Science.gov

Sample records for gene promoter region

  1. Genetic recombination is targeted towards gene promoter regions in dogs.

    PubMed

    Auton, Adam; Rui Li, Ying; Kidd, Jeffrey; Oliveira, Kyle; Nadel, Julie; Holloway, J Kim; Hayward, Jessica J; Cohen, Paula E; Greally, John M; Wang, Jun; Bustamante, Carlos D; Boyko, Adam R

    2013-01-01

    The identification of the H3K4 trimethylase, PRDM9, as the gene responsible for recombination hotspot localization has provided considerable insight into the mechanisms by which recombination is initiated in mammals. However, uniquely amongst mammals, canids appear to lack a functional version of PRDM9 and may therefore provide a model for understanding recombination that occurs in the absence of PRDM9, and thus how PRDM9 functions to shape the recombination landscape. We have constructed a fine-scale genetic map from patterns of linkage disequilibrium assessed using high-throughput sequence data from 51 free-ranging dogs, Canis lupus familiaris. While broad-scale properties of recombination appear similar to other mammalian species, our fine-scale estimates indicate that canine highly elevated recombination rates are observed in the vicinity of CpG rich regions including gene promoter regions, but show little association with H3K4 trimethylation marks identified in spermatocytes. By comparison to genomic data from the Andean fox, Lycalopex culpaeus, we show that biased gene conversion is a plausible mechanism by which the high CpG content of the dog genome could have occurred.

  2. Genetic Recombination Is Targeted towards Gene Promoter Regions in Dogs

    PubMed Central

    Auton, Adam; Rui Li, Ying; Kidd, Jeffrey; Oliveira, Kyle; Nadel, Julie; Holloway, J. Kim; Hayward, Jessica J.; Cohen, Paula E.; Greally, John M.; Wang, Jun; Bustamante, Carlos D.; Boyko, Adam R.

    2013-01-01

    The identification of the H3K4 trimethylase, PRDM9, as the gene responsible for recombination hotspot localization has provided considerable insight into the mechanisms by which recombination is initiated in mammals. However, uniquely amongst mammals, canids appear to lack a functional version of PRDM9 and may therefore provide a model for understanding recombination that occurs in the absence of PRDM9, and thus how PRDM9 functions to shape the recombination landscape. We have constructed a fine-scale genetic map from patterns of linkage disequilibrium assessed using high-throughput sequence data from 51 free-ranging dogs, Canis lupus familiaris. While broad-scale properties of recombination appear similar to other mammalian species, our fine-scale estimates indicate that canine highly elevated recombination rates are observed in the vicinity of CpG rich regions including gene promoter regions, but show little association with H3K4 trimethylation marks identified in spermatocytes. By comparison to genomic data from the Andean fox, Lycalopex culpaeus, we show that biased gene conversion is a plausible mechanism by which the high CpG content of the dog genome could have occurred. PMID:24348265

  3. Functional conservation of the promoter regions of vertebrate tyrosinase genes.

    PubMed

    Sato, S; Tanaka, M; Miura, H; Ikeo, K; Gojobori, T; Takeuchi, T; Yamamoto, H

    2001-11-01

    Tyrosinase is the key enzyme for synthesizing melanin pigments, which primarily determine mammalian skin coloration. Considering the important roles of pigments in the evolution and the adaptation of vertebrates, phylogenetic changes in the coding and flanking regulatory sequences of the tyrosinase gene are particularly intriguing. We have now cloned cDNA encoding tyrosinase from Japanese quail and snapping turtle. These nonmammalian cDNA are highly homologous to those of the mouse and human tyrosinases, whereas the 5' flanking sequences are far less conserved except for a few short sequence motifs. Nevertheless, we demonstrate that the 5' flanking sequences from the quail or turtle tyrosinase genes are capable of directing the expression of a fused mouse tyrosinase cDNA when introduced into cultured mouse albino melanocytes. This experimental method, which reveals the functional conservation of regulatory sequences in one cell type (the melanocyte), may be utilized to evaluate phylogenetic differences in mechanisms controlling specific gene expression in many other types of cells. We also provide evidence that the 5' flanking sequences from these nonmammalian genes are functional in vivo by producing transgenic mice. Phylogenetic changes of vertebrate tyrosinase promoters and the possible involvement of conserved sequence motifs in melanocyte-specific expression of tyrosinase are discussed. PMID:11764277

  4. Allelic and haplotypic diversity of 5'promoter region of the MICA gene.

    PubMed

    Luo, Jia; Tian, Wei; Pan, FengHua; Liu, XueXiang; Li, LiXin

    2014-04-01

    In this study, the 5'promoter region of MHC class I chain-related gene A (MICA) was investigated in 104 healthy, unrelated Han individuals recruited from northern China, using PCR-sequencing method. Twelve variable sites were detected, which were in very strong linkage disequilibrium with each other. Twelve different MICA 5'promoter haplotypes were identified, among which Promoter-7 predominated (0.5529). Twenty-six extended haplotypes incorporating MICA 5'promoter and MICA exons 2-5 were observed in this population, 9 of which were in significant linkage disequilibrium (LD). Phylogenetic analysis of 5'promoter refined MICA sub-lineage structure previously constructed according to MICA coding and 3'untranslated regions. Ewens-Watterson homozygosity statistics at MICA 5'promoter region were consistent with neutral expectations. None of the five variable sites detected within the minimal promoter of MICA gene was located in the putative binding sites for transcription factor. Our study provided for the first time the sequence information about 5'promoter of MICA gene at a human population level. The data will facilitate the understanding of regulation of MICA gene expression, which represents a promising pathway for immune intervention against cancer, autoimmune disorders and infections.

  5. Polymorphisms in the Promoter Region of the Chinese Bovine PPARGC1A Gene

    PubMed Central

    Li, M. J.; Liu, M.; Liu, D.; Lan, X. Y.; Lei, C. Z.; Yang, D. Y.; Chen, H.

    2013-01-01

    The peroxisome proliferator-activated receptor gamma coactivator-1 alpha protein, encoded by the PPARGC1A gene, plays an important role in energy homeostasis. The genetic variations within the PPARGC1A gene promoter region were scanned in 808 Chinese native bovines belonging to three cattle breeds and yaks. A total of 6 SNPs and one 4 bp insertion variation in the promoter region of the bovine PPARGC1A gene were identified: SNP -259 T>A, -301_-298insCTTT, -915 A>G, -1175 T>G, -1590 C>T, -1665 C>T and -1690 G>A, which are in the binding sites of some important transcription factors: sex-determining region Y (SRY), myeloid-specific zinc finger-1 (MZF-1) and octamer factor 1(Oct-1). It is expected that these polymorphisms may regulate PPARGC1A gene transcription and might have consequences at a regulatory level. PMID:25049813

  6. Analysis of the sexual development-promoting region of Schizophyllum commune TRP1 gene.

    PubMed

    Sen, Kikuo; Kinoshita, Hideki; Tazuke, Kazuyuki; Maki, Yoshinori; Yoshiura, Yumi; Yakushi, Toshiharu; Shibai, Hiroshiro; Kurosawa, Shin-Ichi

    2016-10-01

    This study aims to elucidate the mechanism of sexual development of basidiomycetous mushrooms from mating to fruit body formation. Sequencing analysis showed the TRP1 gene of basidiomycete Schizophyllum commune encoded an enzyme with three catalytic regions of GAT (glutamine amidotransferase), IGPS (indole-3-glycerol phosphate synthase), and PRAI (5-phosphoribosyl anthranilate isomerase); among these three regions, the trp1 mutant (Trp(-)) had a missense mutation (L→F) of a 338th amino acid residue of the TRP1 protein within the IGPS region. To investigate the function of IGPS region related to sexual development, dikaryons with high, usual, and no expression of the IGPS region of TRP1 gene were made. The dikaryotic mycelia with high expression of the IGPS formed mature fruit bodies earlier than those with usual and no expression of the IGPS. These results showed that the IGPS region in TRP1 gene promoted sexual development of S. commune. PMID:27296855

  7. Analysis of the sexual development-promoting region of Schizophyllum commune TRP1 gene.

    PubMed

    Sen, Kikuo; Kinoshita, Hideki; Tazuke, Kazuyuki; Maki, Yoshinori; Yoshiura, Yumi; Yakushi, Toshiharu; Shibai, Hiroshiro; Kurosawa, Shin-Ichi

    2016-10-01

    This study aims to elucidate the mechanism of sexual development of basidiomycetous mushrooms from mating to fruit body formation. Sequencing analysis showed the TRP1 gene of basidiomycete Schizophyllum commune encoded an enzyme with three catalytic regions of GAT (glutamine amidotransferase), IGPS (indole-3-glycerol phosphate synthase), and PRAI (5-phosphoribosyl anthranilate isomerase); among these three regions, the trp1 mutant (Trp(-)) had a missense mutation (L→F) of a 338th amino acid residue of the TRP1 protein within the IGPS region. To investigate the function of IGPS region related to sexual development, dikaryons with high, usual, and no expression of the IGPS region of TRP1 gene were made. The dikaryotic mycelia with high expression of the IGPS formed mature fruit bodies earlier than those with usual and no expression of the IGPS. These results showed that the IGPS region in TRP1 gene promoted sexual development of S. commune.

  8. Promoters from genes for plastid proteins possess regions with different sensitivities toward red and blue light.

    PubMed Central

    Lübberstedt, T; Bolle, C E; Sopory, S; Flieger, K; Herrmann, R G; Oelmüller, R

    1994-01-01

    The light-regulated expression of eight nuclear-encoded genes for plastid proteins from spinach (Spinacia oleracea) (RBCS-1 and CAB-1; ATPC and ATPD, encoding the subunits gamma and delta of the ATP synthase; PC and FNR; PSAD and PSAF, encoding the subunits II and III of photosystem I reaction center) was analyzed with promoter/beta-glucuronidase (GUS) gene fusions in transgenic tobacco (Nicotiana tabacum and Nicotiana plumbaginifolia) seedlings and mature plants under standardized light and growth conditions. Unique response patterns were found for each of these promoters. GUS activities differed more than 30-fold. Strong promoters were found for the PC and PSAD genes. On the other hand, the ATPC promoter was relatively weak. Expression of the CAB/GUS gene fusion in etiolated material was at the detection limit; all other chimeric genes were expressed in the dark as well. Light stimulation of GUS activities ranged from 3- (FNR promoter) to more than 100-fold (CAB-1 promoter). The FNR promoter responded only to red light (RL) and not significantly to blue light (BL), whereas the PC promoter contained regions with different sensitivities toward RL and BL. Furthermore, different RNA accumulation kinetics were observed for the PSAF, CAB, FNR, and PC promoter/GUS gene fusions during de-etiolation, which, at least in the case of the PSAF gene, differed from the regulation of the corresponding endogenous genes in spinach and tobacco. The results suggest either that not all cis elements determining light-regulated and quantitative expression are present on the spinach promoter fragments used or that the spinach cis-regulatory elements respond differently to the host (tobacco) regulatory pathway(s). Furthermore, as in tobacco, but not in spinach, the trans-gene hardly responds to single light pulses that operate through phytochrome. Taken together, the results suggest that the genes have been independently translocated from the organelle to the nucleus during phylogeny

  9. Functional analysis and nucleotide sequence of the promoter region of the murine hck gene.

    PubMed Central

    Lock, P; Stanley, E; Holtzman, D A; Dunn, A R

    1990-01-01

    The structure and function of the promoter region and exon 1 of the murine hck gene have been characterized in detail. RNase protection analysis has established that hck transcripts initiate from heterogeneous start sites located within the hck gene. Fusion gene constructs containing hck 5'-flanking sequences and the bacterial Neor gene have been introduced into the hematopoietic cell lines FDC-P1 and WEHI-265 by using a self-inactivating retroviral vector. The transcriptional start sites of the fusion gene are essentially identical to those of the endogenous hck gene. Analysis of infected WEHI-265 cell lines treated with bacterial lipopolysaccharide (LPS) reveals a 3- to 5-fold elevation in the levels of endogenous hck mRNA and a 1.4- to 2.6-fold increase in the level of Neor fusion gene transcripts, indicating that hck 5'-flanking sequences are capable of conferring LPS responsiveness on the Neor gene. The 5'-flanking region of the hck gene contains sequences similar to an element which is thought to be involved in the LPS responsiveness of the class II major histocompatibility gene A alpha k. A subset of these sequences are also found in the 5'-flanking regions of other LPS-responsive genes. Moreover, this motif is related to the consensus binding sequence of NF-kappa B, a transcription factor which is known to be regulated by LPS. Images PMID:2388619

  10. Analysis of tissue-specific region in sericin 1 gene promoter of Bombyx mori

    SciTech Connect

    Liu Yan; Yu Lian; Guo Xiuyang; Guo Tingqing; Wang Shengpeng; Lu Changde . E-mail: cdlu@sibs.ac.cn

    2006-03-31

    The gene encoding sericin 1 (Ser1) of silkworm (Bombyx mori) is specifically expressed in the middle silk gland cells. To identify element involved in this transcription-dependent spatial restriction, truncation of the 5' terminal from the sericin 1 (Ser1) promoter is studied in vivo. A 209 bp DNA sequence upstream of the transcriptional start site (-586 to -378) is found to be responsible for promoting tissue-specific transcription. Analysis of this 209 bp region by overlapping deletion studies showed that a 25 bp region (-500 to -476) suppresses the ectopic expression of the Ser1 promoter. An unknown factor abundant in fat body nuclear extracts is shown to bind to this 25 bp fragment. These results suggest that this 25 bp region and the unknown factor are necessary for determining the tissue-specificity of the Ser1 promoter.

  11. Characterization of the Promoter Region of Biosynthetic Enzyme Genes Involved in Berberine Biosynthesis in Coptis japonica

    PubMed Central

    Yamada, Yasuyuki; Yoshimoto, Tadashi; Yoshida, Sayumi T.; Sato, Fumihiko

    2016-01-01

    The presence of alkaloids is rather specific to certain plant species. However, berberine, an isoquinoline alkaloid, is relatively broadly distributed in the plant kingdom. Thus, berberine biosynthesis has been intensively investigated, especially using Coptis japonica cell cultures. Almost all biosynthetic enzyme genes have already been characterized at the molecular level. Particularly, two transcription factors (TFs), a plant-specific WRKY-type TF, CjWRKY1, and a basic helix-loop-helix TF, CjbHLH1, were shown to comprehensively regulate berberine biosynthesis in C. japonica cells. In this study, we characterized the promoter region of some biosynthetic enzyme genes and associated cis-acting elements involved in the transcriptional regulation via two TFs. The promoter regions of three berberine biosynthetic enzyme genes (CYP80B2, 4′OMT and CYP719A1) were isolated, and their promoter activities were dissected by a transient assay involving the sequentially truncated promoter::luciferase (LUC) reporter constructs. Furthermore, transactivation activities of CjWRKY1 were determined using the truncated promoter::LUC reporter constructs or constructs with mutated cis-elements. These results suggest the involvement of a putative W-box in the regulation of biosynthetic enzyme genes. Direct binding of CjWRKY1 to the W-box DNA sequence was also confirmed by an electrophoresis mobility shift assay and by a chromatin immunoprecipitation assay. In addition, CjbHLH1 also activated transcription from truncated 4′OMT and CYP719A1 promoters independently of CjWRKY1, suggesting the involvement of a putative E-box. Unexpected transcriptional activation of biosynthetic enzyme genes via a non-W-box sequence and by CjWRKY1 as well as the possible involvement of a GCC-box in berberine biosynthesis in C. japonica are discussed. PMID:27642289

  12. Characterization of the Promoter Region of Biosynthetic Enzyme Genes Involved in Berberine Biosynthesis in Coptis japonica.

    PubMed

    Yamada, Yasuyuki; Yoshimoto, Tadashi; Yoshida, Sayumi T; Sato, Fumihiko

    2016-01-01

    The presence of alkaloids is rather specific to certain plant species. However, berberine, an isoquinoline alkaloid, is relatively broadly distributed in the plant kingdom. Thus, berberine biosynthesis has been intensively investigated, especially using Coptis japonica cell cultures. Almost all biosynthetic enzyme genes have already been characterized at the molecular level. Particularly, two transcription factors (TFs), a plant-specific WRKY-type TF, CjWRKY1, and a basic helix-loop-helix TF, CjbHLH1, were shown to comprehensively regulate berberine biosynthesis in C. japonica cells. In this study, we characterized the promoter region of some biosynthetic enzyme genes and associated cis-acting elements involved in the transcriptional regulation via two TFs. The promoter regions of three berberine biosynthetic enzyme genes (CYP80B2, 4'OMT and CYP719A1) were isolated, and their promoter activities were dissected by a transient assay involving the sequentially truncated promoter::luciferase (LUC) reporter constructs. Furthermore, transactivation activities of CjWRKY1 were determined using the truncated promoter::LUC reporter constructs or constructs with mutated cis-elements. These results suggest the involvement of a putative W-box in the regulation of biosynthetic enzyme genes. Direct binding of CjWRKY1 to the W-box DNA sequence was also confirmed by an electrophoresis mobility shift assay and by a chromatin immunoprecipitation assay. In addition, CjbHLH1 also activated transcription from truncated 4'OMT and CYP719A1 promoters independently of CjWRKY1, suggesting the involvement of a putative E-box. Unexpected transcriptional activation of biosynthetic enzyme genes via a non-W-box sequence and by CjWRKY1 as well as the possible involvement of a GCC-box in berberine biosynthesis in C. japonica are discussed. PMID:27642289

  13. Characterization of the Promoter Region of Biosynthetic Enzyme Genes Involved in Berberine Biosynthesis in Coptis japonica

    PubMed Central

    Yamada, Yasuyuki; Yoshimoto, Tadashi; Yoshida, Sayumi T.; Sato, Fumihiko

    2016-01-01

    The presence of alkaloids is rather specific to certain plant species. However, berberine, an isoquinoline alkaloid, is relatively broadly distributed in the plant kingdom. Thus, berberine biosynthesis has been intensively investigated, especially using Coptis japonica cell cultures. Almost all biosynthetic enzyme genes have already been characterized at the molecular level. Particularly, two transcription factors (TFs), a plant-specific WRKY-type TF, CjWRKY1, and a basic helix-loop-helix TF, CjbHLH1, were shown to comprehensively regulate berberine biosynthesis in C. japonica cells. In this study, we characterized the promoter region of some biosynthetic enzyme genes and associated cis-acting elements involved in the transcriptional regulation via two TFs. The promoter regions of three berberine biosynthetic enzyme genes (CYP80B2, 4′OMT and CYP719A1) were isolated, and their promoter activities were dissected by a transient assay involving the sequentially truncated promoter::luciferase (LUC) reporter constructs. Furthermore, transactivation activities of CjWRKY1 were determined using the truncated promoter::LUC reporter constructs or constructs with mutated cis-elements. These results suggest the involvement of a putative W-box in the regulation of biosynthetic enzyme genes. Direct binding of CjWRKY1 to the W-box DNA sequence was also confirmed by an electrophoresis mobility shift assay and by a chromatin immunoprecipitation assay. In addition, CjbHLH1 also activated transcription from truncated 4′OMT and CYP719A1 promoters independently of CjWRKY1, suggesting the involvement of a putative E-box. Unexpected transcriptional activation of biosynthetic enzyme genes via a non-W-box sequence and by CjWRKY1 as well as the possible involvement of a GCC-box in berberine biosynthesis in C. japonica are discussed.

  14. Interferon. gamma. response region in the promoter of the human DPA gene

    SciTech Connect

    Yang, Zhi; Sugawara, Minoru; Ponath, P.D.; Wessendorf, L.; Banerji, J.; Li, Yi; Strominger, J.L. )

    1990-12-01

    The interferon {gamma} (IFN-{gamma}) response region of the human class II major histocompatibility complex gene, DPA, has been localized to a 52-base-pair (bp) DNA fragment in the proximal promotor at {minus}107 to {minus}55 bp after transfection into HeLa cells of a series of 5{prime}, 3{prime}, and gap deletion mutants linked to a reporter gene, human growth hormone, as well as of synthetic oligonucleotides fused to the heterologous promoter thymidine kinase. The 52-mer sequence contains the X and Y box elements conserved in all class II genes; their presence is indispensable for IFN-{gamma} inducibility. Furthermore, an additional 5 bp immediately 5{prime} of the X box of the DPA gene are necessary and sufficient for IFN-{gamma} induction. This region may contain an IFN-{gamma} response element. A closely related sequence has also been found in the vicinity of the critical deletion sites of three other well-studied class II gene promoters, all of which require a much longer sequence 5{prime} of the X box. A fourth element, the W element, located about 15 bp 5{prime} of the X box in all class II genes, is clearly of little importance in IFN-{gamma} inducibility of the DPA gene.

  15. A short upstream promoter region mediates transcriptional regulation of the mouse doublecortin gene in differentiating neurons

    PubMed Central

    2010-01-01

    Background Doublecortin (Dcx), a MAP (Microtubule-Associated Protein), is transiently expressed in migrating and differentiating neurons and thereby characterizes neuronal precursors and neurogenesis in developing and adult neurogenesis. In addition, reduced Dcx expression during development has been related to appearance of brain pathologies. Here, we attempt to unveil the molecular mechanisms controlling Dcx gene expression by studying its transcriptional regulation during neuronal differentiation. Results To determine and analyze important regulatory sequences of the Dcx promoter, we studied a putative regulatory region upstream from the mouse Dcx coding region (pdcx2kb) and several deletions thereof. These different fragments were used in vitro and in vivo to drive reporter gene expression. We demonstrated, using transient expression experiments, that pdcx2kb is sufficient to control specific reporter gene expression in cerebellar cells and in the developing brain (E14.5). We determined the temporal profile of Dcx promoter activity during neuronal differentiation of mouse embryonic stem cells (mESC) and found that transcriptional activation of the Dcx gene varies along with neuronal differentiation of mESC. Deletion experiments and sequence comparison of Dcx promoters across rodents, human and chicken revealed the importance of a highly conserved sequence in the proximal region of the promoter required for specific and strong expression in neuronal precursors and young neuronal cells. Further analyses revealed the presence in this short sequence of several conserved, putative transcription factor binding sites: LEF/TCF (Lymphoid Enhancer Factor/T-Cell Factor) which are effectors of the canonical Wnt pathway; HNF6/OC2 (Hepatocyte Nuclear Factor-6/Oncecut-2) members of the ONECUT family and NF-Y/CAAT (Nuclear Factor-Y). Conclusions Studies of Dcx gene regulatory sequences using native, deleted and mutated constructs suggest that fragments located upstream of the

  16. Validation study of genes with hypermethylated promoter regions associated with prostate cancer recurrence

    PubMed Central

    Stott-Miller, Marni; Zhao, Shanshan; Wright, Jonathan L.; Kolb, Suzanne; Bibikova, Marina; Klotzle, Brandy; Ostrander, Elaine A.; Fan, Jian-Bing; Feng, Ziding; Stanford, Janet L.

    2014-01-01

    Background One challenge in prostate cancer (PCa) is distinguishing indolent from aggressive disease at diagnosis. DNA promoter hypermethylation is a frequent epigenetic event in PCa, but few studies of DNA methylation in relation to features of more aggressive tumors or PCa recurrence have been completed. Methods We used the Infinium® HumanMethylation450 BeadChip to assess DNA methylation in tumor tissue from 407 patients with clinically localized PCa who underwent radical prostatectomy. Recurrence status was determined by follow-up patient surveys, medical record review, and linkage with the SEER registry. The methylation status of 14 genes for which promoter hypermethylation was previously correlated with advanced disease or biochemical recurrence was evaluated. Average methylation level for promoter region CpGs in patients who recurred compared to those with no evidence of recurrence was analyzed. For two genes with differential methylation, time to recurrence was examined. Results During an average follow-up of 11.7 years, 104 (26%) patients recurred. Significant promoter hypermethylation in at least 50% of CpG sites in two genes, ABHD9 and HOXD3, was found in tumors from patients who recurred compared to those without recurrence. Evidence was strongest for HOXD3 (lowest P = 9.46x10−6), with higher average methylation across promoter region CpGs associated with reduced recurrence-free survival (P = 2×10−4). DNA methylation profiles did not differ by recurrence status for the other genes. Conclusions These results validate the association between promoter hypermethylation of ADHB9 and HOXD3 and PCa recurrence. Impact Tumor DNA methylation profiling may help distinguish PCa patients at higher risk for disease recurrence. PMID:24718283

  17. Determination of the promoter region of an early vaccinia virus gene encoding thymidine kinase.

    PubMed

    Weir, J P; Moss, B

    1987-05-01

    Nine recombinant vaccinia viruses that contain overlapping segments of the putative promoter region of the vaccinia virus thymidine kinase (TK) gene linked to DNA coding for the prokaryotic enzyme chloramphenicol acetyltransferase (CAT) were constructed. In each case, the RNA start site and 5 bp of DNA downstream were retained. No significant difference in CAT expression occurred as the deletion was extended from 352 to 32 bp before the RNA start site. Deletion of a further 10 bp, however, led to complete cessation of early promoter activity. Primer extension analysis of the 5' ends of the transcripts verified that the natural TK RNA start site was still used when only 32 bp of upstream DNA remained. Loss of early promoter activity was previously found when deletions were extended from 31 to 24 bp before the RNA start site of another vaccinia gene that is expressed constitutively throughout infection (M.A. Cochran, C. Puckett, and B. Moss, 1985, Proc. Natl. Acad. Sci. USA 82, 19-23). Sequence similarities in the promoter regions of these two genes were noted.

  18. Novel polymorphisms of the APOA2 gene and its promoter region affect body traits in cattle.

    PubMed

    Zhou, Yang; Li, Caixia; Cai, Hanfang; Xu, Yao; Lan, Xianyong; Lei, Chuzhao; Chen, Hong

    2013-12-01

    Apolipoprotein A-II (APOA2) is one of the major constituents of high-density lipoprotein and plays a critical role in lipid metabolism and obesity. However, similar research for the bovine APOA2 gene is lacking. In this study, polymorphisms of the bovine APOA2 gene and its promoter region were detected in 1021 cows from four breeds by sequencing and PCR-RFLP methods. Totally, we detected six novel mutations which included one mutation in the promoter region, two mutations in the exons and three mutations in the introns. There were four polymorphisms within APOA2 gene were analyzed. The allele A, T, T and G frequencies of the four loci were predominant in the four breeds when in separate or combinations analysis which suggested cows with those alleles to be more adapted to the steppe environment. The association analysis indicated three SVs in Nangyang cows, two SVs in Qinchun cows and the 9 haplotypes in Nangyang cows were significantly associated with body traits (P<0.05 or P<0.01). The results of this study suggested the bovine APOA2 gene may be a strong candidate gene for body traits in the cattle breeding program. PMID:24004543

  19. Characterization of the mouse TFF1 (pS2) gene promoter region.

    PubMed

    Terada, T; Sakagami, R; Tabuchi, Y; Maeda, M

    2001-02-01

    Trefoil peptides (TFFs) with a unique trefoil domain(s) are presumed to function in protection and repair of the gastrointestinal epithelial layer. Three peptide family members are differently distributed in the mouse gastrointestinal tract: TFF1/pS2 specifically in stomach, TFF2/SP mainly in stomach, pancreas and duodenum, and TFF3/ITF in intestine. We cloned and sequenced the mouse TFF1 gene 5'-upstream region by means of the genomic walking procedure. The cloned region was ligated to the luciferase reporter gene and then introduced into mouse gastric surface mucous GSM10 cells which express TFF1 and TFF2. The minimum promoter was located in the region containing the TATA-box between -39 and the transcriptional start site. Further upstream regions stimulated (-2192-- -1630bp, -641-- -243bp, -137-- -39bp) and inhibited (-1630-- -641bp, -243-- -137 bp) luciferase gene expression. These regions as well as short segments conserved in the mouse and human 5'-upstream sequences may be important for modulation of the mRNA level of the TFF1 gene.

  20. Construction of chimeric antibodies: cloning of immunoglobulin genes including their promoter regions by PCR.

    PubMed

    Mocikat, R; Kütemeier, G; Harloff, C

    1992-03-01

    In the production of recombinant antibodies, it is necessary to have an immunoglobulin gene promoter for driving the expression of the antibody genes. Here we describe a simple PCR method that allows cloning of the immunoglobulin genes together with their own promoters despite the fact that the sequence of the upstream part of the gene is unknown.

  1. Identification of the promoter region and genetic mutations of the porcine GALP gene.

    PubMed

    Su, Lina; Mei, Shuqi; Tao, Hu; Peng, Xianwen; Sun, Xiaojie; Wu, Huayu; Zhang, Xuying; Qiao, Mu; Li, Fenge

    2013-04-01

    Galanin-like peptide (GALP) gene, encoding a member of the galanin family of neuropeptides involved in reproduction, was differentially expressed in PMSG-hCG stimulated pre-ovulatory ovarian follicles of Chinese Taihu and Large White sows in our previous study. In the present study, promoter region and genetic mutations of the porcine GALP gene were determined. A 1,322 bp contig in 5'-flanking region was predicted to contain 5 potential transcription promoters by Neural Network Promoter Prediction version 2.2. 5'-deletion expression in both CHO and hela cells showed that there were a negative regulatory element at -852 to -803 bp and a positive regulatory element at -1,318 to -1,269 bp. Comparative sequence analyses of Chinese Taihu and Large White GALP gene sequence revealed the c.*27C>G mutation in the 3'-UTR and the c.88-1225C>G mutation in intron 1, which can be detected by HhaI and AluI PCR-RFLP, respectively. The association analysis with litter size traits showed that at both loci CC and GG genotypes were different for NBA for all parities in DIV pigs (P < 0.05). However, two SNPs were not in significant linkage disequilibrium analyzed using SHEsis online software, and could be used in pig breeding individually.

  2. Identification and Characterization of the Human Xylosyltransferase I Gene Promoter Region*

    PubMed Central

    Müller, Benjamin; Prante, Christian; Kleesiek, Knut; Götting, Christian

    2009-01-01

    Human xylosyltransferase I catalyzes the initial and rate-limiting step in the biosynthesis of glycosaminoglycans and proteoglycans. Furthermore, this enzyme has been shown to play a major role in the physiological development of bone and cartilage as well as in pathophysiological processes such as systemic sclerosis, dilated cardiomyopathy, or fibrosis. Here, we report for the first time the identification and characterization of the XYLT1 gene promoter region and important transcription factors involved in its regulation. Members of the activator protein 1 (AP-1) and specificity protein 1 (Sp1) family of transcription factors are necessary for the transcriptional regulation of the XYLT1 gene, which was proven by curcumin, tanshinone IIA, mithramycin A, and short interference RNA treatment. A stepwise 5′ and 3′ deletion of the predicted GC-rich promoter region, which lacks a TATA and/or CAAT box, revealed that a 531-bp core promoter element is able to drive the transcription on a basal level. A binding site for transcription factors of the AP-1 family, which is essential for full promoter activity, was identified by site-directed mutagenesis located 730 bp 5′ of the translation initiation site. The ability of this site to bind members of the AP-1 family was further verified by electrophoretic mobility shift assays. A promoter element containing this binding site was able to drive the transcription to about 79-fold above control in SW1353 chondrosarcoma cells. Our findings provide a first insight into the regulation of the XYLT1 gene and may contribute to understanding the processes taking place during extracellular matrix formation and remodeling in health and disease. PMID:19762916

  3. Polymorphisms of the ELANE Gene Promoter Region in End-Stage Chronic Kidney Disease Patients

    PubMed Central

    Fernandes, Rafael; Freitas, Bruno; Miranda, Vasco; Costa, Elísio; Santos-Silva, Alice; Bronze-da-Rocha, Elsa

    2016-01-01

    End-stage renal disease (ESRD) patients have a high mortality rate that exceeds that of non-ESRD population. The hemodialysis procedure induces neutrophil activation and elastase release, which might have a role in the inflammatory process and in the development of oxidative stress. The ELANE gene encodes the neutrophil elastase. We analyzed the effect of ELANE promoter region polymorphisms and its relation with the circulating levels of elastase, as well as several clinical, biochemical and inflammatory markers in 123 ESRD patients. We found two duplications in heterozygosity in the promoter region and a new polymorphism, the c.-801G>A. ESRD patients heterozygous for the c.-903T>G polymorphism had no changes in the circulating levels of elastase or other evaluated variables, and those homozygous for the c.-741G>A polymorphism showed significant effects on neutrophils count, as well as in neutrophils/lymphocytes ratio, which might be associated with an increased inflammatory process. PMID:27136588

  4. Multiple octamer binding sites in the promoter region of the bovine alpha s2-casein gene.

    PubMed Central

    Groenen, M A; Dijkhof, R J; van der Poel, J J; van Diggelen, R; Verstege, E

    1992-01-01

    Using a set of overlapping oligonucleotides from the promoter region of the bovine alpha s2-casein gene we have identified two nuclear factors which probably are involved in expression of this gene and the related calcium sensitive alpha s1- and beta-casein genes. One of these factors which was present in extracts of all tissues that have been tested including Hela cells turned out to be the octamer binding protein OCT-1. Oct-1 binds with different affinity to 4 sites at positions centred around -480, -260, -210 and -50. The strongest of these 4 binding sites, the one around position -50, is highly conserved in all calcium sensitive caseins of mouse, rat, rabbit and cattle. The other nuclear factor (MGF, mammary gland factor) which is specifically expressed in the mammary gland, binds to a site around position -90. This binding site is also highly conserved in all calcium sensitive caseins of mouse, rat, rabbit and cattle. Images PMID:1508722

  5. Absence of mutation at the 5'-upstream promoter region of the TPM4 gene from cardiac mutant axolotl (Ambystoma mexicanum).

    PubMed

    Denz, Christopher R; Zhang, Chi; Jia, Pingping; Du, Jianfeng; Huang, Xupei; Dube, Syamalima; Thomas, Anish; Poiesz, Bernard J; Dube, Dipak K

    2011-09-01

    Tropomyosins are a family of actin-binding proteins that show cell-specific diversity by a combination of multiple genes and alternative RNA splicing. Of the 4 different tropomyosin genes, TPM4 plays a pivotal role in myofibrillogenesis as well as cardiac contractility in amphibians. In this study, we amplified and sequenced the upstream regulatory region of the TPM4 gene from both normal and mutant axolotl hearts. To identify the cis-elements that are essential for the expression of the TPM4, we created various deletion mutants of the TPM4 promoter DNA, inserted the deleted segments into PGL3 vector, and performed promoter-reporter assay using luciferase as the reporter gene. Comparison of sequences of the promoter region of the TPM4 gene from normal and mutant axolotl revealed no mutations in the promoter sequence of the mutant TPM4 gene. CArG box elements that are generally involved in controlling the expression of several other muscle-specific gene promoters were not found in the upstream regulatory region of the TPM4 gene. In deletion experiments, loss of activity of the reporter gene was noted upon deletion which was then restored upon further deletion suggesting the presence of both positive and negative cis-elements in the upstream regulatory region of the TPM4 gene. We believe that this is the first axolotl promoter that has ever been cloned and studied with clear evidence that it functions in mammalian cell lines. Although striated muscle-specific cis-acting elements are absent from the promoter region of TPM4 gene, our results suggest the presence of positive and negative cis-elements in the promoter region, which in conjunction with positive and negative trans-elements may be involved in regulating the expression of TPM4 gene in a tissue-specific manner.

  6. Cloning and characterization of the promoter regions from the parent and paralogous creatine transporter genes.

    PubMed

    Ndika, Joseph D T; Lusink, Vera; Beaubrun, Claudine; Kanhai, Warsha; Martinez-Munoz, Cristina; Jakobs, Cornelis; Salomons, Gajja S

    2014-01-10

    Interconversion between phosphocreatine and creatine, catalyzed by creatine kinase is crucial in the supply of ATP to tissues with high energy demand. Creatine's importance has been established by its use as an ergogenic aid in sport, as well as the development of intellectual disability in patients with congenital creatine deficiency. Creatine biosynthesis is complemented by dietary creatine uptake. Intracellular transport of creatine is carried out by a creatine transporter protein (CT1/CRT/CRTR) encoded by the SLC6A8 gene. Most tissues express this gene, with highest levels detected in skeletal muscle and kidney. There are lower levels of the gene detected in colon, brain, heart, testis and prostate. The mechanism(s) by which this regulation occurs is still poorly understood. A duplicated unprocessed pseudogene of SLC6A8-SLC6A10P has been mapped to chromosome 16p11.2 (contains the entire SLC6A8 gene, plus 2293 bp of 5'flanking sequence and its entire 3'UTR). Expression of SLC6A10P has so far only been shown in human testis and brain. It is still unclear as to what is the function of SLC6A10P. In a patient with autism, a chromosomal breakpoint that intersects the 5'flanking region of SLC6A10P was identified; suggesting that SLC6A10P is a non-coding RNA involved in autism. Our aim was to investigate the presence of cis-acting factor(s) that regulate expression of the creatine transporter, as well as to determine if these factors are functionally conserved upstream of the creatine transporter pseudogene. Via gene-specific PCR, cloning and functional luciferase assays we identified a 1104 bp sequence proximal to the mRNA start site of the SLC6A8 gene with promoter activity in five cell types. The corresponding 5'flanking sequence (1050 bp) on the pseudogene also had promoter activity in all 5 cell lines. Surprisingly the pseudogene promoter was stronger than that of its parent gene in 4 of the cell lines tested. To the best of our knowledge, this is the first

  7. Assessing the Genome-Wide Effect of Promoter Region Tandem Repeat Natural Variation on Gene Expression

    PubMed Central

    Elmore, Martha H.; Gibbons, John G.; Rokas, Antonis

    2012-01-01

    Copy number polymorphisms of nucleotide tandem repeat (TR) regions, such as microsatellites and minisatellites, are mutationally reversible and highly abundant in eukaryotic genomes. Studies linking TR polymorphism to phenotypic variation have led some to suggest that TR variation modulates and majorly contributes to phenotypic variation; however, studies in which the authors assess the genome-wide impact of TR variation on phenotype are lacking. To address this question, we quantified relationships between polymorphism levels in 143 genome-wide promoter region TRs across 16 isolates of the filamentous fungus Aspergillus flavus and its ecotype Aspergillus oryzae with expression levels of their downstream genes. We found that only 4.3% of relationships tested were significant; these findings were consistent with models in which TRs act as “tuning,” “volume,” or “optimality” “knobs” of phenotype but not with “switch” models. Furthermore, the promoter regions of differentially expressed genes between A. oryzae and A. flavus did not show TR enrichment, suggesting that genome-wide differences in molecular phenotype between the two species are not significantly associated with TRs. Although in some cases TR polymorphisms do contribute to transcript abundance variation, these results argue that at least in this case, TRs might not be major modulators of variation in phenotype. PMID:23275886

  8. Molecular cloning of rhamnose-binding lectin gene and its promoter region from snakehead Channa argus.

    PubMed

    Jia, W Z; Shang, N; Guo, Q L

    2010-09-01

    Lectins are sugar-binding proteins that mediate pathogen recognition and cell-cell interactions. A rhamnose-binding lectin (RBL) gene and its promoter region have been cloned and characterized from snakehead Channa argus. From the transcription initiation site, snakehead rhamnose-binding lectin (SHL) gene extends 2,382 bp to the end of the 3' untranslated region (UTR), and contains nine exons and eight introns. The open reading frame (ORF) of the SHL transcript has 675 bp which encodes 224 amino acids. The molecular structure of SHL is composed of two tandem repeat carbohydrate recognition domains (CRD) with 35% internal identity. Analysis of the gene organization of SHL indicates that the ancestral gene of RBL may diverge and evolve by exon shuffling and gene duplication, producing new forms to play their own roles in various organisms. The characteristics of SHL gene 5' flanking region are the presence of consensus nuclear factor of interleukin 6 (NF-IL6) and IFN-gamma activation (GAS) sites. The results provide indirect evidence that up-regulation of SHL expression may be induced in response to inflammatory stimuli, such as lipopolysaccharide (LPS), interleukin 6 (IL-6), and interferon gamma (IFN-gamma). The transcript of SHL mRNA was expressed in the head kidney, posterior kidney, spleen, liver, intestine, heart, muscle, and ovary. No tissue-specific expressive pattern is different from reported STLs, WCLs, and PFLs, suggesting that different types of RBLs exist in species-specific fish that have evolved and adapted to their surroundings.

  9. Expression of human histo-blood group ABO genes is dependent upon DNA methylation of the promoter region.

    PubMed

    Kominato, Y; Hata, Y; Takizawa, H; Tsuchiya, T; Tsukada, J; Yamamoto, F

    1999-12-24

    We have investigated the regulatory role of DNA methylation in the expression of the human histo-blood group ABO genes. The ABO gene promoter region contains a CpG island whose methylation status correlates well with gene expression in the cell lines tested. The CpG island was found hypomethylated in some cell lines that expressed ABO genes, whereas the other cell lines that did not express ABO genes were hypermethylated. Whereas constitutive transcriptional activity of the ABO gene promoter was demonstrated in both expressor and nonexpressor cell lines by transient transfection of reporter constructs containing the ABO gene promoter sequence, HhaI methylase-catalyzed in vitro methylation of the promoter region prior to DNA transfection suppressed the promoter activity when introduced into the expressor gastric cancer cell line KATOIII cells. On the other hand, in the nonexpressor gastric cancer cell line MKN28 cells, treatment with DNA methyltransferase inhibitor 5-aza-2'-deoxycytidine resulted in demethylation of the ABO gene promoter and appearance of A-transferase messages, as well as A-antigens synthesized by A-transferase. Taken together, these studies suggest that DNA methylation of the ABO gene promoter may play an important role in the regulation of ABO gene expression. PMID:10601288

  10. Non-essential repeats in the promoter region of a Brassica rapa acyl carrier protein gene expressed in developing embryos.

    PubMed

    Scherer, D; Sato, A; McCarter, D W; Radke, S E; Kridl, J C; Knauf, V C

    1992-02-01

    A genomic clone of an acyl carrier protein gene (Bcg4-4) which is highly expressed in developing embryos of Brassica rapa was isolated and sequenced. The promoter and transcription terminator regions of Bcg4-4 were used to express a beta-glucuronidase reporter gene in transgenic rapeseed. Deletion of repeated domains in the promoter region did not lower beta-glucuronidase expression in seeds.

  11. 5-Hydroxy tryptamine transporter (5HTT) gene promoter region polymorphism in anxiety and depressive disorders

    PubMed Central

    Mushtaq, Raheel; Shoib, Sheikh; Shah, Tabindah; Mushtaq, Sahil

    2014-01-01

    Background: 5HTTLPR polymorphism (5- Hydroxy tryptamine transporter linked promoter region polymorphism) is the most widely studied genetic variant in psychiatry. The present study is a modest effort at ascertaining the role of 5HT transporter linked promoter region polymorphism (5HTTLPR) in anxiety and depressive disorders in Kashmir (India).The aim of this study was to examine 5-Hydroxy tryptamine transporter (5HTT) gene promoter region polymorphism in anxiety and depressive disorders. Methods: Thirty patients with unipolar depressive disorders, 30 patients with anxiety disorders and 40 healthy volunteers (controls) were studied on a case control design, using polymerase chain reaction (PCR) and agarose gel electrophoresis after digestion with endonuclease enzyme. Genotypes and allele frequencies were compared using chi square tests, and p value of < 0.05 was considered as statistically significant. Results: The mean (±sd) HAM-A (Hamilton rating scale for anxiety) scores for anxiety and depressive groups were 28.2±5.14 and 17±5.61, respectively (P < 0.001). The mean (±sd) HAM-D (Hamilton rating scale for depression) scores for depressive and anxiety groups were 25±5.58 and 15±6.13, respectively. (p< 0.001). The frequency of S allele was significantly high (83.3% vs 60%) in the group with anxiety (p< 0.05) compared to the control group (p> 0.05). Conclusion: The genetic studies are still evolving as pathogenesis of anxiety and depressive disorders and involve the interaction of environmental factors with various genes. Genetic variation in different populations and hence different environments is important for elucidation of the mechanisms of these disorders. However, the study concludes that the locus under study is not shared between the two disorders. PMID:25679006

  12. Characterisation of the promoter region of the zebrafish six7 gene.

    PubMed

    Drivenes, O; Seo, H C; Fjose, A

    2000-04-25

    The Drosophila homeobox gene sine oculis and its murine homologue Six3 have both been shown to have regulatory functions in eye and brain development. In zebrafish, three Six3-related genes with conserved expression during early eye and head formation have been identified. One of these, six7, is first expressed at the gastrula stage in the involuting axial mesoderm, and later in the overlying neuroectoderm from which the forebrain and optic primordium develop. To elucidate the mechanisms regulating six7 expression, we isolated a 2.7-kb fragment of the 5'-flanking region. Three sequentially deleted fragments of this upstream region were used to produce GFP reporter constructs for analysis of tissue-specific expression in zebrafish embryos. The results show that a 625-bp upstream fragment is sufficient to direct strong expression of the reporter during gastrulation and early neurulation. The proximal part of the promoter contains binding sites for various constitutive transcription factors and an additional upstream element that was shown to be critical in directing expression to the anterior region of the zebrafish brain.

  13. PARP1 Differentially Interacts with Promoter region of DUX4 Gene in FSHD Myoblasts

    PubMed Central

    Sharma, Vishakha; Pandey, Sachchida Nand; Khawaja, Hunain; Brown, Kristy J; Hathout, Yetrib; Chen, Yi-Wen

    2016-01-01

    Objective The goal of the study is to identity proteins, which interact with the promoter region of double homeobox protein 4 (DUX4) gene known to be causative for the autosomal dominant disorder Facioscapulohumeral Muscular Dystrophy (FSHD). Methods We performed a DNA pull down assay coupled with mass spectrometry analysis to identify proteins that interact with a DUX4 promoter probe in Rhabdomyosarcomca (RD) cells. We selected the top ranked protein poly (ADP-ribose) polymerase 1 (PARP1) from our mass spectrometry data for further ChIP-qPCR validation using patients' myoblasts. We then treated FSHD myoblasts with PARP1 inhibitors to investigate the role of PARP1 in the FSHD myoblasts. Results In our mass spectrometry analysis, PARP1 was found to be the top ranked protein interacting preferentially with the DUX4 promoter probe in RD cells. We further validated this interaction by immunoblotting in RD cells (2-fold enrichment compared to proteins pulled down by a control probe, p<0.05) and ChIP-qPCR in patients' myoblasts (65-fold enrichment, p<0.01). Interestingly, the interaction was only observed in FSHD myoblasts but not in the control myoblasts. Upon further treatment of FSHD myoblasts with PARP1 inhibitors, we showed that treatment with a PARP1 inhibitor, 3-aminobenzamide (0.5 mM), for 24 h had a suppression of DUX4 (2.6 fold, p<0.05) and ZSCAN4, a gene previously shown to be upregulated by DUX4, (1.6 fold, p<0.01) in FSHD myoblasts. Treatment with fisetin (0.5 mM), a polyphenol compound with PARP1 inhibitory property, for 24 h also suppressed the expression of DUX4 (44.8 fold, p<0.01) and ZSCAN4 (2.2 fold, p<0.05) in the FSHD myoblasts. We further showed that DNA methyltransferase 1 (DNMT1), a gene regulated by PARP1 was also enriched at the DUX4 promoter in RD cells through immunoblotting (2-fold, p<0.01) and immortalized FSHD myoblasts (42-fold, p<0.01) but not control myoblasts through ChIP qPCR. Conclusion Our results showed that PARP1 and DNMT1

  14. Hypomethylation within gene promoter regions and type 1 diabetes in discordant monozygotic twins.

    PubMed

    Elboudwarej, Emon; Cole, Michael; Briggs, Farren B S; Fouts, Alexandra; Fain, Pamela R; Quach, Hong; Quach, Diana; Sinclair, Elizabeth; Criswell, Lindsey A; Lane, Julie A; Steck, Andrea K; Barcellos, Lisa F; Noble, Janelle A

    2016-04-01

    Genetic susceptibility to type 1 diabetes (T1D) is well supported by epidemiologic evidence; however, disease risk cannot be entirely explained by established genetic variants identified so far. This study addresses the question of whether epigenetic modification of the inherited DNA sequence may contribute to T1D susceptibility. Using the Infinium HumanMethylation450 BeadChip array (450k), a total of seven long-term disease-discordant monozygotic (MZ) twin pairs and five pairs of HLA-identical, disease-discordant non-twin siblings (NTS) were examined for associations between DNA methylation (DNAm) and T1D. Strong evidence for global hypomethylation of CpG sites within promoter regions in MZ twins with TID compared to twins without T1D was observed. DNA methylation data were then grouped into three categories of CpG sites for further analysis, including those within: 1) the major histocompatibility complex (MHC) region, 2) non-MHC genes with reported T1D association through genome wide association studies (GWAS), and 3) the epigenome, or remainder of sites that did not include MHC and T1D associated genes. Initial results showed modest methylation differences between discordant MZ twins for the MHC region and T1D-associated CpG sites, BACH2, INS-IGF2, and CLEC16A (DNAm difference range: 2.2%-5.0%). In the epigenome CpG set, the greatest methylation differences were observed in MAGI2, FANCC, and PCDHB16, (DNAm difference range: 6.9%-16.1%). These findings were not observed in the HLA-identical NTS pairs. Targeted pyrosequencing of five candidate CpG loci identified using the 450k array in the original discordant MZ twins produced similar results using control DNA samples, indicating strong agreement between the two DNA methylation profiling platforms. However, findings for the top five candidate CpG loci were not replicated in six additional T1D-discordant MZ twin pairs. Our results indicate global DNA hypomethylation within gene promoter regions may contribute to T

  15. Gene Expression in Archaea: Studies of Transcriptional Promoters, Messenger RNA Processing, and Five Prime Untranslated Regions in "Methanocaldococcus Jannashchii"

    ERIC Educational Resources Information Center

    Zhang, Jian

    2009-01-01

    Gene expression in Archaea is less understood than those in Bacteria and Eucarya. In general, three steps are involved in gene expression--transcription, RNA processing, and translation. To expand our knowledge of these processes in Archaea, I have studied transcriptional promoters, messenger RNA processing, and 5'-untranslated regions in…

  16. CHRNB2 promoter region: association with subjective effects to nicotine and gene expression differences.

    PubMed

    Hoft, N R; Stitzel, J A; Hutchison, K E; Ehringer, M A

    2011-03-01

    Smoking behavior is a complex, which includes multiple stages in the progression from experimentation to continued use and dependence. The experience of subjective effects, such as dizziness, euphoria, heart pounding, nausea and high, have been associated with varying degrees of persistence and subsequent abuse/dependence of marijuana, cocaine, tobacco and alcohol (Grant et al. 2005, Wagner & Anthony 2002). Previous studies have reported associations between neuronal nicotinic receptor (CHRN) genes and subjective effects to nicotine. We sought to replicate and expand this work by examining eight single nucleotide polymorphisms (SNPs) in a sample of adult smokers (n = 316) who reported subjective effects following cigarette smoking in a controlled laboratory environment. Two SNPs each in the CHRNB2, CHRNB3, CHRNA6 and CHRNA4 genes were examined. A significant association was found between two SNPs and physical effects reported after smoking the first experimental cigarette. SNP rs2072658 is upstream of CHRNB2 (P-value = 0.0046) and rs2229959 is a synonymous change in exon 5 of CHRNA4 (P value = 0.0051). We also examined possible functional relevance of SNP rs2072658 using an in vitro gene expression assay. These studies provided evidence that the minor allele of rs2072658 may lead to decreased gene expression, using two separate cell lines, P19 and SH-SY5Y (18% P < 0.001 and 26% P < 0.001 respectively). The human genetic study and functional assays suggest that variation in the promoter region of CHRNB2 gene may be important in mediating levels of expression of the β2 nicotinic receptor subunit, which may be associated with variation in subjective response to nicotine. PMID:20854418

  17. Regions in the promoter of the yeast FBP1 gene implicated in catabolite repression may bind the product of the regulatory gene MIG1.

    PubMed

    Mercado, J J; Vincent, O; Gancedo, J M

    1991-10-01

    We have identified in the promoter of the yeast FBP1 gene two sites able to bind nuclear proteins. These sites have a nucleotide sequence strongly similar to that of sites which bind the regulatory protein MIG1 in the promoters of GAL4 and SUC2. Deletions performed in the FBP1 promoter showed that one of the sites contributes to catabolite repression of this gene. In this same promoter, another region was identified with a strong effect on the catabolite repression of FBP1. In this region a sequence similar to the consensus for the binding site of the MIG1 protein was also present.

  18. Wound-response regulation of the sweet potato sporamin gene promoter region.

    PubMed

    Wang, Shu-Jen; Lan, Yi-Ching; Chen, Shih-Fung; Chen, Yih-Ming; Yeh, Kai-Wun

    2002-02-01

    Sporamin, a tuberous storage protein of sweet potato, was systemically expressed in leaves and stems by wound stimulation. In an effort to demonstrate the regulatory mechanism of wound response on the sporamin gene, a 1.25 kb sporamin promoter was isolated for studying the wound-induced signal transduction. Two wound response-like elements, a G box-like element and a GCC core-like sequence were found in this promoter. A construct containing the sporamin promoter fused to a beta-glucuronidase (GUS) gene was transferred into tobacco plants by Agrobacterium-mediated transformation. The wound-induced high level of GUS activity was observed in stems and leaves of transgenic tobacco, but not in roots. This expression pattern was similar to that of the sporamin gene in sweet potatoes. Exogenous application of methyl jasmonate (MeJA) activated the sporamin promoter in leaves and stems of sweet potato and transgenic tobacco plants. A competitive inhibitor of ethylene (2,5-norbornadiene; NBD) down-regulated the effect of MeJA on sporamin gene expression. In contrast, salicylic acid (SA), an inhibitor of the octadecanoid pathway, strongly suppressed the sporamin promoter function that was stimulated by wound and MeJA treatments. In conclusion, wound-response expression of the sporamin gene in aerial parts of plants is regulated by the octadecanoid signal pathway.

  19. A single nucleotide polymorphism and sequence analysis of CSN1S1 gene promoter region in Chinese Bos grunniens (yak).

    PubMed

    Bai, W L; Yin, R H; Dou, Q L; Yang, J C; Zhao, S J; Ma, Z J; Yin, R L; Luo, G B; Zhao, Z H

    2010-01-01

    The aim of this study was to investigate the polymorphism of the CSN1S1 gene promoter region in 4 Chinese yak breeds, and compare the yak CSN1S1 gene promoter region sequences with other ruminants. A Polymerase Chain Reaction-Single Strand Conformation Polymorphism protocol was developed for rapid genotyping of the yak CSN1S1 gene. One hundred fifty-eight animals from 4 Chinese yak breeds were genotyped at the CSN1S1 locus using the protocol developed. A single nucleotide polymorphism of the CSN1S1 gene promoter region has been identified in all yak breeds investigated. The polymorphism consists of a single nucleotide substitution G-->A at position 386 of the CSN1S1 gene promoter region, resulting in two alleles named, respectively, G(386) and A(386), based on the nucleotide at position 386. The allele G(386) was found to be more common in the animals investigated. The corresponding nucleotide sequences in GenBank of yak (having the same nucleotides as allele G(386) in this study), bovine, water buffalo, sheep, and goat had similarity of 99.68%, 99.35%, 97.42%, 95.14%, and 94.19%, respectively, with the yak allele A(386.).

  20. Point mutations in the promoter region of the CYBB gene leading to mild chronic granulomatous disease.

    PubMed

    Weening, R S; De Boer, M; Kuijpers, T W; Neefjes, V M; Hack, W W; Roos, D

    2000-12-01

    Chronic granulomatous disease (CGD) is a clinical syndrome of recurrent bacterial and fungal infections caused by a rare disorder of phagocytic cells. In CGD, the phagocytes are unable to generate oxygen radicals after stimulation of these cells, due to a defect in the NADPH oxidase system. This NADPH oxidase is a multicomponent enzyme of at least four subunits, of which the beta-subunit of cytochrome b558, gp91-phox, is encoded by an X-linked gene (called CYBB). We report here five patients from two families; in each family we found a different mutation in the promoter region of CYBB. Both mutations prevented the expression of gp91-phox in the patients' neutrophils and thus caused inability of these cells to generate oxygen radicals. However, the mutations left the gp91-phox expression and the function of the NADPH oxidase in the patients' eosinophils intact. The relatively mild course of the CGD in these patients can probably be attributed to the fact that the eosinophils have retained their oxidative capacity. Furthermore, our results indicate that neutrophils and eosinophils differ in their regulation of gp91-phox expression.

  1. Identification and genetic effect of a variable duplication in the promoter region of the cattle ADIPOQ gene

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The ADIPOQ gene of cattle, is located in the vicinity of the quantitative trait locus (QTL) wich effects marbling, the rib eye muscle area and fat thickness on BTA1. In our study, a novel variable duplication (NW_003103812.1:g.9232067_9232133 dup) in the bovine ADIPOQ promoter region was identified ...

  2. Isolation and sequencing of a putative promoter region of the murine G protein beta 1 subunit (GNB1) gene.

    PubMed

    Kitanaka, Junichi; Kitanaka, Nobue; Takemura, Motohiko; Wang, Xiao-Bing; Hembree, Cambria M; Goodman, Nancy L; Uhl, George R

    2002-02-01

    The expression of the heterotrimeric GTP-binding protein beta 1 subunit gene (GNB1) is regulated by psychostimulants such as cocaine and amphetamines. Since the up-regulation appears to be one of the candidate processes of sensitization, it is necessary to elucidate the cellular and molecular mechanism of the GNB1 gene regulation for a better understanding the establishment of sensitization. In the present study, we describe the isolation and nucleotide sequence analysis of the GNB1 gene promoter region. We have isolated approximately 10 kb of the 5'-flanking region of the mouse of GNB1 gene and found potential elements involved in putative transcriptional control of the GNB1, such as AP1, AP2, Sp1, cyclic AMP response element, and nuclear factor kappa B recognition sites, within the sequences 0.3 kb upstream from the putative transcription start site. This region was highly rich in G + C content, but lacked TATA or CATT boxes. Comparing the nucleotide sequence of the cDNA clone with the human genome databases using the BLAST program a region containing putative exon 1 and promoter of the human GNB1 gene in chromosome 1 was found. The cloning and sequence analysis of an extensive portion of the 5'-flanking regulatory region of the GNB1 gene provides new insights into the factors involved in the regulation by psychostimulants of GNB1 expression. PMID:12180136

  3. A Novel Mutation in the Promoter Region of the β-Globin Gene: HBB: c.-127G > C.

    PubMed

    Bilgen, Turker; Canatan, Duran; Delibas, Serpil; Keser, Ibrahim

    2016-08-01

    Novel β-globin gene mutations are still occasionally being reported, especially when evaluating milder phenotypes. We report here a novel putative mutation in the promoter region of the β-globin gene and assess its clinical implications. A family, parents and four siblings, with hematological and clinical features suspected of being β-globin gene mutation(s), were involved in this study. In addition to hematological and clinical evaluations of the whole family, molecular analyses of the β-globin gene were performed by direct sequencing. Sequencing of the β-globin gene revealed a novel genomic alteration in the regulatory region of the gene. This novel genomic alteration was defined as HBB: c.-127G > C according to the Human Genome Variation Society (HGVS) nomenclature. Two siblings were found to be carriers of the HBB: c.-127G > C mutation, while the other two siblings were carriers of the codon 8 (-AA) (HBB: c.25_26delAA) deletion of the β-globin gene. The mother was a compound heterozygote for the codon 8 and HBB: c.-127G > C mutations. Based on hematological and clinical evaluations, we conclude that this novel β-globin gene promoter region change would be associated with a mild phenotype of β-thalassemia (β-thal). PMID:27349616

  4. Mapping of a replication origin within the promoter region of two unlinked, abundantly transcribed actin genes of Physarum polycephalum.

    PubMed

    Bénard, M; Lagnel, C; Pallotta, D; Pierron, G

    1996-03-01

    We analyzed the replication of two unlinked actin genes, ardB and ardC , which are abundantly transcribed in the naturally synchronous plasmodium of the slime mold Physarum polycephalum. Detection and size measurements of single-stranded nascent replication intermediates (RIs) demonstrate that these two genes are concomitantly replicated at the onset of the 3-h S phase and tightly linked to replication origins. Appearance of RIs on neutral-neutral two-dimensional gels at specific time points in early S phase and analysis of their structure confirmed these results and further established that, in both cases, an efficient, site-specific, bidirectional origin of replication is localized within the promoter region of the gene. We also determined similar elongation rates for the divergent replication forks of the ardC gene replicon. Finally, taking advantage of a restriction fragment length polymorphism, we studied allelic replicons and demonstrate similar localizations and a simultaneous firing of allelic replication origins. Computer search revealed a low level of homology between the promoters of ardB and ardC and, most notably, the absence of DNA sequences similar to the yeast autonomously replicating sequence consensus sequence in these Physarum origin regions. Our results with the ardB and ardC actin genes support the model of early replicating origins located within the promoter regions of abundantly transcribed genes in P. polycephalum. PMID:8622700

  5. Characterization of promoter region and genomic structure of the murine and human genes encoding Src like adapter protein.

    PubMed

    Kratchmarova, I; Sosinowski, T; Weiss, A; Witter, K; Vincenz, C; Pandey, A

    2001-01-10

    Src-like adapter protein (SLAP) was identified as a signaling molecule in a yeast two-hybrid system using the cytoplasmic domain of EphA2, a receptor protein tyrosine kinase (Pandey et al., 1995. Characterization of a novel Src-like adapter protein that associates with the Eck receptor tyrosine kinase. J. Biol. Chem. 270, 19201-19204). It is very similar to members of the Src family of cytoplasmic tyrosine kinases in that it contains very homologous SH3 and SH2 domains (Abram and Courtneidge, 2000. Src family tyrosine kinases and growth factor signaling. Exp. Cell. Res. 254, 1-13.). However, instead of a kinase domain at the C-terminus, it contains a unique C-terminal region. In order to exclude the possibility that an alternative form exists, we have isolated genomic clones containing the murine Slap gene as well as the human SLA gene. The coding regions of murine Slap and human SLA genes contain seven exons and six introns. Absence of any kinase domain in the genomic region confirm its designation as an adapter protein. Additionally, we have cloned and sequenced approximately 2.6 kb of the region 5' to the initiator methionine of the murine Slap gene. When subcloned upstream of a luciferase gene, this fragment increased the transcriptional activity about 6-fold in a human Jurkat T cell line and approximately 52-fold in a murine T cell line indicating that this region contains promoter elements that dictate SLAP expression. We have also cloned the promoter region of the human SLA gene. Since SLAP is transcriptionally regulated by retinoic acid and by activation of B cells, the cloning of its promoter region will permit a detailed analysis of the elements required for its transcriptional regulation.

  6. Functional analysis of the promoter region of amphioxus β-actin gene: a useful tool for driving gene expression in vivo.

    PubMed

    Feng, Jun; Li, Guang; Liu, Xin; Wang, Jing; Wang, Yi-Quan

    2014-10-01

    Amphioxus is a promising new animal model for developmental biology. To develop molecular tools for this model, we characterized the promoter region of a cytoplasmic β-actin gene (Bb-actin-6-2) from the Chinese amphioxus Branchiostoma belcheri. In situ hybridization and real time-quantitative PCR analyses showed that this gene is expressed in many tissues throughout embryonic development. Cloning of cDNA revealed two isoforms with distinct transcription start sites. Isoform #1 exhibits a similar exon/intron and regulatory element organization to that of vertebrate β-actin, whereas isoform #2 lacks the first exon of isoform #1 and recruits its first intron as a promoter. The activities of upstream promoter regions in the two isoforms were examined using the lacZ reporter system in amphioxus embryos. The proximal promoter of isoform #1 drove reporter gene expression broadly in 58.6 % of injected embryos. That of isoform #2 exhibited much higher activity (91.5 %) than that of isoform #1 or the human EF-1-α gene (38.2 %). We determined the minimal promoter regions of the two isoforms via functional analysis. These two regions, alone or inserted a random DNA fragment upstream, had no detectable activity, but when an upstream enhancer was inserted, the promoters directed reporter gene expression in 61.0 and 93.8 %, respectively, of injected embryos in a tissue-specific manner. Our study not only provides insight into the regulatory mechanism underlying amphioxus Bb-actin-6-2 gene expression, but also identifies two sets of efficient proximal and minimal promoters. These promoters could be used to construct gene expression vectors for transgenic studies using amphioxus as a model.

  7. Functional analysis of the promoter region of amphioxus β-actin gene: a useful tool for driving gene expression in vivo.

    PubMed

    Feng, Jun; Li, Guang; Liu, Xin; Wang, Jing; Wang, Yi-Quan

    2014-10-01

    Amphioxus is a promising new animal model for developmental biology. To develop molecular tools for this model, we characterized the promoter region of a cytoplasmic β-actin gene (Bb-actin-6-2) from the Chinese amphioxus Branchiostoma belcheri. In situ hybridization and real time-quantitative PCR analyses showed that this gene is expressed in many tissues throughout embryonic development. Cloning of cDNA revealed two isoforms with distinct transcription start sites. Isoform #1 exhibits a similar exon/intron and regulatory element organization to that of vertebrate β-actin, whereas isoform #2 lacks the first exon of isoform #1 and recruits its first intron as a promoter. The activities of upstream promoter regions in the two isoforms were examined using the lacZ reporter system in amphioxus embryos. The proximal promoter of isoform #1 drove reporter gene expression broadly in 58.6 % of injected embryos. That of isoform #2 exhibited much higher activity (91.5 %) than that of isoform #1 or the human EF-1-α gene (38.2 %). We determined the minimal promoter regions of the two isoforms via functional analysis. These two regions, alone or inserted a random DNA fragment upstream, had no detectable activity, but when an upstream enhancer was inserted, the promoters directed reporter gene expression in 61.0 and 93.8 %, respectively, of injected embryos in a tissue-specific manner. Our study not only provides insight into the regulatory mechanism underlying amphioxus Bb-actin-6-2 gene expression, but also identifies two sets of efficient proximal and minimal promoters. These promoters could be used to construct gene expression vectors for transgenic studies using amphioxus as a model. PMID:25078982

  8. Methylation status and chromatin structure of the myostatin gene promoter region in the sea perch Lateolabrax japonicus (Perciformes).

    PubMed

    Abbas, E M; Takayanagi, A; Shimizu, N; Kato, M

    2011-01-01

    Myostatin is a negative regulator of the growth and development of skeletal muscle mass. In fish, myostatin is expressed in several organs in addition to skeletal muscle. To understand the mechanisms regulating myostatin gene expression in the sea perch, Lateolabrax japonicus, we examined the methylation status of the myostatin gene promoter region in several tissues (liver, eye, kidney, brain, and heart) isolated from adult specimens. The frequency of methylated cytosines was very low in all tissues, regardless of the level of myostatin expression, suggesting that DNA methylation is not involved in the tissue-specific regulation of myostatin expression. Southern blot analysis of genomic DNA obtained from micrococcal nuclease-treated nuclei showed that chromatin digestion occurs in tissues where the myostatin gene is actively transcribed and that the myostatin gene is protected from micrococcal nuclease in tissues where myostatin is not expressed. The chromatin structure in the myostatin gene region appears to regulate its expression without DNA methylation. PMID:22183947

  9. [Methylation of FHIT gene promoter region in DNA from plasma of patients with myelodysplastic syndromes and demethylating effect of decitabine].

    PubMed

    Deng, Yin-Fen; Zhang, Lei; Zhang, Xiu-Qun; Hu, Ming-Qiu; Dai, Dan; Zhang, Xue-Zhong; Xu, Yan-Li

    2012-10-01

    This study was aimed to detect the methylation status of FHIT gene promoter region in the DNA from plasma of patients with myelodysplastic syndrome (MDS), and to investigate the demethylating effect of decitabine. Methylation-specific PCR method was used to detect the methylation status of FHIT gene promoter region in the DNA from plasma of 4 patients with MDS before and after treatment with decitabine plus semis CAG therapy (among them, 1 case of newly diagnosed MDS, 3 cases progressed into acute leukemia). The results indicated that 3 cases were found to have an increased methylation in the promoter region. After treatment with decitabine plus semis CAG, increased methylation was reversed in 2 cases. In 4 cases, 2 cases displayed clinical response. It is concluded that FHIT gene hypermethylation is associated with MDS pathogenesis. Decitabine has demethylating effect on the FHIT gene hypermethylation of plasma from MDS patients. Detecting the methylation status of FHIT gene in DNA from plasma may play a role in MDS auxiliary diagnosis or prognosis.

  10. Characterization of the Promoter Regions of Two Sheep Keratin-Associated Protein Genes for Hair Cortex-Specific Expression.

    PubMed

    Zhao, Zhichao; Liu, Guangbin; Li, Xinyun; Huang, Ji; Xiao, Yujing; Du, Xiaoyong; Yu, Mei

    2016-01-01

    The keratin-associated proteins (KAPs) are the structural proteins of hair fibers and are thought to play an important role in determining the physical properties of hair fibers. These proteins are activated in a striking sequential and spatial pattern in the keratinocytes of hair fibers. Thus, it is important to elucidate the mechanism that underlies the specific transcriptional activity of these genes. In this study, sheep KRTAP 3-3 and KRTAP11-1 genes were found to be highly expressed in wool follicles in a tissue-specific manner. Subsequently, the promoter regions of the two genes that contained the 5' flanking/5' untranslated regions and the coding regions were cloned. Using an in vivo transgenic approach, we found that the promoter regions from the two genes exhibited transcriptional activity in hair fibers. A much stronger and more uniformly expressed green fluorescent signal was observed in the KRTAP11-1-ZsGreen1 transgenic mice. In situ hybridization revealed the symmetrical expression of sheep KRTAP11-1 in the entire wool cortex. Consistently, immunohistochemical analysis demonstrated that the pattern of ZsGreen1 expression in the hair cortex of transgenic mice matches that of the endogenous KRTAP11-1 gene, indicating that the cloned promoter region contains elements that are sufficient to govern the wool cortex-specific transcription of KRTAP11-1. Furthermore, regulatory regions in the 5' upstream sequence of the sheep KRTAP11-1 gene that may regulate the observed hair keratinocyte specificity were identified using in vivo reporter assays. PMID:27100288

  11. Characterization of the Promoter Regions of Two Sheep Keratin-Associated Protein Genes for Hair Cortex-Specific Expression

    PubMed Central

    Zhao, Zhichao; Liu, Guangbin; Li, Xinyun; Huang, Ji; Xiao, Yujing; Du, Xiaoyong; Yu, Mei

    2016-01-01

    The keratin-associated proteins (KAPs) are the structural proteins of hair fibers and are thought to play an important role in determining the physical properties of hair fibers. These proteins are activated in a striking sequential and spatial pattern in the keratinocytes of hair fibers. Thus, it is important to elucidate the mechanism that underlies the specific transcriptional activity of these genes. In this study, sheep KRTAP 3–3 and KRTAP11-1 genes were found to be highly expressed in wool follicles in a tissue-specific manner. Subsequently, the promoter regions of the two genes that contained the 5′ flanking/5′ untranslated regions and the coding regions were cloned. Using an in vivo transgenic approach, we found that the promoter regions from the two genes exhibited transcriptional activity in hair fibers. A much stronger and more uniformly expressed green fluorescent signal was observed in the KRTAP11-1-ZsGreen1 transgenic mice. In situ hybridization revealed the symmetrical expression of sheep KRTAP11-1 in the entire wool cortex. Consistently, immunohistochemical analysis demonstrated that the pattern of ZsGreen1 expression in the hair cortex of transgenic mice matches that of the endogenous KRTAP11-1 gene, indicating that the cloned promoter region contains elements that are sufficient to govern the wool cortex-specific transcription of KRTAP11-1. Furthermore, regulatory regions in the 5′ upstream sequence of the sheep KRTAP11-1 gene that may regulate the observed hair keratinocyte specificity were identified using in vivo reporter assays. PMID:27100288

  12. Characterization of the Promoter Regions of Two Sheep Keratin-Associated Protein Genes for Hair Cortex-Specific Expression.

    PubMed

    Zhao, Zhichao; Liu, Guangbin; Li, Xinyun; Huang, Ji; Xiao, Yujing; Du, Xiaoyong; Yu, Mei

    2016-01-01

    The keratin-associated proteins (KAPs) are the structural proteins of hair fibers and are thought to play an important role in determining the physical properties of hair fibers. These proteins are activated in a striking sequential and spatial pattern in the keratinocytes of hair fibers. Thus, it is important to elucidate the mechanism that underlies the specific transcriptional activity of these genes. In this study, sheep KRTAP 3-3 and KRTAP11-1 genes were found to be highly expressed in wool follicles in a tissue-specific manner. Subsequently, the promoter regions of the two genes that contained the 5' flanking/5' untranslated regions and the coding regions were cloned. Using an in vivo transgenic approach, we found that the promoter regions from the two genes exhibited transcriptional activity in hair fibers. A much stronger and more uniformly expressed green fluorescent signal was observed in the KRTAP11-1-ZsGreen1 transgenic mice. In situ hybridization revealed the symmetrical expression of sheep KRTAP11-1 in the entire wool cortex. Consistently, immunohistochemical analysis demonstrated that the pattern of ZsGreen1 expression in the hair cortex of transgenic mice matches that of the endogenous KRTAP11-1 gene, indicating that the cloned promoter region contains elements that are sufficient to govern the wool cortex-specific transcription of KRTAP11-1. Furthermore, regulatory regions in the 5' upstream sequence of the sheep KRTAP11-1 gene that may regulate the observed hair keratinocyte specificity were identified using in vivo reporter assays.

  13. Hypermethylation of p16 and DAPK promoter gene regions in patients with non-invasive urinary bladder cancer

    PubMed Central

    Jabłonowski, Zbigniew; Reszka, Edyta; Gromadzińska, Jolanta; Wąsowicz, Wojciech; Sosnowski, Marek

    2011-01-01

    Introduction The aim of the study was to examine the frequency of methylation status in promoter regions of p16 and DAPK genes in patients with non-invasive bladder cancer. Material and methods Forty-two patients (92.9% men, 73.8% smokers, 71.4% T1G1, 19.1% T1G2, 9.5% T1G3) and 36 healthy controls were studied. Isolation of genomic DNA from blood serum and methylation-specific PCR (MSP) were applied. Methylation status – methylated and unmethylated promoter regions of p16 and DAPK genes were analysed. Results Seventeen out of 42 patients (40.5%) had the methylated p16 gene, while methylation of the DAPK gene was seen in 27 of 42 cases (64.3%). In 12 patients (28.6%) both analysed genes were methylated. A statistically significant (p = 0.046) higher frequency of DAPK gene methylation (71.4%) was observed in patients with lower grade (G1) bladder cancer. Conclusions Detection of the aberrant hypermethylation of DAPK and p16 genes in blood DNA from non-invasive bladder cancer patients might offer an effective means for earlier auxiliary diagnosis of the malignancy. PMID:22295037

  14. Association of a Human FABP1 Gene Promoter Region Polymorphism with Altered Serum Triglyceride Levels

    PubMed Central

    Zhu, Yi-bing; Huang, Rong-dong; Lu, Qing-Qing; Lin, Xu

    2015-01-01

    Liver fatty acid-binding protein (L-FABP), also known as fatty acid-binding protein 1 (FABP1), is a key regulator of hepatic lipid metabolism. Elevated FABP1 levels are associated with an increased risk of cardiovascular disease (CVD) and metabolic syndromes. In this study, we examine the association of FABP1 gene promoter variants with serum FABP1 and lipid levels in a Chinese population. Four promoter single-nucleotide polymorphisms (SNPs) of FABP1 gene were genotyped in a cross-sectional survey of healthy volunteers (n = 1,182) from Fuzhou city of China. Results showed that only the rs2919872 G>A variant was significantly associated with serum TG concentration(P = 0.032).Compared with the rs2919872 G allele, rs2919872 A allele contributed significantly to reduced serum TG concentration, and this allele dramatically decreased the FABP1 promoter activity(P < 0.05). The rs2919872 A allele carriers had considerably lower serum FABP1 levels than G allele carriers (P < 0.01). In the multivariable linear regression analysis, the rs2919872 A allele was negatively associated with serum FABP1 levels (β = —0.320, P = 0.003), while serum TG levels were positively associated with serum FABP1 levels (β = 0.487, P = 0.014). Our data suggest that compared with the rs2919872 G allele, the rs2919872 A allele reduces the transcriptional activity of FABP1 promoter, and thereby may link FABP1 gene variation to TG level in humans. PMID:26439934

  15. Association of a Human FABP1 Gene Promoter Region Polymorphism with Altered Serum Triglyceride Levels.

    PubMed

    Peng, Xian-E; Wu, Yun-Li; Zhu, Yi-Bing; Huang, Rong-Dong; Lu, Qing-Qing; Lin, Xu

    2015-01-01

    Liver fatty acid-binding protein (L-FABP), also known as fatty acid-binding protein 1 (FABP1), is a key regulator of hepatic lipid metabolism. Elevated FABP1 levels are associated with an increased risk of cardiovascular disease (CVD) and metabolic syndromes. In this study, we examine the association of FABP1 gene promoter variants with serum FABP1 and lipid levels in a Chinese population. Four promoter single-nucleotide polymorphisms (SNPs) of FABP1 gene were genotyped in a cross-sectional survey of healthy volunteers (n = 1,182) from Fuzhou city of China. Results showed that only the rs2919872 G>A variant was significantly associated with serum TG concentration(P = 0.032).Compared with the rs2919872 G allele, rs2919872 A allele contributed significantly to reduced serum TG concentration, and this allele dramatically decreased the FABP1 promoter activity(P < 0.05). The rs2919872 A allele carriers had considerably lower serum FABP1 levels than G allele carriers (P < 0.01). In the multivariable linear regression analysis, the rs2919872 A allele was negatively associated with serum FABP1 levels (β = -0.320, P = 0.003), while serum TG levels were positively associated with serum FABP1 levels (β = 0.487, P = 0.014). Our data suggest that compared with the rs2919872 G allele, the rs2919872 A allele reduces the transcriptional activity of FABP1 promoter, and thereby may link FABP1 gene variation to TG level in humans. PMID:26439934

  16. Structure of the human luteinizing hormone-choriogonadotropin receptor gene: unusual promoter and 5' non-coding regions.

