohgusu, Hideko; Walley, Andrew; Lecoeur, Cecile; Gueorguiev, Maria; Khalaf, Sahira; Davies, Derek; Grossman, Ashley B; Kojima, Masayasu; Petersenn, Stephan; Froguel, Phillipe; Korbonits, Márta
2009-08-01
Ghrelin and its receptor play an important role in glucose metabolism and energy homeostasis, and therefore they are functional candidates for genes carrying susceptibility alleles for type 2 diabetes. We assessed common genetic variation of the ghrelin (GHRL; five single nucleotide polymorphisms (SNP)) and the ghrelin-receptor (GHSR) genes (four SNPs) in 610 Caucasian patients with type 2 diabetes and 820 controls. In addition, promoter reporter assays were conducted to model the regulatory regions of both genes. Neither GHRL nor GHSR gene SNPs were associated with type 2 diabetes. One of the ghrelin haplotypes showed a marginal protective role in type 2 diabetes. We observed profound differences in the regulation of the GHRL gene according to promoter sequence variants. There are three different GHRL promoter haplotypes represented in the studied cohort causing up to 45% difference in the level of gene expression, while the promoter region of GHSR gene is primarily represented by a single haplotype. The GHRL and GHSR gene variants are not associated with type 2 diabetes, although GHRL promoter variants have significantly different activities.
Molecular and functional characterization of the promoter of ETS2, the human c-ets-2 gene.
Mavrothalassitis, G J; Watson, D K; Papas, T S
1990-01-01
The 5' end of the human c-ets-2 gene, ETS2, was cloned and characterized. The major transcription initiation start sites were identified, and the pertinent sequences surrounding the ETS2 promoter were determined. The promoter region of ETS2 does not possess typical "TATA" and "CAAT" elements. However, this promoter contains several repeat regions, as well as two consensus AP2 binding sites and three putative Sp1 sites. There is also a palindromic region similar to the serum response element of the c-fos gene, located 1400 base pairs (bp) upstream from the first major transcription initiation site. A G + C-rich sequence (GC element) with dyad symmetry can be seen in the ETS2 promoter, immediately following an unusually long (approximately 250-bp) polypurine-polypyrimidine tract. A series of deletion fragments from the putative promoter region were ligated in front of the bacterial chloramphenicol acetyltransferase gene and tested for activity following transfection into HeLa cells. The 5' boundary of the region needed for maximum promoter activity was found to be 159 bp upstream of the major initiation site. This region of 159 bp contains putative binding sites for transcription factors Sp1 and AP2 (one for each), the GC element, one small forward repeat, one inverted repeat, and half of the polypurine-pyrimidine tract. The promoter of ETS2 (within the polypyrimidine tract) serves to illustrate an alternative structure that may be present in genes with "TATA-less" promoters. Images PMID:2405393
[Divergence of paralogous growth-hormone-encoding genes and their promoters in Salmonidae].
Kamenskaya, D N; Pankova, M V; Atopkin, D M; Brykov, V A
2017-01-01
In many fish species, including salmonids, the growth-hormone is encoded by two duplicated paralogous genes, gh1 and gh2. Both genes were already in place at the time of divergence of species in this group. A comparison of the entire sequence of these genes of salmonids has shown that their conserved regions are associated with exons, while their most variable regions correspond to introns. Introns C and D include putative regulatory elements (sites Pit-1, CRE, and ERE), that are also conserved. In chars, the degree of polymorphism of gh2 gene is 2-3 times as large as that in gh1 gene. However, a comparison across all Salmonidae species would not extent this observation to other species. In both these chars' genes, the promoters are conserved mainly because they correspond to putative regulatory sequences (TATA box, binding sites for the pituitary transcription factor Pit-1 (F1-F4), CRE, GRE and RAR/RXR elements). The promoter of gh2 gene has a greater degree of polymorphism compared with gh1 gene promoter in all investigated species of salmonids. The observed differences in the rates of accumulation of changes in growth hormone encoding paralogs could be explained by differences in the intensity of selection.
Comparative analysis of myostatin gene and promoter sequences of Qinchuan and Red Angus cattle.
He, Y L; Wu, Y H; Quan, F S; Liu, Y G; Zhang, Y
2013-09-04
To better understand the function of the myostatin gene and its promoter region in bovine, we amplified and sequenced the myostatin gene and promoter from the blood of Qinchuan and Red Angus cattle by using polymerase chain reaction. The sequences of Qinchuan and Red Angus cattle were compared with those of other cattle breeds available in GenBank. Exon splice sites were confirmed by mRNA sequencing. Compared to the published sequence (GenBank accession No. AF320998), 69 single nucleotide polymorphisms (SNPs) were identified in the Qinchuan myostatin gene, only one of which was an insertion mutation in Qinchuan cattle. There was a 16-bp insertion in the first 705-bp intron in 3 Qinchuan cattle. A total of 7 SNPs were identified in exon 3, in which the mutation occurred in the third base of the codon and was synonymous. On comparing the Qinchuan myostatin gene sequence to that of Red Angus cattle, a total of 50 SNPs were identified in the first and third exons. In addition, there were 18 SNPs identified in the Qinchuan cattle promoter region compared with those of other cattle compared to the Red Angus cattle myostatin promoter region. breeds (GenBank accession No. AF348479), but only 14 SNPs when compared to the Red Angus cattle myostatin promoter region.
Kasahara, Koji; Ohyama, Yoshifumi; Kokubo, Tetsuro
2011-01-01
Saccharomyces cerevisiae Hmo1 binds to the promoters of ∼70% of ribosomal protein genes (RPGs) at high occupancy, but is observed at lower occupancy on the remaining RPG promoters. In Δhmo1 cells, the transcription start site (TSS) of the Hmo1-enriched RPS5 promoter shifted upstream, while the TSS of the Hmo1-limited RPL10 promoter did not shift. Analyses of chimeric RPS5/RPL10 promoters revealed a region between the RPS5 upstream activating sequence (UAS) and core promoter, termed the intervening region (IVR), responsible for strong Hmo1 binding and an upstream TSS shift in Δhmo1 cells. Chromatin immunoprecipitation analyses showed that the RPS5-IVR resides within a nucleosome-free region and that pre-initiation complex (PIC) assembly occurs at a site between the IVR and a nucleosome overlapping the TSS (+1 nucleosome). The PIC assembly site was shifted upstream in Δhmo1 cells on this promoter, indicating that Hmo1 normally masks the RPS5-IVR to prevent PIC assembly at inappropriate site(s). This novel mechanism ensures accurate transcriptional initiation by delineating the 5′- and 3′-boundaries of the PIC assembly zone. PMID:21288884
Characterization of the human UDP-galactose:ceramide galactosyltransferase gene promoter.
Tencomnao, T; Yu, R K; Kapitonov, D
2001-02-16
UDP-galactose:ceramide galactosyltransferase (CGT, EC 2.4.1.45) is a key enzyme in the biosynthesis of galactocerebroside, the most abundant glycosphingolipid in the myelin sheath. An 8 kb fragment upstream from the transcription initiation site of CGT gene was isolated from a human genomic DNA library. Primer extension analysis revealed a single transcription initiation site 329 bp upstream from the ATG start codon. Neither a consensus TATA nor a CCAAT box was identified in the proximity to the transcription start site; however, this region contains a high GC content and multiple putative regulatory elements. To investigate the transcriptional regulation of CGT, a series of 5' deletion constructs of the 5'-flanking region were generated and cloned upstream from the luciferase reporter gene. By comparing promoter activity in the human oligodendroglioma (HOG) and human neuroblastoma (LAN-5) cell lines, we found that the CGT promoter functions in a cell type-specific manner. Three positive cis-acting regulatory regions were identified, including a proximal region at -292/-256 which contains the potential binding sites for known transcription factors (TFs) such as Ets and SP1 (GC box), a distal region at -747/-688 comprising a number of binding sites such as the ERE half-site, NF1-like, TGGCA-BP, and CRE, and a third positive cis-acting region distally localized at -1325/-1083 consisting of binding sites for TFs such as nitrogen regulatory, TCF-1, TGGCA-BP, NF-IL6, CF1, bHLH, NF1-like, GATA, and gamma-IRE. A negative cis-acting domain localized in a far distal region at -1594/-1326 was also identified. Our results suggest the presence of both positive and negative cis-regulatory regions essential for the cell-specific expression in the TATA-less promoter of the human CGT gene.
Grichnik, J M; French, B A; Schwartz, R J
1988-01-01
The chicken skeletal alpha-actin gene promoter region (-202 to -12) provides myogenic transcriptional specificity. This promoter contains partial dyad symmetry about an axis at nucleotide -108 and in transfection experiments is capable of directing transcription in a bidirectional manner. At least three different transcription initiation start sites, oriented toward upstream sequences, were mapped 25 to 30 base pairs from TATA-like regions. The opposing transcriptional activity was potentiated upon the deletion of sequences proximal to the alpha-actin transcription start site. Thus, sequences which serve to position RNA polymerase for alpha-actin transcription may allow, in their absence, the selection of alternative and reverse-oriented start sites. Nuclear runoff transcription assays of embryonic muscle indicated that divergent transcription may occur in vivo but with rapid turnover of nuclear transcripts. Divergent transcriptional activity enabled us to define the 3' regulatory boundary of the skeletal alpha-actin promoter which retains a high level of myogenic transcriptional activity. The 3' regulatory border was detected when serial 3' deletions bisected the element (-91 CCAAA TATGG -82) which reduced transcriptional activity by 80%. Previously we showed that disruption of its upstream counterpart (-127 CCAAAGAAGG -136) resulted in about a 90% decrease in activity. These element pairs, which we describe as CCAAT box-associated repeats, are conserved in all sequenced vertebrate sarcomeric actin genes and may act in a cooperative manner to facilitate transcription in myogenic cells. Images PMID:3211124
Oliveira, Lucas Boeno; Louvanto, Karolina; Ramanakumar, Agnihotram V; Franco, Eduardo L; Villa, Luisa L
2013-08-01
Polymorphism in the Toll-like receptor (TLR) 9 gene has been shown to have a significant role in some diseases; however, little is known about its possible role in the natural history of human papillomavirus (HPV) infections. We investigated the association between a single-nucleotide polymorphism (SNP) (rs5743836) in the promoter region of TLR9 (T1237C) and type-specific HPV infections. Specimens were derived from a cohort of 2462 women enrolled in the Ludwig-McGill Cohort Study. We randomly selected 500 women who had a cervical HPV infection detected at least once during the study as cases. We defined two control groups: (i) a random sample of 300 women who always tested HPV negative, and (ii) a sample of 234 women who were always HPV negative but had a minimum of ten visits during the study. TLR9 genotyping was performed using bidirectional PCR amplification of specific alleles. Irrespective of group, the WT homozygous TLR9 genotype (TT) was the most common form, followed by the heterozygous (TC) and the mutant homozygous (CC) forms. There were no consistent associations between polymorphism and infection risk, either overall or by type or species. Likewise, there were no consistently significant associations between polymorphism and HPV clearance or persistence. We concluded that this polymorphism in the promoter region of TLR9 gene does not seem to have a mediating role in the natural history of the HPV infection.
Stadler, Florian; Kolb, Gabriele; Rubusch, Lothar; Baker, Stephen P; Jones, Edward G; Akbarian, Schahram
2005-07-01
Glutamatergic signaling is regulated, in part, through differential expression of NMDA and AMPA/KA channel subunits and G protein-coupled metabotropic receptors. In human brain, region-specific expression patterns of glutamate receptor genes are maintained over the course of decades, suggesting a role for molecular mechanisms involved in long-term regulation of transcription, including methylation of lysine residues at histone N-terminal tails. Using a native chromatin immunoprecipitation assay, we studied histone methylation marks at proximal promoters of 16 ionotropic and metabotropic glutamate receptor genes (GRIN1,2A-D; GRIA1,3,4; GRIK2,4,5; GRM1,3,4,6,7 ) in cerebellar cortex collected across a wide age range from midgestation to 90 years old. Levels of di- and trimethylated histone H3-lysine 4, which are associated with open chromatin and transcription, showed significant differences between promoters and a robust correlation with corresponding mRNA levels in immature and mature cerebellar cortex. In contrast, levels of trimethylated H3-lysine 27 and H4-lysine 20, two histone modifications defining silenced or condensed chromatin, did not correlate with transcription but were up-regulated overall in adult cerebellum. Furthermore, differential gene expression patterns in prefrontal and cerebellar cortex were reflected by similar differences in H3-lysine 4 methylation at promoters. Together, these findings suggest that histone lysine methylation at gene promoters is involved in developmental regulation and maintenance of region-specific expression patterns of ionotropic and metabotropic glutamate receptors. The association of a specific epigenetic mark, H3-(methyl)-lysine 4, with the molecular architecture of glutamatergic signaling in human brain has potential implications for schizophrenia and other disorders with altered glutamate receptor function.
Aberrant methylation in the promoter region of cancer-related genes leads to gene transcriptional inactivation and plays an integral role in lung tumorigenesis. Recent studies demonstrated that promoter methylation was detected not only in lung tumors from patients with lung canc...
Eukaryotic genomes may exhibit up to 10 generic classes of gene promoters.
Gagniuc, Paul; Ionescu-Tirgoviste, Constantin
2012-09-28
The main function of gene promoters appears to be the integration of different gene products in their biological pathways in order to maintain homeostasis. Generally, promoters have been classified in two major classes, namely TATA and CpG. Nevertheless, many genes using the same combinatorial formation of transcription factors have different gene expression patterns. Accordingly, we tried to ask ourselves some fundamental questions: Why certain genes have an overall predisposition for higher gene expression levels than others? What causes such a predisposition? Is there a structural relationship of these sequences in different tissues? Is there a strong phylogenetic relationship between promoters of closely related species? In order to gain valuable insights into different promoter regions, we obtained a series of image-based patterns which allowed us to identify 10 generic classes of promoters. A comprehensive analysis was undertaken for promoter sequences from Arabidopsis thaliana, Drosophila melanogaster, Homo sapiens and Oryza sativa, and a more extensive analysis of tissue-specific promoters in humans. We observed a clear preference for these species to use certain classes of promoters for specific biological processes. Moreover, in humans, we found that different tissues use distinct classes of promoters, reflecting an emerging promoter network. Depending on the tissue type, comparisons made between these classes of promoters reveal a complementarity between their patterns whereas some other classes of promoters have been observed to occur in competition. Furthermore, we also noticed the existence of some transitional states between these classes of promoters that may explain certain evolutionary mechanisms, which suggest a possible predisposition for specific levels of gene expression and perhaps for a different number of factors responsible for triggering gene expression. Our conclusions are based on comprehensive data from three different databases and a
[Gene promoter methylation in glucose-6-phosphate dehydrogenase deficiency].
Xu, Dan-Dan; Wen, Fei-Qiu; Lv, Rong-Yu; Zhang, Min; Chen, Yun-Sheng; Chen, Xiao-Wen
2016-05-01
To investigate the features of methylation in the promoter region of glucose-6-phosphate dehydrogenase (G6PD) gene and the association between gene promoter methylation and G6PD deficiency. Fluorescent quantitative PCR was used to measure the mRNA expression of G6PD in 130 children with G6PD deficiency. Sixty-five children without G6PD deficiency served as the control group. The methylation-sensitive high-resolution melting curve analysis and bisulfite PCR sequencing were used to analyze gene promoter methylation in 22 children with G6PD deficiency and low G6PD mRNA expression. The G6PD gene promoter methylation was analyzed in 44 girls with normal G6PD mRNA expression (7 from G6PD deficiency group and 37 from control group). Twenty-two (16.9%) children with G6PD deficiency had relatively low mRNA expression of G6PD; among whom, 16 boys showed no methylation, and 6 girls showed partial methylation. Among the 44 girls with normal G6PD mRNA expression, 40 showed partial methylation, and 4 showed no methylation (1 case in the G6PD group and 3 cases in the control group). Gene promoter methylation is not associated with G6PD deficiency in boys. Girls have partial methylation or no methylation in the G6PD gene, suggesting that the methylation may be related to G6PD deficiency in girls.
Ramis, Ivy Bastos; Vianna, Júlia Silveira; Halicki, Priscila Cristina Bartolomeu; Lara, Caroline; Tadiotto, Thássia Fernanda; da Silva Maciel, João Batista; Gonçalves, Carla Vitola; von Groll, Andrea; Dellagostin, Odir Antônio; da Silva, Pedro Eduardo Almeida
2015-09-29
Helicobacter pylori infection is associated with gastritis, peptic ulcer disease and gastric carcinoma. The severity of damage is determined by the interplay between environmental/behavioral factors, bacterial pathogenicity genes and host genetic polymorphisms that can influence the secretion levels of inflammatory cytokines. Accordingly, this study aimed to identify polymorphisms in the IL-1B and IL-1RN genes and their associations with H. pylori infection, cagA gene of H. pylori, and gastroduodenal diseases. Gastric biopsy samples from 151 patients infected with H. pylori and 76 uninfected individuals were analyzed. H. pylori infection was diagnosed by histology and PCR. Polymorphisms at positions -511, -31 and +3954 of the IL-1B gene were detected by PCR-RFLP, and an analysis of the VNTR polymorphism of the IL-1RN gene was performed by PCR. It was observed that the presence of the T/T genotype at position -511 and the C/C genotype at position -31 were associated with H. pylori infection and with an increased risk of gastritis in H. pylori-positive patients. Additionally, strains from patients H. pylori-positive carrying the cagA gene was significantly related with the T/T genotype at position -511 of IL-1B. No association of polymorphisms at position +3954 of IL-1B and in the IL-1RN with H. pylori infection and with risk of severe gastric diseases was found. We demonstrated that polymorphisms in the promoter region of the IL-1B gene (at positions -511 and -31) are associated with an enhanced risk of H. pylori infection as well as gastritis in H. pylori-positive patients.
Erpen, L; Tavano, E C R; Harakava, R; Dutt, M; Grosser, J W; Piedade, S M S; Mendes, B M J; Mourão Filho, F A A
2018-05-23
Regulatory sequences from the citrus constitutive genes cyclophilin (CsCYP), glyceraldehyde-3-phosphate dehydrogenase C2 (CsGAPC2), and elongation factor 1-alpha (CsEF1) were isolated, fused to the uidA gene, and qualitatively and quantitatively evaluated in transgenic sweet orange plants. The 5' upstream region of a gene (the promoter) is the most important component for the initiation and regulation of gene transcription of both native genes and transgenes in plants. The isolation and characterization of gene regulatory sequences are essential to the development of intragenic or cisgenic genetic manipulation strategies, which imply the use of genetic material from the same species or from closely related species. We describe herein the isolation and evaluation of the promoter sequence from three constitutively expressed citrus genes: cyclophilin (CsCYP), glyceraldehyde-3-phosphate dehydrogenase C2 (CsGAPC2), and elongation factor 1-alpha (CsEF1). The functionality of the promoters was confirmed by a histochemical GUS assay in leaves, stems, and roots of stably transformed citrus plants expressing the promoter-uidA construct. Lower uidA mRNA levels were detected when the transgene was under the control of citrus promoters as compared to the expression under the control of the CaMV35S promoter. The association of the uidA gene with the citrus-derived promoters resulted in mRNA levels of up to 60-41.8% of the value obtained with the construct containing CaMV35S driving the uidA gene. Moreover, a lower inter-individual variability in transgene expression was observed amongst the different transgenic lines, where gene constructs containing citrus-derived promoters were used. In silico analysis of the citrus-derived promoter sequences revealed that their activity may be controlled by several putative cis-regulatory elements. These citrus promoters will expand the availability of regulatory sequences for driving gene expression in citrus gene-modification programs.
Javierre, Biola M; Burren, Oliver S; Wilder, Steven P; Kreuzhuber, Roman; Hill, Steven M; Sewitz, Sven; Cairns, Jonathan; Wingett, Steven W; Várnai, Csilla; Thiecke, Michiel J; Burden, Frances; Farrow, Samantha; Cutler, Antony J; Rehnström, Karola; Downes, Kate; Grassi, Luigi; Kostadima, Myrto; Freire-Pritchett, Paula; Wang, Fan; Stunnenberg, Hendrik G; Todd, John A; Zerbino, Daniel R; Stegle, Oliver; Ouwehand, Willem H; Frontini, Mattia; Wallace, Chris; Spivakov, Mikhail; Fraser, Peter
2016-11-17
Long-range interactions between regulatory elements and gene promoters play key roles in transcriptional regulation. The vast majority of interactions are uncharted, constituting a major missing link in understanding genome control. Here, we use promoter capture Hi-C to identify interacting regions of 31,253 promoters in 17 human primary hematopoietic cell types. We show that promoter interactions are highly cell type specific and enriched for links between active promoters and epigenetically marked enhancers. Promoter interactomes reflect lineage relationships of the hematopoietic tree, consistent with dynamic remodeling of nuclear architecture during differentiation. Interacting regions are enriched in genetic variants linked with altered expression of genes they contact, highlighting their functional role. We exploit this rich resource to connect non-coding disease variants to putative target promoters, prioritizing thousands of disease-candidate genes and implicating disease pathways. Our results demonstrate the power of primary cell promoter interactomes to reveal insights into genomic regulatory mechanisms underlying common diseases. Copyright © 2016 The Authors. Published by Elsevier Inc. All rights reserved.
Niu, Ying; Li, Jian-Sheng; Luo, Xian-Run
2014-01-25
This work aimed to study a novel transgenic expression system of the CD/TK double suicide genes enhanced by the nuclear matrix attachment region (MAR) for gene therapy. The recombinant vector pMS-CD/TK containing the MAR-survivin promoter-CD/TK cassette was developed and transfected into human gastric cancer SGC-7901 cells. Expression of the CD/TK genes was detected by quantitative real-time PCR (qPCR) and Western blot. Cell viability and apoptosis were measured using the methyl thiazolyl tetrazolium (MTT) assay and flow cytometry. When the MAR fragment was inserted into the upstream of the survivin promoter, the qPCR result showed that the expression of the CD/TK genes significantly increased 7.7-fold in the transgenic SGC-7901 cells with plasmid pMS-CD/TK compared with that without MAR. MTT and flow cytometry analyses indicated that treatment with the prodrugs (5-FC+GCV) significantly decreased the cellular survival rate and enhanced the cellular apoptosis in the SGC-7901 cells. The expression of the CD/TK double suicide genes driven by the survivin promoter can be enhanced by the MAR fragment in human gastric cancer cells. Copyright © 2013 Elsevier B.V. All rights reserved.
Characterization and functional analysis of the Paralichthys olivaceus prdm1 gene promoter.
Li, Peizhen; Wang, Bo; Cao, Dandan; Liu, Yuezhong; Zhang, Quanqi; Wang, Xubo
2017-10-01
PR domain containing protein 1 (Prdm1) is a transcriptional repressor identified in various species and plays multiple important roles in immune response and embryonic development. However, little is known about the transcriptional regulation of the prdm1 gene. This study aims to characterize the promoter of Paralichthys olivaceus prdm1 (Po-prdm1) gene and determine the regulatory mechanism of Po-prdm1 expression. A 2000bp-long 5'-flanking region (translation initiation site designated as +1) of the Po-prdm1 gene was isolated and characterized. The regulatory elements in this fragment were then investigated and many putative transcription factor (TF) binding sites involved in immunity and multiple tissue development were identified. A 5'-deletion analysis was then conducted, and the ability of the deletion mutants to promote luciferase and green fluorescent protein (GFP) expression in a flounder gill cell line was examined. The results revealed that the minimal promoter is located in the region between -446 and -13bp, and the region between -1415 and -13bp enhanced the promoter activity. Site-directed mutation analysis was subsequently performed on the putative regulatory elements sites, and the results indicated that FOXP1, MSX and BCL6 binding sites play negative functional roles in the regulation of the Po-prdm1 expression in FG cells. In vivo analysis demonstrated that a GFP reporter gene containing 1.4kb-long promoter fragment (-1415/-13) was expressed in the head and trunk muscle fibres of transient transgenic zebrafish embryos. Our study provided the basic information for the exploration of Po-prdm1 regulation and expression. Copyright © 2017 Elsevier Inc. All rights reserved.
Uchiumi, Fumiaki; Watanabe, Takeshi; Tanuma, Sei-ichi
2010-05-15
DNA helicases are important in the regulation of DNA transaction and thereby various cellular functions. In this study, we developed a cost-effective multiple DNA transfection assay with DEAE-dextran reagent and analyzed the promoter activities of the human DNA helicases. The 5'-flanking regions of the human DNA helicase-encoding genes were isolated and subcloned into luciferase (Luc) expression plasmids. They were coated onto 96-well plate and used for co-transfection with a renilla-Luc expression vector into various cells, and dual-Luc assays were performed. The profiles of promoter activities were dependent on cell lines used. Among these human DNA helicase genes, XPB, RecQL5, and RTEL promoters were activated during TPA-induced HL-60 cell differentiation. Interestingly, duplicated ets (GGAA) elements are commonly located around the transcription start sites of these genes. The duplicated GGAA motifs are also found in the promoters of DNA replication/repair synthesis factor genes including PARG, ATR, TERC, and Rb1. Mutation analyses suggested that the duplicated GGAA-motifs are necessary for the basal promoter activity in various cells and some of them positively respond to TPA in HL-60 cells. TPA-induced response of 44-bp in the RTEL promoter was attenuated by co-transfection of the PU.1 expression vector. These findings suggest that the duplicated ets motifs regulate DNA-repair associated gene expressions during macrophage-like differentiation of HL-60 cells. Copyright 2010 Elsevier Inc. All rights reserved.
Mayán, Maria D
2013-01-01
Three RNA polymerases coexist in the ribosomal DNA of Saccharomyces cerevisiae. RNAP-I transcribes the 35S rRNA, RNAP-III transcribes the 5S rRNA and RNAP-II is found in both intergenic non-coding regions. Previously, we demonstrated that RNAP-II molecules bound to the intergenic non-coding regions (IGS) of the ribosomal locus are mainly found in a stalled conformation, and the stalled polymerase mediates chromatin interactions, which isolate RNAP-I from the RNAP-III transcriptional domain. Besides, RNAP-II transcribes both IGS regions at low levels, using different cryptic promoters. This report demonstrates that RNAP-II also transcribes two sequences located in the 5'- and 3'-ends of the 35S rRNA gene that overlap with the sequences of the 35S rRNA precursor transcribed by RNAP-I. The sequence located at the promoter region of RNAP-I, called the p-RNA transcript, binds to the transcription termination-related protein, Reb1p, while the T-RNA sequence, located in the termination sites of RNAP-I gene, contains the stem-loop recognized by Rtn1p, which is necessary for proper termination of RNAP-I. Because of their location, these small RNAs may play a key role in the initiation and termination of RNAP-I transcription. To correctly synthesize proteins, eukaryotic cells may retain a mechanism that connects the three main polymerases. This report suggests that cryptic transcription by RNAP-II may be required for normal transcription by RNAP-I in the ribosomal locus of S. cerevisiae. Copyright © 2012 John Wiley & Sons, Ltd.
Letek, Michal; Valbuena, Noelia; Ramos, Angelina; Ordóñez, Efrén; Gil, José A.; Mateos, Luís M.
2006-01-01
The genes involved in gluconate catabolism (gntP and gntK) in Corynebacterium glutamicum are scattered in the chromosome, and no regulatory genes are apparently associated with them, in contrast with the organization of the gnt operon in Escherichia coli and Bacillus subtilis. In C. glutamicum, gntP and gntK are essential genes when gluconate is the only carbon and energy source. Both genes contain upstream regulatory regions consisting of a typical promoter and a hypothetical cyclic AMP (cAMP) receptor protein (CRP) binding region but lack the expected consensus operator region for binding of the GntR repressor protein. Expression analysis by Northern blotting showed monocistronic transcripts for both genes. The expression of gntP and gntK is not induced by gluconate, and the gnt genes are subject to catabolite repression by sugars, such as glucose, fructose, and sucrose, as was detected by quantitative reverse transcription-PCR (qRT-PCR). Specific analysis of the DNA promoter sequences (PgntK and PgntP) was performed using bifunctional promoter probe vectors containing mel (involved in melanin production) or egfp2 (encoding a green fluorescent protein derivative) as the reporter gene. Using this approach, we obtained results parallel to those from qRT-PCR. An applied example of in vivo gene expression modulation of the divIVA gene in C. glutamicum is shown, corroborating the possible use of the gnt promoters to control gene expression. glxR (which encodes GlxR, the hypothetical CRP protein) was subcloned from the C. glutamicum chromosomal DNA and overexpressed in corynebacteria; we found that the level of gnt expression was slightly decreased compared to that of the control strains. The purified GlxR protein was used in gel shift mobility assays, and a specific interaction of GlxR with sequences present on PgntP and PgntK fragments was detected only in the presence of cAMP. PMID:16385030
Letek, Michal; Valbuena, Noelia; Ramos, Angelina; Ordóñez, Efrén; Gil, José A; Mateos, Luís M
2006-01-01
The genes involved in gluconate catabolism (gntP and gntK) in Corynebacterium glutamicum are scattered in the chromosome, and no regulatory genes are apparently associated with them, in contrast with the organization of the gnt operon in Escherichia coli and Bacillus subtilis. In C. glutamicum, gntP and gntK are essential genes when gluconate is the only carbon and energy source. Both genes contain upstream regulatory regions consisting of a typical promoter and a hypothetical cyclic AMP (cAMP) receptor protein (CRP) binding region but lack the expected consensus operator region for binding of the GntR repressor protein. Expression analysis by Northern blotting showed monocistronic transcripts for both genes. The expression of gntP and gntK is not induced by gluconate, and the gnt genes are subject to catabolite repression by sugars, such as glucose, fructose, and sucrose, as was detected by quantitative reverse transcription-PCR (qRT-PCR). Specific analysis of the DNA promoter sequences (PgntK and PgntP) was performed using bifunctional promoter probe vectors containing mel (involved in melanin production) or egfp2 (encoding a green fluorescent protein derivative) as the reporter gene. Using this approach, we obtained results parallel to those from qRT-PCR. An applied example of in vivo gene expression modulation of the divIVA gene in C. glutamicum is shown, corroborating the possible use of the gnt promoters to control gene expression. glxR (which encodes GlxR, the hypothetical CRP protein) was subcloned from the C. glutamicum chromosomal DNA and overexpressed in corynebacteria; we found that the level of gnt expression was slightly decreased compared to that of the control strains. The purified GlxR protein was used in gel shift mobility assays, and a specific interaction of GlxR with sequences present on PgntP and PgntK fragments was detected only in the presence of cAMP.
Promoter Hypermethylation of the ATM Gene as a Novel Biomarker for Breast Cancer
Begam, Nasrin; Jamil, Kaiser; Raju, Suryanarayana G
2017-11-26
Background: Breast cancer may be induced by activation of protooncogenes to oncogenes and in many cases inactivation of tumor suppressor genes. Ataxia telangiectasia mutated (ATM) is an important tumor suppressor gene which plays central roles in the maintenance of genomic integrity by activating cell cycle checkpoints and promoting repair of double-strand breaks of DNA. In breast cancer, decrease ATM expression correlates with a poor outcome; however, the molecular mechanisms underlying downregulation are still unclear. Promoter hypermethylation may contribute in downregulation. Hence the present investigation was designed to evaluate promoter methylation and expression of the ATM gene in breast cancer cases, and to determine links with clinical and demographic manifestations, in a South Indian population. Methods: Tumor biopsy samples were collected from 50 pathologically confirmed sporadic breast cancer cases. DNA was isolated from tumor and adjacent non-tumorous regions, and sodium bisulfite conversion and methylation-specific PCR were performed using MS-PCR primers for the ATM promoter region. In addition, ATM mRNA expression was also analyzed for all samples using real-time PCR. Results: Fifty eight percent (58%) of cancer tissue samples showed promoter hypermethylation for the ATM gene, in contrast to only 4.44% of normal tissues (p= 0.0001). Furthermore, ATM promoter methylation was positively associated with age (p = 0.01), tumor size (p=0.045) and advanced stage of disease i.e. stages III and IV (p =0.019). An association between promoter hypermethylation and lower expression of ATM mRNA was also found (p=0.035). Conclusion: We report for the first time that promoter hypermethylation of ATM gene may be useful as a potential new biomarker for breast cancer, especially in the relatively young patients. Creative Commons Attribution License
Li, M Z; Squires, C H; Monticello, D J; Childs, J D
1996-01-01
The dsz gene cluster of Rhodococcus erythropolis IGTS8 comprises three genes, dszA, dszB, and dszC, whose products are involved in the conversion of dibenzothiophene (DBT) to 2-hydroxybiphenyl and sulfite. This organism can use DBT as the sole sulfur source but not as a carbon source. Dsz activity is repressed by methionine, cysteine, Casamino Acids, and sulfate but not by DBT or dimethyl sulfoxide. We cloned 385 bp of the DNA immediately 5' to dszA in front of the reporter gene lacZ of Escherichia coli. We showed that this region contains a Rhodococcus promoter and at least three dsz regulatory regions. After hydrazine mutagenesis of this DNA, colonies that were able to express beta-galactosidase in the presence of Casamino Acids were isolated. Sequencing of these mutants revealed two possible regulatory regions. One is at -263 to -244, and the other is at -93 to -38, where -1 is the base preceding the A of the initiation codon ATG of dszA. An S1 nuclease protection assay showed that the start of the dsz promoter is the G at -46 and that transcription is repressed by sulfate and cysteine but not by dimethyl sulfoxide. The promoter encompasses a region of potential diad symmetry that may contain an operator. Immediately upstream of the promoter is a protein-binding domain between -146 and -121. Deletion of this region did not affect repression, but promoter activity appeared to be reduced by threefold. Thus, it could be an activator binding site or an enhancer region. PMID:8932295
Ellerström, M; Stålberg, K; Ezcurra, I; Rask, L
1996-12-01
The promoter region (-309 to +44) of the Brassica napus storage protein gene napA was studied in transgenic tobacco by successive 5' as well as internal deletions fused to the reporter gene GUS (beta-glucuronidase). The expression in the two main tissues of the seed, the endosperm and the embryo, was shown to be differentially regulated. This tissue-specific regulation within the seed was found to affect the developmental expression during seed development. The region between -309 to -152, which has a large effect on quantitative expression, was shown to harbour four elements regulating embryo and one regulating endosperm expression. This region also displayed enhancer activity. Deletion of eight bp from position -152 to position -144 totally abolished the activity of the napA promoter. This deletion disrupted a cis element with similarity to an ABA-responsive element (ABRE) overlapping with an E-box, demonstrating its crucial importance for quantitative expression. An internal deletion of the region -133 to -120, resulted in increased activity in both leaves and endosperm and a decreased activity in the embryo. Within this region, a cis element similar to the (CA)n element, found in other storage protein promoters, was identified. This suggest that the (CA)n element is important for conferring seed specificity by serving both as an activator and a repressor element.
Leptin gene promoter DNA methylation in WNIN obese mutant rats
2014-01-01
Background Obesity has become an epidemic in worldwide population. Leptin gene defect could be one of the causes for obesity. Two mutant obese rats WNIN/Ob and WNIN/GROb, isolated at National Centre for Laboratory Animal Sciences (NCLAS), Hyderabad, India, were found to be leptin resistant. The present study aims to understand the regulatory mechanisms underlying the resistance by promoter DNA methylation of leptin gene in these mutant obese rats. Methods Male obese mutant homozygous, carrier and heterozygous rats of WNIN/Ob and WNIN/GROb strain of 6 months old were studied to check the leptin gene expression (RT-PCR) and promoter DNA methylation (MassARRAY Compact system, SEQUENOM) of leptin gene by invivo and insilico approach. Results Homozygous WNIN/Ob and WNIN/GROb showed significantly higher leptin gene expression compared to carrier and lean counterparts. Leptin gene promoter DNA sequence region was analyzed ranging from transcription start site (TSS) to-550 bp length and found four CpGs in this sequence among them only three CpG loci (-309, -481, -502) were methylated in these WNIN mutant rat phenotypes. Conclusion The increased percentage of methylation in WNIN mutant lean and carrier phenotypes is positively correlated with transcription levels. Thus genetic variation may have effect on methylation percentages and subsequently on the regulation of leptin gene expression which may lead to obesity in these obese mutant rat strains. PMID:24495350
Keller, Thomas E; Han, Priscilla; Yi, Soojin V
2016-04-01
Genomes of invertebrates and vertebrates exhibit highly divergent patterns of DNA methylation. Invertebrate genomes tend to be sparsely methylated, and DNA methylation is mostly targeted to a subset of transcription units (gene bodies). In a drastic contrast, vertebrate genomes are generally globally and heavily methylated, punctuated by the limited local hypo-methylation of putative regulatory regions such as promoters. These genomic differences also translate into functional differences in DNA methylation and gene regulation. Although promoter DNA methylation is an important regulatory component of vertebrate gene expression, its role in invertebrate gene regulation has been little explored. Instead, gene body DNA methylation is associated with expression of invertebrate genes. However, the evolutionary steps leading to the differentiation of invertebrate and vertebrate genomic DNA methylation remain unresolved. Here we analyzed experimentally determined DNA methylation maps of several species across the invertebrate-vertebrate boundary, to elucidate how vertebrate gene methylation has evolved. We show that, in contrast to the prevailing idea, a substantial number of promoters in an invertebrate basal chordate Ciona intestinalis are methylated. Moreover, gene expression data indicate significant, epigenomic context-dependent associations between promoter methylation and expression in C. intestinalis. However, there is no evidence that promoter methylation in invertebrate chordate has been evolutionarily maintained across the invertebrate-vertebrate boundary. Rather, body-methylated invertebrate genes preferentially obtain hypo-methylated promoters among vertebrates. Conversely, promoter methylation is preferentially found in lineage- and tissue-specific vertebrate genes. These results provide important insights into the evolutionary origin of epigenetic regulation of vertebrate gene expression. © The Author(s) 2015. Published by Oxford University Press on behalf
Lintas, Carla; Sacco, Roberto; Persico, Antonio M
2016-01-01
Reelin plays a pivotal role in neurodevelopment and in post-natal synaptic plasticity and has been implicated in the pathogenesis of autism spectrum disorder (ASD). The reelin (RELN) gene expression is significantly decreased in ASD, both in the brain and peripherally. Methylation at the RELN gene promoter is largely triggered at puberty, and hypermethylation has been found in post-mortem brains of schizophrenic and bipolar patients. In this study, we assessed RELN gene methylation status in post-mortem temporocortical tissue samples (BA41/42 or 22) of six pairs of post-puberal individuals with ASD and typically developing subjects, matched for sex (male:female, M:F = 5:1), age, and post-mortem interval. ASD patients display a significantly higher number of methylated CpG islands and heavier methylation in the 5' region of the RELN gene promoter, spanning from -458 to -223 bp, whereas controls have more methylated CpG positions and greater extent of methylation at the 3' promoter region, spanning from -222 to +1 bp. The most upstream promoter region (-458 to -364 bp) is methylated only in ASD brains, while the most downstream region (-131 to +1 bp) is methylated exclusively in control brains. Within this general framework, three different methylation patterns are discernible, each correlated with different extents of reduction in reelin gene expression among ASD individuals compared to controls. The methylation pattern is different in ASD and control post-mortem brains. ASD-specific CpG positions, located in the most upstream gene promoter region, may exert a functional role potentially conferring ASD risk by blunting RELN gene expression.
Du, Wei; Rani, Reena; Sipple, Jared; Schick, Jonathan; Myers, Kasiani C; Mehta, Parinda; Andreassen, Paul R; Davies, Stella M; Pang, Qishen
2012-05-03
Oxidative stress has been implicated in the pathogenesis of many human diseases including Fanconi anemia (FA), a genetic disorder associated with BM failure and cancer. Here we show that major antioxidant defense genes are down-regulated in FA patients, and that gene down-regulation is selectively associated with increased oxidative DNA damage in the promoters of the antioxidant defense genes. Assessment of promoter activity and DNA damage repair kinetics shows that increased initial damage, rather than a reduced repair rate, contributes to the augmented oxidative DNA damage. Mechanistically, FA proteins act in concert with the chromatin-remodeling factor BRG1 to protect the promoters of antioxidant defense genes from oxidative damage. Specifically, BRG1 binds to the promoters of the antioxidant defense genes at steady state. On challenge with oxidative stress, FA proteins are recruited to promoter DNA, which correlates with significant increase in the binding of BRG1 within promoter regions. In addition, oxidative stress-induced FANCD2 ubiquitination is required for the formation of a FA-BRG1-promoter complex. Taken together, these data identify a role for the FA pathway in cellular antioxidant defense.
Salinas-Sánchez, Antonio S; Rubio-del-Campo, Antonio; Sánchez-Sánchez, Francisco; Giménez-Bachs, José M; Donate-Moreno, María J; García-Olmo, Dolores C; Escribano-Martínez, Julio
2006-04-01
Epigenetic inactivation is a gene function abnormality that produces no changes in the DNA sequence, with the most frequent epigenetic alteration being hypermethylation of CpG islands in the promoter regions of the genes. Based on recent indications of a potential relationship between mismatch repair genes and renal cell carcinoma (RCC), we were interested in investigating the existence of promoter hypermethylation of the hMLH1 gene in tumor DNA samples from patients with sporadic RCC. Sixty-five tumor tissue specimens were collected consecutively. The DNA was first obtained and purified, then digested with the restriction enzymes Hpa II and Msp I, followed by polimerase chain reaction amplification of 3 promoter regions of the hMLH1 gene, agarose gel electrophoresis, and densitometric analysis of the images of the amplified bands. Mean patient age was 63.7 years. The most frequent cell type was clear cell carcinoma (67.7%). 73.9% of tumors were diagnosed in stages below pT2, 9.3% had gland involvement and 20%, distant metastasis. No somatic hypermethylation was detected in the promoter region of the hMLH1 gene in any of the patients studied. Our data indicate that promoter hypermethylation of the hMLH1 gene is not implicated in the pathogenesis of sporadic RCC, and therefore the existence of another type of mutation, microsatellite instability and/or loss of heterozygosity should be examined to determine the possible role of this gene in sporadic RCC.
Intrinsically bent DNA in replication origins and gene promoters.
Gimenes, F; Takeda, K I; Fiorini, A; Gouveia, F S; Fernandez, M A
2008-06-24
Intrinsically bent DNA is an alternative conformation of the DNA molecule caused by the presence of dA/dT tracts, 2 to 6 bp long, in a helical turn phase DNA or with multiple intervals of 10 to 11 bp. Other than flexibility, intrinsic bending sites induce DNA curvature in particular chromosome regions such as replication origins and promoters. Intrinsically bent DNA sites are important in initiating DNA replication, and are sometimes found near to regions associated with the nuclear matrix. Many methods have been developed to localize bent sites, for example, circular permutation, computational analysis, and atomic force microscopy. This review discusses intrinsically bent DNA sites associated with replication origins and gene promoter regions in prokaryote and eukaryote cells. We also describe methods for identifying bent DNA sites for circular permutation and computational analysis.
Peng, Xian-E; Wu, Yun-Li; Zhu, Yi-Bing; Huang, Rong-Dong; Lu, Qing-Qing; Lin, Xu
2015-01-01
Liver fatty acid-binding protein (L-FABP), also known as fatty acid-binding protein 1 (FABP1), is a key regulator of hepatic lipid metabolism. Elevated FABP1 levels are associated with an increased risk of cardiovascular disease (CVD) and metabolic syndromes. In this study, we examine the association of FABP1 gene promoter variants with serum FABP1 and lipid levels in a Chinese population. Four promoter single-nucleotide polymorphisms (SNPs) of FABP1 gene were genotyped in a cross-sectional survey of healthy volunteers (n = 1,182) from Fuzhou city of China. Results showed that only the rs2919872 G>A variant was significantly associated with serum TG concentration(P = 0.032).Compared with the rs2919872 G allele, rs2919872 A allele contributed significantly to reduced serum TG concentration, and this allele dramatically decreased the FABP1 promoter activity(P < 0.05). The rs2919872 A allele carriers had considerably lower serum FABP1 levels than G allele carriers (P < 0.01). In the multivariable linear regression analysis, the rs2919872 A allele was negatively associated with serum FABP1 levels (β = -0.320, P = 0.003), while serum TG levels were positively associated with serum FABP1 levels (β = 0.487, P = 0.014). Our data suggest that compared with the rs2919872 G allele, the rs2919872 A allele reduces the transcriptional activity of FABP1 promoter, and thereby may link FABP1 gene variation to TG level in humans.
Programming gene expression with combinatorial promoters
Cox, Robert Sidney; Surette, Michael G; Elowitz, Michael B
2007-01-01
Promoters control the expression of genes in response to one or more transcription factors (TFs). The architecture of a promoter is the arrangement and type of binding sites within it. To understand natural genetic circuits and to design promoters for synthetic biology, it is essential to understand the relationship between promoter function and architecture. We constructed a combinatorial library of random promoter architectures. We characterized 288 promoters in Escherichia coli, each containing up to three inputs from four different TFs. The library design allowed for multiple −10 and −35 boxes, and we observed varied promoter strength over five decades. To further analyze the functional repertoire, we defined a representation of promoter function in terms of regulatory range, logic type, and symmetry. Using these results, we identified heuristic rules for programming gene expression with combinatorial promoters. PMID:18004278
Systematic screening for mutations in the promoter and the coding region of the 5-HT{sub 1A} gene
DOE Office of Scientific and Technical Information (OSTI.GOV)
Erdmann, J.; Shimron-Abarbanell, D.; Cichon, S.
1995-10-09
In the present study we sought to identify genetic variation in the 5-HT{sub 1A} receptor gene which through alteration of protein function or level of expression might contribute to the genetic predisposition to neuropsychiatric diseases. Genomic DNA samples from 159 unrelated subjects (including 45 schizophrenic, 46 bipolar affective, and 43 patients with Tourette`s syndrome, as well as 25 healthy controls) were investigated by single-strand conformation analysis. Overlapping PCR (polymerase chain reaction) fragments covered the whole coding sequence as well as the 5{prime} untranslated region of the 5-HT{sub 1A} gene. The region upstream to the coding sequence we investigated contains amore » functional promoter. We found two rare nucleotide sequence variants. Both mutations are located in the coding region of the gene: a coding mutation (A{yields}G) in nucleotide position 82 which leads to an amino acid exchange (Ile{yields}Val) in position 28 of the receptor protein and a silent mutation (C{yields}T) in nucleotide position 549. The occurrence of the Ile-28-Val substitution was studied in an extended sample of patients (n = 352) and controls (n = 210) but was found in similar frequencies in all groups. Thus, this mutation is unlikely to play a significant role in the genetic predisposition to the diseases investigated. In conclusion, our study does not provide evidence that the 5-HT{sub 1A} gene plays either a major or a minor role in the genetic predisposition to schizophrenia, bipolar affective disorder, or Tourette`s syndrome. 29 refs., 4 figs., 1 tab.« less
Aguiar, J; Santurlidis, S; Nowok, J; Alexander, C; Rudnicki, D; Gispert, S; Schulz, W; Auburger, G
1999-01-19
In order to further use the spinocerebellar ataxia 2 (SCA2) promoter for transgenic mice models of "CAG repeat" neurodegeneration, different fragments of this 5' end were ligated into pGL3-Luc plasmid to obtain the better promoter-activity of the physiological promoter for SCA2. Base-par composition of the SCA2-5' region, and promoter prediction algorithms such as TSSW and TSSG, together with the high firefly luciferase expression after 48 hours of transient transfection in mammalian cells lines, showed a typical CpG island for promoter-activity. The promoter activity was specifically localized into the exon 1 of the SCA2 gene. The higher expression of firefly luciferase in the embryonal F9 cells by the use of SCA2 promoter, rather than by the use of CMV promoter may be related with the origin of the nonmethylated CpG island during the early embryogenesis. Analysis of the 5' region from HD gene revealed to a CpG island, which could be containing the physiological promoter for this gene. Copyright 1999 Academic Press.
Margetts, Caroline D E; Morris, Mark; Astuti, Dewi; Gentle, Dean C; Cascon, Alberto; McRonald, Fiona E; Catchpoole, Daniel; Robledo, Mercedes; Neumann, Hartmut P H; Latif, Farida; Maher, Eamonn R
2008-01-01
The molecular genetics of inherited phaeochromocytoma have received considerable attention, but the somatic genetic and epigenetic events that characterise tumourigenesis in sporadic phaeochromocytomas are less well defined. Previously, we found considerable overlap between patterns of promoter region tumour suppressor gene (TSG) hypermethylation in two neural crest tumours, neuroblastoma and phaeochromocytoma. In order to identify candidate biomarkers and epigenetically inactivated TSGs in phaeochromocytoma and neuroblastoma, we characterised changes in gene expression in three neuroblastoma cell lines after treatment with the demethylating agent 5-azacytidine. Promoter region methylation status was then determined for 28 genes that demonstrated increased expression after demethylation. Three genes HSP47, homeobox A9 (HOXA9) and opioid binding protein (OPCML) were methylated in >10% of phaeochromocytomas (52, 17 and 12% respectively). Two of the genes, epithelial membrane protein 3 (EMP3) and HSP47, demonstrated significantly more frequent methylation in neuroblastoma than phaeochromocytoma. These findings extend epigenotype of phaeochromocytoma and identify candidate genes implicated in sporadic phaeochromocytoma tumourigenesis. PMID:18499731
Tsai, P-C; Chen, C-J; Lai, H-M; Chang, S-J
2008-01-01
To explore the associations between the polymorphisms and protein levels of interleukin-6 (IL-6) gene and gout disease. A total of 120 male gout patients and 184 healthy controls were enrolled. Each patient was matched with 1-2 gout-free controls by age within three years. Four polymorphisms in the promoter of IL-6 gene, including -597G/A, -572C/G, -373A(m)T(n), and -174G/C, and the IL-6 levels were analyzed. The clinical characteristics and biochemical markers in plasma were measured, including age of gout onset, duration of gout history, tophus number, gout attack frequency, uric acid, total cholesterol, triglycerides and creatinine. The mean IL-6 level for gout patients was 9.80 (+/-11.76 pg/ml) which showed no significant difference from the controls (7.06+/-7.58 pg/ml, p=0.230). When the IL-6 levels were dichotomized according to the median value (5 pg/ml), there were significantly higher proportions of the gout patients (59.66%) than controls (44%) with high IL-6 levels (OR=1.88, 95% CI=1.17-3.02, p=0.008). Unique genotype was found at polymorphisms -174G/C and -597G/A. Neither the polymorphisms -572C/G nor -373A(m)T(n) in the genotype or allele distributions showed a significant association related to clinical characteristics, biochemical markers, IL-6 levels or gout disease (all p>0.05). Those with gout disease have greater proportions of high IL-6 levels in plasma than controls, and there is no significant association between the four polymorphisms in the promoter region of IL-6 gene and gout disease.
Kimoto, Mai; Kitagawa, Tsuyuki; Kobayashi, Isao; Nakata, Tomohiro; Kuroiwa, Asato; Takiya, Shigeharu
2012-11-01
The sericin-1 gene encoding a glue protein is expressed in the middle silk gland (MSG) of the silkworm, Bombyx mori. A member of the class III POU domain transcription factors, POU-M1, was cloned as the factor bound to the SC site of the sericin-1 promoter and has been proposed to be a positive transcription factor. In this study, we analyzed the expression pattern of the POU-M1 gene in fourth and fifth instars in comparison with the pattern of the sericin-1 gene. The POU-M1 gene was expressed strongly in the region anterior to the sericin-1-expressing portion of the silk gland at both feeding stages. As the sericin-1-expressing region expands from the posterior to middle portions of the MSG in the fifth instar, the POU-M1-expressing region retreated from the middle to anterior portion. Introduction of the expression vector of POU-M1 into the silk glands by gene gun technology repressed promoter activity of the sericin-1 gene, suggesting that POU-M1 regulates the sericin-1 gene negatively. An in vitro binding assay showed that POU-M1 bound not only to the SC site but also to other promoter elements newly detected in vivo. Another spatiotemporal specific factor MIC binds to these elements, and POU-M1 competed with MIC to bind at the -70 site essential for promoter activity. These results suggest that POU-M1 is involved in restricting the anterior boundary of the sericin-1-expressing region in the silk gland by inhibiting the binding of the transcriptional activator to the promoter elements.
Murthy, S C; Bhat, G P; Thimmappaya, B
1985-01-01
A molecular dissection of the adenovirus EIIA early (E) promoter was undertaken to study the sequence elements required for transcription and to examine the nucleotide sequences, if any, specific for its trans-activation by the viral pre-early EIA gene product. A chimeric gene in which the EIIA-E promoter region fused to the coding sequences of the bacterial chloramphenicol acetyltransferase (CAT) gene was used in transient assays to identify the transcriptional control regions. Deletion mapping studies revealed that the upstream DNA sequences up to -86 were sufficient for the optimal basal level transcription in HeLa cells and also for the EIA-induced transcription. A series of linker-scanning (LS) mutants were constructed to precisely identify the nucleotide sequences that control transcription. Analysis of these LS mutants allowed us to identify two regions of the promoter that are critical for the EIIA-E transcription. These regions are located between -29 and -21 (region I) and between -82 and -66 (region II). Mutations in region I affected initiation and appeared functionally similar to the "TATA" sequence of the commonly studied promoters. To examine whether or not the EIIA-E promoter contained DNA sequences specific for the trans-activation by the EIA, the LS mutants were analyzed in a cotransfection assay containing a plasmid carrying the EIA gene. CAT activity of all of the LS mutants was induced by the EIA gene in this assay, suggesting that the induction of transcription of the EIIA-E promoter by the EIA gene is not sequence-specific. Images PMID:3857577
Thomassen, Mads; Tan, Qihua; Kruse, Torben A
2009-01-01
Breast cancer cells exhibit complex karyotypic alterations causing deregulation of numerous genes. Some of these genes are probably causal for cancer formation and local growth whereas others are causal for the various steps of metastasis. In a fraction of tumors deregulation of the same genes might be caused by epigenetic modulations, point mutations or the influence of other genes. We have investigated the relation of gene expression and chromosomal position, using eight datasets including more than 1200 breast tumors, to identify chromosomal regions and candidate genes possibly causal for breast cancer metastasis. By use of "Gene Set Enrichment Analysis" we have ranked chromosomal regions according to their relation to metastasis. Overrepresentation analysis identified regions with increased expression for chromosome 1q41-42, 8q24, 12q14, 16q22, 16q24, 17q12-21.2, 17q21-23, 17q25, 20q11, and 20q13 among metastasizing tumors and reduced gene expression at 1p31-21, 8p22-21, and 14q24. By analysis of genes with extremely imbalanced expression in these regions we identified DIRAS3 at 1p31, PSD3, LPL, EPHX2 at 8p21-22, and FOS at 14q24 as candidate metastasis suppressor genes. Potential metastasis promoting genes includes RECQL4 at 8q24, PRMT7 at 16q22, GINS2 at 16q24, and AURKA at 20q13.
Isolation and characterization of an Arabidopsis biotin carboxylase gene and its promoter.
Bao, X; Shorrosh, B S; Ohlrogge, J B
1997-11-01
In the plastids of most plants, acetyl-CoA carboxylase (ACCase; EC 6.4.1.2) is a multisubunit complex consisting of biotin carboxylase (BC), biotin-carboxyl carrier protien (BCCP), and carboxytransferase (alpha-CT, beta-CT) subunits. To better understand the regulation of this enzyme, we have isolated and sequenced a BC genomic clone from Arabidopsis and partially characterized its promoter. Fifteen introns were identified. The deduced amino acid sequence of the mature BC protein is highly conserved between Arabidopsis and tobacco (92.6% identity). BC expression was evaluated using northern blots and BC/GUS fusion constructs in transgenic Arabidopsis. GUS activity in the BC/GUS transgenics as well as transcript level of the native gene were both found to be higher in silique and flower than in root and leaf. Analysis of tobacco suspension cells transformed with truncated BC promoter/GUS gene fusions indicated the region from -140 to +147 contained necessary promoter elements which supported basal gene expression. A positive regulatory region was found to be located between -2100 and -140, whereas a negative element was possibly located in the first intron. In addition, several conserved regulatory elements were identified in the BC promoter. Surprisingly, although BC is a low-abundance protein, the expression of BC/GUS fusion constructs was similar to 35S/GUS constructs.
Zhu, Yi-bing; Huang, Rong-dong; Lu, Qing-Qing; Lin, Xu
2015-01-01
Liver fatty acid-binding protein (L-FABP), also known as fatty acid-binding protein 1 (FABP1), is a key regulator of hepatic lipid metabolism. Elevated FABP1 levels are associated with an increased risk of cardiovascular disease (CVD) and metabolic syndromes. In this study, we examine the association of FABP1 gene promoter variants with serum FABP1 and lipid levels in a Chinese population. Four promoter single-nucleotide polymorphisms (SNPs) of FABP1 gene were genotyped in a cross-sectional survey of healthy volunteers (n = 1,182) from Fuzhou city of China. Results showed that only the rs2919872 G>A variant was significantly associated with serum TG concentration(P = 0.032).Compared with the rs2919872 G allele, rs2919872 A allele contributed significantly to reduced serum TG concentration, and this allele dramatically decreased the FABP1 promoter activity(P < 0.05). The rs2919872 A allele carriers had considerably lower serum FABP1 levels than G allele carriers (P < 0.01). In the multivariable linear regression analysis, the rs2919872 A allele was negatively associated with serum FABP1 levels (β = —0.320, P = 0.003), while serum TG levels were positively associated with serum FABP1 levels (β = 0.487, P = 0.014). Our data suggest that compared with the rs2919872 G allele, the rs2919872 A allele reduces the transcriptional activity of FABP1 promoter, and thereby may link FABP1 gene variation to TG level in humans. PMID:26439934
Kamalakaran, Sitharthan; Radhakrishnan, Senthil K; Beck, William T
2005-06-03
We developed a pipeline to identify novel genes regulated by the steroid hormone-dependent transcription factor, estrogen receptor, through a systematic analysis of upstream regions of all human and mouse genes. We built a data base of putative promoter regions for 23,077 human and 19,984 mouse transcripts from National Center for Biotechnology Information annotation and 8793 human and 6785 mouse promoters from the Data Base of Transcriptional Start Sites. We used this data base of putative promoters to identify potential targets of estrogen receptor by identifying estrogen response elements (EREs) in their promoters. Our program correctly identified EREs in genes known to be regulated by estrogen in addition to several new genes whose putative promoters contained EREs. We validated six genes (KIAA1243, NRIP1, MADH9, NME3, TPD52L, and ABCG2) to be estrogen-responsive in MCF7 cells using reverse transcription PCR. To allow for extensibility of our program in identifying targets of other transcription factors, we have built a Web interface to access our data base and programs. Our Web-based program for Promoter Analysis of Genome, PAGen@UIC, allows a user to identify putative target genes for vertebrate transcription factors through the analysis of their upstream sequences. The interface allows the user to search the human and mouse promoter data bases for potential target genes containing one or more listed transcription factor binding sites (TFBSs) in their upstream elements, using either regular expression-based consensus or position weight matrices. The data base can also be searched for promoters harboring user-defined TFBSs given as a consensus or a position weight matrix. Furthermore, the user can retrieve putative promoter sequences for any given gene together with identified TFBSs located on its promoter. Orthologous promoters are also analyzed to determine conserved elements.
The pea END1 promoter drives anther-specific gene expression in different plant species.
Gómez, María D; Beltrán, José-Pío; Cañas, Luis A
2004-10-01
END1 was isolated by an immunosubtractive approach intended to identify specific proteins present in the different pea (Pisum sativum L.) floral organs and the genes encoding them. Following this strategy we obtained a monoclonal antibody (mAbA1) that specifically recognized a 26-kDa protein (END1) only detected in anther tissues. Northern blot assays showed that END1 is expressed specifically in the anther. In situ hybridization and immunolocalization assays corroborated the specific expression of END1 in the epidermis, connective, endothecium and middle layer cells during the different stages of anther development. END1 is the first anther-specific gene isolated from pea. The absence of a practicable pea transformation method together with the fact that no END1 homologue gene exists in Arabidopsis prevented us from carrying out END1 functional studies. However, we designed functional studies with the END1 promoter in different dicot species, as the specific spatial and temporal expression pattern of END1 suggested, among other things, the possibility of using its promoter region for biotechnological applications. Using different constructs to drive the uidA (beta-glucuronidase) gene controlled by the 2.7-kb isolated promoter sequence we have proven that the END1 promoter is fully functional in the anthers of transgenic Arabidopsis thaliana (L.) Heynh., Nicotiana tabacum L. (tobacco) and Lycopersicon esculentum Mill. (tomato) plants. The presence in the -330-bp region of the promoter sequence of three putative CArG boxes also suggests that END1 could be a target gene of MADS-box proteins and that, subsequently, it would be activated by genes controlling floral organ identity.
Liu, Xu; Wang, Lina; Guo, Yongtie
2016-10-01
To systematically evaluate the relationship of the methylation of the human-runt-related transcription factor 3 (RUNX3) promoter region and gastric cancer risk through meta-analysis. The studies published in PubMed, EMBASE, Ovid, and CNKI were retrieved. The association between RUNX3 gene promoter methylation and gastric cancer was analyzed using Stata 11.0 (http://www.stata.com; Stata Corporation, College Station, TX, USA) and Review Man 5.0 software (http://ims.cochrane.org/revman/download). Seventeen studies are included in the analysis. Meta-analysis reveals that the odds ratio of the methylation of the RUNX3 promoter region in gastric was 7.32 (95% confidence interval: 5.12-10.47), which was significant higher than the normal gastric tissues (P < 0.05). The RUNX3 gene promoter methylation rate was much higher in tumor tissue than that in normal gastric tissue in patient with gastric cancer, which indicates a close association between gastric cancer and RUNX3 gene promoter methylation.
Core Promoter Functions in the Regulation of Gene Expression of Drosophila Dorsal Target Genes*
Zehavi, Yonathan; Kuznetsov, Olga; Ovadia-Shochat, Avital; Juven-Gershon, Tamar
2014-01-01
Developmental processes are highly dependent on transcriptional regulation by RNA polymerase II. The RNA polymerase II core promoter is the ultimate target of a multitude of transcription factors that control transcription initiation. Core promoters consist of core promoter motifs, e.g. the initiator, TATA box, and the downstream core promoter element (DPE), which confer specific properties to the core promoter. Here, we explored the importance of core promoter functions in the dorsal-ventral developmental gene regulatory network. This network includes multiple genes that are activated by different nuclear concentrations of Dorsal, an NFκB homolog transcription factor, along the dorsal-ventral axis. We show that over two-thirds of Dorsal target genes contain DPE sequence motifs, which is significantly higher than the proportion of DPE-containing promoters in Drosophila genes. We demonstrate that multiple Dorsal target genes are evolutionarily conserved and functionally dependent on the DPE. Furthermore, we have analyzed the activation of key Dorsal target genes by Dorsal, as well as by another Rel family transcription factor, Relish, and the dependence of their activation on the DPE motif. Using hybrid enhancer-promoter constructs in Drosophila cells and embryo extracts, we have demonstrated that the core promoter composition is an important determinant of transcriptional activity of Dorsal target genes. Taken together, our results provide evidence for the importance of core promoter composition in the regulation of Dorsal target genes. PMID:24634215
Internal control regions for transcription of eukaryotic tRNA genes.
Sharp, S; DeFranco, D; Dingermann, T; Farrell, P; Söll, D
1981-01-01
We have identified the region within a eukaryotic tRNA gene required for initiation of transcription. These results were obtained by systematically constructing deletions extending from the 5' or the 3' flanking regions into a cloned Drosophila tRNAArg gene by using nuclease BAL 31. The ability of the newly generated deletion clones to direct the in vitro synthesis of tRNA precursors was measured in transcription systems from Xenopus laevis oocytes, Drosophila Kc cells, and HeLa cells. Two control regions within the coding sequence were identified. The first was essential for transcription and was contained between nucleotides 8 and 25 of the mature tRNA sequence. Genes devoid of the second control region, which was contained between nucleotides 50 and 58 of the mature tRNA sequence, could be transcribed but with reduced efficiency. Thus, the promoter regions within a tRNA gene encode the tRNA sequences of the D stem and D loop, the invariant uridine at position 8, and the semi-invariant G-T-psi-C sequence. Images PMID:6947245
Universal light-switchable gene promoter system
Quail, Peter H.; Huq, Enamul; Tepperman, James; Sato, Sae
2005-02-22
An artificial promoter system that can be fused upstream of any desired gene enabling reversible induction or repression of the expression of the gene at will in any suitable host cell or organisms by light is described. The design of the system is such that a molecule of the plant photoreceptor phytochrome is targeted to the specific DNA binding site in the promoter by a protein domain that is fused to the phytochrome and that specifically recognizes this binding site. This bound phytochrome, upon activation by light, recruits a second fusion protein consisting of a protein that binds to phytochrome only upon light activation and a transcriptional activation domain that activates expression of the gene downstream of the promoter.
Characterization of promoter of EgPAL1, a novel PAL gene from the oil palm Elaeis guineensis Jacq.
Yusuf, Chong Yu Lok; Abdullah, Janna Ong; Shaharuddin, Noor Azmi; Abu Seman, Idris; Abdullah, Mohd Puad
2018-02-01
The oil palm EgPAL1 gene promoter and its regulatory region were functional as a promoter in the heterologous system of Arabidopsis according to the cis-acting elements present in that region. The promoter was developmentally regulated, vascular tissue specific and responsive to water stress agents. Phenylalanine ammonia lyase (PAL, EC 4.3.1.24) is the key enzyme of the phenylpropanoid pathway which plays important roles in plant development and adaptation. To date, there is no report on the study of PAL from oil palm (Elaeis guineensis), an economically important oil crop. In this study, the 5' regulatory sequence of a highly divergent oil palm PAL gene (EgPAL1) was isolated and fused with GUS in Arabidopsis to create two transgenic plants carrying the minimal promoter with (2302 bp) and without its regulatory elements (139 bp). The regulatory sequence contained cis-acting elements known to be important for plant development and stress response including the AC-II element for lignin biosynthesis and several stress responsive elements. The promoter and its regulatory region were fully functional in Arabidopsis. Its activities were characterised by two common fundamental features of PAL which are responsive to plant internal developmental programme and external factors. The promoter was developmentally regulated in certain organs; highly active in young organs but less active or inactive in mature organs. The presence of the AC elements and global activity of the EgPAL1 promoter in all organs resembled the property of lignin-related genes. The existence of the MBS element and enhancement of the promoter activity by PEG reflected the behaviour of drought-responsive genes. Our findings provide a platform for evaluating oil palm gene promoters in the heterologous system of Arabidopsis and give insights into the activities of EgPAL1 promoter in oil palm.
Niculescu, Mihai D.; Yamamuro, Yutaka; Zeisel, Steven H.
2006-01-01
Choline is an important methyl donor and a component of membrane phospholipids. In this study, we tested the hypothesis that choline availability can modulate cell proliferation and the methylation of genes that regulate cell cycling. In several other model systems, hypomethylation of cytosine bases that are followed by a guanosine (CpG) sites in the promoter region of a gene is associated with increased gene expression. We found that in choline-deficient IMR-32 neuroblastoma cells, the promoter of the cyclin-dependent kinase inhibitor 3 gene (CDKN3) was hypomethylated. This change was associated with increased expression of CDKN3 and increased levels of its gene product, kinase-associated phosphatase (KAP), which inhibits the G1/S transition of the cell cycle by dephosphorylating cyclin-dependent kinases. Choline deficiency also reduced global DNA methylation. The percentage of cells that accumulated bromodeoxyuridine (proportional to cell proliferation) was 1.8 times lower in the choline-deficient cells than in the control cells. Phosphorylated retinoblastoma (p110) levels were 3 times lower in the choline-deficient cells than in control cells. These findings suggest that the mechanism whereby choline deficiency inhibits cell proliferation involves hypomethylation of key genes regulating cell cycling. This may be a mechanism for our previously reported observation that stem cell proliferation in hippocampus neuroepithelium is decreased in choline-deficient rat and mouse fetuses. PMID:15147518
Li, Jian-Jun; Zheng, Ping Chen Jue-Ru; Wang, Yao-Zong
2017-06-06
This study aims at exploring the correlations between DNA methylation and polymorphisms in the promoter region of the human telomerase reverse transcriptase (hTERT) gene and postoperative recurrence in patients with thyroid carcinoma (TC). A total of 312 patients diagnosed with TC were chosen for the study and categorized into recurrence (n = 75) and non-recurrence (n = 237) groups. The hTERT rs2736100 and rs2736098 polymorphisms were detected by performing polymerase chain reaction-restriction fragment length polymorphism. DNA methylation in the promoter region of hTERT gene was evaluated by pyrosequencing. A telephonic and/or outpatient follow-up was conducted for all patients. The correlations of DNA methylation and polymorphisms in the promoter region of hTERT with postoperative recurrence of TC patients underwent analysis. The patient in the recurrence group showed evidently different pathological types and tumor stages in comparison to the non-recurrence group. The GG genotype of hTERT rs2736100 might increase the recurrence risk of TC patients. No correlations between hTERT rs2736098 polymorphisms and recurrence risk were observed. Compared to the TT + TG genotype frequency, the rs2736100 GG genotype frequency increased in patients without multicentricity, patients with extrathyroidal invasion, patients with lymph node metastasis, patients with undifferentiated carcinoma, and patients in the III + IV stage. The recurrence group showed significantly higher DNA methylation level compared to the non-recurrence group. The DNA methylation level was closely associated to tumor stage and lymph node metastasis of TC patients in the recurrence group. The DNA methylation and rs2736100 polymorphisms in the promoter region of hTERT gene might be in correlation to postoperative recurrence of TC patients.
Effect of TNF{alpha} on activities of different promoters of human apolipoprotein A-I gene
DOE Office of Scientific and Technical Information (OSTI.GOV)
Orlov, Sergey V., E-mail: serge@iem.sp.ru; Department of Embryology, St. Petersburg State University, 199034 St. Petersburg; Mogilenko, Denis A.
2010-07-23
Research highlights: {yields} TNF{alpha} stimulates the distal alternative promoter of human apoA-I gene. {yields} TNF{alpha} acts by weakening of promoter competition within apoA-I gene (promoter switching). {yields} MEK1/2 and nuclear receptors PPAR{alpha} and LXRs take part in apoA-I promoter switching. -- Abstract: Human apolipoprotein A-I (ApoA-I) is a major structural and functional protein component of high-density lipoproteins. The expression of the apolipoprotein A-I gene (apoA-I) in hepatocytes is repressed by pro-inflammatory cytokines such as IL-1{beta} and TNF{alpha}. Recently, two novel additional (alternative) promoters for human apoA-I gene have been identified. Nothing is known about the role of alternative promoters inmore » TNF{alpha}-mediated downregulation of apoA-I gene. In this article we report for the first time about the different effects of TNF{alpha} on two alternative promoters of human apoA-I gene. Stimulation of HepG2 cells by TNF{alpha} leads to activation of the distal alternative apoA-I promoter and downregulation of the proximal alternative and the canonical apoA-I promoters. This effect is mediated by weakening of the promoter competition within human apoA-I 5'-regulatory region (apoA-I promoter switching) in the cells treated by TNF{alpha}. The MEK1/2-ERK1/2 cascade and nuclear receptors PPAR{alpha} and LXRs are important for TNF{alpha}-mediated apoA-I promoter switching.« less
Zarandi, Ashkan; Irani, Shiva; Savabkar, Sanaz; Chaleshi, Vahid; Ghavideldarestani, Maryam; Mirfakhraie, Reza; Khodadoostan, Mahsa; Nazemalhosseini-Mojarad, Ehsan; Asadzadeh Aghdaei, Hamid
2017-01-01
The aim of this study was to evaluate the methylation status of the promoter region of MLH1 gene in colorectal cancer (CRC) and its precursor lesions as well as elucidate its association with various clinicopathological characteristics among Iranian population. Epigenetic silencing of mismatch repair genes, such as MLH1 , by methylation of CpG islands of their promoter region has been proved to be an important mechanism in colorectal carcinogenesis. Fifty colorectal cancer and polyp tissue samples including 13 Primary colorectal tumor and 37 Adenoma polyp samples were enrolled in this study. Methylation-specific polymerase chain reaction (MSP) was performed to find the frequency of MLH1 Promoter Methylation. Promoter methylation of MLH1 gene was detected in 5 out of 13 tumor tissues and 4 out of 37 adenoma polyp. The frequency of MLH1 methylation in tumor samples was significantly higher compared to that in polyp tissues (P= 0.026). No significant association was observed between MLH1 promoter methylation and clinicopathological characteristics of the patients. The frequency of MLH1 promoter methylation in CRC and colon polyp was 18%. Our findings indicated that methylation of MLH1 promoter region alone cannot be considered as a biomarker for early detection of CRC.
A novel G-quadruplex motif in the Human MET promoter region.
Yan, Jing; Zhao, Deming; Dong, Liping; Pan, Shuang; Hao, Fengjin; Guan, Yifu
2017-12-22
It is known that the guanine-rich strands in proto-oncogene promoters can fold into G-quadruplex structures to regulate gene expression. An intramolecular parallel G-quadruplex has been identified in MET promoter. It acts as a repressor in regulating MET expression. However, the full guanine-rich region in MET promoter forms a hybrid parallel/antiparallel G-quadruplex structure under physiological conditions, which means there are some antiparallel and hybrid parallel/antiparallel G-quadruplex structures in this region. In the present study, our data indicate that g3-5 truncation adopts an intramolecular hybrid parallel/antiparallel G-quadruplex under physiological conditions in vitro The g3-5 G-quadruplex structure significantly stops polymerization by Klenow fragment in K + buffer. Furthermore, the results of circular dichroism (CD) spectra and polymerase stop assay directly demonstrate that the G-quadruplex structure in g3-5 fragment can be stabilized by the G-quadruplex ligand TMPyP4 (5,10,15,20-tetra-(N-methyl-4-pyridyl) porphine). But the dual luciferase assay indicates TMPyP4 has no effect on the formation of g3-5 G-quadruplex in HepG2 cells. The findings in the present study will enrich our understanding of the G-quadruplex formation in proto-oncogene promoters and the mechanisms of gene expression regulation. © 2017 The Author(s).
Core histone genes of Giardia intestinalis: genomic organization, promoter structure, and expression
Yee, Janet; Tang, Anita; Lau, Wei-Ling; Ritter, Heather; Delport, Dewald; Page, Melissa; Adam, Rodney D; Müller, Miklós; Wu, Gang
2007-01-01
Background Giardia intestinalis is a protist found in freshwaters worldwide, and is the most common cause of parasitic diarrhea in humans. The phylogenetic position of this parasite is still much debated. Histones are small, highly conserved proteins that associate tightly with DNA to form chromatin within the nucleus. There are two classes of core histone genes in higher eukaryotes: DNA replication-independent histones and DNA replication-dependent ones. Results We identified two copies each of the core histone H2a, H2b and H3 genes, and three copies of the H4 gene, at separate locations on chromosomes 3, 4 and 5 within the genome of Giardia intestinalis, but no gene encoding a H1 linker histone could be recognized. The copies of each gene share extensive DNA sequence identities throughout their coding and 5' noncoding regions, which suggests these copies have arisen from relatively recent gene duplications or gene conversions. The transcription start sites are at triplet A sequences 1–27 nucleotides upstream of the translation start codon for each gene. We determined that a 50 bp region upstream from the start of the histone H4 coding region is the minimal promoter, and a highly conserved 15 bp sequence called the histone motif (him) is essential for its activity. The Giardia core histone genes are constitutively expressed at approximately equivalent levels and their mRNAs are polyadenylated. Competition gel-shift experiments suggest that a factor within the protein complex that binds him may also be a part of the protein complexes that bind other promoter elements described previously in Giardia. Conclusion In contrast to other eukaryotes, the Giardia genome has only a single class of core histone genes that encode replication-independent histones. Our inability to locate a gene encoding the linker histone H1 leads us to speculate that the H1 protein may not be required for the compaction of Giardia's small and gene-rich genome. PMID:17425802
Hassan, Hazem E.; Keita, Jean-Arnaud; Narayan, Lawrence; Brady, Sean M.; Frederick, Richard; Carlson, Samuel; C. Glass, Karen; Natesan, Senthil; Buttolph, Thomm; Fandy, Tamer E.
2016-01-01
ABSTRACT Curcumin and its analogs exhibited antileukemic activity either as single agent or in combination therapy. Dimethoxycurcumin (DMC) is a more metabolically stable curcumin analog that was shown to induce the expression of promoter-methylated genes without reversing DNA methylation. Accordingly, co-treatment with DMC and DNA methyltransferase (DNMT) inhibitors could hypothetically enhance the re-expression of promoter-methylated tumor suppressor genes. In this study, we investigated the cytotoxic effects and epigenetic changes associated with the combination of DMC and the DNMT inhibitor decitabine (DAC) in primary leukemia samples and cell lines. The combination demonstrated antagonistic cytotoxic effects and was minimally cytotoxic to primary leukemia cells. The combination did not affect the metabolic stability of DMC. Although the combination enhanced the downregulation of nuclear DNMT proteins, the hypomethylating activity of the combination was not increased significantly compared to DAC alone. On the other hand, the combination significantly increased H3K27 acetylation (H3K27Ac) compared to the single agents near the promoter region of promoter-methylated genes. Furthermore, sequential chromatin immunoprecipitation (ChIP) and DNA pyrosequencing of the chromatin-enriched H3K27Ac did not show any significant decrease in DNA methylation compared to other regions. Consequently, the enhanced induction of promoter-methylated genes by the combination compared to DAC alone is mediated by a mechanism that involves increased histone acetylation and not through potentiation of the DNA hypomethylating activity of DAC. Collectively, our results provide the mechanistic basis for further characterization of this combination in leukemia animal models and early phase clinical trials. PMID:27588609
Identification of cis-acting regulatory elements in the human oxytocin gene promoter.
