Sample records for gene promoter sequences

  1. Sequence and regulation of the porcine FSHR gene promoter.


    Wu, Wangjun; Han, Jing; Cao, Rui; Zhang, Jinbi; Li, Bojiang; Liu, Zequn; Liu, Kaiqing; Li, Qifa; Pan, Zengxiang; Chen, Jie; Liu, Honglin


    Follicle-stimulating hormone (FSH) plays a crucial role in animal reproduction and exerts its physiological functions by interacting with the FSH receptor (FSHR). The FSHR is exclusively expressed in granulose cells in the ovary and its expression level is closely related to granulose cell differentiation and follicle maturation. In mammal, most of the follicles undergo atresia, while follicle atresia is mainly caused by granulosa cell apoptosis. However, knowledge on the transcriptional regulatory mechanisms of the porcine FSHR gene in granulosa cell is still limited. In this study, approximately 2.1kb of the proximal promoter sequence of the porcine FSHR gene were obtained by genome walking, and the regulatory elements and transcription factors in the porcine FSHR promoter sequence were predicted. Furthermore, the core promoter region (-1195/-598) of the porcine FSHR gene was identified using a luciferase assay. Subsequently, the relationship between expression levels of the porcine FSHR gene and histone H3K9 acetylation levels around the core promoter region (-787/-572) in vivo and invitro were analyzed. Our results showed that an increased FSHR gene expression level was accompanied with an increase in histone H3K9 acetylation levels, suggesting that histone H3K9 acetylation could regulate the expression of the porcine FSHR gene. PMID:25599592

  2. Characterization of promoter sequence of toll-like receptor genes in Vechur cattle

    PubMed Central

    Lakshmi, R.; Jayavardhanan, K. K.; Aravindakshan, T. V.


    Aim: To analyze the promoter sequence of toll-like receptor (TLR) genes in Vechur cattle, an indigenous breed of Kerala with the sequence of Bos taurus and access the differences that could be attributed to innate immune responses against bovine mastitis. Materials and Methods: Blood samples were collected from Jugular vein of Vechur cattle, maintained at Vechur cattle conservation center of Kerala Veterinary and Animal Sciences University, using an acid-citrate-dextrose anticoagulant. The genomic DNA was extracted, and polymerase chain reaction was carried out to amplify the promoter region of TLRs. The amplified product of TLR2, 4, and 9 promoter regions was sequenced by Sanger enzymatic DNA sequencing technique. Results: The sequence of promoter region of TLR2 of Vechur cattle with the B. taurus sequence present in GenBank showed 98% similarity and revealed variants for four sequence motifs. The sequence of the promoter region of TLR4 of Vechur cattle revealed 99% similarity with that of B. taurus sequence but not reveals significant variant in motifregions. However, two heterozygous loci were observed from the chromatogram. Promoter sequence of TLR9 gene also showed 99% similarity to B. taurus sequence and revealed variants for four sequence motifs. Conclusion: The results of this study indicate that significant variation in the promoter of TLR2 and 9 genes in Vechur cattle breed and may potentially link the influence the innate immunity response against mastitis diseases. PMID:27397987

  3. Identification of potential regulatory motifs in odorant receptor genes by analysis of promoter sequences

    PubMed Central

    Michaloski, Jussara S.; Galante, Pedro A.F.


    Mouse odorant receptors (ORs) are encoded by >1000 genes dispersed throughout the genome. Each olfactory neuron expresses one single OR gene, while the rest of the genes remain silent. The mechanisms underlying OR gene expression are poorly understood. Here, we investigated if OR genes share common cis-regulatory sequences in their promoter regions. We carried out a comprehensive analysis in which the upstream regions of a large number of OR genes were compared. First, using RLM-RACE, we generated cDNAs containing the complete 5′-untranslated regions (5′-UTRs) for a total number of 198 mouse OR genes. Then, we aligned these cDNA sequences to the mouse genome so that the 5′ structure and transcription start sites (TSSs) of the OR genes could be precisely determined. Sequences upstream of the TSSs were retrieved and browsed for common elements. We found DNA sequence motifs that are overrepresented in the promoter regions of the OR genes. Most motifs resemble O/E-like sites and are preferentially localized within 200 bp upstream of the TSSs. Finally, we show that these motifs specifically interact with proteins extracted from nuclei prepared from the olfactory epithelium, but not from brain or liver. Our results show that the OR genes share common promoter elements. The present strategy should provide information on the role played by cis-regulatory sequences in OR gene regulation. PMID:16902085

  4. Interference in transcription of overexpressed genes by promoter-proximal downstream sequences.


    Turchinovich, A; Surowy, H M; Tonevitsky, A G; Burwinkel, B


    Despite a high sequence homology among four human RNAi-effectors Argonaute proteins and their coding sequences, the efficiency of ectopic overexpression of AGO3 and AGO4 coding sequences in human cells is greatly reduced as compared to AGO1 and AGO2. While investigating this phenomenon, we documented the existence of previously uncharacterized mechanism of gene expression regulation, which is manifested in greatly varying basal transcription levels from the RNApolII promoters depending on the promoter-proximal downstream sequences. Specifically, we show that distinct overexpression of Argonaute coding sequences cannot be explained by mRNA degradation in the cytoplasm or nucleus, and exhibits on transcriptional level. Furthermore, the first 1000-2000 nt located immediately downstream the promoter had the most critical influence on ectopic gene overexpression. The transcription inhibiting effect, associated with those downstream sequences, subsided with increasing distance to the promoter and positively correlated with promoter strength. We hypothesize that the same mechanism, which we named promoter proximal inhibition (PPI), could generally contribute to basal transcription levels of genes, and could be mainly responsible for the essence of difficult-to-express recombinant proteins. Finally, our data reveal that expression of recombinant proteins in human cells can be greatly enhanced by using more permissive promoter adjacent downstream sequences. PMID:27485701

  5. Interference in transcription of overexpressed genes by promoter-proximal downstream sequences

    PubMed Central

    Turchinovich, A.; Surowy, H. M.; Tonevitsky, A. G.; Burwinkel, B.


    Despite a high sequence homology among four human RNAi-effectors Argonaute proteins and their coding sequences, the efficiency of ectopic overexpression of AGO3 and AGO4 coding sequences in human cells is greatly reduced as compared to AGO1 and AGO2. While investigating this phenomenon, we documented the existence of previously uncharacterized mechanism of gene expression regulation, which is manifested in greatly varying basal transcription levels from the RNApolII promoters depending on the promoter-proximal downstream sequences. Specifically, we show that distinct overexpression of Argonaute coding sequences cannot be explained by mRNA degradation in the cytoplasm or nucleus, and exhibits on transcriptional level. Furthermore, the first 1000–2000 nt located immediately downstream the promoter had the most critical influence on ectopic gene overexpression. The transcription inhibiting effect, associated with those downstream sequences, subsided with increasing distance to the promoter and positively correlated with promoter strength. We hypothesize that the same mechanism, which we named promoter proximal inhibition (PPI), could generally contribute to basal transcription levels of genes, and could be mainly responsible for the essence of difficult-to-express recombinant proteins. Finally, our data reveal that expression of recombinant proteins in human cells can be greatly enhanced by using more permissive promoter adjacent downstream sequences. PMID:27485701

  6. Functional analysis and nucleotide sequence of the promoter region of the murine hck gene.

    PubMed Central

    Lock, P; Stanley, E; Holtzman, D A; Dunn, A R


    The structure and function of the promoter region and exon 1 of the murine hck gene have been characterized in detail. RNase protection analysis has established that hck transcripts initiate from heterogeneous start sites located within the hck gene. Fusion gene constructs containing hck 5'-flanking sequences and the bacterial Neor gene have been introduced into the hematopoietic cell lines FDC-P1 and WEHI-265 by using a self-inactivating retroviral vector. The transcriptional start sites of the fusion gene are essentially identical to those of the endogenous hck gene. Analysis of infected WEHI-265 cell lines treated with bacterial lipopolysaccharide (LPS) reveals a 3- to 5-fold elevation in the levels of endogenous hck mRNA and a 1.4- to 2.6-fold increase in the level of Neor fusion gene transcripts, indicating that hck 5'-flanking sequences are capable of conferring LPS responsiveness on the Neor gene. The 5'-flanking region of the hck gene contains sequences similar to an element which is thought to be involved in the LPS responsiveness of the class II major histocompatibility gene A alpha k. A subset of these sequences are also found in the 5'-flanking regions of other LPS-responsive genes. Moreover, this motif is related to the consensus binding sequence of NF-kappa B, a transcription factor which is known to be regulated by LPS. Images PMID:2388619

  7. Glyceraldehyde-3-phosphate dehydrogenase gene from Zymomonas mobilis: cloning, sequencing, and identification of promoter region

    SciTech Connect

    Conway, T.; Sewell, G.W.; Ingram, L.O.


    The gene encoding glyceraldehyde-3-phosphate dehydrogenase was isolated from a library of Zymomonas mobilis DNA fragments by complementing a deficient strain of Escherichia coli. It contained tandem promoters which were recognized by E. coli but appeared to function less efficiently than the enteric lac promoter in E. coli. The open reading frame for this gene encoded 337 amino acids with an aggregate molecular weight of 36,099 (including the N-terminal methionine). The primary amino acid sequence for this gene had considerable functional homology and amino acid identity with other eukaryotic and bacterial genes. Based on this comparison, the gap gene from Z. mobilis appeared to be most closely related to that of the thermophilic bacteria and to the chloroplast isozymes. Comparison of this gene with other glycolytic enzymes from Z. mobilis revealed a conserved pattern of codon bias and several common features of gene structure. A tentative transcriptional consensus sequence is proposed for Z. mobilis based on comparison of the five known promoters for three glycolytic enzymes.

  8. The cauliflower mosaic virus (CaMV) 35S promoter sequence alters the level and patterns of activity of adjacent tissue- and organ-specific gene promoters.


    Zheng, Xuelian; Deng, Wei; Luo, Keming; Duan, Hui; Chen, Yongqin; McAvoy, Richard; Song, Shuiqing; Pei, Yan; Li, Yi


    Here we report the effect of the 35S promoter sequence on activities of the tissue- and organ-specific gene promoters in tobacco plants. In the absence of the 35S promoter sequence the AAP2 promoter is active only in vascular tissues as indicated by expression of the AAP2:GUS gene. With the 35S promoter sequence in the same T-plasmid, transgenic plants exhibit twofold to fivefold increase in AAP2 promoter activity and the promoter becomes active in all tissue types. Transgenic plants hosting the ovary-specific AGL5:iaaM gene (iaaM coding an auxin biosynthetic gene) showed a wild-type phenotype except production of seedless fruits, whereas plants hosting the AGL5:iaaM gene along with the 35S promoter sequence showed drastic morphological alterations. RT-PCR analysis confirms that the phenotype was caused by activation of the AGL5:iaaM gene in non-ovary organs including roots, stems and flowers. When the pollen-, ovule- and early embryo-specific PAB5:barnase gene (barnase coding a RNase gene) was transformed, the presence of 35S promoter sequence drastically reduced transformation efficiencies. However, the transformation efficiencies were restored in the absence of 35S promoter, indicating that the 35S promoter might activate the expression of PAB5:barnase in non-reproductive organs such as calli and shoot primordia. Furthermore, if the 35S promoter sequence was replaced with the NOS promoter sequence, no alteration in AAP2, AGL5 or PAB5 promoter activities was observed. Our results demonstrate that the 35S promoter sequence can convert an adjacent tissue- and organ-specific gene promoter into a globally active promoter. PMID:17340093

  9. Genome-wide discovery of cis-elements in promoter sequences using gene expression.


    Troukhan, Maxim; Tatarinova, Tatiana; Bouck, John; Flavell, Richard B; Alexandrov, Nickolai N


    The availability of complete or nearly complete genome sequences, a large number of 5' expressed sequence tags, and significant public expression data allow for a more accurate identification of cis-elements regulating gene expression. We have implemented a global approach that takes advantage of available expression data, genomic sequences, and transcript information to predict cis-elements associated with specific expression patterns. The key components of our approach are: (1) precise identification of transcription start sites, (2) specific locations of cis-elements relative to the transcription start site, and (3) assessment of statistical significance for all sequence motifs. By applying our method to promoters of Arabidopsis thaliana and Mus musculus, we have identified motifs that affect gene expression under specific environmental conditions or in certain tissues. We also found that the presence of the TATA box is associated with increased variability of gene expression. Strong correlation between our results and experimentally determined motifs shows that the method is capable of predicting new functionally important cis-elements in promoter sequences. PMID:19231992

  10. Over-represented localized sequence motifs in ribosomal protein gene promoters of basal metazoans.


    Perina, Drago; Korolija, Marina; Roller, Maša; Harcet, Matija; Jeličić, Branka; Mikoč, Andreja; Cetković, Helena


    Equimolecular presence of ribosomal proteins (RPs) in the cell is needed for ribosome assembly and is achieved by synchronized expression of ribosomal protein genes (RPGs) with promoters of similar strengths. Over-represented motifs of RPG promoter regions are identified as targets for specific transcription factors. Unlike RPs, those motifs are not conserved between mammals, drosophila, and yeast. We analyzed RPGs proximal promoter regions of three basal metazoans with sequenced genomes: sponge, cnidarian, and placozoan and found common features, such as 5'-terminal oligopyrimidine tracts and TATA-boxes. Furthermore, we identified over-represented motifs, some of which displayed the highest similarity to motifs abundant in human RPG promoters and not present in Drosophila or yeast. Our results indicate that humans over-represented motifs, as well as corresponding domains of transcription factors, were established very early in metazoan evolution. The fast evolving nature of RPGs regulatory network leads to formation of other, lineage specific, over-represented motifs. PMID:21457775

  11. Allelic mutations in noncoding genomic sequences construct novel transcription factor binding sites that promote gene overexpression.


    Tian, Erming; Børset, Magne; Sawyer, Jeffrey R; Brede, Gaute; Våtsveen, Thea K; Hov, Håkon; Waage, Anders; Barlogie, Bart; Shaughnessy, John D; Epstein, Joshua; Sundan, Anders


    The growth and survival factor hepatocyte growth factor (HGF) is expressed at high levels in multiple myeloma (MM) cells. We report here that elevated HGF transcription in MM was traced to DNA mutations in the promoter alleles of HGF. Sequence analysis revealed a previously undiscovered single-nucleotide polymorphism (SNP) and crucial single-nucleotide variants (SNVs) in the promoters of myeloma cells that produce large amounts of HGF. The allele-specific mutations functionally reassembled wild-type sequences into the motifs that affiliate with endogenous transcription factors NFKB (nuclear factor kappa-B), MZF1 (myeloid zinc finger 1), and NRF-2 (nuclear factor erythroid 2-related factor 2). In vitro, a mutant allele that gained novel NFKB-binding sites directly responded to transcriptional signaling induced by tumor necrosis factor alpha (TNFα) to promote high levels of luciferase reporter. Given the recent discovery by genome-wide sequencing (GWS) of numerous non-coding mutations in myeloma genomes, our data provide evidence that heterogeneous SNVs in the gene regulatory regions may frequently transform wild-type alleles into novel transcription factor binding properties to aberrantly interact with dysregulated transcriptional signals in MM and other cancer cells. PMID:26220195

  12. Control of gene conversion and somatic hypermutation by immunoglobulin promoter and enhancer sequences.


    Yang, Shu Yuan; Fugmann, Sebastian D; Schatz, David G


    It is thought that gene conversion (GCV) and somatic hypermutation (SHM) of immunoglobulin (Ig) genes occur in two steps: the generation of uracils in DNA by activation-induced cytidine deaminase, followed by their subsequent repair by various DNA repair pathways to generate sequence-diversified products. It is not known how either of the two steps is targeted specifically to Ig loci. Because of the tight link between transcription and SHM, we have investigated the role of endogenous Ig light chain (IgL) transcriptional control elements in GCV/SHM in the chicken B cell line DT40. Promoter substitution experiments led to identification of a strong RNA polymerase II promoter incapable of supporting efficient GCV/SHM. This surprising finding indicates that high levels of transcription are not sufficient for robust GCV/SHM in Ig loci. Deletion of the IgL enhancer in a context in which high-level transcription was not compromised showed that the enhancer is not necessary for GCV/SHM. Our results indicate that cis-acting elements are important for Ig gene diversification, and we propose that targeting specificity is achieved through the combined action of several Ig locus elements that include the promoter. PMID:17178919

  13. Genetic and Functional Sequence Variants of the SIRT3 Gene Promoter in Myocardial Infarction

    PubMed Central

    Yin, Xiaoyun; Pang, Shuchao; Huang, Jian; Cui, Yinghua; Yan, Bo


    Coronary artery disease (CAD), including myocardial infarction (MI), is a common complex disease that is caused by atherosclerosis. Although a large number of genetic variants have been associated with CAD, only 10% of CAD cases could be explained. It has been proposed that low frequent and rare genetic variants may be main causes for CAD. SIRT3, a mitochondrial deacetylase, plays important roles in mitochondrial function and metabolism. Lack of SIRT3 in experimental animal leads to several age-related diseases, including cardiovascular diseases. Therefore, SIRT3 gene variants may contribute to the MI development. In this study, SIRT3 gene promoter was genetically and functionally analyzed in large cohorts of MI patients (n = 319) and ethnic-matched controls (n = 322). Total twenty-three DNA sequence variants (DSVs) were identified, including 10 single-nucleotide polymorphisms (SNPs). Six novel heterozygous DSVs, g.237307A>G, g.237270G>A, g.237023_25del, g.236653C>A, g.236628G>C, g.236557T>C, and two SNPs g.237030C>T (rs12293349) and g.237022C>G (rs369344513), were identified in nine MI patients, but in none of controls. Three SNPs, g.236473C>T (rs11246029), g.236380_81ins (rs71019893) and g.236370C>G (rs185277566), were more significantly frequent in MI patients than controls (P<0.05). These DSVs and SNPs, except g.236557T>C, significantly decreased the transcriptional activity of the SIRT3 gene promoter in cultured HEK-293 cells and H9c2 cells. Therefore, these DSVs identified in MI patients may change SIRT3 level by affecting the transcriptional activity of SIRT3 gene promoter, contributing to the MI development as a risk factor. PMID:27078640

  14. A gene-specific non-enhancer sequence is critical for expression from the promoter of the small heat shock protein gene αB-crystallin

    PubMed Central


    Background Deciphering of the information content of eukaryotic promoters has remained confined to universal landmarks and conserved sequence elements such as enhancers and transcription factor binding motifs, which are considered sufficient for gene activation and regulation. Gene-specific sequences, interspersed between the canonical transacting factor binding sites or adjoining them within a promoter, are generally taken to be devoid of any regulatory information and have therefore been largely ignored. An unanswered question therefore is, do gene-specific sequences within a eukaryotic promoter have a role in gene activation? Here, we present an exhaustive experimental analysis of a gene-specific sequence adjoining the heat shock element (HSE) in the proximal promoter of the small heat shock protein gene, αB-crystallin (cryab). These sequences are highly conserved between the rodents and the humans. Results Using human retinal pigment epithelial cells in culture as the host, we have identified a 10-bp gene-specific promoter sequence (GPS), which, unlike an enhancer, controls expression from the promoter of this gene, only when in appropriate position and orientation. Notably, the data suggests that GPS in comparison with the HSE works in a context-independent fashion. Additionally, when moved upstream, about a nucleosome length of DNA (−154 bp) from the transcription start site (TSS), the activity of the promoter is markedly inhibited, suggesting its involvement in local promoter access. Importantly, we demonstrate that deletion of the GPS results in complete loss of cryab promoter activity in transgenic mice. Conclusions These data suggest that gene-specific sequences such as the GPS, identified here, may have critical roles in regulating gene-specific activity from eukaryotic promoters. PMID:24589182

  15. Using a Solver Over the String Pattern Domain to Analyze Gene Promoter Sequences

    NASA Astrophysics Data System (ADS)

    Rigotti, Christophe; Mitašiūnaitė, Ieva; Besson, Jérémy; Meyniel, Laurène; Boulicaut, Jean-François; Gandrillon, Olivier

    This chapter illustrates how inductive querying techniques can be used to support knowledge discovery from genomic data. More precisely, it presents a data mining scenario to discover putative transcription factor binding sites in gene promoter sequences. We do not provide technical details about the used constraintbased data mining algorithms that have been previously described. Our contribution is to provide an abstract description of the scenario, its concrete instantiation and also a typical execution on real data. Our main extraction algorithm is a complete solver dedicated to the string pattern domain: it computes string patterns that satisfy a given conjunction of primitive constraints. We also discuss the processing steps necessary to turn it into a useful tool. In particular, we introduce a parameter tuning strategy, an appropriate measure to rank the patterns, and the post-processing approaches that can be and have been applied.

  16. The nucleotide sequence of the promoter region of hisS, the structural gene for histidyl-tRNA synthetase.


    Eisenbeis, S J; Parker, J


    A plasmid has been constructed which carries hisS, the structural gene for histidyl-RNA synthetase of E. coli, on a 1.6-kb fragment bounded by PvuII and BstEII sites. The DNA sequence of both ends of this fragment was determined. The amino-terminal sequence of histidyl-tRNA synthetase was also determined to locate the promoter proximal coding region and the frame in which it is read. Three promoters were identified by consensus criteria. The region surrounding these promoters contains extensive twofold symmetry. PMID:6290315

  17. Comparisons of Ribosomal Protein Gene Promoters Indicate Superiority of Heterologous Regulatory Sequences for Expressing Transgenes in Phytophthora infestans

    PubMed Central

    Khachatoorian, Careen; Judelson, Howard S.


    Molecular genetics approaches in Phytophthora research can be hampered by the limited number of known constitutive promoters for expressing transgenes and the instability of transgene activity. We have therefore characterized genes encoding the cytoplasmic ribosomal proteins of Phytophthora and studied their suitability for expressing transgenes in P. infestans. Phytophthora spp. encode a standard complement of 79 cytoplasmic ribosomal proteins. Several genes are duplicated, and two appear to be pseudogenes. Half of the genes are expressed at similar levels during all stages of asexual development, and we discovered that the majority share a novel promoter motif named the PhRiboBox. This sequence is enriched in genes associated with transcription, translation, and DNA replication, including tRNA and rRNA biogenesis. Promoters from the three P. infestans genes encoding ribosomal proteins S9, L10, and L23 and their orthologs from P. capsici were tested for their ability to drive transgenes in stable transformants of P. infestans. Five of the six promoters yielded strong expression of a GUS reporter, but the stability of expression was higher using the P. capsici promoters. With the RPS9 and RPL10 promoters of P. infestans, about half of transformants stopped making GUS over two years of culture, while their P. capsici orthologs conferred stable expression. Since cross-talk between native and transgene loci may trigger gene silencing, we encourage the use of heterologous promoters in transformation studies. PMID:26716454

  18. Induction and maintenance of DNA methylation in plant promoter sequences by apple latent spherical virus-induced transcriptional gene silencing.


    Kon, Tatsuya; Yoshikawa, Nobuyuki


    Apple latent spherical virus (ALSV) is an efficient virus-induced gene silencing vector in functional genomics analyses of a broad range of plant species. Here, an Agrobacterium-mediated inoculation (agroinoculation) system was developed for the ALSV vector, and virus-induced transcriptional gene silencing (VITGS) is described in plants infected with the ALSV vector. The cDNAs of ALSV RNA1 and RNA2 were inserted between the cauliflower mosaic virus 35S promoter and the NOS-T sequences in a binary vector pCAMBIA1300 to produce pCALSR1 and pCALSR2-XSB or pCALSR2-XSB/MN. When these vector constructs were agroinoculated into Nicotiana benthamiana plants with a construct expressing a viral silencing suppressor, the infection efficiency of the vectors was 100%. A recombinant ALSV vector carrying part of the 35S promoter sequence induced transcriptional gene silencing of the green fluorescent protein gene in a line of N. benthamiana plants, resulting in the disappearance of green fluorescence of infected plants. Bisulfite sequencing showed that cytosine residues at CG and CHG sites of the 35S promoter sequence were highly methylated in the silenced generation zero plants infected with the ALSV carrying the promoter sequence as well as in progeny. The ALSV-mediated VITGS state was inherited by progeny for multiple generations. In addition, induction of VITGS of an endogenous gene (chalcone synthase-A) was demonstrated in petunia plants infected with an ALSV vector carrying the native promoter sequence. These results suggest that ALSV-based vectors can be applied to study DNA methylation in plant genomes, and provide a useful tool for plant breeding via epigenetic modification. PMID:25426109

  19. Study of promoter and structural gene sequence of whiB7 in MDR and XDR forms of Mycobacterium tuberculosis.


    Arjomandzadegan, M; Sadrnia, M; Surkova, L K; Titov, L P


    Resistance phenomenon in M tuberculosis is mainly based on decreased permeability of the bacterial envelope and function of effluent pumps. The regulatory gene of the whiB7 transcription determines drug resistance in these bacteria. Increases in WhiB7 protein activity induce transcription of resistance genes leading to intrinsic multidrug resistance. The aim of this work was to evaluate the whiB7 gene sequence in susceptible, MDR and XDR clinical isolates of M tuberculosis in order to further design an inhibitor. Thirty-three clinical isolates of MTB identified as susceptible, MDR and XDR-TB were investigated by PCR for sequencing of the entire promoter (429 bp), structural gene (279 bp) and the end of the upstream gene uvrD (265 bp). No differences were detected in the sequences of the structural gene in susceptible and MDR with XDR isolates and all of them terminated at TGA as stop codon. Examination of sequence profiles of the promoter part of whiB7 by several sets of primers proved that there were no differences between sequence of susceptible, MDR and XDR isolates by type strain (H37Rr). Furthermore, the structure of WhiB7 protein was studied in achieved sequences from clinical isolates. We found that the promoter and structural gene of whiB7 are highly conservative in clinical susceptible and resistant isolates. It is a key finding that would assist in the design of an inhibitor for the WhiB7 protein in all clinical forms in further studies. PMID:22224334

  20. Sequences contained within the promoter of the human thymidine kinase gene can direct cell-cycle regulation of heterologous fusion genes.

    PubMed Central

    Kim, Y K; Wells, S; Lau, Y F; Lee, A S


    Recent evidence on the transcriptional regulation of the human thymidine kinase (TK) gene raises the possibility that cell-cycle regulatory sequences may be localized within its promoter. A hybrid gene that combines the TK 5' flanking sequence and the coding region of the bacterial neomycin-resistance gene (neo) has been constructed. Upon transfection into a hamster fibroblast cell line K12, the hybrid gene exhibits cell-cycle-dependent expression. Deletion analysis reveals that the region important for cell-cycle regulation is within -441 to -63 nucleotides from the transcriptional initiation site. This region (-441 to -63) also confers cell-cycle regulation to the herpes simplex virus thymidine kinase (HSVtk) promoter, which is not expressed in a cell-cycle manner. We conclude that the -441 to -63 sequence within the human TK promoter is important for cell-cycle-dependent expression. Images PMID:3413063

  1. Isolation and sequencing of a putative promoter region of the murine G protein beta 1 subunit (GNB1) gene.


    Kitanaka, Junichi; Kitanaka, Nobue; Takemura, Motohiko; Wang, Xiao-Bing; Hembree, Cambria M; Goodman, Nancy L; Uhl, George R


    The expression of the heterotrimeric GTP-binding protein beta 1 subunit gene (GNB1) is regulated by psychostimulants such as cocaine and amphetamines. Since the up-regulation appears to be one of the candidate processes of sensitization, it is necessary to elucidate the cellular and molecular mechanism of the GNB1 gene regulation for a better understanding the establishment of sensitization. In the present study, we describe the isolation and nucleotide sequence analysis of the GNB1 gene promoter region. We have isolated approximately 10 kb of the 5'-flanking region of the mouse of GNB1 gene and found potential elements involved in putative transcriptional control of the GNB1, such as AP1, AP2, Sp1, cyclic AMP response element, and nuclear factor kappa B recognition sites, within the sequences 0.3 kb upstream from the putative transcription start site. This region was highly rich in G + C content, but lacked TATA or CATT boxes. Comparing the nucleotide sequence of the cDNA clone with the human genome databases using the BLAST program a region containing putative exon 1 and promoter of the human GNB1 gene in chromosome 1 was found. The cloning and sequence analysis of an extensive portion of the 5'-flanking regulatory region of the GNB1 gene provides new insights into the factors involved in the regulation by psychostimulants of GNB1 expression. PMID:12180136

  2. A genome-wide cis-regulatory element discovery method based on promoter sequences and gene co-expression networks

    PubMed Central


    Background Deciphering cis-regulatory networks has become an attractive yet challenging task. This paper presents a simple method for cis-regulatory network discovery which aims to avoid some of the common problems of previous approaches. Results Using promoter sequences and gene expression profiles as input, rather than clustering the genes by the expression data, our method utilizes co-expression neighborhood information for each individual gene, thereby overcoming the disadvantages of current clustering based models which may miss specific information for individual genes. In addition, rather than using a motif database as an input, it implements a simple motif count table for each enumerated k-mer for each gene promoter sequence. Thus, it can be used for species where previous knowledge of cis-regulatory motifs is unknown and has the potential to discover new transcription factor binding sites. Applications on Saccharomyces cerevisiae and Arabidopsis have shown that our method has a good prediction accuracy and outperforms a phylogenetic footprinting approach. Furthermore, the top ranked gene-motif regulatory clusters are evidently functionally co-regulated, and the regulatory relationships between the motifs and the enriched biological functions can often be confirmed by literature. Conclusions Since this method is simple and gene-specific, it can be readily utilized for insufficiently studied species or flexibly used as an additional step or data source for previous transcription regulatory networks discovery models. PMID:23368633

  3. The lgtABCDE gene cluster, involved in lipooligosaccharide biosynthesis in Neisseria gonorrhoeae, contains multiple promoter sequences.


    Braun, Derek C; Stein, Daniel C


    Biosynthesis of the variable core domain of lipooligosaccharide (LOS) in Neisseria gonorrhoeae is mediated by glycosyl transferases encoded by lgtABCDE. Changes within homopolymeric runs within lgtA, lgtC, and lgtD affect the expression state of these genes, with the nature of the LOS expressed determined by the functionality of these genes. However, the mechanism for modulating the amount of multiple LOS chemotypes expressed in a single cell is not understood. Using mutants containing polar disruptions within the lgtABCDE locus, we determined that the expression of this locus is mediated by multiple promoters and that disruption of transcription from these promoters alters the relative levels of simultaneously expressed LOS chemotypes. Expression of the lgtABCDE locus was quantified by using xylE transcriptional fusions, and the data indicate that this locus is transcribed in trace amounts and that subtle changes in transcription result in phenotypic changes. By using rapid amplification of 5' cDNA ends, transcriptional start sites and promoter sequences were identified within lgtABCDE. Most of these promoters possessed 50 to 67% homology with the consensus gearbox promoter sequence of Escherichia coli. PMID:14761998

  4. Genomic structure analysis of promoter sequence of a mouse mu opioid receptor gene.

    PubMed Central

    Min, B H; Augustin, L B; Felsheim, R F; Fuchs, J A; Loh, H H


    We have isolated mouse mu opioid receptor genomic clones (termed MOR) containing the entire amino acid coding sequence corresponding to rat MOR-1 cDNA, including additional 5' flanking sequence. The mouse MOR gene is > 53 kb long, and the coding sequence is divided by three introns, with exon junctions in codons 95 and 213 and between codons 386 and 387. The first intron is > 26 kb, the second is 0.8 kb, and the third is > 12 kb. Multiple transcription initiation sites were observed, with four major sites confirmed by 5' rapid amplification of cDNA ends and RNase protection located between 291 and 268 bp upstream of the translation start codon. Comparison of the 5' flanking sequence with a transcription factor database revealed putative cis-acting regulatory elements for transcription factors affected by cAMP, as well as those involved in the action of gluco- and mineralocorticoids, cytokines, and immune-cell-specific factors. Images PMID:8090773

  5. Regulation of vitellogenin gene expression in transgenic Caenorhabditis elegans: short sequences required for activation of the vit-2 promoter.

    PubMed Central

    MacMorris, M; Broverman, S; Greenspoon, S; Lea, K; Madej, C; Blumenthal, T; Spieth, J


    The Caenorhabditis elegans vitellogenin genes are subject to sex-, stage-, and tissue-specific regulation: they are expressed solely in the adult hermaphrodite intestine. Comparative sequence analysis of the DNA immediately upstream of these genes revealed the presence of two repeated heptameric elements, vit promoter element 1 (VPE1) and VPE2. VPE1 has the consensus sequence TGTCAAT, while VPE2, CTGATAA, shares the recognition sequence of the GATA family of transcription factors. We report here a functional analysis of the VPEs within the 5'-flanking region of the vit-2 gene using stable transgenic lines. The 247 upstream bp containing the VPEs was sufficient for high-level, regulated expression. Furthermore, none of the four deletion mutations or eight point mutations tested resulted in expression of the reporter gene in larvae, males, or inappropriate hermaphrodite tissues. Mutation of the VPE1 closest to the TATA box inactivated the promoter, in spite of the fact that four additional close matches to the VPE1 consensus sequence are present within the 5'-flanking 200 bp. Each of these upstream VPE1-like sequences could be mutated without loss of high-level transgene expression, suggesting that if these VPE1 sequences play a role in regulating vit-2, their effects are more subtle. A site-directed mutation in the overlapping VPE1 and VPE2 at -98 was sufficient to inactivate the promoter, indicating that one or both of these VPEs must be present for activation of vit-2 transcription. Similarly, a small perturbation of the VPE2 at -150 resulted in reduction of fp155 expression, while a more extensive mutation in this element eliminated expression. On the other hand, deletion of this VPE2 and all upstream DNA still permitted correctly regulated expression, although at a very low level, suggesting that this VPE2 performs an important role in activation of vit-2 expression but may not be absolutely required. The results, taken together, demonstrate that both VPE1 and

  6. Regulation of vitellogenin gene expression in transgenic Caenorhabditis elegans: short sequences required for activation of the vit-2 promoter.


    MacMorris, M; Broverman, S; Greenspoon, S; Lea, K; Madej, C; Blumenthal, T; Spieth, J


    The Caenorhabditis elegans vitellogenin genes are subject to sex-, stage-, and tissue-specific regulation: they are expressed solely in the adult hermaphrodite intestine. Comparative sequence analysis of the DNA immediately upstream of these genes revealed the presence of two repeated heptameric elements, vit promoter element 1 (VPE1) and VPE2. VPE1 has the consensus sequence TGTCAAT, while VPE2, CTGATAA, shares the recognition sequence of the GATA family of transcription factors. We report here a functional analysis of the VPEs within the 5'-flanking region of the vit-2 gene using stable transgenic lines. The 247 upstream bp containing the VPEs was sufficient for high-level, regulated expression. Furthermore, none of the four deletion mutations or eight point mutations tested resulted in expression of the reporter gene in larvae, males, or inappropriate hermaphrodite tissues. Mutation of the VPE1 closest to the TATA box inactivated the promoter, in spite of the fact that four additional close matches to the VPE1 consensus sequence are present within the 5'-flanking 200 bp. Each of these upstream VPE1-like sequences could be mutated without loss of high-level transgene expression, suggesting that if these VPE1 sequences play a role in regulating vit-2, their effects are more subtle. A site-directed mutation in the overlapping VPE1 and VPE2 at -98 was sufficient to inactivate the promoter, indicating that one or both of these VPEs must be present for activation of vit-2 transcription. Similarly, a small perturbation of the VPE2 at -150 resulted in reduction of fp155 expression, while a more extensive mutation in this element eliminated expression. On the other hand, deletion of this VPE2 and all upstream DNA still permitted correctly regulated expression, although at a very low level, suggesting that this VPE2 performs an important role in activation of vit-2 expression but may not be absolutely required. The results, taken together, demonstrate that both VPE1 and

  7. Breast cancer gene therapy using an adenovirus encoding human IL-2 under control of mammaglobin promoter/enhancer sequences.


    Chaurasiya, S; Hew, P; Crosley, P; Sharon, D; Potts, K; Agopsowicz, K; Long, M; Shi, C; Hitt, M M


    Interleukin-2 (IL-2) has been used clinically for the treatment of some malignancies, but the toxicities associated with systemic IL-2 therapy are a major challenge. Here we have determined whether transcriptional targeting of IL-2 to breast cancer (BrCa) using an engineered human mammaglobin promoter/enhancer (MPE2) is a feasible option for reducing IL-2-associated toxicities while still achieving a meaningful antitumor effect. We have constructed nonreplicating adenovirus vectors encoding either a reporter gene (luciferase) or human IL-2 (hIL-2) complementary DNA under control of the MPE2 sequence, the murine cytomegalovirus immediate early (MCMV) promoter or the human telomerase reverse transcriptase (hTERT) promoter. Luciferase and hIL-2 complementary DNAs under the control of the MPE2 sequence in adenovirus vectors were expressed at high levels in BrCa cells and at lower levels in normal cells of human and murine origin. Cancer specificity of the hTERT promoter was found to be similar to that of the MPE2 promoter in cells of human origin, but reduced specificity in murine cells. The MPE2 regulatory sequence demonstrated excellent tissue specificity in a mouse tumor model. Whereas the MCMV promoter-controlled IL-2 vector generated high liver toxicity in mice, the MPE2-controlled IL-2 vector generated little or no liver toxicity. Both IL-2 vectors exerted significant tumor growth delay; however, attempts to further enhance antitumor activity of the IL-2 vectors by combining with the proapoptotic drug procaspase activating compound 1 (PAC1) were unsuccessful. PMID:27151235

  8. Regulated expression of the human cytomegalovirus pp65 gene: Octamer sequence in the promoter is required for activation by viral gene products

    SciTech Connect

    Depto, A.S.; Stenberg, R.M.


    To better understand the regulation of late gene expression in human cytomegalovirus (CMV)-infected cells, the authors examined expression of the gene that codes for the 65-kilodalton lower-matrix phosphoprotein (pp65). Analysis of RNA isolated at 72 h from cells infected with CMV Towne or ts66, a DNA-negative temperature-sensitive mutant, supported the fact that pp65 is expressed at low levels prior to viral DNA replication but maximally expressed after the initiation of viral DNA replication. To investigate promoter activation in a transient expression assay, the pp65 promoter was cloned into the indicator plasmid containing the gene for chloramphenicol acetyltransferase (CAT). Transfection of the promoter-CAT construct and subsequent superinfection with CMV resulted in activation of the promoter at early times after infection. Cotransfection with plasmids capable of expressing immediate-early (IE) proteins demonstrated that the promoter was activated by IE proteins and that both IE regions 1 and 2 were necessary. These studies suggest that interactions between IE proteins and this octamer sequence may be important for the regulation and expression of this CMV gene.

  9. Association between a polymorphic poly-T repeat sequence in the promoter of the somatostatin gene and hypertension.


    Tremblay, Monique; Brisson, Diane; Gaudet, Daniel


    Despite the numerous common pathways connecting blood pressure regulation to somatostatin (SST) metabolism, the SST gene has never been seen as a significant blood pressure modulator. The aim of this study was to evaluate the association between a poly-T repeat sequence (rs34872250) in the promoter of the SST gene and blood pressure, according to the obesity status. We genotyped 1918 French-Canadian subjects from a founder population. Analyses were performed according to the length of the poly-T repeat sequence on both alleles and divided into two groups, the 13/13-13/14 group and the 13/15-13/16 group. The effect of age, gender, body mass index, antihypertensive drugs and diabetic status were considered. Systolic, diastolic and mean blood pressures are significantly higher among the 13/15-13/16 group in the whole sample (P<0.05). Whereas the differences remain significant in women, they turn to be non-significant when men are considered alone. The risk of hypertension is increased in the 13/15-13/16 group, particularly among overweight/obese subjects. Systolic blood pressure is significantly higher among overweight/obese carriers of the 13/15-13/16 alleles in the whole sample (P<0.001), in men (P=0.006) and in women (P=0.002), even after correction for age and antihypertensive drugs. These results suggest that the poly-T repeat sequence polymorphism in the promoter of the SST gene is associated with significant variations of blood pressure and could modulate the risk of hypertension, particularly among women. PMID:26818653

  10. Identification of Promoter Motifs Involved in the Network of Phytochrome A-Regulated Gene Expression by Combined Analysis of Genomic Sequence and Microarray Data1[w

    PubMed Central

    Hudson, Matthew E.; Quail, Peter H.


    Several hundred Arabidopsis genes, transcriptionally regulated by phytochrome A (phyA), were previously identified using an oligonucleotide microarray. We have now identified, in silico, conserved sequence motifs in the promoters of these genes by comparing the promoter sequences to those of all the genes present on the microarray from which they were sampled. This was done using a Perl script (called Sift) that identifies over-represented motifs using an enumerative approach. The utility of Sift was verified by analysis of circadian-regulated promoters known to contain a biologically significant motif. Several elements were then identified in phyA-responsive promoters by their over-representation. Five previously undescribed motifs were detected in the promoters of phyA-induced genes. Four novel motifs were found in phyA-repressed promoters, plus a motif that strongly resembles the DE1 element. The G-box, CACGTG, was a prominent hit in both induced and repressed phyA-responsive promoters. Intriguingly, two distinct flanking consensus sequences were observed adjacent to the G-box core sequence: one predominating in phyA-induced promoters, the other in phyA-repressed promoters. Such different conserved flanking nucleotides around the core motif in these two sets of promoters may indicate that different members of the same family of DNA-binding proteins mediate phyA induction and repression. An increased abundance of G-box sequences was observed in the most rapidly phyA-responsive genes and in the promoters of phyA-regulated transcription factors, indicating that G-box-binding transcription factors are upstream components in a transcriptional cascade that mediates phyA-regulated development. PMID:14681527

  11. Capture and identification of proteins that bind to a GGA-rich sequence from the ERBB2 gene promoter region.


    Zhang, Tian; Zhang, Huiping; Wang, Yuexi; McGown, Linda B


    The ERBB2 gene (HER2/neu) is overexpressed in many human breast cancers. It is an important therapeutic target and its product protein is a key biomarker for breast cancer. A 28-bp GGA repeat sequence (Pu28-mer) in the nuclease hypersensitive site of the ERBB2 promoter region may play an important role in the regulation of ERBB2 transcription, possibly involving the formation of a G-quadruplex. In order to investigate this possibility, an affinity MALDI-MS approach was used for in vitro protein capture from nuclear extracts from cultured MCF-7 and BT-474 cancer cells at Pu28-mer and control oligonucleotide-modified surfaces. Captured proteins from MCF-7 cells were analyzed by LC-MS/MS. Based on these results, Western blot was then used to interrogate captured proteins from both MCF-7 and the Her-2/neu-positive BT-474 cells. Results support the formation of a G-quadruplex by Pu28-mer, indicated by circular dichroism spectroscopy, that selectively captures transcription factors including Ku70, Ku80, PURA, nucleolin, and hnRNP K. Chromatin immunoprecipitation confirmed binding of Ku70, Ku80, PURA, and nucleolin to ERBB2 promoter in the live BT-474 cells. These findings may lead to a better understanding of the role of non-duplex DNA structures in gene regulation and provide a more complete picture of the regulation of ErbB2 expression in breast cancer. The results also provide a blueprint for development of "genome-inspired" aptamers based on the Pu28-mer sequence for in vitro and in vivo detection of proteins related to regulation of ERBB2 gene expression and breast cancer. PMID:22899247

  12. The Promoter of a Lysosomal Membrane Transporter Gene, CTNS, Binds Sp-1, Shares Sequences with the Promoter of an Adjacent Gene, CARKL, and Causes Cystinosis If Mutated in a Critical Region

    PubMed Central

    Phornphutkul, Chanika; Anikster, Yair; Huizing, Marjan; Braun, Paula; Brodie, Chaya; Chou, Janice Y.; Gahl, William A.


    Although >55 CTNS mutations occur in patients with the lysosomal storage disorder cystinosis, no regulatory mutations have been reported, because the promoter has not been defined. Using CAT reporter constructs of sequences 5′ to the CTNS coding sequence, we identified the CTNS promoter as the region encompassing nucleotides −316 to +1 with respect to the transcription start site. This region contains an Sp-1 regulatory element (GGCGGCG) at positions −299 to −293, which binds authentic Sp-1, as shown by electrophoretic-mobility–shift assays. Three patients exhibited mutations in the CTNS promoter. One patient with nephropathic cystinosis carried a −295 G→C substitution disrupting the Sp-1 motif, whereas two patients with ocular cystinosis displayed a −303 G→T substitution in one case and a −303 T insertion in the other case. Each mutation drastically reduced CAT activity when inserted into a reporter construct. Moreover, each failed either to cause a mobility shift when exposed to nuclear extract or to compete with the normal oligonucleotide’s mobility shift. The CTNS promoter region shares 41 nucleotides with the promoter region of an adjacent gene of unknown function, CARKL, whose start site is 501 bp from the CTNS start site. However, the patients’ CTNS promoter mutations have no effect on CARKL promoter activity. These findings suggest that the CTNS promoter region should be examined in patients with cystinosis who have fewer than two coding-sequence mutations. PMID:11505338

  13. Detailed analysis of Helicobacter pylori Fur-regulated promoters reveals a Fur box core sequence and novel Fur-regulated genes.


    Pich, Oscar Q; Carpenter, Beth M; Gilbreath, Jeremy J; Merrell, D Scott


    In Helicobacter pylori, iron balance is controlled by the Ferric uptake regulator (Fur), an iron-sensing repressor protein that typically regulates expression of genes implicated in iron transport and storage. Herein, we carried out extensive analysis of Fur-regulated promoters and identified a 7-1-7 motif with dyad symmetry (5'-TAATAATnATTATTA-3'), which functions as the Fur box core sequence of H. pylori. Addition of this sequence to the promoter region of a typically non-Fur regulated gene was sufficient to impose Fur-dependent regulation in vivo. Moreover, mutation of this sequence within Fur-controlled promoters negated regulation. Analysis of the H. pylori chromosome for the occurrence of the Fur box established the existence of well-conserved Fur boxes in the promoters of numerous known Fur-regulated genes, and revealed novel putative Fur targets. Transcriptional analysis of the new candidate genes demonstrated Fur-dependent repression of HPG27_51, HPG27_52, HPG27_199, HPG27_445, HPG27_825 and HPG27_1063, as well as Fur-mediated activation of the cytotoxin associated gene A, cagA (HPG27_507). Furthermore, electrophoretic mobility shift assays confirmed specific binding of Fur to the promoters of each of these genes. Future experiments will determine whether loss of Fur regulation of any of these particular genes contributes to the defects in colonization exhibited by the H. pylori fur mutant. PMID:22507395

  14. Nucleotide sequence and in vivo expression of the ilvY and ilvC genes in Escherichia coli K12. Transcription from divergent overlapping promoters.


    Wek, R C; Hatfield, G W


    The ilvC gene of Escherichia coli K12 encodes acetohydroxy acid isomeroreductase, the second enzyme in the parallel isoleucine-valine biosynthetic pathway. Previous data have shown that transcription of the ilvC gene is induced by the acetohydroxy acid isomeroreductase substrates, acetohydroxybutyrate or acetolactate, and that this substrate induction of ilvC expression is mediated by a positive activator encoded by the ilvY gene. We report here the isolation and complete nucleotide sequence of the ilvY and ilvC genes. The ilvY and ilvC genes encode polypeptides of Mr 33,200 and 54,000, respectively. In vitro transcription-translation of these gene templates results in the synthesis of gene products of these identical molecular weights. The ilvC gene is transcribed in the same direction as the genes of the adjacent ilvGMEDA operon. The ilvY gene is transcribed in a direction opposite to the ilvC and ilvGMEDA genes. The in vivo transcriptional initiation sites of the ilvY and ilvC genes have been determined by S1 nuclease protection experiments. These transcriptional initiation sites are 45 nucleotides apart, and transcription of the ilvY and ilvC genes is initiated via divergent overlapping promoters. The nucleotide sequence of the ilvY and ilvC promoters and 5'-coding regions of Salmonella typhimurium LT2 have been determined. A comparison of these sequences with E. coli K12 suggests regions important in the promotion, regulation, and translation of the ilvY and ilvC genes. A model is presented in which the ilvY-encoded activator binds to an operator site in the overlapping promoter region and reciprocally regulates the transcription of the ilvY and ilvC genes. The carboxyl-terminal amino acid sequence of threonine deaminase encoded by the ilvA gene of the ilv-GMEDA operon of E. coli K12 has been identified by homology with the previously deduced threonine deaminase amino acid sequence encoded by the ilv1 gene of Saccharomyces cerevisiae. Based on the deduced

  15. Sequence analysis of the promoter regions of the classical class I gene RT1.A and two other class I genes of the rat MHC

    SciTech Connect

    Lambracht, D.; Wonigeit, K.


    Major histocompatibility complex (MHC) class I molecules present peptides to CD8+ T cells and thus play key role in immunosurveillance by T-cell-mediated mechanisms. Their expression depends on complex control mechanisms at two major levels: (1) regulation of transcription mediated through the promoter region and additional regulatory elements of the individual class I gene, and (2) availability of appropriate peptides in the endoplasmic reticulum required to stabilize the ternary complex consisting of class I {alpha} chain, {beta}{sub 2}-microglobulin ({beta}{sub 2}m), and peptide. In addition, differences in the ability of different {alpha} chains to bind {beta}{sub 2}m can influence the transport to and turnover within the cell membrane. We have now analyzed the promoter regions of class I genes of the LEW rat strain carrying the RT1{sup 1} haplotype. The analysis of three class I genes in this region has led to the identification of characteristic regulatory sequences. 20 refs., 2 figs.

  16. Promoter sequence of 3-phosphoglycerate kinase gene 1 of lactic acid-producing fungus rhizopus oryzae and a method of expressing a gene of interest in fungal species


    Gao, Johnway [Richland, WA; Skeen, Rodney S [Pendleton, OR


    The present invention provides the promoter clone discovery of phosphoglycerate kinase gene 1 of a lactic acid-producing filamentous fungal strain, Rhizopus oryzae. The isolated promoter can constitutively regulate gene expression under various carbohydrate conditions. In addition, the present invention also provides a design of an integration vector for the transformation of a foreign gene in Rhizopus oryzae.

  17. Promoter sequence of 3-phosphoglycerate kinase gene 2 of lactic acid-producing fungus rhizopus oryzae and a method of expressing a gene of interest in fungal species


    Gao, Johnway [Richland, WA; Skeen, Rodney S [Pendleton, OR


    The present invention provides the promoter clone discovery of phosphoglycerate kinase gene 2 of a lactic acid-producing filamentous fungal strain, Rhizopus oryzae. The isolated promoter can constitutively regulate gene expression under various carbohydrate conditions. In addition, the present invention also provides a design of an integration vector for the transformation of a foreign gene in Rhizopus oryzae.

  18. Protein factors in Blastocladiella emersonii cell extracts recognize similar sequence elements in the promoters of the genes encoding cAMP-dependent protein kinase subunits.


    de Oliveira, J C; Marques, M V; Gomes, S L


    Blastocladiella emersonii contains a single cAMP-dependent protein kinase (PKA), which is similar to the mammalian type II isoforms. Its activity is regulated during development by changes in the levels of the catalytic (C) and regulatory (R) subunits, which occur in parallel with changes in levels of the corresponding mRNAs, suggesting coordinate transcriptional control of the expression of both subunits. Both R and C mRNA levels are low in vegetative cells, rise sharply during sporulation and decrease to basal levels again after germination. To investigate sequence elements common to both Blastocladiella R and C gene promoters, which might be involved in the coordinate regulation of these genes, their 5'-flanking regions were analyzed by gel mobility shift and DNase I footprinting assays. We determined that different DNA-protein complexes are generated when fragments of the R and C gene promoters are incubated with extracts from cells expressing (sporulating cells) or not expressing (vegetative cells) both subunits, and competition experiments suggested that similar protein factors bind to both promoters. DNase I footprinting experiments have indicated that a sequence common to both R and C promoters, and similar to mammalian E-boxes, binds factors present in extracts from vegetative and sporulating cells, whereas sequences flanking the E-boxes in both promoters showed a change in the pattern of DNase I digestion only when the vegetative cell extract was used. This result suggests that the composition of the protein complexes binding to these regions changes during sporulation. PMID:9294034

  19. Cloning of mouse telomerase reverse transcriptase gene promoter and identification of proximal core promoter sequences essential for the expression of transgenes in cancer cells.


    Si, Shao-Yan; Song, Shu-Jun; Zhang, Jian-Zhong; Liu, Jun-Li; Liang, Shuang; Feng, Kai; Zhao, Gang; Tan, Xiao-Qing


    Telomerase is a ribonucleoprotein complex, whose function is to add motif-specific nucleotides to the end of chromosomes. Telomerase consists of three major subunits, the telomerase RNA template (hTR), the telomerase-associated protein (TEP1) and telomerase reverse transcriptase (TERT). TERT is the most important component responsible for the catalytic activity of telomerase and a rate-limiting determinant of the activity. Telomerase activities were at high levels in approximately 90% of mouse cancers or tumor-derived cell lines through TERT transcriptional up-regulation. Unlike human telomerase, telomerase activity exists in colon, liver, ovary and testis but not in brain, heart, stomach and muscle in normal mouse tissues. In this study, we prepared 5' truncations of 1086 bp fragments upstream of the initiating ATG codon of the mTERT gene to construct luciferase reporter gene plasmids, and transfected these plasmids into a normal mouse cell line and several cancer lines to identify the core promoter region essential for transcriptional activation in cancer cells by a luciferase assay. We constructed a eukaryotic expression vector of membrane-expressing staphylococcal endotoxin A (SEA) gene driven by the core promoter region of the mTERT gene and observed if the core promoter region could express the SEA gene in these cancer cells, but not in normal cells following transfection with the construct. The results showed that the transcriptional activities of each fragment of the mTERT gene promoter in the cancer cell lines Hepa1-6, B16 and CT26 were higher than those in NIH3T3 cells, and the proximal 333-bp fragment was the core promoter of the mTERT gene in the cancer cells. The proximal 333-bp fragment was able to make the SEA express on the surface of the cancer cells, but not in NIH3T3 cells. It provides a foundation for cancer targeting gene therapy by using the mTERT gene promoter. PMID:21567104

  20. The Lactobacillus acidophilus S-layer protein gene expression site comprises two consensus promoter sequences, one of which directs transcription of stable mRNA.

    PubMed Central

    Boot, H J; Kolen, C P; Andreadaki, F J; Leer, R J; Pouwels, P H


    S-proteins are proteins which form a regular structure (S-layer) on the outside of the cell walls of many bacteria. Two S-protein-encoding genes are located in opposite directions on a 6.0-kb segment of the chromosome of Lactobacillus acidophilus ATCC 4356 bacteria. Inversion of this chromosomal segment occurs through recombination between two regions with identical sequences, thereby interchanging the expressed and the silent genes. In this study, we show that the region involved in recombination also has a function in efficient S-protein production. Two promoter sequences are present in the S-protein gene expression site, although only the most downstream promoter (P-1) is used to direct mRNA synthesis. S-protein mRNA directed by this promoter has a half-life of 15 min. Its untranslated leader can form a stable secondary structure in which the 5' end is base paired, whereas the ribosome-binding site is exposed. Truncation of this leader sequence results in a reduction in protein production, as shown by reporter gene analysis of Lactobacillus casei. The results obtained indicate that the untranslated leader sequence of S-protein mRNA is involved in efficient S-protein production. PMID:8808926

  1. Automated conserved non-coding sequence (CNS) discovery reveals differences in gene content and promoter evolution among grasses

    PubMed Central

    Turco, Gina; Schnable, James C.; Pedersen, Brent; Freeling, Michael


    Conserved non-coding sequences (CNS) are islands of non-coding sequence that, like protein coding exons, show less divergence in sequence between related species than functionless DNA. Several CNSs have been demonstrated experimentally to function as cis-regulatory regions. However, the specific functions of most CNSs remain unknown. Previous searches for CNS in plants have either anchored on exons and only identified nearby sequences or required years of painstaking manual annotation. Here we present an open source tool that can accurately identify CNSs between any two related species with sequenced genomes, including both those immediately adjacent to exons and distal sequences separated by >12 kb of non-coding sequence. We have used this tool to characterize new motifs, associate CNSs with additional functions, and identify previously undetected genes encoding RNA and protein in the genomes of five grass species. We provide a list of 15,363 orthologous CNSs conserved across all grasses tested. We were also able to identify regulatory sequences present in the common ancestor of grasses that have been lost in one or more extant grass lineages. Lists of orthologous gene pairs and associated CNSs are provided for reference inbred lines of arabidopsis, Japonica rice, foxtail millet, sorghum, brachypodium, and maize. PMID:23874343

  2. Two regulatory proteins that bind to the basic transcription element (BTE), a GC box sequence in the promoter region of the rat P-4501A1 gene.