    PubMed

    Atger, M; Misrahi, M; Sar, S; Le Flem, L; Dessen, P; Milgrom, E

    1995-06-01

    The complete organization of the human luteinizing hormone-choriogonadotropin (LH/CG) receptor (LH/CGR) gene and the structure of 1591 bp of its 5' flanking region have been determined. This gene spans over 70 kbp and contains 11 exons. The first ten exons and part of the last exon encode the extracellular domain of the receptor while the transmembrane and intracellular domains are encoded by the remaining part of the last exon. The gene encodes a 701 amino acids long preprotein, contrary to a previous report of 699 amino acids. Primer extension experiments and polymerase chain reaction (PCR) mapping allowed definition of the transcription initiation site, which is located 1085 bp upstream from the initiation codon. The 5' non-coding region is thus unusually long. The promoter region which is different from the murine LH/CG receptor promoter, contains two putative TATA boxes at positions -34 and -47 and a CAAT box consensus sequence at position -89. A consensus sequence corresponding to a cAMP responsive element is found at position -697. Seven API consensus sequences are also found in the 5' flanking region of the gene. Southern blot experiments demonstrated an informative biallelic polymorphism within the human LH/CG receptor gene locus using BglII endonuclease. The cloning of the human LH/CGR gene and the determination of the organization and structure of its 5' flanking region allow the study of its hormonal, developmental and tissue-specific regulation. Primers and PCR conditions are described for the direct genomic sequencing of all the exons of the gene. This information should facilitate the study of pathological mutations of the receptor.

  17. Regulatory regions in the promoters of the Saccharomyces cerevisiae PYC1 and PYC2 genes encoding isoenzymes of pyruvate carboxylase.

    PubMed

    Menéndez, J; Gancedo, C

    1998-07-15

    We have identified regions in the promoters of the PYC1 and PYC2 genes from Saccharomyces cerevisiae involved in their regulation in different culture conditions. In the case of PYC1, a UAS in the region between -330/-297 and three repressing sequences with the common central core CCGCC at positions -457, -432 and -399 were identified. Specific binding of nuclear proteins to the -330/-214 DNA fragment was abolished in rtg mutants suggesting a role for the RTG genes in the control of PYC1 expression. In the case of the PYC2 promoter, elimination of a fragment from -417 to -291 brings about a two-fold decrease in the expression in repressed conditions and a similar increase in derepression.

  18. The 228bp upstream non-coding region of haloacids transporter gene dehp2 has regulated promoter activity.

    PubMed

    Su, Xianbin; Li, Ruihong; Tsang, Jimmy S H

    2016-11-30

    Biodegradation is an effective way to remove environmental pollutants haloacids, and haloacids uptake is an important step besides cytoplasmic dehalogenation. Previous study has identified a robust haloacids transport system in Burkholderia caribensis MBA4 with two homologous genes deh4p and dehp2 as major players. Both genes are inducible by monochloroacetate (MCA), and dehp2 is conserved among the Burkholderia genus with a two component system upstream. Here we show that dehp2 is not in the same operon with the upstream two component system, and fusion with lacZ confirmed the presence of MCA-inducible promoter activity in the 228bp upstream non-coding region of dehp2. Serial deletion confirmed 112bp upstream is enough for basic promoter activity, but sequence further upstream is useful for enhanced promoter activity. Electrophoretic mobility shift assay of the 228bp region showed a retardation complex with stronger hybridization in the induced condition, suggesting a positive regulation pattern. Regulator(s) binding region was found to lie between -228 to -113bp of dehp2. Quantitative real-time PCR showed that the expressions of dehp2 orthologs in three other Burkholderia species were also MCA-inducible, similar as dehp2. The 5' non-coding regions of these dehp2 orthologs have high sequence similarity with dehp2 promoter, and 100bp upstream of dehp2 orthologs is especially conserved. Our study identified a promoter of haloacids transporter gene that is conserved in the Burkholderia genus, which will benefit future exploitation of them for effective biodegradation of haloacids. PMID:27576348

  19. Analysis of the promoter region of a cardiac specific phospholipase A{sub 2} gene located at 1p35

    SciTech Connect

    Winstead, M.V.; Chen, J.; Tischfield, J.A.

    1994-09-01

    Phospholipases may play an important role in the pathology of tissue damage and in membrane remodeling. We have previously shown that the Group II PLA{sub 2} gene and two PLA{sub 2}-like gene fragments map to 1p35. We have since shown that at least one of the fragments is part of a cardiac-specific PLA{sub 2} gene. Thus the identification and characterization of the regulatory regions of this new phospholipase A{sub 2} (PLA{sub 2}) may be important for understanding the regulation of this gene under normal and pathologic conditions. HPLA2-10, mainly expressed in heart, is a low molecular weight, Ca{sup 2+}-dependent PLA{sub 2} that we have classified as a new group (Group III) based on structural considerations. The 5{prime} regulatory region of HPLA2-10 was isolated from a human genomic DNA bacteriophage library and cloned into pUC19. Computer analysis of the region`s DNA sequence indicates the presence of multiple transcription factor binding sites. A comparison between the human promoter region and the promoter region of the rat homologue, RPLA2-10, indicates that at least two putative transcription factor binding sites are conserved between the two species. These include a CCAAT box and an AGTCCT hexanucleotide, which has been implicated as a binding site for the glucocorticoid receptor. DNA footprint analysis is being performed to determine whether or not these putative regions are sites of protein binding. Also, a proposed view of the evolution of the distinct groups of low molecular weight PLA{sub 2}s will be presented.

  20. Association between VNTR polymorphism in promoter region of prodynorphin (PDYN) gene and heroin dependence.

    PubMed

    Saify, Khyber; Saadat, Iraj; Saadat, Mostafa

    2014-11-30

    Within the core promoter region of prodynorphin (PDYN), a 68-bp sequence was found to occur as a polymorphism element, either singular or as tandemly repeated two, three or four times. We report the sequence of a novel allele (5-repeats). Our study revealed the existence of an ancestral nucleotide (A) at 29th position of the VNTR in human. In total, 442 heroin addicts and 799 controls were included in this study. The present findings revealed a male-limited association between VNTR polymorphism and heroin dependence risk.

  1. Variation in the IGF2 gene promoter region is associated with intramuscular fat content in porcine skeletal muscle.

    PubMed

    Aslan, Ozlem; Hamill, Ruth M; Davey, Grace; McBryan, Jean; Mullen, Anne Maria; Gispert, Marina; Sweeney, Torres

    2012-04-01

    Intramuscular fat (IMF) and subcutaneous fat (back fat-BF) are two of the major fat depots in livestock. A QTN located in the insulin-like growth factor 2 gene (IGF2) has been associated with a desirable reduction in BF depth in pigs. Given that the lipid metabolism of intramuscular adipocytes differs from that of subcutaneous fat adipocytes, this study aimed to search for genetic variation in the IGF2 gene that may be associated with IMF, as well as BF, in diverse pig breeds. Four proximal promoter regions of the IGF2 gene were characterised and the association of IGF2 genetic variation with IMF and BF was assessed. Six promoter SNPs were identified in four promoter regions (P1-P4; sequence coverage 945, 866, 784 and 864 bp, respectively) in phenotypically diverse F1 cross populations. Three promoter SNPs were subsequently genotyped in three pure breeds (Pietrain = 98, Duroc = 99 and Large White = 98). All three SNPs were >95% monomorphic in the Pietrain and Duroc breeds but minor alleles were at moderate frequencies in the Large White breed. These SNPs were linked and one was located in a putative transcription factor binding site. Five haplotypes were inferred and three combined diplotypes tested for association with IMF and BF in the Large White. As expected haplotype 1 (likely in LD with the beneficial QTN allele) was superior for BF level. In contrast, the heterozygote diplotype of the most common haplotypes (1 and 2) was associated with higher IMF and marbling scores compared to either homozygote. Gene expression analysis of divergent animals showed that IGF2 was 1.89 fold up-regulated in muscle with higher compared to lower IMF content. These findings suggest that genetic variation in the promoter region of the IGF2 gene is associated with IMF content in porcine skeletal muscle and that greater expression of the IGF2 gene is associated with higher IMF content. PMID:21779802

  2. A Common Variation in the Promoter Region of Interleukin-6 Gene Shows Association with Exercise Performance

    PubMed Central

    Huuskonen, Antti; Tanskanen, Minna; Lappalainen, Jani; Oksala, Niku; Kyröläinen, Heikki; Atalay, Mustafa

    2009-01-01

    Skeletal muscle-derived interleukin-6 (IL-6) is a pleiotropic cytokine which regulates body metabolism during strenuous physical exercise. OBJECTIVE: The effect of a potentially functional single nucleotide polymorphism (SNP) -174G/C of the IL6 gene (rs1800795) promoter was examined on maximal oxygen uptake (VO2max), body mass index (BMI) and plasma IL-6 levels in response to physical training. Fifty four male military conscripts were studied for 8 weeks during their basic training. At weeks 1, 5 and 8, VO2max and anthropometrics were measured, and blood samples collected before and after acute aerobic exercise. Acute exercise increased plasma IL-6 in subjects with genotype CG. Moreover, during the 8-week training period, a tendency for increased plasma IL-6 was observed in subjects with this genotype. VO2max values increased in all genotype groups, but subjects with genotype CG made the greatest gains in VO2max. Training significantly decreased BMI only in subjects with genotype CG. Our findings suggest that the allele C may have an effect on plasma IL-6 response to acute exercise in healthy male subjects. Exercise training has a favourable effect on VO2max and BMI, with the most prominent effects in subjects with genotype CG. Thus we conclude that this SNP may account for individual response to exercise training. Key points Allele C of the IL6 promoter SNP -174G/C may have an effect on plasma IL-6 response to acute exercise. All subjects responded to physical exercise, but the improvement in VO2max and decrease in BMI after training are more pronounced in the individuals with genotype CG, hence the IL6 promoter SNP -174G/C may have an influence on training responses. The small number of subjects investigated in the present study warrants further research to confirm these findings in large cohorts. PMID:24149537

  3. Definition of regulatory sequence elements in the promoter region and the first intron of the myotonic dystrophy protein kinase gene.

    PubMed

    Storbeck, C J; Sabourin, L A; Waring, J D; Korneluk, R G

    1998-04-10

    Myotonic dystrophy is the most common inherited adult neuromuscular disorder with a global frequency of 1/8000. The genetic defect is an expanding CTG trinucleotide repeat in the 3'-untranslated region of the myotonic dystrophy protein kinase gene. We present the in vitro characterization of cis regulatory elements controlling transcription of the myotonic dystrophy protein kinase gene in myoblasts and fibroblasts. The region 5' to the initiating ATG contains no consensus TATA or CCAAT box. We have mapped two transcriptional start sites by primer extension. Deletion constructs from this region fused to the bacterial chloramphenicol acetyltransferase reporter gene revealed only subtle muscle specific cis elements. The strongest promoter activity mapped to a 189-base pair fragment. This sequence contains a conserved GC box to which the transcription factor Sp1 binds. Reporter gene constructs containing a 2-kilobase pair first intron fragment of the myotonic dystrophy protein kinase gene enhances reporter activity up to 6-fold in the human rhabdomyosarcoma myoblast cell line TE32 but not in NIH 3T3 fibroblasts. Co-transfection of a MyoD expression vector with reporter constructs containing the first intron into 10 T1/2 fibroblasts resulted in a 10-20-fold enhancement of expression. Deletion analysis of four E-box elements within the first intron reveal that these elements contribute to enhancer activity similarly in TE32 myoblasts and 10 T1/2 fibroblasts. These data suggest that E-boxes within the myotonic dystrophy protein kinase first intron mediate interactions with upstream promoter elements to up-regulate transcription of this gene in myoblasts.

  4. Functional relevance of DNA polymorphisms within the promoter region of the prion protein gene and their association to BSE infection.

    PubMed

    Kashkevich, Kseniya; Humeny, Andreas; Ziegler, Ute; Groschup, Martin H; Nicken, Petra; Leeb, Tosso; Fischer, Christine; Becker, Cord-Michael; Schiebel, Katrin

    2007-05-01

    Transmissible spongiform encephalopathies (TSEs) are a group of neurodegenerative diseases that can occur spontaneously or can be caused by infection or mutations within the prion protein gene PRNP. Nonsynonymous DNA polymorphisms within the PRNP gene have been shown to influence susceptibility/resistance to infection in sheep and humans. Analysis of DNA polymorphisms within the core promoter region of the PRNP gene in four major German bovine breeds resulted in the identification of both SNPs and insertion/deletion (indel) polymorphisms. Comparative genotyping of both controls and animals that tested positive for bovine spongiform encephalopathy (BSE) revealed a significantly different distribution of two indel polymorphisms and two SNPs within Braunvieh animals, suggesting an association of these polymorphisms with BSE susceptibility. The functional relevance of these polymorphisms was analyzed using reporter gene constructs in neuronal cells. A specific haplotype near exon 1 was identified that exhibited a significantly lower expression level. Genotyping of nine polymorphisms within the promoter region and haplotype calculation revealed that the haplotype associated with the lowest expression level was underrepresented in the BSE group of all breeds compared to control animals, indicating a correlation of reduced PRNP expression and increased resistance to BSE.

  5. Serotonin Transporter Gene Promoter Region Polymorphism and Selective Processing of Emotional Images

    PubMed Central

    Beevers, Christopher G.; Ellis, Alissa J.; Wells, Tony T.; McGeary, John E.

    2009-01-01

    Several studies have now documented that the serotonin transporter promoter region (5-HTTLPR) polymorphism predicts neural response to affective images in brain regions involved in the experience of emotion. However, the behavioral consequences of this genetic effect are less well known. The current study used eye-tracking methodology to examine how individuals genotyped for the 5-HTTLPR allocated their attention when simultaneously presented an array of positive and negative emotional scenes. Short 5-HTTLPR allele homozygotes displayed a bias to focus on positive images, particularly in the first half of the 30-second trial. In contrast, long 5-HTTLPR allele homozygotes viewed the stimuli in a more evenhanded fashion. Thus, short 5-HTTLPR allele homozygotes may be attempting to regulate greater reactivity to negative stimuli by purposefully turning their attention towards positive stimuli. Although this sensitivity may have benefits under benign conditions, it may also increase vulnerability to affective disorders when cognitive resources needed to turn attention away from negative stimuli are compromised. PMID:19715738

  6. Novel region within the V kappa gene promoter is responsible for tissue and stage-specific expression of immunoglobulin genes in human lymphoid neoplasms.

    PubMed

    Kossakowska, A E; Urbanski, S J

    1989-03-01

    Immunoglobulin gene-specific transacting factors have been shown to play a role in lymphoid tissue-specific expression of immunoglobulin genes. The role of these factors in B-cell differentiation and stage-specific expression of these genes is, however, not fully understood. We have used a model of human lymphoid neoplasia to address this question. Different fragments of unrearranged human variable region of immunoglobulin kappa gene (V kappa) were used for cell-free in vitro transcription and DNA mobility shift assays. Previously described enhancement of in vitro transcription that was only seen with nuclear extracts derived from B-cell neoplasms corresponding to the late stages of B-cell differentiation was shown to be dependent on the actions of these factor(s) on the DNA region within the V kappa gene promoter. This region is located within the 920 bp fragment located 210 bp upstream from the coding region and this fragment represents a possible novel DNA region, which plays a role in the stage- and tissue-specific expression of immunoglobulin genes.

  7. The promoter region of the arg3 gene in Saccharomyces cerevisiae: nucleotide sequence and regulation in an arg3-lacZ gene fusion.

    PubMed

    Crabeel, M; Huygen, R; Cunin, R; Glansdorff, N

    1983-01-01

    We have determined the DNA sequence for the 5' end of the arg3 gene of Saccharomyces cerevisiae, including part of the coding region and the 200 nucleotides immediately upstream. A promoter-deletion mutant was found to have lost all of the sequence lying normally in front of the gene except for the 33 nucleotides preceding the AUG codon. The role of the 5' domain in initiation and regulation of arg3 transcription was assessed by a gene fusion experiment. The Escherichia coli lacZ gene, was truncated of the eight amino-terminal codons substituted in vitro, on a 2mu plasmid, for the carboxy-terminal and 3'-flanking regions of arg3, leaving only the first 19 proximal codons and approximately 1600 nucleotides of the region preceding arg3 on the yeast chromosome. The fused gene was expressed in phase and was still submitted to the two mechanisms regulating the wild-type arg3 gene: the general, probably transcriptional control of amino acid biosynthesis and the specific, apparently post-transcriptional control mediated by the products of the argR genes. These results suggest a determining role for the 5' end portion of the arg3 messenger in the specific arginine-mediated control mechanism. PMID:11894927

  8. Identification of laticifer-specific genes and their promoter regions from a natural rubber producing plant Hevea brasiliensis.

    PubMed

    Aoki, Yuichi; Takahashi, Seiji; Takayama, Daisuke; Ogata, Yoshiyuki; Sakurai, Nozomu; Suzuki, Hideyuki; Asawatreratanakul, Kasem; Wititsuwannakul, Dhirayos; Wititsuwannakul, Rapepun; Shibata, Daisuke; Koyama, Tanetoshi; Nakayama, Toru

    2014-08-01

    Latex, the milky cytoplasm of highly differentiated cells called laticifers, from Hevea brasiliensis is a key source of commercial natural rubber production. One way to enhance natural rubber production would be to express genes involved in natural rubber biosynthesis by a laticifer-specific overexpression system. As a first step to identify promoters which could regulate the laticifer-specific expression, we identified random clones from a cDNA library of H. brasiliensis latex, resulting in 4325 expressed sequence tags (ESTs) assembled into 1308 unigenes (692 contigs and 617 singletons). Quantitative analyses of the transcription levels of high redundancy clones in the ESTs revealed genes highly and predominantly expressed in laticifers, such as Rubber Elongation Factor (REF), Small Rubber Particle Protein and putative protease inhibitor proteins. HRT1 and HRT2, cis-prenyltransferases involved in rubber biosynthesis, was also expressed predominantly in laticifers, although these transcript levels were 80-fold lower than that of REF. The 5'-upstream regions of these laticifer-specific genes were cloned and analyzed in silico, revealing seven common motifs consisting of eight bases. Furthermore, transcription factors specifically expressed in laticifers were also identified. The common motifs in the laticifer-specific genes and the laticifer-specific transcription factors are potentially involved in the regulation of gene expression in laticifers.

  9. Identification of laticifer-specific genes and their promoter regions from a natural rubber producing plant Hevea brasiliensis.

    PubMed

    Aoki, Yuichi; Takahashi, Seiji; Takayama, Daisuke; Ogata, Yoshiyuki; Sakurai, Nozomu; Suzuki, Hideyuki; Asawatreratanakul, Kasem; Wititsuwannakul, Dhirayos; Wititsuwannakul, Rapepun; Shibata, Daisuke; Koyama, Tanetoshi; Nakayama, Toru

    2014-08-01

    Latex, the milky cytoplasm of highly differentiated cells called laticifers, from Hevea brasiliensis is a key source of commercial natural rubber production. One way to enhance natural rubber production would be to express genes involved in natural rubber biosynthesis by a laticifer-specific overexpression system. As a first step to identify promoters which could regulate the laticifer-specific expression, we identified random clones from a cDNA library of H. brasiliensis latex, resulting in 4325 expressed sequence tags (ESTs) assembled into 1308 unigenes (692 contigs and 617 singletons). Quantitative analyses of the transcription levels of high redundancy clones in the ESTs revealed genes highly and predominantly expressed in laticifers, such as Rubber Elongation Factor (REF), Small Rubber Particle Protein and putative protease inhibitor proteins. HRT1 and HRT2, cis-prenyltransferases involved in rubber biosynthesis, was also expressed predominantly in laticifers, although these transcript levels were 80-fold lower than that of REF. The 5'-upstream regions of these laticifer-specific genes were cloned and analyzed in silico, revealing seven common motifs consisting of eight bases. Furthermore, transcription factors specifically expressed in laticifers were also identified. The common motifs in the laticifer-specific genes and the laticifer-specific transcription factors are potentially involved in the regulation of gene expression in laticifers. PMID:25017153

  10. Novel polymorphisms in the promoter region of the perforin gene among distinct Brazilian populations and their functional impact.

    PubMed

    Garcia, F B; Kashima, S; Rodrigues, E S; Silva, I T; Malta, T M; Nicolete, L D de Figueiredo; Haddad, R; Moraes-Souza, H; Covas, D T

    2014-06-01

    Cytotoxic T lymphocytes and natural killer cells play a crucial role in eliminating tumour and virus-infected cells. The perforin is a key part of the arsenal that these cells use to destroy their targets. In this study, we characterized single-nucleotide polymorphisms (SNPs) located in the promoter region of the perforin gene among distinct Brazilian ethnic groups. The study was carried out by sequencing this region in three groups: European, African and Asian descents. We demonstrated for the first time the occurrence of three new polymorphisms in the promoter region of gene PRF1: 494A/G (rs78058707), 720G/A (rs75925789) and 1176C/T (rs75183511). Three other SNPs already described in the literature 63A/G (rs35401316), 112A/G (rs10999428) and 1012C/T (rs35069510) were also detected. The SNPs are distributed differently in the ethnic groups studied. The 112G allele was observed at high frequency, especially among Asian descents (48.1%). The 1012T allele was detected only among European descents, the 494G allele only among Asian descents and 1176T allele only in African descents. Based on the association between the polymorphisms described, ten new haplotypes were originated. In functional analysis, we noticed that SNPs present in most common haplotypes cannot induce significant differences in expression levels of perforin alone. In conclusion, this study demonstrates for the first time the existence of three new polymorphisms in perforin promoter and, contrary to what was stated, the presence of these SNPs does not alter the levels of protein expression.

  11. Aberrant Methylation of the E-Cadherin Gene Promoter Region in the Endometrium of Women With Uterine Fibroids.

    PubMed

    Li, Yan; Ran, Ran; Guan, Yingxia; Zhu, Xiaoxiong; Kang, Shan

    2016-08-01

    A uterine fibroid is a leiomyoma that originates from the smooth muscle layer of the uterus. A variety of endometrial abnormalities are associated with uterine fibroids. This study aims to investigate the methylation status of the E-cadherin gene (CDH1) promoter region in the endometrium of patients with uterine fibroids. The methylation of CDH1 was studied using methylation-specific polymerase chain reaction in the endometrial tissue of 102 patients with uterine fibroids and 50 control patients. The E-cadherin expression was examined by flow cytometry. The methylation rate of CDH1 promoter region was 33.3% in the endometrium of patients with uterine fibroids and 8% in the endometrium of women without fibroids. The frequency of CDH1 promoter methylation in the endometrium of patients with fibroids was significantly higher than that in the endometrium of women without fibroids (P = .001). Furthermore, the E-cadherin expression level in methylation-positive tissues was significantly lower than that in methylation-negative tissues (P = .017). These results suggest that epigenetic aberration of CDH1 may occur in the endometrium of patients with fibroids, which may be associated with E-cadherin protein expression in endometrial tissue. PMID:26880767

  12. Aberrant Methylation of the E-Cadherin Gene Promoter Region in the Endometrium of Women With Uterine Fibroids.

    PubMed

    Li, Yan; Ran, Ran; Guan, Yingxia; Zhu, Xiaoxiong; Kang, Shan

    2016-08-01

    A uterine fibroid is a leiomyoma that originates from the smooth muscle layer of the uterus. A variety of endometrial abnormalities are associated with uterine fibroids. This study aims to investigate the methylation status of the E-cadherin gene (CDH1) promoter region in the endometrium of patients with uterine fibroids. The methylation of CDH1 was studied using methylation-specific polymerase chain reaction in the endometrial tissue of 102 patients with uterine fibroids and 50 control patients. The E-cadherin expression was examined by flow cytometry. The methylation rate of CDH1 promoter region was 33.3% in the endometrium of patients with uterine fibroids and 8% in the endometrium of women without fibroids. The frequency of CDH1 promoter methylation in the endometrium of patients with fibroids was significantly higher than that in the endometrium of women without fibroids (P = .001). Furthermore, the E-cadherin expression level in methylation-positive tissues was significantly lower than that in methylation-negative tissues (P = .017). These results suggest that epigenetic aberration of CDH1 may occur in the endometrium of patients with fibroids, which may be associated with E-cadherin protein expression in endometrial tissue.

  13. An inducible promoter mediates abundant expression from the immediate-early 2 gene region of human cytomegalovirus at late times after infection.

    PubMed Central

    Puchtler, E; Stamminger, T

    1991-01-01

    An abundant late transcript of 1.5 kb originates from the immediate-early 2 (IE-2) gene region of human cytomegalovirus (HCMV) at late times after infection. The transcriptional start of this RNA was precisely mapped, and the putative promoter region was cloned in front of the CAT gene as reporter. This region, which comprises 78 nucleotides of IE-2 sequence upstream of the determined cap site, was strongly activated by viral superinfection at late times in the replicative cycle. As shown by RNase protection analyses, the authentic transcription start is used. No activation of this late promoter was observed after cotransfection with an expression plasmid containing the HCMV IE-1 and -2 gene region. This result suggests that, compared with early and early late promoters of HCMV, different or additional viral functions are required for the activation of true late promoters. Images PMID:1656096

  14. Systematic screening for mutations in the promoter and the coding region of the 5-HT{sub 1A} gene

    SciTech Connect

    Erdmann, J.; Shimron-Abarbanell, D.; Cichon, S.

    1995-10-09

    In the present study we sought to identify genetic variation in the 5-HT{sub 1A} receptor gene which through alteration of protein function or level of expression might contribute to the genetic predisposition to neuropsychiatric diseases. Genomic DNA samples from 159 unrelated subjects (including 45 schizophrenic, 46 bipolar affective, and 43 patients with Tourette`s syndrome, as well as 25 healthy controls) were investigated by single-strand conformation analysis. Overlapping PCR (polymerase chain reaction) fragments covered the whole coding sequence as well as the 5{prime} untranslated region of the 5-HT{sub 1A} gene. The region upstream to the coding sequence we investigated contains a functional promoter. We found two rare nucleotide sequence variants. Both mutations are located in the coding region of the gene: a coding mutation (A{yields}G) in nucleotide position 82 which leads to an amino acid exchange (Ile{yields}Val) in position 28 of the receptor protein and a silent mutation (C{yields}T) in nucleotide position 549. The occurrence of the Ile-28-Val substitution was studied in an extended sample of patients (n = 352) and controls (n = 210) but was found in similar frequencies in all groups. Thus, this mutation is unlikely to play a significant role in the genetic predisposition to the diseases investigated. In conclusion, our study does not provide evidence that the 5-HT{sub 1A} gene plays either a major or a minor role in the genetic predisposition to schizophrenia, bipolar affective disorder, or Tourette`s syndrome. 29 refs., 4 figs., 1 tab.

  15. RNA polymerase II interacts with the promoter region of the noninduced hsp70 gene in Drosophila melanogaster cells

    SciTech Connect

    Gilmour, D.S.; Lis, J.T.

    1986-11-01

    By using a protein-DNA cross-linking method, we examined the in vivo distribution of RNA polymerase II on the hsp70 heat shock gene in Drosophila melanogaster Schneider line 2 cells. In heat shock-induced cells, a high level of RNA polymerase II was detected on the entire gene, while in noninduced cells, the RNA polymerase II was confined to the 5' end of the hsp70 gene, predominantly between nucleotides -12 and +65 relative to the start of transcription. This association of RNA polymerase II was apparent whether the cross-linking was performed by a 10-min UV irradiation of chilled cells with mercury vapor lamps or by a 40-microsecond irradiation of cells with a high-energy xenon flash lamp. We hypothesize that RNA polymerase II has access to, and a high affinity for, the promoter region of this gene before induction, and this poised RNA polymerase II may be critical in the mechanism of transcription activation.

  16. Identification of a cell-type-specific transcriptional repressor in the promoter region of the mouse hepatocyte growth factor gene.

    PubMed Central

    Liu, Y; Beedle, A B; Lin, L; Bell, A W; Zarnegar, R

    1994-01-01

    Hepatocyte growth factor (HGF), a cytokine with multiple functions, exhibits cell-type-specific as well as cytokine- and steroid hormone-regulated expression. The HGF gene is known to be expressed predominately in mesenchymal but not in epithelial cells. In this study, we report the identification of a cell-type-specific transcriptional repressor in the promoter region of the mouse HGF gene, which is evidently responsible for the suppression of HGF expression in epithelial cells. Gel mobility shift assays and DNase I footprinting studies revealed that a 27-bp element (-16 to +11) around the transcription initiation site is responsible for the binding of a nuclear protein which is present in epithelial but not in mesenchymally derived cells. Further analysis of the binding activity of the DNA region with nuclear protein revealed that an approximately 19-bp sequence containing a unique palindromic structure (5'-AACCGACCGGTT-3') overlapped by a CAP box is essential for binding. Substitution of a single base (the contact site) within this region by site-directed mutagenesis resulted in total abrogation of the binding of the nuclear protein and a concomitant increase in the transcriptional activity of various lengths of HGF-chloramphenicol acetyltransferase fused genes when transfected into the epithelial cell line RL95-2 but not the mesenchymal cell line NIH 3T3. Southwestern (DNA-protein) analyses revealed that the nuclear protein which binds to this repressor element is a single polypeptide of approximately 70 kDa. Analysis of the nuclear extract prepared from regenerating mouse liver at various times after two-thirds partial hepatectomy by gel mobility shift assay revealed a substantial reduction (more than 75% within 3 h) in the binding of the repressor to its cognate binding site. Our results suggest that a cis-acting transcriptional repressor in the promoter region of the mouse HGF gene is involved in cell-type-specific regulation through binding to its cognate

  17. Sequence analysis of the promoter regions of the classical class I gene RT1.A and two other class I genes of the rat MHC

    SciTech Connect

    Lambracht, D.; Wonigeit, K.

    1995-04-01

    Major histocompatibility complex (MHC) class I molecules present peptides to CD8+ T cells and thus play key role in immunosurveillance by T-cell-mediated mechanisms. Their expression depends on complex control mechanisms at two major levels: (1) regulation of transcription mediated through the promoter region and additional regulatory elements of the individual class I gene, and (2) availability of appropriate peptides in the endoplasmic reticulum required to stabilize the ternary complex consisting of class I {alpha} chain, {beta}{sub 2}-microglobulin ({beta}{sub 2}m), and peptide. In addition, differences in the ability of different {alpha} chains to bind {beta}{sub 2}m can influence the transport to and turnover within the cell membrane. We have now analyzed the promoter regions of class I genes of the LEW rat strain carrying the RT1{sup 1} haplotype. The analysis of three class I genes in this region has led to the identification of characteristic regulatory sequences. 20 refs., 2 figs.

  18. Epigenetic changes within the promoter regions of antigen processing machinery family genes in Kazakh primary esophageal squamous cell carcinoma.

    PubMed

    Sheyhidin, Ilyar; Hasim, Ayshamgul; Zheng, Feng; Ma, Hong

    2014-01-01

    The esophageal squamous cell carcinoma (ESCC) is thought to develop through a multi-stage process. Epigenetic gene silencing constitutes an alternative or complementary mechanism to mutational events in tumorigenesis. Posttranscriptional regulation of human leukocyte antigen class I (HLA-I) and antigen processing machinery (APM) proteins expression may be associated with novel epigenetic modifications in cancer development. In the present study, we determined the expression levels of HLA-I antigen and APM components by immunohistochemistry. Then by a bisulfite-sequencing PCR (BSP) approach, we identified target CpG islands methylated at the gene promoter region of APM family genes in a ESCC cell line (ECa109), and further quantitative analysis of CpG site specific methylation of these genes in cases of Kazakh primary ESCCs with corresponding non-cancerous esophageal tissues using the Sequenom MassARRAY platform. Here we showed that the development of ESCCs was accompanied by partial or total loss of protein expression of HLA-B, TAP2, LMP7, tapasin and ERp57. The results demonstrated that although no statistical significance was found of global target CpG fragment methylation level sof HLA-B, TAP2, tapasin and ERp57 genes between ESCC and corresponding non-cancerous esophageal tissues, there was significant differences in the methylation level of several single sites between the two groups. Of thesse only the global methylation level of LMP7 gene target fragments was statistically higher (0.0517±0.0357) in Kazakh esophageal cancer than in neighboring normal tissues (0.0380±0.0214, p<0.05). Our results suggest that multiple CpG sites, but not methylation of every site leads to down regulation or deletion of gene expression. Only some of them result in genetic transcription, and silencing of HLA-B, ERp57, and LMP7 expression through hypermethylation of the promoters or other mechanisms may contribute to mechanisms of tumor escape from immune surveillance in Kazakh

  19. Panic Disorder is Associated with the Serotonin Transporter Gene (SLC6A4) But Not the Promoter Region (5-HTTLPR)

    PubMed Central

    Strug, Lisa J.; Suresh, Rathi; Fyer, Abby; Talati, Ardesheer; Adams, Philip B.; Li, Weili; Hodge, Susan E.; Gilliam, T. Conrad; Weissman, Myrna M.

    2008-01-01

    Panic disorder (PD) and social anxiety disorder (SAD) are moderately heritable anxiety disorders. We analyzed five genes, derived from pharmacological or translational mouse models, in a new case-control study of PD and SAD in European Americans: (1) the serotonin transporter (SLC6A4), (2) the serotonin receptor 1A (HTR1A), (3) catechol-o-methyltransferase (COMT), (4) a regulator of g-protein signalling, RGS2, and (5) the gastrin releasing peptide receptor (GRPR). Cases were interviewed using the Schedule for Affective disorders and Schizophrenia (SADS-LA-IV) and were required to have a probable or definite lifetime diagnosis of PD (N = 179), SAD (161) or both (140), with first onset by age 31 and a family history of anxiety. Final diagnoses were determined using the best estimate procedure, blind to genotyping data. Controls were obtained from the NIMH Human Genetics Initiative; only subjects above 25 years of age who screened negative for all psychiatric symptoms were included (N = 470). A total of 45 SNPs were successfully genotyped over the 5 selected genes using Applied Biosystems SNPlex protocol. SLC6A4 provided strong and consistent evidence of association with the PD and PD+SAD groups, with the most significant association in both groups being at rs140701 (χ2=10.72, p=0.001 with PD and χ2=8.59, p=0.003 in the PD+SAD group). This association remained significant after multiple test correction. Those carrying at least one copy of the haplotype A-A-G constructed from rs3794808, rs140701 and rs4583306 have 1.7 times the odds of PD than those without the haplotype (90%CI 1.2-2.3). The SAD only group did not provide evidence of association, suggesting a PD driven association. The findings remained after adjustment for age and sex, and there was no evidence that the association was due to population stratification. The promoter region of the gene, 5-HTTLPR, did not provide any evidence of association, regardless of whether analyzed as a triallelic or biallelic

  20. The dynamics of mobile promoters: Enhanced stability in promoter regions.

    PubMed

    Rabbani, Mahnaz; Wahl, Lindi M

    2016-10-21

    Mobile promoters are emerging as a new class of mobile genetic elements, first identified by examining prokaryote genome sequences, and more recently confirmed by experimental observations in bacteria. Recent datasets have identified over 40,000 putative mobile promoters in sequenced prokaryote genomes, however only one-third of these are in regions of the genome directly upstream from coding sequences, that is, in promoter regions. The presence of many promoter sequences in non-promoter regions is unexplained. Here we develop a general mathematical model for the dynamics of mobile promoters, extending previous work to capture the dynamics both within and outside promoter regions. From this general model, we apply rigorous model selection techniques to identify which parameters are statistically justified in describing the available mobile promoter data, and find best-fit values of these parameters. Our results suggest that high rates of horizontal gene transfer maintain the population of mobile promoters in promoter regions, and that once established at these sites, mobile promoters are rarely lost, but are commonly copied to other genomic regions. In contrast, mobile promoter copies in non-promoter regions are more numerous and more volatile, experiencing substantially higher rates of duplication, loss and diversification. PMID:27460588

  1. Haplotypes in the promoter region of the CIDEC gene associated with growth traits in Nanyang cattle

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Cell death-inducing DFFA-like effector c (CIDEC, also known as Fsp27) has emerged as an important regulator of metabolism associated with lipodystrophy, diabetes, and hepatic steatosis. It is required for unilocular lipid droplet formation and optimal energy storage. The mechanism between this gene ...

  2. Impaired executive control is associated with a variation in the promoter region of the tryptophan hydroxylase 2 gene.

    PubMed

    Reuter, Martin; Ott, Ulrich; Vaitl, Dieter; Hennig, Jürgen

    2007-03-01

    Current models of attention describe attention not as a homogenous entity but as a set of neural networks whose measurement yields a set of three endophenotypes-alerting, orienting, and executive control. Previous findings revealed different neuroanatomical regions for these subsystems, and data from twin studies indicate differences in their heritability. The present study investigated the molecular genetic basis of attention in a sample of 100 healthy subjects. Attention performance was assessed with the attention network test that distinguishes alerting, orienting, and executive control (conflict) using a simple reaction time paradigm with different cues and congruent and incongruent flankers. Two gene loci on candidate genes for cognitive functioning, the functional catechol-O-methyltransferase (COMT) VAL158MET and the tryptophan hydroxylase 2 (TPH2) -703 G/T promoter polymorphism, were tested for possible associations with attention. COMT is involved in the catabolism of dopamine, and TPH is the rate-limiting enzyme for serotonin synthesis. Results showed no effect of the COMT polymorphism on attention performance. However, the TT genotype of TPH2 -03 G/T was significantly associated with more errors (a possible indicator of impaired impulse control; p = .001) and with decreased performance in executive control (p = .001). This single-nucleotide polymorphism on the TPH2 gene explained more than 10% of the variance in both indicators of attention stressing the role of the serotonergic system for cognitive functions.

  3. Effects of genetic variants in the promoter region of the bovine adiponectin (ADIPOQ) gene on marbling of Hanwoo beef cattle.

    PubMed

    Choi, Yoonjeong; Davis, Michael E; Chung, Hoyoung

    2015-07-01

    This study aimed to verify genetic effects of the bovine adiponectin (ADIPOQ) gene on carcass traits of Hanwoo cattle. The measured carcass traits were marbling score (MAR), backfat thickness (BFT), loineye area (LEA), and carcass weight (CAW). Selection of primers was based on the bovine ADIPOQ sequence, and the analysis amplified approximately 267 and 333 bp genomic segments, including 67 bp of insertions in the promoter region. Sequencing analysis confirmed genetic variants (g.81966235C>T, g.81966377T>C, and g.81966364D>I) that showed significant effects on MAR. The present results suggest that the identified SNPs are useful genetic markers for the improvement of carcass traits in Hanwoo cattle.

  4. Prevention of Liver Fibrosis by Triple Helix-Forming Oligodeoxyribonucleotides Targeted to the Promoter Region of Type I Collagen Gene

    PubMed Central

    Koilan, Subramaniyan; Hamilton, David; Baburyan, Narina; Padala, Mythili K.; Weber, Karl T.

    2010-01-01

    Hepatic fibrosis leading to cirrhosis remains a global health problem. The most common etiologies are alcoholism and viral infections. Liver fibrosis is associated with major changes in both quantity and composition of extracellular matix and leads to disorganization of the liver architecture and irreversible damage to the liver function. As of now there is no effective therapy to control fibrosis. The end product of fibrosis is abnormal synthesis and accumulation of type I collagen in the extracellular matrix, which is produced by activated stellate or Ito cells in the damaged liver. Therefore, inhibition of transcription of type I collagen should in principle inhibit its production and accumulation in liver. Normally, DNA exists in a duplex form. However, under some circumstances, DNA can assume triple helical (triplex) structures. Intermolecular triplexes, formed by the addition of a sequence-specific third strand to the major groove of the duplex DNA, have the potential to serve as selective gene regulators. Earlier, we demonstrated efficient triplex formation between the exogenously added triplex-forming oligodeoxyribonucleotides (TFOs) and a specific sequence in the promoter region of the COL1A1 gene. In this study we used a rat model of liver fibrosis, induced by dimethylnitrosamine, to test whether these TFOs prevent liver fibrosis. Our results indicate that both the 25-mer and 18-mer TFOs, specific for the upstream nucleotide sequence from −141 to −165 (relative to the transcription start site) in the 5′ end of collagen gene promoter, effectively prevented accumulation of liver collagen and fibrosis. We also observed improvement in liver function tests. However, mutations in the TFO that eliminated formation of triplexes are ineffective in preventing fibrosis. We believe that these TFOs can be used as potential antifibrotic therapeutic molecules. PMID:20818932

  5. Cell-specific transcriptional regulation and reactivation of galectin-1 gene expression are controlled by DNA methylation of the promoter region.

    PubMed Central

    Benvenuto, G; Carpentieri, M L; Salvatore, P; Cindolo, L; Bruni, C B; Chiariotti, L

    1996-01-01

    The galectin-1 gene is developmentally regulated gene whose activity is strongly modulated during cell differentiation and transformation. We have previously shown that galectin-1 promoter constructs are highly active when transiently transfected in cells both expressing and not expressing the endogenous gene and that the basal activity is determined by a small region encompassing the transcription start site (from positions -50 to +50). We have now investigated the role of DNA methylation in galectin-1 gene expression. Southern blot analysis with HpaII and MspI endonucleases and sodium bisulfite analysis of genomic DNA from expressing and nonexpressing cell lines and cell hybrids showed a close correlation between gene activity and demethylation of the 5' region of the galectin-1 gene. We found that the galectin-1 promoter region is fully methylated, at every CpG site on both strands, in nonexpressing differentiated rat liver (FAO) and thyroid (PC C13) cells and unmethylated in the expressing undifferentiated liver (BRL3A) and thyroid transformed (PC myc/raf) cell lines. In addition, reactivation of the silent FAO alleles in FAO-human osteosarcoma (143tk-) hybrid cells is accompanied by a complete demethylation of the promoter region. Finally, when galectin-1 chloramphenicol acetyltransferase (CAT) promoter constructs were methylated in vitro by SssI methylase at every cytosine residue of the CpG doublets and transfected into mouse fibroblasts, the transcription of the CAT reporter gene was strongly inhibited. PMID:8649381

  6. Genome-Wide Anaplasma phagocytophilum AnkA-DNA Interactions Are Enriched in Intergenic Regions and Gene Promoters and Correlate with Infection-Induced Differential Gene Expression

    PubMed Central

    Dumler, J. Stephen; Sinclair, Sara H.; Pappas-Brown, Valeria; Shetty, Amol C.

    2016-01-01

    Anaplasma phagocytophilum, an obligate intracellular prokaryote, infects neutrophils, and alters cardinal functions via reprogrammed transcription. Large contiguous regions of neutrophil chromosomes are differentially expressed during infection. Secreted A. phagocytophilum effector AnkA transits into the neutrophil or granulocyte nucleus to complex with DNA in heterochromatin across all chromosomes. AnkA binds to gene promoters to dampen cis-transcription and also has features of matrix attachment region (MAR)-binding proteins that regulate three-dimensional chromatin architecture and coordinate transcriptional programs encoded in topologically-associated chromatin domains. We hypothesize that identification of additional AnkA binding sites will better delineate how A. phagocytophilum infection results in reprogramming of the neutrophil genome. Using AnkA-binding ChIP-seq, we showed that AnkA binds broadly throughout all chromosomes in a reproducible pattern, especially at: (i) intergenic regions predicted to be MARs; (ii) within predicted lamina-associated domains; and (iii) at promoters ≤ 3000 bp upstream of transcriptional start sites. These findings provide genome-wide support for AnkA as a regulator of cis-gene transcription. Moreover, the dominant mark of AnkA in distal intergenic regions known to be AT-enriched, coupled with frequent enrichment in the nuclear lamina, provides strong support for its role as a MAR-binding protein and genome “re-organizer.” AnkA must be considered a prime candidate to promote neutrophil reprogramming and subsequent functional changes that belie improved microbial fitness and pathogenicity. PMID:27703927

  7. Microsatellite polymorphism in the P1 promoter region of the IGF-1 gene is associated with endometrial cancer

    PubMed Central

    KWASNIEWSKI, WOJCIECH; GOZDZICKA-JOZEFIAK, ANNA; WOLUN-CHOLEWA, MARIA; POLAK, GRZEGORZ; SIEROCINSKA-SAWA, JADWIGA; KWASNIEWSKA, ANNA; KOTARSKI, JAN

    2016-01-01

    Endometrial carcinoma (EC) is the most common type of gynecological malignancy. Studies have demonstrated that the insulin growth factor (IGF) pathway is implicated in the development of endometrial tumors and that the serum levels of IGF-1 are affected by estrogen. Most EC cells with high microsatellite instability (MSI-H) accumulate mutations at a microsatellite sequence in the IGF-1 gene. The present study investigated the CA repeat polymorphism in the P1 promoter region of the IGF-1 gene among Caucasian females with endometrial hyperplasia, EC and healthy control subjects, whose blood serum and surgical tissue specimens were analyzed. Differences or correlations between the analyzed parameters [serum levels of IGF-1 and IGF binding protein (IGFBP)-1 and IGFBP-3 as well as estrogens among the polymorphisms] were verified using the χ2, Mann-Whitney U, Kruskal-Wallis or Spearman's rank correlation tests. A PCR amplification and DNA sequencing analysis was used for identification of (CA)n repeats in the P1 region of IGF-1. ELISA was used to determine the blood serum levels of IGF-1, IGFBP-1, IGFBP-3 and estrogens. Furthermore, IGF-1 was assessed in endometrial tissues by immunohistochemical analysis. The present study indicated no statistically significant differences between serum levels of IGF-1, IGFBP-1, IGFBP-3 and estrone, estriol and estradiol in the control and study groups. A significant correlation was identified between the IGF-1 levels and estrone levels in the MSI-H polymorphism (r=−0.41, P=0.012) as well as a highly negative correlation between IGF-1 levels and the estradiol levels in the MSI-H polymorphism (r=−0.6, P=0.002). Genotypes without the 19 CA allele were predominantly found in EC. Furthermore, statistical analysis indicated that the number of IGF-1-expressing cells was significantly elevated in MSI-H type 18-20 (P= 0.0072), MSI-L type 19-20 (P=0.025) and microsatellite-stable MSS type 19-19 (P=0.024) compared with those in the MSI-H 20

  8. Transcription factor AP1 binds the functional region of the promoter and regulates gene expression of human PPARdelta in LoVo cell.

    PubMed

    Jiang, Xiaogang; Yang, Xudong; Han, Yan; Lu, Shemin

    2013-12-01

    Peroxisome proliferator-activated receptor δ gene (PPARδ) is correlated with carcinogenesis of colorectal cancer, but the regulation of its gene transcription remains unclear. We herein report that AP1 binds the promoter and regulates PPARδ gene expression. With a luciferase reporter system, we identified a functional promoter region of 30 bp of PPARδ gene by deletion and electrophoretic mobility shift assays (EMSA). Using site-directed mutagenesis and decoy analyses, we demonstrated that AP1 bound the functional transcriptional factor binding site in a region extending from -176 to -73 of the PPARδ promoter, which was confirmed using EMSA and supershift assays. Consequently, inhibition of the AP1 binding site led to decreased PPARδ mRNA. Our study demonstrated that AP1 is the transcriptional factor that contributes to PPARδ expression in LoVo cells.

  9. Protein-DNA interactions in the promoter region of the amyloid precursor protein (APP) gene in human neocortex.

    PubMed

    Lukiw, W J; Rogaev, E I; Wong, L; Vaula, G; McLachlan, D R; St George Hyslop, P

    1994-03-01

    We have investigated protein-DNA interactions in the proximal promoter of the human amyloid precursor protein (APP) gene in temporal lobe neocortical nuclei isolated from control and Alzheimer disease (AD) affected brains. We report that the human APP 5' promoter sequence from -203 to +55 bp, which has been previously reported to contain essential regulatory elements for APP gene transcription, lies in a deoxyribonuclease I, micrococcal nuclease- and restriction endonuclease-sensitive, G+C-rich nucleosome-free gap flanked both 5' and 3' by typical nucleosome structures. As analyzed by electrophoretic mobility shift assay, this extended internucleosomal linker DNA is heavily occupied by nuclear protein factors, and interacts differentially with nuclear protein extracts obtained from HeLa and human brain neocortical nuclei. This suggests that the chromatin conformation of the APP gene promoter may vary in different cell types, and may correlate with differences in APP gene expression. Human recombinant transcription factors AP1, SP1 and TFIID (but not AP2 or brain histones H1, H2B and H4) interact with the -203 to +55 bp of the human APP promoter sequence. Only minor differences were observed in the chromatin structure of the immediate APP promoter between non-AD and AD affected neocortical nuclei, suggesting either that post-transcriptional processes, or that regulatory elements lying elsewhere in the APP gene may be important in the aberrant accumulation of the APP gene product.

  10. Contribution of individual promoters in the ddlB-ftsZ region to the transcription of the essential cell-division gene ftsZ in Escherichia coli.

    PubMed

    Flärdh, K; Garrido, T; Vicente, M

    1997-06-01

    The essential cell-division gene ftsZ is transcribed in Escherichia coli from at least six promoters found within the coding regions of the upstream ddlB, ftsQ, and ftsA genes. The contribution of each one to the final yield of ftsZ transcription has been estimated using transcriptional lacZ fusions. The most proximal promoter, ftsZ2p, contributes less than 5% of the total transcription from the region that reaches ftsZ. The ftsZ4p and ftsZ3p promoters, both located inside ftsA, produce almost 37% of the transcription. An ftsAp promoter within the ftsQ gene yields nearly 12% of total transcription from the region. A large proportion of transcription (approximately 46%) derives from promoters ftsQ2p and ftsQ1p, which are located inside the upstream ddlB gene. Thus, the ftsQAZ genes are to a large extent transcribed as a polycistronic mRNA. However, we find that the ftsZ proximal region is necessary for full expression, which is in agreement with a recent report that mRNA cleavage by RNase E at the end of the ftsA cistron has a significant role in the contol of ftsZ expression.

  11. Analysis of genes negatively regulated by phytochrome action in Lemna gibba and identification of a promoter region required for phytochrome responsiveness.

    PubMed Central

    Okubara, P A; Williams, S A; Doxsee, R A; Tobin, E M

    1993-01-01

    As a step to understanding how the photoreceptor phytochrome acts to change the transcription of specific nuclear genes in Lemna gibba, we wish to compare promoter elements involved in negative regulation by phytochrome with those involved in positive regulation. We have isolated three genes negatively regulated by phytochrome, designated NR (negatively phytochrome regulated) genes (P.A. Okubara, E.M. Tobin [1991] Plant Physiol 96:1237-1245), and we have now sequenced two of these. The promoters of both contain some sequence motifs that are identical with motifs from other genes. We used a transient assay in L. gibba to demonstrate that approximately 1.7 kb pairs of the NPR1 promoter and 1.1 kb pairs of the NPR2 promoter could confer negative phytochrome regulation to a luciferase reporter gene. Deletion analysis of the NPR2 promoter showed that sequences between -208 and -82 from the transcription start were necessary for negative phytochrome regulation. However, this region was not sufficient to confer negative regulation by phytochrome to another promoter. Additionally, we noted that this region showed no similarity to a region identified as important for the negative regulation of the oat phyA promoter (W.B. Bruce, X.-W. Deng, P.H. Quail [1991] EMBO J 10:3015-3024), but it does contain a sequence element found in several other kinds of genes, including ones positively regulated by phytochrome. The deduced amino acid sequences of NPR1 and NPR2 were found to share similarities with many abscisic acid-induced or seed-abundant proteins. Thus, these genes, like other phytochrome-regulated genes, might respond to multiple regulatory signals. PMID:8310060

  12. Root-specific expression of a western white pine PR10 gene is mediated by different promoter regions in transgenic tobacco.

    PubMed

    Liu, Jun-Jun; Ekramoddoullah, Abul K M

    2003-05-01

    We report here the isolation and characterization of a novel PR10 gene, PmPR10-1.14, from western white pine (Pinus monticola Dougl. ex. D. Don). The PmPR10-1.14 gene encodes a polypeptide exhibiting high similarity with other members of the PR10 family and corresponds to one of six isoforms immunodetected in the roots of western white pine. Northern blot and western immunoblot analyses showed that expression of the PR10 gene family, including PmPR10-1.14, was detected in vegetative tissues constitutively, but not in developing reproductive organs. RT-PCR with gene-specific primers showed that the transcript of PmPR10-1.14 gene was found only in lateral roots and needles during growth. To study PR10 gene regulation at the cellular level, PmPR10-1.14 promoter was fused to the beta-glucuronidase (GUS) report gene, and analyzed for transient and stable gene expression. The transient expression assays in agroinfiltrated tobacco leaves indicated that the core promoter of PmPR10-1.14 gene resided in the sequence from -101 to +69 relative to the first nucleotide of PR10 cDNA. Furthermore, the promoter region from -311 to -101 acted as an enhancer, and the region from -506 to -311 as a silencer. Fluorometric GUS assays of transgenic tobacco plants demonstrated that the longest promoter of 1675 bp directed GUS expression constitutively at high levels in the roots of mature plants, but expression levels were too low to be detectable in other organs in histochemical assays. Histochemical localization analysis showed that PmPR10-1.14 promoter directed a tissue-specific expression exclusively during the initiation and development of the lateral roots. The distal 5' deletion of the promoter to -311 did not decrease the expression level significantly in the roots, suggesting that the cis-regulatory elements necessary for a high level of gene expression reside in the proximal fragment from -311 to +69. As one striking feature, PmPR10-1.14 promoter contains two copies of direct

  13. The intergenic region of the maize defensin-like protein genes Def1 and Def2 functions as an embryo-specific asymmetric bidirectional promoter.

    PubMed

    Liu, Xiaoqing; Yang, Wenzhu; Li, Ye; Li, Suzhen; Zhou, Xiaojin; Zhao, Qianqian; Fan, Yunliu; Lin, Min; Chen, Rumei

    2016-07-01

    Bidirectional promoters are identified in diverse organisms with widely varied genome sizes, including bacteria, yeast, mammals, and plants. However, little research has been done on any individual endogenous bidirectional promoter from plants. Here, we describe a promoter positioned in the intergenic region of two defensin-like protein genes, Def1 and Def2 in maize (Zea mays). We examined the expression profiles of Def1 and Def2 in 14 maize tissues by qRT-PCR, and the results showed that this gene pair was expressed abundantly and specifically in seeds. When fused to either green fluorescent protein (GFP) or β-glucuronidase (GUS) reporter genes, P ZmBD1 , P ZmDef1 , and P ZmDef2 were active and reproduced the expression patterns of both Def1 and Def2 genes in transformed immature maize embryos, as well as in developing seeds of transgenic maize. Comparative analysis revealed that PZmBD1 shared most of the expression characteristics of the two polar promoters, but displayed more stringent embryo specificity, delayed expression initiation, and asymmetric promoter activity. Moreover, a truncated promoter study revealed that the core promoters only exhibit basic bidirectional activity, while interacting with necessary cis-elements, which leads to polarity and different strengths. The sophisticated interaction or counteraction between the core promoter and cis-elements may potentially regulate bidirectional promoters. PMID:27279278

  14. Thyroid hormones directly activate the expression of the human and mouse uncoupling protein-3 genes through a thyroid response element in the proximal promoter region

    PubMed Central

    2004-01-01

    The transcription of the human UCP3 (uncoupling protein-3) gene in skeletal muscle is tightly regulated by metabolic signals related to fatty acid availability. However, changes in thyroid status also modulate UCP3 gene expression, albeit by unknown mechanisms. We created transgenic mice bearing the entire human UCP3 gene to investigate the effect of thyroid hormones on human UCP3 gene expression. Treatment of human UCP3 transgenic mice with thyroid hormones induced the expression of the human gene in skeletal muscle. In addition, transient transfection experiments demonstrate that thyroid hormones activate the transcription of the human UCP3 gene promoter when MyoD and the TR (thyroid hormone receptor) were co-transfected. The action of thyroid hormones on UCP3 gene transcription is mediated by the binding of the TR to a proximal region in the UCP3 gene promoter that contains a direct repeat structure. An intact DNA sequence of this site is required for thyroid hormone responsiveness and TR binding. Chromatin immunoprecipitation assays revealed that the TR binds this element in vivo. The murine Ucp3 gene promoter was also dependent on MyoD and responsive to thyroid hormone in transient transfection assays. However, it was much less sensitive to thyroid hormone than the human UCP3 promoter. In summary, UCP3 gene transcription is activated by thyroid hormone treatment in vivo, and this activation is mediated by a TRE (thyroid hormone response element) in the proximal promoter region. Such regulation suggests a link between UCP3 gene expression and the effects of thyroid hormone on mitochondrial function in skeletal muscle. PMID:15496137

  15. Identification of cis-acting regulatory elements in the promoter region of the rat brain creatine kinase gene.

    PubMed Central

    Hobson, G M; Molloy, G R; Benfield, P A

    1990-01-01

    The functional organization of the rat brain creatine kinase (ckb) promoter was analyzed by deletion, linker scanning, and substitution mutagenesis. Mutations were introduced into the ckb promoter of hybrid ckb/neo (neomycin resistance gene) genes, and the mutant genes were expressed transiently in HeLa cells. Expression was assayed by primer extension analysis of neo RNA, which allowed the transcription start sites and the amount of transcription to be determined. Transfections and primer extension reactions were internally controlled by simultaneous analysis of transcription from the adenovirus VA gene located on the same plasmid as the hybrid ckb/neo gene. We demonstrate that 195 bp of the ckb promoter is sufficient for efficient in vivo expression in HeLa cells. A nonconsensus TTAA element at -28 bp appears to provide the TATA box function for the ckb promoter in vivo. Two CCAAT elements, one at -84 bp and the other at -54 bp, and a TATAAA TA element (a consensus TATA box sequence) at -66 bp are required for efficient transcription from the TTAA element. In addition, we present evidence that the consensus beta-globin TATA box responds to the TATAAATA element in the same way as the ckb nonconsensus TTAA element. Images PMID:2247071

  16. Molecular and functional characterization of the promoter region of the mouse LDH/C gene: enhancer-assisted, Sp1-mediated transcriptional activation.

    PubMed Central

    Yang, J; Thomas, K

    1997-01-01

    Molecular and functional studies of the LDH/C 5' upstream promoter elements were undertaken to elucidate the molecular mechanisms involved in temporal activation of LDH/C gene expression in differentiating germ cells. Ligation mediated-PCR (LM-PCR) gene walking techniques were exploited to isolate a 2.1 kb fragment of the mouse LDH/C 5' promoter region. DNA sequence analysis of this isolated genomic fragment indicated that the mouse LDH/C promoter contained TATA and CCAT boxes as well as a GC-box (Sp1-binding site) situated upstream from the transcription start site. PCR-based in vivo DNase I footprinting analysis of a 600 bp fragment of the proximal LDH/C promoter region (-524/+38) in isolated mouse pachytene spermatocytes identified a single footprint over the GC-box motif. Three DNase I hypersensitive sites were also detectable in vivo, in a region containing (CT)n(GA)n repeats upstream from the CCAT box domain. Functional characterization of the promoter region was carried out in a rat C6 glioma cell line and an SV40 transformed germ cell line (GC-1 spg) using wild-type and mutated LDH/C promoter CAT reporter constructs. These studies provide experimental evidence suggesting that transcriptional activation of the LDH/C promoter is regulated by enhancer-mediated coactivation of the Sp1 proteins bound to the GC-box motif footprinted in vivo in pachytene spermatocytes. PMID:9153323

  17. Primate segmental duplication creates novel promoters for the LRRC37 gene family within the 17q21.31 inversion polymorphism region

    PubMed Central

    Bekpen, Cemalettin; Tastekin, Ibrahim; Siswara, Priscillia; Akdis, Cezmi A.; Eichler, Evan E.

    2012-01-01

    The LRRC37 gene family maps to a complex region of the human genome and has been subjected to multiple rounds of segmental duplication. We investigate the expression and regulation of this gene family in multiple tissues and organisms and show a testis-specific expression of this gene family in mouse but a more ubiquitous pattern of expression among primates. Evolutionary and phylogenetic analyses support a model in which new alternative promoters have been acquired during primate evolution. We identify two promoters, Cl8 and particularly Cl3, both of which are highly active in the cerebellum and fetal brain in human and have been duplicated from a promoter region of two unrelated genes, BPTF and DND1, respectively. Two of these more broadly expressed gene family members, LRRC37A1 and A4, define the boundary of a common human inversion polymorphism mapping to chromosome 17q21.31 (the MAPT locus)—a region associated with risk for frontal temporal dementia, Parkinsonism, and intellectual disability. We propose that the regulation of the LRRC37 family occurred in a stepwise manner, acquiring foreign promoters from BPTF and DND1 via segmental duplication. This unusual evolutionary trajectory altered the regulation of the LRRC37 family, leading to increased expression in the fetal brain and cerebellum. PMID:22419166

  18. Characterization of various promoter regions of the human DNA helicase-encoding genes and identification of duplicated ets (GGAA) motifs as an essential transcription regulatory element.

    PubMed

    Uchiumi, Fumiaki; Watanabe, Takeshi; Tanuma, Sei-ichi

    2010-05-15

    DNA helicases are important in the regulation of DNA transaction and thereby various cellular functions. In this study, we developed a cost-effective multiple DNA transfection assay with DEAE-dextran reagent and analyzed the promoter activities of the human DNA helicases. The 5'-flanking regions of the human DNA helicase-encoding genes were isolated and subcloned into luciferase (Luc) expression plasmids. They were coated onto 96-well plate and used for co-transfection with a renilla-Luc expression vector into various cells, and dual-Luc assays were performed. The profiles of promoter activities were dependent on cell lines used. Among these human DNA helicase genes, XPB, RecQL5, and RTEL promoters were activated during TPA-induced HL-60 cell differentiation. Interestingly, duplicated ets (GGAA) elements are commonly located around the transcription start sites of these genes. The duplicated GGAA motifs are also found in the promoters of DNA replication/repair synthesis factor genes including PARG, ATR, TERC, and Rb1. Mutation analyses suggested that the duplicated GGAA-motifs are necessary for the basal promoter activity in various cells and some of them positively respond to TPA in HL-60 cells. TPA-induced response of 44-bp in the RTEL promoter was attenuated by co-transfection of the PU.1 expression vector. These findings suggest that the duplicated ets motifs regulate DNA-repair associated gene expressions during macrophage-like differentiation of HL-60 cells.

  19. Promoter regions of the extA extensin gene from Brassica napus control activation in response to wounding and tensile stress.

    PubMed

    Elliott, K A; Shirsat, A H

    1998-07-01

    To identify controlling cis acting promoter regions in the B. napus extA extensin gene, expression in transgenic tobacco of 5' - 159, -433, -664, -789 and -940 bp promoter truncations linked to the uidA (B-glucuronidase) reporter coding sequence were analysed. The - 159 and -433 bp truncations directed non specific expression in all cell types within the plant. An activator region which increased expression levels 10 fold in all cell types was located between - 159 to -433 bp. A repressor region was found between -664 to -789 bp; removal of this region resulted in a 15 fold increase in expression. Histochemical analysis showed that transgenics containing the -664, -789 and -940 bp truncations directed expression of the fusion gene only in the phloem. A negative regulatory region located between -433 to -664 bp repressed expression in non-phloem cell types. In areas of the plant subject to tensile stress, the repression exerted by the negative regulatory region was overcome, allowing expression in all cell types. The quantitative repressor and activator regions which controlled absolute expression levels in all cell types were separate from the negative regulatory region which controlled cell type specific expression in response to tensile stress. A wound responsive region was found to be located between -940 to -3500 bp. Thus, the extA gene is under complex control, being regulated by 4 sets of positively and negatively acting cis regions, which control wound inducibility, activation in response to tensile stress, and quantitative expression levels. PMID:9687071

  20. Glial fibrillary acidic protein gene promoter is differently modulated by transforming growth factor-beta 1 in astrocytes from distinct brain regions.

    PubMed

    Sousa, Vivian de Oliveira; Romão, Luciana; Neto, Vivaldo Moura; Gomes, Flávia Carvalho Alcantara

    2004-04-01

    The expression of glial fibrillary acidic protein (GFAP), the major intermediate filament protein of mature astrocytes, is regulated under developmental and pathological conditions. Recently, we have investigated GFAP gene modulation by using a transgenic mouse bearing part of the GFAP gene promoter linked to the beta-galactosidase reporter gene. We demonstrated that cerebral cortex neurons activate the GFAP gene promoter, inducing transforming growth factor-beta 1 (TGF-beta 1) secretion by astrocytes. Here, we report that cortical neurons or conditioned medium derived from them do not activate the GFAP gene promoter of transgenic astrocytes derived from midbrain and cerebellum suggesting a neuroanatomical regional specificity of this phenomenon. Surprisingly, they do induce synthesis of TGF-beta 1 by these cells. Western blot and immunocytochemistry assays revealed wild distribution of TGF receptor in all subpopulations of astrocytes and expression of TGF-beta 1 in neurons derived from all regions, thus indicating that the unresponsiveness of the cerebellar and midbrain GFAP gene to TGF-beta 1 is not due to a defect in TGF-beta 1 signalling. Together, our data highlight the great complexity of neuron-glia interactions and might suggest a distinct mechanism underlying modulation of the GFAP gene in the heterogeneous population of astrocytes throughout the central nervous system.

  1. Specific interactions between transcription factors and the promoter-regulatory region of the human cytomegalovirus major immediate-early gene

    SciTech Connect

    Ghazal, P.; Lubon, H.; Hennighausen, L. )

    1988-03-01

    Repeat sequence motifs as well as unique sequences between nucleotides {minus}150 and {minus}22 of the human cytomegalovirus immediate-early 1 gene interact in vitro with nuclear proteins. The authors show that a transcriptional element between nucleotides {minus}91 and {minus}65 stimulated promoter activity in vivo and in vitro by binding specific cellular transcription factors. Finally, a common sequence motif, (T)TGG/AC, present in 15 of the determined binding sites suggests a particular class of nuclear factors associated with the immediate-early 1 gene.

  2. In vivo protein binding sites and nuclease hypersensitivity in the promoter region of a cell cycle regulated human H3 histone gene.

    PubMed Central

    Pauli, U; Chrysogelos, S; Nick, H; Stein, G; Stein, J

    1989-01-01

    The chromatin structure and protein-DNA interactions of a cell cycle regulated human H3 histone gene have been examined at different levels of resolution. Using traditional Southern blot analysis we have investigated the accessibility of the H3 coding region and its flanking sequences to DNase I, S1 nuclease and restriction endonuclease digestion. Using the native genomic blotting method recently developed in our laboratory, two sites of protein-DNA interaction in the proximal 240 bp of the promoter region of this H3 gene were established. Further in vivo analysis of protein-DNA binding sites in intact cells by genomic sequencing revealed, with single nucleotide resolution, the guanine contacts and footprints of the proteins bound to the promoter. The relative locations of protein-DNA interactions in this H3 gene are similar to those identified in vivo and in vitro in a cell cycle dependent human H4 histone gene. The proteins complexed with the H3 histone gene promoter can be dissociated between 0.16 and 0.28 M NaCl. The protein-DNA contacts persist throughout the cell cycle and thus may have a functional relationship with the basal level of transcription of this H3 gene that occurs during and outside of S phase. Images PMID:2539585

  3. [Interaction of negative (CytT) and positive (cAMP-CRP) regulation in the promoter region of the uridine phosphorylase (udp) gene in Escherichia coli K-12].

    PubMed

    Mironov, A S; Nechaeva, G D; Sukhodolets, V V

    1989-03-01

    Interaction of negative (CytR) and positive (cAMP-CRP) control in the promoter region of the uridine phosphorylase (udp) gene of Escherichia coli has been studied by using udp-lac operon fusions in which the structural lacZ gene is expressed from the wild type promoter udpP+ or from mutant promoters udpP1 and udpP18. The specific activity of beta-galactosidase was examined in these fusions in cytR+ and cytR- backgrounds after introduction of specific mutations in crp locus, crp* and crp(a) altering interaction of CRP protein with catabolite-sensitive promoters. The data obtained using crp* mutation confirm the proposed model of the udp gene regulation, according to which CytR repressor protein interferes with CRP binding site in the promoter-operator region of the udp gene and thereby prevents the positive action of cAMP-CRP complex on the udp expression. Additional data in favor of this model were obtained using crp(a) mutation which most probably alters the structure of CRP protein in such a way that it exhibits more high affinity to the udp promoter, as compared to the CytR repressor protein. Indeed, taken by itself, the crp(a) mutation did not lead to any increase in the expression of udpP+-lac fusion under the conditions of cAMP limitation (on glucose-grown cells), in spite of whether or not the CytR repressor was present. However, when combined with the ptsG mutation or when cells were grown on succinate medium, complete constitutive expression of udpP+-lac fusion is observed, even in the presence of the cytR gene product. The effect of the crp(a) mutation was virtually the same in strains harboring udpP1-lac fusion. These data are in accordance with suggestion that udpP1 is a mutation in the site of the promoter-operator region that responds to the cytR gene product, while the corresponding binding site for CRP protein is still unaltered in this mutant. On the other hand, the crp(a) mutation causes only slight alteration in the expression of udpP18-lac

  4. 3-Methylcholanthrene elicits DNA adduct formation in the CYP1A1 promoter region and attenuates reporter gene expression in rat H4IIE cells

    SciTech Connect

    Moorthy, Bhagavatula . E-mail: bmoorthy@bcm.tmc.edu; Muthiah, Kathirvel; Fazili, Inayat S.; Kondraganti, Sudha R.; Wang Lihua; Couroucli, Xanthi I.; Jiang Weiwu

    2007-03-23

    Cytochrome CYP1A (CYP1A) enzymes catalyze bioactivation of 3-methylcholanthrene (MC) to genotoxic metabolites. Here, we tested the hypothesis that CYP1A2 catalyzes formation of MC-DNA adducts that are preferentially formed in the promoter region of CYP1A1, resulting in modulation of CYP1A1 gene expression. MC bound covalently to plasmid DNA (50 {mu}g) containing human CYP1A1 promoter (pGL3-1A1), when incubated with wild-type (WT) liver microsomes (2 mg) and NAPPH 37 {sup o}C for 2 h, giving rise to 9 adducts, as determined by {sup 32}P-postlabeling. Eighty percent of adducts was located in the promoter region. Transient transfection of the adducted plasmids into rat hepatoma (H4IIE) cells for 16 h, followed by MC (1 {mu}M) treatment for 24 h inhibited reporter (luciferase) gene expression by 75%, compared to unadducted controls. Our results suggest that CYP1A2 plays a key role in sequence-specific MC-DNA adduct formation in the CYP1A1 promoter region, leading to attenuation of CYP1A1 gene expression.

  5. An atpE-specific promoter within the coding region of the atpB gene in tobacco chloroplast DNA.

    PubMed

    Kapoor, S; Wakasugi, T; Deno, H; Sugiura, M

    1994-09-01

    The atpB and atpE genes encode beta and epsilon subunits, respectively, of chloroplast ATP synthase and are co-transcribed in the plant species so far studied. In tobacco, an atpB gene-specific probe hybridizes to 2.7- and 2.3-kb transcripts. In addition to these, a probe from the atpE coding region hybridizes also to a 1.0-kb transcript. The 5' end of the atpE-specific transcript has been mapped 430/431 nt upstream of the atpE translation initiation site, within the coding region of the atpB gene. In-vitro capping revealed that this transcript results from a primary transcriptional event and is also characterized by -10 and -35 canonical sequences in the 5' region. It has been found to share a common 3' end with the bi-cistronic transcripts that has been mapped within the coding region of the divergently transcribed trnM gene, approximately 236 nt downstream from the atpE termination codon. Interestingly, this transcript accumulates only in leaves and not in proplastid-containing cultured (BY-2) cells, indicating that, unless it is preferentially degraded in BY-2 cells, its expression might be transcriptionally controlled.

  6. Cloning of the complete gene for carcinoembryonic antigen: analysis of its promoter indicates a region conveying cell type-specific expression.

    PubMed Central

    Schrewe, H; Thompson, J; Bona, M; Hefta, L J; Maruya, A; Hassauer, M; Shively, J E; von Kleist, S; Zimmermann, W

    1990-01-01

    Carcinoembryonic antigen (CEA) is a widely used tumor marker, especially in the surveillance of colonic cancer patients. Although CEA is also present in some normal tissues, it is apparently expressed at higher levels in tumorous tissues than in corresponding normal tissues. As a first step toward analyzing the regulation of expression of CEA at the transcriptional level, we have isolated and characterized a cosmid clone (cosCEA1), which contains the entire coding region of the CEA gene. A close correlation exists between the exon and deduced immunoglobulin-like domain borders. We have determined a cluster of transcriptional starts for CEA and the closely related nonspecific cross-reacting antigen (NCA) gene and have sequenced their putative promoters. Regions of sequence homology are found as far as approximately 500 nucleotides upstream from the translational starts of these genes, but farther upstream they diverge completely. In both cases we were unable to find classic TATA or CAAT boxes at their expected positions. To characterize the CEA and NCA promoters, we carried out transient transfection assays with promoter-indicator gene constructs in the CEA-producing adenocarcinoma cell line SW403, as well as in nonproducing HeLa cells. A CEA gene promoter construct, containing approximately 400 nucleotides upstream from the translational start, showed nine times higher activity in the SW403 than in the HeLa cell line. This indicates that cis-acting sequences which convey cell type-specific expression of the CEA gene are contained within this region. Images PMID:2342461

  7. 5′-Untranslated Region of the Tryptophan Hydroxylase-2 Gene Harbors an Asymmetric Bidirectional Promoter but not Internal Ribosome Entry Site in vitro

    PubMed Central

    Chen, Guo-Lin; Miller, Gregory M.

    2009-01-01

    Tryptophan hydroxylase-2 (TPH2) catalyzes the synthesis of neuronal serotonin, a major neurotransmitter involved in many brain functions and psychiatric disorders. We have previously revealed a critical role of the human TPH2 (hTPH2) 5′-UTR in gene expression regulation. This study aimed to further characterize mechanism(s) by which the hTPH2 5′-UTR regulates gene expression. An internal ribosome entry site (IRES) activity in hTPH2 5′-UTR was suggested by the conventional bicistronic reporter assay; however, further stringent experiments, including in vitro translation, quantitative real-time PCR, Northern blot, ribonuclease protection assay, and monocistronic reporter assay, demonstrated that the hTPH2 5′-UTR harbors a bidirectional promoter, but not IRES, within its downstream segment (61~141). The antisense promoter is much stronger than the sense promoter, but the strength of both promoters are cell-line dependent, with the highest and lowest activities being observed in HEK-293T and SK-N-MC cells, respectively. In accordance with our previous findings, the upstream segment (1~60) of hTPH2 5′-UTR suppresses the neighboring promoter of both direction, independent of the cell line and its location in the 5′- or 3′-flanking regions of the gene. In summary, this study demonstrates that no IRES but an asymmetric bidirectional promoter is present in the downstream segment of hTPH2 5′-UTR, and this promoter is susceptible to a gene silencing effect caused by the upstream segment (1~60) of hTPH2 5′-UTR. Our findings point to the potential involvement of antisense transcription and non-coding RNA in the regulation of TPH2 gene expression. PMID:19344641

  8. Characterization of the cis elements in the proximal promoter regions of the anthocyanin pathway genes reveals a common regulatory logic that governs pathway regulation

    PubMed Central

    Zhu, Zhixin; Wang, Hailong; Wang, Yiting; Guan, Shan; Wang, Fang; Tang, Jingyu; Zhang, Ruijuan; Xie, Lulu; Lu, Yingqing

    2015-01-01

    Cellular activities such as compound synthesis often require the transcriptional activation of an entire pathway; however, the molecular mechanisms underlying pathway activation have rarely been explained. Here, the cis regulatory architecture of the anthocyanin pathway genes targeted by the transcription factor (TF) complex including MYB, bHLH, and WDR was systematically analysed in one species and the findings extended to others. In Ipomoea purpurea, the IpMYB1-IpbHLH2-IpWDR1 (IpMBW) complex was found to be orthologous to the PAP1-GL3-TTG1 (AtPGT) complex of Arabidopsis thaliana, and interacted with a 7-bp MYB-recognizing element (MRE) and a 6-bp bHLH-recognizing element (BRE) at the proximal promoter region of the pathway genes. There was little transcription of the gene in the absence of the MRE or BRE. The cis elements identified experimentally converged on two syntaxes, ANCNNCC for MREs and CACN(A/C/T)(G/T) for BREs, and our bioinformatic analysis showed that these were present within anthocyanin gene promoters in at least 35 species, including both gymnosperms and angiosperms. For the anthocyanin pathway, IpMBW and AtPGT recognized the interspecific promoters of both early and later genes. In A. thaliana, the seed-specific TF complex (TT2, TT8, and TTG1) may regulate all the anthocyanin pathway genes, in addition to the proanthocyanidin-specific BAN. When multiple TF complexes in the anthocyanin pathway were compared, the cis architecture played a role larger than the TF complex in determining the variation in promoter activity. Collectively, a cis logic common to the pathway gene promoters was found, and this logic is essential for the trans factors to regulate the pathway. PMID:25911741

  9. Site-specific base changes in the coding or promoter region of the human beta- and gamma-globin genes by single-stranded oligonucleotides.