Richard, S; Zingg, H H
1991-12-01
The expression of hormone-inducible genes is determined by the interaction of trans-acting factors with hormone-inducible elements and elements mediating basal and cell-specific expression. We have shown earlier that the gene encoding the hypothalamic nonapeptide oxytocin (OT) is under the control of an estrogen response element (ERE). The present study was aimed at identifying cis-acting elements mediating basal expression of the OT gene. A construct containing sequences -381 to +36 of the human OT gene was linked to a reporter gene and transiently transfected into a series of neuronal and nonneuronal cell lines. Expression of this construct was cell specific: it was highest in the neuroblastoma-derived cell line, Neuro-2a, and lowest in NIH 3T3 and JEG-3 cells. By 5' deletion analysis, we determined that a segment from -49 to +36 was capable of mediating cells-pecific promoter activity. Within this segment, we identified three proximal promoter elements (PPE-1, PPE-2, and PPE-3) that are each required for promoter activity. Most notably, mutation of a conserved purine-rich element (GAGAGA) contained within PPE-2 leads to a 10-fold decrease in promoter strength. Gel mobility shift analysis with three different double-stranded oligonucleotides demonstrated that each proximal promoter element binds distinct nuclear factors. In each case, only the homologous oligonucleotide, but neither of the oligonucleotides corresponding to adjacent elements, was able to act as a competitor. Thus, a different set of factors appears to bind independently to each element. By reinserting the homologous ERE or a heterologous glucocorticoid response element upstream of intact or altered proximal promoter segments we determined that removal or mutation of proximal promoter elements decreases basal expression, but does not abrogate the hormone responsiveness of the promoter. In conclusion, these results indicate that an important component of the transcriptional activity of the OT
Corbi, N; Libri, V; Fanciulli, M; Tinsley, J M; Davies, K E; Passananti, C
2000-06-01
Up-regulation of utrophin gene expression is recognized as a plausible therapeutic approach in the treatment of Duchenne muscular dystrophy (DMD). We have designed and engineered new zinc finger-based transcription factors capable of binding and activating transcription from the promoter of the dystrophin-related gene, utrophin. Using the recognition 'code' that proposes specific rules between zinc finger primary structure and potential DNA binding sites, we engineered a new gene named 'Jazz' that encodes for a three-zinc finger peptide. Jazz belongs to the Cys2-His2 zinc finger type and was engineered to target the nine base pair DNA sequence: 5'-GCT-GCT-GCG-3', present in the promoter region of both the human and mouse utrophin gene. The entire zinc finger alpha-helix region, containing the amino acid positions that are crucial for DNA binding, was specifically chosen on the basis of the contacts more frequently represented in the available list of the 'code'. Here we demonstrate that Jazz protein binds specifically to the double-stranded DNA target, with a dissociation constant of about 32 nM. Band shift and super-shift experiments confirmed the high affinity and specificity of Jazz protein for its DNA target. Moreover, we show that chimeric proteins, named Gal4-Jazz and Sp1-Jazz, are able to drive the transcription of a test gene from the human utrophin promoter.
Goodhardt, M; Babinet, C; Lutfalla, G; Kallenbach, S; Cavelier, P; Rougeon, F
1989-01-01
We have produced transgenic mice which synthesize chimeric mouse-rabbit immunoglobulin (Ig) kappa light chains following in vivo recombination of an injected unrearranged kappa gene. The exogenous gene construct contained a mouse germ-line kappa variable (V kappa) gene segment, the mouse germ-line joining (J kappa) locus including the enhancer, and the rabbit b9 constant (C kappa) region. A high level of V-J recombination of the kappa transgene was observed in spleen of the transgenic mice. Surprisingly, a particularly high degree of variability in the exact site of recombination and the presence of non germ-line encoded nucleotides (N-regions) were found at the V-J junction of the rearranged kappa transgene. Furthermore, unlike endogenous kappa genes, rearrangement of the exogenous gene occurred in T-cells of the transgenic mice. These results show that additional sequences, other than the heptamer-nonamer signal sequences and the promoter and enhancer elements, are required to obtain stage- and lineage- specific regulation of Ig kappa light chain gene rearrangement in vivo. Images PMID:2508061
Cloning and Functional Analysis of the Promoter of an Ascorbate Oxidase Gene from Gossypium hirsutum
Xin, Shan; Tao, Chengcheng; Li, Hongbin
2016-01-01
Apoplastic ascorbate oxidase (AO) plays significant roles in plant cell growth. However, the mechanism of underlying the transcriptional regulation of AO in Gossypium hirsutum remains unclear. Here, we obtained a 1,920-bp promoter sequence from the Gossypium hirsutum ascorbate oxidase (GhAO1) gene, and this GhAO1 promoter included a number of known cis-elements. Promoter activity analysis in overexpressing pGhAO1::GFP-GUS tobacco (Nicotiana benthamiana) showed that the GhAO1 promoter exhibited high activity, driving strong reporter gene expression in tobacco trichomes, leaves and roots. Promoter 5’-deletion analysis demonstrated that truncated GhAO1 promoters with serial 5’-end deletions had different GUS activities. A 360-bp fragment was sufficient to activate GUS expression. The P-1040 region had less GUS activity than the P-720 region, suggesting that the 320-bp region from nucleotide -720 to -1040 might include a cis-element acting as a silencer. Interestingly, an auxin-responsive cis-acting element (TGA-element) was uncovered in the promoter. To analyze the function of the TGA-element, tobacco leaves transformed with promoters with different 5’ truncations were treated with indole-3-acetic acid (IAA). Tobacco leaves transformed with the promoter regions containing the TGA-element showed significantly increased GUS activity after IAA treatment, implying that the fragment spanning nucleotides -1760 to -1600 (which includes the TGA-element) might be a key component for IAA responsiveness. Analyses of the AO promoter region and AO expression pattern in Gossypium arboreum (Ga, diploid cotton with an AA genome), Gossypium raimondii (Gr, diploid cotton with a DD genome) and Gossypium hirsutum (Gh, tetraploid cotton with an AADD genome) indicated that AO promoter activation and AO transcription were detected together only in D genome/sub-genome (Gr and Gh) cotton. Taken together, these results suggest that the 1,920-bp GhAO1 promoter is a functional sequence
Xin, Shan; Tao, Chengcheng; Li, Hongbin
2016-01-01
Apoplastic ascorbate oxidase (AO) plays significant roles in plant cell growth. However, the mechanism of underlying the transcriptional regulation of AO in Gossypium hirsutum remains unclear. Here, we obtained a 1,920-bp promoter sequence from the Gossypium hirsutum ascorbate oxidase (GhAO1) gene, and this GhAO1 promoter included a number of known cis-elements. Promoter activity analysis in overexpressing pGhAO1::GFP-GUS tobacco (Nicotiana benthamiana) showed that the GhAO1 promoter exhibited high activity, driving strong reporter gene expression in tobacco trichomes, leaves and roots. Promoter 5'-deletion analysis demonstrated that truncated GhAO1 promoters with serial 5'-end deletions had different GUS activities. A 360-bp fragment was sufficient to activate GUS expression. The P-1040 region had less GUS activity than the P-720 region, suggesting that the 320-bp region from nucleotide -720 to -1040 might include a cis-element acting as a silencer. Interestingly, an auxin-responsive cis-acting element (TGA-element) was uncovered in the promoter. To analyze the function of the TGA-element, tobacco leaves transformed with promoters with different 5' truncations were treated with indole-3-acetic acid (IAA). Tobacco leaves transformed with the promoter regions containing the TGA-element showed significantly increased GUS activity after IAA treatment, implying that the fragment spanning nucleotides -1760 to -1600 (which includes the TGA-element) might be a key component for IAA responsiveness. Analyses of the AO promoter region and AO expression pattern in Gossypium arboreum (Ga, diploid cotton with an AA genome), Gossypium raimondii (Gr, diploid cotton with a DD genome) and Gossypium hirsutum (Gh, tetraploid cotton with an AADD genome) indicated that AO promoter activation and AO transcription were detected together only in D genome/sub-genome (Gr and Gh) cotton. Taken together, these results suggest that the 1,920-bp GhAO1 promoter is a functional sequence with a
Ojeda, Diego A; Niño, Carmen L; López-León, Sandra; Camargo, Andrés; Adan, Ana; Forero, Diego A
2014-02-15
Excessive daytime sleepiness (EDS) is one of the main causes of car and industrial accidents and it is associated with increased morbidity and alterations in quality of life. Prevalence of EDS in the general population around the world ranges from 6.2 to 32.4%, with a heritability of 38-40%. However, few studies have explored the role of candidate genes in EDS. Monoamine oxidase A (MAOA) gene has an important role in the regulation of neurotransmitter levels and a large number of human behaviors. We hypothesized that a functional VNTR in the promoter region of the MAOA gene might be associated with daytime sleepiness in healthy individuals. The Epworth sleepiness scale (ESS) was applied to 210 Colombian healthy subjects (university students), which were genotyped for MAOA-uVNTR. MAOA-uVNTR showed a significant association with ESS scores (p = 0.01): 3/3 genotype carriers had the lowest scores. These results were supported by differences in MAOA-uVNTR frequencies between diurnal somnolence categories (p = 0.03). Our finding provides evidence for the first time that MAOA-uVNTR has a significant association with EDS in healthy subjects. Finally, these data suggest that functional variations in MAOA gene could have a role in other phenotypes of neuropsychiatric relevance. Copyright © 2013 Elsevier B.V. All rights reserved.
Cloning and functional analysis of 5'-upstream region of the Pokemon gene.
Yang, Yutao; Zhou, Xiaowei; Zhu, Xudong; Zhang, Chuanfu; Yang, Zhixin; Xu, Long; Huang, Peitang
2008-04-01
Pokemon, the POK erythroid myeloid ontogenic factor, not only regulates the expression of many genes, but also plays an important role in cell tumorigenesis. To investigate the molecular mechanism regulating expression of the Pokemon gene in humans, its 5'-upstream region was cloned and analyzed. Transient analysis revealed that the Pokemon promoter is constitutive. Deletion analysis and a DNA decoy assay indicated that the NEG-U and NEG-D elements were involved in negative regulation of the Pokemon promoter, whereas the POS-D element was mainly responsible for its strong activity. Electrophoretic mobility shift assays suggested that the NEG-U, NEG-D and POS-D elements were specifically bound by the nuclear extract from A549 cells in vitro. Mutation analysis demonstrated that cooperation of the NEG-U and NEG-D elements led to negative regulation of the Pokemon promoter. Moreover, the NEG-U and NEG-D elements needed to be an appropriate distance apart in the Pokemon promoter in order to cooperate. Taken together, our results elucidate the mechanism underlying the regulation of Pokemon gene transcription, and also define a novel regulatory sequence that may be used to decrease expression of the Pokemon gene in cancer gene therapy.
Venturi, V; Wolfs, K; Leong, J; Weisbeek, P J
1994-10-17
Pseudobactin 358 is the yellow-green fluorescent siderophore [microbial iron(III) transport agent] produced by Pseudomonas putida WCS358 under iron-limiting conditions. The genes encoding pseudobactin 358 biosynthesis are iron-regulated at the level of transcription. In this study, the molecular characterization is reported of a cosmid clone of WCS358 DNA that can stimulate, in an iron-dependent manner, the activity of a WCS358 siderophore gene promoter in the heterologous Pseudomonas strain A225. The functional region in the clone was identified by subcloning, transposon mutagenesis and DNA sequencing as the groESL operon of strain WCS358. This increase in promoter activity was not observed when the groESL genes of strain WCS358 were integrated via a transposon vector into the genome of Pseudomonas A225, indicating that multiple copies of the operon are necessary for the increase in siderophore gene promoter activity. Amplification of the Escherichia coli and WCS358 groESL genes also increased iron-regulated promoter activity in the parent strain WCS358. The groESL operon codes for the chaperone proteins GroES and GroEL, which are responsible for mediating the folding and assembly of many proteins.
Alonso-Peral, Maria M; Oliver, Sandra N; Casao, M Cristina; Greenup, Aaron A; Trevaskis, Ben
2011-01-01
The VERNALIZATION1 (VRN1) gene of temperate cereals is transcriptionally activated by prolonged cold during winter (vernalization) to promote flowering. To investigate the mechanisms controlling induction of VRN1 by prolonged cold, different regions of the VRN1 gene were fused to the GREEN FLUORESCENT PROTEIN (GFP) reporter and expression of the resulting gene constructs was assayed in transgenic barley (Hordeum vulgare). A 2 kb segment of the promoter of VRN1 was sufficient for GFP expression in the leaves and shoot apex of transgenic barley plants. Fluorescence increased at the shoot apex prior to inflorescence initiation and was subsequently maintained in the developing inflorescence. The promoter was also sufficient for low-temperature induction of GFP expression. A naturally occurring insertion in the proximal promoter, which is associated with elevated VRN1 expression and early flowering in some spring wheats, did not abolish induction of VRN1 transcription by prolonged cold, however. A translational fusion of the promoter and transcribed regions of VRN1 to GFP, VRN1::GFP, was localised to nuclei of cells at the shoot apex of transgenic barley plants. The distribution of VRN1::GFP at the shoot apex was similar to the expression pattern of the VRN1 promoter-GFP reporter gene. Fluorescence from the VRN1::GFP fusion protein increased in the developing leaves after prolonged cold treatment. These observations suggest that the promoter of VRN1 is targeted by mechanisms that trigger vernalization-induced flowering in economically important temperate cereal crops.
Jackson, Pamela B; Boccuto, Luigi; Skinner, Cindy; Collins, Julianne S; Neri, Giovanni; Gurrieri, Fiorella; Schwartz, Charles E
2009-08-01
Previous studies in three independent cohorts have shown that the rs1858830 C allele variant in the promoter region of the MET gene on chromosome 7q31 is associated with autism. Another study has found correlations between other alterations in the MET gene and autism in two unrelated cohorts. This study screened two cohorts, an Autistic Disorder cohort from South Carolina and a Pervasive Developmental Disorder (PDD) cohort from Italy, for the presence of the C allele variant in rs1858830. A significant increase in the C allele variant frequency was found in the South Carolina Autistic Disorder patients as compared to South Carolina Controls (chi(2)=5.8, df=1, P=0.02). In the South Carolina cohort, a significant association with Autistic Disorder was found when comparing the CC and CG genotypes to the GG genotype (odds ratio (OR)=1.64; 95% confidence interval (CI)=1.12-2.40; chi(2)=6.5, df=1, P=0.01) in cases and controls. In the Italian cohort, no significant association with PDD was found when comparing the CC or CG genotype to the GG genotype (OR=1.20; 95% CI=0.56-2.56; chi(2)=0.2, df=1, P=0.64). This study is the third independent study to find the rs1858830 C variant in the MET gene promoter to be associated with autism.
Structural properties of prokaryotic promoter regions correlate with functional features.
Meysman, Pieter; Collado-Vides, Julio; Morett, Enrique; Viola, Roberto; Engelen, Kristof; Laukens, Kris
2014-01-01
The structural properties of the DNA molecule are known to play a critical role in transcription. In this paper, the structural profiles of promoter regions were studied within the context of their diversity and their function for eleven prokaryotic species; Escherichia coli, Klebsiella pneumoniae, Salmonella Typhimurium, Pseudomonas auroginosa, Geobacter sulfurreducens Helicobacter pylori, Chlamydophila pneumoniae, Synechocystis sp., Synechoccocus elongates, Bacillus anthracis, and the archaea Sulfolobus solfataricus. The main anchor point for these promoter regions were transcription start sites identified through high-throughput experiments or collected within large curated databases. Prokaryotic promoter regions were found to be less stable and less flexible than the genomic mean across all studied species. However, direct comparison between species revealed differences in their structural profiles that can not solely be explained by the difference in genomic GC content. In addition, comparison with functional data revealed that there are patterns in the promoter structural profiles that can be linked to specific functional loci, such as sigma factor regulation or transcription factor binding. Interestingly, a novel structural element clearly visible near the transcription start site was found in genes associated with essential cellular functions and growth in several species. Our analyses reveals the great diversity in promoter structural profiles both between and within prokaryotic species. We observed relationships between structural diversity and functional features that are interesting prospects for further research to yet uncharacterized functional loci defined by DNA structural properties.
Raynard, Steven J; Baker, Mark D
2004-01-01
In mammalian cells, little is known about the nature of recombination-prone regions of the genome. Previously, we reported that the immunoglobulin heavy chain (IgH) mu locus behaved as a hotspot for mitotic, intrachromosomal gene conversion (GC) between repeated mu constant (Cmu) regions in mouse hybridoma cells. To investigate whether elements within the mu gene regulatory region were required for hotspot activity, gene targeting was used to delete a 9.1 kb segment encompassing the mu gene promoter (Pmu), enhancer (Emu) and switch region (Smu) from the locus. In these cell lines, GC between the Cmu repeats was significantly reduced, indicating that this 'recombination-enhancing sequence' (RES) is necessary for GC hotspot activity at the IgH locus. Importantly, the RES fragment stimulated GC when appended to the same Cmu repeats integrated at ectopic genomic sites. We also show that deletion of Emu and flanking matrix attachment regions (MARs) from the RES abolishes GC hotspot activity at the IgH locus. However, no stimulation of ectopic GC was observed with the Emu/MARs fragment alone. Finally, we provide evidence that no correlation exists between the level of transcription and GC promoted by the RES. We suggest a model whereby Emu/MARS enhances mitotic GC at the endogenous IgH mu locus by effecting chromatin modifications in adjacent DNA.
Promoter methylation assay of SASH1 gene in breast cancer.
Sheyu, Lin; Hui, Liu; Junyu, Zhang; Jiawei, Xu; Honglian, Wang; Qing, Sang; Hengwei, Zhang; Xuhui, Guo; Qinghe, Xing; Lin, He
2013-01-01
To analyze the relationship between the expression of SASH1 and its methylation level of SASH1 gene promoter in human breast cancer. Expression levels of SASH1 were examined in breast cancer tissues and adjacent normal tissues with immunohistochemistry and with real time PCR (RT-PCR) methylation analysis was performed with MassArray. Immunohistochemistry showed that SASH1 expression was strongly reduced in breast cancer compared with adjacent normal tissues. Quantitative methylation analysis by MassArray revealed that CpG sites in SASH1 promoter shared similar methylation pattern in tumor tissue and adjacent normal tissue. The CpG sites with significant difference in methylation level were CpG_26.27 and CpG_54.55. Moreover, 5-aza-2'-deoxycytidine (5-Aza-dc) treatment of tumor cell line MDA-MB-231 caused significant elevation of SASH1 mRNA. Based on these data, we propose that increase of DNA methylation level in the promoter region of gene SASH1, particularly CpG_26.27 or CpG_54.55 sites, possibly repressed SASH1 expression in breast cancer.
Gabriel, J E; Guerra-Slompo, E P; de Souza, E M; de Carvalho, F A L; Madeira, H M F; de Vasconcelos, A T R
2015-08-21
The purpose of the present study was to functionally evaluate the influence of superoxide radical-generating compounds on the heterologous induction of a predicted promoter region of open reading frames for paraquat-inducible genes (pqi genes) revealed during genome annotation analyses of the Chromobacterium violaceum bacterium. A 388-bp fragment corresponding to a pqi gene promoter of C. violaceum was amplified using specific primers and cloned into a conjugative vector containing the Escherichia coli lacZ gene without a promoter. Assessments of the expression of the β-galactosidase enzyme were performed in the presence of menadione (MEN) and phenazine methosulfate (PMS) compounds at different final concentrations to evaluate the heterologous activation of the predicted promoter region of interest in C. violaceum induced by these substrates. Under these experimental conditions, the MEN reagent promoted highly significant increases in the expression of the β-galactosidase enzyme modulated by activating the promoter region of the pqi genes at all concentrations tested. On the other hand, significantly higher levels in the expression of the β-galactosidase enzyme were detected exclusively in the presence of the PMS reagent at a final concentration of 50 μg/mL. The findings described in the present study demonstrate that superoxide radical-generating compounds can activate a predicted promoter DNA motif for pqi genes of the C. violaceum bacterium in a dose-dependent manner.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Depto, A.S.; Stenberg, R.M.
1989-03-01
To better understand the regulation of late gene expression in human cytomegalovirus (CMV)-infected cells, the authors examined expression of the gene that codes for the 65-kilodalton lower-matrix phosphoprotein (pp65). Analysis of RNA isolated at 72 h from cells infected with CMV Towne or ts66, a DNA-negative temperature-sensitive mutant, supported the fact that pp65 is expressed at low levels prior to viral DNA replication but maximally expressed after the initiation of viral DNA replication. To investigate promoter activation in a transient expression assay, the pp65 promoter was cloned into the indicator plasmid containing the gene for chloramphenicol acetyltransferase (CAT). Transfection ofmore » the promoter-CAT construct and subsequent superinfection with CMV resulted in activation of the promoter at early times after infection. Cotransfection with plasmids capable of expressing immediate-early (IE) proteins demonstrated that the promoter was activated by IE proteins and that both IE regions 1 and 2 were necessary. These studies suggest that interactions between IE proteins and this octamer sequence may be important for the regulation and expression of this CMV gene.« less
Watanabe, Keijirou; Hida, Mariko; Sasaki, Takako; Yano, Hiroyuki; Kawano, Kenji; Yoshioka, Hidekatsu; Matsuo, Noritaka
2016-02-01
Type XI collagen is a cartilage-specific extracellular matrix, and is important for collagen fibril formation and skeletal morphogenesis. We have previously reported that NF-Y regulated the proximal promoter activity of the mouse collagen α1(XI) gene (Col11a1) in chondrocytes (Hida et. al. In Vitro Cell. Dev. Biol. Anim. 2014). However, the mechanism of the Col11a1 gene regulation in chondrocytes has not been fully elucidated. In this study, we further characterized the proximal promoter activity of the mouse Col11a1 gene in chondrocytes. Cell transfection experiments with deletion and mutation constructs indicated that the downstream region of the NF-Y binding site (-116 to +1) is also necessary to regulate the proximal promoter activity of the mouse Col11a1 gene. This minimal promoter region has no TATA box and GC-rich sequence; we therefore examined whether the GC-rich sequence (-96 to -67) is necessary for the transcription regulation of the Col11a1 gene. Luciferase assays using a series of mutation constructs exhibited that the GC-rich sequence is a critical element of Col11a1 promoter activity in chondrocytes. Moreover, in silico analysis of this region suggested that one of the most effective candidates was transcription factor Sp1. Consistent with the prediction, overexpression of Sp1 significantly increased the promoter activity. Furthermore, knockdown of Sp1 expression by siRNA transfection suppressed the proximal promoter activity and the expression of endogenous transcript of the mouse Col11a1 gene. Taken together, these results indicate that the transcription factor Sp1 upregulates the proximal promoter activity of the mouse Col11a1 gene in chondrocytes.
Yoshioka, Mikio; Kikuta, Hideaki; Ishiguro, Nobuhisa; Ma, Xiaoming; Kobayashi, Kunihiko
2003-05-01
Chronic active Epstein-Barr virus infection (CAEBV) has been considered to be a non-neoplastic T-cell lymphoproliferative disease associated with Epstein-Barr virus (EBV) infection. In EBV-associated diseases, the cell phenotype-dependent differences in EBV latent gene expression may reflect the strategy of the virus in relation to latent infection. We previously reported that EBV latent gene expression was restricted; EBV nuclear antigen 1 (EBNA1) transcripts were consistently detected in all spleen samples from five CAEBV patients, but EBNA2 transcripts were detected in only one sample. EBV latent gene expression is controlled by distinct usage of three EBNA promoters (Cp, Wp and Qp). In this study, we examined the EBNA promoter usage by RT-PCR and the methylation status in the Cp and Wp regions using bisulfite PCR analysis in spleen samples from CAEBV patients. EBNA1 transcripts were unexpectedly initiated not from Qp but from Cp in all samples in spite of the restricted form of latency. Furthermore, while Cp was active, Cp was heavily methylated, indicating that CAEBV has unique EBV latent gene expression, EBNA promoter usage and EBNA promoter methylation status, in part due to unique splicing of Cp-initiated transcripts and an activation mechanism in hypermethylated Cp.
Sex chromosome loss and the pseudoautosomal region genes in hematological malignancies
Weng, Stephanie; Stoner, Samuel A.; Zhang, Dong-Er
2016-01-01
Cytogenetic aberrations, such as chromosomal translocations, aneuploidy, and amplifications, are frequently detected in hematological malignancies. For many of the common autosomal aberrations, the mechanisms underlying their roles in cancer development have been well-characterized. On the contrary, although loss of a sex chromosome is observed in a broad range of hematological malignancies, how it cooperates in disease development is less understood. Nevertheless, it has been postulated that tumor suppressor genes reside on the sex chromosomes. Although the X and Y sex chromosomes are highly divergent, the pseudoautosomal regions are homologous between both chromosomes. Here, we review what is currently known about the pseudoautosomal region genes in the hematological system. Additionally, we discuss implications for haploinsufficiency of critical pseudoautosomal region sex chromosome genes, driven by sex chromosome loss, in promoting hematological malignancies. Because mechanistic studies on disease development rely heavily on murine models, we also discuss the challenges and caveats of existing models, and propose alternatives for examining the involvement of pseudoautosomal region genes and loss of a sex chromosome in vivo. With the widespread detection of loss of a sex chromosome in different hematological malignances, the elucidation of the role of pseudoautosomal region genes in the development and progression of these diseases would be invaluable to the field. PMID:27655702
Linking disease-associated genes to regulatory networks via promoter organization
Döhr, S.; Klingenhoff, A.; Maier, H.; de Angelis, M. Hrabé; Werner, T.; Schneider, R.
2005-01-01
Pathway- or disease-associated genes may participate in more than one transcriptional co-regulation network. Such gene groups can be readily obtained by literature analysis or by high-throughput techniques such as microarrays or protein-interaction mapping. We developed a strategy that defines regulatory networks by in silico promoter analysis, finding potentially co-regulated subgroups without a priori knowledge. Pairs of transcription factor binding sites conserved in orthologous genes (vertically) as well as in promoter sequences of co-regulated genes (horizontally) were used as seeds for the development of promoter models representing potential co-regulation. This approach was applied to a Maturity Onset Diabetes of the Young (MODY)-associated gene list, which yielded two models connecting functionally interacting genes within MODY-related insulin/glucose signaling pathways. Additional genes functionally connected to our initial gene list were identified by database searches with these promoter models. Thus, data-driven in silico promoter analysis allowed integrating molecular mechanisms with biological functions of the cell. PMID:15701758
Sawado, T; Igarashi, K; Groudine, M
2001-08-28
The mouse beta-globin gene locus control region (LCR), located upstream of the beta-globin gene cluster, is essential for the activated transcription of genes in the cluster. The LCR contains multiple binding sites for transactivators, including Maf-recognition elements (MAREs). However, little is known about the specific proteins that bind to these sites or the time at which they bind during erythroid differentiation. We have performed chromatin immunoprecipitation experiments to determine the recruitment of the erythroid-specific transactivator p45 NF-E2/MafK (p18 NF-E2) heterodimer and small Maf proteins to various regions in the globin gene locus before and after the induction of murine erythroleukemia (MEL) cell differentiation. We report that, before induction, the LCR is occupied by small Maf proteins, and, on erythroid maturation, the NF-E2 complex is recruited to the LCR and the active globin promoters, even though the promoters do not contain MAREs. This differentiation-coupled recruitment of NF-E2 complex correlates with a greater than 100-fold increase in beta-major globin transcription, but is not associated with a significant change in locus-wide histone H3 acetylation. These findings suggest that the beta-globin gene locus exists in a constitutively open chromatin conformation before terminal differentiation, and we speculate that recruitment of NF-E2 complex to the LCR and active promoters may be a rate-limiting step in the activation of beta-globin gene expression.
Lidholm, J; Gustafsson, P
1992-11-01
A comparative transcription analysis of the chloroplast trnK-psbA-trnH region of the two pine species Pinus contorta and Pinus sylvestris is reported. The chloroplast genome of P. contorta has previously been shown to contain a duplicated psbA gene copy integrated closely upstream of the split trnK gene. This rearrangement has resulted in the gene order psbAI-trnK-psbAII-trnH, where psbAII is the ancestral psbA gene copy. In P. sylvestris, a species which lacks the psbA duplication, transcription of the trnK gene originates from a position 291 bp upstream of the trnK 5' exon, adjacent to a canonical promoter structure. In P. contorta, the corresponding promoter structure has been separated from the trnK gene by the insertion of psbAI, and has, in addition, been partially deleted. Analysis of the transcriptional organization of the trnK-psbA-trnH region of the two pine species revealed that the trnK gene in P. contorta is transcriptionally fused to the inserted psbAI gene copy. As a result, trnK is under the control of the psbA promoter in this species and has therefore acquired psbA-like expression characteristics. In P. sylvestris, accumulation of trnK transcripts is not significantly higher in light-grown than in dark-grown seedlings. In contrast, the level of trnK transcripts in P. contorta is approximately 12-fold higher in the light than in the dark. When light-grown seedlings of the two pine species were compared, an approximately 20-fold higher level of trnK RNAs was found in P. contorta. In both pine species, evidence was obtained for trnK-psbA and psbA-trnH co-transcription.
Hong, Jeum Kyu; Hwang, Byung Kook
2009-01-01
The promoter of the pepper pathogen-induced membrane protein gene CaPIMP1 was analyzed by an Agrobacterium-mediated transient expression assay in tobacco leaves. Several stress-related cis-acting elements (GT-1, W-box and ABRE) are located within the CaPIMP1 promoter. In tobacco leaf tissues transiently transformed with a CaPIMP1 promoter-beta-glucuronidase (GUS) gene fusion, serially 5'-deleted CaPIMP1 promoters were differentially activated by Pseudomonas syringae pv. tabaci, ethylene, methyl jasmonate, abscisic acid, and nitric oxide. The -1,193 bp region of the CaPIMP1 gene promoter sequence exhibited full promoter activity. The -417- and -593 bp promoter regions were sufficient for GUS gene activation by ethylene and methyl jasmonate treatments, respectively. However, CaPIMP1 promoter sequences longer than -793 bp were required for promoter activation by abscisic acid and sodium nitroprusside treatments. CaPIMP1 expression was activated in pepper leaves by treatment with ethylene, methyl jasmonate, abscisic acid, beta-amino-n-butyric acid, NaCl, mechanical wounding, and low temperature, but not with salicylic acid. Overexpression of CaPIMP1 in Arabidopsis conferred hypersensitivity to mannitol, NaCl, and ABA during seed germination but not during seedling development. In contrast, transgenic plants overexpressing CaPIMP1 exhibited enhanced tolerance to oxidative stress induced by methyl viologen during germination and early seedling stages. These results suggest that CaPIMP1 expression may alter responsiveness to environmental stress, as well as to pathogen infection.
Amirhaeri, S; Wohlrab, F; Wells, R D
1995-02-17
The influence of simple repeat sequences, cloned into different positions relative to the SV40 early promoter/enhancer, on the transient expression of the chloramphenicol acetyltransferase (CAT) gene was investigated. Insertion of (G)29.(C)29 in either orientation into the 5'-untranslated region of the CAT gene reduced expression in CV-1 cells 50-100 fold when compared with controls with random sequence inserts. Analysis of CAT-specific mRNA levels demonstrated that the effect was due to a reduction of CAT mRNA production rather than to posttranscriptional events. In contrast, insertion of the same insert in either orientation upstream of the promoter-enhancer or downstream of the gene stimulated gene expression 2-3-fold. These effects could be reversed by cotransfection of a competitor plasmid carrying (G)25.(C)25 sequences. The results suggest that a G.C-binding transcription factor modulates gene expression in this system and that promoter strength can be regulated by providing protein-binding sites in trans. Although constructs containing longer tracts of alternating (C-G), (T-G), or (A-T) sequences inhibited CAT expression when inserted in the 5'-untranslated region of the CAT gene, the amount of CAT mRNA was unaffected. Hence, these inhibitions must be due to posttranscriptional events, presumably at the level of translation. These effects of microsatellite sequences on gene expression are discussed with respect to recent data on related simple repeat sequences which cause several human genetic diseases.
Gonzalez, S M; Ferland, L H; Robert, B; Abdelhay, E
1998-06-01
Vertebrate Msx genes are related to one of the most divergent homeobox genes of Drosophila, the muscle segment homeobox (msh) gene, and are expressed in a well-defined pattern at sites of tissue interactions. This pattern of expression is conserved in vertebrates as diverse as quail, zebrafish, and mouse in a range of sites including neural crest, appendages, and craniofacial structures. In the present work, we performed structural and functional analyses in order to identify potential cis-acting elements that may be regulating Msx1 gene expression. To this end, a 4.9-kb segment of the 5'-flanking region was sequenced and analyzed for transcription-factor binding sites. Four regions showing a high concentration of these sites were identified. Transfection assays with fragments of regulatory sequences driving the expression of the bacterial lacZ reporter gene showed that a region of 4 kb upstream of the transcription start site contains positive and negative elements responsible for controlling gene expression. Interestingly, a fragment of 130 bp seems to contain the minimal elements necessary for gene expression, as its removal completely abolishes gene expression in cultured cells. These results are reinforced by comparison of this region with the human Msx1 gene promoter, which shows extensive conservation, including many consensus binding sites, suggesting a regulatory role for them.
KWASNIEWSKI, WOJCIECH; GOZDZICKA-JOZEFIAK, ANNA; WOLUN-CHOLEWA, MARIA; POLAK, GRZEGORZ; SIEROCINSKA-SAWA, JADWIGA; KWASNIEWSKA, ANNA; KOTARSKI, JAN
2016-01-01
Endometrial carcinoma (EC) is the most common type of gynecological malignancy. Studies have demonstrated that the insulin growth factor (IGF) pathway is implicated in the development of endometrial tumors and that the serum levels of IGF-1 are affected by estrogen. Most EC cells with high microsatellite instability (MSI-H) accumulate mutations at a microsatellite sequence in the IGF-1 gene. The present study investigated the CA repeat polymorphism in the P1 promoter region of the IGF-1 gene among Caucasian females with endometrial hyperplasia, EC and healthy control subjects, whose blood serum and surgical tissue specimens were analyzed. Differences or correlations between the analyzed parameters [serum levels of IGF-1 and IGF binding protein (IGFBP)-1 and IGFBP-3 as well as estrogens among the polymorphisms] were verified using the χ2, Mann-Whitney U, Kruskal-Wallis or Spearman's rank correlation tests. A PCR amplification and DNA sequencing analysis was used for identification of (CA)n repeats in the P1 region of IGF-1. ELISA was used to determine the blood serum levels of IGF-1, IGFBP-1, IGFBP-3 and estrogens. Furthermore, IGF-1 was assessed in endometrial tissues by immunohistochemical analysis. The present study indicated no statistically significant differences between serum levels of IGF-1, IGFBP-1, IGFBP-3 and estrone, estriol and estradiol in the control and study groups. A significant correlation was identified between the IGF-1 levels and estrone levels in the MSI-H polymorphism (r=−0.41, P=0.012) as well as a highly negative correlation between IGF-1 levels and the estradiol levels in the MSI-H polymorphism (r=−0.6, P=0.002). Genotypes without the 19 CA allele were predominantly found in EC. Furthermore, statistical analysis indicated that the number of IGF-1-expressing cells was significantly elevated in MSI-H type 18-20 (P= 0.0072), MSI-L type 19-20 (P=0.025) and microsatellite-stable MSS type 19-19 (P=0.024) compared with those in the MSI-H 20
Chen, Huan; Je, Jihyun; Song, Chieun; Hwang, Jung Eun; Lim, Chae Oh
2012-09-01
The dehydration-responsive element-binding factor 2C (DREB2C) is a member of the CBF/DREB subfamily of proteins, which contains a single APETALA2/Ethylene responsive element-binding factor (AP2/ERF) domain. To identify the expression pattern of the DREB2C gene, which contains multiple transcription cis-regulatory elements in its promoter, an approximately 1.4 kb upstream DREB2C sequence was fused to the β-glucuronidase reporter gene (GUS) and the recombinant p1244 construct was transformed into Arabidopsis thaliana (L.) Heynh. The promoter of the gene directed prominent GUS activity in the vasculature in diverse young dividing tissues. Upon applying heat stress (HS), GUS staining was also enhanced in the vasculature of the growing tissues. Analysis of a series of 5'-deletions of the DREB2C promoter revealed that a proximal upstream sequence sufficient for the tissue-specific spatial and temporal induction of GUS expression by HS is localized in the promoter region between -204 and -34 bps relative to the transcriptional start site. Furthermore, electrophoretic mobility shift assay (EMSA) demonstrated that nuclear protein binding activities specific to a -120 to -32 bp promoter fragment increased after HS. These results indicate that the TATA-proximal region and some latent trans-acting factors may cooperate in HS-induced activation of the Arabidopsis DREB2C promoter. © 2012 Institute of Botany, Chinese Academy of Sciences.
Kohno, K; Yasuzawa, K; Hirose, M; Kano, Y; Goshima, N; Tanaka, H; Imamoto, F
1994-06-01
The molecular mechanism of autoregulation of expression of the hupA gene in Escherichia coli was examined. The promoter of the gene contains a palindromic sequence with the potential to form a cruciform DNA structure in which the -35 sequence lies at the base of the stem and the -10 sequence forms a single-stranded loop. An artificial promoter lacking the palindrome, which was constructed by replacing a 10 nucleotide repeat for the predicted cruciform arm by a sequence in the opposite orientation, was not subject to HU-repression. DNA relaxation induced by deleting HU proteins and/or inhibiting DNA gyrase in cells results in increased expression from the hupA promoter. We propose that initiation of transcription of the hupA gene is negatively regulated by steric hindrance of the functional promoter domains for formation of the cruciform configuration, which is facilitated at least in part by negative supercoiling of the hupA promoter DNA region. The promoter region of the hupB gene also contains a palindromic sequence that can assume a cruciform configuration. Negative regulation of this gene by HU proteins may occur by a mechanism similar to that operating for the hupA gene.
Banlaki, Zsofia; Cimarelli, Giulia; Viranyi, Zsofia; Kubinyi, Eniko; Sasvari-Szekely, Maria; Ronai, Zsolt
2017-06-01
A growing body of evidence highlights the relationship between epigenetics, especially DNA methylation, and population divergence as well as speciation. However, little is known about how general the phenomenon of epigenetics-wise separation of different populations is, or whether population assignment is, possible based on solely epigenetic marks. In the present study, we compared DNA methylation profiles between four different canine populations: three domestic dog breeds and their ancestor the gray wolf. Altogether, 79 CpG sites constituting the 65 so-called CpG units located in the promoter regions of genes affecting behavioral and temperamental traits (COMT, HTR1A, MAOA, OXTR, SLC6A4, TPH1, WFS1)-regions putatively targeted during domestication and breed selection. Methylation status of buccal cells was assessed using EpiTYPER technology. Significant inter-population methylation differences were found in 52.3% of all CpG units investigated. DNA methylation profile-based hierarchical cluster analysis indicated an unambiguous segregation of wolf from domestic dog. In addition, one of the three dog breeds (Golden Retriever) investigated also formed a separate, autonomous group. The findings support that population segregation is interrelated with shifts in DNA methylation patterns, at least in putative selection target regions, and also imply that epigenetic profiles could provide a sufficient basis for population assignment of individuals.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Vortkamp, A.; Gessler, M.; Le Paslier, D.
1994-08-01
Disruption of the zinc finger gene GLI3 has been shown to be the cause of Greig cephalopolysyndactyly syndrome (GCPS), at least in some GCPS translocation patients. To characterize this genomic region on human chromosome 7p13, we have isolated a YAC contig of more than 1000 kb including the GLI3 gene. In this contig the gene itself spans at least 200-250 kb. A CpG island is located in the vicinity of the 5{prime} region of the known GLI3 cDNA, implying a potential promoter region. 28 refs., 3 figs., 1 tab.
Gene Expression in Class 2 Integrons Is SOS-Independent and Involves Two Pc Promoters.
Jové, Thomas; Da Re, Sandra; Tabesse, Aurore; Gassama-Sow, Amy; Ploy, Marie-Cécile
2017-01-01
Integrons are powerful bacterial genetic elements that permit the expression and dissemination of antibiotic-resistance gene cassettes. They contain a promoter Pc that allows the expression of gene cassettes captured through site-specific recombination catalyzed by IntI, the integron-encoded integrase. Class 1 and 2 integrons are found in both clinical and environmental settings. The regulation of intI and of Pc promoters has been extensively studied in class 1 integrons and the regulatory role of the SOS response on intI expression has been shown. Here we investigated class 2 integrons. We characterized the P intI2 promoter and showed that intI2 expression is not regulated via the SOS response. We also showed that, unlike class 1 integrons, class 2 integrons possess not one but two active Pc promoters that are located within the attI2 region that seem to contribute equally to gene cassette expression. Class 2 integrons mostly encode an inactive truncated integrase, but the rare class 2 integrons that encode an active integrase are associated with less efficient Pc2 promoter variants. We propose an evolutionary model for class 2 integrons in which the absence of repression of the integrase gene expression led to mutations resulting in either inactive integrase or Pc variants of weaker activity, thereby reducing the potential fitness cost of these integrons.
Two distinct promoters drive transcription of the human D1A dopamine receptor gene.
Lee, S H; Minowa, M T; Mouradian, M M
1996-10-11
The human D1A dopamine receptor gene has a GC-rich, TATA-less promoter located upstream of a small, noncoding exon 1, which is separated from the coding exon 2 by a 116-base pair (bp)-long intron. Serial 3'-deletions of the 5'-noncoding region of this gene, including the intron and 5'-end of exon 2, resulted in 80 and 40% decrease in transcriptional activity of the upstream promoter in two D1A-expressing neuroblastoma cell lines, SK-N-MC and NS20Y, respectively. To investigate the function of this region, the intron and 245 bp at the 5'-end of exon 2 were investigated. Transient expression analyses using various chloramphenicol acetyltransferase constructs showed that the transcriptional activity of the intron is higher than that of the upstream promoter by 12-fold in SK-N-MC cells and by 5.5-fold in NS20Y cells in an orientation-dependent manner, indicating that the D1A intron is a strong promoter. Primer extension and ribonuclease protection assays revealed that transcription driven by the intron promoter is initiated at the junction of intron and exon 2 and at a cluster of nucleotides located 50 bp downstream from this junction. The same transcription start sites are utilized by the chloramphenicol acetyltransferase constructs employed in transfections as well as by the D1A gene expressed within the human caudate. The relative abundance of D1A transcripts originating from the upstream promoter compared with those transcribed from the intron promoter is 1.5-2.9 times in SK-N-MC cells and 2 times in the human caudate. Transcript stability studies in SK-N-MC cells revealed that longer D1A mRNA molecules containing exon 1 are degraded 1.8 times faster than shorter transcripts lacking exon 1. Although gel mobility shift assay could not detect DNA-protein interaction at the D1A intron, competitive co-transfection using the intron as competitor confirmed the presence of trans-acting factors at the intron. These data taken together indicate that the human D1A gene has
Cousin, E; Medcalf, R L; Bergonzelli, G E; Kruithof, E K
1991-01-01
Gene transcription rates and mRNA levels of plasminogen activator inhibitor type 2 (PAI-2) are markedly induced by the tumor promoting agent phorbol 12-myristate 13-acetate (PMA) in human HT1080 fibrosarcoma cells. To identify promoter elements required for basal-, and phorbol ester-inducible expression, deletion mutants of the PAI-1 promoter fused to the chloramphenicol acetyl transferase (CAT) reporter gene, were transiently expressed in HT1080 cells. Constitutive CAT activity was expressed from constructs containing more than 215 bp of promoter sequence, whereas deletion to position -91 bp abolished CAT gene expression. Treatment of transfected cells with PMA resulted in a three- to ten-fold increase in CAT expression from all constructs except from the construct shortened to position -91. DNAse1 protection analysis of the promoter region between -215 and the transcription initiation site revealed numerous protected regions, including two AP1-like binding sites (AP1a and AP1b) and one CRE-like element. Site-directed mutagenesis of the AP1a site or of the CRE-like site resulted in the loss of basal CAT activity and abolished the PMA effect, whereas mutagenesis of AP1b only partially inhibited basal and PMA-mediated expression. Our results suggest that the PAI-2 promoter contains at least two elements required for basal gene transcription and PMA-mediated induction. Images PMID:1650454
Danda, Ravikanth; Krishnan, Gopinath; Ganapathy, Kalaivani; Krishnan, Uma Maheswari; Vikas, Khetan; Elchuri, Sailaja; Chatterjee, Nivedita; Krishnakumar, Subramanian
2013-01-01
In order to realise the full potential of cancer suicide gene therapy that allows the precise expression of suicide gene in cancer cells, we used a tissue specific Epithelial cell adhesion molecule (EpCAM) promoter (EGP-2) that directs transgene Herpes simplex virus-thymidine kinase (HSV-TK) expression preferentially in EpCAM over expressing cancer cells. EpCAM levels are considerably higher in retinoblastoma (RB), a childhood eye cancer with limited expression in normal cells. Use of miRNA regulation, adjacent to the use of the tissue-specific promoter, would provide the second layer of control to the transgene expression only in the tumor cells while sparing the normal cells. To test this hypothesis we cloned let-7b miRNA targets in the 3'UTR region of HSV-TK suicide gene driven by EpCAM promoter because let-7 family miRNAs, including let-7b, were found to be down regulated in the RB tumors and cell lines. We used EpCAM over expressing and let-7 down regulated RB cell lines Y79, WERI-Rb1 (EpCAM (+ve)/let-7b(down-regulated)), EpCAM down regulated, let-7 over expressing normal retinal Müller glial cell line MIO-M1(EpCAM (-ve)/let-7b(up-regulated)), and EpCAM up regulated, let-7b up-regulated normal thyroid cell line N-Thy-Ori-3.1(EpCAM (+ve)/let-7b(up-regulated)) in the study. The cell proliferation was measured by MTT assay, apoptosis was measured by probing cleaved Caspase3, EpCAM and TK expression were quantified by Western blot. Our results showed that the EGP2-promoter HSV-TK (EGP2-TK) construct with 2 or 4 copies of let-7b miRNA targets expressed TK gene only in Y79, WERI-Rb-1, while the TK gene did not express in MIO-M1. In summary, we have developed a tissue-specific, miRNA-regulated dual control vector, which selectively expresses the suicide gene in EpCAM over expressing cells.
Levin, Raz; Heresco-Levy, Uriel; Bachner-Melman, Rachel; Israel, Salomon; Shalev, Idan; Ebstein, Richard P
2009-07-01
Arginine vasopressin and the arginine vasopressin 1a (AVPR1a) gene contribute to a range of social behaviors both in lower vertebrates and in humans. Human promoter-region microsatellite repeat regions (RS1 and RS3) in the AVPR1a gene region have been associated with autism spectrum disorders, prosocial behavior and social cognition. Prepulse inhibition (PPI) of the startle response to auditory stimuli is a largely autonomic response that resonates with social cognition in both animal models and humans. Reduced PPI has been observed in disorders including schizophrenia that are distinguished by deficits in social skills. In the current investigation association was examined between PPI and the AVPR1a RS1 and RS repeat regions and PPI in a group of 113 nonclinical subjects. Using a robust family-based strategy, association was observed between AVPR1a promoter-region repeat length, especially RS3) and PPI (30 ms: global p=0.04; 60 ms p=0.006; 120 ms p=0.008). Notably, longer RS3 alleles were associated with greater levels of prepulse inhibition. Using a short/long classification scheme for the repeat regions, significant association was also observed between all three PPI intervals (30, 60 and 120 ms) and both RS1 and RS3 polymorphisms (PBAT: FBAT-PC(2) statistic p=0.047). Tests of within-subject effects (SPSS GLM) showed significant sexxRS3 interactions at 30 ms (p=0.045) and 60 ms (p=0.01). Longer alleles, especially in male subjects, are associated with significantly higher PPI response, consistent with a role for the promoter repeat region in partially molding social behavior in both animals and humans. This is the first report in humans demonstrating a role of the AVPR1a gene in contributing to the PPI response to auditory stimuli.
Insect and wound induced GUS gene expression from a Beta vulgaris proteinase inhibitor gene promoter
USDA-ARS?s Scientific Manuscript database
Inducible gene promoters that are specifically activated by pathogen invasion or insect pest attack are needed for effective expression of resistance genes to control plant diseases. In the present study, a promoter from a serine proteinase inhibitor gene (BvSTI) shown to be up-regulated in resist...
Four out of eight genes in a mouse chromosome 7 congenic donor region are candidate obesity genes.
Sarahan, Kari A; Fisler, Janis S; Warden, Craig H
2011-09-22
We previously identified a region of mouse chromosome 7 that influences body fat mass in F2 littermates of congenic × background intercrosses. Current analyses revealed that alleles in the donor region of the subcongenic B6.C-D7Mit318 (318) promoted a twofold increase in adiposity in homozygous lines of 318 compared with background C57BL/6ByJ (B6By) mice. Parent-of-origin effects were discounted through cross-fostering studies and an F1 reciprocal cross. Mapping of the donor region revealed that it has a maximal size of 2.8 Mb (minimum 1.8 Mb) and contains a maximum of eight protein coding genes. Quantitative PCR in whole brain, liver, and gonadal white adipose tissue (GWAT) revealed differential expression between genotypes for three genes in females and two genes in males. Alpha-2,8-sialyltransferase 8B (St8sia2) showed reduced 318 mRNA levels in brain for females and males and in GWAT for females only. Both sexes of 318 mice had reduced Repulsive guidance molecule-a (Rgma) expression in GWAT. In brain, Family with sequence similarity 174 member b (Fam174b) had increased expression in 318 females, whereas Chromodomain helicase DNA binding protein 2 (Chd2-2) had reduced expression in 318 males. No donor region genes were differentially expressed in liver. Sequence analysis of coding exons for all genes in the 318 donor region revealed only one single nucleotide polymorphism that produced a nonsynonymous missense mutation, Gln7Pro, in Fam174b. Our findings highlight the difficulty of using expression and sequence to identify quantitative trait genes underlying obesity even in small genomic regions.
Cloning and functional analysis of the promoter region of the human Disc large gene.
Cavatorta, Ana Laura; Giri, Adriana A; Banks, Lawrence; Gardiol, Daniela
2008-11-15
A number of studies have demonstrated the involvement of human Disc large (DLG1) in the control of both cell polarity and maintenance of tissue architecture. However, the mechanisms controlling DLG1 transcription are not fully understood. This is relevant since DLG1 is lost in many tumours during the later stages of malignant progression. Therefore, we performed the cloning and functional analysis of a genomic 5' flanking region of the DLG1 open reading frame with promoter activity. We analyzed the activity of a series of 5' deletion constructs of the DLG1 promoter and determined the minimal essential sequences that are required for promoter activity as well as cis-elements that regulate transcription. We found, within the DLG1 promoter sequences, consensus-binding sites for the Snail family of transcription factors that repress the expression of epithelial markers and are up-regulated in a variety of tumours. Snail transcription factors repress the transcriptional activity of the DLG1 promoter and, ectopically expressed Snail proteins bind to the native DLG1 promoter. These data suggest a role for Snail transcription factors in the control of DLG1 expression and provide a basis for understanding the transcriptional regulation of DLG1.
Jahromi, Marziyeh Salehi; Hill, Jennifer W; Tehrani, Fahimeh Ramezani; Zadeh-Vakili, Azita
2018-05-30
The methylation level of promoters is one of the most studied and well-known epigenetic mechanisms that programs the amount of gene expression. Over expression of steroidogenesis genes via epigenetic control can result in hypetandrogenism, which is the main endocrine aspect of polycystic ovarian syndrome (PCOS). In the present study we aimed to determine and compare the promoter methylation levels of three steroidogenic genes, CYP17, GATA6 and StAR, in theca cells of prenatally androgenized (PNA) rats to those of controls. Pregnant Wistar rats in the PNA group received 5 mg free testosterone, dissolved in 500 mL solvent, subcutaneously injected on day 20 of pregnancy, while controls were injected with 500 mL of solvent only. Theca cell samples, taken from the ovaries of eight to ten female offspring of both the PNA and control groups, were measured for promoter methylation levels of the aforementioned genes, using the bisulfite sequence PCR (BSP) method. Although the promoters of all three genes were slightly hypomethylated in the PNA group, the differences observed were not significant compared to the control group. The methylation of -520 and -822 positions, in the GATA6 and the StAR promoter respectively, were significantly decreased in the PNA group. The results of this study suggest that alterations in the steroidogenesis pathway after exposure to excess androgen may be a result of changes in the pattern of the methylation of the relevant genes. Copyright © 2017. Published by Elsevier Inc.
Reconstructing Dynamic Promoter Activity Profiles from Reporter Gene Data.
Kannan, Soumya; Sams, Thomas; Maury, Jérôme; Workman, Christopher T
2018-03-16
Accurate characterization of promoter activity is important when designing expression systems for systems biology and metabolic engineering applications. Promoters that respond to changes in the environment enable the dynamic control of gene expression without the necessity of inducer compounds, for example. However, the dynamic nature of these processes poses challenges for estimating promoter activity. Most experimental approaches utilize reporter gene expression to estimate promoter activity. Typically the reporter gene encodes a fluorescent protein that is used to infer a constant promoter activity despite the fact that the observed output may be dynamic and is a number of steps away from the transcription process. In fact, some promoters that are often thought of as constitutive can show changes in activity when growth conditions change. For these reasons, we have developed a system of ordinary differential equations for estimating dynamic promoter activity for promoters that change their activity in response to the environment that is robust to noise and changes in growth rate. Our approach, inference of dynamic promoter activity (PromAct), improves on existing methods by more accurately inferring known promoter activity profiles. This method is also capable of estimating the correct scale of promoter activity and can be applied to quantitative data sets to estimate quantitative rates.
2013-01-01
Background The ACVR1 gene encodes a type I receptor for bone morphogenetic proteins (BMPs). Mutations in the ACVR1 gene are associated with Fibrodysplasia Ossificans Progressiva (FOP), a rare and extremely disabling disorder characterized by congenital malformation of the great toes and progressive heterotopic endochondral ossification in muscles and other non-skeletal tissues. Several aspects of FOP pathophysiology are still poorly understood, including mechanisms regulating ACVR1 expression. This work aimed to identify regulatory elements that control ACVR1 gene transcription. Methods and results We first characterized the structure and composition of human ACVR1 gene transcripts by identifying the transcription start site, and then characterized a 2.9 kb upstream region. This region showed strong activating activity when tested by reporter gene assays in transfected cells. We identified specific elements within the 2.9 kb region that are important for transcription factor binding using deletion constructs, co-transfection experiments with plasmids expressing selected transcription factors, site-directed mutagenesis of consensus binding-site sequences, and by protein/DNA binding assays. We also characterized a GC-rich minimal promoter region containing binding sites for the Sp1 transcription factor. Conclusions Our results showed that several transcription factors such as Egr-1, Egr-2, ZBTB7A/LRF, and Hey1, regulate the ACVR1 promoter by binding to the -762/-308 region, which is essential to confer maximal transcriptional activity. The Sp1 transcription factor acts at the most proximal promoter segment upstream of the transcription start site. We observed significant differences in different cell types suggesting tissue specificity of transcriptional regulation. These findings provide novel insights into the molecular mechanisms that regulate expression of the ACVR1 gene and that could be targets of new strategies for future therapeutic treatments. PMID:24047559
Su, Zhao-Zhong; Sarkar, Devanand; Emdad, Luni; Duigou, Gregory J; Young, Charles S H; Ware, Joy; Randolph, Aaron; Valerie, Kristoffer; Fisher, Paul B
2005-01-25
One impediment to effective cancer-specific gene therapy is the rarity of regulatory sequences targeting gene expression selectively in tumor cells. Although many tissue-specific promoters are recognized, few cancer-selective gene promoters are available. Progression-elevated gene-3 (PEG-3) is a rodent gene identified by subtraction hybridization that displays elevated expression as a function of transformation by diversely acting oncogenes, DNA damage, and cancer cell progression. The promoter of PEG-3, PEG-Prom, displays robust expression in a broad spectrum of human cancer cell lines with marginal expression in normal cellular counterparts. Whereas GFP expression, when under the control of a CMV promoter, is detected in both normal and cancer cells, when GFP is expressed under the control of the PEG-Prom, cancer-selective expression is evident. Mutational analysis identifies the AP-1 and PEA-3 transcription factors as primary mediators of selective, cancer-specific expression of the PEG-Prom. Synthesis of apoptosis-inducing genes, under the control of the CMV promoter, inhibits the growth of both normal and cancer cells, whereas PEG-Prom-mediated expression of these genes kills only cancer cells and spares normal cells. The efficacy of the PEG-Prom as part of a cancer gene therapeutic regimen is further documented by in vivo experiments in which PEG-Prom-controlled expression of an apoptosis-inducing gene completely inhibited prostate cancer xenograft growth in nude mice. These compelling observations indicate that the PEG-Prom, with its cancer-specific expression, provides a means of selectively delivering genes to cancer cells, thereby providing a crucial component in developing effective cancer gene therapies.
Ishihara, Satoru; Varma, Rajat; Schwartz, Ronald H.
2010-01-01
To explore the higher order structure of transcribable chromatin in vivo, its local configuration was assessed through the accessibility of the chromatin to crosslinking with formaldehyde. The application of crosslinked and mildly sheared chromatin to sedimentation velocity centrifugation followed by size-fractionation of the DNA enabled us to biochemically distinguish between chromatin with heavily versus sparsely crosslinkable structures. The separated fractions showed a good correlation with gene expression profiles. Genes with poor crosslinking around the promoter region were actively transcribed, while transcripts were hardly detected from genes with extensive crosslinking in their promoter regions. For the inducible gene, Il2, the distribution of the promoter shifted in the gradient following T-cell receptor stimulation, consistent with a change in structure at this locus during activation. The kinetics of this switch preceded the chromatin change observed in a DNase I accessibility assay. Thus, this new chromatin fractionation technique has revealed a change in chromatin structure that has not been previously characterized. PMID:20371521
Seifi Moroudi, Reihane; Masoudi, Ali Akbar; Vaez Torshizi, Rasoul; Zandi, Mohammad
2014-12-01
One of the important behaviors of dogs is trainability which is affected by learning and memory genes. These kinds of the genes have not yet been identified in dogs. In the current research, these genes were found in animal models by mining the biological data and scientific literatures. The proteins of these genes were obtained from the UniProt database in dogs and humans. Not all homologous proteins perform similar functions, thus comparison of these proteins was studied in terms of protein families, domains, biological processes, molecular functions, and cellular location of metabolic pathways in Interpro, KEGG, Quick Go and Psort databases. The results showed that some of these proteins have the same performance in the rat or mouse, dog, and human. It is anticipated that the protein of these genes may be effective in learning and memory in dogs. Then, the expression pattern of the recognized genes was investigated in the dog hippocampus using the existing information in the GEO profile. The results showed that BDNF, TAC1 and CCK genes are expressed in the dog hippocampus, therefore, these genes could be strong candidates associated with learning and memory in dogs. Subsequently, due to the importance of the promoter regions in gene function, this region was investigated in the above genes. Analysis of the promoter indicated that the HNF-4 site of BDNF gene and the transcription start site of CCK gene is exposed to methylation. Phylogenetic analysis of protein sequences of these genes showed high similarity in each of these three genes among the studied species. The dN/dS ratio for BDNF, TAC1 and CCK genes indicates a purifying selection during the evolution of the genes.
Transcriptional organization of the DNA region controlling expression of the K99 gene cluster.
Roosendaal, B; Damoiseaux, J; Jordi, W; de Graaf, F K
1989-01-01
The transcriptional organization of the K99 gene cluster was investigated in two ways. First, the DNA region, containing the transcriptional signals was analyzed using a transcription vector system with Escherichia coli galactokinase (GalK) as assayable marker and second, an in vitro transcription system was employed. A detailed analysis of the transcription signals revealed that a strong promoter PA and a moderate promoter PB are located upstream of fanA and fanB, respectively. No promoter activity was detected in the intercistronic region between fanB and fanC. Factor-dependent terminators of transcription were detected and are probably located in the intercistronic region between fanA and fanB (T1), and between fanB and fanC (T2). A third terminator (T3) was observed between fanC and fanD and has an efficiency of 90%. Analysis of the regulatory region in an in vitro transcription system confirmed the location of the respective transcription signals. A model for the transcriptional organization of the K99 cluster is presented. Indications were obtained that the trans-acting regulatory polypeptides FanA and FanB both function as anti-terminators. A model for the regulation of expression of the K99 gene cluster is postulated.
Matsunaga, Taichi; Yamashita, Jun K
2014-02-07
Specific gene knockout and rescue experiments are powerful tools in developmental and stem cell biology. Nevertheless, the experiments require multiple steps of molecular manipulation for gene knockout and subsequent rescue procedures. Here we report an efficient and single step strategy to generate gene knockout-rescue system in pluripotent stem cells by promoter insertion with CRISPR/Cas9 genome editing technology. We inserted a tetracycline-regulated inducible gene promoter (tet-OFF/TRE-CMV) upstream of the endogenous promoter region of vascular endothelial growth factor receptor 2 (VEGFR2/Flk1) gene, an essential gene for endothelial cell (EC) differentiation, in mouse embryonic stem cells (ESCs) with homologous recombination. Both homo- and hetero-inserted clones were efficiently obtained through a simple selection with a drug-resistant gene. The insertion of TRE-CMV promoter disrupted endogenous Flk1 expression, resulting in null mutation in homo-inserted clones. When the inserted TRE-CMV promoter was activated with doxycycline (Dox) depletion, Flk1 expression was sufficiently recovered from the downstream genomic Flk1 gene. Whereas EC differentiation was almost completely perturbed in homo-inserted clones, Flk1 rescue with TRE-CMV promoter activation restored EC appearance, indicating that phenotypic changes in EC differentiation can be successfully reproduced with this knockout-rescue system. Thus, this promoter insertion strategy with CRISPR/Cas9 would be a novel attractive method for knockout-rescue experiments. Copyright © 2014 Elsevier Inc. All rights reserved.
Promoter regions of potato vacuolar invertase gene in response to sugars and hormones.
Ou, Yongbin; Song, Botao; Liu, Xun; Xie, Conghua; Li, Meng; Lin, Yuan; Zhang, Huiling; Liu, Jun
2013-08-01
Potato vacuolar acid invertase (StvacINV1) (β-fructofuranosidase; EC 3.2.1.26) has been confirmed to play an important role in cold-induced sweetening of potato tubers. However, the transcriptional regulation mechanisms of StvacINV1 are largely unknown. In this study, the 5'-flanking sequence of StvacINV1 was cloned and the cis-acting elements were predicted. Histochemical assay showed that the StvacINV1 promoter governed β-glucuronidase (GUS) expression in potato leaves, stems, roots and tubers. Quantitative analysis of GUS expression suggested that the activity of StvacINV1 promoter was suppressed by sucrose, glucose, fructose, and cold, while enhanced by indole-3-acetic acid (IAA), and gibberellic acid (GA3). Further deletion analysis clarified that the promoter regions from -118 to -551, -551 to -1021, and -1021 to -1521 were required for responding to sucrose/glucose, GA3, and IAA, respectively. These findings provide essential information regarding transcriptional regulation mechanisms of StvacINV1. Copyright © 2013 Elsevier Masson SAS. All rights reserved.
Chopra, A; Gupta, I D; Verma, A; Chakravarty, A K; Vohra, V
2015-01-01
Lactoferrin (Lf) gene promoter was screened for the presence of single nucleotide polymphism in indigenous and crossbred cattle from North India and to evaluate its association with Mastitis. Study revealed the presence of genetic variation in regulatory region of bovine Lactoferrin gene using PCR-RFLP technique. Three genotypes namely GG, GH and HH were identified. A single nucleotide change, from guanine to adenine at 25th position was found to be significantly associated (p<0.05) with clinical mastitis in indigenous Sahiwal and crossbred Karan Fries cattle maintained at organised herd of National Dairy Research Institute, Karnal. A non-significant association was observed between subclinical mastitis, somatic cell score (SCS), and GG genotype in Karan Fries cattle, however, a lower SCS was observed in animals having GG genotype. Overall a lower incidence of clinical mastitis was recorded in those animals having GG genotype of Lf in Sahiwal and Karan Fries (KF) cattle. The SNP identified in the promoter region may effect expression lactoferrin protein, which may lead to different levels of antibacterial and anti-inflammatory activity of Lf gene. Results from this study indicated the probable role played by Lactoferrin promoter to serve as candidate gene for mastitis susceptibility among indigenous and crossbred milch cattle.
Bethge, Tobias; Ajuh, Elvis; Hirsch, Hans H
2016-11-15
Rearrangements or point mutations in the noncoding control region (NCCR) of BK polyomavirus (BKPyV) have been associated with higher viral loads and more pronounced organ pathology in immunocompromised patients. The respective alterations affect a multitude of transcription factor binding sites (TFBS) but consistently cause increased expression of the early viral gene region (EVGR) at the expense of late viral gene region (LVGR) expression. By mutating TFBS, we identified three phenotypic groups leading to strong, intermediate, or impaired EVGR expression and corresponding BKPyV replication. Unexpectedly, Sp1 TFBS mutants either activated or inhibited EVGR expression when located proximal to the LVGR (sp1-4) or the EVGR (sp1-2), respectively. We now demonstrate that the bidirectional balance of EVGR and LVGR expression is dependent on affinity, strand orientation, and the number of Sp1 sites. Swapping the LVGR-proximal high-affinity SP1-4 with the EVGR-proximal low-affinity SP1-2 in site strand flipping or inserting an additional SP1-2 site caused a rearranged NCCR phenotype of increased EVGR expression and faster BKPyV replication. The 5' rapid amplification of cDNA ends revealed an imperfect symmetry between the EVGR- and LVGR-proximal parts of the NCCR, consisting of TATA and TATA-like elements, initiator elements, and downstream promoter elements. Mutation or deletion of the archetypal LVGR promoter, which is found in activated NCCR variants, abrogated LVGR expression, which could be restored by providing large T antigen (LTag) in trans Thus, whereas Sp1 sites control the initial EVGR-LVGR expression balance, LTag expression can override inactivation of the LVGR promoter and acts as a key driver of LVGR expression independently of the Sp1 sites and core promoter elements. Polyomaviridae currently comprise more than 70 members, including 13 human polyomaviruses (PyVs), all of which share a bidirectional genome organization mediated by the NCCR, which determines
Islam, Md Ekramul; Kikuta, Hiroshi; Inoue, Fumitaka; Kanai, Maiko; Kawakami, Atsushi; Parvin, Mst Shahnaj; Takeda, Hiroyuki; Yamasu, Kyo
2006-12-01
In vertebrate embryos, positioning of the boundary between the midbrain and hindbrain (MHB) and subsequent isthmus formation are dependent upon the interaction between the Otx2 and Gbx genes. In zebrafish, sequential expression of gbx1 and gbx2 in the anterior hindbrain contributes to this process, whereas in mouse embryos, a single Gbx gene (Gbx2) is responsible for MHB development. In the present study, to investigate the regulatory mechanism of gbx2 in the MHB/isthmic region of zebrafish embryos, we cloned the gene and showed that its organization is conserved among different vertebrates. Promoter analyses revealed three enhancers that direct reporter gene expression after the end of epiboly in the anterior-most hindbrain, which is a feature of the zebrafish gbx2 gene. One of the enhancers is located upstream of gbx2 (AMH1), while the other two enhancers are located downstream of gbx2 (AMH2 and AMH3). Detailed analysis of the AMH1 enhancer showed that it directs expression in the rhombomere 1 (r1) region and the dorsal thalamus, as has been shown for gbx2, whereas no expression was induced by the AMH1 enhancer in other embryonic regions in which gbx2 is expressed. The AMH1 enhancer is composed of multiple regulatory subregions that share the same spatial specificity. The most active of the regulatory subregions is a 291-bp region that contains at least two Pax2-binding sites, both of which are necessary for the function of the main component (PB1-A region) of the AMH1 enhancer. In accordance with these results, enhancer activity in the PB1-A region, as well as gbx2 expression in r1, was missing in no isthmus mutant embryos that lacked functional pax2a. In addition, we identified an upstream conserved sequence of 227bp that suppresses the enhancer activity of AMH1. Taken together, these findings suggest that gbx2 expression during the somitogenesis stage in zebrafish is regulated by a complex mechanism involving Pax2 as well as activators and suppressors in the
Molecular analysis of the human SLC13A4 sulfate transporter gene promoter
DOE Office of Scientific and Technical Information (OSTI.GOV)
Jefferis, J.; Rakoczy, J.; School of Biomedical Sciences, University of Queensland, St. Lucia, Queensland
2013-03-29
Highlights: ► Basal promoter activity of SLC13A4 −57 to −192 nt upstream of transcription initiation site. ► Human SLC13A4 5′-flanking region has conserved motifs with other placental species. ► Putative NFY, SP1 and KLF7 motifs in SLC13A4 5′-flanking region enhance transcription. -- Abstract: The human solute linked carrier (SLC) 13A4 gene is primarily expressed in the placenta where it is proposed to mediate the transport of nutrient sulfate from mother to fetus. The molecular mechanisms involved in the regulation of SLC13A4 expression remain unknown. To investigate the regulation of SLC13A4 gene expression, we analysed the transcriptional activity of the humanmore » SLC13A4 5′-flanking region in the JEG-3 placental cell line using luciferase reporter assays. Basal transcriptional activity was identified in the region −57 to −192 nucleotides upstream of the SLC13A4 transcription initiation site. Mutational analysis of the minimal promoter region identified Nuclear factor Y (NFY), Specificity protein 1 (SP1) and Krüppel like factor 7 (KLF7) motifs which conferred positive transcriptional activity, as well as Zinc finger protein of the cerebellum 2 (ZIC2) and helix–loop–helix protein 1 (HEN1) motifs that repressed transcription. The conserved NFY, SP1, KLF7, ZIC2 and HEN1 motifs in the SLC13A4 promoter of placental species but not in non-placental species, suggests a potential role for these putative transcriptional factor binding motifs in the physiological control of SLC13A4 mRNA expression.« less
Jezkova, Eva; Kajo, Karol; Zubor, Pavol; Grendar, Marian; Malicherova, Bibiana; Mendelova, Andrea; Dokus, Karol; Lasabova, Zora; Plank, Lukas; Danko, Jan
2016-10-15
Breast cancer is a heterogeneous disease with very different responses to therapy and different length of survival. In many cases, however, the determination of the stage and histopathological characteristics of breast cancer is insufficient to predict prognosis and response to treatment for the vast heterogeneity of the disease. To understand the molecular signature of subtypes of breast cancer, we attempted to identify the methylation status of key tumour suppressor gene Ras association (RalGDS/AF-6) domain family member 1 isoform a (RASSF1A) and a member of the paired-like homeodomain transcription factor family which functions in left-right asymmetry development (PITX2) and to correlate results with known clinicopathological features of breast cancer. Formalin-fixed, paraffin-embedded (FFPE) tissues of breast carcinomas (n = 149) were used for DNA extraction. DNA was modified by bisulphite conversion. Detection of the methylation level of the genes mentioned above was performed by methylation-sensitive high-resolution melting assay (MS-HRM). Based on MS-HRM results for RASSF1A and PITX2, we subdivided the samples into four groups according to methylation level (≤50 % methylated, >50 % methylated, 100 % methylated and completely unmethylated alleles). All degrees of methylation status for both genes underwent analysis of dependence with known clinicopathological features, and we found significant associations. In 134 of 149 (89.9 %) primary breast carcinomas, the RASSF1A promoter was methylated. Total hypermethylation of PITX2 was observed in 60 of 135 (44.4 %) breast cancer cases. RASSF1A hypermethylation had significant association with increased age (p < 0.05), tumour grade (p < 0.0001) and stage (p < 0.0001) in the 100 % methylated group. There was significant association of PITX2 hypermethylation with tumour grade (p < 0.0001) and stage (p < 0.0001). Association between the methylation level of both investigated genes and tumour type was
Legraverend, C; Antonson, P; Flodby, P; Xanthopoulos, K G
1993-01-01
The promoter region of the mouse CCAAT-Enhancer Binding Protein (C/EBP alpha) gene is capable of directing high levels of expression of reporter constructs in various cell lines, albeit even in cells that do not express their endogenous C/EBP alpha gene. To understand the molecular mechanisms underlying this ubiquitous expression, we have characterized the promoter region of the mouse C/EBP alpha gene by a variety of in vitro and in vivo methods. We show that three sites related in sequence to USF, BTE and C/EBP binding sites and present in promoter region -350/+3, are recognized by proteins from rat liver nuclear extracts. The sequence of the C/EBP alpha promoter that includes the USF binding site is also capable of forming stable complexes with purified Myc+Max heterodimers and mutation of this site drastically reduces transcription of C/EBP alpha promoter luciferase constructs both in liver and non liver cell lines. In addition, we identify three novel protein-binding sites two of which display similarity to NF-1 and a NF kappa B binding sites. The region located between nucleotides -197 and -178 forms several heat-stable complexes with liver nuclear proteins in vitro which are recognized mainly by antibodies specific for C/EBP alpha. Furthermore, transient expression of C/EBP alpha and to a lesser extent C/EBP beta expression vectors, results in transactivation of a cotransfected C/EBP alpha promoter-luciferase reporter construct. These experiments support the notion that the C/EBP alpha gene is regulated by C/EBP alpha but other C/EBP-related proteins may also be involved. Images PMID:8493090
Lin, Min; Dan, Hanhong; Li, Yijing
2004-02-01
Leptospira borgpetersenii, one of the causative agents of leptospirosis in both animals and humans, is a bacterial pathogen with characteristic motility that is mediated by the rotation of two periplasmic flagella (PF). The flaB gene coding for a core polypeptide subunit of PF was previously characterized by sequence analysis of its open reading frame (ORF) (M. Lin, J Biochem Mol Biol Biophys 2:181-187, 1999). The present study was undertaken to isolate and clone the uncharacterized sequence upstream of the flaB gene by using a PCR-based genome walking procedure. This has resulted in a 1470-bp genomic DNA sequence in which an 846-bp ORF coding for a 281-amino acid polypeptide (31.3 kDa) is identified 455 bp upstream from the flaB start codon. The encoded protein exhibits 72% amino acid identity to the deduced FlaB protein sequence of L. borgpetersenii and a high degree of sequence homology to the FlaB proteins of other spirochaetes. This has demonstrated for the first time that a second flaB gene homolog is present in a Leptospira species. The newly identified gene is designated flaB1, and the previously cloned flaB renamed flaB2. Within the intergenic sequence between flaB1 and flaB2, a potential stem-loop structure (12-bp inverted repeats) was identified 25 bp downstream of the flaB1 stop codon; this could serve as a transcription terminator for the flaB1 mRNA. Three E. coli-like promoter regions (I, II, and III) for binding Esigma(70), a regulatory sequence uncommonly found in flagellar genes, were predicted upstream of the flaB2 ORF. Only promoter region II contains a promoter that is functional in E. coli, as revealed at phenotypic and transcriptional levels by its capability of directing the expression of the chloramphenicol acetyltransferase (CAT) gene in the promoter probe vector pKK232-8. These observations may suggest that flaB1 and flaB2 are transcribed separately and do not form a transcriptional operon controlled by a single promoter.
Polymorphisms in the leptin gene promoter in Brazilian beef herds.
Guimarães, R C; Azevedo, J S N; Corrêa, S C; Campelo, J E G; Barbosa, E M; Gonçalves, E C; Silva Filho, E
2016-12-02
Brazil is the world's largest producer of beef cattle; however, the quality of its herds needs to be improved. The use of molecular markers as auxiliary tools in selecting animals for reproduction with high pattern for beef production would significantly improve the quality of the final beef product in Brazil. The leptin gene has been demonstrated to be an excellent candidate gene for bovine breeding. The objective of this study was to sequence and compare the leptin gene promoter of Brazil's important cattle breeds in order to identify polymorphisms in it. Blood samples of the Nellore, Guzerat, Tabapuã, and Senepol breeds were collected for genomic DNA extraction. The genomic DNA was used as a template for polymerase chain reaction (PCR) to amplify a 1575-bp fragment, which in turn was sequenced, aligned, and compared between animals of different breeds. Twenty-three single nucleotide polymorphic sites, including transitions and transversions, were detected at positions -1457, -1452, -1446, -1397, -1392, -1361, -1238, -963,-901, -578, -516, -483, -478, -470, -432, -430, -292, -282, -272, -211, -202, -170, and -147. Additionally, two insertion sites at positions -680 and -416 and two deletion sites at positions -1255 and -1059 were detected. As the promoter region of the leptin gene has been demonstrated to vary among breeds, these variations must be tested for their use as potential molecular markers for artificial selection of animals for enhanced beef production in different systems of bovine production in Brazil.
Fu, Chunli; Xing, Yingqi; Song, Xiaonan
2011-04-01
To investigate the association of single nucleotide polymorphism in the matrix metalloproteinase-3 (MMP3) gene promoter with the susceptibility to the middle cerebral artery stenosis. A case-control study was performed by determining the genotype of MMP3 gene promoter region using polymerase chain reaction-restriction fragment length polymorphism in 119 patients with middle cerebral artery stenosis documented by transcranial Doppler compared to 92 control patients. The frequencies of 5A and 6A alleles in MMP3 promoter region were 16.0 and 84.0% respectively in case group compared to 15.8 and 84.2% in control group with no significant difference between the two groups (P > 0.05). No significant difference was also observed in the distribution of genotypes 5A/5A,5A/6A, and 6A/6A between middle cerebral artery stenosis and control groups. Compared to 5A/5A + 5A/6A genotypes,the 6A/6A genotype did not significantly modify the risk of developing the middle cerebral artery stenosis. The MMP3-1171 dupA promoter polymorphisms are not valuable markers of susceptibility of the middle cerebral artery stenosis in this sample of population studied.