    PubMed Central

    Imataka, H; Sogawa, K; Yasumoto, K; Kikuchi, Y; Sasano, K; Kobayashi, A; Hayami, M; Fujii-Kuriyama, Y


    The cDNAs for two DNA binding proteins of BTE, a GC box sequence in the promoter region of the P-450IA1(CYP1A1) gene, have been isolated from a rat liver cDNA library by using the BTE sequence as a binding probe. While one is for the rat equivalent to human Sp1, the other encodes a primary structure of 244 amino acids, a novel DNA binding protein designated BTEB. Both proteins contain a zinc finger domain of Cys-Cys/His-His motif that is repeated three times with sequence similarity of 72% to each other, otherwise they share little or no similarity. The function of BTEB was analysed by transfection of plasmids expressing BTEB and/or Sp1 with appropriate reporter plasmids into a monkey cell line CV-1 and compared with Sp1. BTEB and Sp1 activated the expression of genes with repeated GC box sequences in promoters such as the simian virus 40 early promoter and the human immunodeficiency virus-1 long terminal repeat promoter. In contrast, BTEB repressed the activity of a promoter containing BTE, a single GC box of the CYP1A1 gene that is stimulated by Sp1. When the BTE sequence was repeated five times, however, BTEB turned out to be an activator of the promoter. RNA blot analysis showed that mRNAs for BTEB and Sp1 were expressed in all tissues tested, but their concentrations varied independently in tissues. The former mRNA was rich in the brain, kidney, lung and testis, while the latter was relatively abundant in the thymus and spleen.(ABSTRACT TRUNCATED AT 250 WORDS) Images PMID:1356762

  3. Gene expression promoted by the SV40 DNA targeting sequence and the hypoxia-responsive element under normoxia and hypoxia.


    Sacramento, C B; Moraes, J Z; Denapolis, P M A; Han, S W


    The main objective of the present study was to find suitable DNA-targeting sequences (DTS) for the construction of plasmid vectors to be used to treat ischemic diseases. The well-known Simian virus 40 nuclear DTS (SV40-DTS) and hypoxia-responsive element (HRE) sequences were used to construct plasmid vectors to express the human vascular endothelial growth factor gene (hVEGF). The rate of plasmid nuclear transport and consequent gene expression under normoxia (20% O2) and hypoxia (less than 5% O2) were determined. Plasmids containing the SV40-DTS or HRE sequences were constructed and used to transfect the A293T cell line (a human embryonic kidney cell line) in vitro and mouse skeletal muscle cells in vivo. Plasmid transport to the nucleus was monitored by real-time PCR, and the expression level of the hVEGF gene was measured by ELISA. The in vitro nuclear transport efficiency of the SV40-DTS plasmid was about 50% lower under hypoxia, while the HRE plasmid was about 50% higher under hypoxia. Quantitation of reporter gene expression in vitro and in vivo, under hypoxia and normoxia, confirmed that the SV40-DTS plasmid functioned better under normoxia, while the HRE plasmid was superior under hypoxia. These results indicate that the efficiency of gene expression by plasmids containing DNA binding sequences is affected by the concentration of oxygen in the medium. PMID:20640386

  4. Sequence analysis of mouse vomeronasal receptor gene clusters reveals common promoter motifs and a history of recent expansion

    PubMed Central

    Lane, Robert P.; Cutforth, Tyler; Axel, Richard; Hood, Leroy; Trask, Barbara J.


    We have analyzed the organization and sequence of 73 V1R genes encoding putative pheromone receptors to identify regulatory features and characterize the evolutionary history of the V1R family. The 73 V1Rs arose from seven ancestral genes around the time of mouse–rat speciation through large local duplications, and this expansion may contribute to speciation events. Orthologous V1R genes appear to have been lost during primate evolution. Exceptional noncoding homology is observed across four V1R subfamilies at one cluster and thus may be important for locus-specific transcriptional regulation. PMID:11752409

  5. Tissue-specific binding of testis nuclear proteins to a sequence element within the promoter of the testis-specific histone H1t gene.


    Grimes, S R; Wolfe, S A; Koppel, D A


    The rat histone H1t gene is transcribed only in testis germinal cells. This testis-specific chromosomal protein is first synthesized during spermatogenesis in pachytene spermatocytes and the entire complement of testis histones is replaced during the midspermatid stage of spermiogenesis by positively charged transition nuclear proteins TP1 and TP2. Mobility shift assays conducted using crude nuclear protein extracts from different tissues and an 18-bp DNA sequence element within the H1t promoter as a probe reveal binding only with nuclear proteins from testis. The binding is specifically competed with an excess of the same unlabeled DNA fragment but not with heterologous competitors. A larger oligonucleotide corresponding to the same sequence element plus 18 bp of the adjacent downstream H1/CCAAT element binds nuclear proteins from all tissues tested, but a unique low mobility band is formed only with testis extracts. Protein-DNA crosslinking experiments reveal that two major polypeptides with molecular weights of approximately 13 and 30 kDa bind to the 18-bp H1t promoter sequence element. This strong correlation between the tissue where the H1t gene is transcribed and the presence of testis-specific nuclear proteins that bind to a sequence element within the testis histone H1t promoter supports the possibility that these DNA-binding proteins may participate in formation of an active transcription initiation complex with the testis H1t promoter. PMID:1632632

  6. Sequence Elements Upstream of the Core Promoter Are Necessary for Full Transcription of the Capsule Gene Operon in Streptococcus pneumoniae Strain D39

    PubMed Central

    Wen, Zhensong; Sertil, Odeniel; Cheng, Yongxin; Zhang, Shanshan; Liu, Xue; Wang, Wen-Ching


    Streptococcus pneumoniae is a major bacterial pathogen in humans. Its polysaccharide capsule is a key virulence factor that promotes bacterial evasion of human phagocytic killing. While S. pneumoniae produces at least 94 antigenically different types of capsule, the genes for biosynthesis of almost all capsular types are arranged in the same locus. The transcription of the capsular polysaccharide (cps) locus is not well understood. This study determined the transcriptional features of the cps locus in the type 2 virulent strain D39. The initial analysis revealed that the cps genes are cotranscribed from a major transcription start site at the −25 nucleotide (G) upstream of cps2A, the first gene in the locus. Using unmarked chromosomal truncations and a luciferase-based transcriptional reporter, we showed that the full transcription of the cps genes not only depends on the core promoter immediately upstream of cps2A, but also requires additional elements upstream of the core promoter, particularly a 59-bp sequence immediately upstream of the core promoter. Unmarked deletions of these promoter elements in the D39 genome also led to significant reduction in CPS production and virulence in mice. Lastly, common cps gene (cps2ABCD) mutants did not show significant abnormality in cps transcription, although they produced significantly less CPS, indicating that the CpsABCD proteins are involved in the encapsulation of S. pneumoniae in a posttranscriptional manner. This study has yielded important information on the transcriptional characteristics of the cps locus in S. pneumoniae. PMID:25733517

  7. Histone acetylation accompanied with promoter sequences displaying differential expression profiles of B-class MADS-box genes for phalaenopsis floral morphogenesis.


    Hsu, Chia-Chi; Wu, Pei-Shan; Chen, Tien-Chih; Yu, Chun-Wei; Tsai, Wen-Chieh; Wu, Keqiang; Wu, Wen-Luan; Chen, Wen-Huei; Chen, Hong-Hwa


    Five B-class MADS-box genes, including four APETALA3 (AP3)-like PeMADS2∼5 and one PISTILLATA (PI)-like PeMADS6, specify the spectacular flower morphology in orchids. The PI-like PeMADS6 ubiquitously expresses in all floral organs. The four AP3-like genes, resulted from two duplication events, express ubiquitously at floral primordia and early floral organ stages, but show distinct expression profiles at late floral organ primordia and floral bud stages. Here, we isolated the upstream sequences of PeMADS2∼6 and studied the regulatory mechanism for their distinct gene expression. Phylogenetic footprinting analysis of the 1.3-kb upstream sequences of AP3-like PeMADS2∼5 showed that their promoter regions have sufficiently diverged and contributed to their subfunctionalization. The amplified promoter sequences of PeMADS2∼6 could drive beta-glucuronidase (GUS) gene expression in all floral organs, similar to their expression at the floral primordia stage. The promoter sequence of PeMADS4, exclusively expressed in lip and column, showed a 1.6∼3-fold higher expression in lip/column than in sepal/petal. Furthermore, we noted a 4.9-fold increase in histone acetylation (H3K9K14ac) in the translation start region of PeMADS4 in lip as compared in petal. All these results suggest that the regulation via the upstream sequences and increased H3K9K14ac level may act synergistically to display distinct expression profiles of the AP3-like genes at late floral organ primordia stage for Phalaenopsis floral morphogenesis. PMID:25501842

  8. Histone Acetylation Accompanied with Promoter Sequences Displaying Differential Expression Profiles of B-Class MADS-Box Genes for Phalaenopsis Floral Morphogenesis

    PubMed Central

    Hsu, Chia-Chi; Wu, Pei-Shan; Chen, Tien-Chih; Yu, Chun-Wei; Tsai, Wen-Chieh; Wu, Keqiang; Wu, Wen-Luan; Chen, Wen-Huei; Chen, Hong-Hwa


    Five B-class MADS-box genes, including four APETALA3 (AP3)-like PeMADS2∼5 and one PISTILLATA (PI)-like PeMADS6, specify the spectacular flower morphology in orchids. The PI-like PeMADS6 ubiquitously expresses in all floral organs. The four AP3-like genes, resulted from two duplication events, express ubiquitously at floral primordia and early floral organ stages, but show distinct expression profiles at late floral organ primordia and floral bud stages. Here, we isolated the upstream sequences of PeMADS2∼6 and studied the regulatory mechanism for their distinct gene expression. Phylogenetic footprinting analysis of the 1.3-kb upstream sequences of AP3-like PeMADS2∼5 showed that their promoter regions have sufficiently diverged and contributed to their subfunctionalization. The amplified promoter sequences of PeMADS2∼6 could drive beta-glucuronidase (GUS) gene expression in all floral organs, similar to their expression at the floral primordia stage. The promoter sequence of PeMADS4, exclusively expressed in lip and column, showed a 1.6∼3-fold higher expression in lip/column than in sepal/petal. Furthermore, we noted a 4.9-fold increase in histone acetylation (H3K9K14ac) in the translation start region of PeMADS4 in lip as compared in petal. All these results suggest that the regulation via the upstream sequences and increased H3K9K14ac level may act synergistically to display distinct expression profiles of the AP3-like genes at late floral organ primordia stage for Phalaenopsis floral morphogenesis. PMID:25501842

  9. Molecular mechanisms of human single-minded 2 (SIM2) gene expression: identification of a promoter site in the SIM2 genomic sequence.


    Yamaki, A; Tochigi, J; Kudoh, J; Minoshima, S; Shimizu, N; Shimizu, Y


    We previously postulated that the single-minded 2 (SIM2) gene identified on the human chromosome 21q22.2 is a good candidate gene for the pathogenesis of mental retardation in Down syndrome because its mouse homolog exhibits preferential expression in the mouse diencephalon during early embryogenesis. We analyzed the genomic sequence of the entire SIM2 gene which consists of 11 exons and spans over 50 kb. As a step toward understanding the molecular mechanisms of SIM2 gene expression, we have analyzed the human SIM2 gene expression in nine established human cell lines. Three transcripts of 3.6, 4.4, and 6.0 kb were detected in the glioblastoma cell line, T98G, neuroblastoma cell line, TGW, and transformed embryonic kidney cell line, 293. The RACE analysis using SIM2-expressing human cell line T98G provided evidence for the transcription start site at approximately 1.2 kb upstream of the translation initiation site. The transfection assay using various deletion constructs with reporter gene suggested the presence of a presumptive promoter region. Transient transfection assay in T98G cell line revealed a significant promoter activity located in the 60 bp sequence between nt -1385 and -1325 upstream region of the translation initiation site. This 60 bp sequence contains cis-elements for c-myb, E47 and E2F transcription factors. Moreover, the gel retardation assay using oligo-DNA of various cis-element sequences indicated the presence of protein factor(s) which bind to the cis-element for c-myb. These results suggested that binding of a protein transcription factor(s) such as c-myb or that alike regulates transcription of the SIM2 gene by binding to a small upstream region. PMID:11404025

  10. A fusion promoter created by a new insertion sequence, IS1490, activates transcription of 2,4,5-trichlorophenoxyacetic acid catabolic genes in Burkholderia cepacia AC1100.

    PubMed Central

    Hübner, A; Hendrickson, W


    Transposition and transcriptional activation by insertion sequences in Burkholderia cepacia AC1100 were investigated. Two closely related new elements, IS1413 and IS1490, were identified and characterized. These elements are not highly related to other insertion sequences identified in AC1100 or other B. cepacia isolates. Based on their structures and the sequences of the inverted terminal repeats and the putative transposase protein, the insertion elements (IS elements) are similar to IST2 of Thiobacillus ferrooxidans and several related elements. All the IS elements that have been identified in this strain are found in multiple copies (10 to 40), and they have high-level promoter activity capable of stimulating transcription from a distance up to 500 bp from a target gene. Strain AC1100 was originally isolated after prolonged selection for the ability to utilize the herbicide 2,4,5-trichlorophenoxyacetic acid (2,4,5-T) as a sole carbon source. Three IS elements are located near the first gene of the 2,4,5-T catabolic pathway, tftA. IS1490 inserted 110 bp upstream of tftA and created a fusion promoter responsible for constitutive transcription of the gene. Our results confirm the hypothesis that IS elements play a central role in transcription of 2,4,5-T genes and likely have stimulated rapid evolution of the metabolic pathway. PMID:9098071

  11. Two short sequences in OsNAR2.1 promoter are necessary for fully activating the nitrate induced gene expression in rice roots

    PubMed Central

    Liu, Xiaoqin; Feng, Huimin; Huang, Daimin; Song, Miaoquan; Fan, Xiaorong; Xu, Guohua


    Nitrate is an essential nitrogen source and serves as a signal to control growth and gene expression in plants. In rice, OsNAR2.1 is an essential partner of multiple OsNRT2 nitrate transporters for nitrate uptake over low and high concentration range. Previously, we have reported that −311 bp upstream fragment from the translational start site in the promoter of OsNAR2.1 gene is the nitrate responsive region. To identify the cis-acting DNA elements necessary for nitrate induced gene expression, we detected the expression of beta-glucuronidase (GUS) reporter in the transgenic rice driven by the OsNAR2.1 promoter with different lengths and site mutations of the 311 bp region. We found that −129 to −1 bp region is necessary for the nitrate-induced full activation of OsNAR2.1. Besides, the site mutations showed that the 20 bp fragment between −191 and −172 bp contains an enhancer binding site necessary to fully drive the OsNAR2.1 expression. Part of the 20 bp fragment is commonly presented in the sequences of different promoters of both the nitrate induced NAR2 genes and nitrite reductase NIR1 genes from various higher plants. These findings thus reveal the presence of conserved cis-acting element for mediating nitrate responses in plants. PMID:26150107

  12. Mouse thymidine kinase: the promoter sequence and the gene and pseudogene structures in normal cells and in thymidine kinase deficient mutants.

    PubMed Central

    Seiser, C; Knöfler, M; Rudelstorfer, I; Haas, R; Wintersberger, E


    The mouse genome carries one gene and two pseudogenes for cytoplasmic thymidine kinase. The overall structure of these genes was determined with the help of cosmids and lambda phage clones and the upstream sequence containing the promoter was determined. The data allow an allocation of bands seen in the complex patterns of genomic Southern blots obtained from the DNA of wild type cells and of thymidine kinase deficient mutants to the gene as well as to the two pseudogenes. The much used LTK cell line was found to lack the entire gene but to retain the pseudogenes. Two other TK cell lines had DNA patterns indistinguishable from the wild type. Whereas the LTK line did not produce any TKmRNA, the two other mutants had normal amounts of TKmRNA but no cytoplasmic TK activity. Images PMID:2911464

  13. Functional analysis of the long terminal repeats of intracisternal A-particle genes: Sequences within the U3 region determine both the efficiency and direction of promoter activity

    SciTech Connect

    Christy, R.J.; Huang, R.C.C.


    The transcriptional activity of five intracisternal A-particle (IAP) long terminal repeats (LTRs) in mouse embryonal carcinoma PCC3-A/1 cells and in Ltk/sup -/ cells was determined. The authors tested the promoter activity of the LTRs by coupling them to the reporter gene chloramphenicol acetyltransferase (CAT) or guanosine-xanthine phosphoribosyltransferase (gpt). Each LTR was tested for promoter function in both the sense (5' to 3') and antisense (3' to 5') orientation preceding the reporter gene. The transcriptional activity of individual IAP gene LTRs varied considerably, and the LTR from IAP81 possessed promoter activity in both directions. The bidirectional activity of the IAP81 LTR was confirmed by monitoring Ecogpt expression in stably transfected Ltk/sup -/ cells, with the initiation sites for sense and antisense transcription being localized to within the IAP81 LTR by S1 nuclease mapping. Deletions of LTR81 show that for normal 5'-to-3' gene transcription (sense direction), the /sup 3'/U3/R region determines the basal level of transcription, whereas sequences within the /sup 5'/U3 region enhance transcription four- to fivefold. Deletion mapping for antisense transcription indicates that a 64-base-pair region (nucleotides 47 to 110) within the U3 region is essential for activity. These data indicate that the U3 region contains all the regulatory elements for bidirectional transcription in IAP LTRs.

  14. Violation of an evolutionarily conserved immunoglobulin diversity gene sequence preference promotes production of dsDNA-specific IgG antibodies.


    Silva-Sanchez, Aaron; Liu, Cun Ren; Vale, Andre M; Khass, Mohamed; Kapoor, Pratibha; Elgavish, Ada; Ivanov, Ivaylo I; Ippolito, Gregory C; Schelonka, Robert L; Schoeb, Trenton R; Burrows, Peter D; Schroeder, Harry W


    Variability in the developing antibody repertoire is focused on the third complementarity determining region of the H chain (CDR-H3), which lies at the center of the antigen binding site where it often plays a decisive role in antigen binding. The power of VDJ recombination and N nucleotide addition has led to the common conception that the sequence of CDR-H3 is unrestricted in its variability and random in its composition. Under this view, the immune response is solely controlled by somatic positive and negative clonal selection mechanisms that act on individual B cells to promote production of protective antibodies and prevent the production of self-reactive antibodies. This concept of a repertoire of random antigen binding sites is inconsistent with the observation that diversity (DH) gene segment sequence content by reading frame (RF) is evolutionarily conserved, creating biases in the prevalence and distribution of individual amino acids in CDR-H3. For example, arginine, which is often found in the CDR-H3 of dsDNA binding autoantibodies, is under-represented in the commonly used DH RFs rearranged by deletion, but is a frequent component of rarely used inverted RF1 (iRF1), which is rearranged by inversion. To determine the effect of altering this germline bias in DH gene segment sequence on autoantibody production, we generated mice that by genetic manipulation are forced to utilize an iRF1 sequence encoding two arginines. Over a one year period we collected serial serum samples from these unimmunized, specific pathogen-free mice and found that more than one-fifth of them contained elevated levels of dsDNA-binding IgG, but not IgM; whereas mice with a wild type DH sequence did not. Thus, germline bias against the use of arginine enriched DH sequence helps to reduce the likelihood of producing self-reactive antibodies. PMID:25706374

  15. Massively parallel sequencing of phyllodes tumours of the breast reveals actionable mutations, and TERT promoter hotspot mutations and TERT gene amplification as likely drivers of progression.


    Piscuoglio, Salvatore; Ng, Charlotte Ky; Murray, Melissa; Burke, Kathleen A; Edelweiss, Marcia; Geyer, Felipe C; Macedo, Gabriel S; Inagaki, Akiko; Papanastasiou, Anastasios D; Martelotto, Luciano G; Marchio, Caterina; Lim, Raymond S; Ioris, Rafael A; Nahar, Pooja K; Bruijn, Ino De; Smyth, Lillian; Akram, Muzaffar; Ross, Dara; Petrini, John H; Norton, Larry; Solit, David B; Baselga, Jose; Brogi, Edi; Ladanyi, Marc; Weigelt, Britta; Reis-Filho, Jorge S


    Phyllodes tumours (PTs) are breast fibroepithelial lesions that are graded based on histological criteria as benign, borderline or malignant. PTs may recur locally. Borderline PTs and malignant PTs may metastasize to distant sites. Breast fibroepithelial lesions, including PTs and fibroadenomas, are characterized by recurrent MED12 exon 2 somatic mutations. We sought to define the repertoire of somatic genetic alterations in PTs and whether these may assist in the differential diagnosis of these lesions. We collected 100 fibroadenomas, 40 benign PTs, 14 borderline PTs and 22 malignant PTs; six, six and 13 benign, borderline and malignant PTs, respectively, and their matched normal tissue, were subjected to targeted massively parallel sequencing (MPS) using the MSK-IMPACT sequencing assay. Recurrent MED12 mutations were found in 56% of PTs; in addition, mutations affecting cancer genes (eg TP53, RB1, SETD2 and EGFR) were exclusively detected in borderline and malignant PTs. We found a novel recurrent clonal hotspot mutation in the TERT promoter (-124 C>T) in 52% and TERT gene amplification in 4% of PTs. Laser capture microdissection revealed that these mutations were restricted to the mesenchymal component of PTs. Sequencing analysis of the entire cohort revealed that the frequency of TERT alterations increased from benign (18%) to borderline (57%) and to malignant PTs (68%; p < 0.01), and TERT alterations were associated with increased levels of TERT mRNA (p < 0.001). No TERT alterations were observed in fibroadenomas. An analysis of TERT promoter sequencing and gene amplification distinguished PTs from fibroadenomas with a sensitivity and a positive predictive value of 100% (CI 95.38-100%) and 100% (CI 85.86-100%), respectively, and a sensitivity and a negative predictive value of 39% (CI 28.65-51.36%) and 68% (CI 60.21-75.78%), respectively. Our results suggest that TERT alterations may drive the progression of PTs, and may assist in the differential diagnosis

  16. Promoter architectures and developmental gene regulation.


    Haberle, Vanja; Lenhard, Boris


    Core promoters are minimal regions sufficient to direct accurate initiation of transcription and are crucial for regulation of gene expression. They are highly diverse in terms of associated core promoter motifs, underlying sequence composition and patterns of transcription initiation. Distinctive features of promoters are also seen at the chromatin level, including nucleosome positioning patterns and presence of specific histone modifications. Recent advances in identifying and characterizing promoters using next-generation sequencing-based technologies have provided the basis for their classification into functional groups and have shed light on their modes of regulation, with important implications for transcriptional regulation in development. This review discusses the methodology and the results of genome-wide studies that provided insight into the diversity of RNA polymerase II promoter architectures in vertebrates and other Metazoa, and the association of these architectures with distinct modes of regulation in embryonic development and differentiation. PMID:26783721

  17. Prediction of fine-tuned promoter activity from DNA sequence

    PubMed Central

    Siwo, Geoffrey; Rider, Andrew; Tan, Asako; Pinapati, Richard; Emrich, Scott; Chawla, Nitesh; Ferdig, Michael


    The quantitative prediction of transcriptional activity of genes using promoter sequence is fundamental to the engineering of biological systems for industrial purposes and understanding the natural variation in gene expression. To catalyze the development of new algorithms for this purpose, the Dialogue on Reverse Engineering Assessment and Methods (DREAM) organized a community challenge seeking predictive models of promoter activity given normalized promoter activity data for 90 ribosomal protein promoters driving expression of a fluorescent reporter gene. By developing an unbiased modeling approach that performs an iterative search for predictive DNA sequence features using the frequencies of various k-mers, inferred DNA mechanical properties and spatial positions of promoter sequences, we achieved the best performer status in this challenge. The specific predictive features used in the model included the frequency of the nucleotide G, the length of polymeric tracts of T and TA, the frequencies of 6 distinct trinucleotides and 12 tetranucleotides, and the predicted protein deformability of the DNA sequence. Our method accurately predicted the activity of 20 natural variants of ribosomal protein promoters (Spearman correlation r = 0.73) as compared to 33 laboratory-mutated variants of the promoters (r = 0.57) in a test set that was hidden from participants. Notably, our model differed substantially from the rest in 2 main ways: i) it did not explicitly utilize transcription factor binding information implying that subtle DNA sequence features are highly associated with gene expression, and ii) it was entirely based on features extracted exclusively from the 100 bp region upstream from the translational start site demonstrating that this region encodes much of the overall promoter activity. The findings from this study have important implications for the engineering of predictable gene expression systems and the evolution of gene expression in naturally occurring

  18. Unveiling Mycoplasma hyopneumoniae Promoters: Sequence Definition and Genomic Distribution

    PubMed Central

    Weber, Shana de Souto; Sant'Anna, Fernando Hayashi; Schrank, Irene Silveira


    Several Mycoplasma species have had their genome completely sequenced, including four strains of the swine pathogen Mycoplasma hyopneumoniae. Nevertheless, little is known about the nucleotide sequences that control transcriptional initiation in these microorganisms. Therefore, with the objective of investigating the promoter sequences of M. hyopneumoniae, 23 transcriptional start sites (TSSs) of distinct genes were mapped. A pattern that resembles the σ70 promoter −10 element was found upstream of the TSSs. However, no −35 element was distinguished. Instead, an AT-rich periodic signal was identified. About half of the experimentally defined promoters contained the motif 5′-TRTGn-3′, which was identical to the −16 element usually found in Gram-positive bacteria. The defined promoters were utilized to build position-specific scoring matrices in order to scan putative promoters upstream of all coding sequences (CDSs) in the M. hyopneumoniae genome. Two hundred and one signals were found associated with 169 CDSs. Most of these sequences were located within 100 nucleotides of the start codons. This study has shown that the number of promoter-like sequences in the M. hyopneumoniae genome is more frequent than expected by chance, indicating that most of the sequences detected are probably biologically functional. PMID:22334569

  19. Bioinformatic Identification of Conserved Cis-Sequences in Coregulated Genes.


    Bülow, Lorenz; Hehl, Reinhard


    Bioinformatics tools can be employed to identify conserved cis-sequences in sets of coregulated plant genes because more and more gene expression and genomic sequence data become available. Knowledge on the specific cis-sequences, their enrichment and arrangement within promoters, facilitates the design of functional synthetic plant promoters that are responsive to specific stresses. The present chapter illustrates an example for the bioinformatic identification of conserved Arabidopsis thaliana cis-sequences enriched in drought stress-responsive genes. This workflow can be applied for the identification of cis-sequences in any sets of coregulated genes. The workflow includes detailed protocols to determine sets of coregulated genes, to extract the corresponding promoter sequences, and how to install and run a software package to identify overrepresented motifs. Further bioinformatic analyses that can be performed with the results are discussed. PMID:27557771

  20. Cell-specific expression of the analgesic-antitumor peptide coding sequence under the control of the human α-fetoprotein gene promoter and enhancer

    PubMed Central



    The aim of the present study was to construct a gene-modified hepatocellular carcinoma (HCC)-specific analgesic-antitumor peptide (AGAP) expression vector regulated by the α-fetoprotein (AFP) promoter and enhancer, in order to evaluate its effect. The AFP promoter is generally used in HCC-specific gene therapy strategies. However, this approach is limited by the weak activity of the AFP promoter. Linking the AFP enhancer and promoter has been shown to generate a stronger and more HCC-selective promoter. The AGAP DNA fragment was amplified from the total RNA of the Chinese scorpion, Buthus martensii Karsch. The fragment was subsequently cloned into the pAFP plasmid with the minimal essential DNA fragment, which included the AFP gene promoter and enhancer, to construct the recombinant plasmid, pAFP-AGAP. The plasmid was transfected into HepG2 cells and the mRNA expression levels of AGAP were detected by reverse transcription polymerase chain reaction (RT-PCR). In addition, Cell Counting Kit 8 (CCK-8) was used to analyze the cytotoxicity of plasmid transfection. The length, position and orientation of the inserted AGAP gene were all confirmed to be correct; thus, the recombinant vector was successfully constructed. Using RT-PCR and CCK-8 analysis, the mRNA expression levels of AGAP and the cytotoxicity in AFP-producing human HCC cells were determined. The AFP promoter and enhancer were found to specifically accelerate the expression of the target genes within the cells that were positive for AFP. Therefore, the method used in the present study was demonstrated to be a novel integration of traditional Chinese medicine with western medicine. PMID:25667643

  1. Bayesian classification for promoter prediction in human DNA sequences

    NASA Astrophysics Data System (ADS)

    Bercher, J.-F.; Jardin, P.; Duriez, B.


    Many Computational methods are yet available for data retrieval and analysis of genomic sequences, but some functional sites are difficult to characterize. In this work, we examine the problem of promoter localization in human DNA sequences. Promoters are regulatory regions that governs the expression of genes, and their prediction is reputed difficult, so that this issue is still open. We present the Chaos Game representation (CGR) of DNA sequences which has many interesting properties, and the notion of `genomic signature' that proved relevant in phylogeny applications. Based on this notion, we develop a (naïve) bayesian classifier, evaluate its performances, and show that its adaptive implementation enable to reveal or assess core-promoter positions along a DNA sequence.

  2. Cloning and sequence analysis of myostatin promoter in sheep.


    Du, Rong; Chen, Yong-Fu; An, Xiao-Rong; Yang, Xing-Yuan; Ma, Yi; Zhang, Lei; Yuan, Xiao-Li; Chen, Li-Mei; Qin, Jian


    To better understand the structure and function of the myostatin's gene promoter region in sheep, we cloned and sequenced a 1.517 kb fragment containing the 5'-regulatory region of the sheep myostatin gene (GenBank accession number is AY918121). The promoter sequence consists of three TATA boxes, one CAAT box, and eight putative E-boxes. Some putative muscle growth response elements for Octamer-binding factor 1(Octamer), Activator protein 1(AP1), Growth factor independence 1 zinc finger protein (Gfi-1B), Myocyte enhancer factor 2 (MEF2), Muscle-specific Mt binding site (MTBF), Glucocorticoid response elements (GRE) and Progesterone receptor binding site (PRE) were detected. Some of the motifs are conserved as compared to with that in the goat, bovine and porcine myostatin promoters. However, some differences were also found. PMID:16287620

  3. Expression of the human T-cell receptor V beta 5.3 in Escherichia coli by thermal induction of the trc promoter: nucleotide sequence of the lacIts gene.


    Adari, H; Andrews, B; Ford, P J; Hannig, G; Brosius, J; Makrides, S C


    We have constructed a vector, pKBi, for the high-level expression of the variable beta chain 5.3 (V beta 5.3) of the human T-cell receptor in Escherichia coli. This vector incorporates the trc promoter, a polylinker, two transcription terminators, and the tetracycline resistance gene. Furthermore, the vector contains the lacIts gene that encodes a temperature-sensitive (ts) lac repressor, thus obviating both the need to use IPTG as a transcriptional inducer, and bacterial strains that harbor either the lacI or lacIq genes. The sequence of the lacIts gene shows an open reading frame of 1,080 nucleotides encoding 360 amino acids, and differs from the lacI gene at nucleotide 559 (with reference to the first nucleotide of the start codon). This nucleotide changes from G to A, causing amino acid residue 187 to change from glycine (GGC) to serine (AGC). This mutation imparts thermal sensitivity to the lac repressor protein. This is the first time that a TCR V beta region has been expressed at high levels (up to 28 mg/liter of culture) without fusion partners. The availability of the lacIts gene for thermal induction of the trc promoter, and the presence of the tetracycline resistance gene should make the expression vector pKBi particularly attractive for the efficient production of human therapeutic proteins in bacteria. PMID:7576181

  4. Functional analysis of bipartite begomovirus coat protein promoter sequences

    SciTech Connect

    Lacatus, Gabriela; Sunter, Garry


    We demonstrate that the AL2 gene of Cabbage leaf curl virus (CaLCuV) activates the CP promoter in mesophyll and acts to derepress the promoter in vascular tissue, similar to that observed for Tomato golden mosaic virus (TGMV). Binding studies indicate that sequences mediating repression and activation of the TGMV and CaLCuV CP promoter specifically bind different nuclear factors common to Nicotiana benthamiana, spinach and tomato. However, chromatin immunoprecipitation demonstrates that TGMV AL2 can interact with both sequences independently. Binding of nuclear protein(s) from different crop species to viral sequences conserved in both bipartite and monopartite begomoviruses, including TGMV, CaLCuV, Pepper golden mosaic virus and Tomato yellow leaf curl virus suggests that bipartite begomoviruses bind common host factors to regulate the CP promoter. This is consistent with a model in which AL2 interacts with different components of the cellular transcription machinery that bind viral sequences important for repression and activation of begomovirus CP promoters.

  5. Epigenetic regulation of transposable element derived human gene promoters.


    Huda, Ahsan; Bowen, Nathan J; Conley, Andrew B; Jordan, I King


    It was previously thought that epigenetic histone modifications of mammalian transposable elements (TEs) serve primarily to defend the genome against deleterious effects associated with their activity. However, we recently showed that, genome-wide, human TEs can also be epigenetically modified in a manner consistent with their ability to regulate host genes. Here, we explore the ability of TE sequences to epigenetically regulate individual human genes by focusing on the histone modifications of promoter sequences derived from TEs. We found 1520 human genes that initiate transcription from within TE-derived promoter sequences. We evaluated the distributions of eight histone modifications across these TE-promoters, within and between the GM12878 and K562 cell lines, and related their modification status with the cell-type specific expression patterns of the genes that they regulate. TE-derived promoters are significantly enriched for active histone modifications, and depleted for repressive modifications, relative to the genomic background. Active histone modifications of TE-promoters peak at transcription start sites and are positively correlated with increasing expression within cell lines. Furthermore, differential modification of TE-derived promoters between cell lines is significantly correlated with differential gene expression. LTR-retrotransposon derived promoters in particular play a prominent role in mediating cell-type specific gene regulation, and a number of these LTR-promoter genes are implicated in lineage-specific cellular functions. The regulation of human genes mediated by histone modifications targeted to TE-derived promoters is consistent with the ability of TEs to contribute to the epigenomic landscape in a way that provides functional utility to the host genome. PMID:21215797

  6. Genome Sequence of the Banana Plant Growth-Promoting Rhizobacterium Bacillus amyloliquefaciens BS006.


    Gamez, Rocío M; Rodríguez, Fernando; Bernal, Johan F; Agarwala, Richa; Landsman, David; Mariño-Ramírez, Leonardo


    Bacillus amyloliquefaciens is an important plant growth-promoting rhizobacterium (PGPR). We report the first whole-genome sequence of PGPR Bacillus amyloliquefaciens evaluated in Colombian banana plants. The genome sequences encode genes involved in plant growth and defense, including bacteriocins, ribosomally synthesized antibacterial peptides, in addition to genes that provide resistance to toxic compounds. PMID:26607897

  7. Genome Sequence of the Banana Plant Growth-Promoting Rhizobacterium Bacillus amyloliquefaciens BS006

    PubMed Central

    Gamez, Rocío M.; Rodríguez, Fernando; Bernal, Johan F.; Agarwala, Richa; Landsman, David


    Bacillus amyloliquefaciens is an important plant growth-promoting rhizobacterium (PGPR). We report the first whole-genome sequence of PGPR Bacillus amyloliquefaciens evaluated in Colombian banana plants. The genome sequences encode genes involved in plant growth and defense, including bacteriocins, ribosomally synthesized antibacterial peptides, in addition to genes that provide resistance to toxic compounds. PMID:26607897

  8. Genome Sequence of the Banana Plant Growth-Promoting Rhizobacterium Pseudomonas fluorescens PS006

    PubMed Central

    Gamez, Rocío M.; Rodríguez, Fernando; Ramírez, Sandra; Gómez, Yolanda; Agarwala, Richa; Landsman, David


    Pseudomonas fluorescens is a well-known plant growth-promoting rhizobacterium (PGPR). We report here the first whole-genome sequence of PGPR P. fluorescens evaluated in Colombian banana plants. The genome sequences contains genes involved in plant growth and defense, including bacteriocins, 1-aminocyclopropane-1-carboxylic acid (ACC) deaminase, and genes that provide resistance to toxic compounds. PMID:27151797

  9. Genome Sequence of the Banana Plant Growth-Promoting Rhizobacterium Pseudomonas fluorescens PS006.


    Gamez, Rocío M; Rodríguez, Fernando; Ramírez, Sandra; Gómez, Yolanda; Agarwala, Richa; Landsman, David; Mariño-Ramírez, Leonardo


    Pseudomonas fluorescens is a well-known plant growth-promoting rhizobacterium (PGPR). We report here the first whole-genome sequence of PGPR P. fluorescens evaluated in Colombian banana plants. The genome sequences contains genes involved in plant growth and defense, including bacteriocins, 1-aminocyclopropane-1-carboxylic acid (ACC) deaminase, and genes that provide resistance to toxic compounds. PMID:27151797

  10. Repetitive sequence environment distinguishes housekeeping genes

    PubMed Central

    Eller, C. Daniel; Regelson, Moira; Merriman, Barry; Nelson, Stan; Horvath, Steve; Marahrens, York


    Housekeeping genes are expressed across a wide variety of tissues. Since repetitive sequences have been reported to influence the expression of individual genes, we employed a novel approach to determine whether housekeeping genes can be distinguished from tissue-specific genes their repetitive sequence context. We show that Alu elements are more highly concentrated around housekeeping genes while various longer (>400-bp) repetitive sequences ("repeats"), including Long Interspersed Nuclear Element 1 (LINE-1) elements, are excluded from these regions. We further show that isochore membership does not distinguish housekeeping genes from tissue-specific genes and that repetitive sequence environment distinguishes housekeeping genes from tissue-specific genes in every isochore. The distinct repetitive sequence environment, in combination with other previously published sequence properties of housekeeping genes, were used to develop a method of predicting housekeeping genes on the basis of DNA sequence alone. Using expression across tissue types as a measure of success, we demonstrate that repetitive sequence environment is by far the most important sequence feature identified to date for distinguishing housekeeping genes. PMID:17141428

  11. Repetitive Sequence Variations in the Promoter Region of the Adhesin-Encoding Gene sabA of Helicobacter pylori Affect Transcription

    PubMed Central

    Harvey, Vivian C.; Acio, Catherine R.; Bredehoft, Amy K.; Zhu, Laurence; Hallinger, Daniel R.; Quinlivan-Repasi, Vanessa; Harvey, Samuel E.


    The pathogenesis of diseases elicited by the gastric pathogen Helicobacter pylori is partially determined by the effectiveness of adaptation to the variably acidic environment of the host stomach. Adaptation includes appropriate adherence to the gastric epithelium via outer membrane protein adhesins such as SabA. The expression of sabA is subject to regulation via phase variation in the promoter and coding regions as well as repression by the two-component system ArsRS. In this study, we investigated the role of a homopolymeric thymine [poly(T)] tract −50 to −33 relative to the sabA transcriptional start site in H. pylori strain J99. We quantified sabA expression in H. pylori J99 by quantitative reverse transcription-PCR (RT-PCR), demonstrating significant changes in sabA expression associated with experimental manipulations of poly(T) tract length. Mimicking the length increase of this tract by adding adenines instead of thymines had similar effects, while the addition of other nucleotides failed to affect sabA expression in the same manner. We hypothesize that modification of the poly(T) tract changes DNA topology, affecting regulatory protein interaction(s) or RNA polymerase binding efficiency. Additionally, we characterized the interaction between the sabA promoter region and ArsR, a response regulator affecting sabA expression. Using recombinant ArsR in electrophoretic mobility shift assays (EMSA), we localized binding to a sequence with partial dyad symmetry −20 and +38 relative to the sabA +1 site. The control of sabA expression by both ArsRS and phase variation at two distinct repeat regions suggests the control of sabA expression is both complex and vital to H. pylori infection. PMID:25022855

  12. Core promoter sequence in yeast is a major determinant of expression level

    PubMed Central

    Lubliner, Shai; Regev, Ifat; Lotan-Pompan, Maya; Edelheit, Sarit; Weinberger, Adina; Segal, Eran


    The core promoter is the regulatory sequence to which RNA polymerase is recruited and where it acts to initiate transcription. Here, we present the first comprehensive study of yeast core promoters, providing massively parallel measurements of core promoter activity and of TSS locations and relative usage for thousands of native and designed sequences. We found core promoter activity to be highly correlated to the activity of the entire promoter and that sequence variation in different core promoter regions substantially tunes its activity in a predictable way. We also show that location, orientation, and flanking bases critically affect TATA element function, that transcription initiation in highly active core promoters is focused within a narrow region, that poly(dA:dT) orientation has a functional consequence at the 3′ end of promoters, and that orthologous core promoters across yeast species have conserved activities. Our results demonstrate the importance of core promoters in the quantitative study of gene regulation. PMID:25969468

  13. Acinetobacter cyclohexanone monooxygenase: gene cloning and sequence determination.

    PubMed Central

    Chen, Y C; Peoples, O P; Walsh, C T


    The gene coding for cyclohexanone monooxygenase from Acinetobacter sp. strain NCIB 9871 was isolated by immunological screening methods. We located and determined the nucleotide sequence of the gene. The structural gene is 1,626 nucleotides long and codes for a polypeptide of 542 amino acids; 389 nucleotides 5' and 108 nucleotides 3' of the coding region are also reported. The complete amino acid sequence of the enzyme was derived by translation of the nucleotide sequence. From a comparison of the amino acid sequence with consensus sequences of nucleotide-binding folds, we identified a potential flavin-binding site at the NH2 terminus of the enzyme (residues 6 to 18) and a potential nicotinamide-binding site extending from residue 176 to residue 208 of the protein. An overproduction system for the gene to facilitate genetic manipulations was also constructed by using the tac promoter vector pKK223-3 in Escherichia coli. Images PMID:3338974

  14. Mechanism of gene amplification via yeast autonomously replicating sequences.


    Sehgal, Shelly; Kaul, Sanjana; Dhar, M K


    The present investigation was aimed at understanding the molecular mechanism of gene amplification. Interplay of fragile sites in promoting gene amplification was also elucidated. The amplification promoting sequences were chosen from the Saccharomyces cerevisiae ARS, 5S rRNA regions of Plantago ovata and P. lagopus, proposed sites of replication pausing at Ste20 gene locus of S. cerevisiae, and the bend DNA sequences within fragile site FRA11A in humans. The gene amplification assays showed that plasmid bearing APS from yeast and human beings led to enhanced protein concentration as compared to the wild type. Both the in silico and in vitro analyses were pointed out at the strong bending potential of these APS. In addition, high mitotic stability and presence of TTTT repeats and SAR amongst these sequences encourage gene amplification. Phylogenetic analysis of S. cerevisiae ARS was also conducted. The combinatorial power of different aspects of APS analyzed in the present investigation was harnessed to reach a consensus about the factors which stimulate gene expression, in presence of these sequences. It was concluded that the mechanism of gene amplification was that AT rich tracts present in fragile sites of yeast serve as binding sites for MAR/SAR and DNA unwinding elements. The DNA protein interactions necessary for ORC activation are facilitated by DNA bending. These specific bindings at ORC promote repeated rounds of DNA replication leading to gene amplification. PMID:25685838

  15. Mechanism of Gene Amplification via Yeast Autonomously Replicating Sequences

    PubMed Central

    Dhar, M. K.


    The present investigation was aimed at understanding the molecular mechanism of gene amplification. Interplay of fragile sites in promoting gene amplification was also elucidated. The amplification promoting sequences were chosen from the Saccharomyces cerevisiae ARS, 5S rRNA regions of Plantago ovata and P. lagopus, proposed sites of replication pausing at Ste20 gene locus of S. cerevisiae, and the bend DNA sequences within fragile site FRA11A in humans. The gene amplification assays showed that plasmid bearing APS from yeast and human beings led to enhanced protein concentration as compared to the wild type. Both the in silico and in vitro analyses were pointed out at the strong bending potential of these APS. In addition, high mitotic stability and presence of TTTT repeats and SAR amongst these sequences encourage gene amplification. Phylogenetic analysis of S. cerevisiae ARS was also conducted. The combinatorial power of different aspects of APS analyzed in the present investigation was harnessed to reach a consensus about the factors which stimulate gene expression, in presence of these sequences. It was concluded that the mechanism of gene amplification was that AT rich tracts present in fragile sites of yeast serve as binding sites for MAR/SAR and DNA unwinding elements. The DNA protein interactions necessary for ORC activation are facilitated by DNA bending. These specific bindings at ORC promote repeated rounds of DNA replication leading to gene amplification. PMID:25685838

  16. Compilation and analysis of DNA sequences associated with apparent streptomycete promoters.

    PubMed Central

    Strohl, W R


    The DNA sequences associated with 139 apparent streptomycete transcriptional start sites are compiled and compared. Of these, 29 promoters appeared to belong to a group which are similar to those recognized by eubacterial RNA polymerases containing sigma 70-like subunits. The other 110 putative promoter regions contain a wide diversity of sequences; several of these promoters have obvious sequence similarities in the -10 and/or -35 regions. The apparent Shine-Dalgarno regions of 44 streptomycete genes are also examined and compared. These were found to have a wide range of degree of complementarity to the 3' end of streptomycete 16S rRNA. Eleven streptomycete genes are described and compared in which transcription and translation are proposed to be initiated from the same or nearby nucleotide. An updated consensus sequence for the E sigma 70-like promoters is proposed and a potential group of promoter sequences containing guanine-rich -35 regions also is identified. PMID:1549509

  17. Sequence Variability in Staphylococcal Enterotoxin Genes seb, sec, and sed

    PubMed Central

    Johler, Sophia; Sihto, Henna-Maria; Macori, Guerrino; Stephan, Roger


    Ingestion of staphylococcal enterotoxins preformed by Staphylococcus aureus in food leads to staphylococcal food poisoning, the most prevalent foodborne intoxication worldwide. There are five major staphylococcal enterotoxins: SEA, SEB, SEC, SED, and SEE. While variants of these toxins have been described and were linked to specific hosts or levels or enterotoxin production, data on sequence variation is still limited. In this study, we aim to extend the knowledge on promoter and gene variants of the major enterotoxins SEB, SEC, and SED. To this end, we determined seb, sec, and sed promoter and gene sequences of a well-characterized set of enterotoxigenic Staphylococcus aureus strains originating from foodborne outbreaks, human infections, human nasal colonization, rabbits, and cattle. New nucleotide sequence variants were detected for all three enterotoxins and a novel amino acid sequence variant of SED was detected in a strain associated with human nasal colonization. While the seb promoter and gene sequences exhibited a high degree of variability, the sec and sed promoter and gene were more conserved. Interestingly, a truncated variant of sed was detected in all tested sed harboring rabbit strains. The generated data represents a further step towards improved understanding of strain-specific differences in enterotoxin expression and host-specific variation in enterotoxin sequences. PMID:27258311

  18. Core Promoter Functions in the Regulation of Gene Expression of Drosophila Dorsal Target Genes*

    PubMed Central

    Zehavi, Yonathan; Kuznetsov, Olga; Ovadia-Shochat, Avital; Juven-Gershon, Tamar


    Developmental processes are highly dependent on transcriptional regulation by RNA polymerase II. The RNA polymerase II core promoter is the ultimate target of a multitude of transcription factors that control transcription initiation. Core promoters consist of core promoter motifs, e.g. the initiator, TATA box, and the downstream core promoter element (DPE), which confer specific properties to the core promoter. Here, we explored the importance of core promoter functions in the dorsal-ventral developmental gene regulatory network. This network includes multiple genes that are activated by different nuclear concentrations of Dorsal, an NFκB homolog transcription factor, along the dorsal-ventral axis. We show that over two-thirds of Dorsal target genes contain DPE sequence motifs, which is significantly higher than the proportion of DPE-containing promoters in Drosophila genes. We demonstrate that multiple Dorsal target genes are evolutionarily conserved and functionally dependent on the DPE. Furthermore, we have analyzed the activation of key Dorsal target genes by Dorsal, as well as by another Rel family transcription factor, Relish, and the dependence of their activation on the DPE motif. Using hybrid enhancer-promoter constructs in Drosophila cells and embryo extracts, we have demonstrated that the core promoter composition is an important determinant of transcriptional activity of Dorsal target genes. Taken together, our results provide evidence for the importance of core promoter composition in the regulation of Dorsal target genes. PMID:24634215

  19. Archaeal promoter architecture and mechanism of gene activation.


    Peng, Nan; Ao, Xiang; Liang, Yun Xiang; She, Qunxin


    Sulfolobus solfataricus and Sulfolobus islandicus contain several genes exhibiting D-arabinose-inducible expression and these systems are ideal for studying mechanisms of archaeal gene expression. At sequence level, only two highly conserved cis elements are present on the promoters: a regulatory element named ara box directing arabinose-inducible expression and the basal promoter element TATA, serving as the binding site for the TATA-binding protein. Strikingly, these promoters possess a modular structure that allows an essentially inactive basal promoter to be strongly activated. The invoked mechanisms include TFB (transcription factor B) recruitment by the ara-box-binding factor to activate gene expression and modulation of TFB recruitment efficiency to yield differential gene expression. PMID:21265754

  20. Pilus genes of Neisseria gonorrheae: chromosomal organization and DNA sequence.


    Meyer, T F; Billyard, E; Haas, R; Storzbach, S; So, M


    We have mapped two regions of the Neisseria gonorrheae genome, pilE1 and pilE2, which are involved in pilus expression. When the cells are in the piliated P+ state, these two loci carry sequences necessary for pilin production. A silent locus, pilS1, also maps near pilE1 and pilE2. pilS1 contains structural gene information but lacks pilus promoter sequences. The pilus gene sequences in pilE1 and pilE2 are identical in strain MS11. PMID:6148752

  1. Genome organization in Mycoplasma hyopneumoniae: identification of promoter-like sequences.


    Siqueira, Franciele Maboni; de Souto Weber, Shana; Cattani, Amanda Malvessi; Schrank, Irene Silveira


    Information related to open reading frame (ORF) organization, transcription regulation and promoter sequence has been available for the Mycoplasma hyopneumoniae 7448 genome, demonstrating that the ORFs are continuously transcribed (cotranscription) in large clusters. A species-specific position-specific scoring matrix was applied to scan for putative promoters upstream of all coding sequences on a genome scale in M. hyopneumoniae. This study consisted of a detailed in silico promoter localization analysis by scanning the position-specific promoters upstream of predicted ORF clusters (OCs) and mCs (monocistronic genes) in the M. hyopneumoniae whole genome; this was combined with experimental data for the promoterless ORFs. Promoter-like sequences were found in 86% of the OCs (from the OC first gene) and in 85% of the mCs. A transcription analysis of the promoterless ORF was performed by RT-PCR. This strategy allowed the definition of a specific promoter sequence for all OCs and mCs indicating that all the transcriptional units are preceded by putative promoter sequences (matrix and manually located) and providing evidence for functional gene organization in the M. hyopneumoniae genome. These results shown that the species-specific, position-specific scoring matrix for promoter prediction is effective, further increasing the knowledge of gene organization and transcription initiation in mycoplasmas. PMID:24844214

  2. Characterization of the human 5-lipoxygenase gene promoter

    SciTech Connect

    Hoshiko, S.; Radmark, O.; Samuelsson, B. )


    Nucleotide sequences that direct transcription of the human 5-lipoxygenase gene have been examined by ligation to the chloramphenicol acetyltransferase activity in transfected HeLa and HL-60 cells. Various lengths of 5{prime}-flanking sequences up to 5.9 kilobase pairs 5{prime} of the transcriptional initiation sites were tested. Two positive and two negative apparent regulatory regions were seen. Part of the promoter sequence ({minus}179 to {minus}56 from ATG), which includes five repeated GC boxes (the putative Spl binding sequence) was essential for transcription in both HeLa and HL-60 cells. Gel-shift assays (using the DNA fragment {minus}212 to {minus}88) revealed that the transcriptional factor Spl could bind to this region of the 5-lipoxygenase promoter. Furthermore, HL-60 nuclear extracts contained specific nuclear factor(s) binding to 5-lipoxygenase promoter DNA, which could not be detected in HeLa cell nuclear extracts.

  3. Architecture of a yeast U6 RNA gene promoter.

    PubMed Central

    Eschenlauer, J B; Kaiser, M W; Gerlach, V L; Brow, D A


    The promoters of vertebrate and yeast U6 small nuclear RNA genes are structurally dissimilar, although both are recognized by RNA polymerase III. Vertebrate U6 RNA genes have exclusively upstream promoters, while the U6 RNA gene from the yeast Saccharomyces cerevisiae (SNR6) has internal and downstream promoter elements that match the tRNA gene intragenic A- and B-block elements, respectively. Substitution of the SNR6 A or B block greatly diminished U6 RNA accumulation in vivo, and a subcellular extract competent for RNA polymerase III transcription generated nearly identical DNase I protection patterns over the SNR6 downstream B block and a tRNA gene intragenic B block. We conclude that the SNR6 promoter is functionally similar to tRNA gene promoters, although the effects of extragenic deletion mutations suggest that the downstream location of the SNR6 B block imposes unique positional constraints on its function. Both vertebrate and yeast U6 RNA genes have an upstream TATA box element not normally found in tRNA genes. Substitution of the SNR6 TATA box altered the site of transcription initiation in vivo, while substitution of sequences further upstream had no effect on SNR6 transcription. We present a model for the SNR6 transcription complex that explains these results in terms of their effects on the binding of transcription initiation factor TFIIIB. Images PMID:8474459

  4. Topoisomerase I has a strong binding preference for a conserved hexadecameric sequence in the promoter region of the rRNA gene from Tetrahymena pyriformis.

    PubMed Central

    Andersen, A H; Gocke, E; Bonven, B J; Nielsen, O F; Westergaard, O


    Topoisomerase I is in situ associated with DNaseI hypersensitive sites located in the promotor and terminator regions of the extrachromosomal rDNA in Tetrahymena thermophila at sites with sequences fitting the motif (sequence in text) Reconstitution experiments with purified topoisomerase I and cloned fragments of rDNA demonstrate that the enzyme exhibits the same binding and cleavage properties on naked DNA. These observations are striking as topoisomerase I previously has been found to exhibit low sequence specificity. The specific binding of the enzyme has an absolute requirement for divalent cations with a preference for Ca2+. The strong binding to the hexadecamer has been characterized by competition experiments, and it has been used to determine the molecular weight of the enzyme. Images PMID:2987828

  5. Cloning and sequence analyses of cDNAs for interferon- and virus-induced human Mx proteins reveal that they contain putative guanine nucleotide-binding sites: functional study of the corresponding gene promoter.

    PubMed Central

    Horisberger, M A; McMaster, G K; Zeller, H; Wathelet, M G; Dellis, J; Content, J


    The human protein p78 is induced and accumulated in cells treated with type I interferon or with some viruses. It is the human homolog of the mouse Mx protein involved in resistance to influenza virus. A full-length cDNA clone encoding the human p78 protein was cloned and sequenced. It contained an open reading frame of 662 amino acids, corresponding to a polypeptide with a predicted molecular weight of 75,500, in good agreement with the Mr of 78,000 determined on sodium dodecyl sulfate gels for the purified natural p78 protein. The cloned gene was expressed in vitro and corresponded in size, pI, antigenic determinant(s), and NH2 terminus sequence to the natural p78 protein. A second cDNA was cloned which encoded a 633-amino-acid protein sharing 63% homology with human p78. This p78-related protein was translated in reticulocyte lysates where it shared an antigenic determinant(s) with p78. A putative 5' regulatory region of 83 base pairs contained within the gene promoter region upstream of the presumed p78 mRNA cap site conferred human alpha interferon (IFN-alpha) inducibility to the cat reporter gene. The p78 protein accumulated to high levels in cells treated with IFN-alpha. In contrast, the p78-related protein was not expressed at detectable levels. The rate of decay of p78 levels in diploid cells after a 24-h treatment with IFN-alpha was much slower than the rate of decay of the antiviral state against influenza A virus and vesicular stomatitis virus, suggesting that the p78 protein is probably not involved in an antiviral mechanism. Furthermore, we showed that these proteins, as well as the homologous mouse Mx protein, possess three consensus elements in proper spacing, characteristic of GTP-binding proteins. Images PMID:2154602

  6. Nucleosomal promoter variation generates gene expression noise

    PubMed Central

    Brown, Christopher R.; Boeger, Hinrich


    Gene product molecule numbers fluctuate over time and between cells, confounding deterministic expectations. The molecular origins of this noise of gene expression remain unknown. Recent EM analysis of single PHO5 gene molecules of yeast indicated that promoter molecules stochastically assume alternative nucleosome configurations at steady state, including the fully nucleosomal and nucleosome-free configuration. Given that distinct configurations are unequally conducive to transcription, the nucleosomal variation of promoter molecules may constitute a source of gene expression noise. This notion, however, implies an untested conjecture, namely that the nucleosomal variation arises de novo or intrinsically (i.e., that it cannot be explained as the result of the promoter’s deterministic response to variation in its molecular surroundings). Here, we show—by microscopically analyzing the nucleosome configurations of two juxtaposed physically linked PHO5 promoter copies—that the configurational variation, indeed, is intrinsically stochastic and thus, a cause of gene expression noise rather than its effect. PMID:25468975

  7. Synthetic muscle promoters: activities exceeding naturally occurring regulatory sequences

    NASA Technical Reports Server (NTRS)

    Li, X.; Eastman, E. M.; Schwartz, R. J.; Draghia-Akli, R.