    PubMed

    Yin, Wenxuan; Kren, Betsy T; Steer, Clifford J

    2005-08-15

    SSOs (single-stranded oligonucleotides) can mediate site-specific alteration of base-pairs in episomal and chromosomal target genes in mammalian cells. The TNE (targeted nucleotide exchange) can result in either repair or mutation of a gene sequence and is mediated through endogenous DNA repair pathway(s). Thus the approach provides a technique for the treatment of monogenic disorders associated with specific point mutations such as SCD (sickle cell disease). We studied the potential application of SSOs for SCD by introducing either an A to T substitution at the sixth codon of the human beta-globin gene (sickle locus) or a C to G mutation at -202 of the Ggamma-globin gene promoter region. The latter TNE is an alternative strategy to ameliorate the clinical manifestations of sickle cell anaemia by re-activating fetal haemoglobin gene expression in adult erythrocytes. A sensitive and valid PCR assay system was developed, which allows detection of point mutations as low as 0.01% at these sites. Using this system, TNE between 0.01 and 0.1% at the sickle locus or gamma-globin gene promoter region was detected after transfection with SSOs in cultured human cell lines. TNE in the Ggamma-globin promoter region exhibited varying degrees of strand bias that was dependent on SSO design and the cell's DNA mismatch repair activity. The results suggest that the endogenous DNA repair machinery may permit SSO correction of the sickle defect by modification of the beta- and/or gamma-globin genes.

  10. Immediate-early gene region of human cytomegalovirus trans-activates the promoter of human immunodeficiency virus

    SciTech Connect

    Davis, M.G.; Kenney, S.C.; Kamine, J.; Pagano, J.S.; Huang, E.S.

    1987-12-01

    Almost all homosexual patients with acquired immunodeficiency syndrome are also actively infected with human cytomegalovirus (HCMV). The authors have hypothesized that an interaction between HCMV and human immunodeficiency virus (HIV), the agent that causes acquired immunodeficiency syndrome, may exist at a molecular level and contribute to the manifestations of HIV infection. In this report, they demonstrate that the immediate-early gene region of HCMV, in particular immediate-early region 2, trans-activates the expression of the bacterial gene chloramphenicol acetyltransferase that is fused to the HIV long terminal repeat and carried by plasmid pHIV-CAT. The HCMV immediate-early trans-activator increases the level of mRNA from the plamid pHIV-CAT. The sequences of HIV that are responsive to trans-activation by the HDMV immediate-early region are distinct from HIV sequences that are required for response to the HIV tat. The stimulation of HIV gene expression by HDMV gene functions could enhance the consequences of HIV infection in persons with previous or concurrent HCMV infection.

  11. Genetic basis of olfactory cognition: extremely high level of DNA sequence polymorphism in promoter regions of the human olfactory receptor genes revealed using the 1000 Genomes Project dataset

    PubMed Central

    Ignatieva, Elena V.; Levitsky, Victor G.; Yudin, Nikolay S.; Moshkin, Mikhail P.; Kolchanov, Nikolay A.

    2014-01-01

    The molecular mechanism of olfactory cognition is very complicated. Olfactory cognition is initiated by olfactory receptor proteins (odorant receptors), which are activated by olfactory stimuli (ligands). Olfactory receptors are the initial player in the signal transduction cascade producing a nerve impulse, which is transmitted to the brain. The sensitivity to a particular ligand depends on the expression level of multiple proteins involved in the process of olfactory cognition: olfactory receptor proteins, proteins that participate in signal transduction cascade, etc. The expression level of each gene is controlled by its regulatory regions, and especially, by the promoter [a region of DNA about 100–1000 base pairs long located upstream of the transcription start site (TSS)]. We analyzed single nucleotide polymorphisms using human whole-genome data from the 1000 Genomes Project and revealed an extremely high level of single nucleotide polymorphisms in promoter regions of olfactory receptor genes and HLA genes. We hypothesized that the high level of polymorphisms in olfactory receptor promoters was responsible for the diversity in regulatory mechanisms controlling the expression levels of olfactory receptor proteins. Such diversity of regulatory mechanisms may cause the great variability of olfactory cognition of numerous environmental olfactory stimuli perceived by human beings (air pollutants, human body odors, odors in culinary etc.). In turn, this variability may provide a wide range of emotional and behavioral reactions related to the vast variety of olfactory stimuli. PMID:24715883

  12. [Estimation of the methylation status of the promoter region of the cell cycle gene P14ARF in placental tissues of spontaneous abortuses with chromosomal mosaicism].

    PubMed

    Kashevarova, A A; Tolmacheva, E N; Sukhanova, N N; Sazhenova, E A; Lebedev, I N

    2009-06-01

    The methylation status of the promoter region of the cell cycle gene P14ARF was studied in the extraembryonic mesoderm and in the chorion cytotrophoblast of 46 human spontaneous abortuses with chromosomal mosaicism. Aberrant methylation of alleles of this gene was revealed for the first time in placental tissues of 9% of embryos. The identified epimutations were found to be characteristic of embryos with aneuploid cell clones of postzygotic origin. It is suggested that epigenetic inactivation of loci responsible for the regulation of cell division and for segregation of chromosomes is associated with the occurrence of mosaic forms of the karyotype at early stages of human embryonic development. PMID:19639877

  13. Identification of the Ω4406 Regulatory Region, a Developmental Promoter of Myxococcus xanthus, and a DNA Segment Responsible for Chromosomal Position-Dependent Inhibition of Gene Expression

    PubMed Central

    Loconto, Jennifer; Viswanathan, Poorna; Nowak, Scott J.; Gloudemans, Monica; Kroos, Lee

    2005-01-01

    When starved, Myxococcus xanthus cells send signals to each other that coordinate their movements, gene expression, and differentiation. C-signaling requires cell-cell contact, and increasing contact brought about by cell alignment in aggregates is thought to increase C-signaling, which induces expression of many genes, causing rod-shaped cells to differentiate into spherical spores. C-signaling involves the product of the csgA gene. A csgA mutant fails to express many genes that are normally induced after about 6 h into the developmental process. One such gene was identified by insertion of Tn5 lac at site Ω4406 in the M. xanthus chromosome. Tn5 lac fused transcription of lacZ to the upstream Ω4406 promoter. In this study, the Ω4406 promoter region was identified by analyzing mRNA and by testing different upstream DNA segments for the ability to drive developmental lacZ expression in M. xanthus. The 5′ end of Ω4406 mRNA mapped to approximately 1.3 kb upstream of the Tn5 lac insertion. A 1.0-kb DNA segment from 0.8 to 1.8 kb upstream of the Tn5 lac insertion, when fused to lacZ and integrated at a phage attachment site in the M. xanthus chromosome, showed a similar pattern of developmental expression as Tn5 lac Ω4406. The DNA sequence upstream of the putative transcriptional start site was strikingly similar to promoter regions of other C-signal-dependent genes. Developmental lacZ expression from the 1.0-kb segment was abolished in a csgA mutant but was restored upon codevelopment of the csgA mutant with wild-type cells, which supply C-signal, demonstrating that the Ω4406 promoter responds to extracellular C-signaling. Interestingly, the 0.8-kb DNA segment immediately upstream of Tn5 lac Ω4406 inhibited expression of a downstream lacZ reporter in transcriptional fusions integrated at a phage attachment site in the chromosome but not at the normal Ω4406 location. To our knowledge, this is the first example in M. xanthus of a chromosomal position

  14. hnRNP U interacts with the c-Myc-Max complex on the E-box promoter region inducing the ornithine decarboxylase gene.

    PubMed

    Matsuoka, Yoichiro; Uehara, Norihisa; Tsubura, Airo

    2009-08-01

    The promoter of the ornithine decarboxylase (ODC) gene contains two E-boxes, which are critical sites for transcriptional activation by the binding of c-Myc-Max heterodimers. We have identified heterogeneous nuclear ribonuclear protein U (hnRNP U) as a component of the complex formed on the E-box-containing promoter region of the ODC gene by using DNA-affinity chromatography, immunoprecipitation and chromatin immunoprecipitation assays. The N-terminal domain of hnRNP U was responsible for the association with c-Myc-Max complex. Down-regulation of hnRNP U with RNA interference blocked the induction of the ODC gene and cell growth by serum stimulation, suggesting that hnRNP U is a coactivator of the c-Myc-Max complex and essential for cell proliferation. Electrophoretic mobility-shift assays revealed that the segment between the two E-boxes in the promoter is the primary binding site of hnRNP U. The putative binding sequence was narrowed-down to a 13-nucleotide segment by comparing the sequence between the E-boxes with the binding sites of hnRNP U, which were recently identified in the promoter of Bmal1, a core component of the circadian molecular oscillator. These findings increase our knowledge of how the c-Myc-Max complex exerts its transcriptional regulatory role and suggest that hnRNP U may be a coactivator of this transcriptional activator complex.

  15. Repetitive genomic insertion of gene-sized dsDNAs by targeting the promoter region of a counter-selectable marker

    PubMed Central

    Jeong, Jaehwan; Seo, Han Na; Jung, Yu Kyung; Lee, Jeewon; Ryu, Gyuri; Lee, Wookjae; Kwon, Euijin; Ryoo, Keunsoo; Kim, Jungyeon; Cho, Hwa-Young; Cho, Kwang Myung; Park, Jin Hwan; Bang, Duhee

    2015-01-01

    Genome engineering can be used to produce bacterial strains with a wide range of desired phenotypes. However, the incorporation of gene-sized DNA fragments is often challenging due to the intricacy of the procedure, off-target effects, and low insertion efficiency. Here we report a genome engineering method enabling the continuous incorporation of gene-sized double-stranded DNAs (dsDNAs) into the Escherichia coli genome. DNA substrates are inserted without introducing additional marker genes, by synchronously turning an endogenous counter-selectable marker gene ON and OFF. To accomplish this, we utilized λ Red protein-mediated recombination to insert dsDNAs within the promoter region of a counter-selectable marker gene, tolC. By repeatedly switching the marker gene ON and OFF, a number of desired gene-sized dsDNAs can be inserted consecutively. With this method, we successfully inserted approximately 13 kb gene clusters to generate engineered E. coli strains producing 1,4-butanediol (1,4-BDO). PMID:25736821

  16. Interaction of a rhizobial DNA-binding protein with the promoter region of a plant leghemoglobin gene

    SciTech Connect

    Welters, P.; Metz, B.; Felix, G.; Palme, K. ); Szczyglowski, K. ); Bruijn, F.J. de Michigan State Univ., East Lansing, MI )

    1993-08-01

    A nucleotide sequence was identified approximately 650 bp upstream of the Sesbania rostrata leghemoglobin gene Srglb3 start codon, which interacts specifically with a proteinaceous DNA-binding factor found in nodule extracts but not in extracts from leaves or root. The binding site for this factor was delimited using footprinting techniques. The DNA-binding activity of this factor was found to be heat stable, dependent on divalent cations, and derived from the (infecting) Azorhizobium caulinodans bacteria or bacteroids (A. caulinodans bacterial binding factor 1, AcBBF1). A 9- to 10-kD protein was isolated from a free-living culture of A. caulinodans that co-purifies with the DNA-binding activity (A. caulinodans bacterial binding protein 1, AcBBP1) and interacts specifically with its target (S. rostrata bacterial binding site 1, SrBBS1). The amino acid sequence of the N-terminal 27 residues of AcBBP1 was determined and was found to share significant similarity (46% identity; 68% similarity) with a domain of the herpes simplex virus major DNA-binding protein infected cell protein 8(ICP8). An insertion mutation in the SrBBS1 was found to result in a substantial reduction of the expression of a Srglb3-gus reporter gene fusion in nodules of transgenic Lotus corniculatus plants, suggesting a role for this element in Srglb3 promoter activity. Based on these results, the authors propose that (a) bacterial transacting factor(s) may play a role in infected cell-specific expression of the symbiotically induced plant lb genes. 70 refs., 11 figs.

  17. The regulation of gene expression in transformed maize aleurone and endosperm protoplasts. Analysis of promoter activity, intron enhancement, and mRNA untranslated regions on expression.

    PubMed

    Gallie, D R; Young, T E

    1994-11-01

    Gene expression in the aleurone and endosperm is highly regulated during both seed development and germination. Studies of alpha-amylase expression in the aleurone of barley (Hordeum vulgare) have generated the current paradigm for hormonal control of gene expression in germinating cereal grain. Gene expression studies in both the aleurone and endosperm tissues of maize (Zea mays) seed have been hampered because of a lack of an efficient transformation system. We report here the rapid isolation of protoplasts from maize aleurone and endosperm tissue, their transformation using polyethylene glycol or electroporation, and the regulation of gene expression in these cells. Adh1 promoter activity was reduced relative to the 35S promoter in aleurone and endosperm protoplasts compared to Black Mexican Sweet suspension cells in which it was nearly as strong as the 35S promoter. Intron-mediated stimulation of expression was substantially higher in transformed aleurone or endosperm protoplasts than in cell-suspension culture protoplasts, and the data suggest that the effect of an intron may be affected by cell type. To examine cytoplasmic regulation, the 5' and 3' untranslated regions from a barley alpha-amylase were fused to the firefly luciferase-coding region, and their effect on translation and mRNA stability was examined following the delivery of in vitro synthesized mRNA to aleurone and endosperm protoplasts. The alpha-amylase untranslated regions regulated translational efficiency in a tissue-specific manner, increasing translation in aleurone or endosperm protoplasts but not in maize or carrot cell-suspension protoplasts, in animal cells, or in in vitro translation lysates.

  18. Recombinant plasmids carrying promoters, genes and the origin of DNA replication of the early region of bacteriophage T7.

    PubMed Central

    Scherzinger, E; Lauppe, H F; Voll, N; Wanke, M

    1980-01-01

    Two full-length contiguous HpaI fragments of the 0 to 18.2% region of T7 H DNA (HpF-H and HpG) were inserted into plasmids pHV14 or pC194 using oligo(dG . dC) connectors or synthetic HindIII adaptors. Amplification of the two early T7 fragments was achieved by transforming lysostaphin-treated S. aureus W57 with the hybrid plasmids. Experimental evidence is presented suggesting that neither of these T7 segments can be cloned in an intact form in E. coli. One of the hybrids, pHV14-HpF-H, proved to be unstable even in B. subtilis 168. The supercoiled recombinant plasmids were tested for their capacity to support RNA synthesis by purified E. coli or T7 RNA polymerases and to serve as templates in a cell-free T7 DNA replication system. The results of these in vitro studies indicate the presence of active "early" promoters in the cloned fragment HpF-H and active "late" promoters, as well as a functional origin of replication in the cloned fragment HpG. Images PMID:7433121

  19. Cloning and characterization of the 5' flanking region of the sialomucin complex/rat Muc4 gene: promoter activity in cultured cells.

    PubMed Central

    Price-Schiavi, S A; Perez, A; Barco, R; Carraway, K L

    2000-01-01

    Sialomucin complex (SMC/Muc4) is a heterodimeric glycoprotein complex consisting of a mucin subunit ascites sialoglycoprotein-1 (ASGP-1) and a transmembrane subunit (ASGP-2), which is aberrantly expressed on the surfaces of a variety of tumour cells. SMC is transcribed from a single gene, translated into a large polypeptide precursor, and further processed to yield the mature ASGP-1/ASGP-2 complex. SMC has complex spatial and temporal expression patterns in the normal rat, suggesting that it has complex regulatory mechanisms. A crude exon/intron map of the 5' regions of the SMC/Muc4 gene generated from clones isolated from a normal rat liver genomic DNA library reveals that this gene has a small first exon comprising the 5' untranslated region and signal peptide, followed by a large intron. The second exon appears to be large, comprising the 5' unique region and a large part (probably all) of the tandem repeat domain. This structure is strikingly similar to that reported for the human MUC4 gene. Using PCR-based DNA walking, 2.4 kb of the 5'-flanking region of the SMC/Muc4 gene was cloned and characterized. Promoter-pattern searches yielded multiple motifs commonly found in tissue-specific promoters. Reporter constructs generated from this 2.4 kb fragment demonstrate promoter activity in primary rat mammary epithelial cells (MEC), the human colon tumour cell line HCT-116, and the human lung carcinoma cell line NCI-H292, but not in COS-7 cells, suggesting epithelial cell specificity. Deletion constructs of this sequence transfected into rat MEC or HCT-116 cells demonstrate greatly varying levels of activity, suggesting that there are positive and negative, as well as tissue-specific, regulatory elements in this sequence. Taken together, these data suggest that the rat SMC/Muc4 promoter has been identified, that it is tissue- (epithelial cell-) specific, and that there are both positive and negative, as well as tissue-specific, regulatory elements in the sequence

  20. Association of the Serotonin Transporter Gene Promoter Region (5-HTTLPR) Polymorphism with Biased Attention for Emotional Stimuli

    PubMed Central

    Beevers, Christopher G.; Wells, Tony T.; Ellis, Alissa J.; McGeary, John E.

    2010-01-01

    A deletion polymorphism in the serotonin transporter-linked polymorphic region (5-HTTLPR) has been associated with vulnerability to affective disorders, yet the mechanism by which this gene confers vulnerability remains unclear. Two studies examined associations between the 5-HTTLPR polymorphism and attentional bias for emotional stimuli among non-depressed adults. Biased attention, attention engagement, and difficulty with attention disengagement were assessed with a spatial cueing task using emotional stimuli. Results from Study 1 (N = 38) indicated that short 5-HTTLPR allele carriers experienced greater difficulty disengaging their attention from sad and happy stimuli compared to long allele homozygotes. Study 2 participants (N = 144) were genotyped for the 5-HTTLPR polymorphism, including single nucleotide polymorphism (SNP) rs25531 in the long allele of the 5-HTTLPR. Consistent with Study 1, individuals homozygous for the low expressing 5-HTTLPR alleles (i.e., S and LG) experienced greater difficulty disengaging attention from sad, happy, and fear stimuli than high expressing 5-HTTLPR homozygotes. Since this association exists in healthy adults, it may represent a susceptibility factor for affective disorders that becomes problematic during stressful life experiences. PMID:19685963

  1. Further evidence that the rs1858830 C variant in the promoter region of the MET gene is associated with autistic disorder.

    PubMed

    Jackson, Pamela B; Boccuto, Luigi; Skinner, Cindy; Collins, Julianne S; Neri, Giovanni; Gurrieri, Fiorella; Schwartz, Charles E

    2009-08-01

    Previous studies in three independent cohorts have shown that the rs1858830 C allele variant in the promoter region of the MET gene on chromosome 7q31 is associated with autism. Another study has found correlations between other alterations in the MET gene and autism in two unrelated cohorts. This study screened two cohorts, an Autistic Disorder cohort from South Carolina and a Pervasive Developmental Disorder (PDD) cohort from Italy, for the presence of the C allele variant in rs1858830. A significant increase in the C allele variant frequency was found in the South Carolina Autistic Disorder patients as compared to South Carolina Controls (chi(2)=5.8, df=1, P=0.02). In the South Carolina cohort, a significant association with Autistic Disorder was found when comparing the CC and CG genotypes to the GG genotype (odds ratio (OR)=1.64; 95% confidence interval (CI)=1.12-2.40; chi(2)=6.5, df=1, P=0.01) in cases and controls. In the Italian cohort, no significant association with PDD was found when comparing the CC or CG genotype to the GG genotype (OR=1.20; 95% CI=0.56-2.56; chi(2)=0.2, df=1, P=0.64). This study is the third independent study to find the rs1858830 C variant in the MET gene promoter to be associated with autism.

  2. Prediction of response to chemoradiation in rectal cancer by a gene polymorphism in the epidermal growth factor receptor promoter region

    SciTech Connect

    Spindler, Karen-Lise Garm . E-mail: kalgsp@vgs.vejleamt.dk; Nielsen, Jens Nederby; Lindebjerg, Jan; Brandslund, Ivan; Jakobsen, Anders

    2006-10-01

    Purpose: Epidermal growth factor receptor (EGFR) has been associated with radioresistance in solid tumors. Recently a polymorphism in the Sp1 recognition site of the EGFR promoter region was identified. The present study investigated the predictive value of this polymorphism for the outcome of chemoradiation in locally advanced rectal cancer. Methods and Materials: The study included 77 patients with locally advanced T3 rectal tumors. Treatment consisted of preoperative radiation therapy at a total tumor dose of 65 Gy and concomitant chemotherapy with Uftoral. Blood samples from 63 patients were evaluated for Sp1 -216 G/T polymorphism by polymerase chain reaction analysis. Forty-eight primary tumor biopsies were available for EGFR immunostaining. Patients underwent surgery 8 weeks after treatment. Pathologic response evaluation was performed according to the tumor regression grade (TRG) system. Results: Forty-nine percent had major response (TRG1-2) and 51% moderate response (TRG 3-4) to chemoradiation. The rates of major response were 34% (10/29) in GG homozygote patients compared with 65% (22/34) in patients with T containing variants (p = 0.023). Fifty-eight percent of biopsies were positive for EGFR expression (28/48). The major response rates with regard to EGFR immunostaining were not significantly different. EGFR-positive tumors were found in 83% of the GG homozygote patients compared with 38% of patients with TT or GT variants (p = 0.008). Conclusions: There was a significant correlation between EGFR Sp1 -216 G/T polymorphism and treatment response to chemoradiation in locally advanced rectal cancer. Further investigations of a second set of patient and other treatment schedules are warranted.

  3. A polymorphism in the promoter region of the survivin gene is related to hemorrhagic transformation in patients with acute ischemic stroke.

    PubMed

    Mallolas, Judith; Rodríguez, Rocío; Gubern, Carme; Camós, Susanna; Serena, Joaquín; Castellanos, Mar

    2014-12-01

    Hemorrhagic transformation (HT) of cerebral infarction is a common and serious occurrence following acute ischemic stroke. The expression of survivin, a member of the inhibitor of apoptosis protein family, has been shown to increase after cerebral ischemia. This protein has been mainly located at the microvasculature within the infarcted and peri-infarcted area, so we aimed to investigate whether survivin gene polymorphisms, also known as BIRC5 gene, were associated with HT of cerebral infarction. Polymorphism screening of the BIRC5 gene was performed in 107 patients with a hemispheric ischemic stroke and 93 controls by polymerase chain reaction, single-strand conformation polymorphism and sequencing analysis. Genotype-phenotype correlation was performed in patients. MRI was carried out within 12 h of symptoms onset and at 72 ± 12 h. The presence of HT was determined on the second DWI sequence and classified according to ECASS II criteria. MMP-9 levels were analyzed at admission. Forty-nine patients (45.8%) had HT. The -241 C/T (rs17878467) polymorphism was identified in the promoter region of the survivin gene. The prevalence of the mutant allele (T) was similar in patients and controls (14 vs. 16%, respectively; P = 0.37). However, 9 (29%) patients with allele T had HT compared to 40 (52.6%) of wild-type (P = 0.021). Logistic regression analysis showed that the polymorphism was associated with a lower risk of HT (OR 0.16; 95% CI 0.04-0.65; P = 0.01). The -241 C/T polymorphism in the promoter region of the survivin gene is associated with a lower risk of HT in patients with ischemic stroke. It has recently been reported that the -241 C/T polymorphism increases survivin promoter activity, reinforcing the hypothesis that patients with the mutant allele may have increased survivin expression in the brain. Different mechanisms, including BBB protection by the inhibition or activation of different angiogenic growth factors and the inhibition of apoptosis during

  4. Alternative promoters of gene MAGE4a

    SciTech Connect

    De Plaen, E.; Naerhuyzen, B.; De Smet, C.

    1997-03-01

    Gene MAGE-4 (HGMW-approved symbol MAGE4) is expressed in several types of tumors, but not in normal tissues, except testis and placenta. The 5{prime} end of this gene contains eight homologous exons spread over a 5.8-kb region. These exons are alternatively spliced to a unique second exon and a unique third exon, which encodes a protein of 317 amino acids. The analysis of transcripts found in testis, placenta, and a sarcoma cell line showed that each of the alternative first exons is used in at least one of these tissues. Various regions of the promoter of the fifth alternative exon (1.5) were cloned in a luciferase reporter plasmid, and the constructs were transfected in a sarcoma cell line that expresses MAGE-4. Two Ets motifs located between positions -70 and -29 relative to the transcription start site were found to drive 55% of the promoter activity. A region containing an Sp1 consensus binding site located upstream of the two Ets motifs was found to be responsible for 44% of the transcriptional activity. MAGE-4a promoters 1.4 and 1.6, which also contain the Sp1 and the two Ets binding motifs, supported a level of transcription comparable to that of promoter 1.5, whereas promoter 1.1, which contains only one Ets binding site, was sixfold less active. In line with observations made with gene MAGE-1 (HGMW-approved symbol MAGE1), we found that promoter 1.5 stimulated a high level of transcription in a melanoma cell line that does not express MAGE-4. This suggests that the tumor-specific expression of MAGE genes is not determined by the presence of specific transcription factors. 26 refs., 7 figs., 2 tabs.

  5. Association of TNF-α gene promoter region polymorphisms in bovine leukemia virus (BLV)-infected cattle with different proviral loads.

    PubMed

    Lendez, Pamela Anahi; Passucci, Juan Antonio; Poli, Mario Andres; Gutierrez, Silvina Elena; Dolcini, Guillermina Laura; Ceriani, Maria Carolina

    2015-08-01

    Tumor necrosis factor alpha (TNF-α) is a pleiotropic cytokine involved in the immune response against viral and other infections. Its expression levels are affected by a polymorphism in the promoter region of the gene. Bovine leukemia virus is a retrovirus that infects cattle and develops two different infection profiles in the host. One profile is characterized by a high number of proviral copies integrated into the host genome and a strong immune response against the virus, while the most relevant property of the other profile is that the number of copies integrated into the host genome is almost undetectable and the immune response is very weak. We selected a population of cattle sufficiently large for statistical analysis and classified them according to whether they had a high or low proviral load (HPL or LPL). Polymorphisms in the promoter region were identified by PCR-RFLP. The results indicated that, in the HPL group, the three possible genotypes were normally distributed and that, in the LPL group, there was a significant association between the proviral load and a low frequency of the G/G genotype at position -824. PMID:26051703

  6. Association of TNF-α gene promoter region polymorphisms in bovine leukemia virus (BLV)-infected cattle with different proviral loads.

    PubMed

    Lendez, Pamela Anahi; Passucci, Juan Antonio; Poli, Mario Andres; Gutierrez, Silvina Elena; Dolcini, Guillermina Laura; Ceriani, Maria Carolina

    2015-08-01

    Tumor necrosis factor alpha (TNF-α) is a pleiotropic cytokine involved in the immune response against viral and other infections. Its expression levels are affected by a polymorphism in the promoter region of the gene. Bovine leukemia virus is a retrovirus that infects cattle and develops two different infection profiles in the host. One profile is characterized by a high number of proviral copies integrated into the host genome and a strong immune response against the virus, while the most relevant property of the other profile is that the number of copies integrated into the host genome is almost undetectable and the immune response is very weak. We selected a population of cattle sufficiently large for statistical analysis and classified them according to whether they had a high or low proviral load (HPL or LPL). Polymorphisms in the promoter region were identified by PCR-RFLP. The results indicated that, in the HPL group, the three possible genotypes were normally distributed and that, in the LPL group, there was a significant association between the proviral load and a low frequency of the G/G genotype at position -824.

  7. The c.-190 C>A transversion in promoter region of protamine1 gene as a genetic risk factor for idiopathic oligozoospermia.

    PubMed

    Jamali, Shirin; Karimian, Mohammad; Nikzad, Hossein; Aftabi, Younes

    2016-08-01

    The genome condensation in the sperm head is resulted with replacing of histones by protamines during spermatogenesis. It is reported that defects in the protamine 1 (PRM1) and/or 2 (PRM2) genes cause male infertility. Located on chromosome 16 (16p13.2) these genes contain numerous unstudied single nucleotide polymorphisms. This study aimed to investigate the association of c.-190 C>A and g.298 G>C transversions that respectively occur in PRM1 and PRM2 genes with idiopathic oligozoospermia. In a case-control study, we collected blood samples from 130 idiopathic oligozoospermia and 130 fertile men. Detection of c.-190 C>A and g.298 G>C polymorphisms performed by direct sequencing and PCR-RFLP methods respectively. An in silico analysis was performed by ASSP, NetGene 2, and PNImodeler online web servers. Our data revealed that g.298 G>C transversion in PRM2 was not associated with oligozoospermia (P > 0.05). Whereas, -190CA and -190AA genotypes in PRM1 gene were associated significantly with increased risk of oligozoospermia (P = 0.0017 and 0.0103, respectively). Also carriers of A allele (CA+AA) for PRM1 c.-190 C>A were at a high risk for oligozoospermia (OR 3.2440, 95 % CI 1.8060-5.8270, P = 0.0001). Further, in silico analysis revealed that c.-190 C>A transversion may alter transcription factor interactions with the promoter region of PRM1. The results revealed that the c.-190 C>A transversion may involve in the susceptibility for oligozoospermia and could be represented as a noninvasive molecular marker for genetic diagnosis of idiopathic oligozoospermia. PMID:27216534

  8. G-395A polymorphism in the promoter region of the KLOTHO gene associates with reduced cognitive impairment among the oldest old.

    PubMed

    Hao, Qiukui; Ding, Xiang; Gao, Langli; Yang, Ming; Dong, Birong

    2016-02-01

    This study aimed to examine the possible association between G-395A polymorphism in the promoter region of the KLOTHO gene and cognitive impairment among Chinese nonagenarians and centenarians. This study is a secondary analysis of the Project of Longevity and Aging in Dujiangyan (PLAD) study. Community-dwelling Chinese people aged 90 years or older were included. G-395A (rs1207568) genotyping in the promoter region of the KLOTHO gene was performed using the TaqMan allelic discrimination assay. Cognitive function was assessed with the mini-mental status examination (MMSE). A total of 706 participants (68.0 % female; mean age 93.5 ± 3.6 years) were included. The KLOTHO G-395A polymorphism genotype frequencies for the whole sample were 2.0 % AA, 30.3 % GA, and 67.7 % GG. The GG genotype frequencies for the cognitive impairment and control groups were 70.2 and 62.7 %, respectively. Cognitive impairment prevalence was significantly lower in the GA+AA group than in the GG genotype group (61.4 vs. 69.0 %, p = 0.044). GA+AA genotype subjects had a significantly lower risk of cognitive impairment (odds ratio 0.66; 95 % confidence interval 0.44 to 0.98) than GG genotype individuals after adjusting for age, gender, and other relevant risk factors. KLOTHO G-395A polymorphism associates with reduced cognitive impairment in a sample of Chinese nonagenarians and centenarians.

  9. ESR1 gene promoter region methylation in free circulating DNA and its correlation with estrogen receptor protein expression in tumor tissue in breast cancer patients

    PubMed Central

    2014-01-01

    Background Tumor expression of estrogen receptor (ER) is an important marker of prognosis, and is predictive of response to endocrine therapy in breast cancer. Several studies have observed that epigenetic events, such methylation of cytosines and deacetylation of histones, are involved in the complex mechanisms that regulate promoter transcription. However, the exact interplay of these factors in transcription activity is not well understood. In this study, we explored the relationship between ER expression status in tumor tissue samples and the methylation of the 5′ CpG promoter region of the estrogen receptor gene (ESR1) isolated from free circulating DNA (fcDNA) in plasma samples from breast cancer patients. Methods Patients (n = 110) with non-metastatic breast cancer had analyses performed of ER expression (luminal phenotype in tumor tissue, by immunohistochemistry method), and the ESR1-DNA methylation status (fcDNA in plasma, by quantitative methylation specific PCR technique). Results Our results showed a significant association between presence of methylated ESR1 in patients with breast cancer and ER negative status in the tumor tissue (p = 0.0179). There was a trend towards a higher probability of ESR1-methylation in those phenotypes with poor prognosis i.e. 80% of triple negative patients, 60% of HER2 patients, compared to 28% and 5.9% of patients with better prognosis such as luminal A and luminal B, respectively. Conclusion Silencing, by methylation, of the promoter region of the ESR1 affects the expression of the estrogen receptor protein in tumors of breast cancer patients; high methylation of ESR1-DNA is associated with estrogen receptor negative status which, in turn, may be implicated in the patient’s resistance to hormonal treatment in breast cancer. As such, epigenetic markers in plasma may be of interest as new targets for anticancer therapy, especially with respect to endocrine treatment. PMID:24495356

  10. Environmental Stress Affects DNA Methylation of a CpG Rich Promoter Region of Serotonin Transporter Gene in a Nurse Cohort

    PubMed Central

    Alasaari, Jukka S.; Lagus, Markus; Ollila, Hanna M.; Toivola, Auli; Kivimäki, Mika; Vahtera, Jussi; Kronholm, Erkki; Härmä, Mikko; Puttonen, Sampsa; Paunio, Tiina

    2012-01-01

    Background Shift-working nurses are exposed to a stressful work environment, which puts them at an increased risk for burnout and depression. We explored the effect of environmental stress on serotonin transporter gene (SLC6A4) promoter methylation among nurses from high and low work stress environments. Methodology Using bisulfite sequencing, we investigated the methylation status of five CpG residues of a CpG-rich region in the promoter of SLC6A4 by comparing female shift working nurses from a high work stress environment (n = 24) to low work stress environment (n = 25). We also analyzed the association of 5-HTTLPR polymorphism at 5′ end of SLC6A4. Work stress was assessed by the Karasek’s Model and possible signs of burnout or depression were measured by the Maslach Burnout Index General Survey and Beck Depression Index. Methylation levels were assessed by bisulfite sequencing of DNA extracted from peripheral blood leucocytes. Restriction enzyme treatment followed by standard PCR was used to identify 5-HTTLPR genotypes. Principal Findings We found that nurses in the high stress environment had significantly lower promoter methylation levels at all five CpG residues compared to nurses in the low stress environment (p<0.01). There was no significant interaction of 5-HTTLPR genotype and work stress with methylation (p = 0.58). In unadjusted (bivariate) analysis, burnout was not significantly associated to methylation levels. However, when mutually adjusted for both, burnout and work stress were significant contributors (p = 0.038 and p<0.0001 respectively) to methylation levels. Conclusions Our findings show that environmental stress is concurrent with decreased methylation of the SLC6A4 promoter. This may lead to increased transcriptional activity of the gene, increased reuptake of serotonin from synaptic clefts, and termination of the activity of serotonin. This could present a possible coping mechanism for environmental stress in humans that

  11. Sodium butyrate up-regulates cathelicidin gene expression via activator protein-1 and histone acetylation at the promoter region in a human lung epithelial cell line, EBC-1.

    PubMed

    Kida, Yutaka; Shimizu, Takashi; Kuwano, Koichi

    2006-05-01

    The antimicrobial protein cathelicidin is considered to play an important role in the defense mechanisms against bacterial infection. Recent studies show that sodium butyrate induces cathelicidin gene expression in human colonic, gastric and hepatic cells. However, little is known about the precise regulatory mechanisms underlying sodium butyrate-induced cathelicidin gene expression. In this study, we examined the regulatory mechanisms involved in sodium butyrate-induced cathelicidin gene expression using a human lung epithelial cell line, EBC-1. Our results indicate that sodium butyrate induces both cathelicidin mRNA and protein expression. Moreover, deletion or mutation of a putative activator protein-1 (AP-1) binding site in the cathelicidin gene promoter abrogated the response to sodium butyrate stimulation. Three different mitogen-activated protein (MAP) kinase inhibitors suppressed sodium butyrate-induced transactivation of the cathelicidin promoter. Electrophoretic mobility shift assays (EMSA) showed that nuclear extracts prepared from sodium butyrate-stimulated EBC-1 cells generated specific binding to probe including a putative AP-1 binding site in the cathelicidin gene promoter. Furthermore, chromatin immunoprecipitation (ChIP) assays demonstrated that sodium butyrate augmented histone acetylation of the cathelicidin promoter in EBC-1 cells. Therefore, these results indicate that AP-1 and histone acetylation of the cathelicidin promoter play a critical role in the regulation of inducible cathelicidin gene expression in EBC-1 cells stimulated with sodium butyrate.

  12. Apolipoprotein M regulates the orphan nuclear receptor LRH-1 gene expression through binding to its promoter region in HepG2 cells

    PubMed Central

    Pan, Yi; Zhou, Hou-gang; Zhou, Hui; Hu, Min; Tang, Li-jun

    2015-01-01

    Apolipoprotein M (ApoM) is predominantly located in the high-density lipoprotein in human plasma. It has been demonstrated that ApoM expression could be regulated by several crucial nuclear receptors that are involved in the bile acid metabolism. In the present study, by combining gene-silencing experiments, overexpression studies, and chromatin immunoprecipitation assays, we showed that ApoM positively regulated liver receptor homolog-1 (LRH-1) gene expression via direct binding to an LRH-1 promoter region (nucleotides −406/ −197). In addition, we investigated the effects of farnesoid X receptor agonist GW4064 on hepatic ApoM expression in vitro. In HepG2 cell cultures, both mRNA and protein levels of ApoM and LRH-1 were decreased in a time-dependent manner in the presence of 1 μM GW4064, and the inhibition effect was gradually attenuated after 24 hours. In conclusion, our findings present supportive evidence that ApoM is a regulator of human LRH-1 transcription, and further reveal the importance of ApoM as a critical regulator of bile acids metabolism. PMID:25987835

  13. Apolipoprotein M regulates the orphan nuclear receptor LRH-1 gene expression through binding to its promoter region in HepG2 cells.

    PubMed

    Pan, Yi; Zhou, Hou-gang; Zhou, Hui; Hu, Min; Tang, Li-jun

    2015-01-01

    Apolipoprotein M (ApoM) is predominantly located in the high-density lipoprotein in human plasma. It has been demonstrated that ApoM expression could be regulated by several crucial nuclear receptors that are involved in the bile acid metabolism. In the present study, by combining gene-silencing experiments, overexpression studies, and chromatin immunoprecipitation assays, we showed that ApoM positively regulated liver receptor homolog-1 (LRH-1) gene expression via direct binding to an LRH-1 promoter region (nucleotides -406/ -197). In addition, we investigated the effects of farnesoid X receptor agonist GW4064 on hepatic ApoM expression in vitro. In HepG2 cell cultures, both mRNA and protein levels of ApoM and LRH-1 were decreased in a time-dependent manner in the presence of 1 μM GW4064, and the inhibition effect was gradually attenuated after 24 hours. In conclusion, our findings present supportive evidence that ApoM is a regulator of human LRH-1 transcription, and further reveal the importance of ApoM as a critical regulator of bile acids metabolism.

  14. Effects of 174 G/C polymorphism in the promoter region of the interleukin-6 gene on plasma IL-6 levels and muscle strength in elderly women.

    PubMed

    Pereira, D S; Garcia, D M; Narciso, F M S; Santos, M L A S; Dias, J M D; Queiroz, B Z; Souza, E R; Nóbrega, O T; Pereira, L S M

    2011-02-01

    We investigated the effect of -174 G/C single-nucleotide polymorphism in the promoter region of the IL6 gene on plasma IL-6 levels and muscle strength, and the relationship between IL-6 levels and muscle strength in elderly women. The sample consisted of 199 elderly residents (73.0 ± 7.8 years old) from rest homes and the community in Belo Horizonte, MG, Brazil. -174 G/C polymorphism was determined by direct sequencing of the product by PCR, and plasma IL-6 concentrations were measured by ELISA. Muscle strength in the knee joint was evaluated using a Biodex System 3 Pro® isokinetic dynamometer. ANCOVA was used to determine the effect of polymorphism on IL-6 levels and muscle strength, and the Pearson correlation coefficient to assess the relationship between IL-6 levels and muscle strength. -174 G/C polymorphism was associated with the plasma IL-6 levels of elderly women (P < 0.01) since homozygotes for the G allele showed high IL-6 levels (GG 3.85 pg/mL, GC + CC 2.13 pg/mL). There was no association of polymorphism on muscle strength (P > 0.05). No association was found between IL-6 levels and knee extensor muscle (r = 0.087, P = 0.306) or flexor (r = -0.011, P = 0.894) strength. An interaction between -174 G/C polymorphism and housing conditions of the sample of elderly women was identified, with the effect of genotype on IL-6 levels being higher in the institutionalized elderly. These results support the evidence that -174 G/C polymorphism of the IL6 gene associates with individual variability of plasma IL-6 levels in elderly women.

  15. Insulators form gene loops by interacting with promoters in Drosophila.

    PubMed

    Erokhin, Maksim; Davydova, Anna; Kyrchanova, Olga; Parshikov, Alexander; Georgiev, Pavel; Chetverina, Darya

    2011-09-01

    Chromatin insulators are regulatory elements involved in the modulation of enhancer-promoter communication. The 1A2 and Wari insulators are located immediately downstream of the Drosophila yellow and white genes, respectively. Using an assay based on the yeast GAL4 activator, we have found that both insulators are able to interact with their target promoters in transgenic lines, forming gene loops. The existence of an insulator-promoter loop is confirmed by the fact that insulator proteins could be detected on the promoter only in the presence of an insulator in the transgene. The upstream promoter regions, which are required for long-distance stimulation by enhancers, are not essential for promoter-insulator interactions. Both insulators support basal activity of the yellow and white promoters in eyes. Thus, the ability of insulators to interact with promoters might play an important role in the regulation of basal gene transcription.

  16. Novel basic-region helix-loop-helix transcription factor (AnBH1) of Aspergillus nidulans counteracts the CCAAT-binding complex AnCF in the promoter of a penicillin biosynthesis gene.

    PubMed

    Caruso, Maria Louise; Litzka, Olivier; Martic, Goran; Lottspeich, Friedrich; Brakhage, Axel A

    2002-10-25

    Cis-acting CCAAT elements are found frequently in eukaryotic promoter regions. Many of the genes containing such elements in their promoters are regulated by a conserved multimeric CCAAT-binding complex. In the fungus Emericella (Aspergillus) nidulans, this complex was designated AnCF (A.nidulans CCAAT-binding factor). AnCF regulates several genes, including the penicillin biosynthesis genes ipnA and aatA. Since it is estimated that the CCAAT-binding complex regulates more than 200 genes, an important question concerns the regulation mechanism that allows so many genes to be regulated by a single complex in a gene-specific manner. One of the answers to this question appears to lie in the interaction of AnCF with other transcription factors. Here, a novel transcription factor designated AnBH1 was isolated. The corresponding anbH1 gene was cloned and found to be located on chromosome IV. The deduced AnBH1 protein belongs to the family of basic-region helix-loop-helix (bHLH) transcription factors. AnBH1 binds in vitro as a homodimer to an, not previously described, asymmetric E-box within the aatA promoter that overlaps with the AnCF-binding site. This is the first report demonstrating that the CCAAT-binding complex and a bHLH transcription factor bind to overlapping sites. Since deletion of anbH1 appears to be lethal, the anbH1 gene was replaced by a regulatable alcAp-anbH1 gene fusion. The analysis of aatAp-lacZ expression in such a strain indicated that AnBH1 acts as a repressor of aatA gene expression and therefore counteracts the positive action of AnCF.

  17. No evidence for linkage in the promoter region of the inducible nitric oxide synthase gene (NOS2) in a Danish type 1 diabetes population.

    PubMed

    Johannesen, J; Pociot, F; Kristiansen, O P; Karlsen, A E; Nerup, J

    2000-08-01

    Exposure of human pancreatic islets to a mixture of cytokines induces expression of inducible nitric oxide synthase (iNOS), impairs beta-cell function and induces apoptosis. Exposing human islets to high amounts of NO from chemical NO-donors causes DNA strand breaks and mitochondrial damage, suggesting that NO is deleterious to human beta-cells. Hence, we consider the gene encoding iNOS in beta-cells, NOS2, a candidate gene for type 1 diabetes in humans. In the present study we have tested three identified polymorphisms within the promoter sequence of the human NOS2 gene in a type 1 diabetic family material comprising 154 affected sib-pair families and 103 affected simplex families (1143 individuals in total). PCR-based amplification of the polymorphic loci were established. Linkage analysis was performed using the extended transmission disequilibrium testing (ETDT). A Bsal RFLP was found not to be polymorphic in 20 type 1 diabetic patients and 14 healthy control subjects and was not analysed further. In affected cases a nine allele CCTTT repeat and a bi-allelic TAAA repeat revealed allelewise Petdt of 0.52 and 0.60, respectively. ETDT applied to (TAAA)n; (CCTTT)n haplotypes demonstrated random transmission from heterozygous parents to affected offspring. In conclusion, the tested polymorphisms within the NOS2 gene promoter did not show evidence for linkage to type 1 diabetes in a Danish family material.

  18. Characterization of the human p53 gene promoter

    SciTech Connect

    Tuck, S.P.; Crawford, L.

    1989-05-01

    Transcriptional deregulation of the p53 gene may play an important part in the genesis of some tumors. The authors report here an accurate determination of the transcriptional start sites of the human p53 gene and show that the majority of p53 mRNA molecules do not contain a postulated stem-loop structure at their 5' ends. Recombinant plasmids of the human p53 promoter-leader region fused to the bacterial chloramphenicol acetyltransferase gene (cat) were constructed. After transfection into rodent or human cells, a 350-base-pair fragment spanning the promoter region conferred 4% of the CAT activity mediated by the simian virus 40 early promoter/enhancer. They monitored the efficiency with which 15 3' and 5' promoter deletion constructs initiated transcription. Their results show that an 85-base-pair fragment, previously thought to have resided in exon 1, is that is required for full promoter activity.

  19. The amdR product and a CCAAT-binding factor bind to adjacent, possibly overlapping DNA sequences in the promoter region of the Aspergillus nidulans amdS gene.

    PubMed Central

    van Heeswijck, R; Hynes, M J

    1991-01-01

    The amdS gene of Aspergillus nidulans is regulated by a number of positively acting regulatory genes which act additively and independently. Using gel mobility shift assays with crude nuclear extracts we show here that the product of one of these regulatory genes, the amdR gene, binds to DNA fragments containing part of the promoter region of the amdS gene. This confirms the earlier prediction from DNA sequence data that amdR encodes a DNA-binding protein containing a cysteine-rich 'zinc finger' motif. In addition we detected the binding of another previously unidentified protein to an adjacent, possibly overlapping region of the amdS 5' sequence at the site of a consensus 'CCAAT-box' sequence. Replacement of the CCAAT sequence with CCTTT abolished the binding of this protein which we have designated as an A. nidulans 'CCAAT-box' binding factor (AnCF). The 'CCAAT-box' sequence appears to be involved in determining the basal level of transcription of amdS (T.G.Littlejohn and M.J.H., unpublished data). This suggests that AnCF is a transcription factor, and that the 'CCAAT-box' sequences found in the promoters of some filamentous fungal genes function as binding sites for these factors, as in other eucaryotes. Images PMID:2041742

  20. The amdR product and a CCAAT-binding factor bind to adjacent, possibly overlapping DNA sequences in the promoter region of the Aspergillus nidulans amdS gene.

    PubMed

    van Heeswijck, R; Hynes, M J

    1991-05-25

    The amdS gene of Aspergillus nidulans is regulated by a number of positively acting regulatory genes which act additively and independently. Using gel mobility shift assays with crude nuclear extracts we show here that the product of one of these regulatory genes, the amdR gene, binds to DNA fragments containing part of the promoter region of the amdS gene. This confirms the earlier prediction from DNA sequence data that amdR encodes a DNA-binding protein containing a cysteine-rich 'zinc finger' motif. In addition we detected the binding of another previously unidentified protein to an adjacent, possibly overlapping region of the amdS 5' sequence at the site of a consensus 'CCAAT-box' sequence. Replacement of the CCAAT sequence with CCTTT abolished the binding of this protein which we have designated as an A. nidulans 'CCAAT-box' binding factor (AnCF). The 'CCAAT-box' sequence appears to be involved in determining the basal level of transcription of amdS (T.G. Littlejohn and M.J.H., unpublished data). This suggests that AnCF is a transcription factor, and that the 'CCAAT-box' sequences found in the promoters of some filamentous fungal genes function as binding sites for these factors, as in other eucaryotes.

  1. Characterization of the promoter region of the bovine long-chain acyl-CoA synthetase 1 gene: Roles of E2F1, Sp1, KLF15, and E2F4

    PubMed Central

    Zhao, Zhi-Dong; Zan, Lin-Sen; Li, An-Ning; Cheng, Gong; Li, Shi-Jun; Zhang, Ya-Ran; Wang, Xiao-Yu; Zhang, Ying-Ying

    2016-01-01

    The nutritional value and eating qualities of beef are enhanced when the unsaturated fatty acid content of fat is increased. Long-chain acyl-CoA synthetase 1 (ACSL1) plays key roles in fatty acid transport and degradation, as well as lipid synthesis. It has been identified as a plausible functional and positional candidate gene for manipulations of fatty acid composition in bovine skeletal muscle. In the present study, we determined that bovine ACSL1was highly expressed in subcutaneous adipose tissue and longissimus thoracis. To elucidate the molecular mechanisms involved in bovine ACSL1 regulation, we cloned and characterized the promoter region of ACSL1. Applying 5′-rapid amplification of cDNA end analysis (RACE), we identified multiple transcriptional start sites (TSSs) in its promoter region. Using a series of 5′ deletion promoter plasmids in luciferase reporter assays, we found that the proximal minimal promoter of ACSL1 was located within the region −325/−141 relative to the TSS and it was also located in the predicted CpG island. Mutational analysis and electrophoretic mobility shift assays demonstrated that E2F1, Sp1, KLF15 and E2F4 binding to the promoter region drives ACSL1 transcription. Together these interactions integrate and frame a key functional role for ACSL1 in mediating the lipid composition of beef. PMID:26782942

  2. The zta transactivator involved in induction of lytic cycle gene expression in Epstein-Barr virus-infected lymphocytes binds to both AP-1 and ZRE sites in target promoter and enhancer regions.

    PubMed Central

    Lieberman, P M; Hardwick, J M; Sample, J; Hayward, G S; Hayward, S D

    1990-01-01

    The BZLF1 or zta immediate-early gene of Epstein-Barr virus (EBV) encodes a 33-kilodalton phosphorylated nuclear protein that is a specific transcriptional activator of the EBV lytic cycle when introduced into latently infected B lymphocytes. We have shown previously that the divergent EBV DSL target promoter contains two zta-response regions, one within the minimal promoter and the other in an upstream lymphocyte-dependent enhancer region. In this study, we used footprinting and gel mobility retardation assays to reveal that bacterially synthesized Zta fusion proteins bound directly to six TGTGCAA-like motifs within DSL. Four of the Zta-binding sites lay adjacent to cellular TATA and CAAT factor-binding sites within the minimal promoter, and two mapped within the enhancer region. Single-copy oligonucleotides containing these Zta-binding sites conferred Zta responsiveness to heterologous promoters. In addition, the Zta protein, which possesses a similar basic domain to the conserved DNA-binding region of the c-Fos, c-Jun, GCN4, and CREB protein family, proved to bind directly to the consensus AP-1 site in the collagenase 12-O-tetradecanoylphorbol-13-acetate response element. Cotransfection with zta also trans activated a target reporter gene containing inserted wild-type 12-O-tetradecanoylphorbol-13-acetate response element oligonucleotides. Cellular AP-1 binding activity proved to be low in latently EBV-infected Raji cells but was induced (together with the Zta protein) after activation of the lytic cycle with 12-O-tetradecanoylphorbol-13-acetate. We conclude that EBV may have captured and modified a cellular gene encoding a c-jun-like DNA-binding protein during its evolutionary divergence from other herpesviruses and that this protein is used to specifically redirect transcriptional activity toward expression of EBV lytic-cycle genes in infected cells. Images PMID:2154599

  3. Comparative analysis of the nonA region in Drosophila identifies a highly diverged 5' gene that may constrain nonA promoter evolution.

    PubMed Central

    Campesan, S; Chalmers, D; Sandrelli, F; Megighian, A; Peixoto, A A; Costa, R; Kyriacou, C P

    2001-01-01

    A genomic fragment from Drosophila virilis that contained all the no-on-transientA (nonA) coding information, plus several kilobases of upstream material, was identified. Comparisons of nonA sequences and the gene nonA-like in D. melanogaster, a processed duplication of nonA, suggest that it arose before the split between D. melanogaster and D. virilis. In both species, another gene that lies <350 bp upstream from the nonA transcription starts, and that probably corresponds to the lethal gene l(1)i19, was identified. This gene encodes a protein that shows similarities to GPI1, which is required for the biosynthesis of glycosylphosphatidylinositol (GPI), a component for anchoring eukaryotic proteins to membranes, and so we have named it dGpi1. The molecular evolution of nonA and dGpi1 sequences show remarkable differences, with the latter revealing a level of amino acid divergence that is as high as that of transformer and with extremely low levels of codon bias. Nevertheless, in D. melanogaster hosts, the D. virilis fragment rescues the lethality associated with a mutation of l(1)i19e, as well as the viability and visual defects produced by deletion of nonA(-). The presence of dGpi1 sequences so close to nonA appears to have constrained the evolution of the nonA promoter. PMID:11156994

  4. Molecular cloning of a cDNA encoding human SPH-binding factor, a conserved protein that binds to the enhancer-like region of the U6 small nuclear RNA gene promoter.

    PubMed

    Rincon, J C; Engler, S K; Hargrove, B W; Kunkel, G R

    1998-11-01

    Many vertebrate small nuclear RNA gene promoters contain an SPH motif in their distal control regions that can confer transcriptional stimulation by RNA polymerase II or RNA polymerase III. Using the human U6 gene SPH motif as a probe, we isolated a cDNA encoding human SPH-binding factor (hSBF) from a HeLa cell expression library. The coding region of hSBF is almost identical to ZNF143, a 626 amino acid, seven zinc finger protein of previously unknown function. Furthermore, the predicted amino acid sequence of hSBF is highly homologous to Xenopus laevis and mouse Staf proteins, that bind to SPH motifs and stimulate transcription of selenocysteine tRNA gene promoters. Recombinant hSBF expressed in vitro or from Escherichia coli bound specifically to the human U6 gene SPH motif as shown by DNase I footprinting and electrophoretic mobility shift assays using various mutant SPH sites as competitors. Antibodies prepared against recombinant hSBF inhibited assembly of native SBF-DNA complexes. Immunodepleted HeLa S100 transcription extract no longer supported elevated levels of transcription by RNA polymerase III from a U6 promoter containing an SPH motif, whereas addition of recombinant hSBF protein to the immunodepleted extract reconstituted stimulated transcription.

  5. Sequence determinants spanning -35 motif and AT-rich spacer region impacting Ehrlichia chaffeensis Sigma 70-dependent promoter activity of two differentially expressed p28 outer membrane protein genes

    PubMed Central

    Liu, Huitao; Jakkula, Laxmi U. M. R.; Von Ohlen, Tonia; Ganta, Roman R.

    2016-01-01

    Ehrlichia chaffeensis is an obligate intracellular tick-borne bacterium which causes the disease, human monocytic ehrlichiosis. Ehrlichia chaffeensis contains only two sigma factors, σ32 and σ70. It is difficult to study E. chaffeensis gene regulation due to lack of a transformation system. We developed an Escherichia coli-based transcription system to study E. chaffeensis transcriptional regulation. An E. coli strain with its σ70 repressed with trp promoter is used to express E. chaffeensis σ70. The E. coli system and our previously established in vitro transcription system were used to map transcriptional differences of two Ehrlichia genes encoding p28-outer membrane proteins 14 and 19. We mapped the -10 and -35 motifs and the AT rich spacers located between the two motifs by performing detailed mutational analysis. Mutations within the -35 motif of the genes impacted transcription differently, while -10 motif deletions had no impact. The AT-rich spacers also contributed to transcriptional differences. We further demonstrated that the domain 4.2 of E. chaffeensis σ70 is important for regulating promoter activity and the deletion of region 1.1 of E. chaffeensis σ70 causes enhancement of the promoter activity. This is the first study defining the promoters of two closely related E. chaffeensis genes. PMID:27402867

  6. Identification of Human Gene Core Promoters in Silico

    PubMed Central

    Zhang, Michael Q.

    1998-01-01

    Identification of the 5′-end of human genes requires identification of functional promoter elements. In silico identification of those elements is difficult because of the hierarchical and modular nature of promoter architecture. To address this problem, I propose a new stepwise strategy based on initial localization of a functional promoter into a 1- to 2-kb (extended promoter) region from within a large genomic DNA sequence of 100 kb or larger and further localization of a transcriptional start site (TSS) into a 50- to 100-bp (corepromoter) region. Using positional dependent 5-tuple measures, a quadratic discriminant analysis (QDA) method has been implemented in a new program—CorePromoter. Our experiments indicate that when given a 1- to 2-kb extended promoter, CorePromoter will correctly localize the TSS to a 100-bp interval ∼60% of the time. [Figure 3 can be found in its entirety as an online supplement at http://www.genome.org.] PMID:9521935

  7. Sequence based structural characterization and genetic diversity analysis across coding and promoter regions of goat Toll-like receptor 5 gene.

    PubMed

    Goyal, Shubham; Dubey, P K; Sahoo, B R; Mishra, S K; Niranjan, S K; Singh, Sanjeev; Mahajan, Ritu; Kataria, R S

    2014-05-01

    The exploration of candidate immune response genes in goat may be vital in improving further our understanding about the species specific response to pathogens specifically among the ruminants. In this study, approximately 3.7 kb long genomic sequence of Toll-like receptor 5 (TLR5) covering the entire coding and 5'upstream regions of the gene, was characterized in the Indian goat breeds. Sequence analysis revealed a 2577-nucleotide long open reading frame (ORF) of goat TLR5, encoding 858 amino acids from single exon, similar to other ruminants. The domain structure analysis of goat TLR5 showed the presence of 13 leucine rich repeats (LRRs) in extracellular domain (amino acid position 1-634), single transmembrane domain (position 644-666), and a Toll/interleukin-1 receptor (position 692-837) in cytoplasmic domain, similar to other species. A total of 87 putative transcription factor binding sites were observed within the 5' upstream region of TLR5 gene in goat, 106 in cattle, and 103 in buffalo. Sixteen polymorphic sites were observed in goat TLR5 gene, out of which 10 non-synonymous SNPs were in the functionally important regions. However, none of the amino acid substitutions was found to be potentially damaging to the structure and function of the receptor protein. Further, one of the SNPs in the transmembrane region was genotyped by a TETRA-ARMS PCR in 444 goats of nine breeds from different geographical regions and having different utilities. A significant variation in allelic frequencies was observed across the milch and other types of goat breeds. The comparative modeling of goat TLR5 followed by molecular dynamics simulation gave an insight into its 3D structural arrangements. The molecular docking of Salmonella flagellin and TLR5 dimer elucidated LRRNT (N-terminal) to LRR4 as the key flagellin binding domains region in goat TLR5. The study shows that, although being highly conserved among the ruminants, comparatively high variations in goat TLR5 might give

  8. Gene Regions Responding to Skeletal Muscle Atrophy

    NASA Technical Reports Server (NTRS)

    Booth, Frank W.

    1997-01-01

    Our stated specific aims for this project were: 1) Identify the region(s) of the mouse IIb myosin heavy chain (MHC) promoter necessary for in vivo expression in mouse fast-twitch muscle, and 2) Identify the region(s) of the mouse IIb MHC promoter responsive to immobilization in mouse slow-twitch muscle in vivo. We sought to address these specific aims by introducing various MHC IIb promoter/reporter gene constructs directly into the tibialis anterior and gastrocnemius muscles of living mice. Although the method of somatic gene transfer into skeletal muscle by direct injection has been successfully used in our laboratory to study the regulation of the skeletal alpha actin gene in chicken skeletal muscle, we had many difficulties utilizing this procedure in the mouse. Because of the small size of the mouse soleus and the difficulty in obtaining consistent results, we elected not to study this muscle as first proposed. Rather, our MHC IIb promoter deletion experiments were performed in the gastrocnemius. Further, we decided to use hindlimb unloading via tail suspension to induce an upregulation of the MHC IIb gene, rather than immobilization of the hindlimbs via plaster casts. This change was made because tail suspension more closely mimics spaceflight, and this procedure in our lab results in a smaller loss of overall body mass than the mouse hindlimb immobilization procedure. This suggests that the stress level during tail suspension is less than during immobilization. This research has provided an important beginning point towards understanding the molecular regulation of the MHC lIb gene in response to unweighting of skeletal muscle Future work will focus on the regulation of MHC IIb mRNA stability in response to altered loading of skeletal muscle

  9. Lack of association between rs1800795 (-174 G/C) polymorphism in the promoter region of interleukin-6 gene and susceptibility to type 2 diabetes in Isfahan population

    PubMed Central

    Ghavimi, Reza; Sharifi, Mohammadreza; Mohaghegh, Mohammad Ali; Mohammadian, Hossein; Khadempar, Saedeh; Rezaei, Hamzeh

    2016-01-01

    Background: Type 2 diabetes mellitus (T2DM) is an inflammatory autoimmune disease that mostly affects older adults. The etiology of T2DM includes both genetic and environmental factors. rs1800795 (−174 G/C) single nucleotide polymorphism (SNP) linked with autoimmune disorders predispositions, identified by Genome-Wide Association Study among genes, which immunologically related is considerably over signified. The goal of this study was to evaluate the association between rs1800795 (−174 G/C) polymorphisms in the promoter of interleukin-6 (IL-6) gene with susceptibility to T2DM in a subset of the Iranian population. Materials and Methods: In this case–control study, 120 healthy subjects and 120 patients with T2DM were included. Genomic DNA obtained from whole blood samples and the polymerase chain reaction was used to amplify the fragment of interest contain rs1800795 SNP, restriction fragment length polymorphism method was applied for genotyping of the DNA samples with NlaIII as a restriction enzyme. SPSS for Windows software (version 18.0, SPSS, Chicago, IL, USA) was performed for statistical analysis. Results: No significant differences were found between healthy controls and T2DM patients with respect to the frequency distribution of the cytokine gene polymorphism investigated. Odds ratio, adjusted for sex, age, and smoking status has displayed similar outcomes. Conclusion: These results indicated that the rs1800795 SNP is not a susceptibility gene variant for the development of T2DM in the Isfahan population. Further studies using new data on complex transcriptional interactions between IL-6 polymorphic sites are necessary to determine IL-6 haplotype influence on susceptibility to T2DM. PMID:26962520

  10. Molecular cloning and analysis of the Catsper1 gene promoter.

    PubMed

    Mata-Rocha, Minerva; Alvarado-Cuevas, Edith; Hernández-Sánchez, Javier; Cerecedo, Doris; Felix, Ricardo; Hernández-Reyes, Adriana; Tesoro-Cruz, Emiliano; Oviedo, Norma

    2013-05-01

    CatSper channels are essential for hyperactivity of sperm flagellum, progesterone-mediated chemotaxis and oocyte fertilization. Catsper genes are exclusively expressed in the testis during spermatogenesis, but the function and regulation of the corresponding promoter regions are unknown. Here, we report the cloning and characterization of the promoter regions in the human and murine Catsper1 genes. These promoter regions were identified and isolated from genomic DNA, and transcriptional activities were tested in vitro after transfection into human embryonic kidney 293, mouse Sertoli cells 1 and GC-1spg cell lines as well as by injecting plasmids directly into mouse testes. Although the human and murine Catsper1 promoters lacked a TATA box, a well-conserved CRE site was identified. Both sequences may be considered as TATAless promoters because their transcriptional activity was not affected after deletion of TATA box-like sites. Several transcription initiation sites were revealed by RNA ligase-mediated rapid amplification of the cDNA 5'-ends. We also found that the immediate upstream region and the first exon in the human CATSPER1 gene negatively regulate transcriptional activity. In the murine Catsper1 promoter, binding sites for transcription factors SRY, SOX9 and CREB were protected by the presence of nuclear testis proteins in DNAse degradation assays. Likewise, the mouse Catsper1 promoter exhibited transcriptional activity in both orientations and displayed significant expression levels in mouse testis in vivo, whereas the suppression of transcription signals in the promoter resulted in low expression levels. This study, thus, represents the first identification of the transcriptional control regions in the genes encoding the human and murine CatSper channels.

  11. Repetitive sequence variations in the promoter region of the adhesin-encoding gene sabA of Helicobacter pylori affect transcription.

    PubMed

    Harvey, Vivian C; Acio, Catherine R; Bredehoft, Amy K; Zhu, Laurence; Hallinger, Daniel R; Quinlivan-Repasi, Vanessa; Harvey, Samuel E; Forsyth, Mark H

    2014-10-01

    The pathogenesis of diseases elicited by the gastric pathogen Helicobacter pylori is partially determined by the effectiveness of adaptation to the variably acidic environment of the host stomach. Adaptation includes appropriate adherence to the gastric epithelium via outer membrane protein adhesins such as SabA. The expression of sabA is subject to regulation via phase variation in the promoter and coding regions as well as repression by the two-component system ArsRS. In this study, we investigated the role of a homopolymeric thymine [poly(T)] tract -50 to -33 relative to the sabA transcriptional start site in H. pylori strain J99. We quantified sabA expression in H. pylori J99 by quantitative reverse transcription-PCR (RT-PCR), demonstrating significant changes in sabA expression associated with experimental manipulations of poly(T) tract length. Mimicking the length increase of this tract by adding adenines instead of thymines had similar effects, while the addition of other nucleotides failed to affect sabA expression in the same manner. We hypothesize that modification of the poly(T) tract changes DNA topology, affecting regulatory protein interaction(s) or RNA polymerase binding efficiency. Additionally, we characterized the interaction between the sabA promoter region and ArsR, a response regulator affecting sabA expression. Using recombinant ArsR in electrophoretic mobility shift assays (EMSA), we localized binding to a sequence with partial dyad symmetry -20 and +38 relative to the sabA +1 site. The control of sabA expression by both ArsRS and phase variation at two distinct repeat regions suggests the control of sabA expression is both complex and vital to H. pylori infection.

  12. Analysis of the transcriptional regulation of cancer-related genes by aberrant DNA methylation of the cis-regulation sites in the promoter region during hepatocyte carcinogenesis caused by arsenic

    PubMed Central

    Miao, Zhuang; Wu, Lin; Lu, Ming; Meng, Xianzhi; Gao, Bo; Qiao, Xin; Zhang, Weihui; Xue, Dongbo

    2015-01-01

    Liver is the major organ for arsenic methylation metabolism and may be the potential target of arsenic-induced cancer. In this study, normal human liver cell was treated with arsenic trioxide, and detected using DNA methylation microarray. Some oncogenes, tumor suppressor genes, transcription factors (TF), and tumor-associated genes (TAG) that have aberrant DNA methylation have been identified. However, simple functional studies of genes adjacent to aberrant methylation sites cannot well reflect the regulatory relationship between DNA methylation and gene transcription during the pathogenesis of arsenic-induced liver cancer, whereas a further analysis of the cis-regulatory elements and their trans-acting factors adjacent to DNA methylation can more precisely reflect the relationship between them. MYC and MAX (MYC associated factor X) were found to participating cell cycle through a bioinformatics analysis. Additionally, it was found that the hypomethylation of cis-regulatory sites in the MYC promoter region and the hypermethylation of cis-regulatory sites in the MAX promoter region result in the up-regulation of MYC mRNA expression and the down-regulation of MAX mRNA, which increased the hepatocyte carcinogenesis tendency. PMID:26046465

  13. Identification of a new haplotype within the promoter region of the MSTN gene in horses from five of the most common breeds in Poland.

    PubMed

    Stefaniuk, Monika; Kaczor, Urszula; Augustyn, Romana; Gurgul, Artur; Kulisa, Maria; Podstawski, Zenon

    2014-01-01

    Myostatin (GDF-8) encoded by the MSTN gene is a negative regulator of muscle growth and development and belongs to the TGF-β superfamily of secreted growth and differentiation factors. In Thoroughbred horses, an MSTN sequence polymorphism (g.66493737C>T) is associated with optimum race distance. In the present study, a genetic polymorphism of a predicted promoter of the MSTN gene was investigated in 451 horses belonging to five different breeds: Arabian, Thoroughbred, Polish Konik, Hucul and Polish Heavy Draft. Two SNPs located at g.66495826T>C and g.66495696T>C (chr;18 EquCab 2.0) showed three haplotypes previously described: [g.66495826:T, g.66495696:T], [g.66495826:T, g.66495696:C], [g.66495826:C, g.66495696:T] with frequencies 0.877; 0.101; 0.005; respectively. Analysis performed on Polish Heavy Draft indicated the occurrence of a new haplotype [g.6649582626:C, g.66495696:C] with frequency 0.016.

  14. Identification of a new haplotype within the promoter region of the MSTN gene in horses from five of the most common breeds in Poland.

    PubMed

    Stefaniuk, Monika; Kaczor, Urszula; Augustyn, Romana; Gurgul, Artur; Kulisa, Maria; Podstawski, Zenon

    2014-01-01

    Myostatin (GDF-8) encoded by the MSTN gene is a negative regulator of muscle growth and development and belongs to the TGF-β superfamily of secreted growth and differentiation factors. In Thoroughbred horses, an MSTN sequence polymorphism (g.66493737C>T) is associated with optimum race distance. In the present study, a genetic polymorphism of a predicted promoter of the MSTN gene was investigated in 451 horses belonging to five different breeds: Arabian, Thoroughbred, Polish Konik, Hucul and Polish Heavy Draft. Two SNPs located at g.66495826T>C and g.66495696T>C (chr;18 EquCab 2.0) showed three haplotypes previously described: [g.66495826:T, g.66495696:T], [g.66495826:T, g.66495696:C], [g.66495826:C, g.66495696:T] with frequencies 0.877; 0.101; 0.005; respectively. Analysis performed on Polish Heavy Draft indicated the occurrence of a new haplotype [g.6649582626:C, g.66495696:C] with frequency 0.016. PMID:25403076

  15. Possible consequences of the overlap between the CaMV 35S promoter regions in plant transformation vectors used and the viral gene VI in transgenic plants.

    PubMed

    Podevin, Nancy; du Jardin, Patrick

    2012-01-01

    Multiple variants of the Cauliflower mosaic virus 35S promoter (P35S) are used to drive the expression of transgenes in genetically modified plants, for both research purposes and commercial applications. The genetic organization of the densely packed genome of this virus results in sequence overlap between P35S and viral gene VI, encoding the multifunctional P6 protein. The present paper investigates whether introduction of P35S variants by genetic transformation is likely to result in the expression of functional domains of the P6 protein and in potential impacts in transgenic plants. A bioinformatic analysis was performed to assess the safety for human and animal health of putative translation products of gene VI overlapping P35S. No relevant similarity was identified between the putative peptides and known allergens and toxins, using different databases. From a literature study it became clear that long variants of the P35S do contain an open reading frame, when expressed, might result in unintended phenotypic changes. A flowchart is proposed to evaluate possible unintended effects in plant transformants, based on the DNA sequence actually introduced and on the plant phenotype, taking into account the known effects of ectopically expressed P6 domains in model plants.

  16. Buckwheat (Fagopyrum esculentum Moench) FeMT3 gene in heavy metal stress: protective role of the protein and inducibility of the promoter region under Cu(2+) and Cd(2+) treatments.

    PubMed

    Nikolić, Dragana B; Samardzić, Jelena T; Bratić, Ana M; Radin, Ivan P; Gavrilović, Srdjan P; Rausch, Thomas; Maksimović, Vesna R

    2010-03-24

    The protective role in vivo of buckwheat metallothionein type 3 (FeMT3) during metal stress and the responsiveness of its promoter to metal ions were examined. Increased tolerance to heavy metals of FeMT3 producing Escherichia coli and cup1(Delta) yeast cells was detected. The defensive ability of buckwheat MT3 during Cd and Cu stresses was also demonstrated in Nicotiana debneyii leaves transiently expressing FeMT3. In contrast to phytochelatins, the cytoplasmatic localization of FeMT3 was not altered under heavy metal stress. Functional analysis of the corresponding promoter region revealed extremely high inducibility upon Cu(2+) and Cd(2+) treatments. The confirmed defense ability of FeMT3 protein in vivo and the great responsiveness of its promoter during heavy metal exposure make this gene a suitable candidate for biotechnological applications.

  17. Analysis of the Mycobacterium tuberculosis 85A antigen promoter region.

    PubMed Central

    Kremer, L; Baulard, A; Estaquier, J; Content, J; Capron, A; Locht, C

    1995-01-01

    A mycobacterial expression-secretion vector was constructed in which the Escherichia coli alkaline phosphatase (phoA) reporter gene was placed under the control of the Mycobacterium tuberculosis 85A promoter and secretion signal sequences. In recombinant Mycobacterium smegmatis and Mycobacterium bovis BCG, PhoA activity could readily be detected on the mycobacterial cell surface and in the culture supernatant, indicating that the 85A signals can drive heterologous expression and secretion in both species. In contrast to the mycobacteria, the 85A promoter did not function in E. coli. We mapped the promoter region by progressive deletions using BAL 31 exonuclease and by primer extension analysis. Insertion and deletion mutations within the promoter region indicated that, unlike most E. coli promoters but similar to Streptomyces promoters, the position of the putative -35 region was not critical for efficient promoter activity. In addition, we investigated the ability of the identified signals to drive the production and secretion in BCG of recombinant Schistosoma mansoni glutathione S-transferase (Sm28GST), a protective antigen against schistosomiasis. BALB/c mice immunized with the recombinant BCG by a single dose exhibited a weak but specific T-cell response to Sm28GST. PMID:7836298

  18. Cloning, characterization and promoter analysis of S-RNase gene promoter from Chinese pear (Pyrus pyrifolia).

    PubMed

    Liu, Xue-ying; Wuyun, Ta-na; Zeng, Hong-yan

    2012-09-01

    The 5'-flanking region of the S(12)-, S(13)-, S(21)-RNase with a length of 854 bp, 1448 bp and 1137 bp were successfully isolated by TAIL-PCR from genomic DNA from 'Jinhua', 'Maogong' (Pyrus pyrifolia) and 'Yali' (Pyrus bretschneideri) genomic DNA. Sequence alignment and analysis of S(13)-, S(12)-, S(21)-RNase gene promoter sequences with S(2)-, S(3)-, S(4)-, S(5)-RNase 5'-flanking sequences indicated that a homology region of about 240 bp exists in the regions just upstream of the putative TATA boxes of the seven Chinese/Japanese pear S-RNase genes. Phylogenetic tree suggests that the homology region between the Chinese/Japanese pear and apple S-RNase gene promoter regions reflects the divergence of S-RNase gene was formed before the differentiation of subfamilies. Full length and a series of 5'-deletion fragments-GUS fusions were constructed and introduced into Arabidopsis thaliana plants. GUS activity were detected in S(12)-pro-(1 to 5)-GUS-pBll01.2 transgenic pistils and progressively decreased from S(12)-pro-1-GUS-pBI l01.2 to S(12)-pro-5-GUS-pBll01.2. No GUS activity was detected in S(12)-pro-6-GUS-pBll01.2 transgenic pistil and other tissues of non-transformants and all transgenic plants. The result suggested S(12)-RNase promoter is pistil specific expression promoter.

  19. Promoter region of the bovine growth hormone receptor gene: single nucleotide polymorphism discovery in cattle and association with performance in Brangus bulls.

    PubMed

    Garrett, A J; Rincon, G; Medrano, J F; Elzo, M A; Silver, G A; Thomas, M G

    2008-12-01

    Expression of the GH receptor (GHR) gene and its binding with GH is essential for growth and fat metabolism. A GT microsatellite exists in the promoter of bovine GHR segregating short (11 bp) and long (16 to 20 bp) allele sequences. To detect SNP and complete an association study of genotype to phenotype, we resequenced a 1,195-bp fragment of DNA including the GT microsatellite and exon 1A. Resequencing was completed in 48 familialy unrelated Holstein, Jersey, Brown Swiss, Simmental, Angus, Brahman, and Brangus cattle. Nine SNP were identified. Phylogeny analyses revealed minor distance (i.e., <5%) in DNA sequence among the 5 Bos taurus breeds; however, sequence from Brahman cattle averaged 27.4 +/- 0.07% divergence from the Bos taurus breeds, whereas divergence of Brangus was intermediate. An association study of genotype to phenotype was completed with data from growing Brangus bulls (n = 553 from 96 sires) and data from 4 of the SNP flanking the GT microsatellite. These SNP were found to be in Hardy-Weinberg equilibrium and in phase based on linkage disequilibrium analyses (r(2) = 0.84 and D'= 0.92). An A/G tag SNP was identified (ss86273136) and was located in exon 1A, which began 88 bp downstream from the GT microsatellite. Minor allele frequency of the tag SNP was greater than 10%, and Mendelian segregation was verified in 3 generation pedigrees. The A allele was derived from Brahman, and the G allele was derived from Angus. This tag SNP genotype was a significant effect in analyses of rib fat data collected with ultrasound when bulls were ~365 d of age. Specifically, bulls of the GG genotype had 6.1% more (P = 0.0204) rib fat than bulls of the AA and AG genotypes, respectively. Tag SNP (ss86273136), located in the promoter of GHR, appears to be associated with a measure of corporal fat in Bos taurus x Bos indicus composite cattle.

  20. The -5 A/G single-nucleotide polymorphism in the core promoter region of MT2A and its effect on allele-specific gene expression and Cd, Zn and Cu levels in laryngeal cancer.