Antonini, S R; N'Diaye, N; Baldacchino, V; Hamet, P; Tremblay, J; Lacroix, A
2004-07-01
Gastric inhibitory polypeptide (GIP)-dependent Cushing's syndrome (CS) results from the ectopic expression of non-mutated GIP receptor (hGIPR) in the adrenal cortex. We evaluated whether mutations or polymorphisms in the regulatory region of the GIPR gene could lead to this aberrant expression. We studied 9.0kb upstream and 1.3kb downstream of the GIPR gene putative promoter (pProm) by sequencing leukocyte DNA from controls and from adrenal tissues of GIP- and non-GIP-dependent CS patients. The putative proximal promoter region (800 bp) and the first exon and intron of the hGIPR gene were sequenced on adrenal DNA from nine GIP-dependent CS, as well as on leukocyte DNA of nine normal controls. Three variations found in this region were found in all patients and controls; at position -4/-5, an insertion of a T was seen in four out of nine patients and in five out of nine controls. Transient transfection studies conducted in rat GC and mouse Y1 cells showed that the TT allele confers loss of 40% in the promoter activity. The analysis of the 8-kb distal pProm region revealed eight distal single nucleotide polymorphisms (SNPs) without probable association with the disease, since frequencies in patients and controls were very similar. In conclusion, mutations or SNPs in the regulatory region of the GIPR gene are unlikely to underlie GIP-dependent CS. Copyright 2004 Elsevier Ltd.
Nätt, Daniel; Agnvall, Beatrix; Jensen, Per
2014-01-01
While behavioral sex differences have repeatedly been reported across taxa, the underlying epigenetic mechanisms in the brain are mostly lacking. Birds have previously shown to have only limited dosage compensation, leading to high sex bias of Z-chromosome gene expression. In chickens, a male hyper-methylated region (MHM) on the Z-chromosome has been associated with a local type of dosage compensation, but a more detailed characterization of the avian methylome is limiting our interpretations. Here we report an analysis of genome wide sex differences in promoter DNA-methylation and gene expression in the brain of three weeks old chickens, and associated sex differences in behavior of Red Junglefowl (ancestor of domestic chickens). Combining DNA-methylation tiling arrays with gene expression microarrays we show that a specific locus of the MHM region, together with the promoter for the zinc finger RNA binding protein (ZFR) gene on chromosome 1, is strongly associated with sex dimorphism in gene expression. Except for this, we found few differences in promoter DNA-methylation, even though hundreds of genes were robustly differentially expressed across distantly related breeds. Several of the differentially expressed genes are known to affect behavior, and as suggested from their functional annotation, we found that female Red Junglefowl are more explorative and fearful in a range of tests performed throughout their lives. This paper identifies new sites and, with increased resolution, confirms known sites where DNA-methylation seems to affect sexually dimorphic gene expression, but the general lack of this association is noticeable and strengthens the view that birds do not have dosage compensation. PMID:24782041
Evolution of Drosophila ribosomal protein gene core promoters.
Ma, Xiaotu; Zhang, Kangyu; Li, Xiaoman
2009-03-01
The coordinated expression of ribosomal protein genes (RPGs) has been well documented in many species. Previous analyses of RPG promoters focus only on Fungi and mammals. Recognizing this gap and using a comparative genomics approach, we utilize a motif-finding algorithm that incorporates cross-species conservation to identify several significant motifs in Drosophila RPG promoters. As a result, significant differences of the enriched motifs in RPG promoter are found among Drosophila, Fungi, and mammals, demonstrating the evolutionary dynamics of the ribosomal gene regulatory network. We also report a motif present in similar numbers of RPGs among Drosophila species which does not appear to be conserved at the individual RPG gene level. A module-wise stabilizing selection theory is proposed to explain this observation. Overall, our results provide significant insight into the fast-evolving nature of transcriptional regulation in the RPG module.
Evolution of Drosophila ribosomal protein gene core promoters
Ma, Xiaotu; Zhang, Kangyu; Li, Xiaoman
2011-01-01
The coordinated expression of ribosomal protein genes (RPGs) has been well documented in many species. Previous analyses of RPG promoters focus only on Fungi and mammals. Recognizing this gap and using a comparative genomics approach, we utilize a motif-finding algorithm that incorporates cross-species conservation to identify several significant motifs in Drosophila RPG promoters. As a result, significant differences of the enriched motifs in RPG promoter are found among Drosophila, Fungi, and mammals, demonstrating the evolutionary dynamics of the ribosomal gene regulatory network. We also report a motif present in similar numbers of RPGs among Drosophila species which does not appear to be conserved at the individual RPG gene level. A module-wise stabilizing selection theory is proposed to explain this observation. Overall, our results provide significant insight into the fast-evolving nature of transcriptional regulation in the RPG module. PMID:19059316
Liang, Jianhua; Yang, Lixia; Chen, Xiong; Li, Ling; Guo, Dongliang; Li, Haihang; Zhang, Biyu
2009-09-01
We cloned the promoter of the 9-cis-epoxycarotenoid dioxygenase gene from Arachis hypogaea L. beta-Glucuronidase (GUS) histochemical staining and GUS activity assay indicated that the activity of the promoter was exhibited predominantly in the leaves and enhanced by water and NaCl stresses, and by application of abscisic acid (ABA) and salicylic acid (SA) in transgenic Arabidopsis. Moreover, two novel ABRE-like (abscisic acid response element) elements were identified in the promoter region.
Widespread Enhancer Activity from Core Promoters.
Medina-Rivera, Alejandra; Santiago-Algarra, David; Puthier, Denis; Spicuglia, Salvatore
2018-06-01
Gene expression in higher eukaryotes is precisely regulated in time and space through the interplay between promoters and gene-distal regulatory regions, known as enhancers. The original definition of enhancers implies the ability to activate gene expression remotely, while promoters entail the capability to locally induce gene expression. Despite the conventional distinction between them, promoters and enhancers share many genomic and epigenomic features. One intriguing finding in the gene regulation field comes from the observation that many core promoter regions display enhancer activity. Recent high-throughput reporter assays along with clustered regularly interspaced short palindromic repeats (CRISPR)/Cas9-related approaches have indicated that this phenomenon is common and might have a strong impact on our global understanding of genome organisation and gene expression regulation. Copyright © 2018 Elsevier Ltd. All rights reserved.
Hypermethylation of the TSLC1 Gene Promoter in Primary Gastric Cancers and Gastric Cancer Cell Lines
Honda, Teiichiro; Waki, Takayoshi; Jin, Zhe; Sato, Kiyoshi; Motoyama, Teiichi; Kawata, Sumio; Kimura, Wataru; Nishizuka, Satoshi; Murakami, Yoshinori
2002-01-01
The TSLC1 (tumor suppressor in lung cancer–1) gene is a novel tumor suppressor gene on chromosomal region 11q23.2, and is frequently inactivated by concordant promoter hypermethylation and loss of heterozygosity (LOH) in non‐small cell lung cancer (NSCLC). Because LOH on 11q has also been observed frequently in other human neoplasms including gastric cancer, we investigated the promoter methylation status of TSLC1 in 10 gastric cancer cell lines and 97 primary gastric cancers, as well as the corresponding non‐cancerous gastric tissues, by bisulfite‐SSCP analysis followed by direct sequencing. Allelic status of the TSLC1 gene was also investigated in these cell lines and primary gastric cancers. The TSLC1 promoter was methylated in two gastric cancer cell lines, KATO‐III and ECC10, and in 15 out of 97 (16%) primary gastric cancers. It was not methylated in non‐cancerous gastric tissues, suggesting that this hypermethylation is a cancer‐specific alteration. KATO‐III and ECC10 cells retained two alleles of TSLC1, both of which showed hypermethylation, associated with complete loss of gene expression. Most of the primary gastric cancers with promoter methylation also retained heterozygosity at the TSLC1 locus on 11q23.2. These data indicate that bi‐allelic hypermethylation of the TSLC1 promoter and resulting gene silencing occur in a subset of primary gastric cancers. PMID:12716461
FOXM1 promotes the progression of prostate cancer by regulating PSA gene transcription.
Liu, Youhong; Liu, Yijun; Yuan, Bowen; Yin, Linglong; Peng, Yuchong; Yu, Xiaohui; Zhou, Weibing; Gong, Zhicheng; Liu, Jianye; He, Leye; Li, Xiong
2017-03-07
Androgen/AR is the primary contributor to prostate cancer (PCa) progression by regulating Prostate Specific Antigen (PSA) gene transcription. The disease inevitably evolves to androgen-independent (AI) status. Other mechanisms by which PSA is regulated and develops to AI have not yet been fully determined. FOXM1 is a cell proliferation-specific transcription factor highly expressed in PCa cells compared to non-malignant prostate epithelial cells, suggesting that the aberrant overexpression of FOXM1 contributes to PCa development. In addition to regulating AR gene transcription and cell cycle-regulatory genes, FOXM1 selectively regulates the gene transcription of KLK2 and PSA, typical androgen responsive genes. Screening the potential FOXM1-binding sites by ChIP-PCR, we found that FOXM1 directly binds to the FHK binding motifs in the PSA promoter/enhancer regions. AI C4-2 cells have more FOXM1 binding sites than androgen dependent LNCaP cells. The depletion of FOXM1 by small molecular inhibitors significantly improves the suppression of PSA gene transcription by the anti-AR agent Cadosax. This is the first report showing that FOXM1 promotes PCa progression by regulating PSA gene transcription, particularly in AI PCa cells. The combination of anti-AR agents and FOXM1 inhibitors has the potential to greatly improve therapy for late-stage PCa patients by suppressing PSA levels.
MOHANTY, BIJAYALAXMI; KRISHNAN, S. P. T.; SWARUP, SANJAY; BAJIC, VLADIMIR B.
2005-01-01
• Background and Aims Plants can suffer from oxygen limitation during flooding or more complete submergence and may therefore switch from Kreb's cycle respiration to fermentation in association with the expression of anaerobically inducible genes coding for enzymes involved in glycolysis and fermentation. The aim of this study was to clarify mechanisms of transcriptional regulation of these anaerobic genes by identifying motifs shared by their promoter regions. • Methods Statistically significant motifs were detected by an in silico method from 13 promoters of anaerobic genes. The selected motifs were common for the majority of analysed promoters. Their significance was evaluated by searching for their presence in transcription factor-binding site databases (TRANSFAC, PlantCARE and PLACE). Using several negative control data sets, it was tested whether the motifs found were specific to the anaerobic group. • Key Results Previously, anaerobic response elements have been identified in maize (Zea mays) and arabidopsis (Arabidopsis thaliana) genes. Known functional motifs were detected, such as GT and GC motifs, but also other motifs shared by most of the genes examined. Five motifs detected have not been found in plants hitherto but are present in the promoters of animal genes with various functions. The consensus sequences of these novel motifs are 5′-AAACAAA-3′, 5′-AGCAGC-3′, 5′-TCATCAC-3′, 5′-GTTT(A/C/T)GCAA-3′ and 5′-TTCCCTGTT-3′. • Conclusions It is believed that the promoter motifs identified could be functional by conferring anaerobic sensitivity to the genes that possess them. This proposal now requires experimental verification. PMID:16027132
Oliviero, S; Cortese, R
1989-01-01
Transcription of the human haptoglobin (Hp) gene is induced by interleukin-6 (IL-6) in the human hepatoma cell line Hep3B. Cis-acting elements responsible for this response are localized within the first 186 bp of the 5'-flanking region. Site-specific mutants of the Hp promoter fused to the chloramphenicol acetyl transferase (CAT) gene were analysed by transient transfection into uninduced and IL-6-treated Hep3B cells. We identified three regions, A, B and C, defined by mutation, which are important for the IL-6 response. Band shift experiments using nuclear extracts from untreated or IL-6-treated cells revealed the presence of IL-6-inducible DNA binding activities when DNA fragments containing the A or the C sequences were used. Competition experiments showed that both sequences bind to the same nuclear factors. Polymers of oligonucleotides containing either the A or the C regions confer IL-6 responsiveness to a truncated SV40 promoter. The B region forms several complexes with specific DNA-binding proteins different from those which bind to the A and C region. The B region complexes are identical in nuclear extracts from IL-6-treated and untreated cells. While important for IL-6 induction in the context of the haptoglobin promoter, the B site does not confer IL-6 inducibility to the SV40 promoter. Our results indicate that the IL-6 response of the haptoglobin promoter is dependent on the presence of multiple, partly redundant, cis-acting elements. Images PMID:2787245
Takaoka, N; Fukuzawa, M; Saito, T; Sakaitani, T; Ochiai, H
1999-10-28
We cloned a genomic fragment of the membrane protein gp64 gene of the cellular slime mold Polysphondylium pallidum by inverse PCR. Primer extension analysis identified a major transcription start site 65 bp upstream of the translation start codon. The promoter region of the gp64 gene contains sequences homologous to a TATA box at position -47 to -37 and to an initiator (Inr, PyPyCAPyPyPyPy) at position -3 to +5 from the transcription start site. Successively truncated segments of the promoter were tested for their ability to drive expression of the beta-galactosidase reporter gene in transformed cells; also the difference in activity between growth conditions was compared. The results indicated that there are two positive vegetative regulatory elements extending between -187 and -62 bp from the transcription start site of the gp64 promoter; also their activity was two to three times higher in the cells grown with bacteria in shaken suspension than in the cells grown in an axenic medium.
Yin, Tao; Wu, Hanying; Zhang, Shanglong; Lu, Hongyu; Zhang, Lingxiao; Xu, Yong; Chen, Daming; Liu, Jingmei
2009-01-01
A 1.8 kb 5'-flanking region of the large subunit of ADP-glucose pyrophosphorylase, isolated from watermelon (Citrullus vulgaris S.), has fruit-specific promoter activity in transgenic tomato plants. Two negative regulatory regions, from -986 to -959 and from -472 to -424, were identified in this promoter region by fine deletion analyses. Removal of both regions led to constitutive expression in epidermal cells. Gain-of-function experiments showed that these two regions were sufficient to inhibit RFP (red fluorescent protein) expression in transformed epidermal cells when fused to the cauliflower mosaic virus (CaMV) 35S minimal promoter. Gel mobility shift experiments demonstrated the presence of leaf nuclear factors that interact with these two elements. A TCCAAAA motif was identified in these two regions, as well as one in the reverse orientation, which was confirmed to be a novel specific cis-element. A quantitative beta-glucuronidase (GUS) activity assay of stable transgenic tomato plants showed that the activities of chimeric promoters harbouring only one of the two cis-elements, or both, were approximately 10-fold higher in fruits than in leaves. These data confirm that the TCCAAAA motif functions as a fruit-specific element by inhibiting gene expression in leaves.
Yin, Tao; Wu, Hanying; Zhang, Shanglong; Liu, Jingmei; Lu, Hongyu; Zhang, Lingxiao; Xu, Yong; Chen, Daming
2009-01-01
A 1.8 kb 5′-flanking region of the large subunit of ADP-glucose pyrophosphorylase, isolated from watermelon (Citrullus vulgaris S.), has fruit-specific promoter activity in transgenic tomato plants. Two negative regulatory regions, from –986 to –959 and from –472 to –424, were identified in this promoter region by fine deletion analyses. Removal of both regions led to constitutive expression in epidermal cells. Gain-of-function experiments showed that these two regions were sufficient to inhibit RFP (red fluorescent protein) expression in transformed epidermal cells when fused to the cauliflower mosaic virus (CaMV) 35S minimal promoter. Gel mobility shift experiments demonstrated the presence of leaf nuclear factors that interact with these two elements. A TCCAAAA motif was identified in these two regions, as well as one in the reverse orientation, which was confirmed to be a novel specific cis-element. A quantitative β-glucuronidase (GUS) activity assay of stable transgenic tomato plants showed that the activities of chimeric promoters harbouring only one of the two cis-elements, or both, were ∼10-fold higher in fruits than in leaves. These data confirm that the TCCAAAA motif functions as a fruit-specific element by inhibiting gene expression in leaves. PMID:19073962
Mengin-Lecreulx, Dominique; Ayala, Juan; Bouhss, Ahmed; van Heijenoort, Jean; Parquet, Claudine; Hara, Hiroshi
1998-01-01
Recently, a promoter for the essential gene ftsI, which encodes penicillin-binding protein 3 of Escherichia coli, was precisely localized 1.9 kb upstream from this gene, at the beginning of the mra cluster of cell division and cell envelope biosynthesis genes (H. Hara, S. Yasuda, K. Horiuchi, and J. T. Park, J. Bacteriol. 179:5802–5811, 1997). Disruption of this promoter (Pmra) on the chromosome and its replacement by the lac promoter (Pmra::Plac) led to isopropyl-β-d-thiogalactopyranoside (IPTG)-dependent cells that lysed in the absence of inducer, a defect which was complemented only when the whole region from Pmra to ftsW, the fifth gene downstream from ftsI, was provided in trans on a plasmid. In the present work, the levels of various proteins involved in peptidoglycan synthesis and cell division were precisely determined in cells in which Pmra::Plac promoter expression was repressed or fully induced. It was confirmed that the Pmra promoter is required for expression of the first nine genes of the mra cluster: mraZ (orfC), mraW (orfB), ftsL (mraR), ftsI, murE, murF, mraY, murD, and ftsW. Interestingly, three- to sixfold-decreased levels of MurG and MurC enzymes were observed in uninduced Pmra::Plac cells. This was correlated with an accumulation of the nucleotide precursors UDP–N-acetylglucosamine and UDP–N-acetylmuramic acid, substrates of these enzymes, and with a depletion of the pool of UDP–N-acetylmuramyl pentapeptide, resulting in decreased cell wall peptidoglycan synthesis. Moreover, the expression of ftsZ, the penultimate gene from this cluster, was significantly reduced when Pmra expression was repressed. It was concluded that the transcription of the genes located downstream from ftsW in the mra cluster, from murG to ftsZ, is also mainly (but not exclusively) dependent on the Pmra promoter. PMID:9721276
Cis-acting elements in the promoter region of the human aldolase C gene.
Buono, P; de Conciliis, L; Olivetta, E; Izzo, P; Salvatore, F
1993-08-16
We investigated the cis-acting sequences involved in the expression of the human aldolase C gene by transient transfections into human neuroblastoma cells (SKNBE). We demonstrate that 420 bp of the 5'-flanking DNA direct at high efficiency the transcription of the CAT reporter gene. A deletion between -420 bp and -164 bp causes a 60% decrease of CAT activity. Gel shift and DNase I footprinting analyses revealed four protected elements: A, B, C and D. Competition analyses indicate that Sp1 or factors sharing a similar sequence specificity bind to elements A and B, but not to elements C and D. Sequence analysis shows a half palindromic ERE motif (GGTCA), in elements B and D. Region D binds a transactivating factor which appears also essential to stabilize the initiation complex.
Inferring gene expression from ribosomal promoter sequences, a crowdsourcing approach
Meyer, Pablo; Siwo, Geoffrey; Zeevi, Danny; Sharon, Eilon; Norel, Raquel; Segal, Eran; Stolovitzky, Gustavo; Siwo, Geoffrey; Rider, Andrew K.; Tan, Asako; Pinapati, Richard S.; Emrich, Scott; Chawla, Nitesh; Ferdig, Michael T.; Tung, Yi-An; Chen, Yong-Syuan; Chen, Mei-Ju May; Chen, Chien-Yu; Knight, Jason M.; Sahraeian, Sayed Mohammad Ebrahim; Esfahani, Mohammad Shahrokh; Dreos, Rene; Bucher, Philipp; Maier, Ezekiel; Saeys, Yvan; Szczurek, Ewa; Myšičková, Alena; Vingron, Martin; Klein, Holger; Kiełbasa, Szymon M.; Knisley, Jeff; Bonnell, Jeff; Knisley, Debra; Kursa, Miron B.; Rudnicki, Witold R.; Bhattacharjee, Madhuchhanda; Sillanpää, Mikko J.; Yeung, James; Meysman, Pieter; Rodríguez, Aminael Sánchez; Engelen, Kristof; Marchal, Kathleen; Huang, Yezhou; Mordelet, Fantine; Hartemink, Alexander; Pinello, Luca; Yuan, Guo-Cheng
2013-01-01
The Gene Promoter Expression Prediction challenge consisted of predicting gene expression from promoter sequences in a previously unknown experimentally generated data set. The challenge was presented to the community in the framework of the sixth Dialogue for Reverse Engineering Assessments and Methods (DREAM6), a community effort to evaluate the status of systems biology modeling methodologies. Nucleotide-specific promoter activity was obtained by measuring fluorescence from promoter sequences fused upstream of a gene for yellow fluorescence protein and inserted in the same genomic site of yeast Saccharomyces cerevisiae. Twenty-one teams submitted results predicting the expression levels of 53 different promoters from yeast ribosomal protein genes. Analysis of participant predictions shows that accurate values for low-expressed and mutated promoters were difficult to obtain, although in the latter case, only when the mutation induced a large change in promoter activity compared to the wild-type sequence. As in previous DREAM challenges, we found that aggregation of participant predictions provided robust results, but did not fare better than the three best algorithms. Finally, this study not only provides a benchmark for the assessment of methods predicting activity of a specific set of promoters from their sequence, but it also shows that the top performing algorithm, which used machine-learning approaches, can be improved by the addition of biological features such as transcription factor binding sites. PMID:23950146
Ngô, V; Gourdji, D; Laverrière, J N
1996-01-01
The methylation patterns of the rat prolactin (rPRL) (positions -440 to -20) and growth hormone (rGH) (positions -360 to -110) promoters were analyzed by bisulfite genomic sequencing. Two normal tissues, the anterior pituitary and the liver, and three rat pituitary GH3 cell lines that differ considerably in their abilities to express both genes were tested. High levels of rPRL gene expression were correlated with hypomethylation of the CpG dinucleotides located at positions -277 and -97, near or within positive cis-acting regulatory elements. For the nine CpG sites analyzed in the rGH promoter, an overall hypomethylation-expression coupling was also observed for the anterior pituitary, the liver, and two of the cell lines. The effect of DNA methylation was tested by measuring the transient expression of the chloramphenicol acetyltransferase reporter gene driven by a regionally methylated rPRL promoter. CpG methylation resulted in a decrease in the activity of the rPRL promoter which was proportional to the number of modified CpG sites. The extent of the inhibition was also found to be dependent on the position of methylated sites. Taken together, these data suggest that site-specific methylation may modulate the action of transcription factors that dictate the tissue-specific expression of the rPRL and rGH genes in vivo. PMID:8668139
Koike, Chihiro; Friday, Robert P.; Nakashima, Izumi; Luppi, Patrizia; Fung, John J.; Rao, Abdul S.; Starzl, Thomas E.; Trucco, Massimo
2010-01-01
Background α1,3-galactosyltransferase (α1,3GT) is an enzyme that produces carbohydrate chains termed αGal epitopes found in most mammals, although some species of higher primates, including human, are notable exceptions. The evolutionary origin of the lost α1,3GT enzyme activity is not yet known, although it has been suggested that the promoter activity of this gene in the ancestors of higher primates was inactivated. Methods We used 5′-or 3′-RACE, GenomeWalking, reverse transcriptase polymerase chain reaction (RT-PCR) and dual Luciferase reporter assay for identification of the full-length cDNA, which includes the transcription initiation site and the promoter region of porcine α1,3GT gene. Results The region around exon 1 is guanine and cytosine (GC)-rich (about 70%), comprising a CpG island spanning more than 1.5 kbp. The 5′-flanking region of exon 1 contains multiple transcription factor consensus motifs, including GC-box, SP1, AP2, and GATA-box sites, in the absence of TATA or CAAT-box sequences. The entire gene consists of three 5′ noncoding and six coding region exons spanning more than 52 kbp. Detailed analysis of α1,3GT transcripts revealed two major alternative splicing patterns in the 5′-untranslated region (5′-UTR) and evidence for minor splicing activity that occurs in a tissue-specific manner. Interspecies comparison of 5′-UTR shows minimal homology between porcine and murine sequences except for exon 2, which suggests that the regulatory regions differ among species. Conclusions These observations have important implications for experiments involving genetic manipulation of the α1,3GT gene in transgenic animals in terms of promoter utilization, and particularly in genetically engineering cells for the animal cloning technology by nuclear transfer. PMID:11087141
Kim, Sol; Lee, Soo-Bin; Han, Chae-Seong; Lim, Mi-Na; Lee, Sung-Eun; Yoon, In Sun; Hwang, Yong-Sic
2017-08-01
Oleosins are the most abundant proteins in the monolipid layer surrounding neutral storage lipids that form oil bodies in plants. Several lines of evidence indicate that they are physiologically important for the maintenance of oil body structure and for mobilization of the lipids stored inside. Rice has six oleosin genes in its genome, the expression of all of which was found to be responsive to abscisic acid (ABA) in our examination of mature embryo and aleurone tissues. The 5'-flanking region of OsOle5 was initially characterized for its responsiveness to ABA through a transient expression assay system using the protoplasts from suspension-cultured rice cells. A series of successive deletions and site-directed mutations identified five regions critical for the hormonal induction of its promoter activity. A search for cis-acting elements in these regions deposited in a public database revealed that they contain various promoter elements previously reported to be involved in the ABA response of various genes. A gain-of-function experiment indicated that multiple copies of all five regions were sufficient to provide the minimal promoter with a distinct ABA responsiveness. Comparative sequence analysis of the short, but still ABA-responsive, promoters of OsOle genes revealed no common modular architecture shared by them, indicating that various distinct promoter elements and independent trans-acting factors are involved in the ABA responsiveness of rice oleosin multigenes. Copyright © 2017 Elsevier GmbH. All rights reserved.
Roy, Dipan; Paul, Amit; Roy, Adrita; Ghosh, Ritesh; Ganguly, Payel; Chaudhuri, Shubho
2014-01-01
The rice ortholog of DREB1, OsDREB1b, is transcriptionally induced by cold stress and over-expression of OsDREB1b results in increase tolerance towards high salt and freezing stress. This spatio-temporal expression of OsDREB1b is preceded by the change in chromatin structure at the promoter and the upstream region for gene activation. The promoter and the upstream region of OsDREB1b genes appear to be arranged into a nucleosome array. Nucleosome mapping of ∼700bp upstream region of OsDREB1b shows two positioned nucleosomes between −610 to −258 and a weakly positioned nucleosome at the core promoter and the TSS. Upon cold stress, there is a significant change in the nucleosome arrangement at the upstream region with increase in DNaseI hypersensitivity or MNase digestion in the vicinity of cis elements and TATA box at the core promoter. ChIP assays shows hyper-acetylation of histone H3K9 throughout the locus whereas region specific increase was observed in H3K14ac and H3K27ac. Moreover, there is an enrichment of RNA PolII occupancy at the promoter region during transcription activation. There is no significant change in the H3 occupancy in OsDREB1b locus negating the possibility of nucleosome loss during cold stress. Interestingly, cold induced enhanced transcript level of OsDREB1b as well as histone H3 acetylation at the upstream region was found to diminish when stressed plants were returned to normal temperature. The result indicates absolute necessity of changes in chromatin conformation for the transcription up-regulation of OsDREB1b gene in response to cold stress. The combined results show the existence of closed chromatin conformation at the upstream and promoter region of OsDREB1b in the transcription “off” state. During cold stress, changes in region specific histone modification marks promote the alteration of chromatin structure to facilitate the binding of transcription machinery for proper gene expression. PMID:24940877
Joubert, D Albert; de Lorenzo, Giulia; Vivier, Melané A
2013-03-01
Regulation of defense in plants is a complex process mediated by various signaling pathways. Promoter analysis of defense-related genes is useful to understand these signaling pathways involved in regulation. To this end, the regulation of the polygalacturonase-inhibiting protein encoding gene from Vitis vinifera L. (Vvpgip1) was analyzed with regard to expression pattern and induction profile as well as the promoter in terms of putative regulatory elements present, core promoter size and the start of transcription. Expression of Vvpgip1 is tissue-specific and developmentally regulated. Vvpgip1 expression was induced in response to auxin, salicylic acid and sugar treatment, wounding and pathogen infection. The start of transcription was mapped to 17 bp upstream of the ATG and the core promoter was mapped to the 137 bp upstream of the ATG. Fructose- and Botrytis responsiveness were identified in the region between positions -3.1 and -1.5 kb. The analyses showed induction in water when the leaves were submersed and this response and the response to wounding mapped to the region between positions -1.1 and -0.1 kb. In silico analyses revealed putative cis-acting elements in these areas that correspond well to the induction stimuli tested.
Yoshino, T P; Wu, X J; Liu, H D
1998-09-01
Studies were initiated to begin developing a genetic transformation system for cells derived from the freshwater gastropod, Biomphalaria glabrata, an intermediate host of the human blood fluke Schistosoma mansoni. Using a 70-kD heat-shock protein (HSP70) cDNA probe obtained from the B. glabrata embryonic (Bge) cell line, we cloned from Bge cells a complete HSP70 gene including a 1-kb genomic DNA fragment in its 5'-flanking region containing sequences indicative of a HSP promoter. Identified in the 5'-half (416 nucleotides) of this genomic fragment were TATA and CAAT boxes, two putative transcription initiation sites, and a series of palindromic DNA repeats with shared homology to the heat-shock element consensus sequence (Bge HSP70(0.5k) promoter). The 3'-half of this upstream flanking region was comprised of a 508-base intron located immediately 5' of the ATG start codon. To determine the functionality of the putative snail promoter sequence, Bge HSP promoter/luciferase (Luc) reporter gene constructs were introduced into Bge cells by N-(1-(2,3-dioleoyloxy) propyl)-N,N,N-trimethylammonium methylsulfate (DOTAP)-mediated transfection methods, and assayed for Luc activity 48 hr following a 1.5-hr heat-shock treatment (40 degrees C). Compared with control vectors or the Bge HSP70(0.5k/1.0k) promoter constructs at 26 degrees C, a 10- to 300-fold increase in Luc expression was obtained only in the Bge HSP70 promoter/Luc-transfected cells following heat-shock. Results of transfection experiments demonstrate that the Bge HSP70(0.5k) DNA segment contains appropriate promoter sequences for driving temperature-inducible gene expression in the Bge snail cell line. This report represents the first isolation and functional characterization of an inducible promoter from a freshwater gastropod mollusc. Successful transient expression of a foreign reporter gene in Bge cells using a homologous, inducible promoter sequence now paves the way for development of methods for stable
Munir, Faiza; Hayashi, Satomi; Batley, Jacqueline; Naqvi, Syed Muhammad Saqlan; Mahmood, Tariq
2016-01-01
Controlled transgene expression via a promoter is particularly triggered in response to pathogen infiltration. This is significant for eliciting disease-resistant features in crops through genetic engineering. The germins and germin-like proteins (GLPs) are known to be associated with plant and developmental stages. The 1107-bp Oryza sativa root GLP2 (OsRGLP2) gene promoter fused to a β-glucuronidase (GUS) reporter gene was transformed into potato plants through an Agrobacterium-mediated transformation. The OsRGLP2 promoter was activated in response to Fusarium solani (Mart.) Sacc. and Alternaria solani Sorauer. Quantitative real-time PCR results revealed 4-5-fold increase in promoter activity every 24 h following infection. There was a 15-fold increase in OsRGLP2 promoter activity after 72 h of F. solani (Mart.) Sacc. treatment and a 12-fold increase observed with A. solani Sorauer. Our results confirmed that the OsRGLP2 promoter activity was enhanced under fungal stress. Furthermore, a hyperaccumulation of H2O2 in transgenic plants is a clear signal for the involvement of OsRGLP2 promoter region in the activation of specific genes in the potato genome involved in H2O2-mediated defense response. The OsRGLP2 promoter evidently harbors copies of GT-I and Dof transcription factors (AAAG) that act in response to elicitors generated in the wake of pathogen infection.
Tian, Shi-Lin; Li, Zheng; Li, Li; Shah, S N M; Gong, Zhen-Hui
2017-07-01
Capsanthin/capsorubin synthase ( Ccs ) gene is a key gene that regulates the synthesis of capsanthin and the development of red coloration in pepper fruits. There are three tandem repeat units in the promoter region of Ccs , but the potential effects of the number of repetitive units on the transcriptional regulation of Ccs has been unclear. In the present study, expression vectors carrying different numbers of repeat units of the Ccs promoter were constructed, and the transient expression of the β-glucuronidase ( GUS ) gene was used to detect differences in expression levels associated with the promoter fragments. These repeat fragments and the plant expression vector PBI121 containing the 35s CaMV promoter were ligated to form recombinant vectors that were transfected into Agrobacterium tumefaciens GV3101. A fluorescence spectrophotometer was used to analyze the expression associated with the various repeat units. It was concluded that the constructs containing at least one repeat were associated with GUS expression, though they did not differ from one another. This repeating unit likely plays a role in transcription and regulation of Ccs expression.
Tokunaga, Ayumi; Miura, Atsuko; Okauchi, Yukiyoshi; Segawa, Katsumori; Fukuhara, Atsunori; Okita, Kohei; Takahashi, Masahiko; Funahashi, Tohru; Miyagawa, Jun-Ichiro; Shimomura, Iichiro; Yamagata, Kazuya
2008-03-01
Visfatin is a novel adipocytokine that is expressed by the visceral fat cells. We investigated the role of genetic variation in the visfatin gene in the pathophysiology of type 2 diabetes and clinical variables in Japanese subjects. The 11 exons, and the promoter region of the visfatin gene were screened for single nucleotide polymorphisms (SNPs) by PCR-direct sequencing. We found SNPs in the promoter region (SNP - 1535T>C), exon 2 (SNP + 131C>G, Thr44Arg), and exon 7 (SNP + 903G>A). The allele and genotype frequencies of these SNPs showed no significant differences between 200-448 diabetic and 200-333 control subjects. However, the -1535T/T genotype was associated with lower serum triglyceride levels (T/T vs. T/C + C/C (p = 0.015) and T/T vs. C/C (p = 0.043)) and higher HDL-cholesterol levels (T/T vs. C/C, p = 0.0496) in the nondiabetic subjects. Reporter gene assay of 3T3-L1 adipocytes revealed that the promoter activity of -1535T and -1535C was similar, suggesting that the observed association may reflect linkage disequilibrium between -1535T>C and causative variations of the visfatin gene.
Regulation of Chlamydia Gene Expression by Tandem Promoters with Different Temporal Patterns.
Rosario, Christopher J; Tan, Ming
2016-01-15
Chlamydia is a genus of pathogenic bacteria with an unusual intracellular developmental cycle marked by temporal waves of gene expression. The three main temporal groups of chlamydial genes are proposed to be controlled by separate mechanisms of transcriptional regulation. However, we have noted genes with discrepancies, such as the early gene dnaK and the midcycle genes bioY and pgk, which have promoters controlled by the late transcriptional regulators EUO and σ(28). To resolve this issue, we analyzed the promoters of these three genes in vitro and in Chlamydia trachomatis bacteria grown in cell culture. Transcripts from the σ(28)-dependent promoter of each gene were detected only at late times in the intracellular infection, bolstering the role of σ(28) RNA polymerase in late gene expression. In each case, however, expression prior to late times was due to a second promoter that was transcribed by σ(66) RNA polymerase, which is the major form of chlamydial polymerase. These results demonstrate that chlamydial genes can be transcribed from tandem promoters with different temporal profiles, leading to a composite expression pattern that differs from the expression profile of a single promoter. In addition, tandem promoters allow a gene to be regulated by multiple mechanisms of transcriptional regulation, such as DNA supercoiling or late regulation by EUO and σ(28). We discuss how tandem promoters broaden the repertoire of temporal gene expression patterns in the chlamydial developmental cycle and can be used to fine-tune the expression of specific genes. Chlamydia is a pathogenic bacterium that is responsible for the majority of infectious disease cases reported to the CDC each year. It causes an intracellular infection that is characterized by coordinated expression of chlamydial genes in temporal waves. Chlamydial transcription has been shown to be regulated by DNA supercoiling, alternative forms of RNA polymerase, and transcription factors, but the number
Aberrant gene promoter methylation associated with sporadic multiple colorectal cancer.
Gonzalo, Victoria; Lozano, Juan José; Muñoz, Jenifer; Balaguer, Francesc; Pellisé, Maria; Rodríguez de Miguel, Cristina; Andreu, Montserrat; Jover, Rodrigo; Llor, Xavier; Giráldez, M Dolores; Ocaña, Teresa; Serradesanferm, Anna; Alonso-Espinaco, Virginia; Jimeno, Mireya; Cuatrecasas, Miriam; Sendino, Oriol; Castellví-Bel, Sergi; Castells, Antoni
2010-01-19
Colorectal cancer (CRC) multiplicity has been mainly related to polyposis and non-polyposis hereditary syndromes. In sporadic CRC, aberrant gene promoter methylation has been shown to play a key role in carcinogenesis, although little is known about its involvement in multiplicity. To assess the effect of methylation in tumor multiplicity in sporadic CRC, hypermethylation of key tumor suppressor genes was evaluated in patients with both multiple and solitary tumors, as a proof-of-concept of an underlying epigenetic defect. We examined a total of 47 synchronous/metachronous primary CRC from 41 patients, and 41 gender, age (5-year intervals) and tumor location-paired patients with solitary tumors. Exclusion criteria were polyposis syndromes, Lynch syndrome and inflammatory bowel disease. DNA methylation at the promoter region of the MGMT, CDKN2A, SFRP1, TMEFF2, HS3ST2 (3OST2), RASSF1A and GATA4 genes was evaluated by quantitative methylation specific PCR in both tumor and corresponding normal appearing colorectal mucosa samples. Overall, patients with multiple lesions exhibited a higher degree of methylation in tumor samples than those with solitary tumors regarding all evaluated genes. After adjusting for age and gender, binomial logistic regression analysis identified methylation of MGMT2 (OR, 1.48; 95% CI, 1.10 to 1.97; p = 0.008) and RASSF1A (OR, 2.04; 95% CI, 1.01 to 4.13; p = 0.047) as variables independently associated with tumor multiplicity, being the risk related to methylation of any of these two genes 4.57 (95% CI, 1.53 to 13.61; p = 0.006). Moreover, in six patients in whom both tumors were available, we found a correlation in the methylation levels of MGMT2 (r = 0.64, p = 0.17), SFRP1 (r = 0.83, 0.06), HPP1 (r = 0.64, p = 0.17), 3OST2 (r = 0.83, p = 0.06) and GATA4 (r = 0.6, p = 0.24). Methylation in normal appearing colorectal mucosa from patients with multiple and solitary CRC showed no relevant difference in any evaluated gene. These results provide
Common variants at the promoter region of the APOM confer a risk of rheumatoid arthritis
Hu, Hae-Jin; Jin, Eun-Heui; Yim, Seon-Hee; Yang, So-Young; Jung, Seung-Hyun; Shin, Seung-Hun; Kim, Wan-Uk; Shim, Seung-Cheol; Kim, Tai-Gyu
2011-01-01
Although the genetic component in the etiology of rheumatoid arthritis (RA) has been consistently suggested, many novel genetic loci remain to uncover. To identify RA risk loci, we performed a genome-wide association study (GWAS) with 100 RA cases and 600 controls using Affymetrix SNP array 5.0. The candidate risk locus (APOM gene) was re-sequenced to discover novel promoter and coding variants in a group of the subjects. Replication was performed with the independent case-control set comprising of 578 RAs and 711 controls. Through GWAS, we identified a novel SNP associated with RA at the APOM gene in the MHC class III region on 6p21.33 (rs805297, odds ratio (OR) = 2.28, P = 5.20 × 10-7). Three more polymorphisms were identified at the promoter region of the APOM by the re-sequencing. For the replication, we genotyped the four SNP loci in the independent case-control set. The association of rs805297 identified by GWAS was successfully replicated (OR = 1.40, P = 6.65 × 10-5). The association became more significant in the combined analysis of discovery and replication sets (OR = 1.56, P = 2.73 ± 10-10). The individuals with the rs805297 risk allele (A) at the promoter region showed a significantly lower level of APOM expression compared with those with the protective allele (C) homozygote. In the logistic regressions by the phenotype status, the homozygote risk genotype (A/A) consistently showed higher ORs than the heterozygote one (A/C) for the phenotype-positive RAs. These results indicate that APOM promoter polymorphisms are significantly associated with the susceptibility to RA. PMID:21844665
Jong, M T; Raaka, B M; Samuels, H H
1994-10-01
The 5'-flanking region of the gene for Pit-1, a pituitary-specific transcription factor, was isolated from a rat liver genomic library and sequenced. Expression of a reporter construct containing Pit-1 promoter sequences linked to the bacterial chloramphenicol acetyltransferase (CAT) gene was assessed by transient transfection in rat pituitary GH4C1 cells. Treatment of transfected cells with either dexamethasone (DEX) for 48 h or the phorbol ester 12-O-tetradecanoylphorbol 13-acetate (TPA) for the final 20 h of the 48-h posttransfection period had minimal effects on CAT expression. However, CAT activity was elevated about 20-fold when transfected cells were treated with both DEX and TPA. This apparent synergistic activation was lost when DEX treatment was also limited to the final 20 h of the 48-h posttransfection period, suggesting that a time-dependent accumulation of a DEX-induced gene product might be involved. This putative DEX-induced product appeared to be relatively stable, because synergistic activation was observed in cells treated with DEX alone for 36 h, followed by a 10-h incubation without DEX before the addition of TPA. The Pit-1 gene promoter region between -210 and -142 from the transcription start site conferred synergistic regulation by DEX and TPA when placed upstream of position -105 in the herpes viral thymidine kinase promoter.(ABSTRACT TRUNCATED AT 250 WORDS)
Benner, Christopher; Hutt, Kasey R.; Stunnenberg, Rieka; Garcia-Bassets, Ivan
2013-01-01
Genome-wide maps of DNase I hypersensitive sites (DHSs) reveal that most human promoters contain perpetually active cis-regulatory elements between −150 bp and +50 bp (−150/+50 bp) relative to the transcription start site (TSS). Transcription factors (TFs) recruit cofactors (chromatin remodelers, histone/protein-modifying enzymes, and scaffold proteins) to these elements in order to organize the local chromatin structure and coordinate the balance of post-translational modifications nearby, contributing to the overall regulation of transcription. However, the rules of TF-mediated cofactor recruitment to the −150/+50 bp promoter regions remain poorly understood. Here, we provide evidence for a general model in which a series of cis-regulatory elements (here termed ‘cardinal’ motifs) prefer acting individually, rather than in fixed combinations, within the −150/+50 bp regions to recruit TFs that dictate cofactor signatures distinctive of specific promoter subsets. Subsequently, human promoters can be subclassified based on the presence of cardinal elements and their associated cofactor signatures. In this study, furthermore, we have focused on promoters containing the nuclear respiratory factor 1 (NRF1) motif as the cardinal cis-regulatory element and have identified the pervasive association of NRF1 with the cofactor lysine-specific demethylase 1 (LSD1/KDM1A). This signature might be distinctive of promoters regulating nuclear-encoded mitochondrial and other particular genes in at least some cells. Together, we propose that decoding a signature-based, expanded model of control at proximal promoter regions should lead to a better understanding of coordinated regulation of gene transcription. PMID:24244184
Iwasaki, T; Yamaguchi-Shinozaki, K; Shinozaki, K
1995-05-20
In Arabidopsis thaliana, the induction of a dehydration-responsive gene, rd22, is mediated by abscisic acid (ABA) but the gene does not include any sequence corresponding to the consensus ABA-responsive element (ABRE), RYACGTGGYR, in its promoter region. The cis-regulatory region of the rd22 promoter was identified by monitoring the expression of beta-glucuronidase (GUS) activity in leaves of transgenic tobacco plants transformed with chimeric gene fusions constructed between 5'-deleted promoters of rd22 and the coding region of the GUS reporter gene. A 67-bp nucleotide fragment corresponding to positions -207 to -141 of the rd22 promoter conferred responsiveness to dehydration and ABA on a non-responsive promoter. The 67-bp fragment contains the sequences of the recognition sites for some transcription factors, such as MYC, MYB, and GT-1. The fact that accumulation of rd22 mRNA requires protein synthesis raises the possibility that the expression of rd22 might be regulated by one of these trans-acting protein factors whose de novo synthesis is induced by dehydration or ABA. Although the structure of the RD22 protein is very similar to that of a non-storage seed protein, USP, of Vicia faba, the expression of the GUS gene driven by the rd22 promoter in non-stressed transgenic Arabidopsis plants was found mainly in flowers and bolted stems rather than in seeds.
Fukuzawa, M; Williams, J G
2000-06-01
The cudA gene encodes a nuclear protein that is essential for normal multicellular development. At the slug stage cudA is expressed in the prespore cells and in a sub-region of the prestalk zone. We show that cap site distal promoter sequences direct cudA expression in prespore cells, while proximal sequences direct expression in the prestalk sub-region. The promoter domain that directs prespore-specific transcription consists of a positively acting region, that has the potential to direct expression in all cells within the slug, and a negatively acting region that prevents expression in the prestalk cells. Dd-STATa is the STAT protein that regulates commitment to stalk cell gene expression, where it is known to function as a transcriptional repressor. We show that Dd-STATa binds in vitro to the positively acting part of the prespore domain of the cudA promoter. However, Dd-STATa cannot be utilised for this purpose in vivo, because analysis of a Dd-STATa null mutant strain shows that Dd-STATa is not necessary for cudA transcription in prespore cells. In contrast, the part of the cudA promoter that directs prestalk-specific expression contains a binding site for Dd-STATa that is essential for its biological activity. Dd-STATa appears therefore to serve as a direct activator of cudA transcription in prestalk cells, while a protein with a DNA binding specificity highly related to that of Dd-STATa is utilised to activate cudA transcription in prespore cells.
[Health-Promoting Schools Regional Initiative of the Americas].
Ippolito-Shepherd, Josefa; Cerqueira, Maria Teresa; Ortega, Diana Patricia
2005-01-01
In Latin America, comprehensive health promotion programmes and activities are being implemented in the school setting, which take into account the conceptual framework of the Health-Promoting Schools Regional Initiative of the Pan American Health Organization, Regional office of the World Health Organization (PAHO/WHO). These programmes help to strengthen the working relationships between the health and education sectors. The Health-Promoting Schools Regional Initiative, officially launched by PAHO/WHO in 1995, aims to form future generations to have the knowledge, abilities, and skills necessary for promoting and caring for their health and that of their family and community, as well as to create and maintain healthy environments and communities. The Initiative focuses on three main components: comprehensive health education, the creation and maintenance of healthy physical and psychosocial environments, and the access to health and nutrition services, mental health, and active life. In 2001, PAHO conducted a survey in 19 Latin American countries to assess the status and trends of Health-Promoting Schools in the Region, for the appropriate regional, subregional, and national planning of pertinent health promotion and health education programmes and activities. The results of this survey provided information about policies and national plans, multisectoral coordination mechanisms for the support of health promotion in the school settings, the formation and participation in national and international networks of Health-Promoting Schools and about the level of dissemination of the strategy. For the successful development of Health-Promoting Schools is essential to involve the society as a whole, in order to mobilise human resources and materials necessary for implementing health promotion in the school settings. Thus, the constitution and consolidation of networks has been a facilitating mechanism for the exchange of ideas, resources and experiences to strengthen
Zhao, Si-Si; Zhao, Guo-Dong; Di, Tian-Yuan; Ding, Hua; Wan, Xiao-Ling; Li, Bing; Chen, Yu-Hua; Xu, Ya-Xiang; Shen, Wei-De; Wei, Zheng-Guo
2013-02-01
Cytochrome P450s (CYPs) are widespread proteins that interact with exogenous chemicals from the diet or the environment. CYP9A subfamily genes are important in the silkworm Bombyx mori. We previously reported transcriptional levels of two CYP9A genes in different tissues and their responses to sodium fluoride (NaF). In this study, promoter truncation analysis using a dual-luciferase reporter assay in B. mori ovary cells (BmN) showed that the regions -1,496 to -1,102 bp for CYP9A19, and -1,630 to -1,210 bp for CYP9A22 were essential for basal transcriptional activity. Sequence analysis of these regions revealed several transcriptional regulatory elements but no typical promoter elements. Promoter activities were regulated after NaF induction and with an obvious dose effect. Although the dual-luciferase assay has been widely used to determine the activity of a given promoter in cell lines, problems with it still exist. Our results indicate that both plasmid size and construct protocols affect the experimental results.
Identification of hypothalamic arcuate nucleus-specific enhancer region of Kiss1 gene in mice.
Goto, Teppei; Tomikawa, Junko; Ikegami, Kana; Minabe, Shiori; Abe, Hitomi; Fukanuma, Tatsuya; Imamura, Takuya; Takase, Kenji; Sanbo, Makoto; Tomita, Koichi; Hirabayashi, Masumi; Maeda, Kei-ichiro; Tsukamura, Hiroko; Uenoyama, Yoshihisa
2015-01-01
Pulsatile secretion of GnRH plays a pivotal role in follicular development via stimulating tonic gonadotropin secretion in mammals. Kisspeptin neurons, located in the arcuate nucleus (ARC), are considered to be an intrinsic source of the GnRH pulse generator. The present study aimed to determine ARC-specific enhancer(s) of the Kiss1 gene by an in vivo reporter assay. Three green fluorescent protein (GFP) reporter constructs (long, medium length, and short) were generated by insertion of GFP cDNA at the Kiss1 locus. Transgenic female mice bearing the long and medium-length constructs showed apparent GFP signals in kisspeptin-immunoreactive cells in both the ARC and anteroventral periventricular nucleus, in which another population of kisspeptin neurons are located. On the other hand, transgenic mice bearing 5'-truncated short construct showed few GFP signals in the ARC kisspeptin-immunoreactive cells, whereas they showed colocalization of GFP- and kisspeptin-immunoreactivities in the anteroventral periventricular nucleus. In addition, chromatin immunoprecipitation and chromosome conformation capture assays revealed recruitment of unoccupied estrogen receptor-α in the 5'-upstream region and intricate chromatin loop formation between the 5'-upstream and promoter regions of Kiss1 locus in the ARC. Taken together, the present results indicate that 5'-upstream region of Kiss1 locus plays a critical role in Kiss1 gene expression in an ARC-specific manner and that the recruitment of estrogen receptor-α and formation of a chromatin loop between the Kiss1 promoter and the 5' enhancer region may be required for the induction of ARC-specific Kiss1 gene expression. These results suggest that the 5'-upstream region of Kiss1 locus functions as an enhancer for ARC Kiss1 gene expression in mice.
Itoh, S; Abe, Y; Kubo, A; Okuda, M; Shimoji, M; Nakayama, K; Kamataki, T
1997-02-07
An 11.5 kb fragment of the mouse Cyp3a16 gene containing the 5' flanking region was isolated from the lambda DASHII mouse genomic library. A part of the 5' flanking region and the first exon of Cyp3a16 gene were sequenced. S1 mapping analysis showed the presence of two transcriptional initiation sites. The first exon was completely identical to Cyp3a16 cDNA. The identity of 5' flanking sequences between Cyp3a16 and Cyp3a11 genes was about 69%. A typical TATA box and a basic transcription element (BTE) were found as seen with other CYP3A genes from various animal species Moreover, some putative transcriptional regulatory elements were also found in addition to the sequence motif seen for the formation of Z-type DNA. To examine the transcriptional activity of Cyp3a11 gene, DNA fragments in the 5'-flanking region of the gene were inserted front of the luciferase structural gene, and the constructs were transfected in primary hepatocytes. The analysis of the luciferase activity indicated that the region between -146 and -56 was necessary for the transcription of CYP3a16 gene.
Bégin, Philippe; Schulze, Janika; Baron, Udo; Olek, Sven; Bauer, Rebecca N; Passerini, Laura; Baccheta, Rosa; Nadeau, Kari C
2015-01-01
The FOXP3 gene is the master regulator for T regulatory cells and is under tight DNA methylation control at the Treg specific demethylated region (TSDR) in its first intron. This said, methylation of its promoter region, the significance of which is unknown, has also been associated with various immune-related disease states such as asthma, food allergy, auto-immunity and cancer. Here, we used induced T regulatory cells (iTreg) as a target cell population to identify candidate hypomethylated CpG sites in the FOXP3 gene promoter to design a DNA methylation quantitative assay for this region. Three CpG sites at the promoter region showed clear demethylation pattern associated with high FOXP3 expression after activation in presence of TGFβ and were selected as primary targets to design methylation-dependent RT-PCR primers and probes. We then examined the methylation of this 'inducible-promoter-demethylated-region' (IPDR) in various FOXP3+ T cell subsets. Both naïve and memory thymic-derived Treg cells were found to be fully demethylated at both the IPDR and TSDR. Interestingly, in addition to iTregs, both CD25- and CD25(lo) conventional memory CD4+CD45RA- T cells displayed a high fraction of IPDR demethylated cells in absence of TSDR demethylation. This implies that the fraction of memory T cells should be taken in account when interpreting FOXP3 promoter methylation results from clinical studies. This approach, which is available for testing in clinical samples could have diagnostic and prognostic value in patients with immune or auto-inflammatory diseases.
Gerencsér, Ákos; Barta, Endre; Boa, Simon; Kastanis, Petros; Bösze, Zsuzsanna; Whitelaw, C Bruce A
2002-01-01
κ-casein plays an essential role in the formation, stabilisation and aggregation of milk micelles. Control of κ-casein expression reflects this essential role, although an understanding of the mechanisms involved lags behind that of the other milk protein genes. We determined the 5'-flanking sequences for the murine, rabbit and human κ-casein genes and compared them to the published ruminant sequences. The most conserved region was not the proximal promoter region but an approximately 400 bp long region centred 800 bp upstream of the TATA box. This region contained two highly conserved MGF/STAT5 sites with common spacing relative to each other. In this region, six conserved short stretches of similarity were also found which did not correspond to known transcription factor consensus sites. On the contrary to ruminant and human 5' regulatory sequences, the rabbit and murine 5'-flanking regions did not harbour any kind of repetitive elements. We generated a phylogenetic tree of the six species based on multiple alignment of the κ-casein sequences. This study identified conserved candidate transcriptional regulatory elements within the κ-casein gene promoter. PMID:11929628
Thomson, Cynthia J; Rajala, Amelia K; Carlson, Scott R; Rupert, Jim L
2014-01-01
Sensation seeking is a personality trait that has been associated with disinhibited behaviours including substance use and gambling, but also with high-risk sport practices including skydiving, paragliding, and downhill skiing. Twin studies have shown that sensation seeking is moderately heritable, and candidate genes encoding components involved in dopaminergic transmission have been investigated as contributing to this type of behaviour. To determine whether variants in the regulatory regions of the dopamine-4-receptor gene (DRD4) influenced sport-specific sensation seeking, we analyzed five polymorphisms (-1106T/C, -906T/C, -809G/A, -291C/T, 120-bp duplication) in the promoter region of the gene in a cohort of skiers and snowboarders (n = 599) that represented a broad range of sensation seeking behaviours. We grouped subjects by genotype at each of the five loci and compared impulsive sensation seeking and domain-specific (skiing) sensation seeking between groups. There were no significant associations between genotype(s) and general or domain-specific sensation seeking in the skiers and snowboarders, suggesting that while DRD4 has previously been implicated in sensation seeking, the promoter variants investigated in this study do not contribute to sensation seeking in this athlete population.
Cai, Tao; Hirai, Hiroki; Xu, Huanyu; Notkins, Abner L
2015-06-01
IA-2 is a transmembrane protein found in the dense-core vesicles (DCV) of neuroendocrine cells and one of the major autoantigens in type 1 diabetes. DCV are involved in the secretion of hormones (e.g., insulin) and neurotransmitters. Stimulation of pancreatic β cells with glucose upregulates the expression of IA-2 and an increase in IA-2 results in an increase in the number of DCV. Little is known, however, about the promoter region of IA-2 or the transcriptional factors that regulate the expression of this gene. In the present study, we constructed eight deletion fragments from the upstream region of the IA-2 transcription start site and linked them to a luciferase reporter. By this approach, we have identified a short bp region (-216 to +115) that has strong promoter activity. We also identified a transcription factor, cAMP responsive element-binding protein (CREB), which binds to two CREB-related binding sites located in this region. The binding of CREB to these sites enhanced IA-2 transcription by more than fivefold. We confirmed these findings by site-directed mutagenesis, chromatin immunoprecipitation assays and RNAi inhibition. Based on these findings, we conclude that the PKA pathway is a critical, but not the exclusive signaling pathway involved in IA-2 gene expression.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Nelson, J.A.; Reynolds-Kohler, C.; Smith, B.A.
1987-11-01
To analyze the significance of inducible DNase I-hypersensitive sites occurring in the 5'-flanking sequence of the major immediate-early gene of human cytomegalovirus (HCMV), various deleted portions of the HCMV immediate-early promoter regulatory region were attached to the chloramphenicol acetyltransferase (CAT) gene and assayed for activity in transiently transfected undifferentiated and differentiated human teratocarcinoma cells, Tera-2. Assays of progressive deletions in the promoter regulatory region indicated that removal of a 395-base-pair portion of this element (nucleotides -750 to -1145) containing two inducible DNase I sites which correlate with gene expression resulted in a 7.5-fold increase in CAT activity in undifferentiated cells.more » However, in permissive differentiated Tera-2, human foreskin fibroblast, and HeLa cells, removal of this regulatory region resulted in decreased activity. In addition, attachment of this HCMV upstream element to a homologous or heterologous promoter increased activity three-to fivefold in permissive cells. Therefore, a cis regulatory element exists 5' to the enhancer of the major immediate-early gene of HCMV. This element negatively modulates expression in nonpermissive cells but positively influences expression in permissive cells.« less
Kotur, Nikola; Stankovic, Biljana; Kassela, Katerina; Georgitsi, Marianthi; Vicha, Anna; Leontari, Iliana; Dokmanovic, Lidija; Janic, Dragana; Krstovski, Nada; Klaassen, Kristel; Radmilovic, Milena; Stojiljkovic, Maja; Nikcevic, Gordana; Simeonidis, Argiris; Sivolapenko, Gregory; Pavlovic, Sonja; Patrinos, George P; Zukic, Branka
2012-02-01
TPMT activity is characterized by a trimodal distribution, namely low, intermediate and high methylator. TPMT gene promoter contains a variable number of GC-rich tandem repeats (VNTRs), namely A, B and C, ranging from three to nine repeats in length in an A(n)B(m)C architecture. We have previously shown that the VNTR architecture in the TPMT gene promoter affects TPMT gene transcription. MATERIALS, METHODS & RESULTS: Here we demonstrate, using reporter assays, that 6-mercaptopurine (6-MP) treatment results in a VNTR architecture-dependent decrease of TPMT gene transcription, mediated by the binding of newly recruited protein complexes to the TPMT gene promoter, upon 6-MP treatment. We also show that acute lymphoblastic leukemia patients undergoing 6-MP treatment display a VNTR architecture-dependent response to 6-MP. These data suggest that the TPMT gene promoter VNTR architecture can be potentially used as a pharmacogenomic marker to predict toxicity due to 6-MP treatment in acute lymphoblastic leukemia patients.
NASA Astrophysics Data System (ADS)
Li, Shengjie; Bai, Junjie; Wang, Lin
2008-08-01
Myostatin or GDF-8, a member of the transforming growth factor-β (TGF-β) superfamily, has been demonstrated to be a negative regulator of skeletal muscle mass in mammals. In the present study, we obtained a 5.64 kb sequence of myostatin encoding gene and its promoter from largemouth bass ( Micropterus salmoides). The myostatin encoding gene consisted of three exons (488 bp, 371 bp and 1779 bp, respectively) and two introns (390 bp and 855 bp, respectively). The intron-exon boundaries were conservative in comparison with those of mammalian myostatin encoding genes, whereas the size of introns was smaller than that of mammals. Sequence analysis of 1.569 kb of the largemouth bass myostatin gene promoter region revealed that it contained two TATA boxes, one CAAT box and nine putative E-boxes. Putative muscle growth response elements for myocyte enhancer factor 2 (MEF2), serum response factor (SRF), activator protein 1 (AP1), etc., and muscle-specific Mt binding site (MTBF) were also detected. Some of the transcription factor binding sites were conserved among five teleost species. This information will be useful for studying the transcriptional regulation of myostatin in fish.
Identification of a locus control region for quadruplicated green-sensitive opsin genes in zebrafish
Tsujimura, Taro; Chinen, Akito; Kawamura, Shoji
2007-01-01
Duplication of opsin genes has a crucial role in the evolution of visual system. Zebrafish have four green-sensitive (RH2) opsin genes (RH2–1, RH2–2, RH2–3, and RH2–4) arrayed in tandem. They are expressed in the short member of the double cones (SDC) but differ in expression areas in the retina and absorption spectra of their encoding photopigments. The shortest and the second shortest wavelength subtypes, RH2–1 and RH2–2, are expressed in the central-to-dorsal retina. The longer wavelength subtype, RH2–3, is expressed circumscribing the RH2–1/RH2–2 area, and the longest subtype, RH2–4, is expressed further circumscribing the RH2–3 area and mainly occupying the ventral retina. The present report shows that a 0.5-kb region located 15 kb upstream of the RH2 gene array is an essential regulator for their expression. When the 0.5-kb region was deleted from a P1-artificial chromosome (PAC) clone encompassing the four RH2 genes and when one of these genes was replaced with a reporter GFP gene, the GFP expression in SDCs was abolished in the zebrafish to which a series of the modified PAC clones were introduced. Transgenic studies also showed that the 0.5-kb region conferred the SDC-specific expression for promoters of a non-SDC (UV opsin) and a nonretinal (keratin 8) gene. Changing the location of the 0.5-kb region in the PAC clone conferred the highest expression for its proximal gene. The 0.5-kb region was thus designated as RH2-LCR analogous to the locus control region of the L-M opsin genes of primates. PMID:17646658
Goedecke, Simon; Mühlisch, Jörg; Hempel, Georg; Frühwald, Michael C; Wünsch, Bernhard
2015-12-01
Along with histone modifications, RNA interference and delayed replication timing, DNA methylation belongs to the key processes in epigenetic regulation of gene expression. Therefore, reliable information about the methylation level of particular DNA fragments is of major interest. Herein the methylation level at two positions of the promoter region of the gene methylguanine-O(6) -DNA-Methyltransferase (MGMT) was investigated. Previously, it was demonstrated that the epigenetic status of this DNA region correlates with response to alkylating anticancer agents. An automated CGE method with LIF detection was established to separate the six DNA fragments resulting from combined bisulfite restriction analysis of the methylated and non-methylated MGMT promoter. In COBRA, the DNA was treated with bisulfite converting cytosine into uracil. During PCR uracil pairs with adenine, which changes the original recognition site of the restriction enzyme Taql. Artificial probes generated by mixing appropriate amounts of DNA after bisulfite treatment and PCR amplification were used for validation of the method. The methylation levels of these samples could be determined with high accuracy and precision. DNA samples prepared by mixing the corresponding clones first and then performing PCR amplification led to non-linear correlation between the corrected peak areas and the methylation levels. This effect is explained by slightly different PCR amplification of DNA with different sequences present in the mixture. The superiority of CGE over PAGE was clearly demonstrated. Finally, the established method was used to analyze the methylation levels of human brain tumor tissue samples. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Kaulage, Mangesh H; Maji, Basudeb; Pasadi, Sanjeev; Ali, Asfa; Bhattacharya, Santanu; Muniyappa, K
2018-03-25
Recent studies support the idea that G-quadruplex structures in the promoter regions of oncogenes and telomere DNA can serve as potential therapeutic targets in the treatment of cancer. Accordingly, several different types of organic small molecules that stabilize G-quadruplex structures and inhibit telomerase activity have been discerned. Here, we describe the binding of benzimidazole-carbazole ligands to G-quadruplex structures formed in G-rich DNA sequences containing the promoter regions of human c-MYC, c-KIT1, c-KIT2, VEGF and BCL2 proto-oncogenes. The fluorescence spectroscopic data indicate that benzimidazole-carbazole ligands bind and stabilize the G-quadruplexes in the promoter region of oncogenes. The molecular docking studies provide insights into the mode and extent of binding of this class of ligands to the G-quadruplexes formed in oncogene promoters. The high stability of these G-quadruplex structures was validated by thermal denaturation and telomerase-catalyzed extension of the 3' end. Notably, benzimidazole-carbazole ligands suppress the expression of oncogenes in cancer cells in a dose-dependent manner. We anticipate that benzimidazole-carbazole ligands, by virtue of their ability to stabilize G-quadruplex structures in the promoter regions of oncogenes, might reduce the risk of cancer through the loss of function in the proteins encoded by these genes. Copyright © 2018 Elsevier Masson SAS. All rights reserved.
Huang, Deqi; Jokela, Maarit; Tuusa, Jussi; Skog, Sven; Poikonen, Kari; Syväoja, Juhani E.
2001-01-01
The B-subunits of replicative DNA polymerases from Archaea to humans belong to the same protein family, suggesting that they share a common fundamental function. We report here the gene structure for the B-subunit of human DNA polymerase ɛ (POLE2), whose expression and transcriptional regulation is typical for replication proteins with some unique features. The 75 bp core promoter region, located within exon 1, contains an Sp1 element that is a critical determinant of promoter activity as shown by the luciferase reporter, electrophoretic mobility shift and DNase I footprinting assays. Two overlapping E2F elements adjacent to the Sp1 element are essential for full promoter activity and serum response. Binding sites for E2F1 and NF-1 reside immediately downstream from the core promoter region. Our results suggest that human POLE2 is regulated by two E2F–pocket protein complexes, one associated with Sp1 and the other with NF-1. So far, only one replicative DNA polymerase B-subunit gene promoter, POLA2 encoding the B-subunit of DNA polymerase α, has been characterized. Mitogenic activation of the POLE2 promoter by an E2F-mediated mechanism resembles that of POLA2, but the regulation of basal promoter activity is different between these two genes. PMID:11433027
Laumen, Helmut; Saningong, Akuma D.; Heid, Iris M.; Hess, Jochen; Herder, Christian; Claussnitzer, Melina; Baumert, Jens; Lamina, Claudia; Rathmann, Wolfgang; Sedlmeier, Eva-Maria; Klopp, Norman; Thorand, Barbara; Wichmann, H.-Erich; Illig, Thomas; Hauner, Hans
2009-01-01
OBJECTIVE Adiponectin (APM1, ACDC) is an adipocyte-derived protein with downregulated expression in obesity and insulin-resistant states. Several potentially regulatory single nucleotide polymorphisms (SNPs) within the APM1 gene promoter region have been associated with circulating adiponectin levels. None of them have been functionally characterized in adiponectin-expressing cells. Hence, we investigated three SNPs (rs16861194, rs17300539, and rs266729) for their influence on adiponectin promoter activity and their association with circulating adiponectin levels. RESEARCH DESIGN AND METHODS Basal and rosiglitazone-induced promoter activity of different SNP combinations (haplotypes) was analyzed in 3T3-L1 adipocytes using luciferase reporter gene assays and DNA binding studies comparing all possible APM1 haplotypes. This functional approach was complemented with analysis of epidemiological population-based data of 1,692 participants of the MONICA/KORA S123 cohort and 696 participants from the KORA S4 cohort for SNP and haplotype association with circulating adiponectin levels. RESULTS Major to minor allele replacements of the three SNPs revealed significant effects on promoter activity in luciferase assays. Particularly, a minor variant in rs16861194 resulted in reduced basal and rosiglitazone-induced promoter activity and hypoadiponectinemia in the epidemiological datasets. The haplotype with the minor allele in all three SNPs showed a complete loss of promoter activity, and no subject carried this haplotype in either of the epidemiological samples (combined P value for statistically significant difference from a random sample was 0.006). CONCLUSIONS Our results clearly demonstrate that promoter variants associated with hypoadiponectinemia in humans substantially affect adiponectin promoter activity in adipocytes. Our combination of functional experiments with epidemiological data overcomes the drawback of each approach alone. PMID:19074982
Dron, Michel; Clouse, Steven D.; Dixon, Richard A.; Lawton, Michael A.; Lamb, Christopher J.
1988-01-01
To investigate the mechanisms underlying activation of plant defenses against microbial attack we have studied elicitor regulation of a chimeric gene comprising the 5′ flanking region of a defense gene encoding the phytoalexin biosynthetic enzyme chalcone synthase fused to a bacterial chloramphenicol acetyltransferase gene. Glutathione or fungal elicitor caused a rapid, marked but transient expression of the chimeric gene electroporated into soybean protoplasts. The response closely resembled that of endogenous chalcone synthase genes in suspension cultured cells. Functional analysis of 5′ deletions suggests that promoter activity is determined by an elicitor-regulated activator located between the “TATA box” and nucleotide position -173 and an upstream silencer between -173 and -326. These cis-acting elements function in the transduction of the elicitation signal to initiate elaboration of an inducible defense response. Images PMID:16593981
SnoN co-repressor binds and represses smad7 gene promoter.
Briones-Orta, Marco A; Sosa-Garrocho, Marcela; Moreno-Alvarez, Paola; Fonseca-Sánchez, Miguel A; Macías-Silva, Marina
2006-03-17
SnoN and Ski oncoproteins are co-repressors for Smad proteins and repress TGF-beta-responsive gene expression. The smad7 gene is a TGF-beta target induced by Smad signaling, and its promoter contains the Smad-binding element (SBE) required for a positive regulation by the TGF-beta/Smad pathway. SnoN and Ski co-repressors also bind SBE but regulate negatively smad7 gene. Ski along with Smad4 binds and represses the smad7 promoter, whereas the repression mechanism by SnoN is not clear. Ski and SnoN overexpression inhibits smad7 reporter expression induced through TGF-beta signaling. Using chromatin immunoprecipitation assays, we found that SnoN binds smad7 promoter at the basal condition, whereas after a short TGF-beta treatment for 15-30 min SnoN is downregulated and no longer bound smad7 promoter. Interestingly, after a prolonged TGF-beta treatment SnoN is upregulated and returns to its position on the smad7 promoter, functioning probably as a negative feedback control. Thus, SnoN also seems to regulate negatively the TGF-beta-responsive smad7 gene by binding and repressing its promoter in a similar way to Ski.
Liguori, Renato; Quaranta, Sandro; Di Fiore, Rosanna; Elce, Ausilia; Castaldo, Giuseppe; Amato, Felice
2014-12-01
Plasminogen activator inhibitor-1 (PAI-1) is the major physiological inhibitor of tissue-type plasminogen activator in plasma and the most important regulator of the fibrinolytic pathway. The 4G/5G polymorphism (rs1799889) in the PAI-1 promoter is associated with altered PAI-1 transcription. We have identified a new 4G/5G allele, in which a T is inserted near the 4G tract or replaces a G in the 5G tract, forming a T plus 4G (T4G) region. This new variant was first identified in two women, one had experienced juvenile myocardial infarction, the other repeated miscarriage; both had increased PAI-1 plasma activity. In view of the important influence of this promoter region on PAI-1 protein plasma level, we performed in vitro evaluation of the effects of the T4G variant on the transcription activity of the PAI-1 gene promoter. In silico prediction analysis showed that presence of the T4G allele disrupts the E-Box region upstream of the T4G variant, altering the affinity of the target sequence for E-Box binding factors like upstream stimulatory factor-1 (USF-1). Basal T4G promoter activity was 50% higher compared to 4G and 5G variants, but it was less stimulated by USF-1 overexpression. We also analyzed the effects of IL-1β and IL-6 on the PAI-1 promoter activity of our three constructs and showed that the T4G variant was less affected by IL-1β than the other variants. These findings indicate that the T4G variant may be a novel risk factor for thrombotic events. Copyright © 2014 Elsevier Ltd. All rights reserved.
Association between promoter hypermethylation of the DACT2 gene and tumor stages in breast cancer.
Marusa Borgonio-Cuadra, Veronica; Miranda-Duarte, Antonio; Rojas-Toledo, Xochitl; Garcia-Hernandez, Normand; Alfredo Sierra-Ramirez, Jose; Cardenas-Garcia, Maura; Elena Hernandez-Caballero, Marta
2018-01-01
Aberrant methylation of CpG islands in the promoter is a hallmark of cancer, leading to transcriptional silencing of tumor suppressor genes. The aim of this work was to evaluate the promoter methylation status of the DACT2 gene in breast cancer (BC) tissue and to analyze its possible effect on tumor type or grade. CpG island from the DACT2 promoter in region -240 to -14 from transcriptional start site (TSS) were obtained. Through the use of sodium bisulfite DNA conversion analysis, followed by detection with MSP (methylation specific PCR), we analyzed 79 BC and 15 adjacent healthy samples. T he c ases a nalyzed w ere i n s tage I ( 2.5%), I I (38%), or III (59.5%). The most frequent tumor type was invasive ductal carcinoma (71.4%). Methylation analysis comparing tumor tissues with adjacent non-cancerous tissues showed statistical significance. Methylation was observed in 32.9% (26/79) of the samples; no methylation was found in adjacent healthy tissue. DACT2 methylation was associated with tumor stage I-II (p=0.03) and stage III (p=0.004). An association was found of DACT2 promoter methylation with advanced tumor stages. This gene has been suggested as a potential biomarker, however, more investigation is required to validate this function.
Acosta-MontesdeOca, Adriana; Zariñán, Teresa; Macías, Héctor; Pérez-Solís, Marco A; Ulloa-Aguirre, Alfredo; Gutiérrez-Sagal, Rubén
2012-05-01
To gain further insight on the estrogen-dependent transcriptional regulation of the uteroglobin (UG) gene, we cloned the 5'-flanking region of the UG gene from the phylogenetically ancient volcano rabbit (Romerolagus diazi; Rd). The cloned region spans 812 base pairs (bp; -812/-1) and contains a noncanonical TATA box (TACA). The translation start site is 48 bp downstream from the putative transcription initiation site (AGA), and is preceded by a consensus Kozak box. Comparison of the Rd-UG gene with that previously isolated from rabbits (Oryctolagus cuniculus) showed 93% in sequence identity as well as a number of conserved cis-acting elements, including the estrogen-response element (ERE; -265/-251), which differs from the consensus by two nucleotides. In MCF-7 cells, 17β-estradiol (E(2)) induced transcription of a luciferase reporter driven by the Rd-UG promoter in a similar manner as in an equivalent rabbit UG reporter; the Rd-UG promoter was 30% more responsive to E(2) than the rabbit promoter. Mutagenesis studies on the Rd-ERE confirmed this cis-element as a target of E(2) as two luciferase mutant reporters of the Rd-promoter, one with the rabbit and the other with the consensus ERE, were more responsive to the hormone than the wild-type reporter. Gel shift and super-shift assays showed that estrogen receptor-α indeed binds to the imperfect palindromic sequence of the Rd-ERE. Copyright © 2012 Wiley Periodicals, Inc.
[Novel bidirectional promoter from human genome].
Orekhova, A S; Sverdlova, P S; Spirin, P V; Leonova, O G; Popenko, V I; Prasolov, V S; Rubtsov, P M
2011-01-01
In human and other mammalian genomes a number of closely linked gene pairs transcribed in opposite directions are found. According to bioinformatic analysis up to 10% of human genes are arranged in this way. In present work the fragment of human genome was cloned that separates genes localized at 2p13.1 and oriented "head-to-head", coding for hypothetical proteins with unknown functions--CCDC (Coiled Coil Domain Containing) 142 and TTC (TetraTricopeptide repeat Containing) 31. Intergenic CCDC142-TTC31 region overlaps with CpG-island and contains a number of potential binding sites for transcription factors. This fragment functions as bidirectional promoter in the system ofluciferase reporter gene expression upon transfection of human embryonic kidney (HEK293) cells. The vectors containing genes of two fluorescent proteins--green (EGFP) and red (DsRed2) in opposite orientations separated by the fragment of CCDC142-TTC31 intergenic region were constructed. In HEK293 cells transfected with these vectors simultaneous expression of two fluorescent proteins is observed. Truncated versions of intergenic region were obtained and their promoter activity measured. Minimal promoter fragment contains elements Inr, BRE, DPE characteristic for TATA-less promoters. Thus, from the human genome the novel bidirectional promoter was cloned that can be used for simultaneous constitutive expression of two genes in human cells.
Tao, Yan-Bin; He, Liang-Liang; Niu, Long-Jian; Xu, Zeng-Fu
2015-04-01
The JcUEP promoter is active constitutively in the bio-fuel plant Jatropha curcas , and is an alternative to the widely used CaMV35S promoter for driving constitutive overexpression of transgenes in Jatropha. Well-characterized promoters are required for transgenic breeding of Jatropha curcas, a biofuel feedstock with great potential for production of bio-diesel and bio-jet fuel. In this study, an ubiquitin extension protein gene from Jatropha, designated JcUEP, was identified to be ubiquitously expressed. Thus, we isolated a 1.2 kb fragment of the 5' flanking region of JcUEP and evaluated its activity as a constitutive promoter in Arabidopsis and Jatropha using the β-glucuronidase (GUS) reporter gene. As expected, histochemical GUS assay showed that the JcUEP promoter was active in all Arabidopsis and Jatropha tissues tested. We also compared the activity of the JcUEP promoter with that of the cauliflower mosaic virus 35S (CaMV35S) promoter, a well-characterized constitutive promoter conferring strong transgene expression in dicot species, in various tissues of Jatropha. In a fluorometric GUS assay, the two promoters showed similar activities in stems, mature leaves and female flowers; while the CaMV35S promoter was more effective than the JcUEP promoter in other tissues, especially young leaves and inflorescences. In addition, the JcUEP promoter retained its activity under stress conditions in low temperature, high salt, dehydration and exogenous ABA treatments. These results suggest that the plant-derived JcUEP promoter could be an alternative to the CaMV35S promoter for driving constitutive overexpression of transgenes in Jatropha and other plants.
Promoter analysis of the rabbit POU5F1 gene and its expression in preimplantation stage embryos.