    Relatively low levels of expression from naturally occurring promoters have limited the use of muscle as a gene therapy target. Myogenic restricted gene promoters display complex organization usually involving combinations of several myogenic regulatory elements. By random assembly of E-box, MEF-2, TEF-1, and SRE sites into synthetic promoter recombinant libraries, and screening of hundreds of individual clones for transcriptional activity in vitro and in vivo, several artificial promoters were isolated whose transcriptional potencies greatly exceed those of natural myogenic and viral gene promoters.

  8. Nucleotide sequence of a human tRNA gene heterocluster

    SciTech Connect

    Chang, Y.N.; Pirtle, I.L.; Pirtle, R.M.


    Leucine tRNA from bovine liver was used as a hybridization probe to screen a human gene library harbored in Charon-4A of bacteriophage lambda. The human DNA inserts from plaque-pure clones were characterized by restriction endonuclease mapping and Southern hybridization techniques, using both (3'-/sup 32/P)-labeled bovine liver leucine tRNA and total tRNA as hybridization probes. An 8-kb Hind III fragment of one of these ..gamma..-clones was subcloned into the Hind III site of pBR322. Subsequent fine restriction mapping and DNA sequence analysis of this plasmid DNA indicated the presence of four tRNA genes within the 8-kb DNA fragment. A leucine tRNA gene with an anticodon of AAG and a proline tRNA gene with an anticodon of AGG are in a 1.6-kb subfragment. A threonine tRNA gene with an anticodon of UGU and an as yet unidentified tRNA gene are located in a 1.1-kb subfragment. These two different subfragments are separated by 2.8 kb. The coding regions of the three sequenced genes contain characteristic internal split promoter sequences and do not have intervening sequences. The 3'-flanking region of these three genes have typical RNA polymerase III termination sites of at least four consecutive T residues.

  9. Bacillus licheniformis APase I gene promoter: a strong well-regulated promoter in B. subtilis.


    Lee, J K; Edwards, C W; Hulett, F M


    The 5' regulatory region and the portion of the structural gene coding for the amino-terminal sequence of alkaline phosphatase I (APase I) were isolated from Bacillus licheniformis MC14 using a synthetic oligodeoxynucleotide deduced from the amino acid sequence of the enzyme. The DNA sequence analysis of this region revealed an open reading frame of 129 amino acids containing the amino-terminal sequence of the mature APase protein. The protein sequence was preceded by a putative signal sequence of 32 amino acid residues. The predicted amino acid sequence of the partial APase clone as well as the experimentally determined amino acid sequence of the enzyme indicated that B. licheniformis APase retains the important features conserved among other APases of Bacillus subtilis, Escherichia coli, Saccharomyces cerevisiae, and various human tissues. Heterologous expression studies of the promoter using a fusion with the lacZ gene indicated that it functions as a very strong inducible promoter in B. subtilis that is tightly regulated by phosphate concentration. PMID:1907637

  10. Computational approach towards promoter sequence comparison via TF mapping using a new distance measure.


    Meera, A; Rangarajan, Lalitha; Bhat, Savithri


    We propose a method for identifying transcription factor binding sites (TFBS) in the given promoter sequence and mapping the transcription factors (TFs). The proposed algorithm searches the +1 transcription start site (TSS) for eukaryotic and prokaryotic sequences individually. The algorithm was tested with sequences from both eukaryotes and prokaryotes for at least 9 experimentally verified and validated functional TFs in promoter sequences. The order and type of TF binding to the promoter of genes encoding central metabolic pathway (CMP) enzyme was tabulated. A new similarity measure was devised for scoring the similarity between a pair of promoter sequences based on the number and order of motifs. Further, these were grouped in clusters considering the scores between them. The distance between each of the clusters in individual pathway was calculated and a phylogenetic tree was developed. This method is further applied to other pathways such as lipid and amino acid biosynthesis to retrieve and compare experimentally verified and conserved TFBS. PMID:21369887

  11. Transcriptional Silencing by Hairpin RNAs Complementary to a Gene Promoter

    PubMed Central

    Chu, Yongjun; Kalantari, Roya; Dodd, David W.


    Double-stranded RNAs can target gene promoters and inhibit transcription. To date, most research has focused on synthetic RNA duplexes. Transcriptional silencing by hairpin RNAs would facilitate a better understanding of endogenous RNA-mediated regulation of transcription within cells. Here we examine transcriptional silencing of progesterone receptor (PR) expression by hairpin RNAs. We identify the guide strand as the strand complementary to an antisense transcript at the PR promoter and that hairpin RNAs are active transcriptional silencing agents. The sequence of the hairpin loop affects activity, with the highest activity achieved when the loop has the potential for full complementarity to the antisense transcript target. Introduction of centrally mismatched bases relative to the target transcript does not prevent transcriptional silencing unless the mismatches are present on both the guide and passenger strands. These data demonstrate that hairpin RNAs can cause transcriptional silencing and offer insights into the mechanism of gene modulation by RNAs that target gene promoters. PMID:22703280

  12. [Cloning and characterization of D-113 gene promoter from cotton].


    Luo, Ke-Ming; Guo, Yu-Long; Xiao, Yue-Hua; Hou, Lei; Pei, Yan


    To study the expression of late embryogenesis abundant gene in seeds, the 1,024 bp 5' flanking sequence of D-113 gene, a late embryogenesis abundant gene of Gossypium hirsutum cv. Coker 312, was cloned by PCR. The similarity compared with the sequence of Lea protein gene family published was 92.50%. There are three putative ABREs and one enhancer-like which riches A/T in the promoter. The promoter was fused to the beta-glucuronidase gene to form pLD II. Via a particle bombardment, pLD II was introduced into embryogenic calli of cotton and seeds of Brassica napus which were all treated with abscisic acid for 3d before bombardment, also into roots, stems and leafs of cotton. Transient expression was measured histochemically as spot number 24 h after bombardment. GUS sexpression was observed in the seeds of Brassica napus and the embryogenic calli of cotton, but not found in roots and leaves of cotton. Those results indicated that the expression of D-113 gene promoter was embryo specific. PMID:11902000

  13. Sequence Determinants of Circadian Gene Expression Phase in Cyanobacteria

    PubMed Central

    Vijayan, Vikram


    The cyanobacterium Synechococcus elongatus PCC 7942 exhibits global biphasic circadian oscillations in gene expression under constant-light conditions. Class I genes are maximally expressed in the subjective dusk, whereas class II genes are maximally expressed in the subjective dawn. Here, we identify sequence features that encode the phase of circadian gene expression. We find that, for multiple genes, an ∼70-nucleotide promoter fragment is sufficient to specify class I or II phase. We demonstrate that the gene expression phase can be changed by random mutagenesis and that a single-nucleotide substitution is sufficient to change the phase. Our study provides insight into how the gene expression phase is encoded in the cyanobacterial genome. PMID:23204469

  14. Sequences promoting the transcription of the human XA gene overlapping P450c21A correctly predict the presence of a novel, adrenal-specific, truncated form of tenascin-X

    SciTech Connect

    Tee, Meng Kian; Thomson, A.A.; Bristow, J.; Miller, W.L.


    A compact region in the human class III major histocompatibility locus contains the human genes for the fourth component of human complement (C4) and steroid 21-hydroxylase (P450c21) in one transcriptional orientation, while the gene for the extracellular matrix protein tenascin-X (TN-X) overlaps the last exon of P450c21 on the opposite strand of DNA in the opposite transcriptional orientation. This complex locus is duplicated into A and B loci, so that the organization is 5{prime}-C4A-21A-XA-C4B-21B-XB-3{prime}. Although this duplication event truncated the 65-kb X(B) gene to a 4.5-kb XA gene, the XA gene is transcriptionally active in the adrenal cortex. To examine the basis of the tissue-specific expression of XA and C4B, we cloned the 1763-bp region that lies between the cap sites for XA and C4B and analyzed its promoter activity in both the XA and the C4 orientations. Powerful, liver-specific sequences lie within the first 75 to 138 bp from the C4B cap site, and weaker elements lie within 128 bp of the XA cap site that function in both liver and adrenal cells. Because these 128 bp upstream from the XA cap site are perfectly preserved in the XB gene encoding TN-X, we sought to determine whether a transcript similar to XA arises within the SB gene. RNase protection assays, cDNA cloning, and RT/PCR show that adrenal cells contain a novel transcript, termed short XB (XB-S), which has the same open reading frame as TN-X. Cell-free translation and immunoblotting show that this transcript encodes a novel 74-kDa XB-S protein that is identical to the carboxy-terminal 673 residues of TN-X. Because this protein consists solely of fibronectin type III repeats and a fibrinogen-like domain, it appears to correspond to an evolutionary precursor of the tenascin family of extracellular matrix proteins. 40 refs., 6 figs.

  15. Use of yeast nuclear DNA sequences to define the mitochondrial RNA polymerase promoter in vitro.

    PubMed Central

    Marczynski, G T; Schultz, P W; Jaehning, J A


    We have extended an earlier observation that the TATA box for the nuclear GAL10 gene serves as a promoter for the mitochondrial RNA polymerase in in vitro transcription reactions (C. S. Winkley, M. J. Keller, and J. A. Jaehning, J. Biol. Chem. 260:14214-14223, 1985). In this work, we demonstrate that other nuclear genes also have upstream sequences that function in vitro as mitochondrial RNA polymerase promoters. These genes include the GAL7 and MEL1 genes, which are regulated in concert with the GAL10 gene, the sigma repetitive element, and the 2 microns plasmid origin of replication. We used in vitro transcription reactions to test a large number of nuclear DNA sequences that contain critical mitochondrial promoter sequences as defined by Biswas et al. (T. K. Biswas, J. C. Edwards, M. Rabinowitz, and G. S. Getz, J. Biol. Chem. 262:13690-13696, 1987). The results of these experiments allowed us to extend the definition of essential promoter elements. This extended sequence, -ACTATAAACGatcATAG-, was frequently found in the upstream regulatory regions of nuclear genes. On the basis of these observations, we hypothesized that either (i) a catalytic RNA polymerase related to the mitochondrial enzyme functions in the nucleus of the yeast cell or (ii) a DNA sequence recognition factor is shared by the two genetic compartments. By using cells deficient in the catalytic core of the mitochondrial RNA polymerase (rpo41-) and sensitive assays for transcripts initiating from the nuclear promoter sequences, we have conclusively ruled out a role for the catalytic RNA polymerase in synthesizing transcripts from all of the nuclear sequences analyzed. The possibility that a DNA sequence recognition factor functions in both the nucleus and the mitochondria remains to be tested. Images PMID:2677667

  16. Gene Sequence Homology of Chemokines Across Species

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The abundance of expressed gene and protein sequences available in the biological information databases facilitates comparison of protein homologies. A high degree of sequence similarity typically implies homology regarding structure and function and may provide clues to antibody cross-reactivities...


    Technology Transfer Automated Retrieval System (TEKTRAN)

    The abundance of expressed gene and protein sequences available in the biological information databases facilitates comparison of protein homologies. A high degree of sequence similarity typically implies homology regarding structure and function and may provide clues to antibody cross-react...

  18. Cloning of a marine cyanobacterial promoter for foreign gene expression using a promoter probe vector

    SciTech Connect

    Sode, Koji; Hatano, Naoaki; Tatara, Masahiro


    A marine cyanobacterial promoter was cloned to allow efficient foreign gene expression. This was carried out using chloramphenicol acetyl transferase (CAT) as a marker protein. For rapid and simple measurement of CAT activity, a method based on a fluorescently labeled substrate was improved by utilizing HPLC equipped with a flow-through fluorescent spectrophotometer. This method was used in conjunction with a newly constructed promoter probe vector. Cyanobacterial transformants, harboring plasmid containing a cloned 2-kbp marine cyanobacterial genomic fragment, showed a 10-fold higher CAT activity, compared with that achieved using the kanamycin-resistant gene promoter. From the sequence analysis of the cloned fragment, a putative promoter region was found. 20 refs., 7 figs., 2 tabs.

  19. In vitro mapping of Myotonic Dystrophy (DM) gene promoter

    SciTech Connect

    Storbeck, C.J.; Sabourin, L.; Baird, S.


    The Myotonic Dystrophy Kinase (DMK) gene has been cloned and shared homology to serine/threonine protein kinases. Overexpression of this gene in stably transfected mouse myoblasts has been shown to inhibit fusion into myotubes while myoblasts stably transfected with an antisense construct show increased fusion potential. These experiments, along with data showing that the DM gene is highly expressed in muscle have highlighted the possibility of DMK being involved in myogenesis. The promoter region of the DM gene lacks a consensus TATA box and CAAT box, but harbours numerous transcription binding sites. Clones containing extended 5{prime} upstream sequences (UPS) of DMK only weakly drive the reporter gene chloramphenicol acetyl transferase (CAT) when transfected into C2C12 mouse myoblasts. However, four E-boxes are present in the first intron of the DM gene and transient assays show increased expression of the CAT gene when the first intron is present downstream of these 5{prime} UPS in an orientation dependent manner. Comparison between mouse and human sequence reveals that the regions in the first intron where the E-boxes are located are highly conserved. The mapping of the promoter and the importance of the first intron in the control of DMK expression will be presented.

  20. Characterization of a barley Rubisco activase gene promoter

    SciTech Connect

    Strickland, J.A.; Rundle, S.J.; Zielinski, R. )


    Barley Rubisco Activase (Rca) is a nuclear encoded chloroplast enzyme that activates Rubisco to catalytic competence. Rca mRNA accumulation in barley is light-regulated; the 5{prime}-flanking region of a highly expressed barley Rca gene (HvRca-1) contains several sequence motifs similar to those found in the promoter of other light-regulated, nuclear genes. We have characterized the cis-acting regulatory regions of HvRca-1 by deletion analysis of the 5{prime} flanking region of a cloned gene. These constructs have been assayed in vitro by gel mobility shift assays, as well as by DNA footprinting. Putative regulatory sequences detected in vitro have also been tested in vivo by constructing chimeric genes consisting of deletion mutant promoters fused to a promoterless {beta}-glucuronidase reporter gene. Comparison of results obtained from complimentary parallel in vitro and in vivo assays of identical promoter deletions have provided information on cis-acting regulatory regions of HvRca-1.

  1. Universal light-switchable gene promoter system


    Quail, Peter H.; Huq, Enamul; Tepperman, James; Sato, Sae


    An artificial promoter system that can be fused upstream of any desired gene enabling reversible induction or repression of the expression of the gene at will in any suitable host cell or organisms by light is described. The design of the system is such that a molecule of the plant photoreceptor phytochrome is targeted to the specific DNA binding site in the promoter by a protein domain that is fused to the phytochrome and that specifically recognizes this binding site. This bound phytochrome, upon activation by light, recruits a second fusion protein consisting of a protein that binds to phytochrome only upon light activation and a transcriptional activation domain that activates expression of the gene downstream of the promoter.

  2. Gene Discovery through Expressed Sequence Tag Sequencing in Trypanosoma cruzi

    PubMed Central

    Verdun, Ramiro E.; Di Paolo, Nelson; Urmenyi, Turan P.; Rondinelli, Edson; Frasch, Alberto C. C.; Sanchez, Daniel O.


    Analysis of expressed sequence tags (ESTs) constitutes a useful approach for gene identification that, in the case of human pathogens, might result in the identification of new targets for chemotherapy and vaccine development. As part of the Trypanosoma cruzi genome project, we have partially sequenced the 5′ ends of 1,949 clones to generate ESTs. The clones were randomly selected from a normalized CL Brener epimastigote cDNA library. A total of 14.6% of the clones were homologous to previously identified T. cruzi genes, while 18.4% had significant matches to genes from other organisms in the database. A total of 67% of the ESTs had no matches in the database, and thus, some of them might be T. cruzi-specific genes. Functional groups of those sequences with matches in the database were constructed according to their putative biological functions. The two largest categories were protein synthesis (23.3%) and cell surface molecules (10.8%). The information reported in this paper should be useful for researchers in the field to analyze genes and proteins of their own interest. PMID:9784549

  3. Characterization of the human CD4 gene promoter: transcription from the CD4 gene core promoter is tissue-specific and is activated by Ets proteins.

    PubMed Central

    Salmon, P; Giovane, A; Wasylyk, B; Klatzmann, D


    We analyzed the 5' transcription control sequences of the human CD4 gene. We located the transcription initiation site and showed that the CD4 core promoter (positions -40 to +16) lacks a classical "TATA" or initiator positioning consensus sequence but directs precise and efficient transcription when coupled to the ubiquitously active simian virus 40 enhancer. The transcriptional activity of the CD4 gene promoter correlated with CD4 expression in various cell types. Interestingly, the CD4 core promoter also displayed a tissue-specific transcriptional activity. Within this fragment, three nucleic acid sequences are completely conserved in the murine CD4 gene. One of these sequences contains a perfect ETS consensus sequence. Another ETS consensus sequence is located 1060 nt upstream. Electrophoretic-mobility-shift assays showed that the core promoter ETS motif binds an Ets-related protein specifically expressed at high levels in CD4+ cells. Moreover, in CD4- cells, overexpression of Ets-1 or Ets-2 efficiently and specifically activated transcription from the CD4 promoter and core promoter. These data indicate that Ets transcription factors play a central role in controlling CD4 gene expression, by binding to both a classical remote site and an unusual proximal activator sequence. Images Fig. 2 Fig. 4 PMID:8356078

  4. Sequences far downstream from the classical tRNA promoter elements bind RNA polymerase III transcription factors.

    PubMed Central

    Young, L S; Rivier, D H; Sprague, K U


    We have examined the interaction of transcription factors TFIIIC and TFIIID with a silkworm alanine tRNA gene. Previous functional analysis showed that the promoter for this gene is unusually large compared with the classical tRNA promoter elements (the A and B boxes) and includes sequences downstream from the transcription termination site. The goal of the experiments reported here was to determine which sequences within the full promoter make stable contacts with transcription factors. We show that when TFIIIC and TFIIID are combined, a complex is formed with the tRNA(Ala)C gene. Neither factor alone can form this complex. DNase I digestion of gene-factor complexes reveals that most of the tRNA(Ala)C promoter is in contact with factors. The protected region extends from -1 to at least +136 and includes both the A and B boxes and the previously identified downstream promoter sequences. Analysis of mutant promoters shows that sequence-specific contacts throughout the protected region are required for binding. The role of 3'-flanking sequences in transcription factor binding explains the contribution of these sequences to the tRNA(Ala)C promoter. We discuss the possibility that such sequences affect promoter strength in other tRNA genes. Images PMID:1996100

  5. Cloning and nucleotide sequence of the Lactobacillus casei lactate dehydrogenase gene.

    PubMed Central

    Kim, S F; Baek, S J; Pack, M Y


    An allosteric L-(+)-lactate dehydrogenase gene of Lactobacillus casei ATCC 393 was cloned in Escherichia coli, and the nucleotide sequence of the gene was determined. The gene was composed of an open reading frame of 981 bp, starting with a GTG codon and ending with a TAA codon. The sequences for the promoter and ribosome binding site were identified, and a sequence for a structure resembling a rho-independent transcription terminator was also found. Images PMID:1768113

  6. DNA sequence of the yeast transketolase gene.


    Fletcher, T S; Kwee, I L; Nakada, T; Largman, C; Martin, B M


    Transketolase (EC is the enzyme that, together with aldolase, forms a reversible link between the glycolytic and pentose phosphate pathways. We have cloned and sequenced the transketolase gene from yeast (Saccharomyces cerevisiae). This is the first transketolase gene of the pentose phosphate shunt to be sequenced from any source. The molecular mass of the proposed translated protein is 73,976 daltons, in good agreement with the observed molecular mass of about 75,000 daltons. The 5'-nontranslated region of the gene is similar to other yeast genes. There is no evidence of 5'-splice junctions or branch points in the sequence. The 3'-nontranslated region contains the polyadenylation signal (AATAAA), 80 base pairs downstream from the termination codon. A high degree of homology is found between yeast transketolase and dihydroxyacetone synthase (formaldehyde transketolase) from the yeast Hansenula polymorpha. The overall sequence identity between these two proteins is 37%, with four regions of much greater similarity. The regions from amino acid residues 98-131, 157-182, 410-433, and 474-489 have sequence identities of 74%, 66%, 83%, and 82%, respectively. One of these regions (157-182) includes a possible thiamin pyrophosphate (TPP) binding domain, and another (410-433) may contain the catalytic domain. PMID:1737042

  7. [Modifications of gene expression by tumor promoters].


    Zhang, C; Zhao, Q; Guo, S; Zhao, M; Cheng, S


    The modifications of gene expression by tumor promoters were analyzed in vitro and in vivo. The results of slot blot hybridizations showed that tumor promoter TPA induced c-fos and c-myc expressions in mouse fibroblast cell line BALB/3T3 and rat liver, decreased the levels of Rb RNA in BALB/3T3 cell line and of alpha 1-I3 RNA in rat liver. It was also demonstrated that tumor promoter phenobarbital influenced c-fos and c-myc expressions and decreased alpha 1I3 mRNA level in rat liver during a long term experiment. Phenobarbital was found to have no effect on c-fos and c-myc expressions in rat liver during a short experiment. Tumor promoters induced the expressions of c-fos and c-myc which were positively-related to cancer formation and inhibited the expressions of Rb and alpha 1-I3 which were negatively-related to cancer formation. This implied that tumor promotion played an important role in cancer development and tumor promoters exerted their effects selectively according to the attributes of different genes. PMID:7540119

  8. Isolation and sequence analysis of napin seed specific promoter from Iranian Rapeseed (Brassica napus L.).


    Sohrabi, Maryam; Zebarjadi, Alireza; Najaphy, Abdollah; Kahrizi, Danial


    Rapeseed (Brassica napus L.) has become an important crop during the last 30years. In addition to a high lipid level, the seeds also have a significant protein content, which constitutes 20-25% of the dry seed weight. The synthesis of storage proteins is primarily controlled at transcriptional level and seed-specific expression has been shown to be conferred upon the promoter regions of many storage protein genes. Napin is one of the main storage proteins in rapeseed(')s embryo that is produced in seed developing stage. Its promoter region located at 5' upstream of the napin gene has already been isolated (GenBank number, EU416279.1). In current research, seed-specific promoter (napin) of Iranian B. napus L. was isolated from the genomic DNA and cloned into pBI121 plant binary vector to use in future researches. For this purpose, the napin promoter was amplified by PCR method using specific primers, cloned in pSK(+) vector and sequenced. Sequencing analysis showed that the cloned promoter contained all of conserved motifs such as TATA box (TATAAA), RY repeats (CATGCA), dist-B (TCAAACACC) and prox-B elements (GCCACTTGTC), G-box (CACGTG) and CAAT Motifs, which constituted the seed-specific promoter activity and according to this analysis, the seed-specific promoter activity of cloned sequence was predicted. Based on sequence distances of nucleotide sequences, our sequence had the highest similarity (99.8%) whit B. napus sequence (with EU416279.1 accession number). Finally the promoter obtained might be interesting not only as a useful tool for biotechnological application but also for fundamental research. PMID:25797503

  9. Promoter region of mouse Tcrg genes

    SciTech Connect

    Ishimi, Y.; Huang, Y.Y.; Ohta, S.


    The mouse T-cell receptor (Tcr){gamma} chain is characterized by a specific expression of V gene segments in the thymus corresponding to consecutive developmental stages; i.e., the Vg5 in fetal, Vg6 in neonatal, and Vg4 and Vg7 in adult. The order of the Vg gene usage correlates with the localization of the Vg gene segment on the chromosome; i.e., the Vg5 gene, being most proximal to the Jg1, is used first, followed by the Vg segments away from the Jg1 in a sequential manner. Since they all rearrange to the same Jg1 gene segment, the sequences in the coding region and/or in the 5{prime} upstream region are responsible for the stage-specific transcription. Also, Goldman and co-workers reported the germline transcription of Vg genes preceding their rearrangement. Therefore, the stage-specific transcription may be involved in the regulation of the stage-specific rearrangement; we sequenced and analyzed the 5{prime} flanking regions of the Vg5, Vg6, Vg4, and Vg7 genes to study the transcriptional relation. 18 refs., 2 figs., 1 tab.

  10. Alternative promoters of gene MAGE4a

    SciTech Connect

    De Plaen, E.; Naerhuyzen, B.; De Smet, C.


    Gene MAGE-4 (HGMW-approved symbol MAGE4) is expressed in several types of tumors, but not in normal tissues, except testis and placenta. The 5{prime} end of this gene contains eight homologous exons spread over a 5.8-kb region. These exons are alternatively spliced to a unique second exon and a unique third exon, which encodes a protein of 317 amino acids. The analysis of transcripts found in testis, placenta, and a sarcoma cell line showed that each of the alternative first exons is used in at least one of these tissues. Various regions of the promoter of the fifth alternative exon (1.5) were cloned in a luciferase reporter plasmid, and the constructs were transfected in a sarcoma cell line that expresses MAGE-4. Two Ets motifs located between positions -70 and -29 relative to the transcription start site were found to drive 55% of the promoter activity. A region containing an Sp1 consensus binding site located upstream of the two Ets motifs was found to be responsible for 44% of the transcriptional activity. MAGE-4a promoters 1.4 and 1.6, which also contain the Sp1 and the two Ets binding motifs, supported a level of transcription comparable to that of promoter 1.5, whereas promoter 1.1, which contains only one Ets binding site, was sixfold less active. In line with observations made with gene MAGE-1 (HGMW-approved symbol MAGE1), we found that promoter 1.5 stimulated a high level of transcription in a melanoma cell line that does not express MAGE-4. This suggests that the tumor-specific expression of MAGE genes is not determined by the presence of specific transcription factors. 26 refs., 7 figs., 2 tabs.

  11. The nucleotide sequence of the mouse immunoglobulin epsilon gene: comparison with the human epsilon gene sequence.

    PubMed Central

    Ishida, N; Ueda, S; Hayashida, H; Miyata, T; Honjo, T


    We have determined the nucleotide sequence of the immunoglobulin epsilon gene cloned from newborn mouse DNA. The epsilon gene sequence allows prediction of the amino acid sequence of the constant region of the epsilon chain and comparison of it with sequences of the human epsilon and other mouse immunoglobulin genes. The epsilon gene was shown to be under the weakest selection pressure at the protein level among the immunoglobulin genes although the divergence at the synonymous position is similar. Our results suggest that the epsilon gene may be dispensable, which is in accord with the fact that IgE has only obscure roles in the immune defense system but has an undesirable role as a mediator of hypersensitivity. The sequence data suggest that the human and murine epsilon genes were derived from different ancestors duplicated a long time ago. The amino acid sequence of the epsilon chain is more homologous to those of the gamma chains than the other mouse heavy chains. Two membrane exons, separated by an 80-base intron, were identified 1.7 kb 3' to the CH4 domain of the epsilon gene and shown to conserve a hydrophobic portion similar to those of other heavy chain genes. RNA blot hybridization showed that the epsilon membrane exons are transcribed into two species of mRNA in an IgE hybridoma. Images Fig. 4. PMID:6329728

  12. Promoter sequences and algorithmical methods for identifying them.


    Vanet, A; Marsan, L; Sagot, M F


    This paper presents a survey of currently available mathematical models and algorithmical methods for trying to identify promoter sequences. The methods concern both searching in a genome for a previously defined consensus and extracting a consensus from a set of sequences. Such methods were often tailored for either eukaryotes or prokaryotes although this does not preclude use of the same method for both types of organisms. The survey therefore covers all methods; however, emphasis is placed on prokaryotic promoter sequence identification. Illustrative applications of the main extracting algorithms are given for three bacteria. PMID:10673015

  13. Isolation of the promoters of Atlantic salmon MHCII genes.


    Syed, Mohasina; Vestrheim, Olav; Mikkelsen, Birthe; Lundin, Maria


    The major histocompatibility complex class II (MHCII) has a central role in the immune response of vertebrates with its function of presenting antigenic peptides to the T-cell receptors. We have isolated the promoters and intron 1 of MHCIIalpha and MHCIIbeta genes of Atlantic salmon. To isolate these promoters, we constructed an Atlantic salmon ( Salmo salar) promoter finder kit (analogous to the commercially available "human promoter finder kit"). By nucleotide sequence alignment of known MHCII promoter regions, we identified the 3 conserved regulatory X, X2, and Y boxes in the salmon promoters. The W box was not found. In contrast, a salmon-specific putative W box was identified. Both of the isolated Atlantic salmon MHCIIalpha and beta promoters (included in patent applications by Genomar A/S, Oslo, Norway) were found to be functional since they both gave positive yellow fluorescence protein signal when inserted as promoters in the pEYFP-1 reporter plasmid and transfected into the salmon head kidney cell line (SHK-1). PMID:14502397

  14. Draft Genome Sequence of Plant Growth-Promoting Rhizobacterium Pantoea sp. Strain AS-PWVM4

    PubMed Central

    Khatri, Indu; Kaur, Sukhvir; Devi, Usha; Kumar, Navinder; Sharma, Deepak


    Nonpathogenic Pantoea spp. have been shown to confer biofertilizer and biocontrol activities, indicating their potential for increasing crop yield. Herein, we provide the high-quality genome sequence of Pantoea sp. strain AS-PWVM4, a Gram-negative motile plant growth-promoting rhizobacterium isolated from a pomegranate plant. The 4.9-Mb genome contains genes related to plant growth promotion and the synthesis of siderophores. PMID:24309733

  15. Complete Genome Sequence of Bacillus methylotrophicus Strain B25, a Potential Plant Growth-Promoting Rhizobacterium

    PubMed Central

    Brutel, Aline; Lemainque, Arnaud; Mairey, Barbara; Médigue, Claudine; Vallenet, David; Lefort, Francois; Grizard, Damien


    The complete genome of Bacillus methylotrophicus strain B25, isolated in Switzerland, was sequenced. Its size is 3.85 Mb, and several genes that may contribute to plant growth-promoting activities were identified in silico. PMID:26966215

  16. Nemertean toxin genes revealed through transcriptome sequencing.


    Whelan, Nathan V; Kocot, Kevin M; Santos, Scott R; Halanych, Kenneth M


    Nemerteans are one of few animal groups that have evolved the ability to utilize toxins for both defense and subduing prey, but little is known about specific nemertean toxins. In particular, no study has identified specific toxin genes even though peptide toxins are known from some nemertean species. Information about toxin genes is needed to better understand evolution of toxins across animals and possibly provide novel targets for pharmaceutical and industrial applications. We sequenced and annotated transcriptomes of two free-living and one commensal nemertean and annotated an additional six publicly available nemertean transcriptomes to identify putative toxin genes. Approximately 63-74% of predicted open reading frames in each transcriptome were annotated with gene names, and all species had similar percentages of transcripts annotated with each higher-level GO term. Every nemertean analyzed possessed genes with high sequence similarities to known animal toxins including those from stonefish, cephalopods, and sea anemones. One toxin-like gene found in all nemerteans analyzed had high sequence similarity to Plancitoxin-1, a DNase II hepatotoxin that may function well at low pH, which suggests that the acidic body walls of some nemerteans could work to enhance the efficacy of protein toxins. The highest number of toxin-like genes found in any one species was seven and the lowest was three. The diversity of toxin-like nemertean genes found here is greater than previously documented, and these animals are likely an ideal system for exploring toxin evolution and industrial applications of toxins. PMID:25432940

  17. Nemertean Toxin Genes Revealed through Transcriptome Sequencing

    PubMed Central

    Whelan, Nathan V.; Kocot, Kevin M.; Santos, Scott R.; Halanych, Kenneth M.


    Nemerteans are one of few animal groups that have evolved the ability to utilize toxins for both defense and subduing prey, but little is known about specific nemertean toxins. In particular, no study has identified specific toxin genes even though peptide toxins are known from some nemertean species. Information about toxin genes is needed to better understand evolution of toxins across animals and possibly provide novel targets for pharmaceutical and industrial applications. We sequenced and annotated transcriptomes of two free-living and one commensal nemertean and annotated an additional six publicly available nemertean transcriptomes to identify putative toxin genes. Approximately 63–74% of predicted open reading frames in each transcriptome were annotated with gene names, and all species had similar percentages of transcripts annotated with each higher-level GO term. Every nemertean analyzed possessed genes with high sequence similarities to known animal toxins including those from stonefish, cephalopods, and sea anemones. One toxin-like gene found in all nemerteans analyzed had high sequence similarity to Plancitoxin-1, a DNase II hepatotoxin that may function well at low pH, which suggests that the acidic body walls of some nemerteans could work to enhance the efficacy of protein toxins. The highest number of toxin-like genes found in any one species was seven and the lowest was three. The diversity of toxin-like nemertean genes found here is greater than previously documented, and these animals are likely an ideal system for exploring toxin evolution and industrial applications of toxins. PMID:25432940

  18. Non-contiguous finished genome sequence of plant-growth promoting Serratia proteamaculans S4.


    Neupane, Saraswoti; Goodwin, Lynne A; Högberg, Nils; Kyrpides, Nikos C; Alström, Sadhna; Bruce, David; Quintana, Beverly; Munk, Christine; Daligault, Hajnalka; Teshima, Hazuki; Davenport, Karen; Reitenga, Krista; Green, Lance; Chain, Patrick; Erkkila, Tracy; Gu, Wei; Zhang, Xiaojing; Xu, Yan; Kunde, Yulia; Chertkov, Olga; Han, James; Han, Cliff; Detter, John C; Ivanova, Natalia; Pati, Amrita; Chen, Amy; Szeto, Ernest; Mavromatis, Kostas; Huntemann, Marcel; Nolan, Matt; Pitluck, Sam; Deshpande, Shweta; Markowitz, Victor; Pagani, Ioanna; Klenk, Hans-Peter; Woyke, Tanja; Finlay, Roger D


    Serratia proteamaculans S4 (previously Serratia sp. S4), isolated from the rhizosphere of wild Equisetum sp., has the ability to stimulate plant growth and to suppress the growth of several soil-borne fungal pathogens of economically important crops. Here we present the non-contiguous, finished genome sequence of S. proteamaculans S4, which consists of a 5,324,944 bp circular chromosome and a 129,797 bp circular plasmid. The chromosome contains 5,008 predicted genes while the plasmid comprises 134 predicted genes. In total, 4,993 genes are assigned as protein-coding genes. The genome consists of 22 rRNA genes, 82 tRNA genes and 58 pseudogenes. This genome is a part of the project "Genomics of four rapeseed plant growth-promoting bacteria with antagonistic effect on plant pathogens" awarded through the 2010 DOE-JGI's Community Sequencing Program. PMID:24501629

  19. Non-contiguous finished genome sequence of plant-growth promoting Serratia proteamaculans S4

    PubMed Central

    Goodwin, Lynne A.; Högberg, Nils; Kyrpides, Nikos C.; Alström, Sadhna; Bruce, David; Quintana, Beverly; Munk, Christine; Daligault, Hajnalka; Teshima, Hazuki; Davenport, Karen; Reitenga, Krista; Green, Lance; Chain, Patrick; Erkkila, Tracy; Gu, Wei; Zhang, Xiaojing; Xu, Yan; Kunde, Yulia; Chertkov, Olga; Han, James; Han, Cliff; Detter, John C.; Ivanova, Natalia; Pati, Amrita; Chen, Amy; Szeto, Ernest; Mavromatis, Kostas; Huntemann, Marcel; Nolan, Matt; Pitluck, Sam; Deshpande, Shweta; Markowitz, Victor; Pagani, Ioanna; Klenk, Hans-Peter; Woyke, Tanja; Finlay, Roger D.


    Serratia proteamaculans S4 (previously Serratia sp. S4), isolated from the rhizosphere of wild Equisetum sp., has the ability to stimulate plant growth and to suppress the growth of several soil-borne fungal pathogens of economically important crops. Here we present the non-contiguous, finished genome sequence of S. proteamaculans S4, which consists of a 5,324,944 bp circular chromosome and a 129,797 bp circular plasmid. The chromosome contains 5,008 predicted genes while the plasmid comprises 134 predicted genes. In total, 4,993 genes are assigned as protein-coding genes. The genome consists of 22 rRNA genes, 82 tRNA genes and 58 pseudogenes. This genome is a part of the project “Genomics of four rapeseed plant growth-promoting bacteria with antagonistic effect on plant pathogens” awarded through the 2010 DOE-JGI’s Community Sequencing Program. PMID:24501629

  20. Cloning, sequencing, and expression of bacteriophage BF23 late genes 24 and 25 encoding tail proteins.

    PubMed Central

    Nakayama, S; Kaneko, T; Ishimaru, H; Moriwaki, H; Mizobuchi, K


    Two bacteriophage BF23 late genes, genes 24 and 25, were isolated on a 7.4-kb PstI fragment from the phage DNA, and their nucleotide sequences were determined. Gene 24 encodes a minor tail protein with the expected M(r) of 34,309, and gene 25 located 4 bp upstream of gene 24 encodes a major tail protein with the expected M(r) of 50,329. When total cellular RNA isolated from either phage-infected cells or cells bearing the cloned genes was analyzed by the primer extension method using the primers specific to either gene 25 or gene 24, we identified a possible late gene promoter, designated P25, in the 5'-flanking region of gene 25. This promoter was similar in structure to Escherichia coli promoters for sigma 70. Studies of the translational gene 25- and gene 24-lacZ fusions in the cloned gene system revealed that the promoter P25 was responsible for the expression of both genes 25 and 24 even in the absence of the regulatory genes which were absolutely required for late gene expression in the normal phage-infected cells. These results indicate that the two genes constitute an operon under the control of P25 and that the regulatory gene products of BF23 do not participate directly in specifying the late gene promoter. Images PMID:7961500

  1. High-fidelity promoter profiling reveals widespread alternative promoter usage and transposon-driven developmental gene expression

    PubMed Central

    Batut, Philippe; Dobin, Alexander; Plessy, Charles; Carninci, Piero; Gingeras, Thomas R.


    Many eukaryotic genes possess multiple alternative promoters with distinct expression specificities. Therefore, comprehensively annotating promoters and deciphering their individual regulatory dynamics is critical for gene expression profiling applications and for our understanding of regulatory complexity. We introduce RAMPAGE, a novel promoter activity profiling approach that combines extremely specific 5′-complete cDNA sequencing with an integrated data analysis workflow, to address the limitations of current techniques. RAMPAGE features a streamlined protocol for fast and easy generation of highly multiplexed sequencing libraries, offers very high transcription start site specificity, generates accurate and reproducible promoter expression measurements, and yields extensive transcript connectivity information through paired-end cDNA sequencing. We used RAMPAGE in a genome-wide study of promoter activity throughout 36 stages of the life cycle of Drosophila melanogaster, and describe here a comprehensive data set that represents the first available developmental time-course of promoter usage. We found that >40% of developmentally expressed genes have at least two promoters and that alternative promoters generally implement distinct regulatory programs. Transposable elements, long proposed to play a central role in the evolution of their host genomes through their ability to regulate gene expression, contribute at least 1300 promoters shaping the developmental transcriptome of D. melanogaster. Hundreds of these promoters drive the expression of annotated genes, and transposons often impart their own expression specificity upon the genes they regulate. These observations provide support for the theory that transposons may drive regulatory innovation through the distribution of stereotyped cis-regulatory modules throughout their host genomes. PMID:22936248

  2. Metallothionein cDNA, promoter, and genomic sequences of the tropical green mussel, Perna viridis.


    Khoo, H W; Patel, K H


    The primary structure of the cDNA and metallothionein (MT) genomic sequences of the tropical green mussel (Perna viridis) was determined. The complete cDNA sequences were obtained using degenerate primers designed from known metallothionein consensus amino acid sequences from the temperate species Mytilus edulis. The amino acid sequences of P. viridis metallothionein deduced from the coding region consisted of 72 amino acids with 21 cysteine residues and 9 Cys-X-Cys motifs corresponding to Type I MT class of other species. Two different genomic sequences coding for the same mRNA were obtained. Each putative gene contained a unique 5'UTR and two unique introns located at the same splice sites. The promoters for both genes were different in length and both contained metal responsive elements and active protein-binding sites. The structures of the genomic clones were compared with those of other species. J. Exp. Zool. 284:445-453, 1999. PMID:10451422

  3. Temperature influences on the expression of GFP promoted by the upstream sequence of cpcB from Arthrospira platensis

    NASA Astrophysics Data System (ADS)

    Lu, Yongzhong; Zhang, Xuecheng


    In order to investigate the regulation mechanism of the phycocyanin gene, a series of functional analyses of the upstream sequence of cpcB gene from Arthrospira platensis were conducted in E. coli with green fluorescent protein encoding gene (gfp) as the reporter. Results showed that the gfp gene could express at a high level under the promotion of the upstream sequence, suggesting the existence of some strong promoter elements in it. The expression of GFP was influenced by temperature. Higher temperature led to higher expression level. The bioinformatics analyses followed by mutation analyses on the secondary structure of translation initiation region (TIR) revealed that RNA thermosensor might account for the temperature regulation.

  4. DNA sequence of the Serratia marcescens lipoprotein gene

    PubMed Central

    Nakamura, Kenzo; Inouye, Masayori


    The Serratia marcescens gene for the outer membrane lipoprotein (lpp) was cloned in λ phage vector Charon 14. The recombinant phage was very unstable, and the lpp gene with a 300-base-pair deletion at the transcription termination site was further cloned in pBR322. The DNA sequence of 834 base pairs encompassing the lpp gene was determined and compared with that of the Escherichia coli lpp gene. The sequence comparisons exhibit several unique features. (i) The promoter region is highly conserved (84% homology) and has an extremely high A+T content (78%) as in E. coli (80%). (ii) The 5′ nontranslated region of the lipoprotein mRNA is also highly conserved (95% homology). (iii) In the DNA sequence corresponding to the signal peptide of this secretory protein, there are three drastic changes, including addition of one base pair and deletion of four base pairs in S. marcescens as compared to E. coli. The resultant alterations in the amino acid sequence, however, do not change the basic properties of the signal peptide, which are assumed to be essential for its function in the secretory mechanism. (iv) The DNA sequence from the amino terminus to the 51st residue of the mature lipoprotein is highly conserved (95% homology) and there is no amino acid substitution. (v) The DNA sequence corresponding to the seven amino acid residues at the carboxyl terminus has only 42% homology, resulting in four amino acid substitutions. (vi) Within the section of 40 base pairs beginning with the termination codon (UAA) and ending immediately before the oligo(T) transcription termination site in the E. coli lpp gene, there is about 60% homology. However, after this section, there is no obvious homology between the two sequences, probably because of a deletion of 300 base pairs at this region. (vii) Seven stable stem-and-loop structures could be formed in the mRNA region. (viii) Alterations in the third position of codons used in the lpp gene suggest that the gene has evolved somewhat

  5. Rat hepatic glutaminase: identification of the full coding sequence and characterization of a functional promoter.

    PubMed Central

    Chung-Bok, M I; Vincent, N; Jhala, U; Watford, M


    Glutamine catabolism in mammalian liver is catalysed by a unique isoenzyme of phosphate-activated glutaminase. The full coding and 5' untranslated sequence for rat hepatic glutaminase was isolated by screening lambda ZAP cDNA libraries and a Charon 4a rat genomic library. The sequence produces a mRNA 2225 nt in length, encoding a polypeptide of 535 amino acid residues with a calculated molecular mass of 59.2 kDa. The deduced amino acid sequence of rat liver glutaminase shows 86% similarity to that of rat kidney glutaminase and 65% similarity to a putative glutaminase from Caenorhabditis elegans. A genomic clone to rat liver glutaminase was isolated that contains 3.5 kb of the gene and 7.5 kb of the 5' flanking region. The 1 kb immediately upstream of the hepatic glutaminase gene (from -1022 to +48) showed functional promoter activity in HepG2 hepatoma cells. This promoter region did not respond to treatment with cAMP, but was highly responsive (10-fold stimulation) to the synthetic glucocorticoid dexamethasone. Subsequent 5' deletion analysis indicated that the promoter region between -103 and +48 was sufficient for basal promoter activity. This region does not contain an identifiable TATA element, indicating that transcription of the glutaminase gene is driven by a TATA-less promoter. The region responsive to glucocorticoids was mapped to -252 to -103 relative to the transcription start site. PMID:9164856

  6. Was cDNA sequences modulate transgene expression of was promoter-driven lentiviral vectors.


    Toscano, Miguel G; Benabdellah, Karim; Muñoz, Pilar; Frecha, Cecilia; Cobo, Marién; Martín, Francisco


    Abstract The development of vectors that express a therapeutic transgene efficiently and specifically in hematopoietic cells (HCs) is an important goal for gene therapy of hematological disorders. We have previously shown that a 500-bp fragment from the proximal Was gene promoter in a lentiviral vector (LV) was sufficient to achieve more than 100-fold higher levels of Wiskott-Aldrich syndrome protein in HCs than in nonhematopoietic cells (non-HCs). We show now that this differential was reduced up to 10 times when the enhanced green fluorescent protein gene (eGFP) was expressed instead of Was in the same LV backbone. Insertion of Was cDNA sequences downstream of eGFP in these LVs had a negative effect on transgene expression. This effect varied in different cell types but, overall, Was cDNA sequences increased the hematopoietic specificity of Was promoter-driven LV. We have characterized the minimal fragment required to increase hematopoietic specificity and have demonstrated that the mechanism involves Was promoter regulation and RNA processing. In addition, we have shown that Was cDNA sequences interfere with the enhancer activity of the woodchuck posttranscriptional regulatory element. These results represent the first data showing the role of Was intragenic sequences in gene regulation. PMID:19630517

  7. The complete genome sequence of the plant growth-promoting bacterium Pseudomonas sp. UW4.


    Duan, Jin; Jiang, Wei; Cheng, Zhenyu; Heikkila, John J; Glick, Bernard R


    The plant growth-promoting bacterium (PGPB) Pseudomonas sp. UW4, previously isolated from the rhizosphere of common reeds growing on the campus of the University of Waterloo, promotes plant growth in the presence of different environmental stresses, such as flooding, high concentrations of salt, cold, heavy metals, drought and phytopathogens. In this work, the genome sequence of UW4 was obtained by pyrosequencing and the gaps between the contigs were closed by directed PCR. The P. sp. UW4 genome contains a single circular chromosome that is 6,183,388 bp with a 60.05% G+C content. The bacterial genome contains 5,423 predicted protein-coding sequences that occupy 87.2% of the genome. Nineteen genomic islands (GIs) were predicted and thirty one complete putative insertion sequences were identified. Genes potentially involved in plant growth promotion such as indole-3-acetic acid (IAA) biosynthesis, trehalose production, siderophore production, acetoin synthesis, and phosphate solubilization were determined. Moreover, genes that contribute to the environmental fitness of UW4 were also observed including genes responsible for heavy metal resistance such as nickel, copper, cadmium, zinc, molybdate, cobalt, arsenate, and chromate. Whole-genome comparison with other completely sequenced Pseudomonas strains and phylogeny of four concatenated "housekeeping" genes (16S rRNA, gyrB, rpoB and rpoD) of 128 Pseudomonas strains revealed that UW4 belongs to the fluorescens group, jessenii subgroup. PMID:23516524

  8. The Complete Genome Sequence of the Plant Growth-Promoting Bacterium Pseudomonas sp. UW4

    PubMed Central

    Duan, Jin; Jiang, Wei; Cheng, Zhenyu; Heikkila, John J.; Glick, Bernard R.


    The plant growth-promoting bacterium (PGPB) Pseudomonas sp. UW4, previously isolated from the rhizosphere of common reeds growing on the campus of the University of Waterloo, promotes plant growth in the presence of different environmental stresses, such as flooding, high concentrations of salt, cold, heavy metals, drought and phytopathogens. In this work, the genome sequence of UW4 was obtained by pyrosequencing and the gaps between the contigs were closed by directed PCR. The P. sp. UW4 genome contains a single circular chromosome that is 6,183,388 bp with a 60.05% G+C content. The bacterial genome contains 5,423 predicted protein-coding sequences that occupy 87.2% of the genome. Nineteen genomic islands (GIs) were predicted and thirty one complete putative insertion sequences were identified. Genes potentially involved in plant growth promotion such as indole-3-acetic acid (IAA) biosynthesis, trehalose production, siderophore production, acetoin synthesis, and phosphate solubilization were determined. Moreover, genes that contribute to the environmental fitness of UW4 were also observed including genes responsible for heavy metal resistance such as nickel, copper, cadmium, zinc, molybdate, cobalt, arsenate, and chromate. Whole-genome comparison with other completely sequenced Pseudomonas strains and phylogeny of four concatenated “housekeeping” genes (16S rRNA, gyrB, rpoB and rpoD) of 128 Pseudomonas strains revealed that UW4 belongs to the fluorescens group, jessenii subgroup. PMID:23516524

  9. Sequence Requirements for Myosin Gene Expression and Regulation in Caenorhabditis Elegans

    PubMed Central

    Okkema, P. G.; Harrison, S. W.; Plunger, V.; Aryana, A.; Fire, A.


    Four Caenorhabditis elegans genes encode muscle-type specific myosin heavy chain isoforms: myo-1 and myo-2 are expressed in the pharyngeal muscles; unc-54 and myo-3 are expressed in body wall muscles. We have used transformation-rescue and lacZ fusion assays to determine sequence requirements for regulated myosin gene expression during development. Multiple tissue-specific activation elements are present for all four genes. For each of the four genes, sequences upstream of the coding region are tissue-specific promoters, as shown by their ability to drive expression of a reporter gene (lacZ) in the appropriate muscle type. Each gene contains at least one additional tissue-specific regulatory element, as defined by the ability to enhance expression of a heterologous promoter in the appropriate muscle type. In rescue experiments with unc-54, two further requirements apparently independent of tissue specificity were found: sequences within the 3' non-coding region are essential for activity while an intron near the 5' end augments expression levels. The general intron stimulation is apparently independent of intron sequence, indicating a mechanistic effect of splicing. To further characterize the myosin gene promoters and to examine the types of enhancer sequences in the genome, we have initiated a screen of C. elegans genomic DNA for fragments capable of enhancing the myo-2 promoter. The properties of enhancers recovered from this screen suggest that the promoter is limited to muscle cells in its ability to respond to enhancers. PMID:8244003

  10. Functional Capacity of Shiga-Toxin Promoter Sequences in Eukaryotic Cells

    PubMed Central

    Mejías, María P.; Fernández-Brando, Romina J.; Panek, Cecilia A.; Ramos, Maria V.; Fernández, Gabriela C.; Isturiz, Martín; Ghiringhelli, Pablo D.; Palermo, Marina S.


    Shiga toxins (Stx) are the main virulence factors in enterohemorrhagic Escherichia coli (EHEC) infections, causing diarrhea and hemolytic uremic syndrome (HUS). The genes encoding for Shiga toxin-2 (Stx2) are located in a bacteriophage. The toxin is formed by a single A subunit and five B subunits, each of which has its own promoter sequence. We have previously reported the expression of the B subunit within the eukaryotic environment, probably driven by their own promoter. The aim of this work was to evaluate the ability of the eukaryotic machinery to recognize stx2 sequences as eukaryotic-like promoters. Vero cells were transfected with a plasmid encoding Stx2 under its own promoter. The cytotoxic effect on these cells was similar to that observed upon incubation with purified Stx2. In addition, we showed that Stx2 expression in Stx2-insensitive BHK eukaryotic cells induced drastic morphological and cytoskeletal changes. In order to directly evaluate the capacity of the wild promoter sequences of the A and B subunits to drive protein expression in mammalian cells, GFP was cloned under eukaryotic-like putative promoter sequences. GFP expression was observed in 293T cells transfected with these constructions. These results show a novel and alternative way to synthesize Stx2 that could contribute to the global understanding of EHEC infections with immediate impact on the development of treatments or vaccines against HUS. PMID:23451160

  11. Synthetic promoter elements obtained by nucleotide sequence variation and selection for activity

    PubMed Central

    Edelman, Gerald M.; Meech, Robyn; Owens, Geoffrey C.; Jones, Frederick S.


    Eukaryotic transcriptional regulation in different cells involves large numbers and arrangements of cis and trans elements. To survey the number of cis regulatory elements that are active in different contexts, we have devised a high-throughput selection procedure permitting synthesis of active cis motifs that enhance the activity of a minimal promoter. This synthetic promoter construction method (SPCM) was used to identify >100 DNA sequences that showed increased promoter activity in the neuroblastoma cell line Neuro2A. After determining DNA sequences of selected synthetic promoters, database searches for known elements revealed a predominance of eight motifs: AP2, CEBP, GRE, Ebox, ETS, CREB, AP1, and SP1/MAZ. The most active of the selected synthetic promoters contain composites of a number of these motifs. Assays of DNA binding and promoter activity of three exemplary motifs (ETS, CREB, and SP1/MAZ) were used to prove the effectiveness of SPCM in uncovering active sequences. Up to 10% of 133 selected active sequences had no match in currently available databases, raising the possibility that new motifs and transcriptional regulatory proteins to which they bind may be revealed by SPCM. The method may find uses in constructing databases of active cis motifs, in diagnostics, and in gene therapy. PMID:10725347

  12. Effects of DMSO, glycerol, betaine and their combinations in detecting single nucleotide polymorphisms of epidermal growth factor receptor (EGFR) gene promoter sequence in non-small-cell lung cancer (NSCLC) patients.


    Jurišić, Vladimir; Obradović, Jasmina; Tošić, Natasa; Pavlović, Sonja; Kulić, Milan; Djordjević, Nataša


    The aim of the study was to examine the effects of frequently used polymerase chain reaction (PCR) additives DMSO, glycerol and betaine on amplification of GC-rich epidermal growth factor receptor (EGFR) gene promoter region, in order to detect the presence of -216G>T and -191C>A gene variations in non-small-cell lung cancer (NSCLC) patients. PCR products and restriction fragments were detected by electrophoresis on 8% polyacrylamide gel and 3% agarose gel. Our analysis shows that single used additives including DMSO in concentration of 7% and 10%, glycerol in concentration of 10%, 15% and 20%, as well as betaine in concentration of 1M, 1.5M and 2M significantly enhanced the yield and specificity of PCR reaction. In addition, the combination of 10% DMSO with 15% glycerol has shown positive effects, whereas other analyzed combinations of additives failed to amplify the EGFR promoter region. PMID:27284695

  13. Mutations of the ompK36 Porin Gene and Promoter Impact Responses of Sequence Type 258, KPC-2-Producing Klebsiella pneumoniae Strains to Doripenem and Doripenem-Colistin

    PubMed Central

    Clancy, Cornelius J.; Chen, Liang; Hong, Jae H.; Cheng, Shaoji; Hao, Binghua; Shields, Ryan K.; Farrell, Annie N.; Doi, Yohei; Zhao, Yanan; Perlin, David S.; Kreiswirth, Barry N.


    Doripenem-colistin exerts synergy against some, but not all, Klebsiella pneumoniae carbapenemase (KPC)-producing K. pneumoniae strains in vitro. We determined if doripenem MICs and/or ompK36 porin gene mutations impacted the responses of 23 sequence type 258 (ST258), KPC-2-producing strains to the combination of doripenem (8 μg/ml) and colistin (2 μg/ml) during time-kill assays. The median doripenem and colistin MICs were 32 and 4 μg/ml. Doripenem MICs did not correlate with KPC-2 expression levels. Five and 18 strains had wild-type and mutant ompK36, respectively. The most common mutations were IS5 promoter insertions (n = 7) and insertions encoding glycine and aspartic acid at amino acid (aa) positions 134 and 135 (ins aa134-135 GD; n = 8), which were associated with higher doripenem MICs than other mutations or wild-type ompK36 (all P values ≤ 0.04). Bactericidal activity (24 h) was achieved by doripenem-colistin against 12%, 43%, and 75% of ins aa134-135 GD, IS5, and wild-type/other mutants, respectively (P = 0.04). Doripenem-colistin was more active in time-kill studies than colistin at 12 and 24 h if the doripenem MIC was ≤8 μg/ml (P = 0.0007 and 0.09, respectively), but not if the MIC was >8 μg/ml (P = 0.10 and 0.16). Likewise, doripenem-colistin was more active at 12 and 24 h against the wild type/other mutants than ins aa134-135 GD or IS5 mutants (P = 0.007 and 0.0007). By multivariate analysis, the absence of ins aa134-135 GD or IS5 mutations was the only independent predictor of doripenem-colistin responses at 24 h (P = 0.002). In conclusion, ompK36 genotypes identified ST258 KPC-K. pneumoniae strains that were most likely to respond to doripenem-colistin. PMID:23939888

  14. Draft genome sequence of Pantoea ananatis B1-9, a nonpathogenic plant growth-promoting bacterium.


    Kim, Hyun Jung; Lee, Jin Hee; Kang, Beom Ryong; Rong, Xiaoqing; McSpadden Gardener, Brian B; Ji, Hyung Jin; Park, Chang-Seuk; Kim, Young Cheol


    Pantoea ananatis B1-9 is an endophytic Gram-negative rhizobacterium that was isolated for its ability to promote plant growth and improve crop yield in the field. Here we report the draft genome sequence of P. ananatis B1-9. Comparison of this sequence to the sequenced genome of a plant-pathogenic P. ananatis strain, LMG20103, indicated that the pathogenesis-related genes were absent, but a subset of gene functions that may be related to its plant growth promotion were present. PMID:22247529

  15. Draft Genome Sequence of Delftia tsuruhatensis MTQ3, a Strain of Plant Growth-Promoting Rhizobacterium with Antimicrobial Activity.