    PubMed

    Starska, Katarzyna; Krześlak, Anna; Forma, Ewa; Olszewski, Jurek; Morawiec-Sztandera, Alina; Aleksandrowicz, Paweł; Lewy-Trenda, Iwona; Bryś, Magdalena

    2014-10-15

    Metallothioneins (MTs) are low molecular weight, cysteine-rich heavy metal-binding proteins which participate in the mechanisms of Zn homeostasis, and protect against toxic metals. MTs contain metal-thiolate cluster groups and suppress metal toxicity by binding to them. The aim of this study was to determine the -5 A/G (rs28366003) single-nucleotide polymorphism (SNP) in the core promoter region of the MT2A gene and to investigate its effect on allele-specific gene expression and Cd, Zn and Cu content in squamous cell laryngeal cancer (SCC) and non-cancerous laryngeal mucosa (NCM) as a control. The MT2A promoter region -5 A/G SNP was determined by restriction fragment length polymorphism using 323 SCC and 116 NCM. MT2A gene analysis was performed by quantitative real-time PCR. The frequency of A allele carriage was 94.2% and 91.8% in SCC and NCM, respectively, while G allele carriage was detected in 5.8% and 8.2% of SCC and NCM samples, respectively. As a result, a significant association was identified between the -5 A/G SNP in the MT2A gene with mRNA expression in both groups. Metal levels were analyzed by flame atomic absorption spectrometry. The significant differences were identified between A/A and both the A/G and G/G genotypes, with regard to the concentration of the contaminating metal. The Spearman rank correlation results showed that the MT2A expression and Cd, Zn, Cu levels were negatively correlated. Results obtained in this study suggest that -5 A/G SNP in MT2A gene may have an effect on allele-specific gene expression and accumulation of metal levels in laryngeal cancer.

  1. TNIP1 reduction of HSPA6 gene expression occurs in promoter regions lacking binding sites for known TNIP1-repressed transcription factors.

    PubMed

    Ramirez, Vincent P; Krueger, Winfried; Aneskievich, Brian J

    2015-01-25

    TNFα-induced protein 3-interacting protein 1 (TNIP1) represses signaling pathways initiated by specific nuclear and transmembrane receptors. This effect results in reduced activity of distinct transcription factors such as retinoic acid receptors (RAR), peroxisome-proliferator-activated receptors (PPAR), and NFκB. TNIP1-null and TNIP1-knockin defective for ubiquitin-binding mice show increased liver apoptosis, and enlarged spleen and lymph nodes, respectively. To complement current knowledge of TNIP1's broad physiologic functions as interpreted from in vivo studies and specific expression consequences from transcription factor repression, we determined effects of excess TNIP1 on global gene regulation. Following experimentally increased expression of TNIP1 in cultured keratinocytes, our gene expression microarray analysis not only confirmed TNIP1's association in previously known pathways and functions but also found a novel TNIP1-regulated pathway - the cell stress response. Under standard culture conditions, expression of several heat shock proteins, including HSPA1A, HSPA6, DNAJA1 and DNAJB1, was reduced. In heat-stressed conditions, differential regulation of HSPA1A and HSPA6 was observed, where only HSPA6 expression was reduced after heat-shock. Using HSPA6 as a model to elucidate the mechanism of the TNIP1-mediated HSP repression, we determined that TNIP1 likely represses HSPs through factors other than RAR, PPAR or NFκB despite the presence of these factors' binding sites in the HSPA6 promoter. These results indicate that regulation of HSPs may be through a yet unknown TNIP1-associated pathway. Additionally, these results suggest that TNIP1's reduction of HSP expression levels could negatively impact HSP chaperone capacity or their participation in the cell stress response.

  2. Universal light-switchable gene promoter system

    DOEpatents

    Quail, Peter H.; Huq, Enamul; Tepperman, James; Sato, Sae

    2005-02-22

    An artificial promoter system that can be fused upstream of any desired gene enabling reversible induction or repression of the expression of the gene at will in any suitable host cell or organisms by light is described. The design of the system is such that a molecule of the plant photoreceptor phytochrome is targeted to the specific DNA binding site in the promoter by a protein domain that is fused to the phytochrome and that specifically recognizes this binding site. This bound phytochrome, upon activation by light, recruits a second fusion protein consisting of a protein that binds to phytochrome only upon light activation and a transcriptional activation domain that activates expression of the gene downstream of the promoter.

  3. Characterization of a barley Rubisco activase gene promoter

    SciTech Connect

    Strickland, J.A.; Rundle, S.J.; Zielinski, R. )

    1990-05-01

    Barley Rubisco Activase (Rca) is a nuclear encoded chloroplast enzyme that activates Rubisco to catalytic competence. Rca mRNA accumulation in barley is light-regulated; the 5{prime}-flanking region of a highly expressed barley Rca gene (HvRca-1) contains several sequence motifs similar to those found in the promoter of other light-regulated, nuclear genes. We have characterized the cis-acting regulatory regions of HvRca-1 by deletion analysis of the 5{prime} flanking region of a cloned gene. These constructs have been assayed in vitro by gel mobility shift assays, as well as by DNA footprinting. Putative regulatory sequences detected in vitro have also been tested in vivo by constructing chimeric genes consisting of deletion mutant promoters fused to a promoterless {beta}-glucuronidase reporter gene. Comparison of results obtained from complimentary parallel in vitro and in vivo assays of identical promoter deletions have provided information on cis-acting regulatory regions of HvRca-1.

  4. Genistein mediates the selective radiosensitizing effect in NSCLC A549 cells via inhibiting methylation of the keap1 gene promoter region

    PubMed Central

    Liu, Xiongxiong; Sun, Chao; Liu, Bingtao; Jin, Xiaodong; Li, Ping; Zheng, Xiaogang; Zhao, Ting; Li, Feifei; Li, Qiang

    2016-01-01

    Non-small cell lung cancer (NSCLC) cells often possess a hypermethylated Keap1 promoter, which decreases Keap1 mRNA and protein expression levels, thus impairing the Nrf2-Keap1 pathway and thereby leading to chemo- or radio-resistance. In this study, we showed that genistein selectively exhibited a radiosensitizing effect on NSCLC A549 cells but not on normal lung fibroblast MRC-5 cells. Genistein caused oxidative stress in A549 cells rather than MRC-5 cells, as determined by the oxidation of the ROS-sensitive probe DCFH-DA and oxidative damage marked by MDA, PCO or 8-OHdG content. In A549 instead of MRC-5 cells, genistein reduced the level of methylation in the Keap1 promoter region, leading to an increased mRNA expression, thus effectively inhibited the transcription of Nrf2 to the nucleus, which suppressed the Nrf2-dependent antioxidant and resulted in the upregulation of ROS. Importantly, when combined with radiation, genistein further increased the ROS levels in A549 cells whereas decreasing the radiation-induced oxidative stress in MRC-5 cells, possibly via increasing the expression levels of Nrf2, GSH and HO-1. Moreover, radiation combined with genistein significantly increased cell apoptosis in A549 but not MRC-5 cells. Together, the results herein show that the intrinsic difference in the redox status of A549 and MRC-5 cells could be the target for genistein to selectively sensitize A549 cells to radiation, thereby leading to an increase in radiosensitivity for A549 cells. PMID:27029077

  5. Computational Analyses of Simple Sequence Repeats on Human Tissue Specific Genes Promoters

    NASA Astrophysics Data System (ADS)

    FeiFei, Zhao; XiuJun, Gong; XinMi, Liu; LiFeng, Dong

    Promoter region of gene closely related with tissue specific expression and SSRs (simple sequence repeats) have been shown to have a variety of effects on an organism. This paper used a heuristic method to find SSRs and compared the most frequently SSRs on promoter region of both human tissues specific genes and human housekeeping genes. We used kidney and testis tissue as examples to show the final results. Especially, we found that (AGG)n is kidney specific SSR and (GCG)n is testis specific SSR. We also analyzed the SSRs frequency density distribution on different promoter regions of both tissue specific genes and housekeeping genes, and we found the density of housekeeping genes on core-promoter region is much higher than on other promoter regions.

  6. Promoter region of the bovine growth hormone receptor gene: single nucleotide polymorphism discovery in cattle and association with performance in Brangus bulls.

    PubMed

    Garrett, A J; Rincon, G; Medrano, J F; Elzo, M A; Silver, G A; Thomas, M G

    2008-12-01

    Expression of the GH receptor (GHR) gene and its binding with GH is essential for growth and fat metabolism. A GT microsatellite exists in the promoter of bovine GHR segregating short (11 bp) and long (16 to 20 bp) allele sequences. To detect SNP and complete an association study of genotype to phenotype, we resequenced a 1,195-bp fragment of DNA including the GT microsatellite and exon 1A. Resequencing was completed in 48 familialy unrelated Holstein, Jersey, Brown Swiss, Simmental, Angus, Brahman, and Brangus cattle. Nine SNP were identified. Phylogeny analyses revealed minor distance (i.e., <5%) in DNA sequence among the 5 Bos taurus breeds; however, sequence from Brahman cattle averaged 27.4 +/- 0.07% divergence from the Bos taurus breeds, whereas divergence of Brangus was intermediate. An association study of genotype to phenotype was completed with data from growing Brangus bulls (n = 553 from 96 sires) and data from 4 of the SNP flanking the GT microsatellite. These SNP were found to be in Hardy-Weinberg equilibrium and in phase based on linkage disequilibrium analyses (r(2) = 0.84 and D'= 0.92). An A/G tag SNP was identified (ss86273136) and was located in exon 1A, which began 88 bp downstream from the GT microsatellite. Minor allele frequency of the tag SNP was greater than 10%, and Mendelian segregation was verified in 3 generation pedigrees. The A allele was derived from Brahman, and the G allele was derived from Angus. This tag SNP genotype was a significant effect in analyses of rib fat data collected with ultrasound when bulls were ~365 d of age. Specifically, bulls of the GG genotype had 6.1% more (P = 0.0204) rib fat than bulls of the AA and AG genotypes, respectively. Tag SNP (ss86273136), located in the promoter of GHR, appears to be associated with a measure of corporal fat in Bos taurus x Bos indicus composite cattle. PMID:18676722

  7. Automated liquid culture system misses isoniazid heteroresistance in Mycobacterium tuberculosis isolates with mutations in the promoter region of the inhA gene.

    PubMed

    Zhang, Z; Lu, J; Wang, Y; Pang, Y; Zhao, Y

    2015-03-01

    Heteroresistance in Mycobacterium tuberculosis isolates remains the major challenge for phenotypic drug susceptibility testing (DST) methods to detect drug resistance. The aim of this study was to investigate the abilities of phenotypic DST methods to identify the isoniazid (INH) heteroresistance in M. tuberculosis. We found that the broth dilution method was able to detect INH resistance if 0.5 % resistant bacteria with mutations in the katG and oxyR-ahpC regions were present, while the detection limit ranged from 1 to 10 % for the INH-resistant strains harboring inhA mutations, which was associated with the different mutant types. Additionally, MGIT DST was able to find the recommended 1 % INH resistance due to katG mutations. In contrast, MGIT DST detected resistance in suspensions with 20 % resistant bacteria with inhA mutations. Statistical analysis revealed that the ability of the broth dilution method to detect heteroresistance was better than that of the MGIT DST (p = 0.004). When we further pairwise compared the two methods for detecting heteroresistance according to different mutant loci, the broth dilution method found more heteroresistance due to inhA mutations than MGIT DST (p = 0.001), while the differences for katG and oxyR-ahpC mutations were both not statistically significant (p > 0.05). In conclusion, our findings demonstrate that MGIT DST fails to detect INH heteroresistance in M. tuberculosis isolates with mutations in the promoter region of inhA. In addition, the broth dilution method is more sensitive than MGIT DST in finding INH heteroresistance, indicating that this method may serve as an alternative method to detect the heteroresistance of M. tuberculosis.

  8. Pseudomonas aeruginosa lasI/rhlI quorum sensing genes promote phagocytosis and aquaporin 9 redistribution to the leading and trailing regions in macrophages

    PubMed Central

    Holm, Angelika; Karlsson, Thommie; Vikström, Elena

    2015-01-01

    Pseudomonas aeruginosa controls production of its multiple virulence factors and biofilm development via the quorum sensing (QS) system. QS signals also interact with and affect the behavior of eukaryotic cells. Host water homeostasis and aquaporins (AQP) are essential during pathological conditions since they interfere with the cell cytoskeleton and signaling, and hereby affect cell morphology and functions. We investigated the contribution of P. aeruginosa QS genes lasI/rhlI to phagocytosis, cell morphology, AQP9 expression, and distribution in human macrophages, using immunoblotting, confocal, and nanoscale imaging. Wild type P. aeruginosa with a functional QS system was a more attractive prey for macrophages than the lasI/rhlI mutant lacking the production of QS molecules, 3O-C12-HSL, and C4-HSL, and associated virulence factors. The P. aeruginosa infections resulted in elevated AQP9 expression and relocalization to the leading and trailing regions in macrophages, increased cell area and length; bacteria with a functional QS system lasI/rhlI achieved stronger responses. We present evidence for a new role of water fluxes via AQP9 during bacteria–macrophage interaction and for the QS system as an important stimulus in this process. These novel events in the interplay between P. aeruginosa and macrophages may influence on the outcome of infection, inflammation, and development of disease. PMID:26388857

  9. The promoter of Alzheimer's disease amyloid A4 precursor gene.

    PubMed

    Salbaum, J M; Weidemann, A; Lemaire, H G; Masters, C L; Beyreuther, K

    1988-09-01

    The promoter of the gene for the human precursor of Alzheimer's disease A4 amyloid protein (PAD gene) resembles promoters of housekeeping genes. It lacks a typical TATA box and shows a high GC content of 72% in a DNA region that confers promoter activity to a reporter gene in an in vivo assay. Transcription initiates at multiple sites. Sequences homologous to the consensus binding sites of transcription factor AP-1 and the heat shock control element binding protein were found upstream of the RNA start sites. Six copies of a 9-bp-long GC-rich element are located between positions -200 and -100. A protein--DNA interaction could be mapped to this element. The 3.8 kb of the 5' region of the PAD gene include two Alu-type repetitive sequences. These findings suggest that four mechanisms may participate in the regulation of the PAD gene and could be of relevance for the progression of amyloid deposition in Alzheimer's disease.

  10. The − 5 A/G single-nucleotide polymorphism in the core promoter region of MT2A and its effect on allele-specific gene expression and Cd, Zn and Cu levels in laryngeal cancer

    SciTech Connect

    Starska, Katarzyna; Krześlak, Anna; Forma, Ewa; Morawiec-Sztandera, Alina; Aleksandrowicz, Paweł; Lewy-Trenda, Iwona; and others

    2014-10-15

    Metallothioneins (MTs) are low molecular weight, cysteine-rich heavy metal-binding proteins which participate in the mechanisms of Zn homeostasis, and protect against toxic metals. MTs contain metal-thiolate cluster groups and suppress metal toxicity by binding to them. The aim of this study was to determine the − 5 A/G (rs28366003) single-nucleotide polymorphism (SNP) in the core promoter region of the MT2A gene and to investigate its effect on allele-specific gene expression and Cd, Zn and Cu content in squamous cell laryngeal cancer (SCC) and non-cancerous laryngeal mucosa (NCM) as a control. The MT2A promoter region − 5 A/G SNP was determined by restriction fragment length polymorphism using 323 SCC and 116 NCM. MT2A gene analysis was performed by quantitative real-time PCR. The frequency of A allele carriage was 94.2% and 91.8% in SCC and NCM, respectively, while G allele carriage was detected in 5.8% and 8.2% of SCC and NCM samples, respectively. As a result, a significant association was identified between the − 5 A/G SNP in the MT2A gene with mRNA expression in both groups. Metal levels were analyzed by flame atomic absorption spectrometry. The significant differences were identified between A/A and both the A/G and G/G genotypes, with regard to the concentration of the contaminating metal. The Spearman rank correlation results showed that the MT2A expression and Cd, Zn, Cu levels were negatively correlated. Results obtained in this study suggest that − 5 A/G SNP in MT2A gene may have an effect on allele-specific gene expression and accumulation of metal levels in laryngeal cancer. - Highlights: • MT2A gene expression and metal content in laryngeal cancer tissues • Association between SNP (rs28366003) and expression of MT2A • Significant associations between the SNP and Cd, Zn and Cu levels • Negative correlation between MT2A gene expression and Cd, Zn and Cu levels.

  11. Structural properties of prokaryotic promoter regions correlate with functional features.

    PubMed

    Meysman, Pieter; Collado-Vides, Julio; Morett, Enrique; Viola, Roberto; Engelen, Kristof; Laukens, Kris

    2014-01-01

    The structural properties of the DNA molecule are known to play a critical role in transcription. In this paper, the structural profiles of promoter regions were studied within the context of their diversity and their function for eleven prokaryotic species; Escherichia coli, Klebsiella pneumoniae, Salmonella Typhimurium, Pseudomonas auroginosa, Geobacter sulfurreducens Helicobacter pylori, Chlamydophila pneumoniae, Synechocystis sp., Synechoccocus elongates, Bacillus anthracis, and the archaea Sulfolobus solfataricus. The main anchor point for these promoter regions were transcription start sites identified through high-throughput experiments or collected within large curated databases. Prokaryotic promoter regions were found to be less stable and less flexible than the genomic mean across all studied species. However, direct comparison between species revealed differences in their structural profiles that can not solely be explained by the difference in genomic GC content. In addition, comparison with functional data revealed that there are patterns in the promoter structural profiles that can be linked to specific functional loci, such as sigma factor regulation or transcription factor binding. Interestingly, a novel structural element clearly visible near the transcription start site was found in genes associated with essential cellular functions and growth in several species. Our analyses reveals the great diversity in promoter structural profiles both between and within prokaryotic species. We observed relationships between structural diversity and functional features that are interesting prospects for further research to yet uncharacterized functional loci defined by DNA structural properties.

  12. Cloning of a marine cyanobacterial promoter for foreign gene expression using a promoter probe vector

    SciTech Connect

    Sode, Koji; Hatano, Naoaki; Tatara, Masahiro

    1996-06-01

    A marine cyanobacterial promoter was cloned to allow efficient foreign gene expression. This was carried out using chloramphenicol acetyl transferase (CAT) as a marker protein. For rapid and simple measurement of CAT activity, a method based on a fluorescently labeled substrate was improved by utilizing HPLC equipped with a flow-through fluorescent spectrophotometer. This method was used in conjunction with a newly constructed promoter probe vector. Cyanobacterial transformants, harboring plasmid containing a cloned 2-kbp marine cyanobacterial genomic fragment, showed a 10-fold higher CAT activity, compared with that achieved using the kanamycin-resistant gene promoter. From the sequence analysis of the cloned fragment, a putative promoter region was found. 20 refs., 7 figs., 2 tabs.

  13. Promoter polymorphism T-786C, 894G→T at exon 7 of endothelial nitric oxide synthase gene are associated with risk of osteoporosis in Sichuan region male residents

    PubMed Central

    Gu, Zuchao; Zhang, Yu; Qiu, Guixing

    2015-01-01

    Objective: To investigate the association between genetic polymorphism of T-786C in promoter region, 894G→T at exon 7 of endothelial nitric oxide synthase (eNOS) gene and osteoporosis (OP) disease. Method: The genotypes of 350 patients with osteoporosis and 350 healthy controls were detected by polymerase chain reaction (PCR) and DNA sequencing. The allele ratios and genotype distributions in the patients and controls were assessed using the Pearson χ2-test. Odds ratios (OR) with two tailed P-values and 95% confidence intervals (CI) were calculated as a measure of the association of the eNOS genotypes with OP. Result: the C allele distribution frequency of T-786C eNOS gene in OP group (8.5%) was significantly higher than that in control group (3.9%), relative risk (OR) of OP associated with the CC genotype was 2.68 (95% CI, 0.92 to 1.37). The T allele frequency of 894G→T at exon 7 in eNOS gene in OP group (11.5%) was also significantly higher than that in control group (5.2%), OR of OP associated with the TT genotype was 2.60 (all P<0.05). Conclusion: The analysis results indicated that both T-786C in promoter region and 894G→T at exon 7 of eNOS gene might be genetic predisposal factors of OP, these polymorphisms may be independently or synergic with other loci to have an impact on the incidence of OP. PMID:26823879

  14. A single nucleotide polymorphism in the promoter region of river buffalo stearoyl CoA desaturase gene (SCD) is associated with milk yield.

    PubMed

    Pauciullo, Alfredo; Cosenza, Gianfranco; Steri, Roberto; Coletta, Angelo; La Battaglia, Antonio; Di Berardino, Dino; Macciotta, Nicolò P P; Ramunno, Luigi

    2012-11-01

    An association study between the milk yield trait and the stearoyl-CoA desaturase (SCD) polymorphism (g.133A > C) in Italian Mediterranean river buffalo was carried out. A full characterization of the river buffalo SCD promoter region was presented. Genotyping information was provided and a quick method for allelic discrimination was developed. The frequency of the C allele was 0·16. Test-day (TD) records (43 510) of milk production belonging to 226 lactations of 169 buffalo cows were analysed with a mixed linear model in order to estimate the effect of g.133A > C genotype, as well as the effect of parity and calving season. The SCD genotype was significantly associated with milk yield (P = 0·02). The genotype AC showed an over-dominance effect with an average daily milk yield approximately 2 kg/d higher than CC buffaloes. Such a difference represents about 28% more milk/d. The effect of the genotype was constant across lactation stages. The contribution of SCD genotype (r(2)SCD) to the total phenotypic variance in milk yield was equal to 0·12. This report is among the first indications of genetic association between a trait of economic importance in river buffalo. Although such results need to be confirmed with large-scale studies in the same and other buffalo populations, they might offer useful indications for the application of MAS programmes in river buffalo and in the future they might be of great economic interest for the river buffalo dairy industry. PMID:22994977

  15. Pollen- and anther-specific chi promoters from petunia: tandem promoter regulation of the chiA gene.

    PubMed

    van Tunen, A J; Mur, L A; Brouns, G S; Rienstra, J D; Koes, R E; Mol, J N

    1990-05-01

    We have analyzed the spatial and temporal activities of chalcone flavanone isomerase (chi) A and B gene promoters from petunia. To study the tandem promoter regulation of chiA, various chiA promoter fragments were fused with the beta-glucuronidase (GUS) reporter gene. Analysis of transgenic plants containing these chimeric genes provided definitive proof that the chiA coding region is regulated by two distinct promoters (designated PA1 and PA2). We also showed that both promoters can function independently and that the chiA PA1 promoter is expressed in limb (epidermal and parenchyma cells), tube (inner epidermal and parenchyma cells), seed (seed coat, endosperm, and embryo), sepal, leaf, and stem. The use of chiA and chiB promoters in the regulation of anther- and pollen-specific gene expression has been studied. By analyzing transgenic plants containing chimeric genes consisting of chiA and B promoter fragments and the GUS reporter gene, we were able to identify a 0.44-kilobase chiA PA2 promoter fragment that drives pollen-specific gene expression and a 1.75-kilobase chiB PB promoter fragment that confers anther-specific (pollen and tapetum cells) expression to the GUS gene.

  16. In vitro mapping of Myotonic Dystrophy (DM) gene promoter

    SciTech Connect

    Storbeck, C.J.; Sabourin, L.; Baird, S.

    1994-09-01

    The Myotonic Dystrophy Kinase (DMK) gene has been cloned and shared homology to serine/threonine protein kinases. Overexpression of this gene in stably transfected mouse myoblasts has been shown to inhibit fusion into myotubes while myoblasts stably transfected with an antisense construct show increased fusion potential. These experiments, along with data showing that the DM gene is highly expressed in muscle have highlighted the possibility of DMK being involved in myogenesis. The promoter region of the DM gene lacks a consensus TATA box and CAAT box, but harbours numerous transcription binding sites. Clones containing extended 5{prime} upstream sequences (UPS) of DMK only weakly drive the reporter gene chloramphenicol acetyl transferase (CAT) when transfected into C2C12 mouse myoblasts. However, four E-boxes are present in the first intron of the DM gene and transient assays show increased expression of the CAT gene when the first intron is present downstream of these 5{prime} UPS in an orientation dependent manner. Comparison between mouse and human sequence reveals that the regions in the first intron where the E-boxes are located are highly conserved. The mapping of the promoter and the importance of the first intron in the control of DMK expression will be presented.

  17. Identification of polymorphisms in the promoter region of the bovine heat shock protein gene and associations with bull calf weaning weight

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Our objective was to evaluate the relationship between genotypic variation of the bovine HSP-70 promoter and bull calf weaning weights and serum concentrations of HSP-70 at weaning. Blood samples were collected from 33 crossbred bull calves. Calves were sired by Angus bulls and had Brahman-cross dam...

  18. ABERRANT PROMOTER METHYLATION OF MULTIPLE GENES IN SPUTUM FROM INDIVIDUALS EXPOSED TO SMOKY COAL EMISSIONS

    EPA Science Inventory

    Aberrant methylation in the promoter region of cancer-related genes leads to gene transcriptional inactivation and plays an integral role in lung tumorigenesis. Recent studies demonstrated that promoter methylation was detected not only in lung tumors from patients with lung canc...

  19. Conditional promoters for analysis of essential genes in Zymoseptoria tritici.

    PubMed

    Kilaru, S; Ma, W; Schuster, M; Courbot, M; Steinberg, G

    2015-06-01

    Development of new fungicides, needed for sustainable control of fungal plant pathogens, requires identification of novel anti-fungal targets. Essential fungal-specific proteins are good candidates, but due to their importance, gene deletion mutants are not viable. Consequently, their cellular role often remains elusive. This hindrance can be overcome by the use of conditional mutants, where expression is controlled by an inducible/repressible promoter. Here, we introduce 5 inducible/repressible promoter systems to study essential genes in the wheat pathogen Zymoseptoria tritici. We fused the gene for enhanced green-fluorescent protein (egfp) to the promoter region of Z. tritici nitrate reductase (Pnar1; induced by nitrogen and repressed by ammonium), 1,4-β-endoxylanase A (Pex1A; induced by xylose and repressed by maltodextrin), l-arabinofuranosidase B (PlaraB; induced by arabinose and repressed by glucose), galactose-1-phosphate uridylyltransferase 7 (Pgal7; induced by galactose and repressed by glucose) and isocitrate lyase (Picl1; induced by sodium acetate and repressed by glucose). This was followed by quantitative analysis of cytoplasmic reporter fluorescence under induced and repressed conditions. We show that Pnar1, PlaraB and Pex1A drive very little or no egfp expression when repressed, but induce moderate protein production when induced. In contrast, Pgal7 and Picl1 show considerable egfp expression when repressed, and were strongly induced in the presence of their inducers. Normalising the expression levels of all promoters to that of the α-tubulin promoter Ptub2 revealed that PlaraB was the weakest promoter (∼20% of Ptub2), whereas Picl1 strongly expressed the reporter (∼250% of Ptub2). The use of these tools promises a better understanding of essential genes, which will help developing novel control strategies that protect wheat from Z. tritici. PMID:26092803

  20. Association of the 5-HTT gene-linked promoter region (5-HTTLPR) polymorphism with psychiatric disorders: review of psychopathology and pharmacotherapy

    PubMed Central

    Kenna, George A; Roder-Hanna, Nick; Leggio, Lorenzo; Zywiak, William H; Clifford, James; Edwards, Steven; Kenna, John A; Shoaff, Jessica; Swift, Robert M

    2012-01-01

    Serotonin (5-HT) regulates important biological and psychological processes including mood, and may be associated with the development of several psychiatric disorders. An association between psychopathology and genes that regulate 5-HT neurotransmission is a robust area of research. Identification of the genes responsible for the predisposition, development, and pharmacological response of various psychiatric disorders is crucial to the advancement of our understanding of their underlying neurobiology. This review highlights research investigating 5-HT transporter (5-HTTLPR) polymorphism, because studies investigating the impact of the 5-HTTLPR polymorphism have demonstrated significant associations with many psychiatric disorders. Decreased transcriptional activity of the S allele (“risk allele”) may be associated with a heightened amygdala response leading to anxiety-related personality traits, major depressive disorder, suicide attempts, and bipolar disorder. By contrast, increased transcriptional activity of the L allele is considered protective for depression but is also associated with completed suicide, nicotine dependence, and attention deficit hyperactivity disorder. For some disorders, such as post-traumatic stress disorder and major depressive disorder, the research suggests that treatment response may vary by allele (such as an enhanced response to serotonin specific reuptake inhibitors in patients with major depressive disorder and post-traumatic stress disorder with L alleles), and for alcohol dependence, the association and treatment for S or L alleles may vary with alcoholic subtype. While some studies suggest that 5-HTTLPR polymorphism can moderate the response to pharmacotherapy, the association between 5-HTTLPR alleles and therapeutic outcomes is inconsistent. The discovery of triallelic 5-HTTLPR alleles (LA/LG/S) may help to explain some of the conflicting results of many past association studies, while concurrently providing more

  1. Functional study of the equine beta-casein and kappa-casein gene promoters.

    PubMed

    Lenasi, Tina; Kokalj-Vokac, Nadja; Narat, Mojca; Baldi, Antonella; Dovc, Peter

    2005-01-01

    Casein genes are expressed in a tissue-specific and highly coordinated manner. The main goals of casein gene promoter studies are to unravel cis- and trans-acting factors involved in the complex signalling pathway controlling milk production, and to explore the possibility of using these promoters for tissue-specific production of heterologous proteins in the mammary gland. Here we present a comparative study of the equine beta-casein and kappa-casein gene proximal promoters. In order to confirm the assumption that in the horse, as in other mammalian species, casein genes are organized in a cluster located on a single chromosome, we performed in situ hybridization of pro-metaphase chromosomes with two BAC clones containing different equine casein genes. Sequence analysis of the beta-casein and kappa-casein gene proximal promoters revealed binding sites for activators (STAT5, GRE, NF1, MAF) and repressors (YY1, PMF), characteristic for casein genes. The alignments of casein gene promoters revealed the highest sequence identity in the proximal promoter region between the equine and human beta-casein gene promoters. We directly compared the activity of equine beta-casein and kappa-casein gene promoters in vitro using bovine mammary gland cell line BME-UV1. In this system, the kappa-casein gene proximal promoter activated the reporter gene expression more efficiently than the beta-casein gene promoter of approximately the same length. The 810 bp of beta-casein promoter activated the reporter gene expression more efficiently than the long fragment (1920 bp) and the 1206 bp fragment of the same promoter, which included also 396 bp of 5' UTR.

  2. A further analysis of the relationship between yellow ripe-fruit color and the capsanthin-capsorubin synthase gene in pepper (Capsicum sp.) indicated a new mutant variant in C. annuum and a tandem repeat structure in promoter region.

    PubMed

    Li, Zheng; Wang, Shu; Gui, Xiao-Ling; Chang, Xiao-Bei; Gong, Zhen-Hui

    2013-01-01

    Mature pepper (Capsicum sp.) fruits come in a variety of colors, including red, orange, yellow, brown, and white. To better understand the genetic and regulatory relationships between the yellow fruit phenotype and the capsanthin-capsorubin synthase gene (Ccs), we examined 156 Capsicum varieties, most of which were collected from Northwest Chinese landraces. A new ccs variant was identified in the yellow fruit cultivar CK7. Cluster analysis revealed that CK7, which belongs to the C. annuum species, has low genetic similarity to other yellow C. annuum varieties. In the coding sequence of this ccs allele, we detected a premature stop codon derived from a C to G change, as well as a downstream frame-shift caused by a 1-bp nucleotide deletion. In addition, the expression of the gene was detected in mature CK7 fruit. Furthermore, the promoter sequences of Ccs from some pepper varieties were examined, and we detected a 176-bp tandem repeat sequence in the promoter region. In all C. annuum varieties examined in this study, the repeat number was three, compared with four in two C. chinense accessions. The sequence similarity ranged from 84.8% to 97.7% among the four types of repeats, and some putative cis-elements were also found in every repeat. This suggests that the transcriptional regulation of Ccs expression is complex. Based on the analysis of the novel C. annuum mutation reported here, along with the studies of three mutation types in yellow C. annuum and C. chinense accessions, we suggest that the mechanism leading to the production of yellow color fruit may be not as complex as that leading to orange fruit production.

  3. Association of APOA5 Gene Promoter Region -1131T>C Polymorphism (rs662799) to Plasma Triglyceride Level in Patients with Type 2 Diabetic Nephropathy

    PubMed Central

    Mahrooz, Abdolkarim; Ansari, Vahid; Makhlough, Atieh; Hashemi-Sooteh, Mohammad-Bagher

    2016-01-01

    Introduction Diabetic Nephropathy (DN), a serious complication of Type 2 Diabetic Mellitus (T2DM), is progressive and susceptibility to DN varies among T2DM patients. ApoA5-1131T>C polymorphism revealed that is strongly associated with triglyceride levels and proposed as a predisposing factor for DN. Aim The purpose of this study was to investigate the association -1131T>C ApoA5 gene polymorphism with serum lipids levels in Type 2 diabetic (DM) patients with or without DN in north of Iran (Mazandaran province). Materials and Methods This study comprised patients with established T2DM (n=161) and controls (n=58). Genotyping of APOA5 -1131T>C polymorphisms was performed by PCR–RFLP. Diabetic patients were divided into two groups: with nephropathy (DN+, n = 90) and without nephropathy (DN-, n = 71). Lipids and lipoproteins were assessed by enzymatic methods. Results The genotype frequencies were 63.8 % TT, 31 % TC, 5.2 % CC in controls, 33.8% TT, 52.1 % TC, 14.1 % CC in DN- and 44.4 % TT, 36.7 % TC, 18.9 % CC in DN+ patients. The TC genotype and the CC genotype were overexpressed among DN+ and DN-population in comparison to the control group. The highest and the lowest TG levels in both diabetic patients and controls belonged to CC+TC and TT genotypes, respectively. Furthermore in both patients TG increased with this order: TT< TCC polymorphisms influence lipid levels in type 2 diabetic patients. PMID:27437205

  4. Isolation and functional characterization of a novel seed-specific promoter region from peanut.

    PubMed

    Sunkara, Sowmini; Bhatnagar-Mathur, Pooja; Sharma, Kiran Kumar

    2014-01-01

    The importance of using tissue-specific promoters in the genetic transformation of plants has been emphasized increasingly. Here, we report the isolation of a novel seed-specific promoter region from peanut and its validation in Arabidopsis and tobacco seeds. The reported promoter region referred to as groundnut seed promoter (GSP) confers seed-specific expression in heterologous systems, which include putative promoter regions of the peanut (Arachis hypogaea L.) gene 8A4R19G1. This region was isolated, sequenced, and characterized using gel shift assays. Tobacco transgenics obtained using binary vectors carrying uidA reporter gene driven by GSP and/or cauliflower mosaic virus 35S promoters were confirmed through polymerase chain reaction (PCR), RT-PCR, and computational analysis of motifs which revealed the presence of TATA, CAAT boxes, and ATG signals. This seed-specific promoter region successfully targeted the reporter uidA gene to seed tissues in both Arabidopsis and tobacco model systems, where its expression was confirmed by histochemical analysis of the transgenic seeds. This promoter region is routinely being used in the genetic engineering studies in legumes aimed at targeting novel transgenes to the seeds, especially those involved in micronutrient enhancement, fungal resistance, and molecular pharming.

  5. Isolation and functional characterization of a novel seed-specific promoter region from peanut.

    PubMed

    Sunkara, Sowmini; Bhatnagar-Mathur, Pooja; Sharma, Kiran Kumar

    2014-01-01

    The importance of using tissue-specific promoters in the genetic transformation of plants has been emphasized increasingly. Here, we report the isolation of a novel seed-specific promoter region from peanut and its validation in Arabidopsis and tobacco seeds. The reported promoter region referred to as groundnut seed promoter (GSP) confers seed-specific expression in heterologous systems, which include putative promoter regions of the peanut (Arachis hypogaea L.) gene 8A4R19G1. This region was isolated, sequenced, and characterized using gel shift assays. Tobacco transgenics obtained using binary vectors carrying uidA reporter gene driven by GSP and/or cauliflower mosaic virus 35S promoters were confirmed through polymerase chain reaction (PCR), RT-PCR, and computational analysis of motifs which revealed the presence of TATA, CAAT boxes, and ATG signals. This seed-specific promoter region successfully targeted the reporter uidA gene to seed tissues in both Arabidopsis and tobacco model systems, where its expression was confirmed by histochemical analysis of the transgenic seeds. This promoter region is routinely being used in the genetic engineering studies in legumes aimed at targeting novel transgenes to the seeds, especially those involved in micronutrient enhancement, fungal resistance, and molecular pharming. PMID:24078220

  6. Comprehensive annotation of bidirectional promoters identifies co-regulation among breast and ovarian cancer genes.

    PubMed

    Yang, Mary Q; Koehly, Laura M; Elnitski, Laura L

    2007-04-20

    A "bidirectional gene pair" comprises two adjacent genes whose transcription start sites are neighboring and directed away from each other. The intervening regulatory region is called a "bidirectional promoter." These promoters are often associated with genes that function in DNA repair, with the potential to participate in the development of cancer. No connection between these gene pairs and cancer has been previously investigated. Using the database of spliced-expressed sequence tags (ESTs), we identified the most complete collection of human transcripts under the control of bidirectional promoters. A rigorous screen of the spliced EST data identified new bidirectional promoters, many of which functioned as alternative promoters or regulated novel transcripts. Additionally, we show a highly significant enrichment of bidirectional promoters in genes implicated in somatic cancer, including a substantial number of genes implicated in breast and ovarian cancers. The repeated use of this promoter structure in the human genome suggests it could regulate co-expression patterns among groups of genes. Using microarray expression data from 79 human tissues, we verify regulatory networks among genes controlled by bidirectional promoters. Subsets of these promoters contain similar combinations of transcription factor binding sites, including evolutionarily conserved ETS factor binding sites in ERBB2, FANCD2, and BRCA2. Interpreting the regulation of genes involved in co-expression networks, especially those involved in cancer, will be an important step toward defining molecular events that may contribute to disease.

  7. Mimivirus gene promoters exhibit an unprecedented conservation among all eukaryotes.

    PubMed

    Suhre, Karsten; Audic, Stéphane; Claverie, Jean-Michel

    2005-10-11

    The initial analysis of the recently sequenced genome of Acanthamoeba polyphaga Mimivirus, the largest known double-stranded DNA virus, predicted a proteome of size and complexity more akin to small parasitic bacteria than to other nucleocytoplasmic large DNA viruses and identified numerous functions never before described in a virus. It has been proposed that the Mimivirus lineage could have emerged before the individualization of cellular organisms from the three domains of life. An exhaustive in silico analysis of the noncoding moiety of all known viral genomes now uncovers the unprecedented perfect conservation of an AAAATTGA motif in close to 50% of the Mimivirus genes. This motif preferentially occurs in genes transcribed from the predicted leading strand and is associated with functions required early in the viral infectious cycle, such as transcription and protein translation. A comparison with the known promoter of unicellular eukaryotes, amoebal protists in particular, strongly suggests that the AAAATTGA motif is the structural equivalent of the TATA box core promoter element. This element is specific to the Mimivirus lineage and may correspond to an ancestral promoter structure predating the radiation of the eukaryotic kingdoms. This unprecedented conservation of core promoter regions is another exceptional feature of Mimivirus that again raises the question of its evolutionary origin.

  8. Downregulation of miR-320a/383-sponge-like long non-coding RNA NLC1-C (narcolepsy candidate-region 1 genes) is associated with male infertility and promotes testicular embryonal carcinoma cell proliferation

    PubMed Central

    Lü, M; Tian, H; Cao, Y-x; He, X; Chen, L; Song, X; Ping, P; Huang, H; Sun, F

    2015-01-01

    Long non-coding RNAs (lncRNAs), which are extensively transcribed from the genome, have been proposed to be key regulators of diverse biological processes. However, little is known about the role of lncRNAs in regulating spermatogenesis in human males. Here, using microarray technology, we show altered expression of lncRNAs in the testes of infertile men with maturation arrest (MA) or hypospermatogenesis (Hypo), with 757 and 2370 differentially down-regulated and 475 and 163 up-regulated lncRNAs in MA and Hypo, respectively. These findings were confirmed by quantitative real-time PCR (qRT-PCR) assays on select lncRNAs, including HOTTIP, imsrna320, imsrna292 and NLC1-C (narcolepsy candidate-region 1 genes). Interestingly, NLC1-C, also known as long intergenic non-protein-coding RNA162 (LINC00162), was down-regulated in the cytoplasm and accumulated in the nucleus of spermatogonia and primary spermatocytes in the testes of infertile men with mixed patterns of MA compared with normal control. The accumulation of NLC1-C in the nucleus repressed miR-320a and miR-383 transcript and promoted testicular embryonal carcinoma cell proliferation by binding to Nucleolin. Here, we define a novel mechanism by which lncRNAs modulate miRNA expression at the transcriptional level by binding to RNA-binding proteins to regulate human spermatogenesis. PMID:26539909

  9. MnTE-2-PyP reduces prostate cancer growth and metastasis by suppressing p300 activity and p300/HIF-1/CREB binding to the promoter region of the PAI-1 gene.

    PubMed

    Tong, Qiang; Weaver, Michael R; Kosmacek, Elizabeth A; O'Connor, Brian P; Harmacek, Laura; Venkataraman, Sujatha; Oberley-Deegan, Rebecca E

    2016-05-01

    To improve radiation therapy-induced quality of life impairments for prostate cancer patients, the development of radio-protectors is needed. Our previous work has demonstrated that MnTE-2-PyP significantly protects urogenital tissues from radiation-induced damage. So, in order for MnTE-2-PyP to be used clinically as a radio-protector, it is fully necessary to explore the effect of MnTE-2-PyP on human prostate cancer progression. MnTE-2-PyP inhibited prostate cancer growth in the presence and absence of radiation and also inhibited prostate cancer migration and invasion. MnTE-2-PyP altered p300 DNA binding, which resulted in the inhibition of HIF-1β and CREB signaling pathways. Accordingly, we also found that MnTE-2-PyP reduced the expression of three genes regulated by HIF-1β and/or CREB: TGF-β2, FGF-1 and PAI-1. Specifically, MnTE-2-PyP decreased p300 complex binding to a specific HRE motif within the PAI-1 gene promoter region, suppressed H3K9 acetylation, and consequently, repressed PAI-1 expression. Mechanistically, less p300 transcriptional complex binding is not due to the reduction of binding between p300 and HIF-1/CREB transcription factors, but through inhibiting the binding of HIF-1/CREB transcription factors to DNA. Our data provide an in depth mechanism by which MnTE-2-PyP reduces prostate cancer growth and metastasis, which validates the clinical use of MnTE-2-PyP as a radio-protector to enhance treatment outcomes in prostate cancer radiotherapy. PMID:26944191

  10. The first intron of the murine beta-casein gene contains a functional promoter.

    PubMed

    Kolb, Andreas

    2003-07-11

    Caseins are the major milk proteins in most mammals. Together with calcium and phosphate they form the casein micelle. The corresponding casein genes are clustered in mammalian genomes and their expression is coordinately regulated with regard to developmental and tissue specificity. Casein gene promoters are responsive to lactogenic hormones, cell-matrix, and cell-cell interactions. Transcriptional enhancer elements are found in the 5(') upstream regions of casein genes but have also been detected in the first intron of the bovine beta-casein gene. We show here that the first intron of the murine beta-casein gene has three discernible functions. First, transcriptional enhancer elements present in the intron increase the basal activity of the beta-casein promoter. In addition, these intronic enhancer elements augment the induction of the beta-casein promoter by lactogenic hormones. Finally, we demonstrate that the first intron of the murine beta-casein gene contains a functional promoter.

  11. Definition of the human N-myc promoter region during development in a transgenic mouse model.

    PubMed

    Tai, K F; Rogers, S W; Pont-Kingdon, G; Carroll, W L

    1999-09-01

    The N-myc oncogene directs organogenesis, and gene amplification is associated with aggressive forms of neuroblastoma, a common malignant tumor in children. N-myc is expressed in fetal epithelium, and expression decreases markedly postnatally. To localize sequences responsible for directing expression, we have analyzed the human N-myc promoter. We noted previously that N-myc promoter regions 5' to exon 1 directed reporter gene expression in all cell lines, including those without detectable N-myc transcripts. However, when promoter constructs included 3' exon 1 and the 5' portion of intron 1, reporter activity was detected only when there was expression of the endogenous gene. To determine the role of this "tissue-specific region" in directing expression during development, we generated transgenic mice carrying N-myc promoter lacZ minigenes that contained 5' N-myc promoter elements alone or the promoter linked to the 3' exon 1/5' intron 1 tissue-specific region. Animals lacking the tissue-specific exon 1/intron 1 region showed beta-galactosidase expression in the CNS, but expression was not observed in other organs in which endogenously derived N-myc transcripts were seen. Within the CNS, transgene expression was seen mainly in the olfactory system and was not observed in other areas in which expression of the murine gene has been noted. In contrast, no transgene expression was observed in any of the animals carrying the tissue-specific exon 1/intron 1 region. Thus, sequences that direct expression within the olfactory system were contained within our 5' promoter transgene, whereas sequences that guide the ubiquitous expression of N-myc during organogenesis lie outside the regions studied here. Finally, the exon 1/intron 1 region seems to act in a dominant fashion to repress expression in the CNS from the immediate 5' N-myc promoter. PMID:10473038

  12. Characterization of tissue-specific transcription by the human synapsin I gene promoter

    SciTech Connect

    Thiel, G. Univ. of Texas, Dallas ); Greengard, P. ); Suedhof, T.C. )

    1991-04-15

    Synapsin Ia and synapsin Ib are abundant synaptic vesicle proteins that are derived by differential splicing from a single gene. To identify control elements directing the neuronal expression of synapsins Ia/b, the authors functionally analyzed the promoter region of the human synapsin I gene. A hybrid gene was constructed containing 2 kilobases of 5{prime} flanking sequence from the synapsin I gene fused to the bacterial gene chloramphenicol acetyltransferase and transfected into 12 different neuronal and nonneuronal cell lines. In general, expression of the chimeric reporter gene showed excellent correlation with endogenous expression of synapsin I in different neuronal cell lines, whereas transcription was low in all nonneuronal cell lines examined. The addition of the simian virus 40 enhancer promoted non-tissue-specific expression. Deletion mutagenesis of the synapsin I promoter revealed the presence of positive and negative sequence elements. A basal (constitutive) promoter that directs reporter gene expression in neuronal and nonneuronal cell lines was mapped to the region {minus}115 to +47. The promoter region from {minus}422 to {minus}22 contains positive elements that upon fusion with the herpes simplex virus thymidine kinase promoter potentiate its transcription in PC12 and neuroblastoma cells but not in Chinese hamster ovary cells.

  13. Promoter elements determining weak expression of the GAL4 regulatory gene of Saccharomyces cerevisiae.

    PubMed Central

    Griggs, D W; Johnston, M

    1993-01-01

    The GAL4 gene of Saccharomyces cerevisiae (encoding the activator of transcription of the GAL genes) is poorly expressed and is repressed during growth on glucose. To determine the basis for its weak expression and to identify DNA sequences recognized by proteins that activate transcription of a gene that itself encodes an activator of transcription, we have analyzed GAL4 promoter structure. We show that the GAL4 promoter is about 90-fold weaker than the strong GAL1 promoter and at least 7-fold weaker than the feeble URA3 promoter and that this low level of GAL4 expression is primarily due to a weak promoter. By deletion mapping, the GAL4 promoter can be divided into three functional regions. Two of these regions contain positive elements; a distal region termed the UASGAL4 (upstream activation sequence) contains redundant elements that increase promoter function, and a central region termed the UESGAL4 (upstream essential sequence) is essential for even basal levels of GAL4 expression. The third element, an upstream repression sequence, mediates glucose repression of GAL4 expression and is located between the UES and the transcriptional start site. The UASGAL4 is unusual because it is not interchangable with UAS elements in other yeast promoters; it does not function as a UAS element when inserted in a CYC1 promoter, and a normally strong UAS functions poorly in place of UASGAL4 in the GAL4 promoter. Similarly, the UES element of GAL4 does not function as a TATA element in a test promoter, and consensus TATA elements do not function in place of UES elements in the GAL4 promoter. These results suggest that GAL4 contains a weak TATA-less promoter and that the proteins regulating expression of this regulatory gene may be novel and context specific. PMID:8393142

  14. The core promoter: At the heart of gene expression.

    PubMed

    Danino, Yehuda M; Even, Dan; Ideses, Diana; Juven-Gershon, Tamar

    2015-08-01

    The identities of different cells and tissues in multicellular organisms are determined by tightly controlled transcriptional programs that enable accurate gene expression. The mechanisms that regulate gene expression comprise diverse multiplayer molecular circuits of multiple dedicated components. The RNA polymerase II (Pol II) core promoter establishes the center of this spatiotemporally orchestrated molecular machine. Here, we discuss transcription initiation, diversity in core promoter composition, interactions of the basal transcription machinery with the core promoter, enhancer-promoter specificity, core promoter-preferential activation, enhancer RNAs, Pol II pausing, transcription termination, Pol II recycling and translation. We further discuss recent findings indicating that promoters and enhancers share similar features and may not substantially differ from each other, as previously assumed. Taken together, we review a broad spectrum of studies that highlight the importance of the core promoter and its pivotal role in the regulation of metazoan gene expression and suggest future research directions and challenges.

  15. Genome-wide analysis of alternative promoters of human genes using a custom promoter tiling array

    PubMed Central

    Singer, Gregory AC; Wu, Jiejun; Yan, Pearlly; Plass, Christoph; Huang, Tim HM; Davuluri, Ramana V

    2008-01-01

    Background Independent lines of evidence suggested that a large fraction of human genes possess multiple promoters driving gene expression from distinct transcription start sites. Understanding which promoter is employed in which cellular context is required to unravel gene regulatory networks within the cell. Results We have developed a custom microarray platform that tiles roughly 35,000 alternative putative promoters from nearly 7,000 genes in the human genome. To demonstrate the utility of this array platform, we have analyzed the patterns of promoter usage in 17β-estradiol (E2)-treated and untreated MCF7 cells and show widespread usage of alternative promoters. Most intriguingly, we show that the downstream promoter in E2-sensitive multiple promoter genes tends to be very close to the 3'-terminus of the gene, suggesting exotic mechanisms of expression regulation in these genes. Conclusion The usage of alternative promoters greatly multiplies the transcriptional complexity available within the human genome. The fact that many of these promoters are incapable of driving the synthesis of a meaningful protein-encoding transcript further complicates the story. PMID:18655706

  16. Functional domains of the Xenopus laevis 5S gene promoter.

    PubMed Central

    Pieler, T; Oei, S L; Hamm, J; Engelke, U; Erdmann, V A

    1985-01-01

    To study the fine structure of the Xenopus laevis somatic 5S gene internal control region, we have created 15 different transversions using mutagenic oligonucleotide primers. The effects of these mutations on 5S DNA transcription in vitro as well as on stable complex formation with transcription factor TF III A and TF III C in crude nuclear extracts were analyzed. Mutations in the common class III 5' promoter element (nucleotides 50-61 in the 5S gene) interfere with transcription activity and stable complex formation whenever they contradict the tDNA box A consensus sequence. The second promoter element is defined by a major sequence block (nucleotides 80-89, box C) and two additional internal residues (70 and 71) at a distance of roughly one helical turn from both the major 3' and 5' control sequences; these two 3' elements contain the primary TF III A binding domain. The remaining nucleotides (62-69 and 71-79) when mutated do not interfere with transcription activity or factor binding and thus they constitute two spacer elements within a symmetrically structured 5S gene promoter. An increase in the relative spacing of box A and box C by insertion of 3 bp between nucleotides 66 and 67 leads to a drastic reduction in transcription activity and the ability to form a stable complex with TF III A and/or TF III C. Thus, accurate spacing is essential for the proper orientation of TF III A on 5S DNA and/or TF III C binding. Images Fig. 1. Fig. 3. Fig. 4. PMID:3004969

  17. Type 1 plaminogen activator inhibitor gene: Functional analysis and glucocorticoid regulation of its promoter

    SciTech Connect

    Van Zonneveld, A.J.; Curriden, S.A.; Loskutoff, D.J. )

    1988-08-01

    Plasminogen activator inhibitor type 1 is an important component of the fibrinolytic system and its biosynthesis is subject to complex regulation. To study this regulation at the level of transcription, the authors have identified and sequenced the promoter of the human plasminogen activator inhibitor type 1 gene. Nuclease protection experiments were performed by using endothelial cell mRNA and the transcription initiation (cap) site was established. Sequence analysis of the 5{prime} flanking region of the gene revealed a perfect TATA box at position {minus}28 to position {minus}23, the conserved distance from the cap site. Comparative functional studies with the firefly luciferase gene as a reporter gene showed that fragments derived from this 5{prime} flanking region exhibited high promoter activity when transfected into bovine aortic endothelial cells and mouse Ltk{sup {minus}} fibroblasts but were inactive when introduced into HeLa cells. These studies indicate that the fragments contain the plasminogen activator inhibitor type 1 promoter and that it is expressed in a tissue-specific manner. Although the fragments were also silent in rat FTO2B hepatoma cells, their promoter activity could be induced up to 40-fold with the synthetic glucocorticoid dexamethasone. Promoter deletion mapping experiments and studies involving the fusion of promoter fragments to a heterologous gene indicated that dexamethasone induction is mediated by a glucocorticoid responsive element with enhancer-like properties located within the region between nucleotides {minus}305 and +75 of the plasminogen activator inhibitor type 1 gene.

  18. Interactions of Drosophila Ultrabithorax Regulatory Regions with Native and Foreign Promoters

    PubMed Central

    Casares, F.; Bender, W.; Merriam, J.; Sanchez-Herrero, E.

    1997-01-01

    The Ultrabithorax (Ubx) gene of the Drosophila bithorax complex is required to specify parasegments 5 and 6. Two P-element ``enhancer traps'' have been recovered within the locus that contain the bacterial lacZ gene under the control of the P-element promoter. The P insertion that is closer to the Ubx promoter expresses lacZ in a pattern similar to that of the normal Ubx gene, but also in parasegment 4 during embryonic development. Two deletions have been recovered that remove the normal Ubx promoter plus several kilobases on either side, but retain the lacZ reporter gene. The lacZ patterns from the deletion derivatives closely match the normal pattern of Ubx expression in late embryos and imaginal discs. The lacZ genes in the deletion derivatives are also negatively regulated by Ubx and activated in trans by Contrabithorax mutations, again like the normal Ubx gene. Thus, the deleted regions, including several kilobases around the Ubx promoter, are not required for long range interactions with Ubx regulatory regions. The deletion derivatives also stimulate transvection, a pairing-dependent interaction with the Ubx promoter on the homologous chromosome. PMID:9017395

  19. Maize Adh-1 promoter sequences control anaerobic regulation: addition of upstream promoter elements from constitutive genes is necessary for expression in tobacco

    PubMed Central

    Ellis, J.G.; Llewellyn, D.J.; Dennis, E.S.; Peacock, W.J.

    1987-01-01

    The promoter region of a maize alcohol dehydrogenase gene (Adh-1) was linked to a reporter gene encoding chloramphenicol acetyl transferase (CAT) and transformed stably into tobacco cells using T-DNA vectors. No CAT enzyme activity could be detected in transgenic tobacco plants unless upstream promoter elements from the octopine synthase gene or the cauliflower mosaic virus 35S promoter were supplied in addition to the maize promoter region. CAT enzyme activity and transcription of the chimaeric gene were then readily detected after anaerobic induction. The first 247 bp upstream of the translation initiation codon of the maize Adh-1 gene were sufficient to impose anaerobic regulation on the hybrid gene and S1 nuclease mapping confirmed mRNA initiation is from the normal maize Adh-1 transcription start point. ImagesFig. 1.Fig. 2.Fig. 3.Fig. 4.Fig. 5.Fig. 6. PMID:15981329

  20. Analysis of cytosine-adenine repeats in P1 promoter region of IGF-1 gene in peripheral blood cells and cervical tissue samples of females with cervical intraepithelial lesions and squamous cervical cancer

    PubMed Central

    KWASNIEWSKI, WOJCIECH; GOZDZICKA-JOZEFIAK, ANNA; KOTARSKA, MARIA; POLAK, GRZEGORZ; BARCZYNSKI, BARTLOMIEJ; BRONIARCZYK, JUSTYNA; NOWAK, WITOLD; WOLUN-CHOLEWA, MARIA; KWASNIEWSKA, ANNA; KOTARSKI, JAN

    2015-01-01

    High oncogenic risk human papillomaviruses (HPVs) are closely associated with cancer of the cervix. However, HPV infection alone may not be sufficient to cause cervical cancer, and other factors or cofactors may have a cumulative effect on the risk of progression from cervical HPV infection to cancer. The present study investigates the cytosine-adenine (CA) repeat polymorphism in the P1 promoter region of the insulin-like growth factor-1 (IGF-1) gene among cervical precancerous and cancer patients and healthy control females. The association between these polymorphisms, tissue and blood serum levels of IGF-1, and cervical cancer risk and progression is evaluated. The material for analysis consisted of blood cells and postoperative tissues from patients diagnosed with low-grade squamous intraepithelial lesions (L-SILs), high-grade squamous intraepithelial lesions (H-SILs) and invasive cervical cancer (ICC). A polymerase chain reaction amplification and the sequencing of DNA were used for the identification of (CA)n repeats in the IGF-1 P1 region and detection of HPV DNA. The blood serum concentration of IGF was determined by enzyme-linked immunosorbent assay. The identification of the IGF-1 protein in the cervical tissues was performed by immunohistochemical analysis. The range of the length of the CA repeats in the study DNA was 11 to 21. However, the most common allele length and genotype in the control and study patients from serum and tissues was 19 CA repeats and a homozygous genotype of CA19/19. Statistically significant differences in the concentration of IGF-1 in the blood serum were observed between H-SILs and controls, only (p=0.047). However, the concentration of IGF-1 in the group of females with CA19/19, CA19<19 and CA19>19 was significantly higher in the group of patients with H-SIL (P=0.041) and ICC (P=0.048) in comparison with the control group. An association was detected between CA repeat length <19 and/or >19, IGF concentration in blood serum and

  1. Delimitation and functional characterization of the bidirectional THOX-DUOXA promoter regions in thyrocytes.

    PubMed

    Christophe-Hobertus, Christiane; Christophe, Daniel

    2010-04-12

    The THOX and DUOXA genes encode components of the oxidative machinery involved in thyroid hormone biosynthesis. Both of these genes are duplicated in mammalian genomes and are positioned in a head-to-head configuration, THOX1 facing DUOXA1 and THOX2 facing DUOXA2, respectively. The intergenic regions in both couples of genes exhibit dissimilar compositions, being highly GC-rich in the case of THOX1-DUOXA1 but not in the other case. In this study we localized precisely the transcription starts of all four genes using the RLM-RACE technique. It revealed that the distance between THOX1 and DUOXA1 transcription units is of about 70bp only, whereas THOX2 and DUOXA2 transcription starts are separated by 170bp. Analysis of these putative promoter regions revealed the presence of several potential binding sites for transcription factor Sp1 within the THOX1-DUOXA1 intergenic space, and of a TATA box and an Inr element in front of DUOXA2 and THOX2 genes, respectively. The putative promoter regions were inserted into a specifically designed vector harbouring two distinct reporter genes facing each other and their activity was investigated in transient transfection experiments in rat thyroid PCCl3 cells. Both regions exhibited bidirectional promoter activity in the assay. Gel shift experiments using extracts obtained from PCCl3 cells demonstrated the existence of at least one functional Sp1 binding site within the THOX1-DUOXA1 promoter. When Sp1 binding was abolished by mutation of the DNA sequence, a clear reduction in promoter activity in both THOX1 and DUOXA1 directions was observed in the functional assay. As these promoter sequences are well conserved in mammalian genomes, it appears very likely that the results we obtained here in the rat may be extended to the other species.

  2. [Health-Promoting Schools Regional Initiative of the Americas].

    PubMed

    Ippolito-Shepherd, Josefa; Cerqueira, Maria Teresa; Ortega, Diana Patricia

    2005-01-01

    In Latin America, comprehensive health promotion programmes and activities are being implemented in the school setting, which take into account the conceptual framework of the Health-Promoting Schools Regional Initiative of the Pan American Health Organization, Regional office of the World Health Organization (PAHO/WHO). These programmes help to strengthen the working relationships between the health and education sectors. The Health-Promoting Schools Regional Initiative, officially launched by PAHO/WHO in 1995, aims to form future generations to have the knowledge, abilities, and skills necessary for promoting and caring for their health and that of their family and community, as well as to create and maintain healthy environments and communities. The Initiative focuses on three main components: comprehensive health education, the creation and maintenance of healthy physical and psychosocial environments, and the access to health and nutrition services, mental health, and active life. In 2001, PAHO conducted a survey in 19 Latin American countries to assess the status and trends of Health-Promoting Schools in the Region, for the appropriate regional, subregional, and national planning of pertinent health promotion and health education programmes and activities. The results of this survey provided information about policies and national plans, multisectoral coordination mechanisms for the support of health promotion in the school settings, the formation and participation in national and international networks of Health-Promoting Schools and about the level of dissemination of the strategy. For the successful development of Health-Promoting Schools is essential to involve the society as a whole, in order to mobilise human resources and materials necessary for implementing health promotion in the school settings. Thus, the constitution and consolidation of networks has been a facilitating mechanism for the exchange of ideas, resources and experiences to strengthen

  3. Insect and wound induced GUS gene expression from a Beta vulgaris proteinase inhibitor gene promoter

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Inducible gene promoters that are specifically activated by pathogen invasion or insect pest attack are needed for effective expression of resistance genes to control plant diseases. In the present study, a promoter from a serine proteinase inhibitor gene (BvSTI) shown to be up-regulated in resist...

  4. Cloning and partial characterization of the mouse glutamine:fructose-6-phosphate amidotransferase (GFAT) gene promoter.

    PubMed Central

    Sayeski, P P; Wang, D; Su, K; Han, I O; Kudlow, J E

    1997-01-01

    Glutamine:fructose-6-phosphate amidotransferase (GFAT) is the enzyme that is rate limiting in the synthesis of glucosamine and hexosamines. Glucosamine has been proposed to contribute to the glucotoxicity of diabetes. Evidence that the gene encoding GFAT is transcriptionally regulated prompted us to clone and characterize its promoter. The position of the mouse GFAT promoter relative to the translational start site was located by primer extension and found to be 149 bp upstream of the translational start site. A 1.9 kb SacI fragment of the GFAT gene was found to contain the promoter and 88 bp of sequence downstream of the transcriptional start site. This promoter segment could drive expression of a luciferase reporter gene, could confer correct transcriptional initiation to the reporter and could confer the EGF-responsiveness previously observed in the native gene. The mouse GFAT promoter lacks a canonical TATA box and has several GC boxes within a highly GC-rich region. Deletional analysis of the promoter indicated that a proximal element extending to -120 relative to the transcriptional start site could confer reporter expression at a level of 57% of the 1.9 kb construct. Detailed analysis of this proximal region by DNase I footprinting, electrophoretic mobility shift assays and site-directed mutagenesis indicated that Sp1 binds to three elements in this proximal promoter segment and plays a vital role in regulation of transcription from this gene. PMID:9060444

  5. Lactase gene promoter fragments mediate differential spatial and temporal expression patterns in transgenic mice.

    PubMed

    Wang, Zhi; Maravelias, Charalambos; Sibley, Eric

    2006-04-01

    Lactase gene expression is spatiotemporally regulated during mammalian gut development. We hypothesize that distinct DNA control regions specify appropriate spatial and temporal patterning of lactase gene expression. In order to define regions of the lactase promoter involved in mediating intestine-specific and spatiotemporal restricted expression, transgenic mice harboring 100 bp, 1.3- and 2.0- kb fragments of the 5' flanking region of the rat lactase gene cloned upstream of a luciferase reporter were characterized. The 100-bp lactase promoter-reporter transgenic mouse line expressed maximal luciferase activity in the intestine with a posterior shift in spatial restriction and ectopic expression in the stomach and lung. The temporal pattern of expression mediated by the 1.3-kb promoter?reporter transgene increases with postnatal maturation in contrast with the postnatal decline mediated by the 2.0-kb promoter-reporter transgene and the endogenous lactase gene. The differential transgene expression patterns mediated by the lactase promoter fragments suggests that intestine-specific spatial and temporal control elements reside in distinct regions of the DNA sequences upstream of the lactase gene transcription start-site.

  6. Characterization of promoter sequence of toll-like receptor genes in Vechur cattle

    PubMed Central

    Lakshmi, R.; Jayavardhanan, K. K.; Aravindakshan, T. V.

    2016-01-01

    Aim: To analyze the promoter sequence of toll-like receptor (TLR) genes in Vechur cattle, an indigenous breed of Kerala with the sequence of Bos taurus and access the differences that could be attributed to innate immune responses against bovine mastitis. Materials and Methods: Blood samples were collected from Jugular vein of Vechur cattle, maintained at Vechur cattle conservation center of Kerala Veterinary and Animal Sciences University, using an acid-citrate-dextrose anticoagulant. The genomic DNA was extracted, and polymerase chain reaction was carried out to amplify the promoter region of TLRs. The amplified product of TLR2, 4, and 9 promoter regions was sequenced by Sanger enzymatic DNA sequencing technique. Results: The sequence of promoter region of TLR2 of Vechur cattle with the B. taurus sequence present in GenBank showed 98% similarity and revealed variants for four sequence motifs. The sequence of the promoter region of TLR4 of Vechur cattle revealed 99% similarity with that of B. taurus sequence but not reveals significant variant in motifregions. However, two heterozygous loci were observed from the chromatogram. Promoter sequence of TLR9 gene also showed 99% similarity to B. taurus sequence and revealed variants for four sequence motifs. Conclusion: The results of this study indicate that significant variation in the promoter of TLR2 and 9 genes in Vechur cattle breed and may potentially link the influence the innate immunity response against mastitis diseases. PMID:27397987

  7. Analysis of Polymorphisms in the Lactotransferrin Gene Promoter and Dental Caries

    PubMed Central

    Brancher, João Armando; Pecharki, Giovana Daniela; Doetzer, Andrea Duarte; Medeiros, Kamilla Gabriella dos Santos; Cordeiro Júnior, Carlos Alberto; Sotomaior, Vanessa Santos; Bauer, Peter; Trevilatto, Paula Cristina

    2011-01-01

    Regarding host aspects, there has been strong evidence for a genetic component in the etiology of caries. The salivary protein lactotransferrin (LTF) exhibits antibacterial activity, but there is no study investigating the association of polymorphisms in the promoter region of LTF gene with caries. The objective of this study was firstly to search the promoter region of the human LTF gene for variations and, if existent, to investigate the association of the identified polymorphisms with dental caries in 12-year-old students. From 687 unrelated, 12-year-old, both sex students, 50 individuals were selected and divided into two groups of extreme phenotypes according to caries experience: 25 students without (DMFT = 0) and 25 with caries experience (DMFT ≥ 4). The selection of individuals with extreme phenotypes augments the chances to find gene variations which could be associated with such phenotypes. LTF gene-putative promoter region (+39 to −1143) of the selected 50 individuals was analyzed by high-resolution melting technique. Fifteen students, 8 without (DMFT = 0) and 7 with caries experience (mean DMFT = 6.28), presented deviations of the pattern curve suggestive of gene variations and were sequenced. However, no polymorphisms were identified in the putative promoter region of the LTF gene. PMID:22190933

  8. Automatic annotation of eukaryotic genes, pseudogenes and promoters

    PubMed Central

    Solovyev, Victor; Kosarev, Peter; Seledsov, Igor; Vorobyev, Denis

    2006-01-01

    Background The ENCODE gene prediction workshop (EGASP) has been organized to evaluate how well state-of-the-art automatic gene finding methods are able to reproduce the manual and experimental gene annotation of the human genome. We have used Softberry gene finding software to predict genes, pseudogenes and promoters in 44 selected ENCODE sequences representing approximately 1% (30 Mb) of the human genome. Predictions of gene finding programs were evaluated in terms of their ability to reproduce the ENCODE-HAVANA annotation. Results The Fgenesh++ gene prediction pipeline can identify 91% of coding nucleotides with a specificity of 90%. Our automatic pseudogene finder (PSF program) found 90% of the manually annotated pseudogenes and some new ones. The Fprom promoter prediction program identifies 80% of TATA promoters sequences with one false positive prediction per 2,000 base-pairs (bp) and 50% of TATA-less promoters with one false positive prediction per 650 bp. It can be used to identify transcription start sites upstream of annotated coding parts of genes found by gene prediction software. Conclusion We review our software and underlying methods for identifying these three important structural and functional genome components and discuss the accuracy of predictions, recent advances and open problems in annotating genomic sequences. We have demonstrated that our methods can be effectively used for initial automatic annotation of the eukaryotic genome. PMID:16925832

  9. Evolutionary Transition of Promoter and Gene Body DNA Methylation across Invertebrate–Vertebrate Boundary

    PubMed Central

    Keller, Thomas E.; Han, Priscilla; Yi, Soojin V.

    2016-01-01

    Genomes of invertebrates and vertebrates exhibit highly divergent patterns of DNA methylation. Invertebrate genomes tend to be sparsely methylated, and DNA methylation is mostly targeted to a subset of transcription units (gene bodies). In a drastic contrast, vertebrate genomes are generally globally and heavily methylated, punctuated by the limited local hypo-methylation of putative regulatory regions such as promoters. These genomic differences also translate into functional differences in DNA methylation and gene regulation. Although promoter DNA methylation is an important regulatory component of vertebrate gene expression, its role in invertebrate gene regulation has been little explored. Instead, gene body DNA methylation is associated with expression of invertebrate genes. However, the evolutionary steps leading to the differentiation of invertebrate and vertebrate genomic DNA methylation remain unresolved. Here we analyzed experimentally determined DNA methylation maps of several species across the invertebrate–vertebrate boundary, to elucidate how vertebrate gene methylation has evolved. We show that, in contrast to the prevailing idea, a substantial number of promoters in an invertebrate basal chordate Ciona intestinalis are methylated. Moreover, gene expression data indicate significant, epigenomic context-dependent associations between promoter methylation and expression in C. intestinalis. However, there is no evidence that promoter methylation in invertebrate chordate has been evolutionarily maintained across the invertebrate–vertebrate boundary. Rather, body-methylated invertebrate genes preferentially obtain hypo-methylated promoters among vertebrates. Conversely, promoter methylation is preferentially found in lineage- and tissue-specific vertebrate genes. These results provide important insights into the evolutionary origin of epigenetic regulation of vertebrate gene expression. PMID:26715626

  10. Characterization of SSU5C promoter of a rbcS gene from duckweed (Lemna gibba).

    PubMed

    Wang, Youru; Zhang, Yong; Yang, Baoyu; Chen, Shiyun

    2011-04-01

    Photosynthesis-associated nuclear genes are able to respond to multiple environmental and developmental signals. Studies have shown that light signals coordinate with hormone signaling pathways to control photomorphogenesis. A small subunit of ribulose-1,5 bisphosphate carboxylase/oxygenase (rbcS) gene promoter was cloned from duckweed (Lemna gibba). Sequence analysis revealed this promoter is different from the previously reported rbcs promoters and is named SSU5C. Analysis of T1 transgenic tobacco plants with a reporter gene under the control of the SSU5C promoter revealed that this promoter is tissue-specific and is positively regulated by red light. Promoter deletion analysis confirmed a region from position -152 to -49 relative to the start of transcription containing boxes X, Y and Z, and is identified to be critical for phytochrome responses. Further functional analysis of constructs of box-X, Y, Z, which was respectively fused to the basal SSU5C promoter, defined boxes X, Y and Z alone are able to direct phytochrome-regulated expression, indicating that boxes Y and Z are different from those of the SSU5B promoters in L. gibba. This promoter may be used for plant gene expression in a tissue-specific manner. PMID:21080078

  11. Dual promoter activation by the human beta-globin locus control region.

    PubMed Central

    Bresnick, E H; Felsenfeld, G

    1994-01-01

    The human beta-globin locus control region (LCR) is necessary for high-level and position-independent expression of globin genes in erythroid cells. A variety of mechanisms have been proposed for the cis-activation of individual members of the beta-globin gene family by the LCR located 10-50 kilobases upstream. It is not known, however, whether a given LCR can activate all developmentally appropriate globin family members on its chromosome or whether, within a given chromosome, the LCR must be committed to activating only a single gene. We have devised an experiment to distinguish between these possibilities. This experiment takes advantage of the fact that if two genes in a cluster are transcriptionally active and their promoters, therefore, are in a conformation hypersensitive to nucleases, restriction enzymes that cleave the promoters will excise the intervening chromatin fragment. The Apa I sites on human fetal G gamma- and A gamma-globin gene promoters are accessible to cleavage in nuclei from the human erythroleukemia cell line K562, which expresses these genes, but not in HeLa cells. We find that Apa I digestion leads to excision in high yield of the fragment spanning these promoters, showing that a LCR element is capable of sharing its activating function among members of a gene cluster on a single chromosome. Images PMID:8108408

  12. The ribosomal gene spacer region in archaebacteria

    NASA Technical Reports Server (NTRS)

    Achenbach-Richter, L.; Woese, C. R.

    1988-01-01

    Sequences for the spacer regions that separate the 16S and 23S ribosomal RNA genes have been determined for four more (strategically placed) archaebacteria. These confirm the general rule that methanogens and extreme halophiles have spacers that contain a single tRNAala gene, while tRNA genes are not found in the spacer region of the true extreme thermophiles. The present study also shows that the spacer regions from the sulfate reducing Archaeglobus and the extreme thermophile Thermococcus (both of which cluster phylogenetically with the methanogens and extreme halophiles) contain each a tRNAala gene. Thus, not only all methanogens and extreme halophiles show this characteristic, but all organisms on the "methanogen branch" of the archaebacterial tree appear to do so. The finding of a tRNA gene in the spacer region of the extreme thermophile Thermococcus celer is the first known phenotypic property that links this organism with its phylogenetic counterparts, the methanogens, rather than with its phenotypic counterparts, the sulfur-dependent extreme thermophiles.

  13. The TATA-less promoter of VP1, a plant gene controlling seed germination.

    PubMed

    Carrari, F; Frankel, N; Lijavetzky, D; Benech-Arnold, R; Sánchez, R; Iusem, N D

    2001-01-01

    Vp1 is a seed-specific gene involved in the control of dormancy and germination. We here present the complete sequence of the sorghum vp1 promoter/enhancer region highlighting its main features, especially the lack of canonical TATA and CAAT boxes and the presence of elements responsive to abscisic acid and light. The region closest to the start of transcription is highly homologous to the partial proximal sequence reported for the maize vp1 promoter. This region is interrupted by a 57-nt stretch containing 14 CT microsatellite repeats. We observed a poor overall homology to the promoter from abi3 gene, the Arabidopsis counterpart bearing a similar coding sequence. However, there exists a high degree of homology (89%) between a TATA-rich 103-bp stretch of the sorghum vp1 promoter located about 700 nt upstream of the startpoint and miniature inverted transposable elements (MITEs) interspersed within the sorghum seed-specific kafirin cluster. This sorghum MITE-like element displays considerable homology (68%) to the TATA-less promoter from the sorghum NADP-malate dehydrogenase gene and lesser similarity to the Tourist, Pilgrim and Batuta MITEs previously identified within the promoter from the maize Abp1 (auxin-binding protein) gene.

  14. The TATA-less promoter of VP1, a plant gene controlling seed germination.

    PubMed

    Carrari, F; Frankel, N; Lijavetzky, D; Benech-Arnold, R; Sánchez, R; Iusem, N D

    2001-01-01

    Vp1 is a seed-specific gene involved in the control of dormancy and germination. We here present the complete sequence of the sorghum vp1 promoter/enhancer region highlighting its main features, especially the lack of canonical TATA and CAAT boxes and the presence of elements responsive to abscisic acid and light. The region closest to the start of transcription is highly homologous to the partial proximal sequence reported for the maize vp1 promoter. This region is interrupted by a 57-nt stretch containing 14 CT microsatellite repeats. We observed a poor overall homology to the promoter from abi3 gene, the Arabidopsis counterpart bearing a similar coding sequence. However, there exists a high degree of homology (89%) between a TATA-rich 103-bp stretch of the sorghum vp1 promoter located about 700 nt upstream of the startpoint and miniature inverted transposable elements (MITEs) interspersed within the sorghum seed-specific kafirin cluster. This sorghum MITE-like element displays considerable homology (68%) to the TATA-less promoter from the sorghum NADP-malate dehydrogenase gene and lesser similarity to the Tourist, Pilgrim and Batuta MITEs previously identified within the promoter from the maize Abp1 (auxin-binding protein) gene. PMID:11761708

  15. Nucleosome Stability Distinguishes Two Different Promoter Types at All Protein-Coding Genes in Yeast.

    PubMed

    Kubik, Slawomir; Bruzzone, Maria Jessica; Jacquet, Philippe; Falcone, Jean-Luc; Rougemont, Jacques; Shore, David

    2015-11-01

    Previous studies indicate that eukaryotic promoters display a stereotypical chromatin landscape characterized by a well-positioned +1 nucleosome near the transcription start site and an upstream -1 nucleosome that together demarcate a nucleosome-free (or -depleted) region. Here we present evidence that there are two distinct types of promoters distinguished by the resistance of the -1 nucleosome to micrococcal nuclease digestion. These different architectures are characterized by two sequence motifs that are broadly deployed at one set of promoters where a nuclease-sensitive ("fragile") nucleosome forms, but concentrated in a narrower, nucleosome-free region at all other promoters. The RSC nucleosome remodeler acts through the motifs to establish stable +1 and -1 nucleosome positions, while binding of a small set of general regulatory (pioneer) factors at fragile nucleosome promoters plays a key role in their destabilization. We propose that the fragile nucleosome promoter architecture is adapted for regulation of highly expressed, growth-related genes.