Kobolak, Julianna; Kiss, Katalin; Polgar, Zsuzsanna; Mamo, Solomon; Rogel-Gaillard, Claire; Tancos, Zsuzsanna; Bock, Istvan; Baji, Arpad G; Tar, Krisztina; Pirity, Melinda K; Dinnyes, Andras
2009-09-04
The POU5F1 gene encodes the octamer-binding transcription factor-4 (Oct4). It is crucial in the regulation of pluripotency during embryonic development and widely used as molecular marker of embryonic stem cells (ESCs). The objective of this study was to identify and to analyse the promoter region of rabbit POU5F1 gene; furthermore to examine its expression pattern in preimplantation stage rabbit embryos. The upstream region of rabbit POU5F1 was subcloned sequenced and four highly conserved promoter regions (CR1-4) were identified. The highest degree of similarity on sequence level was found among the conserved domains between rabbit and human. Among the enhancers the proximal enhancer region (PE-1A) exhibited the highest degree of homology (96.4%). Furthermore, the CR4 regulator domain containing the distal enhancer (DE-2A) was responsible for stem cell-specific expression. Also, BAC library screen revealed the existence of a processed pseudogene of rabbit POU5F1. The results of quantitative real-time PCR experiments showed that POU5F1 mRNA was abundantly present in oocytes and zygotes, but it was gradually reduced until the activation of the embryonic genome, thereafter a continuous increase in POU5F1 mRNA level was observed until blastocyst stage. By using the XYClone laser system the inner cell mass (ICM) and trophoblast portions of embryos were microdissected and examined separately and POU5F1 mRNA was detected in both cell types. In this study we provide a comparative sequence analysis of the regulatory region of rabbit POU5F1 gene. Our data suggest that the POU5F1 gene is strictly regulated during early mammalian development. We proposed that the well conserved CR4 region containing the DE-2A enhancer is responsible for the highly conserved ESC specific gene expression. Notably, we are the first to report that the rabbit POU5F1 is not restricted to ICM cells only, but it is expressed in trophoblast cells as well. This information may be well applicable to
First Pass Annotation of Promoters on Human Chromosome 22
Scherf, Matthias; Klingenhoff, Andreas; Frech, Kornelie; Quandt, Kerstin; Schneider, Ralf; Grote, Korbinian; Frisch, Matthias; Gailus-Durner, Valérie; Seidel, Alexander; Brack-Werner, Ruth; Werner, Thomas
2001-01-01
The publication of the first almost complete sequence of a human chromosome (chromosome 22) is a major milestone in human genomics. Together with the sequence, an excellent annotation of genes was published which certainly will serve as an information resource for numerous future projects. We noted that the annotation did not cover regulatory regions; in particular, no promoter annotation has been provided. Here we present an analysis of the complete published chromosome 22 sequence for promoters. A recent breakthrough in specific in silico prediction of promoter regions enabled us to attempt large-scale prediction of promoter regions on chromosome 22. Scanning of sequence databases revealed only 20 experimentally verified promoters, of which 10 were correctly predicted by our approach. Nearly 40% of our 465 predicted promoter regions are supported by the currently available gene annotation. Promoter finding also provides a biologically meaningful method for “chromosomal scaffolding”, by which long genomic sequences can be divided into segments starting with a gene. As one example, the combination of promoter region prediction with exon/intron structure predictions greatly enhances the specificity of de novo gene finding. The present study demonstrates that it is possible to identify promoters in silico on the chromosomal level with sufficient reliability for experimental planning and indicates that a wealth of information about regulatory regions can be extracted from current large-scale (megabase) sequencing projects. Results are available on-line at http://genomatix.gsf.de/chr22/. PMID:11230158
Conserved regulatory elements of the promoter sequence of the gene rpoH of enteric bacteria
Ramírez-Santos, Jesús; Collado-Vides, Julio; García-Varela, Martin; Gómez-Eichelmann, M. Carmen
2001-01-01
The rpoH regulatory region of different members of the enteric bacteria family was sequenced or downloaded from GenBank and compared. In addition, the transcriptional start sites of rpoH of Yersinia frederiksenii and Proteus mirabilis, two distant members of this family, were determined. Sequences similar to the σ70 promoters P1, P4 and P5, to the σE promoter P3 and to boxes DnaA1, DnaA2, cAMP receptor protein (CRP) boxes CRP1, CRP2 and box CytR present in Escherichia coli K12, were identified in sequences of closely related bacteria such as: E.coli, Shigella flexneri, Salmonella enterica serovar Typhimurium, Citrobacter freundii, Enterobacter cloacae and Klebsiella pneumoniae. In more distant bacteria, Y.frederiksenii and P.mirabilis, the rpoH regulatory region has a distal P1-like σ70 promoter and two proximal promoters: a heat-induced σE-like promoter and a σ70 promoter. Sequences similar to the regulatory boxes were not identified in these bacteria. This study suggests that the general pattern of transcription of the rpoH gene in enteric bacteria includes a distal σ70 promoter, >200 nt upstream of the initiation codon, and two proximal promoters: a heat-induced σE-like promoter and a σ70 promoter. A second proximal σ70 promoter under catabolite-regulation is probably present only in bacteria closely related to E.coli. PMID:11139607
Wang, Qian-Fei; Lauring, Josh; Schlissel, Mark S.
2000-01-01
The RAG-2 gene encodes a component of the V(D)J recombinase which is essential for the assembly of antigen receptor genes in B and T lymphocytes. Previously, we reported that the transcription factor BSAP (PAX-5) regulates the murine RAG-2 promoter in B-cell lines. A partially overlapping but distinct region of the proximal RAG-2 promoter was also identified as an important element for promoter activity in T cells; however, the responsible factor was unknown. In this report, we present data demonstrating that c-Myb binds to a Myb consensus site within the proximal promoter and is critical for its activity in T-lineage cells. We show that c-Myb can transactivate a RAG-2 promoter-reporter construct in cotransfection assays and that this transactivation depends on the proximal promoter Myb consensus site. By using a chromatin immunoprecipitation (ChIP) strategy, fractionation of chromatin with anti-c-Myb antibody specifically enriched endogenous RAG-2 promoter DNA sequences. DNase I genomic footprinting revealed that the c-Myb site is occupied in a tissue-specific fashion in vivo. Furthermore, an integrated RAG-2 promoter construct with mutations at the c-Myb site was not enriched in the ChIP assay, while a wild-type integrated promoter construct was enriched. Finally, this lack of binding of c-Myb to a chromosomally integrated mutant RAG-2 promoter construct in vivo was associated with a striking decrease in promoter activity. We conclude that c-Myb regulates the RAG-2 promoter in T cells by binding to this consensus c-Myb binding site. PMID:11094072
Characterization of the Structural Gene Promoter of Aedes aegypti Densovirus
Ward, Todd W.; Kimmick, Michael W.; Afanasiev, Boris N.; Carlson, Jonathan O.
2001-01-01
Aedes aegypti densonucleosis virus (AeDNV) has two promoters that have been shown to be active by reporter gene expression analysis (B. N. Afanasiev, Y. V. Koslov, J. O. Carlson, and B. J. Beaty, Exp. Parasitol. 79:322–339, 1994). Northern blot analysis of cells infected with AeDNV revealed two transcripts 1,200 and 3,500 nucleotides in length that are assumed to express the structural protein (VP) gene and nonstructural protein genes, respectively. Primer extension was used to map the transcriptional start site of the structural protein gene. Surprisingly, the structural protein gene transcript began at an initiator consensus sequence, CAGT, 60 nucleotides upstream from the map unit 61 TATAA sequence previously thought to define the promoter. Constructs with the β-galactosidase gene fused to the structural protein gene were used to determine elements necessary for promoter function. Deletion or mutation of the initiator sequence, CAGT, reduced protein expression by 93%, whereas mutation of the TATAA sequence at map unit 61 had little effect. An additional open reading frame was observed upstream of the structural protein gene that can express β-galactosidase at a low level (20% of that of VP fusions). Expression of the AeDNV structural protein gene was shown to be stimulated by the major nonstructural protein NS1 (Afanasiev et al., Exp. parasitol., 1994). To determine the sequences required for transactivation, expression of structural protein gene–β-galactosidase gene fusion constructs differing in AeDNV genome content was measured with and without NS1. The presence of NS1 led to an 8- to 10-fold increase in expression when either genomic end was present, compared to a 2-fold increase with a construct lacking the genomic ends. An even higher (37-fold) increase in expression occurred with both genomic ends present; however, this was in part due to template replication as shown by Southern blot analysis. These data indicate the location and importance of
Kovina, A P; Petrova, N V; Razin, S V; Yarovaia, O V
2016-01-01
In warm-blooded vertebrates, the α- and β-globin genes are organized in domains of different types and are regulated in different fashion. In cold-blooded vertebrates and, in particular, the tropical fish Danio rerio, the α- and β-globin genes form two gene clusters. A major D. rerio globin gene cluster is in chromosome 3 and includes the α- and β-globin genes of embryonic-larval and adult types. The region upstream of the cluster contains c16orf35, harbors the main regulatory element (MRE) of the α-globin gene domain in warm-blooded vertebrates. In this study, transient transfection of erythroid cells with genetic constructs containing a reporter gene under the control of potential regulatory elements of the domain was performed to characterize the promoters of the embryonic-larval and adult α- and β-globin genes of the major cluster. Also, in the 5th intron of c16orf35 in Danio reriowas detected a functional analog of the warm-blooded vertebrate MRE. This enhancer stimulated activity of the promoters of both adult and embryonic-larval α- and β-globin genes.
Banerjee, Joydeep; Sahoo, Dipak Kumar; Dey, Nrisingha; Houtz, Robert L.; Maiti, Indu Bhushan
2013-01-01
On chromosome 4 in the Arabidopsis genome, two neighboring genes (calmodulin methyl transferase At4g35987 and senescence associated gene At4g35985) are located in a head-to-head divergent orientation sharing a putative bidirectional promoter. This 1258 bp intergenic region contains a number of environmental stress responsive and tissue specific cis-regulatory elements. Transcript analysis of At4g35985 and At4g35987 genes by quantitative real time PCR showed tissue specific and stress inducible expression profiles. We tested the bidirectional promoter-function of the intergenic region shared by the divergent genes At4g35985 and At4g35987 using two reporter genes (GFP and GUS) in both orientations in transient tobacco protoplast and Agro-infiltration assays, as well as in stably transformed transgenic Arabidopsis and tobacco plants. In transient assays with GFP and GUS reporter genes the At4g35985 promoter (P85) showed stronger expression (about 3.5 fold) compared to the At4g35987 promoter (P87). The tissue specific as well as stress responsive functional nature of the bidirectional promoter was evaluated in independent transgenic Arabidopsis and tobacco lines. Expression of P85 activity was detected in the midrib of leaves, leaf trichomes, apical meristemic regions, throughout the root, lateral roots and flowers. The expression of P87 was observed in leaf-tip, hydathodes, apical meristem, root tips, emerging lateral root tips, root stele region and in floral tissues. The bidirectional promoter in both orientations shows differential up-regulation (2.5 to 3 fold) under salt stress. Use of such regulatory elements of bidirectional promoters showing spatial and stress inducible promoter-functions in heterologous system might be an important tool for plant biotechnology and gene stacking applications. PMID:24260266
Selective AR Modulators that Distinguish Proliferative from Differentiative Gene Promoters
2016-08-01
AWARD NUMBER: W81XWH-14-1-0292 TITLE: Selective AR Modulators that Distinguish Proliferative from Differentiative Gene Promoters PRINCIPAL...Approved for Public Release; Distribution Unlimited The views, opinions and/or findings contained in this report are those of the author(s) and...29 Jul 2016 4. TITLE AND SUBTITLE Selective AR Modulators that Distinguish Proliferative from Differentiative Gene Promoters 5a. CONTRACT NUMBER
Fauteux, François; Strömvik, Martina V
2009-01-01
Background Accurate computational identification of cis-regulatory motifs is difficult, particularly in eukaryotic promoters, which typically contain multiple short and degenerate DNA sequences bound by several interacting factors. Enrichment in combinations of rare motifs in the promoter sequence of functionally or evolutionarily related genes among several species is an indicator of conserved transcriptional regulatory mechanisms. This provides a basis for the computational identification of cis-regulatory motifs. Results We have used a discriminative seeding DNA motif discovery algorithm for an in-depth analysis of 54 seed storage protein (SSP) gene promoters from three plant families, namely Brassicaceae (mustards), Fabaceae (legumes) and Poaceae (grasses) using backgrounds based on complete sets of promoters from a representative species in each family, namely Arabidopsis (Arabidopsis thaliana (L.) Heynh.), soybean (Glycine max (L.) Merr.) and rice (Oryza sativa L.) respectively. We have identified three conserved motifs (two RY-like and one ACGT-like) in Brassicaceae and Fabaceae SSP gene promoters that are similar to experimentally characterized seed-specific cis-regulatory elements. Fabaceae SSP gene promoter sequences are also enriched in a novel, seed-specific E2Fb-like motif. Conserved motifs identified in Poaceae SSP gene promoters include a GCN4-like motif, two prolamin-box-like motifs and an Skn-1-like motif. Evidence of the presence of a variant of the TATA-box is found in the SSP gene promoters from the three plant families. Motifs discovered in SSP gene promoters were used to score whole-genome sets of promoters from Arabidopsis, soybean and rice. The highest-scoring promoters are associated with genes coding for different subunits or precursors of seed storage proteins. Conclusion Seed storage protein gene promoter motifs are conserved in diverse species, and different plant families are characterized by a distinct combination of conserved motifs
Thomson, Cynthia J.; Rajala, Amelia K.; Carlson, Scott R.; Rupert, Jim L.
2014-01-01
Sensation seeking is a personality trait that has been associated with disinhibited behaviours including substance use and gambling, but also with high-risk sport practices including skydiving, paragliding, and downhill skiing. Twin studies have shown that sensation seeking is moderately heritable, and candidate genes encoding components involved in dopaminergic transmission have been investigated as contributing to this type of behaviour. To determine whether variants in the regulatory regions of the dopamine-4-receptor gene (DRD4) influenced sport-specific sensation seeking, we analyzed five polymorphisms (−1106T/C, −906T/C, −809G/A, −291C/T, 120-bp duplication) in the promoter region of the gene in a cohort of skiers and snowboarders (n = 599) that represented a broad range of sensation seeking behaviours. We grouped subjects by genotype at each of the five loci and compared impulsive sensation seeking and domain-specific (skiing) sensation seeking between groups. There were no significant associations between genotype(s) and general or domain-specific sensation seeking in the skiers and snowboarders, suggesting that while DRD4 has previously been implicated in sensation seeking, the promoter variants investigated in this study do not contribute to sensation seeking in this athlete population. PMID:24691022
Robakowska-Hyzorek, Dagmara; Oprzadek, Jolanta; Zelazowska, Beata; Olbromski, Rafał; Zwierzchowski, Lech
2010-06-01
Myogenic factor 5 (Myf5), a product of the Myf5 gene, belongs to the MRF family of basic helix-loop-helix transcription factors that regulate myogenesis. Their roles in muscle growth and development make their genes candidates for molecular markers of meat production in livestock, but nucleotide sequence polymorphism has not been thoroughly studied in MRF genes. We detected four single nucleotide polymorphisms (SNPs) within exon 1 of the Myf5 gene, encoding the NH-terminal transactivation domain of the Myf5 protein. Three of these mutations change the amino acid sequence. The distribution of these SNPs was highly skewed in cattle populations; most of the mutations were found in only a few or even single individuals. Of the nine SNPs found in the promoter region of Myf5, one (transversion g.-723G-->T) was represented by all three genotypes distributed in the cattle populations studied. This polymorphism showed an influence on Myf5 gene expression in the longissimus dorsi muscle and was associated with sirloin weight and fat weight in sirloin in carcasses of Holstein-Friesian cattle.
Nemec, Petr; Pavkova-Goldbergova, Monika; Gatterova, Jindra; Fojtik, Zdenek; Vasku, Anna; Soucek, Miroslav
2009-08-01
Interleukin-10 (IL-10) is an immunoregulatory cytokine, usually considered to mediate the downregulation of the inflammatory response in rheumatoid arthritis (RA). Some effects of IL-10 are not anti-inflammatory; for example, the activation of B cells to promote autoantibody production. Allelic polymorphisms located in the promoter region of the IL-10 gene may contribute to the regulation of autoantibodies production. To examine the putative association between the -1082 G/A polymorphism in the promoter region of the IL-10 gene and the susceptibility to disease onset and severity of RA, a total of 144 patients with RA diagnosed according to the revised criteria of the American College of Rheumatology for RA were consecutively recruited into the study. Radiographic progression of RA was scored according to the Sharp/van der Heijde method. Serum levels of rheumatoid factors (RFs) were measured by enzyme-linked immunosorbent assay. Polymerase chain reaction amplification was used for the analysis of the promoter polymorphism of the IL-10 gene. We observed significant differences in genotype distribution of the -1082 G/A polymorphism between IgM RF, IgA RF, and IgG RF positive/negative subgroups of RA patients, with higher prevalence of the GG genotype within IgM RF (Pg = 0.006), IgA RF (Pg = 0.05), and IgG RF (Pg = 0.007) negative RA patients. Results obtained in this study provide the evidence of an association between the -1082 G/A polymorphism in the IL-10 gene promoter and the production of RFs in RA patients.
An, Soo Hyun; Choi, Hyong Woo; Hong, Jeum Kyu; Hwang, Byung Kook
2009-11-01
Analysis of the promoters of defense-related genes is valuable for determining stress signaling and transcriptional activation during pathogen infection. Here, we have isolated and functionally characterized the promoter region of the pepper (Capsicum annuum) pectin methylesterase inhibitor 1 (CaPMEI1) gene in transiently transformed tobacco plants and stably transformed Arabidopsis plants. Among four 5' deletion constructs analyzed, the -958-bp CaPMEI1 promoter induced a high level of GUS reporter activity in tobacco leaf tissue, driven by pathogen infection as well as by ethylene and methyl jasmonate (MeJA) treatment. The 204-bp region from -958 bp to -754 bp of the CaPMEI1 promoter is responsible for the stress-responsive expression. In addition, the pepper transcription factor CARAV1 activated the CaPMEI1 promoter in tobacco leaves, whereas the transcription factor CAbZIP1 did not. In the transgenic Arabidopsis plants, the -958 bp CaPMEI1 promoter was functionally regulated by developmental cues, bacterial and oomycete pathogen infections, and treatment with ethylene and MeJA. Histochemical GUS staining analyses of Arabidopsis tissues revealed that the CaPMEI1 promoter was mainly activated in leaf veins in response to various biotic and abiotic stimuli. Together, these results suggest that CaPMEI1 promoter activation may be a critical molecular event for host defense response and ethylene- and MeJA-mediated CaPMEI1 gene expression.
Tokuhiro, Keizo; Miyagawa, Yasushi; Yamada, Shuichi; Hirose, Mika; Ohta, Hiroshi; Nishimune, Yoshitake; Tanaka, Hiromitsu
2007-03-01
Haspin is a unique protein kinase expressed predominantly in haploid male germ cells. The genomic structure of haspin (Gsg2) has revealed it to be intronless, and the entire transcription unit is in an intron of the integrin alphaE (Itgae) gene. Transcription occurs from a bidirectional promoter that also generates an alternatively spliced integrin alphaE-derived mRNA (Aed). In mice, the testis-specific alternative splicing of Aed is expressed bidirectionally downstream from the Gsg2 transcription initiation site, and a segment consisting of 26 bp transcribes both genomic DNA strands between Gsg2 and the Aed transcription initiation sites. To investigate the mechanisms for this unique gene regulation, we cloned and characterized the Gsg2 promoter region. The 193-bp genomic fragment from the 5' end of the Gsg2 and Aed genes, fused with EGFP and DsRed genes, drove the expression of both proteins in haploid germ cells of transgenic mice. This promoter element contained only a GC-rich sequence, and not the previously reported DNA sequences known to bind various transcription factors--with the exception of E2F1, TCFAP2A1 (AP2), and SP1. Here, we show that the 193-bp DNA sequence is sufficient for the specific, bidirectional, and synchronous expression in germ cells in the testis. We also demonstrate the existence of germ cell nuclear factors specifically bound to the promoter sequence. This activity may be regulated by binding to the promoter sequence with germ cell-specific nuclear complex(es) without regulation via DNA methylation.
Identification of regions correlating MGMT promoter methylation and gene expression in glioblastomas
Everhard, Sibille; Tost, Jörg; Abdalaoui, Hafida El; Crinière, Emmanuelle; Busato, Florence; Marie, Yannick; Gut, Ivo G.; Sanson, Marc; Mokhtari, Karima; Laigle-Donadey, Florence; Hoang-Xuan, Khê; Delattre, Jean-Yves; Thillet, Joëlle
2009-01-01
The O6-methylguanine-DNA methyltransferase gene (MGMT) is methylated in several cancers, including gliomas. However, the functional role of cysteine-phosphate-guanine (CpG) island (CGI) methylation in MGMT silencing is still controversial. The aim of this study was to investigate whether MGMT CGI methylation correlates inversely with RNA expression of MGMT in glioblastomas and to determine the CpG region whose methylation best reflects the level of expression. The methylation level of CpG sites that are potentially related to expression was investigated in 54 glioblastomas by pyrosequencing, a highly quantitative method, and analyzed with respect to their MGMT mRNA expression status. Three groups of patients were identified according to the methylation pattern of all 52 analyzed CpG sites. Overall, an 85% rate of concordance was observed between methylation and expression (p < 0.0001). When analyzing each CpG separately, six CpG sites were highly correlated with expression (p < 0.0001), and two CpG regions could be used as surrogate markers for RNA expression in 81.5% of the patients. This study indicates that there is good statistical agreement between MGMT methylation and expression, and that some CpG regions better reflect MGMT expression than do others. However, if transcriptional repression is the key mechanism in explaining the higher chemosensitivity of MGMT-methylated tumors, a substantial rate of discordance should lead clinicians to be cautious when deciding on a therapeutic strategy based on MGMT methylation status alone. PMID:19224763
Everhard, Sibille; Tost, Jörg; El Abdalaoui, Hafida; Crinière, Emmanuelle; Busato, Florence; Marie, Yannick; Gut, Ivo G; Sanson, Marc; Mokhtari, Karima; Laigle-Donadey, Florence; Hoang-Xuan, Khê; Delattre, Jean-Yves; Thillet, Joëlle
2009-08-01
The O(6)-methylguanine-DNA methyltransferase gene (MGMT) is methylated in several cancers, including gliomas. However, the functional role of cysteine-phosphate-guanine (CpG) island (CGI) methylation in MGMT silencing is still controversial. The aim of this study was to investigate whether MGMT CGI methylation correlates inversely with RNA expression of MGMT in glioblastomas and to determine the CpG region whose methylation best reflects the level of expression. The methylation level of CpG sites that are potentially related to expression was investigated in 54 glioblastomas by pyrosequencing, a highly quantitative method, and analyzed with respect to their MGMT mRNA expression status. Three groups of patients were identified according to the methylation pattern of all 52 analyzed CpG sites. Overall, an 85% rate of concordance was observed between methylation and expression (p < 0.0001). When analyzing each CpG separately, six CpG sites were highly correlated with expression (p < 0.0001), and two CpG regions could be used as surrogate markers for RNA expression in 81.5% of the patients. This study indicates that there is good statistical agreement between MGMT methylation and expression, and that some CpG regions better reflect MGMT expression than do others. However, if transcriptional repression is the key mechanism in explaining the higher chemosensitivity of MGMT-methylated tumors, a substantial rate of discordance should lead clinicians to be cautious when deciding on a therapeutic strategy based on MGMT methylation status alone.
Rentsendorj, Otgonchimeg; Nagy, Andrea; Sinkó, Ildikó; Daraba, Andreea; Barta, Endre; Kiss, Ibolya
2005-08-01
The matrilin-1 gene has the unique feature that it is expressed in chondrocytes in a developmental stage-specific manner. Previously, we found that the chicken matrilin-1 long promoter with or without the intronic enhancer and the short promoter with the intronic enhancer restricted the transgene expression to the columnar proliferative chondroblasts and prehypertrophic chondrocytes of growth-plate cartilage in transgenic mice. To study whether the short promoter shared by these transgenes harbours cartilage-specific control elements, we generated transgenic mice expressing the LacZ reporter gene under the control of the matrilin-1 promoter between -338 and +67. Histological analysis of the founder embryos demonstrated relatively weak transgene activity in the developing chondrocranium, axial and appendicular skeleton with highest level of expression in the columnar proliferating chondroblasts and prehypertrophic chondrocytes. Computer analysis of the matrilin-1 genes of amniotes revealed a highly conserved Pe1 (proximal promoter element 1) and two less-conserved sequence blocks in the distal promoter region. The inverted Sox motifs of the Pe1 element interacted with chondrogenic transcription factors Sox9, L-Sox5 and Sox6 in vitro and another factor bound to the spacer region. Point mutations in the Sox motifs or in the spacer region interfered with or altered the formation of nucleoprotein complexes in vitro and significantly decreased the reporter gene activity in transient expression assays in chondrocytes. In vivo occupancy of the Sox motifs in genomic footprinting in the expressing cell type, but not in fibroblasts, also supported the involvement of Pe1 in the tissue-specific regulation of the gene. Our results indicate that interaction of Pe1 with distal DNA elements is required for the high level, cartilage- and developmental stage-specific transgene expression.
Watanabe, Daisuke; Kaneko, Akie; Sugimoto, Yukiko; Ohnuki, Shinsuke; Takagi, Hiroshi; Ohya, Yoshikazu
2017-02-01
A loss-of-function mutation in the RIM15 gene, which encodes a Greatwall-like protein kinase, is one of the major causes of the high alcoholic fermentation rates in Saccharomyces cerevisiae sake strains closely related to Kyokai no. 7 (K7). However, impairment of Rim15p may not be beneficial under more severe fermentation conditions, such as in the late fermentation stage, as it negatively affects stress responses. To balance stress tolerance and fermentation performance, we inserted the promoter of a gluconeogenic gene, PCK1, into the 5'-untranslated region (5'-UTR) of the RIM15 gene in a laboratory strain to achieve repression of RIM15 gene expression in the glucose-rich early stage with its induction in the stressful late stage of alcoholic fermentation. The promoter-engineered strain exhibited a fermentation rate comparable to that of the RIM15-deleted strain with no decrease in cell viability. The engineered strain achieved better alcoholic fermentation performance than the RIM15-deleted strain under repetitive and high-glucose fermentation conditions. These data demonstrated the validity of promoter engineering of the RIM15 gene that governs inhibitory control of alcoholic fermentation. Copyright © 2016 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.
Thomas, David; Finan, Chris; Newport, Melanie J; Jones, Susan
2015-10-01
The complexity of DNA can be quantified using estimates of entropy. Variation in DNA complexity is expected between the promoters of genes with different transcriptional mechanisms; namely housekeeping (HK) and tissue specific (TS). The former are transcribed constitutively to maintain general cellular functions, and the latter are transcribed in restricted tissue and cells types for specific molecular events. It is known that promoter features in the human genome are related to tissue specificity, but this has been difficult to quantify on a genomic scale. If entropy effectively quantifies DNA complexity, calculating the entropies of HK and TS gene promoters as profiles may reveal significant differences. Entropy profiles were calculated for a total dataset of 12,003 human gene promoters and for 501 housekeeping (HK) and 587 tissue specific (TS) human gene promoters. The mean profiles show the TS promoters have a significantly lower entropy (p<2.2e-16) than HK gene promoters. The entropy distributions for the 3 datasets show that promoter entropies could be used to identify novel HK genes. Functional features comprise DNA sequence patterns that are non-random and hence they have lower entropies. The lower entropy of TS gene promoters can be explained by a higher density of positive and negative regulatory elements, required for genes with complex spatial and temporary expression. Copyright © 2015 Elsevier Ltd. All rights reserved.
The ribosomal gene spacer region in archaebacteria
NASA Technical Reports Server (NTRS)
Achenbach-Richter, L.; Woese, C. R.
1988-01-01
Sequences for the spacer regions that separate the 16S and 23S ribosomal RNA genes have been determined for four more (strategically placed) archaebacteria. These confirm the general rule that methanogens and extreme halophiles have spacers that contain a single tRNAala gene, while tRNA genes are not found in the spacer region of the true extreme thermophiles. The present study also shows that the spacer regions from the sulfate reducing Archaeglobus and the extreme thermophile Thermococcus (both of which cluster phylogenetically with the methanogens and extreme halophiles) contain each a tRNAala gene. Thus, not only all methanogens and extreme halophiles show this characteristic, but all organisms on the "methanogen branch" of the archaebacterial tree appear to do so. The finding of a tRNA gene in the spacer region of the extreme thermophile Thermococcus celer is the first known phenotypic property that links this organism with its phylogenetic counterparts, the methanogens, rather than with its phenotypic counterparts, the sulfur-dependent extreme thermophiles.
2014-01-01
Background Deciphering of the information content of eukaryotic promoters has remained confined to universal landmarks and conserved sequence elements such as enhancers and transcription factor binding motifs, which are considered sufficient for gene activation and regulation. Gene-specific sequences, interspersed between the canonical transacting factor binding sites or adjoining them within a promoter, are generally taken to be devoid of any regulatory information and have therefore been largely ignored. An unanswered question therefore is, do gene-specific sequences within a eukaryotic promoter have a role in gene activation? Here, we present an exhaustive experimental analysis of a gene-specific sequence adjoining the heat shock element (HSE) in the proximal promoter of the small heat shock protein gene, αB-crystallin (cryab). These sequences are highly conserved between the rodents and the humans. Results Using human retinal pigment epithelial cells in culture as the host, we have identified a 10-bp gene-specific promoter sequence (GPS), which, unlike an enhancer, controls expression from the promoter of this gene, only when in appropriate position and orientation. Notably, the data suggests that GPS in comparison with the HSE works in a context-independent fashion. Additionally, when moved upstream, about a nucleosome length of DNA (−154 bp) from the transcription start site (TSS), the activity of the promoter is markedly inhibited, suggesting its involvement in local promoter access. Importantly, we demonstrate that deletion of the GPS results in complete loss of cryab promoter activity in transgenic mice. Conclusions These data suggest that gene-specific sequences such as the GPS, identified here, may have critical roles in regulating gene-specific activity from eukaryotic promoters. PMID:24589182
DOE Office of Scientific and Technical Information (OSTI.GOV)
Santhanam, U.; Ray, A.; Sehgal, P.B.
1991-09-01
The aberrant overexpression of interleukin 6 (IL-6) is implicated as an autocrine mechanism in the enhanced proliferation of the neoplastic cell elements in various B- and T-cell malignancies and in some carcinomas and sarcomas; many of these neoplasms have been shown to be associated with a mutated p53 gene. The possibility that wild-type (wt) p53, a nuclear tumor-suppressor protein, but not its transforming mutants might serve to repress IL-6 gene expression was investigated in HeLa cells. The authors transiently cotransfected these cells with constitutive cytomegalovirus (CMV) enhancer/promoter expression plasmids overproducing wt or mutant human or murine p53 and with appropriatemore » chloramphenicol acetyltransferase (CAT) reporter plasmids containing the promoter elements of human IL-6, c-fos, or {beta}-actin genes or of porcine major histocompatibility complex (MHC) class I gene in pN-38 to evaluate the effect of the various p53 species on these promoters. These observations identify transcriptional repression as a property of p53 and suggest that p53 and RB may be involved as transcriptional repressors in modulating IL-6 gene expression during cellular differentiation and oncogenesis.« less
Lee, Bom-Yi; Park, So-Yeon; Ryu, Hyun-Mee; Shin, Chan-Young; Ko, Ki-Nam; Han, Jung-Yeol; Koren, Gideon; Cho, Youl-Hee
2015-02-01
Alcohol exposure has been shown to cause devastating effects on neurobehavioral development in numerous animal and human studies. The alteration of DNA methylation levels in gene-specific promoter regions has been investigated in some studies of human alcoholics. This study was aimed to investigate whether social alcohol consumption during periconceptional period is associated with epigenetic alteration and its generational transmission in the blood cells. We investigated patterns of alcohol intake in a prospective cohort of 355 pairs of pregnant women and their spouses who reported alcohol intake during the periconceptional period. A subpopulation of 164 families was established for the epigenetic study based on the availability of peripheral blood and cord blood DNA. The relative methylation changes of dopamine transporter (DAT), serotonin transporter (SERT), and methyl CpG binding protein 2 (MeCP2) gene promoters were analyzed using methylation-specific endonuclease digestion followed by quantitative real-time polymerase chain reaction. The relative methylation level of the DAT gene promoter was decreased in the group of mothers reporting above moderate drinking (p = 0.029) and binge drinking (p = 0.037) during pregnancy. The relative methylation level of the DAT promoter was decreased in the group of fathers reporting heavy binge drinking (p = 0.003). The relative methylation levels of the SERT gene promoter were decreased in the group of newborns of light drinking mothers before pregnancy (p = 0.012) and during pregnancy (p = 0.003). The methylation level in the MeCP2 promoter region of babies whose mothers reported above moderate drinking during pregnancy was increased (p = 0.02). In addition, methylation pattern in the DAT promoter region of babies whose fathers reported heavy binge drinking was decreased (p = 0.049). These findings suggest that periconceptional alcohol intake may cause epigenetic changes in specific locus of parental and
Caputi, Francesca Felicia; Palmisano, Martina; Carboni, Lucia; Candeletti, Sanzio; Romualdi, Patrizia
2016-12-01
The recreational drug of abuse 3,4-methylenedioxymethamphetamine (MDMA) has been shown to produce neurotoxic damage and long-lasting changes in several brain areas. In addition to the involvement of serotoninergic and dopaminergic systems, little information exists about the contribution of nociceptin/orphaninFQ (N/OFQ)-NOP and dynorphin (DYN)-KOP systems in neuronal adaptations evoked by MDMA. Here we investigated the behavioral and molecular effects induced by acute (8mg/kg) or repeated (8mg/kg twice daily for seven days) MDMA exposure. MDMA exposure affected body weight gain and induced hyperlocomotion; this latter effect progressively decreased after repeated administration. Gene expression analysis indicated a down-regulation of the N/OFQ system and an up-regulation of the DYN system in the nucleus accumbens (NAc), highlighting an opposite systems regulation in response to MDMA exposure. Since histone modifications have been strongly associated to the addiction-related maladaptive changes, we examined two permissive (acH3K9 and me3H3K4) and two repressive transcription marks (me3H3K27 and me2H3K9) at the pertinent opioid gene promoter regions. Chromatin immunoprecipitation assays revealed that acute MDMA increased me3H3K4 at the pN/OFQ, pDYN and NOP promoters. Following acute and repeated treatment a significant decrease of acH3K9 at the pN/OFQ promoter was observed, which correlated with gene expression results. Acute treatment caused an acH3K9 increase and a me2H3K9 decrease at the pDYN promoter which matched its mRNA up-regulation. Our data indicate that the activation of the DYNergic stress system together with the inactivation of the N/OFQergic anti-stress system contribute to the neuroadaptive actions of MDMA and offer novel epigenetic information associated with MDMA abuse. Copyright © 2016 Elsevier Ltd. All rights reserved.
Kéri, Szabolcs
2009-09-01
Why are genetic polymorphisms related to severe mental disorders retained in the gene pool of a population? A possible answer is that these genetic variations may have a positive impact on psychological functions. Here, I show that a biologically relevant polymorphism of the promoter region of the neuregulin 1 gene (SNP8NRG243177/rs6994992) is associated with creativity in people with high intellectual and academic performance. Intriguingly, the highest creative achievements and creative-thinking scores were found in people who carried the T/T genotype, which was previously shown to be related to psychosis risk and altered prefrontal activation.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Huang, R.C.; Gourlie, B.; Price, J.
1987-05-01
During the late fall and winter, the winter flounder produces a family of unique antifreeze proteins (AFP) to prevent the lethal formation of ice crystals in its blood. They have been able to induce winter flounder AFP mRNA synthesis in vivo by lowering the ambient temperature of the fish from 18/sup 0/C in the summer months when AFP synthesis is at a minimum to 4/sup 0/C. Furthermore, they have demonstrated and thoroughly investigated this cold induction of AFP mRNA synthesis in vitro in isolated liver tissue and in nuclear preparations isolated from liver tissue. A drug selection vector (pRSV/sub gpt/)more » which uses RSV promoter for the expression of xanthine-guanine phosphoribosyltransferase (gpt) gene and contains an AFP gene and 1.7 kb of its 5' upstream control region has been constructed for studies of gene transfer into cells of other fish species. These studies were made using a variety of gene transfer techniques into tissue culture cell lines derived from rainbow trout, bluegill, and salmon. Drug resistant colonies from all three species have been obtained and the presence of AFP DNA has been positively identified by Southern analysis. In addition, Northern blot analysis has shown that both gpt gene and AFP gene are active in these cells since mRNA/sub gpt/ and mRNA/sub AFP/ can be detected by probing with the respective gene sequences.« less
Lambertini, Elisabetta; Tavanti, Elisa; Torreggiani, Elena; Penolazzi, Letizia; Gambari, Roberto; Piva, Roberta
2008-07-01
Estrogen-responsive genes often have an estrogen response element (ERE) positioned next to activator protein-1 (AP-1) binding sites. Considering that the interaction between ERE and AP-1 elements has been described for the modulation of bone-specific genes, we investigated the 17-beta-estradiol responsiveness and the role of these cis-elements present in the F promoter of the human estrogen receptor alpha (ERalpha) gene. The F promoter, containing the sequence analyzed here, is one of the multiple promoters of the human ERalpha gene and is the only active promoter in bone tissue. Through electrophoretic mobility shift (EMSA), chromatin immunoprecipitation (ChIP), and re-ChIP assays, we investigated the binding of ERalpha and four members of the AP-1 family (c-Jun, c-fos, Fra-2, and ATF2) to a region located approximately 800 bp upstream of the transcriptional start site of exon F of the human ERalpha gene in SaOS-2 osteoblast-like cells. Reporter gene assay experiments in combination with DNA binding assays demonstrated that F promoter activity is under the control of upstream cis-acting elements which are recognized by specific combinations of ERalpha, c-Jun, c-fos, and ATF2 homo- and heterodimers. Moreover, ChIP and re-ChIP experiments showed that these nuclear factors bind the F promoter in vivo with a simultaneous occupancy stimulated by 17-beta-estradiol. Taken together, our findings support a model in which ERalpha/AP-1 complexes modulate F promoter activity under conditions of 17-beta-estradiol stimulation. (c) 2008 Wiley-Liss, Inc.
Duodenal ulcer promoting gene of Helicobacter pylori.
Lu, Hong; Hsu, Ping-I; Graham, David Y; Yamaoka, Yoshio
2005-04-01
Identification of a disease-specific H pylori virulence factors predictive of the outcome of infection remains unachieved. We used the polymerase chain reaction and Southern blot to compare the presence of 14 vir homologue genes with clinical presentation of H pylori infection, mucosal histology, and mucosal interleukin (IL)-8 levels. We examined 500 H pylori strains from East Asia and South America, including 120 with gastritis, 140 with duodenal ulcer (DU), 110 with gastric ulcer (GU), and 130 with gastric cancer. Only 1 gene that encompassed both jhp0917 and jhp0918 called dupA (duodenal ulcer promoting gene) was associated with a specific clinical outcome. dupA was present in 42% of DU vs. 21% of gastritis (adjusted odds ratio [OR] = 3.1, 95% confidence interval [CI]: 1.7-5.7). Its presence was also associated with more intense antral neutrophil infiltration and IL-8 levels and was a marker for protection against gastric atrophy, intestinal metaplasia, and gastric cancer (OR for gastric cancer = 0.42, 95% CI: 0.2-0.9 compared with gastritis). In vitro studies in gastric epithelial cells using dupA -deleted and -complemented mutants showed that the dupA plays roles in IL-8 production, in activation of transcription factors responsible for IL-8 promoter activity, and in increased survivability at low pH. dupA is a novel marker associated with an increased risk for DU and reduced risk for gastric atrophy and cancer. Its association with DU-promoting and -protective effects against atrophy/cancer was evident in both Asian and Western countries.
Mao, Yongjiang; Zhu, Xiaorui; Xing, Shiyu; Zhang, Meirong; Zhang, Huimin; Wang, Xiaolong; Karrow, Niel; Yang, Liguo; Yang, Zhangping
2015-12-01
Lactoferrin is an iron-binding protein found in cow's milk that plays an important role in preventing mastitis caused by intramammary infection. In this study, 20 Chinese Holstein cows were selected randomly for PCR amplification and sequencing of the bovine lactoferrin gene promoter region and used for SNP discovery in the region between nucleotide positions -461 to -132. Three SNPs (-270T>C, -190G>A and -156A>G) were identified in bovine lactoferrin, then Chinese Holstein cows (n=866) were genotyped using Sequenom MassARRAY (Sequenom Inc., San Diego, CA) based on the previous SNP information in this study, and the associations between SNPs or haplotype and milk somatic cell score (SCS) and production traits were analyzed by the least squares method in the GLM procedure of SAS. SNPs -270T>C and -156A>G showed close linkage disequilibrium (r(2)=0.76). The SNP -190G>A showed a significant association with SCS, and individuals with genotype GG had higher SCS than genotypes AG and AA. Associations were found between the SNPs -270T>C and -190G>A with SCS and the milk composition. The software MatInspector revealed that these SNPs were located within several potential transcription factor binding sites, including NF-κB p50, KLF7 and SP1, and may alter gene expression, but further investigation will be required to elucidate the biological and practical relevance of these SNPs. Copyright © 2015 Elsevier Ltd. All rights reserved.
The application of powerful promoters to enhance gene expression in industrial microorganisms.
Zhou, Shenghu; Du, Guocheng; Kang, Zhen; Li, Jianghua; Chen, Jian; Li, Huazhong; Zhou, Jingwen
2017-02-01
Production of useful chemicals by industrial microorganisms has been attracting more and more attention. Microorganisms screened from their natural environment usually suffer from low productivity, low stress resistance, and accumulation of by-products. In order to overcome these disadvantages, rational engineering of microorganisms to achieve specific industrial goals has become routine. Rapid development of metabolic engineering and synthetic biology strategies provide novel methods to improve the performance of industrial microorganisms. Rational regulation of gene expression by specific promoters is essential to engineer industrial microorganisms for high-efficiency production of target chemicals. Identification, modification, and application of suitable promoters could provide powerful switches at the transcriptional level for fine-tuning of a single gene or a group of genes, which are essential for the reconstruction of pathways. In this review, the characteristics of promoters from eukaryotic, prokaryotic, and archaea microorganisms are briefly introduced. Identification of promoters based on both traditional biochemical and systems biology routes are summarized. Besides rational modification, de novo design of promoters to achieve gradient, dynamic, and logic gate regulation are also introduced. Furthermore, flexible application of static and dynamic promoters for the rational engineering of industrial microorganisms is highlighted. From the perspective of powerful promoters in industrial microorganisms, this review will provide an extensive description of how to regulate gene expression in industrial microorganisms to achieve more useful goals.
Zhang, Zhichun; Tian, Hua; Lv, Ping; Wang, Weiping; Jia, Zhuqing; Wang, Sainan; Zhou, Chunyan; Gao, Xuejun
2015-01-01
Mutation of distal-less homeobox 3 (DLX3) is responsible for human tricho-dento-osseous syndrome (TDO) with amelogenesis imperfecta, indicating a crucial role of DLX3 in amelogenesis. However, the expression pattern of DLX3 and its specific function in amelogenesis remain largely unknown. The aim of this study was to investigate the effects of DLX3 on enamel matrix protein (EMP) genes. By immunohistochemistry assays of mouse tooth germs, stronger immunostaining of DLX3 protein was identified in ameloblasts in the secretory stage than in the pre-secretory and maturation stages, and the same pattern was found for Dlx3 mRNA using Realtime PCR. In a mouse ameloblast cell lineage, forced expression of DLX3 up-regulated the expression of the EMP genes Amelx, Enam, Klk4, and Odam, whereas knockdown of DLX3 down-regulated these four EMP genes. Further, bioinformatics, chromatin immunoprecipitation, and luciferase assays revealed that DLX3 transactivated Enam, Amelx, and Odam through direct binding to their enhancer regions. Particularly, over-expression of mutant-DLX3 (c.571_574delGGGG, responsible for TDO) inhibited the activation function of DLX3 on expression levels and promoter activities of the Enam, Amelx, and Odam genes. Together, our data show that DLX3 promotes the expression of the EMP genes Amelx, Enam, Klk4, and Odam in amelogenesis, while mutant-DLX3 disrupts this regulatory function, thus providing insights into the molecular mechanisms underlying the enamel defects of TDO disease.
Zhang, Zhichun; Tian, Hua; Lv, Ping; Wang, Weiping; Jia, Zhuqing; Wang, Sainan; Zhou, Chunyan; Gao, Xuejun
2015-01-01
Mutation of distal-less homeobox 3 (DLX3) is responsible for human tricho-dento-osseous syndrome (TDO) with amelogenesis imperfecta, indicating a crucial role of DLX3 in amelogenesis. However, the expression pattern of DLX3 and its specific function in amelogenesis remain largely unknown. The aim of this study was to investigate the effects of DLX3 on enamel matrix protein (EMP) genes. By immunohistochemistry assays of mouse tooth germs, stronger immunostaining of DLX3 protein was identified in ameloblasts in the secretory stage than in the pre-secretory and maturation stages, and the same pattern was found for Dlx3 mRNA using Realtime PCR. In a mouse ameloblast cell lineage, forced expression of DLX3 up-regulated the expression of the EMP genes Amelx, Enam, Klk4, and Odam, whereas knockdown of DLX3 down-regulated these four EMP genes. Further, bioinformatics, chromatin immunoprecipitation, and luciferase assays revealed that DLX3 transactivated Enam, Amelx, and Odam through direct binding to their enhancer regions. Particularly, over-expression of mutant-DLX3 (c.571_574delGGGG, responsible for TDO) inhibited the activation function of DLX3 on expression levels and promoter activities of the Enam, Amelx, and Odam genes. Together, our data show that DLX3 promotes the expression of the EMP genes Amelx, Enam, Klk4, and Odam in amelogenesis, while mutant-DLX3 disrupts this regulatory function, thus providing insights into the molecular mechanisms underlying the enamel defects of TDO disease. PMID:25815730
PPARγ and NF-κB regulate the gene promoter activity of their shared repressor, TNIP1
Gurevich, Igor; Zhang, Carmen; Encarnacao, Priscilla C.; Struzynski, Charles P.; Livings, Sarah E.; Aneskievich, Brian J.
2011-01-01
Human TNFAIP3 interacting protein 1 (TNIP1) has diverse functions including support of HIV replication through its interaction with viral Nef and matrix proteins, reduction of TNFα-induced signaling through its interaction with NF-κB pathway proteins, and corepression of agonist-bound retinoic acid receptors and peroxisome proliferator-activated receptors (PPAR). The wide tissue distribution of TNIP1 provides the opportunity to influence numerous cellular responses in these roles and defining control of TNIP1 expression would be central to improved understanding of its impact on cell function. We cloned 6kb of the human TNIP1 promoter and performed predictive and functional analyses to identify regulatory elements. The promoter region proximal to the transcription start site is GC-rich without a recognizable TATA box. In contrast to this proximal ~500bp region, 6kb of the promoter increased reporter construct constitutive activity over five-fold. Throughout the 6kb length, in silico analysis identified several potential binding sites for both constitutive and inducible transcription factors; among the latter were candidate NF-κB binding sequences and peroxisome proliferator response elements (PPREs). We tested NF-κB and PPAR regulation of the endogenous TNIP1 gene and cloned promoter by expression studies, electrophoretic mobility shift assays, and chromatin immunoprecipitations. We validated NF-κB sites in the TNIP1 promoter proximal and distal regions as well as one PPRE in the distal region. The ultimate control of the TNIP1 promoter is likely to be a combination of constitutive transcription factors and those subject to activation such as NF-κB and PPAR. PMID:22001530
A strategy of gene overexpression based on tandem repetitive promoters in Escherichia coli.
Li, Mingji; Wang, Junshu; Geng, Yanping; Li, Yikui; Wang, Qian; Liang, Quanfeng; Qi, Qingsheng
2012-02-06
For metabolic engineering, many rate-limiting steps may exist in the pathways of accumulating the target metabolites. Increasing copy number of the desired genes in these pathways is a general method to solve the problem, for example, the employment of the multi-copy plasmid-based expression system. However, this method may bring genetic instability, structural instability and metabolic burden to the host, while integrating of the desired gene into the chromosome may cause inadequate transcription or expression. In this study, we developed a strategy for obtaining gene overexpression by engineering promoter clusters consisted of multiple core-tac-promoters (MCPtacs) in tandem. Through a uniquely designed in vitro assembling process, a series of promoter clusters were constructed. The transcription strength of these promoter clusters showed a stepwise enhancement with the increase of tandem repeats number until it reached the critical value of five. Application of the MCPtacs promoter clusters in polyhydroxybutyrate (PHB) production proved that it was efficient. Integration of the phaCAB genes with the 5CPtacs promoter cluster resulted in an engineered E.coli that can accumulate 23.7% PHB of the cell dry weight in batch cultivation. The transcription strength of the MCPtacs promoter cluster can be greatly improved by increasing the tandem repeats number of the core-tac-promoter. By integrating the desired gene together with the MCPtacs promoter cluster into the chromosome of E. coli, we can achieve high and stale overexpression with only a small size. This strategy has an application potential in many fields and can be extended to other bacteria.
Intragenic Locus in Human PIWIL2 Gene Shares Promoter and Enhancer Functions.
Skvortsova, Yulia V; Kondratieva, Sofia A; Zinovyeva, Marina V; Nikolaev, Lev G; Azhikina, Tatyana L; Gainetdinov, Ildar V
2016-01-01
Recently, more evidence supporting common nature of promoters and enhancers has been accumulated. In this work, we present data on chromatin modifications and non-polyadenylated transcription characteristic for enhancers as well as results of in vitro luciferase reporter assays suggesting that PIWIL2 alternative promoter in exon 7 also functions as an enhancer for gene PHYHIP located 60Kb upstream. This finding of an intragenic enhancer serving as a promoter for a shorter protein isoform implies broader impact on understanding enhancer-promoter networks in regulation of gene expression.
Rossi, Valeria; Beffagna, Giorgia; Rampazzo, Alessandra; Bauce, Barbara; Danieli, Gian Antonio
2004-06-23
Isthmins represent a novel family of vertebrate secreted proteins containing one copy of the thrombospondin type 1 repeat (TSR), which in mammals is shared by several proteins with diverse biological functions, including cell adhesion, angiogenesis, and patterning of developing nervous system. We have determined the genomic organization of human TAIL1 (thrombospondin and AMOP containing isthmin-like 1), a novel isthmin-like gene encoding a protein that contains a TSR and a C-terminal AMOP domain (adhesion-associated domain in MUC4 and other proteins), characteristic of extracellular proteins involved in adhesion processes. TAIL1 gene encompasses more than 24.4 kb. Analysis of the DNA sequence surrounding the putative transcriptional start region revealed a TATA-less promoter located in a CpG island. Several consensus binding sites for the transcription factors Sp1 and MZF-1 were identified in this promoter region. In humans, TAIL1 gene is located on chromosome 14q24.3 within ARVD1 (arrhythmogenic right ventricular dysplasia/cardiomyopathy, type 1) critical region; preliminary evidence suggests that it is expressed in several tissues, showing multiple alternative splicing.
Carlier, Aurelien L.; von Bodman, S. B.
2006-01-01
The upstream region of the Pantoea stewartii rcsA gene features two promoters, one for constitutive basal-level expression and a second autoregulated promoter for induced expression. The EsaR quorum-sensing repressor binds to a site centered between the two promoters, blocking transcription elongation from the regulated promoter under noninducing conditions. PMID:16740966
Agarwal, Parul; Garg, Varsha; Gautam, Taru; Pillai, Beena; Kanoria, Shaveta; Burma, Pradeep Kumar
2014-04-01
Several reports of promoters from plants, viral and artificial origin that confer high constitutive expression are known. Among these the CaMV 35S promoter is used extensively for transgene expression in plants. We identified candidate promoters from Arabidopsis based on their transcript levels (meta-analysis of available microarray control datasets) to test their activity in comparison to the CaMV 35S promoter. A set of 11 candidate genes were identified which showed high transcript levels in the aerial tissue (i.e. leaf, shoot, flower and stem). In the initial part of the study binary vectors were developed wherein the promoter and 5'UTR region of these candidate genes (Upstream Regulatory Module, URM) were cloned upstream to the reporter gene β glucuronidase (gus). The promoter strengths were tested in transformed callus of Nicotiana tabacum and Gossypium hirsutum. On the basis of the results obtained from the callus, the influence of the URM cassettes on transgene expression was tested in transgenic tobacco. The URM regions of the genes encoding a subunit of photosystem I (PHOTO) and geranyl geranyl reductase (GGR) in A. thaliana genome showed significantly high levels of GUS activity in comparison to the CaMV 35S promoter. Further, when the 5'UTRs of both the genes were placed downstream to the CaMV 35S promoter it led to a substantial increase in GUS activity in transgenic tobacco lines and cotton callus. The enhancement observed was even higher to that observed with the viral leader sequences like Ω and AMV, known translational enhancers. Our results indicate that the two URM cassettes or the 5'UTR regions of PHOTO and GGR when placed downstream to the CaMV 35S promoter can be used to drive high levels of transgene expression in dicotyledons.
Xu, Li; Ji, Jin-Jun; Le, Wangping; Xu, Yan S; Dou, Dandan; Pan, Jieli; Jiao, Yifeng; Zhong, Tianfei; Wu, Dehong; Wang, Yumei; Wen, Chengping; Xie, Guan-Qun; Yao, Feng; Zhao, Heng; Fan, Yong-Sheng; Chin, Y Eugene
2015-10-15
Cytokine or growth factor activated STAT3 undergoes multiple post-translational modifications, dimerization and translocation into nuclei, where it binds to serum-inducible element (SIE, 'TTC(N3)GAA')-bearing promoters to activate transcription. The STAT3 DNA binding domain (DBD, 320-494) mutation in hyper immunoglobulin E syndrome (HIES), called the HIES mutation (R382Q, R382W or V463Δ), which elevates IgE synthesis, inhibits SIE binding activity and sensitizes genes such as TNF-α for expression. However, the mechanism by which the HIES mutation sensitizes STAT3 in gene induction remains elusive. Here, we report that STAT3 binds directly to the AGG-element with the consensus sequence 'AGG(N3)AGG'. Surprisingly, the helical N-terminal region (1-355), rather than the canonical STAT3 DBD, is responsible for AGG-element binding. The HIES mutation markedly enhances STAT3 AGG-element binding and AGG-promoter activation activity. Thus, STAT3 is a dual specificity transcription factor that promotes gene expression not only via SIE- but also AGG-promoter activity. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.
Li, Tianlu; De Clercq, Nikki; Medina, Daniel A; Garre, Elena; Sunnerhagen, Per; Pérez-Ortín, José E; Alepuz, Paula
2016-02-01
The highly conserved Saccharomyces cerevisiae cap-binding protein Cbc1/Sto1 binds mRNA co-transcriptionally and acts as a key coordinator of mRNA fate. Recently, Cbc1 has also been implicated in transcription elongation and pre-initiation complex (PIC) formation. Previously, we described Cbc1 to be required for cell growth under osmotic stress and to mediate osmostress-induced translation reprogramming. Here, we observe delayed global transcription kinetics in cbc1Δ during osmotic stress that correlates with delayed recruitment of TBP and RNA polymerase II to osmo-induced promoters. Interestingly, we detect an interaction between Cbc1 and the MAPK Hog1, which controls most gene expression changes during osmostress, and observe that deletion of CBC1 delays the accumulation of the activator complex Hot1-Hog1 at osmostress promoters. Additionally, CBC1 deletion specifically reduces transcription rates of highly transcribed genes under non-stress conditions, such as ribosomal protein (RP) genes, while having low impact on transcription of weakly expressed genes. For RP genes, we show that recruitment of the specific activator Rap1, and subsequently TBP, to promoters is Cbc1-dependent. Altogether, our results indicate that binding of Cbc1 to the capped mRNAs is necessary for the accumulation of specific activators as well as PIC components at the promoters of genes whose expression requires high and rapid transcription. Copyright © 2016 Elsevier B.V. All rights reserved.
Properties of promoters cloned randomly from the Saccharomyces cerevisiae genome.
Santangelo, G M; Tornow, J; McLaughlin, C S; Moldave, K
1988-01-01
Promoters were isolated at random from the genome of Saccharomyces cerevisiae by using a plasmid that contains a divergently arrayed pair of promoterless reporter genes. A comprehensive library was constructed by inserting random (DNase I-generated) fragments into the intergenic region upstream from the reporter genes. Simple in vivo assays for either reporter gene product (alcohol dehydrogenase or beta-galactosidase) allowed the rapid identification of promoters from among these random fragments. Poly(dA-dT) homopolymer tracts were present in three of five randomly cloned promoters. With two exceptions, each RNA start site detected was 40 to 100 base pairs downstream from a TATA element. All of the randomly cloned promoters were capable of activating reporter gene transcription bidirectionally. Interestingly, one of the promoter fragments originated in a region of the S. cerevisiae rDNA spacer; regulated divergent transcription (presumably by RNA polymerase II) initiated in the same region. Images PMID:2847031
Means, A L; Slansky, J E; McMahon, S L; Knuth, M W; Farnham, P J
1992-03-01
The transcription rate of the dihydrofolate reductase (DHFR) gene increases at the G1/S boundary of the proliferative cell cycle. Through analysis of transiently and stably transfected NIH 3T3 cells, we have now demonstrated that DHFR promoter sequences extending from -270 to +20 are sufficient to confer similar regulation on a reporter gene. Mutation of a protein binding site that spans sequences from -16 to +11 in the DHFR promoter resulted in loss of the transcriptional increase at the G1/S boundary. Purification of an activity from HeLa nuclear extract that binds to this region enriched for a 180-kDa polypeptide (HIP1). Using this HIP1 preparation, we have identified specific positions within the binding site that are critical for efficient protein-DNA interactions. An analysis of association and dissociation rates suggests that bound HIP1 protein can exchange rapidly with free protein. This rapid exchange may facilitate the burst of transcriptional activity from the DHFR promoter at the G1/S boundary.
Means, A L; Slansky, J E; McMahon, S L; Knuth, M W; Farnham, P J
1992-01-01
The transcription rate of the dihydrofolate reductase (DHFR) gene increases at the G1/S boundary of the proliferative cell cycle. Through analysis of transiently and stably transfected NIH 3T3 cells, we have now demonstrated that DHFR promoter sequences extending from -270 to +20 are sufficient to confer similar regulation on a reporter gene. Mutation of a protein binding site that spans sequences from -16 to +11 in the DHFR promoter resulted in loss of the transcriptional increase at the G1/S boundary. Purification of an activity from HeLa nuclear extract that binds to this region enriched for a 180-kDa polypeptide (HIP1). Using this HIP1 preparation, we have identified specific positions within the binding site that are critical for efficient protein-DNA interactions. An analysis of association and dissociation rates suggests that bound HIP1 protein can exchange rapidly with free protein. This rapid exchange may facilitate the burst of transcriptional activity from the DHFR promoter at the G1/S boundary. Images PMID:1545788
Promoting gene expression in plants by permissive histone lysine methylation
Millar, Tony; Finnegan, E Jean
2009-01-01
Plants utilize sophisticated epigenetic regulatory mechanisms to coordinate changes in gene expression during development and in response to environmental stimuli. Epigenetics refers to the modification of DNA and chromatin associated proteins, which affect gene expression and cell function, without changing the DNA sequence. Such modifications are inherited through mitosis, and in rare instances through meiosis, although it can be reversible and thus regulatory. Epigenetic modifications are controlled by groups of proteins, such as the family of histone lysine methytransferases (HKMTs). The catalytic core known as the SET domain encodes HKMT activity and either promotes or represses gene expression. A large family of SET domain proteins is present in Arabidopsis where there is growing evidence that two classes of these genes are involved in promoting gene expression in a diverse range of developmental processes. This review will focus on the function of these two classes and the processes that they control, highlighting the huge potential this regulatory mechanism has in plants. PMID:19816124
Benferhat, Rima; Josse, Thibaut; Albaud, Benoit; Gentien, David; Mansuroglu, Zeyni; Marcato, Vasco; Souès, Sylvie; Le Bonniec, Bernard; Bouloy, Michèle; Bonnefoy, Eliette
2012-10-01
Rift Valley fever virus (RVFV) is a highly pathogenic Phlebovirus that infects humans and ruminants. Initially confined to Africa, RVFV has spread outside Africa and presently represents a high risk to other geographic regions. It is responsible for high fatality rates in sheep and cattle. In humans, RVFV can induce hepatitis, encephalitis, retinitis, or fatal hemorrhagic fever. The nonstructural NSs protein that is the major virulence factor is found in the nuclei of infected cells where it associates with cellular transcription factors and cofactors. In previous work, we have shown that NSs interacts with the promoter region of the beta interferon gene abnormally maintaining the promoter in a repressed state. In this work, we performed a genome-wide analysis of the interactions between NSs and the host genome using a genome-wide chromatin immunoprecipitation combined with promoter sequence microarray, the ChIP-on-chip technique. Several cellular promoter regions were identified as significantly interacting with NSs, and the establishment of NSs interactions with these regions was often found linked to deregulation of expression of the corresponding genes. Among annotated NSs-interacting genes were present not only genes regulating innate immunity and inflammation but also genes regulating cellular pathways that have not yet been identified as targeted by RVFV. Several of these pathways, such as cell adhesion, axonal guidance, development, and coagulation were closely related to RVFV-induced disorders. In particular, we show in this work that NSs targeted and modified the expression of genes coding for coagulation factors, demonstrating for the first time that this hemorrhagic virus impairs the host coagulation cascade at the transcriptional level.
Benferhat, Rima; Josse, Thibaut; Albaud, Benoit; Gentien, David; Mansuroglu, Zeyni; Marcato, Vasco; Souès, Sylvie; Le Bonniec, Bernard
2012-01-01
Rift Valley fever virus (RVFV) is a highly pathogenic Phlebovirus that infects humans and ruminants. Initially confined to Africa, RVFV has spread outside Africa and presently represents a high risk to other geographic regions. It is responsible for high fatality rates in sheep and cattle. In humans, RVFV can induce hepatitis, encephalitis, retinitis, or fatal hemorrhagic fever. The nonstructural NSs protein that is the major virulence factor is found in the nuclei of infected cells where it associates with cellular transcription factors and cofactors. In previous work, we have shown that NSs interacts with the promoter region of the beta interferon gene abnormally maintaining the promoter in a repressed state. In this work, we performed a genome-wide analysis of the interactions between NSs and the host genome using a genome-wide chromatin immunoprecipitation combined with promoter sequence microarray, the ChIP-on-chip technique. Several cellular promoter regions were identified as significantly interacting with NSs, and the establishment of NSs interactions with these regions was often found linked to deregulation of expression of the corresponding genes. Among annotated NSs-interacting genes were present not only genes regulating innate immunity and inflammation but also genes regulating cellular pathways that have not yet been identified as targeted by RVFV. Several of these pathways, such as cell adhesion, axonal guidance, development, and coagulation were closely related to RVFV-induced disorders. In particular, we show in this work that NSs targeted and modified the expression of genes coding for coagulation factors, demonstrating for the first time that this hemorrhagic virus impairs the host coagulation cascade at the transcriptional level. PMID:22896612
Schausi, Diane; Tiffoche, Christophe; Thieulant, Marie-Lise
2003-07-01
We have characterized the intronic promoter of the rat estrogen receptor (ER) alpha gene, responsible for the lactotrope-specific truncated ER product (TERP)-1 isoform expression. Transcriptional regulation was investigated by transient transfections using 5'-deletion constructs. TERP promoter constructs were highly active in MMQ cells, a pure lactotrope cell line, whereas a low basal activity was detected in alphaT3-1 gonadotrope cells or in COS-7 monkey kidney cells. Serial deletion analysis revealed that 1) a minimal -693-bp region encompassing the TATA box is sufficient to allow lactotrope-specific expression; 2) the promoter contains strong positive cis-acting elements both in the distal and proximal regions, and 3) the region spanning the -1698/-1194 region includes repressor elements. Transient transfection studies, EMSAs, and gel shifts demonstrated that estrogen activates the TERP promoter via an estrogen-responsive element (ERE1) located within the proximal region. Mutation of ERE1 site completely abolishes the estradiol-dependent transcription, indicating that ERE1 site is sufficient to confer estrogen responsiveness to TERP promoter. In addition, ERalpha action was synergized by transfection of the pituitary-specific factor Pit-1. EMSAs showed that a single Pit-1 DNA binding element in the vicinity of the TATA box is sufficient to confer response by the TERP promoter. In conclusion, we demonstrated, for the first time, that TERP promoter regulation involves ERE and Pit-1 cis-elements and corresponding trans-acting factors, which could play a role in the physiological changes that occur in TERP-1 transcription in lactotrope cells.
Enhancer activity of Helitron in sericin-1 gene promoter from Bombyx mori.
Huang, Ke; Li, Chun-Feng; Wu, Jie; Wei, Jun-Hong; Zou, Yong; Han, Min-Jin; Zhou, Ze-Yang
2016-06-01
Sericin is a kind of water-soluble protein expressed specifically in the middle silk gland of Bombyx mori. When the sericin-1 gene promoter was cloned and a transgenic vector was constructed to express a foreign protein, a specific Helitron, Bmhel-8, was identified in the sericin-1 gene promoter sequence in some genotypes of Bombyx mori and Bombyx mandarina. Given that the Bmhel-8 Helitron transposon was present only in some genotypes, it could be the source of allelic variation in the sericin-1 promoter. The length of the sericin-1 promoter sequence is approximately 1063 or 643 bp. The larger size of the sequence or allele is ascribed to the presence of Bmhel-8. Silkworm genotypes can be homozygous for either the shorter or larger promoter sequence or heterozygous, containing both alleles. Bmhel-8 in the sericin-1 promoter exhibits enhancer activity, as demonstrated by a dual-luciferase reporter system in BmE cell lines. Furthermore, Bmhel-8 displays enhancer activity in a sericin-1 promoter-driven gene expression system but does not regulate the tissue-specific expression of sericin-1. © 2016 Institute of Zoology, Chinese Academy of Sciences.
Zhou, Fei; Sun, Tian-Hu; Zhao, Lei; Pan, Xi-Wu; Lu, Shan
2015-01-01
The Artemisia annua L. β-pinene synthase QH6 was previously determined to be circadian-regulated at the transcriptional level, showing a rhythmic fluctuation of steady-state transcript abundances. Here we isolated both the genomic sequence and upstream promoter region of QH6. Different regulatory elements, such as G-box (TGACACGTGGCA, -421 bp from the translation initiation site) which might have effects on rhythmic gene expression, were found. Using the yeast one-hybrid and electrophoretic mobility shift assay (EMSA), we confirmed that the bZIP transcription factor HY5 binds to this motif of QH6. Studies with promoter truncations before and after this motif suggested that this G-box was important for the diurnal fluctuation of the transgenic β-glucuronidase gene (GUS) transcript abundance in Arabidopsis thaliana. GUS gene driven by the promoter region immediately after G-box showed an arrhythmic expression in both light/dark (LD) and constant dark (DD) conditions, whereas the control with G-box retained its fluctuation in both LD and DD. We further transformed A. thaliana with the luciferase gene (LUC) driven by an 1400 bp fragment upstream QH6 with its G-box intact or mutated, respectively. The luciferase activity assay showed that a peak in the early morning disappeared in the mutant. Gene expression analysis also demonstrated that the rhythmic expression of LUC was abolished in the hy5-1 mutant.
Sung, Shian-Ying; Chang, Junn-Liang; Chen, Kuan-Chou; Yeh, Shauh-Der; Liu, Yun-Ru; Su, Yen-Hao; Hsueh, Chia-Yen; Chung, Leland W K; Hsieh, Chia-Ling
2016-01-01
Stromal-epithelial interaction has been shown to promote local tumor growth and distant metastasis. We sought to create a promising gene therapy approach that co-targets cancer and its supporting stromal cells for combating castration-resistant prostate tumors. Herein, we demonstrated that human osteonectin is overexpressed in the prostate cancer epithelium and tumor stroma in comparison with their normal counterpart. We designed a novel human osteonectin promoter (hON-522E) containing positive transcriptional regulatory elements identified in both the promoter and exon 1 region of the human osteonectin gene. In vitro reporter assays revealed that the hON-522E promoter is highly active in androgen receptor negative and metastatic prostate cancer and bone stromal cells compared to androgen receptor-positive prostate cancer cells. Moreover, in vivo prostate-tumor-promoting activity of the hON-522E promoter was confirmed by intravenous administration of an adenoviral vector containing the hON-522E promoter-driven luciferase gene (Ad-522E-Luc) into mice bearing orthotopic human prostate tumor xenografts. In addition, an adenoviral vector with the hON-522E-promoter-driven herpes simplex virus thymidine kinase gene (Ad-522E-TK) was highly effective against the growth of androgen-independent human prostate cancer PC3M and bone stromal cell line in vitro and in pre-established PC3M tumors in vivo upon addition of the prodrug ganciclovir. Because of the heterogeneity of human prostate tumors, hON-522E promoter-mediated gene therapy has the potential for the treatment of hormone refractory and bone metastatic prostate cancers.
Duodenal Ulcer Promoting Gene of Helicobacter pylori
LU, HONG; HSU, PING–I; GRAHAM, DAVID Y.; YAMAOKA, YOSHIO
2011-01-01
Background & Aims Identification of a disease-specific H pylori virulence factors predictive of the outcome of infection remains unachieved. Methods We used the polymerase chain reaction and Southern blot to compare the presence of 14 vir homologue genes with clinical presentation of H pylori infection, mucosal histology, and mucosal interleukin (IL)-8 levels. Results We examined 500 H pylori strains from East Asia and South America, including 120 with gastritis, 140 with duodenal ulcer (DU), 110 with gastric ulcer (GU), and 130 with gastric cancer. Only 1 gene that encompassed both jhp0917 and jhp0918 called dupA (duodenal ulcer promoting gene) was associated with a specific clinical outcome. dupA was present in 42% of DU vs. 21% of gastritis (adjusted odds ratio [OR] = 3.1, 95% confidence interval [CI]: 1.7–5.7). Its presence was also associated with more intense antral neutrophil infiltration and IL-8 levels and was a marker for protection against gastric atrophy, intestinal metaplasia, and gastric cancer (OR for gastric cancer = 0.42, 95% CI: 0.2–0.9 compared with gastritis). In vitro studies in gastric epithelial cells using dupA-deleted and -complemented mutants showed that the dupA plays roles in IL-8 production, in activation of transcription factors responsible for IL-8 promoter activity, and in increased survivability at low pH. Conclusions dupA is a novel marker associated with an increased risk for DU and reduced risk for gastric atrophy and cancer. Its association with DU-promoting and -protective effects against atrophy/cancer was evident in both Asian and Western countries. PMID:15825067
Casimiro, Ana C; Vinga, Susana; Freitas, Ana T; Oliveira, Arlindo L
2008-02-07
Motif finding algorithms have developed in their ability to use computationally efficient methods to detect patterns in biological sequences. However the posterior classification of the output still suffers from some limitations, which makes it difficult to assess the biological significance of the motifs found. Previous work has highlighted the existence of positional bias of motifs in the DNA sequences, which might indicate not only that the pattern is important, but also provide hints of the positions where these patterns occur preferentially. We propose to integrate position uniformity tests and over-representation tests to improve the accuracy of the classification of motifs. Using artificial data, we have compared three different statistical tests (Chi-Square, Kolmogorov-Smirnov and a Chi-Square bootstrap) to assess whether a given motif occurs uniformly in the promoter region of a gene. Using the test that performed better in this dataset, we proceeded to study the positional distribution of several well known cis-regulatory elements, in the promoter sequences of different organisms (S. cerevisiae, H. sapiens, D. melanogaster, E. coli and several Dicotyledons plants). The results show that position conservation is relevant for the transcriptional machinery. We conclude that many biologically relevant motifs appear heterogeneously distributed in the promoter region of genes, and therefore, that non-uniformity is a good indicator of biological relevance and can be used to complement over-representation tests commonly used. In this article we present the results obtained for the S. cerevisiae data sets.
Role of promoter element in c-mpl gene expression induced by TPO.
Sunohara, Masataka; Morikawa, Shigeru; Fuse, Akira; Sato, Iwao
2013-01-01
Thrombopoietin (TPO) and its receptor, c-Mpl, play the crucial role for the development of megakaryocyte and considered to regulate megakaryocytopoiesis. Previously we reported that TPO increased the c-mpl promoter activity determined by a transient expression system using a vector containing the luciferase gene as a reporter and the expression of the c-mpl gene is modulated by transcription through a protein kinase C (PKC)-dependent pathway in the megakaryoblastic cells. In this research, to elucidate the required elements in c-mpl promoter, the promoter activity of the deletion constructs and site-directed mutagenesis were measured by a transient transfection assay system. Destruction of -77GATA in c-mpl promoter decreased the activity by 22.8%. Our study elucidated that -77GATA involved in TPO-induced c-mpl gene expression in a human megakaryoblastic cell line, CMK.
NASA Technical Reports Server (NTRS)
Stains, Joseph P.; Lecanda, Fernando; Screen, Joanne; Towler, Dwight A.; Civitelli, Roberto
2003-01-01
Loss-of-function mutations of gap junction proteins, connexins, represent a mechanism of disease in a variety of tissues. We have shown that recessive (gene deletion) or dominant (connexin45 overexpression) disruption of connexin43 function results in osteoblast dysfunction and abnormal expression of osteoblast genes, including down-regulation of osteocalcin transcription. To elucidate the molecular mechanisms of gap junction-sensitive transcriptional regulation, we systematically analyzed the rat osteocalcin promoter for sensitivity to gap junctional intercellular communication. We identified an Sp1/Sp3 containing complex that assembles on a minimal element in the -70 to -57 region of the osteocalcin promoter in a gap junction-dependent manner. This CT-rich connexin-response element is necessary and sufficient to confer gap junction sensitivity to the osteocalcin proximal promoter. Repression of osteocalcin transcription occurs as a result of displacement of the stimulatory Sp1 by the inhibitory Sp3 on the promoter when gap junctional communication is perturbed. Modulation of Sp1/Sp3 recruitment also occurs on the collagen Ialpha1 promoter and translates into gap junction-sensitive transcriptional control of collagen Ialpha1 gene expression. Thus, regulation of Sp1/Sp3 recruitment to the promoter may represent a potential general mechanism for transcriptional control of target genes by signals passing through gap junctions.
A Genetic Approach to Promoter Recognition during Trans Induction of Viral Gene Expression
NASA Astrophysics Data System (ADS)
Coen, Donald M.; Weinheimer, Steven P.; McKnight, Steven L.
1986-10-01
Viral infection of mammalian cells entails the regulated induction of viral gene expression. The induction of many viral genes, including the herpes simplex virus gene encoding thymidine kinase (tk), depends on viral regulatory proteins that act in trans. Because recognition of the tk promoter by cellular transcription factors is well understood, its trans induction by viral regulatory proteins may serve as a useful model for the regulation of eukaryotic gene expression. A comprehensive set of mutations was therefore introduced into the chromosome of herpes simplex virus at the tk promoter to directly analyze the effects of promoter mutations on tk transcription. The promoter domains required for efficient tk expression under conditions of trans induction corresponded to those important for recognition by cellular transcription factors. Thus, trans induction of tk expression may be catalyzed initially by the interaction of viral regulatory proteins with cellular transcription factors.
Baker, Katie; Bayer, Micha; Cook, Nicola; Dreißig, Steven; Dhillon, Taniya; Russell, Joanne; Hedley, Pete E; Morris, Jenny; Ramsay, Luke; Colas, Isabelle; Waugh, Robbie; Steffenson, Brian; Milne, Iain; Stephen, Gordon; Marshall, David; Flavell, Andrew J
2014-01-01
The low-recombining pericentromeric region of the barley genome contains roughly a quarter of the genes of the species, embedded in low-recombining DNA that is rich in repeats and repressive chromatin signatures. We have investigated the effects of pericentromeric region residency upon the expression, diversity and evolution of these genes. We observe no significant difference in average transcript level or developmental RNA specificity between the barley pericentromeric region and the rest of the genome. In contrast, all of the evolutionary parameters studied here show evidence of compromised gene evolution in this region. First, genes within the pericentromeric region of wild barley show reduced diversity and significantly weakened purifying selection compared with the rest of the genome. Second, gene duplicates (ohnolog pairs) derived from the cereal whole-genome duplication event ca. 60MYa have been completely eliminated from the barley pericentromeric region. Third, local gene duplication in the pericentromeric region is reduced by 29% relative to the rest of the genome. Thus, the pericentromeric region of barley is a permissive environment for gene expression but has restricted gene evolution in a sizeable fraction of barley's genes. PMID:24947331
Yu, Yihe; Xu, Weirong; Wang, Jie; Wang, Lei; Yao, Wenkong; Xu, Yan; Ding, Jiahua; Wang, Yuejin
2013-01-01
RING-finger proteins (RFP) function as ubiquitin ligases and play key roles in plant responses to biotic and abiotic stresses. However, little information is available on the regulation of RFP expression. Here, we isolate and characterize the RFP promoter sequence from the disease-resistant Chinese wild grape Vitis pseudoreticulata accession Baihe-35-1. Promoter-GUS fusion assays revealed that defense signaling molecules, powdery mildew infection, and heat stress induce VpRFP1 promoter activity. By contrast, the RFP1 promoter isolated from Vitis vinifera was only slightly induced by pathogen infection and heat treatment. By promoter deletion analysis, we found that the -148 bp region of the VpRFP1 promoter was the core functional promoter region. We also found that, in Arabidopsis, VpRFP1 expressed under its own promoter activated defense-related gene expression and improved disease resistance, but the same construct using the VvRFP1 promoter slightly improve disease resistance. Our results demonstrated that the -148 bp region of the VpRFP1 promoter plays a key role in response to pathogen and heat stress, and suggested that expression differences between VpRFP1 and VvRFP1 may be key for the differing disease resistance phenotypes of the two Vitis genotypes.
Calonge, María Julia; Seoane, Joan; Massagué, Joan
2004-05-28
A critical component of the epidermal basement membrane, collagen type VII, is produced by keratinocytes and fibroblasts, and its production is stimulated by the cytokine transforming growth factor-beta (TGF-beta). The gene, COL7A1, is activated by TGF-beta via Smad transcription factors in cooperation with AP1. Here we report a previously unsuspected level of complexity in this regulatory process. We provide evidence that TGF-beta may activate the COL7A1 promoter by two distinct inputs operating through a common region of the promoter. One input is provided by TGF-beta-induced Smad complexes via two Smad binding elements that function redundantly depending on the cell type. The second input is provided by relieving the COL7A1 promoter from chicken ovalbumin upstream promoter transcription factor (COUP-TF)-mediated transcriptional repression. We identified COUP-TFI and -TFII as factors that bind to the TGF-beta-responsive region of the COL7A1 promoter in an expression library screening. COUP-TFs bind to a site between the two Smad binding elements independently of Smad or AP1 and repress the basal and TGF-beta-stimulated activities of this promoter. We provide evidence that endogenous COUP-TF activity represses the COL7A1 promoter. Furthermore, we show that TGF-beta addition causes a rapid and profound down-regulation of COUP-TF expression in keratinocytes and fibroblasts. The results suggest that TGF-beta signaling may exert tight control over COL7A1 by offsetting the balance between opposing Smad and COUP-TFs.