    Hou, Qihui; Wang, Chengqiang; Guo, Haimeng; Xia, Zhilin; Ye, Jiangping; Liu, Kai; Yang, Yanan; Hou, Xiaoyang; Liu, Hu; Wang, Jun; Du, Binghai; Ding, Yanqin


    Delftia tsuruhatensis MTQ3 is a plant growth-promoting rhizobacterium (PGPR) isolated from tobacco rhizosphere. Here, we report the draft genome sequence of D. tsuruhatensis MTQ3. Several functional genes related to antimicrobial activity and environment adaption have been found in the genome. This is the first genome sequence of D. tsuruhatensis related to PGPR. PMID:26251486

  16. Draft Genome Sequence of Bacillus amyloliquefaciens XK-4-1, a Plant Growth-Promoting Endophyte with Antifungal Activity.


    Sun, Zhengxiang; Hsiang, Tom; Zhou, Yi; Zhou, Jinglong


    Here, we report the draft genome sequence of a bacterial plant-growth-promoting endophyte, Bacillus amyloliquefaciens XK-4-1, which consists of one circular chromosome of 3,941,805 bp with 3,702 coding sequences (CDSs). The data presented highlight multiple sets of functional genes associated with its plant-beneficial characteristics. PMID:26564038

  17. Draft Genome Sequence of Bacillus amyloliquefaciens XK-4-1, a Plant Growth-Promoting Endophyte with Antifungal Activity

    PubMed Central

    Hsiang, Tom; Zhou, Yi; Zhou, Jinglong


    Here, we report the draft genome sequence of a bacterial plant-growth-promoting endophyte, Bacillus amyloliquefaciens XK-4-1, which consists of one circular chromosome of 3,941,805 bp with 3,702 coding sequences (CDSs). The data presented highlight multiple sets of functional genes associated with its plant-beneficial characteristics. PMID:26564038

  18. Reporter Gene Silencing in Targeted Mouse Mutants Is Associated with Promoter CpG Island Methylation

    PubMed Central

    Kirov, Julia V.; Adkisson, Michael; Nava, A. J.; Cipollone, Andreana; Willis, Brandon; Engelhard, Eric K.; Lloyd, K. C. Kent; de Jong, Pieter; West, David B.


    Targeted mutations in mouse disrupt local chromatin structure and may lead to unanticipated local effects. We evaluated targeted gene promoter silencing in a group of six mutants carrying the tm1a Knockout Mouse Project allele containing both a LacZ reporter gene driven by the native promoter and a neo selection cassette. Messenger RNA levels of the reporter gene and targeted gene were assessed by qRT-PCR, and methylation of the promoter CpG islands and LacZ coding sequence were evaluated by sequencing of bisulfite-treated DNA. Mutants were stratified by LacZ staining into presumed Silenced and Expressed reporter genes. Silenced mutants had reduced relative quantities LacZ mRNA and greater CpG Island methylation compared with the Expressed mutant group. Within the silenced group, LacZ coding sequence methylation was significantly and positively correlated with CpG Island methylation, while promoter CpG methylation was only weakly correlated with LacZ gene mRNA. The results support the conclusion that there is promoter silencing in a subset of mutants carrying the tm1a allele. The features of targeted genes which promote local silencing when targeted remain unknown. PMID:26275310

  19. Reporter Gene Silencing in Targeted Mouse Mutants Is Associated with Promoter CpG Island Methylation.


    Kirov, Julia V; Adkisson, Michael; Nava, A J; Cipollone, Andreana; Willis, Brandon; Engelhard, Eric K; Lloyd, K C Kent; de Jong, Pieter; West, David B


    Targeted mutations in mouse disrupt local chromatin structure and may lead to unanticipated local effects. We evaluated targeted gene promoter silencing in a group of six mutants carrying the tm1a Knockout Mouse Project allele containing both a LacZ reporter gene driven by the native promoter and a neo selection cassette. Messenger RNA levels of the reporter gene and targeted gene were assessed by qRT-PCR, and methylation of the promoter CpG islands and LacZ coding sequence were evaluated by sequencing of bisulfite-treated DNA. Mutants were stratified by LacZ staining into presumed Silenced and Expressed reporter genes. Silenced mutants had reduced relative quantities LacZ mRNA and greater CpG Island methylation compared with the Expressed mutant group. Within the silenced group, LacZ coding sequence methylation was significantly and positively correlated with CpG Island methylation, while promoter CpG methylation was only weakly correlated with LacZ gene mRNA. The results support the conclusion that there is promoter silencing in a subset of mutants carrying the tm1a allele. The features of targeted genes which promote local silencing when targeted remain unknown. PMID:26275310

  20. Multiple Mobile Promoter Regions for the Rare Carbapenem Resistance Gene of Bacteroides fragilis

    PubMed Central

    Podglajen, I.; Breuil, J.; Rohaut, A.; Monsempes, C.; Collatz, E.


    Two novel insertion sequences (IS), IS1187 and IS1188, are described upstream from the carbapenem resistance gene cfiA in strains of Bacteroides fragilis. Mapping, with the RACE procedure, of transcription start sites of cfiA in these and two other previously reported IS showed that transcription of this rarely encountered gene is initiated close to a variety of B. fragilis consensus promoter sequences, as recently defined (D. P. Bayley, E. R. Rocha, and C. J. Smith, FEMS Microbiol. Lett. 193:149–154, 2000). In the cases of IS1186 and IS1188, these sequences overlap with putative Eς70 promoter sequences, while in IS942 and IS1187 such sequences can be observed either upstream or downstream of the B. fragilis promoters. PMID:11344163

  1. A new idea for simple and rapid monitoring of gene expression: requirement of nucleotide sequences encoding an N-terminal HA tag in the T7 promoter-driven expression in E. coli.


    Moon, Jeong-Mi; Kim, Goo-Young; Rhim, Hyangshuk


    Mammalian expression vectors are used to overexpress genes of interest in mammalian cells. High temperature requirement protein A1 (HtrA1), used as a specific target, was expressed from the pHA-M-HtrA1 plasmid in HEK293T cells, inducing cell death. Expression of HtrA1 was driven by the pHA-M-HtrA1 mammalian expression vector in E. coli resulting in growth suppression of E. coli in an HtrA1 serine protease-dependent manner. By using various combinations of promoters, target genes and N-terminal tags, the T7 promoter and N-terminal HA tag in the mammalian expression vector were shown to be responsible for expression of target genes in E. coli. Thus the pHA-M-HtrA1 plasmid can be used as a novel, rapid pre-test system for expression and cytotoxicity of the specific target gene in E. coli before assessing its functions in mammalian cells. PMID:22714269

  2. DNA duplex stability as discriminative characteristic for Escherichia coli σ(54)- and σ(28)- dependent promoter sequences.


    de Avila e Silva, Scheila; Forte, Franciele; T S Sartor, Ivaine; Andrighetti, Tahila; J L Gerhardt, Günther; Longaray Delamare, Ana Paula; Echeverrigaray, Sergio


    The advent of modern high-throughput sequencing has made it possible to generate vast quantities of genomic sequence data. However, the processing of this volume of information, including prediction of gene-coding and regulatory sequences remains an important bottleneck in bioinformatics research. In this work, we integrated DNA duplex stability into the repertoire of a Neural Network (NN) capable of predicting promoter regions with augmented accuracy, specificity and sensitivity. We took our method beyond a simplistic analysis based on a single sigma subunit of RNA polymerase, incorporating the six main sigma-subunits of Escherichia coli. This methodology employed successfully re-discovered known promoter sequences recognized by E. coli RNA polymerase subunits σ(24), σ(28), σ(32), σ(38), σ(54) and σ(70), with highlighted accuracies for σ(28)- and σ(54)- dependent promoter sequences (values obtained were 80% and 78.8%, respectively). Furthermore, the discrimination of promoters according to the σ factor made it possible to extract functional commonalities for the genes expressed by each type of promoter. The DNA duplex stability rises as a distinctive feature which improves the recognition and classification of σ(28)- and σ(54)- dependent promoter sequences. The findings presented in this report underscore the usefulness of including DNA biophysical parameters into NN learning algorithms to increase accuracy, specificity and sensitivity in promoter beyond what is accomplished based on sequence alone. PMID:24172230

  3. Analysis of cis-sequence of subgenomic transcript promoter from the Figwort mosaic virus and comparison of promoter activity with the cauliflower mosaic virus promoters in monocot and dicot cells.


    Bhattacharyya, Somnath; Dey, Nrisingha; Maiti, Indu B


    A sub-genomic transcript (Sgt) promoter was isolated from the Figwort mosaic virus (FMV) genomic clone. The FMV Sgt promoter was linked to heterologous coding sequences to form a chimeric gene construct. The 5'-3'-boundaries required for maximal activity and involvement of cis-sequences for optimal expression in plants were defined by 5'-, 3'-end deletion and internal deletion analysis of FMV Sgt promoter fragments coupled with a beta-glucuronidase reporter gene in both transient protoplast expression experiments and in transgenic plants. A 301 bp FMV Sgt promoter fragment (sequence -270 to +31 from the transcription start site; TSS) provided maximum promoter activity. The TSS of the FMV Sgt promoter was determined by primer extension analysis using total RNA from transgenic plants developed for FMV Sgt promoter: uidA fusion gene. An activator domain located upstream of the TATA box at -70 to -100 from TSS is absolutely required for promoter activity and its function is critically position-dependent with respect to TATA box. Two sequence motifs AGATTTTAAT (coordinates -100 to -91) and GTAAGCGC (coordinates -80 to -73) were found to be essential for promoter activity. The FMV Sgt promoter is less active in monocot cells; FMV Sgt promoter expression level was about 27.5-fold higher in tobacco cells compared to that in maize cells. Comparative expression analysis of FMV Sgt promoter with cauliflower mosaic virus (CaMV) 35S promoter showed that the FMV Sgt promoter is about 2-fold stronger than the CaMV 35S promoter. The FMV Sgt promoter is a constitutive promoter; expression level in seedlings was in the order: root>leaf>stem. PMID:12457962

  4. Draft Genome Sequence of Plant Growth-Promoting Rhizobium Mesorhizobium amorphae, Isolated from Zinc-Lead Mine Tailings

    PubMed Central

    Hao, Xiuli; Lin, Yanbing; Johnstone, Laurel; Baltrus, David A.; Miller, Susan J.


    Here, we describe the draft genome sequence of Mesorhizobium amorphae strain CCNWGS0123, isolated from nodules of Robinia pseudoacacia growing on zinc-lead mine tailings. A large number of metal(loid) resistance genes, as well as genes reported to promote plant growth, were identified, presenting a great future potential for aiding phytoremediation in metal(loid)-contaminated soil. PMID:22247533

  5. Efficient chimeric plant promoters derived from plant infecting viral promoter sequences.


    Acharya, Sefali; Ranjan, Rajiv; Pattanaik, Sitakanta; Maiti, Indu B; Dey, Nrisingha


    In the present study, we developed a set of three chimeric/hybrid promoters namely FSgt-PFlt, PFlt-UAS-2X and MSgt-PFlt incorporating different important domains of Figwort Mosaic Virus sub-genomic transcript promoter (FSgt, -270 to -60), Mirabilis Mosaic Virus sub-genomic transcript promoter (MSgt, -306 to -125) and Peanut Chlorotic Streak Caulimovirus full-length transcript promoter (PFlt-, -353 to +24 and PFlt-UAS, -353 to -49). We demonstrated that these chimeric/hybrid promoters can drive the expression of reporter genes in different plant species including tobacco, Arabidopsis, petunia, tomato and spinach. FSgt-PFlt, PFlt-UAS-2X and MSgt-PFlt promoters showed 4.2, 1.5 and 1.2 times stronger GUS activities compared to the activity of the CaMV35S promoter, respectively, in tobacco protoplasts. Protoplast-derived recombinant promoter driven GFP showed enhanced accumulation compared to that obtained under the CaMV35S promoter. FSgt-PFlt, PFlt-UAS-2X and MSgt-PFlt promoters showed 3.0, 1.3 and 1.0 times stronger activities than the activity of the CaMV35S² (a modified version of the CaMV35S promoter with double enhancer domain) promoter, respectively, in tobacco (Nicotiana tabacum, var. Samsun NN). Alongside, we observed a fair correlation between recombinant promoter-driven GUS accumulation with the corresponding uidA-mRNA level in transgenic tobacco. Histochemical (X-gluc) staining of whole transgenic seedlings and fluorescence images of ImaGene Green™ treated floral parts expressing the GUS under the control of recombinant promoters also support above findings. Furthermore, we confirmed that these chimeric promoters are inducible in the presence of 150 μM salicylic acid (SA) and abscisic acid (ABA). Taken altogether, we propose that SA/ABA inducible chimeric/recombinant promoters could be used for strong expression of gene(s) of interest in crop plants. PMID:24178585

  6. Tandem gene arrays in Trypanosoma brucei: Comparative phylogenomic analysis of duplicate sequence variation

    PubMed Central

    Jackson, Andrew P


    Background The genome sequence of the protistan parasite Trypanosoma brucei contains many tandem gene arrays. Gene duplicates are created through tandem duplication and are expressed through polycistronic transcription, suggesting that the primary purpose of long, tandem arrays is to increase gene dosage in an environment where individual gene promoters are absent. This report presents the first account of the tandem gene arrays in the T. brucei genome, employing several related genome sequences to establish how variation is created and removed. Results A systematic survey of tandem gene arrays showed that substantial sequence variation existed across the genome; variation from different regions of an array often produced inconsistent phylogenetic affinities. Phylogenetic relationships of gene duplicates were consistent with concerted evolution being a widespread homogenising force. However, tandem duplicates were not usually identical; therefore, any homogenising effect was coincident with divergence among duplicates. Allelic gene conversion was detected using various criteria and was apparently able to both remove and introduce sequence variation. Tandem arrays containing structural heterogeneity demonstrated how sequence homogenisation and differentiation can occur within a single locus. Conclusion The use of multiple genome sequences in a comparative analysis of tandem gene arrays identified substantial sequence variation among gene duplicates. The distribution of sequence variation is determined by a dynamic balance of conservative and innovative evolutionary forces. Gene trees from various species showed that intraspecific duplicates evolve in concert, perhaps through frequent gene conversion, although this does not prevent sequence divergence, especially where structural heterogeneity physically separates a duplicate from its neighbours. In describing dynamics of sequence variation that have consequences beyond gene dosage, this survey provides a basis for

  7. Sequence and expression of a halobacterial beta-galactosidase gene.


    Holmes, M L; Dyall-Smith, M L


    Studies of gene expression in haloarchaea have been greatly hindered by the lack of a convenient reporter gene. In a previous study, a beta-galactosidase from Haloferax alicantei was purified and several peptide sequences determined. The peptide sequences have now been used to clone the entire beta-galactosidase gene (designated bgaH) along with some flanking chromosomal DNA. The deduced amino acid sequence of BgaH was 665 amino acids (74 kDa) and showed greatest amino acid similarity to members of glycosyl hydrolase family 42 [classification of Henrissat, B., and Bairoch, A. (1993) New families in the classification of glycosyl hydrolases based on amino acid sequence similarities. Biochem J 293: 781-788]. Within this family, BgaH was most similar (42-43% aa identity) to enzymes from extremely thermophilic bacteria such as Thermotoga and Thermus. Family 42 enzymes are only distantly related to the Sulfolobus LacS and Escherichia coli LacZ enzymes (families one and two respectively). Three open reading frames (ORFs) upstream of bgaH were readily identified by database searches as glucose-fructose oxidoreductase, 2-dehydro-3-deoxyphosphogluconate aldolase and 2-keto-3-deoxygluconate kinase, enzymes that are also involved in carbohydrate metabolism. Downstream of bgaH there was an ORF which contained a putative fibronectin III motif. The bgaH gene was engineered into a halobacterial plasmid vector and introduced into Haloferax volcanii, a widely used strain that lacks detectable beta-galactosidase activity. Transformants were shown to express the enzyme; colonies turned blue when sprayed with Xgal and enzyme activity could be easily quantitated using a standard ONPG assay. In an accompanying publication, Patenge et al. (2000) have demonstrated the utility of bgaH as a promoter reporter in Halobacterium salinarum. PMID:10760168

  8. Essential and nonessential sequences in malPp, a positively controlled promoter in Escherichia coli.


    Raibaud, O; Gutierrez, C; Schwartz, M


    A plasmid bearing the malPp promoter was digested with Bal31 to obtain a set of deletions with closely spaced endpoints in the upstream region of this promoter. Some of these deletions were sequenced, and their effect on malPQ expression was determined after having transferred them onto the chromosome. We found that a site which binds the cyclic AMP receptor protein in vitro and which is centered at position -93 with respect to the site of transcription initiation could be deleted without affecting malPQ expression. In contrast, the activity of the malPp promoter decreased abruptly when the deletions reached position -72. The downstream region of the promoter was analyzed by using a technique of "sequence replacement" which involved the selection of Mal+ pseudorevertants from strains which carried small deletions in the -25 region. The pseudorevertants, which expressed the malPQ operon in a manner indistinguishable from wild type, had grossly different sequences downstream from position -38, except for a few positions, some of which must be important for promoter function. By combining all presently available information, it is suggested that the malPp promoter contains three binding sites for its activator, the product of gene malT. These sites are defined by three quasi-identical hexanucleotides present in one orientation around position -37 and twice in the other orientation around positions -60 and -73. PMID:3156124

  9. The genomic sequence of the murine major vault protein and its promoter.


    Mossink, Marieke; van Zon, Arend; Fränzel-Luiten, Erna; Schoester, Martijn; Scheffer, George L; Scheper, Rik J; Sonneveld, Pieter; Wiemer, Erik A C


    Vaults are ribonucleoproteins of unknown function, consisting of three different proteins and multiple copies of small untranslated RNA molecules. One of the protein subunits has been identified as TEP1, a protein that is also associated with the telomerase complex. Another protein appears to contain a functional PARP domain and is hence called VPARP. The third protein, major vault protein (MVP), is believed to make up 70% of the total mass of the vault complex and to be responsible for the typical barrel-shaped structure of vaults. We have isolated the murine MVP cDNA and compared the amino acid sequence with MVP from other species. Over 90% of sequence identity was found between mouse, human and rat, and a considerable degree of identity between mouse and MVPs from lower eukaryotes. We also found that the genomic structure of the murine MVP gene closely resembles the organization of the human MVP gene, both consisting of 15 exons of which most have exactly the same size. Finally we have isolated a genomic region upstream (and partially overlapping) the first untranslated exon, that displayed promoter activity in a luciferase reporter assay. Furthermore, we showed that the sequences from the first exon together with the 5'-end of the first intron enhance the promoter activity, implying the presence of essential promoter elements in this region. Alignment of the murine promoter region with the homologous sequences of the human gene revealed an identity of 58%. The apparent presence of conserved promoter elements suggests a similar regulation of human and murine MVP expression. PMID:12234684

  10. Silencing of CHD5 Gene by Promoter Methylation in Leukemia

    PubMed Central

    Zhao, Rui; Meng, Fanyi; Wang, Nisha; Ma, Wenli; Yan, Qitao


    Chromodomain helicase DNA binding protein 5 (CHD5) was previously proposed to function as a potent tumor suppressor by acting as a master regulator of a tumor-suppressive network. CHD5 is down-regulated in several cancers, including leukemia and is responsible for tumor generation and progression. However, the mechanism of CHD5 down-regulation in leukemia is largely unknown. In this study, quantitative reverse-transcriptase polymerase chain reaction and western blotting analyses revealed that CHD5 was down-regulated in human leukemia cell lines and samples. Luciferase reporter assays showed that most of the baseline regulatory activity was localized from 500 to 200 bp upstream of the transcription start site. Bisulfite DNA sequencing of the identified regulatory element revealed that the CHD5 promoter was hypermethylated in human leukemia cells and samples. Thus, CHD5 expression was inversely correlated with promoter DNA methylation in these samples. Treatment with DNA methyltransferase inhibitor 5-aza-2′-deoxycytidine (DAC) activates CHD5 expression in human leukemia cell lines. In vitro luciferase reporter assays demonstrated that methylation of the CHD5 promoter repressed its promoter activity. Furthermore, a chromatin immunoprecipitation assay combined with qualitative PCR identified activating protein 2 (AP2) as a potential transcription factor involved in CHD5 expression and indicated that treatment with DAC increases the recruitment of AP2 to the CHD5 promoter. In vitro transcription-factor activity studies showed that AP2 over-expression was able to activate CHD5 promoter activity. Our findings indicate that repression of CHD5 gene expression in human leukemia is mediated in part by DNA methylation of its promoter. PMID:24454811

  11. A multistep bioinformatic approach detects putative regulatory elements in gene promoters

    PubMed Central

    Bortoluzzi, Stefania; Coppe, Alessandro; Bisognin, Andrea; Pizzi, Cinzia; Danieli, Gian Antonio


    Background Searching for approximate patterns in large promoter sequences frequently produces an exceedingly high numbers of results. Our aim was to exploit biological knowledge for definition of a sheltered search space and of appropriate search parameters, in order to develop a method for identification of a tractable number of sequence motifs. Results Novel software (COOP) was developed for extraction of sequence motifs, based on clustering of exact or approximate patterns according to the frequency of their overlapping occurrences. Genomic sequences of 1 Kb upstream of 91 genes differentially expressed and/or encoding proteins with relevant function in adult human retina were analyzed. Methodology and results were tested by analysing 1,000 groups of putatively unrelated sequences, randomly selected among 17,156 human gene promoters. When applied to a sample of human promoters, the method identified 279 putative motifs frequently occurring in retina promoters sequences. Most of them are localized in the proximal portion of promoters, less variable in central region than in lateral regions and similar to known regulatory sequences. COOP software and reference manual are freely available upon request to the Authors. Conclusion The approach described in this paper seems effective for identifying a tractable number of sequence motifs with putative regulatory role. PMID:15904489

  12. Isolated yeast promoter sequence and a method of regulated heterologous expression


    Gao, Johnway; Skeen, Rodney S.; Hooker, Brian S.; Anderson, Daniel B.


    The present invention provides the promoter clone discovery of a glucoamylase gene of a starch utilizing yeast strain Schwanniomyces castellii. The isolated glucoamylase promoter is an inducible promoter, which can regulate strong gene expression in starch culture medium.

  13. Compensation for differences in gene copy number among yeast ribosomal proteins is encoded within their promoters

    PubMed Central

    Zeevi, Danny; Sharon, Eilon; Lotan-Pompan, Maya; Lubling, Yaniv; Shipony, Zohar; Raveh-Sadka, Tali; Keren, Leeat; Levo, Michal; Weinberger, Adina; Segal, Eran


    Coordinate regulation of ribosomal protein (RP) genes is key for controlling cell growth. In yeast, it is unclear how this regulation achieves the required equimolar amounts of the different RP components, given that some RP genes exist in duplicate copies, while others have only one copy. Here, we tested whether the solution to this challenge is partly encoded within the DNA sequence of the RP promoters, by fusing 110 different RP promoters to a fluorescent gene reporter, allowing us to robustly detect differences in their promoter activities that are as small as ∼10%. We found that single-copy RP promoters have significantly higher activities, suggesting that proper RP stoichiometry is indeed partly encoded within the RP promoters. Notably, we also partially uncovered how this regulation is encoded by finding that RP promoters with higher activity have more nucleosome-disfavoring sequences and characteristic spatial organizations of these sequences and of binding sites for key RP regulators. Mutations in these elements result in a significant decrease of RP promoter activity. Thus, our results suggest that intrinsic (DNA-dependent) nucleosome organization may be a key mechanism by which genomes encode biologically meaningful promoter activities. Our approach can readily be applied to uncover how transcriptional programs of other promoters are encoded. PMID:22009988

  14. Sequence analysis of a cluster of twenty-one tRNA genes in Bacillus subtilis.

    PubMed Central

    Green, C J; Vold, B S


    The DNA sequence of a cluster of twenty-one tRNA genes distal to a rRNA gene set in B. subtilis was determined. None of the tRNA genes are repeated in the sequence. The only classes of tRNAs that are not represented are those for cysteine, glutamine, tryptophan, and tyrosine. Three of the tRNA genes in this cluster do not have the 3'-CCA sequence encoded in the gene. There is no RNA polymerase terminator sequence in the region between the 5S gene and the first tRNA gene or within the tRNA gene cluster. A terminator sequence was found directly after the last tRNA gene. This rRNA and tRNA gene cluster probably represents one transcriptional unit. However, there may be an RNA polymerase promoter site within this sequence, which raises some interesting questions concerning the regulation of transcription for these tRNA genes. PMID:6310512

  15. Isolation and characterization of oil palm constitutive promoter derived from ubiquitin extension protein (uep1) gene.


    Masura, Subhi Siti; Parveez, Ghulam Kadir Ahmad; Ismail, Ismanizan


    The ubiquitin extension protein (uep1) gene was identified as a constitutively expressed gene in oil palm. We have isolated and characterized the 5' region of the oil palm uep1 gene, which contains an 828 bp sequence upstream of the uep1 translational start site. Construction of a pUEP1 transformation vector, which contains gusA reporter gene under the control of uep1 promoter, was carried out for functional analysis of the promoter through transient expression studies. It was found that the 5' region of uep1 functions as a constitutive promoter in oil palm and could drive GUS expression in all tissues tested, including embryogenic calli, embryoid, immature embryo, young leaflet from mature palm, green leaf, mesocarp and meristematic tissues (shoot tip). This promoter could also be used in dicot systems as it was demonstrated to be capable of driving gusA gene expression in tobacco. PMID:20123048

  16. Characterization of tissue-specific transcription by the human synapsin I gene promoter

    SciTech Connect

    Thiel, G. Univ. of Texas, Dallas ); Greengard, P. ); Suedhof, T.C. )


    Synapsin Ia and synapsin Ib are abundant synaptic vesicle proteins that are derived by differential splicing from a single gene. To identify control elements directing the neuronal expression of synapsins Ia/b, the authors functionally analyzed the promoter region of the human synapsin I gene. A hybrid gene was constructed containing 2 kilobases of 5{prime} flanking sequence from the synapsin I gene fused to the bacterial gene chloramphenicol acetyltransferase and transfected into 12 different neuronal and nonneuronal cell lines. In general, expression of the chimeric reporter gene showed excellent correlation with endogenous expression of synapsin I in different neuronal cell lines, whereas transcription was low in all nonneuronal cell lines examined. The addition of the simian virus 40 enhancer promoted non-tissue-specific expression. Deletion mutagenesis of the synapsin I promoter revealed the presence of positive and negative sequence elements. A basal (constitutive) promoter that directs reporter gene expression in neuronal and nonneuronal cell lines was mapped to the region {minus}115 to +47. The promoter region from {minus}422 to {minus}22 contains positive elements that upon fusion with the herpes simplex virus thymidine kinase promoter potentiate its transcription in PC12 and neuroblastoma cells but not in Chinese hamster ovary cells.

  17. ARID3B Directly Regulates Ovarian Cancer Promoting Genes

    PubMed Central

    Bobbs, Alexander; Gellerman, Katrina; Hallas, William Morgan; Joseph, Stancy; Yang, Chao; Kurkewich, Jeffrey; Cowden Dahl, Karen D.


    The DNA-binding protein AT-Rich Interactive Domain 3B (ARID3B) is elevated in ovarian cancer and increases tumor growth in a xenograft model of ovarian cancer. However, relatively little is known about ARID3B's function. In this study we perform the first genome wide screen for ARID3B direct target genes and ARID3B regulated pathways. We identified and confirmed numerous ARID3B target genes by chromatin immunoprecipitation (ChIP) followed by microarray and quantitative RT-PCR. Using motif-finding algorithms, we characterized a binding site for ARID3B, which is similar to the previously known site for the ARID3B paralogue ARID3A. Functionality of this predicted site was demonstrated by ChIP analysis. We next demonstrated that ARID3B induces expression of its targets in ovarian cancer cell lines. We validated that ARID3B binds to an epidermal growth factor receptor (EGFR) enhancer and increases mRNA expression. ARID3B also binds to the promoter of Wnt5A and its receptor FZD5. FZD5 is highly expressed in ovarian cancer cell lines, and is upregulated by exogenous ARID3B. Both ARID3B and FZD5 expression increase adhesion to extracellular matrix (ECM) components including collagen IV, fibronectin and vitronectin. ARID3B-increased adhesion to collagens II and IV require FZD5. This study directly demonstrates that ARID3B binds target genes in a sequence-specific manner, resulting in increased gene expression. Furthermore, our data indicate that ARID3B regulation of direct target genes in the Wnt pathway promotes adhesion of ovarian cancer cells. PMID:26121572

  18. Enhancer activity of Helitron in sericin-1 gene promoter from Bombyx mori.


    Huang, Ke; Li, Chun-Feng; Wu, Jie; Wei, Jun-Hong; Zou, Yong; Han, Min-Jin; Zhou, Ze-Yang


    Sericin is a kind of water-soluble protein expressed specifically in the middle silk gland of Bombyx mori. When the sericin-1 gene promoter was cloned and a transgenic vector was constructed to express a foreign protein, a specific Helitron, Bmhel-8, was identified in the sericin-1 gene promoter sequence in some genotypes of Bombyx mori and Bombyx mandarina. Given that the Bmhel-8 Helitron transposon was present only in some genotypes, it could be the source of allelic variation in the sericin-1 promoter. The length of the sericin-1 promoter sequence is approximately 1063 or 643 bp. The larger size of the sequence or allele is ascribed to the presence of Bmhel-8. Silkworm genotypes can be homozygous for either the shorter or larger promoter sequence or heterozygous, containing both alleles. Bmhel-8 in the sericin-1 promoter exhibits enhancer activity, as demonstrated by a dual-luciferase reporter system in BmE cell lines. Furthermore, Bmhel-8 displays enhancer activity in a sericin-1 promoter-driven gene expression system but does not regulate the tissue-specific expression of sericin-1. PMID:27067405


    Technology Transfer Automated Retrieval System (TEKTRAN)

    Peroxiredoxin 6 gene (Prdx6) of channel catfish, Ictalurus punctatus, was cloned and sequenced. Total RNA from channel catfish tissues was isolated, reverse transcribed and amplified. The sequence of the channel catfish Prdx6 gene consists of 1003 nucleotides. Analysis of the nucleotide sequence ...

  20. Analysis of aberrant methylation on promoter sequences of tumor suppressor genes and total DNA in sputum samples: a promising tool for early detection of COPD and lung cancer in smokers

    PubMed Central


    Background Chronic obstructive pulmonary disease (COPD) is a disorder associated to cigarette smoke and lung cancer (LC). Since epigenetic changes in oncogenes and tumor suppressor genes (TSGs) are clearly important in the development of LC. In this study, we hypothesize that tobacco smokers are susceptible for methylation in the promoter region of TSGs in airway epithelial cells when compared with non-smoker subjects. The purpose of this study was to investigate the usefulness of detection of genes promoter methylation in sputum specimens, as a complementary tool to identify LC biomarkers among smokers with early COPD. Methods We determined the amount of DNA in induced sputum from patients with COPD (n = 23), LC (n = 26), as well as in healthy subjects (CTR) (n = 33), using a commercial kit for DNA purification, followed by absorbance measurement at 260 nm. The frequency of CDKN2A, CDH1 and MGMT promoter methylation in the same groups was determined by methylation-specific polymerase chain reaction (MSP). The Fisher’s exact test was employed to compare frequency of results between different groups. Results DNA concentration was 7.4 and 5.8 times higher in LC and COPD compared to the (CTR) (p < 0.0001), respectively. Methylation status of CDKN2A and MGMT was significantly higher in COPD and LC patients compared with CTR group (p < 0.0001). Frequency of CDH1 methylation only showed a statistically significant difference between LC patients and CTR group (p < 0.05). Conclusions We provide evidence that aberrant methylation of TSGs in samples of induced sputum is a useful tool for early diagnostic of lung diseases (LC and COPD) in smoker subjects. Virtual slides The abstract MUST finish with the following text: Virtual Slides The virtual slide(s) for this article can be found here: PMID:22818553

  1. Identification of a DNA methylation-dependent activator sequence in the pseudoxanthoma elasticum gene, ABCC6.


    Arányi, Tamás; Ratajewski, Marcin; Bardóczy, Viola; Pulaski, Lukasz; Bors, András; Tordai, Attila; Váradi, András


    ABCC6 encodes MRP6, a member of the ABC protein family with an unknown physiological role. The human ABCC6 and its two pseudogenes share 99% identical DNA sequence. Loss-of-function mutations of ABCC6 are associated with the development of pseudoxanthoma elasticum (PXE), a recessive hereditary disorder affecting the elastic tissues. Various disease-causing mutations were found in the coding region; however, the mutation detection rate in the ABCC6 coding region of bona fide PXE patients is only approximately 80%. This suggests that polymorphisms or mutations in the regulatory regions may contribute to the development of the disease. Here, we report the first characterization of the ABCC6 gene promoter. Phylogenetic in silico analysis of the 5' regulatory regions revealed the presence of two evolutionarily conserved sequence elements embedded in CpG islands. The study of DNA methylation of ABCC6 and the pseudogenes identified a correlation between the methylation of the CpG island in the proximal promoter and the ABCC6 expression level in cell lines. Both activator and repressor sequences were uncovered in the proximal promoter by reporter gene assays. The most potent activator sequence was one of the conserved elements protected by DNA methylation on the endogenous gene in non-expressing cells. Finally, in vitro methylation of this sequence inhibits the transcriptional activity of the luciferase promoter constructs. Altogether these results identify a DNA methylation-dependent activator sequence in the ABCC6 promoter. PMID:15760889

  2. Draft Genome Sequence of the Biocontrol and Plant Growth-Promoting Rhizobacterium Pseudomonas fluorescens strain UM270.


    Hernández-Salmerón, Julie E; Hernández-León, Rocio; Orozco-Mosqueda, Ma Del Carmen; Valencia-Cantero, Eduardo; Moreno-Hagelsieb, Gabriel; Santoyo, Gustavo


    The Pseudomonas fluorescens strain UM270 was isolated form the rhizosphere of wild Medicago spp. A previous work has shown that this pseudomonad isolate was able to produce diverse diffusible and volatile compounds involved in plant protection and growth promotion. Here, we present the draft genome sequence of the rhizobacterium P. fluorescens strain UM270. The sequence covers 6,047,974 bp of a single chromosome, with 62.66 % G + C content and no plasmids. Genome annotations predicted 5,509 genes, 5,396 coding genes, 59 RNA genes and 110 pseudogenes. Genome sequence analysis revealed the presence of genes involved in biological control and plant-growth promoting activities. We anticipate that the P. fluorescens strain UM270 genome will contribute insights about bacterial plant protection and beneficial properties through genomic comparisons among fluorescent pseudomonads. PMID:26767092

  3. Promoter DNA demethylation of Keap1 gene in diabetic cardiomyopathy

    PubMed Central

    Liu, Zhong-Zhi; Zhao, Xiang-Zhi; Zhang, Xue-Song; Zhang, Mei


    Researches have shown that the onset of diabetes is closely associated with oxidative stress and the chronic exposure leads to the development of complications such as diabetic cardiomyopathy. One of the central adaptive responses against the oxidative stresses is the activation of the nuclear transcriptional factor, NF-E2-related factor 2 (Nrf2), which then activates more than 20 different antioxidative enzymes. Kelch-like ECH associated protein 1 (Keap1) targets and binds to Nrf2 for proteosomal degradation. The aim of the present study was to investigate the status of Nrf2 mediated antioxidant system in myocardial biopsies of non-diabetic (NDM) and type-2 diabetic (DM-T2) cardiomyopathy patients. The western blot analysis of antioxidant proteins, real-time PCR analysis of Nrf2/Keap1 gene and bisulphate DNA sequencing analysis to study the methylation status of the CpG islands of Keap1 promoter DNA were performed. The immunoblot analysis showed the decreased level of antioxidant proteins other than Keap1 in the diabetic cardiopathy patients. Similarly, mRNA levels of Keap1 showed 5-fold increase in diabetic patients. Further analysis on promoter region of Keap1 gene revealed 80% demethylation in diabetic patients. Altogether, our results indicated that demethylation of the CpG islands in the Keap1 promoter will activate the expression of Keap1 protein, which then increases the targeting of Nrf2 for proteosomal degradation. Decreased Nrf2 activity represses the transcription of many antioxidant enzyme genes and alters the redox-balance up on diabetes. Thus, our study clearly demonstrates the failure of Nrf2 mediated antioxidant system revealed in biopsies of diabetic cardiomyopathy. PMID:25674242

  4. Nucleotide sequence of the thermostable direct hemolysin gene of Vibrio parahaemolyticus.

    PubMed Central

    Nishibuchi, M; Kaper, J B


    The gene encoding the thermostable direct hemolysin of Vibrio parahaemolyticus was characterized. This gene (designated tdh) was subcloned into pBR322 in Escherichia coli, and the functional tdh gene was localized to a 1.3-kilobase HindIII fragment. This fragment was sequenced, and the structural gene was found to encode a mature protein of 165 amino acid residues. The mature protein sequence was preceded by a putative signal peptide sequence of 24 amino acids. A putative tdh promoter, determined by its similarity to concensus sequences, was not functional in E. coli. However, a promoter that was functional in E. coli was shown to exist further upstream by use of a promoter probe plasmid. A 5.7-kilobase SalI fragment containing the structural gene and both potential promoters was cloned into a broad-host-range plasmid and mobilized into a Kanagawa phenomenon-negative V. parahaemolyticus strain. In contrast to E. coli, where the hemolysin was detected only in cell lysates, introduction of the cloned gene into V. parahaemolyticus resulted in the production of extracellular hemolysin. Images PMID:3988703

  5. Gene and translation initiation site prediction in metagenomic sequences

    SciTech Connect

    Hyatt, Philip Douglas; LoCascio, Philip F; Hauser, Loren John; Uberbacher, Edward C


    Gene prediction in metagenomic sequences remains a difficult problem. Current sequencing technologies do not achieve sufficient coverage to assemble the individual genomes in a typical sample; consequently, sequencing runs produce a large number of short sequences whose exact origin is unknown. Since these sequences are usually smaller than the average length of a gene, algorithms must make predictions based on very little data. We present MetaProdigal, a metagenomic version of the gene prediction program Prodigal, that can identify genes in short, anonymous coding sequences with a high degree of accuracy. The novel value of the method consists of enhanced translation initiation site identification, ability to identify sequences that use alternate genetic codes and confidence values for each gene call. We compare the results of MetaProdigal with other methods and conclude with a discussion of future improvements.

  6. Photoregulation of a phytochrome gene promoter from oat transferred into rice by particle bombardment.

    PubMed Central

    Bruce, W B; Christensen, A H; Klein, T; Fromm, M; Quail, P H


    The regulatory photoreceptor phytochrome controls the transcription of its own phy genes in a negative feedback fashion. We have exploited microprojectile-mediated gene transfer to develop a rapid transient expression assay system for the study of DNA sequences involved in the phytochrome-regulated expression of these genes. The 5'-flanking sequence and part of the structural region of an oat phy gene have been fused to a reporter coding sequence (chloramphenicol acetyltransferase, CAT) and introduced into intact darkgrown seedlings by using high-velocity microprojectiles. Expression is assayable in less than 24 hr from bombardment. The introduced oat phy-CAT fusion gene is expressed and down-regulated by white light in barley, rice, and oat, whereas no expression is detected in three dicots tested, tobacco, cucumber, and Arabidopsis thaliana. In bombarded rice shoots, red/far-red light-reversible repression of expression of the heterologous oat phy-CAT gene shows that it is regulated by phytochrome in a manner parallel to that of the endogenous rice phy genes. These data indicate that the transduction pathway components and promoter sequences involved in autoregulation of phy expression have been evolutionarily conserved between oat and rice. The experiments show the feasibility of using high-velocity microprojectile-mediated gene transfer for the rapid analysis of light-controlled monocot gene promoters in monocot tissues that until now have been recalcitrant to such studies. Images PMID:2602370

  7. Identification of genes in genomic and EST sequences

    SciTech Connect

    Fields, C.; Adams, M.D.; Kerlavage, A.R.; Dubnick, M.; McCombie, W.R.; Martin-Gallardo, A.; Venter, J.C.; White, O.


    Currently-available software tools are capable of predicting the locations of most protein-coding genes in anonymous genomic DNA sequences. The use of predicted exxon to select primers for PCR amplification from cDNA libraries allows the complete structures of novel genes to be determined efficiently. As the number of expressed sequence tag (EST) sequences increases, the fraction of genes that can be localized in genomic sequences by searching EST databases will rapidly approach unity. The challenge for automated DNA sequence analysis is now to develop methods for accurately predicting gene structure and alternative splicing patterns. Substantially improving current accuracies in gene structure prediction will require retrospective comparative analysis of sequences from different organisms and gene families.

  8. A cis-regulatory sequence from a short intergenic region gives rise to a strong microbe-associated molecular pattern-responsive synthetic promoter.


    Lehmeyer, Mona; Hanko, Erik K R; Roling, Lena; Gonzalez, Lilian; Wehrs, Maren; Hehl, Reinhard


    The high gene density in Arabidopsis thaliana leaves only relatively short intergenic regions for potential cis-regulatory sequences. To learn more about the regulation of genes harbouring only very short upstream intergenic regions, this study investigates a recently identified novel microbe-associated molecular pattern (MAMP)-responsive cis-sequence located within the 101 bp long intergenic region upstream of the At1g13990 gene. It is shown that the cis-regulatory sequence is sufficient for MAMP-responsive reporter gene activity in the context of its native promoter. The 3' UTR of the upstream gene has a quantitative effect on gene expression. In context of a synthetic promoter, the cis-sequence is shown to achieve a strong increase in reporter gene activity as a monomer, dimer and tetramer. Mutation analysis of the cis-sequence determined the specific nucleotides required for gene expression activation. In transgenic A. thaliana the synthetic promoter harbouring a tetramer of the cis-sequence not only drives strong pathogen-responsive reporter gene expression but also shows a high background activity. The results of this study contribute to our understanding how genes with very short upstream intergenic regions are regulated and how these regions can serve as a source for MAMP-responsive cis-sequences for synthetic promoter design. PMID:26833485

  9. Type 1 plaminogen activator inhibitor gene: Functional analysis and glucocorticoid regulation of its promoter

    SciTech Connect

    Van Zonneveld, A.J.; Curriden, S.A.; Loskutoff, D.J. )


    Plasminogen activator inhibitor type 1 is an important component of the fibrinolytic system and its biosynthesis is subject to complex regulation. To study this regulation at the level of transcription, the authors have identified and sequenced the promoter of the human plasminogen activator inhibitor type 1 gene. Nuclease protection experiments were performed by using endothelial cell mRNA and the transcription initiation (cap) site was established. Sequence analysis of the 5{prime} flanking region of the gene revealed a perfect TATA box at position {minus}28 to position {minus}23, the conserved distance from the cap site. Comparative functional studies with the firefly luciferase gene as a reporter gene showed that fragments derived from this 5{prime} flanking region exhibited high promoter activity when transfected into bovine aortic endothelial cells and mouse Ltk{sup {minus}} fibroblasts but were inactive when introduced into HeLa cells. These studies indicate that the fragments contain the plasminogen activator inhibitor type 1 promoter and that it is expressed in a tissue-specific manner. Although the fragments were also silent in rat FTO2B hepatoma cells, their promoter activity could be induced up to 40-fold with the synthetic glucocorticoid dexamethasone. Promoter deletion mapping experiments and studies involving the fusion of promoter fragments to a heterologous gene indicated that dexamethasone induction is mediated by a glucocorticoid responsive element with enhancer-like properties located within the region between nucleotides {minus}305 and +75 of the plasminogen activator inhibitor type 1 gene.

  10. Identification and characterization of the human XIST gene promoter: implications for models of X chromosome inactivation.

    PubMed Central

    Hendrich, B D; Plenge, R M; Willard, H F


    The XIST gene in both humans and mice is expressed exclusively from the inactive X chromosome and is required for X chromosome inactivation to occur early in development. In order to understand transcriptional regulation of the XIST gene, we have identified and characterized the human XIST promoter and two repeated DNA elements that modulate promoter activity. As determined by reporter gene constructs, the XIST minimal promoter is constitutively active at high levels in human male and female cell lines and in transgenic mice. We demonstrate that this promoter activity is dependent in vitro upon binding of the common transcription factors SP1, YY1 and TBP. We further identify two cis -acting repeated DNA sequences that influence reporter gene activity. First, DNA fragments containing a set of highly conserved repeats located within the 5'-end of XIST stimulate reporter activity 3-fold in transiently transfected cell lines. Second, a 450 bp alternating purine-pyrimidine repeat located 25 kb upstream of the XIST promoter partially suppresses promoter activity by approximately 70% in transient transfection assays. These results indicate that the XIST promoter is constitutively active and that critical steps in the X inactivation process must involve silencing of XIST on the active X chromosome by factors that interact with and/or recognize sequences located outside the minimal promoter. PMID:9185579

  11. Brain-specific genes have identifier sequences in their introns.

    PubMed Central

    Milner, R J; Bloom, F E; Lai, C; Lerner, R A; Sutcliffe, J G


    The 82-nucleotide identifier (ID) sequence is present in the rat genome in 1-1.5 X 10(5) copies and in cDNA clones of precursors of brain-specific mRNAs. One brain-specific gene contains more than one ID sequence in its introns. There is an excess of ID sequences to brain genes, and some ID sequences appear to have been inserted as mobile elements into other genetic locations. Therefore, brain genes contain ID sequences in their introns, but not all ID sequences are located in brain gene introns. A brain ID consensus sequence has been obtained by comparing 8 ID nucleotide sequences. Images PMID:6583673

  12. Molecular cloning and characterization of the promoter region of the porcine apolipoprotein E gene.


    Xia, Jihan; Hu, Bingjun; Mu, Yulian; Xin, Leilei; Yang, Shulin; Li, Kui


    Apolipoprotein E (APOE), a component of lipoproteins plays an important role in the transport and metabolism of cholesterol, and is associated with hyperlipoproteinemia and Alzheimer's disease. In order to further understand the characterization of APOE gene, the promoter of APOE gene of Landrace pigs was analyzed in the present study. The genomic structure and amino acid sequence in pigs were analyzed and found to share high similarity in those of human but low similarity in promoter region. Real-time PCR revealed the APOE gene expression pattern of pigs in diverse tissues. The highest expression level was observed in liver, relatively low expression in other tissues, especially in stomach and muscle. Furthermore, the promoter expressing in Hepa 1-6 was significantly better at driving luciferase expression compared with C2C12 cell. After analysis of porcine APOE gene promoter regions, potential transcription factor binding sites were predicted and two GC signals, a TATA box were indicated. Results of promoter activity analysis indicated that one of potential regulatory elements was located in the region -669 to -259, which was essential for a high expression of the APOE gene. Promoter mutation and deletion analysis further suggested that the C/EBPA binding site within the APOE promoter was responsible for the regulation of APOE transcription. Electrophoretic mobility shift assays also showed the binding site of the transcription factor C/EBPA. This study advances our knowledge of the promoter of the porcine APOE gene. PMID:24464129

  13. The TATA-less promoter of VP1, a plant gene controlling seed germination.


    Carrari, F; Frankel, N; Lijavetzky, D; Benech-Arnold, R; Sánchez, R; Iusem, N D


    Vp1 is a seed-specific gene involved in the control of dormancy and germination. We here present the complete sequence of the sorghum vp1 promoter/enhancer region highlighting its main features, especially the lack of canonical TATA and CAAT boxes and the presence of elements responsive to abscisic acid and light. The region closest to the start of transcription is highly homologous to the partial proximal sequence reported for the maize vp1 promoter. This region is interrupted by a 57-nt stretch containing 14 CT microsatellite repeats. We observed a poor overall homology to the promoter from abi3 gene, the Arabidopsis counterpart bearing a similar coding sequence. However, there exists a high degree of homology (89%) between a TATA-rich 103-bp stretch of the sorghum vp1 promoter located about 700 nt upstream of the startpoint and miniature inverted transposable elements (MITEs) interspersed within the sorghum seed-specific kafirin cluster. This sorghum MITE-like element displays considerable homology (68%) to the TATA-less promoter from the sorghum NADP-malate dehydrogenase gene and lesser similarity to the Tourist, Pilgrim and Batuta MITEs previously identified within the promoter from the maize Abp1 (auxin-binding protein) gene. PMID:11761708

  14. The complete sequence of soybean chlorotic mottle virus DNA and the identification of a novel promoter.


    Hasegawa, A; Verver, J; Shimada, A; Saito, M; Goldbach, R; Van Kammen, A; Miki, K; Kameya-Iwaki, M; Hibi, T


    The complete nucleotide sequence of an infectious clone of soybean chlorotic mottle virus (SoyCMV) DNA was determined and compared with those of three other caulimoviruses, cauliflower mosaic virus (CaMV), carnation etched ring virus and figwort mosaic virus. The double-stranded DNA genome of SoyCMV (8,175 bp) contained nine open reading frames (ORFs) and one large intergenic region. The primer binding sites, gene organization and size of ORFs were similar to those of the other caulimoviruses, except for ORF I, which was split into ORF Ia and Ib. The amino acid sequences deduced from each ORF showed only short, highly homologous regions in several of the corresponding ORFs of the three other caulimoviruses. A promoter fragment of 378 bp in SoyCMV ORF III showed a strong expression activity, comparable to that of the CaMV 35S promoter, in tobacco mesophyll protoplasts as determined by a beta-glucuronidase assay using electrotransfection. The fragment contained CAAT and TATA boxes but no transcriptional enhancer signal as reported for the CaMV 35S promoter. Instead, it had sequences homologous to a part of the translational enhancer signal reported for the 5'-leader sequence of tobacco mosaic virus RNA. PMID:2602148

  15. Excision of plastid marker genes using directly repeated DNA sequences.


    Mudd, Elisabeth A; Madesis, Panagiotis; Avila, Elena Martin; Day, Anil


    Excision of marker genes using DNA direct repeats makes use of the predominant homologous recombination pathways present in the plastids of algae and plants. The method is simple, efficient, and widely applicable to plants and microalgae. Marker excision frequency is dependent on the length and number of directly repeated sequences. When two repeats are used a repeat size of greater than 600 bp promotes efficient excision of the marker gene. A wide variety of sequences can be used to make the direct repeats. Only a single round of transformation is required, and there is no requirement to introduce site-specific recombinases by retransformation or sexual crosses. Selection is used to maintain the marker and ensure homoplasmy of transgenic plastid genomes. Release of selection allows the accumulation of marker-free plastid genomes generated by marker excision, which is spontaneous, random, and a unidirectional process. Positive selection is provided by linking marker excision to restoration of the coding region of an herbicide resistance gene from two overlapping but incomplete coding regions. Cytoplasmic sorting allows the segregation of cells with marker-free transgenic plastids. The marker-free shoots resulting from direct repeat-mediated excision of marker genes have been isolated by vegetative propagation of shoots in the T0 generation. Alternatively, accumulation of marker-free plastid genomes during growth, development and flowering of T0 plants allows the collection of seeds that give rise to a high proportion of marker-free T1 seedlings. The simplicity and convenience of direct repeat excision facilitates its widespread use to isolate marker-free crops. PMID:24599849

  16. Expression of multi-functional cellulase gene mfc in Coprinus cinereus under control of different basidiomycete promoters.


    Cheng, Shujie; Yang, Peizhou; Guo, Liqiong; Lin, Junfang; Lou, Nannan


    Multi-functional cellulase gene mfc was expressed in Coprinus cinereus under naturally non-inductive conditions using three heterologous promoters. Endo-beta-1,4-glucanase expression was achieved in solid and liquid media with promoter sequences from the Lentinula edodesgpd gene, the Flammulina velutipes gpd gene and the Volvariella volvaceagpd gene. As measured by enzyme activity in liquid cultures, a 613-bp gpd promoter fragment from L. edodes was most efficient, followed by a 752-bp gpd fragment from F. velutipes. The V. volvacea gpd promoter sequence was less active, in comparison. Irrespective of the promoter used, enzymatic activities increase 34-fold for highly active transformants and 29-fold for less active one by using cellulase-inducing medium. The highest activities of endo-beta-1,4-glucanase (34.234 U/ml) and endo-beta-1,4-xylanase (263.695 U/ml) were reached by using the L. edodesgpd promoter. PMID:19442518

  17. Using shotgun sequence data to find active restriction enzyme genes.


    Zheng, Yu; Posfai, Janos; Morgan, Richard D; Vincze, Tamas; Roberts, Richard J


    Whole genome shotgun sequence analysis has become the standard method for beginning to determine a genome sequence. The preparation of the shotgun sequence clones is, in fact, a biological experiment. It determines which segments of the genome can be cloned into Escherichia coli and which cannot. By analyzing the complete set of sequences from such an experiment, it is possible to identify genes lethal to E. coli. Among this set are genes encoding restriction enzymes which, when active in E. coli, lead to cell death by cleaving the E. coli genome at the restriction enzyme recognition sites. By analyzing shotgun sequence data sets we show that this is a reliable method to detect active restriction enzyme genes in newly sequenced genomes, thereby facilitating functional annotation. Active restriction enzyme genes have been identified, and their activity demonstrated biochemically, in the sequenced genomes of Methanocaldococcus jannaschii, Bacillus cereus ATCC 10987 and Methylococcus capsulatus. PMID:18988632

  18. Complete genome sequence of the rapeseed plant-growth promoting Serratia plymuthica strain AS9

    SciTech Connect

    Neupane, Saraswoti; Hogberg, Nils; Alstrom, Sadhna; Lucas, Susan; Han, James; Lapidus, Alla L.; Cheng, Jan-Fang; Bruce, David; Goodwin, Lynne A.; Pitluck, Sam; Peters, Lin; Ovchinnikova, Galina; Lu, Megan; Han, Cliff; Detter, J. Chris; Tapia, Roxanne; Fiebig, Anne; Land, Miriam L; Hauser, Loren John; Kyrpides, Nikos C; Ivanova, N; Pagani, Ioanna; Klenk, Hans-Peter; Woyke, Tanja; Finlay, Roger D.


    Serratia plymuthica are plant-associated, plant beneficial species belonging to the family Enterobacteriaceae. The members of the genus Serratia are ubiquitous in nature and their life style varies from endophytic to free-living. S. plymuthica AS9 is of special interest for its ability to inhibit fungal pathogens of rapeseed and to promote plant growth. The genome of S. plymuthica AS9 comprises a 5,442,880 bp long circular chromosome that consists of 4,952 protein-coding genes, 87 tRNA genes and 7 rRNA operons. This genome is part of the project entitled Genomics of four rapeseed plant growth promoting bacteria with antagonistic effect on plant pathogens awarded through the 2010 DOE-JGI Community Sequencing Program (CSP2010).

  19. Complete genome sequence of the rapeseed plant-growth promoting Serratia plymuthica strain AS9

    PubMed Central

    Högberg, Nils; Alström, Sadhna; Lucas, Susan; Han, James; Lapidus, Alla; Cheng, Jan-Fang; Bruce, David; Goodwin, Lynne; Pitluck, Sam; Peters, Lin; Ovchinnikova, Galina; Lu, Megan; Han, Cliff; Detter, John C.; Tapia, Roxanne; Fiebig, Anne; Land, Miriam; Hauser, Loren; Kyrpides, Nikos C.; Ivanova, Natalia; Pagani, Ioanna; Klenk, Hans-Peter; Woyke, Tanja; Finlay, Roger D.


    Serratia plymuthica are plant-associated, plant beneficial species belonging to the family Enterobacteriaceae. The members of the genus Serratia are ubiquitous in nature and their life style varies from endophytic to free-living. S. plymuthica AS9 is of special interest for its ability to inhibit fungal pathogens of rapeseed and to promote plant growth. The genome of S. plymuthica AS9 comprises a 5,442,880 bp long circular chromosome that consists of 4,952 protein-coding genes, 87 tRNA genes and 7 rRNA operons. This genome is part of the project entitled “Genomics of four rapeseed plant growth promoting bacteria with antagonistic effect on plant pathogens” awarded through the 2010 DOE-JGI Community Sequencing Program (CSP2010). PMID:22675598

  20. Nucleotide sequence of the gene for human prothrombin

    SciTech Connect

    Degen, S.J.F.; Davie, E.W.