  16. The promoter of the cereal VERNALIZATION1 gene is sufficient for transcriptional induction by prolonged cold.

    PubMed

    Alonso-Peral, Maria M; Oliver, Sandra N; Casao, M Cristina; Greenup, Aaron A; Trevaskis, Ben

    2011-01-01

    The VERNALIZATION1 (VRN1) gene of temperate cereals is transcriptionally activated by prolonged cold during winter (vernalization) to promote flowering. To investigate the mechanisms controlling induction of VRN1 by prolonged cold, different regions of the VRN1 gene were fused to the GREEN FLUORESCENT PROTEIN (GFP) reporter and expression of the resulting gene constructs was assayed in transgenic barley (Hordeum vulgare). A 2 kb segment of the promoter of VRN1 was sufficient for GFP expression in the leaves and shoot apex of transgenic barley plants. Fluorescence increased at the shoot apex prior to inflorescence initiation and was subsequently maintained in the developing inflorescence. The promoter was also sufficient for low-temperature induction of GFP expression. A naturally occurring insertion in the proximal promoter, which is associated with elevated VRN1 expression and early flowering in some spring wheats, did not abolish induction of VRN1 transcription by prolonged cold, however. A translational fusion of the promoter and transcribed regions of VRN1 to GFP, VRN1::GFP, was localised to nuclei of cells at the shoot apex of transgenic barley plants. The distribution of VRN1::GFP at the shoot apex was similar to the expression pattern of the VRN1 promoter-GFP reporter gene. Fluorescence from the VRN1::GFP fusion protein increased in the developing leaves after prolonged cold treatment. These observations suggest that the promoter of VRN1 is targeted by mechanisms that trigger vernalization-induced flowering in economically important temperate cereal crops.

  17. Promoter Identification and Transcription Analysis of Penicillin-Binding Protein Genes in Streptococcus pneumoniae R6

    PubMed Central

    Peters, Katharina; Pipo, Julia; Schweizer, Inga; Hakenbeck, Regine

    2016-01-01

    Penicillin-binding proteins (PBPs) are membrane-associated enzymes, which are involved in the last two steps of peptidoglycan biosynthesis, and some of them are key players in cell division. Furthermore, they are targets of β-lactams, the most widely used antibiotics. Nevertheless, very little is known about the expression and regulation of PBP genes. Using transcriptional mapping, we now determined the promoter regions of PBP genes from the laboratory strain Streptococcus pneumoniae R6 and examined the expression profile of these six promoters. The extended −10 region is highly conserved and complies with a σA-type promoter consensus sequence. In contrast, the −35 region is poorly conserved, indicating the possibility for differential PBP regulation. All PBP promoters were constitutively expressed and highly active during the exponential and early stationary growth phase. However, the individual expression of PBP promoters varied approximately fourfold, with pbp1a being the highest and pbp3 the lowest. Furthermore, the deletion of one nucleotide in the spacer region of the PBP3 promoter reduced pbp3 expression ∼10-fold. The addition of cefotaxime above the minimal inhibitory concentration (MIC) did not affect PBP expression in the penicillin-sensitive R6 strain. No evidence for regulation of S. pneumoniae PBP genes was obtained. PMID:27409661

  18. Unconventional Sequence Requirement for Viral Late Gene Core Promoters of Murine Gammaherpesvirus 68

    PubMed Central

    Wong-Ho, Elaine; Davis, Zoe H.; Zhang, Bingqing; Huang, Jian; Gong, Hao; Deng, Hongyu; Liu, Fenyong; Glaunsinger, Britt; Sun, Ren

    2014-01-01

    Infection with the human gammaherpesviruses, Epstein-Barr virus (EBV) and Kaposi's sarcoma-associated herpesvirus (KSHV), is associated with several cancers. During lytic replication of herpesviruses, viral genes are expressed in an ordered cascade. However, the mechanism by which late gene expression is regulated has not been well characterized in gammaherpesviruses. In this study, we have investigated the cis element that mediates late gene expression during de novo lytic infection with murine gammaherpesvirus 68 (MHV-68). A reporter system was established and used to assess the activity of viral late gene promoters upon infection with MHV-68. It was found that the viral origin of lytic replication, orilyt, must be on the reporter plasmid to support activation of the late gene promoter. Furthermore, the DNA sequence required for the activation of late gene promoters was mapped to a core element containing a distinct TATT box and its neighboring sequences. The critical nucleotides of the TATT box region were determined by systematic mutagenesis in the reporter system, and the significance of these nucleotides was confirmed in the context of the viral genome. In addition, EBV and KSHV late gene core promoters could be activated by MHV-68 lytic replication, indicating that the mechanisms controlling late gene expression are conserved among gammaherpesviruses. Therefore, our results on MHV-68 establish a solid foundation for mechanistic studies of late gene regulation. PMID:24403583

  19. Limited specificity of promoter constructs for gene therapy in osteosarcoma.

    PubMed

    Pollmann, Annika; Kabisch, Hartmut; Block, Andreas; Müller, Jürgen; Hellwinkel, Olaf J C

    2004-10-01

    Osteosarcoma (OS), a malignant bone neoplasia in childhood, has poor prognosis if metastases appear in the lung. A novel therapeutic approach could consist in a gene therapeutic treatment of OS metastases. However, if promiscuous viral vectors are applied for the delivery of potentially toxic transgenes, their misdelivery into normal tissues could cause severe complications. This problem could be circumvented by application of OS-specific promoters for transgene expression control. We analysed the function of promoters described to be tumour-, osteosarcoma- or osteoblast-specific. Expression rates driven by osteoblast- specific fragments from the collagen1A1-promoter, the human Osteocalcin-promoter, the bone-sialoprotein promoter and the beta-catenin promoter depending on vitamin supplementation were analysed in five OS cell lines, in normal lung fibroblasts and in a non-osteoblastic prostate cancer cell line (LNCaP) by dual luciferase assays. In addition, an unspecific but doxycyclin-repressible promoter construct (pAd.3r-luc) was examined. We found that all constructs were active in OS cell lines to varying extents. The complete human Osteocalcin promoter and the bone-sialoprotein promoter were partially induced by vitamin D3 or C respectively while the pAd.3r-luc activity could be shut down by doxycyclin. In contrast, the human Osteocalcin-promoter was not activated by vitamin D3 in LNCaP cells; its action remained relatively low. Interestingly, excepting the beta-catenin promoter, we measured strong activities of all promoters in lung fibroblast cells. Our study demonstrates that promoter activity should be evaluated not only for the target cells of the gene therapeutic approaches, but also for neighbouring normal tissues. Unspecific but repressible promoters could represent an alternative. PMID:15375610

  20. Gene product identification and promoter analysis of hig locus of plasmid Rts1.

    PubMed

    Tian, Q B; Hayashi, T; Murata, T; Terawaki, Y

    1996-08-14

    The hig (host inhibition of growth) genes of plasmid Rts1 belong to the plasmid-encoded proteic killer gene family. Compared with other proteic killer genes described so far, hig is unique in that the toxic part (higB) exists upstream of the antidote gene (higA). Here we describe results of the promoter analysis of hig genes together with identification of the proteic gene products of higA and higB. Two promoters were identified in the hig locus; a stronger one, named Phig, is located upstream of higB and a weaker one, PhigA, is upstream of higA within the higB coding region. The Phig activity was negatively regulated by HigA and this regulation was augmented by HigB, whereas PhigA was not subjected to such a regulation.

  1. Methylation Status of Vitamin D Receptor Gene Promoter in Benign and Malignant Adrenal Tumors

    PubMed Central

    Pilon, Catia; Rebellato, Andrea; Urbanet, Riccardo; Guzzardo, Vincenza; Cappellesso, Rocco; Sasano, Hironobu; Fassina, Ambrogio

    2015-01-01

    We previously showed a decreased expression of vitamin D receptor (VDR) mRNA/protein in a small group of adrenocortical carcinoma (ACC) tissues, suggesting the loss of a protective role of VDR against malignant cell growth in this cancer type. Downregulation of VDR gene expression may result from epigenetics events, that is, methylation of cytosine nucleotide of CpG islands in VDR gene promoter. We analyzed methylation of CpG sites in the VDR gene promoter in normal adrenals and adrenocortical tumor samples. Methylation of CpG-rich 5′ regions was assessed by bisulfite sequencing PCR using bisulfite-treated DNA from archival microdissected paraffin-embedded adrenocortical tissues. Three normal adrenals and 23 various adrenocortical tumor samples (15 adenomas and 8 carcinomas) were studied. Methylation in the promoter region of VDR gene was found in 3/8 ACCs, while no VDR gene methylation was observed in normal adrenals and adrenocortical adenomas. VDR mRNA and protein levels were lower in ACCs than in benign tumors, and VDR immunostaining was weak or negative in ACCs, including all 3 methylated tissue samples. The association between VDR gene promoter methylation and reduced VDR gene expression is not a rare event in ACC, suggesting that VDR epigenetic inactivation may have a role in adrenocortical carcinogenesis. PMID:26843863

  2. Isolation and characterization of "GmScream" promoters that regulate highly expressing soybean (Glycine max Merr.) genes.

    PubMed

    Zhang, Ning; McHale, Leah K; Finer, John J

    2015-12-01

    To increase our understanding of the regulatory components that control gene expression, it is important to identify, isolate and characterize new promoters. In this study, a group of highly expressed soybean (Glycine max Merr.) genes, which we have named "GmScream", were first identified from RNA-Seq data. The promoter regions were then identified, cloned and fused with the coding region of the green fluorescent protein (gfp) gene, for introduction and analysis in different tissues using 3 tools for validation. Approximately half of the GmScream promoters identified showed levels of GFP expression comparable to or higher than the Cauliflower Mosaic Virus 35S (35S) promoter. Using transient expression in lima bean cotyledonary tissues, the strongest GmScream promoters gave over 6-fold higher expression than the 35S promoter while several other GmScream promoters showed 2- to 3-fold higher expression. The two highest expressing promoters, GmScreamM4 and GmScreamM8, regulated two different elongation factor 1A genes in soybean. In stably transformed soybean tissues, GFP driven by the GmScreamM4 or GmScreamM8 promoter exhibited constitutive high expression in most tissues with preferentially higher expression in proliferative embryogenic tissues, procambium, vascular tissues, root tips and young embryos. Using deletion analysis of the promoter, two proximal regions of the GmScreamM8 promoter were identified as contributing significantly to high levels of gene expression.

  3. Functional analysis of promoters in the nisin gene cluster of Lactococcus lactis.

    PubMed Central

    de Ruyter, P G; Kuipers, O P; Beerthuyzen, M M; van Alen-Boerrigter, I; de Vos, W M

    1996-01-01

    The promoters in the nisin gene cluster nisABTCIPRKFEG of Lactococcus lactis were characterized by primer extension and transcriptional fusions to the Escherichia coli promoterless beta-glucuronidase gene (gusA). Three promoters preceding the nisA, nisR, and nisF genes, which all give rise to gusA expression in the nisin-producing strain L. lactis NZ9700, were identified. The transcriptional autoregulation of nisA by signal transduction involving the sensor histidine kinase NisK and the response regulator NisR has been demonstrated previously (0. P. Kuipers, M. M. Beerthuyzen, P. G. G. A. de Ruyter, E. J. Luesink, and W. M. de Vos, J. Biol. Chem. 270: 27299-27304, 1995), and therefore the possible nisin-dependent expression of gusA under control of the nisR and nisF promoters was also investigated. The nisR promoter was shown to direct nisin-independent gusA expression in L. lactis MG 1363, which is a nisin-transposon- and plasmid-free strain. L. lactis NZ9800, which does not produce nisin because of a deletion in the nisA gene, containing the nisF-gusA fusion plasmid, gave rise to beta-glucuronidase production only after induction by nisin. A similar regulation was found in L. lactis NZ3900, which contains a single copy of the nisR and nisK genes but no other genes of the nisin gene cluster. In contrast, when the nisK gene was disrupted, no beta-glucuronidase activity directed by the nisF promoter could be detected even after induction with nisin. These results show that, like the nisA promoter, the nisF promoter is nisin inducible. The nisF and nisA promoter sequences have significant similarities and contain a conserved region that could be important for transcriptional control. PMID:8655538

  4. Regulation of transcription of the adenovirus EII promoter by gene products: Absence of sequence specificity

    SciTech Connect

    Kingston, R.E.; Kaufman, R.J.; Sharp, P.A.

    1984-10-01

    During adenovirus infection, the EII promoter is positively regulated by products of the EIa region. The authors have studied this regulation by fusing a DNA segment containing the adenovirus EII promoter to a dihydrofolate reductase cDNA segment. Expression of this hybrid gene is stimulated in trans when cell lines containing an integrated copy are either transfected with plasmids carrying the EIa region or infected with adenovirus. This suggests that EIa activity regulates transcription of the EII promoter in the absence of other viral proteins and that this stimulation can occur when the EII promoter is organized in cellular chromatin. Transcription from the EII promoter is initiated at two sites in cell lines lacking EIa activity. Introduction of the EIa region preferentially stimulated transcription from one of these two sites. A sensitive, stable cotransfection assay was used to test for specific EII sequences required for stimulation. EIa activity stimulates all mutaant promoters; the most extensive deletion retained only 18 base pairs of sequences upstream of the initiation site. They suggest that regulation of a promoter by the EIa region does not depend on the presence of a set of specific sequences, but instead reflects a characteristic of promoters that have been exogenously introduced into cells. Insertion of the 72-base-pair repeat of simian-virus 40 in cis enhances transcription from the EII promoter. The stimulatory effects of EIa activity and of the simian virus 40 sequence are additive and appear to differ mechanistically.

  5. Single-nucleotide polymorphisms and activity analysis of the promoter and enhancer of the pig lactase gene.

    PubMed

    Du, Hai-Ting; Zhu, Hong-Yan; Wang, Jia-Mei; Zhao, Wei; Tao, Xiao-Li; Ba, Cai-Feng; Tian, Yu-Min; Su, Yu-Hong

    2014-07-15

    Lactose intolerance in northern Europeans is strongly associated with a single-nucleotide polymorphism (SNP) located 14 kb upstream of the human lactase gene: -13,910 C/T. We examined whether SNPs in the 5' flanking region of the pig lactase gene are similar to those in the human gene and whether these polymorphisms play a functional role in regulating pig lactase gene expression. The 5' flanking region of the lactase gene from several different breeds of pigs was cloned and analyzed for gene regulatory activity of a luciferase reporter gene. One SNP was found in the enhancer region (-797 G/A) and two were found in the promoter region (-308G/C and -301 A/G). The promoter C-308,G-301(Pro-CG) strongly promotes the expression of the lactase gene, but the promoter G-308,A-301(Pro-GA) does not. The enhancer A-797(Enh-A) genotype for Pro-GA can significantly enhance promoter activity, but has an inhibitory effect on Pro-CG. The Enhancer G-797(Enh-G) has a significant inhibitory effect on both promoters. In conclusion, the order of effectiveness on the pig lactase gene is Enh-A+Pro-GA>Enh-A/G+Pro-CG>Enh-G+Pro-GA.

  6. Single-nucleotide polymorphisms and activity analysis of the promoter and enhancer of the pig lactase gene.

    PubMed

    Du, Hai-Ting; Zhu, Hong-Yan; Wang, Jia-Mei; Zhao, Wei; Tao, Xiao-Li; Ba, Cai-Feng; Tian, Yu-Min; Su, Yu-Hong

    2014-07-15

    Lactose intolerance in northern Europeans is strongly associated with a single-nucleotide polymorphism (SNP) located 14 kb upstream of the human lactase gene: -13,910 C/T. We examined whether SNPs in the 5' flanking region of the pig lactase gene are similar to those in the human gene and whether these polymorphisms play a functional role in regulating pig lactase gene expression. The 5' flanking region of the lactase gene from several different breeds of pigs was cloned and analyzed for gene regulatory activity of a luciferase reporter gene. One SNP was found in the enhancer region (-797 G/A) and two were found in the promoter region (-308G/C and -301 A/G). The promoter C-308,G-301(Pro-CG) strongly promotes the expression of the lactase gene, but the promoter G-308,A-301(Pro-GA) does not. The enhancer A-797(Enh-A) genotype for Pro-GA can significantly enhance promoter activity, but has an inhibitory effect on Pro-CG. The Enhancer G-797(Enh-G) has a significant inhibitory effect on both promoters. In conclusion, the order of effectiveness on the pig lactase gene is Enh-A+Pro-GA>Enh-A/G+Pro-CG>Enh-G+Pro-GA. PMID:24809963

  7. Repression of the Drosophila proliferating-cell nuclear antigen gene promoter by zerknuellt protein

    SciTech Connect

    Yamaguchi, Masamitsu; Hirose, Fumiko; Nishida, Yasuyoshi; Matsukage, Akio )

    1991-10-01

    A 631-bp fragment containing the 5{prime}-flanking region of the Drosophila melanogaster proliferating-cell nuclear antigen (PCNA) gene was placed upstream of the chloramphenicol acetyltransferase (CAT) gene of a CAT vector. A transient expression assay of CAT activity in Drosophila Kc cells transfected with this plasmid and a set of 5{prime}-deletion derivatives revealed that the promoter function resided within a 192-bp region. Cotransfection with a zerknuellt (zen)-expressing plasmid specifically repressed CAT expression. However, cotransfection with expression plasmids for a nonfunctional zen mutation, even skipped, or bicoid showed no significant effect on CAT expression. RNase protection analysis revealed that the repression by zen was at the transcription step. The target sequence of zen was mapped within the 34-bp region of the PCNA gene promoter, even though it lacked zen protein-binding sites. Transgenic flies carrying the PCNA gene regulatory region fused with lacZ were established. These results indicate that zen indirectly represses PCNA gene expression, probably by regulating the expression of some transcription factor(s) that binds to the PCNA gene promoter.

  8. Identification of a set of genes showing regionally enriched expression in the mouse brain

    PubMed Central

    D'Souza, Cletus A; Chopra, Vikramjit; Varhol, Richard; Xie, Yuan-Yun; Bohacec, Slavita; Zhao, Yongjun; Lee, Lisa LC; Bilenky, Mikhail; Portales-Casamar, Elodie; He, An; Wasserman, Wyeth W; Goldowitz, Daniel; Marra, Marco A; Holt, Robert A; Simpson, Elizabeth M; Jones, Steven JM

    2008-01-01

    Background The Pleiades Promoter Project aims to improve gene therapy by designing human mini-promoters (< 4 kb) that drive gene expression in specific brain regions or cell-types of therapeutic interest. Our goal was to first identify genes displaying regionally enriched expression in the mouse brain so that promoters designed from orthologous human genes can then be tested to drive reporter expression in a similar pattern in the mouse brain. Results We have utilized LongSAGE to identify regionally enriched transcripts in the adult mouse brain. As supplemental strategies, we also performed a meta-analysis of published literature and inspected the Allen Brain Atlas in situ hybridization data. From a set of approximately 30,000 mouse genes, 237 were identified as showing specific or enriched expression in 30 target regions of the mouse brain. GO term over-representation among these genes revealed co-involvement in various aspects of central nervous system development and physiology. Conclusion Using a multi-faceted expression validation approach, we have identified mouse genes whose human orthologs are good candidates for design of mini-promoters. These mouse genes represent molecular markers in several discrete brain regions/cell-types, which could potentially provide a mechanistic explanation of unique functions performed by each region. This set of markers may also serve as a resource for further studies of gene regulatory elements influencing brain expression. PMID:18625066

  9. Identification of the promoter sequences involved in the cell specific expression of the rat somatostatin gene.

    PubMed Central

    Andrisani, O M; Hayes, T E; Roos, B; Dixon, J E

    1987-01-01

    DNA sequences containing the 5' flanking region of the rat somatostatin gene were linked to the coding sequence of the bacterial chloramphenicol acetyl transferase gene. This recombinant plasmid is active in expressing CAT activity in the neuronally derived, somatostatin producing CA-77 cell line. Deletion analyses of the somatostatin promoter show that the sequences proximal to position -60, relative to the cap site are required for expression of this promoter. A 4 base pair deletion of residues -46 through -43 within the somatostatin promoter results in a down mutation in vivo suggesting the existence of an element critical for the expression of the promoter in CA-77 cells. In addition, the somatostatin recombinant and its 5' deletion constructs preferentially express CAT activity in CA-77 cells, whereas only basal level of expression is observed in HeLa, BSC40, and RIN-5F cell lines, pointing to the cell specific nature of this promoter. Images PMID:2886975

  10. Promoter methylation of candidate genes associated with familial testicular cancer.

    PubMed

    Mirabello, Lisa; Kratz, Christian P; Savage, Sharon A; Greene, Mark H

    2012-01-01

    Recent genomic studies have identified risk SNPs in or near eight genes associated with testicular germ cell tumors (TGCT). Mouse models suggest a role for Dnd1 epigenetics in TGCT susceptibility, and we have recently reported that transgenerational inheritance of epigenetic events may be associated with familial TGCT risk. We now investigate whether aberrant promoter methylation of selected candidate genes is associated with familial TGCT risk. Pyrosequencing assays were designed to evaluate CpG methylation in the promoters of selected genes in peripheral blood DNA from 153 TGCT affecteds and 116 healthy male relatives from 101 multiple-case families. Wilcoxon rank-sum tests and logistic regression models were used to investigate associations between promoter methylation and TGCT. We also quantified gene product expression of these genes, using quantitative PCR. We observed increased PDE11A, SPRY4 and BAK1 promoter methylation, and decreased KITLG promoter methylation, in familial TGCT cases versus healthy male family controls. A significant upward risk trend was observed for PDE11A when comparing the middle and highest tertiles of methylation to the lowest [odds ratio (OR) =1.55, 95% confidence intervals (CI) 0.82-2.93, and 1.94, 95% CI 1.03-3.66], respectively; P(trend)=0.042). A significant inverse association was observed for KITLG when comparing the middle and lowest tertiles to the highest (OR=2.15, 95% CI 1.12-4.11, and 2.15, 95% CI 1.12-4.14, respectively; P(trend)=0.031). There was a weak inverse correlation between promoter methylation and KITLG expression. Our results suggest that familial TGCT susceptibility may be associated with promoter methylation of previously-identified TGCT risk-modifying genes. Larger studies are warranted. PMID:23050052

  11. Aberrant promoter methylation of multiple genes in sputum from individuals exposed to smoky coal emissions

    PubMed Central

    Liu, Yang; Lan, Qing; Shen, Min; Mumford, Judy; Keohavong, Phouthone

    2010-01-01

    Summary Aberrant methylation in the promoter region of cancer-related genes leads to gene transcriptional inactivation and plays an integral role in lung tumorigenesis. Recent studies demonstrated that promoter methylation was detected not only in lung tumors from patients with lung cancer but also in sputum of smokers without the disease, suggesting the potential for aberrant gene promoter methylation in sputum as a predictive marker for lung cancer. In the present study, we investigated promoter methylation of 4 genes frequently detected in lung tumors, including p16, MGMT, RASSF1A and DAPK genes, in sputum samples obtained from 107 individuals, including 34 never-smoking females and 73 mostly smoking males, who had no evidence of lung cancer but who were exposed to smoky coal emission in Xuan Wei County, China, where lung cancer rate is more than 6 times the Chinese national average rate. Forty nine of the individuals showed evidence of chronic bronchitis while the remaining 58 individuals showed no such a symptom. Promoter methylation of p16, MGMT, RASSF1A and DAPK was detected in 51.4% (55/107), 17.8% (19/107), 29.9% (32/107), and 15.9% (17/107) of the sputum samples from these individuals, respectively. There were no differences in promoter methylation frequencies of any of these genes according to smoking status or gender of the subjects or between individuals with chronic bronchitis and those without evidence of such a symptom. Therefore, individuals exposed to smoky coal emissions in this region harbored in their sputum frequent promoter methylation of these genes that have been previously found in lung tumors and implicated in lung cancer development. PMID:18751376

  12. Linker scanner mutagenesis of the Xenopus laevis ribosomal gene promoter.

    PubMed Central

    Reeder, R H; Pennock, D; McStay, B; Roan, J; Tolentino, E; Walker, P

    1987-01-01

    We have assayed a series of linker scanner mutants which cover the Xenopus laevis ribosomal gene promoter at approximately ten base pair intervals. All of these mutations adversely affect promoter activity with the exception of one mutation which stimulates activity. Thus, none are neutral. We show that most of the mutations can be partially rescued by ligating a block of enhancer elements upstream of the promoter. In addition, we have made extracts from liver nuclei which produce DNaseI protection footprints over the promoter. Analysis of both strands reveals a prominent footprinting domain from about -5 to -30. However, lesser changes in the digestion pattern are detected over most of the promoter. Previously published analyses have suggested that this promoter might be composed of three functional domains. The experiments presented here suggest that either 1) the three putative domains are so closely arranged that the boundaries are difficult to discern, or 2) the situation is more complex. Images PMID:3658698

  13. Identification of learning and memory genes in canine; promoter investigation and determining the selective pressure.

    PubMed

    Seifi Moroudi, Reihane; Masoudi, Ali Akbar; Vaez Torshizi, Rasoul; Zandi, Mohammad

    2014-12-01

    One of the important behaviors of dogs is trainability which is affected by learning and memory genes. These kinds of the genes have not yet been identified in dogs. In the current research, these genes were found in animal models by mining the biological data and scientific literatures. The proteins of these genes were obtained from the UniProt database in dogs and humans. Not all homologous proteins perform similar functions, thus comparison of these proteins was studied in terms of protein families, domains, biological processes, molecular functions, and cellular location of metabolic pathways in Interpro, KEGG, Quick Go and Psort databases. The results showed that some of these proteins have the same performance in the rat or mouse, dog, and human. It is anticipated that the protein of these genes may be effective in learning and memory in dogs. Then, the expression pattern of the recognized genes was investigated in the dog hippocampus using the existing information in the GEO profile. The results showed that BDNF, TAC1 and CCK genes are expressed in the dog hippocampus, therefore, these genes could be strong candidates associated with learning and memory in dogs. Subsequently, due to the importance of the promoter regions in gene function, this region was investigated in the above genes. Analysis of the promoter indicated that the HNF-4 site of BDNF gene and the transcription start site of CCK gene is exposed to methylation. Phylogenetic analysis of protein sequences of these genes showed high similarity in each of these three genes among the studied species. The dN/dS ratio for BDNF, TAC1 and CCK genes indicates a purifying selection during the evolution of the genes.

  14. Zebrafish U6 small nuclear RNA gene promoters contain a SPH element in an unusual location.

    PubMed

    Halbig, Kari M; Lekven, Arne C; Kunkel, Gary R

    2008-09-15

    Promoters for vertebrate small nuclear RNA (snRNA) genes contain a relatively simple array of transcriptional control elements, divided into proximal and distal regions. Most of these genes are transcribed by RNA polymerase II (e.g., U1, U2), whereas the U6 gene is transcribed by RNA polymerase III. Previously identified vertebrate U6 snRNA gene promoters consist of a proximal sequence element (PSE) and TATA element in the proximal region, plus a distal region with octamer (OCT) and SphI postoctamer homology (SPH) elements. We have found that zebrafish U6 snRNA promoters contain the SPH element in a novel proximal position immediately upstream of the TATA element. The zebrafish SPH element is recognized by SPH-binding factor/selenocysteine tRNA gene transcription activating factor/zinc finger protein 143 (SBF/Staf/ZNF143) in vitro. Furthermore, a zebrafish U6 promoter with a defective SPH element is inefficiently transcribed when injected into embryos.

  15. Transcriptional regulation of teleost aicda genes. Pt 1 suppressors of promiscuous promoters

    Technology Transfer Automated Retrieval System (TEKTRAN)

    In order to better understand antibody affinity maturation in fishes we sought to identify gene regulatory elements that could drive expression of activated B-cell specific fluorescent reporter transgenes in zebrafish. Specifically the promoter and several non-coding regions of the channel catfish (...

  16. Transcriptional promoter of the human alpha 1(V) collagen gene (COL5A1).

    PubMed Central

    Lee, S; Greenspan, D S

    1995-01-01

    We have characterized the 5' region of the human alpha 1(V) collagen gene (COL5A1). The transcriptional promoter is shown to have a number of features characteristic of the promoters of 'housekeeping' and growth-control-related genes. It lacks obvious TATA and CAAT boxes, has multiple transcription start sites, has a high GC content, lies within a well-defined CpG island and has a number of consensus sites for the potential binding of transcription factor Sp1. This type of promoter structure, while unusual for a collagen gene, is consistent with the broad distribution of expression of COL5A1 and is reminiscent of the promoter structures of the genes encoding type VI collagen, which has a similarly broad distribution of expression. Stepwise deletion of COL5A1 5' sequences, placed upstream of a heterologous reporter gene, yielded a gradual decrease in promoter activity, indicating that the COL5A1 promoter is composed of an array of cis-acting elements. A minimal promoter region contained within the 212 bp immediately upstream of the major transcription start site contained no consensus sequences for the binding of known transcription factors, but gel mobility shift assays showed this region to bind nuclear factors, including Sp1, at a number of sites. The major transcription start site is flanked by an upstream 34-bp oligopurine/oligopyrimidine stretch, or 'GAGA' box, and a downstream 56-bp GAGA box which contains a 10-bp mirror repeat and is sensitive to cleavage with S1 nuclease. Images Figure 1 Figure 3 Figure 4 Figure 6 PMID:7646438

  17. The Mouse Solitary Odorant Receptor Gene Promoters as Models for the Study of Odorant Receptor Gene Choice

    PubMed Central

    Degl'Innocenti, Andrea

    2016-01-01

    Background In vertebrates, several anatomical regions located within the nasal cavity mediate olfaction. Among these, the main olfactory epithelium detects most conventional odorants. Olfactory sensory neurons, provided with cilia exposed to the air, detect volatile chemicals via an extremely large family of seven-transmembrane chemoreceptors named odorant receptors. Their genes are expressed in a monogenic and monoallelic fashion: a single allele of a single odorant receptor gene is transcribed in a given mature neuron, through a still uncharacterized molecular mechanism known as odorant receptor gene choice. Aim Odorant receptor genes are typically arranged in genomic clusters, but a few are isolated (we call them solitary) from the others within a region broader than 1 Mb upstream and downstream with respect to their transcript's coordinates. The study of clustered genes is problematic, because of redundancy and ambiguities in their regulatory elements: we propose to use the solitary genes as simplified models to understand odorant receptor gene choice. Procedures Here we define number and identity of the solitary genes in the mouse genome (C57BL/6J), and assess the conservation of the solitary status in some mammalian orthologs. Furthermore, we locate their putative promoters, predict their homeodomain binding sites (commonly present in the promoters of odorant receptor genes) and compare candidate promoter sequences with those of wild-caught mice. We also provide expression data from histological sections. Results In the mouse genome there are eight intact solitary genes: Olfr19 (M12), Olfr49, Olfr266, Olfr267, Olfr370, Olfr371, Olfr466, Olfr1402; five are conserved as solitary in rat. These genes are all expressed in the main olfactory epithelium of three-day-old mice. The C57BL/6J candidate promoter of Olfr370 has considerably varied compared to its wild-type counterpart. Within the putative promoter for Olfr266 a homeodomain binding site is predicted. As a

  18. Honey bee promoter sequences for targeted gene expression.

    PubMed

    Schulte, C; Leboulle, G; Otte, M; Grünewald, B; Gehne, N; Beye, M

    2013-08-01

    The honey bee, Apis mellifera, displays a rich behavioural repertoire, social organization and caste differentiation, and has an interesting mode of sex determination, but we still know little about its underlying genetic programs. We lack stable transgenic tools in honey bees that would allow genetic control of gene activity in stable transgenic lines. As an initial step towards a transgenic method, we identified promoter sequences in the honey bee that can drive constitutive, tissue-specific and cold shock-induced gene expression. We identified the promoter sequences of Am-actin5c, elp2l, Am-hsp83 and Am-hsp70 and showed that, except for the elp2l sequence, the identified sequences were able to drive reporter gene expression in Sf21 cells. We further demonstrated through electroporation experiments that the putative neuron-specific elp2l promoter sequence can direct gene expression in the honey bee brain. The identification of these promoter sequences is an important initial step in studying the function of genes with transgenic experiments in the honey bee, an organism with a rich set of interesting phenotypes. PMID:23668189

  19. Interaction of CCAAT/enhancer-binding protein alpha and beta with the rat caeruloplasmin gene promoter.

    PubMed Central

    Bingle, C D; Fleming, R E; Gitlin, J D

    1993-01-01

    To determine the mechanisms of expression of the rat caeruloplasmin gene, the promoter region was analysed by DNAase I footprinting. Using nuclear extract from rat liver, a prominent site of protein-DNA interaction was detected from -93 to -48 upstream of the caeruloplasmin gene transcription start and sequence analysis of this region revealed three potential CCAAT/enhancer-binding protein (C/EBP) consensus elements. Mobility-shift analysis using an oligonucleotide encoding this region identified specific binding of proteins from rat liver nuclear extract, and some of these complexes were supershifted using antisera to the C/EBP alpha and beta family members. Mobility-shift studies using a polypeptide encoding the DNA-binding domain of C/EBP alpha also revealed a specific interaction with this region of the caeruloplasmin promoter, and DNAase I footprinting using this polypeptide protected the identical region from -93 to -48. Co-transfection of expression plasmids encoding C/EBP alpha or a related leucine-zipper factor D-binding protein (DBP) revealed a C/EBP-specific increase in reporter gene activity in HepG2 cells transfected with caeruloplasmin-chloramphenicol acetyltransferase containing the -93 to -48 region. A similar result was obtained when these constructs were co-transfected into mouse L cells which were shown not to express the endogenous caeruloplasmin gene. Taken together, these data indicate a role for C/EBP alpha and beta in mediating transcription from the caeruloplasmin gene promoter and suggest that this region of the promoter is not responsible for tissue-specific expression. Images Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 PMID:8373362

  20. Characterization of a putative cis-regulatory element that controls transcriptional activity of the pig uroplakin II gene promoter

    SciTech Connect

    Kwon, Deug-Nam; Park, Mi-Ryung; Park, Jong-Yi; Cho, Ssang-Goo; Park, Chankyu; Oh, Jae-Wook; Song, Hyuk; Kim, Jae-Hwan; Kim, Jin-Hoi

    2011-07-01

    Highlights: {yields} The sequences of -604 to -84 bp of the pUPII promoter contained the region of a putative negative cis-regulatory element. {yields} The core promoter was located in the 5F-1. {yields} Transcription factor HNF4 can directly bind in the pUPII core promoter region, which plays a critical role in controlling promoter activity. {yields} These features of the pUPII promoter are fundamental to development of a target-specific vector. -- Abstract: Uroplakin II (UPII) is a one of the integral membrane proteins synthesized as a major differentiation product of mammalian urothelium. UPII gene expression is bladder specific and differentiation dependent, but little is known about its transcription response elements and molecular mechanism. To identify the cis-regulatory elements in the pig UPII (pUPII) gene promoter region, we constructed pUPII 5' upstream region deletion mutants and demonstrated that each of the deletion mutants participates in controlling the expression of the pUPII gene in human bladder carcinoma RT4 cells. We also identified a new core promoter region and putative negative cis-regulatory element within a minimal promoter region. In addition, we showed that hepatocyte nuclear factor 4 (HNF4) can directly bind in the pUPII core promoter (5F-1) region, which plays a critical role in controlling promoter activity. Transient cotransfection experiments showed that HNF4 positively regulates pUPII gene promoter activity. Thus, the binding element and its binding protein, HNF4 transcription factor, may be involved in the mechanism that specifically regulates pUPII gene transcription.

  1. [Cloning and characterization of D-113 gene promoter from cotton].

    PubMed

    Luo, Ke-Ming; Guo, Yu-Long; Xiao, Yue-Hua; Hou, Lei; Pei, Yan

    2002-02-01

    To study the expression of late embryogenesis abundant gene in seeds, the 1,024 bp 5' flanking sequence of D-113 gene, a late embryogenesis abundant gene of Gossypium hirsutum cv. Coker 312, was cloned by PCR. The similarity compared with the sequence of Lea protein gene family published was 92.50%. There are three putative ABREs and one enhancer-like which riches A/T in the promoter. The promoter was fused to the beta-glucuronidase gene to form pLD II. Via a particle bombardment, pLD II was introduced into embryogenic calli of cotton and seeds of Brassica napus which were all treated with abscisic acid for 3d before bombardment, also into roots, stems and leafs of cotton. Transient expression was measured histochemically as spot number 24 h after bombardment. GUS sexpression was observed in the seeds of Brassica napus and the embryogenic calli of cotton, but not found in roots and leaves of cotton. Those results indicated that the expression of D-113 gene promoter was embryo specific. PMID:11902000

  2. Functional analysis of the transcriptional promoter for the CYP1A1 gene.

    PubMed Central

    Jones, K W; Whitlock, J P

    1990-01-01

    In mouse hepatoma cells, the environmental contaminant 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD) increases the transcription rate of the CYP1A1 gene, which encodes a cytochrome P-450 enzyme. In this study, we analyzed the DNA region immediately upstream of the CYP1A1 gene. A domain that extends upstream to nucleotide--166 was found to function as a transcriptional promoter. The promoter was silent when uncoupled from the dioxin-responsive enhancer located farther upstream. DNase footprinting experiments indicated that nuclear proteins interact with distinct domains of the promoter in a TCDD-independent fashion. Mutational analyses indicated that the CYP1A1 promoter contains at least three functional domains, including a TATAAA sequence, a CCAAT box transcription factor/nuclear factor I-like recognition motif, and a guanine-rich G box. Images PMID:2398886

  3. ECRbase: Database of Evolutionary Conserved Regions, Promoters, and Transcription Factor Binding Sites in Vertebrate Genomes

    DOE Data Explorer

    Loots, Gabriela G. [LLNL; Ovcharenko, I. [LLNL

    Evolutionary conservation of DNA sequences provides a tool for the identification of functional elements in genomes. This database of evolutionary conserved regions (ECRs) in vertebrate genomes features a database of syntenic blocks that recapitulate the evolution of rearrangements in vertebrates and a comprehensive collection of promoters in all vertebrate genomes generated using multiple sources of gene annotation. The database also contains a collection of annotated transcription factor binding sites (TFBSs) in evolutionary conserved and promoter elements. ECRbase currently includes human, rhesus macaque, dog, opossum, rat, mouse, chicken, frog, zebrafish, and fugu genomes. (taken from paper in Journal: Bioinformatics, November 7, 2006, pp. 122-124

  4. Molecular mechanisms underlying the regulation of the MFG-E8 gene promoter activity in physiological and inflammatory conditions

    PubMed Central

    Wang, Xiao; Bu, Heng-Fu; Liu, Shirley XL; De Plaen, Isabelle G.; Tan, Xiao-Di

    2015-01-01

    Milk fat globule-EGF factor 8 (MFG-E8) is expressed by macrophages and plays an important role in attenuating inflammation and maintaining tissue homeostasis. Previously, we and others found that LPS inhibits MFG-E8 gene expression in macrophages. Here, we characterized the 5′-flanking region of the mouse MFG-E8 gene. To functionally analyze the upstream regulatory region of the MFG-E8 gene, a series of luciferase reporter gene constructs containing deleted or mutated regulatory elements were prepared. Using the luciferase assay, we revealed that Sp1 binding motifs within the proximal promoter region were necessary for full activity of the MFG-E8 promoter, whereas AP-1 like binding sequence at −372 played a role in governing the promoter activity at a homeostatic level. With chromatin immunoprecipitation assay, we showed that Sp1 and c-Jun physically interact with the MFG-E8 promoter region in vivo. In addition, Sp1 was found to regulate the MFG-E8 promoter activity positively and c-Jun negatively. Furthermore, we demonstrated that LPS inhibited MFG-E8 promoter activity via targeting Sp1 and AP-1-like motifs in the 5′-flanking region. Collectively, our data indicate that Sp1 and AP-1-related factors are involved in the regulation of MFG-E8 gene transcription by targeting their binding sites in the 5′-flanking region under physiological and inflammatory states. PMID:25711369

  5. A characterization of the elements comprising the promoter of the mouse ribosomal protein gene RPS16.

    PubMed

    Hariharan, N; Perry, R P

    1989-07-11

    The elements comprising the mouse rpS16 promoter were characterized by transfection experiments with mutant genes in which various portions of the 5' flanking region and exon I were removed or substituted with extraneous DNA sequence. These experiments were carried out with otherwise intact rpS16 genes transfected into monkey kidney (COS) cells and also with chimeric rpS16-CAT gene constructs transfected into mouse plasmacytoma cells and COS cells. The locations of the functionally important elements were generally correlated with the locations of binding sites for specific nuclear factors, which were identified by gel-mobility shift analyses and methylation interference footprints. The most upstream element, which is located approximately 165 bp from the cap site, binds the Sp1 transcription factor and augments the promoter activity by 2 to 2.5-fold. In addition, there is a complex bipartite element in the -83 to -59 region, an element in the -37 to -12 region and an element in the +9 to +29 region of exon I, all of which are essential for rpS16 expression. The rpS16 promoter has a general architecture that resembles other mouse rp promoters; however, it also possesses some distinctive characteristics. PMID:2762128

  6. Promoter and expression studies on an Arabidopsis thaliana dehydrin gene.

    PubMed

    Rouse, D T; Marotta, R; Parish, R W

    1996-03-01

    A genomic clone of a group 2 lea/rab/dehydrin gene from Arabidopsis thaliana, Xero2/lti30, was cloned and sequenced. Promoter-GUS fusions were introduced into plants to analyse the promoter and determine expression patterns. Using root cultures, GUS expression was found to be moderately stimulated by abscisic acid (ABA), wounding, cold and dehydration. Results with an ABA-deficient mutant suggested endogenous ABA is required for these responses. Promoter deletion studies indicated multiple cis-acting elements are involved in the induction of the gene. GUS expression occurred in desiccated seeds, in all tissues of young seedlings and in roots (with the exception of the root tip), desiccated pollen grains, trichomes and the vascular tissues of leaves and stems in mature plants.

  7. PHF8 and REST/NRSF co-occupy gene promoters to regulate proximal gene expression.

    PubMed

    Wang, Juan; Lin, Xueqiu; Wang, Su; Wang, Chenfei; Wang, Qixuan; Duan, Xikun; Lu, Peng; Wang, Qian; Wang, Chengyang; Liu, X Shirley; Huang, Jinyan

    2014-01-01

    Chromatin regulators play an important role in the development of human diseases. In this study, we focused on Plant Homeo Domain Finger protein 8 (PHF8), a chromatin regulator that has attracted special concern recently. PHF8 is a histone lysine demethylase ubiquitously expressed in nuclei. Mutations of PHF8 are associated with X-linked mental retardation. It usually functions as a transcriptional co-activator by associating with H3K4me3 and RNA polymerase II. We found that PHF8 may associate with another regulator, REST/NRSF, predominately at promoter regions via studying several published PHF8 chromatin immunoprecipitation-sequencing (ChIP-Seq) datasets. Our analysis suggested that PHF8 not only activates but may also repress gene expression. PMID:24852203

  8. 5' control regions of the apolipoprotein(a) gene and members of the related plasminogen gene family.

    PubMed Central

    Wade, D P; Clarke, J G; Lindahl, G E; Liu, A C; Zysow, B R; Meer, K; Schwartz, K; Lawn, R M

    1993-01-01

    Elevated blood levels of apolipoprotein(a), the component of lipoprotein(a) that distinguishes it from low density lipoprotein, are a major risk factor for atherosclerosis. The apolipoprotein(a) gene is highly similar to the plasminogen gene and to at least four other genes or pseudogenes. The 5' untranslated and flanking sequences of these six genes contain extensive regions of near identity and share sequence elements involved in the initiation of transcription and translation. About 1000 base pairs of flanking DNA of each gene are sufficient to promote transcription in cultured hepatocytes. The apolipoprotein(a) gene promoter contains functional interleukin 6-responsive elements, consistent with the reported acute-phase response of apolipoprotein(a). Flanking genomic fragments of the apoliprotein(a) gene from two individuals with vastly different plasma apolipoprotein(a) concentrations have sequence differences that are reflected in differences in the rate of in vitro transcription. Images PMID:7679504

  9. Four Inducible Promoters for Controlled Gene Expression in the Oleaginous Yeast Rhodotorula toruloides

    PubMed Central

    Johns, Alexander M. B.; Love, John; Aves, Stephen J.

    2016-01-01

    Rhodotorula (Rhodosporidium) toruloides is an oleaginous yeast with great biotechnological potential, capable of accumulating lipid up to 70% of its dry biomass, and of carotenoid biosynthesis. However, few molecular genetic tools are available for manipulation of this basidiomycete yeast and its high genomic GC content can make routine cloning difficult. We have developed plasmid vectors for transformation of R. toruloides which include elements for Saccharomyces cerevisiae in-yeast assembly; this method is robust to the assembly of GC-rich DNA and of large plasmids. Using such vectors we screened for controllable promoters, and identified inducible promoters from the genes NAR1, ICL1, CTR3, and MET16. These four promoters have independent induction/repression conditions and exhibit different levels and rates of induction in R. toruloides, making them appropriate for controllable transgene expression in different experimental situations. Nested deletions were used to identify regulatory regions in the four promoters, and to delimit the minimal inducible promoters, which are as small as 200 bp for the NAR1 promoter. The NAR1 promoter shows very tight regulation under repressed conditions as determined both by an EGFP reporter gene and by conditional rescue of a leu2 mutant. These new tools facilitate molecular genetic manipulation and controllable gene expression in R. toruloides.

  10. Chimeric promoter mediates guard cell-specific gene expression in tobacco under water deficit.

    PubMed

    Na, Jong-Kuk; Metzger, James D

    2014-09-01

    The engineering of stomatal activity under water deficit through guard cell-specific gene regulation is an effective approach to improve drought tolerance of crops but it requires an appropriate promoter(s) inducible by water deficit in guard cells. We report that a chimeric promoter can induce guard cell-specific gene expression under water deficit. A chimeric promoter, p4xKST82-rd29B, was constructed using a tetramer of the 82 bp guard cell-specific regulatory region of potato KST1 promoter (4xKST82) and Arabidopsis dehydration-responsive rd29B promoter. Transgenic tobacco plants carrying p4xKST82-rd29B:mGFP-GUS exhibited GUS expression in response to water deficit. GUS enzyme activity of p4xKST82-rd29B:mGFP-GUS transgenic plants increased ~300 % by polyethylene glycol treatment compared to that of control plant but not by abscisic acid (ABA), indicating that the p4xKST82-rd29B chimeric promoter can be used to induce the guard cell-specific expression of genes of interest in response to water deficit in an ABA-independent manner.

  11. Differential interactions of promoter elements in stress responses of the Arabidopsis Adh gene.

    PubMed Central

    Dolferus, R; Jacobs, M; Peacock, W J; Dennis, E S

    1994-01-01

    The Adh (alcohol dehydrogenase, EC 1.1.1.1.) gene from Arabidopsis thaliana (L.) Heynh. can be induced by dehydration and cold, as well as by hypoxia. A 1-kb promoter fragment (CADH: -964 to +53) is sufficient to confer the stress induction and tissue-specific developmental expression characteristics of the Adh gene to a beta-glucuronidase reporter gene. Deletion mapping of the 5' end and site-specific mutagenesis identified four regions of the promoter essential for expression under the three stress conditions. Some sequence elements are important for response to all three stress treatments, whereas others are stress specific. The most critical region essential for expression of the Arabidopsis Adh promoter under all three environmental stresses (region IV: -172 to -141) contains sequences homologous to the GT motif (-160 to -152) and the GC motif (-147 to -144) of the maize Adh1 anaerobic responsive element. Region III (-235 to -172) contains two regions shown by R.J. Ferl and B.H. Laughner ([1989] Plant Mol Biol 12: 357-366) to bind regulatory proteins; mutation of the G-box-1 region (5'-CCACGTGG-3', -216 to -209) does not affect expression under uninduced or hypoxic conditions, but significantly reduces induction by cold stress and, to a lesser extent, by dehydration stress. Mutation of the other G-box-like sequence (G-box-2: 5'-CCAAGTGG-3', -193 to -182) does not change hypoxic response and affects cold and dehydration stress only slightly. G-box-2 mutations also promote high levels of expression under uninduced conditions. Deletion of region I (-964 to -510) results in increased expression under uninduced and all stress conditions, suggesting that this region contains a repressor binding site. Region II (-510 to -384) contains a positive regulatory element and is necessary for high expression levels under all treatments. PMID:7972489

  12. Genomic organization and promoter analysis of the Trichomonas vaginalis core histone gene families.

    PubMed

    Cong, Peikuan; Luo, Yingfeng; Bao, Weidong; Hu, Songnian

    2010-03-01

    Core histone gene is a well-established model to study eukaryote gene transcription regulation mechanism. However, the protozoan core histone gene regulation mechanism remains largely unknown. In this study, we observed almost all protozoan Trichomonas vaginalis core histone genes (60/74) organize as gene pairs in a head-to-head manner, thus facilitating the divergent transcription of both partners. Additionally, the majority of both T. vaginalis core histone genes pairs (50/60) and solitary genes (10/14), contain three over-represented motifs with conserved positional architecture at their promoter regions. Notably of the three motifs, Motif I is highly similar to the Inr which mediates the transcription start site selection in T. vaginalis. Motif II and Motif III preferably locate at the promoter regions of the T. vaginalis genome. Those findings reveal that both genomic organization and cis-acting transcription elements facilitate these large number of T. vaginalis core histone genes under the control of the same transcription machine. PMID:19744576

  13. Genomic organization and promoter analysis of the Trichomonas vaginalis core histone gene families.

    PubMed

    Cong, Peikuan; Luo, Yingfeng; Bao, Weidong; Hu, Songnian

    2010-03-01

    Core histone gene is a well-established model to study eukaryote gene transcription regulation mechanism. However, the protozoan core histone gene regulation mechanism remains largely unknown. In this study, we observed almost all protozoan Trichomonas vaginalis core histone genes (60/74) organize as gene pairs in a head-to-head manner, thus facilitating the divergent transcription of both partners. Additionally, the majority of both T. vaginalis core histone genes pairs (50/60) and solitary genes (10/14), contain three over-represented motifs with conserved positional architecture at their promoter regions. Notably of the three motifs, Motif I is highly similar to the Inr which mediates the transcription start site selection in T. vaginalis. Motif II and Motif III preferably locate at the promoter regions of the T. vaginalis genome. Those findings reveal that both genomic organization and cis-acting transcription elements facilitate these large number of T. vaginalis core histone genes under the control of the same transcription machine.

  14. Promoter regulatory domain identification of cassava starch synthase IIb gene in transgenic tobacco.

    PubMed

    Guan, Zhihui; Chen, Xin; Xie, Hairong; Wang, Wenquan

    2016-05-01

    Soluble starch synthase is a key enzyme in the starch biosynthesis pathway, and its enzyme activity significantly influences starch components in cassava storage root. However, studies on the regulation mechanism of soluble starch synthase gene are rare. In this study, we cloned the 5' flanking sequence of the MeSSIIb gene and predicted the distribution of cis-elements. The region from -453 to -1 was considered the primary core promoter by the quantitative detection of GUS activity in transgenic tobacco plants containing 5' truncated promoters fused with the GUS gene. Analysis results clarified that the region from -531 to -454 significantly repressed promoter activity. The region from -453 to -388 was a repressive domain of ethylene, and some unknown drought responsive cis-elements were located in the region from -387 to -1. These findings will provide useful information on the functional assay and transcriptional regulation mechanisms of the MeSSIIb gene. PMID:26919397

  15. Cloning of mouse telomerase reverse transcriptase gene promoter and identification of proximal core promoter sequences essential for the expression of transgenes in cancer cells.

    PubMed

    Si, Shao-Yan; Song, Shu-Jun; Zhang, Jian-Zhong; Liu, Jun-Li; Liang, Shuang; Feng, Kai; Zhao, Gang; Tan, Xiao-Qing

    2011-08-01

    Telomerase is a ribonucleoprotein complex, whose function is to add motif-specific nucleotides to the end of chromosomes. Telomerase consists of three major subunits, the telomerase RNA template (hTR), the telomerase-associated protein (TEP1) and telomerase reverse transcriptase (TERT). TERT is the most important component responsible for the catalytic activity of telomerase and a rate-limiting determinant of the activity. Telomerase activities were at high levels in approximately 90% of mouse cancers or tumor-derived cell lines through TERT transcriptional up-regulation. Unlike human telomerase, telomerase activity exists in colon, liver, ovary and testis but not in brain, heart, stomach and muscle in normal mouse tissues. In this study, we prepared 5' truncations of 1086 bp fragments upstream of the initiating ATG codon of the mTERT gene to construct luciferase reporter gene plasmids, and transfected these plasmids into a normal mouse cell line and several cancer lines to identify the core promoter region essential for transcriptional activation in cancer cells by a luciferase assay. We constructed a eukaryotic expression vector of membrane-expressing staphylococcal endotoxin A (SEA) gene driven by the core promoter region of the mTERT gene and observed if the core promoter region could express the SEA gene in these cancer cells, but not in normal cells following transfection with the construct. The results showed that the transcriptional activities of each fragment of the mTERT gene promoter in the cancer cell lines Hepa1-6, B16 and CT26 were higher than those in NIH3T3 cells, and the proximal 333-bp fragment was the core promoter of the mTERT gene in the cancer cells. The proximal 333-bp fragment was able to make the SEA express on the surface of the cancer cells, but not in NIH3T3 cells. It provides a foundation for cancer targeting gene therapy by using the mTERT gene promoter. PMID:21567104

  16. Efficient expression of protein coding genes from the murine U1 small nuclear RNA promoters.

    PubMed Central

    Bartlett, J S; Sethna, M; Ramamurthy, L; Gowen, S A; Samulski, R J; Marzluff, W F

    1996-01-01

    Few promoters are active at high levels in all cells. Of these, the majority encode structural RNAs transcribed by RNA polymerases I or III and are not accessible for the expression of proteins. An exception are the small nuclear RNAs (snRNAs) transcribed by RNA polymerase II. Although snRNA biosynthesis is unique and thought not to be compatible with synthesis of functional mRNA, we have tested these promoters for their ability to express functional mRNAs. We have used the murine U1a and U1b snRNA gene promoters to express the Escherichia coli lacZ gene and the human alpha-globin gene from either episomal or integrated templates by transfection, or infection into a variety of mammalian cell types. Equivalent expression of beta-galactosidase was obtained from < 250 nucleotides of 5'-flanking sequence containing the complete promoter of either U1 snRNA gene or from the 750-nt cytomegalovirus promoter and enhancer regions. The mRNA was accurately initiated at the U1 start site, efficiently spliced and polyadenylylated, and localized to polyribosomes. Recombinant adenovirus containing the U1b-lacZ chimeric gene transduced and expressed beta-galactosidase efficiently in human 293 cells and airway epithelial cells in culture. Viral vectors containing U1 snRNA promoters may be an attractive alternative to vectors containing viral promoters for persistent high-level expression of therapeutic genes or proteins. Images Fig. 2 Fig. 3 Fig. 4 Fig. 5 PMID:8799116

  17. Urban land use limits regional bumble bee gene flow.

    PubMed

    Jha, Shalene; Kremen, C

    2013-05-01

    Potential declines in native pollinator communities and increased reliance on pollinator-dependent crops have raised concerns about native pollinator conservation and dispersal across human-altered landscapes. Bumble bees are one of the most effective native pollinators and are often the first to be extirpated in human-altered habitats, yet little is known about how bumble bees move across fine spatial scales and what landscapes promote or limit their gene flow. In this study, we examine regional genetic differentiation and fine-scale relatedness patterns of the yellow-faced bumble bee, Bombus vosnesenskii, to investigate how current and historic habitat composition impact gene flow. We conducted our study across a landscape mosaic of natural, agricultural and urban/suburban habitats, and we show that B. vosnesenskii exhibits low but significant levels of differentiation across the study system (F(ST) = 0.019, D(est) = 0.049). Most importantly, we reveal significant relationships between pairwise F(ST) and resistance models created from contemporary land use maps. Specifically, B. vosnesenskii gene flow is most limited by commercial, industrial and transportation-related impervious cover. Finally, our fine-scale analysis reveals significant but declining relatedness between individuals at the 1-9 km spatial scale, most likely due to local queen dispersal. Overall, our results indicate that B. vosnesenskii exhibits considerable local dispersal and that regional gene flow is significantly limited by impervious cover associated with urbanization.

  18. Polymorphic core promoter GA-repeats alter gene expression of the early embryonic developmental genes.

    PubMed

    Valipour, E; Kowsari, A; Bayat, H; Banan, M; Kazeminasab, S; Mohammadparast, S; Ohadi, M

    2013-12-01

    Protein complexes that bind to 'GAGA' DNA elements are necessary to replace nucleosomes to create a local chromatin environment that facilitates a variety of site-specific regulatory responses. Three to four elements are required for the disruption of a preassembled nucleosome. We have previously identified human protein-coding gene core promoters that are composed of exceptionally long GA-repeats. The functional implication of those GA-repeats is beginning to emerge in the core promoter of the human SOX5 gene, which is involved in multiple developmental processes. In the current study, we analyze the functional implication of GA-repeats in the core promoter of two additional genes, MECOM and GABRA3, whose expression is largely limited to embryogenesis. We report a significant difference in gene expression as a result of different alleles across those core promoters in the HEK-293 cell line. Across-species homology check for the GABRA3 GA-repeats revealed that those repeats are evolutionary conserved in mouse and primates (p<1 × 10(-8)). The MECOM core promoter GA-repeats are also conserved in numerous species, of which human has the longest repeat and complexity. We propose a novel role for GA-repeat core promoters to regulate gene expression in the genes involved in development and evolution.

  19. Simultaneous gene inactivation and promoter reporting in cyanobacteria.

    PubMed

    Chen, Kangming; Xu, Xinyi; Gu, Liping; Hildreth, Michael; Zhou, Ruanbao

    2015-02-01

    homolog, and a previously unknown function of gene all2508. Thus, gene expression and phenotypic analysis of mutants can be achieved simultaneously by targeted gene inactivation using the pZR606-based system. This combined approach for targeted gene inactivation and its promoter reporting with GFP may be broadly applicable to the study of gene function in other prokaryotic organisms. PMID:25434810

  20. Promoter DNA Hypermethylation and Gene Repression in Undifferentiated Arabidopsis Cells

    PubMed Central

    Berdasco, María; Alcázar, Rubén; García-Ortiz, María Victoria; Ballestar, Esteban; Fernández, Agustín F.; Roldán-Arjona, Teresa; Tiburcio, Antonio F.; Altabella, Teresa; Buisine, Nicolas; Quesneville, Hadi; Baudry, Antoine; Lepiniec, Loïc; Alaminos, Miguel; Rodríguez, Roberto; Lloyd, Alan; Colot, Vincent; Bender, Judith; Canal, María Jesús; Esteller, Manel; Fraga, Mario F.

    2008-01-01

    Maintaining and acquiring the pluripotent cell state in plants is critical to tissue regeneration and vegetative multiplication. Histone-based epigenetic mechanisms are important for regulating this undifferentiated state. Here we report the use of genetic and pharmacological experimental approaches to show that Arabidopsis cell suspensions and calluses specifically repress some genes as a result of promoter DNA hypermethylation. We found that promoters of the MAPK12, GSTU10 and BXL1 genes become hypermethylated in callus cells and that hypermethylation also affects the TTG1, GSTF5, SUVH8, fimbrin and CCD7 genes in cell suspensions. Promoter hypermethylation in undifferentiated cells was associated with histone hypoacetylation and primarily occurred at CpG sites. Accordingly, we found that the process specifically depends on MET1 and DRM2 methyltransferases, as demonstrated with DNA methyltransferase mutants. Our results suggest that promoter DNA methylation may be another important epigenetic mechanism for the establishment and/or maintenance of the undifferentiated state in plant cells. PMID:18827894

  1. Integrated epigenomic analyses of enhancer as well as promoter regions in gastric cancer

    PubMed Central

    Baek, Su-Jin; Kim, Mirang; Bae, Dong-Hyuck; Kim, Jeong-Hwan; Kim, Hee-Jin; Han, Myoung-Eun; Oh, Sae-Ock; Kim, Yong Sung; Kim, Seon-Young

    2016-01-01

    Abnormal DNA methylation is an epigenetic mechanism that promotes gastric carcinogenesis. While the abnormal methylation at promoter regions has been characterized for many genes, the function of DNA methylation marks at distal regulatory regions in gastric cancer remains poorly described. Here, we performed RNA-seq, MBD-seq, and H3K27ac ChIP-seq on gastric tissues and cell lines to understand the epigenetic changes in the distal as well as the proximal regulatory regions. In total, 257,651 significant DMRs (Differentially methylated regions) were identified in gastric cancer, and the majority of these DMRs were located in the intergenic, intronic, and non-coding RNA regions. We identified the aberrant expression of many genes and lncRNAs due to changes in DNA methylation. Furthermore, we profiled the molecular subtype-specific methylation patterns in gastric cancer to characterize subtype-specific regulators that undergo DNA methylation changes. Our findings provide insights for understanding methylation changes at distal regulatory regions and reveal novel epigenetic targets in gastric cancer. PMID:27016420

  2. Diversity and characterization of polymorphic 5' promoter haplotypes of MICA and MICB genes.

    PubMed

    Cox, S T; Madrigal, J A; Saudemont, A

    2014-09-01

    The major histocompatibility complex (MHC) class I-related chain A (MICA) and B (MICB) are ligands for the natural killer group 2, member D (NKG2D) activating receptor expressed on natural killer (NK) cells, natural killer T (NKT) cells, CD8+ T cells and γδ T cells. Natural killer group 2, member D (NKG2D) ligand expression is stress-related and upregulated by infected or oncogenic cells leading to cytolysis. MICA and MICB genes display considerable polymorphism among individuals and studies have investigated allelic association with disease and relevance of MICA in transplantation, with variable success. It is now known that promoters of MICA and MICB are polymorphic with some polymorphisms associating with reduced expression. We sequenced International Histocompatibility Workshop (IHW) cell line DNA to determine promoter types and alleles encoded by exons 2-6. We found 8 of 12 known MICA promoter polymorphisms and although promoter P7 dominated, other promoters associated with the same allele. For example, MICA*002:01 had promoters P3, P4 or P7 and the common MICA*008:01/04 type had P1, P6 or P7. Similarly, we sequenced 8 of 12 known MICB promoter haplotypes. Some coding region defined MICB alleles had a single promoter, for example, MICB*002:01 and promoter P9, whereas the promiscuous MICB*005 allele had promoters P1, P2, P5, P6, P10 or P12. The results indicate potential for variation in expression of MICA and MICB ligands between individuals with the same allelic types. If differential expression by polymorphic MICA and MICB promoters is confirmed by functional studies, involvement of these genes in disease susceptibility or adverse transplantation outcomes may require knowledge of both promoter and allelic types to make meaningful conclusions.

  3. High level transgenic expression of soybean (Glycine max) GmERF and Gmubi gene promoters isolated by a novel promoter analysis pipeline

    PubMed Central

    2010-01-01

    Background Although numerous factors can influence gene expression, promoters are perhaps the most important component of the regulatory control process. Promoter regions are often defined as a region upstream of the transcriptional start. They contain regulatory elements that interact with regulatory proteins to modulate gene expression. Most genes possess their own unique promoter and large numbers of promoters are therefore available for study. Unfortunately, relatively few promoters have been isolated and characterized; particularly from soybean (Glycine max). Results In this research, a bioinformatics approach was first performed to identify members of the Gmubi (G.max ubiquitin) and the GmERF (G. max Ethylene Response Factor) gene families of soybean. Ten Gmubi and ten GmERF promoters from selected genes were cloned upstream of the gfp gene and successfully characterized using rapid validation tools developed for both transient and stable expression. Quantification of promoter strength using transient expression in lima bean (Phaseolus lunatus) cotyledonary tissue and stable expression in soybean hairy roots showed that the intensity of gfp gene expression was mostly conserved across the two expression systems. Seven of the ten Gmubi promoters yielded from 2- to 7-fold higher expression than a standard CaMV35S promoter while four of the ten GmERF promoters showed from 1.5- to 2.2-times higher GFP levels compared to the CaMV35S promoter. Quantification of GFP expression in stably-transformed hairy roots of soybean was variable among roots derived from different transformation events but consistent among secondary roots, derived from the same primary transformation events. Molecular analysis of hairy root events revealed a direct relationship between copy number and expression intensity; higher copy number events displayed higher GFP expression. Conclusion In this study, we present expression intensity data on 20 novel soybean promoters from two different gene

  4. The combination of a synthetic promoter and a CMV promoter improves foreign gene expression efficiency in myocytes.

    PubMed

    Jianwei, Dai; Qianqian, Zhang; Songcai, Liu; Mingjun, Zhang; Xiaohui, Ren; Linlin, Hao; Qingyan, Jiang; Yongliang, Zhang

    2012-04-15

    Skeletal muscle is becoming an attractive target tissue for gene therapy. Nevertheless, the low level of gene therapeutic expression in this tissue is the major limitation to it becoming an ideal target for gene transfer. The promoter is important element for gene transcription; however, the gene expression efficiencies and specificities of viral promoters and skeletal muscle-specific promotors are in themselves limiting factors. In this study, we established a dual-promoters system in skeletal muscle using a cytomegalovirus (CMV) promoter and a skeletal muscle-specific synthetic promoter. Mouse myoblast cell line C2C12 cells were transfected with the system. We demonstrated that the dual-promoters system could significantly improve exogenous gene expression rate in vitro when compared with a single CMV promoter system and a skeletal muscle-specific synthetic promoter system in C2C12 cell line, by 69.48% and 41.93%, respectively. Next, we evaluated the system efficiency in vivo, the results showed that the dual-promoters system increased gene expression in mice 1.23-fold and 1.60-fold, respectively compared with expression controlled by the two single promoter vectors. Finally, we tested the dual-promoters system in growth hormone-releasing hormone (GHRH) gene therapy, and revealed that when these two promoters co-drove the GHRH gene expression in vivo animal growth was enhanced significantly. All these results indicate that use of the dual-promoter vector was more efficient for gene expression in skeletal muscle tissue than use of the single promoter vectors. These finding could, hopefully, lead to the development of a high efficiency expression system in myocytes and form an ideal approach for gene therapy.

  5. Functional characterization of the 5'-regulatory region of the murine apolipoprotein gene.

    PubMed

    Lahiri, D K; Alley, G M; Ge, Y-W; Du, Y

    2002-11-01

    The apolipoprotein E (APOE) gene causes a major risk factor for the development of Alzheimer's disease (AD). To study the transcription control of the mouse (m) APOE gene, we first tested the promoter activity of a 721-base-pair (bp) 5'-flanking region, which is located 771 bp upstream from the translation initiation codon. We cloned the 721-bp region upstream of the reporter chloramphenicol acetyl transferase (CAT) gene into a promoterless vector (pBLCAT3). The mAPOE promoter and vector DNA were separately transfected in rat glial C6 and neuronal PC12 cell lines. The 721-bp APOE region (from position 329 to 1050) is functionally active in different cell lines tested. The serial deletion analysis indicates that the 266-bp promoter region (from 784 to 1050) has the highest and the 67-bp region (from 983 to 1050) the lowest activity on the reporter gene in neuronal and astrocytic cell lines. These studies suggest that the 147-bp region (from 637 to 784) has a negative regulatory effect on the reporter gene. In the gel shift assay, the 67-bp region binds to a specific transcription factor(s) in PC12 nuclear extracts. Our results suggest that mAPOE can also be expressed in neuronal cells in addition to the astrocytic cells. Characterization of mAPOE promoter is important for the AD drug development discovery and APOE transgenic mice studies.

  6. Sequences contained within the promoter of the human thymidine kinase gene can direct cell-cycle regulation of heterologous fusion genes.

    PubMed Central

    Kim, Y K; Wells, S; Lau, Y F; Lee, A S

    1988-01-01

    Recent evidence on the transcriptional regulation of the human thymidine kinase (TK) gene raises the possibility that cell-cycle regulatory sequences may be localized within its promoter. A hybrid gene that combines the TK 5' flanking sequence and the coding region of the bacterial neomycin-resistance gene (neo) has been constructed. Upon transfection into a hamster fibroblast cell line K12, the hybrid gene exhibits cell-cycle-dependent expression. Deletion analysis reveals that the region important for cell-cycle regulation is within -441 to -63 nucleotides from the transcriptional initiation site. This region (-441 to -63) also confers cell-cycle regulation to the herpes simplex virus thymidine kinase (HSVtk) promoter, which is not expressed in a cell-cycle manner. We conclude that the -441 to -63 sequence within the human TK promoter is important for cell-cycle-dependent expression. Images PMID:3413063

  7. Maximal Expression of the Evolutionarily Conserved Slit2 Gene Promoter Requires Sp1.

    PubMed

    Saunders, Jacquelyn; Wisidagama, D Roonalika; Morford, Travis; Malone, Cindy S

    2016-08-01

    Slit2 is a neural axon guidance and chemorepellent protein that stimulates motility in a variety of cell types. The role of Slit2 in neural development and neoplastic growth and migration has been well established, while the genetic mechanisms underlying regulation of the Slit2 gene have not. We identified the core and proximal promoter of Slit2 by mapping multiple transcriptional start sites, analyzing transcriptional activity, and confirming sequence homology for the Slit2 proximal promoter among a number of species. Deletion series and transient transfection identified the Slit2 proximal promoter as within 399 base pairs upstream of the start of transcription. A crucial region for full expression of the Slit2 proximal promoter lies between 399 base pairs and 296 base pairs upstream of the start of transcription. Computer modeling identified three transcription factor-binding consensus sites within this region, of which only site-directed mutagenesis of one of the two identified Sp1 consensus sites inhibited transcriptional activity of the Slit2 proximal promoter (-399 to +253). Bioinformatics analysis of the Slit2 proximal promoter -399 base pair to -296 base pair region shows high sequence conservation over twenty-two species, and that this region follows an expected pattern of sequence divergence through evolution.

  8. [Cloning and regulation of pig estrogen related receptor β gene (ESRRB) promoter].

    PubMed

    Yang, Yang; Wang, Yaxian; Du, Lixia; Wang, Huayan

    2015-04-01

    The estrogen related receptor family member Esrrb (Estrogen related receptor β) is a gene that expresses in the early stage of embryo and plays an important role in the core pluripotent network. Its function has been analyzed in human and mouse, although no report so far related to pig. Therefore, to explore its mechanism of transcriptional regulation and expression pattern, we cloned a 3.3 kb pig ESRRB promoter by PCR and constructed the green fluorescence protein (GFP) reporter vector pE3.3. We used these vectors to study the ESRRB expression pattern in 293T, Hela and C2C12. Sequence was analyzed for regulatory elements that share homology to known transcription factor binding sites by TFSEARCH and JASPER program. Some pluripotency related genes such as SMAD, STAT3, MYC, KLF4 and ESRRB have been found within the 3.3 kb sequence by co-transfected pig ESRRB promoter and these potential regulators. We found that ESRRB only expressed in 293T and SMAD could activate ESRRB expression obviously. To determine the core promoter region, a series of ESRRB promoter fragments with gradually truncated 5'-end were produced by PCR and inserted into pGL3-Basic vector. After transient transfection into 293T, dual luciferase assay was used to measure these promoter activities. The result suggested that the core promoter of pig ESRRB located within -25 bp to -269 bp region. These results suggest that these transcription factor binding sites and the core promoter region may be essential for transcriptional regulation of pig ESRRB gene. PMID:26380406

  9. Cloning and Functional Analysis of the Promoter of an Ascorbate Oxidase Gene from Gossypium hirsutum.

    PubMed

    Xin, Shan; Tao, Chengcheng; Li, Hongbin

    2016-01-01

    Apoplastic ascorbate oxidase (AO) plays significant roles in plant cell growth. However, the mechanism of underlying the transcriptional regulation of AO in Gossypium hirsutum remains unclear. Here, we obtained a 1,920-bp promoter sequence from the Gossypium hirsutum ascorbate oxidase (GhAO1) gene, and this GhAO1 promoter included a number of known cis-elements. Promoter activity analysis in overexpressing pGhAO1::GFP-GUS tobacco (Nicotiana benthamiana) showed that the GhAO1 promoter exhibited high activity, driving strong reporter gene expression in tobacco trichomes, leaves and roots. Promoter 5'-deletion analysis demonstrated that truncated GhAO1 promoters with serial 5'-end deletions had different GUS activities. A 360-bp fragment was sufficient to activate GUS expression. The P-1040 region had less GUS activity than the P-720 region, suggesting that the 320-bp region from nucleotide -720 to -1040 might include a cis-element acting as a silencer. Interestingly, an auxin-responsive cis-acting element (TGA-element) was uncovered in the promoter. To analyze the function of the TGA-element, tobacco leaves transformed with promoters with different 5' truncations were treated with indole-3-acetic acid (IAA). Tobacco leaves transformed with the promoter regions containing the TGA-element showed significantly increased GUS activity after IAA treatment, implying that the fragment spanning nucleotides -1760 to -1600 (which includes the TGA-element) might be a key component for IAA responsiveness. Analyses of the AO promoter region and AO expression pattern in Gossypium arboreum (Ga, diploid cotton with an AA genome), Gossypium raimondii (Gr, diploid cotton with a DD genome) and Gossypium hirsutum (Gh, tetraploid cotton with an AADD genome) indicated that AO promoter activation and AO transcription were detected together only in D genome/sub-genome (Gr and Gh) cotton. Taken together, these results suggest that the 1,920-bp GhAO1 promoter is a functional sequence with a

  10. Cloning and Functional Analysis of the Promoter of an Ascorbate Oxidase Gene from Gossypium hirsutum

    PubMed Central

    Xin, Shan; Tao, Chengcheng; Li, Hongbin

    2016-01-01

    Apoplastic ascorbate oxidase (AO) plays significant roles in plant cell growth. However, the mechanism of underlying the transcriptional regulation of AO in Gossypium hirsutum remains unclear. Here, we obtained a 1,920-bp promoter sequence from the Gossypium hirsutum ascorbate oxidase (GhAO1) gene, and this GhAO1 promoter included a number of known cis-elements. Promoter activity analysis in overexpressing pGhAO1::GFP-GUS tobacco (Nicotiana benthamiana) showed that the GhAO1 promoter exhibited high activity, driving strong reporter gene expression in tobacco trichomes, leaves and roots. Promoter 5’-deletion analysis demonstrated that truncated GhAO1 promoters with serial 5’-end deletions had different GUS activities. A 360-bp fragment was sufficient to activate GUS expression. The P-1040 region had less GUS activity than the P-720 region, suggesting that the 320-bp region from nucleotide -720 to -1040 might include a cis-element acting as a silencer. Interestingly, an auxin-responsive cis-acting element (TGA-element) was uncovered in the promoter. To analyze the function of the TGA-element, tobacco leaves transformed with promoters with different 5’ truncations were treated with indole-3-acetic acid (IAA). Tobacco leaves transformed with the promoter regions containing the TGA-element showed significantly increased GUS activity after IAA treatment, implying that the fragment spanning nucleotides -1760 to -1600 (which includes the TGA-element) might be a key component for IAA responsiveness. Analyses of the AO promoter region and AO expression pattern in Gossypium arboreum (Ga, diploid cotton with an AA genome), Gossypium raimondii (Gr, diploid cotton with a DD genome) and Gossypium hirsutum (Gh, tetraploid cotton with an AADD genome) indicated that AO promoter activation and AO transcription were detected together only in D genome/sub-genome (Gr and Gh) cotton. Taken together, these results suggest that the 1,920-bp GhAO1 promoter is a functional sequence

  11. Identification and Analysis of Regulatory Elements in Porcine Bone Morphogenetic Protein 15 Gene Promoter.

    PubMed

    Wan, Qianhui; Wang, Yaxian; Wang, Huayan

    2015-10-27

    Bone morphogenetic protein 15 (BMP15) is secreted by the mammalian oocytes and is indispensable for ovarian follicular development, ovulation, and fertility. To determine the regulation mechanism of BMP15 gene, the regulatory sequence of porcine BMP15 was investigated in this study. The cloned BMP15 promoter retains the cell-type specificity, and is activated in cells derived from ovarian tissue. The luciferase assays in combination with a series of deletion of BMP15 promoter sequence show that the -427 to -376 bp region of BMP15 promoter is the primary regulatory element, in which there are a number of transcription factor binding sites, including LIM homeobox 8 (LHX8), newborn ovary homeobox gene (NOBOX), and paired-like homeodomain transcription factor 1 (PITX1). Determination of tissue-specific expression reveals that LHX8, but not PITX1 and NOBOX, is exclusively expressed in pig ovary tissue and is translocated into the cell nuclei. Overexpression of LHX8 in Chinese hamster ovary (CHO) cells could significantly promote BMP15 promoter activation. This study confirms a key regulatory element that is located in the proximal region of BMP15 promoter and is regulated by the LHX8 factor.