Cancer cell specific cytotoxic gene expression mediated by ARF tumor suppressor promoter constructs
DOE Office of Scientific and Technical Information (OSTI.GOV)
Kurayoshi, Kenta; Ozono, Eiko; Iwanaga, Ritsuko
Highlights: • ARF promoter showed higher responsiveness to deregulated E2F activity than the E2F1 promoter. • ARF promoter showed higher cancer cell-specificity than E2F1 promoter to drive gene expression. • HSV-TK driven by ARF promoter showed higher cancer cell-specific cytotoxicity than that driven by E2F1 promoter. - Abstract: In current cancer treatment protocols, such as radiation and chemotherapy, side effects on normal cells are major obstacles to radical therapy. To avoid these side effects, a cancer cell-specific approach is needed. One way to specifically target cancer cells is to utilize a cancer specific promoter to express a cytotoxic gene (suicidemore » gene therapy) or a viral gene required for viral replication (oncolytic virotherapy). For this purpose, the selected promoter should have minimal activity in normal cells to avoid side effects, and high activity in a wide variety of cancers to obtain optimal therapeutic efficacy. In contrast to the AFP, CEA and PSA promoters, which have high activity only in a limited spectrum of tumors, the E2F1 promoter exhibits high activity in wide variety of cancers. This is based on the mechanism of carcinogenesis. Defects in the RB pathway and activation of the transcription factor E2F, the main target of the RB pathway, are observed in almost all cancers. Consequently, the E2F1 promoter, which is mainly regulated by E2F, has high activity in wide variety of cancers. However, E2F is also activated by growth stimulation in normal growing cells, suggesting that the E2F1 promoter may also be highly active in normal growing cells. In contrast, we found that the tumor suppressor ARF promoter is activated by deregulated E2F activity, induced by forced inactivation of pRB, but does not respond to physiological E2F activity induced by growth stimulation. We also found that the deregulated E2F activity, which activates the ARF promoter, is detected only in cancer cell lines. These observations suggest that ARF
Baker, S M; Masi, A; Liu, D F; Novitsky, B K; Deich, R A
1995-01-01
The gene products from an 8-kb region adjacent to the 3' end of the ptx operon are required by Bordetella pertussis for the export of pertussis holotoxin. At least one of these gene products (PtlC) is specifically required for the export of assembled holotoxin from the periplasmic space. ptlC mutants exhibit a 20-fold reduction in the amount of holotoxin present in the culture supernatant but have no effect upon the assembly or steady-state level of holotoxin present in the periplasmic space. Impaired export of holotoxin from the ptlC strain blocks expression of toxin at a posttranscriptional level, and wild-type levels of ptx mRNA are detected in the mutant strain. The transcription of ptl is subject to modulation by MgSO4 in the same manner as ptx is; however, in B. pertussis strains containing an E. coli tac promoter in place of the native ptx promoter, wild-type levels of ptx mRNA are present and holotoxin is synthesized and exported even in the presence of MgSO4. Promoter mapping of the region extending from the ptxS3 coding region to the ptlC coding region failed to detect the ptl transcription initiation site. Additional RNase protection experiments with ptx promoter deletion and substitution strains indicate that the ptl operon is transcribed from the ptx promoter as part of a > 11-kb mRNA. PMID:7558300
Sequences 5' to translation start regulate expression of petunia rbcS genes.
Dean, C; Favreau, M; Bedbrook, J; Dunsmuir, P
1989-01-01
The promoter sequences that contribute to quantitative differences in expression of the petunia genes (rbcS) encoding the small subunit of ribulose bisphosphate carboxylase have been characterized. The promoter regions of the two most abundantly expressed petunia rbcS genes, SSU301 and SSU611, show sequence similarity not present in other rbcS genes. We investigated the significance of these and other sequences by adding specific regions from the SSU301 promoter (the most strongly expressed gene) to equivalent regions in the SSU911 promoter (the least strongly expressed gene) and assaying the expression of the fusions in transgenic tobacco plants. In this way, we characterized an SSU301 promoter region (either from -285 to -178 or -291 to -204) which, when added to SSU911, in either orientation, increased SSU911 expression 25-fold. This increase was equivalent to that caused by addition of the entire SSU301 5'-flanking region. Replacement of SSU911 promoter sequences between -198 and the start codon with sequences from the equivalent region of SSU301 did not increase SSU911 expression significantly. The -291 to -204 SSU301 promoter fragment contributes significantly to quantitative differences in expression between the petunia rbcS genes. PMID:2535543
Analysis of the regulatory region of the protease III (ptr) gene of Escherichia coli K-12.
Claverie-Martin, F; Diaz-Torres, M R; Kushner, S R
1987-01-01
The ptr gene of Escherichia coli encodes protease III (Mr 110,000) and a 50-kDa polypeptide, both of which are found in the periplasmic space. The gene is physically located between the recC and recB loci on the E. coli chromosome. The nucleotide sequence of a 1167-bp EcoRV-ClaI fragment of chromosomal DNA containing the promoter region and 885 bp of the ptr coding sequence has been determined. S1 nuclease mapping analysis showed that the major 5' end of the ptr mRNA was localized 127 bp upstream from the ATG start codon. The open reading frame (ORF), preceded by a Shine-Dalgarno sequence, extends to the end of the sequenced DNA. Downstream from the -35 and -10 regions is a sequence that strongly fits the consensus sequence of known nitrogen-regulated promoters. A signal peptide of 23 amino acids residues is present at the N terminus of the derived amino acid sequence. The cleavage site as well as the ORF were confirmed by sequencing the N terminus of mature protease III.
A synthetic promoter library for constitutive gene expression in Lactobacillus plantarum.
Rud, Ida; Jensen, Peter Ruhdal; Naterstad, Kristine; Axelsson, Lars
2006-04-01
A synthetic promoter library (SPL) for Lactobacillus plantarum has been developed, which generalizes the approach for obtaining synthetic promoters. The consensus sequence, derived from rRNA promoters extracted from the L. plantarum WCFS1 genome, was kept constant, and the non-consensus sequences were randomized. Construction of the SPL was performed in a vector (pSIP409) previously developed for high-level, inducible gene expression in L. plantarum and Lactobacillus sakei. A wide range of promoter strengths was obtained with the approach, covering 3-4 logs of expression levels in small increments of activity. The SPL was evaluated for the ability to drive beta-glucuronidase (GusA) and aminopeptidase N (PepN) expression. Protein production from the synthetic promoters was constitutive, and the most potent promoters gave high protein production with levels comparable to those of native rRNA promoters, and production of PepN protein corresponding to approximately 10-15 % of the total cellular protein. High correlation was obtained between the activities of promoters when tested in L. sakei and L. plantarum, which indicates the potential of the SPL for other Lactobacillus species. The SPL enables fine-tuning of stable gene expression for various applications in L. plantarum.
Amador, A; Papaceit, M; Juan, E
2001-06-01
The Adh locus of Drosophilidae is organized as a single gene transcribed from two spatially and temporally regulated promoters except in species of the repleta group, which have two single promoter genes. Here we show that in Drosophila funebris the Adh gene is transcribed from a single promoter, in both larva and adult, with qualitative and quantitative species specific-differences in tissue distribution. The gene is expressed in larval fat body but in other tissues such as gastric caeca, midgut and Malpighian tubules its expression is reduced compared to most Drosophilidae species, and in adults it is almost limited to the fat body. The comparative analysis of gene expression of two strains, which differ by a duplication, indicates that the cis elements necessary for this pattern of expression in larvae are included in the region of 1.55 kb upstream of the transcription initiation site. This new organization reveals the evolution of a different regulatory strategy to express the Adh gene in the subgenus Drosophila.
Almarza, Elena; Río, Paula; Meza, Nestor W; Aldea, Montserrat; Agirre, Xabier; Guenechea, Guillermo; Segovia, José C; Bueren, Juan A
2007-08-01
Recent published data have shown the efficacy of gene therapy treatments of certain monogenic diseases. Risks of insertional oncogenesis, however, indicate the necessity of developing new vectors with weaker or cell-restricted promoters to minimize the trans-activation activity of integrated proviruses. We have inserted the proximal promoter of the vav proto-oncogene into self-inactivating lentiviral vectors (vav-LVs) and investigated the expression pattern and therapeutic efficacy of these vectors. Compared with other LVs frequently used in gene therapy, vav-LVs mediated a weak, though homogeneous and stable, expression in in vitro-cultured cells. Transplantation experiments using transduced mouse bone marrow and human CD34(+) cells confirmed the stable activity of the promoter in vivo. To investigate whether the weak activity of this promoter was compatible with a therapeutic effect, a LV expressing the Fanconi anemia A (FANCA) gene was constructed (vav-FANCA LV). Although this vector induced a low expression of FANCA, compared to the expression induced by a LV harboring the spleen focus-forming virus (SFFV) promoter, the two vectors corrected the phenotype of cells from a patient with FA-A with the same efficacy. We propose that self-inactivating vectors harboring weak promoters, such as the vav promoter, will improve the safety of gene therapy and will be of particular interest for the treatment of diseases where a high expression of the transgene is not required.
Wei, Dawei; Raza, Sayed Haidar Abbas; Zhang, Jiupan; Gui, Linsheng; Rahman, Siddiq Ur; Khan, Rajwali; Hosseini, Seyed Mahdi; Kaleri, Hubdar Ali; Zan, Linsen
2018-05-20
The sine oculis homeobox homolog 4 (SIX4) gene belongs to the SIX gene family, which plays a critical role in muscle regeneration and early stages of ontogeny. This study aimed to detect promoter variations of bovine SIX4 genes in Qinchuan cattle, and to evaluate the effect of transcription regulations and body measurement traits. Quantitative real-time PCR (qPCR) results showed that the mRNA expression levels of SIX4 gene were found significantly highest in longissimus thoracis tissue and individual before attaining the stage of physiological maturity. Using sequencing technology on a total of 428 Qinchuan cattle, seven single nucleotide polymorphisms (SNPs) were identified in the promoter region of SIX4, and seven haplotypes representing 18 potential transcription factor compositions of polymorphic potential cis-acting elements. Association analysis indicated that the H 3 -H 3 diplotype performed greater withers height, chest depth, chest circumference, back fat thickness and ultrasound loin muscle area (P < 0.05) than H 5 -H 6 , which were consistent with the promoter activity of Hap3 haplotype was higher than the Hap5 and Hap6 haplotype in vitro. These potential transcription factor information and combined genotypes H 3 -H 3 of the SIX4 gene can be used as a molecular marker for selection of economic traits in Qinchuan cattle. Copyright © 2018 Elsevier B.V. All rights reserved.
Kolpakova, E; Frengen, E; Stokke, T; Olsnes, S
2000-01-01
Acidic fibroblast growth factor (aFGF) intracellular binding protein (FIBP) is a protein found mainly in the nucleus that might be involved in the intracellular function of aFGF. Here we present a comparative analysis of the deduced amino acid sequences of human, murine and Drosophila FIBP analogues and demonstrate that FIBP is an evolutionarily conserved protein. The human gene spans more than 5 kb, comprising ten exons and nine introns, and maps to chromosome 11q13.1. Two slightly different splice variants found in different tissues were isolated and characterized. Sequence analysis of the region surrounding the translation start revealed a CpG island, a classical feature of widely expressed genes. Functional studies of the promoter region with a luciferase reporter system suggested a strong transcriptional activity residing within 600 bp of the 5' flanking region. PMID:11104667
Genome-wide characterization of mammalian promoters with distal enhancer functions.
Dao, Lan T M; Galindo-Albarrán, Ariel O; Castro-Mondragon, Jaime A; Andrieu-Soler, Charlotte; Medina-Rivera, Alejandra; Souaid, Charbel; Charbonnier, Guillaume; Griffon, Aurélien; Vanhille, Laurent; Stephen, Tharshana; Alomairi, Jaafar; Martin, David; Torres, Magali; Fernandez, Nicolas; Soler, Eric; van Helden, Jacques; Puthier, Denis; Spicuglia, Salvatore
2017-07-01
Gene expression in mammals is precisely regulated by the combination of promoters and gene-distal regulatory regions, known as enhancers. Several studies have suggested that some promoters might have enhancer functions. However, the extent of this type of promoters and whether they actually function to regulate the expression of distal genes have remained elusive. Here, by exploiting a high-throughput enhancer reporter assay, we unravel a set of mammalian promoters displaying enhancer activity. These promoters have distinct genomic and epigenomic features and frequently interact with other gene promoters. Extensive CRISPR-Cas9 genomic manipulation demonstrated the involvement of these promoters in the cis regulation of expression of distal genes in their natural loci. Our results have important implications for the understanding of complex gene regulation in normal development and disease.
Brown, Sherine; Ordovás, José M; Campos, Hannia
2003-10-01
To test the hypothesis that APOC3 gene polymorphisms modulate the effect of saturated fat (SAT) intake on plasma lipoproteins and LDL size. We studied 336 randomly selected residents from Costa Rica. APOC3 polymorphisms were genotyped in the promoter region (T-455C, T-625del) and the C3238G 3' untranslated region (UTR). Dietary intake was assessed by a validated food-frequency questionnaire (FFQ) and median saturated fat intake (11%) was used to define low and high exposure to saturated fat. Allele frequencies were 0.49, 0.51 and 0.19 for the APOC3-455C, -625de1, and APOC3 3238G alleles, respectively. Significant gene-diet interactions were found for total (P<0.0004) and LDL cholesterol (P<0.01). In homozygotes for the APOC3-455T-625T alleles, saturated fat intake was associated with a 13% increase in total cholesterol (P<0.001) and a 20% increase in LDL cholesterol (P<0.001). In contrast, no association between plasma lipoproteins and saturated fat intake was found among carriers of the APOC3-455C-625del allele. The APOC3 3238G UTR allele did not modify the observed association. Compared to a diet high in saturated fat, a habitually low saturated fat diet is associated with a beneficial lipoprotein profile only among homozygotes of the APOC3 promoter 455T-625T polymorphism.
Promoter-Terminator Gene Loops Affect Alternative 3'-End Processing in Yeast.
Lamas-Maceiras, Mónica; Singh, Badri Nath; Hampsey, Michael; Freire-Picos, María A
2016-04-22
Many eukaryotic genes undergo alternative 3'-end poly(A)-site selection producing transcript isoforms with 3'-UTRs of different lengths and post-transcriptional fates. Gene loops are dynamic structures that juxtapose the 3'-ends of genes with their promoters. Several functions have been attributed to looping, including memory of recent transcriptional activity and polarity of transcription initiation. In this study, we investigated the relationship between gene loops and alternative poly(A)-site. Using the KlCYC1 gene of the yeast Kluyveromyces lactis, which includes a single promoter and two poly(A) sites separated by 394 nucleotides, we demonstrate in two yeast species the formation of alternative gene loops (L1 and L2) that juxtapose the KlCYC1 promoter with either proximal or distal 3'-end processing sites, resulting in the synthesis of short and long forms of KlCYC1 mRNA. Furthermore, synthesis of short and long mRNAs and formation of the L1 and L2 loops are growth phase-dependent. Chromatin immunoprecipitation experiments revealed that the Ssu72 RNA polymerase II carboxyl-terminal domain phosphatase, a critical determinant of looping, peaks in early log phase at the proximal poly(A) site, but as growth phase advances, it extends to the distal site. These results define a cause-and-effect relationship between gene loops and alternative poly(A) site selection that responds to different physiological signals manifested by RNA polymerase II carboxyl-terminal domain phosphorylation status. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.
Engineered promoters enable constant gene expression at any copy number in bacteria.
Segall-Shapiro, Thomas H; Sontag, Eduardo D; Voigt, Christopher A
2018-04-01
The internal environment of growing cells is variable and dynamic, making it difficult to introduce reliable parts, such as promoters, for genetic engineering. Here, we applied control-theoretic ideas to design promoters that maintained constant levels of expression at any copy number. Theory predicts that independence to copy number can be achieved by using an incoherent feedforward loop (iFFL) if the negative regulation is perfectly non-cooperative. We engineered iFFLs into Escherichia coli promoters using transcription-activator-like effectors (TALEs). These promoters had near-identical expression in different genome locations and plasmids, even when their copy number was perturbed by genomic mutations or changes in growth medium composition. We applied the stabilized promoters to show that a three-gene metabolic pathway to produce deoxychromoviridans could retain function without re-tuning when the stabilized-promoter-driven genes were moved from a plasmid into the genome.
Promoter methylation assay of SASH1 gene in hepatocellular carcinoma.
Peng, Liu; Wei, He; Liren, Li
2014-01-01
To analyse the relationship between the expression of SASH1 and its methylation level in human hepatocellular carcinoma. Expression levels of SASH1 were examined with real-time PCR (RT-PCR) in tissues and cells, and methylation analysis was performed with MassArray. The expression levels of SASH1 were strongly reduced in liver cancer tissues compared with adjacent normal tissues. Quantitative methylation analysis by MassArray revealed different CpG sites in SASH1 promoter shared similar methylation pattern between liver cancer tissues and adjacent normal tissues and the CpG sites of significant difference in methylation level were found as follows: CpG_3, CpG_17, CpG_21.22, CpG_25, CpG_26.27, CpG_28, CpG_34.35.36 and CpG_51.52. Moreover, 5-aza-2'-deoxycytidine treatment of Hep-G2 cell line caused significant elevation of SASH1 mRNA. Based on these data, we propose that increase of DNA methylation degree in the promoter region of SASH1 gene, particularly CpG_26.27 sites, possibly repressed SASH1 expression in liver cancer.
Dai, Yuanyuan; Chang, Wenjiao; Zhao, Changcheng; Peng, Jing; Xu, Liangfei; Lu, Huaiwei; Zhou, Shusheng; Ma, Xiaoling
2017-05-01
Acquisition of vancomycin resistance in Staphylococcus aureus is often accompanied by a reduction in virulence, but the mechanisms underlying this change remain unclear. The present study was undertaken to investigate this process in a clinical heterogeneous vancomycin-intermediate S. aureus (hVISA) strain, 10827; an hVISA reference strain, Mu3; and a VISA reference strain, Mu50, along with their respective series of vancomycin-induced resistant strains. In these strains, increasing MICs of vancomycin were associated with increased expression of the vancomycin resistance-associated regulator gene ( vraR ) and decreased expression of virulence genes ( hla , hlb , and coa ) and virulence-regulated genes (RNAIII, agrA , and saeR ). These results suggested that VraR might have a direct or indirect effect on virulence in S. aureus In electrophoretic mobility shift assays, VraR did not bind to promoter sequences of hla , hlb , and coa genes, but it did bind to the agr promoter region. In DNase I footprinting assays, VraR protected a 15-nucleotide (nt) sequence in the intergenic region between the agr P2 and P3 promoters. These results indicated that when S. aureus is subject to induction by vancomycin, expression of vraR is upregulated, and VraR binding inhibits the function of the Agr quorum-sensing system, causing reductions in the virulence of VISA/hVISA strains. Our results suggested that VraR in S. aureus is involved not only in the regulation of vancomycin resistance but also in the regulation of virulence. Copyright © 2017 American Society for Microbiology.
Saveliev, Alexei; Zhu, Fan; Yuan, Yan
2002-08-01
Viral immediate-early (IE) genes are the first class of viral genes expressed during primary infection or reactivation from latency. They usually encode regulatory proteins that play crucial roles in viral life cycle. In a previous study, four regions in the KSHV genome were found to be actively transcribed in the immediate-early stage of viral reactivation in primary effusion lymphoma cells. Three immediate-early transcripts were characterized in these regions, as follows: mRNAs for ORF50 (KIE-1), ORF-45 (KIE-2), and ORF K4.2 (KIE-3) (F. X. Zhu, T. Cusano, and Y. Yuan, 1999, J. Virol. 73, 5556-5567). In the present study, we further analyzed the expression of genes in these IE regions in BC-1 and BCBL-1 cells. One of the immediate-early regions (KIE-1) that encompasses ORF50 and other genes was intensively studied to establish a detailed transcription map and expression patterns of genes in this region. This study led to identification of several novel IE transcripts in this region. They include a 2.6-kb mRNA which encodes ORF48/ORF29b, a family of transcripts that are complementary to ORF50 mRNA and a novel K8 IE mRNA of 1.5 kb. Together with the IE mRNA for ORF50 which was identified previously, four immediate-early genes have been mapped to KIE-1 region. Therefore, we would designate KIE-1 the major immediate-early region of KSHV. In addition, we showed that transcription of K8 gene is controlled by two promoters, yielding two transcripts, an immediate-early mRNA of 1.5 kb and a delayed-early mRNA of 1.3 kb.
Promoter architecture dictates cell-to-cell variability in gene expression.
Jones, Daniel L; Brewster, Robert C; Phillips, Rob
2014-12-19
Variability in gene expression among genetically identical cells has emerged as a central preoccupation in the study of gene regulation; however, a divide exists between the predictions of molecular models of prokaryotic transcriptional regulation and genome-wide experimental studies suggesting that this variability is indifferent to the underlying regulatory architecture. We constructed a set of promoters in Escherichia coli in which promoter strength, transcription factor binding strength, and transcription factor copy numbers are systematically varied, and used messenger RNA (mRNA) fluorescence in situ hybridization to observe how these changes affected variability in gene expression. Our parameter-free models predicted the observed variability; hence, the molecular details of transcription dictate variability in mRNA expression, and transcriptional noise is specifically tunable and thus represents an evolutionarily accessible phenotypic parameter. Copyright © 2014, American Association for the Advancement of Science.
Genome-wide analysis of promoter architecture in Drosophila melanogaster
DOE Office of Scientific and Technical Information (OSTI.GOV)
Hoskins, Roger A.; Landolin, Jane M.; Brown, James B.
2010-10-20
Core promoters are critical regions for gene regulation in higher eukaryotes. However, the boundaries of promoter regions, the relative rates of initiation at the transcription start sites (TSSs) distributed within them, and the functional significance of promoter architecture remain poorly understood. We produced a high-resolution map of promoters active in the Drosophila melanogaster embryo by integrating data from three independent and complementary methods: 21 million cap analysis of gene expression (CAGE) tags, 1.2 million RNA ligase mediated rapid amplification of cDNA ends (RLMRACE) reads, and 50,000 cap-trapped expressed sequence tags (ESTs). We defined 12,454 promoters of 8037 genes. Our analysismore » indicates that, due to non-promoter-associated RNA background signal, previous studies have likely overestimated the number of promoter-associated CAGE clusters by fivefold. We show that TSS distributions form a complex continuum of shapes, and that promoters active in the embryo and adult have highly similar shapes in 95% of cases. This suggests that these distributions are generally determined by static elements such as local DNA sequence and are not modulated by dynamic signals such as histone modifications. Transcription factor binding motifs are differentially enriched as a function of promoter shape, and peaked promoter shape is correlated with both temporal and spatial regulation of gene expression. Our results contribute to the emerging view that core promoters are functionally diverse and control patterning of gene expression in Drosophila and mammals.« less
Cicatiello, Luigi; Addeo, Raffaele; Sasso, Annarita; Altucci, Lucia; Petrizzi, Valeria Belsito; Borgo, Raphaelle; Cancemi, Massimo; Caporali, Simona; Caristi, Silvana; Scafoglio, Claudio; Teti, Diana; Bresciani, Francesco; Perillo, Bruno; Weisz, Alessandro
2004-01-01
Transcriptional activation of the cyclin D1 gene (CCND1) plays a pivotal role in G1-phase progression, which is thereby controlled by multiple regulatory factors, including nuclear receptors (NRs). Appropriate CCND1 gene activity is essential for normal development and physiology of the mammary gland, where it is regulated by ovarian steroids through a mechanism(s) that is not fully elucidated. We report here that CCND1 promoter activation by estrogens in human breast cancer cells is mediated by recruitment of a c-Jun/c-Fos/estrogen receptor α complex to the tetradecanoyl phorbol acetate-responsive element of the gene, together with Oct-1 to a site immediately adjacent. This process coincides with the release from the same DNA region of a transcriptional repressor complex including Yin-Yang 1 (YY1) and histone deacetylase 1 and is sufficient to induce the assembly of the basal transcription machinery on the promoter and to lead to initial cyclin D1 accumulation in the cell. Later on in estrogen stimulation, the cyclin D1/Cdk4 holoenzyme associates with the CCND1 promoter, where E2F and pRb can also be found, contributing to the long-lasting gene enhancement required to drive G1-phase completion. Interestingly, progesterone triggers similar regulatory events through its own NRs, suggesting that the gene regulation cascade described here represents a crossroad for the transcriptional control of G1-phase progression by different classes of NRs. PMID:15282324
Identification of a p53-response element in the promoter of the proline oxidase gene
DOE Office of Scientific and Technical Information (OSTI.GOV)
Maxwell, Steve A.; Kochevar, Gerald J.
2008-05-02
Proline oxidase (POX) is a p53-induced proapoptotic gene. We investigated whether p53 could bind directly to the POX gene promoter. Chromatin immunoprecipitation (ChIP) assays detected p53 bound to POX upstream gene sequences. In support of the ChIP results, sequence analysis of the POX gene and its 5' flanking sequences revealed a potential p53-binding site, GGGCTTGTCTTCGTGTGACTTCTGTCT, located at 1161 base pairs (bp) upstream of the transcriptional start site. A 711-bp DNA fragment containing the candidate p53-binding site exhibited reporter gene activity that was induced by p53. In contrast, the same DNA region lacking the candidate p53-binding site did not show significantmore » p53-response activity. Electrophoretic mobility shift assay (EMSA) in ACHN renal carcinoma cell nuclear lysates confirmed that p53 could bind to the 711-bp POX DNA fragment. We concluded from these experiments that a p53-binding site is positioned at -1161 to -1188 bp upstream of the POX transcriptional start site.« less
Mutations in the Promoter Region of the Aldolase B Gene that cause Hereditary Fructose Intolerance
Coffee, Erin M.; Tolan, Dean R.
2010-01-01
SUMMARY Hereditary fructose intolerance (HFI) is a potentially fatal inherited metabolic disease caused by a deficiency of aldolase B activity in the liver and kidney. Over 40 disease-causing mutations are known in the protein-coding region of ALDOB. Mutations upstream of the protein-coding portion of ALDOB are reported here for the first time. DNA sequence analysis of 61 HFI patients revealed single base mutations in the promoter, intronic enhancer, and the first exon, which is entirely untranslated. One mutation, g.–132G>A, is located within the promoter at an evolutionarily conserved nucleotide within a transcription factor-binding site. A second mutation, IVS1+1G>C, is at the donor splice site of the first exon. In vitro electrophoretic mobility shift assays show a decrease in nuclear extract-protein binding at the g.–132G>A mutant site. The promoter mutation results in decreased transcription using luciferase reporter plasmids. Analysis of cDNA from cells transfected with plasmids harboring the IVS1+1G>C mutation results in aberrant splicing leading to complete retention of the first intron (~ 5 kb). The IVS1+1G>C splicing mutation results in loss of luciferase activity from a reporter plasmid. These novel mutations in ALDOB represent 2% of alleles in American HFI patients, with IVS1+1G>C representing a significantly higher allele frequency (6%) among HFI patients of Hispanic and African-American ethnicity. PMID:20882353
[Prediction of Promoter Motifs in Virophages].
Gong, Chaowen; Zhou, Xuewen; Pan, Yingjie; Wang, Yongjie
2015-07-01
Virophages have crucial roles in ecosystems and are the transport vectors of genetic materials. To shed light on regulation and control mechanisms in virophage--host systems as well as evolution between virophages and their hosts, the promoter motifs of virophages were predicted on the upstream regions of start codons using an analytical tool for prediction of promoter motifs: Multiple EM for Motif Elicitation. Seventeen potential promoter motifs were identified based on the E-value, location, number and length of promoters in genomes. Sputnik and zamilon motif 2 with AT-rich regions were distributed widely on genomes, suggesting that these motifs may be associated with regulation of the expression of various genes. Motifs containing the TCTA box were predicted to be late promoter motif in mavirus; motifs containing the ATCT box were the potential late promoter motif in the Ace Lake mavirus . AT-rich regions were identified on motif 2 in the Organic Lake virophage, motif 3 in Yellowstone Lake virophage (YSLV)1 and 2, motif 1 in YSLV3, and motif 1 and 2 in YSLV4, respectively. AT-rich regions were distributed widely on the genomes of virophages. All of these motifs may be promoter motifs of virophages. Our results provide insights into further exploration of temporal expression of genes in virophages as well as associations between virophages and giant viruses.
Finkova, Alena; Vazna, Alzbeta; Hrachovina, Ondrej; Bendova, Sarka; Prochazkova, Kamila; Sedlacek, Zdenek
2009-08-01
Germline TP53 mutations are found in only 70% of families with the Li-Fraumeni syndrome (LFS), and with an even lower frequency in families suggestive of LFS but not meeting clinical criteria of the syndrome. Despite intense efforts, to date, no other genes have been associated with the disorder in a significant number of TP53 mutation-negative families. A search for defects in TP53 other than heterozygous missense mutations showed that neither intron variants nor sequence variants in the TP53 promoter are frequent in LFS, and multiexon deletions have been found to be responsible for LFS only in several cases. Another cancer predisposition syndrome, hereditary non-polyposis colon cancer, has been associated with epigenetic silencing of one allele of the MLH1 or MSH2 genes. This prompted us to test the methylation of the TP53 gene promoter in a set of 14 families suggestive of LFS using bisulphite sequencing of three DNA fragments from the 5' region of the gene. We found no detectable methylation at any of the CG dinucleotides tested. Thus, epigenetic silencing of the TP53 promoter is not a frequent cause of the disorder in families suggestive of LFS but with no germline mutations in the coding part of the gene.
Zhao, Wenchao; Wang, Shaohui; Li, Xin; Huang, Hongyu; Sui, Xiaolei; Zhang, Zhenxian
2012-08-01
Ginger (Zingiber officinale Rosc.) is prone to photoinhibition under intense sunlight. Excessive light can be dissipated by the xanthophyll cycle, where violaxanthin de-epoxidase (VDE) plays a critical role in protecting the photosynthesis apparatus from the damage of excessive light. We isolated ~2.0 kb of ginger VDE (GVDE) gene promoter, which contained the circadian box, I-box, G-box and GT-1 motif. Histochemical staining of Arabidopsis indicated the GVDE promoter was active in almost all organs, especially green tissues. β-glucuronidase (GUS) activity driven by GVDE promoter was repressed rather than activated by high light. GUS activity was altered by hormones, growth regulators and abiotic stresses, which increased with 2,4-dichlorophenoxyacetic acid and decreased with abscisic acid, salicylic acid, zeatin, salt (sodium chloride) and polyethylene glycol. Interestingly, GUS activities with gibberellin or indole-3-acetic acid increased in the short-term (24 h) and decreased in the long-term (48 and 72 h). Analysis of 5' flank deletion found two crucial functional regions residing in -679 to -833 and -63 to -210. Northern blotting analysis found transcription to be regulated by the endogenous circadian clock. Finally, we found a region necessary for regulating the circadian rhythm and another for the basic promoter activity. Key message A novel promoter, named GVDE promoter, was first isolated and analyzed in this study. We have determined one region crucial for promoter activity and another responsible for keeping circadian rhythms.
Grunseich, Christopher; Wang, Isabel X; Watts, Jason A; Burdick, Joshua T; Guber, Robert D; Zhu, Zhengwei; Bruzel, Alan; Lanman, Tyler; Chen, Kelian; Schindler, Alice B; Edwards, Nancy; Ray-Chaudhury, Abhik; Yao, Jianhua; Lehky, Tanya; Piszczek, Grzegorz; Crain, Barbara; Fischbeck, Kenneth H; Cheung, Vivian G
2018-02-01
R-loops are three-stranded nucleic acid structures found abundantly and yet often viewed as by-products of transcription. Studying cells from patients with a motor neuron disease (amyotrophic lateral sclerosis 4 [ALS4]) caused by a mutation in senataxin, we uncovered how R-loops promote transcription. In ALS4 patients, the senataxin mutation depletes R-loops with a consequent effect on gene expression. With fewer R-loops in ALS4 cells, the expression of BAMBI, a negative regulator of transforming growth factor β (TGF-β), is reduced; that then leads to the activation of the TGF-β pathway. We uncovered that genome-wide R-loops influence promoter methylation of over 1,200 human genes. DNA methyl-transferase 1 favors binding to double-stranded DNA over R-loops. Thus, in forming R-loops, nascent RNA blocks DNA methylation and promotes further transcription. Hence, our results show that nucleic acid structures, in addition to sequences, influence the binding and activity of regulatory proteins. Copyright © 2017 Elsevier Inc. All rights reserved.
Rhee, Sun-Ju; Jang, Yoon Jeong; Lee, Gung Pyo
2016-06-01
Heterologous gene expression using plant virus vectors enables research on host-virus interactions and the production of useful proteins, but the host range of plant viruses limits the practical applications of such vectors. Here, we aimed to develop a viral vector based on cucumber fruit mottle mosaic virus (CFMMV), a member of the genus Tobamovirus, whose members infect cucurbits. The subgenomic promoter (SGP) in the coat protein (CP) gene, which was used to drive heterologous expression, was mapped by analyzing deletion mutants from a CaMV 35S promoter-driven infectious CFMMV clone. The region from nucleotides (nt) -55 to +160 relative to the start codon of the open reading frame (ORF) of CP was found to be a fully active promoter, and the region from nt -55 to +100 was identified as the active core promoter. Based on these SGPs, we constructed a cloning site in the CFMMV vector and successfully expressed enhanced green fluorescent protein (EGFP) in Nicotiana benthamiana and watermelon (Citrullus lanatus). Co-inoculation with the P19 suppressor increased EGFP expression and viral replication by blocking degradation of the viral genome. Our CFMMV vector will be useful as an expression vector in cucurbits.
Matsutani, Sachiko
2004-08-09
In eukaryotes, RNA polymerase III (RNAP III) transcribes the genes for small RNAs like tRNAs, 5S rRNA, and several viral RNAs, and short interspersed repetitive elements (SINEs). The genes for these RNAs and SINEs have internal promoters that consist of two regions. These two regions are called the A and B blocks. The multisubunit transcription factor TFIIIC is required for transcription initiation of RNAP III; in transcription of tRNAs, the B-block binding subunit of TFIIIC recognizes a promoter. Although internal promoter sequences are conserved in eukaryotes, no evidence of homology between the B-block binding subunits of vertebrates and yeasts has been reported previously. Here, I reported the results of PSI-BLAST searches using the B-block binding subunits of human and Shizosacchromyces pombe as queries, showing that the same Arabidopsis proteins were hit with low E-values in both searches. Comparison of the convergent iterative alignments obtained by these PSI-BLAST searches revealed that the vertebrate, yeast, and Arabidopsis proteins have similarities in their N-terminal one-third regions. In these regions, there were three domains with conserved sequence similarities, one located in the N-terminal end region. The N-terminal end region of the B-block binding subunit of Saccharomyces cerevisiae is tentatively identified as a HMG box, which is the DNA binding motif. Although I compared the alignment of the N-terminal end regions of the B-block binding subunits, and their homologs, with that of the HMG boxes, it is not clear whether they are related. Molecular phylogenetic analyses using the small subunit rRNA and ubiquitous proteins like actin and alpha-tubulin, show that fungi are more closely related to animals than either is to plants. Interestingly, the results obtained in this study show that, with respect to the B-block binding subunits of TFIIICs, animals appear to be evolutionarily closer to plants than to fungi.
Callard, G V; Tchoudakova, A V; Kishida, M; Wood, E
2001-12-01
Teleost fish are characterized by exceptionally high levels of brain estrogen biosynthesis when compared to the brains of other vertebrates or to the ovaries of the same fish. Goldfish (Carassius auratus) and zebrafish (Danio rerio) have utility as complementary models for understanding the molecular basis and functional significance of exaggerated neural estrogen biosynthesis. Multiple cytochrome P450 aromatase (P450arom) cDNAs that derive from separate gene loci (cyp19a and cyp19b) are differentially expressed in brain (P450aromB>A) and ovary (P450aromA>B) and have a different developmental program (B>A) and response to estrogen upregulation (B only). As measured by increased P450aromB mRNA, a functional estrogen response system is first detected 24-48 h post-fertilization (hpf), consistent with the onset of estrogen receptor (ER) expression (alpha, beta, and gamma). The 5'-flanking region of the cyp19b gene has a TATA box, two estrogen response elements (EREs), an ERE half-site (ERE1/2), a nerve growth factor inducible-B protein (NGFI-B)/Nur77 responsive element (NBRE) binding site, and a sequence identical to the zebrafish GATA-2 gene neural specific enhancer. The cyp19a promoter region has TATA and CAAT boxes, a steroidogenic factor-1 (SF-1) binding site, and two aryl hydrocarbon receptor (AhR)/AhR nuclear translocator factor (ARNT) binding motifs. Both genes have multiple potential SRY/SOX binding sites (16 and 8 in cyp19b and cyp19a, respectively). Luciferase reporters have basal promoter activity in GH3 cells, but differences (a>b) are opposite to fish pituitary (b>a). When microinjected into fertilized zebrafish eggs, a cyp19b promoter-driven green fluorescent protein (GFP) reporter (but not cyp19a) is expressed in neurons of 30-48 hpf embryos, most prominently in retinal ganglion cells (RGCs) and their projections to optic tectum. Further studies are required to identify functionally relevant cis-elements and cellular factors, and to determine the
Kuzuoka, M; Takahashi, T; Guron, C; Raghow, R
1994-05-01
Detailed molecular organization of the coding and upstream regulatory regions of the murine homeodomain-containing gene, Msx-1, is reported. The protein-encoding portion of the gene is contained in two exons, 590 and 1214 bp in length, separated by a 2107-bp intron; the homeodomain is located in the second exon. The two-exon organization of the murine Msx-1 gene resembles a number of other homeodomain-containing genes. The 5'-(GTAAGT) and 3'-(CCCTAG) splicing junctions and the mRNA polyadenylation signal (UAUAA) of the murine Msx-1 gene are also characteristic of other vertebrate genes. By nuclease protection and primer extension assays, the start of transcription of the Msx-1 gene was located 256 bp upstream of the first AUG. Computer analysis of the promoter proximal 1280-bp sequence revealed a number of potentially important cis-regulatory sequences; these include the recognition elements for Ap-1, Ap-2, Ap-3, Sp-1, a possible binding site for RAR:RXR, and a number of TCF-1 consensus motifs. Importantly, a perfect reverse complement of (C/G)TTAATTG, which was recently shown to be an optimal binding sequence for the homeodomain of Msx-1 protein (K.M. Catron, N. Iler, and C. Abate (1993) Mol. Cell. Biol. 13:2354-2365), was also located in the murine Msx-1 promoter. Binding of bacterially expressed Msx-1 homeodomain polypeptide to Msx-1-specific oligonucleotide was experimentally demonstrated, raising a distinct possibility of autoregulation of this developmentally regulated gene.
Genes in one megabase of the HLA class I region
DOE Office of Scientific and Technical Information (OSTI.GOV)
Wei, H.; Fan, Wu-Fang; Xu, Hongxia
1993-11-15
To define the gene content of the HLA class I region, cDNA selection was applied to three overlapping yeast artificial chromosomes (YACs) that spanned 1 megabase (Mb) of this region of the human major histocompatibility complex. These YACs extended from the region centromeric to HLA-E to the region telomeric to HLA-F. In additions to the recognized class I genes and pseudogenes and the anonymous non-class-I genes described recently by the authors and others, 20 additional anonymous cDNA clones were identified from this 1-Mb region. They also identified a long repetitive DNA element in the region between HLA-B and HLA-E. Homologuesmore » of this outside of the HLA complex. The portion of the HLA class I region represented by these YACs shows an average gene density as high as the class II and class III regions. Thus, the high gene density portion of the HLA complex is extended to more than 3 Mb.« less
Hybrid promoters directed tBid gene expression to breast cancer cells by transcriptional targeting.
Farokhimanesh, Samila; Rahbarizadeh, Fatemeh; Rasaee, Mohammad J; Kamali, Abbas; Mashkani, Baratali
2010-01-01
Developing cancer gene therapy constructs based on transcriptional targeting of genes to cancer cells is a new and promising modality for treatment of cancer. Introducing truncated Bid (tBid), a recently known member of the Bcl-2 family, eradicates cancer cells efficiently. For transcriptional targeting of tBid, two dual-specificity promoters, combining cancer specific core promoters and response modules, were designed. These two core promoter modules contained cancer specific promoters of MUC1 and Survivin genes accompanied by hypoxia-responsive elements and estrogen responsive elements (microenvironment condition of breast cancer cells) which were employed to achieve a higher and more specific level of tBid expression in breast cancer cells. Correlation of the level of tBid expression in normal and cancer cell lines with promoter activity was measured by RT-PCR after treatment with hypoxia and estrogen. The level of tBid expression under control of new hybrid promoters was compared with its expression under control of cytomegalovirus (CMV) promoter as a control. Our data revealed that the level of tBid expression in breast cancer cells were nearly 11 times more than normal cells because of the cancer specific promoters, although tBid expression under control of CMV promoter was almost the same in normal and cancer cell lines. Increased apoptosis was detected in the transfected breast cancer cell lines by the Caspase-3 activity assay. The application of these promoters may prove to have the advantage of tumor selective gene therapy in breast cancer cells and low-potential toxicity for normal tissues.
Wang, Guang-Zhong; Lercher, Martin J.; Hurst, Laurence D.
2011-01-01
Abstract How is noise in gene expression modulated? Do mechanisms of noise control impact genome organization? In yeast, the expression of one gene can affect that of a very close neighbor. As the effect is highly regionalized, we hypothesize that genes in different orientations will have differing degrees of coupled expression and, in turn, different noise levels. Divergently organized gene pairs, in particular those with bidirectional promoters, have close promoters, maximizing the likelihood that expression of one gene affects the neighbor. With more distant promoters, the same is less likely to hold for gene pairs in nondivergent orientation. Stochastic models suggest that coupled chromatin dynamics will typically result in low abundance-corrected noise (ACN). Transcription of noncoding RNA (ncRNA) from a bidirectional promoter, we thus hypothesize to be a noise-reduction, expression-priming, mechanism. The hypothesis correctly predicts that protein-coding genes with a bidirectional promoter, including those with a ncRNA partner, have lower ACN than other genes and divergent gene pairs uniquely have correlated ACN. Moreover, as predicted, ACN increases with the distance between promoters. The model also correctly predicts ncRNA transcripts to be often divergently transcribed from genes that a priori would be under selection for low noise (essential genes, protein complex genes) and that the latter genes should commonly reside in divergent orientation. Likewise, that genes with bidirectional promoters are rare subtelomerically, cluster together, and are enriched in essential gene clusters is expected and observed. We conclude that gene orientation and transcription of ncRNAs are candidate modulators of noise. PMID:21402863
Conserved Curvature of RNA Polymerase I Core Promoter Beyond rRNA Genes: The Case of the Tritryps
Smircich, Pablo; Duhagon, María Ana; Garat, Beatriz
2015-01-01
In trypanosomatids, the RNA polymerase I (RNAPI)-dependent promoters controlling the ribosomal RNA (rRNA) genes have been well identified. Although the RNAPI transcription machinery recognizes the DNA conformation instead of the DNA sequence of promoters, no conformational study has been reported for these promoters. Here we present the in silico analysis of the intrinsic DNA curvature of the rRNA gene core promoters in Trypanosoma brucei, Trypanosoma cruzi, and Leishmania major. We found that, in spite of the absence of sequence conservation, these promoters hold conformational properties similar to other eukaryotic rRNA promoters. Our results also indicated that the intrinsic DNA curvature pattern is conserved within the Leishmania genus and also among strains of T. cruzi and T. brucei. Furthermore, we analyzed the impact of point mutations on the intrinsic curvature and their impact on the promoter activity. Furthermore, we found that the core promoters of protein-coding genes transcribed by RNAPI in T. brucei show the same conserved conformational characteristics. Overall, our results indicate that DNA intrinsic curvature of the rRNA gene core promoters is conserved in these ancient eukaryotes and such conserved curvature might be a requirement of RNAPI machinery for transcription of not only rRNA genes but also protein-coding genes. PMID:26718450
Kleinmanns, Julia A; Schatlowski, Nicole; Heckmann, David; Schubert, Daniel
2017-01-01
HIGHLIGHTS The PRC2 interacting protein BLISTER likely acts downstream of PRC2 to silence Polycomb target genes and is a key regulator of specific stress responses in Arabidopsis . Polycomb group (PcG) proteins are key epigenetic regulators of development. The highly conserved Polycomb repressive complex 2 (PRC2) represses thousands of target genes by trimethylating H3K27 (H3K27me3). Plant specific PcG components and functions are largely unknown, however, we previously identified the plant-specific protein BLISTER (BLI) as a PRC2 interactor. BLI regulates PcG target genes and promotes cold stress resistance. To further understand the function of BLI , we analyzed the transcriptional profile of bli-1 mutants. Approximately 40% of the up-regulated genes in bli are PcG target genes, however, bli-1 mutants did not show changes in H3K27me3 levels at all tested genes, indicating that BLI regulates PcG target genes downstream of or in parallel to PRC2. Interestingly, a significant number of BLI regulated H3K27me3 target genes is regulated by the stress hormone absciscic acid (ABA). We further reveal an overrepresentation of genes responding to abiotic stresses such as drought, high salinity, or heat stress among the up-regulated genes in bli mutants. Consistently, bli mutants showed reduced desiccation stress tolerance. We conclude that the PRC2 associated protein BLI is a key regulator of stress-responsive genes in Arabidopsis : it represses ABA-responsive PcG target genes, likely downstream of PRC2, and promotes resistance to several stresses such as cold and drought.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Starska, Katarzyna, E-mail: katarzyna.starska@umed.lodz.pl; Krześlak, Anna; Forma, Ewa
2014-10-15
Metallothioneins (MTs) are low molecular weight, cysteine-rich heavy metal-binding proteins which participate in the mechanisms of Zn homeostasis, and protect against toxic metals. MTs contain metal-thiolate cluster groups and suppress metal toxicity by binding to them. The aim of this study was to determine the − 5 A/G (rs28366003) single-nucleotide polymorphism (SNP) in the core promoter region of the MT2A gene and to investigate its effect on allele-specific gene expression and Cd, Zn and Cu content in squamous cell laryngeal cancer (SCC) and non-cancerous laryngeal mucosa (NCM) as a control. The MT2A promoter region − 5 A/G SNP was determinedmore » by restriction fragment length polymorphism using 323 SCC and 116 NCM. MT2A gene analysis was performed by quantitative real-time PCR. The frequency of A allele carriage was 94.2% and 91.8% in SCC and NCM, respectively, while G allele carriage was detected in 5.8% and 8.2% of SCC and NCM samples, respectively. As a result, a significant association was identified between the − 5 A/G SNP in the MT2A gene with mRNA expression in both groups. Metal levels were analyzed by flame atomic absorption spectrometry. The significant differences were identified between A/A and both the A/G and G/G genotypes, with regard to the concentration of the contaminating metal. The Spearman rank correlation results showed that the MT2A expression and Cd, Zn, Cu levels were negatively correlated. Results obtained in this study suggest that − 5 A/G SNP in MT2A gene may have an effect on allele-specific gene expression and accumulation of metal levels in laryngeal cancer. - Highlights: • MT2A gene expression and metal content in laryngeal cancer tissues • Association between SNP (rs28366003) and expression of MT2A • Significant associations between the SNP and Cd, Zn and Cu levels • Negative correlation between MT2A gene expression and Cd, Zn and Cu levels.« less
Light-regulated promoters for tunable, temporal, and affordable control of fungal gene expression.
Fuller, Kevin K; Dunlap, Jay C; Loros, Jennifer J
2018-05-01
Regulatable promoters are important genetic tools, particularly for assigning function to essential and redundant genes. They can also be used to control the expression of enzymes that influence metabolic flux or protein secretion, thereby optimizing product yield in bioindustry. This review will focus on regulatable systems for use in filamentous fungi, an important group of organisms whose members include key research models, devastating pathogens of plants and animals, and exploitable cell factories. Though we will begin by cataloging those promoters that are controlled by nutritional or chemical means, our primary focus will rest on those who can be controlled by a literal flip-of-the-switch: promoters of light-regulated genes. The vvd promoter of Neurospora will first serve as a paradigm for how light-driven systems can provide tight, robust, tunable, and temporal control of either autologous or heterologous fungal proteins. We will then discuss a theoretical approach to, and practical considerations for, the development of such promoters in other species. To this end, we have compiled genes from six previously published light-regulated transcriptomic studies to guide the search for suitable photoregulatable promoters in your fungus of interest.
Boutrot, Freddy; Meynard, Donaldo; Guiderdoni, Emmanuel; Joudrier, Philippe; Gautier, Marie-Françoise
2007-03-01
Plant non-specific lipid transfer proteins (nsLTPs) are encoded by a multigene family and support physiological functions, which remain unclear. We adapted an efficient ligation-mediated polymerase chain reaction (LM-PCR) procedure that enabled isolation of 22 novel Triticum aestivum nsLtp (TaLtp) genes encoding types 1 and 2 nsLTPs. A phylogenetic tree clustered the wheat nsLTPs into ten subfamilies comprising 1-7 members. We also studied the activity of four type 1 and two type 2 TaLtp gene promoters in transgenic rice using the 1-Glucuronidase reporter gene. The activities of the six promoters displayed both overlapping and distinct features in rice. In vegetative organs, these promoters were active in leaves and root vascular tissues while no beta-Glucuronidase (GUS) activity was detected in stems. In flowers, the GUS activity driven by the TaLtp7.2a, TaLtp9.1a, TaLtp9.2d, and TaLtp9.3e gene promoters was associated with vascular tissues in glumes and in the extremities of anther filaments whereas only the TaLtp9.4a gene promoter was active in anther epidermal cells. In developing grains, GUS activity and GUS immunolocalization data evidenced complex patterns of activity of the TaLtp7.1a, TaLtp9.2d, and TaLtp9.4a gene promoters in embryo scutellum and in the grain epicarp cell layer. In contrast, GUS activity driven by TaLtp7.2a, TaLtp9.1a, and TaLtp9.3e promoters was restricted to the vascular bundle of the embryo scutellum. This diversity of TaLtp gene promoter activity supports the hypothesis that the encoded TaLTPs possess distinct functions in planta.
Tchoudakova, A; Kishida, M; Wood, E; Callard, G V
2001-11-01
Teleost fish are characterized by exceptionally high levels of neural estrogen biosynthesis when compared with the brains of other vertebrates or to the ovaries of the same fish. Two P450arom mRNAs which derive from separate gene loci (cyp19a and cyp19b) are differentially expressed in brain (b>a) and ovary (a>b) and have a different developmental program (b>a) and estrogen upregulation (b only). A polymerase chain reaction (PCR)-based genomic walking strategy was used to isolate the 5'-flanking regions of the goldfish (Carassius auratus) cyp19 genes. Sequence analysis of the cyp19b gene approximately 1.8 kb upstream of the transcription start site revealed a TATA box at nucleotide (nt) -30, two estrogen responsive elements (EREs; nt -351 and -211) and a consensus binding site (NBRE) for nerve growth factor inducible-B protein (NGFI-B/Nur77) at -286, which includes another ERE half-site. Also present were a sequence at nt -399 (CCCTCCT) required for neural specificity of the zebrafish GATA-2 gene, and 16 copies of an SRY/SOX binding motif. The 5'-flanking region ( approximately 1.0 kb) of the cyp19a gene had TATA (nt -48) and CAAT (nt -71) boxes, a steroidogenic factor-1 (SF-1) binding site (nt -265), eight copies of the SRY/SOX motif, and two copies of a recognition site for binding the arylhydrocarbon receptor (AhR)/AhR nuclear translocator factor (ARNT) heterodimer. Both genes had elements previously identified in the brain specific exon I promoter of the mouse aromatase gene. Cyp19a- and -b/luciferase constructs showed basal promoter activity in aromatase-expressing rodent pituitary (GH3) cells, but differences (a>b) did not reflect expression in fish pituitary in vivo (b>a), implying a lack of appropriate cell factors. Consistent with the onset of cyp19b expression in zebrafish embryos, microinjection of a green fluorescent protein (GFP) reporter plasmid into fertilized eggs revealed labeling in neural tissues at 30-48 h post-fertilization (hpf), most
Fragoso-Medina, Jorge; Rodriguez, Gabriela; Zarain-Herzberg, Angel
2018-05-01
The cardiac sarco/endoplasmic reticulum Ca 2+ -ATPase-2a (SERCA2a) is vital for the correct handling of calcium concentration in cardiomyocytes. Recent studies showed that the induction of endoplasmic reticulum (ER) stress (ERS) with the SERCA2 inhibitor Thapsigargin (Tg) increases the mRNA and protein levels of SERCA2a. The SERCA2 gene promoter contains an ERS response element (ERSE) at position -78 bp that is conserved among species and might transcriptionally regulate SERCA2 gene expression. However, its involvement in SERCA2 basal and calcium-mediated transcriptional activation has not been elucidated. In this work, we show that in cellular cultures of neonatal rat ventricular myocytes, the treatment with Tg or the calcium ionophore A23187 increases the SERCA2a mRNA and protein abundance, as well as the transcriptional activity of two chimeric human SERCA2 gene constructs, containing -254 and -2579 bp of 5'-regulatory region cloned in the pGL3-basic vector and transiently transfected in cultured cardiomyocytes. We found that the ERSE present in the SERCA2 proximal promoter contains a CCAAT box that is involved in basal and ERS-mediated hSERCA2 transcriptional activation. The EMSA results showed that the CCAAT box present in the ERSE recruits the NF-Y transcription factor. Additionally, by ChIP assays, we confirmed in vivo binding of NF-Y and C/EBPβ transcription factors to the SERCA2 gene proximal promoter.
Liu, Dongren; Qi, Yuancheng; Gao, Yuqian; Shen, Jinwen; Qiu, Liyou
2013-01-01
Mushroom β-glucans are potent immunological stimulators in medicine, but their productivities are very low. In this study, we successfully improved its production by promoter engineering in Pleurotus ostreatus. The promoter for β-1,3-glucan synthase gene (GLS) was replaced by the promoter of glyceraldehyde-3-phosphate dehydrogenase gene of Aspergillus nidulans. The homologous recombination fragment for swapping GLS promoter comprised five segments, which were fused by two rounds of combined touchdown PCR and overlap extension PCR (TD-OE PCR), and was introduced into P. ostreatus through PEG/CaCl2-mediated protoplast transformation. The transformants exhibited one to three fold higher transcription of GLS gene and produced 32% to 131% higher yield of β-glucans than the wild type. The polysaccharide yields had a significant positive correlation to the GLS gene expression. The infrared spectra of the polysaccharides all displayed the typical absorption peaks of β-glucans. This is the first report of successful swapping of promoters in filamentous fungi. PMID:23637884
McKay, Jill A; Adriaens, Michiel; Evelo, Chris T; Ford, Dianne; Mathers, John C
2016-09-01
Early-life exposures are critical in fetal programming and may influence function and health in later life. Adequate maternal folate consumption during pregnancy is essential for healthy fetal development and long-term offspring health. The mechanisms underlying fetal programming are poorly understood, but are likely to involve gene regulation. Epigenetic marks, including DNA methylation, regulate gene expression and are modifiable by folate supply. We observed transcriptional changes in fetal liver in response to maternal folate depletion and hypothesized that these changes are concomitant with altered gene promoter methylation. Female C57BL/6J mice were fed diets containing 2 or 0.4 mg folic acid/kg for 4 wk before mating and throughout pregnancy. At 17.5-day gestation, genome-wide gene expression and promoter methylation were measured by microarray analysis in male fetal livers. While 989 genes were differentially expressed, 333 promoters had altered methylation (247 hypermethylated, 86 hypomethylated) in response to maternal folate depletion. Only 16 genes had both expression and methylation changes. However, most methylation changes occurred in genomic regions neighboring expression changes. In response to maternal folate depletion, altered expression at the mRNA level was not associated with altered promoter methylation of the same gene in fetal liver. © 2016 The Authors. Molecular Nutrition & Food Research Published by Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.
Tsytsykova, Alla V.; Rajsbaum, Ricardo; Falvo, James V.; Ligeiro, Filipa; Neely, Simon R.; Goldfeld, Anne E.
2007-01-01
Here we provide a mechanism for specific, efficient transcription of the TNF gene and, potentially, other genes residing within multigene loci. We identify and characterize highly conserved noncoding elements flanking the TNF gene, which undergo activation-dependent intrachromosomal interactions. These elements, hypersensitive site (HSS)−9 and HSS+3 (9 kb upstream and 3 kb downstream of the TNF gene, respectively), contain DNase I hypersensitive sites in naive, T helper 1, and T helper 2 primary T cells. Both HSS-9 and HSS+3 inducibly associate with acetylated histones, indicative of chromatin remodeling, bind the transcription factor nuclear factor of activated T cells (NFAT)p in vitro and in vivo, and function as enhancers of NFAT-dependent transactivation mediated by the TNF promoter. Using the chromosome conformation capture assay, we demonstrate that upon T cell activation intrachromosomal looping occurs in the TNF locus. HSS-9 and HSS+3 each associate with the TNF promoter and with each other, circularizing the TNF gene and bringing NFAT-containing nucleoprotein complexes into close proximity. TNF gene regulation thus reveals a mode of intrachromosomal interaction that combines a looped gene topology with interactions between enhancers and a gene promoter. PMID:17940009
Characterization of the Autophagy related gene-8a (Atg8a) promoter in Drosophila melanogaster.
Bali, Arundhati; Shravage, Bhupendra V
2017-01-01
Autophagy is an evolutionarily conserved process which is upregulated under various stress conditions, including nutrient stress and oxidative stress. Amongst autophagy related genes (Atgs), Atg8a (LC3 in mammals) is induced several-fold during nutrient limitation in Drosophila. The minimal Atg8a cis-regulatory module (CRM) which mediates transcriptional upregulation under various stress conditions is not known. Here, we describe the generation and analyses of a series of Atg8a promoter deletions which drive the expression of an mCherry-Atg8a fusion cassette. Expression studies revealed that a 200 bp region of Atg8a is sufficient to drive expression of Atg8a in nutrient rich conditions in fat body and ovaries, as well as under nutrient deficient conditions in the fat body. Furthermore, this 200 bp region can mediate Atg8a upregulation during developmental histolysis of the larval fat body and under oxidative stress conditions induced by H 2 O 2 . Finally, the expression levels of Atg8a from this promoter are sufficient to rescue the lethality of the Atg8a mutant. The 200 bp promoter-fusion reporter provides a valuable tool which can be used in genetic screens to identify transcriptional and post-transcriptional regulators of Atg8a.
Tammimies, Kristiina; Bieder, Andrea; Lauter, Gilbert; Sugiaman-Trapman, Debora; Torchet, Rachel; Hokkanen, Marie-Estelle; Burghoorn, Jan; Castrén, Eero; Kere, Juha; Tapia-Páez, Isabel; Swoboda, Peter
2016-01-01
DYX1C1, DCDC2, and KIAA0319 are three of the most replicated dyslexia candidate genes (DCGs). Recently, these DCGs were implicated in functions at the cilium. Here, we investigate the regulation of these DCGs by Regulatory Factor X transcription factors (RFX TFs), a gene family known for transcriptionally regulating ciliary genes. We identify conserved X-box motifs in the promoter regions of DYX1C1, DCDC2, and KIAA0319 and demonstrate their functionality, as well as the ability to recruit RFX TFs using reporter gene and electrophoretic mobility shift assays. Furthermore, we uncover a complex regulation pattern between RFX1, RFX2, and RFX3 and their significant effect on modifying the endogenous expression of DYX1C1 and DCDC2 in a human retinal pigmented epithelial cell line immortalized with hTERT (hTERT-RPE1). In addition, induction of ciliogenesis increases the expression of RFX TFs and DCGs. At the protein level, we show that endogenous DYX1C1 localizes to the base of the cilium, whereas DCDC2 localizes along the entire axoneme of the cilium, thereby validating earlier localization studies using overexpression models. Our results corroborate the emerging role of DCGs in ciliary function and characterize functional noncoding elements, X-box promoter motifs, in DCG promoter regions, which thus can be targeted for mutation screening in dyslexia and ciliopathies associated with these genes.—Tammimies, K., Bieder, A., Lauter, G., Sugiaman-Trapman, D., Torchet, R., Hokkanen, M.-E., Burghoorn, J., Castrén, E., Kere, J., Tapia-Páez, I., Swoboda, P. Ciliary dyslexia candidate genes DYX1C1 and DCDC2 are regulated by Regulatory Factor (RF) X transcription factors through X-box promoter motifs. PMID:27451412
Tammimies, Kristiina; Bieder, Andrea; Lauter, Gilbert; Sugiaman-Trapman, Debora; Torchet, Rachel; Hokkanen, Marie-Estelle; Burghoorn, Jan; Castrén, Eero; Kere, Juha; Tapia-Páez, Isabel; Swoboda, Peter
2016-10-01
DYX1C1, DCDC2, and KIAA0319 are three of the most replicated dyslexia candidate genes (DCGs). Recently, these DCGs were implicated in functions at the cilium. Here, we investigate the regulation of these DCGs by Regulatory Factor X transcription factors (RFX TFs), a gene family known for transcriptionally regulating ciliary genes. We identify conserved X-box motifs in the promoter regions of DYX1C1, DCDC2, and KIAA0319 and demonstrate their functionality, as well as the ability to recruit RFX TFs using reporter gene and electrophoretic mobility shift assays. Furthermore, we uncover a complex regulation pattern between RFX1, RFX2, and RFX3 and their significant effect on modifying the endogenous expression of DYX1C1 and DCDC2 in a human retinal pigmented epithelial cell line immortalized with hTERT (hTERT-RPE1). In addition, induction of ciliogenesis increases the expression of RFX TFs and DCGs. At the protein level, we show that endogenous DYX1C1 localizes to the base of the cilium, whereas DCDC2 localizes along the entire axoneme of the cilium, thereby validating earlier localization studies using overexpression models. Our results corroborate the emerging role of DCGs in ciliary function and characterize functional noncoding elements, X-box promoter motifs, in DCG promoter regions, which thus can be targeted for mutation screening in dyslexia and ciliopathies associated with these genes.-Tammimies, K., Bieder, A., Lauter, G., Sugiaman-Trapman, D., Torchet, R., Hokkanen, M.-E., Burghoorn, J., Castrén, E., Kere, J., Tapia-Páez, I., Swoboda, P. Ciliary dyslexia candidate genes DYX1C1 and DCDC2 are regulated by Regulatory Factor (RF) X transcription factors through X-box promoter motifs. © The Author(s).
Androgen receptor agonism promotes an osteogenic gene program in preadipocytes
Hartig, Sean M.; Feng, Qin; Ochsner, Scott A.; Xiao, Rui; McKenna, Neil J.; McGuire, Sean E.; He, Bin
2013-01-01
Androgens regulate body composition by interacting with the androgen receptor (AR) to control gene expression in a tissue-specific manner. To identify novel regulatory roles for AR in preadipocytes, we created a 3T3-L1 cell line stably expressing human AR. We found AR expression is required for androgen-mediated inhibition of 3T3-L1 adipogenesis. This inhibition is characterized by decreased lipid accumulation, reduced expression of adipogenic genes, and induction of genes associated with osteoblast differentiation. Collectively, our results suggest androgens promote an osteogenic gene program at the expense of adipocyte differentiation. PMID:23567971
Rivera-Juarez, Maria de Los Angeles; Rosas-Murrieta, Nora Hilda; Mendieta-Carmona, Victoriano; Hernandez-Pacheco, Raquel Esneidy; Zamora-Ginez, Irma; Rodea-Avila, Carlos; Apresa-Garcia, Teresa; Garay-Villar, Onix; Aguilar-Lemarroy, Adriana; Jave-Suarez, Luis Felipe; Diaz-Orea, Maria Alicia; Milflores-Flores, Lorena; Reyes-Salinas, Juan Salvador; Ceja-Utrera, Francisco Javier; Vazquez-Zamora, Victor Javier; Vargas-Maldonado, Tomas; Reyes-Carmona, Sandra; Sosa-Jurado, Francisca; Santos-Lopez, Gerardo; Reyes-Leyva, Julio; Vallejo-Ruiz, Veronica
2014-01-01
Sialyltransferase gene expression is altered in several cancers, including examples in the cervix. Transcriptional regulation of the responsible genes depends on different promoters. We aimed to determine the association of single-nucleotide polymorphisms in the B3 promoter of the ST3GAL4 gene and the P1 promoter of the ST6GAL1 gene with cervical premalignant lesions or cervical cancer. A blood sample and/or cervical scrapes were obtained from 104 women with normal cytology, 154 with premalignant lesions and 100 with cervical cancer. We also included 119 blood samples of random donors. The polymorphisms were identified by sequencing from PCR products. For the B3 promoter, a fragment of 506 bp (from nucleotide -408 to +98) was analyzed, and for the P1 promoter a 490 bp (-326 to +164) fragment. The polymorphism analysis showed that at SNP rs10893506, genotypes CC and CT of the ST3GAL4 B3 promoter were associated with the presence of premalignant lesions (OR=2.89; 95%CI 1.72-4.85) and cervical cancer (OR=2.23; 95%CI 1.27-3.91). We detected only one allele of each polymorphism in the ST6GAL1 P1 promoter. We did not detect any genetic variability in the P1 promoter region in our study population. Our results suggest that the rs10893506 polymorphism -22C/T may increase susceptibility to premalignant and malignant lesions of the cervix.
Roy Choudhury, Swarup; Roy, Sujit; Das, Ranjan; Sengupta, Dibyendu N
2008-12-01
Sucrose phosphate synthase (SPS) (EC 2.3.1.14) is the key regulatory component in sucrose formation in banana (Musa acuminata subgroup Cavendish, cv Giant governor) fruit during ripening. This report illustrates differential transcriptional responses of banana SPS gene following ethylene, auxin, wounding, low temperature and different photoperiods during ripening in banana fruit. Whereas ethylene strongly stimulated SPS transcript accumulation, auxin and cold treatment only marginally increased the abundance of SPS mRNA level, while wounding negatively regulated SPS gene expression. Conversely, SPS transcript level was distinctly increased by constant exposure to white light. Protein level, enzymatic activity of SPS and sucrose synthesis were substantially increased by ethylene and increased exposure to white light conditions as compared to other treatments. To further study the transcriptional regulation of SPS in banana fruit, the promoter region of SPS gene was cloned and some cis-acting regulatory elements such as a reverse GCC-box ERE, two ARE motifs (TGTCTC), one LTRE (CCGAA), a GAGA-box (GAGA...) and a GATA-box LRE (GATAAG) were identified along with the TATA and CAAT-box. DNA-protein interaction studies using these cis-elements indicated a highly specific cis-trans interaction in the banana nuclear extract. Furthermore, we specifically studied the light responsive characteristics of GATA-box containing synthetic as well as native banana SPS promoter. Transient expression assays using banana SPS promoter have also indicated the functional importance of the SPS promoter in regulating gene expression. Together, these results provide insights into the transcriptional regulation of banana SPS gene in response to phytohormones and other environmental factors during fruit ripening.
ERIC Educational Resources Information Center
Roohi, Jasmin; DeVincent, Carla J.; Hatchwell, Eli; Gadow, Kenneth D.
2009-01-01
The aim of the present study was to examine the association between a variable number tandem repeat (VNTR) functional polymorphism in the promoter region of the MAO-A gene and severity of ADHD and anxiety in boys with ASD. Parents and teachers completed a DSM-IV-referenced rating scale for 5- to 14-year-old boys with ASD (n = 43). Planned…
Development of Plant Gene Vectors for Tissue-Specific Expression Using GFP as a Reporter Gene
NASA Technical Reports Server (NTRS)
Jackson, Jacquelyn; Egnin, Marceline; Xue, Qi-Han; Prakash, C. S.
1997-01-01
Reporter genes are widely employed in plant molecular biology research to analyze gene expression and to identify promoters. Gus (UidA) is currently the most popular reporter gene but its detection requires a destructive assay. The use of jellyfish green fluorescent protein (GFP) gene from Aequorea Victoria holds promise for noninvasive detection of in vivo gene expression. To study how various plant promoters are expressed in sweet potato (Ipomoea batatas), we are transcriptionally fusing the intron-modified (mGFP) or synthetic (modified for codon-usage) GFP coding regions to these promoters: double cauliflower mosaic virus 35S (CaMV 35S) with AMV translational enhancer, ubiquitin7-intron-ubiquitin coding region (ubi7-intron-UQ) and sporaminA. A few of these vectors have been constructed and introduced into E. coli DH5a and Agrobacterium tumefaciens EHA105. Transient expression studies are underway using protoplast-electroporation and particle bombardment of leaf tissues.
Ottini, Laura; Rizzolo, Piera; Siniscalchi, Ester; Zijno, Andrea; Silvestri, Valentina; Crebelli, Riccardo; Marcon, Francesca
2015-02-01
The influence of DNA repair capacity, plasma nutrients and tobacco smoke exposure on DNA methylation was investigated in blood cells of twenty-one couples of monozygotic twins with discordant smoking habits. All study subjects had previously been characterized for mutagen sensitivity with challenge assays with ionizing radiation in peripheral blood lymphocytes. Plasma levels of folic acid, vitamin B12 and homocysteine were also available from a previous investigation. In this work DNA methylation in the promoter region of a panel of ten genes involved in cell cycle control, differentiation, apoptosis and DNA repair (p16, FHIT, RAR, CDH1, DAPK1, hTERT, RASSF1A, MGMT, BRCA1 and PALB2) was assessed in the same batches of cells isolated for previous studies, using the methylation-sensitive high-resolution melting technique. Fairly similar profiles of gene promoter methylation were observed within co-twins compared to unrelated subjects (p= 1.23 × 10(-7)), with no significant difference related to smoking habits (p = 0.23). In a regression analysis the methylation index of study subjects, used as synthetic descriptor of overall promoter methylation, displayed a significant inverse correlation with radiation-induced micronuclei (p = 0.021) and plasma folic acid level (p = 0.007) both in smokers and in non-smokers. The observed association between repair of radiation-induced DNA damage and promoter methylation suggests the involvement of the DNA repair machinery in DNA modification. Data also highlight the possible modulating effect of folate deficiency on DNA methylation and the strong influence of familiarity on the individual epigenetic profile. Copyright © 2015 Elsevier B.V. All rights reserved.
Kiermer, V; Van Lint, C; Briclet, D; Vanhulle, C; Kettmann, R; Verdin, E; Burny, A; Droogmans, L
1998-07-01
Bovine leukemia virus (BLV) replication is controlled by both cis- and trans-acting elements. The virus-encoded transactivator, Tax, is necessary for efficient transcription from the BLV promoter, although it is not present during the early stages of infection. Therefore, sequences that control Tax-independent transcription must play an important role in the initiation of viral gene expression. This study demonstrates that the R-U5 sequence of BLV stimulates Tax-independent reporter gene expression directed by the BLV promoter. R-U5 was also stimulatory when inserted immediately downstream from the transcription initiation site of a heterologous promoter. Progressive deletion analysis of this region revealed that a 46-bp element corresponding to the 5' half of U5 is principally responsible for the stimulation. This element exhibited enhancer activity when inserted upstream or downstream from the herpes simplex virus thymidine kinase promoter. This enhancer contains a binding site for the interferon regulatory factors IRF-1 and IRF-2. A 3-bp mutation that destroys the IRF recognition site caused a twofold decrease in Tax-independent BLV long terminal repeat-driven gene expression. These observations suggest that the IRF binding site in the U5 region of BLV plays a role in the initiation of virus replication.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Ohashi, Koji; Munetsuna, Eiji; Yamada, Hiroya, E-mail: hyamada@fujita-hu.ac.jp
DNA methylation status is affected by environmental factors, including nutrition. Fructose consumption is considered a risk factor for the conditions that make up metabolic syndrome such as dyslipidemia. However, the pathogenetic mechanism by which fructose consumption leads to metabolic syndrome is unclear. Based on observations that epigenetic modifications are closely related to induction of metabolic syndrome, we hypothesized that fructose-induced metabolic syndrome is caused by epigenetic alterations. Male SD rats were designated to receive water or 20% fructose solution for 14 weeks. mRNA levels for peroxisome proliferator-activated receptor alpha (PPARα) and carnitine palmitoyltransferase 1A (CPT1A) was analyzed using Real-time PCR.more » Restriction digestion and real-time PCR (qAMP) was used for the analysis of DNA methylation status. Hepatic lipid accumulation was also observed by fructose intake. Fructose feeding also significantly decreased mRNA levels for PPARα and CPT1A. qAMP analysis demonstrated the hypermethylation of promoter regions of PPARα and CTP1A genes. Fructose-mediated attenuated gene expression may be mediated by alterations of DNA methylation status, and pathogenesis of metabolic syndrome induced by fructose relates to DNA methylation status. - Highlights: • No general consensus has been reached regarding the molecular mechanisms of the pathogenesis of fructose-induced diseases. • Significant increase in hepatic total methylation level was observed after fructose-supplemented feeding. • Fructose feeding significantly decreased mRNA levels for PPARα and CPT1A. • qAMP analysis demonstrated the hypermethylation of promoter regions of PPARα and CTP1A genes. • Fructose-mediated attenuated gene expression may be mediated by alterations of DNA methylation status in rat liver.« less
Cloning of the promoter region of a human gene, FOXL2, and its regulation by STAT3.
Han, Yangyang; Wang, Tianxiao; Sun, Shudong; Zhai, Zhaohui; Tang, Shengjian
2017-09-01
Forkhead box L2 (FOXL2) is a transcription factor, which is involved in blepharophimosis, ptosis, and epicanthus in versus syndrome (BPES), premature ovarian failure (POF), as well as almost all stages of ovarian development and function. FOXL2 has various target genes, which are implicated in numerous processes, including sex determination, cell cycle regulation and apoptosis and stress response regulation in mammals. However, studies regarding the upstream regulation of FOXL2 are limited. In the present study, the promoter of FOXL2 was successfully cloned and registered in Gen Bank, and a dual luciferase reporter (DLR) analysis demonstrated that the luciferase activity was significantly induced by the promoter of FOXL2. Subsequently, bioinformatics analysis indicated that FOXL2 may be regulated by STAT3, and this was confirmed by a DLR analysis and western blotting, using STAT3 inhibitors. Further study using real‑time cellular analysis indicated that the viability of He La cells was markedly suppressed by STAT3 inhibitors. The present study demonstrated novel findings regarding the upstream regulation of FOXL2 expression and provide a new perspective for future studies in the field.
Bukowska, Agnieszka; Wieczorek, Edyta; Przybek, Monika; Zienolddiny, Shanbeh; Reszka, Edyta
2017-01-01
Some recent evidence suggests that environmental and lifestyle factors may modify DNA methylation. We hypothesized that rotating night work and several modifiable factors may be associated with the methylation of the promoter regions within two tumor suppressor and DNA repair genes: BRCA1 and BRCA2. The methylation status of BRCA1 and BRCA2 was determined via qMSP reactions using DNA samples derived from blood leucocytes of 347 nurses and midwives working rotating nights and 363 working during the days. The subjects were classified into unmethylated vs methylated BRCA1 and BRCA2 when the methylation index was 0% or >0%, respectively. The adjusted odds ratios with 95% confidence intervals were calculated for night work status, smoking, obesity, physical activity and alcohol drinking. Current night shift work or night work history was not associated with methylation status of the promoter sites within BRCA1 and BRCA2 genes. We observed weak associations between smoking and the methylation status of BRCA1 with OR = 1.50 (95%CI: 0.98–2.29) for current smoking, OR = 1.83, 95CI: 1.08–3.13 for smoking longer than 31 years, and 0.1>p>0.05 for trends for the number of cigarettes per day, smoking duration and packyears. In conclusion, no links between night shift work and methylation of the promoter region within the BRCA1, and BRCA2 genes were observed in this exploratory analysis. The findings of our study weakly support the hypothesis that smoking may contribute to epigenetic events. PMID:28594926
Cone-Specific Promoters for Gene Therapy of Achromatopsia and Other Retinal Diseases
Ye, Guo-Jie; Budzynski, Ewa; Sonnentag, Peter; Nork, T. Michael; Sheibani, Nader; Gurel, Zafer; Boye, Sanford L.; Peterson, James J.; Boye, Shannon E.; Hauswirth, William W.; Chulay, Jeffrey D.
2016-01-01
Adeno-associated viral (AAV) vectors containing cone-specific promoters have rescued cone photoreceptor function in mouse and dog models of achromatopsia, but cone-specific promoters have not been optimized for use in primates. Using AAV vectors administered by subretinal injection, we evaluated a series of promoters based on the human L-opsin promoter, or a chimeric human cone transducin promoter, for their ability to drive gene expression of green fluorescent protein (GFP) in mice and nonhuman primates. Each of these promoters directed high-level GFP expression in mouse photoreceptors. In primates, subretinal injection of an AAV-GFP vector containing a 1.7-kb L-opsin promoter (PR1.7) achieved strong and specific GFP expression in all cone photoreceptors and was more efficient than a vector containing the 2.1-kb L-opsin promoter that was used in AAV vectors that rescued cone function in mouse and dog models of achromatopsia. A chimeric cone transducin promoter that directed strong GFP expression in mouse and dog cone photoreceptors was unable to drive GFP expression in primate cones. An AAV vector expressing a human CNGB3 gene driven by the PR1.7 promoter rescued cone function in the mouse model of achromatopsia. These results have informed the design of an AAV vector for treatment of patients with achromatopsia. PMID:26603570
Cone-Specific Promoters for Gene Therapy of Achromatopsia and Other Retinal Diseases.