    A human genomic DNA library was screened for the gene coding for human prothrombin with a cDNA coding for the human protein. Eighty-one positive lambda phage were identified, and three were chosen for further characterization. These three phage hybridized with 5' and/or 3' probes prepared from the prothrombin cDNA. The complete DNA sequence of 21 kilobases of the human prothrombin gene was determined and included a 4.9-kilobase region that was previously sequenced. The gene for human prothrombin contains 14 exons separated by 13 intervening sequences. The exons range in size from 25 to 315 base pairs, while the introns range from 84 to 9447 base pairs. Ninety percent of the gene is composed of intervening sequence. All the intron splice junctions are consistent with sequences found in other eukaryotic genes, except for the presence of GC rather than GT on the 5' end of intervening sequence L. Thirty copies of Alu repetitive DNA and two copies of partial KpnI repeats were identified in clusters within several of the intervening sequences, and these repeats represent 40% of the DNA sequence of the gene. The size, distribution, and sequence homology of the introns within the gene were the compared to those of the genes for the other vitamin K dependent proteins and several other serine proteases.

  1. Genome Sequencing of a Mung Bean Plant Growth Promoting Strain of P. aeruginosa with Biocontrol Ability

    PubMed Central

    Illakkiam, Devaraj; Shankar, Manoharan; Ponraj, Paramasivan; Rajendhran, Jeyaprakash


    Pseudomonas aeruginosa PGPR2 is a mung bean rhizosphere strain that produces secondary metabolites and hydrolytic enzymes contributing to excellent antifungal activity against Macrophomina phaseolina, one of the prevalent fungal pathogens of mung bean. Genome sequencing was performed using the Ion Torrent Personal Genome Machine generating 1,354,732 reads (6,772,433 sequenced bases) achieving ~25-fold coverage of the genome. Reference genome assembly using MIRA 3.4.0 yielded 198 contigs. The draft genome of PGPR2 encoded 6803 open reading frames, of which 5314 were genes with predicted functions, 1489 were genes of known functions, and 80 were RNA-coding genes. Strain specific and core genes of P. aeruginosa PGPR2 that are relevant to rhizospheric habitat were identified by pangenome analysis. Genes involved in plant growth promoting function such as synthesis of ACC deaminase, indole-3-acetic acid, trehalose, mineral scavenging siderophores, hydrogen cyanide, chitinases, acyl homoserine lactones, acetoin, 2,3-butanediol, and phytases were identified. In addition, niche-specific genes such as phosphate solubilising 3-phytase, adhesins, pathway-specific transcriptional regulators, a diguanylate cyclase involved in cellulose synthesis, a receptor for ferrienterochelin, a DEAD/DEAH-box helicase involved in stress tolerance, chemotaxis/motility determinants, an HtpX protease, and enzymes involved in the production of a chromanone derivative with potent antifungal activity were identified. PMID:25184130

  2. Regulation of sesquiterpene cyclase gene expression. Characterization of an elicitor- and pathogen-inducible promoter.

    PubMed Central

    Yin, S; Mei, L; Newman, J; Back, K; Chappell, J


    The promoter for a tobacco (Nicotiana tabacum) sesquiterpene cyclase gene, a key regulatory step in sesquiterpene phytoalexin biosynthesis, has been analyzed. The EAS4 promoter was fused to the beta-glucuronidase (GUS) reporter gene, and the temporal and spatial expression patterns of GUS activity were examined in stably transformed plants and in transient expression assays using electroporated protoplasts of tobacco. No GUS activity was observed in any tissues under normal growth conditions. A low level of GUS activity was detected in wounded leaf, root, and stem tissues, whereas a much higher level was observed when these tissues were challenged with elicitors or microbial pathogens. The GUS expression pattern directed by the EAS4 promoter was identical to the induction patterns observed for the endogenous sesquiterpene cyclase genes. Neither exogenous salicylic acid nor methyl jasmonate induced GUS expression; and H2O2 induced GUS expression to only a limited extent. Although the EAS4 promoter contains cis-sequences resembling previously identified transcriptional control motifs, other cis-sequences important for quantitative and qualitative gene expression were identified by deletion and gain-of-function analyses. The EAS4 promoter differs from previously described pathogen-/elicitor-inducible promoters because it only supports inducible gene expression and directs unique spatial expression patterns. PMID:9342864

  3. Identification of distal silencing elements in the murine interferon-A11 gene promoter.

    PubMed Central

    Roffet, P; Lopez, S; Navarro, S; Bandu, M T; Coulombel, C; Vignal, M; Doly, J; Vodjdani, G


    The murine interferon-A11 (Mu IFN-A11) gene is a member of the IFN-A multigenic family. In mouse L929 cells, the weak response of the gene's promoter to viral induction is due to a combination of both a point mutation in the virus responsive element (VRE) and the presence of negatively regulating sequences surrounding the VRE. In the distal part of the promoter, the negatively acting E1E2 sequence was delimited. This sequence displays an inhibitory effect in either orientation or position on the inducibility of a virus-responsive heterologous promoter. It selectively represses VRE-dependent transcription but is not able to reduce the transcriptional activity of a VRE-lacking promoter. In a transient transfection assay, an E1E2-containing DNA competitor was able to derepress the native Mu IFN-A11 promoter. Specific nuclear factors bind to this sequence; thus the binding of trans-regulators participates in the repression of the Mu IFN-A11 gene. The E1E2 sequence contains an IFN regulatory factor (IRF)-binding site. Recombinant IRF2 binds this sequence and anti-IRF2 antibodies supershift a major complex formed with nuclear extracts. The protein composing the complex is 50 kDa in size, indicating the presence of IRF2 or antigenically related proteins in the complex. The Mu IFN-A11 gene is the first example within the murine IFN-A family, in which a distal promoter element has been identified that can negatively modulate the transcriptional response to viral induction. PMID:8760352

  4. Heterologous gene expression driven by carbonic anhydrase gene promoter in Dunaliella salina

    NASA Astrophysics Data System (ADS)

    Chai, Yurong; Lu, Yumin; Wang, Tianyun; Hou, Weihong; Xue, Lexun


    Dunaliella salina, a halotolerant unicellular green alga without a rigid cell wall, can live in salinities ranging from 0.05 to 5 mol/L NaCl. These features of D. salina make it an ideal host for the production of antibodies, oral vaccine, and commercially valuable polypeptides. To produce high level of heterologous proteins from D. salina, highly efficient promoters are required to drive expression of target genes under controlled condition. In the present study, we cloned a 5' franking region of 1.4 kb from the carbonic anhydrase ( CAH) gene of D. salina by genomic walking and PCR. The fragment was ligated to the pMD18-T vector and characterized. Sequence analysis indicated that this region contained conserved motifs, including a TATA- like box and CAAT-box. Tandem (GT)n repeats that had a potential role of transcriptional control, were also found in this region. The transcription start site (TSS) of the CAH gene was determined by 5' RACE and nested PCR method. Transformation assays showed that the 1.4 kb fragment was able to drive expression of the selectable bar (bialaphos resistance) gene when the fusion was transformed into D. salina by biolistics. Northern blotting hybridizations showed that the bar transcript was most abundant in cells grown in 2 mol/L NaCl, and less abundant in 0.5 mol/L NaCl, indicating that expression of the bar gene was induced at high salinity. These results suggest the potential use of the CAH gene promoter to induce the expression of heterologous genes in D. salina under varied salt condition.

  5. Nonessential region of bacteriophage P4: DNA sequence, transcription, gene products, and functions.

    PubMed Central

    Ghisotti, D; Finkel, S; Halling, C; Dehò, G; Sironi, G; Calendar, R


    We sequenced the leftmost 2,640 base pairs of bacteriophage P4 DNA, thus completing the sequence of the 11,627-base-pair P4 genome. The newly sequenced region encodes three nonessential genes, which are called gop, beta, and cII (in order, from left to right). The gop gene product kills Escherichia coli when the beta protein is absent; the gop and beta genes are transcribed rightward from the same promoter. The cII gene is transcribed leftward to a rho-independent terminator. Mutation of this terminator creates a temperature-sensitive phenotype, presumably owing to a defect in expression of the beta gene. Images PMID:2403440

  6. Recognition of Yeast Species from Gene Sequence Comparisons

    Technology Transfer Automated Retrieval System (TEKTRAN)

    This review discusses recognition of yeast species from gene sequence comparisons, which have been responsible for doubling the number of known yeasts over the past decade. The resolution provided by various single gene sequences is examined for both ascomycetous and basidiomycetous species, and th...

  7. Reclassification of ascomycetous yeasts from gene sequence analyses

    Technology Transfer Automated Retrieval System (TEKTRAN)

    During the past decade, identification of yeasts and their classification has been based almost exclusively on gene sequence analysis. Primarily as a result of using diagnostic gene sequences, such as D1/D2 LSU and ITS ribosomal RNAs, the number of known species has doubled. With the faster sequen...

  8. Organization and sequence of the human alpha-lactalbumin gene.

    PubMed Central

    Hall, L; Emery, D C; Davies, M S; Parker, D; Craig, R K


    A recombinant bacteriophage containing the entire alpha-lactalbumin gene was isolated from a human genomic library constructed in bacteriophage lambda L47. Within this recombinant the 2.5 kb alpha-lactalbumin gene is flanked by about 5 kb of sequence on either side. The complete nucleotide sequence of the gene and its immediate flanking sequences were determined and compared with those of the rat alpha-lactalbumin gene. These studies showed that the size, organization and sequence of the exons have been highly conserved, whereas the introns have diverged considerably. In particular, the first intron of the human gene was found to contain an Alu repetitive sequence not present in the rat. A high degree of homology (67%) was also observed in the 5' flanking regions, extending as far as 655 nucleotide residues upstream of the transcriptional initiation site. Comparison of the 5' flanking sequences of these two alpha-lactalbumin genes with those of five casein genes has revealed the presence of a highly conserved region [consensus sequence: RGAAGRAAA(N)TGGACAGAAATCAA(CG)TTTCTA], extending from position -140 to -110 in all seven sequences examined, suggesting a possible regulatory role in the hormonal control or tissue-specific expression of milk protein genes in the mammary gland. Images Fig. 1. PMID:2954544

  9. Motif discovery in promoters of genes co-localized and co-expressed during myeloid cells differentiation

    PubMed Central

    Coppe, Alessandro; Ferrari, Francesco; Bisognin, Andrea; Danieli, Gian Antonio; Ferrari, Sergio; Bicciato, Silvio; Bortoluzzi, Stefania


    Genes co-expressed may be under similar promoter-based and/or position-based regulation. Although data on expression, position and function of human genes are available, their true integration still represents a challenge for computational biology, hampering the identification of regulatory mechanisms. We carried out an integrative analysis of genomic position, functional annotation and promoters of genes expressed in myeloid cells. Promoter analysis was conducted by a novel multi-step method for discovering putative regulatory elements, i.e. over-represented motifs, in a selected set of promoters, as compared with a background model. The combination of transcriptional, structural and functional data allowed the identification of sets of promoters pertaining to groups of genes co-expressed and co-localized in regions of the human genome. The application of motif discovery to 26 groups of genes co-expressed in myeloid cells differentiation and co-localized in the genome showed that there are more over-represented motifs in promoters of co-expressed and co-localized genes than in promoters of simply co-expressed genes (CEG). Motifs, which are similar to the binding sequences of known transcription factors, non-uniformly distributed along promoter sequences and/or occurring in highly co-expressed subset of genes were identified. Co-expressed and co-localized gene sets were grouped in two co-expressed genomic meta-regions, putatively representing functional domains of a high-level expression regulation. PMID:19059999

  10. Isolation and characterization of a polyubiquitin gene and its promoter region from Mesembryanthemum crystallinum.


    Azad, Muhammad Abul Kalam; Morita, Kunio; Ohnishi, Jun-ichi; Kore-eda, Shin


    Transcript levels of the polyubiquitin gene McUBI1 had been reported to be constant during Crassulacean acid metabolism (CAM) induction in the facultative CAM plant, Mesembryanthemum crystallinum. Here, we report the sequences of the full-length cDNA of McUBI1 and its promoter, and validation of the McUBI1 promoter as an internal control driving constitutive expression in transient assays using the dual-luciferase system to investigate the regulation of CAM-related gene expression. The McUBI1 promoter drove strong, constitutive expression during CAM induction. We compared the activities of this promoter with those of the cauliflower mosaic virus (CaMV) 35S promoter in detached C3- and CAM-performing M. crystallinum and tobacco leaves. We confirmed stable expression of the genes controlled by the McUBI1 promoter with far less variability than under the CaMV 35S promoter in M. crystallinum, whereas both promoters worked well in tobacco. We found the McUBI1 promoter more suitable than the CaMV 35S promoter as an internal control for transient expression assays in M. crystallinum. PMID:23470760

  11. Evaluation of a novel promoter from Populus trichocarpa for mature xylem tissue specific gene delivery.


    Nguyen, Van Phap; Cho, Jin-Seong; Choi, Young-Im; Lee, Sang-Won; Han, Kyung-Hwan; Ko, Jae-Heung


    Wood (i.e., secondary xylem) is an important raw material for many industrial applications. Mature xylem (MX) tissue-specific genetic modification offers an effective means to improve the chemical and physical properties of the wood. Here, we describe a promoter that drives strong gene expression in a MX tissue-specific manner. Using whole-transcriptome genechip analyses of different tissue types of poplar, we identified five candidate genes that had strong expression in the MX tissue. The putative promoter sequences of the five MX-specific genes were evaluated for their promoter activity in both transgenic Arabidopsis and poplar. Among them, we found the promoter of Potri.013G007900.1 (called the PtrMX3 promoter) had the strongest activity in MX and thus was further characterized. In the stem and root tissues of transgenic Arabidopsis plants, the PtrMX3 promoter activity was found exclusively in MX tissue. MX-specific activity of the promoter was reproduced in the stem tissue of transgenic poplar plants. The PtrMX3 promoter activity was not influenced by abiotic stresses or exogenously applied growth regulators, indicating the PtrMX3 promoter is bona fide MX tissue-specific. Our study provides a strong MX-specific promoter for MX-specific modifications of woody biomass. PMID:27038601

  12. Complete genome sequence of Bacillus amyloliquefaciens strain Co1-6, a plant growth-promoting rhizobacterium of Calendula officinalis

    SciTech Connect

    Koeberl, Martina; White, Richard A.; Erschen, Sabine; Spanberger, Nora; El-Arabi, Tarek F.; Jansson, Janet K.; Berg, Gabriele


    The genome sequence of Bacillus amyloliquefaciens strain Co1-6, a plant growth-promoting rhizobacterium (PGPR) with broad-spectrum antagonistic activities against plant pathogenic fungi, bacteria and nematodes, consists of a single 3.9 Mb circular chromosome. The genome reveals genes putatively responsible for its promising biocontrol and PGP properties.

  13. Complete Genome Sequence of Bacillus amyloliquefaciens Strain Co1-6, a Plant Growth-Promoting Rhizobacterium of Calendula officinalis

    PubMed Central

    White, Richard A.; Erschen, Sabine; Spanberger, Nora; El-Arabi, Tarek F.; Jansson, Janet K.; Berg, Gabriele


    The genome sequence of Bacillus amyloliquefaciens strain Co1-6, a plant growth-promoting rhizobacterium (PGPR) with broad-spectrum antagonistic activity against plant-pathogenic fungi, bacteria, and nematodes, consists of a single 3.9-Mb circular chromosome. The genome reveals genes putatively responsible for its promising biocontrol and PGP properties. PMID:26272562

  14. Complete genome sequence of Bacillus amyloliquefaciens strain Co1-6, a plant growth-promoting rhizobacterium of Calendula officinalis


    Köberl, Martina; White, Richard A.; Erschen, Sabine; Spanberger, Nora; El-Arabi, Tarek F.; Jansson, Janet K.; Berg, Gabriele


    The genome sequence of Bacillus amyloliquefaciens strain Co1-6, a plant growth-promoting rhizobacterium (PGPR) with broad-spectrum antagonistic activity against plant-pathogenic fungi, bacteria, and nematodes, consists of a single 3.9-Mb circular chromosome. The genome reveals genes putatively responsible for its promising biocontrol and PGP properties.

  15. Draft Genome Sequence of Bacillus methylotrophicus FKM10, a Plant Growth-Promoting Rhizobacterium Isolated from Apple Rhizosphere

    PubMed Central

    Wang, Chengqiang; Hu, Xiuna; Liu, Kai; Hou, Qihui; Yang, Qianqian


    Bacillus methylotrophicus FKM10 is a strain of plant growth-promoting rhizobacterium with antimicrobial activity, which was isolated from apple rhizosphere. Here, we present the genome sequence of B. methylotrophicus FKM10. Two scaffolds were finally assembled, and several functional genes related to its antimicrobial activity were discovered. PMID:26868409

  16. Draft Genome Sequence of Brevibacillus brevis DZQ7, a Plant Growth-Promoting Rhizobacterium with Broad-Spectrum Antimicrobial Activity.


    Hou, Qihui; Wang, Chengqiang; Hou, Xiaoyang; Xia, Zhilin; Ye, Jiangping; Liu, Kai; Liu, Hu; Wang, Jun; Guo, Haimeng; Yu, Xiaoning; Yang, Yanan; Du, Binghai; Ding, Yanqin


    Brevibacillus brevis DZQ7 is a plant growth-promoting rhizobacterium (PGPR) isolated from tobacco rhizosphere. Here, we report the draft genome sequence of B. brevis DZQ7. Several functional genes related to antimicrobial activity were identified in the genome. PMID:26294619

  17. Draft Genome Sequence of Bacillus methylotrophicus FKM10, a Plant Growth-Promoting Rhizobacterium Isolated from Apple Rhizosphere.


    Wang, Chengqiang; Hu, Xiuna; Liu, Kai; Hou, Qihui; Yang, Qianqian; Ding, Yanqin; Du, Binghai


    Bacillus methylotrophicus FKM10 is a strain of plant growth-promoting rhizobacterium with antimicrobial activity, which was isolated from apple rhizosphere. Here, we present the genome sequence of B. methylotrophicus FKM10. Two scaffolds were finally assembled, and several functional genes related to its antimicrobial activity were discovered. PMID:26868409

  18. Complete Genome Sequence of Bacillus amyloliquefaciens Strain Co1-6, a Plant Growth-Promoting Rhizobacterium of Calendula officinalis.


    Köberl, Martina; White, Richard A; Erschen, Sabine; Spanberger, Nora; El-Arabi, Tarek F; Jansson, Janet K; Berg, Gabriele


    The genome sequence of Bacillus amyloliquefaciens strain Co1-6, a plant growth-promoting rhizobacterium (PGPR) with broad-spectrum antagonistic activity against plant-pathogenic fungi, bacteria, and nematodes, consists of a single 3.9-Mb circular chromosome. The genome reveals genes putatively responsible for its promising biocontrol and PGP properties. PMID:26272562

  19. Fusion genes and their discovery using high throughput sequencing.


    Annala, M J; Parker, B C; Zhang, W; Nykter, M


    Fusion genes are hybrid genes that combine parts of two or more original genes. They can form as a result of chromosomal rearrangements or abnormal transcription, and have been shown to act as drivers of malignant transformation and progression in many human cancers. The biological significance of fusion genes together with their specificity to cancer cells has made them into excellent targets for molecular therapy. Fusion genes are also used as diagnostic and prognostic markers to confirm cancer diagnosis and monitor response to molecular therapies. High-throughput sequencing has enabled the systematic discovery of fusion genes in a wide variety of cancer types. In this review, we describe the history of fusion genes in cancer and the ways in which fusion genes form and affect cellular function. We also describe computational methodologies for detecting fusion genes from high-throughput sequencing experiments, and the most common sources of error that lead to false discovery of fusion genes. PMID:23376639

  20. Regulation of the promoter of rat apolipoprotein A-I gene in cultured cells

    SciTech Connect

    Chao, Y.; Pan, T.; Wu, T.; Hao, Q.; Yamin, T.; Kroon, P.A.


    In order to study the regulation of the promoter of apolipoprotein (apo) A-I gene, they joined the 5' end of rat apo A-I gene (1.9 Kb) to the coding region of bacterial chloramphenicol acetyltransferase (CAT) gene. The chimeric gene produced high levels of CAT activity in both mouse L cells and Hep G2 cells in transient expression assays. Ethanol increased the levels of rat apo A-I promoter activity in both cells. However, dexamethasone increased rat apo A-I promoter activity only in Hep G2 cells. Similar results were obtained in stable expression cell lines. Nucleotide deletion experiments showed DNA sequences between -149 and -469 base pairs upstream from the rat apo A-I transcription site are required for the high level of expression and that the regulatory sequences are located further upstream. These data demonstrated that the 5' end of rat apo A-I gene contains sequences which are responsible for the regulation of apo A-I expression by ethanol and dexamethasone and that the expression and regulation of rat apo A-I promoter are cell specific.

  1. Identification of a novel first exon in the human dystrophin gene and of a new promoter located more than 500 kb upstream of the nearest known promoter

    SciTech Connect

    Yanagawa, H.; Nishio, H.; Takeshima, Y.


    The dystrophin gene, which is muted in patients with Duchenne and Becker muscular dystrophies, is the largest known human gene. Five alternative promoters have been characterized until now. Here we show that a novel dystrophin isoform with a different first exon can be produced through transcription initiation at a previously-unidentified alternative promoter. The case study presented is that of patient with Duchenne muscular dystrophy who had a deletion extending from 5{prime} end of the dystrophin gene to exon 2, including all promoters previously mapped in the 5{prime} part of the gene. Transcripts from lymphoblastoid cells were found to contain sequences corresponding to exon 3, indicating the presence of new promoter upstream of this exon. The nucleotide sequence of amplified cDNA corresponding to the 5{prime} end of the new transcript indicated that the 5{prime} end of exon 3 was extended by 9 codons, only the last (most 3{prime}) of which codes for methionine. The genomic nucleotide sequence upstream from the new exon, as determined using inverse polymerase chain reaction, revealed the presence of sequences similar to a TATA box, an octamer motif and an MEF-2 element. The identified promoter/exon did not map to intron 2, as might have been expected, but to a position more than 500 kb upstream of the most 5{prime} of the previously-identified promoters, thereby adding 500 kb to the dystrophin gene. The sequence of part of the new promoter region is very similar to that of certain medium reiteration frequency repetitive sequences. These findings may help us understand the molecular evolution of the dystrophin gene.

  2. A sequencing strategy for identifying variation throughout the prion gene of BSE-affected cattle

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Cattle prion gene (PRNP) polymorphisms have been associated with bovine spongiform encephalopathy (BSE) susceptibility. We developed a method for sequencing bovine PRNP through all exons, introns and part of the promoter (25.2 kb) that accounts for known variation. The method can be used to detect...

  3. Tuning Gene Expression in Yarrowia lipolytica by a Hybrid Promoter Approach▿†

    PubMed Central

    Blazeck, John; Liu, Leqian; Redden, Heidi; Alper, Hal


    The development of strong and tunable promoter elements is necessary to enable metabolic and pathway engineering applications for any host organism. Here, we have expanded and generalized a hybrid promoter approach to produce libraries of high-expressing, tunable promoters in the nonconventional yeast Yarrowia lipolytica. These synthetic promoters are comprised of two modular components: the enhancer element and the core promoter element. By exploiting this basic promoter architecture, we have overcome native expression limitations and provided a strategy for both increasing the native promoter capacity and producing libraries for tunable gene expression in a cellular system with ill-defined genetic tools. In doing so, this work has created the strongest promoters ever reported for Y. lipolytica. Furthermore, we have characterized these promoters at the single-cell level through the use of a developed fluorescence-based assay as well as at the transcriptional and whole-cell levels. The resulting promoter libraries exhibited a range of more than 400-fold in terms of mRNA levels, and the strongest promoters in this set had 8-fold-higher fluorescence levels than those of typically used endogenous promoters. These results suggest that promoters in Y. lipolytica are enhancer limited and that this limitation can be partially or fully alleviated through the addition of tandem copies of upstream activation sequences (UASs). Finally, this work illustrates that tandem copies of UAS regions can serve as synthetic transcriptional amplifiers that may be generically used to increase the expression levels of promoters. PMID:21926196

  4. Sequence-directed nucleosome-depletion is sufficient to activate transcription from a yeast core promoter in vivo.


    Ichikawa, Yuichi; Morohashi, Nobuyuki; Tomita, Nobuyuki; Mitchell, Aaron P; Kurumizaka, Hitoshi; Shimizu, Mitsuhiro


    Nucleosome-depleted regions (NDRs) (also called nucleosome-free regions or NFRs) are often found in the promoter regions of many yeast genes, and are formed by multiple mechanisms, including the binding of activators and enhancers, the actions of chromatin remodeling complexes, and the specific DNA sequences themselves. However, it remains unclear whether NDR formation per se is essential for transcriptional activation. Here, we examined the relationship between nucleosome organization and gene expression using a defined yeast reporter system, consisting of the CYC1 minimal core promoter and the lacZ gene. We introduced simple repeated sequences that should be either incorporated in nucleosomes or excluded from nucleosomes in the site upstream of the TATA boxes. The (CTG)12, (GAA)12 and (TGTAGG)6 inserts were incorporated into a positioned nucleosome in the core promoter region, and did not affect the reporter gene expression. In contrast, the insertion of (CGG)12, (TTAGGG)6, (A)34 or (CG)8 induced lacZ expression by 10-20 fold. Nucleosome mapping analyses revealed that the inserts that induced the reporter gene expression prevented nucleosome formation, and created an NDR upstream of the TATA boxes. Thus, our results demonstrated that NDR formation dictated by DNA sequences is sufficient for transcriptional activation from the core promoter in vivo. PMID:27208777

  5. Cloning and partial characterization of the mouse glutamine:fructose-6-phosphate amidotransferase (GFAT) gene promoter.

    PubMed Central

    Sayeski, P P; Wang, D; Su, K; Han, I O; Kudlow, J E


    Glutamine:fructose-6-phosphate amidotransferase (GFAT) is the enzyme that is rate limiting in the synthesis of glucosamine and hexosamines. Glucosamine has been proposed to contribute to the glucotoxicity of diabetes. Evidence that the gene encoding GFAT is transcriptionally regulated prompted us to clone and characterize its promoter. The position of the mouse GFAT promoter relative to the translational start site was located by primer extension and found to be 149 bp upstream of the translational start site. A 1.9 kb SacI fragment of the GFAT gene was found to contain the promoter and 88 bp of sequence downstream of the transcriptional start site. This promoter segment could drive expression of a luciferase reporter gene, could confer correct transcriptional initiation to the reporter and could confer the EGF-responsiveness previously observed in the native gene. The mouse GFAT promoter lacks a canonical TATA box and has several GC boxes within a highly GC-rich region. Deletional analysis of the promoter indicated that a proximal element extending to -120 relative to the transcriptional start site could confer reporter expression at a level of 57% of the 1.9 kb construct. Detailed analysis of this proximal region by DNase I footprinting, electrophoretic mobility shift assays and site-directed mutagenesis indicated that Sp1 binds to three elements in this proximal promoter segment and plays a vital role in regulation of transcription from this gene. PMID:9060444

  6. Sequence homologies in the protamine gene family of rainbow trout.

    PubMed Central

    Aiken, J M; McKenzie, D; Zhao, H Z; States, J C; Dixon, G H


    We have sequenced five different rainbow trout protamine genes plus their flanking regions. The genes are not clustered and do not contain intervening sequences. There is an extremely high degree of sequence conservation in the coding and 3' untranslated regions of the gene. Downstream sequences exhibit little homology though conserved regions are found 250 base pairs 3' to the gene. There are four regions upstream of the gene that are highly conserved in the six clones, including the canonical Goldberg - Hogness box which is 45 base pairs 5' to the coding region. A second homologous region is found 90 bases upstream. Although in the same approximate location as the CAAT box found upstream of other genes, it does not contain the canonical CAAT sequence. Further upstream of the protamine genes at -115 there is an A-T rich sequence while a 25 base pair conserved sequence is located 150 bases upstream. In addition we report the presence of a potential Z-DNA region of predominantly A-C repeats approximately one kilobase downstream of one of the genes. Images PMID:6308564

  7. Insect and wound induced GUS gene expression from a Beta vulgaris proteinase inhibitor gene promoter

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Inducible gene promoters that are specifically activated by pathogen invasion or insect pest attack are needed for effective expression of resistance genes to control plant diseases. In the present study, a promoter from a serine proteinase inhibitor gene (BvSTI) shown to be up-regulated in resist...

  8. Overlapping activator sequences determined for two oppositely oriented promoters in halophilic Archaea

    PubMed Central

    Bauer, Martina; Marschaus, Larissa; Reuff, Muriel; Besche, Verena; Sartorius-Neef, Simone; Pfeifer, Felicitas


    Transcription of the genomic region involved in gas vesicle formation in Halobacterium salinarum (p-vac) and Haloferax mediterranei (mc-vac) is driven by two divergent promoters, PA and PD, separated by only 35 nt. Both promoters are activated by the transcription activator GvpE which in the case of PmcA requires a 20-nt sequence (UAS) consisting of two conserved 8-nt sequence portions located upstream of BRE. Here, we determined the two UAS elements in the promoter region of p-vac by scanning mutageneses using constructs containing PpD (without PpA) fused to the bgaH reporter gene encoding an enzyme with β-galactosidase activity, or the dual reporter construct pApD with PpD fused to bgaH and PpA to an altered version of gvpA. The two UAS elements found exhibited a similar extension and distance to BRE as previously determined for the UAS in PmcA. Their distal 8-nt portions almost completely overlapped in the centre of PpD–PpA, and mutations in this region negatively affected the GvpE-mediated activation of both promoters. Any alteration of the distance between BRE and UAS resulted in the loss of the GvpE activation, as did a complete substitution of the proximal 8-nt portion, underlining that a close location of UAS and BRE was very important. PMID:18056077

  9. A viral satellite DNA vector-induced transcriptional gene silencing via DNA methylation of gene promoter in Nicotiana benthamiana.


    Ju, Zheng; Wang, Lei; Cao, Dongyan; Zuo, Jinhua; Zhu, Hongliang; Fu, Daqi; Luo, Yunbo; Zhu, Benzhong


    Virus-induced gene silencing (VIGS) has been widely used for plant functional genomics study at the post-transcriptional level using various DNA or RNA viral vectors. However, while virus-induced transcriptional gene silencing (VITGS) via DNA methylation of gene promoter was achieved using several plant RNA viral vectors, it has not yet been done using a satellite DNA viral vector. In this study, a viral satellite DNA associated with tomato yellow leaf curl China virus (TYLCCNV), which has been modified as a VIGS vector in previous research, was developed as a VITGS vector. Firstly, the viral satellite DNA VIGS vector was further optimized to a more convenient p1.7A+2mβ vector with high silencing efficiency of the phytoene desaturase (PDS) gene in Nicotiana benthamiana plants. Secondly, the constructed VITGS vector (TYLCCNV:35S), which carried a portion of the cauliflower mosaic virus 35S promoter, could successfully induce heritable transcriptional gene silencing (TGS) of the green fluorescent protein (GFP) gene in the 35S-GFP transgenic N. benthamiana line 16c plants. Moreover, bisulfite sequencing results revealed higher methylated cytosine residues at CG, CHG and CHH sites of the 35S promoter sequence in TYLCCNV:35S-inoculated plants than in TYLCCNV-inoculated line 16c plants (control). Overall, these results demonstrated that the viral satellite DNA vector could be used as an effective VITGS vector to study DNA methylation in plant genomes. PMID:27422476

  10. Structural analysis and promoter characterization of the human collagenase-3 gene (MMP13)

    SciTech Connect

    Pendas, A.M.; Balbin, M.; Llano, E.


    Human collagenase-3 (MMP13) is a recently identified member of the matrix metalloproteinase (MMP) family that is expressed in breast carcinomas and in articular cartilage from arthritic patients. In this work we have isolated and characterized genomic clones coding for human collagenase-3. This gene is composed of 10 exons and 9 introns and spans over 12.5 kb. The overall organization of the collagenase-3 gene is similar to that of other MMP genes clustered at chromosome 11q22, including fibroblast collagenase (MMP-1), matrilysin (MMP-7), and macrophage metalloelastase (MMP-12), but is more distantly related to genes coding for stromelysin-3 (MMP-11), gelatinase-A (MMP-2), and gelatinase-B (MMP-9), which map outside of this gene cluster. Nucleotide sequence analysis of about 1 kb of the 5{prime}-flanking region of the collagenase-3 gene revealed the presence of a TATA box, an AP-1 motif, a PEA-3 consensus sequence, an osteoblast specific element (OSE-2), and a TGF-{beta} inhibitory element. Transient transfection experiments in HeLa and COS-1 cells with chloramphenicol acetyltransferase (CAT)-containing constructs showed that the AP-1 site is functional and responsible for the observed inducibility of the reporter gene by the tumor promoter 12-O-tetradecanoylphorbol-13-acetate (TPA). However, and in contrast to other MMP genes, no significative synergistic effect on CAT activity between the AP-1 and PEA-3 elements found in the collagenase-3 gene promoter was found. DNA binding analysis with nuclear extracts from HeLa cells revealed the formation of specific complexes between collagenase-3 promoter sequences containing the AP-1 site and nuclear proteins. The presence of this AP-1 functional site, which is able to confer responsiveness to a variety of tumor promoters and oncogene products, may contribute to explaining the high-level expression of collagenase-3 in breast carcinomas and degenerative joint diseases. 48 refs., 5 figs., 2 tabs.

  11. Optimization of gene sequences under constant mutational pressure and selection

    NASA Astrophysics Data System (ADS)

    Kowalczuk, M.; Gierlik, A.; Mackiewicz, P.; Cebrat, S.; Dudek, M. R.


    We have analyzed the influence of constant mutational pressure and selection on the nucleotide composition of DNA sequences of various size, which were represented by the genes of the Borrelia burgdorferi genome. With the help of MC simulations we have found that longer DNA sequences accumulate much less base substitutions per sequence length than short sequences. This leads us to the conclusion that the accuracy of replication may determine the size of genome.

  12. Nucleotide sequence of SHV-2 beta-lactamase gene

    SciTech Connect

    Garbarg-Chenon, A.; Godard, V.; Labia, R.; Nicolas, J.C. )


    The nucleotide sequence of plasmid-mediated beta-lactamase SHV-2 from Salmonella typhimurium (SHV-2pHT1) was determined. The gene was very similar to chromosomally encoded beta-lactamase LEN-1 of Klebsiella pneumoniae. Compared with the sequence of the Escherichia coli SHV-2 enzyme (SHV-2E.coli) obtained by protein sequencing, the deduced amino acid sequence of SHV-2pHT1 differed by three amino acid substitutions.

  13. Alu sequence involvement in transcriptional insulation of the keratin 18 gene in transgenic mice.

    PubMed Central

    Thorey, I S; Ceceña, G; Reynolds, W; Oshima, R G


    The human keratin 18 (K18) gene is expressed in a variety of adult simple epithelial tissues, including liver, intestine, lung, and kidney, but is not normally found in skin, muscle, heart, spleen, or most of the brain. Transgenic animals derived from the cloned K18 gene express the transgene in appropriate tissues at levels directly proportional to the copy number and independently of the sites of integration. We have investigated in transgenic mice the dependence of K18 gene expression on the distal 5' and 3' flanking sequences and upon the RNA polymerase III promoter of an Alu repetitive DNA transcription unit immediately upstream of the K18 promoter. Integration site-independent expression of tandemly duplicated K18 transgenes requires the presence of either an 825-bp fragment of the 5' flanking sequence or the 3.5-kb 3' flanking sequence. Mutation of the RNA polymerase III promoter of the Alu element within the 825-bp fragment abolishes copy number-dependent expression in kidney but does not abolish integration site-independent expression when assayed in the absence of the 3' flanking sequence of the K18 gene. The characteristics of integration site-independent expression and copy number-dependent expression are separable. In addition, the formation of the chromatin state of the K18 gene, which likely restricts the tissue-specific expression of this gene, is not dependent upon the distal flanking sequences of the 10-kb K18 gene but rather may depend on internal regulatory regions of the gene. Images PMID:7692231

  14. DNA sequence and expression of the 36-kilodalton outer membrane protein gene of Brucella abortus.

    PubMed Central

    Ficht, T A; Bearden, S W; Sowa, B A; Adams, L G


    The cloning of the gene(s) encoding a 36-kilodalton (kDa) cell envelope protein of Brucella abortus has been previously described (T. A. Ficht, S. W. Bearden, B. A. Sowa, and L. G. Adams, Infect, Immun. 56:2036-2046, 1988). In an attempt to define the nature of the previously described duplication at this locus we have sequenced 3,500 base pairs of genomic DNA encompassing this region. The duplication represented two similar open reading frames which shared more than 85% homology at the nucleotide level but differed primarily because of the absence of 108 nucleotides from one of the two gene copies. These two genes were read from opposite strands and potentially encoded proteins which are 96% homologous. The predicted gene products were identical over the first 100 amino acids, including 22-amino-acid-long signal sequences. The amino acid composition of the predicted proteins was similar to that obtained for the Brucella porin isolated by Verstreate et al. (D. R. Verstreate, M. T. Creasy, N. T. Caveney, C. L. Baldwin, M. W. Blab, and A. J. Winter, Infect. Immun. 35:979-989, 1982) and presumably represented two copies of the porin gene, tentatively identified as omp 2a (silent) and omp 2b (expressed). The homology between the two genes extended to and included Shine-Dalgarno sequences 7 base pairs upstream from the ATG start codons. Homology at the 3' ends extended only as far as the termination codon, but both genes had putative rho-independent transcription termination sites. Localization of the promoters proved more difficult, since the canonical procaryotic sequences could not be identified in the region upstream of either gene. Promoter activity was demonstrated by ligation to a promoterless lacZ gene in pMC1871. However, only one active promoter could be identified by using this system. A 36-kDa protein was synthesized in E. coli with the promoter in the native orientation and was identical in size to the protein produced in laboratory-grown B. abortus. When

  15. Characterization of the promoter, signal sequence, and amino terminus of a secreted beta-galactosidase from "Streptomyces lividans".

    PubMed Central

    Eckhardt, T; Strickler, J; Gorniak, L; Burnett, W V; Fare, L R


    The gene for a secreted 130-kilodalton beta-galactosidase from "Streptomyces lividans" has been cloned, its promoter, signal sequence, and amino terminal region have been localized, and their nucleotide sequence has been determined. The signal sequence extends over 56 amino acids and shows the characteristic-features of signal sequences, including a hydrophilic amino terminus followed by a hydrophobic core near the signal cleavage site. The secretion of beta-galactosidase depends on the presence of the signal sequence. beta-Galactosidase is the major protein in culture supernatants and extracts of strains expressing the cloned beta-galactosidase gene and represents a valuable tool in the study of protein secretion in Streptomyces spp. Images PMID:2442141

  16. Genomic organization and 5{prime}-flanking DNA sequence of the murine stomatin gene (Epb72)

    SciTech Connect

    Gallagher, P.G.; Turetsky, T.; Mentzer, W.C.


    Stomatin is a poorly understood integral membrane protein that is absent from the erythrocyte membranes of many patients with hereditary stomatocytosis. This report describes the cloning of the murine stomatin chromosomal gene, determination of its genomic structure, and characterization of the 5{prime}-flanking genomic DNA sequences. The stomatin gene is encoded by seven exons spread over {approximately}25 kb of genomic DNA. There is no concordance between the exon structure of the stomatin gene and the locations of three domains predicted on the basis of protein structure. Inspection of the 5{prime}-flanking DNA sequences reveals features of a TATA-less housekeeping gene promoter and consensus sequences for a number of potential DNA-binding proteins. 12 refs., 2 figs., 1 tab.

  17. Characterization of the human p53 gene promoter

    SciTech Connect

    Tuck, S.P.; Crawford, L.


    Transcriptional deregulation of the p53 gene may play an important part in the genesis of some tumors. The authors report here an accurate determination of the transcriptional start sites of the human p53 gene and show that the majority of p53 mRNA molecules do not contain a postulated stem-loop structure at their 5' ends. Recombinant plasmids of the human p53 promoter-leader region fused to the bacterial chloramphenicol acetyltransferase gene (cat) were constructed. After transfection into rodent or human cells, a 350-base-pair fragment spanning the promoter region conferred 4% of the CAT activity mediated by the simian virus 40 early promoter/enhancer. They monitored the efficiency with which 15 3' and 5' promoter deletion constructs initiated transcription. Their results show that an 85-base-pair fragment, previously thought to have resided in exon 1, is that is required for full promoter activity.

  18. Hematopoietic gene promoters subjected to a group-combinatorial study of DNA samples: identification of a megakaryocytic selective DNA signature

    PubMed Central

    Hazony, Yehonathan; Lu, Jun; St. Hilaire, Cynthia; Ravid, Katya


    Identification of common sub-sequences for a group of functionally related DNA sequences can shed light on the role of such elements in cell-specific gene expression. In the megakaryocytic lineage, no one single unique transcription factor was described as linage specific, raising the possibility that a cluster of gene promoter sequences presents a unique signature. Here, the megakaryocytic gene promoter group, which consists of both human and mouse 5′ non-coding regions, served as a case study. A methodology for group-combinatorial search has been implemented as a customized software platform. It extracts the longest common sequences for a group of related DNA sequences and allows for single gaps of varying length, as well as double- and multiple-gap sequences. The results point to common DNA sequences in a group of genes that is selectively expressed in megakaryocytes, and which does not appear in a large group of control, random and specific sequences. This suggests a role for a combination of these sequences in cell-specific gene expression in the megakaryocytic lineage. The data also point to an intrinsic cross-species difference in the organization of 5′ non-coding sequences within the mammalian genomes. This methodology may be used for the identification of regulatory sequences in other lineages. PMID:16936310

  19. Classification of Arabidopsis thaliana gene sequences: clustering of coding sequences into two groups according to codon usage improves gene prediction.


    Mathé, C; Peresetsky, A; Déhais, P; Van Montagu, M; Rouzé, P


    While genomic sequences are accumulating, finding the location of the genes remains a major issue that can be solved only for about a half of them by homology searches. Prediction methods are thus required, but unfortunately are not fully satisfying. Most prediction methods implicitly assume a unique model for genes. This is an oversimplification as demonstrated by the possibility to group coding sequences into several classes in Escherichia coli and other genomes. As no classification existed for Arabidopsis thaliana, we classified genes according to the statistical features of their coding sequences. A clustering algorithm using a codon usage model was developed and applied to coding sequences from A. thaliana, E. coli, and a mixture of both. By using it, Arabidopsis sequences were clustered into two classes. The CU1 and CU2 classes differed essentially by the choice of pyrimidine bases at the codon silent sites: CU2 genes often use C whereas CU1 genes prefer T. This classification discriminated the Arabidopsis genes according to their expressiveness, highly expressed genes being clustered in CU2 and genes expected to have a lower expression, such as the regulatory genes, in CU1. The algorithm separated the sequences of the Escherichia-Arabidopsis mixed data set into five classes according to the species, except for one class. This mixed class contained 89 % Arabidopsis genes from CU1 and 11 % E. coli genes, mostly horizontally transferred. Interestingly, most genes encoding organelle-targeted proteins, except the photosynthetic and photoassimilatory ones, were clustered in CU1. By tailoring the GeneMark CDS prediction algorithm to the observed coding sequence classes, its quality of prediction was greatly improved. Similar improvement can be expected with other prediction systems. PMID:9925779

  20. Precise nucleosome positioning in the promoter of the chicken beta A globin gene.


    Kefalas, P; Gray, F C; Allan, J


    Histone octamers were reconstituted onto 5' end-labelled DNA fragments derived from the promoter region of the chicken beta A globin gene. The location of the reconstituted histone octamer with respect to the DNA sequence of each fragment was assessed by Exonuclease III digestion of purified nucleosome monomers. By this approach we have found a strong preference for histone octamers to be positioned over nucleotides -206 to -62 relative to the gene cap site. This stretch of DNA contains all those 5' beta globin sequences which, by DNase footprinting, bind specific protein factors and incorporates three promoter consensus sequence motifs. The upstream terminal 32 base pairs of this DNA segment contains the binding sites for the erythrocyte specific G-string binding protein and transcription factor Spl and appears to be relatively weakly bound to the histone octamer. PMID:3340546

  1. Precise nucleosome positioning in the promoter of the chicken beta A globin gene.

    PubMed Central

    Kefalas, P; Gray, F C; Allan, J


    Histone octamers were reconstituted onto 5' end-labelled DNA fragments derived from the promoter region of the chicken beta A globin gene. The location of the reconstituted histone octamer with respect to the DNA sequence of each fragment was assessed by Exonuclease III digestion of purified nucleosome monomers. By this approach we have found a strong preference for histone octamers to be positioned over nucleotides -206 to -62 relative to the gene cap site. This stretch of DNA contains all those 5' beta globin sequences which, by DNase footprinting, bind specific protein factors and incorporates three promoter consensus sequence motifs. The upstream terminal 32 base pairs of this DNA segment contains the binding sites for the erythrocyte specific G-string binding protein and transcription factor Spl and appears to be relatively weakly bound to the histone octamer. Images PMID:3340546

  2. Single molecule targeted sequencing for cancer gene mutation detection.


    Gao, Yan; Deng, Liwei; Yan, Qin; Gao, Yongqian; Wu, Zengding; Cai, Jinsen; Ji, Daorui; Li, Gailing; Wu, Ping; Jin, Huan; Zhao, Luyang; Liu, Song; Ge, Liangjin; Deem, Michael W; He, Jiankui


    With the rapid decline in cost of sequencing, it is now affordable to examine multiple genes in a single disease-targeted clinical test using next generation sequencing. Current targeted sequencing methods require a separate step of targeted capture enrichment during sample preparation before sequencing. Although there are fast sample preparation methods available in market, the library preparation process is still relatively complicated for physicians to use routinely. Here, we introduced an amplification-free Single Molecule Targeted Sequencing (SMTS) technology, which combined targeted capture and sequencing in one step. We demonstrated that this technology can detect low-frequency mutations using artificially synthesized DNA sample. SMTS has several potential advantages, including simple sample preparation thus no biases and errors are introduced by PCR reaction. SMTS has the potential to be an easy and quick sequencing technology for clinical diagnosis such as cancer gene mutation detection, infectious disease detection, inherited condition screening and noninvasive prenatal diagnosis. PMID:27193446

  3. Single molecule targeted sequencing for cancer gene mutation detection

    PubMed Central

    Gao, Yan; Deng, Liwei; Yan, Qin; Gao, Yongqian; Wu, Zengding; Cai, Jinsen; Ji, Daorui; Li, Gailing; Wu, Ping; Jin, Huan; Zhao, Luyang; Liu, Song; Ge, Liangjin; Deem, Michael W.; He, Jiankui


    With the rapid decline in cost of sequencing, it is now affordable to examine multiple genes in a single disease-targeted clinical test using next generation sequencing. Current targeted sequencing methods require a separate step of targeted capture enrichment during sample preparation before sequencing. Although there are fast sample preparation methods available in market, the library preparation process is still relatively complicated for physicians to use routinely. Here, we introduced an amplification-free Single Molecule Targeted Sequencing (SMTS) technology, which combined targeted capture and sequencing in one step. We demonstrated that this technology can detect low-frequency mutations using artificially synthesized DNA sample. SMTS has several potential advantages, including simple sample preparation thus no biases and errors are introduced by PCR reaction. SMTS has the potential to be an easy and quick sequencing technology for clinical diagnosis such as cancer gene mutation detection, infectious disease detection, inherited condition screening and noninvasive prenatal diagnosis. PMID:27193446

  4. Efficiency of ligation-mediated PCR and TAIL-PCR methods for isolation of RbcS promoter sequences from green microalgae Ankistrodesmus convolutus.


    Thanh, Tran; Chi, Vu Thi Quynh; Abdullah, Mohd Puad; Omar, Hishamuddin; Napis, Suhaimi


    Isolation of promoter sequences from known gene sequences is a tedious task in genome-related research. An efficient method of obtaining the promoter sequences is necessary in order to successfully use targeted promoters for genetic manipulations. Here, efficiency and usefulness of two PCR-based methods, namely: ligation-mediated PCR and thermal asymmetric interlaced (TAIL) PCR, for isolation of promoter sequences of the ribulose-1,5-bisphosphate carboxylase/oxygenase small subunit (RbcS) gene from green microalgae Ankistrodesmus convolutus (A. convolutus) were evaluated. The results showed that the amplification efficiency of TAIL-PCR was higher than that of the ligation-mediated PCR method, i.e. the amplified promoter fragments of 1.2 and 0.8 kb in length or promoter sequences of 813 and 606 bp (after eliminating the unreadable sequences). The use of TAIL-PCR described here presents a low cost and efficient strategy for the isolation of promoter sequences of known genes, especially in GC-rich regions, and species with little or no available genome information such as A. convolutus. PMID:22642102

  5. Different promoter affinities account for specificity in MYC-dependent gene regulation

    PubMed Central

    Lorenzin, Francesca; Benary, Uwe; Baluapuri, Apoorva; Walz, Susanne; Jung, Lisa Anna; von Eyss, Björn; Kisker, Caroline; Wolf, Jana; Eilers, Martin; Wolf, Elmar


    Enhanced expression of the MYC transcription factor is observed in the majority of tumors. Two seemingly conflicting models have been proposed for its function: one proposes that MYC enhances expression of all genes, while the other model suggests gene-specific regulation. Here, we have explored the hypothesis that specific gene expression profiles arise since promoters differ in affinity for MYC and high-affinity promoters are fully occupied by physiological levels of MYC. We determined cellular MYC levels and used RNA- and ChIP-sequencing to correlate promoter occupancy with gene expression at different concentrations of MYC. Mathematical modeling showed that binding affinities for interactions of MYC with DNA and with core promoter-bound factors, such as WDR5, are sufficient to explain promoter occupancies observed in vivo. Importantly, promoter affinity stratifies different biological processes that are regulated by MYC, explaining why tumor-specific MYC levels induce specific gene expression programs and alter defined biological properties of cells. DOI: PMID:27460974

  6. Genetic analysis of the TBX3 gene promoter in ventricular septal defects.


    Chen, Dongfeng; Qiao, Yanli; Meng, Haihong; Pang, Shuchao; Huang, Wenhui; Zhang, Hongyu; Yan, Bo


    Congenital heart disease (CHD) is the most common birth defect in humans. Genetic causes and underlying molecular mechanisms for CHD remain largely unknown. T-box transcription factor 3 (TBX3) plays a critical role in the developing heart in a dose-dependent manner. TBX3 represses chamber myocardial gene expression. Mutations in TBX3 gene have been associated to ulnar-mammary syndrome with multiple developmental defects, including cardiac defects. We hypothesized that the sequence variants within TBX3 gene promoter that change TBX3 levels may mediate CHD development. In this study, TBX3 gene promoter was genetically analyzed in large cohorts of patients with ventricular septal defect (VSD) (n=325) and ethnic-matched healthy controls (n=359). Seven sequence variants, including two single-nucleotide polymorphisms (g.3863 C>T and g.4095G>T), three novel deletions (g.4433_4435del, g.4672_4675del and g.4820_4821del) and two novel insertions (g.3913_3914ins and g.4735_4736ins), were identified. Five of the seven variants were identified in VSD patients and controls with similar frequencies. Two other variants were found only in controls. These variants, which were observed in high frequencies, did not modify or interrupt the critical binding site for basic transcription factors. Taken together, these results suggested that the sequence variants within the TBX3 gene promoter did not contribute to VSD etiology. PMID:23116943

  7. Functional elements of the promoter region of the Aspergillus oryzae glaA gene encoding glucoamylase.


    Hata, Y; Kitamoto, K; Gomi, K; Kumagai, C; Tamura, G


    Analysis was made of the promoter region of the Aspergillus oryzae glaA gene encoding glucoamylase. Northern blots using a glucoamylase cDNA as a probe indicated that the amount of mRNA corresponding to the glaA gene increased when expression was induced by starch or maltose. The promoter region of the glaA gene was fused to the Escherichia coli uidA gene, encoding beta-glucuronidase (GUS), and the resultant plasmid was introduced into A. oryzae. Expression of GUS protein in the A. oryzae transformants was induced by maltose, indicating that the glaA-GUS gene was regulated at the level of transcription in the presence of maltose. The nucleotide sequence 1.1 kb upstream of the glaA coding region was determined. A comparison of the nucleotide sequence of the A. oryzae glaA promoter with those of A. oryzae amyB, encoding alpha-amylase, and A. niger glaA showed two regions with similar sequences. Deletion and site-specific mutation analysis of these homologous regions indicated that both are essential for direct high-level expression when grown on maltose. PMID:1339327

  8. Cloning, sequence, and expression of a lipase gene from Pseudomonas cepacia: lipase production in heterologous hosts requires two Pseudomonas genes.