  12. Identification and Analysis of Regulatory Elements in Porcine Bone Morphogenetic Protein 15 Gene Promoter

    PubMed Central

    Wan, Qianhui; Wang, Yaxian; Wang, Huayan

    2015-01-01

    Bone morphogenetic protein 15 (BMP15) is secreted by the mammalian oocytes and is indispensable for ovarian follicular development, ovulation, and fertility. To determine the regulation mechanism of BMP15 gene, the regulatory sequence of porcine BMP15 was investigated in this study. The cloned BMP15 promoter retains the cell-type specificity, and is activated in cells derived from ovarian tissue. The luciferase assays in combination with a series of deletion of BMP15 promoter sequence show that the −427 to −376 bp region of BMP15 promoter is the primary regulatory element, in which there are a number of transcription factor binding sites, including LIM homeobox 8 (LHX8), newborn ovary homeobox gene (NOBOX), and paired-like homeodomain transcription factor 1 (PITX1). Determination of tissue-specific expression reveals that LHX8, but not PITX1 and NOBOX, is exclusively expressed in pig ovary tissue and is translocated into the cell nuclei. Overexpression of LHX8 in Chinese hamster ovary (CHO) cells could significantly promote BMP15 promoter activation. This study confirms a key regulatory element that is located in the proximal region of BMP15 promoter and is regulated by the LHX8 factor. PMID:26516845

  13. Analysis of functional elements in the human Egr-1 gene promoter.

    PubMed

    Aicher, W K; Sakamoto, K M; Hack, A; Eibel, H

    1999-01-01

    The early growth response (Egr)-1 gene encoding a zinc-finger transcription factor is transiently induced in many different cell types upon various differentiation signals. However, in synovial fibroblasts of rheumatoid arthritis patients, Egr-1 is constitutively expressed at high levels, and several genes with Egr-1 binding sites in their promoter regions have been associated with disease progression of RA. We analyzed the control of Egr-1 transcription by characterizing those regulatory elements in the Egr-1 promoter that induce Egr-1 expression in fibroblasts. Using reporter gene assays and deletion mutants of the Egr-1 promoter we could demonstrate that Egr-1 transcription is mainly activated by a single serum response element, whereas other transcription factor binding sites, including binding sites for AP-1 or Egr-1, were found to play a minor role. Furthermore, we identified a novel regulatory element in the human Egr-1 promoter similar to a NF kappa-B binding site. Deletion of this element enhanced Egr-1 promoter activity in 3T3 but not in L929 fibroblasts. Stimulation by phorbolester induced only transient Egr-1 expression in 3T3 fibroblasts but a extended expression of Egr-1 in L929 cells. These data suggest that in fibroblasts the most proximal serum response element in the Egr-1 promoter represents the major activation site, whereas binding of the NFkB-like factor may serve as negative regulatory signal for Egr-1 transcription in fibroblasts.

  14. The expression profile and promoter analysis of ultraspiracle gene in the silkworm Bombyx mori.

    PubMed

    Huang, Ming-xia; Du, Jie; Su, Bao-jin; Zhao, Guo-dong; Shen, Wei-de; Wei, Zheng-guo

    2014-12-01

    The nuclear receptor, ultraspiracle protein (USP), is a transcription factor and an essential component of a heterodimeric receptor complex with ecdysone receptor. However, the mechanisms underlying the transcriptional regulation of USP in silkworm are unknown. In this study, using dual-spike-in qPCR method, we examined the expression of Bombyx ultraspiracle gene (BmUSP) in various tissues of silkworm as well as expression changes after stimulation with ecdysone. The results showed that the expression levels of BmUSP gene varied in different tissues and were increased 2 h after exposure to ecdysone. To identify the molecular mechanism underlying the regulation of USP gene expression in silkworm Bombyx mori, promoter truncation analyses were performed using the luciferase reporter assay and Bac-to-Bac expression system in several tissues of B. mori. BmUSP gene promoter with 5' end serial deletions showed different levels of activity in various tissues, higher in fat body and Malpighian tubule. Deletion of the region from -485 to -445 and -307 to -281 upstream of BmUSP gene abolished and increased its promoter activity, respectively. This region contains AP-1, Dfd transcription factor binding sites. These results indicate that BmUSP are expressed at different levels in different tissues of the silkworm, but all are subjected to the regulation by ecdysone. This study would provide an important foundation for investigating the mechanism underlying the transcriptional regulation of BmUSP in the silkworm.

  15. The artificial zinc finger coding gene 'Jazz' binds the utrophin promoter and activates transcription.

    PubMed

    Corbi, N; Libri, V; Fanciulli, M; Tinsley, J M; Davies, K E; Passananti, C

    2000-06-01

    Up-regulation of utrophin gene expression is recognized as a plausible therapeutic approach in the treatment of Duchenne muscular dystrophy (DMD). We have designed and engineered new zinc finger-based transcription factors capable of binding and activating transcription from the promoter of the dystrophin-related gene, utrophin. Using the recognition 'code' that proposes specific rules between zinc finger primary structure and potential DNA binding sites, we engineered a new gene named 'Jazz' that encodes for a three-zinc finger peptide. Jazz belongs to the Cys2-His2 zinc finger type and was engineered to target the nine base pair DNA sequence: 5'-GCT-GCT-GCG-3', present in the promoter region of both the human and mouse utrophin gene. The entire zinc finger alpha-helix region, containing the amino acid positions that are crucial for DNA binding, was specifically chosen on the basis of the contacts more frequently represented in the available list of the 'code'. Here we demonstrate that Jazz protein binds specifically to the double-stranded DNA target, with a dissociation constant of about 32 nM. Band shift and super-shift experiments confirmed the high affinity and specificity of Jazz protein for its DNA target. Moreover, we show that chimeric proteins, named Gal4-Jazz and Sp1-Jazz, are able to drive the transcription of a test gene from the human utrophin promoter.

  16. Structural analysis and promoter characterization of the human collagenase-3 gene (MMP13)

    SciTech Connect

    Pendas, A.M.; Balbin, M.; Llano, E.

    1997-03-01

    Human collagenase-3 (MMP13) is a recently identified member of the matrix metalloproteinase (MMP) family that is expressed in breast carcinomas and in articular cartilage from arthritic patients. In this work we have isolated and characterized genomic clones coding for human collagenase-3. This gene is composed of 10 exons and 9 introns and spans over 12.5 kb. The overall organization of the collagenase-3 gene is similar to that of other MMP genes clustered at chromosome 11q22, including fibroblast collagenase (MMP-1), matrilysin (MMP-7), and macrophage metalloelastase (MMP-12), but is more distantly related to genes coding for stromelysin-3 (MMP-11), gelatinase-A (MMP-2), and gelatinase-B (MMP-9), which map outside of this gene cluster. Nucleotide sequence analysis of about 1 kb of the 5{prime}-flanking region of the collagenase-3 gene revealed the presence of a TATA box, an AP-1 motif, a PEA-3 consensus sequence, an osteoblast specific element (OSE-2), and a TGF-{beta} inhibitory element. Transient transfection experiments in HeLa and COS-1 cells with chloramphenicol acetyltransferase (CAT)-containing constructs showed that the AP-1 site is functional and responsible for the observed inducibility of the reporter gene by the tumor promoter 12-O-tetradecanoylphorbol-13-acetate (TPA). However, and in contrast to other MMP genes, no significative synergistic effect on CAT activity between the AP-1 and PEA-3 elements found in the collagenase-3 gene promoter was found. DNA binding analysis with nuclear extracts from HeLa cells revealed the formation of specific complexes between collagenase-3 promoter sequences containing the AP-1 site and nuclear proteins. The presence of this AP-1 functional site, which is able to confer responsiveness to a variety of tumor promoters and oncogene products, may contribute to explaining the high-level expression of collagenase-3 in breast carcinomas and degenerative joint diseases. 48 refs., 5 figs., 2 tabs.

  17. Three promoters regulate the transcriptional activity of the human holocarboxylase synthetase gene1,2

    PubMed Central

    Xia, Mengna; Malkaram, Sridhar A.; Zempleni, Janos

    2013-01-01

    Holocarboxylase synthetase (HLCS) is the only protein biotin ligase in the human proteome. HLCS-dependent biotinylation of carboxylases plays crucial roles in macronutrient metabolism. HLCS appears to be an essential part of multiprotein complexes in the chromatin that cause gene repression and contribute toward genome stability. Consistent with these essential functions, HLCS knockdown causes strong phenotypes including shortened life span and low stress resistance in Drosophila melanogaster, and de-repression of long-terminal repeats in humans, other mammalian cell lines, and Drosophila. Despite previous observations that the expression of HLCS depends on biotin status in rats and in human cell lines, little is known about the regulation of HLCS expression. The goal of this study was to identify promoters that regulate the expression of the human HLCS gene. Initially, the human HLCS locus was interrogated in silico using predictors of promoters including sequences of HLCS mRNA and expressed sequence tags, CpG islands, histone marks denoting transcriptionally poised chromatin, transcription factor binding sites, and DNaseI hypersensitive regions. Our predictions revealed three putative HLCS promoters, denoted P1, P2, and P3. Promoters lacked a TATA box, which is typical for housekeeping genes. When the three promoters were cloned into a luciferase reporter plasmid, reporter gene activity was at least three times background noise in human breast, colon, and kidney cell lines; activities consistently followed the pattern P1> >P3>P2. Promoter activity depended on the concentration of biotin in culture media, but the effect was moderate. We conclude that we have identified promoters in the human HLCS gene. PMID:24075901

  18. hTERT and BIRC5 gene promoters for cancer gene therapy: A comparative study

    PubMed Central

    Shepelev, Mikhail V.; Kopantzev, Eugene P.; Vinogradova, Tatiana V.; Sverdlov, Eugene D.; Korobko, Igor V.

    2016-01-01

    Human telomerase reverse transcriptase (hTERT) and survivin (BIRC5) gene promoters are frequently used for transcriptional targeting of tumor cells, yet there is no comprehensive comparative analysis allowing rational choice of a promoter for a particular therapy. In the current study, the transcriptional activity of hTERT, human BIRC5 and mouse Birc5 promoters and their modifications were compared in 10 human cancer cell lines using the luciferase reporter gene activity assay. The results revealed that BIRC5- and hTERT-based promoters had strikingly different cell specificities with comparable activities in only 40% of cell lines. Importantly, relative hTERT and BIRC5 transcript abundance cannot be used to predict the most potent promoter. Among the hTERT-based promoters that were assessed, modification with the minimal cytomegalovirus promoter generally resulted in the most potent activity. Mouse Birc5 and modified human BIRC5 promoters were superior to the unmodified human survivin promoter; however, their tumor specificities must be investigated further. In summary, the present results emphasize the desirability for construction of more universal tumor-specific promoters to efficiently target a wide spectrum of tumor cells. PMID:27446419

  19. A promoter probe plasmid based on green fluorescent protein : a strategy for studying meningococcal gene expression.

    PubMed

    Webb, S A; Langford, P R; Kroll, J S

    2001-01-01

    Many bacterial genes are regulated in an environment-responsive fashion, and from the perspective of a pathogen, the host represents just another environment. Many genes that contribute to virulence are differentially expressed in response to host environments that they encounter during colonization and invasion (1). Recognition of this has led to the development of selection or reporter systems that utilize the increased activity of promoters during growth in vivo to identify genes that are selectively expressed during infection, and, thus, may contribute to the infection process (2-5). One of these techniques, differential fluorescence induction (2,3), involves the use of a promoter-probe plasmid that utilizes a variant of green fluorescent protein (GFP) as its reporter. The technique has been used successfully to identify novel Salmonella typhimurium genes that are selectively expressed following exposure to acid environments (3) and during infection of macrophages (2). GFP reporter systems have also been used to evaluate in vivo gene expression in other organisms including Staphylococcus aureus (6), Listeria monocytogenes (7), and Mycobacterium marinum (8). This chapter describes the use of the GFP-promoter-probe plasmid, pJSK411, which is suitable for the evaluation of differential gene expression in Neisseria meningitidis (Fig.1). Fig. 1. Map of pJSK411 demonstrating restriction sites within the multiple cloning site. The binding site for the 401 US primer overlies the XhoI site and the 41 1DS primer binding site lies within the coding region of GFPmut3.

  20. Identification of chromatin marks at TERRA promoter and encoding region.

    PubMed

    Negishi, Yutaka; Kawaji, Hideya; Minoda, Aki; Usui, Kengo

    2015-11-27

    TERRA is a long non-coding RNA that is essential for telomere integrity. Although it is transcribed from subtelomeres and telomeres, how it is expressed in heterochromatic region is currently unknown. In this study, we focused our analysis on TERRA-encoding region TelBam3.4 and TelBam3.4-like sequences, and determined their transcription start sites, as well as enrichment of RNA polymerase II and histone modifications. We found that H3K4me3 and H3K9me3 are present at TERRA promoters, whereas H3K27ac and H3K9me3 are present at telomeric repeats. Consistently, we show that presence of active histone modifications H3K4me3 and H3K27ac are correlated to TERRA expression. These results mark an important step towards understanding telomere maintenance and transcription.

  1. The 3' flanking region of the human ABO histo-blood group gene is involved in negative regulation of gene expression.

    PubMed

    Sano, Rie; Nakajima, Tamiko; Takahashi, Keiko; Kubo, Rieko; Yazawa, Shin; Kominato, Yoshihiko

    2011-01-01

    Gene expression is driven by promoters, enhancers, silencers, and other cis-regulatory elements upstream and downstream of the gene. Previous studies of the regulation of human ABO gene transcription have focused mainly on the 5' region, including the core promoter and the region proximal to it. However, as the involvement of the 3' flanking region in transcriptional regulation has not yet been examined, we focused on this issue. The 3' region approximately 2.2kb downstream of the ABO gene was PCR-amplified and inserted into a cloning vector, followed by sequence determination and preparation of luciferase reporter vectors. Transient transfections into KATOIII and K562 cells were performed using various reporter plasmids containing the 3' region. The 3' region of the ABO gene, which was characterized by a high degree of sequence repetition, was effectively cloned by a single-copy cloning method. Transfections in KATOIII and K562 cells showed that negative elements were demonstrable within the 3' region. These observations suggest that negative regulatory elements seem to be present in the 3' region of ABO in both epithelial and erythroid lineages. As we had observed a negative region just upstream of the ABO promoter, transcription from ABO could be negatively regulated by repressive regions just upstream of the promoter and downstream of the gene. Further studies of the enhancer will be required for elucidating the molecular basis of ABO gene expression. PMID:21144789

  2. Isolation and Functional Characterization of a Lycopene β-cyclase Gene Promoter from Citrus

    PubMed Central

    Lu, Suwen; Zhang, Yin; Zheng, Xiongjie; Zhu, Kaijie; Xu, Qiang; Deng, Xiuxin

    2016-01-01

    Lycopene β-cyclases are key enzymes located at the branch point of the carotenoid biosynthesis pathway. However, the transcriptional regulatory mechanisms of LCYb1 in citrus with abundant carotenoid accumulation are still unclear. To understand the molecular basis of CsLCYb1 expression, we isolated and functionally characterized the 5′ upstream sequences of CsLCYb1 from citrus. The full-length CsLCYb1 promoter and a series of its 5′ deletions were fused to the β-glucuronidase (GUS) reporter gene and transferred into different plants (tomato, Arabidopsis and citrus callus) to test the promoter activities. The results of all transgenic species showed that the 1584 bp upstream region from the translational start site displayed maximal promoter activity, and the minimal promoter containing 746 bp upstream sequences was sufficient for strong basal promoter activity. Furthermore, the CsLCYb1 promoter activity was developmentally and tissue-specially regulated in transgenic Arabidopsis, and it was affected by multiple hormones and environmental cues in transgenic citrus callus under various treatments. Finer deletion analysis identified an enhancer element existing as a tandem repeat in the promoter region between -574 to -513 bp and conferring strong promoter activity. The copy numbers of the enhancer element differed among various citrus species, leading to the development of a derived simple sequence repeat marker to distinguish different species. In conclusion, this study elucidates the expression characteristics of the LCYb1 promoter from citrus and further identifies a novel enhancer element required for the promoter activity. The characterized promoter fragment would be an ideal candidate for genetic engineering and seeking of upstream trans-acting elements.

  3. Isolation and Functional Characterization of a Lycopene β-cyclase Gene Promoter from Citrus.

    PubMed

    Lu, Suwen; Zhang, Yin; Zheng, Xiongjie; Zhu, Kaijie; Xu, Qiang; Deng, Xiuxin

    2016-01-01

    Lycopene β-cyclases are key enzymes located at the branch point of the carotenoid biosynthesis pathway. However, the transcriptional regulatory mechanisms of LCYb1 in citrus with abundant carotenoid accumulation are still unclear. To understand the molecular basis of CsLCYb1 expression, we isolated and functionally characterized the 5' upstream sequences of CsLCYb1 from citrus. The full-length CsLCYb1 promoter and a series of its 5' deletions were fused to the β-glucuronidase (GUS) reporter gene and transferred into different plants (tomato, Arabidopsis and citrus callus) to test the promoter activities. The results of all transgenic species showed that the 1584 bp upstream region from the translational start site displayed maximal promoter activity, and the minimal promoter containing 746 bp upstream sequences was sufficient for strong basal promoter activity. Furthermore, the CsLCYb1 promoter activity was developmentally and tissue-specially regulated in transgenic Arabidopsis, and it was affected by multiple hormones and environmental cues in transgenic citrus callus under various treatments. Finer deletion analysis identified an enhancer element existing as a tandem repeat in the promoter region between -574 to -513 bp and conferring strong promoter activity. The copy numbers of the enhancer element differed among various citrus species, leading to the development of a derived simple sequence repeat marker to distinguish different species. In conclusion, this study elucidates the expression characteristics of the LCYb1 promoter from citrus and further identifies a novel enhancer element required for the promoter activity. The characterized promoter fragment would be an ideal candidate for genetic engineering and seeking of upstream trans-acting elements. PMID:27679644

  4. Conserved regulatory elements of the promoter sequence of the gene rpoH of enteric bacteria

    PubMed Central

    Ramírez-Santos, Jesús; Collado-Vides, Julio; García-Varela, Martin; Gómez-Eichelmann, M. Carmen

    2001-01-01

    The rpoH regulatory region of different members of the enteric bacteria family was sequenced or downloaded from GenBank and compared. In addition, the transcriptional start sites of rpoH of Yersinia frederiksenii and Proteus mirabilis, two distant members of this family, were determined. Sequences similar to the σ70 promoters P1, P4 and P5, to the σE promoter P3 and to boxes DnaA1, DnaA2, cAMP receptor protein (CRP) boxes CRP1, CRP2 and box CytR present in Escherichia coli K12, were identified in sequences of closely related bacteria such as: E.coli, Shigella flexneri, Salmonella enterica serovar Typhimurium, Citrobacter freundii, Enterobacter cloacae and Klebsiella pneumoniae. In more distant bacteria, Y.frederiksenii and P.mirabilis, the rpoH regulatory region has a distal P1-like σ70 promoter and two proximal promoters: a heat-induced σE-like promoter and a σ70 promoter. Sequences similar to the regulatory boxes were not identified in these bacteria. This study suggests that the general pattern of transcription of the rpoH gene in enteric bacteria includes a distal σ70 promoter, >200 nt upstream of the initiation codon, and two proximal promoters: a heat-induced σE-like promoter and a σ70 promoter. A second proximal σ70 promoter under catabolite-regulation is probably present only in bacteria closely related to E.coli. PMID:11139607

  5. Isolation and Functional Characterization of a Lycopene β-cyclase Gene Promoter from Citrus

    PubMed Central

    Lu, Suwen; Zhang, Yin; Zheng, Xiongjie; Zhu, Kaijie; Xu, Qiang; Deng, Xiuxin

    2016-01-01

    Lycopene β-cyclases are key enzymes located at the branch point of the carotenoid biosynthesis pathway. However, the transcriptional regulatory mechanisms of LCYb1 in citrus with abundant carotenoid accumulation are still unclear. To understand the molecular basis of CsLCYb1 expression, we isolated and functionally characterized the 5′ upstream sequences of CsLCYb1 from citrus. The full-length CsLCYb1 promoter and a series of its 5′ deletions were fused to the β-glucuronidase (GUS) reporter gene and transferred into different plants (tomato, Arabidopsis and citrus callus) to test the promoter activities. The results of all transgenic species showed that the 1584 bp upstream region from the translational start site displayed maximal promoter activity, and the minimal promoter containing 746 bp upstream sequences was sufficient for strong basal promoter activity. Furthermore, the CsLCYb1 promoter activity was developmentally and tissue-specially regulated in transgenic Arabidopsis, and it was affected by multiple hormones and environmental cues in transgenic citrus callus under various treatments. Finer deletion analysis identified an enhancer element existing as a tandem repeat in the promoter region between -574 to -513 bp and conferring strong promoter activity. The copy numbers of the enhancer element differed among various citrus species, leading to the development of a derived simple sequence repeat marker to distinguish different species. In conclusion, this study elucidates the expression characteristics of the LCYb1 promoter from citrus and further identifies a novel enhancer element required for the promoter activity. The characterized promoter fragment would be an ideal candidate for genetic engineering and seeking of upstream trans-acting elements. PMID:27679644

  6. Methodology for single nucleotide polymorphism selection in promoter regions for clinical use. An example of its applicability

    PubMed Central

    Marques, Herlander; Freitas, José; Medeiros, Rui; Longatto-Filho, Adhemar

    2016-01-01

    Genetic variability in humans can explain many differences in disease risk factors. Polymorphism-related studies focus mainly on the single nucleotide polymorphisms (SNPs) of coding regions of the genes. SNPs on DNA binding motifs of the promoter region have been less explored. On a recent study of SNPs in patients with non-Hodgkin lymphomas we faced the problem of SNP selection from promoter regions and developed a practical methodology for clinical studies. The process consists in identifying SNPs in the coding and promoter regions of the antigen-processing system using the ‘dbSNP’ database. With the ‘HapMap’ program, we select SNPs with frequencies >20% in Caucasian populations. For coding regions, we sought biologically and clinically relevant SNPs described in the literature. For the promoter regions, we determined their chromosomal location on ‘QiagenSABioscience’ site database. The nucleotide sequence of ancestral and variant alleles is available in the ‘dbSNP’. These sequences were used in ‘Promoter TESS’ to determine binding differences of transcription factors. Each sequence may have affinity to different TFs. Thus, SNP selection on the promoter regions was based in the differences on TF binding pattern between the old and the new allele. The potential clinical relevance of the new TFs was also evaluated before the final selection. With this approach, we found that almost half of the relevant SNP fall within the promoter region. In conclusion, we were able to develop a methodology of oriented selection of promoter regions of human genes, comparing the TF with affinity to the ancestral allele with the TF to a variant allele. We selected those SNPs that change the TF’s affinity to a pattern with functional significance. PMID:27766139

  7. SMARCAL1 Negatively Regulates C-Myc Transcription By Altering The Conformation Of The Promoter Region

    PubMed Central

    Sharma, Tapan; Bansal, Ritu; Haokip, Dominic Thangminlen; Goel, Isha; Muthuswami, Rohini

    2015-01-01

    SMARCAL1, a member of the SWI2/SNF2 protein family, stabilizes replication forks during DNA damage. In this manuscript, we provide the first evidence that SMARCAL1 is also a transcriptional co-regulator modulating the expression of c-Myc, a transcription factor that regulates 10–15% genes in the human genome. BRG1, SMARCAL1 and RNAPII were found localized onto the c-myc promoter. When HeLa cells were serum starved, the occupancy of SMARCAL1 on the c-myc promoter increased while that of BRG1 and RNAPII decreased correlating with repression of c-myc transcription. Using Active DNA-dependent ATPase A Domain (ADAAD), the bovine homolog of SMARCAL1, we show that the protein can hydrolyze ATP using a specific region upstream of the CT element of the c-myc promoter as a DNA effector. The energy, thereby, released is harnessed to alter the conformation of the promoter DNA. We propose that SMARCAL1 negatively regulates c-myc transcription by altering the conformation of its promoter region during differentiation. PMID:26648259

  8. SMARCAL1 Negatively Regulates C-Myc Transcription By Altering The Conformation Of The Promoter Region.

    PubMed

    Sharma, Tapan; Bansal, Ritu; Haokip, Dominic Thangminlen; Goel, Isha; Muthuswami, Rohini

    2015-12-09

    SMARCAL1, a member of the SWI2/SNF2 protein family, stabilizes replication forks during DNA damage. In this manuscript, we provide the first evidence that SMARCAL1 is also a transcriptional co-regulator modulating the expression of c-Myc, a transcription factor that regulates 10-15% genes in the human genome. BRG1, SMARCAL1 and RNAPII were found localized onto the c-myc promoter. When HeLa cells were serum starved, the occupancy of SMARCAL1 on the c-myc promoter increased while that of BRG1 and RNAPII decreased correlating with repression of c-myc transcription. Using Active DNA-dependent ATPase A Domain (ADAAD), the bovine homolog of SMARCAL1, we show that the protein can hydrolyze ATP using a specific region upstream of the CT element of the c-myc promoter as a DNA effector. The energy, thereby, released is harnessed to alter the conformation of the promoter DNA. We propose that SMARCAL1 negatively regulates c-myc transcription by altering the conformation of its promoter region during differentiation.

  9. The regulatory region of the human plasminogen activator inhibitor type-1 (PAI-1) gene.

    PubMed Central

    Riccio, A; Lund, L R; Sartorio, R; Lania, A; Andreasen, P A; Danø, K; Blasi, F

    1988-01-01

    The human gene for plasminogen activator inhibitor type-1 (PAI-1) has been isolated and its promoter region characterized. PAI-1 regulation by glucocorticoids, transforming growth factor-beta (TGF-beta) and the phorbol ester PMA is shown to be exerted at the promoter level. A fragment spanning 805 nucleotides of the 5' flanking and 72 of the 5' untranslated region contain information enough to promote transcription and to respond to glucocorticoids when fused to a reporter gene and transfected into human fibrosarcoma cells. A moderately repetitive DNA sequence, containing a TATA box, a GRE consensus, a Z-DNA forming sequence and two imperfect direct repeats at the extremities, is present a few nucleotides 5' of the human PAI-1 gene transcription start site, raising the possibility that this gene could have been activated by DNA insertion during evolution. Images PMID:3130610

  10. Thyroid hormone receptors bind to defined regions of the growth hormone and placental lactogen genes.

    PubMed Central

    Barlow, J W; Voz, M L; Eliard, P H; Mathy-Harter, M; De Nayer, P; Economidis, I V; Belayew, A; Martial, J A; Rousseau, G G

    1986-01-01

    The intracellular receptor for thyroid hormone is a protein found in chromatin. Since thyroid hormone stimulates transcription of the growth hormone gene through an unknown mechanism, the hypothesis that the thyroid hormone-receptor complex interacts with defined regions of this gene has been investigated in a cell-free system. Nuclear extracts from human lymphoblastoid IM-9 cells containing thyroid hormone receptors were incubated with L-3,5,3'-tri[125I]iodothyronine and calf thymus DNA-cellulose. Restriction fragments of the human growth hormone gene were added to determine their ability to inhibit labeled receptor binding to DNA-cellulose. These fragments encompassed nucleotide sequences from about three kilobase pairs upstream to about four kilobase pairs downstream from the transcription initiation site. The thyroid hormone-receptor complex bound preferentially to the 5'-flanking sequences of the growth hormone gene in a region between nucleotide coordinates -290 and -129. The receptor also bound to an analogous promoter region in the human placental lactogen gene, which has 92% nucleotide sequence homology with the growth hormone gene. These binding regions appear to be distinct from those that are recognized by the receptor for glucocorticoids, which stimulate growth hormone gene expression synergistically with thyroid hormone. The presence of thyroid hormone was required for binding of its receptor to the growth hormone gene promoter, suggesting that thyroid hormone renders the receptor capable of recognizing specific gene regions. PMID:3466175

  11. Isolation and characterization of an Arabidopsis biotin carboxylase gene and its promoter.

    PubMed

    Bao, X; Shorrosh, B S; Ohlrogge, J B

    1997-11-01

    In the plastids of most plants, acetyl-CoA carboxylase (ACCase; EC 6.4.1.2) is a multisubunit complex consisting of biotin carboxylase (BC), biotin-carboxyl carrier protien (BCCP), and carboxytransferase (alpha-CT, beta-CT) subunits. To better understand the regulation of this enzyme, we have isolated and sequenced a BC genomic clone from Arabidopsis and partially characterized its promoter. Fifteen introns were identified. The deduced amino acid sequence of the mature BC protein is highly conserved between Arabidopsis and tobacco (92.6% identity). BC expression was evaluated using northern blots and BC/GUS fusion constructs in transgenic Arabidopsis. GUS activity in the BC/GUS transgenics as well as transcript level of the native gene were both found to be higher in silique and flower than in root and leaf. Analysis of tobacco suspension cells transformed with truncated BC promoter/GUS gene fusions indicated the region from -140 to +147 contained necessary promoter elements which supported basal gene expression. A positive regulatory region was found to be located between -2100 and -140, whereas a negative element was possibly located in the first intron. In addition, several conserved regulatory elements were identified in the BC promoter. Surprisingly, although BC is a low-abundance protein, the expression of BC/GUS fusion constructs was similar to 35S/GUS constructs.

  12. Promoter methylation confers kidney-specific expression of the Klotho gene.

    PubMed

    Azuma, Masahiro; Koyama, Daisuke; Kikuchi, Jiro; Yoshizawa, Hiromichi; Thasinas, Dissayabutra; Shiizaki, Kazuhiro; Kuro-o, Makoto; Furukawa, Yusuke; Kusano, Eiji

    2012-10-01

    The aging suppressor geneKlotho is predominantly expressed in the kidney irrespective of species. Because Klotho protein is an essential component of an endocrine axis that regulates renal phosphate handling, the kidney-specific expression is biologically relevant; however, little is known about its underlying mechanisms. Here we provide in vitro and in vivo evidence indicating that promoter methylation restricts the expression of the Klotho gene in the kidney. Based on evolutionary conservation and histone methylation patterns, the region up to -1200 bp was defined as a major promoter element of the human Klotho gene. This region displayed promoter activity equally in Klotho-expressing and -nonexpressing cells in transient reporter assays, but the activity was reduced to ∼20% when the constructs were integrated into the chromatin in the latter. Both endogenous and transfected Klotho promoters were 30-40% methylated in Klotho-nonexpressing cells, but unmethylated in Klotho-expressing renal tubular cells. DNA demethylating agents increased Klotho expression 1.5- to 3.0-fold in nonexpressing cells and restored the activity of silenced reporter constructs. Finally, we demonstrated that a severe hypomorphic allele of Klotho had aberrant CpG methylation in kl/kl mice. These findings might be useful in therapeutic intervention for accelerated aging and several complications caused by Klotho down-regulation.

  13. A conserved CATTCCT motif is required for skeletal muscle-specific activity of the cardiac troponin T gene promoter.

    PubMed Central

    Mar, J H; Ordahl, C P

    1988-01-01

    Transcription of the cardiac troponin T (cTNT) gene is restricted to cardiac and embryonic skeletal muscle tissue. A DNA segment containing 129 nucleotides upstream from the cTNT transcription initiation site (cTNT-129) directs expression of a heterologous marker gene in transfected embryonic skeletal muscle cells but is inactive in embryonic cardiac or fibroblast cells. By using chimeric promoter constructions, in which distal and proximal segments of cTNT-129 are fused to reciprocal segments of the herpes simplex virus thymidine kinase (HSV tk) gene promoter, the DNA segment responsible for this cell specificity can be localized to the cTNT distal promoter region, located between 50 and 129 nucleotides upstream of the transcription initiation site. The ability of the cTNT distal promoter region to confer skeletal muscle-specific activity upon a heterologous promoter is abolished when it is displaced 60 nucleotides upstream, indicating that its ability to direct skeletal muscle-specific transcription probably requires proximity to other components of the transcription initiation region. Two copies of the heptamer, CATTCCT ("muscle-CAT" or "M-CAT" motif), reside within the 80-nucleotide cTNT distal promoter region. A 3-nucleotide mutation in one of these copies inactivates the cTNT promoter in skeletal muscle cells. Therefore, the M-CAT motif is a distal promoter element required for expression of the cTNT promoter in embryonic skeletal muscle cells. Since the M-CAT motif is found in other contractile protein gene promoters, it may represent one example of a muscle-specific promoter element. Images PMID:3413104

  14. Definition of the ovalbumin gene promoter by transfer of an ovalglobin fusion gene into cultured cells.

    PubMed Central

    Knoll, B J; Zarucki-Schulz, T; Dean, D C; O'Malley, B W

    1983-01-01

    In order to study the initiation of transcription from the ovalbumin gene promoter, we constructed a hybrid gene (ovalglobin) in which 753 bps of ovalbumin gene 5'-flanking sequence were joined to the chicken adult beta-globin gene. When transfected into HeLa S3 cells, ovalglobin gene transcription initiated at the ovalbumin gene cap site, as measured by S1 nuclease and primer extension analysis. Deletion of 5'-flanking sequences to position -95 had little effect on transcription; deletion to -77 reduced transcription to about 20% of the wild type level and deletion to -48 reduced the level to about 2%. A deletion to -24, removing the sequence TATATAT, abolished transcription entirely. Hormonal regulation of the ovalglobin gene was observed when primary oviduct cells were used as recipients for DNA transfection. Under these conditions, addition of progesterone increased the level of ovalglobin transcripts to more than 10 times the uninduced level. Images PMID:6314256

  15. Site-specific methylation of the rat prolactin and growth hormone promoters correlates with gene expression.

    PubMed Central

    Ngô, V; Gourdji, D; Laverrière, J N

    1996-01-01

    The methylation patterns of the rat prolactin (rPRL) (positions -440 to -20) and growth hormone (rGH) (positions -360 to -110) promoters were analyzed by bisulfite genomic sequencing. Two normal tissues, the anterior pituitary and the liver, and three rat pituitary GH3 cell lines that differ considerably in their abilities to express both genes were tested. High levels of rPRL gene expression were correlated with hypomethylation of the CpG dinucleotides located at positions -277 and -97, near or within positive cis-acting regulatory elements. For the nine CpG sites analyzed in the rGH promoter, an overall hypomethylation-expression coupling was also observed for the anterior pituitary, the liver, and two of the cell lines. The effect of DNA methylation was tested by measuring the transient expression of the chloramphenicol acetyltransferase reporter gene driven by a regionally methylated rPRL promoter. CpG methylation resulted in a decrease in the activity of the rPRL promoter which was proportional to the number of modified CpG sites. The extent of the inhibition was also found to be dependent on the position of methylated sites. Taken together, these data suggest that site-specific methylation may modulate the action of transcription factors that dictate the tissue-specific expression of the rPRL and rGH genes in vivo. PMID:8668139

  16. Isolation and functional analysis of the promoter of the amphioxus Hsp70a gene.

    PubMed

    Li, Dingliang; Li, Guang; Wang, Kunru; Liu, Xin; Li, Weiye; Chen, Xinhua; Wang, Yiquan

    2012-11-15

    Amphioxus is a promising laboratorial model animal for studying the evolutionary and developmental mechanisms that appeared during the invertebrate-chordate to vertebrate transition. However, the main drawback for the use of amphioxus as a model organism is the lack of well-developed technical approaches. Conditional gene expression, as performed with thermal control, is a very useful strategy in gene function studies. To make this method possible in amphioxus studies, here we report the isolation and characterization of an amphioxus Hsp70 gene (Hsp70a) and its promoter in Chinese amphioxus (Branchiostoma belcheri). Hsp70a showed very low expression at normal temperatures but was robustly induced in animals upon heat shock. The basal cis-acting elements (CAAT and TATA), as well as four heat shock elements (HSEs), were found within the regulatory region (-1031 to -11 upstream from the start codon), but surprisingly most of the elements were located in the 5'UTR region (-252 to -10). Reporter constructs, including sequences from both the transcription start site (TSS) and ATG were tested for transient expression in EPC cells and microinjected zebrafish embryos. Results suggested that the 5'UTR region, which includes a TATA box at -92bp, a CAAT box at -152bp, and three HSE elements (-212 to -106), represents the core hsp promoter sequence of the B. belcheri Hsp70a gene. Therefore in this study we identified an effectively thermo-inducible promoter in amphioxus that could be used for the establishment of a conditional gene expression system in which the target gene can be regulated in a temporal- or tissue-specific way in amphioxus.

  17. Common DNA structural features exhibited by eukaryotic ribosomal gene promoters.

    PubMed Central

    Marilley, M; Pasero, P

    1996-01-01

    Nucleotide sequences of DNA regions containing eukaryotic ribosomal promoters were analysed using strategies designed to reveal sequence-directed structural features. DNA curvature, duplex stability and pattern of twist angle variation were studied by computer modelling. Although ribosomal promoters are known to lack sequence homology (unless very closely related species are considered), investigation of these structural characteristics uncovered striking homologies in all the taxonomic groups examined so far. This wide conservation of DNA structures, while DNA sequence is not conserved, suggests that the determined structures are fundamental for ribosomal promoter function. Moreover, this result agrees well with the recent observations showing that RNA polymerase I transcription factors have not evolved as intensively as previously suspected. PMID:8710487

  18. Annotation of gene promoters by integrative data-mining of ChIP-seq Pol-II enrichment data

    PubMed Central

    2010-01-01

    Background Use of alternative gene promoters that drive widespread cell-type, tissue-type or developmental gene regulation in mammalian genomes is a common phenomenon. Chromatin immunoprecipitation methods coupled with DNA microarray (ChIP-chip) or massive parallel sequencing (ChIP-seq) are enabling genome-wide identification of active promoters in different cellular conditions using antibodies against Pol-II. However, these methods produce enrichment not only near the gene promoters but also inside the genes and other genomic regions due to the non-specificity of the antibodies used in ChIP. Further, the use of these methods is limited by their high cost and strong dependence on cellular type and context. Methods We trained and tested different state-of-art ensemble and meta classification methods for identification of Pol-II enriched promoter and Pol-II enriched non-promoter sequences, each of length 500 bp. The classification models were trained and tested on a bench-mark dataset, using a set of 39 different feature variables that are based on chromatin modification signatures and various DNA sequence features. The best performing model was applied on seven published ChIP-seq Pol-II datasets to provide genome wide annotation of mouse gene promoters. Results We present a novel algorithm based on supervised learning methods to discriminate promoter associated Pol-II enrichment from enrichment elsewhere in the genome in ChIP-chip/seq profiles. We accumulated a dataset of 11,773 promoter and 46,167 non-promoter sequences, each of length 500 bp, generated from RNA Pol-II ChIP-seq data of five tissues (Brain, Kidney, Liver, Lung and Spleen). We evaluated the classification models in building the best predictor and found that Bagging and Random Forest based approaches give the best accuracy. We implemented the algorithm on seven different published ChIP-seq datasets to provide a comprehensive set of promoter annotations for both protein-coding and non-coding genes in

  19. Structural analysis of the human hydroxyindole-O-methyltransferase gene. Presence of two distinct promoters.

    PubMed

    Rodriguez, I R; Mazuruk, K; Schoen, T J; Chader, G J

    1994-12-16

    Hydroxyindole-O-methyltransferase (HIOMT) catalyzes the last step in the metabolic pathway that synthesizes the hormone melatonin. We have found HIOMT mRNA present in small amounts in human retina and in relatively high abundance in the pineal gland. Two distinct 5' ends were found in human retina using a solid-phase 5'-rapid amplification of cDNA ends technique. The two 5' regions appear to originate from two distinct putative promoters. Although many similarities exist between the two promoters, they contain distinctive elements. Putative promoter A, for example, contains a recently discovered photoreceptor-conserved element (PCE-1, CAATTAAG) at -27 not found in promoter B, while promoter B contains an Ap1 site (ATGAGTCAA) at -166 and an octamer site (ATGCAAT) at -59 not found in promoter A. The HIOMT messages are also alternatively spliced in between exons 6 and 8, generating three distinct messages. One of the alternatively spliced messages contains a line-1 repetitive element that is spliced into the mRNA precisely as exon 6. Importantly, the downstream open reading frame is not altered by any of these splicing combinations. The gene is approximately 35 kilobases long containing either 9 or 10 exons (including the line-1 element) depending on which promoter is active. All of the splice sites follow the GT/AG rule. The dual promoters and opportunities for alternative splicing suggest a variety of mechanisms for control of HIOMT expression and biological activity in different tissues not previously recognized.

  20. Transcription of the interleukin 4 gene is regulated by multiple promoter elements

    PubMed Central

    1993-01-01

    Activation of T helper cell 1 (Th1) and Th2 results in transcription of the interleukin 2 (IL-2) and IL-4 cytokine genes, respectively. Whereas many of the regulatory elements and factors responsible for IL-2 transcription in T cells are well defined, little is known about parallel mechanisms that drive transcription of the IL-4 gene. Here we have analyzed the murine IL-4 promoter, both in vivo and in a Th2 clone. 3 kb of IL-4 upstream sequence is shown to be sufficient to achieve tissue-specific and inducible expression of a thymidine kinase reporter gene in vivo in a manner that mirrors the expression of endogenous IL-4. Tissue-specific and inducible expression is also demonstrated in a Th2 clone, but not in a B cell line. Deletional and mutational analysis of the IL-4 promoter demonstrated that sequences from -100 to -28 were necessary for a transcriptional response to Concanavalin A or anti-CD3 monoclonal antibody. An overlapping, yet smaller region, spanning the sequences from -60 to -28 bp was shown to be required for the response to ionomycin. Mutation of an 8-bp region from -43 to -35 of the IL-4 promoter completely abrogated IL-4 gene transcription in response to all stimuli tested. In addition, our results show that the effects of the immunosuppressive agent Cyclosporin A map to the same DNA sequences as the positive control elements. These results identify DNA sequences that are functionally important for the control of IL-4 gene transcription both in vivo and in vitro. Although these sequences are highly conserved in the human and murine IL-4 genes, they are largely not present in the IL-2 enhancer complex. Thus, cytokine-specific cis-acting elements may be one mechanism by which these two cytokine genes are differentially regulated. PMID:8496684

  1. Novel strong tissue specific promoter for gene expression in human germ cells

    PubMed Central

    2010-01-01

    Background Tissue specific promoters may be utilized for a variety of applications, including programmed gene expression in cell types, tissues and organs of interest, for developing different cell culture models or for use in gene therapy. We report a novel, tissue-specific promoter that was identified and engineered from the native upstream regulatory region of the human gene NDUFV1 containing an endogenous retroviral sequence. Results Among seven established human cell lines and five primary cultures, this modified NDUFV1 upstream sequence (mNUS) was active only in human undifferentiated germ-derived cells (lines Tera-1 and EP2102), where it demonstrated high promoter activity (~twice greater than that of the SV40 early promoter, and comparable to the routinely used cytomegaloviral promoter). To investigate the potential applicability of the mNUS promoter for biotechnological needs, a construct carrying a recombinant cytosine deaminase (RCD) suicide gene under the control of mNUS was tested in cell lines of different tissue origin. High cytotoxic effect of RCD with a cell-death rate ~60% was observed only in germ-derived cells (Tera-1), whereas no effect was seen in a somatic, kidney-derived control cell line (HEK293). In further experiments, we tested mNUS-driven expression of a hyperactive Sleeping Beauty transposase (SB100X). The mNUS-SB100X construct mediated stable transgene insertions exclusively in germ-derived cells, thereby providing further evidence of tissue-specificity of the mNUS promoter. Conclusions We conclude that mNUS may be used as an efficient promoter for tissue-specific gene expression in human germ-derived cells in many applications. Our data also suggest that the 91 bp-long sequence located exactly upstream NDUFV1 transcriptional start site plays a crucial role in the activity of this gene promoter in vitro in the majority of tested cell types (10/12), and an important role - in the rest two cell lines. PMID:20716342

  2. Functional molecular analysis of a circadian clock gene timeless promoter from the Drosophilid fly Chymomyza costata.

    PubMed

    Kobelková, Alena; Bajgar, Adam; Dolezel, David

    2010-12-01

    The circadian transcription of the tim gene is tightly regulated by the protein complex dCLK/CYC, which directly interacts with a series of closely spaced E-box and E-box-like elements in the Drosophila timeless promoter. The tim promoter from D. melanogaster has been studied in detail both in tissue cultures and in living flies yet has never been investigated in other species. This article presents a detailed functional analysis of the tim promoter from the drosophilid fly, Chymomyza costata, in Drosophila tissue cultures. A comparison of tim promoters from wt and npd-mutants confirmed that the 1855 bp deletion in the latter removes crucial regulatory cis-elements as well as the minimal promoter, being subsequently responsible for the lack of tim mRNA expression. Deletion and substitution mutations of the wt tim promoter showed that the region containing the canonical E-box, TER-box, and 2 incomplete E-box sequences is essential for CLK/CYC-mediated expression, while the PERR element appears to be a repressor in S2 cells. Furthermore, the expression of the circadian genes timeless, period , vrille, and doubletime was quantified in C. costata adults. Striking differences were found in expression profiles for tim, per, and vri between wild-type and npd-mutant individuals.

  3. Repressive BMP2 gene regulatory elements near the BMP2 promoter

    SciTech Connect

    Jiang, Shan; Chandler, Ronald L.; Fritz, David T.; Mortlock, Douglas P.; Rogers, Melissa B.

    2010-02-05

    The level of bone morphogenetic protein 2 (BMP2) profoundly influences essential cell behaviors such as proliferation, differentiation, apoptosis, and migration. The spatial and temporal pattern of BMP2 synthesis, particular in diverse embryonic cells, is highly varied and dynamic. We have identified GC-rich sequences within the BMP2 promoter region that strongly repress gene expression. These elements block the activity of a highly conserved, osteoblast enhancer in response to FGF2 treatment. Both positive and negative gene regulatory elements control BMP2 synthesis. Detecting and mapping the repressive motifs is essential because they impede the identification of developmentally regulated enhancers necessary for normal BMP2 patterns and concentration.

  4. Genetic and functional analysis of the TBX3 gene promoter in indirect inguinal hernia.

    PubMed

    Zhao, Zhongqing; Tian, Wenjun; Wang, Lin; Wang, Haihua; Qin, Xianyun; Xing, Qining; Pang, Shuchao; Yan, Bo

    2015-01-01

    Inguinal hernia is a common developmental disease in children and most cases are indirect inguinal hernia (IIH). Genetic factors have been suggested to play important roles in IIH. Although IIH has been observed in several human syndromes, genetic causes and molecular mechanisms for IIH remain unknown. TBX3 is a member of the T-box family of transcription factors that are essential to the embryonic development. Human studies and animal experiments have demonstrated that TBX3 is required for the development of the heart, limbs, mammary glands and other tissues and organs. TBX3 gene expression has been detected in human fibroblast and tissues of abdominal wall. We speculated that TBX3 may be involved in the IIH formation. Since TBX3 activity is highly dosage-sensitive, a TBX3 gene promoter was genetically and functionally analyzed in IIH patients and ethnic-matched controls in this study. One heterozygous deletion variant (g.4820_4821del) was identified in one IIH patient, but in none of controls. The variant significantly decreased TBX3 gene promoter activities, likely by creating a binding site for sex-determining region Y (SRY), mobility group transcription factor. One heterozygous insertion variant (g.3913_3914ins) was only found in one control, which did not affect TBX3 gene promoter activities. Taken together, TBX3 gene variants may contribute to IIH as a rare risk factor by reducing TBX3 levels. PMID:25455105

  5. Transcription of promoter from the human APRIL gene regulated by Sp1 and NF-kB.

    PubMed

    Xu, J; Ding, W F; Shao, K K; Wang, X D; Wang, G H; Li, H Q; Wang, H M

    2012-01-01

    A proliferation-inducing ligand (APRIL) which stimulates the cell proliferation is abundantly expressed in colorectal cancer (CRC) tumors. In this report, the promoter region of the APRIL gene was determined and the major transcription factor was investigated for the first time. Deletion analysis of 5'-flanking region of the human APRIL gene and transient transfection revealed that a 538 bp region (from -1539 to -1001) was essential for promoter activation of the APRIL gene. The data from electrophoretic mobility shift assays (EMSA) indicated that the 538 bp promoter region was responsive to the specificity protein 1 (Sp1) and nuclear factor kappa B (NF-kB). Overexpression of Sp1 or NF-kB increased the activity of the APRIL promoter. Mithramycin A (inhibitor of Sp1) and Bay11-7082 (inhibitor of NF-kB) exhibited an inhibitory activity to APRIL promoter. Our results will benefit to the APRIL gene regulation investigation and contribute to discover new drug target for the APRIL gene therapy of CRC.

  6. ARID3B Directly Regulates Ovarian Cancer Promoting Genes

    PubMed Central

    Bobbs, Alexander; Gellerman, Katrina; Hallas, William Morgan; Joseph, Stancy; Yang, Chao; Kurkewich, Jeffrey; Cowden Dahl, Karen D.

    2015-01-01

    The DNA-binding protein AT-Rich Interactive Domain 3B (ARID3B) is elevated in ovarian cancer and increases tumor growth in a xenograft model of ovarian cancer. However, relatively little is known about ARID3B's function. In this study we perform the first genome wide screen for ARID3B direct target genes and ARID3B regulated pathways. We identified and confirmed numerous ARID3B target genes by chromatin immunoprecipitation (ChIP) followed by microarray and quantitative RT-PCR. Using motif-finding algorithms, we characterized a binding site for ARID3B, which is similar to the previously known site for the ARID3B paralogue ARID3A. Functionality of this predicted site was demonstrated by ChIP analysis. We next demonstrated that ARID3B induces expression of its targets in ovarian cancer cell lines. We validated that ARID3B binds to an epidermal growth factor receptor (EGFR) enhancer and increases mRNA expression. ARID3B also binds to the promoter of Wnt5A and its receptor FZD5. FZD5 is highly expressed in ovarian cancer cell lines, and is upregulated by exogenous ARID3B. Both ARID3B and FZD5 expression increase adhesion to extracellular matrix (ECM) components including collagen IV, fibronectin and vitronectin. ARID3B-increased adhesion to collagens II and IV require FZD5. This study directly demonstrates that ARID3B binds target genes in a sequence-specific manner, resulting in increased gene expression. Furthermore, our data indicate that ARID3B regulation of direct target genes in the Wnt pathway promotes adhesion of ovarian cancer cells. PMID:26121572

  7. Identification and cell type specificity of the tyrosine hydroxylase gene promoter.

    PubMed Central

    Harrington, C A; Lewis, E J; Krzemien, D; Chikaraishi, D M

    1987-01-01

    Genomic DNA encoding the rat tyrosine hydroxylase (TH) gene was isolated from a lambda phage library using a nick-translated fragment from a cDNA clone for rat TH. We have determined the initiation site for TH RNA synthesis and have sequenced 1100 bases of the primary transcript and 5' flanking region. The 5' end of the transcript is the same in several rat tissues in which TH is expressed as well as in rat pheochromocytoma cells (PC). RNA prepared from PC cells that had been stimulated with dexamethasone also mapped to the same transcription start site. Sequence upstream from the initiation site contains the canonical TATA box, but no apparent CAAT box. When a portion of the 5' flanking region of the TH gene (-773 to + 27) is fused to the chloramphenicol acetyltransferase (CAT) gene, it promotes expression of CAT in pheochromocytoma cells and GH4 cells, but not in two neural tumour lines, RT4-D and B103, nor in several non neural cell lines. This suggests that this region of the TH gene has features that confer tissue-restricted expression on the TH promoter. Images PMID:2882469

  8. Identification of a Single-Nucleotide Insertion in the Promoter Region Affecting the sodC Promoter Activity in Brucella neotomae

    PubMed Central

    Moustafa, Dina A.; Jain, Neeta; Sriranganathan, Nammalwar; Vemulapalli, Ramesh

    2010-01-01

    Brucella neotomae is not known to be associated with clinical disease in any host species. Previous research suggested that B. neotomae might not express detectable levels of Cu/Zn superoxide dismutase (SOD), a periplasmic enzyme known to be involved in protecting Brucella from oxidative bactericidal effects of host phagocytes. This study was undertaken to investigate the genetic basis for the disparity in SOD expression in B. neotomae. Our Western blot and SOD enzyme assay analyses indicated that B. neotomae does express SOD, but at a substantially reduced level. Nucleotide sequence analysis of region upstream to the sodC gene identified a single-nucleotide insertion in the potential promoter region. The same single-nucleotide insertion was also detected in the sodC promoter of B. suis strain Thomsen, belonging to biovar 2 in which SOD expression was undetectable previously. Examination of the sodC promoter activities using translational fusion constructs with E. coli β-galactosidase demonstrated that the B. neotomae and B. suis biovar 2 promoters were very weak in driving gene expression. Site-directed mutation studies indicated that the insertion of A in the B. neotomae sodC promoter reduced the promoter activity. Increasing the level of SOD expression in B. neotomae through complementation with B. abortus sodC gene did not alter the bacterial survival in J774A.1 macrophage-like cells and in tissues of BALB/c and C57BL/6 mice. These results for the first time demonstrate the occurrence of a single-nucleotide polymorphism affecting promoter function and gene expression in Brucella. PMID:21124845

  9. Effect of TNF{alpha} on activities of different promoters of human apolipoprotein A-I gene

    SciTech Connect

    Orlov, Sergey V.; Mogilenko, Denis A.; Shavva, Vladimir S.; Dizhe, Ella B.; Ignatovich, Irina A.; Perevozchikov, Andrej P.

    2010-07-23

    Research highlights: {yields} TNF{alpha} stimulates the distal alternative promoter of human apoA-I gene. {yields} TNF{alpha} acts by weakening of promoter competition within apoA-I gene (promoter switching). {yields} MEK1/2 and nuclear receptors PPAR{alpha} and LXRs take part in apoA-I promoter switching. -- Abstract: Human apolipoprotein A-I (ApoA-I) is a major structural and functional protein component of high-density lipoproteins. The expression of the apolipoprotein A-I gene (apoA-I) in hepatocytes is repressed by pro-inflammatory cytokines such as IL-1{beta} and TNF{alpha}. Recently, two novel additional (alternative) promoters for human apoA-I gene have been identified. Nothing is known about the role of alternative promoters in TNF{alpha}-mediated downregulation of apoA-I gene. In this article we report for the first time about the different effects of TNF{alpha} on two alternative promoters of human apoA-I gene. Stimulation of HepG2 cells by TNF{alpha} leads to activation of the distal alternative apoA-I promoter and downregulation of the proximal alternative and the canonical apoA-I promoters. This effect is mediated by weakening of the promoter competition within human apoA-I 5'-regulatory region (apoA-I promoter switching) in the cells treated by TNF{alpha}. The MEK1/2-ERK1/2 cascade and nuclear receptors PPAR{alpha} and LXRs are important for TNF{alpha}-mediated apoA-I promoter switching.

  10. The Interrelationship between Promoter Strength, Gene Expression, and Growth Rate

    PubMed Central

    Klesmith, Justin R.; Detwiler, Emily E.; Tomek, Kyle J.; Whitehead, Timothy A.

    2014-01-01

    In exponentially growing bacteria, expression of heterologous protein impedes cellular growth rates. Quantitative understanding of the relationship between expression and growth rate will advance our ability to forward engineer bacteria, important for metabolic engineering and synthetic biology applications. Recently, a work described a scaling model based on optimal allocation of ribosomes for protein translation. This model quantitatively predicts a linear relationship between microbial growth rate and heterologous protein expression with no free parameters. With the aim of validating this model, we have rigorously quantified the fitness cost of gene expression by using a library of synthetic constitutive promoters to drive expression of two separate proteins (eGFP and amiE) in E. coli in different strains and growth media. In all cases, we demonstrate that the fitness cost is consistent with the previous findings. We expand upon the previous theory by introducing a simple promoter activity model to quantitatively predict how basal promoter strength relates to growth rate and protein expression. We then estimate the amount of protein expression needed to support high flux through a heterologous metabolic pathway and predict the sizable fitness cost associated with enzyme production. This work has broad implications across applied biological sciences because it allows for prediction of the interplay between promoter strength, protein expression, and the resulting cost to microbial growth rates. PMID:25286161

  11. The interrelationship between promoter strength, gene expression, and growth rate.

    PubMed

    Bienick, Matthew S; Young, Katherine W; Klesmith, Justin R; Detwiler, Emily E; Tomek, Kyle J; Whitehead, Timothy A

    2014-01-01

    In exponentially growing bacteria, expression of heterologous protein impedes cellular growth rates. Quantitative understanding of the relationship between expression and growth rate will advance our ability to forward engineer bacteria, important for metabolic engineering and synthetic biology applications. Recently, a work described a scaling model based on optimal allocation of ribosomes for protein translation. This model quantitatively predicts a linear relationship between microbial growth rate and heterologous protein expression with no free parameters. With the aim of validating this model, we have rigorously quantified the fitness cost of gene expression by using a library of synthetic constitutive promoters to drive expression of two separate proteins (eGFP and amiE) in E. coli in different strains and growth media. In all cases, we demonstrate that the fitness cost is consistent with the previous findings. We expand upon the previous theory by introducing a simple promoter activity model to quantitatively predict how basal promoter strength relates to growth rate and protein expression. We then estimate the amount of protein expression needed to support high flux through a heterologous metabolic pathway and predict the sizable fitness cost associated with enzyme production. This work has broad implications across applied biological sciences because it allows for prediction of the interplay between promoter strength, protein expression, and the resulting cost to microbial growth rates.

  12. Tissue-specific expression and promoter analysis of the tobacco Itp1 gene.

    PubMed Central

    Canevascini, S; Caderas, D; Mandel, T; Fleming, A J; Dupuis, I; Kuhlemeier, C

    1996-01-01

    The Nicotiana tabacum Itp1 gene (Ntltp1) encodes a small basic protein that belongs to a class of putative lipid transfer proteins. These proteins transfer lipids between membranes in vitro, but their in vivo function remains hotly debated. This gene also serves as an important early marker for epidermis differentiation. We report here the analysis of the spatial and developmental activity of the Ntltp1 promoter, and we define a sequence element required for epidermis-specific expression. Transgenic plants were created containing 1346 bp of the Ntltp1 promoter fused upstream of the beta-glucuronidase (GUS) gene. In the mature aerial tissues, GUS activity was detected predominantly in the epidermis, whereas in younger aerial tissues, such as the shoot apical meristem and floral meristem, GUS expression was not restricted to the tunica layer. Unexpectedly, GUS activity was also detected in young roots particularly in the root epidermis. Furthermore, the Ntltp1 promoter displayed a tissue and developmental specific pattern of activity during germination. These results suggest that the Ntltp1 gene is highly expressed in regions of the plant that are vulnerable to pathogen attack and are thus consistent with the proposed function of lipid transfer proteins in plant defense. Deletions of the promoter from its 5' end revealed that the 148 bp preceding the translational start site are sufficient for epidermis-specific expression. Sequence comparison identified an eight-nucleotide palindromic sequence CTAGCTAG in the leader of Ntltp1, which is conserved in a number of other Itp genes. By gel retardation analysis, the presence of specific DNA-protein complexes in this region was demonstrated. The characterization of these factors may lead to the identification of factors that control early events in epidermis differentiation. PMID:8883375

  13. Cloning and characterization of 5'-untranslated region of porcine beta casein gene (CSN2).

    PubMed

    Lee, Poongyeon; Chung, Hee Kyoung; Lee, Hyun-Gi; Lee, Hwi-Cheul; Woo, Jae-Seok; Lee, Seunghoon; Jo, Su-Jin; Chang, Won-Kyong; Lee, Hoon-Taek; Kwon, Moosik; Park, Jin-Ki

    2008-10-01

    beta-Casein (CSN2) is a major milk protein in most mammals. The CSN2 gene is generally induced by lactogenic hormones bound to its promoter. The expression of this gene can be enhanced by signal transducers and activators of transcription (STAT) and glucocorticoid receptor (GR). Here, we analyzed the promoter and intron 1 regions of the porcine CSN2 gene. The porcine CSN2 promoter and intron 1 regions (-3098bp to +2446bp) were cloned into the pGL3-Basic vector containing the luciferase reporter gene (pCSN2-PEI). Lactogenic signals induced the transcription of porcine CSN2. By using AG490, a Janus kinase (JAK) inhibitor, we demonstrated that STAT5 positively regulates the transcription of porcine CSN2. Further, seven STAT mutants were generated by site-directed mutagenesis. By performing electrophoretic mobility shift assays (EMSAs), we located a critical element for pCSN2-PEI transcription bound to STAT5 in the -102bp to -84bp region. The construct containing only the promoter region (pCSN2-P), however, did not exert any promotive effects on transcription in two cell types-a mouse mammary epithelial cell line (HC11) and porcine mammary gland epithelial cells (PMECs). Thus, the construct containing intron 1 of porcine CSN2 exerts an elevating effect on transcription. We suggest that the transcription of porcine CSN2 is regulated by lactogenic signals via the STAT5 site (-102bp to -84bp) and intron 1.

  14. Characterization of the highly active fragment of glyceraldehyde-3-phosphate dehydrogenase gene promoter for recombinant protein expression in Pleurotus ostreatus.

    PubMed

    Yin, Chaomin; Zheng, Liesheng; Zhu, Jihong; Chen, Liguo; Ma, Aimin

    2015-03-01

    Developing efficient native promoters is important for improving recombinant protein expression by fungal genetic engineering. The promoter region of glyceraldehyde-3-phosphate dehydrogenase gene in Pleurotus ostreatus (Pogpd) was isolated and optimized by upstream truncation. The activities of these promoters with different lengths were further confirmed by fluorescence, quantitative real-time PCR and Western blot analysis. A truncated Pogpd-P2 fragment (795 bp) drove enhanced green fluorescence protein (egfp) gene expression in P. ostreatus much more efficiently than full-length Pogpd-P1. Further truncating Pogpd-P2 to 603, 403 and 231 bp reduced the eGFP expression significantly. However, the 403-bp fragment between -356 bp and the start codon was the minimal but sufficient promoter element for eGFP expression. Compact native promoters for genetic engineering of P. ostreatus were successfully developed and validated in this study. This will broaden the preexisting repertoire of fungal promoters for biotechnology application. PMID:25743073

  15. Macrophage nitric oxide synthase gene: two upstream regions mediate induction by interferon gamma and lipopolysaccharide.

    PubMed Central

    Lowenstein, C J; Alley, E W; Raval, P; Snowman, A M; Snyder, S H; Russell, S W; Murphy, W J

    1993-01-01

    The promoter region of the mouse gene for macrophage-inducible nitric oxide synthase (mac-NOS; EC 1.14.13.39) has been characterized. A putative TATA box is 30 base pairs upstream of the transcription start site. Computer analysis reveals numerous potential binding sites for transcription factors, many of them associated with stimuli that induce mac-NOS expression. To localize functionally important portions of the regulatory region, we constructed deletion mutants of the mac-NOS 5' flanking region and placed them upstream of a luciferase reporter gene. The macrophage cell line RAW 264.7, when transfected with a minimal promoter construct, expresses little luciferase activity when stimulated by lipopolysaccharide (LPS), interferon gamma (IFN-gamma), or both. Maximal expression depends on two discrete regulatory regions upstream of the putative TATA box. Region I (position -48 to -209) increases luciferase activity approximately 75-fold over the minimal promoter construct. Region I contains LPS-related responsive elements, including a binding site for nuclear factor interleukin 6 (NF-IL6) and the kappa B binding site for NF-kappa B, suggesting that this region regulates LPS-induced expression of the mac-NOS gene. Region II (position -913 to -1029) alone does not increase luciferase expression, but together with region I it causes an additional 10-fold increase in expression. Together the two regions increase expression 750-fold over activity obtained from a minimal promoter construct. Region II contains motifs for binding IFN-related transcription factors and thus probably is responsible for IFN-mediated regulation of LPS-induced mac-NOS. Delineation of these two cooperative regions explains at the level of transcription how IFN-gamma and LPS act in concert to induce maximally the mac-NOS gene and, furthermore, how IFN-gamma augments the inflammatory response to LPS. Images Fig. 2 PMID:7692452

  16. Hydroxymethylcytosine and demethylation of the γ-globin gene promoter during erythroid differentiation

    PubMed Central

    Ruiz, Maria Armila; Rivers, Angela; Ibanez, Vinzon; Vaitkus, Kestis; Mahmud, Nadim; DeSimone, Joseph; Lavelle, Donald

    2015-01-01

    The mechanism responsible for developmental stage-specific regulation of γ-globin gene expression involves DNA methylation. Previous results have shown that the γ-globin promoter is nearly fully demethylated during fetal liver erythroid differentiation and partially demethylated during adult bone marrow erythroid differentiation. The hypothesis that 5-hydroxymethylcytosine (5hmC), a known intermediate in DNA demethylation pathways, is involved in demethylation of the γ-globin gene promoter during erythroid differentiation was investigated by analyzing levels of 5-methylcytosine (5mC) and 5hmC at a CCGG site within the 5′ γ-globin gene promoter region in FACS-purified cells from baboon bone marrow and fetal liver enriched for different stages of erythroid differentiation. Our results show that 5mC and 5hmC levels at the γ-globin promoter are dynamically modulated during erythroid differentiation with peak levels of 5hmC preceding and/or coinciding with demethylation. The Tet2 and Tet3 dioxygenases that catalyze formation of 5hmC are expressed during early stages of erythroid differentiation and Tet3 expression increases as differentiation proceeds. In baboon CD34+ bone marrow-derived erythroid progenitor cell cultures, γ-globin expression was positively correlated with 5hmC and negatively correlated with 5mC at the γ-globin promoter. Supplementation of culture media with Vitamin C, a cofactor of the Tet dioxygenases, reduced γ-globin promoter DNA methylation and increased γ-globin expression when added alone and in an additive manner in combination with either DNA methyltransferase or LSD1 inhibitors. These results strongly support the hypothesis that the Tet-mediated 5hmC pathway is involved in developmental stage-specific regulation of γ-globin expression by mediating demethylation of the γ-globin promoter. PMID:25932923

  17. Helicobacter pylori cagA Promoter Region Sequences Influence CagA Expression and Interleukin 8 Secretion.

    PubMed

    Ferreira, Rui M; Pinto-Ribeiro, Ines; Wen, Xiaogang; Marcos-Pinto, Ricardo; Dinis-Ribeiro, Mário; Carneiro, Fátima; Figueiredo, Ceu

    2016-02-15

    Heterogeneity at the Helicobacter pylori cagA gene promoter region has been linked to variation in CagA expression and gastric histopathology. Here, we characterized the cagA promoter and expression in 46 H. pylori strains from Portugal. Our results confirm the relationship between cagA promoter region variation and protein expression originally observed in strains from Colombia. We observed that individuals with intestinal metaplasia were all infected with H. pylori strains containing a specific cagA motif. Additionally, we provided novel functional evidence that strain-specific sequences in the cagA promoter region and CagA expression levels influence interleukin 8 secretion by the host gastric epithelial cells.

  18. A cis-regulatory sequence from a short intergenic region gives rise to a strong microbe-associated molecular pattern-responsive synthetic promoter.

    PubMed

    Lehmeyer, Mona; Hanko, Erik K R; Roling, Lena; Gonzalez, Lilian; Wehrs, Maren; Hehl, Reinhard

    2016-06-01

    The high gene density in Arabidopsis thaliana leaves only relatively short intergenic regions for potential cis-regulatory sequences. To learn more about the regulation of genes harbouring only very short upstream intergenic regions, this study investigates a recently identified novel microbe-associated molecular pattern (MAMP)-responsive cis-sequence located within the 101 bp long intergenic region upstream of the At1g13990 gene. It is shown that the cis-regulatory sequence is sufficient for MAMP-responsive reporter gene activity in the context of its native promoter. The 3' UTR of the upstream gene has a quantitative effect on gene expression. In context of a synthetic promoter, the cis-sequence is shown to achieve a strong increase in reporter gene activity as a monomer, dimer and tetramer. Mutation analysis of the cis-sequence determined the specific nucleotides required for gene expression activation. In transgenic A. thaliana the synthetic promoter harbouring a tetramer of the cis-sequence not only drives strong pathogen-responsive reporter gene expression but also shows a high background activity. The results of this study contribute to our understanding how genes with very short upstream intergenic regions are regulated and how these regions can serve as a source for MAMP-responsive cis-sequences for synthetic promoter design.

  19. A cis-regulatory sequence from a short intergenic region gives rise to a strong microbe-associated molecular pattern-responsive synthetic promoter.

    PubMed

    Lehmeyer, Mona; Hanko, Erik K R; Roling, Lena; Gonzalez, Lilian; Wehrs, Maren; Hehl, Reinhard

    2016-06-01

    The high gene density in Arabidopsis thaliana leaves only relatively short intergenic regions for potential cis-regulatory sequences. To learn more about the regulation of genes harbouring only very short upstream intergenic regions, this study investigates a recently identified novel microbe-associated molecular pattern (MAMP)-responsive cis-sequence located within the 101 bp long intergenic region upstream of the At1g13990 gene. It is shown that the cis-regulatory sequence is sufficient for MAMP-responsive reporter gene activity in the context of its native promoter. The 3' UTR of the upstream gene has a quantitative effect on gene expression. In context of a synthetic promoter, the cis-sequence is shown to achieve a strong increase in reporter gene activity as a monomer, dimer and tetramer. Mutation analysis of the cis-sequence determined the specific nucleotides required for gene expression activation. In transgenic A. thaliana the synthetic promoter harbouring a tetramer of the cis-sequence not only drives strong pathogen-responsive reporter gene expression but also shows a high background activity. The results of this study contribute to our understanding how genes with very short upstream intergenic regions are regulated and how these regions can serve as a source for MAMP-responsive cis-sequences for synthetic promoter design. PMID:26833485

  20. Inhibition by naloxone of promoter activity of the neurofilament gene in SK-N-SH cells.

    PubMed

    Niu, S Y; Kuo, C H; Taira, E; Muraoka, O; Irie, Y; Gan, Y H; Do, E; Miki, N

    2000-01-01

    Chronic administration of morphine is known to decrease the levels of neurofilaments (NFs) in the ventral tegmental area. We ligated a promoter region of the mouse 68-KDa neurofilament (NF-68) gene to the pGL3-enhancer vector containing a luciferase gene, transfected it into SK-N-SH cells and then analyzed transcriptional activity in the cells treated with agonists or antagonists of opiate receptors. The activity of the NF-68 promoter was suppressed by naloxone about 55% at 10(-5) M and 30% at 10(-7) M at 48 h, but suppressed not by morphine. Naltrexone at 10(-5) M suppressed the promoter activity about 20%, but levallorphan, DAMGO, DPDPE and U50488 did not. The inhibition by naloxone was dose-dependent and not reversed by morphine. The inhibitory effect of naloxone was not observed in N18TG-2 cells and PC12 cells. Experiments with various deletion mutants revealed that a region responsible for naloxone suppression spans from -328 to -101 in the gene. These results suggest that naloxone has the ability to suppress transcriptional activity in some neurons.

  1. Arabidopsis meiotic crossover hotspots overlap with H2A.Z nucleosomes at gene promoters

    PubMed Central

    Choi, Kyuha; Zhao, Xiaohui; Kelly, Krystyna A.; Venn, Oliver; Higgins, James D.; Yelina, Nataliya E.; Hardcastle, Thomas J.; Ziolkowski, Piotr A.; Copenhaver, Gregory P.; Franklin, F. Chris H.; McVean, Gil; Henderson, Ian R.

    2013-01-01

    PRDM9 directs human meiotic crossover hotspots to intergenic sequence motifs, whereas budding yeast hotspots overlap low nucleosome density regions in gene promoters. To investigate hotspots in plants, which lack PRDM9, we used coalescent analysis of Arabidopsis genetic variation. Crossovers increase towards gene promoters and terminators, and hotspots are associated with active chromatin modifications, including H2A.Z, histone H3K4me3, low nucleosome density and low DNA methylation. Hotspot-enriched A-rich and CTT-repeat DNA motifs occur upstream and downstream of transcriptional start respectively. Crossovers are asymmetric around promoters and highest over CTT-motifs and H2A.Z-nucleosomes. Pollen-typing, segregation and cytogenetic analysis show decreased crossovers in the arp6 H2A.Z deposition mutant, at multiple scales. During meiosis H2A.Z and DMC1/RAD51 recombinases form overlapping chromosomal foci. As arp6 reduces DMC1/RAD51 foci, H2A.Z may promote formation or processing of meiotic DNA double-strand breaks. We propose that gene chromatin ancestrally designates hotspots within eukaryotes and PRDM9 is a derived state within vertebrates. PMID:24056716

  2. Characterization and regulation of the bovine stearoyl-CoA desaturase gene promoter

    SciTech Connect

    Keating, Aileen F.; Kennelly, John J.; Zhao Fengqi . E-mail: fzhao@uvm.edu

    2006-05-26

    The bovine stearoyl-CoA desaturase (Scd) gene plays an important role in the bovine mammary gland where substrates such as stearic and vaccenic acids are converted to oleic acid and conjugated linoleic acid (CLA), respectively. Up to 90% of the CLA in bovine milk is formed due to the action of this enzyme in the mammary gland. The areas of the bovine promoter of importance in regulating this key enzyme were examined and an area of 36 bp in length was identified as having a critical role in transcriptional activation and is designated the Scd transcriptional enhancer element (STE). Electrophoretic mobility shift assay detected three binding complexes on this area in Mac-T cell nuclear extracts. Treatment of cells with CLA caused a significant reduction in transcriptional activity, with this effect being mediated through the STE region. The bovine Scd gene promoter was up-regulated by insulin and down-regulated by oleic acid.

  3. Myeloid Translocation Gene-16 Co-Repressor Promotes Degradation of Hypoxia-Inducible Factor 1

    PubMed Central

    Kumar, Parveen; Gullberg, Urban; Olsson, Inge; Ajore, Ram

    2015-01-01

    The myeloid translocation gene 16 (MTG16) co-repressor down regulates expression of multiple glycolytic genes, which are targets of the hypoxia-inducible factor 1 (HIF1) heterodimer transcription factor that is composed of oxygen-regulated labile HIF1α and stable HIF1β subunits. For this reason, we investigated whether MTG16 might regulate HIF1 negatively contributing to inhibition of glycolysis and stimulation of mitochondrial respiration. A doxycycline Tet-On system was used to control levels of MTG16 in B-lymphoblastic Raji cells. Results from co-association studies revealed MTG16 to interact with HIF1α. The co-association required intact N-terminal MTG16 residues including Nervy Homology Region 1 (NHR1). Furthermore, electrophoretic mobility shift assays demonstrated an association of MTG16 with hypoxia response elements (HREs) in PFKFB3, PFKFB4 and PDK1 promoters in-vitro. Results from chromatin immunoprecipitation assays revealed co-occupancy of these and other glycolytic gene promoters by HIF1α, HIF1β and MTG16 in agreement with possible involvement of these proteins in regulation of glycolytic target genes. In addition, MTG16 interacted with prolyl hydroxylase D2 and promoted ubiquitination and proteasomal degradation of HIF1α. Our findings broaden the area of MTG co-repressor functions and reveal MTG16 to be part of a protein complex that controls the levels of HIF1α. PMID:25974097

  4. Genomic structure, gene expression, and promoter analysis of human multidrug resistance-associated protein 7

    SciTech Connect

    Kao, Hsin-Hsin; Chang, Ming-Shi; Cheng, Jan-Fang; Huang, Jin-Ding

    2002-03-15

    The multidrug resistance-associated protein (MRP) subfamily transporters associated with anticancer drug efflux are attributed to the multidrug-resistance of cancer cells. The genomic organization of human multidrug resistance-associated protein 7 (MRP7) was identified. The human MRP7 gene, consisting of 22 exons and 21 introns, greatly differs from other members of the human MRP subfamily. A splicing variant of human MRP7, MRP7A, expressed in most human tissues, was also characterized. The 1.93-kb promoter region of MRP7 was isolated and shown to support luciferase activity at a level 4- to 5-fold greater than that of the SV40 promoter. Basal MRP7 gene expression was regulated by 2 regions in the 5-flanking region at 1,780 1,287 bp, and at 611 to 208 bp. In Madin-Darby canine kidney (MDCK) cells, MRP7 promoter activity was increased by 226 percent by genotoxic 2-acetylaminofluorene and 347 percent by the histone deacetylase inhibitor, trichostatin A. The protein was expressed in the membrane fraction of transfected MDCK cells.

  5. Repression of the interleukin 6 gene promoter by p53 and the retinoblastoma susceptibility gene product

    SciTech Connect

    Santhanam, U.; Ray, A.; Sehgal, P.B. )

    1991-09-01

    The aberrant overexpression of interleukin 6 (IL-6) is implicated as an autocrine mechanism in the enhanced proliferation of the neoplastic cell elements in various B- and T-cell malignancies and in some carcinomas and sarcomas; many of these neoplasms have been shown to be associated with a mutated p53 gene. The possibility that wild-type (wt) p53, a nuclear tumor-suppressor protein, but not its transforming mutants might serve to repress IL-6 gene expression was investigated in HeLa cells. The authors transiently cotransfected these cells with constitutive cytomegalovirus (CMV) enhancer/promoter expression plasmids overproducing wt or mutant human or murine p53 and with appropriate chloramphenicol acetyltransferase (CAT) reporter plasmids containing the promoter elements of human IL-6, c-fos, or {beta}-actin genes or of porcine major histocompatibility complex (MHC) class I gene in pN-38 to evaluate the effect of the various p53 species on these promoters. These observations identify transcriptional repression as a property of p53 and suggest that p53 and RB may be involved as transcriptional repressors in modulating IL-6 gene expression during cellular differentiation and oncogenesis.

  6. Molecular cloning and functional characterization of Catharanthus roseus hydroxymethylbutenyl 4-diphosphate synthase gene promoter from the methyl erythritol phosphate pathway.