Ye, Guo-Jie; Budzynski, Ewa; Sonnentag, Peter; Nork, T Michael; Sheibani, Nader; Gurel, Zafer; Boye, Sanford L; Peterson, James J; Boye, Shannon E; Hauswirth, William W; Chulay, Jeffrey D
2016-01-01
Adeno-associated viral (AAV) vectors containing cone-specific promoters have rescued cone photoreceptor function in mouse and dog models of achromatopsia, but cone-specific promoters have not been optimized for use in primates. Using AAV vectors administered by subretinal injection, we evaluated a series of promoters based on the human L-opsin promoter, or a chimeric human cone transducin promoter, for their ability to drive gene expression of green fluorescent protein (GFP) in mice and nonhuman primates. Each of these promoters directed high-level GFP expression in mouse photoreceptors. In primates, subretinal injection of an AAV-GFP vector containing a 1.7-kb L-opsin promoter (PR1.7) achieved strong and specific GFP expression in all cone photoreceptors and was more efficient than a vector containing the 2.1-kb L-opsin promoter that was used in AAV vectors that rescued cone function in mouse and dog models of achromatopsia. A chimeric cone transducin promoter that directed strong GFP expression in mouse and dog cone photoreceptors was unable to drive GFP expression in primate cones. An AAV vector expressing a human CNGB3 gene driven by the PR1.7 promoter rescued cone function in the mouse model of achromatopsia. These results have informed the design of an AAV vector for treatment of patients with achromatopsia.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Spink, Barbara C.; Bloom, Michael S.; Wu, Susan
The aryl hydrocarbon receptor (AhR) regulates expression of numerous genes, including those of the CYP1 gene family. With the goal of determining factors that control AHR gene expression, our studies are focused on the role of the short tandem repeat polymorphism, (GGGGC){sub n}, located in the proximal promoter of the human AHR gene. When luciferase constructs containing varying GGGGC repeats were transfected into cancer cell lines derived from the lung, colon, and breast, the number of GGGGC repeats affected AHR promoter activity. The number of GGGGC repeats was determined in DNA from 327 humans and from 38 samples representing 5more » species of non-human primates. In chimpanzees and 3 species of macaques, only (GGGGC){sub 2} alleles were observed; however, in western gorilla, (GGGGC){sub n} alleles with n = 2, 4, 5, 6, 7, and 8 were identified. In all human populations examined, the frequency of (GGGGC){sub n} was n = 4 > 5 ≫ 2, 6. When frequencies of the (GGGGC){sub n} alleles in DNA from patients with lung, colon, or breast cancer were evaluated, the occurrence of (GGGGC){sub 2} was found to be 8-fold more frequent among lung cancer patients in comparison with its incidence in the general population, as represented by New York State neonates. Analysis of matched tumor and non-tumor DNA samples from the same individuals provided no evidence of microsatellite instability. These studies indicate that the (GGGGC){sub n} short tandem repeats are inherited, and that the (GGGGC){sub 2} allele in the AHR proximal promoter region should be further investigated with regard to its potential association with lung cancer susceptibility. - Highlights: • The AHR proximal promoter contains a polymorphism, (GGGGC){sub n}, where n = 4 > 5 ≫ 2, 6 • Matched tumor and non-tumor DNA did not show (GGGGC){sub n} microsatellite instability • AHR promoter activity of a construct with (GGGGC){sub 2} was lower than that of (GGGGC){sub 4} • The frequency of (GGGGC){sub 2
Epigenetic Transgenerational Actions of Vinclozolin on Promoter Regions of the Sperm Epigenome
Guerrero-Bosagna, Carlos; Settles, Matthew; Lucker, Ben; Skinner, Michael K.
2010-01-01
Previous observations have demonstrated that embryonic exposure to the endocrine disruptor vinclozolin during gonadal sex determination promotes transgenerational adult onset disease such as male infertility, kidney disease, prostate disease, immune abnormalities and tumor development. The current study investigates genome-wide promoter DNA methylation alterations in the sperm of F3 generation rats whose F0 generation mother was exposed to vinclozolin. A methylated DNA immunoprecipitation with methyl-cytosine antibody followed by a promoter tilling microarray (MeDIP-Chip) procedure was used to identify 52 different regions with statistically significant altered methylation in the sperm promoter epigenome. Mass spectrometry bisulfite analysis was used to map the CpG DNA methylation and 16 differential DNA methylation regions were confirmed, while the remainder could not be analyzed due to bisulfite technical limitations. Analysis of these validated regions identified a consensus DNA sequence (motif) that associated with 75% of the promoters. Interestingly, only 16.8% of a random set of 125 promoters contained this motif. One candidate promoter (Fam111a) was found to be due to a copy number variation (CNV) and not a methylation change, suggesting initial alterations in the germline epigenome may promote genetic abnormalities such as induced CNV in later generations. This study identifies differential DNA methylation sites in promoter regions three generations after the initial exposure and identifies common genome features present in these regions. In addition to primary epimutations, a potential indirect genetic abnormality was identified, and both are postulated to be involved in the epigenetic transgenerational inheritance observed. This study confirms that an environmental agent has the ability to induce epigenetic transgenerational changes in the sperm epigenome. PMID:20927350
Epigenetic transgenerational actions of vinclozolin on promoter regions of the sperm epigenome.
Guerrero-Bosagna, Carlos; Settles, Matthew; Lucker, Ben; Skinner, Michael K
2010-09-30
Previous observations have demonstrated that embryonic exposure to the endocrine disruptor vinclozolin during gonadal sex determination promotes transgenerational adult onset disease such as male infertility, kidney disease, prostate disease, immune abnormalities and tumor development. The current study investigates genome-wide promoter DNA methylation alterations in the sperm of F3 generation rats whose F0 generation mother was exposed to vinclozolin. A methylated DNA immunoprecipitation with methyl-cytosine antibody followed by a promoter tilling microarray (MeDIP-Chip) procedure was used to identify 52 different regions with statistically significant altered methylation in the sperm promoter epigenome. Mass spectrometry bisulfite analysis was used to map the CpG DNA methylation and 16 differential DNA methylation regions were confirmed, while the remainder could not be analyzed due to bisulfite technical limitations. Analysis of these validated regions identified a consensus DNA sequence (motif) that associated with 75% of the promoters. Interestingly, only 16.8% of a random set of 125 promoters contained this motif. One candidate promoter (Fam111a) was found to be due to a copy number variation (CNV) and not a methylation change, suggesting initial alterations in the germline epigenome may promote genetic abnormalities such as induced CNV in later generations. This study identifies differential DNA methylation sites in promoter regions three generations after the initial exposure and identifies common genome features present in these regions. In addition to primary epimutations, a potential indirect genetic abnormality was identified, and both are postulated to be involved in the epigenetic transgenerational inheritance observed. This study confirms that an environmental agent has the ability to induce epigenetic transgenerational changes in the sperm epigenome.
Scieglinska, D; Widłak, W; Konopka, W; Poutanen, M; Rahman, N; Huhtaniemi, I; Krawczyk, Z
2001-01-01
The rat Hst70 gene and its mouse counterpart Hsp70.2 belong to the family of Hsp70 heat shock genes and are specifically expressed in male germ cells. Previous studies regarding the structure of the 5' region of the transcription unit of these genes as well as localization of the 'cis' elements conferring their testis-specific expression gave contradictory results [Widlak, Markkula, Krawczyk, Kananen and Huhtaniemi (1995) Biochim. Biophys. Acta 1264, 191-200; Dix, Rosario-Herrle, Gotoh, Mori, Goulding, Barret and Eddy (1996) Dev. Biol. 174, 310-321]. In the present paper we solve these controversies and show that the 5' untranslated region (UTR) of the Hst70 gene contains an intron which is localized similar to that of the mouse Hsp70.2 gene. Reverse transcriptase-mediated PCR, Northern blotting and RNase protection analysis revealed that the transcription initiation of both genes starts at two main distant sites, and one of them is localized within the intron. As a result two populations of Hst70 gene transcripts with similar sizes but different 5' UTR structures can be detected in total testicular RNA. Functional analysis of the Hst70 gene promoter in transgenic mice and transient transfection assays proved that the DNA fragment of approx. 360 bp localized upstream of the ATG transcription start codon is the minimal promoter required for testis-specific expression of the HST70/chloramphenicol acetyltransferase transgene. These experiments also suggest that the expression of the gene may depend on 'cis' regulatory elements localized within exon 1 and the intron sequences. PMID:11563976
Identification of distal silencing elements in the murine interferon-A11 gene promoter.
Roffet, P; Lopez, S; Navarro, S; Bandu, M T; Coulombel, C; Vignal, M; Doly, J; Vodjdani, G
1996-08-01
The murine interferon-A11 (Mu IFN-A11) gene is a member of the IFN-A multigenic family. In mouse L929 cells, the weak response of the gene's promoter to viral induction is due to a combination of both a point mutation in the virus responsive element (VRE) and the presence of negatively regulating sequences surrounding the VRE. In the distal part of the promoter, the negatively acting E1E2 sequence was delimited. This sequence displays an inhibitory effect in either orientation or position on the inducibility of a virus-responsive heterologous promoter. It selectively represses VRE-dependent transcription but is not able to reduce the transcriptional activity of a VRE-lacking promoter. In a transient transfection assay, an E1E2-containing DNA competitor was able to derepress the native Mu IFN-A11 promoter. Specific nuclear factors bind to this sequence; thus the binding of trans-regulators participates in the repression of the Mu IFN-A11 gene. The E1E2 sequence contains an IFN regulatory factor (IRF)-binding site. Recombinant IRF2 binds this sequence and anti-IRF2 antibodies supershift a major complex formed with nuclear extracts. The protein composing the complex is 50 kDa in size, indicating the presence of IRF2 or antigenically related proteins in the complex. The Mu IFN-A11 gene is the first example within the murine IFN-A family, in which a distal promoter element has been identified that can negatively modulate the transcriptional response to viral induction.
Leng, Shuguang; Stidley, Christine A.; Liu, Yushi; Edlund, Christopher K.; Willink, Randall P.; Han, Younghun; Landi, Maria Teresa; Thun, Michael; Picchi, Maria A.; Bruse, Shannon E.; Crowell, Richard E.; Van Den Berg, David; Caporaso, Neil E.; Amos, Christopher I.; Siegfried, Jill M.; Tesfaigzi, Yohannes; Gilliland, Frank D.; Belinsky, Steven A.
2011-01-01
The detection of tumor suppressor gene promoter methylation in sputum-derived exfoliated cells predicts early lung cancer. Here we identified genetic determinants for this epigenetic process and examined their biological effects on gene regulation. A two-stage approach involving discovery and replication was employed to assess the association between promoter hypermethylation of a 12-gene panel and common variation in 40 genes involved in carcinogen metabolism, regulation of methylation, and DNA damage response in members of the Lovelace Smokers Cohort (n=1434). Molecular validation of three identified variants was conducted using primary bronchial epithelial cells. Association of study-wide significance (P<8.2×10−5) was identified for rs1641511, rs3730859, and rs1883264 in TP53, LIG1, and BIK, respectively. These SNPs were significantly associated with altered expression of the corresponding genes in primary bronchial epithelial cells. In addition, rs3730859 in LIG1 was also moderately associated with increased risk for lung cancer among Caucasian smokers. Together, our findings suggest that genetic variation in DNA replication and apoptosis pathways impacts the propensity for gene promoter hypermethylation in the aerodigestive tract of smokers. The incorporation of genetic biomarkers for gene promoter hypermethylation with clinical and somatic markers may improve risk assessment models for lung cancer. PMID:22139380
Javan, Bita; Shahbazi, Majid
2017-01-01
Transcriptional targeting is the best approach for specific gene therapy. Hypoxia is a common feature of the tumour microenvironment. Therefore, targeting gene expression in hypoxic cells by placing transgene under the control of a hypoxia-responsive promoter can be a good strategy for cancer-specific gene therapy. The hypoxia-inducible gene expression system has been investigated more in suicide gene therapy and it can also be of great help in knocking down cancer gene therapy with siRNAs. However, this system needs to be optimised to have maximum efficacy with minimum side effects in normal tissues. The combination of tissue-/tumour-specific promoters with HRE core sequences has been found to enhance the specificity and efficacy of this system. In this review, hypoxia-inducible gene expression system as well as gene therapy strategies targeting tumour hypoxia will be discussed. This review will also focus on hypoxia-inducible tumour-specific promoters as a dual-targeting transcriptional regulation systems developed for cancer-specific gene therapy. PMID:28798809
Kathiria, Palak; Sidler, Corinne; Woycicki, Rafal; Yao, Youli; Kovalchuk, Igor
2013-07-01
The role of resistance (R) genes in plant pathogen interaction has been studied extensively due to its economical impact on agriculture. Interaction between tobacco mosaic virus (TMV) and the N protein from tobacco is one of the most widely used models to understand various aspects of pathogen resistance. The transcription activity governed by N gene promoter is one of the least understood elements of the model. In this study, the N gene promoter was cloned and fused with two different reporter genes, one encoding β-glucuronidase (N::GUS) and another, luciferase (N::LUC). Tobacco plants transformed with the N::GUS or N::LUC reporter constructs were screened for homozygosity and stable expression. Histochemical analysis of N::GUS tobacco plants revealed that the expression is organ specific and developmentally regulated. Whereas two week old plants expressed GUS in midveins only, 6-wk-old plants also expressed GUS in leaf lamella. Roots did not show GUS expression at any time during development. Experiments to address effects of external stress were performed using N::LUC tobacco plants. These experiments showed that N gene promoter expression was suppressed when plants were exposed to high but not low temperatures. Expression was also upregulated in response to TMV, but no changes were observed in plants treated with SA.
Effect of promoter architecture on the cell-to-cell variability in gene expression.
Sanchez, Alvaro; Garcia, Hernan G; Jones, Daniel; Phillips, Rob; Kondev, Jané
2011-03-01
According to recent experimental evidence, promoter architecture, defined by the number, strength and regulatory role of the operators that control transcription, plays a major role in determining the level of cell-to-cell variability in gene expression. These quantitative experiments call for a corresponding modeling effort that addresses the question of how changes in promoter architecture affect variability in gene expression in a systematic rather than case-by-case fashion. In this article we make such a systematic investigation, based on a microscopic model of gene regulation that incorporates stochastic effects. In particular, we show how operator strength and operator multiplicity affect this variability. We examine different modes of transcription factor binding to complex promoters (cooperative, independent, simultaneous) and how each of these affects the level of variability in transcriptional output from cell-to-cell. We propose that direct comparison between in vivo single-cell experiments and theoretical predictions for the moments of the probability distribution of mRNA number per cell can be used to test kinetic models of gene regulation. The emphasis of the discussion is on prokaryotic gene regulation, but our analysis can be extended to eukaryotic cells as well.
Effect of Promoter Architecture on the Cell-to-Cell Variability in Gene Expression
Sanchez, Alvaro; Garcia, Hernan G.; Jones, Daniel; Phillips, Rob; Kondev, Jané
2011-01-01
According to recent experimental evidence, promoter architecture, defined by the number, strength and regulatory role of the operators that control transcription, plays a major role in determining the level of cell-to-cell variability in gene expression. These quantitative experiments call for a corresponding modeling effort that addresses the question of how changes in promoter architecture affect variability in gene expression in a systematic rather than case-by-case fashion. In this article we make such a systematic investigation, based on a microscopic model of gene regulation that incorporates stochastic effects. In particular, we show how operator strength and operator multiplicity affect this variability. We examine different modes of transcription factor binding to complex promoters (cooperative, independent, simultaneous) and how each of these affects the level of variability in transcriptional output from cell-to-cell. We propose that direct comparison between in vivo single-cell experiments and theoretical predictions for the moments of the probability distribution of mRNA number per cell can be used to test kinetic models of gene regulation. The emphasis of the discussion is on prokaryotic gene regulation, but our analysis can be extended to eukaryotic cells as well. PMID:21390269
Gupta, Sanjay; Pathak, Rashmi U; Kanungo, Madhu S
2006-08-01
One approach to the understanding of the molecular basis of aging in higher organisms may be to use genes whose timing and rate of expression during the life span run parallel with specific functions that can be monitored. The genes for egg proteins, such as vitellogenin (VTG), which is expressed in the liver, and ovalbumin, lysozyme etc. that are expressed in the oviduct of birds, meet these requirements. Egg laying function is dependent on the production of these proteins, which, in turn, depends on the expression of their genes. In this communication we present the age-related studies on the VTG II gene of the bird, Japanese quail. The gene is expressed only in the liver and its expression is considerably lower in old birds that do not lay eggs. Comparison of the promoter region of the gene carrying the two important cis-acting elements, estrogen responsive element (ERE) and progesterone responsive element (PRE), shows it to be 100% homologous to the corresponding region of the chicken VTG II gene. Methylation of DNA and conformation of chromatin of this region were studied, as they are known to be important for regulation of expression of genes. Our studies show that in the liver of adult female quails which lay eggs, a -CCGG- sequence located in this region is hypomethylated, and the chromatin encompassing this region of the gene is relaxed. In the old, the -CCGG- sequence is hypermethylated and the chromatin is compact. This is correlated with a decrease in the expression of the gene and decrease in egg production. Further, electrophoretic mobility shift assay (EMSA) shows that the levels/affinity of specific trans-acting factors that bind to ERE and PRE present in the region, are not different in adult and old birds. Hence the methylation status of the -CCGG- sequence that is located in-between the ERE and the PRE may be crucial for the conformation of chromatin and availability of these two important cis-acting elements for the binding of the trans
Ren, Wei; Zhu, Liang-Hua; Xu, Hua-Guo; Jin, Rui; Zhou, Guo-Ping
2012-06-01
Interferon regulatory factor 3 (IRF-3), an essential transcriptional regulator of the interferon genes, plays an important role in host defense against viral and microbial infection as well as in cell growth regulation. Promoter plays a crucial role in gene transcription. We have reported the characterization of the wide type of human IRF-3 promoter, but the characterization of the spliced variant of human IRF-3 Int2V1 promoter has not been systematically analyzed. To observe the spliced variant of human IRF-3 promoter, we have cloned the human IRF-3 gene promoter region containing 300 nucleotides upstream the transcription start site (TSS). Transient transfection of 5' deleted promoter-reporter constructs and luciferase assay illustrated the region -159/-100 relative to the TSS is sufficient for full promoter activity. This region contains GATA1 and specific protein-1 (Sp1) transcription factor binding sites. Interestingly, mutation of this Sp1 site reduced the promoter activity by 50%. However, overexpression of Sp1 increased the transcription activity by 2.4-fold. These results indicated that the spliced variant of human IRF-3 gene core promoter was located within the region -159/-100 relative to the TSS. Sp1 transcription factor upregulates the spliced variant of human IRF-3 gene promoter.
Jiao, Song; Yu, Huimin; Shen, Zhongyao
2018-09-25
To satisfy the urgent demand for promoter engineering that can accurately regulate the metabolic circuits and expression of specific genes in the Rhodococcus microbial platform, a promoter-ribosome binding site (RBS) coupled mini-pool with fine-tuning of different activity levels was successfully established. Transcriptome analyses of R. ruber TH revealed several representative promoters with different activity levels, e.g., Pami, Pcs, Pnh, P50sl36, PcbiM, PgroE and Pniami. β-Galactosidase (LacZ) reporter measurement demonstrated that different gene expression levels could be obtained with these natural promoters combined with an optimal RBS of ami. Further use of these promoters to overexpress the nitrile hydratase (NHase) gene with RBSami in R. ruber THdAdN produced different expression levels consistent with the transcription analyses. The -35 and -10 core elements of different promoters were further analyzed, and the conserved sequences were revealed to be TTGNNN and (T/C)GNNA(A/C)AAT. By mutating the core elements of the strong promoters, Pnh and Pami, into the above consensus sequence, two even stronger promoters, PnhM and PamiM, were obtained with 2.2-fold and 7.7-fold improvements in transcription, respectively. Integrating several strategies, including transcriptome promoter screening, -35 and -10 core element identification, core element point-mutation, RBS optimization and diverse reporter verification, a fine-tuning promoter-RBS combination mini-pool with different activity levels in Rhodococcus strains was successfully established. This development is significant for broad applications of the Rhodococcus genus as a microbial platform. Copyright © 2018 Elsevier B.V. All rights reserved.
Lambret-Frotté, Julia; Artico, Sinara; Muniz Nardeli, Sarah; Fonseca, Fernando; Brilhante Oliveira-Neto, Osmundo; Grossi-de-Sá, Maria Fatima; Alves-Ferreira, Marcio
2016-01-01
Cotton is one of the most economically important cultivated crops. It is the major source of natural fiber for the textile industry and an important target for genetic modification for both biotic stress and herbicide tolerance. Therefore, the characterization of genes and regulatory regions that might be useful for genetic transformation is indispensable. The isolation and characterization of new regulatory regions is of great importance to drive transgene expression in genetically modified crops. One of the major drawbacks in cotton production is pest damage; therefore, the most promising, cost-effective, and sustainable method for pest control is the development of genetically resistant cotton lines. Considering this scenario, our group isolated and characterized the promoter region of a MCO (multicopper oxidase) from Gossypium hirsutum, named GhAO-like1 (ascorbate oxidase-like1). The quantitative expression, together with the in vivo characterization of the promoter region reveals that GhAO-like1 has a flower- and fruit-specific expression pattern. The GUS activity is mainly observed in stamens, as expected considering that the GhAO-like1 regulatory sequence is enriched in cis elements, which have been characterized as a target of reproductive tissue specific transcription factors. Both histological and quantitative analyses in Arabidopsis thaliana have confirmed flower (mainly in stamens) and fruit expression of GhAO-like1. In the present paper, we isolated and characterized both in silico and in vivo the promoter region of the GhAO-like1 gene. The regulatory region of GhAO-like1 might be useful to confer tissue-specific expression in genetically modified plants.
RGmatch: matching genomic regions to proximal genes in omics data integration.
Furió-Tarí, Pedro; Conesa, Ana; Tarazona, Sonia
2016-11-22
The integrative analysis of multiple genomics data often requires that genome coordinates-based signals have to be associated with proximal genes. The relative location of a genomic region with respect to the gene (gene area) is important for functional data interpretation; hence algorithms that match regions to genes should be able to deliver insight into this information. In this work we review the tools that are publicly available for making region-to-gene associations. We also present a novel method, RGmatch, a flexible and easy-to-use Python tool that computes associations either at the gene, transcript, or exon level, applying a set of rules to annotate each region-gene association with the region location within the gene. RGmatch can be applied to any organism as long as genome annotation is available. Furthermore, we qualitatively and quantitatively compare RGmatch to other tools. RGmatch simplifies the association of a genomic region with its closest gene. At the same time, it is a powerful tool because the rules used to annotate these associations are very easy to modify according to the researcher's specific interests. Some important differences between RGmatch and other similar tools already in existence are RGmatch's flexibility, its wide range of user options, compatibility with any annotatable organism, and its comprehensive and user-friendly output.
A Review of Computational Intelligence Methods for Eukaryotic Promoter Prediction.
Singh, Shailendra; Kaur, Sukhbir; Goel, Neelam
2015-01-01
In past decades, prediction of genes in DNA sequences has attracted the attention of many researchers but due to its complex structure it is extremely intricate to correctly locate its position. A large number of regulatory regions are present in DNA that helps in transcription of a gene. Promoter is one such region and to find its location is a challenging problem. Various computational methods for promoter prediction have been developed over the past few years. This paper reviews these promoter prediction methods. Several difficulties and pitfalls encountered by these methods are also detailed, along with future research directions.
Xu, Meixiang; Cross, Courtney E; Speidel, Jordan T; Abdel-Rahman, Sherif Z
2016-10-01
The O 6 -methylguanine-DNA methyltransferase (MGMT) protein removes O 6 -alkyl-guanine adducts from DNA. MGMT expression can thus alter the sensitivity of cells and tissues to environmental and chemotherapeutic alkylating agents. Previously, we defined the haplotype structure encompassing single nucleotide polymorphisms (SNPs) in the MGMT promoter/enhancer (P/E) region and found that haplotypes, rather than individual SNPs, alter MGMT promoter activity. The exact mechanism(s) by which these haplotypes exert their effect on MGMT promoter activity is currently unknown, but we noted that many of the SNPs comprising the MGMT P/E haplotypes are located within or in close proximity to putative transcription factor binding sites. Thus, these haplotypes could potentially affect transcription factor binding and, subsequently, alter MGMT promoter activity. In this study, we test the hypothesis that MGMT P/E haplotypes affect MGMT promoter activity by altering transcription factor (TF) binding to the P/E region. We used a promoter binding TF profiling array and a reporter assay to evaluate the effect of different P/E haplotypes on TF binding and MGMT expression, respectively. Our data revealed a significant difference in TF binding profiles between the different haplotypes evaluated. We identified TFs that consistently showed significant haplotype-dependent binding alterations (p ≤ 0.01) and revealed their role in regulating MGMT expression using siRNAs and a dual-luciferase reporter assay system. The data generated support our hypothesis that promoter haplotypes alter the binding of TFs to the MGMT P/E and, subsequently, affect their regulatory function on MGMT promoter activity and expression level.
Faithful transcription initiation from a mitochondrial promoter in transgenic plastids
Bohne, Alexandra-Viola; Ruf, Stephanie; Börner, Thomas; Bock, Ralph
2007-01-01
The transcriptional machineries of plastids and mitochondria in higher plants exhibit striking similarities. All mitochondrial genes and part of the plastid genes are transcribed by related phage-type RNA polymerases. Furthermore, the majority of mitochondrial promoters and a subset of plastid promoters show a similar structural organization. We show here that the plant mitochondrial atpA promoter is recognized by plastid RNA polymerases in vitro and in vivo. The Arabidopsis phage-type RNA polymerase RpoTp, an enzyme localized exclusively to plastids, was found to recognize the mitochondrial atpA promoter in in vitro assays suggesting the possibility that mitochondrial promoters might function as well in plastids. We have, therefore, generated transplastomic tobacco plants harboring in their chloroplast genome the atpA promoter fused to the coding region of the bacterial nptII gene. The chimeric nptII gene was found to be efficiently transcribed in chloroplasts. Mapping of the 5′ ends of the nptII transcripts revealed accurate recognition of the atpA promoter by the chloroplast transcription machinery. We show further that the 5′ untranslated region (UTR) of the mitochondrial atpA transcript is capable of mediating translation in chloroplasts. The functional and evolutionary implications of these findings as well as possible applications in chloroplast genome engineering are discussed. PMID:17959651
Evolution of Hsp70 Gene Expression: A Role for Changes in AT-Richness within Promoters
Ma, Ronghui; Zhang, Bo; Kang, Le
2011-01-01
In disparate organisms adaptation to thermal stress has been linked to changes in the expression of genes encoding heat-shock proteins (Hsp). The underlying genetics, however, remain elusive. We show here that two AT-rich sequence elements in the promoter region of the hsp70 gene of the fly Liriomyza sativae that are absent in the congeneric species, Liriomyza huidobrensis, have marked cis-regulatory consequences. We studied the cis-regulatory consequences of these elements (called ATRS1 and ATRS2) by measuring the constitutive and heat-shock-induced luciferase luminescence that they drive in cells transfected with constructs carrying them modified, deleted, or intact, in the hsp70 promoter fused to the luciferase gene. The elements affected expression level markedly and in different ways: Deleting ATRS1 augmented both the constitutive and the heat-shock-induced luminescence, suggesting that this element represses transcription. Interestingly, replacing the element with random sequences of the same length and A+T content delivered the wild-type luminescence pattern, proving that the element's high A+T content is crucial for its effects. Deleting ATRS2 decreased luminescence dramatically and almost abolished heat-shock inducibility and so did replacing the element with random sequences matching the element's length and A+T content, suggesting that ATRS2's effects on transcription and heat-shock inducibility involve a common mechanism requiring at least in part the element's specific primary structure. Finally, constitutive and heat-shock luminescence were reduced strongly when two putative binding sites for the Zeste transcription factor identified within ATRS2 were altered through site-directed mutagenesis, and the heat-shock-induced luminescence increased when Zeste was over-expressed, indicating that Zeste participates in the effects mapped to ATRS2 at least in part. AT-rich sequences are common in promoters and our results suggest that they should play important
DOE Office of Scientific and Technical Information (OSTI.GOV)
Li Hongwei; Department of Neurological Surgery, University of Virginia Health System, Charlottesville, VA 22908; Li Jinzhong
PSA promoter has been demonstrated the utility for tissue-specific toxic gene therapy in prostate cancer models. Characterization of foreign gene overexpression in normal animals elicited by PSA promoter should help evaluate therapy safety. Here we constructed an adenovirus vector (AdPSA-Luc), containing firefly luciferase gene under the control of the 5837 bp long prostate-specific antigen promoter. A charge coupled device video camera was used to non-invasively image expression of firefly luciferase in nude mice on days 3, 7, 11 after injection of 2 x 10{sup 9} PFU of AdPSA-Luc virus via tail vein. The result showed highly specific expression of themore » luciferase gene in lungs of mice from day 7. The finding indicates the potential limitations of the suicide gene therapy of prostate cancer based on selectivity of PSA promoter. By contrary, it has encouraging implications for further development of vectors via PSA promoter to enable gene therapy for pulmonary diseases.« less
Qamra, Aditi; Xing, Manjie; Padmanabhan, Nisha; Kwok, Jeffrey Jun Ting; Zhang, Shenli; Xu, Chang; Leong, Yan Shan; Lee Lim, Ai Ping; Tang, Qianqao; Ooi, Wen Fong; Suling Lin, Joyce; Nandi, Tannistha; Yao, Xiaosai; Ong, Xuewen; Lee, Minghui; Tay, Su Ting; Keng, Angie Tan Lay; Gondo Santoso, Erna; Ng, Cedric Chuan Young; Ng, Alvin; Jusakul, Apinya; Smoot, Duane; Ashktorab, Hassan; Rha, Sun Young; Yeoh, Khay Guan; Peng Yong, Wei; Chow, Pierce K H; Chan, Weng Hoong; Ong, Hock Soo; Soo, Khee Chee; Kim, Kyoung-Mee; Wong, Wai Keong; Rozen, Steven G; Teh, Bin Tean; Kappei, Dennis; Lee, Jeeyun; Connolly, John; Tan, Patrick
2017-06-01
Promoter elements play important roles in isoform and cell type-specific expression. We surveyed the epigenomic promoter landscape of gastric adenocarcinoma, analyzing 110 chromatin profiles (H3K4me3, H3K4me1, H3K27ac) of primary gastric cancers, gastric cancer lines, and nonmalignant gastric tissues. We identified nearly 2,000 promoter alterations (somatic promoters), many deregulated in various epithelial malignancies and mapping frequently to alternative promoters within the same gene, generating potential pro-oncogenic isoforms ( RASA3 ). Somatic promoter-associated N-terminal peptides displaying relative depletion in tumors exhibited high-affinity MHC binding predictions and elicited potent T-cell responses in vitro , suggesting a mechanism for reducing tumor antigenicity. In multiple patient cohorts, gastric cancers with high somatic promoter usage also displayed reduced T-cell cytolytic marker expression. Somatic promoters are enriched in PRC2 occupancy, display sensitivity to EZH2 therapeutic inhibition, and are associated with novel cancer-associated transcripts. By generating tumor-specific isoforms and decreasing tumor antigenicity, epigenomic promoter alterations may thus drive intrinsic tumorigenesis and also allow nascent cancers to evade host immunity. Significance: We apply epigenomic profiling to demarcate the promoter landscape of gastric cancer. Many tumor-specific promoters activate different promoters in the same gene, some generating pro-oncogenic isoforms. Tumor-specific promoters also reduce tumor antigenicity by causing relative depletion of immunogenic peptides, contributing to cancer immunoediting and allowing tumors to evade host immune attack. Cancer Discov; 7(6); 630-51. ©2017 AACR. This article is highlighted in the In This Issue feature, p. 539 . ©2017 American Association for Cancer Research.
Eye drop delivery of nano-polymeric micelle formulated genes with cornea-specific promoters.
Tong, Yaw-Chong; Chang, Shwu-Fen; Liu, Chia-Yang; Kao, Winston W-Y; Huang, Chong Heng; Liaw, Jiahorng
2007-11-01
This study evaluates the eye drop delivery of genes with cornea-specific promoters, i.e., keratin 12 (K12) and keratocan (Kera3.2) promoters, by non-ionic poly(ethylene oxide)-poly(propylene oxide)-poly(ethylene oxide) (PEO-PPO-PEO) polymeric micelles (PM) to mouse and rabbit eyes, and investigates the underlying mechanisms. Three PM-formulated plasmids (pCMV-Lac Z, pK12-Lac Z and pKera3.2-Lac Z) containing the Lac Z gene for beta-galactosidase (beta-Gal) whose expression was driven by the promoter of either the cytomegalovirus early gene, the keratin 12 gene or the keratocan gene, were characterized by critical micelle concentration (CMC), dynamic light scattering (DLS), and atomic force microscopy (AFM). Transgene expression in ocular tissue after gene delivery was analyzed by 5-bromo-4-chloro-3-indolyl-beta-D-galactoside (X-Gal) color staining, 1,2-dioxetane beta-Gal enzymatic activity measurement, and real-time polymerase chain reaction (PCR) analysis. The delivery mechanisms of plasmid-PM on mouse and rabbit corneas were evaluated by EDTA and RGD (arginine-glycine-aspartic acid) peptide. The sizes of the three plasmid-PM complexes were around 150-200 nm with unimodal distribution. Enhanced stability was found for three plasmid-PM formulations after DNase I treatment. After six doses of eye drop delivery of pK12-Lac Z-PM three times a day, beta-Gal activity was significantly increased in both mouse and rabbit corneas. Stroma-specific Lac Z expression was only found in pKera3.2-Lac Z-PM-treated animals with pretreatment by 5 mM EDTA, an opener of junctions. Lac Z gene expression in both pK12-Lac Z-PM and pKera3.2-Lac Z-PM delivery groups was decreased by RGD peptide pretreatment. Cornea epithelium- and stroma-specific gene expression could be achieved using cornea-specific promoters of keratin 12 and keratocan genes, and the gene was delivered with PM formulation through non-invasive, eye drop in mice and rabbits. The transfection mechanism of plasmid-PM may
Kimura, Yukiko; Nishimura, Fusae T; Abe, Shuntaro; Fukunaga, Tatsushige; Tanii, Hideji; Saijoh, Kiyofumi
2009-02-01
Class II alcohol dehydrogenase (pi-ADH), encoded by alcohol dehydrogenase (ADH4), is considered to contribute to ethanol (EtOH) oxidation in the liver at high concentration. Four single nucleotide polymorphisms (SNPs) were found in the promoter region of this gene. Analysis of genotype distribution in 102 unrelated Japanese subjects revealed that four loci were in strong linkage disequilibrium and could be classified into three haplotypes. The effects of these polymorphisms on transcriptional activity were investigated in HepG2 cells. Transcriptional activity was significantly higher in cells with the -136A allele than in those with the -136C allele. To investigate whether this difference in transcriptional activity caused a difference in EtOH elimination, previous data on blood EtOH changes after 0.4 g/kg body weight alcohol ingestion were analyzed. When analyzed based on aldehyde dehydrogenase-2 gene (ALDH2) (487)Glu/Lys genotype, the significantly lower level of EtOH at peak in subjects with -136C/A and -136A/A genotype compared with subjects with -136C/C genotype indicated that -136 bp was a suggestive locus for differences in EtOH oxidation. This effect was observed only in subjects with ALDH2 (487)Glu/Glu. These results suggested that the SNP at -136bp in the ADH4 promoter had an effect on transcriptional regulation, and that the higher activity of the -136A allele compared with the -136C allele caused a lower level of blood EtOH after alcohol ingestion; that is, individuals with the -136A allele may consume more EtOH and might have a higher risk for development of alcohol dependence than those without the -136A allele.
Pavelitz, Thomas; Bailey, Arnold D.; Elco, Christopher P.; Weiner, Alan M.
2008-01-01
In mammals, small multigene families generate spliceosomal U snRNAs that are nearly as abundant as rRNA. Using the tandemly repeated human U2 genes as a model, we show by footprinting with DNase I and permanganate that nearly all sequences between the enhancer-like distal sequence element and the initiation site are protected during interphase whereas the upstream half of the U2 snRNA coding region is exposed. We also show by chromatin immunoprecipitation that the SNAPc complex, which binds the TATA-like proximal sequence element, is removed at metaphase but remains bound under conditions that induce locus-specific metaphase fragility of the U2 genes, such as loss of CSB, BRCA1, or BRCA2 function, treatment with actinomycin D, or overexpression of the tetrameric p53 C terminus. We propose that the U2 snRNA promoter establishes a persistently open state to facilitate rapid reinitiation and perhaps also to bypass TFIIH-dependent promoter melting; this open state would then be disassembled to allow metaphase chromatin condensation. PMID:18378697
Lentiviral Gene Therapy Using Cellular Promoters Cures Type 1 Gaucher Disease in Mice
Dahl, Maria; Doyle, Alexander; Olsson, Karin; Månsson, Jan-Eric; Marques, André R A; Mirzaian, Mina; Aerts, Johannes M; Ehinger, Mats; Rothe, Michael; Modlich, Ute; Schambach, Axel; Karlsson, Stefan
2015-01-01
Gaucher disease is caused by an inherited deficiency of the enzyme glucosylceramidase. Due to the lack of a fully functional enzyme, there is progressive build-up of the lipid component glucosylceramide. Insufficient glucosylceramidase activity results in hepatosplenomegaly, cytopenias, and bone disease in patients. Gene therapy represents a future therapeutic option for patients unresponsive to enzyme replacement therapy and lacking a suitable bone marrow donor. By proof-of-principle experiments, we have previously demonstrated a reversal of symptoms in a murine disease model of type 1 Gaucher disease, using gammaretroviral vectors harboring strong viral promoters to drive glucosidase β-acid (GBA) gene expression. To investigate whether safer vectors can correct the enzyme deficiency, we utilized self-inactivating lentiviral vectors (SIN LVs) with the GBA gene under the control of human phosphoglycerate kinase (PGK) and CD68 promoter, respectively. Here, we report prevention of, as well as reversal of, manifest disease symptoms after lentiviral gene transfer. Glucosylceramidase activity above levels required for clearance of glucosylceramide from tissues resulted in reversal of splenomegaly, reduced Gaucher cell infiltration and a restoration of hematological parameters. These findings support the use of SIN-LVs with cellular promoters in future clinical gene therapy protocols for type 1 Gaucher disease. PMID:25655314
Zhang, Hongli; Hou, Jiajia; Jiang, Pingping; Qi, Shoumei; Xu, Changzheng; He, Qiuxia; Ding, Zhaohua; Wang, Zhiwu; Zhang, Kewei; Li, Kunpeng
2016-01-01
Salinity and drought often affect plant growth and crop yields. Cloning and identification of salinity and drought stress inducible promoters is of great significance for their use in the genetic improvement of crop resistance. Previous studies showed that phosphatidylinositol synthase is involved in plant salinity and drought stress responses but its promoter has not been characterized by far. In the study, the promoter (pZmPIS, 1834 bp upstream region of the translation initiation site) was isolated from maize genome. To functionally validate the promoter, eight 5′ deletion fragments of pZmPIS in different lengths were fused to GUS to produce pZmPIS::GUS constructs and transformed into tobacco, namely PZ1–PZ8. The transcription activity and expression pattern obviously changed when the promoter was truncated. Previous studies have demonstrated that NaCl and PEG treatments are usually used to simulate salinity and drought treatments. The results showed that PZ1–PZ7 can respond well upon NaCl and PEG treatments, while PZ8 not. PZ7 (467 bp) displayed the highest transcription activity in all tissues of transgenic tobacco amongst 5′ deleted promoter fragments, which corresponds to about 20 and 50% of CaMV35S under normal and NaCl or PEG treatment, respectively. This implied that PZ7 is the core region of pZmPIS which confers high-level gene expression and NaCl or PEG inducible nature. The 113 bp segment between PZ7 and PZ8 (-467 to -355 bp) was considered as the key sequence for ZmPIS responding to NaCl or PEG treatment. GUS transient assay in tobacco leaves showed that this segment was sufficient for the NaCl or PEG stress response. Bioinformatic analysis revealed that the 113 bp sequence may contain new elements that are crucial for ZmPIS response to NaCl or PEG stress. These results promote our understanding on transcriptional regulation mechanism of ZmPIS and the characterized PZ7 promoter fragment would be an ideal candidate for the overexpression of
Nakamura, Mikiko; Suzuki, Ayako; Akada, Junko; Tomiyoshi, Keisuke; Hoshida, Hisashi; Akada, Rinji
2015-12-01
Mammalian gene expression constructs are generally prepared in a plasmid vector, in which a promoter and terminator are located upstream and downstream of a protein-coding sequence, respectively. In this study, we found that front terminator constructs-DNA constructs containing a terminator upstream of a promoter rather than downstream of a coding region-could sufficiently express proteins as a result of end joining of the introduced DNA fragment. By taking advantage of front terminator constructs, FLAG substitutions, and deletions were generated using mutagenesis primers to identify amino acids specifically recognized by commercial FLAG antibodies. A minimal epitope sequence for polyclonal FLAG antibody recognition was also identified. In addition, we analyzed the sequence of a C-terminal Ser-Lys-Leu peroxisome localization signal, and identified the key residues necessary for peroxisome targeting. Moreover, front terminator constructs of hepatitis B surface antigen were used for deletion analysis, leading to the identification of regions required for the particle formation. Collectively, these results indicate that front terminator constructs allow for easy manipulations of C-terminal protein-coding sequences, and suggest that direct gene expression with PCR-amplified DNA is useful for high-throughput protein analysis in mammalian cells.
Alam, Tanvir; Medvedeva, Yulia A.; Jia, Hui; ...
2014-10-02
Transcriptional regulation of protein-coding genes is increasingly well-understood on a global scale, yet no comparable information exists for long non-coding RNA (lncRNA) genes, which were recently recognized to be as numerous as protein-coding genes in mammalian genomes. We performed a genome-wide comparative analysis of the promoters of human lncRNA and protein-coding genes, finding global differences in specific genetic and epigenetic features relevant to transcriptional regulation. These two groups of genes are hence subject to separate transcriptional regulatory programs, including distinct transcription factor (TF) proteins that significantly favor lncRNA, rather than coding-gene, promoters. We report a specific signature of promoter-proximal transcriptionalmore » regulation of lncRNA genes, including several distinct transcription factor binding sites (TFBS). Experimental DNase I hypersensitive site profiles are consistent with active configurations of these lncRNA TFBS sets in diverse human cell types. TFBS ChIP-seq datasets confirm the binding events that we predicted using computational approaches for a subset of factors. For several TFs known to be directly regulated by lncRNAs, we find that their putative TFBSs are enriched at lncRNA promoters, suggesting that the TFs and the lncRNAs may participate in a bidirectional feedback loop regulatory network. Accordingly, cells may be able to modulate lncRNA expression levels independently of mRNA levels via distinct regulatory pathways. Our results also raise the possibility that, given the historical reliance on protein-coding gene catalogs to define the chromatin states of active promoters, a revision of these chromatin signature profiles to incorporate expressed lncRNA genes is warranted in the future.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Alam, Tanvir; Medvedeva, Yulia A.; Jia, Hui
Transcriptional regulation of protein-coding genes is increasingly well-understood on a global scale, yet no comparable information exists for long non-coding RNA (lncRNA) genes, which were recently recognized to be as numerous as protein-coding genes in mammalian genomes. We performed a genome-wide comparative analysis of the promoters of human lncRNA and protein-coding genes, finding global differences in specific genetic and epigenetic features relevant to transcriptional regulation. These two groups of genes are hence subject to separate transcriptional regulatory programs, including distinct transcription factor (TF) proteins that significantly favor lncRNA, rather than coding-gene, promoters. We report a specific signature of promoter-proximal transcriptionalmore » regulation of lncRNA genes, including several distinct transcription factor binding sites (TFBS). Experimental DNase I hypersensitive site profiles are consistent with active configurations of these lncRNA TFBS sets in diverse human cell types. TFBS ChIP-seq datasets confirm the binding events that we predicted using computational approaches for a subset of factors. For several TFs known to be directly regulated by lncRNAs, we find that their putative TFBSs are enriched at lncRNA promoters, suggesting that the TFs and the lncRNAs may participate in a bidirectional feedback loop regulatory network. Accordingly, cells may be able to modulate lncRNA expression levels independently of mRNA levels via distinct regulatory pathways. Our results also raise the possibility that, given the historical reliance on protein-coding gene catalogs to define the chromatin states of active promoters, a revision of these chromatin signature profiles to incorporate expressed lncRNA genes is warranted in the future.« less
Ren, He-Lin; Hu, Yuan; Guo, Ya-Jun; Li, Lu-Lin
2016-06-01
Within Baculoviridae, little is known about the molecular mechanisms of replication in betabaculoviruses, despite extensive studies in alphabaculoviruses. In this study, the promoters of nine late genes of the betabaculovirus Plutella xylostella granulovirus (PlxyGV) were cloned into a transient expression vector and the alphabaculovirus Autographa californica multiple nucleopolyhedrovirus (AcMNPV) genome, and compared with homologous late gene promoters of AcMNPV in Sf9 cells. In transient expression assays, all PlxyGV late promoters were activated in cells transfected with the individual reporter plasmids together with an AcMNPV bacmid. In infected cells, reporter gene expression levels with the promoters of PlxyGV e18 and AcMNPV vp39 and gp41 were significantly higher than those of the corresponding AcMNPV or PlxyGV promoters, which had fewer late promoter motifs. Observed expression levels were lower for the PlxyGV p6.9, pk1, gran, p10a, and p10b promoters than for the corresponding AcMNPV promoters, despite equal numbers of late promoter motifs, indicating that species-specific elements contained in some late promoters were favored by the native viral RNA polymerases for optimal transcription. The 8-nt sequence TAAATAAG encompassing the ATAAG motif was conserved in the AcMNPV polh, p10, and pk1 promoters. The 5-nt sequence CAATT located 4 or 5 nt upstream of the T/ATAAG motif was conserved in the promoters of PlxyGV gran, p10c, and pk1. The results of this study demonstrated that PlxyGV late gene promoters could be effectively activated by the RNA polymerase from AcMNPV, implying that late gene expression systems are regulated by similar mechanisms in alphabaculoviruses and betabaculoviruses.
[The Role of 5-Aza-CdR on Methylation of Promoter in RASSF1A Gene in Endometrial Carcinoma].
Huang, Li-ping; Chen, Chen; Wang, Xue-ping; Liu, Hui
2015-05-01
To explore the effect of demethylating drug 5-Aza-2'-deoxycytidine (5-Aza-CdR) on methtylation status of the Ras-association domain familylA gene (RASSF1A) in human endometrial carcinoma. Randomly'assign the human endometrial carcinoma cell line HEC-1-B into groups and use demethylating drug 5-Aza-CdR of different concentration to treat them. Then Methylation-specific polymerase chain reaction (MSP), real-time PCR, Western blot, TUNEL technology were used to analyze methylation status of RASSF1A promoter CpG islands, RASSF1A mRNA expression, RASSF1A protein expression and apoptosis of HEC-1-B cell. High DNA methylation in RASSF1A gene promoter region, low RASSF1A mRNA level and protein expression and out of control of human endometrial carcinoma cell HEC-1-B apoptosis were observed. 5-Aza-CdR of different concentration could reverse RASSF1A gene's methylation status, recover the expression of mRNA and protein, and control the growth of HEC-1-B by inducing apoptosis. Aberrant methylation of RASSF1A in endometrial cancer as a therapeutic target, demethylating agent 5-Aza-CdR could be an effective way of gene therapy.
Regions of extreme synonymous codon selection in mammalian genes
Schattner, Peter; Diekhans, Mark
2006-01-01
Recently there has been increasing evidence that purifying selection occurs among synonymous codons in mammalian genes. This selection appears to be a consequence of either cis-regulatory motifs, such as exonic splicing enhancers (ESEs), or mRNA secondary structures, being superimposed on the coding sequence of the gene. We have developed a program to identify regions likely to be enriched for such motifs by searching for extended regions of extreme codon conservation between homologous genes of related species. Here we present the results of applying this approach to five mammalian species (human, chimpanzee, mouse, rat and dog). Even with very conservative selection criteria, we find over 200 regions of extreme codon conservation, ranging in length from 60 to 178 codons. The regions are often found within genes involved in DNA-binding, RNA-binding or zinc-ion-binding. They are highly depleted for synonymous single nucleotide polymorphisms (SNPs) but not for non-synonymous SNPs, further indicating that the observed codon conservation is being driven by negative selection. Forty-three percent of the regions overlap conserved alternative transcript isoforms and are enriched for known ESEs. Other regions are enriched for TpA dinucleotides and may contain conserved motifs/structures relating to mRNA stability and/or degradation. We anticipate that this tool will be useful for detecting regions enriched in other classes of coding-sequence motifs and structures as well. PMID:16556911
LuFLA1PRO and LuBGAL1PRO promote gene expression in the phloem fibres of flax (Linum usitatissimum).
Hobson, Neil; Deyholos, Michael K
2013-04-01
Cell type-specific promoters were identified that drive gene expression in an industrially important product. To identify flax (Linum usitatissimum) gene promoters, we analyzed the genomic regions upstream of a fasciclin-like arabinogalactan protein (LuFLA1) and a beta-galactosidase (LuBGAL1). Both of these genes encode transcripts that have been found to be highly enriched in tissues bearing phloem fibres. Using a beta-glucuronidase (GUS) reporter construct, we found that a 908-bp genomic sequence upstream of LuFLA1 (LuFLA1PRO) directed GUS expression with high specificity to phloem fibres undergoing secondary cell wall development. The DNA sequence upstream of LuBGAL1 (LuBGAL1PRO) likewise produced GUS staining in phloem fibres with developing secondary walls, as well as in tissues of developing flowers and seed bolls. These data provide further evidence of a specific role for LuFLA1 in phloem fibre development, and demonstrate the utility of LuFLA1PRO and LuBGAL1PRO as tools for biotechnology and further investigations of phloem fibre development.
Nadjar-Boger, Elisabeth; Funkenstein, Bruria
2011-02-01
Myostatin (MSTN) is a member of the transforming growth factor-ß superfamily that functions as a negative regulator of skeletal muscle development and growth in mammals. Fish express at least two genes for MSTN: MSTN-1 and MSTN-2. To date, MSTN-2 promoters have been cloned only from salmonids and zebrafish. Here we described the cloning and sequence analysis of MSTN-2 gene and its 5' flanking region in the marine fish Sparus aurata (saMSTN-2). We demonstrate the existence of three alleles of the promoter and three alleles of the first intron. Sequence comparison of the promoter region in the three alleles revealed that although the sequences of the first 1050 bp upstream of the translation start site are almost identical in the three alleles, a substantial sequence divergence is seen further upstream. Careful sequence analysis of the region upstream of the first 1050 bp in the three alleles identified several elements that appear to be repeated in some or all sequences, at different positions. This suggests that the promoter region of saMSTN-2 has been subjected to various chromosomal rearrangements during the course of evolution, reflecting either insertion or deletion events. Screening of several genomic DNA collections indicated differences in allele frequency, with allele 'b' being the most abundant, followed by allele 'c', whereas allele 'a' is relatively rare. Sequence analysis of saMSTN-2 gene also revealed polymorphism in the first intron, identifying three alleles. The length difference in alleles '1R' and '2R' of the first intron is due to the presence of one or two copies of a repeated block of approximately 150 bp, located at the 5' end of the first intron. The third allele, '4R', has an additional insertion of 323 bp located 116 bp upstream of the 3' end of the first intron. Analysis of several DNA collections showed that the '2R' allele is the most common, followed by the '4R' allele, whereas the '1R' allele is relatively rare. Progeny analysis of a
Duzyj, Christina M; Paidas, Michael J; Jebailey, Lellean; Huang, Jing Shun; Barnea, Eytan R
2014-01-01
Intimate embryo-maternal interaction is paramount for pregnancy success post-implantation. The embryo follows a specific developmental timeline starting with neural system, dependent on endogenous and decidual factors. Beyond altered genetics/epigenetics, post-natal diseases may initiate at prenatal/neonatal, post-natal period, or through a continuum. Preimplantation factor (PIF) secreted by viable embryos promotes implantation and trophoblast invasion. Synthetic PIF reverses neuroinflammation in non-pregnant models. PIF targets embryo proteins that protect against oxidative stress and protein misfolding. We report of PIF's embryotrophic role and potential to prevent developmental disorders by regulating uterine milieu at implantation and first trimester. PIF's effect on human implantation (human endometrial stromal cells (HESC)) and first-trimester decidua cultures (FTDC) was examined, by global gene expression (Affymetrix), disease-biomarkers ranking (GeneGo), neuro-specific genes (Ingenuity) and proteins (mass-spectrometry). PIF co-cultured epidermal growth factor (EGF) in both HESC and FTDC (Affymetrix) was evaluated. In HESC, PIF promotes neural differentiation and transmission genes (TLX2, EPHA10) while inhibiting retinoic acid receptor gene, which arrests growth. PIF promotes axon guidance and downregulates EGF-dependent neuroregulin signaling. In FTDC, PIF promotes bone morphogenetic protein pathway (SMAD1, 53-fold) and axonal guidance genes (EPH5) while inhibiting PPP2R2C, negative cell-growth regulator, involved in Alzheimer's and amyotrophic lateral sclerosis. In HESC, PIF affects angiotensin via beta-arrestin, transforming growth factor-beta (TGF-β), notch, BMP, and wingless-int (WNT) signaling pathways that promote neurogenesis involved in childhood neurodevelopmental diseases-autism and also affected epithelial-mesenchymal transition involved in neuromuscular disorders. In FTDC, PIF upregulates neural development and hormone signaling, while
2014-01-01
Background Intimate embryo-maternal interaction is paramount for pregnancy success post-implantation. The embryo follows a specific developmental timeline starting with neural system, dependent on endogenous and decidual factors. Beyond altered genetics/epigenetics, post-natal diseases may initiate at prenatal/neonatal, post-natal period, or through a continuum. Preimplantation factor (PIF) secreted by viable embryos promotes implantation and trophoblast invasion. Synthetic PIF reverses neuroinflammation in non-pregnant models. PIF targets embryo proteins that protect against oxidative stress and protein misfolding. We report of PIF’s embryotrophic role and potential to prevent developmental disorders by regulating uterine milieu at implantation and first trimester. Methods PIF’s effect on human implantation (human endometrial stromal cells (HESC)) and first-trimester decidua cultures (FTDC) was examined, by global gene expression (Affymetrix), disease-biomarkers ranking (GeneGo), neuro-specific genes (Ingenuity) and proteins (mass-spectrometry). PIF co-cultured epidermal growth factor (EGF) in both HESC and FTDC (Affymetrix) was evaluated. Results In HESC, PIF promotes neural differentiation and transmission genes (TLX2, EPHA10) while inhibiting retinoic acid receptor gene, which arrests growth. PIF promotes axon guidance and downregulates EGF-dependent neuroregulin signaling. In FTDC, PIF promotes bone morphogenetic protein pathway (SMAD1, 53-fold) and axonal guidance genes (EPH5) while inhibiting PPP2R2C, negative cell-growth regulator, involved in Alzheimer’s and amyotrophic lateral sclerosis. In HESC, PIF affects angiotensin via beta-arrestin, transforming growth factor-beta (TGF-β), notch, BMP, and wingless-int (WNT) signaling pathways that promote neurogenesis involved in childhood neurodevelopmental diseases—autism and also affected epithelial-mesenchymal transition involved in neuromuscular disorders. In FTDC, PIF upregulates neural development
Ajaz, Sadia; Khaliq, Shagufta; Abid, Aiysha; Hassan, Asad Shehzad; Hashmi, Altaf; Sultan, Gauhar; Mohsin, Rehan; Mubarrak, Mohammad; Naqvi, Syed Ali Anwar; Rizvi, Syed Adib-ul-Hasan; Mehdi, Syed Qasim
2011-09-01
Vascular endothelial growth factor (VEGF) protein plays an important role in tumor development and progression. Polymorphisms in the VEGF gene may lead to over- or underexpression of the protein and may be associated with either risk or progression of malignancy. The aim of this case-control study is to identify and quantify the correlation between VEGF polymorphisms and renal cell carcinoma (RCC). Restriction fragment length polymorphism methods were used for the analysis of VEGF polymorphisms at -2578 and +936 positions in the promoter and 3'-untranslated regions, respectively. The VEGF -2578 A-allele was associated with an increased risk of RCC (odds ratio: 1.6; 95% CI: 1.2-2.3) and A-carrier genotypes were strongly correlated (odds ratio: 2.7; 95% CI: 1.5-4.7) with higher risk. Comparison of VEGF +936 C/T polymorphism between patient and control groups revealed no association with renal carcinoma. Both VEGF -2578 C/A and VEGF +936 C/T polymorphisms showed no significant association with the histopathological parameters of RCC. This study shows that VEGF -2578 A-allele and A-carrier genotypes are associated with an increased risk of RCC. In groups with higher incidence of RCC, a screening test for this polymorphism may be recommended in conjunction with other established markers.
An Oomycete CRN Effector Reprograms Expression of Plant HSP Genes by Targeting their Promoters
Song, Tianqiao; Ma, Zhenchuan; Shen, Danyu; Li, Qi; Li, Wanlin; Su, Liming; Ye, Tingyue; Zhang, Meixiang; Wang, Yuanchao; Dou, Daolong
2015-01-01
Oomycete pathogens produce a large number of CRN effectors to manipulate plant immune responses and promote infection. However, their functional mechanisms are largely unknown. Here, we identified a Phytophthora sojae CRN effector PsCRN108 which contains a putative DNA-binding helix-hairpin-helix (HhH) motif and acts in the plant cell nucleus. Silencing of the PsCRN108 gene reduced P. sojae virulence to soybean, while expression of the gene in Nicotiana benthamiana and Arabidopsis thaliana enhanced plant susceptibility to P. capsici. Moreover, PsCRN108 could inhibit expression of HSP genes in A. thaliana, N. benthamiana and soybean. Both the HhH motif and nuclear localization signal of this effector were required for its contribution to virulence and its suppression of HSP gene expression. Furthermore, we found that PsCRN108 targeted HSP promoters in an HSE- and HhH motif-dependent manner. PsCRN108 could inhibit the association of the HSE with the plant heat shock transcription factor AtHsfA1a, which initializes HSP gene expression in response to stress. Therefore, our data support a role for PsCRN108 as a nucleomodulin in down-regulating the expression of plant defense-related genes by directly targeting specific plant promoters. PMID:26714171
An Oomycete CRN Effector Reprograms Expression of Plant HSP Genes by Targeting their Promoters.
Song, Tianqiao; Ma, Zhenchuan; Shen, Danyu; Li, Qi; Li, Wanlin; Su, Liming; Ye, Tingyue; Zhang, Meixiang; Wang, Yuanchao; Dou, Daolong
2015-12-01
Oomycete pathogens produce a large number of CRN effectors to manipulate plant immune responses and promote infection. However, their functional mechanisms are largely unknown. Here, we identified a Phytophthora sojae CRN effector PsCRN108 which contains a putative DNA-binding helix-hairpin-helix (HhH) motif and acts in the plant cell nucleus. Silencing of the PsCRN108 gene reduced P. sojae virulence to soybean, while expression of the gene in Nicotiana benthamiana and Arabidopsis thaliana enhanced plant susceptibility to P. capsici. Moreover, PsCRN108 could inhibit expression of HSP genes in A. thaliana, N. benthamiana and soybean. Both the HhH motif and nuclear localization signal of this effector were required for its contribution to virulence and its suppression of HSP gene expression. Furthermore, we found that PsCRN108 targeted HSP promoters in an HSE- and HhH motif-dependent manner. PsCRN108 could inhibit the association of the HSE with the plant heat shock transcription factor AtHsfA1a, which initializes HSP gene expression in response to stress. Therefore, our data support a role for PsCRN108 as a nucleomodulin in down-regulating the expression of plant defense-related genes by directly targeting specific plant promoters.
Sato, Toshitsugu; Irie, Toshikazu; Yoshino, Fumihiko
2017-08-01
Lentinula edodes (shiitake), which have a powerful ligninolytic system, is one of the most important edible mushrooms in Asia. In this study, we introduced the manganese peroxidase (MnP, EC 1.11.1.13) gene from Pleurotus ostreatus driven by L. edodes laccase 1 gene promoter into L. edodes for expression. The resulting transformant expressed the recombinant gene and showed a higher level of MnP activity than that of the wild-type strain.
Promoters active in interphase are bookmarked during mitosis by ubiquitination
Arora, Mansi; Zhang, Jie; Heine, George F.; Ozer, Gulcin; Liu, Hui-wen; Huang, Kun; Parvin, Jeffrey D.
2012-01-01
We analyzed modification of chromatin by ubiquitination in human cells and whether this mark changes through the cell cycle. HeLa cells were synchronized at different stages and regions of the genome with ubiquitinated chromatin were identified by affinity purification coupled with next-generation sequencing. During interphase, ubiquitin marked the chromatin on the transcribed regions of ∼70% of highly active genes and deposition of this mark was sensitive to transcriptional inhibition. Promoters of nearly half of the active genes were highly ubiquitinated specifically during mitosis. The ubiquitination at the coding regions in interphase but not at promoters during mitosis was enriched for ubH2B and dependent on the presence of RNF20. Ubiquitin labeling of both promoters during mitosis and transcribed regions during interphase, correlated with active histone marks H3K4me3 and H3K36me3 but not a repressive histone modification, H3K27me3. The high level of ubiquitination at the promoter chromatin during mitosis was transient and was removed within 2 h after the cells exited mitosis and entered the next cell cycle. These results reveal that the ubiquitination of promoter chromatin during mitosis is a bookmark identifying active genes during chromosomal condensation in mitosis, and we suggest that this process facilitates transcriptional reactivation post-mitosis. PMID:22941662
Fernández, Cecilia S; Bruque, Carlos D; Taboas, Melisa; Buzzalino, Noemí D; Espeche, Lucia D; Pasqualini, Titania; Charreau, Eduardo H; Alba, Liliana G; Ghiringhelli, Pablo D; Dain, Liliana
2015-09-01
The aim of the current study was to search for the presence of genetic variants in the CYP21A2 Z promoter regulatory region in patients with congenital adrenal hyperplasia due to 21-hydroxylase deficiency. Screening of the 10 most frequent pseudogene-derived mutations was followed by direct sequencing of the entire coding sequence, the proximal promoter, and a distal regulatory region in DNA samples from patients with at least one non-determined allele. We report three non-classical patients that presented a novel genetic variant-g.15626A>G-within the Z promoter regulatory region. In all the patients, the novel variant was found in cis with the mild, less frequent, p.P482S mutation located in the exon 10 of the CYP21A2 gene. The putative pathogenic implication of the novel variant was assessed by in silico analyses and in vitro assays. Topological analyses showed differences in the curvature and bendability of the DNA region bearing the novel variant. By performing functional studies, a significantly decreased activity of a reporter gene placed downstream from the regulatory region was found by the G transition. Our results may suggest that the activity of an allele bearing the p.P482S mutation may be influenced by the misregulated CYP21A2 transcriptional activity exerted by the Z promoter A>G variation.
Funata, Sayaka; Matsusaka, Keisuke; Yamanaka, Ryota; Yamamoto, Shogo; Okabe, Atsushi; Fukuyo, Masaki; Aburatani, Hiroyuki; Fukayama, Masashi; Kaneda, Atsushi
2017-08-15
Aberrant DNA hypermethylation is a major epigenetic mechanism to inactivate tumor suppressor genes in cancer. Epstein-Barr virus positive gastric cancer is the most frequently hypermethylated tumor among human malignancies. Herein, we performed comprehensive analysis of epigenomic alteration during EBV infection, by Infinium HumanMethylation 450K BeadChip for DNA methylation and ChIP-sequencing for histone modification alteration during EBV infection into gastric cancer cell line MKN7. Among 7,775 genes with increased DNA methylation in promoter regions, roughly half were "DNA methylation-sensitive" genes, which acquired DNA methylation in the whole promoter regions and thus were repressed. These included anti-oncogenic genes, e.g. CDKN2A . The other half were "DNA methylation-resistant" genes, where DNA methylation is acquired in the surrounding of promoter regions, but unmethylated status is protected in the vicinity of transcription start site. These genes thereby retained gene expression, and included DNA repair genes. Histone modification was altered dynamically and coordinately with DNA methylation alteration. DNA methylation-sensitive genes significantly correlated with loss of H3K27me3 pre-marks or decrease of active histone marks, H3K4me3 and H3K27ac. Apoptosis-related genes were significantly enriched in these epigenetically repressed genes. Gain of active histone marks significantly correlated with DNA methylation-resistant genes. Genes related to mitotic cell cycle and DNA repair were significantly enriched in these epigenetically activated genes. Our data show that orchestrated epigenetic alterations are important in gene regulation during EBV infection, and histone modification status in promoter regions significantly associated with acquisition of de novo DNA methylation or protection of unmethylated status at transcription start site.
Identification of genes from the Treacher Collins candidate region
DOE Office of Scientific and Technical Information (OSTI.GOV)
Dixon, M.; Dixon, J.; Edwards, S.
Treacher Collins syndrome (TCOF1) is an autosomal dominant disorder of craniofacial development. The TCOF1 locus has previously been mapped to chromosome 5q32-33. The candidate gene region has been defined as being between two flanking markers, ribosomal protein S14 (RPS14) and Annexin 6 (ANX6), by analyzing recombination events in affected individuals. It is estimated that the distance between these flanking markers is 500 kb by three separate analysis methods: (1) radiation hybrid mapping; (2) genetic linkage; and (3) YAC contig analysis. A cosmid contig which spans the candidate gene region for TCOF1 has been constructed by screening the Los Alamos Nationalmore » Laboratory flow-sorted chromosome 5 cosmid library. Cosmids were obtained by using a combination of probes generated from YAC end clones, Alu-PCR fragments from YACs, and asymmetric PCR fragments from both T7 and T3 cosmid ends. Exon amplifications, the selection of genomic coding sequences based upon the presence of functional splice acceptor and donor sites, was used to identify potential exon sequences. Sequences found to be conserved between species were then used to screen cDNA libraries in order to identify candidate genes. To date, four different cDNAs have been isolated from this region and are being analyzed as potential candidate genes for TCOF1. These include the genes encoding plasma glutathione peroxidase (GPX3), heparin sulfate sulfotransferase (HSST), a gene with homology to the ETS family of proteins and one which shows no homology to any known genes. Work is also in progress to identify and characterize additional cDNAs from the candidate gene region.« less
Association of Interleukin-10 gene promoter polymorphisms with obstructive sleep apnea.
Özdaş, Sibel; Özdaş, Talih; Acar, Mustafa; Erbek, Selim S; Köseoğlu, Sabri; Göktürk, Gökhan; Izbirak, Afife
2016-05-01
Interleukin-10 (IL) is an anti-inflammatory cytokine that regulates normal sleep patterns, and recent studies have reported that it is a potential useful biomarker to identify presence and severity of sleep apnea syndrome (OSAS). Promoter polymorphisms of IL-10 gene have been associated with altered expression levels, which contributes to OSAS. The aim of this study was to determine the prevalence of -1082 G/A, -819 C/T, and -592 C/A promoter polymorphisms of IL-10 gene in individuals with OSAS and controls. An open-label study was performed in the Otorhinolaryngology and Sleep Disorders Outpatient Clinics. One hundred four cases with OSAS were included as the study group, and 78 individuals without OSAS were included as the controls. DNAs were extracted from peripheral blood leukocytes, and the sites that encompassed those polymorphisms were identified by DNA sequencing analyses. Data were analyzed with SNPStats and multifactor dimensionality reduction (MDR) software. The prevalence of OSAS was higher in males in the study group when compared to controls (P = 0.0003). The IL-10-1082 G/A, -819 C/T, and -592 C/A SNPs, and their minor alleles were associated with a significantly increased risk for OSAS compared to the controls (P ˂ 0.05 for all). Furthermore, ATA haplotype frequency was significantly higher in the study group compared to the control group, but the GCC haplotype frequency was lower (P = 0.0001 and P = 0.0001). As indicated in MDR analysis, combinations of IL-10 gene were associated with OSAS in single-, double-, and triple-locus analyses. The prevalences of the IL-10 gene promoter polymorphisms were different in OSAS patients and the controls in Turkish population. IL-10 gene polymorphisms may lead to altered inflammatory cascade, which might contribute to OSAS. Further studies on larger cohorts are needed to validate our findings.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Ma, Jing; Chen, Xi; Liu, Yanan
2015-12-01
Ancestral TCDD exposure could induce epigenetic transgenerational phenotypes, which may be mediated in part by imprinted gene inheritance. The aim of our study was to evaluate the transgenerational effects of ancestral TCDD exposure on the imprinted gene insulin-like growth factor-2 (Igf2) in rat somatic tissue. TCDD was administered daily by oral gavage to groups of F0 pregnant SD rats at dose levels of 0 (control), 200 or 800 ng/kg bw during gestation day 8–14. Animal transgenerational model of ancestral exposure to TCDD was carefully built, avoiding sibling inbreeding. Hepatic Igf2 expression of the TCDD male progeny was decreased concomitantly withmore » hepatic damage and increased activities of serum hepatic enzymes both in the F1 and F3 generation. Imprinted Control Region (ICR) of Igf2 manifested a hypermethylated pattern, whereas methylation status in the Differentially Methylated Region 2 (DMR2) showed a hypomethylated manner in the F1 generation. These epigenetic alterations in these two regions maintained similar trends in the F3 generation. Meanwhile, the expressions of DNA methyltransferases (DNMT1, DNMT3A and DNMT3B) changed in a non-monotonic manner both in the F1 and F3 generation. This study provides evidence that ancestral TCDD exposure may promote epigenetic transgenerational alterations of imprinted gene Igf2 in adult somatic tissue. - Highlights: • Ancestral TCDD exposure induces epigenetic transgenerational inheritance. • Ancestral TCDD exposure affects methylation status in ICR and DMR2 region of Igf2. • DNMTs play a role in TCDD induced epigenetic transgenerational changes of Igf2.« less
Carbajo, Daniel; Magi, Shigeyuki; Itoh, Masayoshi; Kawaji, Hideya; Lassmann, Timo; Arner, Erik; Forrest, Alistair R R; Carninci, Piero; Hayashizaki, Yoshihide; Daub, Carsten O; Okada-Hatakeyama, Mariko; Mar, Jessica C
2015-01-01
Understanding how cells use complex transcriptional programs to alter their fate in response to specific stimuli is an important question in biology. For the MCF-7 human breast cancer cell line, we applied gene expression trajectory models to identify the genes involved in driving cell fate transitions. We modified trajectory models to account for the scenario where cells were exposed to different stimuli, in this case epidermal growth factor and heregulin, to arrive at different cell fates, i.e. proliferation and differentiation respectively. Using genome-wide CAGE time series data collected from the FANTOM5 consortium, we identified the sets of promoters that were involved in the transition of MCF-7 cells to their specific fates versus those with expression changes that were generic to both stimuli. Of the 1,552 promoters identified, 1,091 had stimulus-specific expression while 461 promoters had generic expression profiles over the time course surveyed. Many of these stimulus-specific promoters mapped to key regulators of the ERK (extracellular signal-regulated kinases) signaling pathway such as FHL2 (four and a half LIM domains 2). We observed that in general, generic promoters peaked in their expression early on in the time course, while stimulus-specific promoters tended to show activation of their expression at a later stage. The genes that mapped to stimulus-specific promoters were enriched for pathways that control focal adhesion, p53 signaling and MAPK signaling while generic promoters were enriched for cell death, transcription and the cell cycle. We identified 162 genes that were controlled by an alternative promoter during the time course where a subset of 37 genes had separate promoters that were classified as stimulus-specific and generic. The results of our study highlighted the degree of complexity involved in regulating a cell fate transition where multiple promoters mapping to the same gene can demonstrate quite divergent expression profiles.
Tyrka, A R; Parade, S H; Welch, E S; Ridout, K K; Price, L H; Marsit, C; Philip, N S; Carpenter, L L
2016-07-05
Early adversity increases risk for developing psychopathology. Epigenetic modification of stress reactivity genes is a likely mechanism contributing to this risk. The glucocorticoid receptor (GR) gene is of particular interest because of the regulatory role of the GR in hypothalamic-pituitary-adrenal (HPA) axis function. Mounting evidence suggests that early adversity is associated with GR promoter methylation and gene expression. Few studies have examined links between GR promoter methylation and psychopathology, and findings to date have been mixed. Healthy adult participants (N=340) who were free of psychotropic medications reported on their childhood experiences of maltreatment and parental death and desertion. Lifetime depressive and anxiety disorders and past substance-use disorders were assessed using the Structured Clinical Interview for the Diagnostic and Statistical Manual of Mental Disorders, Fourth Edition. Methylation of exon 1F of the GR gene (NR3C1) was examined in leukocyte DNA via pyrosequencing. On a separate day, a subset of the participants (n=231) completed the dexamethasone/corticotropin-releasing hormone (Dex/CRH) test. Childhood adversity and a history of past substance-use disorder and current or past depressive or anxiety disorders were associated with lower levels of NR3C1 promoter methylation across the region as a whole and at individual CpG sites (P<0.05). The number of adversities was negatively associated with NR3C1 methylation in participants with no lifetime disorder (P=0.018), but not in those with a lifetime disorder. GR promoter methylation was linked to altered cortisol responses to the Dex/CRH test (P<0.05). This study presents evidence of reduced methylation of NR3C1 in association with childhood maltreatment and depressive, anxiety and substance-use disorders in adults. This finding stands in contrast to our prior work, but is consistent with emerging findings, suggesting complexity in the regulation of this gene.
Furlan, Daniela; Sahnane, Nora; Bernasconi, Barbara; Frattini, Milo; Tibiletti, Maria Grazia; Molinari, Francesca; Marando, Alessandro; Zhang, Lizhi; Vanoli, Alessandro; Casnedi, Selenia; Adsay, Volkan; Notohara, Kenji; Albarello, Luca; Asioli, Sofia; Sessa, Fausto; Capella, Carlo; La Rosa, Stefano
2014-05-01
Genetic and epigenetic alterations involved in the pathogenesis of pancreatic acinar cell carcinomas (ACCs) are poorly characterized, including the frequency and role of gene-specific hypermethylation, chromosome aberrations, and copy number alterations (CNAs). A subset of ACCs is known to show alterations in the APC/β-catenin pathway which includes mutations of APC gene. However, it is not known whether, in addition to mutation, loss of APC gene function can occur through alternative genetic and epigenetic mechanisms such as gene loss or promoter methylation. We investigated the global methylation profile of 34 tumor suppressor genes, CNAs of 52 chromosomal regions, and APC gene alterations (mutation, methylation, and loss) together with APC mRNA level in 45 ACCs and related peritumoral pancreatic tissues using methylation-specific multiplex ligation probe amplification (MS-MLPA), fluorescence in situ hybridization (FISH), mutation analysis, and reverse transcription-droplet digital PCR. ACCs did not show an extensive global gene hypermethylation profile. RASSF1 and APC were the only two genes frequently methylated. APC mutations were found in only 7 % of cases, while APC loss and methylation were more frequently observed (48 and 56 % of ACCs, respectively). APC mRNA low levels were found in 58 % of cases and correlated with CNAs. In conclusion, ACCs do not show extensive global gene hypermethylation. APC alterations are frequently involved in the pathogenesis of ACCs mainly through gene loss and promoter hypermethylation, along with reduction of APC mRNA levels.
Transactivation of the proximal promoter of human oxytocin gene by TR4 orphan receptor
DOE Office of Scientific and Technical Information (OSTI.GOV)
Wang, C.-P.; Lee, Y.-F.; Chang, C.
2006-12-08
The human testicular receptor 4 (TR4) shares structural homology with members of the nuclear receptor superfamily. Some other members of this superfamily were able to regulate the transcriptional activity of the human oxytocin (OXT) promoter by binding to the first DR0 regulatory site. However, little investigation was conducted systematically in the study of the second dDR4 site of OXT proximal promoter, and the relationship between the first and the second sites of OXT promoter. Here, we demonstrated for the first time that TR4 could increase the proximal promoter activity of the human OXT gene via DR0, dDR4, and OXT (bothmore » DR0 and dDR4) elements, respectively. TR4 might induce OXT gene expression through the OXT element in a dose-dependent manner. However, there is no synergistic effect between DR0 and dDR4 elements during TR4 transactivation. Taken together, these results suggested that TR4 should be one of important regulators of OXT gene expression.« less
PAX6 MiniPromoters drive restricted expression from rAAV in the adult mouse retina
Hickmott, Jack W; Chen, Chih-yu; Arenillas, David J; Korecki, Andrea J; Lam, Siu Ling; Molday, Laurie L; Bonaguro, Russell J; Zhou, Michelle; Chou, Alice Y; Mathelier, Anthony; Boye, Sanford L; Hauswirth, William W; Molday, Robert S; Wasserman, Wyeth W; Simpson, Elizabeth M
2016-01-01
Current gene therapies predominantly use small, strong, and readily available ubiquitous promoters. However, as the field matures, the availability of small, cell-specific promoters would be greatly beneficial. Here we design seven small promoters from the human paired box 6 (PAX6) gene and test them in the adult mouse retina using recombinant adeno-associated virus. We chose the retina due to previous successes in gene therapy for blindness, and the PAX6 gene since it is: well studied; known to be driven by discrete regulatory regions; expressed in therapeutically interesting retinal cell types; and mutated in the vision-loss disorder aniridia, which is in need of improved therapy. At the PAX6 locus, 31 regulatory regions were bioinformatically predicted, and nine regulatory regions were constructed into seven MiniPromoters. Driving Emerald GFP, these MiniPromoters were packaged into recombinant adeno-associated virus, and injected intravitreally into postnatal day 14 mice. Four MiniPromoters drove consistent retinal expression in the adult mouse, driving expression in combinations of cell-types that endogenously express Pax6: ganglion, amacrine, horizontal, and Müller glia. Two PAX6-MiniPromoters drive expression in three of the four cell types that express PAX6 in the adult mouse retina. Combined, they capture all four cell types, making them potential tools for research, and PAX6-gene therapy for aniridia. PMID:27556059
PAX6 MiniPromoters drive restricted expression from rAAV in the adult mouse retina.