    PubMed Central

    Jørgensen, S; Skov, K W; Diderichsen, B


    The lipA gene encoding an extracellular lipase from Pseudomonas cepacia was cloned and sequenced. Downstream from the lipase gene an open reading frame was identified, and the corresponding gene was named limA. lipA was well expressed only in the presence of limA. limA exerts its effect both in cis and in trans and therefore produces a diffusible gene product, presumably a protein of 344 amino acids. Replacement of the lipA expression signals (promoter, ribosome-binding site, and signal peptide-coding sequences) by heterologous signals from gram-positive bacteria still resulted in limA-dependent lipA expression in Escherichia coli, Bacillus subtilis, and Streptomyces lividans. Images PMID:1987151

  9. The regulation of the Oct-1 gene transcription is mediated by two promoters.


    Pankratova, Elizaveta V; Sytina, Elena V; Luchina, Nadejda N; Krivega, Ivan V


    The ubiquitous transcription factor Oct-1 is a member of the POU domain family of regulatory proteins. Target genes controlled by Oct-1 include housekeeping genes, e.g. the genes encoding histon H2B or snRNAs, as well as tissue-specific genes, e.g. the genes encoding the light and heavy chains of immunoglobulines, some interleukins, and others. Oct-1 pre-mRNA may be spliced in several ways, resulting in production of several protein isoforms that may differ functionally. The 5'-end of the Oct-1 gene contains two exons-exon 1U and exon 1L that alternatively present in Oct-1 mRNA. We studied regulation of transcription of the Oct-1 gene using reporter gene assays of promoter-luciferase gene-constructs. It was shown that transcription of the Oct-1 gene is regulated by two promoters located upstream of the exon 1U and upstream of the exon 1L. The promoter located upstream of the exon 1U contains G/C-rich sequences and multiple Sp1 sites, while the promoter located upstream of the exon 1L contains A/T-rich motifs and autoregulation-related cis-elements: two octamer sites ATGCAAAT, two octamer related sites and multiple TAAT-core sites. Exons 1U and 1L in the human OTF-1 locus encoding the Oct-1 gene are located at the distance of 108 kbp. In the murine locus otf-1 the distance between exons 1U and 1L is 67 kbp. We suggest that the two promoters can differ functionally. PMID:12853155

  10. Degenerative primer design and gene sequencing validation for select turkey genes.


    Hutsko, Stephanie L; Lilburn, Michael S; Wick, Macdonald


    We successfully designed and validated degenerative primers for turkey genes MUC2, RPS13, TBP and TFF2 based on chicken sequences in order to use gene transcription analysis to evaluate (quantify) the mucin transcription to probiotic supplementation in turkeys. Primers were designed for the genes MUC2, TFF2, RPS13 and TBP using a degenerative primer design method based on the available Gallus gallus sequences. All primer sets, which produced a single PCR amplicon of the expected sizes, were cloned into the TOPO(®) vector and then transformed into TOP 10(®) competent cells. Plasmid DNA isolation was performed on the TOP10(®) cell culture and sent for sequencing. Sequences were analyzed using NCBI BLAST. All genes sequenced had over 90% homology with both the chicken and predicted turkey sequences. The sequences were used to design new 100% homologous primer sets for the genes of interest. PMID:27053625

  11. Genome Sequence of the Plant Growth Promoting Endophytic Bacterium Enterobacter sp. 638

    PubMed Central

    Taghavi, Safiyh; van der Lelie, Daniel; Hoffman, Adam; Zhang, Yian-Biao; Walla, Michael D.; Vangronsveld, Jaco; Newman, Lee; Monchy, Sébastien


    Enterobacter sp. 638 is an endophytic plant growth promoting gamma-proteobacterium that was isolated from the stem of poplar (Populus trichocarpa×deltoides cv. H11-11), a potentially important biofuel feed stock plant. The Enterobacter sp. 638 genome sequence reveals the presence of a 4,518,712 bp chromosome and a 157,749 bp plasmid (pENT638-1). Genome annotation and comparative genomics allowed the identification of an extended set of genes specific to the plant niche adaptation of this bacterium. This includes genes that code for putative proteins involved in survival in the rhizosphere (to cope with oxidative stress or uptake of nutrients released by plant roots), root adhesion (pili, adhesion, hemagglutinin, cellulose biosynthesis), colonization/establishment inside the plant (chemiotaxis, flagella, cellobiose phosphorylase), plant protection against fungal and bacterial infections (siderophore production and synthesis of the antimicrobial compounds 4-hydroxybenzoate and 2-phenylethanol), and improved poplar growth and development through the production of the phytohormones indole acetic acid, acetoin, and 2,3-butanediol. Metabolite analysis confirmed by quantitative RT–PCR showed that, the production of acetoin and 2,3-butanediol is induced by the presence of sucrose in the growth medium. Interestingly, both the genetic determinants required for sucrose metabolism and the synthesis of acetoin and 2,3-butanediol are clustered on a genomic island. These findings point to a close interaction between Enterobacter sp. 638 and its poplar host, where the availability of sucrose, a major plant sugar, affects the synthesis of plant growth promoting phytohormones by the endophytic bacterium. The availability of the genome sequence, combined with metabolome and transcriptome analysis, will provide a better understanding of the synergistic interactions between poplar and its growth promoting endophyte Enterobacter sp. 638. This information can be further exploited to

  12. Nucleotide sequence and expression of the gene encoding the EcoRII modification enzyme.

    PubMed Central

    Som, S; Bhagwat, A S; Friedman, S


    The gene coding for the EcoRII modification enzyme has been cloned and the nucleotide sequence of 1933 base pairs containing the gene has been determined. The gene codes for a protein of 477 amino acids. Two transcriptional start sites have been mapped by S1 mapping. One deletion that removes 34 N-terminal amino acids was found to have partial enzyme activity. Comparison of the EcoRII methylase sequence with other cytosine methylases revealed several domains of partial homology among all cytosine methylases. Cloning the gene in multicopy pUC vectors increased the expression by 6-18 fold. A 40 fold overproduction of the EcoRII methylase was obtained by cloning the gene in the expression vector carrying the lambda PL promoter. Images PMID:3029675

  13. Conserved cis-regulatory modules in promoters of genes encoding wheat high-molecular-weight glutenin subunits

    PubMed Central

    Ravel, Catherine; Fiquet, Samuel; Boudet, Julie; Dardevet, Mireille; Vincent, Jonathan; Merlino, Marielle; Michard, Robin; Martre, Pierre


    The concentration and composition of the gliadin and glutenin seed storage proteins (SSPs) in wheat flour are the most important determinants of its end-use value. In cereals, the synthesis of SSPs is predominantly regulated at the transcriptional level by a complex network involving at least five cis-elements in gene promoters. The high-molecular-weight glutenin subunits (HMW-GS) are encoded by two tightly linked genes located on the long arms of group 1 chromosomes. Here, we sequenced and annotated the HMW-GS gene promoters of 22 electrophoretic wheat alleles to identify putative cis-regulatory motifs. We focused on 24 motifs known to be involved in SSP gene regulation. Most of them were identified in at least one HMW-GS gene promoter sequence. A common regulatory framework was observed in all the HMW-GS gene promoters, as they shared conserved cis-regulatory modules (CCRMs) including all the five motifs known to regulate the transcription of SSP genes. This common regulatory framework comprises a composite box made of the GATA motifs and GCN4-like Motifs (GLMs) and was shown to be functional as the GLMs are able to bind a bZIP transcriptional factor SPA (Storage Protein Activator). In addition to this regulatory framework, each HMW-GS gene promoter had additional motifs organized differently. The promoters of most highly expressed x-type HMW-GS genes contain an additional box predicted to bind R2R3-MYB transcriptional factors. However, the differences in annotation between promoter alleles could not be related to their level of expression. In summary, we identified a common modular organization of HMW-GS gene promoters but the lack of correlation between the cis-motifs of each HMW-GS gene promoter and their level of expression suggests that other cis-elements or other mechanisms regulate HMW-GS gene expression. PMID:25429295

  14. A novel DNA replication origin identified in the human heat shock protein 70 gene promoter.

    PubMed Central

    Taira, T; Iguchi-Ariga, S M; Ariga, H


    A general and sensitive method for the mapping of initiation sites of DNA replication in vivo, developed by Vassilev and Johnson, has revealed replication origins in the region of simian virus 40 ori, in the regions upstream from the human c-myc gene and downstream from the Chinese hamster dihydrofolate reductase gene, and in the enhancer region of the mouse immunoglobulin heavy-chain gene. Here we report that the region containing the promoter of the human heat shock protein 70 (hsp70) gene was identified as a DNA replication origin in HeLa cells by this method. Several segments of the region were cloned into pUC19 and examined for autonomously replicating sequence (ARS) activity. The plasmids carrying the segments replicated episomally and semiconservatively when transfected into HeLa cells. The segments of ARS activity contained the sequences previously identified as binding sequences for a c-myc protein complex (T. Taira, Y. Negishi, F. Kihara, S. M. M. Iguchi-Ariga, and H. Ariga, Biochem. Biophys. Acta 1130:166-174, 1992). Mutations introduced within the c-myc protein complex binding sequences abolished the ARS activity. Moreover, the ARS plasmids stably replicated at episomal state for a long time in established cell lines. The results suggest that the promoter region of the human hsp70 gene plays a role in DNA replication as well as in transcription. Images PMID:8065368

  15. Modular organization and development activity of an Arabidopsis thaliana EF-1 alpha gene promoter.


    Curie, C; Axelos, M; Bardet, C; Atanassova, R; Chaubet, N; Lescure, B


    The activity of the Arabidopsis thalana A1 EF-1 alpha gene promoter was analyzed in transgenic Arabidopsis plants. The 5' upstream sequence of the A1 gene and several promoter deletions were fused to the beta-glucuronidase (GUS) coding region. Promoter activity was monitored by quantitative and histochemical assays of GUS activity. The results show that the A1 promoter exhibits a modular organization. Sequences both upstream and downstream relative to the transcription initiation site are involved in quantitative and tissue-specific expression during vegetative growth. One upstream element may be involved in the activation of expression in meristematic tissues; the downstream region, corresponding to an intron within the 5' non-coding region (5'IVS), is important for expression in roots; both upstream and downstream sequences are required for expression in leaves, suggesting combinatorial properties of EF-1 alpha cis-regulatory elements. This notion of specific combinatorial regulation is reinforced by the results of transient expression experiments in transfected Arabidopsis protoplasts. The deletion of the 5'IVS has much more effect on expression when the promoter activity is under the control of A1 EF-1 alpha upstream sequences than when these upstream sequences were replaced by the 35S enhancer. Similarly, a synthetic oligonucleotide corresponding to an A1 EF-1 alpha upstream cis-acting element (the TEF1 box), is able to restore partially the original activity when fused to a TEF1-less EF1-alpha promoter but has no significant effect when fused to an enhancer-less 35S promoter. PMID:8492811

  16. Nucleotide sequence of the regulatory locus controlling expression of bacterial genes for bioluminescence.

    PubMed Central

    Engebrecht, J; Silverman, M


    Production of light by the marine bacterium Vibrio fischeri and by recombinant hosts containing cloned lux genes is controlled by the density of the culture. Density-dependent regulation of lux gene expression has been shown to require a locus consisting of the luxR and luxI genes and two closely linked divergent promoters. As part of a genetic analysis to understand the regulation of bioluminescence, we have sequenced the region of DNA containing this control circuit. Open reading frames corresponding to luxR and luxI were identified; transcription start sites were defined by S1 nuclease mapping and sequences resembling promoter elements were located. Images PMID:3697093

  17. Methylation Status of Vitamin D Receptor Gene Promoter in Benign and Malignant Adrenal Tumors

    PubMed Central

    Pilon, Catia; Rebellato, Andrea; Urbanet, Riccardo; Guzzardo, Vincenza; Cappellesso, Rocco; Sasano, Hironobu; Fassina, Ambrogio


    We previously showed a decreased expression of vitamin D receptor (VDR) mRNA/protein in a small group of adrenocortical carcinoma (ACC) tissues, suggesting the loss of a protective role of VDR against malignant cell growth in this cancer type. Downregulation of VDR gene expression may result from epigenetics events, that is, methylation of cytosine nucleotide of CpG islands in VDR gene promoter. We analyzed methylation of CpG sites in the VDR gene promoter in normal adrenals and adrenocortical tumor samples. Methylation of CpG-rich 5′ regions was assessed by bisulfite sequencing PCR using bisulfite-treated DNA from archival microdissected paraffin-embedded adrenocortical tissues. Three normal adrenals and 23 various adrenocortical tumor samples (15 adenomas and 8 carcinomas) were studied. Methylation in the promoter region of VDR gene was found in 3/8 ACCs, while no VDR gene methylation was observed in normal adrenals and adrenocortical adenomas. VDR mRNA and protein levels were lower in ACCs than in benign tumors, and VDR immunostaining was weak or negative in ACCs, including all 3 methylated tissue samples. The association between VDR gene promoter methylation and reduced VDR gene expression is not a rare event in ACC, suggesting that VDR epigenetic inactivation may have a role in adrenocortical carcinogenesis. PMID:26843863

  18. Aleurone nuclear proteins bind to similar elements in the promoter regions of two gibberellin-regulated alpha-amylase genes.


    Rushton, P J; Hooley, R; Lazarus, C M


    Binding of nuclear proteins from wild oat aleurone protoplasts to the promoter regions of two gibberellin-regulated wheat alpha-amylase genes (alpha-Amy1/18 and alpha-Amy2/54) has been studied by gel retardation and DNase 1 footprinting. Gel retardation studies using 300-430 bp fragments of the promoters showed similar binding characteristics with nuclear extracts from both gibberellin A1-treated and untreated protoplasts. DNase 1 footprints localised binding of nuclear proteins from gibberellin A1-treated aleurone protoplasts to regions in both promoters. Similar sequence elements in the promoter regions of both genes were protected from digestion although the location and number of footprints in each promoter region were different. Each footprint contained either a sequence similar to the cAMP and/or phorbol ester response elements, or a hyphenated palindrome sequence. The presence of cAMP and/or phorbol ester response element-like sequences in the footprints suggests that transcription factors of the bZIP type may be involved in the expression of alpha-amylase genes in aleurone cells. Footprints containing hyphenated palindrome sequences, found in the promoter regions of both genes, suggest the possible involvement of other classes of transcription factor. The conserved alpha-amylase promoter sequence TAA-CAGA was also shown to bind nuclear protein in the alpha-Amy2/54 promoter. These observations are discussed in relation to alpha-amylase gene expression in aleurone and to functional data concerning these genes. PMID:1511135

  19. rpoB Gene Sequencing for Identification of Corynebacterium Species

    PubMed Central

    Khamis, Atieh; Raoult, Didier; La Scola, Bernard


    The genus Corynebacterium is a heterogeneous group of species comprising human and animal pathogens and environmental bacteria. It is defined on the basis of several phenotypic characters and the results of DNA-DNA relatedness and, more recently, 16S rRNA gene sequencing. However, the 16S rRNA gene is not polymorphic enough to ensure reliable phylogenetic studies and needs to be completely sequenced for accurate identification. The almost complete rpoB sequences of 56 Corynebacterium species were determined by both PCR and genome walking methods. In all cases the percent similarities between different species were lower than those observed by 16S rRNA gene sequencing, even for those species with degrees of high similarity. Several clusters supported by high bootstrap values were identified. In order to propose a method for strain identification which does not require sequencing of the complete rpoB sequence (approximately 3,500 bp), we identified an area with a high degree of polymorphism, bordered by conserved sequences that can be used as universal primers for PCR amplification and sequencing. The sequence of this fragment (434 to 452 bp) allows accurate species identification and may be used in the future for routine sequence-based identification of Corynebacterium species. PMID:15364970

  20. GeneTack database: genes with frameshifts in prokaryotic genomes and eukaryotic mRNA sequences.


    Antonov, Ivan; Baranov, Pavel; Borodovsky, Mark


    Database annotations of prokaryotic genomes and eukaryotic mRNA sequences pay relatively low attention to frame transitions that disrupt protein-coding genes. Frame transitions (frameshifts) could be caused by sequencing errors or indel mutations inside protein-coding regions. Other observed frameshifts are related to recoding events (that evolved to control expression of some genes). Earlier, we have developed an algorithm and software program GeneTack for ab initio frameshift finding in intronless genes. Here, we describe a database (freely available at containing genes with frameshifts (fs-genes) predicted by GeneTack. The database includes 206 991 fs-genes from 1106 complete prokaryotic genomes and 45 295 frameshifts predicted in mRNA sequences from 100 eukaryotic genomes. The whole set of fs-genes was grouped into clusters based on sequence similarity between fs-proteins (conceptually translated fs-genes), conservation of the frameshift position and frameshift direction (-1, +1). The fs-genes can be retrieved by similarity search to a given query sequence via a web interface, by fs-gene cluster browsing, etc. Clusters of fs-genes are characterized with respect to their likely origin, such as pseudogenization, phase variation, etc. The largest clusters contain fs-genes with programed frameshifts (related to recoding events). PMID:23161689

  1. Promoter region of the human platelet-derived growth factor A-chain gene

    SciTech Connect

    Takimoto, Yasuo; Wang, Zhao Yi; Kobler, K.; Deuel, T.F. )


    The platelet-derived growth factor (PDGF) A- and B-chain genes are widely expressed in mammalian tissues and their homodimeric gene products appear to regulate the autocrine growth of both normal and transformed cells. In this study, we analyzed the 5{prime} flanking sequences of the human PDGF A-chain gene to seek elements important to regulating its transcription. The promoter reigon was exceptionally G + C-rich and contained a TATA box but no CAAT box. The transcription start site was identified 845 base pairs 5{prime} to the translation initiation site by S1 nuclease mapping and by primer extension. Both in vitro transcription and transient expression of the chloramphenicol acetyltransferase gene linked to the PDGF A-chain 5{prime} flanking sequences established that the putative promoter region was active, and RNase H mapping established that the three characteristic mRNAs used the same transcription start site, which was used in normal endothelial cells and in two human tumor cell lines that express high levels of A-chain transcripts. The results extablished an exceptionally G + C-rich promoter region and a single transcription start site active for each of the three mRNAs of the PDGF A-chain gene. DNA sites of potential importance in mediating the activation of the PDGF A-chain gene in normal cells and in transformed cell lines expressing high levels of PDGF A-chain were identified.

  2. Characterization of the promoter region of the gene for the rat neutral and basic amino acid transporter and chromosomal localization of the human gene.

    PubMed Central

    Yan, N; Mosckovitz, R; Gerber, L D; Mathew, S; Murty, V V; Tate, S S; Udenfriend, S


    The promoter region of the rat kidney neutral and basic amino acid transporter (NBAT) gene has been isolated and sequenced. The major transcription initiation site was mapped by primer extension. The entire promoter region and a set of 5' deletions within it were expressed at a high level in LLC-PK1 cells using the luciferase indicator gene. Positive and negative regulatory elements in the promoter region were observed. A human genomic clone of the transporter was also obtained and was used to localize the NBAT gene at the p21 region of chromosome 2. Images PMID:8052618

  3. Limited specificity of promoter constructs for gene therapy in osteosarcoma.


    Pollmann, Annika; Kabisch, Hartmut; Block, Andreas; Müller, Jürgen; Hellwinkel, Olaf J C


    Osteosarcoma (OS), a malignant bone neoplasia in childhood, has poor prognosis if metastases appear in the lung. A novel therapeutic approach could consist in a gene therapeutic treatment of OS metastases. However, if promiscuous viral vectors are applied for the delivery of potentially toxic transgenes, their misdelivery into normal tissues could cause severe complications. This problem could be circumvented by application of OS-specific promoters for transgene expression control. We analysed the function of promoters described to be tumour-, osteosarcoma- or osteoblast-specific. Expression rates driven by osteoblast- specific fragments from the collagen1A1-promoter, the human Osteocalcin-promoter, the bone-sialoprotein promoter and the beta-catenin promoter depending on vitamin supplementation were analysed in five OS cell lines, in normal lung fibroblasts and in a non-osteoblastic prostate cancer cell line (LNCaP) by dual luciferase assays. In addition, an unspecific but doxycyclin-repressible promoter construct (pAd.3r-luc) was examined. We found that all constructs were active in OS cell lines to varying extents. The complete human Osteocalcin promoter and the bone-sialoprotein promoter were partially induced by vitamin D3 or C respectively while the pAd.3r-luc activity could be shut down by doxycyclin. In contrast, the human Osteocalcin-promoter was not activated by vitamin D3 in LNCaP cells; its action remained relatively low. Interestingly, excepting the beta-catenin promoter, we measured strong activities of all promoters in lung fibroblast cells. Our study demonstrates that promoter activity should be evaluated not only for the target cells of the gene therapeutic approaches, but also for neighbouring normal tissues. Unspecific but repressible promoters could represent an alternative. PMID:15375610

  4. Transcriptional promoter of the human alpha 1(V) collagen gene (COL5A1).

    PubMed Central

    Lee, S; Greenspan, D S


    We have characterized the 5' region of the human alpha 1(V) collagen gene (COL5A1). The transcriptional promoter is shown to have a number of features characteristic of the promoters of 'housekeeping' and growth-control-related genes. It lacks obvious TATA and CAAT boxes, has multiple transcription start sites, has a high GC content, lies within a well-defined CpG island and has a number of consensus sites for the potential binding of transcription factor Sp1. This type of promoter structure, while unusual for a collagen gene, is consistent with the broad distribution of expression of COL5A1 and is reminiscent of the promoter structures of the genes encoding type VI collagen, which has a similarly broad distribution of expression. Stepwise deletion of COL5A1 5' sequences, placed upstream of a heterologous reporter gene, yielded a gradual decrease in promoter activity, indicating that the COL5A1 promoter is composed of an array of cis-acting elements. A minimal promoter region contained within the 212 bp immediately upstream of the major transcription start site contained no consensus sequences for the binding of known transcription factors, but gel mobility shift assays showed this region to bind nuclear factors, including Sp1, at a number of sites. The major transcription start site is flanked by an upstream 34-bp oligopurine/oligopyrimidine stretch, or 'GAGA' box, and a downstream 56-bp GAGA box which contains a 10-bp mirror repeat and is sensitive to cleavage with S1 nuclease. Images Figure 1 Figure 3 Figure 4 Figure 6 PMID:7646438

  5. Promoter library designed for fine-tuned gene expression in Pichia pastoris

    PubMed Central

    Hartner, Franz S.; Ruth, Claudia; Langenegger, David; Johnson, Sabrina N.; Hyka, Petr; Lin-Cereghino, Geoffrey P.; Lin-Cereghino, Joan; Kovar, Karin; Cregg, James M.; Glieder, Anton


    Although frequently used as protein production host, there is only a limited set of promoters available to drive the expression of recombinant proteins in Pichia pastoris. Fine-tuning of gene expression is often needed to maximize product yield and quality. However, for efficient knowledge-based engineering, a better understanding of promoter function is indispensable. Consequently, we created a promoter library by deletion and duplication of putative transcription factor-binding sites within the AOX1 promoter (PAOX1) sequence. This first library initially spanned an activity range between ∼6% and >160% of the wild-type promoter activity. After characterization of the promoter library employing a green fluorescent protein (GFP) variant, the new regulatory toolbox was successfully utilized in a ‘real case’, i.e. the expression of industrial enzymes. Characterization of the library under repressing, derepressing and inducing conditions displayed at least 12 cis-acting elements involved in PAOX1-driven high-level expression. Based on this deletion analysis, novel short artificial promoter variants were constructed by combining cis-acting elements with basal promoter. In addition to improving yields and quality of heterologous protein production, the new PAOX1 synthetic promoter library constitutes a basic toolbox to fine-tune gene expression in metabolic engineering and sequential induction of protein expression in synthetic biology. PMID:18539608

  6. A short upstream promoter region mediates transcriptional regulation of the mouse doublecortin gene in differentiating neurons

    PubMed Central


    Background Doublecortin (Dcx), a MAP (Microtubule-Associated Protein), is transiently expressed in migrating and differentiating neurons and thereby characterizes neuronal precursors and neurogenesis in developing and adult neurogenesis. In addition, reduced Dcx expression during development has been related to appearance of brain pathologies. Here, we attempt to unveil the molecular mechanisms controlling Dcx gene expression by studying its transcriptional regulation during neuronal differentiation. Results To determine and analyze important regulatory sequences of the Dcx promoter, we studied a putative regulatory region upstream from the mouse Dcx coding region (pdcx2kb) and several deletions thereof. These different fragments were used in vitro and in vivo to drive reporter gene expression. We demonstrated, using transient expression experiments, that pdcx2kb is sufficient to control specific reporter gene expression in cerebellar cells and in the developing brain (E14.5). We determined the temporal profile of Dcx promoter activity during neuronal differentiation of mouse embryonic stem cells (mESC) and found that transcriptional activation of the Dcx gene varies along with neuronal differentiation of mESC. Deletion experiments and sequence comparison of Dcx promoters across rodents, human and chicken revealed the importance of a highly conserved sequence in the proximal region of the promoter required for specific and strong expression in neuronal precursors and young neuronal cells. Further analyses revealed the presence in this short sequence of several conserved, putative transcription factor binding sites: LEF/TCF (Lymphoid Enhancer Factor/T-Cell Factor) which are effectors of the canonical Wnt pathway; HNF6/OC2 (Hepatocyte Nuclear Factor-6/Oncecut-2) members of the ONECUT family and NF-Y/CAAT (Nuclear Factor-Y). Conclusions Studies of Dcx gene regulatory sequences using native, deleted and mutated constructs suggest that fragments located upstream of the

  7. Efficient transcription of the human angiotensin II type 2 receptor gene requires intronic sequence elements.

    PubMed Central

    Warnecke, C; Willich, T; Holzmeister, J; Bottari, S P; Fleck, E; Regitz-Zagrosek, V


    To investigate mechanisms of human angiotensin II type 2 receptor (hAT2) gene regulation we functionally characterized the promoter and downstream regions of the gene. 5'-Terminal deletion mutants from -1417/+100 to -46/+100 elicited significant but low functional activity in luciferase reporter gene assays with PC12W cells. Inclusion into the promoter constructs of intron 1 and the transcribed region of the hAT2 gene up to the translation start enhanced luciferase activity 6.7+/-1.6-fold and 11.6+/-1.7-fold (means+/-S.E.M.) respectively, whereas fusion of the promoter to the spliced 5' untranslated region of hAT2 cDNA did not, which indicated an enhancement caused by intronic sequence elements. Reverse transcriptase-mediated PCR confirmed that the chimaeric hAT2-luciferase mRNA was regularly spliced in PC12W cells. A Northern blot analysis of transfected cells showed levels of luciferase mRNA expression consistent with the respective enzyme activities. Mapping of intron 1 revealed that a 12 bp sequence in the centre of the intron was required for the increase in promoter activity, whereas the 5' adjacent intronic region mediated a decrease in luciferase activity. Mutation of the 12 bp region led to altered protein binding and markedly decreased luciferase activity. Cloned into a promoterless luciferase vector, a 123 bp intron 1 fragment was able to direct reporter gene expression to the same activity as occurred in conjunction with the 5' flanking region. These results indicate that sequence elements in intron 1 are necessary for efficient transcription of hAT2. In reporter gene assays, intron 1 might by itself function as a promoter and initiate transcription from an alternative start point. PMID:10229654

  8. A silent composite hemoglobinopathy characterized by gene sequencing.


    Zorai, A; Moumni, I; Benmansour, I; Chaouachi, D; Ghanem, A; Abbes, S


    We report the case of a 35-year-old Tunisian women with a chronic anemia non investigated for a long time. Laboratory analysis using advanced technology of DNA sequencing revealed a compound heterozygote for Hb O Arab and cd 39 beta degrees-thalassemia. It's the first time that such a genotype has been characterized by gene sequencing. PMID:23461145

  9. Flagellin gene sequence variation in the genus Pseudomonas.


    Bellingham, N F; Morgan, J A; Saunders, J R; Winstanley, C


    Flagellin gene (fliC) sequences from 18 strains of Pseudomonas sensu stricto representing 8 different species, and 9 representative fliC sequences from other members of the gamma sub-division of proteobacteria, were compared. Analysis was performed on N-terminal, C-terminal and whole fliC sequences. The fliC analyses confirmed the inferred relationship between P. mendocina, P. oleovorans and P. aeruginosa based on 16S rRNA sequence comparisons. In addition, the analyses indicated that P. putida PRS2000 was closely related to P. fluorescens SBW25 and P. fluorescens NCIMB 9046T, but suggested that P. putida PaW8 and P. putida PRS2000 were more closely related to other Pseudomonas spp. than they were to each other. There were a number of inconsistencies in inferred evolutionary relationships between strains, depending on the analysis performed. In particular, whole flagellin gene comparisons often differed from those obtained using N- and C-terminal sequences. However, there were also inconsistencies between the terminal region analyses, suggesting that phylogenetic relationships inferred on the basis of fliC sequence should be treated with caution. Although the central domain of fliC is highly variable between Pseudomonas strains, there was evidence of sequence similarities between the central domains of different Pseudomonas fliC sequences. This indicates the possibility of recombination in the central domain of fliC genes within Pseudomonas species, and between these genes and those from other bacteria. PMID:11518318

  10. First draft genome sequencing of indole acetic acid producing and plant growth promoting fungus Preussia sp. BSL10.


    Khan, Abdul Latif; Asaf, Sajjad; Khan, Abdur Rahim; Al-Harrasi, Ahmed; Al-Rawahi, Ahmed; Lee, In-Jung


    Preussia sp. BSL10, family Sporormiaceae, was actively producing phytohormone (indole-3-acetic acid) and extra-cellular enzymes (phosphatases and glucosidases). The fungus was also promoting the growth of arid-land tree-Boswellia sacra. Looking at such prospects of this fungus, we sequenced its draft genome for the first time. The Illumina based sequence analysis reveals an approximate genome size of 31.4Mbp for Preussia sp. BSL10. Based on ab initio gene prediction, total 32,312 coding sequences were annotated consisting of 11,967 coding genes, pseudogenes, and 221 tRNA genes. Furthermore, 321 carbohydrate-active enzymes were predicted and classified into many functional families. PMID:26995610

  11. Complete mitogenome sequences of four flatfishes (Pleuronectiformes) reveal a novel gene arrangement of L-strand coding genes

    PubMed Central


    Background Few mitochondrial gene rearrangements are found in vertebrates and large-scale changes in these genomes occur even less frequently. It is difficult, therefore, to propose a mechanism to account for observed changes in mitogenome structure. Mitochondrial gene rearrangements are usually explained by the recombination model or tandem duplication and random loss model. Results In this study, the complete mitochondrial genomes of four flatfishes, Crossorhombus azureus (blue flounder), Grammatobothus krempfi, Pleuronichthys cornutus, and Platichthys stellatus were determined. A striking finding is that eight genes in the C. azureus mitogenome are located in a novel position, differing from that of available vertebrate mitogenomes. Specifically, the ND6 and seven tRNA genes (the Q, A, C, Y, S1, E, P genes) encoded by the L-strand have been translocated to a position between tRNA-T and tRNA-F though the original order of the genes is maintained. Conclusions These special features are used to suggest a mechanism for C. azureus mitogenome rearrangement. First, a dimeric molecule was formed by two monomers linked head-to-tail, then one of the two sets of promoters lost function and the genes controlled by the disabled promoters became pseudogenes, non-coding sequences, and even were lost from the genome. This study provides a new gene-rearrangement model that accounts for the events of gene-rearrangement in a vertebrate mitogenome. PMID:23962312

  12. Regulatory sequences of Arabidopsis drive reporter gene expression in nematode feeding structures.

    PubMed Central

    Barthels, N; van der Lee, F M; Klap, J; Goddijn, O J; Karimi, M; Puzio, P; Grundler, F M; Ohl, S A; Lindsey, K; Robertson, L; Robertson, W M; Van Montagu, M; Gheysen, G; Sijmons, P C


    In the quest for plant regulatory sequences capable of driving nematode-triggered effector gene expression in feeding structures, we show that promoter tagging is a valuable tool. A large collection of transgenic Arabidopsis plants was generated. They were transformed with a beta-glucuronidase gene functioning as a promoter tag. Three T-DNA constructs, pGV1047, p delta gusBin19, and pMOG553, were used. Early responses to nematode invasion were of primary interest. Six lines exhibiting beta-glucuronidase activity in syncytia induced by the beet cyst nematode were studied. Reporter gene activation was also identified in galls induced by root knot and ectoparasitic nematodes. Time-course studies revealed that all six tags were differentially activated during the development of the feeding structure. T-DNA-flanking regions responsible for the observed responses after nematode infection were isolated and characterized for promoter activity. PMID:9437858

  13. Draft Genome Sequence of Burkholderia ambifaria RZ2MS16, a Plant Growth-Promoting Rhizobacterium Isolated from Guarana, a Tropical Plant.


    Batista, Bruna Durante; Taniguti, Lucas Mitsuo; Monteiro-Vitorello, Claudia Barros; Azevedo, João Lúcio; Quecine, Maria Carolina


    Burkholderia ambifaria strain RZ2MS16 was isolated from the rhizosphere of Amazon guarana in Brazil. This bacterium exhibits a remarkable capacity to promote the growth of corn and soybean. Here, we report the draft genome sequence of RZ2MS16 and some genes related to multiple traits involved in plant growth promotion. PMID:26988044

  14. Draft Genome Sequence of Burkholderia ambifaria RZ2MS16, a Plant Growth-Promoting Rhizobacterium Isolated from Guarana, a Tropical Plant

    PubMed Central

    Batista, Bruna Durante; Taniguti, Lucas Mitsuo; Monteiro-Vitorello, Claudia Barros; Azevedo, João Lúcio


    Burkholderia ambifaria strain RZ2MS16 was isolated from the rhizosphere of Amazon guarana in Brazil. This bacterium exhibits a remarkable capacity to promote the growth of corn and soybean. Here, we report the draft genome sequence of RZ2MS16 and some genes related to multiple traits involved in plant growth promotion. PMID:26988044

  15. Structure and sequence divergence of two archaebacterial genes

    SciTech Connect

    Cue, D.; Beckler, G.S.; Reeve, J.N.; Konisky, J.


    The DNA sequences of a region that includes the hisA gene of two related methanogenic archaebacteria, Methanococcus voltae and Methanococcus vannielii, have been compared. Both organisms show a similar genome organization in this region, displaying three open reading frames (ORFs) separated by regions of very high A+T content. Two of the ORFs, including ORFHisA, show significant DNA sequence homology. As might be expected for organisms having a genome that is A+T-rich, there is a high preference for A and U as the third base in codons. A ribosome binding site, G-G-T-G, is located 6 base pairs preceding the ATG translation initiation sequence of both hisA genes. The sequences upstream of the two hisA genes show only limited sequence homology. The M. voltae intergenic region contains four tandemly arranged repetitions of an 11-base-pair sequence, whereas the M. vannielii sequence contains both direct and inverted repetitive sequences. Based on the degree of hisA sequence homology, the authors conclude that M. voltae and M. vannielii are less closely related taxonomically than are members of the enteric group of eubacteria.

  16. Cloning and Characterization of the Human Trefoil Factor 3 Gene Promoter

    PubMed Central

    Zhou, Yifang; Mao, Xuefei; Deng, Xiangdong


    Human trefoil factor 3 (hTFF3) is a small-molecule peptide with potential medicinal value. Its main pharmacological function is to alleviate gastrointestinal mucosal injuries caused by various factors and promote the repair of damaged mucosa. However, how its transcription is regulated is not yet known. The aim of this study was to clone the hTFF3 gene promoter region, identify the core promoter and any transcription factors that bind to the promoter, and begin to clarify the regulation of its expression. The 5′ flanking sequence of the hTFF3 gene was cloned from human whole blood genomic DNA by PCR. Truncated promoter fragments with different were cloned and inserted into the pGL3-Basic vector to determine the position of the core hTFF3 promoter. Transcription element maintaining basic transcriptional activity was assessed by mutation techniques. Protein-DNA interactions were analyzed by chromatin immunoprecipitation (ChIP). RNA interference and gene over-expression were performed to assay the effect of transcription factor on the hTFF3 expression. The results showed that approximately 1,826 bp of the fragment upstream of hTFF3 was successfully amplified, and its core promoter region was determined to be from −300 bp to −280 bp through analysis of truncated mutants. Mutation analysis confirmed that the sequence required to maintain basic transcriptional activity was accurately positioned from −300 bp to −296 bp. Bioinformatic analysis indicated that this area contained a Sp1 binding site. Sp1 binding to the hTFF3 promoter was confirmed by ChIP experiments. Sp1 over-expression and interference experiments showed that Sp1 enhanced the transcriptional activity of the hTFF3 promoter and increased hTFF3 expression. This study demonstrated that Sp1 plays an important role in maintaining the transcription of hTFF3. PMID:24743382

  17. DNA sequencing and expression of the formyl coenzyme A transferase gene, frc, from Oxalobacter formigenes.

    PubMed Central

    Sidhu, H; Ogden, S D; Lung, H Y; Luttge, B G; Baetz, A L; Peck, A B


    Oxalic acid, a highly toxic by-product of metabolism, is catabolized by a limited number of bacterial species utilizing an activation-decarboxylation reaction which yields formate and CO2. frc, the gene encoding formyl coenzyme A transferase, an enzyme which transfers a coenzyme A moiety to activate oxalic acid, was cloned from the bacterium Oxalobacter formigenes. DNA sequencing revealed a single open reading frame of 1,284 bp capable of encoding a 428-amino-acid protein. A presumed promoter region and a rho-independent termination sequence suggest that this gene is part of a monocistronic operon. A PCR fragment containing the open reading frame, when overexpressed in Escherichia coli, produced a product exhibiting enzymatic activity similar to the purified native enzyme. With this, the two genes necessary for bacterial catabolism of oxalate, frc and oxc, have now been cloned, sequenced, and expressed. PMID:9150242

  18. Nucleotide sequence of the gene encoding the nitrogenase iron protein of Thiobacillus ferrooxidans

    SciTech Connect

    Pretorius, I.M.; Rawlings, D.E.; O'Neill, E.G.; Jones, W.A.; Kirby, R.; Woods, D.R.


    The DNA sequence was determined for the cloned Thiobacillus ferrooxidans nifH and part of the nifD genes. The DNA chains were radiolabeled with (..cap alpha..-/sup 32/P)dCTP (3000 Ci/mmol) or (..cap alpha..-/sup 35/S)dCTP (400 Ci/mmol). A putative T. ferrooxidans nifH promoter was identified whose sequences showed perfect consensus with those of the Klebsiella pneumoniae nif promoter. Two putative consensus upstream activator sequences were also identified. The amino acid sequence was deduced from the DNA sequence. In a comparison of nifH DNA sequences from T. ferrooxidans and eight other nitrogen-fixing microbes, a Rhizobium sp. isolated from Parasponia andersonii showed the greatest homology (74%) and Clostridium pasteurianum (nifH1) showed the least homology (54%). In the comparison of the amino acid sequences of the Fe proteins, the Rhizobium sp. and Rhizobium japonicum showed the greatest homology (both 86%) and C. pasteurianum (nifH1 gene product) demonstrated the least homology (56%) to the T. ferrooxidans Fe protein.

  19. Cloning and characterizing of the murine IRF-3 gene promoter region.


    Xu, Hua-Guo; Liu, Lifei; Gao, Shan; Jin, Rui; Ren, Wei; Zhou, Guo-Ping


    The interferon regulatory factor 3 (IRF-3) plays essential roles in inflammation and immune response. Here, we cloned the nucleotide sequence of the 5'-flanking region of the murine IRF-3 gene (mIRF-3) and characterized the molecular mechanisms controlling the mIRF-3 transcriptional activity in NIH3T3 cells. Analyses of a series of 5' deletion constructs demonstrated that a 301 bp region (-255/+46) of the mIRF-3 gene is sufficient for full promoter activity. This region contains IK1, Egr2, Cmyb, E2F1 and YY1 putative transcription factor binding sites. Mutation of Egr2 or YY1 site led to 52-68 % decrease of the mIRF-3 promoter activity, and double Egr2 and YY1 mutation reduced the promoter activity to 20 % of the wild-type promoter activity. Furthermore, knockingdown of endogenous Egr2 or YY1 by a siRNA strategy markedly inhibited the mIRF-3 promoter activity. Chromatin immunoprecipitation assays showed that Egr2 and YY1 interact with the mIRF-3 promoter in vivo. These results suggested that the basal promoter activity of the mIRF-3 gene is regulated by transcription factors Egr2 and YY1 in NIH3T3 cells. PMID:26740329

  20. Direct repeat sequences in the Streptomyces chitinase-63 promoter direct both glucose repression and chitin induction

    PubMed Central

    Ni, Xiangyang; Westpheling, Janet


    The chi63 promoter directs glucose-sensitive, chitin-dependent transcription of a gene involved in the utilization of chitin as carbon source. Analysis of 5′ and 3′ deletions of the promoter region revealed that a 350-bp segment is sufficient for wild-type levels of expression and regulation. The analysis of single base changes throughout the promoter region, introduced by random and site-directed mutagenesis, identified several sequences to be important for activity and regulation. Single base changes at −10, −12, −32, −33, −35, and −37 upstream of the transcription start site resulted in loss of activity from the promoter, suggesting that bases in these positions are important for RNA polymerase interaction. The sequences centered around −10 (TATTCT) and −35 (TTGACC) in this promoter are, in fact, prototypical of eubacterial promoters. Overlapping the RNA polymerase binding site is a perfect 12-bp direct repeat sequence. Some base changes within this direct repeat resulted in constitutive expression, suggesting that this sequence is an operator for negative regulation. Other base changes resulted in loss of glucose repression while retaining the requirement for chitin induction, suggesting that this sequence is also involved in glucose repression. The fact that cis-acting mutations resulted in glucose resistance but not inducer independence rules out the possibility that glucose repression acts exclusively by inducer exclusion. The fact that mutations that affect glucose repression and chitin induction fall within the same direct repeat sequence module suggests that the direct repeat sequence facilitates both chitin induction and glucose repression. PMID:9371809

  1. Novel strong tissue specific promoter for gene expression in human germ cells

    PubMed Central


    Background Tissue specific promoters may be utilized for a variety of applications, including programmed gene expression in cell types, tissues and organs of interest, for developing different cell culture models or for use in gene therapy. We report a novel, tissue-specific promoter that was identified and engineered from the native upstream regulatory region of the human gene NDUFV1 containing an endogenous retroviral sequence. Results Among seven established human cell lines and five primary cultures, this modified NDUFV1 upstream sequence (mNUS) was active only in human undifferentiated germ-derived cells (lines Tera-1 and EP2102), where it demonstrated high promoter activity (~twice greater than that of the SV40 early promoter, and comparable to the routinely used cytomegaloviral promoter). To investigate the potential applicability of the mNUS promoter for biotechnological needs, a construct carrying a recombinant cytosine deaminase (RCD) suicide gene under the control of mNUS was tested in cell lines of different tissue origin. High cytotoxic effect of RCD with a cell-death rate ~60% was observed only in germ-derived cells (Tera-1), whereas no effect was seen in a somatic, kidney-derived control cell line (HEK293). In further experiments, we tested mNUS-driven expression of a hyperactive Sleeping Beauty transposase (SB100X). The mNUS-SB100X construct mediated stable transgene insertions exclusively in germ-derived cells, thereby providing further evidence of tissue-specificity of the mNUS promoter. Conclusions We conclude that mNUS may be used as an efficient promoter for tissue-specific gene expression in human germ-derived cells in many applications. Our data also suggest that the 91 bp-long sequence located exactly upstream NDUFV1 transcriptional start site plays a crucial role in the activity of this gene promoter in vitro in the majority of tested cell types (10/12), and an important role - in the rest two cell lines. PMID:20716342

  2. Promoter methylation of candidate genes associated with familial testicular cancer.


    Mirabello, Lisa; Kratz, Christian P; Savage, Sharon A; Greene, Mark H


    Recent genomic studies have identified risk SNPs in or near eight genes associated with testicular germ cell tumors (TGCT). Mouse models suggest a role for Dnd1 epigenetics in TGCT susceptibility, and we have recently reported that transgenerational inheritance of epigenetic events may be associated with familial TGCT risk. We now investigate whether aberrant promoter methylation of selected candidate genes is associated with familial TGCT risk. Pyrosequencing assays were designed to evaluate CpG methylation in the promoters of selected genes in peripheral blood DNA from 153 TGCT affecteds and 116 healthy male relatives from 101 multiple-case families. Wilcoxon rank-sum tests and logistic regression models were used to investigate associations between promoter methylation and TGCT. We also quantified gene product expression of these genes, using quantitative PCR. We observed increased PDE11A, SPRY4 and BAK1 promoter methylation, and decreased KITLG promoter methylation, in familial TGCT cases versus healthy male family controls. A significant upward risk trend was observed for PDE11A when comparing the middle and highest tertiles of methylation to the lowest [odds ratio (OR) =1.55, 95% confidence intervals (CI) 0.82-2.93, and 1.94, 95% CI 1.03-3.66], respectively; P(trend)=0.042). A significant inverse association was observed for KITLG when comparing the middle and lowest tertiles to the highest (OR=2.15, 95% CI 1.12-4.11, and 2.15, 95% CI 1.12-4.14, respectively; P(trend)=0.031). There was a weak inverse correlation between promoter methylation and KITLG expression. Our results suggest that familial TGCT susceptibility may be associated with promoter methylation of previously-identified TGCT risk-modifying genes. Larger studies are warranted. PMID:23050052

  3. Analysis of Polymorphisms in the Lactotransferrin Gene Promoter and Dental Caries

    PubMed Central

    Brancher, João Armando; Pecharki, Giovana Daniela; Doetzer, Andrea Duarte; Medeiros, Kamilla Gabriella dos Santos; Cordeiro Júnior, Carlos Alberto; Sotomaior, Vanessa Santos; Bauer, Peter; Trevilatto, Paula Cristina


    Regarding host aspects, there has been strong evidence for a genetic component in the etiology of caries. The salivary protein lactotransferrin (LTF) exhibits antibacterial activity, but there is no study investigating the association of polymorphisms in the promoter region of LTF gene with caries. The objective of this study was firstly to search the promoter region of the human LTF gene for variations and, if existent, to investigate the association of the identified polymorphisms with dental caries in 12-year-old students. From 687 unrelated, 12-year-old, both sex students, 50 individuals were selected and divided into two groups of extreme phenotypes according to caries experience: 25 students without (DMFT = 0) and 25 with caries experience (DMFT ≥ 4). The selection of individuals with extreme phenotypes augments the chances to find gene variations which could be associated with such phenotypes. LTF gene-putative promoter region (+39 to −1143) of the selected 50 individuals was analyzed by high-resolution melting technique. Fifteen students, 8 without (DMFT = 0) and 7 with caries experience (mean DMFT = 6.28), presented deviations of the pattern curve suggestive of gene variations and were sequenced. However, no polymorphisms were identified in the putative promoter region of the LTF gene. PMID:22190933

  4. Gene identification and classification in the Synechocystis genomic sequence by recursive gene mark analysis.


    Hirosawa, M; Isono, K; Hayes, W; Borodovsky, M


    The GeneMark method has proven to be an efficient gene-finding tool for the analysis of prokaryotic genomic sequence data. We have developed a procedure of deriving and utilizing several GeneMark models in order to get better gene-detection performance. Upon applying this procedure to the 1.0 Mb contiguous DNA sequence of Synechocystis sp. strain PCC6803, we were able to cluster predicted genes into distinct classes and to produce the class-specific GeneMark models reflecting statistical characteristics of each gene class. One gene class apparently includes genes of exogenous origin. Using class-specific models reduces the gene under prediction error rate down to 1.7% in comparison with 8.1% reported in the previous study when only one GeneMark model was used. PMID:9522117

  5. The regions of sequence variation in caulimovirus gene VI.


    Sanger, M; Daubert, S; Goodman, R M


    The sequence of gene VI from figwort mosaic virus (FMV) clone x4 was determined and compared with that previously published for FMV clone DxS. Both clones originated from the same virus isolation, but the virus used to clone DxS was propagated extensively in a host of a different family prior to cloning whereas that used to clone x4 was not. Differences in the amino acid sequence inferred from the DNA sequences occurred in two clusters. An N-terminal conserved region preceded two regions of variation separated by a central conserved region. Variation in cauliflower mosaic virus (CaMV) gene VI sequences, all of which were derived from virus isolates from hosts from one host family, was similar to that seen in the FMV comparison, though the extent of variation was less. Alignment of gene VI domains from FMV and CaMV revealed regions of amino acid sequence identical in both viruses within the conserved regions. The similarity in the pattern of conserved and variable domains of these two viruses suggests common host-interactive functions in caulimovirus gene VI homologues, and possibly an analogy between caulimoviruses and certain animal viruses in the influence of the host on sequence variability of viral genes. PMID:2024500

  6. Structure and expression of the nuclear gene coding for the chloroplast ribosomal protein L21: developmental regulation of a housekeeping gene by alternative promoters.

    PubMed Central

    Lagrange, T; Franzetti, B; Axelos, M; Mache, R; Lerbs-Mache, S


    We have cloned and sequenced the nuclear gene of the chloroplast ribosomal protein L21 (rpl21) of Spinacia oleracea. The gene consists of five exons and four introns. All introns are located in the sequence which corresponds to the Escherichia coli-like central core of the protein. L21 mRNA is present in photosynthetic (leaves) and nonphotosynthetic (roots and seeds) plant organs, although large quantitative differences exist. Primer extension and S1 nuclease mapping experiments revealed the existence of two types of transcripts in leaves. The two corresponding start sites were defined as P1 and P2. In roots and seeds, we found only the shorter of the two transcripts (initiated at P2). The nucleotide sequence surrounding P2 resembles promoters for housekeeping and vertebrate r-protein genes. Analysis of several promoter constructions by transient expression confirmed that both transcripts originate from transcription initiation. Results are interpreted to mean that the expression of the rpl21 gene is regulated by alternative promoters. One of the promoters (P2) is constitutive, and the other one (P1) is specifically induced in leaves, i.e., its activation should be related to the transformation of amyloplasts or proplastids to chloroplasts. The gene thus represents the first example of a housekeeping gene which is regulated by the organ-specific usage of alternative promoters. Primer extension analysis and S1 nuclease mapping of another nucleus-encoded chloroplast ribosomal protein gene (rps1) give evidence that the same type of regulation by two-promoter usage might be a more general phenomenon of plant chloroplast-related ribosomal protein genes. Preliminary results indicate that presence of conserved sequences within the rpl21 and rps1 promoter regions which compete for the same DNA binding activities. Images PMID:8455634

  7. Cloning and sequencing of the gene for human. beta. -casein

    SciTech Connect

    Loennerdal, B.; Bergstroem, S.; Andersson, Y.; Hialmarsson, K.; Sundgyist, A.; Hernell, O. )


    Human {beta}-casein is a major protein in human milk. This protein is part of the casein micelle and has been suggested to have several physiological functions in the newborn. Since there is limited information on {beta}casein and the factors that affect its concentration in human milk, the authors have isolated and sequenced the gene for this protein. A human mammary gland cDNA library (Clontech) in gt 11 was screened by plaque hy-hybridization using a 42-mer synthetic {sup 32}p-labelled oligo-nucleotide. Positive clones were identified and isolated, DNA was prepared and the gene isolated by cleavage with EcoR1. Following subcloning (PUC18), restriction mapping and Southern blotting, DNA for sequencing was prepared. The gene was sequenced by the dideoxy method. Human {beta}-casein has 212 amino acids and the amino acid sequence deducted from the nucleotide sequence is to 91% identical to the published sequence for human {beta}-casein show a high degree of conservation at the leader peptide and the highly phosphorylated sequences, but also deletions and divergence at several positions. These results provide insight into the structure of the human {beta}-casein gene and will facilitate studies on factors affecting its expression.

  8. Organization of the noncontiguous promoter components of adenovirus VAI RNA gene is strikingly similar to that of eucaryotic tRNA genes.

    PubMed Central

    Bhat, R A; Metz, B; Thimmappaya, B


    The intragenic transcriptional control region (internal promoter) of the adenovirus type 2 VAI RNA gene was mutated by deletion, insertion, and substitution of DNA sequences at the plasmid level. The mutant plasmids were assayed for in vitro transcriptional activity by using HeLa cell extracts. The mutant clones with substitution or insertion of DNA sequences or both between nucleotides +18 and +53 of the VAI RNA gene were all transcriptionally active, although to various extents. Substitution of unrelated DNA sequences up to +26 or between +54 and +61 abolished the transcriptional activity completely. Based on these results, the intragenic promoter sequences of the VAI RNA gene can be subdivided into two components: element A, +10 to +18; and element B, +54 to +69. The distance between the A and B components could be enlarged from its normal 35 base pairs to 75 base pairs without destroying the transcriptional activity. However, a deletion of 4 or 6 base pairs in the DNA segment separating the A and B components (segment C) reduced the transcriptional activity of the genes to less than 2% of that of the wild type. When the VAI RNA gene with its element A or B was substituted for the corresponding element A or B of the Xenopus laevis tRNAMet gene, the hybrid genes transcribed close to the level of the wild-type VAI RNA gene and about 10- to 20-fold more efficiently than the tRNAMet gene. Thus, the organization of DNA sequences in the internal promoter of the VAI RNA gene appears to be very similar to that of eucaryotic tRNA genes. This similarity suggests an evolutionary relationship of the VAI RNA gene to tRNA genes. Images PMID:6656762

  9. Morquio A syndrome: Cloning, sequence, and structure of the human N-acetylgalactosamine 6-sulfatase (GALNS) gene

    SciTech Connect

    Morris, C.P.; Guo, Xiao-Hui; Apostolou, S.


    Deficiency of the lysosomal enzyme, N-acetylgalactosamine 6-sulfatase (GALNS;EC, results in the storage of the glycosaminoglycans, keratan sulfate and chrondroitin 6-sulfate, which leads to the lysosomal storage disorder Morquio A syndrome. Four overlapping genomic clones derived from a chromosome 16-specific gridded cosmid library containing the entire GALNS gene were isolated. The structure of the gene and the sequence of the exon/intron boundaries and the 5{prime} promoter region were determined. The GALNS gene is split into 14 exons spanning approximately 40 kb. The potential promoter for GALNS lacks a TATA box but contains GC box consensus sequences, consistent with its role as a housekeeping gene. The GALNS gene contains an Alu repeat in intron 5 and a VNTR-like sequence in intron 6. 12 refs., 3 figs., 1 tab.

  10. SxtA gene sequence analysis of dinoflagellate Alexandrium minutum

    NASA Astrophysics Data System (ADS)

    Norshaha, Safida Anira; Latib, Norhidayu Abdul; Usup, Gires; Yusof, Nurul Yuziana Mohd


    The dinoflagellate Alexandrium minutum is typically known for the production of potent neurotoxins such as saxitoxin, affecting the health of human seafood consumers via paralytic shellfish poisoning (PSP). These phenomena is related to the harmful algal blooms (HABs) that is believed to be influenced by environmental and nutritional factors. Previous study has revealed that SxtA gene is a starting gene that involved in the saxitoxin production pathway. The aim of this study was to analyse the sequence of the sxtA gene in A. minutum. The dinoflagellates culture was cultured at temperature 26°C with 16:8-hour light:dark photocycle. After the samples were harvested, RNA was extracted, complementary DNA (cDNA) was synthesised and amplified by polymerase chain reaction (PCR). The PCR products were then purified and cloned before sequenced. The SxtA sequence obtained was then analyzed in order to identify the presence of SxtA gene in Alexandrium minutum.