    PubMed

    Ginis, Olivia; Courdavault, Vincent; Melin, Céline; Lanoue, Arnaud; Giglioli-Guivarc'h, Nathalie; St-Pierre, Benoit; Courtois, Martine; Oudin, Audrey

    2012-05-01

    The Madagascar periwinkle produces monoterpenoid indole alkaloids (MIA) of high interest due to their therapeutical values. The terpenoid moiety of MIA is derived from the methyl erythritol phosphate (MEP) and seco-iridoid pathways. These pathways are regarded as the limiting branch for MIA biosynthesis in C. roseus cell and tissue cultures. In previous studies, we demonstrated a coordinated regulation at the transcriptional and spatial levels of genes from both pathways. We report here on the isolation of the 5'-flanking region (1,049 bp) of the hydroxymethylbutenyl 4-diphosphate synthase (HDS) gene from the MEP pathway. To investigate promoter transcriptional activities, the HDS promoter was fused to GUS reporter gene. Agrobacterium-mediated transformation of young tobacco leaves revealed that the cloned HDS promoter displays a tissue-specific GUS staining restricted to the vascular region of the leaves and limited to a part of the vein that encompasses the phloem in agreement with the previous localization of HDS transcripts in C. roseus aerial organs. Further functional characterizations in stably or transiently transformed C. roseus cells allowed us to identify the region that can be consider as the minimal promoter and to demonstrate the induction of HDS promoter by several hormonal signals (auxin, cytokinin, methyljasmonate and ethylene) leading to MIA production. These results, and the bioinformatic analysis of the HDS 5'-region, suggest that the HDS promoter harbours a number of cis-elements binding specific transcription factors that would regulate the flux of terpenoid precursors involved in MIA biosynthesis.

  7. Identification of a novel first exon in the human dystrophin gene and of a new promoter located more than 500 kb upstream of the nearest known promoter

    SciTech Connect

    Yanagawa, H.; Nishio, H.; Takeshima, Y.

    1994-09-01

    The dystrophin gene, which is muted in patients with Duchenne and Becker muscular dystrophies, is the largest known human gene. Five alternative promoters have been characterized until now. Here we show that a novel dystrophin isoform with a different first exon can be produced through transcription initiation at a previously-unidentified alternative promoter. The case study presented is that of patient with Duchenne muscular dystrophy who had a deletion extending from 5{prime} end of the dystrophin gene to exon 2, including all promoters previously mapped in the 5{prime} part of the gene. Transcripts from lymphoblastoid cells were found to contain sequences corresponding to exon 3, indicating the presence of new promoter upstream of this exon. The nucleotide sequence of amplified cDNA corresponding to the 5{prime} end of the new transcript indicated that the 5{prime} end of exon 3 was extended by 9 codons, only the last (most 3{prime}) of which codes for methionine. The genomic nucleotide sequence upstream from the new exon, as determined using inverse polymerase chain reaction, revealed the presence of sequences similar to a TATA box, an octamer motif and an MEF-2 element. The identified promoter/exon did not map to intron 2, as might have been expected, but to a position more than 500 kb upstream of the most 5{prime} of the previously-identified promoters, thereby adding 500 kb to the dystrophin gene. The sequence of part of the new promoter region is very similar to that of certain medium reiteration frequency repetitive sequences. These findings may help us understand the molecular evolution of the dystrophin gene.

  8. Division genes in Escherichia coli are expressed coordinately to cell septum requirements by gearbox promoters.

    PubMed

    Aldea, M; Garrido, T; Pla, J; Vicente, M

    1990-11-01

    The cell division ftsQAZ cluster and the ftsZ-dependent bolA morphogene of Escherichia coli are found to be driven by gearboxes, a distinct class of promoters characterized by showing an activity that is inversely dependent on growth rate. These promoters contain specific sequences upstream from the mRNA start point, and their -10 region is essential for the inverse growth rate dependence. Gearbox promoters are essential for driving ftsQAZ and bolA gene expression so that the encoded products are synthesized at constant amounts per cell independently of cell size. This mode of regulation would be expected for the expression of proteins that either play a regulatory role in cell division or form a stoichiometric component of the septum, a structure that, independently of cell size and growth rate, is produced once per cell cycle.

  9. A proximal promoter region of Arabidopsis DREB2C confers tissue-specific expression under heat stress.

    PubMed

    Chen, Huan; Je, Jihyun; Song, Chieun; Hwang, Jung Eun; Lim, Chae Oh

    2012-09-01

    The dehydration-responsive element-binding factor 2C (DREB2C) is a member of the CBF/DREB subfamily of proteins, which contains a single APETALA2/Ethylene responsive element-binding factor (AP2/ERF) domain. To identify the expression pattern of the DREB2C gene, which contains multiple transcription cis-regulatory elements in its promoter, an approximately 1.4 kb upstream DREB2C sequence was fused to the β-glucuronidase reporter gene (GUS) and the recombinant p1244 construct was transformed into Arabidopsis thaliana (L.) Heynh. The promoter of the gene directed prominent GUS activity in the vasculature in diverse young dividing tissues. Upon applying heat stress (HS), GUS staining was also enhanced in the vasculature of the growing tissues. Analysis of a series of 5'-deletions of the DREB2C promoter revealed that a proximal upstream sequence sufficient for the tissue-specific spatial and temporal induction of GUS expression by HS is localized in the promoter region between -204 and -34 bps relative to the transcriptional start site. Furthermore, electrophoretic mobility shift assay (EMSA) demonstrated that nuclear protein binding activities specific to a -120 to -32 bp promoter fragment increased after HS. These results indicate that the TATA-proximal region and some latent trans-acting factors may cooperate in HS-induced activation of the Arabidopsis DREB2C promoter.

  10. COX-2 gene expression in colon cancer tissue related to regulating factors and promoter methylation status

    PubMed Central

    2011-01-01

    Background Increased cyclooxygenase activity promotes progression of colorectal cancer, but the mechanisms behind COX-2 induction remain elusive. This study was therefore aimed to define external cell signaling and transcription factors relating to high COX-2 expression in colon cancer tissue. Method Tumor and normal colon tissue were collected at primary curative operation in 48 unselected patients. COX-2 expression in tumor and normal colon tissue was quantified including microarray analyses on tumor mRNA accounting for high and low tumor COX-2 expression. Cross hybridization was performed between tumor and normal colon tissue. Methylation status of up-stream COX-2 promoter region was evaluated. Results Tumors with high COX-2 expression displayed large differences in gene expression compared to normal colon. Numerous genes with altered expression appeared in tumors of high COX-2 expression compared to tumors of low COX-2. COX-2 expression in normal colon was increased in patients with tumors of high COX-2 compared to normal colon from patients with tumors of low COX-2. IL1β, IL6 and iNOS transcripts were up-regulated among external cell signaling factors; nine transcription factors (ATF3, C/EBP, c-Fos, Fos-B, JDP2, JunB, c-Maf, NF-κB, TCF4) showed increased expression and 5 (AP-2, CBP, Elk-1, p53, PEA3) were decreased in tumors with high COX-2. The promoter region of COX-2 gene did not show consistent methylation in tumor or normal colon tissue. Conclusions Transcription and external cell signaling factors are altered as covariates to COX-2 expression in colon cancer tissue, but DNA methylation of the COX-2 promoter region was not a significant factor behind COX-2 expression in tumor and normal colon tissue. PMID:21668942

  11. Regulatory regions in the yeast FBP1 and PCK1 genes.

    PubMed

    Mercado, J J; Gancedo, J M

    1992-10-19

    By deletion analysis of the fusion genes FBP1-lacZ and PCK1-lacZ we have identified a number of strong regulatory regions in the genes FBP1 and PCK1 which encode fructose-1,6-bisphosphatase and phosphoenolpyruvate carboxykinase. Lack of expression of beta-galactosidase in fusions lacking sequences from the coding regions suggests the existence of downstream activating elements. Both promoters have several UAS and URS regions as well as sites implicated in catabolite repression. We have found in both genes consensus sequences for the binding of the same regulatory proteins, such as yAP1, MIG1 or the complex HAP2/HAP3/HAP4. Neither deletion nor overexpression of the MIG1 gene affected the regulated expression of the FBP1 or PCK1 genes.

  12. Promoter-like sequences regulating transcriptional activity in neurexin and neuroligin genes.

    PubMed

    Runkel, Fabian; Rohlmann, Astrid; Reissner, Carsten; Brand, Stefan-Martin; Missler, Markus

    2013-10-01

    Synapse function requires the cell-adhesion molecules neurexins (Nrxn) and neuroligins (Nlgn). Although these molecules are essential for neurotransmission and prefer distinct isoform combinations for interaction, little is known about their transcriptional regulation. Here, we started to explore this important aspect because expression of Nrxn1-3 and Nlgn1-3 genes is altered in mice lacking the transcriptional regulator methyl-CpG-binding protein2 (MeCP2). Since MeCP2 can bind to methylated CpG-dinucleotides and Nrxn/Nlgn contain CpG-islands, we tested genomic sequences for transcriptional activity in reporter gene assays. We found that their influence on transcription are differentially activating or inhibiting. As we observed an activity difference between heterologous and neuronal cell lines for distinct Nrxn1 and Nlgn2 sequences, we dissected their putative promoter regions. In both genes, we identify regions in exon1 that can induce transcription, in addition to the alternative transcriptional start points in exon2. While the 5'-regions of Nrxn1 and Nlgn2 contain two CpG-rich elements that show distinct methylation frequency and binding to MeCP2, other regions may act independently of this transcriptional regulator. These data provide first insights into regulatory sequences of Nrxn and Nlgn genes that may represent an important aspect of their function at synapses in health and disease.

  13. Elevation of transgene expression level by flanking matrix attachment regions (MAR) is promoter dependent: a study of the interactions of six promoters with the RB7 3' MAR.

    PubMed

    Mankin, S Luke; Allen, George C; Phelan, Thomas; Spiker, Steven; Thompson, William F

    2003-02-01

    We have analyzed effects of a matrix attachment region (MAR) from the tobacco RB7 gene on transgene expression from six different promoters in stably transformed tobacco cell cultures. The presence of MARs flanking the transgene increased expression of constructs based on the constitutive CaMV 35S, NOS, and OCS promoters. Expression from an induced heat shock promoter was also increased and MARs did not cause expression in the absence of heat shock. There was also no effect of MARs on the pea ferredoxin promoter, which is not normally expressed in this cell line. Importantly, most transgenes flanked by RB7 MAR elements showed a large reduction in the number of low expressing GUS transformants relative to control constructs without MARs. PMID:12650520

  14. Analysis of Hypothetical Promoter Domains of DKFZp564A1164, NPHS1 and HSPOX1 Genes

    SciTech Connect

    Hammond, S S

    2003-11-29

    For this study, a high throughput method for identifying and testing regulatory elements was examined. In addition, the validity of promoters predicted by FirstEF was tested. It was found that by combining computer based promoter and first exon predictions from FirstEF (Davuluri et al., 2001) with PCR-based cloning to generate luciferase reporter constructs, and by testing reporter activity in cultured mammalian cells plated in a 96 well format one could identify promoter activity in a relatively high throughput manner. The data generated in this study suggest that FirstEF predictions are sometimes incorrect. Therefore, having a strategy for defining which FirstEF predicted promoters to test first may accelerate the process. Initially testing promoters that are at a confirmed transcription start site for a gene, at a possible alternate transcription start site or in a region of conserved sequence would be the best candidates, while promoters predicted in gene desert regions may not be as easy to confirm. The luciferase assay lent itself very well to the high throughput search, however the subcloning did not always go smoothly. The numerous steps that this traditional subcloning method requires were time consuming and increased the opportunities for errors. A faster method that skips many of the traditional subcloning steps, such as the Creator{trademark} system by Clontech is currently being investigated by our lab. The development and testing of substantially larger enhancer/silencer regulatory elements may not be possible at this time using these high throughput methods. These regulatory elements are generally GC rich making them more difficult to PCR and subclone. Additionally, confirming upstream untranslated first exons was not possible within this time scale using the SMART RACE protocol. It will be necessary to further explore the limitations within these procedures in order to confirm these and future regulatory elements. Alterations and modifications to

  15. Differential Regulation of the Period Genes in Striatal Regions following Cocaine Exposure

    PubMed Central

    Falcon, Edgardo; Ozburn, Angela; Mukherjee, Shibani; Roybal, Kole; McClung, Colleen A.

    2013-01-01

    Several studies have suggested that disruptions in circadian rhythms contribute to the pathophysiology of multiple psychiatric diseases, including drug addiction. In fact, a number of the genes involved in the regulation of circadian rhythms are also involved in modulating the reward value for drugs of abuse, like cocaine. Thus, we wanted to determine the effects of chronic cocaine on the expression of several circadian genes in the Nucleus Accumbens (NAc) and Caudate Putamen (CP), regions of the brain known to be involved in the behavioral responses to drugs of abuse. Moreover, we wanted to explore the mechanism by which these genes are regulated following cocaine exposure. Here we find that after repeated cocaine exposure, expression of the Period (Per) genes and Neuronal PAS Domain Protein 2 (Npas2) are elevated, in a somewhat regionally selective fashion. Moreover, NPAS2 (but not CLOCK (Circadian Locomotor Output Cycles Kaput)) protein binding at Per gene promoters was enhanced following cocaine treatment. Mice lacking a functional Npas2 gene failed to exhibit any induction of Per gene expression after cocaine, suggesting that NPAS2 is necessary for this cocaine-induced regulation. Examination of Per gene and Npas2 expression over twenty-four hours identified changes in diurnal rhythmicity of these genes following chronic cocaine, which were regionally specific. Taken together, these studies point to selective disruptions in Per gene rhythmicity in striatial regions following chronic cocaine treatment, which are mediated primarily by NPAS2. PMID:23776671

  16. Selection for Unequal Densities of Sigma70 Promoter-like Signalsin Different Regions of Large Bacterial Genomes

    SciTech Connect

    Huerta, Araceli M.; Francino, M. Pilar; Morett, Enrique; Collado-Vides, Julio

    2006-03-01

    The evolutionary processes operating in the DNA regions that participate in the regulation of gene expression are poorly understood. In Escherichia coli, we have established a sequence pattern that distinguishes regulatory from nonregulatory regions. The density of promoter-like sequences, that are recognizable by RNA polymerase and may function as potential promoters, is high within regulatory regions, in contrast to coding regions and regions located between convergently-transcribed genes. Moreover, functional promoter sites identified experimentally are often found in the subregions of highest density of promoter-like signals, even when individual sites with higher binding affinity for RNA polymerase exist elsewhere within the regulatory region. In order to investigate the generality of this pattern, we have used position weight matrices describing the -35 and -10 promoter boxes of E. coli to search for these motifs in 43 additional genomes belonging to most established bacterial phyla, after specific calibration of the matrices according to the base composition of the noncoding regions of each genome. We have found that all bacterial species analyzed contain similar promoter-like motifs, and that, in most cases, these motifs follow the same genomic distribution observed in E. coli. Differential densities between regulatory and nonregulatory regions are detectable in most bacterial genomes, with the exception of those that have experienced evolutionary extreme genome reduction. Thus, the phylogenetic distribution of this pattern mirrors that of genes and other genomic features that require weak selection to be effective in order to persist. On this basis, we suggest that the loss of differential densities in the reduced genomes of host-restricted pathogens and symbionts is the outcome of a process of genome degradation resulting from the decreased efficiency of purifying selection in highly structured small populations. This implies that the differential

  17. US-INDIA TECHNICAL COLLABORATION TO PROMOTE REGIONAL STABILITY.

    SciTech Connect

    Killinger, M. H.; Griggs, J. R.; Apt, Kenneth E.; Doyle, J. E.

    2001-01-01

    Two US-India documents were signed in 2000 that provided new impetus for scientific and technical cooperation between the two countries. The first document is the US-India Science and Technology Agreement, which is aimed at 'promoting scientific and technological cooperation between the people of their two countries.' The second is the US-India Joint Statement on Energy and Environment, which states 'the United States and India believe that energy and environment could be one of the most important areas of cooperation between the two countries.' In addition to the work already underway as part of these two agreements, the US Department of Energy (DOE) has established a US-India Science and Technology Initiative to utilize the expertise of DOE national laboratories to conduct activities that support US policy objectives in South Asia. PNNL and LANL are working with US government agencies to identify appropriate non-sensitive, non-nuclear areas for US-Indian technical collaboration. The objectives of such collaboration are to address visible national and international problems, build trust between the United States and India, and contribute to regional stability in South Asia. This paper describes the approach for this engagement, the Indian scientific organization and infrastructure, potential areas for collaboration, and current status of the initiative.

  18. A Microsatellite Polymorphism in IGF1 Gene Promoter and Timing of Natural Menopause in Caucasian Women

    PubMed Central

    Kaczmarek, Maria; Pacholska-Bogalska, Joanna; Kwaśniewski, Wojciech; Kotarski, Jan; Halerz-Nowakowska, Barbara; Goździka-Józefiak, Anna

    2015-01-01

    Background: Genes involved in the IGF-1 aging pathways in the human ovary can be considered strong candidates for predictors of the natural menopause timing. This study evaluates the association between a cytosine-adenine (CA) microsatellite polymorphism in the IGF1 gene promoter P1 and age at natural menopause. Methods: Genomic DNA was extracted from the peripheral blood, PCR was performed using primers designed to amplify the polymorphic (CA)n repeat of the human IGF1 gene, an allele dose effect for the most common (CA)19 repeats allele, Cox proportional hazard regression models and the Kaplan-Meier cumulative survivorship method with the log-rank test were used to determine statistical significance of studied associations in a sample of 257 Polish women aged 40-58 years. Results: Crude Cox proportional hazard regression analysis confirmed the association between the IGF1 gene polymorphism and the menopause timing (p=0.038). This relationship remained statistically significant after controlling for other menopause confounders in multivariate modelling. Out of the input variables, the (CA)n polymorphism in the IGF1 gene promoter, age at menarche and smoking status were independent covariates of the natural menopause timing (χ2 =12.845; df=3; p=0.034). The onset of menopause at a younger age was likely associated with the IGF1 genotype variant not carrying the (CA)19 repeats allele, menarche before the age of 12 and a current cigarette smoker status (HR=1.6). Conclusion: This study provides evidence that a common cytosine-adenine (CA) microsatellite repeat polymorphism in the P1 promoter region of the IGF1 gene is an independent predictive factor for age at natural menopause in Caucasian women also after adjusting for other menopause covariates. PMID:25552916

  19. Regulatory elements involved in constitutive and phorbol ester-inducible expression of the plasminogen activator inhibitor type 2 gene promoter.

    PubMed Central

    Cousin, E; Medcalf, R L; Bergonzelli, G E; Kruithof, E K

    1991-01-01

    Gene transcription rates and mRNA levels of plasminogen activator inhibitor type 2 (PAI-2) are markedly induced by the tumor promoting agent phorbol 12-myristate 13-acetate (PMA) in human HT1080 fibrosarcoma cells. To identify promoter elements required for basal-, and phorbol ester-inducible expression, deletion mutants of the PAI-1 promoter fused to the chloramphenicol acetyl transferase (CAT) reporter gene, were transiently expressed in HT1080 cells. Constitutive CAT activity was expressed from constructs containing more than 215 bp of promoter sequence, whereas deletion to position -91 bp abolished CAT gene expression. Treatment of transfected cells with PMA resulted in a three- to ten-fold increase in CAT expression from all constructs except from the construct shortened to position -91. DNAse1 protection analysis of the promoter region between -215 and the transcription initiation site revealed numerous protected regions, including two AP1-like binding sites (AP1a and AP1b) and one CRE-like element. Site-directed mutagenesis of the AP1a site or of the CRE-like site resulted in the loss of basal CAT activity and abolished the PMA effect, whereas mutagenesis of AP1b only partially inhibited basal and PMA-mediated expression. Our results suggest that the PAI-2 promoter contains at least two elements required for basal gene transcription and PMA-mediated induction. Images PMID:1650454

  20. Chymotrypsin protease inhibitor gene family in rice: Genomic organization and evidence for the presence of a bidirectional promoter shared between two chymotrypsin protease inhibitor genes.

    PubMed

    Singh, Amanjot; Sahi, Chandan; Grover, Anil

    2009-01-01

    Protease inhibitors play important roles in stress and developmental responses of plants. Rice genome contains 17 putative members in chymotrypsin protease inhibitor (ranging in size from 7.21 to 11.9 kDa) gene family with different predicted localization sites. Full-length cDNA encoding for a putative subtilisin-chymotrypsin protease inhibitor (OCPI2) was obtained from Pusa basmati 1 (indica) rice seedlings. 620 bp-long OCPI2 cDNA contained 219 bp-long ORF, coding for 72 amino acid-long 7.7 kDa subtilisin-chymotrypsin protease inhibitor (CPI) cytoplasmic protein. Expression analysis by semi-quantitative RT-PCR analysis showed that OCPI2 transcript is induced by varied stresses including salt, ABA, low temperature and mechanical injury in both root and shoot tissues of the seedlings. Transgenic rice plants produced with OCPI2 promoter-gus reporter gene showed that this promoter directs high salt- and ABA-regulated expression of the GUS gene. Another CPI gene (OCPI1) upstream to OCPI2 (with 1126 bp distance between the transcription initiation sites of the two genes; transcription in the reverse orientation) was noted in genome sequence of rice genome. A vector that had GFP and GUS reporter genes in opposite orientations driven by 1881 bp intergenic sequence between the OCPI2 and OCPI1 (encompassing the region between the translation initiation sites of the two genes) was constructed and shot in onion epidermal cells by particle bombardment. Expression of both GFP and GUS from the same epidermal cell showed that this sequence represents a bidirectional promoter. Examples illustrating gene pairs showing co-expression of two divergent neighboring genes sharing a bidirectional promoter have recently been extensively worked out in yeast and human systems. We provide an example of a gene pair constituted of two homologous genes showing co-expression governed by a bidirectional promoter in rice. PMID:18952157

  1. The ftsQ1p gearbox promoter of Escherichia coli is a major sigma S-dependent promoter in the ddlB-ftsA region.

    PubMed

    Ballesteros, M; Kusano, S; Ishihama, A; Vicente, M

    1998-10-01

    The most potent promoters in the ddlB-ftsA region of the dcw cluster have been analysed for sigmaS-dependent transcription. Only the gearbox promoter ftsQ1p was found to be transcribed in vitro by RNA polymerase holoenzyme coupled to sigmaS (EsigmaS). This dependency on sigmaS was also found in vivo when single-copy fusions to a reporter gene were analysed in rpoS and rpoS+ backgrounds. Although ftsQ1p can be transcribed by RNA polymerase containing either sigmaD or sigmaS, there is a preference for EsigmaS when the assay conditions include potassium glutamate and supercoiled templates, a property shared with the bolA1p gearbox promoter. The rest of the promoters assayed, ftsQ2p and ftsZ2p3p4p, similarly to the control bolA2p promoter, were preferentially transcribed by EsigmaD, the housekeeper polymerase. The ftsQ1p and the bolA1p promoters also share the presence of AT-rich sequences upstream of the - 35 region and the requirement for an intact wild-type alpha-subunit for a proficient transcription, allowing their joint classification as gearboxes.

  2. Aly/ REF, a factor for mRNA transport, activates RH gene promoter function.

    PubMed

    Suganuma, Hiroshi; Kumada, Maki; Omi, Toshinori; Gotoh, Takaya; Lkhagvasuren, Munkhtulga; Okuda, Hiroshi; Kamesaki, Toyomi; Kajii, Eiji; Iwamoto, Sadahiko

    2005-06-01

    The rhesus (Rh) blood group antigens are of considerable importance in transfusion medicine as well as in newborn or autoimmune hemolytic diseases due to their high antigenicity. We identified a major DNaseI hypersensitive site at the 5' flanking regions of both RHD and RHCE exon 1. A 34 bp fragment located at -191 to -158 from a translation start position, and containing the TCCCCTCCC sequence, was involved in enhancing promoter activity, which was assessed by luciferase reporter gene assay. A biotin-labelled 34 bp probe isolated an mRNA transporter protein, Aly/REF. The specific binding of Aly/REF to RH promoter in erythroid was confirmed by chromatin immunoprecipitation assay. The silencing of Aly/REF by siRNA reduced not only the RH promoter activity of the reporter gene but also transcription from the native genome. These facts provide second proof of Aly/REF as a transcription coactivator, initially identified as a coactivator for the TCRalpha enhancer function. Aly/REF might be a novel transcription cofactor for erythroid-specific genes.

  3. Promoter analysis of the membrane protein gp64 gene of the cellular slime mold Polysphondylium pallidum.

    PubMed

    Takaoka, N; Fukuzawa, M; Saito, T; Sakaitani, T; Ochiai, H

    1999-10-28

    We cloned a genomic fragment of the membrane protein gp64 gene of the cellular slime mold Polysphondylium pallidum by inverse PCR. Primer extension analysis identified a major transcription start site 65 bp upstream of the translation start codon. The promoter region of the gp64 gene contains sequences homologous to a TATA box at position -47 to -37 and to an initiator (Inr, PyPyCAPyPyPyPy) at position -3 to +5 from the transcription start site. Successively truncated segments of the promoter were tested for their ability to drive expression of the beta-galactosidase reporter gene in transformed cells; also the difference in activity between growth conditions was compared. The results indicated that there are two positive vegetative regulatory elements extending between -187 and -62 bp from the transcription start site of the gp64 promoter; also their activity was two to three times higher in the cells grown with bacteria in shaken suspension than in the cells grown in an axenic medium. PMID:10542319

  4. Bovine and rodent tamm-horsfall protein (THP) genes: cloning, structural analysis, and promoter identification.

    PubMed

    Yu, H; Papa, F; Sukhatme, V P

    1994-01-01

    We have isolated bovine and rodent cDNA and genomic clones encoding the kidney-specific Tamm-Horsfall protein (THP). In both species the gene contains 11 exons, the first of which is noncoding. Exon/intron junctions were analyzed and all were shown to follow the AG/GT rule. A kidney-specific DNase I hypersensitive site was mapped onto a rodent genomic fragment for which the sequence is highly conserved in three species (rat, cow, and human) over a stretch of 350 base pairs. Primer extension and RNase protection analysis identified a transcription start site at the 3' end of this conserved region. A TATA box is located at 32 nucleotides upstream of the start site in the bovine gene and 34 nucleotides upstream in the rodent gene. An inverted CCAAT motif occurs at 65 and 66 nucleotides upstream of the start site in the bovine and rodent genes, respectively. Other highly conserved regions were noted in this 350 bp region and these are likely to be binding sites for transcription factors. A functional assay based on an in vitro transcription system confirmed that the conserved region is an RNA Pol II promoter. The in vitro system accurately initiated transcription from the in vivo start site and was highly sensitive to inhibition by alpha-amanitin at a concentration of 2.5 micrograms/ml. These studies set the stage for the further definition of cis-acting sequences and trans-factors regulating expression of the THP gene, a model for kidney-specific gene expression.

  5. Molecular analysis of the human SLC13A4 sulfate transporter gene promoter

    SciTech Connect

    Jefferis, J.; Rakoczy, J.; Simmons, D.G.; Dawson, P.A.

    2013-03-29

    Highlights: ► Basal promoter activity of SLC13A4 −57 to −192 nt upstream of transcription initiation site. ► Human SLC13A4 5′-flanking region has conserved motifs with other placental species. ► Putative NFY, SP1 and KLF7 motifs in SLC13A4 5′-flanking region enhance transcription. -- Abstract: The human solute linked carrier (SLC) 13A4 gene is primarily expressed in the placenta where it is proposed to mediate the transport of nutrient sulfate from mother to fetus. The molecular mechanisms involved in the regulation of SLC13A4 expression remain unknown. To investigate the regulation of SLC13A4 gene expression, we analysed the transcriptional activity of the human SLC13A4 5′-flanking region in the JEG-3 placental cell line using luciferase reporter assays. Basal transcriptional activity was identified in the region −57 to −192 nucleotides upstream of the SLC13A4 transcription initiation site. Mutational analysis of the minimal promoter region identified Nuclear factor Y (NFY), Specificity protein 1 (SP1) and Krüppel like factor 7 (KLF7) motifs which conferred positive transcriptional activity, as well as Zinc finger protein of the cerebellum 2 (ZIC2) and helix–loop–helix protein 1 (HEN1) motifs that repressed transcription. The conserved NFY, SP1, KLF7, ZIC2 and HEN1 motifs in the SLC13A4 promoter of placental species but not in non-placental species, suggests a potential role for these putative transcriptional factor binding motifs in the physiological control of SLC13A4 mRNA expression.

  6. Evolution of a Sigma Factor: An All-In-One of Gene Duplication, Horizontal Gene Transfer, Purifying Selection, and Promoter Differentiation

    PubMed Central

    López-Leal, Gamaliel; Cevallos, Miguel A.; Castillo-Ramírez, Santiago

    2016-01-01

    Sigma factors are an essential part of bacterial gene regulation and have been extensively studied as far as their molecular mechanisms and protein structure are concerned. However, their molecular evolution, especially for the alternative sigma factors, is poorly understood. Here, we analyze the evolutionary forces that have shaped the rpoH sigma factors within the alphaproteobacteria. We found that an ancient duplication gave rise to two major groups of rpoH sigma factors and that after this event horizontal gene transfer (HGT) occurred in rpoH1 group. We also noted that purifying selection has differentially affected distinct parts of the gene; singularly, the gene segment that encodes the region 4.2, which interacts with the −35 motif of the RpoH-dependent genes, has been under relaxed purifying selection. Furthermore, these two major groups are clearly differentiated from one another regarding their promoter selectivity, as rpoH1 is under the transcriptional control of σ70 and σ32, whereas rpoH2 is under the transcriptional control of σ24. Our results suggest a scenario in which HGT, gene loss, variable purifying selection and clear promoter specialization occurred after the ancestral duplication event. More generally, our study offers insights into the molecular evolution of alternative sigma factors and highlights the importance of analyzing not only the coding regions but also the promoter regions. PMID:27199915

  7. Characterization of the promoter and 5'-UTR intron of oleic acid desaturase (FAD2) gene in Brassica napus.

    PubMed

    Xiao, Gang; Zhang, Zhen Qian; Yin, Chang Fa; Liu, Rui Yang; Wu, Xian Meng; Tan, Tai Long; Chen, She Yuan; Lu, Chang Ming; Guan, Chun Yun

    2014-07-15

    In the present study, we characterized the transcriptional regulatory region (KF038144) controlling the expression of a constitutive FAD2 in Brassica napus. There are multiple FAD2 gene copies in B. napus genome. The FAD2 gene characterized and analyzed in the study is located on chromosome A5 and was designated as BnFAD2A5-1. BnFAD2A5-1 harbors an intron (1,192 bp) within its 5'-untranslated region (5'-UTR). This intron demonstrated promoter activity. Deletion analysis of the BnFAD2A5-1 promoter and intron through the β-glucuronidase (GUS) reporter system revealed that the -220 to -1 bp is the minimum promoter region, while -220 to -110 bp and +34 to +285 bp are two important regions conferring high-levels of transcription. BnFAD2 transcripts were induced by light, low temperature, and abscisic acid (ABA). These observations demonstrated that not only the promoter but also the intron are involved in controlling the expression of the BnFAD2A5-1 gene. The intron-mediated regulation is an essential aspect of the gene expression regulation.

  8. Association of a Monoamine Oxidase-A Gene Promoter Polymorphism with ADHD and Anxiety in Boys with Autism Spectrum Disorder

    ERIC Educational Resources Information Center

    Roohi, Jasmin; DeVincent, Carla J.; Hatchwell, Eli; Gadow, Kenneth D.

    2009-01-01

    The aim of the present study was to examine the association between a variable number tandem repeat (VNTR) functional polymorphism in the promoter region of the MAO-A gene and severity of ADHD and anxiety in boys with ASD. Parents and teachers completed a DSM-IV-referenced rating scale for 5- to 14-year-old boys with ASD (n = 43). Planned…

  9. Mapping and validation of Xanthomonas citri subsp citri genes regulated by putative plant-inducible promoter box (PIP-box).

    PubMed

    Carvalho, F M S; Oliveira, J C F; Laia, M L; Jacob, T R; Ferreira, R M; Ferro, M I T; Tezza, R I D; Zingaretti, S M; Silva, C F; Ferro, J A

    2016-01-01

    Citrus canker, caused by the Gram-negative bacterium Xanthomonas citri subsp citri (Xac), is a major disease affecting citriculture worldwide, because of the susceptibility of the host and the lack of efficient control methods. Previous studies have reported that some genes of phytopathogenic bacteria possess a consensus nucleotide sequence (TTCGC...N15...TTCGC) designated the "plant-inducible-promoter box" (PIP box) located in the promoter region, which is responsible for activating the expression of pathogenicity and virulence factors when the pathogen is in contact with the host plant. In this study, we mapped and investigated the expression of 104 Xac genes associated with the PIP box sequences using a macroarray analysis. Xac gene expression was observed during in vitro (Xac grown for 12 or 20 h in XAM1 induction medium) or in vivo (bacteria grown in orange leaves for 3 to 5 days) infection conditions. Xac grown in non-induction NB liquid medium was used as the control. cDNA was isolated from bacteria grown under the different conditions and hybridized to the macroarray, and 32 genes differentially expressed during the infection period (in vitro or in vivo induction) were identified. The macroarray results were validated for some of the genes through semi-quantitative RT-PCR, and the functionality of the PIP box-containing promoter was demonstrated by activating b-glucuronidase reporter gene activity by the PIP box-containing promoter region during Xac-citrus host interaction. PMID:27173329

  10. The CHR promoter element controls cell cycle-dependent gene transcription and binds the DREAM and MMB complexes

    PubMed Central

    Müller, Gerd A.; Quaas, Marianne; Schümann, Michael; Krause, Eberhard; Padi, Megha; Fischer, Martin; Litovchick, Larisa; DeCaprio, James A.; Engeland, Kurt

    2012-01-01

    Cell cycle-dependent gene expression is often controlled on the transcriptional level. Genes like cyclin B, CDC2 and CDC25C are regulated by cell cycle-dependent element (CDE) and cell cycle genes homology region (CHR) promoter elements mainly through repression in G0/G1. It had been suggested that E2F4 binding to CDE sites is central to transcriptional regulation. However, some promoters are only controlled by a CHR. We identify the DREAM complex binding to the CHR of mouse and human cyclin B2 promoters in G0. Association of DREAM and cell cycle-dependent regulation is abrogated when the CHR is mutated. Although E2f4 is part of the complex, a CDE is not essential but can enhance binding of DREAM. We show that the CHR element is not only necessary for repression of gene transcription in G0/G1, but also for activation in S, G2 and M phases. In proliferating cells, the B-myb-containing MMB complex binds the CHR of both promoters independently of the CDE. Bioinformatic analyses identify many genes which contain conserved CHR elements in promoters binding the DREAM complex. With Ube2c as an example from that screen, we show that inverse CHR sites are functional promoter elements that can bind DREAM and MMB. Our findings indicate that the CHR is central to DREAM/MMB-dependent transcriptional control during the cell cycle. PMID:22064854

  11. Targeted expression of suicide gene by tissue-specific promoter and microRNA regulation for cancer gene therapy.

    PubMed

    Danda, Ravikanth; Krishnan, Gopinath; Ganapathy, Kalaivani; Krishnan, Uma Maheswari; Vikas, Khetan; Elchuri, Sailaja; Chatterjee, Nivedita; Krishnakumar, Subramanian

    2013-01-01

    In order to realise the full potential of cancer suicide gene therapy that allows the precise expression of suicide gene in cancer cells, we used a tissue specific Epithelial cell adhesion molecule (EpCAM) promoter (EGP-2) that directs transgene Herpes simplex virus-thymidine kinase (HSV-TK) expression preferentially in EpCAM over expressing cancer cells. EpCAM levels are considerably higher in retinoblastoma (RB), a childhood eye cancer with limited expression in normal cells. Use of miRNA regulation, adjacent to the use of the tissue-specific promoter, would provide the second layer of control to the transgene expression only in the tumor cells while sparing the normal cells. To test this hypothesis we cloned let-7b miRNA targets in the 3'UTR region of HSV-TK suicide gene driven by EpCAM promoter because let-7 family miRNAs, including let-7b, were found to be down regulated in the RB tumors and cell lines. We used EpCAM over expressing and let-7 down regulated RB cell lines Y79, WERI-Rb1 (EpCAM (+ve)/let-7b(down-regulated)), EpCAM down regulated, let-7 over expressing normal retinal Müller glial cell line MIO-M1(EpCAM (-ve)/let-7b(up-regulated)), and EpCAM up regulated, let-7b up-regulated normal thyroid cell line N-Thy-Ori-3.1(EpCAM (+ve)/let-7b(up-regulated)) in the study. The cell proliferation was measured by MTT assay, apoptosis was measured by probing cleaved Caspase3, EpCAM and TK expression were quantified by Western blot. Our results showed that the EGP2-promoter HSV-TK (EGP2-TK) construct with 2 or 4 copies of let-7b miRNA targets expressed TK gene only in Y79, WERI-Rb-1, while the TK gene did not express in MIO-M1. In summary, we have developed a tissue-specific, miRNA-regulated dual control vector, which selectively expresses the suicide gene in EpCAM over expressing cells. PMID:24391761

  12. Sox3 binds to 11β-hydroxysteroid dehydrogenase gene promoter suggesting transcriptional interaction in catfish.

    PubMed

    Rajakumar, Anbazhagan; Senthilkumaran, Balasubramanian

    2016-04-01

    In fishes, the expression of steroidogenic enzyme genes and their related transcription factors (TFs) are critical for the regulation of steroidogenesis and gonadal development. 11-KT is the potent androgen and hence, 11β-hsd, enzyme involved in 11-KT production is important. Regulation of 11β-hsd gene was never studied in any fishes. At first 11β-hsd was cloned and recombinant protein was tested for enzyme activity prior to expression and promoter motif analysis. Expression changes revealed stage- and sex-dependent increase in the ontogenic studies. Further, 11β-hsd expression was higher during spawning phase of reproductive cycle and was found to be gonadotropin inducible both in vivo and in vitro. ∼2kb of 5' upstream region of 11β-hsd, was cloned from catfish genomic DNA library and in silico promoter analysis revealed putative TF binding sites such as Sox3, Wt1, Pax2, Dmrt1 and Ad4BP/SF-1. Luciferase reporter assay using the sequential deletion constructs in human embryonic kidney and Chinese hamster ovary cells revealed considerable promoter activity of the constructs containing Sox3, but not with other motifs largely. Site-directed mutagenesis, Sox3 over expression, electrophoretic mobility shift and chromatin immunoprecipitation assays further substantiated the binding of Sox3 to its corresponding cis-acting element in the upstream promoter motif of 11β-hsd. This is the first report to show that Sox3 binds to the 11β-hsd gene promoter and transactivates to regulate male reproduction in a teleost. PMID:26772480

  13. Alternative promoter usage and differential expression of multiple transcripts of mouse Prkar1a gene.

    PubMed

    Banday, Abdul Rouf; Azim, Shafquat; Tabish, Mohammad

    2011-11-01

    Prkar1a gene encodes regulatory type 1 alpha subunit (RIα) of cAMP-dependent protein kinase (PKA) in mouse. The role of this gene has been implicated in Carney complex and many cancer types that suggest its involvement in physiological processes like cell cycle regulation, growth and/or proliferation. We have identified and sequenced partial cDNA clones encoding four alternatively spliced transcripts of mouse Prkar1a gene. These transcripts have alternate 5' UTR structure which results from splicing of three exons (designated as E1a, E1b, and E1c) to canonical exon 2. The designated transcripts T1, T2, T3, and T4 contain 5' UTR exons as E1c, E1a + E1b, E1a, and E1b, respectively. The transcript T1 corresponded to earlier reported transcript in GenBank. In silico study of genomic DNA sequence revealed three distinct promoter regions namely, P1, P2, and P3 upstream of the exons E1a, E1b, and E1c, respectively. P1 is non-CpG-related promoter but P2 and P3 are CpG-related promoters; however, all three are TATA less. RT-PCR analysis demonstrated the expression of all four transcripts in late postnatal stages; however, these were differentially regulated in early postnatal stages of 0.5 day, 3 day, and 15 day mice in different tissue types. Variations in expression of Prkar1a gene transcripts suggest their regulation from multiple promoters that respond to a variety of signals arising in or out of the cell in tissue and developmental stage-specific manner. PMID:21638026

  14. Human PSENEN and U2AF1L4 genes are concertedly regulated by a genuine bidirectional promoter.

    PubMed

    Didych, D A; Shamsutdinov, M F; Smirnov, N A; Akopov, S B; Monastyrskaya, G S; Uspenskaya, N Y; Nikolaev, L G; Sverdlov, E D

    2013-02-15

    Head-to-head genes with a short distance between their transcription start sites may constitute up to 10% of all genes in the genomes of various species. It was hypothesized that this intergenic space may represent bidirectional promoters which are able to initiate transcription of both genes, but the true bidirectionality was proved only for a few of them. We present experimental evidence that, according to several criteria, a 269 bp region located between the PSENEN and U2AF1L4 human genes is a genuine bidirectional promoter regulating a concerted divergent transcription of these genes. Concerted transcription of PSENEN and U2AF1L4 can be necessary for regulation of T-cell activity. PMID:23246698

  15. Functional variation in promoter region of monoamine oxidase A and subtypes of alcoholism: haplotype analysis.

    PubMed

    Parsian, Abbas; Cloninger, C Robert; Sinha, Rashmi; Zhang, Zhen Hua

    2003-02-01

    Monoamine oxidase (MAO) is a mitochondrial enzyme involved in the degradation of certain neurotransmitter amines. MAO-A, due to its function in central nervous system, has been one of the important candidate genes involved in the development of neuropsychiatric disorders. A functional polymorphism in the promoter region of the MAO-A gene has been identified. This variation affects the transcriptional efficiency of the gene. To determine the role of this MAO-A functional polymorphism in the development of subtypes of alcoholism, a sample of alcoholics and normal controls were screened with this marker. The allele frequency differences between total alcoholics, Types I and II alcoholics, and normal controls was not significant. Comparison of male alcoholics to male normal controls for the frequencies of two-loci and three-loci haplotypes was statistically significant. After Bonferroni's correction for multiple tests none of the results remained significant at P < 0.05. Our results indicate that MAO-A may play a role in the development of alcoholism but the gene effect is very small.

  16. The promoter competition assay (PCA): a new approach to identify motifs involved in the transcriptional activity of reporter genes.

    PubMed

    Hube, Florent; Myal, Yvonne; Leygue, Etienne

    2006-05-01

    Identifying particular motifs responsible for promoter activity is a crucial step toward the development of new gene-based preventive and therapeutic strategies. However, to date, experimental methods to study promoter activity remain limited. We present in this report a promoter competition assay designed to identify, within a given promoter region, motifs critical for its activity. This assay consists in co-transfecting the promoter to be analyzed and double-stranded oligonucleotides which will compete for the binding of transcription factors. Using the recently characterized SBEM promoter as model, we first delineated the feasibility of the method and optimized the experimental conditions. We then identified, within an 87-bp region responsible for a strong expression of the reporter gene, an octamer-binding site essential for its transcriptional regulation. The importance of this motif has been confirmed by site-directed mutagenesis. The promoter competition assay appears to be a fast and efficient approach to identify, within a given promoter sequence, sites critical for its activity.

  17. Germin-like protein 2 gene promoter from rice is responsive to fungal pathogens in transgenic potato plants.

    PubMed

    Munir, Faiza; Hayashi, Satomi; Batley, Jacqueline; Naqvi, Syed Muhammad Saqlan; Mahmood, Tariq

    2016-01-01

    Controlled transgene expression via a promoter is particularly triggered in response to pathogen infiltration. This is significant for eliciting disease-resistant features in crops through genetic engineering. The germins and germin-like proteins (GLPs) are known to be associated with plant and developmental stages. The 1107-bp Oryza sativa root GLP2 (OsRGLP2) gene promoter fused to a β-glucuronidase (GUS) reporter gene was transformed into potato plants through an Agrobacterium-mediated transformation. The OsRGLP2 promoter was activated in response to Fusarium solani (Mart.) Sacc. and Alternaria solani Sorauer. Quantitative real-time PCR results revealed 4-5-fold increase in promoter activity every 24 h following infection. There was a 15-fold increase in OsRGLP2 promoter activity after 72 h of F. solani (Mart.) Sacc. treatment and a 12-fold increase observed with A. solani Sorauer. Our results confirmed that the OsRGLP2 promoter activity was enhanced under fungal stress. Furthermore, a hyperaccumulation of H2O2 in transgenic plants is a clear signal for the involvement of OsRGLP2 promoter region in the activation of specific genes in the potato genome involved in H2O2-mediated defense response. The OsRGLP2 promoter evidently harbors copies of GT-I and Dof transcription factors (AAAG) that act in response to elicitors generated in the wake of pathogen infection. PMID:26277722

  18. Germin-like protein 2 gene promoter from rice is responsive to fungal pathogens in transgenic potato plants.

    PubMed

    Munir, Faiza; Hayashi, Satomi; Batley, Jacqueline; Naqvi, Syed Muhammad Saqlan; Mahmood, Tariq

    2016-01-01

    Controlled transgene expression via a promoter is particularly triggered in response to pathogen infiltration. This is significant for eliciting disease-resistant features in crops through genetic engineering. The germins and germin-like proteins (GLPs) are known to be associated with plant and developmental stages. The 1107-bp Oryza sativa root GLP2 (OsRGLP2) gene promoter fused to a β-glucuronidase (GUS) reporter gene was transformed into potato plants through an Agrobacterium-mediated transformation. The OsRGLP2 promoter was activated in response to Fusarium solani (Mart.) Sacc. and Alternaria solani Sorauer. Quantitative real-time PCR results revealed 4-5-fold increase in promoter activity every 24 h following infection. There was a 15-fold increase in OsRGLP2 promoter activity after 72 h of F. solani (Mart.) Sacc. treatment and a 12-fold increase observed with A. solani Sorauer. Our results confirmed that the OsRGLP2 promoter activity was enhanced under fungal stress. Furthermore, a hyperaccumulation of H2O2 in transgenic plants is a clear signal for the involvement of OsRGLP2 promoter region in the activation of specific genes in the potato genome involved in H2O2-mediated defense response. The OsRGLP2 promoter evidently harbors copies of GT-I and Dof transcription factors (AAAG) that act in response to elicitors generated in the wake of pathogen infection.

  19. Cloning and characterization of largemouth bass ( Micropterus salmoides) myostatin encoding gene and its promoter

    NASA Astrophysics Data System (ADS)

    Li, Shengjie; Bai, Junjie; Wang, Lin

    2008-08-01

    Myostatin or GDF-8, a member of the transforming growth factor-β (TGF-β) superfamily, has been demonstrated to be a negative regulator of skeletal muscle mass in mammals. In the present study, we obtained a 5.64 kb sequence of myostatin encoding gene and its promoter from largemouth bass ( Micropterus salmoides). The myostatin encoding gene consisted of three exons (488 bp, 371 bp and 1779 bp, respectively) and two introns (390 bp and 855 bp, respectively). The intron-exon boundaries were conservative in comparison with those of mammalian myostatin encoding genes, whereas the size of introns was smaller than that of mammals. Sequence analysis of 1.569 kb of the largemouth bass myostatin gene promoter region revealed that it contained two TATA boxes, one CAAT box and nine putative E-boxes. Putative muscle growth response elements for myocyte enhancer factor 2 (MEF2), serum response factor (SRF), activator protein 1 (AP1), etc., and muscle-specific Mt binding site (MTBF) were also detected. Some of the transcription factor binding sites were conserved among five teleost species. This information will be useful for studying the transcriptional regulation of myostatin in fish.

  20. Regulation of gene expression in the protozoan parasite Entamoeba invadens: identification of core promoter elements and promoters with stage-specific expression patterns.

    PubMed

    Manna, Dipak; Ehrenkaufer, Gretchen M; Singh, Upinder

    2014-10-01

    Developmental switching between life-cycle stages is a common feature among many pathogenic organisms. Entamoeba histolytica is an important human pathogen and is a leading parasitic cause of death globally. During its life cycle, Entamoeba converts between cysts (essential for disease transmission) and trophozoites (responsible for tissue invasion). Despite being central to its biology, the triggers that are involved in the developmental pathways of this parasite are not well understood. In order to define the transcriptional network associated with stage conversion we used Entamoeba invadens which serves as a model system for Entamoeba developmental biology, and performed RNA sequencing at different developmental time points. In this study RNA-Seq data was utilised to define basal transcriptional control elements as well as to identify promoters which regulate stage-specific gene expression patterns. We discovered that the 5' and 3' untranslated regions of E. invadens genes are short, a median of 20 nucleotides (nt) and 26 nt respectively. Bioinformatics analysis of DNA sequences proximate to the start and stop codons identified two conserved motifs: (i) E. invadens Core Promoter Motif - GAAC-Like (EiCPM-GL) (GAACTACAAA), and (ii) E. invadens 3'-U-Rich Motif (Ei3'-URM) (TTTGTT) in the 5' and 3' flanking regions, respectively. Electrophoretic mobility shift assays demonstrated that both motifs specifically bind nuclear protein(s) from E. invadens trophozoites. Additionally, we identified select genes with stage-specific expression patterns and analysed the ability of each gene promoter to drive a luciferase reporter gene during the developmental cycle. This approach confirmed three trophozoite-specific, four encystation-specific and two excystation-specific promoters. This work lays the framework for use of stage-specific promoters to express proteins of interest in a particular life-cycle stage, adding to the molecular toolbox for genetic manipulation of E

  1. Rapid Divergence of Prolamin Gene Promoters of Maize After Gene Amplification and Dispersal

    PubMed Central

    Wu, Yongrui; Messing, Joachim

    2012-01-01

    Seeds have evolved to accommodate complicated processes like senescence, dormancy, and germination. Central to these is the storage of carbohydrates and proteins derived from sugars and amino acids synthesized during photosynthesis. In the grasses, the bulk of amino acids is stored in the prolamin superfamily that specifically accumulates in seed endosperm during senescence. Their promoters contain a conserved cis-element, called prolamin-box (P-box), recognized by the trans-activator P-box binding factor (PBF). Because of the lack of null mutants in all grass species, its physiological role in storage–protein gene expression has been elusive. In contrast, a null mutant of another endosperm-specific trans-activator Opaque2 (O2) has been shown to be required for the transcriptional activation of subsets of this superfamily by binding to the O2 box. Here, we used RNAi to knockdown Pbf expression and found that only 27-kDa γ- and 22-kDa α-zein gene expression were affected, whereas the level of other zeins remained unchanged. Still, transgenic seeds had an opaque seed phenotype. Combination of PbfRNAi and o2 resulted in further reduction of α-zein expression. We also tested the interaction of promoters and constitutively expressed PBF and O2. Whereas transgenic promoters could be activated, endogenous promoters appeared to be not accessible to transcriptional activation, presumably due to differential chromatin states. Although analysis of the methylation of binding sites of PBF and O2 correlated with the expression of endogenous 22-kDa α-zein promoters, a different mechanism seems to apply to the 27-kDa γ-zein promoter, which does not undergo methylation changes. PMID:22798485

  2. Structural and functional analysis of a promoter of the human granulin/epithelin gene.

    PubMed Central

    Bhandari, V; Daniel, R; Lim, P S; Bateman, A

    1996-01-01

    Granulins (grns) or epithelins (epis) are peptides with molecular masses of approx. 6 kDa that modulate the growth of cells. The precursor for the grns/epis, which might itself be biologically active, is a secreted glycoprotein containing multiple repeats of the grn/epi motif. Grn/epi mRNA occurs widely in vivo, particularly in tissues rich in epithelial and haematopoietic cells. To understand better the role of the gene products for grn/epi it is important to determine the patterns of grn/epi gene expression and how this is regulated. To assist in this we have obtained the 5' sequence of the human grn/epi gene, and using chimaeras of the grn/epi -5' sequence and the chloramphenicol acetyltransferase gene we have shown a strong promoter activity associated with the 5' sequence of the human grn/epi gene. We have further delineated regions of the 5' sequence that confer high-level expression on the chimaeric gene. PMID:8912679

  3. Functional redundancy of promoter elements ensures efficient transcription of the human 7SK gene in vivo.

    PubMed

    Boyd, D C; Turner, P C; Watkins, N J; Gerster, T; Murphy, S

    1995-11-10

    Deletion and mutation studies of the human 7SK gene transfected into HeLa cells have identified three functional regions of the promoter corresponding to the TATA box at -25, the proximal sequence element (PSE) between -49 and -65 and the distal sequence element (DSE) between -243 and -210. These elements show sequence homology to equivalent regions in other snRNA genes and are functionally analogous. Unlike the DSEs of many snRNA genes however, the 7SK DSE does not contain a consensus binding site for the transcription factor Oct-1 but rather, contains two non-consensus Oct-1 binding sites that can function independently of one another to enhance transcription. Unusually, the 7SK PSE can retain function even after extensive mutation and removal of the conserved TGACC of the PSE has little effect in the context of the whole promoter. However, the same mutation abolishes transcription in the absence of the DSE suggesting that protein/protein interactions between DSE and PSE binding factors can compensate for a mutant PSE. Mutation of the 7SK TATA box allows snRNA type transcription by RNA polymerase II to occur and this is enhanced by the DSE, indicating that both the DSE and the PSE can also function with pol II. In addition, mutation of the TATA box does not abolish pol III dependent transcription, suggesting that other sequence elements may also play a role in the determination of polymerase specificity. Although the human 7SK gene is transcribed efficiently in Xenopus oocytes, analysis of the 7SK wild-type gene and mutants in Xenopus oocytes gives significantly different results from the analysis in HeLa cells indicating that the recognition of functional elements is not the same in the two systems.

  4. High-throughput mapping of the promoters of the mouse olfactory receptor genes reveals a new type of mammalian promoter and provides insight into olfactory receptor gene regulation

    PubMed Central

    Clowney, E. Josephine; Magklara, Angeliki; Colquitt, Bradley M.; Pathak, Nidhi; Lane, Robert P.; Lomvardas, Stavros

    2011-01-01

    The olfactory receptor (OR) genes are the largest mammalian gene family and are expressed in a monogenic and monoallelic fashion in olfactory neurons. Using a high-throughput approach, we mapped the transcription start sites of 1085 of the 1400 murine OR genes and performed computational analysis that revealed potential transcription factor binding sites shared by the majority of these promoters. Our analysis produced a hierarchical model for OR promoter recognition in which unusually high AT content, a unique epigenetic signature, and a stereotypically positioned O/E site distinguish OR promoters from the rest of the murine promoters. Our computations revealed an intriguing correlation between promoter AT content and evolutionary plasticity, as the most AT-rich promoters regulate rapidly evolving gene families. Within the AT-rich promoter category the position of the TATA-box does not correlate with the transcription start site. Instead, a spike in GC composition might define the exact location of the TSS, introducing the concept of “genomic contrast” in transcriptional regulation. Finally, our experiments show that genomic neighborhood rather than promoter sequence correlates with the probability of different OR genes to be expressed in the same olfactory cell. PMID:21705439

  5. Organization of the 5' region of the rat ATP citrate lyase gene.

    PubMed Central

    Kim, K S; Park, S W; Moon, Y A; Kim, Y S

    1994-01-01

    A genomic clone, encompassing the 5' flanking region and the first seven exons of rat ATP citrate lyase gene, was isolated from a rat genomic library and sequenced. Primer-extension analysis showed that mRNA is transcribed at 4407 nucleotides upstream from the translation start site. Primer-extension analysis and sequencing of ATP citrate lyase cDNA amplified by PCR showed that the promoter used for transcription is identical in mammary gland, lung, liver, brain and kidney. Southern-blot analysis showed that the ATP citrate lyase gene exists as a single copy. The 5' flanking region contains several consensus sequences defined as promoter elements. These include a CAAT box and Sp1-binding sites. However, a TATA box lacks this promoter. The expression of the chloramphenicol acetyltransferase gene was induced by the 5' flanking region (-2370 to -1) in the CHO cell line. The 5' flanking region also contains several sequence elements that may be involved in the transcriptional regulation of the gene. Images Figure 2 Figure 3 Figure 4 Figure 6 PMID:7945200

  6. Cloning and Transcriptional Activity of the Mouse Omi/HtrA2 Gene Promoter

    PubMed Central

    Liu, Dan; Liu, Xin; Wu, Ye; Wang, Wen; Ma, Xinliang; Liu, Huirong

    2016-01-01

    HtrA serine peptidase 2 (HtrA2), also named Omi, is a pro-apoptotic protein that exhibits dramatic changes in expression levels in a variety of disorders, including ischemia/reperfusion injury, cancer, and neurodegeneration. In our study, Omi/HtrA2 protein levels were high in the heart, brain, kidney and liver, with elevated heart/brain expression in aging mice. A similar expression pattern was observed at the mRNA level, which suggests that the regulation of Omi/HtrA2 is predominately transcriptional. Promoter binding by transcription factors is the main influencing factor of transcription, and to identify specific promoter elements that contribute to the differential expression of mouse Omi/HtrA2, we constructed truncated Omi/HtrA2 promoter/luciferase reporter vectors and analyzed their relative luciferase activity; it was greatest in the promoter regions at −1205~−838 bp and −146~+93 bp, with the −838~−649 bp region exhibiting negative regulatory activity. Bioinformatics analysis suggested that the Omi/HtrA2 gene promoter contains a CpG island at −709~+37 bp, and eight heat shock transcription factor 1 (HSF1) sites, two Sp1 transcription factor (SP1)sites, one activator protein (AP) site, seven p53 sites, and four YY1 transcription factor(YY1) sites were predicted in the core areas. Furthermore, we found that p53 and HSF1 specifically binds to the Omi/HtrA2 promoter using chromatin immunoprecipitation analysis. These results provide a foundation for understanding Omi/HtrA2 regulatory mechanisms, which could further understanding of HtrA-associated diseases. PMID:26784188

  7. CpG promoter methylation status is not a prognostic indicator of gene expression in beryllium challenge.

    PubMed

    Tooker, Brian C; Ozawa, Katherine; Newman, Lee S

    2016-05-01

    Individuals exposed to beryllium (Be) may develop Be sensitization (BeS) and progress to chronic beryllium disease (CBD). Recent studies with other metal antigens suggest epigenetic mechanisms may be involved in inflammatory disease processes, including granulomatous lung disorders and that a number of metal cations alter gene methylation. The objective of this study was to determine if Be can exert an epigenetic effect on gene expression by altering methylation in the promoter region of specific genes known to be involved in Be antigen-mediated gene expression. To investigate this objective, three macrophage tumor mouse cell lines known to differentially produce tumor necrosis factor (TNF)-α, but not interferon (IFN)-γ, in response to Be antigen were cultured with Be or controls. Following challenges, ELISA were performed to quantify induced TNFα and IFNγ expression. Bisulfate-converted DNA was evaluated by pyrosequencing to quantify CpG methylation within the promoters of TNFα and IFNγ. Be-challenged H36.12J cells expressed higher levels of TNFα compared to either H36.12E cells or P388D.1 cells. However, there were no variations in TNFα promoter CpG methylation levels between cell lines at the six CpG sites tested. H36.12J cell TNFα expression was shown to be metal-specific by the induction of significantly more TNFα when exposed to Be than when exposed to aluminum sulfate, or nickel (II) chloride, but not when exposed to cobalt (II) chloride. However, H36.12J cell methylation levels at the six CpG sites examined in the TNFα promoter did not correlate with cytokine expression differences. Nonetheless, all three cell lines had significantly more promoter methylation at the six CpG sites investigated within the IFNγ promoter (a gene that is not expressed) when compared to the six CpG sites investigated in the TNFα promoter, regardless of treatment condition (p < 1.17 × 10(-9)). These findings suggest that, in this cell system, promoter hypo

  8. CpG promoter methylation status is not a prognostic indicator of gene expression in beryllium challenge.

    PubMed

    Tooker, Brian C; Ozawa, Katherine; Newman, Lee S

    2016-05-01

    Individuals exposed to beryllium (Be) may develop Be sensitization (BeS) and progress to chronic beryllium disease (CBD). Recent studies with other metal antigens suggest epigenetic mechanisms may be involved in inflammatory disease processes, including granulomatous lung disorders and that a number of metal cations alter gene methylation. The objective of this study was to determine if Be can exert an epigenetic effect on gene expression by altering methylation in the promoter region of specific genes known to be involved in Be antigen-mediated gene expression. To investigate this objective, three macrophage tumor mouse cell lines known to differentially produce tumor necrosis factor (TNF)-α, but not interferon (IFN)-γ, in response to Be antigen were cultured with Be or controls. Following challenges, ELISA were performed to quantify induced TNFα and IFNγ expression. Bisulfate-converted DNA was evaluated by pyrosequencing to quantify CpG methylation within the promoters of TNFα and IFNγ. Be-challenged H36.12J cells expressed higher levels of TNFα compared to either H36.12E cells or P388D.1 cells. However, there were no variations in TNFα promoter CpG methylation levels between cell lines at the six CpG sites tested. H36.12J cell TNFα expression was shown to be metal-specific by the induction of significantly more TNFα when exposed to Be than when exposed to aluminum sulfate, or nickel (II) chloride, but not when exposed to cobalt (II) chloride. However, H36.12J cell methylation levels at the six CpG sites examined in the TNFα promoter did not correlate with cytokine expression differences. Nonetheless, all three cell lines had significantly more promoter methylation at the six CpG sites investigated within the IFNγ promoter (a gene that is not expressed) when compared to the six CpG sites investigated in the TNFα promoter, regardless of treatment condition (p < 1.17 × 10(-9)). These findings suggest that, in this cell system, promoter hypo

  9. CpG Promoter Methylation Status is not a Prognostic Indicator of Gene Expression in Beryllium Challenge

    PubMed Central

    Tooker, Brian C.; Ozawa, Katie; Newman, Lee S.

    2016-01-01

    Individuals exposed to beryllium (Be) may develop Be sensitization (BeS) and progress to chronic beryllium disease (CBD). Recent studies with other metal antigens suggest epigenetic mechanisms may be involved in inflammatory disease processes, including granulomatous lung disorders and that a number of metal cations alter gene methylation. The objective of this study was to determine if Be can exert an epigenetic effect on gene expression by altering methylation in the promoter region of specific genes known to be involved in Be antigen-mediated gene expression. To investigate this objective, three macrophage tumor mouse cell lines known to differentially produce tumor necrosis factor (TNF)-α, but not interferon (IFN)-γ, in response to Be antigen were cultured with Be or controls. Following challenges, ELISA were performed to quantify induced TNFα and IFNγ expression. Bisulfate-converted DNA was evaluated by pyrosequencing to quantify CpG methylation within the promoters of TNFα and IFNγ. Be-challenged H36.12J cells expressed higher levels of TNFα compared to either H36.12E cells or P388D.1 cells. However, there were no variations in TNFα promoter CpG methylation levels between cell lines at the 6 CpG sites tested. H36.12J cell TNFα expression was shown to be metal specific by the induction of significantly more TNFα when exposed to Be than when exposed to aluminum sulfate, or nickel (II) chloride but not when exposed to cobalt (II) chloride. However, H36.12J cell methylation levels at the six CpG sites examined in the TNFα promoter did not correlate with cytokine expression differences. Nonetheless, all three cell lines had significantly more promoter methylation at the six CpG sites investigated within the IFNα promoter (a gene that is not expressed) when compared to the six CpG sites investigated in the TNFα promoter, regardless of treatment condition (p < 1.17 × 10−9). These findings suggest that in this cell system, promoter hypo

  10. Regulation of glnB gene promoter expression in Azospirillum brasilense by the NtrC protein.

    PubMed

    Huergo, Luciano F; Souza, Emanuel M; Steffens, M Berenice R; Yates, M Geoffrey; Pedrosa, Fabio O; Chubatsu, Leda S

    2003-06-01

    In Azospirillum brasilense the glnB and glnA genes are clustered in an operon regulated by three different promoters: two located upstream of glnB (glnBp1-sigma(70), and glnBp2-sigma(N)) and one as yet unidentified promoter, in the glnBA intergenic region. We have investigated the expression of the glnB gene promoter using glnB-lacZ gene fusions, mutation analysis, heterologous expression and DNA band-shift assays. Deletion of the glnB promoter region showed that NtrC-binding sequences were essential for glnB expression under nitrogen limitation. The A. brasilense NtrC protein activated transcription of glnB-lacZ fusions in the heterologous genetic background of Escherichia coli. Expression of glnB-lacZ fusions in two A. brasilense ntrC mutants differed from that in the wild-type strain. In vitro studies also indicated that the purified NtrC protein from E. coli was able to bind to the glnB promoter region of A. brasilense. Our results show that the NtrC protein activates glnBglnA expression under nitrogen limitation in A. brasilense.

  11. Two negative cis-regulatory regions involved in fruit-specific promoter activity from watermelon (Citrullus vulgaris S.).

    PubMed

    Yin, Tao; Wu, Hanying; Zhang, Shanglong; Lu, Hongyu; Zhang, Lingxiao; Xu, Yong; Chen, Daming; Liu, Jingmei

    2009-01-01

    A 1.8 kb 5'-flanking region of the large subunit of ADP-glucose pyrophosphorylase, isolated from watermelon (Citrullus vulgaris S.), has fruit-specific promoter activity in transgenic tomato plants. Two negative regulatory regions, from -986 to -959 and from -472 to -424, were identified in this promoter region by fine deletion analyses. Removal of both regions led to constitutive expression in epidermal cells. Gain-of-function experiments showed that these two regions were sufficient to inhibit RFP (red fluorescent protein) expression in transformed epidermal cells when fused to the cauliflower mosaic virus (CaMV) 35S minimal promoter. Gel mobility shift experiments demonstrated the presence of leaf nuclear factors that interact with these two elements. A TCCAAAA motif was identified in these two regions, as well as one in the reverse orientation, which was confirmed to be a novel specific cis-element. A quantitative beta-glucuronidase (GUS) activity assay of stable transgenic tomato plants showed that the activities of chimeric promoters harbouring only one of the two cis-elements, or both, were approximately 10-fold higher in fruits than in leaves. These data confirm that the TCCAAAA motif functions as a fruit-specific element by inhibiting gene expression in leaves.

  12. Brain regions and genes affecting postural control.

    PubMed

    Lalonde, R; Strazielle, C

    2007-01-01

    Postural control is integrated in all facets of motor commands. The role of cortico-subcortical pathways underlying postural control, including cerebellum and its afferents (climbing, mossy, and noradrenergic fibers), basal ganglia, motor thalamus, and parieto-frontal neocortex has been identified in animal models, notably through the brain lesion technique in rats and in mice with spontaneous and induced mutations. These studies are complemented by analyses of the factors underlying postural deficiencies in patients with cerebellar atrophy. With the gene deletion technique in mice, specific genes expressed in cerebellum encoding glutamate receptors (Grid2 and Grm1) and other molecules (Prkcc, Cntn6, Klf9, Syt4, and En2) have also been shown to affect postural control. In addition, transgenic mouse models of the synucleinopathies and of Huntington's disease cause deficiencies of motor coordination resembling those of patients with basal ganglia damage.

  13. Gene promoter of apoptosis inhibitory protein IAP2: identification of enhancer elements and activation by severe hypoxia.

    PubMed Central

    Dong, Zheng; Nishiyama, Junichiro; Yi, Xiaolan; Venkatachalam, Manjeri A; Denton, Michael; Gu, Sumin; Li, Senlin; Qiang, Mei

    2002-01-01

    Inhibitors of apoptosis (IAPs) antagonize cell death and regulate the cell cycle. One mechanism controlling IAP expression is translation initiation through the internal ribosome entry sites. Alternatively, IAP expression can be regulated at the transcription level. We showed recently the activation of IAP2 transcription by severe hypoxia. To pursue this regulation, we have cloned the full-length cDNA of rat IAP2, and have isolated and analysed the promoter regions of this gene. The cDNA encodes a protein of 589 amino acids, exhibiting structural features of IAP. In rat tissues, a major IAP2 transcript of approximately 3.5 kb was detected. We subsequently isolated 3.3 kb of the proximal 5'-flanking regions of this gene, which showed significant promoter activity. Of interest, 5' sequential deletion of the promoter sequence identified an enhancer of approximately 200 bp. Deletion of cAMP-response-element-binding protein (CREB) sites in the enhancer sequence diminished its activity. Finally, the IAP2 gene promoter was activated significantly by severe hypoxia and not by CoCl(2) or desferrioxamine, pharmacological inducers of hypoxia-inducible factor-1. In conclusion, in this study we have cloned the full-length cDNA of rat IAP2, and for the first time we have isolated and analysed promoter sequences of this gene, leading to the identification of enhancer elements. Moreover, we have demonstrated activation of the gene promoter by severe hypoxia, a condition shown to induce IAP2. These findings provide a basis for further investigation of gene regulation of IAP2, a protein with multiple functions. PMID:12023884

  14. The 5'-flanking regions of three pea legumin genes: comparison of the DNA sequences.

    PubMed Central

    Lycett, G W; Croy, R R; Shirsat, A H; Richards, D M; Boulter, D

    1985-01-01

    Approximately 1200 nucleotides of sequence data from the promoter and 5'-flanking regions of each of three pea (Pisum sativum L.) legumin genes (legA, legB and legC) are presented. The promoter regions of all three genes were found to be identical including the "TATA box", and "CAAT box', and sequences showing homology to the SV40 enhancers. The legA sequence begins to diverge from the others about 300bp from the start codon, whereas the other two genes remain identical for another 550bp. The regions of partial homology exhibit deletions or insertions and some short, comparatively well conserved sequences. The significance of these features is discussed in terms of evolutionary mechanisms and their possible functional roles. The legC gene contains a region that may potentially form either of two mutually exclusive stem-loop structures, one of which has a stem 42bp long, which suggests that it could be fairly stable. We suggest that a mechanism of switching between such alternative structures may play some role in gene control or may represent the insertion of a transposable element. PMID:2997721

  15. Modifications to the INSM1 promoter to preserve specificity and activity for use in adenoviral gene therapy of neuroendocrine carcinomas.

    PubMed

    Akerstrom, V; Chen, C; Lan, M S; Breslin, M B

    2012-12-01

    The INSM1 gene encodes a transcriptional repressor that is exclusively expressed in neuronal and neuroendocrine tissue during embryonic development that is re-activated in neuroendocrine tumors. Using the 1.7 kbp INSM1 promoter, an adenoviral HSV thymidine kinase gene therapy was tested for the treatment of neuroendocrine tumors. An unforeseen interference on the INSM1 promoter specificity from the adenoviral genome was observed. Attempts were made to protect the INSM1 promoter from the influence of essential adenoviral sequences and to further enhance the tissue specificity of the INSM1 promoter region. Using the chicken β-globin HS4 insulator sequence, we eliminated off-target tissue expression from the Ad-INSM1 promoter-luciferase2 constructs in vivo. In addition, inclusion of two copies of the mouse nicotinic acetylcholine receptor (n(AchR)) neuronal-restrictive silencer element (NRSE) reduced nonspecific activation of the INSM1 promoter both in vitro and in vivo. Further, inclusion of both the HS4 insulator with the n(AchR) 2 × NRSE modification showed a two log increase in luciferase activity measured from the NCI-H1155 xenograft tumors compared with the original adenovirus construct. The alterations increase the therapeutic potential of adenoviral INSM1 promoter-driven suicide gene therapy for the treatment of a variety of neuroendocrine tumors. PMID:23079673

  16. Length of guanosine homopolymeric repeats modulates promoter activity of subfamily II tpr genes of Treponema pallidum ssp. pallidum.

    PubMed

    Giacani, Lorenzo; Lukehart, Sheila; Centurion-Lara, Arturo

    2007-11-01

    In Treponema pallidum, homopolymeric guanosine repeats of varying length are present upstream of both Subfamily I (tprC, D, F and I) and II (tprE, G and J) tpr genes, a group of potential virulence factors, immediately upstream of the +1 nucleotide. To investigate the influence of these poly-G sequences on promoter activity, tprE, G, J, F and I promoter regions containing homopolymeric tracts with different numbers of Gs, the ribosomal binding site and start codon were cloned in frame with the green fluorescent protein reporter gene (GFP), and promoter activity was measured both as fluorescence emission from Escherichia coli cultures transformed with the different plasmid constructs and using quantitative RT-PCR. For tprJ, G and E-derived clones, fluorescence was significantly higher with constructs containing eight Gs or fewer, while plasmids containing the same promoters with none or more Gs gave modest or no signal above the background. In contrast, tprF/I-derived clones induced similar levels of fluorescence regardless of the number of Gs within the promoter. GFP mRNA quantification showed that all of the promoters induced measurable transcription of the GFP gene; however, only for Subfamily II promoters was message synthesis inversely correlated to the number of Gs in the construct.

  17. Length of guanosine homopolymeric repeats modulates promoter activity of subfamily II tpr genes of Treponema pallidum ssp. pallidum

    PubMed Central

    Giacani, Lorenzo; Lukehart, Sheila; Centurion-Lara, Arturo

    2010-01-01

    In Treponema pallidum, homopolymeric guanosine repeats of varying length are present upstream of both Subfamily I (tprC, D, F and I) and II (tprE, G and J) tpr genes, a group of potential virulence factors, immediately upstream of the +1 nucleotide. To investigate the influence of these poly-G sequences on promoter activity, tprE, G, J, F and I promoter regions containing homopolymeric tracts with different numbers of Gs, the ribosomal binding site and start codon were cloned in frame with the green fluorescent protein reporter gene (GFP), and promoter activity was measured both as fluorescence emission from Escherichia coli cultures transformed with the different plasmid constructs and using quantitative RT-PCR. For tprJ, G and E-derived clones, fluorescence was significantly higher with constructs containing eight Gs or fewer, while plasmids containing the same promoters with none or more Gs gave modest or no signal above the background. In contrast, tprF/I-derived clones induced similar levels of fluorescence regardless of the number of Gs within the promoter. GFP mRNA quantification showed that all of the promoters induced measurable transcription of the GFP gene; however, only for Subfamily II promoters was message synthesis inversely correlated to the number of Gs in the construct. PMID:17683506

  18. Promoter methylation and downregulated expression of the TBX15 gene in ovarian carcinoma

    PubMed Central

    Gozzi, Gaia; Chelbi, Sonia T.; Manni, Paola; Alberti, Loredana; Fonda, Sergio; Saponaro, Sara; Fabbiani, Luca; Rivasi, Francesco; Benhattar, Jean; Losi, Lorena

    2016-01-01

    TBX15 is a gene involved in the development of mesodermal derivatives. As the ovaries and the female reproductive system are of mesodermal origin, the aim of the present study was to determine the methylation status of the TBX15 gene promoter and the expression levels of TBX15 in ovarian carcinoma, which is the most lethal and aggressive type of gynecological tumor, in order to determine the role of TBX15 in the pathogenesis of ovarian carcinoma. This alteration could be used to predict tumor development, progression, recurrence and therapeutic effects. The study was conducted on 80 epithelial ovarian carcinoma and 17 control cases (normal ovarian and tubal tissues). TBX15 promoter methylation was first determined by pyrosequencing following bisulfite modification, then by cloning and sequencing, in order to obtain information about the epigenetic haplotype. Immunohistochemical analysis was performed to evaluate the correlation between the methylation and protein expression levels. Data revealed a statistically significant increase of the TBX15 promoter region methylation in 82% of the tumor samples and in various histological subtypes. Immunohistochemistry showed an inverse correlation between methylation levels and the expression of the TBX15 protein. Furthermore, numerous tumor samples displayed varying degrees of intratumor heterogeneity. Thus, the present study determined that ovarian carcinoma typically expresses low levels of TBX15 protein, predominantly due to an epigenetic mechanism. This may have a role in the pathogenesis of ovarian carcinoma independent of the histological subtype.