Hickmott, Jack W; Chen, Chih-Yu; Arenillas, David J; Korecki, Andrea J; Lam, Siu Ling; Molday, Laurie L; Bonaguro, Russell J; Zhou, Michelle; Chou, Alice Y; Mathelier, Anthony; Boye, Sanford L; Hauswirth, William W; Molday, Robert S; Wasserman, Wyeth W; Simpson, Elizabeth M
2016-01-01
Current gene therapies predominantly use small, strong, and readily available ubiquitous promoters. However, as the field matures, the availability of small, cell-specific promoters would be greatly beneficial. Here we design seven small promoters from the human paired box 6 (PAX6) gene and test them in the adult mouse retina using recombinant adeno-associated virus. We chose the retina due to previous successes in gene therapy for blindness, and the PAX6 gene since it is: well studied; known to be driven by discrete regulatory regions; expressed in therapeutically interesting retinal cell types; and mutated in the vision-loss disorder aniridia, which is in need of improved therapy. At the PAX6 locus, 31 regulatory regions were bioinformatically predicted, and nine regulatory regions were constructed into seven MiniPromoters. Driving Emerald GFP, these MiniPromoters were packaged into recombinant adeno-associated virus, and injected intravitreally into postnatal day 14 mice. Four MiniPromoters drove consistent retinal expression in the adult mouse, driving expression in combinations of cell-types that endogenously express Pax6: ganglion, amacrine, horizontal, and Müller glia. Two PAX6-MiniPromoters drive expression in three of the four cell types that express PAX6 in the adult mouse retina. Combined, they capture all four cell types, making them potential tools for research, and PAX6-gene therapy for aniridia.
Nomura, M; Tsujimura, A; Begum, N A; Matsumoto, M; Wabiko, H; Toyoshima, K; Seya, T
2000-01-01
The murine membrane cofactor protein (CD46) gene is expressed exclusively in testis, in contrast to human CD46, which is expressed ubiquitously. To elucidate the mechanism of differential CD46 gene expression among species, we cloned entire murine CD46 genomic DNA and possible regulatory regions were placed in the flanking region of the luciferase reporter gene. The reporter gene assay revealed a silencing activity not in the promoter, but in the 3'-flanking region of the gene and the silencer-like element was identified within a 0.2-kb region between 0.6 and 0.8 kb downstream of the stop codon. This silencer-like element was highly similar to that of the pig MHC class-I gene. The introduction of a mutation into this putative silencer element of murine CD46 resulted in an abrogation of the silencing effect. Electrophoretic mobility-shift assay indicated the presence of the binding molecule(s) for this silencer sequence in murine cell lines and tissues. A size difference of the protein-silencer-element complex was observed depending upon the solubilizers used for preparation of the nuclear extracts. A mutated silencer sequence failed to interact with the binding molecules. The level of the binding factor was lower in the testicular germ cells compared with other organs. Thus the silencer element and its binding factor may play a role in transcriptional regulation of murine CD46 gene expression. These results imply that the effects of the CD46 silencer element encompass the innate immune and reproductive systems, and in mice may determine the testicular germ-cell-dominant expression of CD46. PMID:11023821
Tong, Ying; Zheng, Kang; Zhao, Shufang; Xiao, Guanxiu; Luo, Chen
2012-11-01
Recent studies demonstrated that sequence divergence in both transcriptional regulatory region and coding region contributes to the subfunctionalization of duplicate gene. However, whether sequence divergence in the 3'-untranslated region (3'-UTR) has an impact on the subfunctionalization of duplicate genes remains unclear. Here, we identified two diverging duplicate vsx1 (visual system homeobox-1) loci in goldfish, named vsx1A1 and vsx1A2. Phylogenetic analysis suggests that vsx1A1 and vsx1A2 may arise from a duplication of vsx1 after the separation of goldfish and zebrafish. Sequence comparison revealed that divergence in both transcriptional and translational regulatory regions is higher than divergence in the introns. vsx1A2 expresses during blastula and gastrula stages and in adult retina but silences from segmentation stage to hatching stage, vsx1A1 starts expression from segmentation onward. Comparing to that zebrafish vsx1 expresses in all the developmental stages and in the adult retina, it appears that goldfish vsx1A1 and vsx1A2 are under going to share the functions of ancestral vsx1. The different but overlapping temporal expression patterns of vsx1A1 and vsx1A2 suggest that sequence divergence in the promoter region of duplicate vsx1 is not sufficient for partitioning the functions of ancestral vsx1. By comparing vsx1A1 and vsx1A2 3'-UTR-linked green fluorescent protein gene expression patterns, we demonstrated that the 3'-UTR of vsx1A1 remains but the 3'-UTR of vsx1A2 has lost the capability of mediating bipolar cell specific expression during retina development. These results indicate that sequence divergence in the 3'-UTRs has a clear effect on subfunctionalization of the duplicate genes. © 2012 WILEY PERIODICALS, INC.
Moschetti, R; Marsano, R M; Barsanti, P; Caggese, C; Caizzi, R
2004-05-01
Foldback ( FB) elements are transposable elements found in many eukaryotic genomes; they are thought to contribute significantly to genome plasticity. In Drosophila melanogaster, FBs have been shown to be involved in the transposition of large chromosomal regions and in the genetic instability of some alleles of the white gene. In this report we show that FB mediated transposition of w(67C23), a mutation that deletes the promoter of the white gene and its first exon, containing the start codon, can restore expression of the white gene. We have characterized three independent events in which a 14-kb fragment from the w(67C23) locus was transposed into an intron region in three different genes. In each case a local promoter drives the expression of white, producing a chimeric mRNA. These findings suggest that, on an evolutionary timescale, FB elements may contribute to the creation of new genes via exon shuffling.
Vargas, José Eduardo; Salton, Gabrielle; Sodré de Castro Laino, Andressa; Pires, Tiago Dalberto; Bonamino, Martin; Lenz, Guido; Delgado-Cañedo, Andrés
2012-11-01
Gene transfer based on lentiviral vectors allow the integration of exogenous genes into the genome of a target cell, turning these vectors into one of the most used methods for stable transgene expression in mammalian cells, in vitro and in vivo. Currently, there are no lentivectors that allow the cloning of different genes to be regulated by different promoters. Also, there are none that permit the analysis of the expression through an IRES (internal ribosome entry site)-- reporter gene system. In this work, we have generated a series of lentivectors containing: (1) a malleable structure to allow the cloning of different target genes in a multicloning site (mcs); (2) unique site to exchange promoters, and (3) IRES followed by one of two reporter genes: eGFP or DsRed. The series of the produced vectors were named pLR (for lentivirus and RSV promoter) and were fairly efficient with a strong fluorescence of the reporter genes in direct transfection and viral transduction experiments. This being said, the pLR series have been found to be powerful biotechnological tools for stable gene transfer and expression. Copyright © 2012 Elsevier Inc. All rights reserved.
Müller, Joachim G; Isomatsu, Yukihisa; Koushik, Srinagesh V; O'Quinn, Michael; Xu, Lin; Kappler, Christiana S; Hapke, Elizabeth; Zile, Michael R; Conway, Simon J; Menick, Donald R
2002-02-08
The NCX1 gene contains three promoters (H1, K1, and Br1), and as a result of alternative promoter usage and alternative splicing, there are multiple tissue-specific variants of the Na(+)-Ca(2+) exchanger. We have proposed that for NCX1, the H1 promoter regulates expression in the heart, the K1 promoter regulates expression in the kidney, and the Br1 promoter regulates expression in the brain as well as low-level ubiquitous expression. Here, using a transgenic mouse model, we test the role of the DNA region including -1831 to 67 bp of intron 1, encompassing exon H1 of the feline NCX1 gene (NCX1H1). The NCX1H1 promoter was sufficient for driving the normal spatiotemporal pattern of NCX1 expression in cardiac development. The luciferase reporter gene was expressed in a heart-restricted pattern both in early embryos (embryonic days 8 to 14) and in later embryos (after embryonic day 14), when NCX1 is also expressed in other tissues. In the adult, no luciferase activity was detected in the kidney, liver, spleen, uterus, or skeletal muscle; minimal activity was detected in the brain; and very high levels of luciferase expression were detected in the heart. Transverse aortic constriction-operated mice showed significantly increased left ventricular mass after 7 days. In addition, there was a 2-fold upregulation of NCX1H1 promoter activity in the left ventricle in animals after 7 days of pressure overload compared with both control and sham-operated animals. This work demonstrates that the NCX1H1 promoter directs cardiac-specific expression of the exchanger in both the embryo and adult and is also sufficient for the upregulation of NCX1 in response to pressure overload.
Chiou, Ming-Jyun; Chao, Tsung-Tai; Wu, Jen-Leih; Kuo, Ching-Ming; Chen, Jyh-Yih
2006-10-20
During mouse embryogenesis, CTGF/CCN2 is expressed in zones containing hypertrophic chondroctyes and calcifying cartilage such as long bones, ribs, vertebral column, and phalanges. But in fish, its expression is yet unclear. Development of the vertebrae is morphologically similar among vertebrates, indicating that the underlying mechanism regulating the process is highly conserved during evolution. Analysis of 3.2kb of the CTGF/CCN2 proximal promoter sequence revealed a consensus TATAA box, putative AP1, Brn-2, CdxA, C/EBP alpha, C/EBP beta, C-Ets-, delta E, HFH-2, and HSF2 binding sites. Transient expression experiments with a 5'-deletion revealed at least 4 regulatory regions in the zebrafish CTGF/CCN2 gene, 2 with a stimulatory effect on transcription and 2 with an apparent inhibitory effect after IGF-I treatment in the ZFL cell line. To study the promoter-specific expression, we constructed a series of CTGF/CCN2 (3.0-, 2.5-, 2.0-, 1.5-, 1.0-, and 0.4-kb) promoter-driven green fluorescent protein (GFP) fragments encoding the GFP cDNA transgene which was microinjected into zebrafish embryos. Morphological studies of transgenic zebrafish indicated that the CTGF/CCN2 promoter-driven GFP transcripts appeared in the notochord. Targeted knockdown of the CTGF/CCN2 gene by two antisense morpholino oligonucleotides resulted in disruptions to notochord development. From a comparative point of view, this study of the CTGF/CCN2 gene in zebrafish may correlate well with those previously published on the mouse. These molecular results suggest that CTGF/CCN2 plays an important role in notochord development and is required for general embryonic development.
Crowther, Lisa M; Wang, Shu-Ching Mary; Eriksson, Natalie A; Myers, Stephen A; Murray, Lauren A; Muscat, George E O
2011-02-24
We demonstrate that chicken ovalbumin upstream promoter-transcription factor II (COUP-TFII) mRNA is more abundantly expressed (than COUP-TFI mRNA) in skeletal muscle C2C12 cells and in (type I and II) skeletal muscle tissue from C57BL/10 mice. Consequently, we have utilized the ABI TaqMan Low Density Array (TLDA) platform to analyze gene expression changes specifically attributable to ectopic COUP-TFII (relative to vector only) expression in muscle cells. Utilizing a TLDA-based platform and 5 internal controls, we analyze the entire NR superfamily, 96 critical metabolic genes, and 48 important myogenic regulatory genes on the TLDA platform utilizing 5 internal controls. The low density arrays were analyzed by rigorous statistical analysis (with Genorm normalization, Bioconductor R, and the Empirical Bayes statistic) using the (integromics) statminer software. In addition, we validated the differentially expressed patho-physiologically relevant gene (identified on the TLDA platform) glucose transporter type 4 (Glut4). We demonstrated that COUP-TFII expression increased the steady state levels of Glut4 mRNA and protein, while ectopic expression of truncated COUP-TFII lacking helix 12 (COUP-TFΔH12) reduced Glut4 mRNA expression in C2C12 cells. Moreover, COUP-TFII expression trans-activated the Glut4 promoter (-997/+3), and ChIP analysis identified selective recruitment of COUP-TFII to a region encompassing a highly conserved SP1 binding site (in mouse, rat, and human) at nt positions -131/-118. Mutation of the SpI site ablated COUP-TFII mediated trans-activation of the Glut4 promoter. In conclusion, this study demonstrates that in skeletal muscle cells, COUP-TFII regulates several nuclear hormone receptors, and critical metabolic and muscle specific genes.
Sakumi, K; Sekiguchi, M
1989-01-20
The Ada protein of Escherichia coli catalyzes transfer of methyl groups from methylated DNA to its own molecule, and the methylated form of Ada protein promotes transcription of its own gene, ada. Using an in vitro reconstituted system, we found that both the sigma factor and the methylated Ada protein are required for transcription of the ada gene. To elucidate molecular mechanisms involved in the regulation of the ada transcription, we investigated interactions of the non-methylated and methylated forms of Ada protein and the RNA polymerase holo enzyme (the core enzyme and sigma factor) with a DNA fragment carrying the ada promoter region. Footprinting analyses revealed that the methylated Ada protein binds to a region from positions -63 to -31, which includes the ada regulatory sequence AAAGCGCA. No firm binding was observed with the non-methylated Ada protein, although some DNase I-hypersensitive sites were produced in the promoter by both types of Ada protein. RNA polymerase did bind to the promoter once the methylated Ada protein had bound to the upstream sequence. To correlate these phenomena with the process in vivo, we used the DNAs derived from promoter-defective mutants. No binding of Ada protein nor of RNA polymerase occurred with a mutant DNA having a C to G substitution at position -47 within the ada regulatory sequence. In the case of a -35 box mutant with a T to A change at position -34, the methylated Ada protein did bind to the ada regulatory sequence, yet there was no RNA polymerase binding. Thus, the binding of the methylated Ada protein to the upstream region apparently facilitates binding of the RNA polymerase to the proper region of the promoter. The Ada protein possesses two known methyl acceptor sites, Cys69 and Cys321. The role of methylation of each cysteine residue was investigated using mutant forms of the Ada protein. The Ada protein with the cysteine residue at position 69 replaced by alanine was incapable of binding to the ada
Functional genetic variants within the SIRT2 gene promoter in type 2 diabetes mellitus.
Liu, Tingting; Yang, Wentao; Pang, Shuchao; Yu, Shipeng; Yan, Bo
2018-03-01
Type 2 diabetes mellitus (T2D) is a common and complex metabolic diseases caused by interactions between environmental and genetic factors. Genome-wide association studies have identified more than 80 common genetic variants for T2D, which account for only ∼10% of the heritability of T2D cases. SIRT2, a member of NAD(+)-dependent class III deacetylases, is involved in genomic stability, metabolism, inflammation, oxidative stress and autophagy. In maintaining metabolic homeostasis, SIRT2 regulates adipocyte differentiation, fatty acid oxidation, gluconeogenesis, and insulin sensitivity. Thus, we hypothesized that DNA sequence variants (DSVs) in SIRT2 gene promoter may change SIRT2 levels, contributing to T2D. SIRT2 gene promoter was genetically and functionally analyzed in large cohorts of T2D patients (n = 365) and ethnic-matched controls (n = 358). A total of 18 DSVs, including 5 SNPs, were identified in this study. Four novel heterozygous DSVs (g.38900912G > T, g.38900561C > T, g.38900359C > T and g.38900237G > A) were identified in four T2D patients, three of which (g.38900912G > T, g.38900359C > T and g.38900237G > A) significantly increased the transcriptional activity of the SIRT2 gene promoter in cultured pancreatic beta cells (P < .01). Seven novel heterozygous DSVs were only found in controls, and one heterozygous deletion DSV and five SNPs were found in both T2D patients and controls, which did not significantly affect SIRT2 gene promoter activity (P > .05). Our findings suggested that the DSVs may increase SIRT2 gene promoter activity and SIRT2 levels, contributing to T2D development as a risk factor. Copyright © 2018 Elsevier B.V. All rights reserved.
Funata, Sayaka; Matsusaka, Keisuke; Yamanaka, Ryota; Yamamoto, Shogo; Okabe, Atsushi; Fukuyo, Masaki; Aburatani, Hiroyuki; Fukayama, Masashi; Kaneda, Atsushi
2017-01-01
Aberrant DNA hypermethylation is a major epigenetic mechanism to inactivate tumor suppressor genes in cancer. Epstein-Barr virus positive gastric cancer is the most frequently hypermethylated tumor among human malignancies. Herein, we performed comprehensive analysis of epigenomic alteration during EBV infection, by Infinium HumanMethylation 450K BeadChip for DNA methylation and ChIP-sequencing for histone modification alteration during EBV infection into gastric cancer cell line MKN7. Among 7,775 genes with increased DNA methylation in promoter regions, roughly half were “DNA methylation-sensitive” genes, which acquired DNA methylation in the whole promoter regions and thus were repressed. These included anti-oncogenic genes, e.g. CDKN2A. The other half were “DNA methylation-resistant” genes, where DNA methylation is acquired in the surrounding of promoter regions, but unmethylated status is protected in the vicinity of transcription start site. These genes thereby retained gene expression, and included DNA repair genes. Histone modification was altered dynamically and coordinately with DNA methylation alteration. DNA methylation-sensitive genes significantly correlated with loss of H3K27me3 pre-marks or decrease of active histone marks, H3K4me3 and H3K27ac. Apoptosis-related genes were significantly enriched in these epigenetically repressed genes. Gain of active histone marks significantly correlated with DNA methylation-resistant genes. Genes related to mitotic cell cycle and DNA repair were significantly enriched in these epigenetically activated genes. Our data show that orchestrated epigenetic alterations are important in gene regulation during EBV infection, and histone modification status in promoter regions significantly associated with acquisition of de novo DNA methylation or protection of unmethylated status at transcription start site. PMID:28903418
Manoochehri, Mehdi; Borhani, Nasim; Karbasi, Ashraf; Koochaki, Ameneh; Kazemi, Bahram
2016-07-01
Aberrant DNA methylation has been investigated in carcinogenesis and as biomarker for the early detection of colorectal cancer (CRC). The present study aimed to define the methylation status in the regulatory elements of two proapoptotic genes, Fas cell surface death receptor (FAS) and BCL2-associated X protein (BAX). DNA methylation analysis was performed in tumor and adjacent normal tissue using Hpa II/ Msp I restriction digestion and methylation-specific polymerase chain reaction (PCR). The results observed downregulation of the FAS and BAX genes in the CRC tissues compared with the adjacent normal samples. Furthermore, demethylation using 5-aza-2'-deoxycytidine treatment followed by reverse-transcription quantitative PCR were performed on the HT-29 cell line to measure BAX and FAS mRNA expression following demethylation. The 5-aza-2'-deoxycytidine treatment resulted in significant FAS gene upregulation in the HT-29 cell line, but no significant difference in BAX expression. Furthermore, analysis of CpG islands in the FAS gene promoter revealed that the FAS promoter was significantly hypermethylated in 53.3% of tumor tissues compared with adjacent normal samples. Taken together, the results indicate that decreased expression of the FAS gene due to hypermethylation of its promoter may lead to apoptotic resistance, and acts as an important step during colorectal carcinogenesis.
Gumucio, D L; Rood, K L; Gray, T A; Riordan, M F; Sartor, C I; Collins, F S
1988-01-01
The molecular mechanisms responsible for the human fetal-to-adult hemoglobin switch have not yet been elucidated. Point mutations identified in the promoter regions of gamma-globin genes from individuals with nondeletion hereditary persistence of fetal hemoglobin (HPFH) may mark cis-acting sequences important for this switch, and the trans-acting factors which interact with these sequences may be integral parts in the puzzle of gamma-globin gene regulation. We have used gel retardation and footprinting strategies to define nuclear proteins which bind to the normal gamma-globin promoter and to determine the effect of HPFH mutations on the binding of a subset of these proteins. We have identified five proteins in human erythroleukemia cells (K562 and HEL) which bind to the proximal promoter region of the normal gamma-globin gene. One factor, gamma CAAT, binds the duplicated CCAAT box sequences; the -117 HPFH mutation increases the affinity of interaction between gamma CAAT and its cognate site. Two proteins, gamma CAC1 and gamma CAC2, bind the CACCC sequence. These proteins require divalent cations for binding. The -175 HPFH mutation interferes with the binding of a fourth protein, gamma OBP, which binds an octamer sequence (ATGCAAAT) in the normal gamma-globin promoter. The HPFH phenotype of the -175 mutation indicates that the octamer-binding protein may play a negative regulatory role in this setting. A fifth protein, EF gamma a, binds to sequences which overlap the octamer-binding site. The erythroid-specific distribution of EF gamma a and its close approximation to an apparent repressor-binding site suggest that it may be important in gamma-globin regulation. Images PMID:2468996
Pergamin-Hight, Lee; Bakermans-Kranenburg, Marian J; van Ijzendoorn, Marinus H; Bar-Haim, Yair
2012-02-15
Selective attention to negative information has been strongly implicated in the etiology and maintenance of anxiety and offered as a potential intermediate phenotype for anxiety disorders. Attention biases have been studied in relation to a polymorphism in the promoter region of the serotonin transporter gene (5-HTTLPR) offering equivocal findings. The present meta-analysis tested whether the extant published data support the notion that variation in the 5-HTTLPR genotype modulates selective attention to negative information. Eleven relevant samples from 10 published articles were identified through a systematic literature search (total n = 807). Relevant attention bias and 5-HTTLPR data were extracted based on specific coding rules, and Cohen's d effect size index was used to calculate all outcome measures. Publication bias was assessed using various methods. Carriers of the low (SS, SL(G), L(G)L(G)) transmission efficacy genotype display attentional vigilance toward negatively valenced stimuli, a pattern not found in the intermediate (SL(A), L(A)L(G)) and high (L(A)L(A)) efficacy genotypes. This phenomenon emerges as of medium effect size. The meta-analysis supports the notion that allele variants of the 5-HTTLPR are associated with selective attention to negative stimuli. More studies are needed to fully establish the consistency of this effect. Future studies applying systematic attention bias modification may shed further light on the role of 5-HTTLPR in the development of anxiety disorders and in the prediction of clinical response to attention bias modification treatments. Copyright © 2012 Society of Biological Psychiatry. Published by Elsevier Inc. All rights reserved.
Nam, Jae-Kook; Lee, Mi-Hyang; Seo, Hae-Hyun; Kim, Seok-Ki; Lee, Kang-Huyn; Kim, In-Hoo; Lee, Sang-Jin
2010-05-01
Tumor or tissue specific replicative adenovirus armed with a therapeutic gene has shown a promising anti-cancer therapeutic modality. However, because the genomic packaging capacity is constrained, only a few places inside it are available for transgene insertion. In the present study, we introduce a novel strategy utilizing the early E4 region for the insertion of therapeutic gene(s). We constructed the conditionally replication-competent adenovirus (CRAd), Ad5E4(mRFP) by: (i) replacing the E4/E1a promoter by the prostate-specific enhancer element; (ii) inserting mRFP inside the E4orf1-4 deletion region; and (iii) sub-cloning enhanced green fluorescent protein controlled by cytomegalovirus promoter in the left end of the viral genome. Subsequently, we evaluated its replication abilities and killing activities in vitro, as well as its in vivo anti-tumor efficacy in CWR22rv xenografts. When infected with Ad5E4(mRFP), the number and intensity of the mRFP gene products increased in a prostate cancer cell-specific manner as designed, suggesting that the mRFP gene and E4orfs other than E4orf1-4 were well synthesized from one transcript via alternative splicing as the recombinant adenovirus replicated. As expected from the confirmed virus replication capability, Ad5E4(mRFP) induced cell lysis as potent as the wild-type adenovirus and effectively suppressed tumor growth when tested in the CWR22rv xenografts in nude mice. Furthermore, Ad5E4(endo/angio) harboring an endostatin-angiostatin gene in E4orf1-4 was able to enhance CRAd by replacing mRFP with a therapeutic gene. The approach employed in the present study for the insertion of a therapeutic transgene in CRAd should facilitate the construction of CRAd containing multiple therapeutic genes in the viral genome that may have the potential to serve as highly potent cancer therapeutic reagents. Copyright (c) 2010 John Wiley & Sons, Ltd.
Puhl, Henry L.; Ikeda, Stephen R.
2008-01-01
Voltage-gated sodium channels (VGSC) are critical membrane components that participate in the electrical activity of excitable cells. The type one VGSC family includes the tetrodotoxin insensitive sodium channel, Nav1.8, encoded by the Scn10a gene. Nav1.8 expression is restricted to small and medium diameter nociceptive sensory neurons of the dorsal root (DRG) and cranial sensory ganglia. In order to understand the stringent transcriptional regulation of the Scn10a gene, the sensory neuron specific promoter was functionally identified. While identifying the mRNA 5’ end, alternative splicing within the 5’ UTR was observed to create heterogeneity in the RNA transcript. Four kilobases of upstream genomic DNA was cloned and the presence of tissue specific promoter activity was tested by microinjection and adenoviral infection of fluorescent protein reporter constructs into primary mouse and rat neurons, and cell lines. The region contained many putative transcription factor binding sites and strong homology with the predicted rat ortholog. Homology to the predicted human ortholog was limited to the proximal end and several conserved cis elements were noted. Two regulatory modules were identified by microinjection of reporter constructs into DRG and superior cervical ganglia neurons: a neuron specific proximal promoter region between −1.6 and −0.2kb of the transcription start site cluster, and a distal sensory neuron switch region beyond −1.6kb that restricted fluorescent protein expression to a subset of primary sensory neurons. PMID:18466327
Transgelin gene is frequently downregulated by promoter DNA hypermethylation in breast cancer.
Sayar, Nilufer; Karahan, Gurbet; Konu, Ozlen; Bozkurt, Betul; Bozdogan, Onder; Yulug, Isik G
2015-01-01
CpG hypermethylation in gene promoters is a frequent mechanism of tumor suppressor gene silencing in various types of cancers. It usually occurs at early steps of cancer progression and can be detected easily, giving rise to development of promising biomarkers for both detection and progression of cancer, including breast cancer. 5-aza-2'-deoxycytidine (AZA) is a DNA demethylating and anti-cancer agent resulting in induction of genes suppressed via DNA hypermethylation. Using microarray expression profiling of AZA- or DMSO-treated breast cancer and non-tumorigenic breast (NTB) cells, we identified for the first time TAGLN gene as a target of DNA hypermethylation in breast cancer. TAGLN expression was significantly and frequently downregulated via promoter DNA hypermethylation in breast cancer cells compared to NTB cells, and also in 13/21 (61.9 %) of breast tumors compared to matched normal tissues. Analyses of public microarray methylation data showed that TAGLN was also hypermethylated in 63.02 % of tumors compared to normal tissues; relapse-free survival of patients was worse with higher TAGLN methylation; and methylation levels could discriminate between tumors and healthy tissues with 83.14 % sensitivity and 100 % specificity. Additionally, qRT-PCR and immunohistochemistry experiments showed that TAGLN expression was significantly downregulated in two more independent sets of breast tumors compared to normal tissues and was lower in tumors with poor prognosis. Colony formation was increased in TAGLN silenced NTB cells, while decreased in overexpressing BC cells. TAGLN gene is frequently downregulated by DNA hypermethylation, and TAGLN promoter methylation profiles could serve as a future diagnostic biomarker, with possible clinical impact regarding the prognosis in breast cancer.
Identification of Genes Promoting Skin Youthfulness by Genome-Wide Association Study
Chang, Anne L.S.; Atzmon, Gil; Bergman, Aviv; Brugmann, Samantha; Atwood, Scott X; Chang, Howard Y; Barzilai, Nir
2014-01-01
To identify genes that promote facial skin youthfulness (SY), a genome-wide association study on an Ashkenazi Jewish discovery group (n=428) was performed using Affymetrix 6.0 Single-Nucleotide Polymorphism (SNP) Array. After SNP quality controls, 901,470 SNPs remained for analysis. The eigenstrat method showed no stratification. Cases and controls were identified by global facial skin aging severity including intrinsic and extrinsic parameters. Linear regression adjusted for age and gender, with no significant differences in smoking history, body mass index, menopausal status, or personal or family history of centenarians. Six SNPs met the Bonferroni threshold with Pallele<10−8; two of these six had Pgenotype<10−8. Quantitative trait loci mapping confirmed linkage disequilibrium. The six SNPs were interrogated by MassARRAY in a replication group (n=436) with confirmation of rs6975107, an intronic region of KCND2 (potassium voltage-gated channel, Shal-related family member 2) (Pgenotype=0.023). A second replication group (n=371) confirmed rs318125, downstream of DIAPH2 (diaphanous homolog 2 (Drosophila)) (Pallele=0.010, Pgenotype=0.002) and rs7616661, downstream of EDEM1 (ER degradation enhancer, mannosidase α-like 1) (Pgenotype=0.042). DIAPH2 has been associated with premature ovarian insufficiency, an aging phenotype in humans. EDEM1 associates with lifespan in animal models, although not humans. KCND2 is expressed in human skin, but has not been associated with aging. These genes represent new candidate genes to study the molecular basis of healthy skin aging. PMID:24037343
Hiesel, Rudolf; Schobel, Werner; Schuster, Wolfgang; Brennicke, Axel
1987-01-01
Two loci encoding subunit III of the cytochrome oxidase (COX) in Oenothera mitochondria have been identified from a cDNA library of mitochondrial transcripts. A 657-bp sequence block upstream from the open reading frame is also present in the two copies of the COX subunit I gene and is presumably involved in homologous sequence rearrangement. The proximal points of sequence rearrangements are located 3 bp upstream from the COX I and 1139 bp upstream from the COX III initiation codons. The 5'-termini of both COX I and COX III mRNAs have been mapped in this common sequence confining the promoter region for the Oenothera mitochondrial COX I and COX III genes to the homologous sequence block. ImagesFig. 5. PMID:15981332
Montgomery, J; Pollard, V; Deikman, J; Fischer, R L
1993-01-01
The tomato fruit consists of a thick, fleshy pericarp composed predominantly of highly vacuolated parenchymatous cells, which surrounds the seeds. During ripening, the activation of gene expression results in dramatic biochemical and physiological changes in the pericarp. The polygalacturonase (PG) gene, unlike many fruit ripening-induced genes, is not activated by the increase in ethylene hormone concentration associated with the onset of ripening. To investigate ethylene concentration-independent gene transcription in ripe tomato fruit, we analyzed the expression of chimeric PG promoter-beta-glucuronidase (GUS) reporter gene fusions in transgenic tomato plants. We determined that a 1.4-kb PG promoter directs ripening-regulated transcription in outer pericarp but not in inner pericarp cells, with a sharp boundary of PG promoter activity located midway through the pericarp. Promoter deletion analysis indicated that a minimum of three promoter regions influence the spatial regulation of PG transcription. A positive regulatory region from -231 to -134 promotes gene transcription in the outer pericarp of ripe fruit. A second positive regulatory region from -806 to -443 extends gene activity to the inner pericarp. However, a negative regulatory region from -1411 to -1150 inhibits gene transcription in the inner pericarp. DNase I footprint analysis showed that nuclear proteins in unripe and ripe fruit interact with DNA sequences within each of these three regulatory regions. Thus, temporal and spatial control of PG transcription is mediated by the interaction of negative and positive regulatory promoter elements, resulting in gene activity in the outer pericarp but not the inner pericarp of ripe tomato fruit. The expression pattern of PG suggests that, although they are morphologically similar, there is a fundamental difference between the parenchymatous cells within the inner and outer pericarp. PMID:8400876
Divergent transcription is associated with promoters of transcriptional regulators
2013-01-01
Background Divergent transcription is a wide-spread phenomenon in mammals. For instance, short bidirectional transcripts are a hallmark of active promoters, while longer transcripts can be detected antisense from active genes in conditions where the RNA degradation machinery is inhibited. Moreover, many described long non-coding RNAs (lncRNAs) are transcribed antisense from coding gene promoters. However, the general significance of divergent lncRNA/mRNA gene pair transcription is still poorly understood. Here, we used strand-specific RNA-seq with high sequencing depth to thoroughly identify antisense transcripts from coding gene promoters in primary mouse tissues. Results We found that a substantial fraction of coding-gene promoters sustain divergent transcription of long non-coding RNA (lncRNA)/mRNA gene pairs. Strikingly, upstream antisense transcription is significantly associated with genes related to transcriptional regulation and development. Their promoters share several characteristics with those of transcriptional developmental genes, including very large CpG islands, high degree of conservation and epigenetic regulation in ES cells. In-depth analysis revealed a unique GC skew profile at these promoter regions, while the associated coding genes were found to have large first exons, two genomic features that might enforce bidirectional transcription. Finally, genes associated with antisense transcription harbor specific H3K79me2 epigenetic marking and RNA polymerase II enrichment profiles linked to an intensified rate of early transcriptional elongation. Conclusions We concluded that promoters of a class of transcription regulators are characterized by a specialized transcriptional control mechanism, which is directly coupled to relaxed bidirectional transcription. PMID:24365181
Cao, Baoping; Yang, Weili; Jin, Yongshuai; Zhang, Meiying; He, Tao; Zhan, Qimin; Herman, James G; Zhong, Guanglin; Guo, Mingzhou
2016-11-01
Naked cuticle homolog 2 (NKD2) was found to be frequently methylated in human breast and gastric cancers. However, the epigenetic changes and mechanisms of NKD2 in human esophageal cancer remain unclear. Nine esophageal cancer cell lines and 154 cases of primary esophageal cancer samples were analyzed using methylation-specific polymerase chain reaction, immunohistochemical analysis, Western blot, and xenograft mouse models. Loss of NKD2 expression and complete methylation were found in KYSE150 and TE1 cells. Reduced NKD2 expression and partial methylation of the promoter region were observed in KYSE30, KYSE70, KYSE410, KYSE140, and COLO680 cells. High levels of NKD2 expression and unmethylation were detected in KYSE450 and TE8 cells. Reexpression of NKD2 was induced by 5-aza-2'-deoxycytidine in cells in which NKD2 was not expressed or cells in which NKD2 expression was reduced. NKD2 was methylated in 53.2% of human primary esophageal cancer samples (82 of 154), and promoter region hypermethylation was significantly associated with reduced expression of NKD2 (p < 0.01). NKD2 methylation was associated with tumor, node, and metastasis stage and lymph node metastasis (p < 0.01). Our results suggest that NKD2 is regulated by promoter region methylation and that methylation of NKD2 may serve as a prognostic marker in esophageal cancer. Our further studies demonstrate that NKD2 suppresses cell proliferation, colony formation, cell invasion, and migration and also induces G1/S checkpoint arrest in esophageal cancer cells. NKD2 suppressed xenograft tumor growth and inhibited Wnt signaling in human esophageal cancer cells. NKD2 is frequently methylated in human esophageal cancer, and the expression of NKD2 is regulated by promoter region methylation. NKD2 suppresses esophageal cancer progression by inhibiting Wnt signaling both in vitro and in vivo. Copyright © 2016 International Association for the Study of Lung Cancer. Published by Elsevier Inc. All rights reserved.
Ede, Christopher; Chen, Ximin; Lin, Meng-Yin; Chen, Yvonne Y
2016-05-20
Inducible transcription systems play a crucial role in a wide array of synthetic biology circuits. However, the majority of inducible promoters are constructed from a limited set of tried-and-true promoter parts, which are susceptible to common shortcomings such as high basal expression levels (i.e., leakiness). To expand the toolbox for regulated mammalian gene expression and facilitate the construction of mammalian genetic circuits with precise functionality, we quantitatively characterized a panel of eight core promoters, including sequences with mammalian, viral, and synthetic origins. We demonstrate that this selection of core promoters can provide a wide range of basal gene expression levels and achieve a gradient of fold-inductions spanning 2 orders of magnitude. Furthermore, commonly used parts such as minimal CMV and minimal SV40 promoters were shown to achieve robust gene expression upon induction, but also suffer from high levels of leakiness. In contrast, a synthetic promoter, YB_TATA, was shown to combine low basal expression with high transcription rate in the induced state to achieve significantly higher fold-induction ratios compared to all other promoters tested. These behaviors remain consistent when the promoters are coupled to different genetic outputs and different response elements, as well as across different host-cell types and DNA copy numbers. We apply this quantitative understanding of core promoter properties to the successful engineering of human T cells that respond to antigen stimulation via chimeric antigen receptor signaling specifically under hypoxic environments. Results presented in this study can facilitate the design and calibration of future mammalian synthetic biology systems capable of precisely programmed functionality.
Horowitz, Julie E; Bassing, Craig H
2014-02-15
The RAG proteins are comprised of core endonuclease domains and noncore regions that modulate endonuclease activity. Mutation or deletion of noncore RAG regions in humans causes immunodeficiency and altered TCR repertoire, and mice expressing core but not full-length Rag1 (Rag1(C/C)) or Rag2 (Rag2(C/C)) exhibit lymphopenia, reflecting impaired V(D)J recombination and lymphocyte development. Rag1(C/C) mice display reduced D-to-J and V-to-DJ rearrangements of TCRβ and IgH loci, whereas Rag2(C/C) mice show decreased V-to-DJ rearrangements and altered Vβ/VH repertoire. Because Vβs/VHs only recombine to DJ complexes, the Rag1(C/C) phenotype could reflect roles for noncore RAG1 regions in promoting recombination during only the D-to-J step or during both steps. In this study, we demonstrate that a preassembled TCRβ gene, but not a preassembled DβJβ complex or the prosurvival BCL2 protein, completely rescues αβ T cell development in Rag1(C/C) mice. We find that Rag1(C/C) mice exhibit altered Vβ utilization in Vβ-to-DJβ rearrangements, increased usage of 3'Jα gene segments in Vα-to-Jα rearrangements, and abnormal changes in Vβ repertoire during αβ TCR selection. Inefficient Vβ/VH recombination signal sequences (RSSs) have been hypothesized to cause impaired V-to-DJ recombination on the background of a defective recombinase as in core-Rag mice. We show that replacement of the Vβ14 RSS with a more efficient RSS increases Vβ14 recombination and rescues αβ T cell development in Rag1(C/C) mice. Our data indicate that noncore RAG1 regions establish a diverse TCR repertoire by overcoming Vβ RSS inefficiency to promote Vβ recombination and αβ T cell development, and by modulating TCRβ and TCRα gene segment utilization.
Promoter methylation profile in gallbladder cancer.
Roa, Juan Carlos; Anabalón, Leonardo; Roa, Iván; Melo, Angélica; Araya, Juan Carlos; Tapia, Oscar; de Aretxabala, Xavier; Muñoz, Sergio; Schneider, Barbara
2006-03-01
Methylation in the promoter region of genes is an important mechanism of inactivation of tumor suppressor genes. Our objective was to analyze the methylation pattern of some of the genes involved in carcinogenesis of the gallbladder, examining the immunohistochemical expression of proteins, clinical features, and patient survival time. Twenty cases of gallbladder cancer were selected from the frozen tumor bank. The DNA extracted was analyzed by means of a methylation-specific polymerase chain reaction test for the CDKN2A (p16), MLH1, APC, FHIT, and CDH1 (E-cadherin) genes. Morphological and clinical data and follow-up information were obtained. All cases were in an advanced stage: histologically moderate or poorly differentiated tumors (95%). Methylation of the promoter area of genes was observed in 5%, 20%, 30%, 40%, and 65% of cases, and an altered immunohistochemical pattern (AIP) in 5%, 35%, 21%, 25%, and 66% for the MLH1, CDKN2A, FHIT, APC, and CDH1 genes, respectively. The Kappa concordance index between methylation of the promoter area and AIP for the MLH1 and CDH1 genes was very high (K > 0.75) and substantial for APC (K > 0.45). No correlation was found between survival time and the methylation of the genes studied. The high frequency of gene methylation (with the exception of MLH1) and the high agreement between AIP and methylation of the gene promoter area for the MLH1, APC, and CDH1 genes suggest that the inactivation of tumor suppressor genes and of the genes related to the control of cellular proliferation through this mechanism is involved in gallbladder carcinogenesis.
Mutation in BMPR2 Promoter: A ‘Second Hit’ for Manifestation of Pulmonary Arterial Hypertension?
Ehlken, Nicola; Fischer, Christine; Lichtblau, Mona; Grünig, Ekkehard; Hinderhofer, Katrin
2015-01-01
Background Hereditary pulmonary arterial hypertension (HPAH) can be caused by autosomal dominant inherited mutations of TGF-β genes, such as the bone morphogenetic protein receptor 2 (BMPR2) and Endoglin (ENG) gene. Additional modifier genes may play a role in disease manifestation and severity. In this study we prospectively assessed two families with known BMPR2 or ENG mutations clinically and genetically and screened for a second mutation in the BMPR2 promoter region. Methods We investigated the BMPR2 promoter region by direct sequencing in two index-patients with invasively confirmed diagnosis of HPAH, carrying a mutation in the BMPR2 and ENG gene, respectively. Sixteen family members have been assessed clinically by non-invasive methods and genetically by direct sequencing. Results In both index patients with a primary BMPR2 deletion (exon 2 and 3) and Endoglin missense variant (c.1633G>A, p.(G545S)), respectively, we detected a second mutation (c.-669G>A) in the promoter region of the BMPR2 gene. The index patients with 2 mutations/variants were clinically severely affected at early age, whereas further family members with only one mutation had no manifest HPAH. Conclusion The finding of this study supports the hypothesis that additional mutations may lead to an early and severe manifestation of HPAH. This study shows for the first time that in the regulatory region of the BMPR2 gene the promoter may be important for disease penetrance. Further studies are needed to assess the incidence and clinical relevance of mutations of the BMPR2 promoter region in a larger patient cohort. PMID:26167679
Matsuo, Noritaka; Yu-Hua, Wang; Sumiyoshi, Hideaki; Sakata-Takatani, Keiko; Nagato, Hitoshi; Sakai, Kumiko; Sakurai, Mami; Yoshioka, Hidekatsu
2003-08-29
We have characterized the proximal promoter region of the human COL11A1 gene. Transient transfection assays indicate that the segment from -199 to +1 is necessary for the activation of basal transcription. Electrophoretic mobility shift assays (EMSAs) demonstrated that the ATTGG sequence, within the -147 to -121 fragment, is critical to bind nuclear proteins in the proximal COL11A1 promoter. We demonstrated that the CCAAT binding factor (CBF/NF-Y) bound to this region using an interference assay with consensus oligonucleotides and a supershift assay with specific antibodies in an EMSA. In a chromatin immunoprecipitation assay and EMSA using DNA-affinity-purified proteins, CBF/NF-Y proteins directly bound this region in vitro and in vivo. We also showed that four tandem copies of the CBF/NF-Y-binding fragment produced higher transcriptional activity than one or two copies, whereas the absence of a CBF/NF-Y-binding fragment suppressed the COL11A1 promoter activity. Furthermore, overexpression of a dominant-negative CBF-B/NF-YA subunit significantly inhibited promoter activity in both transient and stable cells. These results indicate that the CBF/NF-Y proteins regulate the transcription of COL11A1 by directly binding to the ATTGG sequence in the proximal promoter region.
Variable responses of two VlMYBA gene promoters to ABA and ACC in Kyoho grape berries.
Zhai, Xiawan; Zhang, Yushu; Kai, Wenbin; Liang, Bin; Jiang, Li; Du, Yangwei; Wang, Juan; Sun, Yufei; Leng, Ping
2017-04-01
The VlMYBA subfamily of transcription factors has been known to be the functional regulators in anthocyanin biosynthesis in red grapes. In this study, the expressions of the VlMYBA1-2 and VlMYBA 2 genes, and the responses of the VlMYBA1-2/2 promoters to ABA and ACC treatments in Kyoho grape berries are examined through quantitative real-time PCR analysis and the transient expression assay. The results show that the expressions of VlMYBA1-2/2 increase dramatically after véraison and reach their highest levels when the berries are nearly fully ripe. Exogenous ABA promotes the expressions of VlMYBA1-2/2, whereas the ACC treatment increases the expression of VlMYBA2, however, it has no effect on VlMYBA1-2. The ABA treatment has a faster and stronger effect on berry pigmentation than ACC does. The VlMYBA1-2 promoter sequence contains two ABA response elements (ABRE) but no ethylene response element (ERE), whereas the VlMYBA2 promoter sequence contains two ABRE and one ERE in the upstream region of the start codon. The VlMYBA2 promoter can be activated by both ABA (more effective) and ACC, whereas the VlMYBA1-2 promoter can be activated by ABA only. In sum, ABA can promote the coloring of Kyoho grape by the promotion of VlMYBA1-2/2 transcriptions via activating the response of their promoters to ABA, whereas ethylene only regulates VlMYBA2 through the response activation of its promoter to ACC which partially enhances the coloring. Copyright © 2017 Elsevier GmbH. All rights reserved.
Hayashi, Keiko; Yoshida, Hitoshi
2009-02-01
The plant genome contains a large number of disease resistance (R) genes that have evolved through diverse mechanisms. Here, we report that a long terminal repeat (LTR) retrotransposon contributed to the evolution of the rice blast resistance gene Pit. Pit confers race-specific resistance against the fungal pathogen Magnaporthe grisea, and is a member of the nucleotide-binding site leucine-rich repeat (NBS-LRR) family of R genes. Compared with the non-functional allele Pit(Npb), the functional allele Pit(K59) contains four amino acid substitutions, and has the LTR retrotransposon Renovator inserted upstream. Pathogenesis assays using chimeric constructs carrying the various regions of Pit(K59) and Pit(Npb) suggest that amino acid substitutions might have a potential effect in Pit resistance; more importantly, the upregulated promoter activity conferred by the Renovator sequence is essential for Pit function. Our data suggest that transposon-mediated transcriptional activation may play an important role in the refunctionalization of additional 'sleeping' R genes in the plant genome.
Ordovás, Laura; Roy, Rosa; Pampín, Sandra; Zaragoza, Pilar; Osta, Rosario; Rodríguez-Rey, Jose Carlos; Rodellar, Clementina
2008-07-15
Fatty acid synthase (FASN) is an enzyme that catalyzes de novo synthesis of fatty acids in cells. The bovine FASN gene maps to BTA 19, where several quantitative trait loci for fat-related traits have been described. Our group recently reported the identification of a single nucleotide polymorphism (SNP), g.763G>C, in the bovine FASN 5' flanking region that was significantly associated with milk fat content in dairy cattle. The g.763G>C SNP was part of a GC-rich region that may constitute a cis element for members of the Sp transcription factor family. Thus the SNP could alter the transcription factor binding ability of the FASN promoter and consequently affect the promoter activity of the gene. However, the functional consequences of the SNP on FASN gene expression are unknown. The present study was therefore directed at elucidating the underlying molecular mechanism that could explain the association of the SNP with milk fat content. Three cellular lines (3T3L1, HepG2, and MCF-7) were used to test the promoter and the transcription factor binding activities by luciferase reporter assays and electrophoretic mobility shift assays, respectively. Band shift assays were also carried out with nuclear extracts from lactating mammary gland (LMG) to further investigate the role of the SNP in this tissue. Our results demonstrate that the SNP alters the bovine FASN promoter activity in vitro and the Sp1/Sp3 binding ability of the sequence. In bovine LMG, the specific binding of Sp3 may account for the association with milk fat content.
Luo, Yushuang; Kou, Xiaoxiao; Ding, Xuezhi; Hu, Shengbiao; Tang, Ying; Li, Wenping; Huang, Fan; Yang, Qi; Chen, Hanna; Xia, Liqiu
2012-02-01
To promote spinosad biosynthesis by improving the limited oxygen supply during high-density fermentation of Saccharopolyspora spinosa, the open reading frame of the Vitreoscilla hemoglobin gene was placed under the control of the promoter for the erythromycin resistance gene by splicing using overlapping extension PCR. This was cloned into the integrating vector pSET152, yielding the Vitreoscilla hemoglobin gene expression plasmid pSET152EVHB. This was then introduced into S. spinosa SP06081 by conjugal transfer, and integrated into the chromosome by site-specific recombination at the integration site ΦC31 on pSET152EVHB. The resultant conjugant, S. spinosa S078-1101, was genetically stable. The integration was further confirmed by PCR and Southern blotting analysis. A carbon monoxide differential spectrum assay showed that active Vitreoscilla hemoglobin was successfully expressed in S. spinosa S078-1101. Fermentation results revealed that expression of the Vitreoscilla hemoglobin gene significantly promoted spinosad biosynthesis under normal oxygen and moderately oxygen-limiting conditions (P<0.01). These findings demonstrate that integrating expression of the Vitreoscilla hemoglobin gene improves oxygen uptake and is an effective means for the genetic improvement of S. spinosa fermentation.
Calvete, Oriol; González, Josefa; Betrán, Esther; Ruiz, Alfredo
2012-01-01
Chromosomal inversions are usually portrayed as simple two-breakpoint rearrangements changing gene order but not gene number or structure. However, increasing evidence suggests that inversion breakpoints may often have a complex structure and entail gene duplications with potential functional consequences. Here, we used a combination of different techniques to investigate the breakpoint structure and the functional consequences of a complex rearrangement fixed in Drosophila buzzatii and comprising two tandemly arranged inversions sharing the middle breakpoint: 2m and 2n. By comparing the sequence in the breakpoint regions between D. buzzatii (inverted chromosome) and D. mojavensis (noninverted chromosome), we corroborate the breakpoint reuse at the molecular level and infer that inversion 2m was associated with a duplication of a ∼13 kb segment and likely generated by staggered breaks plus repair by nonhomologous end joining. The duplicated segment contained the gene CG4673, involved in nuclear transport, and its two nested genes CG5071 and CG5079. Interestingly, we found that other than the inversion and the associated duplication, both breakpoints suffered additional rearrangements, that is, the proximal breakpoint experienced a microinversion event associated at both ends with a 121-bp long duplication that contains a promoter. As a consequence of all these different rearrangements, CG5079 has been lost from the genome, CG5071 is now a single copy nonnested gene, and CG4673 has a transcript ∼9 kb shorter and seems to have acquired a more complex gene regulation. Our results illustrate the complex effects of chromosomal rearrangements and highlight the need of complementing genomic approaches with detailed sequence-level and functional analyses of breakpoint regions if we are to fully understand genome structure, function, and evolutionary dynamics. PMID:22328714
Gao, Johnway [Richland, WA; Skeen, Rodney S [Pendleton, OR
2002-10-15
The present invention provides the promoter clone discovery of phosphoglycerate kinase gene 1 of a lactic acid-producing filamentous fungal strain, Rhizopus oryzae. The isolated promoter can constitutively regulate gene expression under various carbohydrate conditions. In addition, the present invention also provides a design of an integration vector for the transformation of a foreign gene in Rhizopus oryzae.
Gao, Johnway [Richland, WA; Skeen, Rodney S [Pendleton, OR
2003-03-04
The present invention provides the promoter clone discovery of phosphoglycerate kinase gene 2 of a lactic acid-producing filamentous fungal strain, Rhizopus oryzae. The isolated promoter can constitutively regulate gene expression under various carbohydrate conditions. In addition, the present invention also provides a design of an integration vector for the transformation of a foreign gene in Rhizopus oryzae.
Ozone-induced gene expression occurs via ethylene-dependent and -independent signalling.
Grimmig, Bernhard; Gonzalez-Perez, Maria N; Leubner-Metzger, Gerhard; Vögeli-Lange, Regina; Meins, Fred; Hain, Rüdiger; Penuelas, Josep; Heidenreich, Bernd; Langebartels, Christian; Ernst, Dieter; Sandermann, Heinrich
2003-03-01
Recent studies suggest that ethylene is involved in signalling ozone-induced gene expression. We show here that application of ozone increased glucuronidase (GUS) expression of chimeric reporter genes regulated by the promoters of the tobacco class I beta-1,3-glucanases (GLB and Gln2) and the grapevine resveratrol synthase (Vst1) genes in transgenic tobacco leaves. 5'-deletion analysis of the class I beta-1,3-glucanase promoter revealed that ozone-induced gene regulation is mainly mediated by the distal enhancer region containing the positively acting ethylene-responsive element (ERE). In addition, application of 1-methylcyclopropene (1-MCP), an inhibitor of ethylene action, blocked ozone-induced class I beta-1,3-glucanase promoter activity. Enhancer activity and ethylene-responsiveness depended on the integrity of the GCC boxes, cis-acting elements present in the ERE of the class I beta-1,3-glucanase and the basic-type pathogenesis-related PR-1 protein (PRB-1b) gene promoters. The minimal PRB-1b promoter containing only the ERE with intact GCC boxes, was sufficient to confer 10-fold ozone inducibility to a GUS-reporter gene, while a substitution mutation in the GCC box abolished ozone responsiveness. The ERE region of the class I beta-1,3-glucanase promoter containing two intact GCC boxes confered strong ozone inducibility to a minimal cauliflower mosaic virus (CaMV) 35S RNA promoter, whereas two single-base substitution in the GCC boxes resulted in a complete loss of ozone inducibility. Taken together, these datastrongly suggest that ethylene is signalling ozone-induced expression of class I beta-l,3-glucanase and PRB-1b genes. Promoter analysis of the stilbene synthase Vst1 gene unravelled different regions for ozone and ethylene-responsiveness. Application of 1-MCP blocked ethylene-induced Vst1 induction, but ozone induction was not affected. This shows that ozone-induced gene expression occurs via at least two different signalling mechanisms and suggests an
Chao, Chun-Nun; Lin, Mien-Chun; Fang, Chiung-Yao; Chen, Pei-Lain; Chang, Deching; Shen, Cheng-Huang; Wang, Meilin
2016-01-01
Lung adenocarcinoma, the most commonly diagnosed type of lung cancer, has a poor prognosis even with combined surgery, chemotherapy, or molecular targeted therapies. Most patients are diagnosed with an in-operable advanced or metastatic disease, both pointing to the necessity of developing effective therapies for lung adenocarcinoma. Surfactant protein B (SP-B) has been found to be overexpressed in lung adenocarcinoma. In addition, it has also been demonstrated that human lung adenocarcinoma cells are susceptible to the JC polyomavirus (JCPyV) infection. Therefore, we designed that the JCPyV virus-like particle (VLP) packaged with an SP-B promoter-driven thymidine kinase suicide gene (pSPB-tk) for possible gene therapy of human lung adenocarcinoma. Plasmids expressing the GFP (pSPB-gfp) or thymidine kinase gene (pSPB-tk) under the control of the human SP-B promoter were constructed. The promoter's tissue specificity was tested by transfection of pSPB-gfp into A549, CH27, and H460 human lung carcinoma cells and non-lung cells. The JCPyV VLP's gene transfer efficiency and the selective cytotoxicity of pSPB-tk combined with ganciclovir (GCV) were tested in vitro and in a xenograft mouse model. In the current study, we found that SP-B promoter-driven GFP was specifically expressed in human lung adenocarcinoma (A549) and large cell carcinoma (H460) cells. JCPyV VLPs were able to deliver a GFP reporter gene into A549 cells for expression. Selective cytotoxicity was observed in A549 but not non-lung cells that were transfected with pSPB-tk or infected with pSPB-tk-carrying JCPyV VLPs. In mice injected with pSPB-tk-carrying JCPyV VLPs through the tail vein and treated with ganciclovir (GCV), a potent 80% inhibition of growth of human lung adenocarcinoma nodules resulted. The JCPyV VLPs combined with the use of SP-B promoter demonstrates effectiveness as a potential gene therapy against human lung adenocarcinoma.
Identification of HMX1 target genes: A predictive promoter model approach
Boulling, Arnaud; Wicht, Linda
2013-01-01
Purpose A homozygous mutation in the H6 family homeobox 1 (HMX1) gene is responsible for a new oculoauricular defect leading to eye and auricular developmental abnormalities as well as early retinal degeneration (MIM 612109). However, the HMX1 pathway remains poorly understood, and in the first approach to better understand the pathway’s function, we sought to identify the target genes. Methods We developed a predictive promoter model (PPM) approach using a comparative transcriptomic analysis in the retina at P15 of a mouse model lacking functional Hmx1 (dmbo mouse) and its respective wild-type. This PPM was based on the hypothesis that HMX1 binding site (HMX1-BS) clusters should be more represented in promoters of HMX1 target genes. The most differentially expressed genes in the microarray experiment that contained HMX1-BS clusters were used to generate the PPM, which was then statistically validated. Finally, we developed two genome-wide target prediction methods: one that focused on conserving PPM features in human and mouse and one that was based on the co-occurrence of HMX1-BS pairs fitting the PPM, in human or in mouse, independently. Results The PPM construction revealed that sarcoglycan, gamma (35kDa dystrophin-associated glycoprotein) (Sgcg), teashirt zinc finger homeobox 2 (Tshz2), and solute carrier family 6 (neurotransmitter transporter, glycine) (Slc6a9) genes represented Hmx1 targets in the mouse retina at P15. Moreover, the genome-wide target prediction revealed that mouse genes belonging to the retinal axon guidance pathway were targeted by Hmx1. Expression of these three genes was experimentally validated using a quantitative reverse transcription PCR approach. The inhibitory activity of Hmx1 on Sgcg, as well as protein tyrosine phosphatase, receptor type, O (Ptpro) and Sema3f, two targets identified by the PPM, were validated with luciferase assay. Conclusions Gene expression analysis between wild-type and dmbo mice allowed us to develop a PPM
Ou, Lei; Yao, Li; Guo, Yihong; Fan, Suzhen
2013-02-01
Variants in hepatic lipase (HL) gene which is a lipolytic enzyme involved in the metabolism of plasma lipoprotein and regulating lipid and lipoprotein metabolism are potential candidate genes for type 2 diabetes. Association of the polymorphisms in the promoter region of the HL gene (LIPC) to the plasma HDL-C concentration has been investigated. In this study, we investigated whether the G-250A polymorphism of LIPC is associated with type 2 diabetes in Chinese Han population. A total of 130 patients with type 2 diabetes and 133 healthy subjects as control were randomly selected from January 2008 to January 2011 in endocrine wards of Zhengzhou People's Hospital. The G-250A polymorphisms were studied by polymerase chain reaction and restriction fragment length polymorphism. A logistic regression analysis was performed to determine the association between the rare allele and type 2 diabetes mellitus. The frequency of the -250A allele was 0.297 in the T2DM group and 0.388 in the control group (P<0.05), with the difference remaining significant. Patients who are carrying of the -250A allele in the promoter of the LIPC gene are susceptible to type 2 diabetes mellitus in Chinese Han population. Copyright © 2012 Elsevier Masson SAS. All rights reserved.
In, K H; Asano, K; Beier, D; Grobholz, J; Finn, P W; Silverman, E K; Silverman, E S; Collins, T; Fischer, A R; Keith, T P; Serino, K; Kim, S W; De Sanctis, G T; Yandava, C; Pillari, A; Rubin, P; Kemp, J; Israel, E; Busse, W; Ledford, D; Murray, J J; Segal, A; Tinkleman, D; Drazen, J M
1997-03-01
Five lipoxygenase (5-LO) is the first committed enzyme in the metabolic pathway leading to the synthesis of the leukotrienes. We examined genomic DNA isolated from 25 normal subjects and 31 patients with asthma (6 of whom had aspirin-sensitive asthma) for mutations in the known transcription factor binding regions and the protein encoding region of the 5-LO gene. A family of mutations in the G + C-rich transcription factor binding region was identified consisting of the deletion of one, deletion of two, or addition of one zinc finger (Sp1/Egr-1) binding sites in the region 176 to 147 bp upstream from the ATG translation start site where there are normally 5 Sp1 binding motifs in tandem. Reporter gene activity directed by any of the mutant forms of the transcription factor binding region was significantly (P < 0.05) less effective than the activity driven by the wild type transcription factor binding region. Electrophoretic mobility shift assays (EMSAs) demonstrated the capacity of wild type and mutant transcription factor binding regions to bind nuclear extracts from human umbilical vein endothelial cells (HUVECs). These data are consistent with a family of mutations in the 5-LO gene that can modify reporter gene transcription possibly through differences in Sp1 and Egr-1 transactivation.
Singh, Dhirendra P.; Bhargavan, Biju; Chhunchha, Bhavana; Kubo, Eri; Kumar, Anil; Fatma, Nigar
2012-01-01
LEDGF/p75 interacts with DNA/protein to regulate gene expression and function. Despite the recognized diversity of function of LEDGF/p75, knowledge of its transregulation is in its infancy. Here we report that LEDGF/p75 gene is TATA-less, contains GC-rich cis elements and is transcriptionally regulated by Sp1 involving small ubiquitin-like modifier (Sumo1). Using different cell lines, we showed that Sp1 overexpression increased the level of LEDGF/p75 protein and mRNA expression in a concentration-dependent fashion. In contrast, RNA interference depletion of intrinsic Sp1 or treatment with artemisinin, a Sp1 inhibitor, reduced expression of LEDGF/p75, suggesting Sp1-mediated regulation of LEDGF/p75. In silico analysis disclosed three evolutionarily conserved, putative Sp1 sites within LEDGF/p75 proximal promoter (−170/+1 nt). DNA-binding and transactivation assays using deletion and point mutation constructs of LEDGF/p75 promoter-CAT revealed that all Sp1 sites (−50/−43, −109/−102 and −146/−139) differentially regulate LEDGF/p75. Cotransfection studies with Sp1 in Drosophila cells that were Sp1-deficient, showed increased LEDGF/p75 transcription, while in lens epithelial cells (LECs) promoter activity was inhibited by artemisinin. These events were correlated with levels of endogenous Sp1-dependent LEDGF/p75 expression, and higher resistance to UVB-induced cell death. ChIP and transactivation assays showed that Sumoylation of Sp1 repressed its transcriptional activity as evidenced through its reduced binding to GC-box and reduced ability to activate LEDGF/p75 transcription. As whole, results revealed the importance of Sp1 in regulating expression of LEDGF/p75 gene and add to our knowledge of the factors that control LEDGF/p75 within cellular microenvironments, potentially providing a foundation for LEDGF/p75 expression-based transcription therapy. PMID:22615874
MANOOCHEHRI, MEHDI; BORHANI, NASIM; KARBASI, ASHRAF; KOOCHAKI, AMENEH; KAZEMI, BAHRAM
2016-01-01
Aberrant DNA methylation has been investigated in carcinogenesis and as biomarker for the early detection of colorectal cancer (CRC). The present study aimed to define the methylation status in the regulatory elements of two proapoptotic genes, Fas cell surface death receptor (FAS) and BCL2-associated X protein (BAX). DNA methylation analysis was performed in tumor and adjacent normal tissue using HpaII/MspI restriction digestion and methylation-specific polymerase chain reaction (PCR). The results observed downregulation of the FAS and BAX genes in the CRC tissues compared with the adjacent normal samples. Furthermore, demethylation using 5-aza-2′-deoxycytidine treatment followed by reverse-transcription quantitative PCR were performed on the HT-29 cell line to measure BAX and FAS mRNA expression following demethylation. The 5-aza-2′-deoxycytidine treatment resulted in significant FAS gene upregulation in the HT-29 cell line, but no significant difference in BAX expression. Furthermore, analysis of CpG islands in the FAS gene promoter revealed that the FAS promoter was significantly hypermethylated in 53.3% of tumor tissues compared with adjacent normal samples. Taken together, the results indicate that decreased expression of the FAS gene due to hypermethylation of its promoter may lead to apoptotic resistance, and acts as an important step during colorectal carcinogenesis. PMID:27347139
Saify, Khyber; Saadat, Iraj; Saadat, Mostafa
2016-09-01
Catalase (CAT, OMIM: 115500) is one of the major antioxidant enzymes, which plays an important role in the clearance of reactive oxygen species. Three genetic polymorphisms of A-21T (rs7943316), C-262T (rs1001179), and C-844T (rs769214) in the promoter region of the CAT have been reported. It has been suggested that these polymorphisms may alter the recognition sites of transcriptional factors, therefore it might be concluded that these polymorphisms may alter the expression levels of the gene. The aim of the present study is to evaluate the associations between these genetic variations and the CAT mRNA levels in human peripheral blood cells. The present study consisted of 47 healthy students of Shiraz University (south-west Iran). Genotypes of the CAT polymorphisms were determined by PCR based method. The quantitative CAT mRNA expression levels were investigated using quantitative real-time PCR. Analysis of variance revealed significant differences between the study genotypes (For A-21T polymorphism: F = 7.45; df = 2, 44; P = 0.002; For C-262T polymorphism: F = 15.17; df = 2, 44; P < 0.001). The studied polymorphisms showed linkage disequilibrium (D' = 1.0, r 2 = 0.1813, χ 2 = 17.03, P < 0.0001). The mRNA levels of CAT in the AC/TT, TC/TC, TC/TT, and TC/TC diplotypes significantly were higher than the mRNA levels in AC/AC diplotype. There was a significant difference between the study genotypes (F = 9.24; df = 5, 41; P < 0.001). The TC/TC and TT/TT diplotypes showed about 2 and 4 folds CAT mRNA levels compared with the AC/AC diplotype. The present findings indicated that these polymorphisms were significantly associated with the gene expression.
Edgnülü, Tuba G; Özge, Aynur; Erdal, Nurten; Kuru, Oktay; Erdal, Mehmet E
2014-01-01
Monoamine oxidase (MAO) enzymes play an important role in the etiology of many neurological diseases. Tension type headache (TTH) treatments contain inhibitors for selective re-uptake of serotonin and monoamine oxidase inhibitors. MAO (EC 1.4.3.4) has two isoenzymes known as MAOA and MAOB. A promoter polymorphism of a variable number of tandem repeats (VNTR) in the MAOA gene seems to affect MAOA transcriptional activity in vitro. Also, G/A polymorphism in intron 13 (rs1799836) of the MAOB gene have been previously found to be associated with the variability of MAOB enzyme activity. The aim of our study was to investigate a possible association of monoamine oxidase (MAOA and MAOB) gene polymorphisms in tension type headache. MAO gene polymorphisms were examined in a group of 120 TTH patients and in another 168 unrelated healthy volunteers (control group). MAOA promoter and MAOB intron 13 polymorphisms were genotyped using PCR-based methods. An overall comparison between the genotype of MAOA and MAOB genes and allele frequencies of the patients and the control group did not reveal any statistically significant difference between the patients and the control group (p=0.162). Factors like estrogen dosage, the limited number of male patients and other genes' neurotransmitters involved in the etiology of TTH could be responsible for our non-significant results.
Boes, Aaron D; Fischer, David; Geerling, Joel C; Bruss, Joel; Saper, Clifford B; Fox, Michael D
2018-05-29
The hypothalamus is a central hub for regulating sleep-wake patterns, the circuitry of which has been investigated extensively in experimental animals. This work has identified a wake-promoting region in the posterior hypothalamus, with connections to other wake-promoting regions, and a sleep-promoting region in the anterior hypothalamus, with inhibitory projections to the posterior hypothalamus. It is unclear whether a similar organization exists in humans. Here, we use anatomical landmarks to identify homologous sleep and wake-promoting regions of the human hypothalamus and investigate their functional relationships using resting-state functional connectivity MRI in healthy awake participants. First, we identify a negative correlation (anticorrelation) between the anterior and posterior hypothalamus, two regions with opposing roles in sleep-wake regulation. Next, we show that hypothalamic connectivity predicts a pattern of regional sleep-wake changes previously observed in humans. Specifically, regions that are more positively correlated with the posterior hypothalamus and more negatively correlated with the anterior hypothalamus correspond to regions with the greatest change in cerebral blood flow between sleep-wake states. Taken together, these findings provide preliminary evidence relating a hypothalamic circuit investigated in animals to sleep-wake neuroimaging results in humans, with implications for our understanding of human sleep-wake regulation and the functional significance of anticorrelations.
Gene transfer to brain using herpes simplex virus vectors.
Glorioso, J C; Goins, W F; Meaney, C A; Fink, D J; DeLuca, N A
1994-01-01
Herpes simplex virus type 1 represents an ideal candidate for development as a vehicle for gene transfer to postmitotic neurons of the central nervous system. The natural biology of this virus makes it well suited for this purpose as it is capable of infecting a variety of neuronal cell types in the brain where the viral genome can persist indefinitely in a latent state. In latency, the viral lytic genes are transcriptionally silent and a unique set of latency-associated transcripts are expressed. Two impediments to using herpes simplex virus vectors must be overcome: (1) A noncytotoxic mutant virus backbone must be engineered, and (2) a suitable promoter-regulator that stably expresses foreign genes from the vector genome during latency must be constructed. Deletion of specific immediate early genes from the vector can render the virus nontoxic to neurons in culture and in vivo following stereotactic inoculation into specific regions of the brain. Because these viruses cannot replicate, they enter latency on infection of central nervous system neurons. A number of viral and cellular promoters have been tested for their ability to express genes during latency. Strong viral promoters and neurospecific promoters display transient activity. Although the promoter regions for the latency-associated transcripts are highly active in the peripheral nervous system, they show low-level but persistent activity in the brain. Experiments are in progress to exploit RNA polymerase III gene promoters or novel recombinant promoters capable of auto-inducing their own expression in order to increase gene expression during latency in brain neurons.
Liu, Chunlai; Li, Yongwen; Dong, Yunlong; Zhang, Hongbing; Li, Ying; Liu, Hongyu; Chen, Jun
2016-09-20
The EML4-ALK fusion gene is a newly discovered driver gene of non-small cell lung cancer and exhibits special clinical and pathological features. The JAK-STAT signaling pathway, an important downstream signaling pathway of EML4-ALK, is aberrantly sustained and activated in EML4-ALK-positive lung cancer cells fusion gene, but the underlying reason remains unknown. The suppressor of cytokine signaling (SOCS) is a negative regulatory factor that mainly inhibits the proliferation, differentiation, and induction of apoptotic cells by inhibiting the JAK-STAT signaling pathway. The aberrant methylation of the SOCS gene leads to inactivation of tumors and abnormal activation of the JAK2-STAT signaling pathway. The aim of this study is to investigate the methylation status of the SOCS3 promoter in EML4-ALK-positive H2228 cells and lung cancer tissues. The methylation status of the SOCS3 promoter in EML4-ALK-positive H2228 lung cancer cells and lung cancer tissues was detected by methylation-specific PCR (MSP) analysis and verified by DNA sequencing. The expression levels of SOCS3 in H2228 cells were detected by Western blot and Real-time PCR analyses after treatment with the DNA methyltransferase inhibitor 5'-Aza-dC. MSP and DNA sequencing assay results indicated the presence of SOCS3 promoter methylation in H2228 cells as well as in three cases of seven EML4-ALK-positive lung cancer tissues. The expression level of SOCS3 significantly increased in H2228 cells after 5'-Aza-dC treatment. The aerrant methylation of the SOCS3 promoter region in EML4-ALK (+) H2228 cells and lung cancer tissues may be significantly involved in the pathogenesis of EML4-ALK-positive lung cancer.
Synthetic Promoters Functional in Francisella novicida and Escherichia coli
McWhinnie, Ralph L.
2014-01-01
In this work, we describe the identification of synthetic, controllable promoters that function in the bacterial pathogen Francisella novicida, a model facultative intracellular pathogen. Synthetic DNA fragments consisting of the tetracycline operator (tetO) flanked by a random nucleotide sequence were inserted into a Francisella novicida shuttle plasmid upstream of a promoterless artificial operon containing the reporter genes cat and lacZ. Fragments able to promote transcription were selected for based on their ability to drive expression of the cat gene, conferring chloramphenicol resistance. Promoters of various strengths were found, many of which were repressed in the presence of the tetracycline repressor (TetR) and promoted transcription only in the presence of the TetR inducer anhydrotetracycline. A subset of both constitutive and inducible synthetic promoters were characterized to find their induction ratios and to identify their transcription start sites. In cases where tetO was located between or downstream of the −10 and −35 regions of the promoter, control by TetR was observed. If the tetO region was upstream of the −35 region by more than 9 bp, it did not confer TetR control. We found that three of three promoters isolated in F. novicida functioned at a comparable level in E. coli; however, none of the 10 promoters isolated in E. coli functioned at a significant level in F. novicida. Our results allowed us to isolate minimal F. novicida promoters of 47 and 48 bp in length. PMID:24141126
Wang, Xiaolong; Zhou, PeiHua; Sun, XueJun; Wei, GuangBing; Zhang, Li; Wang, Hui; Yao, JianFeng; Jia, PengBo; Zheng, JianBao
2016-05-01
One of the current challenges facing cancer gene therapy is the tumour-specific targeting of therapeutic genes. Effective targeting in gene therapy requires accurate spatial and temporal control of gene expression. To develop a sufficient and accurate tumour-targeting method for cancer gene therapy, we have investigated the use of hyperthermia to control the expression of a transgene under the control of the human telomerase reverse transcriptase (hTERT) promoter and eight heat shock elements (8HSEs). Luciferase reporters were constructed by inserting eight HSEs and the hTERT promoter (8HSEs-hTERTp) upstream of the pGL4.20 vector luciferase gene. The luciferase activity of the hTERT promoter and 8HSEs-hTERT promoter were then compared in the presence and absence of heat. The differences in luciferase activity were analysed using dual luciferase assays in SW480 (high hTERT expression), MKN28 and MRC-5 cells (low hTERT expression). The luciferase activity of the Hsp70B promoter was also compared to the 8HSEs-hTERT promoter in the above listed cell lines. Lentiviral vector and heat-induced expression of EGFP expression under the control of the 8HSEs-hTERT promoter in cultured cells and mouse tumour xenografts was measured by reverse transcription polymerase (RT-PCR), Western blot and immunofluorescence assays. hTERT promoter activity was higher in SW480 cells than in MKN28 or MRC-5 cells. At 43 °C, the luciferase activity of the 8HSEs-hTERT promoter was significantly increased in SW480 cells, but not in MKN28 or MRC-5 cells. Importantly, the differences in luciferase activity were much more obvious in both high (SW480) and low (MKN28 and MRC-5) hTERT expressing cells when the activity of the 8HSEs-hTERT promoter was compared to the Hsp70B promoter. Moreover, under the control of 8HSEs-hTERT promoter in vitro and in vivo, EGFP expression was obviously increased by heat treatment in SW480 cells but not in MKN28 or MRC-5 cells, nor was expression increased under
Park, Do Youn; Sakamoto, Hideo; Kirley, Sandra D.; Ogino, Shuji; Kawasaki, Takako; Kwon, Eunjeong; Mino-Kenudson, Mari; Lauwers, Gregory Y.; Chung, Daniel C.; Rueda, Bo R.; Zukerberg, Lawrence R.
2007-01-01
Cables is a cyclin-dependent kinase-binding nuclear protein that maps to chromosome 18q11-12. Here, we assessed Cables expression in 160 colorectal cancers (CRCs), its role in colon cancer cell growth, and the potential mechanisms of Cables inactivation. Expression levels, promoter methylation, and mutational status of Cables were investigated in colon cancer cell lines and primary colon tumors. Chromosome 18q loss of heterozygosity (LOH) was evaluated with multiple polymorphic markers. Cables inhibited cellular proliferation and colony formation in colon cancer cell lines. Cables expression was reduced in 65% of primary CRCs. No mutations were detected in 10 exons of Cables in 20 primary colon tumors. Cables promoter was methylated in cell lines with decreased Cables expression and vice versa. 5-Aza-2′-deoxycytidine resulted in increased Cables expression in methylated cell lines. There was a significant correlation between promoter methylation and Cables gene expression in primary colon tumors. Sixty-five percent of primary colon tumors demonstrated chromosome 18q LOH. LOH involving the Cables region was observed in 35% of cases, including those in which more distal portions of chromosome 18q were retained, and Cables expression was decreased in all such cases. Loss of Cables expression in 65% of CRCs suggests that it is a common event in colonic carcinogenesis, with promoter methylation and LOH appearing to be important mechanisms of Cables gene inactivation. PMID:17982127
Zhu, Changfu; Yang, Qingjie; Ni, Xiuzhen; Bai, Chao; Sheng, Yanmin; Shi, Lianxuan; Capell, Teresa; Sandmann, Gerhard; Christou, Paul
2014-04-01
Over the last two decades, many carotenogenic genes have been cloned and used to generate metabolically engineered plants producing higher levels of carotenoids. However, comparatively little is known about the regulation of endogenous carotenogenic genes in higher plants, and this restricts our ability to predict how engineered plants will perform in terms of carotenoid content and composition. During petal development in the Great Yellow Gentian (Gentiana lutea), carotenoid accumulation, the formation of chromoplasts and the upregulation of several carotenogenic genes are temporally coordinated. We investigated the regulatory mechanisms responsible for this coordinated expression by isolating five G. lutea carotenogenic gene (GlPDS, GlZDS, GlLYCB, GlBCH and GlLYCE) promoters by inverse polymerase chain reaction (PCR). Each promoter was sufficient for developmentally regulated expression of the gusA reporter gene following transient expression in tomato (Solanum lycopersicum cv. Micro-Tom). Interestingly, the GlLYCB and GlBCH promoters drove high levels of gusA expression in chromoplast-containing mature green fruits, but low levels in chloroplast-containing immature green fruits, indicating a strict correlation between promoter activity, tomato fruit development and chromoplast differentiation. As well as core promoter elements such as TATA and CAAT boxes, all five promoters together with previously characterized GlZEP promoter contained three common cis-regulatory motifs involved in the response to methyl jasmonate (CGTCA) and ethylene (ATCTA), and required for endosperm expression (Skn-1_motif, GTCAT). These shared common cis-acting elements may represent binding sites for transcription factors responsible for co-regulation. Our data provide insight into the regulatory basis of the coordinated upregulation of carotenogenic gene expression during flower development in G. lutea. © 2013 Scandinavian Plant Physiology Society.
Wiśniewska, A; Dąbrowska-Bronk, J; Szafrański, K; Fudali, S; Święcicka, M; Czarny, M; Wilkowska, A; Morgiewicz, K; Matusiak, J; Sobczak, M; Filipecki, M
2013-06-01
The potato cyst nematode (Globodera rostochiensis) induces feeding sites (syncytia) in tomato and potato roots. In a previous study, 135 tomato genes up-regulated during G. rostochiensis migration and syncytium development were identified. Five genes (CYP97A29, DFR, FLS, NIK and PMEI) were chosen for further study to examine their roles in plant-nematode interactions. The promoters of these genes were isolated and potential cis regulatory elements in their sequences were characterized using bioinformatics tools. Promoter fusions with the β-glucuronidase gene were constructed and introduced into tomato and potato genomes via transformation with Agrobacterium rhizogenes to produce hairy roots. The analysed promoters displayed different activity patterns in nematode-infected and uninfected transgenic hairy roots.