  11. Sequence and expression analyses of the UL37 and UL38 genes of Aujeszky's disease virus.


    Braun, A; Kaliman, A; Boldogköi, Z; Aszódi, A; Fodor, I


    Previously, we sequenced the HSV-1 Ul39-Ul40 homologue genes of Aujeszky's disease virus (ADV), also designated as pseudorabies virus (Kaliman et al., 1994a, b). Now we report the nucleotide sequence of the adjacent DNA that encodes Ul38, the 5'-region (750 bp) of Ul37, and the promoter regions between these divergently arranged two genes. The ADV Ul38 gene encodes a protein of 368 amino acids. Amino acid sequence comparison of ADV Ul38 with that of other herpesviruses revealed significant structural homology. In a transcription study using RNase protection assay and Northern blot hybridization, we found that the Ul38 gene had one initiation site, but the Ul37 gene was initiated at two transcription sites with two potential initiator AUGs, one of which was dominant. Comparison of ADV Ul37, Ul38 and ribonucleotide reductase gene expression showed that these genes belong to the same temporal class with early kinetics. Data of structural and transcriptional studies suggest that regulation of the expression of these two ADV genes could differ from that of the HSV-1 virus. PMID:11402671

  12. Analysis of Pseudomonas putida alkane-degradation gene clusters and flanking insertion sequences: evolution and regulation of the alk genes.


    van Beilen, J B; Panke, S; Lucchini, S; Franchini, A G; Röthlisberger, M; Witholt, B


    The Pseudomonas putida GPo1 (commonly known as Pseudomonas oleovorans GPo1) alkBFGHJKL and alkST gene clusters, which encode proteins involved in the conversion of n-alkanes to fatty acids, are located end to end on the OCT plasmid, separated by 9.7 kb of DNA. This DNA segment encodes, amongst others, a methyl-accepting transducer protein (AlkN) that may be involved in chemotaxis to alkanes. In P. putida P1, the alkBFGHJKL and alkST gene clusters are flanked by almost identical copies of the insertion sequence ISPpu4, constituting a class 1 transposon. Other insertion sequences flank and interrupt the alk genes in both strains. Apart from the coding regions of the GPo1 and P1 alk genes (80-92% sequence identity), only the alkB and alkS promoter regions are conserved. Competition experiments suggest that highly conserved inverted repeats in the alkB and alkS promoter regions bind ALKS: PMID:11390693

  13. Biased distribution of DNA uptake sequences towards genome maintenance genes.


    Davidsen, Tonje; Rødland, Einar A; Lagesen, Karin; Seeberg, Erling; Rognes, Torbjørn; Tønjum, Tone


    Repeated sequence signatures are characteristic features of all genomic DNA. We have made a rigorous search for repeat genomic sequences in the human pathogens Neisseria meningitidis, Neisseria gonorrhoeae and Haemophilus influenzae and found that by far the most frequent 9-10mers residing within coding regions are the DNA uptake sequences (DUS) required for natural genetic transformation. More importantly, we found a significantly higher density of DUS within genes involved in DNA repair, recombination, restriction-modification and replication than in any other annotated gene group in these organisms. Pasteurella multocida also displayed high frequencies of a putative DUS identical to that previously identified in H.influenzae and with a skewed distribution towards genome maintenance genes, indicating that this bacterium might be transformation competent under certain conditions. These results imply that the high frequency of DUS in genome maintenance genes is conserved among phylogenetically divergent species and thus are of significant biological importance. Increased DUS density is expected to enhance DNA uptake and the over-representation of DUS in genome maintenance genes might reflect facilitated recovery of genome preserving functions. For example, transient and beneficial increase in genome instability can be allowed during pathogenesis simply through loss of antimutator genes, since these DUS-containing sequences will be preferentially recovered. Furthermore, uptake of such genes could provide a mechanism for facilitated recovery from DNA damage after genotoxic stress. PMID:14960717

  14. The complete nucleotide sequence and structure of the gene encoding bovine phenylethanolamine N-methyltransferase.


    Batter, D K; D'Mello, S R; Turzai, L M; Hughes, H B; Gioio, A E; Kaplan, B B


    A cDNA clone for bovine adrenal phenylethanolamine N-methyltransferase (PNMT) was used to screen a Charon 28 genomic library. One phage was identified, designated lambda P1, which included the entire PNMT gene. Construction of a restriction map, with subsequent Southern blot analysis, allowed the identification of exon-containing fragments. Dideoxy sequence analysis of these fragments, and several more further upstream, indicates that the bovine PNMT gene is 1,594 base pairs in length, consisting of three exons and two introns. The transcription initiation site was identified by two independent methods and is located approximately 12 base pairs upstream from the ATG translation start site. The 3' untranslated region is 88 base pairs in length and contains the expected polyadenylation signal (AATAAA). A putative promoter sequence (TATA box) is located about 25 base pairs upstream from the transcription initiation site. Computer comparison of the nucleotide sequence data with the consensus sequences of known regulatory elements revealed potential binding sites for glucocorticoid receptors and the Sp1 regulatory protein in the 5' flanking region of the gene. Additionally, comparison of the sequence of the exons of the PNMT gene with cDNA sequences for other enzymes involved in biogenic amine synthesis revealed no significant homology, indicating that PNMT is not a member of a multigene family of catecholamine biosynthetic enzymes. PMID:3379652

  15. Efficient expression of protein coding genes from the murine U1 small nuclear RNA promoters.

    PubMed Central

    Bartlett, J S; Sethna, M; Ramamurthy, L; Gowen, S A; Samulski, R J; Marzluff, W F


    Few promoters are active at high levels in all cells. Of these, the majority encode structural RNAs transcribed by RNA polymerases I or III and are not accessible for the expression of proteins. An exception are the small nuclear RNAs (snRNAs) transcribed by RNA polymerase II. Although snRNA biosynthesis is unique and thought not to be compatible with synthesis of functional mRNA, we have tested these promoters for their ability to express functional mRNAs. We have used the murine U1a and U1b snRNA gene promoters to express the Escherichia coli lacZ gene and the human alpha-globin gene from either episomal or integrated templates by transfection, or infection into a variety of mammalian cell types. Equivalent expression of beta-galactosidase was obtained from < 250 nucleotides of 5'-flanking sequence containing the complete promoter of either U1 snRNA gene or from the 750-nt cytomegalovirus promoter and enhancer regions. The mRNA was accurately initiated at the U1 start site, efficiently spliced and polyadenylylated, and localized to polyribosomes. Recombinant adenovirus containing the U1b-lacZ chimeric gene transduced and expressed beta-galactosidase efficiently in human 293 cells and airway epithelial cells in culture. Viral vectors containing U1 snRNA promoters may be an attractive alternative to vectors containing viral promoters for persistent high-level expression of therapeutic genes or proteins. Images Fig. 2 Fig. 3 Fig. 4 Fig. 5 PMID:8799116

  16. A Systematic Analysis of Human Disease-Associated Gene Sequences In Drosophila melanogaster

    PubMed Central

    Reiter, Lawrence T.; Potocki, Lorraine; Chien, Sam; Gribskov, Michael; Bier, Ethan


    We performed a systematic BLAST analysis of 929 human disease gene entries associated with at least one mutant allele in the Online Mendelian Inheritance in Man (OMIM) database against the recently completed genome sequence of Drosophila melanogaster. The results of this search have been formatted as an updateable and searchable on-line database called Homophila. Our analysis identified 714 distinct human disease genes (77% of disease genes searched) matching 548 unique Drosophila sequences, which we have summarized by disease category. This breakdown into disease classes creates a picture of disease genes that are amenable to study using Drosophila as the model organism. Of the 548 Drosophila genes related to human disease genes, 153 are associated with known mutant alleles and 56 more are tagged by P-element insertions in or near the gene. Examples of how to use the database to identify Drosophila genes related to human disease genes are presented. We anticipate that cross-genomic analysis of human disease genes using the power of Drosophila second-site modifier screens will promote interaction between human and Drosophila research groups, accelerating the understanding of the pathogenesis of human genetic disease. The Homophila database is available at PMID:11381037

  17. The 14-3-3 gene expression specificity in response to stress is promoter-dependent.


    Aksamit, Anna; Korobczak, Alina; Skala, Jacek; Lukaszewicz, Marcin; Szopa, Jan


    Genomic clone coding for the 16R isoform of 14-3-3 proteins from potato plants has recently been described. This paper reports on 20R-gene isolation and analysis, and compares two isoforms. The northern blot analysis of mRNA of the 20R 14-3-3 isoform suggests its similarity to 16R. Vascular tissue-specific expression and age-dependent synthesis in potato leaves has been detected in both promoters. Screening of the potato genomic library using 20R cDNA isoform resulted in identification and isolation of the corresponding gene. This gene contains four exons and three introns. Inspecting the promoter sequence of the 20R isoform revealed several boxes important for the regulation of gene expression. The strongest GUS expression in transgenic potato plants transformed with the uidA reporter gene under the 20R promoter has been found in young leaf and stem vascular tissue, root tips, pollen and ovules. Mature fragments exhibit a significant decrease in GUS staining, which suggests age-dependent promoter activity. The analysis of transgenic plants transformed with 20R-GUS in contrast to 16R-GUS has revealed strong activation of the 20R promoter by metal ions and NaCl. Instead the 16R promoter is strongly affected by virus and salicylic acid treatments. The only factor, which strongly induced both promoters, was abscisic acid. It is thus suggested that promoter domain composition is the main factor differentiating the appearance of 14-3-3 isoforms. PMID:16081528

  18. The Mouse Solitary Odorant Receptor Gene Promoters as Models for the Study of Odorant Receptor Gene Choice

    PubMed Central

    Degl'Innocenti, Andrea


    Background In vertebrates, several anatomical regions located within the nasal cavity mediate olfaction. Among these, the main olfactory epithelium detects most conventional odorants. Olfactory sensory neurons, provided with cilia exposed to the air, detect volatile chemicals via an extremely large family of seven-transmembrane chemoreceptors named odorant receptors. Their genes are expressed in a monogenic and monoallelic fashion: a single allele of a single odorant receptor gene is transcribed in a given mature neuron, through a still uncharacterized molecular mechanism known as odorant receptor gene choice. Aim Odorant receptor genes are typically arranged in genomic clusters, but a few are isolated (we call them solitary) from the others within a region broader than 1 Mb upstream and downstream with respect to their transcript's coordinates. The study of clustered genes is problematic, because of redundancy and ambiguities in their regulatory elements: we propose to use the solitary genes as simplified models to understand odorant receptor gene choice. Procedures Here we define number and identity of the solitary genes in the mouse genome (C57BL/6J), and assess the conservation of the solitary status in some mammalian orthologs. Furthermore, we locate their putative promoters, predict their homeodomain binding sites (commonly present in the promoters of odorant receptor genes) and compare candidate promoter sequences with those of wild-caught mice. We also provide expression data from histological sections. Results In the mouse genome there are eight intact solitary genes: Olfr19 (M12), Olfr49, Olfr266, Olfr267, Olfr370, Olfr371, Olfr466, Olfr1402; five are conserved as solitary in rat. These genes are all expressed in the main olfactory epithelium of three-day-old mice. The C57BL/6J candidate promoter of Olfr370 has considerably varied compared to its wild-type counterpart. Within the putative promoter for Olfr266 a homeodomain binding site is predicted. As a

  19. Sequence and analysis of the human ABL gene, the BCR gene, and regions involved in the Philadelphia chromosomal translocation

    SciTech Connect

    Burian, D.; Clifton, S.W.; Crabtree, J.


    The complete human BCR gene (152j-141 nt) on chromosome 22 and greater than 80% of the human ABL gene (179-512 nt) on chromosome 9 have been sequenced from mapped cosmid and plasmid clones via a shotgun strategy. Because these two chromosomes are translocated with breakpoints within the BCR and ABL genes in Philadelphia chromosome-positive leukemias, knowledge of these sequences also might provide insight into the validity of various theories of chromosomal rearrangements. Comparison of these genes with their cDNA sequences reveal the positions of 23 BCR exons and putative alternative BCR first and second exons, as well as the common ABL exons 2-11, respectively. Additionally, these regions include the alternative ABL first exons 1b and 1a, a new gene 5` to the first ABL exon, and an open reading frame with homology to an EST within the BCR fourth intron. Further analysis reveals an Alu homology of 38.83 and 39.35% for the BCR and ABL genes, respectively, with other repeat elements present to a lesser extent. Four new Philadelphia chromosome translocation breakpoints from chronic myelogenous leukemia patients also were sequenced, and the positions of these and several other previously sequenced breakpoints now have been mapped precisely, although no consistent breakpoint features immediately were apparent. Comparative analysis of genomic sequences encompassing the murine homologues to the human ABL exons 1b and 1a, as well as regions encompassing the ABL exons 2 and 3, reveals that although there is a high degree of homology in their corresponding exons and promoter regions, these two vertebrate species show a striking lack of homology outside these regions. 122 refs., 5 figs., 4 tabs.

  20. Maximal Expression of the Evolutionarily Conserved Slit2 Gene Promoter Requires Sp1.


    Saunders, Jacquelyn; Wisidagama, D Roonalika; Morford, Travis; Malone, Cindy S


    Slit2 is a neural axon guidance and chemorepellent protein that stimulates motility in a variety of cell types. The role of Slit2 in neural development and neoplastic growth and migration has been well established, while the genetic mechanisms underlying regulation of the Slit2 gene have not. We identified the core and proximal promoter of Slit2 by mapping multiple transcriptional start sites, analyzing transcriptional activity, and confirming sequence homology for the Slit2 proximal promoter among a number of species. Deletion series and transient transfection identified the Slit2 proximal promoter as within 399 base pairs upstream of the start of transcription. A crucial region for full expression of the Slit2 proximal promoter lies between 399 base pairs and 296 base pairs upstream of the start of transcription. Computer modeling identified three transcription factor-binding consensus sites within this region, of which only site-directed mutagenesis of one of the two identified Sp1 consensus sites inhibited transcriptional activity of the Slit2 proximal promoter (-399 to +253). Bioinformatics analysis of the Slit2 proximal promoter -399 base pair to -296 base pair region shows high sequence conservation over twenty-two species, and that this region follows an expected pattern of sequence divergence through evolution. PMID:26456684

  1. Insights into corn genes derived from large-scale cDNA sequencing.


    Alexandrov, Nickolai N; Brover, Vyacheslav V; Freidin, Stanislav; Troukhan, Maxim E; Tatarinova, Tatiana V; Zhang, Hongyu; Swaller, Timothy J; Lu, Yu-Ping; Bouck, John; Flavell, Richard B; Feldmann, Kenneth A


    We present a large portion of the transcriptome of Zea mays, including ESTs representing 484,032 cDNA clones from 53 libraries and 36,565 fully sequenced cDNA clones, out of which 31,552 clones are non-redundant. These and other previously sequenced transcripts have been aligned with available genome sequences and have provided new insights into the characteristics of gene structures and promoters within this major crop species. We found that although the average number of introns per gene is about the same in corn and Arabidopsis, corn genes have more alternatively spliced isoforms. Examination of the nucleotide composition of coding regions reveals that corn genes, as well as genes of other Poaceae (Grass family), can be divided into two classes according to the GC content at the third position in the amino acid encoding codons. Many of the transcripts that have lower GC content at the third position have dicot homologs but the high GC content transcripts tend to be more specific to the grasses. The high GC content class is also enriched with intronless genes. Together this suggests that an identifiable class of genes in plants is associated with the Poaceae divergence. Furthermore, because many of these genes appear to be derived from ancestral genes that do not contain introns, this evolutionary divergence may be the result of horizontal gene transfer from species not only with different codon usage but possibly that did not have introns, perhaps outside of the plant kingdom. By comparing the cDNAs described herein with the non-redundant set of corn mRNAs in GenBank, we estimate that there are about 50,000 different protein coding genes in Zea. All of the sequence data from this study have been submitted to DDBJ/GenBank/EMBL under accession numbers EU940701-EU977132 (FLI cDNA) and FK944382-FL482108 (EST). PMID:18937034

  2. Activation of the cytotactin promoter by the homeobox-containing gene Evx-1.

    PubMed Central

    Jones, F S; Chalepakis, G; Gruss, P; Edelman, G M


    Cytotactin is a morphoregulatory molecule of the extracellular matrix affecting cell shape, division, and migration that appears in a characteristic and complex site-restricted pattern during embryogenesis. The promoter region of the gene that encodes chicken cytotactin contains a variety of potential regulatory sequences. These include putative binding sites for homeodomain proteins and a phorbol 12-O-tetradecanoate 13-acetate response element (TRE)/AP-1 element, a potential target for transcription factors thought to be involved in growth-factor signal transduction. To determine the effects of homeobox-containing genes on cytotactin promoter activity, we conducted a series of cotransfection experiments on NIH 3T3 cells using cytotactin promoter-chloramphenicol acetyltransferase (CAT) reporter gene constructs and plasmids driving the expression of mouse homeobox genes Evx-1 and Hox-1.3. cotransfection with Evx-1 stimulated cytotactin promoter activity whereas cotransfection in control experiments with Hox-1.3 had no effect. To localize the sequences required for Evx-1 activation, we tested a series of deletions in the cytotactin promoter. An 89-base-pair region containing a consensus TRE/AP-1 element was found to be required for activation. An oligonucleotide segment containing this TRE/AP-1 site was found to confer Evx-1 inducibility on a simian virus 40 minimal promoter; mutation of the TRE/AP-1 site abolished this activity. To explore the potential role of growth factors in cytotactin promoter activation, chicken embryo fibroblasts, which are known to synthesize cytotactin, were first transfected with cytotactin promoter constructs and cultured under minimal conditions in 1% fetal bovine serum. Although the cells exhibited only low levels of CAT activity under these conditions, cells exposed for 12 h to 10% (vol/vol) fetal bovine serum showed a marked increase in CAT activity. Cotransfection with Evx-1 and cytotactin promoter constructs of cells cultured in 1

  3. Xenopus cytoskeletal actin and human c-fos gene promoters share a conserved protein-binding site.


    Mohun, T; Garrett, N; Treisman, R


    Xenopus laevis cytoskeletal actin gene promoters contain a 20-bp sequence homologous to the serum response element (SRE) required for transient human c-fos gene transcription in response to serum factors. Both sequences bind the same factor in HeLa cell extracts, as shown by binding competition, DNase I and dimethylsulphate (DMS) protection and DMS interference assays. A similar protein is present in Xenopus laevis oocytes. Sequences containing the SRE homology are essential for constitutive activity of the actin promoter in both Xenopus and mouse cells, and a synthetic SRE functions as a promoter element in these cells. In mouse cells, transcription of both transfected Xenopus actin and actin/c-fos fusion genes is activated following serum stimulation. These data suggest that the SRE and its cognate protein form part of a regulatory pathway that has been highly conserved during evolution. PMID:3582369

  4. Xenopus cytoskeletal actin and human c-fos gene promoters share a conserved protein-binding site.

    PubMed Central

    Mohun, T; Garrett, N; Treisman, R


    Xenopus laevis cytoskeletal actin gene promoters contain a 20-bp sequence homologous to the serum response element (SRE) required for transient human c-fos gene transcription in response to serum factors. Both sequences bind the same factor in HeLa cell extracts, as shown by binding competition, DNase I and dimethylsulphate (DMS) protection and DMS interference assays. A similar protein is present in Xenopus laevis oocytes. Sequences containing the SRE homology are essential for constitutive activity of the actin promoter in both Xenopus and mouse cells, and a synthetic SRE functions as a promoter element in these cells. In mouse cells, transcription of both transfected Xenopus actin and actin/c-fos fusion genes is activated following serum stimulation. These data suggest that the SRE and its cognate protein form part of a regulatory pathway that has been highly conserved during evolution. Images Fig. 2. Fig. 3. Fig. 4. Fig. 5. Fig. 6. PMID:3582369

  5. IS2-mediated re-arrangement of the promoter sequence suppresses metabolic burden of the recombinant plasmid.


    Valesová, R; Stepánek, V; Vecerek, B; Kyslík, P


    Recombinant plasmid pKA18 of the high expression bacterial system for penicillin amidase ('penicillin G acylase') bears the 3' end region of IS2 element. The IS2 sequence replaces the -35 region of promoter of pga and extends up to TAGTAT box at position -10 of the promoter region. It therefore forms a hybrid promoter of pga ppgaHT. A natural promoter ppgaWT was not detected on any recombinant plasmid isolated from recombinant strains of Escherichia coli constitutively producing penicillin amidase. PCR fragments carrying both types of promoters were cloned into the promoter-probe vector pET2 to compare their transcriptional activity: the activity of ppgaWT was 5x higher than that of ppgaHT. The same nucleotide "G" localized 28 nucleotides upstream of the translation start point was identified as the respective transcription start point of both mRNAs. An attempt was made to place the pga gene cloned on a plasmid under the control of the natural promoter: not a single clone expressing penicillin amidase was found among 150 transformants. High transcriptional activity of the natural promoter together with high pga gene dosage could result in a deleterious metabolic burden of the periplasmic enzyme. PMID:16408844

  6. A transcriptional regulatory element in the coding sequence of the human Bcl-2 gene

    PubMed Central

    Lang, Georgina; Gombert, Wendy M; Gould, Hannah J


    We investigated the protein-binding sites in a DNAse I hypersensitive site associated with bcl-2 gene expression in human B cells. We mapped this hypersensitive site to the coding sequence of exon 2 of the bcl-2 gene in the bcl-2-expressing REH B-cell line. Electrophoretic mobility shift assays (EMSAs) with extracts from REH cells revealed three previously unrecognized B-Myb-binding sites in this sequence. The protein was identified as B-Myb by using a specific antibody and EMSAs. Accordingly, the levels of B-Myb and bcl-2 proteins, and of Myb EMSA activity, were correlated over a wide range of cell lines, representing different stages of B-cell development. Transfection of REH cells with antisense B-myb down-regulated EMSA activity and the level of bcl-2, and led to the apoptosis of REH cells. Transfection of the bcl-2-non-expressing RPMI 8226 cell line with a B-Myb expression vector induced B-Myb EMSA activity and the expression of bcl-2. Reporter assays indicated that the HSS8 sequence containing the three B-Myb sites may act as an enhancer when it is linked to the bcl-2 gene promoter. Interaction of B-Myb with HSS8 may enhance bcl-2 gene expression by co-operating with positive regulatory elements (e.g. previously identified B-Myb response elements) or silencing negative response elements in the bcl-2 gene promoter. PMID:15606792

  7. The construction of a synthetic Escherichia coli trp promoter and its use in the expression of a synthetic interferon gene.

    PubMed Central

    Windass, J D; Newton, C R; De Maeyer-Guignard, J; Moore, V E; Markham, A F; Edge, M D


    An 82 base pair DNA fragment has been synthesised which contains the E. coli trp promoter and operator sequences and also encodes the first Shine Dalgarno sequence of the trp operon. This DNA fragment is flanked by EcoRI and ClaI/TaqI cohesive ends and is thus easy to clone, transfer between vector systems and couple to genes to drive their expression. It has been cloned into plasmid pAT153, producing a convenient trp promoter vector. We have also joined the fragment to a synthetic IFN-alpha 1 gene, using synthetic oligonucleotides to generate a completely natural, highly efficient bacterial translation initiation signal on the promoter proximal side of the IFN gene. Plasmids carrying this construction enable E. coli cells to express IFN-alpha 1 almost constitutively and with significantly higher efficiency than from a lacUV5 promoter based system. Images PMID:6184675

  8. Enhancer and promoter elements directing activation and glucocorticoid repression of the. cap alpha. /sub 1/-fetoprotein gene in hepatocytes

    SciTech Connect

    Guertin, M.; La Rue, H.; Bernier, D.; Wrange, O.; Chevrette, M.; Gingras, M.C.; Belanger, L.


    Mutations were introduced in 7 kilobases of 5'-flanking rat ..cap alpha../sub 1/-fetoprotein (AFP) genomic DNA, linked to the chloramphenicol acetyltransferase gene. AFP promoter activity and its repression by a glucocorticoid hormone were assessed by stable and transient expression assays. Stable transfection assays were more sensitive and accurate than transient expression assays in a Morris 7777 rat hepatoma recipient (Hepa7.6), selected for its strong AFP repression by dexamethasone. The segment of DNA encompassing a hepatocyte-constitutive chromatin DNase I-hypersensitive site at -3.7 kilobases and a liver developmental stage-specific site at -2.5 kilobases contains interacting enhancer elements sufficient for high AFP promoter activity in Hepa7.6 or HepG2 cells. Deletions and point mutations define an upstream promoter domain of AFP gene activation, operating with at least three distinct promoter-activating elements, PEI at -65 base pairs, PEII at -120 base pairs, and DE at -160 base pairs. PEI and PEII share homologies with albumin promoter sequences, PEII is a near-consensus nuclear factor I recognition sequence, and DE overlaps a glucocorticoid receptor recognition sequence. An element conferring glucocorticoid repression of AFP gene activity is located in the upstream AFP promoter domain. Receptor-binding assays indicate that this element is the glucocorticoid receptor recognition sequence which overlaps with promoter-activating element DE.

  9. Gene Discovery through Genomic Sequencing of Brucella abortus

    PubMed Central

    Sánchez, Daniel O.; Zandomeni, Ruben O.; Cravero, Silvio; Verdún, Ramiro E.; Pierrou, Ester; Faccio, Paula; Diaz, Gabriela; Lanzavecchia, Silvia; Agüero, Fernán; Frasch, Alberto C. C.; Andersson, Siv G. E.; Rossetti, Osvaldo L.; Grau, Oscar; Ugalde, Rodolfo A.


    Brucella abortus is the etiological agent of brucellosis, a disease that affects bovines and human. We generated DNA random sequences from the genome of B. abortus strain 2308 in order to characterize molecular targets that might be useful for developing immunological or chemotherapeutic strategies against this pathogen. The partial sequencing of 1,899 clones allowed the identification of 1,199 genomic sequence surveys (GSSs) with high homology (BLAST expect value < 10−5) to sequences deposited in the GenBank databases. Among them, 925 represent putative novel genes for the Brucella genus. Out of 925 nonredundant GSSs, 470 were classified in 15 categories based on cellular function. Seven hundred GSSs showed no significant database matches and remain available for further studies in order to identify their function. A high number of GSSs with homology to Agrobacterium tumefaciens and Rhizobium meliloti proteins were observed, thus confirming their close phylogenetic relationship. Among them, several GSSs showed high similarity with genes related to nodule nitrogen fixation, synthesis of nod factors, nodulation protein symbiotic plasmid, and nodule bacteroid differentiation. We have also identified several B. abortus homologs of virulence and pathogenesis genes from other pathogens, including a homolog to both the Shda gene from Salmonella enterica serovar Typhimurium and the AidA-1 gene from Escherichia coli. Other GSSs displayed significant homologies to genes encoding components of the type III and type IV secretion machineries, suggesting that Brucella might also have an active type III secretion machinery. PMID:11159979

  10. Genome Sequence of the Plant Growth Promoting Endophytic Bacterium Enterobacter sp. 638

    SciTech Connect

    Taghavi, S.; van der Lelie, D.; Hoffman, A.; Zhang, Y.-B.; Walla, M. D.; Vangronsveld, J.; Newman, L.; Monchy, S.


    Enterobacter sp. 638 is an endophytic plant growth promoting gamma-proteobacterium that was isolated from the stem of poplar (Populus trichocarpa x deltoides cv. H11-11), a potentially important biofuel feed stock plant. The Enterobacter sp. 638 genome sequence reveals the presence of a 4,518,712 bp chromosome and a 157,749 bp plasmid (pENT638-1). Genome annotation and comparative genomics allowed the identification of an extended set of genes specific to the plant niche adaptation of this bacterium. This includes genes that code for putative proteins involved in survival in the rhizosphere (to cope with oxidative stress or uptake of nutrients released by plant roots), root adhesion (pili, adhesion, hemagglutinin, cellulose biosynthesis), colonization/establishment inside the plant (chemiotaxis, flagella, cellobiose phosphorylase), plant protection against fungal and bacterial infections (siderophore production and synthesis of the antimicrobial compounds 4-hydroxybenzoate and 2-phenylethanol), and improved poplar growth and development through the production of the phytohormones indole acetic acid, acetoin, and 2,3-butanediol. Metabolite analysis confirmed by quantitative RT-PCR showed that, the production of acetoin and 2,3-butanediol is induced by the presence of sucrose in the growth medium. Interestingly, both the genetic determinants required for sucrose metabolism and the synthesis of acetoin and 2,3-butanediol are clustered on a genomic island. These findings point to a close interaction between Enterobacter sp. 638 and its poplar host, where the availability of sucrose, a major plant sugar, affects the synthesis of plant growth promoting phytohormones by the endophytic bacterium. The availability of the genome sequence, combined with metabolome and transcriptome analysis, will provide a better understanding of the synergistic interactions between poplar and its growth promoting endophyte Enterobacter sp. 638. This information can be further exploited to

  11. Identification, sequencing and structural analysis of a nifA-like gene of Acetobacter diazotrophicus.


    Teixeira, K R; Morgan, T; Meletzus, D; Galler, R; Baldani, J I; Kennedy, C


    A recombinant plasmid, pAD101, containing a DNA fragment of Acetobacter diazotrophicus strain PAL5 was isolated by its ability to restore Nif+ phenotype to a nifA- ntrC- double mutant of Azotobacter vinelandii. Hybridization with the nifA genes of Azospirillum brasilense located the nifA gene more precisely to specific fragments of pAD101. DNA sequencing of appropriate subclones of pAD101 revealed that the nifA gene was adjacent to the nifB gene in A. diazotrophicus, and the 5' end of the nifB gene was located downstream of the nitrogenase MoFe subunit gene, nifK. The deduced aminoacid sequence of A. diazotrophicus nifA and nifB gene were most similar to the NifA and NifB proteins of Azorhizobium caulinodans and Rhodobacter capsulatus, respectively. In addition, nucleotide sequences upstream of the A. diazotrophicus nifA-encoding region indicate features similar to those in the A. caulinodans nifA promoter region involved in O2 and fixed N regulation of nifA expression. PMID:10530336

  12. Different regulatory sequences control creatine kinase-M gene expression in directly injected skeletal and cardiac muscle.

    PubMed Central

    Vincent, C K; Gualberto, A; Patel, C V; Walsh, K


    Regulatory sequences of the M isozyme of the creatine kinase (MCK) gene have been extensively mapped in skeletal muscle, but little is known about the sequences that control cardiac-specific expression. The promoter and enhancer sequences required for MCK gene expression were assayed by the direct injection of plasmid DNA constructs into adult rat cardiac and skeletal muscle. A 700-nucleotide fragment containing the enhancer and promoter of the rabbit MCK gene activated the expression of a downstream reporter gene in both muscle tissues. Deletion of the enhancer significantly decreased expression in skeletal muscle but had no detectable effect on expression in cardiac muscle. Further deletions revealed a CArG sequence motif at position -179 within the promoter that was essential for cardiac-specific expression. The CArG element of the MCK promoter bound to the recombinant serum response factor and YY1, transcription factors which control expression from structurally similar elements in the skeletal actin and c-fos promoters. MCK-CArG-binding activities that were similar or identical to serum response factor and YY1 were also detected in extracts from adult cardiac muscle. These data suggest that the MCK gene is controlled by different regulatory programs in adult cardiac and skeletal muscle. Images PMID:8423791

  13. Integration of bioinformatics and synthetic promoters leads to the discovery of novel elicitor-responsive cis-regulatory sequences in Arabidopsis.


    Koschmann, Jeannette; Machens, Fabian; Becker, Marlies; Niemeyer, Julia; Schulze, Jutta; Bülow, Lorenz; Stahl, Dietmar J; Hehl, Reinhard


    A combination of bioinformatic tools, high-throughput gene expression profiles, and the use of synthetic promoters is a powerful approach to discover and evaluate novel cis-sequences in response to specific stimuli. With Arabidopsis (Arabidopsis thaliana) microarray data annotated to the PathoPlant database, 732 different queries with a focus on fungal and oomycete pathogens were performed, leading to 510 up-regulated gene groups. Using the binding site estimation suite of tools, BEST, 407 conserved sequence motifs were identified in promoter regions of these coregulated gene sets. Motif similarities were determined with STAMP, classifying the 407 sequence motifs into 37 families. A comparative analysis of these 37 families with the AthaMap, PLACE, and AGRIS databases revealed similarities to known cis-elements but also led to the discovery of cis-sequences not yet implicated in pathogen response. Using a parsley (Petroselinum crispum) protoplast system and a modified reporter gene vector with an internal transformation control, 25 elicitor-responsive cis-sequences from 10 different motif families were identified. Many of the elicitor-responsive cis-sequences also drive reporter gene expression in an Agrobacterium tumefaciens infection assay in Nicotiana benthamiana. This work significantly increases the number of known elicitor-responsive cis-sequences and demonstrates the successful integration of a diverse set of bioinformatic resources combined with synthetic promoter analysis for data mining and functional screening in plant-pathogen interaction. PMID:22744985

  14. Integration of Bioinformatics and Synthetic Promoters Leads to the Discovery of Novel Elicitor-Responsive cis-Regulatory Sequences in Arabidopsis1[C][W][OA

    PubMed Central

    Koschmann, Jeannette; Machens, Fabian; Becker, Marlies; Niemeyer, Julia; Schulze, Jutta; Bülow, Lorenz; Stahl, Dietmar J.; Hehl, Reinhard


    A combination of bioinformatic tools, high-throughput gene expression profiles, and the use of synthetic promoters is a powerful approach to discover and evaluate novel cis-sequences in response to specific stimuli. With Arabidopsis (Arabidopsis thaliana) microarray data annotated to the PathoPlant database, 732 different queries with a focus on fungal and oomycete pathogens were performed, leading to 510 up-regulated gene groups. Using the binding site estimation suite of tools, BEST, 407 conserved sequence motifs were identified in promoter regions of these coregulated gene sets. Motif similarities were determined with STAMP, classifying the 407 sequence motifs into 37 families. A comparative analysis of these 37 families with the AthaMap, PLACE, and AGRIS databases revealed similarities to known cis-elements but also led to the discovery of cis-sequences not yet implicated in pathogen response. Using a parsley (Petroselinum crispum) protoplast system and a modified reporter gene vector with an internal transformation control, 25 elicitor-responsive cis-sequences from 10 different motif families were identified. Many of the elicitor-responsive cis-sequences also drive reporter gene expression in an Agrobacterium tumefaciens infection assay in Nicotiana benthamiana. This work significantly increases the number of known elicitor-responsive cis-sequences and demonstrates the successful integration of a diverse set of bioinformatic resources combined with synthetic promoter analysis for data mining and functional screening in plant-pathogen interaction. PMID:22744985

  15. Nucleotide sequence and expression of alpha-glucosidase-encoding gene (agdA) from Aspergillus oryzae.


    Minetoki, T; Gomi, K; Kitamoto, K; Kumagai, C; Tamura, G


    We have isolated an alpha-glucosidase(AGL)-encoding gene (agdA) from Aspergillus oryzae by heterologous hybridization using the corresponding Aspergillus niger gene as a probe. Southern hybridization analysis showed that the agdA gene is on a 5.0-kb ScaI fragment and there is a single copy in the A. oryzae chromosome. Comparison with the A. niger agdA gene indicated that the agdA gene contains three putative introns from 52 to 59 nucleotides long, and that it encodes 985 amino acid residues. The deduced amino acid sequence of A. oryzae AGL is 78% homologous with the A. niger AGL. The high degree of homology with the amino acid sequence bordering the putative catalytic residue of a number of AGL enzymes, and this enzyme suggests that Asp492 is a catalytic residue of A. oryzae AGL. The cloned gene was functional. Transformants of A. oryzae containing multiple copies of the cloned agdA gene showed a 6-16 fold increase in AGL activity. Like the Taka-amylase A and glucoamylase genes of A. oryzae, expression of the agdA gene was induced when maltose was provided as a carbon source, but expression was not induced by glucose. This result suggested that cis-element(s) involved in maltose induction may be also present in the agdA promoter region. PMID:7549103

  16. Structural and functional analysis of the mouse mdr1b gene promoter.


    Cohen, D; Piekarz, R L; Hsu, S I; DePinho, R A; Carrasco, N; Horwitz, S B


    The overproduction of P-glycoprotein, an integral membrane protein thought to function as a drug efflux pump, is the hallmark of the multidrug resistance phenotype. In murine multidrug resistant J774.2 cell lines, distinct mdr genes, mdr1a and mdr1b, encode unique P-glycoprotein isoforms. To examine the transcriptional regulation of the mdr1b gene, its promoter was isolated and characterized. The transcription initiation site was mapped by primer extension, and the 5'-flanking region was sequenced. Several potential regulatory elements were identified in this region. A transient expression vector was constructed by fusion of 540 base pairs of 5'-flanking sequence and part of the first untranslated exon to the chloramphenicol acetyltransferase (CAT) gene. When transfected into monkey kidney COS-1, rat pituitary GH3 or T47D human breast cells, the mdr1b 5'-flanking sequences were capable of driving CAT expression. Transient transfection studies using deletion subclones of the mdr1b-CAT construct were done to locate potential cis-acting sequences. The studies indicate the presence of cis-acting elements in the 5'-flanking region of the mdr1b gene. The implications of these findings for expression and regulation of the mdr1b gene are discussed. PMID:1671222

  17. Recurrent epimutations activate gene body promoters in primary glioblastoma.


    Nagarajan, Raman P; Zhang, Bo; Bell, Robert J A; Johnson, Brett E; Olshen, Adam B; Sundaram, Vasavi; Li, Daofeng; Graham, Ashley E; Diaz, Aaron; Fouse, Shaun D; Smirnov, Ivan; Song, Jun; Paris, Pamela L; Wang, Ting; Costello, Joseph F


    Aberrant DNA hypomethylation may play an important role in the growth rate of glioblastoma (GBM), but the functional impact on transcription remains poorly understood. We assayed the GBM methylome with MeDIP-seq and MRE-seq, adjusting for copy number differences, in a small set of non-glioma CpG island methylator phenotype (non-G-CIMP) primary tumors. Recurrent hypomethylated loci were enriched within a region of chromosome 5p15 that is specified as a cancer amplicon and also encompasses TERT, encoding telomerase reverse transcriptase, which plays a critical role in tumorigenesis. Overall, 76 gene body promoters were recurrently hypomethylated, including TERT and the oncogenes GLI3 and TP73. Recurring hypomethylation also affected previously unannotated alternative promoters, and luciferase reporter assays for three of four of these promoters confirmed strong promoter activity in GBM cells. Histone H3 lysine 4 trimethylation (H3K4me3) ChIP-seq on tissue from the GBMs uncovered peaks that coincide precisely with tumor-specific decrease of DNA methylation at 200 loci, 133 of which are in gene bodies. Detailed investigation of TP73 and TERT gene body hypomethylation demonstrated increased expression of corresponding alternate transcripts, which in TP73 encodes a truncated p73 protein with oncogenic function and in TERT encodes a putative reverse transcriptase-null protein. Our findings suggest that recurring gene body promoter hypomethylation events, along with histone H3K4 trimethylation, alter the transcriptional landscape of GBM through the activation of a limited number of normally silenced promoters within gene bodies, in at least one case leading to expression of an oncogenic protein. PMID:24709822

  18. Combinatorial Pooling Enables Selective Sequencing of the Barley Gene Space

    PubMed Central

    Lonardi, Stefano; Duma, Denisa; Alpert, Matthew; Cordero, Francesca; Beccuti, Marco; Bhat, Prasanna R.; Wu, Yonghui; Ciardo, Gianfranco; Alsaihati, Burair; Ma, Yaqin; Wanamaker, Steve; Resnik, Josh; Bozdag, Serdar; Luo, Ming-Cheng; Close, Timothy J.


    For the vast majority of species – including many economically or ecologically important organisms, progress in biological research is hampered due to the lack of a reference genome sequence. Despite recent advances in sequencing technologies, several factors still limit the availability of such a critical resource. At the same time, many research groups and international consortia have already produced BAC libraries and physical maps and now are in a position to proceed with the development of whole-genome sequences organized around a physical map anchored to a genetic map. We propose a BAC-by-BAC sequencing protocol that combines combinatorial pooling design and second-generation sequencing technology to efficiently approach denovo selective genome sequencing. We show that combinatorial pooling is a cost-effective and practical alternative to exhaustive DNA barcoding when preparing sequencing libraries for hundreds or thousands of DNA samples, such as in this case gene-bearing minimum-tiling-path BAC clones. The novelty of the protocol hinges on the computational ability to efficiently compare hundred millions of short reads and assign them to the correct BAC clones (deconvolution) so that the assembly can be carried out clone-by-clone. Experimental results on simulated data for the rice genome show that the deconvolution is very accurate, and the resulting BAC assemblies have high quality. Results on real data for a gene-rich subset of the barley genome confirm that the deconvolution is accurate and the BAC assemblies have good quality. While our method cannot provide the level of completeness that one would achieve with a comprehensive whole-genome sequencing project, we show that it is quite successful in reconstructing the gene sequences within BACs. In the case of plants such as barley, this level of sequence knowledge is sufficient to support critical end-point objectives such as map-based cloning and marker-assisted breeding. PMID:23592960

  19. The long-range interaction landscape of gene promoters.


    Sanyal, Amartya; Lajoie, Bryan R; Jain, Gaurav; Dekker, Job


    The vast non-coding portion of the human genome is full of functional elements and disease-causing regulatory variants. The principles defining the relationships between these elements and distal target genes remain unknown. Promoters and distal elements can engage in looping interactions that have been implicated in gene regulation. Here we have applied chromosome conformation capture carbon copy (5C) to interrogate comprehensively interactions between transcription start sites (TSSs) and distal elements in 1% of the human genome representing the ENCODE pilot project regions. 5C maps were generated for GM12878, K562 and HeLa-S3 cells and results were integrated with data from the ENCODE consortium. In each cell line we discovered >1,000 long-range interactions between promoters and distal sites that include elements resembling enhancers, promoters and CTCF-bound sites. We observed significant correlations between gene expression, promoter-enhancer interactions and the presence of enhancer RNAs. Long-range interactions show marked asymmetry with a bias for interactions with elements located ∼120 kilobases upstream of the TSS. Long-range interactions are often not blocked by sites bound by CTCF and cohesin, indicating that many of these sites do not demarcate physically insulated gene domains. Furthermore, only ∼7% of looping interactions are with the nearest gene, indicating that genomic proximity is not a simple predictor for long-range interactions. Finally, promoters and distal elements are engaged in multiple long-range interactions to form complex networks. Our results start to place genes and regulatory elements in three-dimensional context, revealing their functional relationships. PMID:22955621

  20. The nucleotide sequence of the bacteriophage T5 ltf gene.


    Kaliman, A V; Kulshin, V E; Shlyapnikov, M G; Ksenzenko, V N; Kryukov, V M


    The nucleotide sequence of the bacteriophage T5 Bg/II-BamHI fragment (4,835 bp in length) known to carry a gene encoding the LTF protein which forms the phage L-shaped tail fibers was determined. It was shown to contain an open reading frame for 1,396 amino acid residues that corresponds to a protein of 147.8 kDa. The coding region of ltf gene is preceded by a typical Shine-Dalgarno sequence. Downstream from the ltf gene there is a strong transcription terminator. Data bank analysis of the LTF protein sequence reveals 55.1% identity to the hypothetical protein ORF 401 of bacteriophage lambda in a segment of 118 amino acids overlap. PMID:7789514

  1. Chymotrypsin protease inhibitor gene family in rice: Genomic organization and evidence for the presence of a bidirectional promoter shared between two chymotrypsin protease inhibitor genes.


    Singh, Amanjot; Sahi, Chandan; Grover, Anil


    Protease inhibitors play important roles in stress and developmental responses of plants. Rice genome contains 17 putative members in chymotrypsin protease inhibitor (ranging in size from 7.21 to 11.9 kDa) gene family with different predicted localization sites. Full-length cDNA encoding for a putative subtilisin-chymotrypsin protease inhibitor (OCPI2) was obtained from Pusa basmati 1 (indica) rice seedlings. 620 bp-long OCPI2 cDNA contained 219 bp-long ORF, coding for 72 amino acid-long 7.7 kDa subtilisin-chymotrypsin protease inhibitor (CPI) cytoplasmic protein. Expression analysis by semi-quantitative RT-PCR analysis showed that OCPI2 transcript is induced by varied stresses including salt, ABA, low temperature and mechanical injury in both root and shoot tissues of the seedlings. Transgenic rice plants produced with OCPI2 promoter-gus reporter gene showed that this promoter directs high salt- and ABA-regulated expression of the GUS gene. Another CPI gene (OCPI1) upstream to OCPI2 (with 1126 bp distance between the transcription initiation sites of the two genes; transcription in the reverse orientation) was noted in genome sequence of rice genome. A vector that had GFP and GUS reporter genes in opposite orientations driven by 1881 bp intergenic sequence between the OCPI2 and OCPI1 (encompassing the region between the translation initiation sites of the two genes) was constructed and shot in onion epidermal cells by particle bombardment. Expression of both GFP and GUS from the same epidermal cell showed that this sequence represents a bidirectional promoter. Examples illustrating gene pairs showing co-expression of two divergent neighboring genes sharing a bidirectional promoter have recently been extensively worked out in yeast and human systems. We provide an example of a gene pair constituted of two homologous genes showing co-expression governed by a bidirectional promoter in rice. PMID:18952157

  2. Localisation of cis elements in the promoter of a wheat alpha-Amy2 gene.


    Huttly, A K; Phillips, A L; Tregear, J W


    A functional analysis of the promoter from the wheat alpha-amylase gene alpha-Amy2/54 is described. Mutant alpha-Amy2/54 promoters containing replacements or deletions were constructed and their ability to direct expression of the reporter gene beta-glucuronidase (GUS) in gibberellin-responsive oat aleurone protoplasts analysed. Chimaeric promoters using regions of the cauliflower mosaic virus (CaMV) 35S and alpha-Amy2/54 promoters were also analysed. The results suggest that at least three regions within the alpha-Amy2/54 promoter contain cis elements that are necessary for high-level gibberellin-regulated transcription. Fusion of 1.8 kb of promoter sequence upstream from -117 bp to a minimal (-55 CaMV 35S) promoter gave rise to hormone-independent expression implying that the region 3' to -117 bp contains an element which represses transcription in the absence of gibberellin or presence of abscisic acid. PMID:1511136

  3. Influence of transcriptional and translational control sequences on the expression of foreign genes in Caulobacter crescentus.

    PubMed Central

    Yap, W H; Thanabalu, T; Porter, A G


    The influence of expression control sequences (ECSs; promoters and ribosome-binding sites [RBSs]), transcriptional terminators, and gene orientation on the expression of the Escherichia coli lacZ gene in the gram-negative microorganisms Caulobacter crescentus and E. coli was investigated. A series of broad-host-range expression vectors, based on the RK2 plasmid derivative pRK248, were constructed. The ECSs included the tac promoter, the promoter for the surface layer protein of C. crescentus, and promoters from a number of gram-positive bacteria together with their associated RBSs. In addition, synthetic ECSs were constructed by using different combinations of promoters and RBSs. lacZ expression was found to be dependent on the nature of the promoter and RBS and, to a lesser extent, on the presence of a transcriptional terminator and the orientation of the promoter-lacZ construct in pRK248. The relative efficiencies of the various ECSs in driving lacZ expression differed markedly in C. crescentus and E. coli. In C. crescentus, the ECS ptac1 (tac promoter and consensus RBS for C. crescentus mRNAs) appeared to be the most efficient, producing 12-fold-higher activity than did pSL (promoter for the surface layer protein of C. crescentus and its putative RBS). pSL was not transcribed in E. coli, whereas various promoters from gram-positive microorganisms were transcribed in both C. crescentus and E. coli. A number of ECSs were also used to drive mosquitocidal toxin gene expression in C. crescentus, and a correlation between toxin expression and lacZ expression was observed. PMID:8169208

  4. [Cloning and regulation of pig estrogen related receptor β gene (ESRRB) promoter].


    Yang, Yang; Wang, Yaxian; Du, Lixia; Wang, Huayan


    The estrogen related receptor family member Esrrb (Estrogen related receptor β) is a gene that expresses in the early stage of embryo and plays an important role in the core pluripotent network. Its function has been analyzed in human and mouse, although no report so far related to pig. Therefore, to explore its mechanism of transcriptional regulation and expression pattern, we cloned a 3.3 kb pig ESRRB promoter by PCR and constructed the green fluorescence protein (GFP) reporter vector pE3.3. We used these vectors to study the ESRRB expression pattern in 293T, Hela and C2C12. Sequence was analyzed for regulatory elements that share homology to known transcription factor binding sites by TFSEARCH and JASPER program. Some pluripotency related genes such as SMAD, STAT3, MYC, KLF4 and ESRRB have been found within the 3.3 kb sequence by co-transfected pig ESRRB promoter and these potential regulators. We found that ESRRB only expressed in 293T and SMAD could activate ESRRB expression obviously. To determine the core promoter region, a series of ESRRB promoter fragments with gradually truncated 5'-end were produced by PCR and inserted into pGL3-Basic vector. After transient transfection into 293T, dual luciferase assay was used to measure these promoter activities. The result suggested that the core promoter of pig ESRRB located within -25 bp to -269 bp region. These results suggest that these transcription factor binding sites and the core promoter region may be essential for transcriptional regulation of pig ESRRB gene. PMID:26380406

  5. Diverse nucleotide compositions and sequence fluctuation in Rubisco protein genes

    NASA Astrophysics Data System (ADS)

    Holden, Todd; Dehipawala, S.; Cheung, E.; Bienaime, R.; Ye, J.; Tremberger, G., Jr.; Schneider, P.; Lieberman, D.; Cheung, T.


    The Rubisco protein-enzyme is arguably the most abundance protein on Earth. The biology dogma of transcription and translation necessitates the study of the Rubisco genes and Rubisco-like genes in various species. Stronger correlation of fractal dimension of the atomic number fluctuation along a DNA sequence with Shannon entropy has been observed in the studied Rubisco-like gene sequences, suggesting a more diverse evolutionary pressure and constraints in the Rubisco sequences. The strategy of using metal for structural stabilization appears to be an ancient mechanism, with data from the porphobilinogen deaminase gene in Capsaspora owczarzaki and Monosiga brevicollis. Using the chi-square distance probability, our analysis supports the conjecture that the more ancient Rubisco-like sequence in Microcystis aeruginosa would have experienced very different evolutionary pressure and bio-chemical constraint as compared to Bordetella bronchiseptica, the two microbes occupying either end of the correlation graph. Our exploratory study would indicate that high fractal dimension Rubisco sequence would support high carbon dioxide rate via the Michaelis- Menten coefficient; with implication for the control of the whooping cough pathogen Bordetella bronchiseptica, a microbe containing a high fractal dimension Rubisco-like sequence (2.07). Using the internal comparison of chi-square distance probability for 16S rRNA (~ E-22) versus radiation repair Rec-A gene (~ E-05) in high GC content Deinococcus radiodurans, our analysis supports the conjecture that high GC content microbes containing Rubisco-like sequence are likely to include an extra-terrestrial origin, relative to Deinococcus radiodurans. Similar photosynthesis process that could utilize host star radiation would not compete with radiation resistant process from the biology dogma perspective in environments such as Mars and exoplanets.

  6. Repression of the Drosophila proliferating-cell nuclear antigen gene promoter by zerknuellt protein

    SciTech Connect

    Yamaguchi, Masamitsu; Hirose, Fumiko; Nishida, Yasuyoshi; Matsukage, Akio )


    A 631-bp fragment containing the 5{prime}-flanking region of the Drosophila melanogaster proliferating-cell nuclear antigen (PCNA) gene was placed upstream of the chloramphenicol acetyltransferase (CAT) gene of a CAT vector. A transient expression assay of CAT activity in Drosophila Kc cells transfected with this plasmid and a set of 5{prime}-deletion derivatives revealed that the promoter function resided within a 192-bp region. Cotransfection with a zerknuellt (zen)-expressing plasmid specifically repressed CAT expression. However, cotransfection with expression plasmids for a nonfunctional zen mutation, even skipped, or bicoid showed no significant effect on CAT expression. RNase protection analysis revealed that the repression by zen was at the transcription step. The target sequence of zen was mapped within the 34-bp region of the PCNA gene promoter, even though it lacked zen protein-binding sites. Transgenic flies carrying the PCNA gene regulatory region fused with lacZ were established. These results indicate that zen indirectly represses PCNA gene expression, probably by regulating the expression of some transcription factor(s) that binds to the PCNA gene promoter.

  7. Molecular Analysis of the Sequences Surrounding blaOXA-45 Reveals Acquisition of This Gene by Pseudomonas aeruginosa via a Novel ISCR Element, ISCR5▿

    PubMed Central

    Li, Hongyang; Walsh, Timothy R.; Toleman, Mark A.


    The blaOXA-45 gene of Pseudomonas aeruginosa 07-406 is driven by a promoter found within a truncated ISPme1 insertion sequence. The gene is located between nonidentical repeats of a new ISCR element, ISCR5, which is likely responsible for its acquisition. Sequence analysis indicates that ISCR5 is a chimera of ISCR3 and ISCR16. PMID:19064894

  8. Cloning and functional analysis of human acyl coenzyme A: Cholesterol acyltransferase1 gene P1 promoter.


    Ge, Jing; Cheng, Bei; Qi, Benling; Peng, Wen; Wen, Hui; Bai, Lijuan; Liu, Yun; Zhai, Wei


    Acyl-coenzyme A: cholesterol acyltransferase 1 (ACAT1) catalyzes the conversion of free cholesterol (FC) to cholesterol ester. The human ACAT1 gene P1 promoter has been cloned. However, the activity and specificity of the ACAT1 gene P1 promoter in diverse cell types remains unclear. The P1 promoter fragment was digested with KpnI/XhoI from a P1 promoter cloning vector, and was subcloned into the multiple cloning site of the Firefly luciferase vector pGL3‑Enhancer to obtain the construct P1E‑1. According to the analysis of biological information, the P1E‑1 plasmid was used to generate deletions of the ACAT1 gene P1 promoter with varying 5' ends and an identical 3' end at +65 by polymerase chain reaction (PCR). All the 5'‑deletion constructs of the P1 promoter were identified by PCR, restriction enzyme digestion mapping and DNA sequencing. The transcriptional activity of each construct was detected after transient transfection into THP‑1, HepG2, HEK293 and Hela cells using DEAE‑dextran and Lipofectamine 2000 liposome transfection reagent. Results showed that the transcriptional activity of the ACAT1 gene P1 promoter and deletions of P1 promoter in THP‑1 and HepG2 cells was higher than that in HEK293 and HeLa cells. Moreover, the transcriptional activity of P1E‑9 was higher compared with those of other deletions in THP‑1, HepG2, HEK293 and HeLa cells. These findings indicate that the transcriptional activity of the P1 promoter and the effects of deletions vary with different cell lines. Thus, the P1 promoter may drive ACAT1 gene expression with cell‑type specificity. In addition, the core sequence of ACAT1 gene P1 promoter was suggested to be between -125 and +65 bp. PMID:27220725

  9. Analysis of tissue-specific region in sericin 1 gene promoter of Bombyx mori

    SciTech Connect

    Liu Yan; Yu Lian; Guo Xiuyang; Guo Tingqing; Wang Shengpeng; Lu Changde . E-mail:


    The gene encoding sericin 1 (Ser1) of silkworm (Bombyx mori) is specifically expressed in the middle silk gland cells. To identify element involved in this transcription-dependent spatial restriction, truncation of the 5' terminal from the sericin 1 (Ser1) promoter is studied in vivo. A 209 bp DNA sequence upstream of the transcriptional start site (-586 to -378) is found to be responsible for promoting tissue-specific transcription. Analysis of this 209 bp region by overlapping deletion studies showed that a 25 bp region (-500 to -476) suppresses the ectopic expression of the Ser1 promoter. An unknown factor abundant in fat body nuclear extracts is shown to bind to this 25 bp fragment. These results suggest that this 25 bp region and the unknown factor are necessary for determining the tissue-specificity of the Ser1 promoter.

  10. Repressive BMP2 gene regulatory elements near the BMP2 promoter

    SciTech Connect

    Jiang, Shan; Chandler, Ronald L.; Fritz, David T.; Mortlock, Douglas P.; Rogers, Melissa B.


    The level of bone morphogenetic protein 2 (BMP2) profoundly influences essential cell behaviors such as proliferation, differentiation, apoptosis, and migration. The spatial and temporal pattern of BMP2 synthesis, particular in diverse embryonic cells, is highly varied and dynamic. We have identified GC-rich sequences within the BMP2 promoter region that strongly repress gene expression. These elements block the activity of a highly conserved, osteoblast enhancer in response to FGF2 treatment. Both positive and negative gene regulatory elements control BMP2 synthesis. Detecting and mapping the repressive motifs is essential because they impede the identification of developmentally regulated enhancers necessary for normal BMP2 patterns and concentration.

  11. Quantitative Analyses of Core Promoters Enable Precise Engineering of Regulated Gene Expression in Mammalian Cells.


    Ede, Christopher; Chen, Ximin; Lin, Meng-Yin; Chen, Yvonne Y


    Inducible transcription systems play a crucial role in a wide array of synthetic biology circuits. However, the majority of inducible promoters are constructed from a limited set of tried-and-true promoter parts, which are susceptible to common shortcomings such as high basal expression levels (i.e., leakiness). To expand the toolbox for regulated mammalian gene expression and facilitate the construction of mammalian genetic circuits with precise functionality, we quantitatively characterized a panel of eight core promoters, including sequences with mammalian, viral, and synthetic origins. We demonstrate that this selection of core promoters can provide a wide range of basal gene expression levels and achieve a gradient of fold-inductions spanning 2 orders of magnitude. Furthermore, commonly used parts such as minimal CMV and minimal SV40 promoters were shown to achieve robust gene expression upon induction, but also suffer from high levels of leakiness. In contrast, a synthetic promoter, YB_TATA, was shown to combine low basal expression with high transcription rate in the induced state to achieve significantly higher fold-induction ratios compared to all other promoters tested. These behaviors remain consistent when the promoters are coupled to different genetic outputs and different response elements, as well as across different host-cell types and DNA copy numbers. We apply this quantitative understanding of core promoter properties to the successful engineering of human T cells that respond to antigen stimulation via chimeric antigen receptor signaling specifically under hypoxic environments. Results presented in this study can facilitate the design and calibration of future mammalian synthetic biology systems capable of precisely programmed functionality. PMID:26883397

  12. Cloning and Functional Analysis of the Promoter of an Ascorbate Oxidase Gene from Gossypium hirsutum.


    Xin, Shan; Tao, Chengcheng; Li, Hongbin


    Apoplastic ascorbate oxidase (AO) plays significant roles in plant cell growth. However, the mechanism of underlying the transcriptional regulation of AO in Gossypium hirsutum remains unclear. Here, we obtained a 1,920-bp promoter sequence from the Gossypium hirsutum ascorbate oxidase (GhAO1) gene, and this GhAO1 promoter included a number of known cis-elements. Promoter activity analysis in overexpressing pGhAO1::GFP-GUS tobacco (Nicotiana benthamiana) showed that the GhAO1 promoter exhibited high activity, driving strong reporter gene expression in tobacco trichomes, leaves and roots. Promoter 5'-deletion analysis demonstrated that truncated GhAO1 promoters with serial 5'-end deletions had different GUS activities. A 360-bp fragment was sufficient to activate GUS expression. The P-1040 region had less GUS activity than the P-720 region, suggesting that the 320-bp region from nucleotide -720 to -1040 might include a cis-element acting as a silencer. Interestingly, an auxin-responsive cis-acting element (TGA-element) was uncovered in the promoter. To analyze the function of the TGA-element, tobacco leaves transformed with promoters with different 5' truncations were treated with indole-3-acetic acid (IAA). Tobacco leaves transformed with the promoter regions containing the TGA-element showed significantly increased GUS activity after IAA treatment, implying that the fragment spanning nucleotides -1760 to -1600 (which includes the TGA-element) might be a key component for IAA responsiveness. Analyses of the AO promoter region and AO expression pattern in Gossypium arboreum (Ga, diploid cotton with an AA genome), Gossypium raimondii (Gr, diploid cotton with a DD genome) and Gossypium hirsutum (Gh, tetraploid cotton with an AADD genome) indicated that AO promoter activation and AO transcription were detected together only in D genome/sub-genome (Gr and Gh) cotton. Taken together, these results suggest that the 1,920-bp GhAO1 promoter is a functional sequence with a

  13. Illumina MiSeq sequencing disfavours a sequence motif in the GFP reporter gene

    PubMed Central

    Van den Hoecke, Silvie; Verhelst, Judith; Saelens, Xavier


    Green fluorescent protein (GFP) is one of the most used reporter genes. We have used next-generation sequencing (NGS) to analyse the genetic diversity of a recombinant influenza A virus that expresses GFP and found a remarkable coverage dip in the GFP coding sequence. This coverage dip was present when virus-derived RT-PCR product or the parental plasmid DNA was used as starting material for NGS and regardless of whether Nextera XT transposase or Covaris shearing was used for DNA fragmentation. Therefore, the sequence coverage dip in the GFP coding sequence was not the result of emerging GFP mutant viruses or a bias introduced by Nextera XT fragmentation. Instead, we found that the Illumina MiSeq sequencing method disfavours the ‘CCCGCC’ motif in the GFP coding sequence. PMID:27193250

  14. Illumina MiSeq sequencing disfavours a sequence motif in the GFP reporter gene.


    Van den Hoecke, Silvie; Verhelst, Judith; Saelens, Xavier


    Green fluorescent protein (GFP) is one of the most used reporter genes. We have used next-generation sequencing (NGS) to analyse the genetic diversity of a recombinant influenza A virus that expresses GFP and found a remarkable coverage dip in the GFP coding sequence. This coverage dip was present when virus-derived RT-PCR product or the parental plasmid DNA was used as starting material for NGS and regardless of whether Nextera XT transposase or Covaris shearing was used for DNA fragmentation. Therefore, the sequence coverage dip in the GFP coding sequence was not the result of emerging GFP mutant viruses or a bias introduced by Nextera XT fragmentation. Instead, we found that the Illumina MiSeq sequencing method disfavours the 'CCCGCC' motif in the GFP coding sequence. PMID:27193250

  15. Exploiting single-molecule transcript sequencing for eukaryotic gene prediction.


    Minoche, André E; Dohm, Juliane C; Schneider, Jessica; Holtgräwe, Daniela; Viehöver, Prisca; Montfort, Magda; Sörensen, Thomas Rosleff; Weisshaar, Bernd; Himmelbauer, Heinz


    We develop a method to predict and validate gene models using PacBio single-molecule, real-time (SMRT) cDNA reads. Ninety-eight percent of full-insert SMRT reads span complete open reading frames. Gene model validation using SMRT reads is developed as automated process. Optimized training and prediction settings and mRNA-seq noise reduction of assisting Illumina reads results in increased gene prediction sensitivity and precision. Additionally, we present an improved gene set for sugar beet (Beta vulgaris) and the first genome-wide gene set for spinach (Spinacia oleracea). The workflow and guidelines are a valuable resource to obtain comprehensive gene sets for newly sequenced genomes of non-model eukaryotes. PMID:26328666

  16. Promoter Structure of the RNA Polymerase II Large Subunit Gene in Caenorhabditis elegans and C. briggsae

    PubMed Central

    Bird, D. McK.; Kaloshian, I.; Molinari, S.