  19. Promoter methylation and downregulated expression of the TBX15 gene in ovarian carcinoma

    PubMed Central

    Gozzi, Gaia; Chelbi, Sonia T.; Manni, Paola; Alberti, Loredana; Fonda, Sergio; Saponaro, Sara; Fabbiani, Luca; Rivasi, Francesco; Benhattar, Jean; Losi, Lorena

    2016-01-01

    TBX15 is a gene involved in the development of mesodermal derivatives. As the ovaries and the female reproductive system are of mesodermal origin, the aim of the present study was to determine the methylation status of the TBX15 gene promoter and the expression levels of TBX15 in ovarian carcinoma, which is the most lethal and aggressive type of gynecological tumor, in order to determine the role of TBX15 in the pathogenesis of ovarian carcinoma. This alteration could be used to predict tumor development, progression, recurrence and therapeutic effects. The study was conducted on 80 epithelial ovarian carcinoma and 17 control cases (normal ovarian and tubal tissues). TBX15 promoter methylation was first determined by pyrosequencing following bisulfite modification, then by cloning and sequencing, in order to obtain information about the epigenetic haplotype. Immunohistochemical analysis was performed to evaluate the correlation between the methylation and protein expression levels. Data revealed a statistically significant increase of the TBX15 promoter region methylation in 82% of the tumor samples and in various histological subtypes. Immunohistochemistry showed an inverse correlation between methylation levels and the expression of the TBX15 protein. Furthermore, numerous tumor samples displayed varying degrees of intratumor heterogeneity. Thus, the present study determined that ovarian carcinoma typically expresses low levels of TBX15 protein, predominantly due to an epigenetic mechanism. This may have a role in the pathogenesis of ovarian carcinoma independent of the histological subtype. PMID:27698863

  20. Genetic Variants in the STMN1 Transcriptional Regulatory Region Affect Promoter Activity and Fear Behavior in English Springer Spaniels

    PubMed Central

    Zhang, Hanying; Xu, Yinxue

    2016-01-01

    Stathmin 1 (STMN1) is a neuronal growth-associated protein that is involved in microtubule dynamics and plays an important role in synaptic outgrowth and plasticity. Given that STMN1 affects fear behavior, we hypothesized that genetic variations in the STMN1 transcriptional regulatory region affect gene transcription activity and control fear behavior. In this study, two single nucleotide polymorphisms (SNPs), g. -327 A>G and g. -125 C>T, were identified in 317 English Springer Spaniels. A bioinformatics analysis revealed that both were loci located in the canine STMN1 putative promoter region and affected transcription factor binding. A statistical analysis revealed that the TT genotype at g.-125 C>T produced a significantly greater fear level than that of the CC genotype (P < 0.05). Furthermore, the H4H4 (GTGT) haplotype combination was significantly associated with canine fear behavior (P < 0.01). Using serially truncated constructs of the STMN1 promoters and the luciferase reporter, we found that a 395 bp (−312 nt to +83 nt) fragment constituted the core promoter region. The luciferase assay also revealed that the H4 (GT) haplotype promoter had higher activity than that of other haplotypes. Overall, our results suggest that the two SNPs in the canine STMN1 promoter region could affect canine fear behavior by altering STMN1 transcriptional activity. PMID:27390866

  1. Differential methylation of the promoter and first exon of the RASSF1A gene in hepatocarcinogenesis

    PubMed Central

    Jain, Surbhi; Xie, Lijia; Boldbaatar, Batbold; Lin, Selena Y.; Hamilton, James P.; Meltzer, Stephen J.; Chen, Shun-Hua; Hu, Chi-Tan; Block, Timothy M.; Song, Wei; Su, Ying-Hsiu

    2015-01-01

    Aim Aberrant methylation of the promoter, P2, and the first exon, E1, regions of the tumor suppressor gene RASSF1A, have been associated with hepatocellular carcinoma (HCC), albeit with poor specificity. This study analyzed the methylation profiles of P1, P2 and E1 regions of the gene to identify the region of which methylation most specifically corresponds to HCC and to evaluate the potential of this methylated region as a biomarker in urine for HCC screening. Methods Bisulfite DNA sequencing and quantitative methylation-specific polymerase chain reaction assays were performed to compare methylation of the 56 CpG sites in regions P1, P2 and E1 in DNA isolated from normal, hepatitic, cirrhotic, adjacent non-HCC, and HCC liver tissue and urine samples for the characterization of hypermethylation of the RASSF1A gene as a biomarker for HCC screening. Results In tissue, comparing HCC (n = 120) with cirrhosis and hepatitis together (n = 70), methylation of P1 had an area under the receiver operating characteristics curve (AUROC) of 0.90, whereas methylation of E1 and P2 had AUROC of 0.84 and 0.72, respectively. At 90% sensitivity, specificity for P1 methylation was 72.9% versus 38.6% for E1 and 27.1% for P2. Methylated P1 DNA was detected in urine in association with cirrhosis and HCC. It had a sensitivity of 81.8% for α-fetoprotein negative HCC. Conclusion Among the three regions analyzed, methylation of P1 is the most specific for HCC and holds great promise as a DNA marker in urine for screening of cirrhosis and HCC. PMID:25382672

  2. Identification of a p53-response element in the promoter of the proline oxidase gene

    SciTech Connect

    Maxwell, Steve A. Kochevar, Gerald J.

    2008-05-02

    Proline oxidase (POX) is a p53-induced proapoptotic gene. We investigated whether p53 could bind directly to the POX gene promoter. Chromatin immunoprecipitation (ChIP) assays detected p53 bound to POX upstream gene sequences. In support of the ChIP results, sequence analysis of the POX gene and its 5' flanking sequences revealed a potential p53-binding site, GGGCTTGTCTTCGTGTGACTTCTGTCT, located at 1161 base pairs (bp) upstream of the transcriptional start site. A 711-bp DNA fragment containing the candidate p53-binding site exhibited reporter gene activity that was induced by p53. In contrast, the same DNA region lacking the candidate p53-binding site did not show significant p53-response activity. Electrophoretic mobility shift assay (EMSA) in ACHN renal carcinoma cell nuclear lysates confirmed that p53 could bind to the 711-bp POX DNA fragment. We concluded from these experiments that a p53-binding site is positioned at -1161 to -1188 bp upstream of the POX transcriptional start site.

  3. Evidence for RNA synthesis in the intergenic region between enhancer and promoter and its inhibition by insulators in Drosophila melanogaster.

    PubMed

    Tchurikov, Nickolai A; Kretova, Olga V; Moiseeva, Evgenia D; Sosin, Dmitri V

    2009-01-01

    Uncovering the nature of communication between enhancers, promoters and insulators is important for understanding the fundamental mechanisms that ensure appropriate gene expression levels. Here we describe an approach employing transient expression of genetic luciferase reporter gene constructs with quantitative RT-PCR analysis of transcription between an enhancer and Hsp70 promoter. We tested genetic constructs containing gypsy and/or Fab7 insulators in different orientations, and an enhancer from copia LTR-retroelement [(enh)copia]. A single gypsy or Fab7 insulator inserted between the promoter and enhancer in any polarity reduced enhancer action. A pair of insulators flanking the gene in any orientation exhibited increased insulation activity. We detected promoter-independent synthesis of non-coding RNA in the intergenic region of the constructs, which was induced by the enhancer in both directions and repressed by a single insulator or a pair of insulators. These results highlight the involvement of RNA-tracking mechanisms in the communications between enhancers and promoters, which are inhibited by insulators.

  4. Genetic and functional analysis of the von Hippel-Lindau (VHL) tumour suppressor gene promoter

    PubMed Central

    Zatyka, M; Morrissey, C; Kuzmin, I; Lerman, M; Latif, F; Richards, F; Maher, E

    2002-01-01

    The VHL gatekeeper tumour suppressor gene is inactivated in the familial cancer syndrome von Hippel-Lindau disease and in most sporadic clear cell renal cell carcinomas. Recently the VHL gene product has been identified as a specific component of a SCF-like complex, which regulates proteolytic degradation of the hypoxia inducible transcription factors HIF-1 and HIF-2. pVHL is critical for normal development and mRNA expression studies suggest a role in nephrogenesis. Despite the importance of VHL in oncogenesis and development, little is known about the regulation of VHL expression. To investigate VHL promoter activity, we performed comparative sequence analysis of human, primate, and rodent 5‘ VHL sequences. We then proceeded to deletion analysis of regions showing significant evolutionary conservation between human and rat promoter sequences, and defined two positive and one negative regulatory regions. Analysis of specific putative transcription factor binding sites identified a functional Sp1 site, which was shown to be a regulatory element. Overlapping Sp1/AP2 sites were also identified and candidate E2F1 binding sites evaluated. Three binding sites for as yet unidentified transcription factors were mapped also. These investigations provide a basis for elucidating the regulation of VHL expression in development, the molecular pathology of epigenetic silencing of VHL in tumourigenesis, and suggest a possible link between Sp1, VHL, and nephrogenesis. PMID:12114475

  5. Binding of the Lactococcal Drug Dependent Transcriptional Regulator LmrR to Its Ligands and Responsive Promoter Regions

    PubMed Central

    van der Berg, Jan Pieter; Madoori, Pramod Kumar; Komarudin, Amalina Ghaisani; Thunnissen, Andy-Mark; Driessen, Arnold J. M.

    2015-01-01

    The heterodimeric ABC transporter LmrCD from Lactococcus lactis is able to extrude several different toxic compounds from the cell, fulfilling a role in the intrinsic and induced drug resistance. The expression of the lmrCD genes is regulated by the multi-drug binding repressor LmrR, which also binds to its own promoter to autoregulate its own expression. Previously, we reported the crystal structure of LmrR in the presence and absence of the drugs Hoechst 33342 and daunomycin. Analysis of the mechanism how drugs control the repressor activity of LmrR is impeded by the fact that these drugs also bind to DNA. Here we identified, using X-ray crystallography and fluorescence, that riboflavin binds into the drug binding cavity of LmrR, adopting a similar binding mode as Hoechst 33342 and daunomycin. Microscale thermophoresis was employed to quantify the binding affinity of LmrR to its responsive promoter regions and to evaluate the cognate site of LmrR in the lmrCD promoter region. Riboflavin reduces the binding affinity of LmrR for the promoter regions. Our results support a model wherein drug binding to LmrR relieves the LmrR dependent repression of the lmrCD genes. PMID:26267906

  6. Superoxide radical-generating compounds activate a predicted promoter site for paraquat-inducible genes of the Chromobacterium violaceum bacterium in a dose-dependent manner.

    PubMed

    Gabriel, J E; Guerra-Slompo, E P; de Souza, E M; de Carvalho, F A L; Madeira, H M F; de Vasconcelos, A T R

    2015-01-01

    The purpose of the present study was to functionally evaluate the influence of superoxide radical-generating compounds on the heterologous induction of a predicted promoter region of open reading frames for paraquat-inducible genes (pqi genes) revealed during genome annotation analyses of the Chromobacterium violaceum bacterium. A 388-bp fragment corresponding to a pqi gene promoter of C. violaceum was amplified using specific primers and cloned into a conjugative vector containing the Escherichia coli lacZ gene without a promoter. Assessments of the expression of the β-galactosidase enzyme were performed in the presence of menadione (MEN) and phenazine methosulfate (PMS) compounds at different final concentrations to evaluate the heterologous activation of the predicted promoter region of interest in C. violaceum induced by these substrates. Under these experimental conditions, the MEN reagent promoted highly significant increases in the expression of the β-galactosidase enzyme modulated by activating the promoter region of the pqi genes at all concentrations tested. On the other hand, significantly higher levels in the expression of the β-galactosidase enzyme were detected exclusively in the presence of the PMS reagent at a final concentration of 50 μg/mL. The findings described in the present study demonstrate that superoxide radical-generating compounds can activate a predicted promoter DNA motif for pqi genes of the C. violaceum bacterium in a dose-dependent manner. PMID:26345950

  7. Cloning and functional analysis of 5'-upstream region of the Pokemon gene.

    PubMed

    Yang, Yutao; Zhou, Xiaowei; Zhu, Xudong; Zhang, Chuanfu; Yang, Zhixin; Xu, Long; Huang, Peitang

    2008-04-01

    Pokemon, the POK erythroid myeloid ontogenic factor, not only regulates the expression of many genes, but also plays an important role in cell tumorigenesis. To investigate the molecular mechanism regulating expression of the Pokemon gene in humans, its 5'-upstream region was cloned and analyzed. Transient analysis revealed that the Pokemon promoter is constitutive. Deletion analysis and a DNA decoy assay indicated that the NEG-U and NEG-D elements were involved in negative regulation of the Pokemon promoter, whereas the POS-D element was mainly responsible for its strong activity. Electrophoretic mobility shift assays suggested that the NEG-U, NEG-D and POS-D elements were specifically bound by the nuclear extract from A549 cells in vitro. Mutation analysis demonstrated that cooperation of the NEG-U and NEG-D elements led to negative regulation of the Pokemon promoter. Moreover, the NEG-U and NEG-D elements needed to be an appropriate distance apart in the Pokemon promoter in order to cooperate. Taken together, our results elucidate the mechanism underlying the regulation of Pokemon gene transcription, and also define a novel regulatory sequence that may be used to decrease expression of the Pokemon gene in cancer gene therapy. PMID:18355317

  8. Cloning and functional analysis of 5'-upstream region of the Pokemon gene.

    PubMed

    Yang, Yutao; Zhou, Xiaowei; Zhu, Xudong; Zhang, Chuanfu; Yang, Zhixin; Xu, Long; Huang, Peitang

    2008-04-01

    Pokemon, the POK erythroid myeloid ontogenic factor, not only regulates the expression of many genes, but also plays an important role in cell tumorigenesis. To investigate the molecular mechanism regulating expression of the Pokemon gene in humans, its 5'-upstream region was cloned and analyzed. Transient analysis revealed that the Pokemon promoter is constitutive. Deletion analysis and a DNA decoy assay indicated that the NEG-U and NEG-D elements were involved in negative regulation of the Pokemon promoter, whereas the POS-D element was mainly responsible for its strong activity. Electrophoretic mobility shift assays suggested that the NEG-U, NEG-D and POS-D elements were specifically bound by the nuclear extract from A549 cells in vitro. Mutation analysis demonstrated that cooperation of the NEG-U and NEG-D elements led to negative regulation of the Pokemon promoter. Moreover, the NEG-U and NEG-D elements needed to be an appropriate distance apart in the Pokemon promoter in order to cooperate. Taken together, our results elucidate the mechanism underlying the regulation of Pokemon gene transcription, and also define a novel regulatory sequence that may be used to decrease expression of the Pokemon gene in cancer gene therapy.

  9. Variation in hemoglobin F production among normal and sickle cell adults is not related to nucleotide substitutions in the gamma promoter regions.

    PubMed

    Economou, E P; Antonarakis, S E; Kazazian, H H; Serjeant, G R; Dover, G J

    1991-01-01

    Single nucleotide substitutions in the promoter regions of the A gamma- and G gamma-globin genes have been associated with increased fetal hemoglobin (HbF) production. We wished to determine whether these or other unrecognized substitutions in the gamma promoter regions are responsible for the 20-fold variation in HbF production in sickle cell patients or normal adults. From a random sampling of 250 sickle cell (SS) patients and 125 normal adults, 17 individuals representing the highest and lowest HbF producers were selected for study. All three common restriction fragment length polymorphism beta-globin region haplotypes (Benin, Central African Republic, and Senegal) were found in both the highest and lowest HbF producers with SS disease. Using the polymerase chain reaction amplification and direct sequencing of the amplified DNA product, we examined the promoter regions of both the A gamma and G gamma genes from -350 bp to +50 bp of the CAP site. No mutations were found in either gamma gene promoter region. We conclude that nucleotide substitutions in the promoter regions (-350 to +50 bp) of both gamma genes are not responsible for the marked variation in HbF production among SS or normal individuals.

  10. [Primary targeting of functional regions involved in transcriptional regulation on watermelon fruit-specific promoter WSP].

    PubMed

    Wu, Han-Ying; Liu, Jing-Mei; Yang, Xin-Ting; Zhu, Zhu-Jun; Shou, Sen-Yan

    2003-03-01

    Fruit ripening is associated with a number of physiological and biochemical changes. They include degradation of chlorophyll, synthesis of flavor compounds, carotenoid biosynthesis, conversion of starch to sugars, cell wall solublisation and fruit softening. These changes are brought about by the expression of specific genes. People are interested in the molecular mechanism involved in the regulation of gene transcription during fruit ripening. Many fruit-specific promoters such as PG, E4, E8, and 2A11 have been characterized and shown to direct ripening-specific expression of reporter genes. AGPase plays the key role in catalyzing the biosynthesis of starch in plants. It is a heterotetrameric enzyme with two small subunits and two large subunits, which are encoded by different genes. In higher plants, small subunits are highly conserved among plant species and expressed in all tissues. And the large subunits are present at multiple isoforms and expressed in a tissue-specific pattern. In fruits, the expression pattern of the large subunits varies with plant species. That made it important to study the transcriptional regulation of the large subunits of AGPase in different plant species. Northern-blot analysis indicates in watermelon, an isoform of the large subunits Wml1 expressed specifically in fruits, not in leaves. The 5' flanking region of Wml1, which covers 1573bp, has been isolated through the method of uneven PCR. And transient expression assay has shown that the 1573bp (named WSP) can direct fruit-specific expression of GUS gene. Our goal in this study was to scan the promoter region for main regulatory regions involved in fruit-specific expression. A chimaeric gene was constructed containing the WSP promoter, the beta-glucuronidase (GUS) structural sequence as a reporter gene and the nopaline synthase polyadenylation site (NOS-ter). The plasmid pSPA was digested with Hind III + Hinc II and promoter fragment of 1573bp (from 180bp to 1752bp) was cut out and

  11. Identification of a locus control region for quadruplicated green-sensitive opsin genes in zebrafish.

    PubMed

    Tsujimura, Taro; Chinen, Akito; Kawamura, Shoji

    2007-07-31

    Duplication of opsin genes has a crucial role in the evolution of visual system. Zebrafish have four green-sensitive (RH2) opsin genes (RH2-1, RH2-2, RH2-3, and RH2-4) arrayed in tandem. They are expressed in the short member of the double cones (SDC) but differ in expression areas in the retina and absorption spectra of their encoding photopigments. The shortest and the second shortest wavelength subtypes, RH2-1 and RH2-2, are expressed in the central-to-dorsal retina. The longer wavelength subtype, RH2-3, is expressed circumscribing the RH2-1/RH2-2 area, and the longest subtype, RH2-4, is expressed further circumscribing the RH2-3 area and mainly occupying the ventral retina. The present report shows that a 0.5-kb region located 15 kb upstream of the RH2 gene array is an essential regulator for their expression. When the 0.5-kb region was deleted from a P1-artificial chromosome (PAC) clone encompassing the four RH2 genes and when one of these genes was replaced with a reporter GFP gene, the GFP expression in SDCs was abolished in the zebrafish to which a series of the modified PAC clones were introduced. Transgenic studies also showed that the 0.5-kb region conferred the SDC-specific expression for promoters of a non-SDC (UV opsin) and a nonretinal (keratin 8) gene. Changing the location of the 0.5-kb region in the PAC clone conferred the highest expression for its proximal gene. The 0.5-kb region was thus designated as RH2-LCR analogous to the locus control region of the L-M opsin genes of primates.

  12. Promoter variants determine γ-aminobutyric acid homeostasis-related gene transcription in human epileptic hippocampi.

    PubMed

    Pernhorst, Katharina; Raabe, Anna; Niehusmann, Pitt; van Loo, Karen M J; Grote, Alexander; Hoffmann, Per; Cichon, Sven; Sander, Thomas; Schoch, Susanne; Becker, Albert J

    2011-12-01

    The functional consequences of single nucleotide polymorphisms associated with episodic brain disorders such as epilepsy and depression are unclear. Allelic associations with generalized epilepsies have been reported for single nucleotide polymorphisms rs1883415 (ALDH5A1; succinic semialdehyde dehydrogenase) and rs4906902 (GABRB3; GABAA β3), both of which are present in the 5' regulatory region of genes involved in γ-aminobutyric acid (GABA) homeostasis. To address their allelic association with episodic brain disorders and allele-specific impact on the transcriptional regulation of these genes in human brain tissue, DNA and messenger RNA (mRNA) isolated from hippocampi were obtained at epilepsy surgery of 146 pharmacoresistant mesial temporal lobe epilepsy (mTLE) patients and from 651 healthy controls. We found that the C allele of rs1883415 is accumulated to a greater extentin mTLE versus controls. By real-time quantitative reverse transcription-polymerase chain reaction analyses, individuals homozygous for the C allele showed higher ALDH5A1 mRNA expression. The rs4906902 G allele of the GABRB3 gene was overrepresented in mTLE patients with depression; individuals homozygous for the G allele showed reduced GABRB3 mRNA expression. Bioinformatic analyses suggest that rs1883415 and rs4906902 alter the DNA binding affinity of the transcription factors Egr-3 in ALDH5A1 and MEF-2 in GABRB3 promoters, respectively. Using in vitro luciferase transfection assays, we observed that, in both cases, the transcription factors regulate gene expression depending on the allelic variant in the same direction as in the human hippocampi. Our data suggest that distinct promoter variants may sensitize individuals for differential, potentially stimulus-induced alterations of GABA homeostasis-relevant gene expression. This might contribute to the episodic onset of symptoms and point to new targets for pharmacotherapies.

  13. Regulated expression of the human cytomegalovirus pp65 gene: Octamer sequence in the promoter is required for activation by viral gene products

    SciTech Connect

    Depto, A.S.; Stenberg, R.M.

    1989-03-01

    To better understand the regulation of late gene expression in human cytomegalovirus (CMV)-infected cells, the authors examined expression of the gene that codes for the 65-kilodalton lower-matrix phosphoprotein (pp65). Analysis of RNA isolated at 72 h from cells infected with CMV Towne or ts66, a DNA-negative temperature-sensitive mutant, supported the fact that pp65 is expressed at low levels prior to viral DNA replication but maximally expressed after the initiation of viral DNA replication. To investigate promoter activation in a transient expression assay, the pp65 promoter was cloned into the indicator plasmid containing the gene for chloramphenicol acetyltransferase (CAT). Transfection of the promoter-CAT construct and subsequent superinfection with CMV resulted in activation of the promoter at early times after infection. Cotransfection with plasmids capable of expressing immediate-early (IE) proteins demonstrated that the promoter was activated by IE proteins and that both IE regions 1 and 2 were necessary. These studies suggest that interactions between IE proteins and this octamer sequence may be important for the regulation and expression of this CMV gene.

  14. Four out of eight genes in a mouse chromosome 7 congenic donor region are candidate obesity genes.

    PubMed

    Sarahan, Kari A; Fisler, Janis S; Warden, Craig H

    2011-09-22

    We previously identified a region of mouse chromosome 7 that influences body fat mass in F2 littermates of congenic × background intercrosses. Current analyses revealed that alleles in the donor region of the subcongenic B6.C-D7Mit318 (318) promoted a twofold increase in adiposity in homozygous lines of 318 compared with background C57BL/6ByJ (B6By) mice. Parent-of-origin effects were discounted through cross-fostering studies and an F1 reciprocal cross. Mapping of the donor region revealed that it has a maximal size of 2.8 Mb (minimum 1.8 Mb) and contains a maximum of eight protein coding genes. Quantitative PCR in whole brain, liver, and gonadal white adipose tissue (GWAT) revealed differential expression between genotypes for three genes in females and two genes in males. Alpha-2,8-sialyltransferase 8B (St8sia2) showed reduced 318 mRNA levels in brain for females and males and in GWAT for females only. Both sexes of 318 mice had reduced Repulsive guidance molecule-a (Rgma) expression in GWAT. In brain, Family with sequence similarity 174 member b (Fam174b) had increased expression in 318 females, whereas Chromodomain helicase DNA binding protein 2 (Chd2-2) had reduced expression in 318 males. No donor region genes were differentially expressed in liver. Sequence analysis of coding exons for all genes in the 318 donor region revealed only one single nucleotide polymorphism that produced a nonsynonymous missense mutation, Gln7Pro, in Fam174b. Our findings highlight the difficulty of using expression and sequence to identify quantitative trait genes underlying obesity even in small genomic regions.

  15. Four out of eight genes in a mouse chromosome 7 congenic donor region are candidate obesity genes

    PubMed Central

    Sarahan, Kari A.; Fisler, Janis S.

    2011-01-01

    We previously identified a region of mouse chromosome 7 that influences body fat mass in F2 littermates of congenic × background intercrosses. Current analyses revealed that alleles in the donor region of the subcongenic B6.C-D7Mit318 (318) promoted a twofold increase in adiposity in homozygous lines of 318 compared with background C57BL/6ByJ (B6By) mice. Parent-of-origin effects were discounted through cross-fostering studies and an F1 reciprocal cross. Mapping of the donor region revealed that it has a maximal size of 2.8 Mb (minimum 1.8 Mb) and contains a maximum of eight protein coding genes. Quantitative PCR in whole brain, liver, and gonadal white adipose tissue (GWAT) revealed differential expression between genotypes for three genes in females and two genes in males. Alpha-2,8-sialyltransferase 8B (St8sia2) showed reduced 318 mRNA levels in brain for females and males and in GWAT for females only. Both sexes of 318 mice had reduced Repulsive guidance molecule-a (Rgma) expression in GWAT. In brain, Family with sequence similarity 174 member b (Fam174b) had increased expression in 318 females, whereas Chromodomain helicase DNA binding protein 2 (Chd2-2) had reduced expression in 318 males. No donor region genes were differentially expressed in liver. Sequence analysis of coding exons for all genes in the 318 donor region revealed only one single nucleotide polymorphism that produced a nonsynonymous missense mutation, Gln7Pro, in Fam174b. Our findings highlight the difficulty of using expression and sequence to identify quantitative trait genes underlying obesity even in small genomic regions. PMID:21730028

  16. NFAT targets signaling molecules to gene promoters in pancreatic β-cells.

    PubMed

    Lawrence, Michael C; Borenstein-Auerbach, Nofit; McGlynn, Kathleen; Kunnathodi, Faisal; Shahbazov, Rauf; Syed, Ilham; Kanak, Mazhar; Takita, Morihito; Levy, Marlon F; Naziruddin, Bashoo

    2015-02-01

    Nuclear factor of activated T cells (NFAT) is activated by calcineurin in response to calcium signals derived by metabolic and inflammatory stress to regulate genes in pancreatic islets. Here, we show that NFAT targets MAPKs, histone acetyltransferase p300, and histone deacetylases (HDACs) to gene promoters to differentially regulate insulin and TNF-α genes. NFAT and ERK associated with the insulin gene promoter in response to glucagon-like peptide 1, whereas NFAT formed complexes with p38 MAPK (p38) and Jun N-terminal kinase (JNK) upon promoters of the TNF-α gene in response to IL-1β. Translocation of NFAT and MAPKs to gene promoters was calcineurin/NFAT dependent, and complex stability required MAPK activity. Knocking down NFATc2 expression, eliminating NFAT DNA binding sites, or interfering with NFAT nuclear import prevented association of MAPKs with gene promoters. Inhibiting p38 and JNK activity increased NFAT-ERK association with promoters, which repressed TNF-α and enhanced insulin gene expression. Moreover, inhibiting p38 and JNK induced a switch from NFAT-p38/JNK-histone acetyltransferase p300 to NFAT-ERK-HDAC3 complex formation upon the TNF-α promoter, which resulted in gene repression. Histone acetyltransferase/HDAC exchange was reversed on the insulin gene by p38/JNK inhibition in the presence of glucagon-like peptide 1, which enhanced gene expression. Overall, these data indicate that NFAT directs signaling enzymes to gene promoters in islets, which contribute to protein-DNA complex stability and promoter regulation. Furthermore, the data suggest that TNF-α can be repressed and insulin production can be enhanced by selectively targeting signaling components of NFAT-MAPK transcriptional/signaling complex formation in pancreatic β-cells. These findings have therapeutic potential for suppressing islet inflammation while preserving islet function in diabetes and islet transplantation.

  17. Proximal promoter elements of the human zeta-globin gene confer embryonic-specific expression on a linked reporter gene in transgenic mice.

    PubMed

    Pondel, M D; Sharpe, J A; Clark, S; Pearson, L; Wood, W G; Proudfoot, N J

    1996-11-01

    We have investigated the transcriptional regulation of the human embryonic zeta-globin gene promoter. First, we examined the effect that deletion of sequences 5' to zeta-globin's CCAAT box have on zeta-promoter activity in erythroid cell lines. Deletions of sequences between -116 and -556 (cap = 0) had little effect while further deletion to -84 reduced zeta-promoter activity by only 2-3-fold in both transiently and stably transfected erythroid cells. Constructs containing 67, 84 and 556 bp of zeta-globin 5' flanking region linked to a beta-galactosidase reporter gene (lacZ) and hypersensitive site -40 (HS-40) of the human alpha-globin gene cluster were then employed for the generation of transgenic mice. LacZ expression from all constructs, including a 67 bp zeta-globin promoter, was erythroid-specific and most active between 8.5 and 10.5 days post-fertilisation. By 16.5 days gestation, lacZ expression dropped 40-100-fold. These results suggest that embryonic-specific activation of the human zeta-globin promoter is conferred by a 67 bp zeta-promoter fragment containing only a CCAAT and TATA box. PMID:8932366

  18. Identification and characterization of regulatory elements in the promoter of ACVR1, the gene mutated in Fibrodysplasia Ossificans Progressiva

    PubMed Central

    2013-01-01

    Background The ACVR1 gene encodes a type I receptor for bone morphogenetic proteins (BMPs). Mutations in the ACVR1 gene are associated with Fibrodysplasia Ossificans Progressiva (FOP), a rare and extremely disabling disorder characterized by congenital malformation of the great toes and progressive heterotopic endochondral ossification in muscles and other non-skeletal tissues. Several aspects of FOP pathophysiology are still poorly understood, including mechanisms regulating ACVR1 expression. This work aimed to identify regulatory elements that control ACVR1 gene transcription. Methods and results We first characterized the structure and composition of human ACVR1 gene transcripts by identifying the transcription start site, and then characterized a 2.9 kb upstream region. This region showed strong activating activity when tested by reporter gene assays in transfected cells. We identified specific elements within the 2.9 kb region that are important for transcription factor binding using deletion constructs, co-transfection experiments with plasmids expressing selected transcription factors, site-directed mutagenesis of consensus binding-site sequences, and by protein/DNA binding assays. We also characterized a GC-rich minimal promoter region containing binding sites for the Sp1 transcription factor. Conclusions Our results showed that several transcription factors such as Egr-1, Egr-2, ZBTB7A/LRF, and Hey1, regulate the ACVR1 promoter by binding to the -762/-308 region, which is essential to confer maximal transcriptional activity. The Sp1 transcription factor acts at the most proximal promoter segment upstream of the transcription start site. We observed significant differences in different cell types suggesting tissue specificity of transcriptional regulation. These findings provide novel insights into the molecular mechanisms that regulate expression of the ACVR1 gene and that could be targets of new strategies for future therapeutic treatments. PMID:24047559

  19. A similar 5'-flanking region is required for estrogen and progesterone induction of ovalbumin gene expression.

    PubMed

    Dean, D C; Gope, R; Knoll, B J; Riser, M E; O'Malley, B W

    1984-08-25

    We have previously transferred an ovalbumin-beta-globin fusion gene (ovalglobin) into primary cultures of chick oviduct cells and demonstrated that an ovalbumin gene 5'-flanking sequence between -221 and -95 is necessary for progesterone-mediated transcriptional induction (Dean, D. C., Knoll, B. J., Riser, M. E., and O'Malley, B. W. (1983) Nature (Lond.) 305, 551-554). Here we compare 5'-flanking sequences required for induction of the ovalglobin gene by 17 beta-estradiol and progesterone. The early gene of simian virus 40 was inserted into the same plasmid as the ovalbumin fusion gene to serve as an internal control. Since transcription of the viral early gene was unaffected by the presence of steroid hormone or deletions in the ovalbumin gene 5'-flanking region, the level of its transcripts could be monitored as a reference standard for ovalglobin transcription. Ovalglobin transcripts initiated principally from the ovalbumin cap site in the presence or absence of progesterone and 17 beta-estradiol. Deletion of 5'-flanking sequences to -197 had little effect on the induction with either hormone, while successive deletions to -180, -161, and -143 resulted in a gradual decrease in the level of induction. Deletion to -95 eliminated the induction. The results of this study indicate that DNA control elements for regulation of the ovalbumin gene by estrogen and progesterone either overlap directly or are clustered in close proximity in the 5'-flanking region near the ovalbumin gene promoter. PMID:6088508

  20. Multiple Independent Retroelement Insertions in the Promoter of a Stress Response Gene Have Variable Molecular and Functional Effects in Drosophila

    PubMed Central

    Merenciano, Miriam; Ullastres, Anna; González, Josefa

    2016-01-01

    Promoters are structurally and functionally diverse gene regulatory regions. The presence or absence of sequence motifs and the spacing between the motifs defines the properties of promoters. Recent alternative promoter usage analyses in Drosophila melanogaster revealed that transposable elements significantly contribute to promote diversity. In this work, we analyzed in detail one of the transposable element insertions, named FBti0019985, that has been co-opted to drive expression of CG18446, a candidate stress response gene. We analyzed strains from different natural populations and we found that besides FBti0019985, there are another eight independent transposable elements inserted in the proximal promoter region of CG18446. All nine insertions are solo-LTRs that belong to the roo family. We analyzed the sequence of the nine roo insertions and we investigated whether the different insertions were functionally equivalent by performing 5’-RACE, gene expression, and cold-stress survival experiments. We found that different insertions have different molecular and functional consequences. The exact position where the transposable elements are inserted matters, as they all showed highly conserved sequences but only two of the analyzed insertions provided alternative transcription start sites, and only the FBti0019985 insertion consistently affects CG18446 expression. The phenotypic consequences of the different insertions also vary: only FBti0019985 was associated with cold-stress tolerance. Interestingly, the only previous report of transposable elements inserting repeatedly and independently in a promoter region in D. melanogaster, were also located upstream of a stress response gene. Our results suggest that functional validation of individual structural variants is needed to resolve the complexity of insertion clusters. PMID:27517860

  1. The uteroglobin gene region: hormonal regulation, repetitive elements and complete nucleotide sequence of the gene.

    PubMed Central

    Suske, G; Wenz, M; Cato, A C; Beato, M

    1983-01-01

    Differential uteroglobin induction represents an appropriate model for the molecular analysis of the mechanism by which steroid hormones control gene expression in mammals. We have analyzed the structure and hormonal regulation of a 35 Kb region of genomic DNA in which the uteroglobin gene is located. The complete sequence of 3,700 nucleotides including the uteroglobin gene and its flanking regions has been determined, and the limits of the gene established by S1 nuclease mapping. Several regions containing repeated sequences were mapped by blot hybridization, one of which is located within the large intron in the uteroglobin gene. Analysis of the RNAs extracted from endometrium, lung and liver, after treatment with estrogen and/or progesterone shows that within the 35 Kb region, the uteroglobin gene is the only DNA segment whose transcription into stable RNA is induced by progesterone. Images PMID:6304644

  2. Expression of the human amylase genes: Recent origin of a salivary amylase promoter from an actin pseudogene

    SciTech Connect

    Samuelson, L.C.; Gumucio, D.L.; Meisler, M.H. ); Wiebauer, K. )

    1988-09-12

    The human genes encoding salivary amylase (AMY1) and pancreatic amylase (AMY2) are nearly identical in structure and sequence. The authors have used ribonuclease protection studies to identify the functional gene copies in this multigene family. Riboprobes derived from each gene were hybridized to RNA from human pancreas, parotid and liver. The sizes of the protected fragments demonstrated that both pancreatic genes are expressed in pancreas. One of the pancreatic genes, AMY2B, is also transcribed at a low level in liver, but not from the promoter used in pancreas. AMY1 transcripts were detected in parotid, but not in pancreas or liver. Unexpected fragments protected by liver RNA led to the discovery that the 5{prime} regions of the five human amylase genes contain a processed {gamma}-actin pseudogene. The promoter and start site for transcription of AMY1 are recently derived from the 3{prime} untranslated region of {gamma}-actin. In addition, insertion of an endogenous retrovirus has interrupted the {gamma}-actin pseudogene in four of the five amylase genes.

  3. Twist1 Directly Regulates Genes That Promote Cell Proliferation and Migration in Developing Heart Valves

    PubMed Central

    Lee, Mary P.; Yutzey, Katherine E.

    2011-01-01

    Twist1, a basic helix-loop-helix transcription factor, is expressed in mesenchymal precursor populations during embryogenesis and in metastatic cancer cells. In the developing heart, Twist1 is highly expressed in endocardial cushion (ECC) valve mesenchymal cells and is down regulated during valve differentiation and remodeling. Previous studies demonstrated that Twist1 promotes cell proliferation, migration, and expression of primitive extracellular matrix (ECM) molecules in ECC mesenchymal cells. Furthermore, Twist1 expression is induced in human pediatric and adult diseased heart valves. However, the Twist1 downstream target genes that mediate increased cell proliferation and migration during early heart valve development remain largely unknown. Candidate gene and global gene profiling approaches were used to identify transcriptional targets of Twist1 during heart valve development. Candidate target genes were analyzed for evolutionarily conserved regions (ECRs) containing E-box consensus sequences that are potential Twist1 binding sites. ECRs containing conserved E-box sequences were identified for Twist1 responsive genes Tbx20, Cdh11, Sema3C, Rab39b, and Gadd45a. Twist1 binding to these sequences in vivo was determined by chromatin immunoprecipitation (ChIP) assays, and binding was detected in ECCs but not late stage remodeling valves. In addition identified Twist1 target genes are highly expressed in ECCs and have reduced expression during heart valve remodeling in vivo, which is consistent with the expression pattern of Twist1. Together these analyses identify multiple new genes involved in cell proliferation and migration that are differentially expressed in the developing heart valves, are responsive to Twist1 transcriptional function, and contain Twist1-responsive regulatory sequences. PMID:22242143

  4. Nonessential region of bacteriophage P4: DNA sequence, transcription, gene products, and functions.

    PubMed Central

    Ghisotti, D; Finkel, S; Halling, C; Dehò, G; Sironi, G; Calendar, R

    1990-01-01

    We sequenced the leftmost 2,640 base pairs of bacteriophage P4 DNA, thus completing the sequence of the 11,627-base-pair P4 genome. The newly sequenced region encodes three nonessential genes, which are called gop, beta, and cII (in order, from left to right). The gop gene product kills Escherichia coli when the beta protein is absent; the gop and beta genes are transcribed rightward from the same promoter. The cII gene is transcribed leftward to a rho-independent terminator. Mutation of this terminator creates a temperature-sensitive phenotype, presumably owing to a defect in expression of the beta gene. Images PMID:2403440

  5. Amplification of TGFβ Induced ITGB6 Gene Transcription May Promote Pulmonary Fibrosis.

    PubMed

    Tatler, Amanda L; Goodwin, Amanda T; Gbolahan, Olumide; Saini, Gauri; Porte, Joanne; John, Alison E; Clifford, Rachel L; Violette, Shelia M; Weinreb, Paul H; Parfrey, Helen; Wolters, Paul J; Gauldie, Jack; Kolb, Martin; Jenkins, Gisli

    2016-01-01

    Idiopathic pulmonary fibrosis (IPF) is a devastating, progressive disease with poor survival rates and limited treatment options. Upregulation of αvβ6 integrins within the alveolar epithelial cells is a characteristic feature of IPF and correlates with poor patient survival. The pro-fibrotic cytokine TGFβ1 can upregulate αvβ6 integrin expression but the molecular mechanisms driving this effect have not previously been elucidated. We confirm that stimulation with exogenous TGFβ1 increases expression of the integrin β6 subunit gene (ITGB6) and αvβ6 integrin cell surface expression in a time- and concentration-dependent manner. TGFβ1-induced ITGB6 expression occurs via transcriptional activation of the ITGB6 gene, but does not result from effects on ITGB6 mRNA stability. Basal expression of ITGB6 in, and αvβ6 integrins on, lung epithelial cells occurs via homeostatic αvβ6-mediated TGFβ1 activation in the absence of exogenous stimulation, and can be amplified by TGFβ1 activation. Fundamentally, we show for the first time that TGFβ1-induced ITGB6 expression occurs via canonical Smad signalling since dominant negative constructs directed against Smad3 and 4 inhibit ITGB6 transcriptional activity. Furthermore, disruption of a Smad binding site at -798 in the ITGB6 promoter abolishes TGFβ1-induced ITGB6 transcriptional activity. Using chromatin immunoprecipitation we demonstrate that TGFβ1 stimulation of lung epithelial cells results in direct binding of Smad3, and Smad4, to the ITGB6 gene promoter within this region. Finally, using an adenoviral TGFβ1 over-expression model of pulmonary fibrosis we demonstrate that Smad3 is crucial for TGFβ1-induced αvβ6 integrin expression within the alveolar epithelium in vivo. Together, these data confirm that a homeostatic, autocrine loop of αvβ6 integrin activated TGFβ1-induced ITGB6 gene expression regulates epithelial basal αvβ6 integrin expression, and demonstrates that this occurs via Smad

  6. Amplification of TGFβ Induced ITGB6 Gene Transcription May Promote Pulmonary Fibrosis

    PubMed Central

    Tatler, Amanda L.; Goodwin, Amanda T.; Gbolahan, Olumide; Saini, Gauri; Porte, Joanne; John, Alison E.; Clifford, Rachel L.; Violette, Shelia M.; Weinreb, Paul H.; Parfrey, Helen; Wolters, Paul J.; Gauldie, Jack; Kolb, Martin; Jenkins, Gisli

    2016-01-01

    Idiopathic pulmonary fibrosis (IPF) is a devastating, progressive disease with poor survival rates and limited treatment options. Upregulation of αvβ6 integrins within the alveolar epithelial cells is a characteristic feature of IPF and correlates with poor patient survival. The pro-fibrotic cytokine TGFβ1 can upregulate αvβ6 integrin expression but the molecular mechanisms driving this effect have not previously been elucidated. We confirm that stimulation with exogenous TGFβ1 increases expression of the integrin β6 subunit gene (ITGB6) and αvβ6 integrin cell surface expression in a time- and concentration-dependent manner. TGFβ1-induced ITGB6 expression occurs via transcriptional activation of the ITGB6 gene, but does not result from effects on ITGB6 mRNA stability. Basal expression of ITGB6 in, and αvβ6 integrins on, lung epithelial cells occurs via homeostatic αvβ6-mediated TGFβ1 activation in the absence of exogenous stimulation, and can be amplified by TGFβ1 activation. Fundamentally, we show for the first time that TGFβ1-induced ITGB6 expression occurs via canonical Smad signalling since dominant negative constructs directed against Smad3 and 4 inhibit ITGB6 transcriptional activity. Furthermore, disruption of a Smad binding site at -798 in the ITGB6 promoter abolishes TGFβ1-induced ITGB6 transcriptional activity. Using chromatin immunoprecipitation we demonstrate that TGFβ1 stimulation of lung epithelial cells results in direct binding of Smad3, and Smad4, to the ITGB6 gene promoter within this region. Finally, using an adenoviral TGFβ1 over-expression model of pulmonary fibrosis we demonstrate that Smad3 is crucial for TGFβ1-induced αvβ6 integrin expression within the alveolar epithelium in vivo. Together, these data confirm that a homeostatic, autocrine loop of αvβ6 integrin activated TGFβ1-induced ITGB6 gene expression regulates epithelial basal αvβ6 integrin expression, and demonstrates that this occurs via Smad

  7. Human miR223 promoter as a novel myelo-specific promoter for chronic granulomatous disease gene therapy.

    PubMed

    Brendel, Christian; Hänseler, Walther; Wohlgensinger, Vital; Bianchi, Matteo; Tokmak, Serap; Chen-Wichmann, Linping; Kuzmenko, Elena; Cesarovic, Nikola; Nicholls, Flora; Reichenbach, Janine; Seger, Reinhard; Grez, Manuel; Siler, Ulrich

    2013-06-01

    Targeting transgene expression to specific hematopoietic cell lineages could contribute to the safety of retroviral vectors in gene therapeutic applications. Chronic granulomatous disease (CGD), a defect of phagocytic cells, can be managed by gene therapy, using retroviral vectors with targeted expression to myeloid cells. In this context, we analyzed the myelospecificity of the human miR223 promoter, which is known to be strongly upregulated during myeloid differentiation, to drive myeloid-restricted expression of p47(phox) and gp91(phox) in mouse models of CGD and in primary patient-derived cells. The miR223 promoter restricted the expression of p47(phox), gp91(phox), and green fluorescent protein (GFP) within self-inactivating (SIN) gamma- and lentiviral vectors to granulocytes and macrophages, with only marginal expression in lymphocytes or hematopoietic stem and progenitor cells. Furthermore, gene transfer into primary CD34+ cells derived from a p47(phox) patient followed by ex vivo differentiation to neutrophils resulted in restoration of Escherichia coli killing activity by miR223 promoter-mediated p47(phox) expression. These results indicate that the miR223 promoter as an internal promoter within SIN gene therapy vectors is able to efficiently correct the CGD phenotype with negligible activity in hematopoietic progenitors, thereby limiting the risk of insertional oncogenesis and development of clonal dominance.

  8. Molecular cloning and activity analysis of a seed-specific FAD2-1B gene promoter from Glycine max.

    PubMed

    Zhao, Y; Sha, W; Wang, Q Y; Zhai, Y; Zhao, Y; Shao, S L

    2015-01-01

    Microsomal omega-6 fatty acid desaturase (FAD2-1B) is an enzyme that regulates the polyunsaturated fatty acid content in soybeans (Glycine max). In this study, the FAD2-1B gene was determined to be highly expressed in soybean seeds using quantitative real-time PCR(qRT-PCR). To investigate the expression pattern and activity of the FAD2-1B promoter, a 1929 bp 5'-upstream genomic DNA fragment, named PF, was isolated according to the soybean genomic sequence. Sequence analysis revealed the presence of many motifs related to seed-specific promoters in the PF fragment, such as E-box, SEF4, Skn-1 motif, AACACA, AATAAA and so on. Tobacco transgenics carrying the gus reporter gene driven by the PF and/or 35S promoters were confirmed by PCR and RT-PCR. qRT-PCR and histochemical GUS assays showed that the PF promoter could regulate gus gene accumulation in seeds and the expression level was higher than in other organs. In the meantime, it exhibited similar activity to the 35S promoter in seeds, which could be associated with seed-related cis-elements found in the 1-248 bp, 451-932 bp, and 1627-1803 bp regions of the promoter. PMID:26386665

  9. Two distinct promoter elements in the human rRNA gene identified by linker scanning mutagenesis.

    PubMed Central

    Haltiner, M M; Smale, S T; Tjian, R

    1986-01-01

    A cell-free RNA polymerase I transcription system was used to evaluate the transcription efficiency of 21 linker scanning mutations that span the human rRNA gene promoter. Our analysis revealed the presence of two major control elements, designated the core and upstream elements, that affect the level of transcription initiation. The core element extends from -45 to +18 relative to the RNA start site, and transcription is severely affected (up to 100-fold) by linker scanning mutations in this region. Linker scanning and deletion mutations in the upstream element, located between nucleotides -156 and -107, cause a three- to fivefold reduction in transcription. Under certain reaction conditions, such as the presence of a high ratio of protein to template or supplementation of the reaction with partially purified protein fractions, sequences upstream of the core element can have an even greater effect (20- to 50-fold) on RNA polymerase I transcription. Primer extension analysis showed that RNA synthesized from all of these mutant templates is initiated at the correct in vivo start site. To examine the functional relationship between the core and the upstream region, mutant promoters were constructed that alter the orientation, distance, or multiplicity of these control elements relative to each other. The upstream control element appears to function in only one orientation, and its position relative to the core is constrained within a fairly narrow region. Moreover, multiple core elements in close proximity to each other have an inhibitory effect on transcription. Images PMID:3785147

  10. Tumor Restrictive Suicide Gene Therapy for Glioma Controlled by the FOS Promoter

    PubMed Central

    Hu, Jiliang; Song, Weijian; Luo, Jie; Jiang, Shan; Yan, Fei; Zhai, Baojin

    2015-01-01

    Effective suicide gene delivery and expression are crucial to achieving successful effects in gene therapy. An ideal tumor-specific promoter expresses therapeutic genes in tumor cells with minimal normal tissue expression. We compared the activity of the FOS (FBJ murine osteosarcoma viral oncogene homolog) promoter with five alternative tumor-specific promoters in glioma cells and non-malignant astrocytes. The FOS promoter caused significantly higher transcriptional activity in glioma cell lines than all alternative promoters with the exception of CMV. The FOS promoter showed 13.9%, 32.4%, and 70.8% of the transcriptional activity of CMV in three glioma cell lines (U87, U251, and U373). Importantly, however, the FOS promoter showed only 1.6% of the transcriptional activity of CMV in normal astrocytes. We also tested the biologic activity of recombinant adenovirus containing the suicide gene herpes simplex virus thymidine kinase (HSV-tk) driven by the FOS promoter, including selective killing efficacy in vitro and tumor inhibition rate in vivo. Adenoviral-mediated delivery of the HSV-tk gene controlled by the FOS promoter conferred a cytotoxic effect on human glioma cells in vitro and in vivo. This study suggests that use of the FOS-tk adenovirus system is a promising strategy for glioma-specific gene therapy but still much left for improvement. PMID:26571389

  11. Identification of wheat chromosomal regions containing expressed resistance genes.

    PubMed Central

    Dilbirligi, Muharrem; Erayman, Mustafa; Sandhu, Devinder; Sidhu, Deepak; Gill, Kulvinder S

    2004-01-01

    The objectives of this study were to isolate and physically localize expressed resistance (R) genes on wheat chromosomes. Irrespective of the host or pest type, most of the 46 cloned R genes from 12 plant species share a strong sequence similarity, especially for protein domains and motifs. By utilizing this structural similarity to perform modified RNA fingerprinting and data mining, we identified 184 putative expressed R genes of wheat. These include 87 NB/LRR types, 16 receptor-like kinases, and 13 Pto-like kinases. The remaining were seven Hm1 and two Hs1(pro-1) homologs, 17 pathogenicity related, and 42 unique NB/kinases. About 76% of the expressed R-gene candidates were rare transcripts, including 42 novel sequences. Physical mapping of 121 candidate R-gene sequences using 339 deletion lines localized 310 loci to 26 chromosomal regions encompassing approximately 16% of the wheat genome. Five major R-gene clusters that spanned only approximately 3% of the wheat genome but contained approximately 47% of the candidate R genes were observed. Comparative mapping localized 91% (82 of 90) of the phenotypically characterized R genes to 18 regions where 118 of the R-gene sequences mapped. PMID:15020436

  12. Convergent transcription initiates from oppositely oriented promoters within the 5 prime end regions of Drosophila melanogaster F elements

    SciTech Connect

    Minchiotti, G. ); Di Nocera, P.P. )

    1991-10-01

    Drosophila melanogaster F elements are mobile, oligo(A)-terminated DNA sequences that likely propagate by the retrotranscription of RNA intermediates. Plasmids bearing DNA segments from the left-hand region of a full-length F element fused to the CAT gene were used as templates for transient expression assays in Drosophila Schneider II cultured cells. Protein and RNA analyses led to the identification of two promoters, F{sub in} and F{sub out}, that transcribe in opposite orientations. Analysis of the template activity of 3{prime} deletion derivatives indicates that the level of accumulation of F{sub in}RNA is also dependent upon the presence of sequences located within the +175 to +218 interval. The F{sub out} promoter drives transcription in the opposite orientation with respect to F{sub in}, F{sub out} transcripts initiate at nearby sites within the +92 to +102 interval. Sequences downstream of these multiple RNA start sites are not required for the activity of the F{sub out} promoter. Deletions knocking out the F{sub in} promoter do not impair F{sub out} transcription; conversely, initiation at the F{sub in} promoter still takes place in templates that lack the F{sub out} promoter. At a low level, both promoters are active in cultured cells.

  13. CBF mediates adenovirus Ela trans-activation by interaction at the C-terminal promoter targeting domain of conserved region 3.

    PubMed

    Agoff, S N; Wu, B

    1994-12-01

    Genetic and biochemical evidence suggest that conserved region 3 (CR3) of the adenovirus Ela polypeptide can provide two distinct and separable functions: an N-terminal transcriptional activation region and a C-terminal promoter targeting region. It is thought that the promoter targeting region of Ela CR3 interacts with promoter-specific transcription factors, thereby bringing the activation region of Ela CR3 in proximity of the promoter. Here we report that CBF, a CCAAT-box-binding factor that regulates hsp70 gene expression and mediates Ela trans-activation in vivo, interacts with the promoter targeting region of Ela CR3 in vitro. Point mutations in Ela CR3 that are defective in stimulating transcription from the hsp70 promoter are also defective in stimulating transcription directed by a synthetic activator, GAL-CBF, composed of the DNA-binding domain of yeast GAL4 fused to CBF. These mutations fall into two classes with respect to their abilities to interact with CBF in vitro. Mutations in the transcriptional activation region of Ela CR3 do not affect binding to CBF, but mutation of the promoter targeting region of Ela CR3 prevents association with CBF in vitro.

  14. The regions of sequence variation in caulimovirus gene VI.

    PubMed

    Sanger, M; Daubert, S; Goodman, R M

    1991-06-01

    The sequence of gene VI from figwort mosaic virus (FMV) clone x4 was determined and compared with that previously published for FMV clone DxS. Both clones originated from the same virus isolation, but the virus used to clone DxS was propagated extensively in a host of a different family prior to cloning whereas that used to clone x4 was not. Differences in the amino acid sequence inferred from the DNA sequences occurred in two clusters. An N-terminal conserved region preceded two regions of variation separated by a central conserved region. Variation in cauliflower mosaic virus (CaMV) gene VI sequences, all of which were derived from virus isolates from hosts from one host family, was similar to that seen in the FMV comparison, though the extent of variation was less. Alignment of gene VI domains from FMV and CaMV revealed regions of amino acid sequence identical in both viruses within the conserved regions. The similarity in the pattern of conserved and variable domains of these two viruses suggests common host-interactive functions in caulimovirus gene VI homologues, and possibly an analogy between caulimoviruses and certain animal viruses in the influence of the host on sequence variability of viral genes.

  15. Gene expression and promoter analysis of a novel tomato aldo-keto reductase in response to environmental stresses.

    PubMed

    Suekawa, Marina; Fujikawa, Yukichi; Inada, Shuhei; Murano, Asako; Esaka, Muneharu

    2016-08-01

    The functional role of an uncharacterized tomato (Solanum lycopersicum) aldo-keto reductase 4B, denoted as SlAKR4B, was investigated. The gene expression of tomato SlAKR4B was detected at a high level in the senescent leaves and the ripening fruits of tomato. Although d-galacturonic acid reductase activities tended to be higher in tomato SlAKR4B-overexpressing transgenic tobacco BY-2 cell lines than those in control cell lines, SlAKR4B gene expression was not well correlated with l-ascorbic acid content among the cell lines. The analysis of the transgenic cell lines showed that tomato SlAKR4B has enzyme activities toward d-galacturonic acid as well as glyceraldehyde and glyoxal, suggesting that the SlAKR4B gene encodes a functional enzyme in tomato. Gene expression of SlAKR4B was induced by NaCl, H2O2, and plant hormones such as salicylic acid and jasmonic acid, suggesting that SlAKR4B is involved in the stress response. The transient expression assay using protoplasts showed the promoter activity of the SlAKR4B gene was as high as that of the cauliflower mosaic virus 35S promoter. Also, the promoter region of the SlAKR4B gene was suggested to contain cis-element(s) for abiotic stress-inducible expression. PMID:27337067

  16. The wheat HMW-glutenin 1Dy10 gene promoter controls endosperm expression in Brachypodium distachyon

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The grass species Brachypodium distachyon has emerged as a model system for the study of gene structure and function in temperate cereals. As a first demonstration of the utility of Brachypodium to study wheat gene promoter function, we transformed it with a T-DNA that included the GUS reporter gene...

  17. GacA-controlled activation of promoters for small RNA genes in Pseudomonas fluorescens.

    PubMed

    Humair, Bérénice; Wackwitz, Birgit; Haas, Dieter

    2010-03-01

    The Gac/Rsm signal transduction pathway positively regulates secondary metabolism, production of extracellular enzymes, and biocontrol properties of Pseudomonas fluorescens CHA0 via the expression of three noncoding small RNAs, termed RsmX, RsmY, and RsmZ. The architecture and function of the rsmY and rsmZ promoters were studied in vivo. A conserved palindromic upstream activating sequence (UAS) was found to be necessary but not sufficient for rsmY and rsmZ expression and for activation by the response regulator GacA. A poorly conserved linker region located between the UAS and the -10 promoter sequence was also essential for GacA-dependent rsmY and rsmZ expression, suggesting a need for auxiliary transcription factors. One such factor involved in the activation of the rsmZ promoter was identified as the PsrA protein, previously recognized as an activator of the rpoS gene and a repressor of fatty acid degradation. Furthermore, the integration host factor (IHF) protein was found to bind with high affinity to the rsmZ promoter region in vitro, suggesting that DNA bending contributes to the regulated expression of rsmZ. In an rsmXYZ triple mutant, the expression of rsmY and rsmZ was elevated above that found in the wild type. This negative feedback loop appears to involve the translational regulators RsmA and RsmE, whose activity is antagonized by RsmXYZ, and several hypothetical DNA-binding proteins. This highly complex network controls the expression of the three small RNAs in response to cell physiology and cell population densities.

  18. Regulatory region in choline acetyltransferase gene directs developmental and tissue-specific expression in transgenic mice.

    PubMed Central

    Lönnerberg, P; Lendahl, U; Funakoshi, H; Arhlund-Richter, L; Persson, H; Ibáñez, C F

    1995-01-01

    Acetylcholine, one of the main neurotransmitters in the nervous system, is synthesized by the enzyme choline acetyltransferase (ChAT; acetyl-CoA:choline O-acetyltransferase, EC 2.3.1.6). The molecular mechanisms controlling the establishment, maintenance, and plasticity of the cholinergic phenotype in vivo are largely unknown. A previous report showed that a 3800-bp, but not a 1450-bp, 5' flanking segment from the rat ChAT gene promoter directed cell type-specific expression of a reporter gene in cholinergic cells in vitro. Now we have characterized a distal regulatory region of the ChAT gene that confers cholinergic specificity on a heterologous downstream promoter in a cholinergic cell line and in transgenic mice. A 2342-bp segment from the 5' flanking region of the ChAT gene behaved as an enhancer in cholinergic cells but as a repressor in noncholinergic cells in an orientation-independent manner. Combined with a heterologous basal promoter, this fragment targeted transgene expression to several cholinergic regions of the central nervous system of transgenic mice, including basal forebrain, cortex, pons, and spinal cord. In eight independent transgenic lines, the pattern of transgene expression paralleled qualitatively and quantitatively that displayed by endogenous ChAT mRNA in various regions of the rat central nervous system. In the lumbar enlargement of the spinal cord, 85-90% of the transgene expression was targeted to the ventral part of the cord, where cholinergic alpha-motor neurons are located. Transgene expression in the spinal cord was developmentally regulated and responded to nerve injury in a similar way as the endogenous ChAT gene, indicating that the 2342-bp regulatory sequence contains elements controlling the plasticity of the cholinergic phenotype in developing and injured neurons. Images Fig. 1 Fig. 2 PMID:7732028

  19. Expression of the rat liver carnitine palmitoyltransferase I (CPT-Ialpha) gene is regulated by Sp1 and nuclear factor Y: chromosomal localization and promoter characterization.

    PubMed Central

    Steffen, M L; Harrison, W R; Elder, F F; Cook, G A; Park, E A

    1999-01-01

    Carnitine palmitoyltransferase (CPT)-I catalyses the transfer of long-chain fatty acids from CoA to carnitine for translocation across the mitochondrial inner membrane. Expression of the 'liver' isoform of the CPT-I gene (CPT-Ialpha) is subject to developmental, hormonal and tissue-specific regulation. To understand the basis for control of CPT-Ialpha gene expression, we have characterized the proximal promoter of the CPT-Ialpha gene. Here, we report the sequence of 6839 base pairs of the promoter and the localization of the rat CPT-Ialpha gene to region q43 on chromosome 1. Our studies show that the first 200 base pairs of the promoter are sufficient to drive transcription of the CPT-Ialpha gene. Within this region are two sites that bind both Sp1 and Sp3 transcription factors. In addition, nuclear factor Y (NF-Y) binds the proximal promoter. Mutation at the Sp1 or NF-Y sites severely decreases transcription from the CPT-Ialpha promoter. Other protein binding sites were identified within the first 200 base pairs of the promoter by DNase I footprinting, and these elements contribute to CPT-Ialpha gene expression. Our studies demonstrate that CPT-Ialpha is a TATA-less gene which utilizes NF-Y and Sp proteins to drive basal expression. PMID:10333485

  20. Transcription factor IIIA induced bending of the Xenopus somatic 5S gene promoter.

    PubMed

    Schroth, G P; Cook, G R; Bradbury, E M; Gottesfeld, J M

    1989-08-10

    Transcription factor IIIA (TFIIIA), the canonical zinc-finger protein, is a protein of relative molecular mass 39,000 (39K) that is required for transcription of 5S-ribosomal subunit genes in Xenopus. It binds in a sequence-specific manner to the internal control region of the 5S gene (see Fig. 1) and facilitates transcription of the gene by RNA polymerase III. It also binds to the 5S gene product to form a 7S ribonucleoprotein particle. In oocytes the 7S particle acts as a storage form of the RNA to be utilized later in development. TFIIIA binds to DNA through its 30 K N-terminal domain, which contains nine zinc-fingers. TFIIIA was the first protein described to have this type of DNA binding motif, but numerous other proteins have now been shown to have zinc-finger domains. A structure for a single zinc-finger from the yeast protein ADR1, was recently proposed based on two-dimensional NMR data (ref. 8), and a similar structure was proposed based on comparison with crystal structures of other metalloproteins. Although models for the interaction of TFIIIA with the 5S-ribosomal gene DNA have been proposed, based on nuclease digestion and methylation interference data, little precise structural information is available for TFIIIA and the physical basis for the interaction of zinc-fingers with DNA is not understood. Using both circular permutation and circularization assays we provide convincing biochemical evidence that TFIIIA bends the DNA at the internal promoter of the 5S gene.

  1. Control of expression by the cellulose synthase (bcsA) promoter region from Acetobacter xylinum BPR 2001.

    PubMed

    Nakai, T; Moriya, A; Tonouchi, N; Tsuchida, T; Yoshinaga, F; Horinouchi, S; Sone, Y; Mori, H; Sakai, F; Hayashi, T

    1998-06-15

    The 5' upstream region (about 3.1kb) of the cellulose synthase operon (bcs operon) has been isolated by cloning from Acetobacter xylinum strain BPR 2001. The expression level of the upstream region was determined using sucrose synthase cDNA as a reporter gene in the shuttle vector pSA19. The expression occurred with the 1.1-kb upstream sequence from the ATG start codon of the bcs operon but not with the 241-bp upstream sequence in A. xylinum, although neither the 1.1-kb nor the 241-bp upstream sequence caused any expression as a promoter in Escherichia coli. The level of expression with the 1. 1-kb upstream sequence in A. aceti was 75% of that in A. xylinum. These results suggest that the upstream region functions as a specific promoter for the Acetobacter genus. The expression was reduced by the introduction of the 241-bp upstream region between the lac promoter and the reporter gene in E. coli and was not detected in A. xylinum. This suggests that the short upstream region composed of 241bp contains the site(s) which causes a negative regulation on the transcription for bcs operon. The production of recombinant protein with the ribosome-binding site (RBS) of A. xylinum obtained from the bcs operon, was reduced to about half in E. coli, and that with the site of the lac promoter was also reduced to about half in A. xylinum. This shows that a species-specific predominance occurs during interaction between mRNA and 16S rRNA in the RBS between A. xylinum and E. coli. PMID:9630539

  2. Large sex differences in chicken behavior and brain gene expression coincide with few differences in promoter DNA-methylation.

    PubMed

    Nätt, Daniel; Agnvall, Beatrix; Jensen, Per

    2014-01-01

    While behavioral sex differences have repeatedly been reported across taxa, the underlying epigenetic mechanisms in the brain are mostly lacking. Birds have previously shown to have only limited dosage compensation, leading to high sex bias of Z-chromosome gene expression. In chickens, a male hyper-methylated region (MHM) on the Z-chromosome has been associated with a local type of dosage compensation, but a more detailed characterization of the avian methylome is limiting our interpretations. Here we report an analysis of genome wide sex differences in promoter DNA-methylation and gene expression in the brain of three weeks old chickens, and associated sex differences in behavior of Red Junglefowl (ancestor of domestic chickens). Combining DNA-methylation tiling arrays with gene expression microarrays we show that a specific locus of the MHM region, together with the promoter for the zinc finger RNA binding protein (ZFR) gene on chromosome 1, is strongly associated with sex dimorphism in gene expression. Except for this, we found few differences in promoter DNA-methylation, even though hundreds of genes were robustly differentially expressed across distantly related breeds. Several of the differentially expressed genes are known to affect behavior, and as suggested from their functional annotation, we found that female Red Junglefowl are more explorative and fearful in a range of tests performed throughout their lives. This paper identifies new sites and, with increased resolution, confirms known sites where DNA-methylation seems to affect sexually dimorphic gene expression, but the general lack of this association is noticeable and strengthens the view that birds do not have dosage compensation. PMID:24782041

  3. Large Sex Differences in Chicken Behavior and Brain Gene Expression Coincide with Few Differences in Promoter DNA-Methylation

    PubMed Central

    Nätt, Daniel; Agnvall, Beatrix; Jensen, Per

    2014-01-01

    While behavioral sex differences have repeatedly been reported across taxa, the underlying epigenetic mechanisms in the brain are mostly lacking. Birds have previously shown to have only limited dosage compensation, leading to high sex bias of Z-chromosome gene expression. In chickens, a male hyper-methylated region (MHM) on the Z-chromosome has been associated with a local type of dosage compensation, but a more detailed characterization of the avian methylome is limiting our interpretations. Here we report an analysis of genome wide sex differences in promoter DNA-methylation and gene expression in the brain of three weeks old chickens, and associated sex differences in behavior of Red Junglefowl (ancestor of domestic chickens). Combining DNA-methylation tiling arrays with gene expression microarrays we show that a specific locus of the MHM region, together with the promoter for the zinc finger RNA binding protein (ZFR) gene on chromosome 1, is strongly associated with sex dimorphism in gene expression. Except for this, we found few differences in promoter DNA-methylation, even though hundreds of genes were robustly differentially expressed across distantly related breeds. Several of the differentially expressed genes are known to affect behavior, and as suggested from their functional annotation, we found that female Red Junglefowl are more explorative and fearful in a range of tests performed throughout their lives. This paper identifies new sites and, with increased resolution, confirms known sites where DNA-methylation seems to affect sexually dimorphic gene expression, but the general lack of this association is noticeable and strengthens the view that birds do not have dosage compensation. PMID:24782041

  4. Large sex differences in chicken behavior and brain gene expression coincide with few differences in promoter DNA-methylation.

    PubMed

    Nätt, Daniel; Agnvall, Beatrix; Jensen, Per

    2014-01-01

    While behavioral sex differences have repeatedly been reported across taxa, the underlying epigenetic mechanisms in the brain are mostly lacking. Birds have previously shown to have only limited dosage compensation, leading to high sex bias of Z-chromosome gene expression. In chickens, a male hyper-methylated region (MHM) on the Z-chromosome has been associated with a local type of dosage compensation, but a more detailed characterization of the avian methylome is limiting our interpretations. Here we report an analysis of genome wide sex differences in promoter DNA-methylation and gene expression in the brain of three weeks old chickens, and associated sex differences in behavior of Red Junglefowl (ancestor of domestic chickens). Combining DNA-methylation tiling arrays with gene expression microarrays we show that a specific locus of the MHM region, together with the promoter for the zinc finger RNA binding protein (ZFR) gene on chromosome 1, is strongly associated with sex dimorphism in gene expression. Except for this, we found few differences in promoter DNA-methylation, even though hundreds of genes were robustly differentially expressed across distantly related breeds. Several of the differentially expressed genes are known to affect behavior, and as suggested from their functional annotation, we found that female Red Junglefowl are more explorative and fearful in a range of tests performed throughout their lives. This paper identifies new sites and, with increased resolution, confirms known sites where DNA-methylation seems to affect sexually dimorphic gene expression, but the general lack of this association is noticeable and strengthens the view that birds do not have dosage compensation.

  5. Regulation of tissue-specific expression of alternative peripheral myelin protein-22 (PMP22) gene transcripts by two promoters

    SciTech Connect

    Patel, P.I.; Schoener-Scott, R.; Lupski, J.R.

    1994-09-01

    Mutations affecting the peripheral myelin protein-22 (PMP22) gene have been shown to be associated with inherited peripheral neuropathies. We have cloned and characterized the human PMP22 gene which spans approximately 40 kilobases and contains four coding exons. Towards developing gene therapy regimens for the associated peripheral neuropathies, we have initiated detailed analysis of the 5{prime} flanking region of the PMP22 gene and identified two alternatively transcribed, but untranslated exons. Mapping of separate PMP22 mRNA transcription initiation sites to each of these exons indicates that PMP22 expression is regulated by two alternatively used promoters. Both putative promoter sequences demonstrated the ability to drive expression of reporter genes in transfection experiments. Furthermore, the structure of the 5{prime} portion of the PMP22 gene appears to be identical in rat and human, supporting the biological significance of the observed arrangement of regulatory regions. The relative expression of the alternative PMP22 transcripts is tissue-specific and high levels of the exon 1A-containing transcript are tightly coupled to myelin formation. In contrast, exon 1B-containing transcripts are predominant in non-neural tissues and in growth-arrested primary fibroblasts. The observed regulation of the PMP22 by a complex molecular mechanism is consistent with the proposed dual role of PMP22 in neural and non-neural tissue.

  6. Isolation and characterization of rubisco small subunit gene promoter from common wheat (Triticum aestivum L.).

    PubMed

    Mukherjee, Shalini; Stasolla, Claudio; Brûlé-Babel, Anita; Ayele, Belay T

    2015-01-01

    Choice of an appropriate promoter is critical to express target genes in intended tissues and developmental stages. However, promoters capable of directing gene expression in specific tissues and stages are not well characterized in monocot species. To identify such a promoter in wheat, this study isolated a partial sequence of the wheat small subunit of RuBisCO (TarbcS) promoter. In silico analysis revealed the presence of elements that are characteristic to rbcS promoters of other, mainly dicot, species. Transient expression of the TarbcS:GUS in immature wheat embryos and tobacco leaves but not in the wheat roots indicate the functionality of the TarbcS promoter fragment in directing the expression of target genes in green plant tissues.

  7. Coexpression of two closely linked avian genes for purine nucleotide synthesis from a bidirectional promoter.

    PubMed Central

    Gavalas, A; Dixon, J E; Brayton, K A; Zalkin, H

    1993-01-01

    Two avian genes encoding essential steps in the purine nucleotide biosynthetic pathway are transcribed divergently from a bidirectional promoter element. The bidirectional promoter, embedded in a CpG island, directs coexpression of GPAT and AIRC genes from distinct transcriptional start sites 229 bp apart. The bidirectional promoter can be divided in half, with each half retaining partial activity towards the cognate gene. GPAT and AIRC genes encode the enzymes that catalyze step 1 and steps 6 plus 7, respectively, in the de novo purine biosynthetic pathway. This is the first report of genes coding for structurally unrelated enzymes of the same pathway that are tightly linked and transcribed divergently from a bidirectional promoter. This arrangement has the potential to provide for regulated coexpression comparable to that in a prokaryotic operon. Images PMID:8336716

  8. A regional approach to promoting improved care of multiples.

    PubMed

    Malmstrom, P M

    2001-04-01

    Live births of multiples in the U.S. rose 35% from 87,700 in 1988 to 118,295 in 1998. This increase presents public health issues due to the elevated health and psychosocial risks that accompany multiple birth. However, health and social service providers and educators are poorly prepared to address the specific needs of the multiple birth population. The Twin Service Network Project therefore developed regional networks of multiple birth training and resources in California to address this problem. Results indicate that these can substantially improve the care available to multiples. The project's integrated package of training and parenting education materials is available to other regions to assist in such efforts.

  9. High divergence in primate-specific duplicated regions: Human and chimpanzee Chorionic Gonadotropin Beta genes

    PubMed Central

    2008-01-01

    selection on LHB and CGB8, and a positive evolution of CGB1. Conclusion If generalized, our data suggests that in addition to species-specific deletions and duplications, parallel duplication events may have contributed to genetic differences separating humans from their closest relatives. Compared to unique genomic segments, duplicated regions are characterized by high divergence promoted by intraspecies gene conversion and species-specific chromosomal rearrangements, including the alterations in gene copy number. PMID:18606016

  10. Demethylation of the human eotaxin-3 gene promoter leads to the elevated expression of eotaxin-3

    PubMed Central

    Lim, Eunjin; Rothenberg, Marc E.

    2014-01-01

    DNA demethylation has been primarily studied in the context of development biology, cell fate, and cancer, with less attention on inflammation. Herein, we investigate the association between DNA methylation and production of the chemoattractant cytokine eotaxin-3 in the tissue of patients with allergic disease. Regions of the human eotaxin-3 promoter were found to be hypomethylated in primary epithelial cells obtained from allergic tissue compared with normal control tissue (CTL). The demethylation of a specific CpG site (designated CpG 2), which is juxtaposed to a key cyclic AMP-responsive element (CRE) site, was significantly demethylated in patient-derived compared to CTL-derived epithelial cells. Levels of methylation at CpG 2 inversely correlated with basal and IL-13–induced eotaxin-3 gene expression. Conversely, global inhibition of methylation with 5-azacytidine (5-AzaC) promoted eotaxin-3 production in association with decreasing CpG 2 methylation. In addition, the basal and IL-13-induced eotaxin-3 transcriptional activity was suppressed by promoter methylation using a methylation-free in vitro system. Further, electrophoretic mobility shift assays (EMSA) demonstrated that the attachment of CREB binding protein (CBP) and activating transcription factor 2 (ATF-2) to the CRE site was methylation dependent. Taken together, these data identify a contributory role for DNA methylation in regulating eotaxin-3 production in human allergic inflammation. PMID:24323578

  11. Truncated cotton subtilase promoter directs guard cell-specific expression of foreign genes in tobacco and Arabidopsis.

    PubMed

    Han, Lei; Han, Ya-Nan; Xiao, Xing-Guo

    2013-01-01

    A 993-bp regulatory region upstream of the translation start codon of subtilisin-like serine protease gene was isolated from Gossypium barbadense. This (T/A)AAAG-rich region, GbSLSP, and its 5'- and 3'-truncated versions were transferred into tobacco and Arabidopsis after fusing with GUS or GFP. Histochemical and quantitative GUS analysis and confocal GFP fluorescence scanning in the transgenic plants showed that the GbSLSP-driven GUS and GFP expressed preferentially in guard cells, whereas driven by GbSLSPF2 to GbSLSPF4, the 5'-truncated GbSLSP versions with progressively reduced Dof1 elements, both GUS and GFP expressed exclusively in guard cells, and the expression strength declined with (T/A)AAAG copy decrement. Deletion of 5'-untranslated region from GbSLSP markedly weakened the activity of GUS and GFP, while deletion from the strongest guard cell-specific promoter, GbSLSPF2, not only significantly decreased the expression strength, but also completely abolished the guard cell specificity. These results suggested both guard cell specificity and expression strength of the promoters be coordinately controlled by 5'-untranslated region and a cluster of at least 3 (T/A)AAAG elements within a region of about 100 bp relative to transcription start site. Our guard cell-specific promoters will enrich tools to manipulate gene expression in guard cells for scientific research and crop improvement.

  12. Identification of genes from the Treacher Collins candidate region

    SciTech Connect

    Dixon, M.; Dixon, J.; Edwards, S. |

    1994-09-01

    Treacher Collins syndrome (TCOF1) is an autosomal dominant disorder of craniofacial development. The TCOF1 locus has previously been mapped to chromosome 5q32-33. The candidate gene region has been defined as being between two flanking markers, ribosomal protein S14 (RPS14) and Annexin 6 (ANX6), by analyzing recombination events in affected individuals. It is estimated that the distance between these flanking markers is 500 kb by three separate analysis methods: (1) radiation hybrid mapping; (2) genetic linkage; and (3) YAC contig analysis. A cosmid contig which spans the candidate gene region for TCOF1 has been constructed by screening the Los Alamos National Laboratory flow-sorted chromosome 5 cosmid library. Cosmids were obtained by using a combination of probes generated from YAC end clones, Alu-PCR fragments from YACs, and asymmetric PCR fragments from both T7 and T3 cosmid ends. Exon amplifications, the selection of genomic coding sequences based upon the presence of functional splice acceptor and donor sites, was used to identify potential exon sequences. Sequences found to be conserved between species were then used to screen cDNA libraries in order to identify candidate genes. To date, four different cDNAs have been isolated from this region and are being analyzed as potential candidate genes for TCOF1. These include the genes encoding plasma glutathione peroxidase (GPX3), heparin sulfate sulfotransferase (HSST), a gene with homology to the ETS family of proteins and one which shows no homology to any known genes. Work is also in progress to identify and characterize additional cDNAs from the candidate gene region.

  13. Multiobjective H2/H∞ synthetic gene network design based on promoter libraries.

    PubMed

    Wu, Chih-Hung; Zhang, Weihei; Chen, Bor-Sen

    2011-10-01

    Some current promoter libraries have been developed for synthetic gene networks. But an efficient method to engineer a synthetic gene network with some desired behaviors by selecting adequate promoters from these promoter libraries has not been presented. Thus developing a systematic method to efficiently employ promoter libraries to improve the engineering of synthetic gene networks with desired behaviors is appealing for synthetic biologists. In this study, a synthetic gene network with intrinsic parameter fluctuations and environmental disturbances in vivo is modeled by a nonlinear stochastic system. In order to engineer a synthetic gene network with a desired behavior despite intrinsic parameter fluctuations and environmental disturbances in vivo, a multiobjective H(2)/H(∞) reference tracking (H(2) optimal tracking and H(∞) noise filtering) design is introduced. The H(2) optimal tracking can make the tracking errors between the behaviors of a synthetic gene network and the desired behaviors as small as possible from the minimum mean square error point of view, and the H(∞) noise filtering can attenuate all possible noises, from the worst-case noise effect point of view, to achieve a desired noise filtering ability. If the multiobjective H(2)/H(∞) reference tracking design is satisfied, the synthetic gene network can robustly and optimally track the desired behaviors, simultaneously. First, based on the dynamic gene regulation, the existing promoter libraries are redefined by their promoter activities so that they can be efficiently selected in the design procedure. Then a systematic method is developed to select an adequate promoter set from the redefined promoter libraries to synthesize a gene network satisfying these two design objectives. But the multiobjective H(2)/H(∞) reference tracking design problem needs to solve a difficult Hamilton-Jacobi Inequality (HJI)-constrained optimization problem. Therefore, the fuzzy approximation method is

  14. 5-Aza-CdR can reverse gefitinib resistance caused by DAPK gene promoter methylation in lung adenocarcinoma cells.

    PubMed

    Yang, Bo; Yang, Zhi-Guang; Gao, Bao; Shao, Guo-Guang; Li, Guang-Hu

    2015-01-01

    To explore the relationship between death associated protein kinase (DAPK) gene promoter methylation and gefitinib resistance in Lung adenocarcinoma cell lines. EGFR-mutation lung adenocarcinoma cell lines PC9 and the gefitinib-resistant with T790M Mutation cell lines PC9/GR were chosen as cell models, and PC9/GR were treated with 5-aza-CdR (1 μmol/L). The experiments were divided into three groups: PC9 group, PC9/GR group and PC9/GR with 5-Aza-CdR pretreatment g