Dong, S-S; Guo, Y; Zhu, D-L; Chen, X-F; Wu, X-M; Shen, H; Chen, X-D; Tan, L-J; Tian, Q; Deng, H-W; Yang, T-L
2016-07-01
With ENCODE epigenomic data and results from published genome-wide association studies (GWASs), we aimed to find regulatory signatures of obesity genes and discover novel susceptibility genes. Obesity genes were obtained from public GWAS databases and their promoters were annotated based on the regulatory element information. Significantly enriched or depleted epigenomic elements in the promoters of obesity genes were evaluated and all human genes were then prioritized according to the existence of the selected elements to predict new candidate genes. Top-ranked genes were subsequently applied to validate their associations with obesity-related traits in three independent in-house GWAS samples. We identified RAD21 and EZH2 as over-represented, and STAT2 (signal transducer and activator of transcription 2) and IRF3 (interferon regulatory transcription factor 3) as depleted transcription factors. Histone modification of H3K9me3 and chromatin state segmentation of 'poised promoter' and 'repressed' were over-represented. All genes were prioritized and we selected the top five genes for validation at the population level. Combining results from the three GWAS samples, rs7522101 in ESRRG (estrogen-related receptor-γ) remained significantly associated with body mass index after multiple testing corrections (P=7.25 × 10(-5)). It was also associated with β-cell function (P=1.99 × 10(-3)) and fasting glucose level (P<0.05) in the meta-analyses of glucose and insulin-related traits consortium (MAGIC) data set.Cnoclusions:In summary, we identified epigenomic characteristics for obesity genes and suggested ESRRG as a novel obesity-susceptibility gene.
Chymkowitch, Pierre; Nguéa P, Aurélie; Aanes, Håvard; Koehler, Christian J.; Thiede, Bernd; Lorenz, Susanne; Meza-Zepeda, Leonardo A.; Klungland, Arne; Enserink, Jorrit M.
2015-01-01
Transcription factors are abundant Sumo targets, yet the global distribution of Sumo along the chromatin and its physiological relevance in transcription are poorly understood. Using Saccharomyces cerevisiae, we determined the genome-wide localization of Sumo along the chromatin. We discovered that Sumo-enriched genes are almost exclusively involved in translation, such as tRNA genes and ribosomal protein genes (RPGs). Genome-wide expression analysis showed that Sumo positively regulates their transcription. We also discovered that the Sumo consensus motif at RPG promoters is identical to the DNA binding motif of the transcription factor Rap1. We demonstrate that Rap1 is a molecular target of Sumo and that sumoylation of Rap1 is important for cell viability. Furthermore, Rap1 sumoylation promotes recruitment of the basal transcription machinery, and sumoylation of Rap1 cooperates with the target of rapamycin kinase complex 1 (TORC1) pathway to promote RPG transcription. Strikingly, our data reveal that sumoylation of Rap1 functions in a homeostatic feedback loop that sustains RPG transcription during translational stress. Taken together, Sumo regulates the cellular translational capacity by promoting transcription of tRNA genes and RPGs. PMID:25800674
Wu, Sen; Wang, Yaning; Ning, Yue; Guo, Hongfang; Wang, Xiaoyu; Zhang, Le; Khan, Rajwali; Cheng, Gong; Wang, Hongbao; Zan, Linsen
2018-03-29
Signal transducer and activator of transcription 3 (STAT3) plays a critical role in leptin-mediated regulation of energy metabolism. This study investigated genetic variation in STAT3 promoter regions and verified their contribution to bovine body size traits. We first estimated the degree of conservation in STAT3, followed by measurements of its mRNA expression during fetal and adult stages of Qinchuan cattle. We then sequenced the STAT3 promoter region to determine genetic variants and evaluate their association with body size traits. From fetus to adult, STAT3 expression increased significantly in muscle, fat, heart, liver, and spleen tissues ( p < 0.01), but decreased in the intestine, lung, and rumen ( p < 0.01). We identified and named five single nucleotide polymorphisms (SNPs): SNP1-304A>C, SNP2-285G>A, SNP3-209A>C, SNP4-203A>G, and SNP5-188T>C. These five mutations fell significantly outside the Hardy-Weinberg equilibrium (HWE) (Chi-squared test, p < 0.05) and significantly associated with body size traits ( p < 0.05). Individuals with haplotype H3H3 (CC-GG-CC-GG-CC) were larger in body size than other haplotypes. Therefore, variations in the STAT3 gene promoter regions, most notably haplotype H3H3, may benefit marker-assisted breeding of Qinchuan cattle.
Wang, Yaning; Ning, Yue; Guo, Hongfang; Wang, Xiaoyu; Zhang, Le; Cheng, Gong; Wang, Hongbao; Zan, Linsen
2018-01-01
Signal transducer and activator of transcription 3 (STAT3) plays a critical role in leptin-mediated regulation of energy metabolism. This study investigated genetic variation in STAT3 promoter regions and verified their contribution to bovine body size traits. We first estimated the degree of conservation in STAT3, followed by measurements of its mRNA expression during fetal and adult stages of Qinchuan cattle. We then sequenced the STAT3 promoter region to determine genetic variants and evaluate their association with body size traits. From fetus to adult, STAT3 expression increased significantly in muscle, fat, heart, liver, and spleen tissues (p < 0.01), but decreased in the intestine, lung, and rumen (p < 0.01). We identified and named five single nucleotide polymorphisms (SNPs): SNP1-304A>C, SNP2-285G>A, SNP3-209A>C, SNP4-203A>G, and SNP5-188T>C. These five mutations fell significantly outside the Hardy–Weinberg equilibrium (HWE) (Chi-squared test, p < 0.05) and significantly associated with body size traits (p < 0.05). Individuals with haplotype H3H3 (CC-GG-CC-GG-CC) were larger in body size than other haplotypes. Therefore, variations in the STAT3 gene promoter regions, most notably haplotype H3H3, may benefit marker-assisted breeding of Qinchuan cattle. PMID:29596388
Al-Quraishy, Saleh; Dkhil, Mohamed A; Abdel-Baki, Abdel-Azeem S; Ghanjati, Foued; Erichsen, Lars; Santourlidis, Simeon; Wunderlich, Frank; Araúzo-Bravo, Marcos J
2017-05-01
Epigenetic mechanisms such as DNA methylation are increasingly recognized to be critical for vaccination efficacy and outcome of different infectious diseases, but corresponding information is scarcely available for host defense against malaria. In the experimental blood-stage malaria Plasmodium chabaudi, we investigate the possible effects of a blood-stage vaccine on DNA methylation of gene promoters in the liver, known as effector against blood-stage malaria, using DNA methylation microarrays. Naturally susceptible Balb/c mice acquire, by protective vaccination, the potency to survive P. chabaudi malaria and, concomitantly, modifications of constitutive DNA methylation of promoters of numerous genes in the liver; specifically, promoters of 256 genes are hyper(=up)- and 345 genes are hypo(=down)-methylated (p < 0.05). Protective vaccination also leads to changes in promoter DNA methylation upon challenge with P. chabaudi at peak parasitemia on day 8 post infection (p.i.), when 571 and 1013 gene promoters are up- and down-methylated, respectively, in relation to constitutive DNA methylation (p < 0.05). Gene set enrichment analyses reveal that both vaccination and P. chabaudi infections mainly modify promoters of those genes which are most statistically enriched with functions relating to regulation of transcription. Genes with down-methylated promoters encompass those encoding CX3CL1, GP130, and GATA2, known to be involved in monocyte recruitment, IL-6 trans-signaling, and onset of erythropoiesis, respectively. Our data suggest that vaccination may epigenetically improve parts of several effector functions of the liver against blood-stage malaria, as, e.g., recruitment of monocyte/macrophage to the liver accelerated liver regeneration and extramedullary hepatic erythropoiesis, thus leading to self-healing of otherwise lethal P. chabaudi blood-stage malaria.
[Inactivation of PMS2 gene by promoter methylation in nasopharyngeal carcinoma].
Ni, H F; Jiang, B; Zhou, Z; Li, Y; Yuan, X Y; Cao, X L; Huang, G W
2016-11-23
Objective: To investigate the inactivation of PMS2 gene mediated by promoter methylation and its regulatory mechanism in nasopharyngeal carcinoma (NPC). Methods: Fifty-four NPC tissues, 16 normal nasopharyngeal epithelia (NNE), 5 NPC cell lines (CNE1, CNE2, TWO3, HNE1 and HONE1) and 1 normal nasopharyngeal epithelial cell line (NP69) were collected.Methylation-specific PCR (MSP) was used to detect the PMS2 promoter methylation, semi-quantitative reverse transcription PCR (qRT-PCR) was applied to determine its mRNA expression, and immunohistochemistry (IHC) was used to detect the protein expression of PMS2. The expressions of PMS2 mRNA in CNE1 and CNE2 cells before and after treated with methyltransferase inhibitor 5-aza-2-deoxycytidine were analyzed by qRT-PCR. The impact of methylation and demethylation on the mRNA expression of PMS2, and the association of mRNA and protein expression of PMS2 with clinicopathological features of nasopharyngeal cancer were analyzed. Results: Methylation of PMS2 gene was detected in all of the five NPC cell lines, but not in normal nasopharyngeal epithelial NP69 cells. The methylation rate of PMS2 gene in NPC tissues was 63% (34/54), significantly higher than that of the normal nasopharyngeal epithelia (0/16, P <0.001). The expression levels of PMS2 mRNA and protein were significantly down-regulated in the 54 NPC tissues when compared with those in the 16 NNE tissues ( P <0.001), and were also significantly lower in the 34 methylated NPC tissues than those in the 20 unmethylated NPC tissues ( P <0.001). After treatment with 5-aza-2-deoxycytidine, the expression of PMS2 mRNA was restored in the CNE1 and CNE2 cells.However, the expressions of PMS2 mRNA and protein were not significantly correlated with patients' age, gender, TNM stage, histopathologic type or lymph node metastasis ( P >0.05 for all). Conclusions: Promoter methylation-mediated inactivation of PMS2 gene participates in carcinogenesis and development of NPC. PMS2 may be
Xian, Jian; Aitchison, Alan; Bobrow, Linda; Corbett, Gerard; Pannell, Richard; Rabbitts, Terence; Rabbitts, Pamela
2004-09-15
The DUTT1 gene is located on human chromosome 3, band p12, within a region of nested homozygous deletions in breast and lung tumors. It is therefore a candidate tumor suppressor gene in humans and is the homologue (ROBO1) of the Drosophila axonal guidance receptor gene, Roundabout. We have shown previously that mice with a targeted homozygous deletion within the Dutt1/Robo1 gene generally die at birth due to incomplete lung development: survivors die within the first year of life with epithelial bronchial hyperplasia as a common feature. Because Dutt1/Robo1 heterozygous mice develop normally, we have determined their tumor susceptibility. Mice with a targeted deletion within one Dutt1/Robo1 allele spontaneously develop lymphomas and carcinomas in their second year of life with a 3-fold increase in incidence compared with controls: invasive lung adenocarcinomas are by far the predominant carcinoma. In addition to the mutant allele, loss of heterozygosity analysis indicates that these tumors retain the structurally normal allele but with substantial methylation of the gene's promoter. Substantial reduction of Dutt1/Robo1 protein expression in tumors is observed by Western blotting and immunohistochemistry. This suggests that Dutt1/Robo1 is a classic tumor suppressor gene requiring inactivation of both alleles to elicit tumorigenesis in these mice.
Promoter methylation of AREG, HOXA11, hMLH1, NDRG2, NPTX2 and Tes genes in glioblastoma.
Skiriutė, Daina; Vaitkienė, Paulina; Ašmonienė, Virginija; Steponaitis, Giedrius; Deltuva, Vytenis Pranas; Tamašauskas, Arimantas
2013-07-01
Epigenetic alterations alone or in combination with genetic mechanisms play a key role in brain tumorigenesis. Glioblastoma is one of the most common, lethal and poor clinical outcome primary brain tumors with extraordinarily miscellaneous epigenetic alterations profile. The aim of this study was to investigate new potential prognostic epigenetic markers such as AREG, HOXA11, hMLH1, NDRG2, NTPX2 and Tes genes promoter methylation, frequency and value for patients outcome. We examined the promoter methylation status using methylation-specific polymerase chain reaction in 100 glioblastoma tissue samples. The value for clinical outcome was calculated using Kaplan-Meier estimation with log-rank test. DNA promoter methylation was frequent event appearing more than 45 % for gene. AREG and HOXA11 methylation status was significantly associated with patient age. HOXA11 showed the tendency to be associated with patient outcome in glioblastomas. AREG gene promoter methylation showed significant correlation with poor patient outcome. AREG methylation remained significantly associated with patient survival in a Cox multivariate model including MGMT promoter methylation status. This study of new epigenetic targets has shown considerably high level of analyzed genes promoter methylation variability in glioblastoma tissue. AREG gene might be valuable marker for glioblastoma patient survival prognosis, however further analysis is needed to clarify the independence and appropriateness of the marker.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Alam, T.; Papaconstantinou, J.
1992-02-25
The synthesis and secretion of several acute-phase proteins increases markedly following physiological stress. {alpha}{sub 1}-Acid glycoprotein (AGP), a major acute-phase reactant made by the liver, is strongly induced by inflammatory agents such as lipopolysaccharide (LPS). Nuclear run-on assay showed a 17-fold increase in the rate of AGP transcription 4 h following LPS injection. DNase I footprinting assays revealed multiple protein binding domains in the mouse AGP-1 promoter region. Region B ({minus}104 to {minus}91) is protected by a liver-enriched transcription factor that is heat labile and in limiting quantity. An adjacent region, C ({minus}125 to {minus}104), is well-protected by nuclear extractsmore » from hepatocytes. Electrophoretic mobility shift assays indicated that only one DNA-protein complex can form with an oligonucleotide corresponding to region B. However, nuclear proteins from untreated mouse liver can form three strong complexes (C1, C2, and C3) and a weak one (C4) with oligonucleotide C. An acute-phase-inducible DNA-binding protein (AP-DBP) forms complex 4. A dramatic increase (over 11-fold) in AP-DBP binding activity is seen with nuclear proteins from LPS-stimulated animals. Interestingly, AP-DBP, a heat-stable factor, can form heterodimers with the transcription factor CCAAT/enhancer binding protein (C/EBP). Furthermore, purified C/EBP also binds avidly to region C. The studies indicate that several liver-enriched nuclear factors can interact with AGP-1 promoter and that AP-DBP binds to the AGP-1 promoter with high affinity only during the acute-phase induction.« less
A regulatory toolbox of MiniPromoters to drive selective expression in the brain
Portales-Casamar, Elodie; Swanson, Douglas J.; Liu, Li; de Leeuw, Charles N.; Banks, Kathleen G.; Ho Sui, Shannan J.; Fulton, Debra L.; Ali, Johar; Amirabbasi, Mahsa; Arenillas, David J.; Babyak, Nazar; Black, Sonia F.; Bonaguro, Russell J.; Brauer, Erich; Candido, Tara R.; Castellarin, Mauro; Chen, Jing; Chen, Ying; Cheng, Jason C. Y.; Chopra, Vik; Docking, T. Roderick; Dreolini, Lisa; D'Souza, Cletus A.; Flynn, Erin K.; Glenn, Randy; Hatakka, Kristi; Hearty, Taryn G.; Imanian, Behzad; Jiang, Steven; Khorasan-zadeh, Shadi; Komljenovic, Ivana; Laprise, Stéphanie; Liao, Nancy Y.; Lim, Jonathan S.; Lithwick, Stuart; Liu, Flora; Liu, Jun; Lu, Meifen; McConechy, Melissa; McLeod, Andrea J.; Milisavljevic, Marko; Mis, Jacek; O'Connor, Katie; Palma, Betty; Palmquist, Diana L.; Schmouth, Jean-François; Swanson, Magdalena I.; Tam, Bonny; Ticoll, Amy; Turner, Jenna L.; Varhol, Richard; Vermeulen, Jenny; Watkins, Russell F.; Wilson, Gary; Wong, Bibiana K. Y.; Wong, Siaw H.; Wong, Tony Y. T.; Yang, George S.; Ypsilanti, Athena R.; Jones, Steven J. M.; Holt, Robert A.; Goldowitz, Daniel; Wasserman, Wyeth W.; Simpson, Elizabeth M.
2010-01-01
The Pleiades Promoter Project integrates genomewide bioinformatics with large-scale knockin mouse production and histological examination of expression patterns to develop MiniPromoters and related tools designed to study and treat the brain by directed gene expression. Genes with brain expression patterns of interest are subjected to bioinformatic analysis to delineate candidate regulatory regions, which are then incorporated into a panel of compact human MiniPromoters to drive expression to brain regions and cell types of interest. Using single-copy, homologous-recombination “knockins” in embryonic stem cells, each MiniPromoter reporter is integrated immediately 5′ of the Hprt locus in the mouse genome. MiniPromoter expression profiles are characterized in differentiation assays of the transgenic cells or in mouse brains following transgenic mouse production. Histological examination of adult brains, eyes, and spinal cords for reporter gene activity is coupled to costaining with cell-type–specific markers to define expression. The publicly available Pleiades MiniPromoter Project is a key resource to facilitate research on brain development and therapies. PMID:20807748
A regulatory toolbox of MiniPromoters to drive selective expression in the brain.
Portales-Casamar, Elodie; Swanson, Douglas J; Liu, Li; de Leeuw, Charles N; Banks, Kathleen G; Ho Sui, Shannan J; Fulton, Debra L; Ali, Johar; Amirabbasi, Mahsa; Arenillas, David J; Babyak, Nazar; Black, Sonia F; Bonaguro, Russell J; Brauer, Erich; Candido, Tara R; Castellarin, Mauro; Chen, Jing; Chen, Ying; Cheng, Jason C Y; Chopra, Vik; Docking, T Roderick; Dreolini, Lisa; D'Souza, Cletus A; Flynn, Erin K; Glenn, Randy; Hatakka, Kristi; Hearty, Taryn G; Imanian, Behzad; Jiang, Steven; Khorasan-zadeh, Shadi; Komljenovic, Ivana; Laprise, Stéphanie; Liao, Nancy Y; Lim, Jonathan S; Lithwick, Stuart; Liu, Flora; Liu, Jun; Lu, Meifen; McConechy, Melissa; McLeod, Andrea J; Milisavljevic, Marko; Mis, Jacek; O'Connor, Katie; Palma, Betty; Palmquist, Diana L; Schmouth, Jean-François; Swanson, Magdalena I; Tam, Bonny; Ticoll, Amy; Turner, Jenna L; Varhol, Richard; Vermeulen, Jenny; Watkins, Russell F; Wilson, Gary; Wong, Bibiana K Y; Wong, Siaw H; Wong, Tony Y T; Yang, George S; Ypsilanti, Athena R; Jones, Steven J M; Holt, Robert A; Goldowitz, Daniel; Wasserman, Wyeth W; Simpson, Elizabeth M
2010-09-21
The Pleiades Promoter Project integrates genomewide bioinformatics with large-scale knockin mouse production and histological examination of expression patterns to develop MiniPromoters and related tools designed to study and treat the brain by directed gene expression. Genes with brain expression patterns of interest are subjected to bioinformatic analysis to delineate candidate regulatory regions, which are then incorporated into a panel of compact human MiniPromoters to drive expression to brain regions and cell types of interest. Using single-copy, homologous-recombination "knockins" in embryonic stem cells, each MiniPromoter reporter is integrated immediately 5' of the Hprt locus in the mouse genome. MiniPromoter expression profiles are characterized in differentiation assays of the transgenic cells or in mouse brains following transgenic mouse production. Histological examination of adult brains, eyes, and spinal cords for reporter gene activity is coupled to costaining with cell-type-specific markers to define expression. The publicly available Pleiades MiniPromoter Project is a key resource to facilitate research on brain development and therapies.
NASA Astrophysics Data System (ADS)
Bae, Ju Yun; Laplaza, José; Jeffries, Thomas W.
Orientation of adjacent genes has been reported to affect their expression in eukaryotic systems, and metabolic engineering also often makes repeated use of a few promoters to obtain high expression. To improve transcriptional control in heterologous expression, we examined how these factors affect gene expression and enzymatic activity in Saccharomyces cerevisiae. We assembled d-xylose reductase (XYL1) and d-xylitol dehydrogenase (XYL2) in four ways. Each pair of genes was placed in two different tandem (l→2→ or √1√2), convergent (1→√2), and divergent (√1 2→) orientations in autonomous plasmids. The TEF1 promoter was used to drive XYL1 and the TDH3 promoter to drive XYL2 in each of the constructs. The effects of gene orientation on growth, transcription, and enzyme activity were analyzed. The transcription level as measured by quantitative PCR (q-PCR) correlated with enzyme activities, but our data did not show a significant effect of gene orientation. To test the possible dilution of promoter strength due to multiple use of the same promoter, we examined the level of expression of XYL1 driven by either the TEF1 or TDH3 promoter when carried on a single copy plasmid. We then coexpressed XYL2 from either a single or multicopy plasmid, which was also driven by the same promoter. XYL2 transcript and enzyme expression increased with plasmid copy number, while the expression of XYLl was constant regardless of the number of other TEF1 or TDH3 promoters present in the cell. According to our data, there is no significant effect of gene orientation or multiple promoter use on gene transcription and translation when genes are expressed from plasmids; however, other factors could affect expression of adjacent genes in chromosomes.
Mechanical Strain Promotes Oligodendrocyte Differentiation by Global Changes of Gene Expression
Jagielska, Anna; Lowe, Alexis L.; Makhija, Ekta; Wroblewska, Liliana; Guck, Jochen; Franklin, Robin J. M.; Shivashankar, G. V.; Van Vliet, Krystyn J.
2017-01-01
Differentiation of oligodendrocyte progenitor cells (OPC) to oligodendrocytes and subsequent axon myelination are critical steps in vertebrate central nervous system (CNS) development and regeneration. Growing evidence supports the significance of mechanical factors in oligodendrocyte biology. Here, we explore the effect of mechanical strains within physiological range on OPC proliferation and differentiation, and strain-associated changes in chromatin structure, epigenetics, and gene expression. Sustained tensile strain of 10–15% inhibited OPC proliferation and promoted differentiation into oligodendrocytes. This response to strain required specific interactions of OPCs with extracellular matrix ligands. Applied strain induced changes in nuclear shape, chromatin organization, and resulted in enhanced histone deacetylation, consistent with increased oligodendrocyte differentiation. This response was concurrent with increased mRNA levels of the epigenetic modifier histone deacetylase Hdac11. Inhibition of HDAC proteins eliminated the strain-mediated increase of OPC differentiation, demonstrating a role of HDACs in mechanotransduction of strain to chromatin. RNA sequencing revealed global changes in gene expression associated with strain. Specifically, expression of multiple genes associated with oligodendrocyte differentiation and axon-oligodendrocyte interactions was increased, including cell surface ligands (Ncam, ephrins), cyto- and nucleo-skeleton genes (Fyn, actinins, myosin, nesprin, Sun1), transcription factors (Sox10, Zfp191, Nkx2.2), and myelin genes (Cnp, Plp, Mag). These findings show how mechanical strain can be transmitted to the nucleus to promote oligodendrocyte differentiation, and identify the global landscape of signaling pathways involved in mechanotransduction. These data provide a source of potential new therapeutic avenues to enhance OPC differentiation in vivo. PMID:28473753
Tyrka, A R; Parade, S H; Welch, E S; Ridout, K K; Price, L H; Marsit, C; Philip, N S; Carpenter, L L
2016-01-01
Early adversity increases risk for developing psychopathology. Epigenetic modification of stress reactivity genes is a likely mechanism contributing to this risk. The glucocorticoid receptor (GR) gene is of particular interest because of the regulatory role of the GR in hypothalamic–pituitary–adrenal (HPA) axis function. Mounting evidence suggests that early adversity is associated with GR promoter methylation and gene expression. Few studies have examined links between GR promoter methylation and psychopathology, and findings to date have been mixed. Healthy adult participants (N=340) who were free of psychotropic medications reported on their childhood experiences of maltreatment and parental death and desertion. Lifetime depressive and anxiety disorders and past substance-use disorders were assessed using the Structured Clinical Interview for the Diagnostic and Statistical Manual of Mental Disorders, Fourth Edition. Methylation of exon 1F of the GR gene (NR3C1) was examined in leukocyte DNA via pyrosequencing. On a separate day, a subset of the participants (n=231) completed the dexamethasone/corticotropin-releasing hormone (Dex/CRH) test. Childhood adversity and a history of past substance-use disorder and current or past depressive or anxiety disorders were associated with lower levels of NR3C1 promoter methylation across the region as a whole and at individual CpG sites (P<0.05). The number of adversities was negatively associated with NR3C1 methylation in participants with no lifetime disorder (P=0.018), but not in those with a lifetime disorder. GR promoter methylation was linked to altered cortisol responses to the Dex/CRH test (P<0.05). This study presents evidence of reduced methylation of NR3C1 in association with childhood maltreatment and depressive, anxiety and substance-use disorders in adults. This finding stands in contrast to our prior work, but is consistent with emerging findings, suggesting complexity in the regulation of this gene. PMID
Differential transcriptional control of the two tRNA(fMet) genes of Escherichia coli K-12.
Nagase, T; Ishii, S; Imamoto, F
1988-07-15
The metZ gene of Escherichia coli, which encodes the tRNA(f1Met), was cloned. Using the nucleotide sequence, in vitro transcription, and S1 nuclease mapping analyses, we identified the promoter region, transcriptional start point, the two tandem tRNA(f1Met) structural genes separated by an intergenic space of 33 bp, and the two Rho-independent transcriptional termination sites, in that order. We compared the promoter region of the metZ gene with that of the metY gene, which encodes the tRNA(f2Met) and is located in the promoter-proximal portion of the nusA operon. A G + C-rich sequence (5'-GCGCATCCAC-3'), similar to the corresponding sequence of the rrn promoters that are under stringent control, was found between the Pribnow box and the transcriptional start point of the metZ promoter, but not in the metY promoter region. We therefore examined the effect of guanosine 3'-diphosphate, 5'-diphosphate (ppGpp), the chemical mediator of stringent control, and found that ppGpp inhibited the transcription of the metZ gene, but not that of the metY gene. These data suggested that the promoters for metZ and metY have different physiological functions and are regulated by different mechanisms.
Zhang, Xin; Huang, Danping; Jia, Xiwei; Zou, Zhihua; Wang, Yilei; Zhang, Ziping
2018-04-01
In this study, the 5'-flanking region of molt-inhibiting hormone (MIH) gene was cloned by Tail-PCR. It is 2024 bp starting from the translation initiation site, and 1818 bp starting from the predicted transcription start site. Forecast analysis results by the bioinformatics software showed that the transcription start site is located at 207 bp upstream of the start codon ATG, and TATA box is located at 240 bp upstream of the start codon ATG. Potential transcription factor binding sites include Sp1, NF-1, Oct-1, Sox-2, RAP1, and so on. There are two CpG islands, located at -25- +183 bp and -1451- -1316 bp respectively. The transfection results of luciferase reporter constructs showed that the core promoter region was located in the fragment -308 bp to -26 bp. NF-kappaB and RAP1 were essential for mih basal transcriptional activity. There are three kinds of polymorphism CA in the 5'-flanking sequence, and they can influence mih promoter activity. These findings provide a genetic foundation of the further research of mih transcription regulation. Copyright © 2017 Elsevier Inc. All rights reserved.
Casco-Robles, Martin Miguel; Miura, Tomoya; Chiba, Chikafumi
2015-06-01
The adult newt has the ability to regenerate the neural retina following injury, a process achieved primarily by the retinal pigment epithelium (RPE). To deliver exogenous genes to the RPE for genetic manipulation of regenerative events, we isolated the newt RPE65 promoter region by genome walking. First, we cloned the 2.8 kb RPE65 promoter from the newt, Cynops pyrrhogaster. Sequence analysis revealed several conserved regulatory elements described previously in mouse and human RPE65 promoters. Second, having previously established an I-SceI-mediated transgenic protocol for the newt, we used it here to examine the -657 bp proximal promoter of RPE65. The promoter assay used with F0 transgenic newts confirmed transgene expression of mCherry fluorescent protein in the RPE. Using bioinformatic tools and the TRANSFAC database, we identified a 340 bp CpG island located between -635 and -296 bp in the promoter; this region contains response elements for the microphthalmia-associated transcription factor known as MITF (CACGTG, CATGTG), and E-boxes (CANNTG). Sex-determining region box 9 (or SOX9) response element previously reported in the regulation of RPE genes (including RPE65) was also identified in the newt RPE65 promoter. Third, we identified DNA motif boxes in the newt RPE65 promoter that are conserved among other vertebrates. The newt RPE65 promoter is an invaluable tool for site-specific delivery of exogenous genes or genetic manipulation systems for the study of retinal regeneration in this animal.
Graw, J; Liebstein, A; Pietrowski, D; Schmitt-John, T; Werner, T
1993-12-22
The murine genes, gamma B-cry and gamma C-cry, encoding the gamma B- and gamma C-crystallins, were isolated from a genomic DNA library. The complete nucleotide (nt) sequences of both genes were determined from 661 and 711 bp, respectively, upstream from the first exon to the corresponding polyadenylation sites, comprising more than 2650 and 2890 bp, respectively. The new sequences were compared to the partial cDNA sequences available for the murine gamma B-cry and gamma C-cry, as well as to the corresponding genomic sequences from rat and man, at both the nt and predicted amino acid (aa) sequence levels. In the gamma B-cry promoter region, a canonical CCAAT-box, a TATA-box, putative NF-I and C/EBP sites were detected. An R-repeat is inserted 366 bp upstream from the transcription start point. In contrast, the gamma C-cry promoter does not contain a CCAAT-box, but some other putative binding sites for transcription factors (AP-2, UBP-1, LBP-1) were located by computer analysis. The promoter regions of all six gamma-cry from mouse, rat and human, except human psi gamma F-cry, were analyzed for common sequence elements. A complex sequence element of about 70-80 bp was found in the proximal promoter, which contains a gamma-cry-specific and almost invariant sequence (crygpel) of 14 nt, and ends with the also invariant TATA-box. Within the complex sequence element, a minimum of three further features specific for the gamma A-, gamma B- and gamma D/E/F-cry genes can be defined, at least two of which were recently shown to be functional. In addition to these four sequence elements, a subtype-specific structure of inverted repeats with different-sized spacers can be deduced from the multiple sequence alignment. A phylogenetic analysis based on the promoter region, as well as the complete exon 3 of all gamma-cry from mouse, rat and man, suggests separation of only five gamma-cry subtypes (gamma A-, gamma B-, gamma C-, gamma D- and gamma E/F-cry) prior to species separation.
In, K H; Asano, K; Beier, D; Grobholz, J; Finn, P W; Silverman, E K; Silverman, E S; Collins, T; Fischer, A R; Keith, T P; Serino, K; Kim, S W; De Sanctis, G T; Yandava, C; Pillari, A; Rubin, P; Kemp, J; Israel, E; Busse, W; Ledford, D; Murray, J J; Segal, A; Tinkleman, D; Drazen, J M
1997-01-01
Five lipoxygenase (5-LO) is the first committed enzyme in the metabolic pathway leading to the synthesis of the leukotrienes. We examined genomic DNA isolated from 25 normal subjects and 31 patients with asthma (6 of whom had aspirin-sensitive asthma) for mutations in the known transcription factor binding regions and the protein encoding region of the 5-LO gene. A family of mutations in the G + C-rich transcription factor binding region was identified consisting of the deletion of one, deletion of two, or addition of one zinc finger (Sp1/Egr-1) binding sites in the region 176 to 147 bp upstream from the ATG translation start site where there are normally 5 Sp1 binding motifs in tandem. Reporter gene activity directed by any of the mutant forms of the transcription factor binding region was significantly (P < 0.05) less effective than the activity driven by the wild type transcription factor binding region. Electrophoretic mobility shift assays (EMSAs) demonstrated the capacity of wild type and mutant transcription factor binding regions to bind nuclear extracts from human umbilical vein endothelial cells (HUVECs). These data are consistent with a family of mutations in the 5-LO gene that can modify reporter gene transcription possibly through differences in Sp1 and Egr-1 transactivation. PMID:9062372
Combgap Promotes Ovarian Niche Development and Chromatin Association of EcR-Binding Regions in BR-C.
Hitrik, Anna; Popliker, Malka; Gancz, Dana; Mukamel, Zohar; Lifshitz, Aviezer; Schwartzman, Omer; Tanay, Amos; Gilboa, Lilach
2016-11-01
The development of niches for tissue-specific stem cells is an important aspect of stem cell biology. Determination of niche size and niche numbers during organogenesis involves precise control of gene expression. How this is achieved in the context of a complex chromatin landscape is largely unknown. Here we show that the nuclear protein Combgap (Cg) supports correct ovarian niche formation in Drosophila by controlling ecdysone-Receptor (EcR)- mediated transcription and long-range chromatin contacts in the broad locus (BR-C). Both cg and BR-C promote ovarian growth and the development of niches for germ line stem cells. BR-C levels were lower when Combgap was either reduced or over-expressed, indicating an intricate regulation of the BR-C locus by Combgap. Polytene chromosome stains showed that Cg co-localizes with EcR, the major regulator of BR-C, at the BR-C locus and that EcR binding to chromatin was sensitive to changes in Cg levels. Proximity ligation assay indicated that the two proteins could reside in the same complex. Finally, chromatin conformation analysis revealed that EcR-bound regions within BR-C, which span ~30 KBs, contacted each other. Significantly, these contacts were stabilized in an ecdysone- and Combgap-dependent manner. Together, these results highlight Combgap as a novel regulator of chromatin structure that promotes transcription of ecdysone target genes and ovarian niche formation.
Combgap Promotes Ovarian Niche Development and Chromatin Association of EcR-Binding Regions in BR-C
Gancz, Dana; Lifshitz, Aviezer; Tanay, Amos
2016-01-01
The development of niches for tissue-specific stem cells is an important aspect of stem cell biology. Determination of niche size and niche numbers during organogenesis involves precise control of gene expression. How this is achieved in the context of a complex chromatin landscape is largely unknown. Here we show that the nuclear protein Combgap (Cg) supports correct ovarian niche formation in Drosophila by controlling ecdysone-Receptor (EcR)- mediated transcription and long-range chromatin contacts in the broad locus (BR-C). Both cg and BR-C promote ovarian growth and the development of niches for germ line stem cells. BR-C levels were lower when Combgap was either reduced or over-expressed, indicating an intricate regulation of the BR-C locus by Combgap. Polytene chromosome stains showed that Cg co-localizes with EcR, the major regulator of BR-C, at the BR-C locus and that EcR binding to chromatin was sensitive to changes in Cg levels. Proximity ligation assay indicated that the two proteins could reside in the same complex. Finally, chromatin conformation analysis revealed that EcR-bound regions within BR-C, which span ~30 KBs, contacted each other. Significantly, these contacts were stabilized in an ecdysone- and Combgap-dependent manner. Together, these results highlight Combgap as a novel regulator of chromatin structure that promotes transcription of ecdysone target genes and ovarian niche formation. PMID:27846223
DOE Office of Scientific and Technical Information (OSTI.GOV)
Xu, Yu, E-mail: xuyu1001@gmail.com; Hubei Key Laboratory of Tumor Biological Behaviors and Hubei Cancer Clinical Study Center, 169 Donghu Road, Wuhan 430071; Liu, Zhengchun, E-mail: l135027@126.com
Highlights: {yields} A novel chimeric promoter consisting of CArG element and hTERT promoter was developed. {yields} The promoter was characterized with radiation-inducibility and tumor-specificity. {yields} Suicide gene system driven by the promoter showed remarkable cytotoxicity in vitro. {yields} Co-expression of IL12 enhanced the promoter mediated suicide gene therapy in vivo. -- Abstract: The human telomerase reverse transcriptase (hTERT) promoter has been widely used in target gene therapy of cancer. However, low transcriptional activity limited its clinical application. Here, we designed a novel dual radiation-inducible and tumor-specific promoter system consisting of CArG elements and the hTERT promoter, resulting in increased expressionmore » of reporter genes after gamma-irradiation. Therapeutic and side effects of adenovirus-mediated horseradish peroxidase (HRP)/indole-3-acetic (IAA) system downstream of the chimeric promoter were evaluated in mice bearing Lewis lung carcinoma, combining with or without adenovirus-mediated interleukin 12 (IL12) gene driven by the cytomegalovirus promoter. The combination treatment showed more effective suppression of tumor growth than those with single agent alone, being associated with pronounced intratumoral T-lymphocyte infiltration and minor side effects. Our results suggest that the combination treatment with HRP/IAA system driven by the novel chimeric promoter and the co-expression of IL12 might be an effective and safe target gene therapy strategy of cancer.« less
Clinical significance of miRNA host gene promoter methylation in prostate cancer.
Daniunaite, Kristina; Dubikaityte, Monika; Gibas, Povilas; Bakavicius, Arnas; Rimantas Lazutka, Juozas; Ulys, Albertas; Jankevicius, Feliksas; Jarmalaite, Sonata
2017-07-01
Only a part of prostate cancer (PCa) patients has aggressive malignancy requiring adjuvant treatment after radical prostatectomy (RP). Biomarkers capable to predict biochemical PCa recurrence (BCR) after RP would significantly improve preoperative risk stratification and treatment decisions. MicroRNA (miRNA) deregulation has recently emerged as an important phenomenon in tumor development and progression, however, the mechanisms remain largely unstudied. In the present study, based on microarray profiling of DNA methylation in 9 pairs of PCa and noncancerous prostate tissues (NPT), host genes of miR-155-5p, miR-152-3p, miR-137, miR-31-5p, and miR-642a, -b were analyzed for promoter methylation in 129 PCa, 35 NPT, and 17 benign prostatic hyperplasia samples (BPH) and compared to the expression of mature miRNAs and their selected targets (DNMT1, KDM1A, and KDM5B). The Cancer Genome Atlas dataset was utilized for validation. Methylation of mir-155, mir-152, and mir-137 host genes was PCa-specific, and downregulation of miR-155-5p significantly correlated with promoter methylation. Higher KDM5B expression was observed in samples with methylated mir-155 or mir-137 promoters, whereas upregulation of KDM1A and DNMT1 was associated with mir-155 and mir-152 methylation status, respectively. Promoter methylation of mir-155, mir-152, and mir-31 was predictive of BCR-free survival in various Cox models and increased the prognostic value of clinicopathologic factors. In conclusion, methylated mir-155, mir-152, mir-137, and mir-31 host genes are promising diagnostic and/or prognostic biomarkers of PCa. Methylation status of particular miRNA host genes as independent variables or in combinations might assist physicians in identifying poor prognosis PCa patients preoperatively. © The Author 2017. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.
Casein Kinase II Regulation of the Hot1 Transcription Factor Promotes Stochastic Gene Expression*
Burns, Laura T.; Wente, Susan R.
2014-01-01
In Saccharomyces cerevisiae, Hog1 MAPK is activated and induces a transcriptional program in response to hyperosmotic stress. Several Hog1-responsive genes exhibit stochastic transcription, resulting in cell-to-cell variability in mRNA and protein levels. However, the mechanisms governing stochastic gene activity are not fully defined. Here we uncover a novel role for casein kinase II (CK2) in the cellular response to hyperosmotic stress. CK2 interacts with and phosphorylates the Hot1 transcription factor; however, Hot1 phosphorylation is not sufficient for controlling the stochastic response. The CK2 protein itself is required to negatively regulate mRNA expression of Hot1-responsive genes and Hot1 enrichment at target promoters. Single-cell gene expression analysis reveals altered activation of Hot1-targeted STL1 in ck2 mutants, resulting in a bimodal to unimodal shift in expression. Together, this work reveals a novel CK2 function during the hyperosmotic stress response that promotes cell-to-cell variability in gene expression. PMID:24817120
Shalaby, Sally M; El-Shal, Amal S; Abdelaziz, Lobna A; Abd-Elbary, Eman; Khairy, Mostafa M
2018-02-20
Rectal cancer involves one-third of colorectal cancers (CRCs). Recently, data supported that DNA methylation have a role in CRC pathogenesis. In the present study we aimed to analyze the methylation status of MGMT and ERCC1 promoter regions in blood and tissue of patients with benign and malignant rectal tumors. We also studied the methylated MGMT and ERCC1 genes and their relations with clinicopathological features. Furthermore, we suggested that methylation may play a critical function in the regulation of MGMT and ERCC1 expression. Fifty patients with non-metastatic cancer rectum and 43 patients with benign rectal lesions were involved in the study. DNA extraction from blood and rectal specimens was done to analyze the methylation status of MGMT and ERCC1 genes by methylation-specific PCR method. RNA was extracted also to determine the expression levels of these genes by real time-PCR. The frequency of MGMT and ERCC1 methylation was significantly higher in rectum cancers than in benign tumors both for the tissue and the blood (p<0.001). There was no relation between MGMT or ERCC1 methylation and clinicopathological features; while they were correlated with the response to therapy. An interesting finding that the agreement of the methylation levels in the blood and rectal tissue was classified as good (κ=0.78) for MGMT gene and as very good (κ=0.85) for ERCC1. Lastly, the MGMT and ERCC1 genes methylation was associated with down-regulation of their mRNA expression when compared with the non-methylated status. Our findings provided evidence that both blood and tumor tissue MGMT and ERCC1 methylation were associated with cancer rectum. MGMT or ERCC1 methylation in blood could be suitable non-invasive biomarkers differentiating benign and malignant rectal tumors. Furthermore, the methylation of the MGMT and ERCC1 promoter regions was associated with down-regulation of their mRNA expression. Copyright © 2017 Elsevier B.V. All rights reserved.
Nucleosome Positioning and NDR Structure at RNA Polymerase III Promoters
NASA Astrophysics Data System (ADS)
Helbo, Alexandra Søgaard; Lay, Fides D.; Jones, Peter A.; Liang, Gangning; Grønbæk, Kirsten
2017-02-01
Chromatin is structurally involved in the transcriptional regulation of all genes. While the nucleosome positioning at RNA polymerase II (pol II) promoters has been extensively studied, less is known about the chromatin structure at pol III promoters in human cells. We use a high-resolution analysis to show substantial differences in chromatin structure of pol II and pol III promoters, and between subtypes of pol III genes. Notably, the nucleosome depleted region at the transcription start site of pol III genes extends past the termination sequences, resulting in nucleosome free gene bodies. The +1 nucleosome is located further downstream than at pol II genes and furthermore displays weak positioning. The variable position of the +1 location is seen not only within individual cell populations and between cell types, but also between different pol III promoter subtypes, suggesting that the +1 nucleosome may be involved in the transcriptional regulation of pol III genes. We find that expression and DNA methylation patterns correlate with distinct accessibility patterns, where DNA methylation associates with the silencing and inaccessibility at promoters. Taken together, this study provides the first high-resolution map of nucleosome positioning and occupancy at human pol III promoters at specific loci and genome wide.
Lack of death receptor 4 (DR4) expression through gene promoter methylation in gastric carcinoma.
Lee, Kyung Hwa; Lim, Sang Woo; Kim, Ho Gun; Kim, Dong Yi; Ryu, Seong Yeob; Joo, Jae Kyun; Kim, Jung Chul; Lee, Jae Hyuk
2009-07-01
To determine the underlying mechanism for the differential expression, the extent of promoter methylation in tumor necrosis factor-related apoptosis-inducing ligand (TRAIL)-related genes acting downstream of TRAIL was examined in early and advanced gastric carcinomas. The extent of promoter methylation in the DR4, DR5, DcR1, DcR2, and CASP8 genes was quantified using bisulfite modification and methylation-specific polymerase chain reaction. The promoters for DcR1, DcR2, and CASP8 were largely unmethylated in early gastric carcinoma, advanced gastric carcinoma, and controls, with no significant difference among them. Protein levels of DR4, DcR1, and DcR2 as revealed by immunohistochemistry correlated with the extent of the respective promoter methylation (P < 0.05 in all cases). Hypomethylation, rather than hypermethylation, of the DR4 promoter was noted in invasive gastric malignancies, with statistical significance (P = 0.003). The promoter methylation status of TRAIL receptors in gastric carcinoma may have clinical implications for improving therapeutic strategies in patients with gastric carcinoma.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Lee Jialing; Klase, Zachary; Gao Xiaoqi
An AT-rich region of the human cytomegalovirus (CMV) genome between the UL127 open reading frame and the major immediate-early (MIE) enhancer is referred to as the unique region (UR). It has been shown that the UR represses activation of transcription from the UL127 promoter and functions as a boundary between the divergent UL127 and MIE genes during human CMV infection [Angulo, A., Kerry, D., Huang, H., Borst, E.M., Razinsky, A., Wu, J., Hobom, U., Messerle, M., Ghazal, P., 2000. Identification of a boundary domain adjacent to the potent human cytomegalovirus enhancer that represses transcription of the divergent UL127 promoter. J.more » Virol. 74 (6), 2826-2839; Lundquist, C.A., Meier, J.L., Stinski, M.F., 1999. A strong negative transcriptional regulatory region between the human cytomegalovirus UL127 gene and the major immediate-early enhancer. J. Virol. 73 (11), 9039-9052]. A putative forkhead box-like (FOX-like) site, AAATCAATATT, was identified in the UR and found to play a key role in repression of the UL127 promoter in recombinant virus-infected cells [Lashmit, P.E., Lundquist, C.A., Meier, J.L., Stinski, M.F., 2004. Cellular repressor inhibits human cytomegalovirus transcription from the UL127 promoter. J. Virol. 78 (10), 5113-5123]. However, the cellular factors which associate with the UR and FOX-like region remain to be determined. We reported previously that pancreatic-duodenal homeobox factor-1 (PDX1) bound to a 45-bp element located within the UR [Chao, S.H., Harada, J.N., Hyndman, F., Gao, X., Nelson, C.G., Chanda, S.K., Caldwell, J.S., 2004. PDX1, a Cellular Homeoprotein, Binds to and Regulates the Activity of Human Cytomegalovirus Immediate Early Promoter. J. Biol. Chem. 279 (16), 16111-16120]. Here we demonstrate that two additional cellular homeoproteins, special AT-rich sequence binding protein 1 (SATB1) and CCAAT displacement protein (CDP), bind to the human CMV UR in vitro and in vivo. Furthermore, CDP is identified as a FOX-like binding
The myotonic dystrophy kinase 3{prime}-untranslated region and its effect on gene expression
DOE Office of Scientific and Technical Information (OSTI.GOV)
Ang, C.W.Y.; Sabourin, L.A.; Narang, M.A.
1994-09-01
Myotonic dystrophy (DM) is an autosomal dominant neuromuscular disease involving the expansion of an unstable CTG repeat in the 3{prime}-untranslated (3{prime}-UTR) region of the DM kinase (DMK) gene. Increased levels of mRNA in congenital compared to normal tissue have been shown, suggesting elevated DMK levels may be responsible for the disease phenotype. To study the effect of the DMK 3{prime}UTR on gene expression, a reporter gene system was constructed using the constitutive CMV promoter with the chloramphenicol acetyl transferase (CAT) open reading frame and the DMK 3{prime}UTR containing from 5 repeats up to 90 repeats. Transient transfection into a rhabdomyosarcomamore » cell line shows a three-fold increase in CAT activity from constructs containing a wildtype 3{prime}UTR (5 and 20 repeats) compared to a control construct containing only a poly(A) signal. Reporter constructs with repeats in the protomutation (50 repeats) and mutation (90 repeats) range show a greater than 10-fold increase over control CAT activity. These results suggest the presence of elements in the DMK 3{prime}UTR capable of conferring increased gene expression. We are currently investigating cell-specific activity of the constructs and conducting deletion mapping to identify regulatory elements in the 3{prime}-UTR.« less
Gévry, Nicolas; Adam, Maryse; Blanchette, Mathieu
2005-01-01
H2A.Z is an evolutionary conserved histone variant involved in transcriptional regulation, antisilencing, silencing, and genome stability. The mechanism(s) by which H2A.Z regulates these various biological functions remains poorly defined, in part due to the lack of knowledge regarding its physical location along chromosomes and the bearing it has in regulating chromatin structure. Here we mapped H2A.Z across the yeast genome at an approximately 300-bp resolution, using chromatin immunoprecipitation combined with tiling microarrays. We have identified 4,862 small regions—typically one or two nucleosomes wide—decorated with H2A.Z. Those “Z loci” are predominantly found within specific nucleosomes in the promoter of inactive genes all across the genome. Furthermore, we have shown that H2A.Z can regulate nucleosome positioning at the GAL1 promoter. Within HZAD domains, the regions where H2A.Z shows an antisilencing function, H2A.Z is localized in a wider pattern, suggesting that the variant histone regulates a silencing and transcriptional activation via different mechanisms. Our data suggest that the incorporation of H2A.Z into specific promoter-bound nucleosomes configures chromatin structure to poise genes for transcriptional activation. The relevance of these findings to higher eukaryotes is discussed. PMID:16248679
2010-01-01
Background Carotenoids are a group of C40 isoprenoid molecules that play diverse biological and ecological roles in plants. Tomato is an important vegetable in human diet and provides the vitamin A precursor β-carotene. Genes encoding enzymes involved in carotenoid biosynthetic pathway have been cloned. However, regulation of genes involved in carotenoid biosynthetic pathway and accumulation of specific carotenoid in chromoplasts are not well understood. One of the approaches to understand regulation of carotenoid metabolism is to characterize the promoters of genes encoding proteins involved in carotenoid metabolism. Lycopene β-cyclase is one of the crucial enzymes in carotenoid biosynthesis pathway in plants. Its activity is required for synthesis of both α-and β-carotenes that are further converted into other carotenoids such as lutein, zeaxanthin, etc. This study describes the isolation and characterization of chromoplast-specific Lycopene β-cyclase (CYC-B) promoter from a green fruited S. habrochaites genotype EC520061. Results A 908 bp region upstream to the initiation codon of the Lycopene β-cyclase gene was cloned and identified as full-length promoter. To identify promoter region necessary for regulating developmental expression of the ShCYC-B gene, the full-length promoter and its three different 5' truncated fragments were cloned upstream to the initiation codon of GUS reporter cDNA in binary vectors. These four plant transformation vectors were separately transformed in to Agrobacterium. Agrobacterium-mediated transient and stable expression systems were used to study the GUS expression driven by the full-length promoter and its 5' deletion fragments in tomato. The full-length promoter showed a basal level activity in leaves, and its expression was upregulated > 5-fold in flowers and fruits in transgenic tomato plants. Deletion of -908 to -577 bp 5' to ATG decreases the ShCYC-B promoter strength, while deletion of -908 to -437 bp 5' to ATG led to
Osakabe, Yuriko; Osakabe, Keishi; Chiang, Vincent L
2009-01-01
We characterized promoter activity of a phenylpropanoid biosynthetic gene encoding 4-coumarate Co-A ligase (4CL), Pta4Clalpha, from Pinus taeda. Histochemical- and quantitative assays of GUS expression in the vascular tissue were performed using transgenic tobacco plants expressing promoter-GUS reporters. Deletion analysis of the Pta4Clalpha promoter showed that the region -524 to -252, which has two AC elements, controls the high expression levels in ray-parenchyma cells of older tobacco stems. High activity level of the promoter domain of Pta4CLalpha was also detected in the xylem cells under bending stress. DNA-protein complexes were detected in the reactions of the Pta4CLalpha promoter fragments with the nuclear proteins of xylem of P. taeda. The AC elements in the Pta4CLalpha promoter appeared to have individual roles during xylem development that are activated in a coordinated manner in response to stress in transgenic tobacco.
Gadd45a opens up the promoter regions of miR-295 facilitating pluripotency induction
Li, Linpeng; Chen, Keshi; Wu, Yi; Long, Qi; Zhao, Danyun; Ma, Bochao; Pei, Duanqing; Liu, Xingguo
2017-01-01
MicroRNAs (miRNAs) play crucial roles in the establishment of pluripotent state by controlling pluripotent network. However, the molecular mechanisms controlling miRNAs during somatic cell reprogramming remain obscure. In this study, we show Gadd45a (growth arrest and DNA-damage-inducible protein 45a) enhances reprogramming by activating miR-295. Furthermore, we show that Gadd45a binds the promoter regions of miR-295. Nuclease accessibility assay indicates that Gadd45a opens the promoter regions of miR-295. Levels of H3K9Ac and H3K27Ac on the promoter regions of miR-295 were also increased. In conclusion, our results indicate that Gadd45a relaxes the promoter regions of miR-295 and promotes the expression of miR-295 during reprogramming, implying a concise mechanism of Gadd45a and miR-290 cluster cooperation in cell-fate determination. PMID:29022923
Conserved Role of Intragenic DNA Methylation in Regulating Alternative Promoters
Maunakea, Alika K.; Nagarajan, Raman P.; Bilenky, Mikhail; Ballinger, Tracy J.; D’Souza, Cletus; Fouse, Shaun D.; Johnson, Brett E.; Hong, Chibo; Nielsen, Cydney; Zhao, Yongjun; Turecki, Gustavo; Delaney, Allen; Varhol, Richard; Thiessen, Nina; Shchors, Ksenya; Heine, Vivi M.; Rowitch, David H.; Xing, Xiaoyun; Fiore, Chris; Schillebeeckx, Maximiliaan; Jones, Steven J.M.; Haussler, David; Marra, Marco A.; Hirst, Martin; Wang, Ting; Costello, Joseph F.
2014-01-01
While the methylation of DNA in 5′ promoters suppresses gene expression, the role of DNA methylation in gene bodies is unclear1–5. In mammals, tissue- and cell type-specific methylation is present in a small percentage of 5′ CpG island (CGI) promoters, while a far greater proportion occurs across gene bodies, coinciding with highly conserved sequences5–10. Tissue-specific intragenic methylation might reduce,3 or, paradoxically, enhance transcription elongation efficiency1,2,4,5. Capped analysis of gene expression (CAGE) experiments also indicate that transcription commonly initiates within and between genes11–15. To investigate the role of intragenic methylation, we generated a map of DNA methylation from human brain encompassing 24.7 million of the 28 million CpG sites. From the dense, high-resolution coverage of CpG islands, the majority of methylated CpG islands were revealed to be in intragenic and intergenic regions, while less than 3% of CpG islands in 5′ promoters were methylated. The CpG islands in all three locations overlapped with RNA markers of transcription initiation, and unmethylated CpG islands also overlapped significantly with trimethylation of H3K4, a histone modification enriched at promoters16. The general and CpG-island-specific patterns of methylation are conserved in mouse tissues. An in-depth investigation of the human SHANK3 locus17,18 and its mouse homologue demonstrated that this tissue-specific DNA methylation regulates intragenic promoter activity in vitro and in vivo. These methylation-regulated, alternative transcripts are expressed in a tissue and cell type-specific manner, and are expressed differentially within a single cell type from distinct brain regions. These results support a major role for intragenic methylation in regulating cell context-specific alternative promoters in gene bodies. PMID:20613842
Tabor, S; Richardson, C C
1985-01-01
The RNA polymerase gene of bacteriophage T7 has been cloned into the plasmid pBR322 under the inducible control of the lambda PL promoter. After induction, T7 RNA polymerase constitutes 20% of the soluble protein of Escherichia coli, a 200-fold increase over levels found in T7-infected cells. The overproduced enzyme has been purified to homogeneity. During extraction the enzyme is sensitive to a specific proteolysis, a reaction that can be prevented by a modification of lysis conditions. The specificity of T7 RNA polymerase for its own promoters, combined with the ability to inhibit selectively the host RNA polymerase with rifampicin, permits the exclusive expression of genes under the control of a T7 RNA polymerase promoter. We describe such a coupled system and its use to express high levels of phage T7 gene 5 protein, a subunit of T7 DNA polymerase. Images PMID:3156376
NASA Astrophysics Data System (ADS)
Sandoval, V.; Barton, K.; Longhurst, A.
2012-12-01
Revoluta (Rev) is a transcription factor that establishes leaf polarity inArabidopsis thaliana. Through previous work in Dr. Barton's Lab, it is known that Revoluta binds to the ZPR3 promoter, thus activating the ZPR3 gene product inArabidopsis thaliana. Using this knowledge, two separate DNA constructs were made, one carrying revgene and in the other, the ZPR3 promoter fussed with the GUS gene. When inoculated in Nicotiana benthimiana (tobacco), the pMDC32 plasmid produces the Rev protein. Rev binds to the ZPR3 promoter thereby activating the transcription of the GUS gene, which can only be expressed in the presence of Rev. When GUS protein comes in contact with X-Gluc it produce the blue stain seen (See Figure 1). In the past, variability has been seen of GUS expression on tobacco therefore we hypothesized that changing the growing conditions and leaf age might improve how well it's expressed.
Regulation of a mammalian gene bearing a CpG island promoter and a distal enhancer.
Berrozpe, Georgina; Bryant, Gene O; Warpinski, Katherine; Ptashne, Mark
2013-08-15
A quantitative nucleosome occupancy assay revealed rules for nucleosome disposition in yeast and showed how disposition affects regulation of the GAL genes. Here, we show how those findings apply to the control of Kit, a mammalian gene. The Kit promoter lies in a CpG island, and its enhancer (active in mast cells) lies some 150 kb upstream. Nucleosomes form with especially high avidities at the Kit promoter, a reaction that, we surmise, ensures extremely low basal expression. In mast cells, transcriptional activators displace nucleosomes that are less tightly formed at the Kit enhancer. In turn, the active enhancer replaces a single Kit promoter nucleosome with the transcriptional machinery, thereby inducing transcription over 1,000-fold. As at the yeast GAL genes, the inhibitory effects of nucleosomes facilitate high factors of induction by mammalian activators working in the absence of specific repressors. Copyright © 2013 The Authors. Published by Elsevier Inc. All rights reserved.
Tripathi, Prateek; Rabara, Roel C; Reese, R Neil; Miller, Marissa A; Rohila, Jai S; Subramanian, Senthil; Shen, Qingxi J; Morandi, Dominique; Bücking, Heike; Shulaev, Vladimir; Rushton, Paul J
2016-02-09
The purpose of this project was to identify metabolites, proteins, genes, and promoters associated with water stress responses in soybean. A number of these may serve as new targets for the biotechnological improvement of drought responses in soybean (Glycine max). We identified metabolites, proteins, and genes that are strongly up or down regulated during rapid water stress following removal from a hydroponics system. 163 metabolites showed significant changes during water stress in roots and 93 in leaves. The largest change was a root-specific 160-fold increase in the coumestan coumestrol making it a potential biomarker for drought and a promising target for improving drought responses. Previous reports suggest that coumestrol stimulates mycorrhizal colonization and under certain conditions mycorrhizal plants have improved drought tolerance. This suggests that coumestrol may be part of a call for help to the rhizobiome during stress. About 3,000 genes were strongly up-regulated by drought and we identified regulators such as ERF, MYB, NAC, bHLH, and WRKY transcription factors, receptor-like kinases, and calcium signaling components as potential targets for soybean improvement as well as the jasmonate and abscisic acid biosynthetic genes JMT, LOX1, and ABA1. Drought stressed soybean leaves show reduced mRNA levels of stomatal development genes including FAMA-like, MUTE-like and SPEECHLESS-like bHLH transcription factors and leaves formed after drought stress had a reduction in stomatal density of 22.34 % and stomatal index of 17.56 %. This suggests that reducing stomatal density may improve drought tolerance. MEME analyses suggest that ABRE (CACGT/CG), CRT/DRE (CCGAC) and a novel GTGCnTGC/G element play roles in transcriptional activation and these could form components of synthetic promoters to drive expression of transgenes. Using transformed hairy roots, we validated the increase in promoter activity of GmWRKY17 and GmWRKY67 during dehydration and after 20
Man, Michal; Epel, Bernard L
2004-06-01
A replicon based on Tobacco mosaic virus that was engineered to express the open reading frame (ORF) of the green fluorescent protein (GFP) gene in place of the native coat protein (CP) gene from a minimal CP subgenomic (sg) RNA promoter was found to accumulate very low levels of GFP. Regulatory regions within the CP ORF were identified that, when presented as untranslated regions flanking the GFP ORF, enhanced or inhibited sg transcription and GFP expression. Full GFP expression from the CP sgRNA promoter required more than the first 20 nt of the CP ORF but not beyond the first 56 nt. Further analysis indicated the presence of an enhancer element between nt +25 and +55 with respect to the CP translation start site. The inclusion of this enhancer sequence upstream of the GFP ORF led to elevated sg transcription and to a 50-fold increase in GFP accumulation in comparison with a minimal CP promoter in which the entire CP ORF was displaced by the GFP ORF. Inclusion of the 3'-terminal 22 nt had a minor positive effect on GFP accumulation, but the addition of extended untranslated sequences from the 3' terminus of the CP ORF downstream of the GFP ORF was basically found to inhibit sg transcription. Secondary structure analysis programs predicted the CP sgRNA promoter to reside within two stable stem-loop structures, which are followed by an enhancer region.
Sequences in the intergenic spacer influence RNA Pol I transcription from the human rRNA promoter
DOE Office of Scientific and Technical Information (OSTI.GOV)
Li, W.M.; Sylvester, J.E.
1994-09-01
In most eucaryotic species, ribosomal genes are tandemly repeated about 100-5000 times per haploid genome. The 43 Kb human rDNA repeat consists of a 13 Kb coding region for the 18S, 5.8S, 28S ribosomal RNAs (rRNAs) and transcribed spacers separated by a 30 Kb intergenic spacer. For species such as frog, mouse and rat, sequences in the intergenic spacer other than the gene promoter have been shown to modulate transcription of the ribosomal gene. These sequences are spacer promoters, enhancers and the terminator for spacer transcription. We are addressing whether the human ribosomal gene promoter is similarly influenced. In-vitro transcriptionmore » run-off assays have revealed that the 4.5 kb region (CBE), directly upstream of the gene promoter, has cis-stimulation and trans-competition properties. This suggests that the CBE fragment contains an enhancer(s) for ribosomal gene transcription. Further experiments have shown that a fragment ({approximately}1.6 kb) within the CBE fragment also has trans-competition function. Deletion subclones of this region are being tested to delineate the exact sequences responsible for these modulating activities. Previous sequence analysis and functional studies have revealed that CBE contains regions of DNA capable of adopting alternative structures such as bent DNA, Z-DNA, and triple-stranded DNA. Whether these structures are required for modulating transcription remains to be determined as does the specific DNA-protein interaction involved.« less
Chymkowitch, Pierre; Nguéa, Aurélie P; Aanes, Håvard; Koehler, Christian J; Thiede, Bernd; Lorenz, Susanne; Meza-Zepeda, Leonardo A; Klungland, Arne; Enserink, Jorrit M
2015-06-01
Transcription factors are abundant Sumo targets, yet the global distribution of Sumo along the chromatin and its physiological relevance in transcription are poorly understood. Using Saccharomyces cerevisiae, we determined the genome-wide localization of Sumo along the chromatin. We discovered that Sumo-enriched genes are almost exclusively involved in translation, such as tRNA genes and ribosomal protein genes (RPGs). Genome-wide expression analysis showed that Sumo positively regulates their transcription. We also discovered that the Sumo consensus motif at RPG promoters is identical to the DNA binding motif of the transcription factor Rap1. We demonstrate that Rap1 is a molecular target of Sumo and that sumoylation of Rap1 is important for cell viability. Furthermore, Rap1 sumoylation promotes recruitment of the basal transcription machinery, and sumoylation of Rap1 cooperates with the target of rapamycin kinase complex 1 (TORC1) pathway to promote RPG transcription. Strikingly, our data reveal that sumoylation of Rap1 functions in a homeostatic feedback loop that sustains RPG transcription during translational stress. Taken together, Sumo regulates the cellular translational capacity by promoting transcription of tRNA genes and RPGs. © 2015 Chymkowitch et al.; Published by Cold Spring Harbor Laboratory Press.
Cloning of cardiac, kidney, and brain promoters of the feline ncx1 gene.
Barnes, K V; Cheng, G; Dawson, M M; Menick, D R
1997-04-25
The Na+-Ca2+ exchanger (NCX1) plays a major role in calcium efflux and therefore in the control and regulation of intracellular calcium in the heart. The exchanger has been shown to be regulated at several levels including transcription. NCX1 mRNA levels are up-regulated in both cardiac hypertrophy and failure. In this work, the 5'-end of the ncx1 gene has been cloned to study the mechanisms that mediate hypertrophic stimulation and cardiac expression. The feline ncx1 gene has three exons that encode 5'-untranslated sequences that are under the control of three tissue-specific promoters. The cardiac promoter drives expression in cardiocytes, but not in mouse L cells. Although it contains at least one enhancer (-2000 to -1250 base pairs (bp)) and one or more negative elements (-1250 to -250 bp), a minimum promoter (-250 to +200 bp) is sufficient for cardiac expression and alpha-adrenergic stimulation.
Halophytes: Potential Resources for Salt Stress Tolerance Genes and Promoters.
Mishra, Avinash; Tanna, Bhakti
2017-01-01
Halophytes have demonstrated their capability to thrive under extremely saline conditions and thus considered as one of the best germplasm for saline agriculture. Salinity is a worldwide problem, and the salt-affected areas are increasing day-by-day because of scanty rainfall, poor irrigation system, salt ingression, water contamination, and other environmental factors. The salinity stress tolerance mechanism is a very complex phenomenon, and some pathways are coordinately linked for imparting salinity tolerance. Though a number of salt responsive genes have been reported from the halophytes, there is always a quest for promising stress-responsive genes that can modulate plant physiology according to the salt stress. Halophytes such as Aeluropus, Mesembryanthemum, Suaeda, Atriplex, Thellungiella, Cakile , and Salicornia serve as a potential candidate for the salt-responsive genes and promoters. Several known genes like antiporters ( NHX, SOS, HKT, VTPase ), ion channels (Cl - , Ca 2+ , aquaporins), antioxidant encoding genes ( APX, CAT, GST, BADH, SOD ) and some novel genes such as USP, SDR1, SRP etc. were isolated from halophytes and explored for developing stress tolerance in the crop plants (glycophytes). It is evidenced that stress triggers salt sensors that lead to the activation of stress tolerance mechanisms which involve multiple signaling proteins, up- or down-regulation of several genes, and finally the distinctive or collective effects of stress-responsive genes. In this review, halophytes are discussed as an excellent platform for salt responsive genes which can be utilized for developing salinity tolerance in crop plants through genetic engineering.
Brait, Mariana; Ling, Shizhang; Nagpal, Jatin K.; Chang, Xiaofei; Park, Hannah Lui; Lee, Juna; Okamura, Jun; Yamashita, Keishi; Sidransky, David; Kim, Myoung Sook
2012-01-01
The human cysteine dioxygenase 1 (CDO1) gene is a non-heme structured, iron-containing metalloenzyme involved in the conversion of cysteine to cysteine sulfinate, and plays a key role in taurine biosynthesis. In our search for novel methylated gene promoters, we have analyzed differential RNA expression profiles of colorectal cancer (CRC) cell lines with or without treatment of 5-aza-2′-deoxycytidine. Among the genes identified, the CDO1 promoter was found to be differentially methylated in primary CRC tissues with high frequency compared to normal colon tissues. In addition, a statistically significant difference in the frequency of CDO1 promoter methylation was observed between primary normal and tumor tissues derived from breast, esophagus, lung, bladder and stomach. Downregulation of CDO1 mRNA and protein levels were observed in cancer cell lines and tumors derived from these tissue types. Expression of CDO1 was tightly controlled by promoter methylation, suggesting that promoter methylation and silencing of CDO1 may be a common event in human carcinogenesis. Moreover, forced expression of full-length CDO1 in human cancer cells markedly decreased the tumor cell growth in an in vitro cell culture and/or an in vivo mouse model, whereas knockdown of CDO1 increased cell growth in culture. Our data implicate CDO1 as a novel tumor suppressor gene and a potentially valuable molecular marker for human cancer. PMID:23028699
Qi, Jingjing; Yu, Yong; Akilli Öztürk, Özlem; Holland, Jane D; Besser, Daniel; Fritzmann, Johannes; Wulf-Goldenberg, Annika; Eckert, Klaus; Fichtner, Iduna; Birchmeier, Walter
2016-10-01
We have previously identified a 115-gene signature that characterises the metastatic potential of human primary colon cancers. The signature included the canonical Wnt target gene BAMBI, which promoted experimental metastasis in mice. Here, we identified three new direct Wnt target genes from the signature, and studied their functions in epithelial-mesenchymal transition (EMT), cell migration and experimental metastasis. We examined experimental liver metastases following injection of selected tumour cells into spleens of NOD/SCID mice. Molecular and cellular techniques were used to identify direct transcription target genes of Wnt/β-catenin signals. Microarray analyses and experiments that interfered with cell migration through inhibitors were performed to characterise downstream signalling systems. Three new genes from the colorectal cancer (CRC) metastasis signature, BOP1, CKS2 and NFIL3, were identified as direct transcription targets of β-catenin/TCF4. Overexpression and knocking down of these genes in CRC cells promoted and inhibited, respectively, experimental metastasis in mice, EMT and cell motility in culture. Cell migration was repressed by interfering with distinct signalling systems through inhibitors of PI3K, JNK, p38 mitogen-activated protein kinase and/or mTOR. Gene expression profiling identified a series of migration-promoting genes, which were induced by BOP1, CKS2 and NFIL3, and could be repressed by inhibitors that are specific to these pathways. We identified new direct Wnt/β-catenin target genes, BOP1, CKS2 and NFIL3, which induced EMT, cell migration and experimental metastasis of CRC cells. These genes crosstalk with different downstream signalling systems, and activate migration-promoting genes. These pathways and downstream genes may serve as therapeutic targets in the treatment of CRC metastasis. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://www.bmj.com/company/products-services/rights-and-licensing/
2013-01-01
Background Vasa is a member of the DEAD-box protein family that plays an indispensable role in mammalian spermatogenesis, particularly during meiosis. Bovine vasa homology (Bvh) of Bos taurus has been reported, however, its function in bovine testicular tissue remains obscure. This study aimed to reveal the functions of Bvh and to determine whether Bvh is a candidate gene in the regulation of spermatogenesis in bovine, and to illustrate whether its transcription is regulated by alternative splicing and DNA methylation. Results Here we report the molecular characterization, alternative splicing pattern, expression and promoter methylation status of Bvh. The full-length coding region of Bvh was 2190 bp, which encodes a 729 amino acid (aa) protein containing nine consensus regions of the DEAD box protein family. Bvh is expressed only in the ovary and testis of adult cattle. Two splice variants were identified and termed Bvh-V4 (2112 bp and 703 aa) and Bvh-V45 (2040 bp and 679 aa). In male cattle, full-length Bvh (Bvh-FL), Bvh-V4 and Bvh-V45 are exclusively expressed in the testes in the ratio of 2.2:1.6:1, respectively. Real-time PCR revealed significantly reduced mRNA expression of Bvh-FL, Bvh-V4 and Bvh-V45 in testes of cattle-yak hybrids, with meiotic arrest compared with cattle and yaks with normal spermatogenesis (P < 0.01). The promoter methylation level of Bvh in the testes of cattle-yak hybrids was significantly greater than in cattle and yaks (P < 0.01). Conclusion In the present study, Bvh was isolated and characterized. These data suggest that Bvh functions in bovine spermatogenesis, and that transcription of the gene in testes were regulated by alternative splice and promoter methylation. PMID:23815438
Ludueña, Liliana M; Anzuay, Maria S; Magallanes-Noguera, Cynthia; Tonelli, Maria L; Ibañez, Fernando J; Angelini, Jorge G; Fabra, Adriana; McIntosh, Matthew; Taurian, Tania
2017-10-01
The mineral phosphate-solubilizing phenotype in bacteria is attributed predominantly to secretion of gluconic acid produced by oxidation of glucose by the glucose dehydrogenase enzyme and its cofactor, pyrroloquinoline quinone. This study analyzes pqqE gene expression and pqq promoter activity in the native phosphate-solubilizing bacterium Serratia sp S119 growing under P-limitation, and in the presence of root exudates obtained from peanut plants, also growing under P-limitation. Results indicated that Serratia sp. S119 contains a pqq operon composed of six genes (pqqA,B,C,D,E,F) and two promoters, one upstream of pqqA and other between pqqA and pqqB. PqqE gene expression and pqq promoter activity increased under P-limiting growth conditions and not under N-deficient conditions. In the plant-bacteria interaction assay, the activity of the bacterial pqq promoter region varied depending on the concentration and type of root exudates and on the bacterial growth phase. Root exudates from peanut plants growing under P-available and P-limiting conditions showed differences in their composition. It is concluded from this study that the response of Serratia sp. S119 to phosphorus limitation involves an increase in expression of pqq genes, and that molecules exuded by peanut roots modify expression of these phosphate-solubilizing bacterial genes during plant-bacteria interactions. Copyright © 2017 Institut Pasteur. Published by Elsevier Masson SAS. All rights reserved.
In silico identification of novel ligands for G-quadruplex in the c- MYC promoter
NASA Astrophysics Data System (ADS)
Kang, Hyun-Jin; Park, Hyun-Ju
2015-04-01
G-quadruplex DNA formed in NHEIII1 region of oncogene promoter inhibits transcription of the genes. In this study, virtual screening combining pharmacophore-based search and structure-based docking screening was conducted to discover ligands binding to G-quadruplex in promoter region of c- MYC. Several hit ligands showed the selective PCR-arresting effects for oligonucleotide containing c- MYC G-quadruplex forming sequence. Among them, three hits selectively inhibited cell proliferation and decreased c- MYC mRNA level in Ramos cells, where NHEIII1 is included in translocated c- MYC gene for overexpression. Promoter assay using two kinds of constructs with wild-type and mutant sequences showed that interaction of these ligands with the G-quadruplex resulted in turning-off of the reporter gene. In conclusion, combined virtual screening methods were successfully used for discovery of selective c- MYC promoter G-quadruplex binders with anticancer activity.
Zarka, Daniel G.; Vogel, Jonathan T.; Cook, Daniel; Thomashow, Michael F.
2003-01-01
The Arabidopsis CBF1, 2, and 3 genes (also known as DREB1b, c, and a, respectively) encode transcriptional activators that have a central role in cold tolerance. CBF1-3 are rapidly induced upon exposing plants to low temperature, followed by expression of CBF-targeted genes, the CBF regulon, resulting in an increase in plant freezing tolerance. At present, little is known about the cold-sensing mechanism that controls CBF expression. Results presented here indicate that this mechanism does not require a cold shock to bring about the accumulation of CBF transcripts, but instead, absolute temperature is monitored with a greater degree of input, i.e. lower temperature, resulting in a greater output, i.e. higher levels of CBF transcripts. Temperature-shift experiments also indicate that the cold-sensing mechanism becomes desensitized to a given low temperature, such as 4°C, and that resensitization to that temperature requires between 8 and 24 h at warm temperature. Gene fusion experiments identified a 125-bp section of the CBF2 promoter that is sufficient to impart cold-responsive gene expression. Mutational analysis of this cold-responsive region identified two promoter segments that work in concert to impart robust cold-regulated gene expression. These sequences, designated ICEr1 and ICEr2 (induction of CBF expression region 1 or 2), were also shown to stimulate transcription in response to mechanical agitation and the protein synthesis inhibitor, cycloheximide. PMID:14500791
Sorkina, Alina; Bardosh, Gabriel; Liu, Yong-Zhong; Fridman, Ifat; Schlizerman, Ludmila; Zur, Naftali; Or, Etti; Goldschmidt, Eliezer E; Blumwald, Eduardo; Sadka, Avi
2011-09-01
While searching for genes expressed in acid lemon but not in acidless lime pulp, we isolated clone Cl111 which showed the following expression phenotypes: (1) while it was expressed in the ovaries in both varieties, its mRNA was detected only in the pulp of the acid fruit, (2) no or very low expression of the gene was detected in vegetative organs. These expression patterns suggested that Cl111 is an ovary- and pulp-specific gene. The ability of ~2-kb fragments upstream of the transcription start site of the lemon and lime genes to confer reporter-gene activity was investigated by transient expression in isolated juice vesicles of both varieties. Whereas Cl111 promoter from lemon showed faint activity in lemon and lime juice vesicles, no activity was evident with the lime promoter. The activities of the 2-kb fragments and their delimited fragments were further investigated in tomato. The results indicated that the promoters were active in a manner similar to that in acid lemon and acidless lime: the lemon promoter generated activity in the fruit endocarp, analogous to citrus fruit pulp. The delimitation analyses identified an expression-conferring region which, in the lemon promoter, contained a sequence homologous to a fruit-specific element of the melon cucumisin gene. Another region, which reduced promoter activity, contained an I-Box-like sequence, identified as a fruit-specific negative element. Taken together, Cl111 promoter was confirmed to be pulp- and flower-specific. Differences in the expression of Cl111 between the two varieties could be attributable to changes in the gene promoter region.
Eftang, Lars Lohne; Klajic, Jovana; Kristensen, Vessela N; Tost, Jörg; Esbensen, Qin Ying; Blom, Gustav Peter; Bukholm, Ida Rashida Khan; Bukholm, Geir
2016-03-16
A large number of epigenetic alterations has been found to be implicated in the etiology of gastric cancer. We have studied the DNA methylation status of 27 500 gene promoter regions in 24 gastric adenocarcinomas from a Norwegian cohort, and aimed at identifying the hypermethylated regions. We have compared our findings to the gene expression in the same tissue, and linked our results to prognosis and survival. Biopsies from gastric adenocarcinomas and adjacent normal gastric mucosa were obtained from 24 patients following surgical resection of the tumor. Genome-wide DNA methylation profiling of the tumor and matched non-cancerous mucosa was performed. The results were compared to whole transcriptome cDNA microarray analysis of the same material. Most of the gene promoter regions in both types of tissue showed a low degree of methylation, however there was a small, but significant hypermethylation of the tumors. Hierarchical clustering showed separate grouping of the tumor and normal tissue. Hypermethylation of the promoter region of the GFRA3 gene showed a strong correlation to post-operative survival and several of the clinicopathological parameters, however no difference was found between the two main histological types of gastric cancer. There was only a modest correlation between the DNA methylation status and gene expression. The different DNA methylation clusters of the tumors and normal tissue indicate that aberrant DNA methylation is a distinct feature of gastric cancer, although there is little difference in the overall, and low, methylation levels between the two tissue types. The GFRA3 promoter region showed marked hypermethylation in almost all tumors, and its correlation with survival and other clinicopathological parameters may have important prognostic significance.