    The 5'-end of the Caenorhabditis elegans ama-1 gene transcript, which encodes the largest subunit of RNA polymerase II, was cloned. Sequencing revealed that the message is trans-spliced. To characterize the Ce-ama-1 promoter, DNA sequence spanning 3 kb upstream from the initiation codon was determined. Typical elements, such as TATA and Spl sites, were absent. The homologue of ama-1 in C. briggsae, Cb-ama-1, was isolated and its 5' flanking sequence compared with that of Ce-ama-1, revealing only limited similarity, although both sequences included a potential initiator-class transcriptional regulator and phased repeats of an AT₃C motif. The latter elements are postulated to facilitate DNA bending and may play a role in transcription regulation. PMID:19274143

  17. Gene Transfer Strategies to Promote Chondrogenesis and Cartilage Regeneration.


    Im, Gun-Il


    Gene transfer has been used experimentally to promote chondrogenesis and cartilage regeneration. While it is controversial to apply gene therapy for nonlethal conditions such as cartilage defect, there is a possibility that the transfer of therapeutic transgenes may dramatically increase the effectiveness of cell therapy and reduce the quantity of cells that are needed to regenerate cartilage. Single or combination of growth factors and transcription factors has been transferred to mesenchymal stem cells or articular chondrocytes using both nonviral and viral approaches. The current challenge for the clinical applications of genetically modified cells is ensuring the safety of gene therapy while guaranteeing effectiveness. Viral gene delivery methods have been mainstays currently with enhanced safety features being recently refined. On the other hand, efficiency has been greatly improved in nonviral delivery. This review summarizes the history and recent update on the gene transfer to enhance chondrogenesis from stem cells or articular chondrocytes. PMID:26414246

  18. Clustering of Cancer Cell Lines Using A Promoter- Targeted Liquid Hybridization Capture-Based Bisulfite Sequencing Approach.


    Gao, Fei; Wang, Junwen; Ji, Guanyu; Liu, Siyang; Yao, Yu; Wang, Tong; Wu, Honglong; Xia, Yudong; Gong, Desheng; Jiang, Hui; Yang, Huanming; Zhang, Xiuqing


    DNA methylation plays a significant role in assuring cell identity, thus potentiating its application in molecular classification of cancers in respect to tissue-origins or clinically and etiologically distinct subtypes. In this study, we optimized our liquid hybridization capture-based bisulfite sequencing (LHC-BS) approach on the gene promoter regions of 11 cell lines. Our results indicated that promoter methylomes could not only cluster cancer cell lines with respect to tissue origins but also differentiate cancer subtypes based on CpG island methylator phenotype (CIMP). Promoter-targeted LHC-BS as means for comprehensive screening and classifying cancer cells with promoter methylomes provided a powerful strategy for further complex clinical studies. PMID:26269607

  19. Conditional promoters for analysis of essential genes in Zymoseptoria tritici.


    Kilaru, S; Ma, W; Schuster, M; Courbot, M; Steinberg, G


    Development of new fungicides, needed for sustainable control of fungal plant pathogens, requires identification of novel anti-fungal targets. Essential fungal-specific proteins are good candidates, but due to their importance, gene deletion mutants are not viable. Consequently, their cellular role often remains elusive. This hindrance can be overcome by the use of conditional mutants, where expression is controlled by an inducible/repressible promoter. Here, we introduce 5 inducible/repressible promoter systems to study essential genes in the wheat pathogen Zymoseptoria tritici. We fused the gene for enhanced green-fluorescent protein (egfp) to the promoter region of Z. tritici nitrate reductase (Pnar1; induced by nitrogen and repressed by ammonium), 1,4-β-endoxylanase A (Pex1A; induced by xylose and repressed by maltodextrin), l-arabinofuranosidase B (PlaraB; induced by arabinose and repressed by glucose), galactose-1-phosphate uridylyltransferase 7 (Pgal7; induced by galactose and repressed by glucose) and isocitrate lyase (Picl1; induced by sodium acetate and repressed by glucose). This was followed by quantitative analysis of cytoplasmic reporter fluorescence under induced and repressed conditions. We show that Pnar1, PlaraB and Pex1A drive very little or no egfp expression when repressed, but induce moderate protein production when induced. In contrast, Pgal7 and Picl1 show considerable egfp expression when repressed, and were strongly induced in the presence of their inducers. Normalising the expression levels of all promoters to that of the α-tubulin promoter Ptub2 revealed that PlaraB was the weakest promoter (∼20% of Ptub2), whereas Picl1 strongly expressed the reporter (∼250% of Ptub2). The use of these tools promises a better understanding of essential genes, which will help developing novel control strategies that protect wheat from Z. tritici. PMID:26092803

  20. Epigenomic elements enriched in the promoters of autoimmunity susceptibility genes.


    Dozmorov, Mikhail G; Wren, Jonathan D; Alarcón-Riquelme, Marta E


    Genome-wide association studies have identified a number of autoimmune disease-susceptibility genes. Whether or not these loci share any regulatory or functional elements, however, is an open question. Finding such common regulators is of considerable research interest in order to define systemic therapeutic targets. The growing amount of experimental genomic annotations, particularly those from the ENCODE project, provide a wealth of opportunities to search for such commonalities. We hypothesized that regulatory commonalities might not only delineate a regulatory landscape predisposing to autoimmune diseases, but also define functional elements distinguishing specific diseases. We further investigated if, and how, disease-specific epigenomic elements can identify novel genes yet to be associated with the diseases. We evaluated transcription factors, histone modifications, and chromatin state data obtained from the ENCODE project for statistically significant over- or under-representation in the promoters of genes associated with Systemic Lupus Erythematosus (SLE), Rheumatoid Arthritis (RA), and Systemic Sclerosis (SSc). We identified BATF, BCL11A, IRF4, NFkB, PAX5, and PU.1 as transcription factors over-represented in SLE- and RA-susceptibility gene promoters. H3K4me1 and H3K4me2 epigenomic marks were associated with SLE susceptibility genes, and H3K9me3 was common to both SLE and RA. In contrast to a transcriptionally active signature in SLE and RA, SSc-susceptibility genes were depleted in activating epigenomic elements. Using epigenomic elements enriched in SLE and RA, we identified additional immune and B cell signaling-related genes with the same elements in their promoters. Our analysis suggests common and disease-specific epigenomic elements that may define novel therapeutic targets for controlling aberrant activation of autoimmune susceptibility genes. PMID:24213554

  1. Sequence and gene expression evolution of paralogous genes in willows.


    Harikrishnan, Srilakshmy L; Pucholt, Pascal; Berlin, Sofia


    Whole genome duplications (WGD) have had strong impacts on species diversification by triggering evolutionary novelties, however, relatively little is known about the balance between gene loss and forces involved in the retention of duplicated genes originating from a WGD. We analyzed putative Salicoid duplicates in willows, originating from the Salicoid WGD, which took place more than 45 Mya. Contigs were constructed by de novo assembly of RNA-seq data derived from leaves and roots from two genotypes. Among the 48,508 contigs, 3,778 pairs were, based on fourfold synonymous third-codon transversion rates and syntenic positions, predicted to be Salicoid duplicates. Both copies were in most cases expressed in both tissues and 74% were significantly differentially expressed. Mean Ka/Ks was 0.23, suggesting that the Salicoid duplicates are evolving by purifying selection. Gene Ontology enrichment analyses showed that functions related to DNA- and nucleic acid binding were over-represented among the non-differentially expressed Salicoid duplicates, while functions related to biosynthesis and metabolism were over-represented among the differentially expressed Salicoid duplicates. We propose that the differentially expressed Salicoid duplicates are regulatory neo- and/or subfunctionalized, while the non-differentially expressed are dose sensitive, hence, functionally conserved. Multiple evolutionary processes, thus drive the retention of Salicoid duplicates in willows. PMID:26689951

  2. Sequence and gene expression evolution of paralogous genes in willows

    PubMed Central

    Harikrishnan, Srilakshmy L.; Pucholt, Pascal; Berlin, Sofia


    Whole genome duplications (WGD) have had strong impacts on species diversification by triggering evolutionary novelties, however, relatively little is known about the balance between gene loss and forces involved in the retention of duplicated genes originating from a WGD. We analyzed putative Salicoid duplicates in willows, originating from the Salicoid WGD, which took place more than 45 Mya. Contigs were constructed by de novo assembly of RNA-seq data derived from leaves and roots from two genotypes. Among the 48,508 contigs, 3,778 pairs were, based on fourfold synonymous third-codon transversion rates and syntenic positions, predicted to be Salicoid duplicates. Both copies were in most cases expressed in both tissues and 74% were significantly differentially expressed. Mean Ka/Ks was 0.23, suggesting that the Salicoid duplicates are evolving by purifying selection. Gene Ontology enrichment analyses showed that functions related to DNA- and nucleic acid binding were over-represented among the non-differentially expressed Salicoid duplicates, while functions related to biosynthesis and metabolism were over-represented among the differentially expressed Salicoid duplicates. We propose that the differentially expressed Salicoid duplicates are regulatory neo- and/or subfunctionalized, while the non-differentially expressed are dose sensitive, hence, functionally conserved. Multiple evolutionary processes, thus drive the retention of Salicoid duplicates in willows. PMID:26689951

  3. The Gene-Finder computer tools for analysis of human and model organisms genome sequences.


    Solovyev, V; Salamov, A


    We present a complex of new programs for promoter, 3'-processing, splice sites, coding exons and gene structure identification in genomic DNA of several model species. The human gene structure prediction program FGENEH, exon prediction-FEXH and splice site prediction-HSPL have been modified for sequence analysis of Drosophila (FGENED, FEXD and DSPL), C.elegance (FGENEN, FEXN and NSPL), Yeast (FEXY and YSPL) and Plant (FGENEA, FEXA and ASPL) genomic sequences. We recomputed all frequency and discriminant function parameters for these organisms and adjusted organism specific minimal intron lengths. An accuracy of coding region prediction for these programs is similar with the observed accuracy of FEXH and FGENEH. We have developed FEXHB and FGENEHB programs combining pattern recognition features and information about similarity of predicted exons with known sequences in protein databases. These programs have approximately 10% higher average accuracy of coding region recognition. Two new programs for human promoter site prediction (TSSG and TSSW) have been developed which use Gosh (1993) and Wingender (1994) data bases of functional motifs, respectively. POLYAH program was designed for prediction of 3'-processing regions in human genes and CDSB program was developed for bacterial gene prediction. We have developed a new approach to predict multiple genes based on double dynamic programming, that is very important for analysis of long genomic DNA fragments generated by genome sequencing projects. Analysis of uncharacterized sequences based on our methods is available through the University of Houston, Weizmann Institute of Science email servers and several Web pages at Baylor College of Medicine. PMID:9322052

  4. Nucleotide sequence corresponding to five chemotaxis genes in Escherichia coli.

    PubMed Central

    Mutoh, N; Simon, M I


    The nucleotide sequence of DNA which contains five chemotaxis-related genes of Escherichia coli, cheW, cheR, cheB, cheY, and cheZ, and part of the cheA gene was determined. Molecular weights of the polypeptides encoded by these genes were calculated from translated amino acid sequences, and they were 18,100 for cheW, 32,700 for cheR, 37,500 for cheB, 14,100 for cheY, and 24,000 for cheZ. Nucleotide sequences which could act as ribosome-binding sites were found in the upstream region of each gene. After the termination codon of the cheW gene, a typical rho-independent transcription termination signal was observed. There are no other open reading frames long enough to encode polypeptides in this region except those which code for the two previously reported genes tar and tap. PMID:3510184

  5. Chimeric DNA methyltransferases target DNA methylation to specific DNA sequences and repress expression of target genes

    PubMed Central

    Li, Fuyang; Papworth, Monika; Minczuk, Michal; Rohde, Christian; Zhang, Yingying; Ragozin, Sergei; Jeltsch, Albert


    Gene silencing by targeted DNA methylation has potential applications in basic research and therapy. To establish targeted methylation in human cell lines, the catalytic domains (CDs) of mouse Dnmt3a and Dnmt3b DNA methyltransferases (MTases) were fused to different DNA binding domains (DBD) of GAL4 and an engineered Cys2His2 zinc finger domain. We demonstrated that (i) Dense DNA methylation can be targeted to specific regions in gene promoters using chimeric DNA MTases. (ii) Site-specific methylation leads to repression of genes controlled by various cellular or viral promoters. (iii) Mutations affecting any of the DBD, MTase or target DNA sequences reduce targeted methylation and gene silencing. (iv) Targeted DNA methylation is effective in repressing Herpes Simplex Virus type 1 (HSV-1) infection in cell culture with the viral titer reduced by at least 18-fold in the presence of an MTase fused to an engineered zinc finger DBD, which binds a single site in the promoter of HSV-1 gene IE175k. In short, we show here that it is possible to direct DNA MTase activity to predetermined sites in DNA, achieve targeted gene silencing in mammalian cell lines and interfere with HSV-1 propagation. PMID:17151075

  6. The structure and complete nucleotide sequence of the human cyclophilin 40 (PPID) gene

    SciTech Connect

    Yokoi, Haruhiko; Shimizu, Yukiko; Anazawa, Hideharu


    Cyclophilin 40 is a recently identified member of the cyclophilin family that is found in an unactivated steroid hormone receptor complex. Cyclophilin 40 possesses a region homologous to FKBP59, a member of the FK506-binding protein family that is also a component of the receptor complex. We report the isolation and sequencing of the entire human cyclophilin 40 (hCyP40) gene (human gene symbol PPID). The gene contains 10 exons (43 to 698 bp) and 9 introns encompassing 14.2 kb. The exon organization of the cyclophilin-like region is not similar to that of the human cyclophilin A gene (PPIA), suggesting their early divergence in evolution. Determination of the sequence of the 5{prime} end of the hCyP40 mRNA by an {open_quotes}anchor-ligation PCR{close_quotes} procedure showed that transcription is initiated from a cluster of sites about 80 bp upstream from the first in-frame ATG. The immediate 5{prime}-flanking region of the gene lacks typical TATA and CAAT boxes, but is GC-rich and contains Sp1 sites, features characteristic of promoters associated with housekeeping genes. The hCyP40 gene was mapped to chromosome 4 by PCR with genomic DNA from somatic cell hybrids. As shown by {open_quotes}Zoo blot{close_quotes} analysis, the cylophilin 40 gene appears to be highly conserved throughout evolution. 47 refs., 4 figs., 1 tab.

  7. Chicken TAP genes differ from their human orthologues in locus organisation, size, sequence features and polymorphism.


    Walker, Brian A; van Hateren, Andrew; Milne, Sarah; Beck, Stephan; Kaufman, Jim


    We have previously shown that in the chicken major histocompatibility complex, the two transporters associated with antigen processing genes (TAP1 and TAP2) are located head to head between two classical class I genes. Here we show that the region between these two TAP genes has transcription factor-binding sites in common with class I gene promoters. The TAP genes are also up-regulated by interferon-gamma in a similar way to mammalian TAP genes and in a way that suggests they are both transcribed from a bi-directional promoter. The gene structures of TAP1 and TAP2 differ from that of human TAPs in that TAP1 has a truncated exon 1 and TAP2 has fused exons, resulting in a much smaller gene size. The truncation of TAP1 results in the loss of approximately 150 amino acids, which are thought to be involved in endoplasmic reticulum retention, heterodimer formation and tapasin binding, compared to human TAP1. Most of the protein sequence features involved in binding ATP are conserved, with two exceptions: chicken TAP1 has a glycine in the switch region where other TAPs have glutamine or histidine, and both chicken TAP genes have serines in the C motif where mammalian TAP2 has an alanine. Lastly, the chicken TAP genes are highly polymorphic, with at least as many TAP alleles as there are class I alleles, as seen by investigating nine inbred lines of chicken. The close proximity of the TAP genes to the class I genes and the high level of polymorphism may allow co-evolution of the genes, allowing TAP molecules to transport peptides specifically for the class I molecules of that haplotype. PMID:15900495

  8. Perylene and coronene derivatives binding to G-rich promoter oncogene sequences efficiently reduce their expression in cancer cells.


    Micheli, Emanuela; Altieri, Alessandro; Cianni, Lorenzo; Cingolani, Chiara; Iachettini, Sara; Bianco, Armandodoriano; Leonetti, Carlo; Cacchione, Stefano; Biroccio, Annamaria; Franceschin, Marco; Rizzo, Angela


    A novel approach to cancer therapeutics is emerging in the field of G-quadruplex (G4) ligands, small molecules designed to stabilize four-stranded structures that can form at telomeres as well as in other genomic sequences, including oncogene promoter sequences, 5'-UTR regions and introns. In this study, we investigated the binding activity of perylene and coronene derivatives PPL3C, CORON and EMICORON to G4 structures formed within the promoter regions of two important cancer-related genes, c-MYC and BCL-2, and their biochemical effects on gene and protein expression. In order to fully characterize the ability of the selected ligands to bind and stabilize the G4 structures originated by the c-MYC and BCL-2 promoter sequences, we performed electrospray ionization mass spectrometry (ESI-MS), Fluorescence Resonance Energy Transfer (FRET) measurements, Circular Dichroism (CD) spectra and polymerase stop assay. Altogether our results showed that the ligands had a high capacity in binding and stabilizing the G4 structures within the c-MYC and BCL-2 promoter sequences in vitro. Notably, when we evaluated by quantitative real-time PCR and western blotting analysis, the effects of treatment with the different G4 ligands on c-MYC and BCL2 expression in a human melanoma cell line, EMICORON appeared the most effective compound in reducing the mRNA and protein levels of both genes. These results encourage to consider EMICORON as a promising example of multimodal class of an antineoplastic drug, affecting different tumor crucial pathways simultaneously: telomere maintenance (as previously described), cell proliferation and apoptosis via down-regulation of both c-MYC and BCL-2 (this paper). PMID:27086081

  9. Sequence evolution and expression regulation of stress-responsive genes in natural populations of wild tomato.


    Fischer, Iris; Steige, Kim A; Stephan, Wolfgang; Mboup, Mamadou


    The wild tomato species Solanum chilense and S. peruvianum are a valuable non-model system for studying plant adaptation since they grow in diverse environments facing many abiotic constraints. Here we investigate the sequence evolution of regulatory regions of drought and cold responsive genes and their expression regulation. The coding regions of these genes were previously shown to exhibit signatures of positive selection. Expression profiles and sequence evolution of regulatory regions of members of the Asr (ABA/water stress/ripening induced) gene family and the dehydrin gene pLC30-15 were analyzed in wild tomato populations from contrasting environments. For S. chilense, we found that Asr4 and pLC30-15 appear to respond much faster to drought conditions in accessions from very dry environments than accessions from more mesic locations. Sequence analysis suggests that the promoter of Asr2 and the downstream region of pLC30-15 are under positive selection in some local populations of S. chilense. By investigating gene expression differences at the population level we provide further support of our previous conclusions that Asr2, Asr4, and pLC30-15 are promising candidates for functional studies of adaptation. Our analysis also demonstrates the power of the candidate gene approach in evolutionary biology research and highlights the importance of wild Solanum species as a genetic resource for their cultivated relatives. PMID:24205149

  10. Sequence Evolution and Expression Regulation of Stress-Responsive Genes in Natural Populations of Wild Tomato

    PubMed Central

    Fischer, Iris; Steige, Kim A.; Stephan, Wolfgang; Mboup, Mamadou


    The wild tomato species Solanum chilense and S. peruvianum are a valuable non-model system for studying plant adaptation since they grow in diverse environments facing many abiotic constraints. Here we investigate the sequence evolution of regulatory regions of drought and cold responsive genes and their expression regulation. The coding regions of these genes were previously shown to exhibit signatures of positive selection. Expression profiles and sequence evolution of regulatory regions of members of the Asr (ABA/water stress/ripening induced) gene family and the dehydrin gene pLC30-15 were analyzed in wild tomato populations from contrasting environments. For S. chilense, we found that Asr4 and pLC30-15 appear to respond much faster to drought conditions in accessions from very dry environments than accessions from more mesic locations. Sequence analysis suggests that the promoter of Asr2 and the downstream region of pLC30-15 are under positive selection in some local populations of S. chilense. By investigating gene expression differences at the population level we provide further support of our previous conclusions that Asr2, Asr4, and pLC30-15 are promising candidates for functional studies of adaptation. Our analysis also demonstrates the power of the candidate gene approach in evolutionary biology research and highlights the importance of wild Solanum species as a genetic resource for their cultivated relatives. PMID:24205149

  11. Dinoflagellate 17S rRNA sequence inferred from the gene sequence: Evolutionary implications.


    Herzog, M; Maroteaux, L


    We present the complete sequence of the nuclear-encoded small-ribosomal-subunit RNA inferred from the cloned gene sequence of the dinoflagellate Prorocentrum micans. The dinoflagellate 17S rRNA sequence of 1798 nucleotides is contained in a family of 200 tandemly repeated genes per haploid genome. A tentative model of the secondary structure of P. micans 17S rRNA is presented. This sequence is compared with the small-ribosomal-subunit rRNA of Xenopus laevis (Animalia), Saccharomyces cerevisiae (Fungi), Zea mays (Planta), Dictyostelium discoideum (Protoctista), and Halobacterium volcanii (Monera). Although the secondary structure of the dinoflagellate 17S rRNA presents most of the eukaryotic characteristics, it contains sufficient archaeobacterial-like structural features to reinforce the view that dinoflagellates branch off very early from the eukaryotic lineage. PMID:16578795

  12. Dinoflagellate 17S rRNA sequence inferred from the gene sequence: Evolutionary implications

    PubMed Central

    Herzog, Michel; Maroteaux, Luc


    We present the complete sequence of the nuclear-encoded small-ribosomal-subunit RNA inferred from the cloned gene sequence of the dinoflagellate Prorocentrum micans. The dinoflagellate 17S rRNA sequence of 1798 nucleotides is contained in a family of 200 tandemly repeated genes per haploid genome. A tentative model of the secondary structure of P. micans 17S rRNA is presented. This sequence is compared with the small-ribosomal-subunit rRNA of Xenopus laevis (Animalia), Saccharomyces cerevisiae (Fungi), Zea mays (Planta), Dictyostelium discoideum (Protoctista), and Halobacterium volcanii (Monera). Although the secondary structure of the dinoflagellate 17S rRNA presents most of the eukaryotic characteristics, it contains sufficient archaeobacterial-like structural features to reinforce the view that dinoflagellates branch off very early from the eukaryotic lineage. PMID:16578795

  13. A conserved intronic U1 snRNP-binding sequence promotes trans-splicing in Drosophila

    PubMed Central

    Gao, Jun-Li; Fan, Yu-Jie; Wang, Xiu-Ye; Zhang, Yu; Pu, Jia; Li, Liang; Shao, Wei; Zhan, Shuai; Hao, Jianjiang


    Unlike typical cis-splicing, trans-splicing joins exons from two separate transcripts to produce chimeric mRNA and has been detected in most eukaryotes. Trans-splicing in trypanosomes and nematodes has been characterized as a spliced leader RNA-facilitated reaction; in contrast, its mechanism in higher eukaryotes remains unclear. Here we investigate mod(mdg4), a classic trans-spliced gene in Drosophila, and report that two critical RNA sequences in the middle of the last 5′ intron, TSA and TSB, promote trans-splicing of mod(mdg4). In TSA, a 13-nucleotide (nt) core motif is conserved across Drosophila species and is essential and sufficient for trans-splicing, which binds U1 small nuclear RNP (snRNP) through strong base-pairing with U1 snRNA. In TSB, a conserved secondary structure acts as an enhancer. Deletions of TSA and TSB using the CRISPR/Cas9 system result in developmental defects in flies. Although it is not clear how the 5′ intron finds the 3′ introns, compensatory changes in U1 snRNA rescue trans-splicing of TSA mutants, demonstrating that U1 recruitment is critical to promote trans-splicing in vivo. Furthermore, TSA core-like motifs are found in many other trans-spliced Drosophila genes, including lola. These findings represent a novel mechanism of trans-splicing, in which RNA motifs in the 5′ intron are sufficient to bring separate transcripts into close proximity to promote trans-splicing. PMID:25838544

  14. Glial cell-specific expression of the serotonin 2 receptor gene: selective reactivation of a repressed promoter.


    Ding, D; Toth, M; Zhou, Y; Parks, C; Hoffman, B J; Shenk, T


    The 5' flanking region of the 5-HT2 receptor gene has been cloned, sequenced and its transcriptional regulatory functions analyzed. The promoter lacks an identifiable TATA motif, and utilizes at least 11 clustered start sites. Promoter function was analyzed by transient assays in rat C6 glioma cells, which were shown to express the endogenous 5-HT2 receptor gene, as well as in rat CREF and human HeLa cells which do not express the endogenous gene. The basal promoter functioned equally well in all three cell lines; and a repression domain, located upstream of the basal promoter, inhibited activity of the promoter in all three cell lines. A far upstream cell specific activator domain restored promoter activity in C6 glioma cells, but did not reactivate the silenced promoter in CREF or HeLa cells. The upstream activator domain, repressor domain and basal promoter functioned in concert to achieve cell type specific expression. The activator domain did not direct C6 glioma cell specific expression in the absence of the repressor domain or in constructs carrying a heterologous basal promoter. These results indicate that glial cell expression of the 5-HT2 receptor gene is achieved through a cell type specific reactivation of a repressed promoter. PMID:8302156

  15. Recombinations between Alu repeat sequences that result in partial deletions within the C1 inhibitor gene.


    Ariga, T; Carter, P E; Davis, A E


    Genomic DNA sequence analysis was used to define the extent of deletions within the C1 inhibitor gene in two families with type I hereditary angioneurotic edema. Southern blot analysis initially indicated the presence of the partial deletions. One deletion was approximately 2 kb and included exon VII, whereas the other was approximately 8.5 kb and included exons IV-VI. Genomic libraries from an affected member of each family were constructed and clones containing the deletions were analyzed. Sequence analysis of the deletion joints of the mutants and corresponding regions of the normal gene in the two families demonstrated that both deletion joints resulted from recombination of two Alu repetitive DNA elements. Alu repeat sequences from introns VI and VII combined to make a novel Alu in family A, and Alu sequences in introns III and VI were spliced to make a new Alu in family B. The splice sites in the Alu sequences of both mutants were located in the left arm of the Alu element, and both recombination joints overlapped one of the RNA polymerase III promoter sequences. Because the involved Alu sequences, in both instances, were oriented in the same direction, unequal crossingover is the most likely mechanism to account for these mutations. PMID:2276734

  16. Specific interactions between transcription factors and the promoter-regulatory region of the human cytomegalovirus major immediate-early gene

    SciTech Connect

    Ghazal, P.; Lubon, H.; Hennighausen, L. )


    Repeat sequence motifs as well as unique sequences between nucleotides {minus}150 and {minus}22 of the human cytomegalovirus immediate-early 1 gene interact in vitro with nuclear proteins. The authors show that a transcriptional element between nucleotides {minus}91 and {minus}65 stimulated promoter activity in vivo and in vitro by binding specific cellular transcription factors. Finally, a common sequence motif, (T)TGG/AC, present in 15 of the determined binding sites suggests a particular class of nuclear factors associated with the immediate-early 1 gene.

  17. Site-specific methylation of the rat prolactin and growth hormone promoters correlates with gene expression.

    PubMed Central

    Ngô, V; Gourdji, D; Laverrière, J N


    The methylation patterns of the rat prolactin (rPRL) (positions -440 to -20) and growth hormone (rGH) (positions -360 to -110) promoters were analyzed by bisulfite genomic sequencing. Two normal tissues, the anterior pituitary and the liver, and three rat pituitary GH3 cell lines that differ considerably in their abilities to express both genes were tested. High levels of rPRL gene expression were correlated with hypomethylation of the CpG dinucleotides located at positions -277 and -97, near or within positive cis-acting regulatory elements. For the nine CpG sites analyzed in the rGH promoter, an overall hypomethylation-expression coupling was also observed for the anterior pituitary, the liver, and two of the cell lines. The effect of DNA methylation was tested by measuring the transient expression of the chloramphenicol acetyltransferase reporter gene driven by a regionally methylated rPRL promoter. CpG methylation resulted in a decrease in the activity of the rPRL promoter which was proportional to the number of modified CpG sites. The extent of the inhibition was also found to be dependent on the position of methylated sites. Taken together, these data suggest that site-specific methylation may modulate the action of transcription factors that dictate the tissue-specific expression of the rPRL and rGH genes in vivo. PMID:8668139

  18. Understanding the Pathogenicity of Noncoding Mismatch Repair Gene Promoter Variants in Lynch Syndrome.


    Liu, Qing; Thompson, Bryony A; Ward, Robyn L; Hesson, Luke B; Sloane, Mathew A


    Lynch syndrome is the most common familial cancer condition that mainly predisposes to tumors of the colon and endometrium. Cancer susceptibility is caused by the autosomal dominant inheritance of a loss-of-function mutation or epimutation in one of the DNA mismatch repair (MMR) genes. Cancer risk assessment is often possible with nonsynonymous coding region mutations, but in many cases patients present with DNA sequence changes within noncoding regions, including the promoters, of MMR genes. The pathogenic role of promoter variants, and hence clinical significance, is unclear and this hinders the clinical management of carriers. In this review, we provide an overview of the classification of MMR gene variants, outline the laboratory assays and online resources that can be used to assess the causality of promoter variants in Lynch syndrome, and highlight some of the practical challenges of demonstrating the pathogenicity of these variants. In conclusion, we propose a guide that could be integrated into the current InSiGHT classification scheme to help determine if a MMR gene promoter variant is pathogenic. PMID:26888055

  19. Anabolic ornithine carbamoyltransferase of Pseudomonas aeruginosa: nucleotide sequence and transcriptional control of the argF structural gene.

    PubMed Central

    Itoh, Y; Soldati, L; Stalon, V; Falmagne, P; Terawaki, Y; Leisinger, T; Haas, D


    In Pseudomonas aeruginosa PAO the anabolic ornithine carbamoyltransferase (OTCase, EC is the product of the argF gene and the only arginine biosynthetic enzyme whose synthesis is repressible by arginine. We have determined the complete nucleotide sequence of the argF gene including its promoter-control region. The deduced amino acid sequence of the anabolic OTCase consists of 305 residues (Mr 33,924), and this was confirmed by the N-terminal amino acid sequence, the total amino acid composition, and the subunit Mr of the purified enzyme. The native anabolic OTCase (Mr 110,000 to 125,000) was found to be a trimer by cross-linking experiments. P. aeruginosa also has a catabolic OTCase (the arcB gene product), which catalyzes the reverse reaction of the anabolic conversion. At the nucleotide sequence level, the P. aeruginosa argF gene had 52.4% identity with the arcB gene. The Escherichia coli argF and argI genes, which code for anabolic OTCase isoenzymes, had 47.3 and 44.9% identity, respectively, with the P. aeruginosa argF sequence. This suggests that these four genes have evolved from a common ancestral gene. The arcB gene appears to be more closely related to the E. coli argF gene than to the P. aeruginosa argF gene. Two transcripts (mRNA-1, mRNA-2) of the P. aeruginosa argF gene were identified by S1 mapping. The transcription initiation site for mRNA-1 was preceded by sequences having partial homology with the E. coli -35 and -10 consensus promoter sequences. No sequence similar to consensus promoters of enteric bacteria was found upstream of the 5' end of mRNA-2. E. coli carrying a P. aeruginosa argF+ recombinant plasmid produced mRNA-1 with low efficiency but no (or very little) mRNA-2. Arginine repressed argF transcription in P. aeruginosa. In the argF promoter region no sequence homologous to the "arg box" (arginine operator module) of E. coli was found. The mechanism of arginine repression in P. aeruginosa thus appears to be different from that in

  20. Activation of a muscle-specific actin gene promoter in serum-stimulated fibroblasts.

    PubMed Central

    Stoflet, E S; Schmidt, L J; Elder, P K; Korf, G M; Foster, D N; Strauch, A R; Getz, M J


    Treatment of AKR-2B mouse fibroblasts with serum growth factors or inhibitors of protein synthesis, such as cycloheximide, results in a stimulation of cytoskeletal beta-actin transcription but has no effect on transcription of muscle-specific isotypes, such as the vascular smooth muscle (VSM) alpha-actin gene. Deletion mapping and site-specific mutagenesis studies demonstrated that a single "CArG" element of the general form CC(A/T)6GG was necessary and possibly sufficient to impart serum and cycloheximide-inducibility to the beta-actin promoter. Although the VSM alpha-actin promoter exhibits at least three similar sequence elements, it remained refractory to serum and cycloheximide induction. However, deletion of a 33 base pair sequence between -191 and -224 relative to the transcription start site resulted in the transcriptional activation of this muscle-specific promoter in rapidly growing or serum-stimulated fibroblasts. Although the activity of this truncated promoter was potentiated by cycloheximide in a manner indistinguishable from that of the beta-actin promoter, this was dependent on a more complex array of interacting elements. These included at least one CArG box and a putative upstream activating element closely associated with the -191 to -224 inhibitory sequences. These results demonstrate that the expression of a muscle-specific actin gene in fibroblasts is suppressed by a cis-acting negative control element and that in the absence of this element, the promoter is responsive to growth factor-induced signal transduction pathways. Images PMID:1421567

  1. Variation in Rubisco activase (RCAβ) gene promoters and expression in soybean [Glycine max (L.) Merr].


    Chao, Maoni; Yin, Zhitong; Hao, Derong; Zhang, Jinyu; Song, Haina; Ning, Ailing; Xu, Xiaoming; Yu, Deyue


    Understanding the genetic basis of Rubisco activase (RCA) gene regulation and altering its expression levels to optimize Rubisco activation may provide an approach to enhance plant productivity. However, the genetic mechanisms and the effect of RCA expression on phenotype are still unknown in soybean. This work analysed the expression of RCA genes and demonstrated that two RCA isoforms presented different expression patterns. Compared with GmRCAα, GmRCAβ was expressed at higher mRNA and protein levels. In addition, GmRCAα and GmRCAβ were positively correlated with chlorophyll fluorescence parameters and seed yield, suggesting that changes in expression of RCA has a potential applicability in breeding for enhanced soybean productivity. To identify the genetic factors that cause expression level variation of GmRCAβ, expression quantitative trait loci (eQTL) mapping was combined with allele mining in a natural population including 219 landraces. The eQTL mapping showed that a combination of both cis- and trans-acting eQTLs might control GmRCAβ expression. As promoters can affect both cis- and trans-acting eQTLs by altering cis-acting regulatory elements or transcription factor binding sites, this work subsequently focused on the promoter region of GmRCAβ. Single-nucleotide polymorphisms in the GmRCAβ promoter were identified and shown to correlate with expression level diversity. These SNPs were classified into two groups, A and B. Further transient expression showed that GUS expression driven by the group A promoter was stronger than that by the group B promoter, suggesting that promoter sequence types could influence gene expression levels. These results would improve understanding how variation within promoters affects gene expression and, ultimately, phenotypic diversity in natural populations. PMID:24170743

  2. Polymorphic core promoter GA-repeats alter gene expression of the early embryonic developmental genes.


    Valipour, E; Kowsari, A; Bayat, H; Banan, M; Kazeminasab, S; Mohammadparast, S; Ohadi, M


    Protein complexes that bind to 'GAGA' DNA elements are necessary to replace nucleosomes to create a local chromatin environment that facilitates a variety of site-specific regulatory responses. Three to four elements are required for the disruption of a preassembled nucleosome. We have previously identified human protein-coding gene core promoters that are composed of exceptionally long GA-repeats. The functional implication of those GA-repeats is beginning to emerge in the core promoter of the human SOX5 gene, which is involved in multiple developmental processes. In the current study, we analyze the functional implication of GA-repeats in the core promoter of two additional genes, MECOM and GABRA3, whose expression is largely limited to embryogenesis. We report a significant difference in gene expression as a result of different alleles across those core promoters in the HEK-293 cell line. Across-species homology check for the GABRA3 GA-repeats revealed that those repeats are evolutionary conserved in mouse and primates (p<1 × 10(-8)). The MECOM core promoter GA-repeats are also conserved in numerous species, of which human has the longest repeat and complexity. We propose a novel role for GA-repeat core promoters to regulate gene expression in the genes involved in development and evolution. PMID:24055488

  3. Tissue-specific regulation of the mouse Pkhd1 (ARPKD) gene promoter

    PubMed Central

    Williams, Scott S.; Cobo-Stark, Patricia; Hajarnis, Sachin; Aboudehen, Karam; Shao, Xinli; Richardson, James A.; Patel, Vishal


    Autosomal recessive polycystic kidney disease, an inherited disorder characterized by the formation of cysts in renal collecting ducts and biliary dysgenesis, is caused by mutations of the polycystic kidney and hepatic disease 1 (PKHD1) gene. Expression of PKHD1 is tissue specific and developmentally regulated. Here, we show that a 2.0-kb genomic fragment containing the proximal promoter of mouse Pkhd1 directs tissue-specific expression of a lacZ reporter gene in transgenic mice. LacZ is expressed in renal collecting ducts beginning during embryonic development but is not expressed in extrarenal tissues. The Pkhd1 promoter contains a binding site for the transcription factor hepatocyte nuclear factor (HNF)-1β, which is required for activity in transfected cells. Mutation of the HNF-1β-binding site abolishes the expression of the lacZ reporter gene in renal collecting ducts. Transgenes containing the 2.0-kb promoter and 2.7 kb of additional genomic sequence extending downstream to the second exon are expressed in the kidney, intrahepatic bile ducts, and male reproductive tract. This pattern overlaps with the endogenous expression of Pkhd1 and coincides with sites of expression of HNF-1β. We conclude that the proximal 2.0-kb promoter is sufficient for tissue-specific expression of Pkhd1 in renal collecting ducts in vivo and that HNF-1β is required for Pkhd1 promoter activity in collecting ducts. Additional genomic sequences located from exons 1-2 or elsewhere in the gene locus are required for expression in extrarenal tissues. PMID:24899057

  4. Cloning and promoter identification of the iron-regulated cir gene of Escherichia coli.

    PubMed Central

    Griggs, D W; Tharp, B B; Konisky, J


    The cir gene, which encodes the colicin I receptor protein and is regulated by both cellular iron content and growth temperature, was cloned into a multicopy-number plasmid. Physical mapping and complementation analysis established the position of cir between mgl and nfo on the Escherichia coli chromosome. A gene encoding a 32,000-dalton polypeptide was located downstream of and adjacent to cir, but did not appear to be part of the same transcriptional unit. A 525-base-pair fragment from the 5' end of the 1.8-kilobase-pair receptor-coding region directed iron-regulated transcription and translation of a hybrid cir-lacZ gene. Two overlapping promoters were identified by determination of the transcriptional start sites and by sequence analysis. A small open reading frame (120 nucleotides) of unknown significance preceded the receptor-coding sequence. Examination of the amino acid sequence of the receptor purified from the outer membrane revealed that the gene product was processed by removal of a signal peptide and that the mature form had an amino acid sequence near its amino terminus which closely resembled that of several other TonB-dependent proteins. Images PMID:3316180

  5. Analyzing S-adenosylhomocysteine hydrolase gene sequences in deuterostome genomes.


    Zhao, Jing-Nan; Wang, Yuan; Zhao, Bo-Sheng; Chen, Ling-Ling


    S-adenosylhomocysteine hydrolase (SAHH) gene sequences of sea-urchin, two amphioxus, sea-squirt and eight vertebrates are comparatively analyzed in the current analysis. Although SAHH protein sequences are highly conserved in these species, their nucleotide sequences are much different, ranging from 5,446 bp in amphioxus to 40,174 bp in zebra fish. The length divergence is mainly caused by distinct introns in some species. SAHH genes in amphioxus (or sea-urchin), sea-squirt and vertebrates are composed of eight, nine and ten exons, respectively. Sequence alignment shows that exon 3 in amphioxus and sea-urchin is similar to exons 3 + 4 in vertebrates, exon 5 in amphioxus and sea-urchin is similar to exons 5 + 6 in sea-squirt, and the two exons are fused into exon 6 in vertebrates. Furthermore, exon 7 in sea-squirt is similar to exons 7 + 8 in vertebrates, indicating that exon-fission and exon-fusion events have been taken place during the evolution of deuterostome SAHH genes. Active sites and NAD+-binding sites are located in exons 2 7 in amphioxus, which are dispersed into much more exons along with the evolution of vertebrates. It is speculated that ten-exon organization of SAHH gene occurred after the separation of invertebrates and vertebrates. Synonymous and non-synonymous substitution analysis shows that negative selection plays a dominant role in the evolution of SAHH genes. Phylogenetic analysis shows that SAHH genes in amphioxus, sea-urchin and sea-squirt form a cluster and locate at the base of neighbor-joining tree, suggesting that they are the archetype of vertebrate SAHH genes. PMID:19795919

  6. Simultaneous gene inactivation and promoter reporting in cyanobacteria.


    Chen, Kangming; Xu, Xinyi; Gu, Liping; Hildreth, Michael; Zhou, Ruanbao


    homolog, and a previously unknown function of gene all2508. Thus, gene expression and phenotypic analysis of mutants can be achieved simultaneously by targeted gene inactivation using the pZR606-based system. This combined approach for targeted gene inactivation and its promoter reporting with GFP may be broadly applicable to the study of gene function in other prokaryotic organisms. PMID:25434810

  7. Matrix metalloproteinase-3 gene promoter polymorphisms: A potential risk factor for pelvic organ prolapse

    PubMed Central

    Karachalios, Charalampos; Bakas, Panagiotis; Kaparos, Georgios; Demeridou, Styliani; Liapis, Ilias; Grigoriadis, Charalampos; Liapis, Aggelos


    Pelvic organ prolapse (POP) is a common multifactorial condition. Matrix metalloproteinases (MMPs) are enzymes capable of breaking down various connective tissue elements. Single-nucleotide polymorphisms (SNPs) in regulatory areas of MMP-encoding genes can alter their transcription rate, and therefore the possible effect on pelvic floor supporting structures. The insertion of an adenine (A) base in the promoter of the MMP-3 gene at position −1612/−1617 produces a sequence of six adenines (6A), whereas the other allele has five (5A). The aim of the present study was to investigate the possible association of MMP-3 gene promoter SNPs with the risk of POP. The patient group comprised 80 women with clinically significant POP [Stage II, III or IV; POP quantification (POP-Q) system]. The control group consisted of 80 females without any or important pelvic floor support defects (Stages 0 or I; POP-Q system). All the participants underwent the same preoperative evaluation. SNP detection was determined with whole blood sample DNA analysis by quantitative polymerase chain reaction (PCR) in LightCycler® PCR platforms, using the technique of sequence-specific hybridization probe-binding assays and melting temperature curve analysis. The results showed there was no statistically significant difference between 5A/5A, 5A/6A and 6A/6A MMP-3 gene promoter variants in the two study groups (P=0.4758). Therefore, MMP-3 gene promoter SNPs alone is insufficient to increase the genetic susceptibility to POP development. PMID:27588175

  8. A library of synthetic transcription activator-like effector-activated promoters for coordinated orthogonal gene expression in plants

    PubMed Central

    Brückner, Kathleen; Schäfer, Petra; Weber, Ernst; Grützner, Ramona; Marillonnet, Sylvestre; Tissier, Alain


    A library of synthetic promoters containing the binding site of a single designer transcription activator-like effector (dTALE) was constructed. The promoters contain a constant sequence, consisting of an 18-base long dTALE-binding site and a TATA box, flanked by degenerate sequences of 49 bases downstream and 19 bases upstream. Forty-three of these promoters were sequenced and tested in transient assays in Nicotiana benthamiana using a GUS reporter gene. The strength of expression of the promoters ranged from around 5% to almost 100% of the viral 35S promoter activity. We then demonstrated the utility of these promoters for metabolic engineering by transiently expressing three genes for the production of a plant diterpenoid in N. benthamiana. The simplicity of the promoter structure shows great promise for the development of genetic circuits, with wide potential applications in plant synthetic biology and metabolic engineering. PMID:25846505

  9. Identification of a p53-response element in the promoter of the proline oxidase gene

    SciTech Connect

    Maxwell, Steve A. Kochevar, Gerald J.


    Proline oxidase (POX) is a p53-induced proapoptotic gene. We investigated whether p53 could bind directly to the POX gene promoter. Chromatin immunoprecipitation (ChIP) assays detected p53 bound to POX upstream gene sequences. In support of the ChIP results, sequence analysis of the POX gene and its 5' flanking sequences revealed a potential p53-binding site, GGGCTTGTCTTCGTGTGACTTCTGTCT, located at 1161 base pairs (bp) upstream of the transcriptional start site. A 711-bp DNA fragment containing the candidate p53-binding site exhibited reporter gene activity that was induced by p53. In contrast, the same DNA region lacking the candidate p53-binding site did not show significant p53-response activity. Electrophoretic mobility shift assay (EMSA) in ACHN renal carcinoma cell nuclear lysates confirmed that p53 could bind to the 711-bp POX DNA fragment. We concluded from these experiments that a p53-binding site is positioned at -1161 to -1188 bp upstream of the POX transcriptional start site.

  10. A micronucleus-specific sequence exists in the 5'-upstream region of calmodulin gene in Tetrahymena thermophila.

    PubMed Central

    Katoh, M; Hirono, M; Takemasa, T; Kimura, M; Watanabe, Y


    Tetrahymena thermophila possesses a transcriptionally inactive micronucleus and an active macronucleus. Both nuclei are developed from micronucleus-derived germ nuclei during conjugation. Extensive DNA rearrangement and transcriptional activation are known to be involved in macronuclear development, but little has been known about these processes in a particular functional gene. Therefore the micro- and macronuclear genomic DNAs for calmodulin gene were analyzed. A 1,384 bp micronucleus-specific sequence located about 3.5 kb upstream of calmodulin gene has been found, suggesting DNA rearrangement during macronuclear development. The micronucleus-specific sequence had 85% A + T, no extensive ORF, ATTAs at both ends, and two palindromic structures just outside of both ends. Interestingly, the micronucleus-specific sequence included a T-rich tract, T16CT5, in the middle, and a nearly complementary A-rich tract, A5TA10GA5, existed 7 bp upstream from the initiation codon. In addition, there was a 20 bp repetitive sequence TAAT(TAAC)4 about 100 bp upstream of the micronucleus-specific sequence and also in the promoter region of calmodulin gene. Although the functional significance of the micronucleus-specific sequence remains unclear, T16CT5 and TAAT(TAAC)4 elements might exert an influence on transcription of the calmodulin gene. Stringent Southern hybridization revealed that this micronucleus-specific sequence or very similar sequence(s) were abundant in the Tetrahymena micronuclear genome. Images PMID:8506136

  11. Spliced synthetic genes as internal controls in RNA sequencing experiments.


    Hardwick, Simon A; Chen, Wendy Y; Wong, Ted; Deveson, Ira W; Blackburn, James; Andersen, Stacey B; Nielsen, Lars K; Mattick, John S; Mercer, Tim R


    RNA sequencing (RNA-seq) can be used to assemble spliced isoforms, quantify expressed genes and provide a global profile of the transcriptome. However, the size and diversity of the transcriptome, the wide dynamic range in gene expression and inherent technical biases confound RNA-seq analysis. We have developed a set of spike-in RNA standards, termed 'sequins' (sequencing spike-ins), that represent full-length spliced mRNA isoforms. Sequins have an entirely artificial sequence with no homology to natural reference genomes, but they align to gene loci encoded on an artificial in silico chromosome. The combination of multiple sequins across a range of concentrations emulates alternative splicing and differential gene expression, and it provides scaling factors for normalization between samples. We demonstrate the use of sequins in RNA-seq experiments to measure sample-specific biases and determine the limits of reliable transcript assembly and quantification in accompanying human RNA samples. In addition, we have designed a complementary set of sequins that represent fusion genes arising from rearrangements of the in silico chromosome to aid in cancer diagnosis. RNA sequins provide a qualitative and quantitative reference with which to navigate the complexity of the human transcriptome. PMID:27502218

  12. Gene identification in prokaryotic genomes, phages, metagenomes, and EST sequences with GeneMarkS suite.


    Borodovsky, Mark; Lomsadze, Alex


    This unit describes how to use several gene-finding programs from the GeneMark line developed for finding protein-coding ORFs in genomic DNA of prokaryotic species, in genomic DNA of eukaryotic species with intronless genes, in genomes of viruses and phages, and in prokaryotic metagenomic sequences, as well as in EST sequences with spliced-out introns. These bioinformatics tools were demonstrated to have state-of-the-art accuracy, and have been frequently used for gene annotation in novel nucleotide sequences. An additional advantage of these sequence-analysis tools is that the problem of algorithm parameterization is solved automatically, with parameters estimated by iterative self-training (unsupervised training). PMID:24510847

  13. Gene identification in prokaryotic genomes, phages, metagenomes, and EST sequences with GeneMarkS suite.


    Borodovsky, Mark; Lomsadze, Alex


    This unit describes how to use several gene-finding programs from the GeneMark line developed for finding protein-coding ORFs in genomic DNA of prokaryotic species, in genomic DNA of eukaryotic species with intronless genes, in genomes of viruses and phages, and in prokaryotic metagenomic sequences, as well as in EST sequences with spliced-out introns. These bioinformatics tools were demonstrated to have state-of-the-art accuracy and have been frequently used for gene annotation in novel nucleotide sequences. An additional advantage of these sequence-analysis tools is that the problem of algorithm parameterization is solved automatically, with parameters estimated by iterative self-training (unsupervised training). PMID:21901741

  14. Cloning and characterization of the promoter regions from the parent and paralogous creatine transporter genes.


    Ndika, Joseph D T; Lusink, Vera; Beaubrun, Claudine; Kanhai, Warsha; Martinez-Munoz, Cristina; Jakobs, Cornelis; Salomons, Gajja S


    Interconversion between phosphocreatine and creatine, catalyzed by creatine kinase is crucial in the supply of ATP to tissues with high energy demand. Creatine's importance has been established by its use as an ergogenic aid in sport, as well as the development of intellectual disability in patients with congenital creatine deficiency. Creatine biosynthesis is complemented by dietary creatine uptake. Intracellular transport of creatine is carried out by a creatine transporter protein (CT1/CRT/CRTR) encoded by the SLC6A8 gene. Most tissues express this gene, with highest levels detected in skeletal muscle and kidney. There are lower levels of the gene detected in colon, brain, heart, testis and prostate. The mechanism(s) by which this regulation occurs is still poorly understood. A duplicated unprocessed pseudogene of SLC6A8-SLC6A10P has been mapped to chromosome 16p11.2 (contains the entire SLC6A8 gene, plus 2293 bp of 5'flanking sequence and its entire 3'UTR). Expression of SLC6A10P has so far only been shown in human testis and brain. It is still unclear as to what is the function of SLC6A10P. In a patient with autism, a chromosomal breakpoint that intersects the 5'flanking region of SLC6A10P was identified; suggesting that SLC6A10P is a non-coding RNA involved in autism. Our aim was to investigate the presence of cis-acting factor(s) that regulate expression of the creatine transporter, as well as to determine if these factors are functionally conserved upstream of the creatine transporter pseudogene. Via gene-specific PCR, cloning and functional luciferase assays we identified a 1104 bp sequence proximal to the mRNA start site of the SLC6A8 gene with promoter activity in five cell types. The corresponding 5'flanking sequence (1050 bp) on the pseudogene also had promoter activity in all 5 cell lines. Surprisingly the pseudogene promoter was stronger than that of its parent gene in 4 of the cell lines tested. To the best of our knowledge, this is the first

  15. Optimizing promoters and secretory signal sequences for producing ethanol from inulin by recombinant Saccharomyces cerevisiae carrying Kluyveromyces marxianus inulinase.


    Hong, Soo-Jeong; Kim, Hyo Jin; Kim, Jin-Woo; Lee, Dae-Hee; Seo, Jin-Ho


    Inulin is a polyfructan that is abundant in plants such as Jerusalem artichoke, chicory and dahlia. Inulinase can easily hydrolyze inulin to fructose, which is consumed by microorganisms. Generally, Saccharomyces cerevisiae, an industrial workhorse strain for bioethanol production, is known for not having inulinase activity. The inulinase gene from Kluyveromyces marxianus (KmINU), with the ability of converting inulin to fructose, was introduced into S. cerevisiae D452-2. The inulinase gene was fused to three different types of promoter (GPD, PGK1, truncated HXT7) and secretory signal sequence (KmINU, MFα1, SUC2) to generate nine expression cassettes. The inulin fermentation performance of the nine transformants containing different promoter and signal sequence combinations for inulinase production were compared to select an optimized expression system for efficient inulin fermentation. Among the nine inulinase-producing transformants, the S. cerevisiae carrying the PGK1 promoter and MFα1 signal sequence (S. cerevisiae D452-2/p426PM) showed not only the highest specific KmINU activity, but also the best inulin fermentation capability. Finally, a batch fermentation of the selected S. cerevisiae D452-2/p426PM in a bioreactor with 188.2 g/L inulin was performed to produce 80.2 g/L ethanol with 0.43 g ethanol/g inulin of ethanol yield and 1.22 g/L h of ethanol productivity. PMID:25142154

  16. Characterization of a polypurine/polypyrimidine sequence upstream of the mouse metallothionein-I gene.

    PubMed Central

    Becker, N A; Maher, L J


    A 128 base pair long homopurine/homopyrimidine (R/Y) element is located approximately 1.2 kb upstream of the transcription start point of the mouse metallothionein-I ( MT-I ) gene. We present a detailed in vitro structural characterization of the MT-I R/Y sequence as determined by enzymatic and chemical probes. An approximately 190 bp fragment containing the MT-I R/Y sequence was subcloned into a recombinant vector. Low resolution analysis with S1 nuclease indicates that DNA in this region was unpaired in supercoiled plasmids treated at low pH. High resolution mapping with chemical probes selective for non-B DNA structures provides evidence that the MT-I R/Y sequence adopts one or more H-DNA structures. We also investigated this sequence to determine if it can influence transcriptional regulation. Promoter/reporter constructs were prepared in which the MT-I R/Y sequence was positioned in either orientation upstream of either the MT-I or HSV-TK promoters. Promoter/reporter activities were evaluated by transient transfection assays using mouse NIH3T3 cells. The MT-I R/Y sequence displayed no detectable activity as a cis -acting transcriptional regulatory element. These results demonstrate that although the MT-I R/Y sequence is able to adopt a non-B DNA structure under certain in vitro conditions, there is no evidence that this sequence plays a significant role in transcriptional regulation. PMID:9518488

  17. Sequencing and complementation analysis of the nifUSV genes from Azospirillum brasilense.


    Frazzon, J; Schrank, I S


    The functionality of nitrogenase in diazotrophic bacteria is dependent upon nif genes other than the structural nifH, D, and K genes which encode the enzyme subunit proteins. Such genes are involved in the activation of nif gene expression, maturation of subunit proteins, cofactor biosynthesis, and electron transport. In this work, approximately 5500 base pairs located within the major nif gene cluster of Azospirillum brasilense Sp7 have been sequenced. The deduced open reading frames were compared to the nif gene products of Azotobacter vinelandii and other diazotrophs. This analysis indicates the presence of five ORFs encoding ORF2, nifU, nifS, nifV, and ORF4 in the same sequential organization as found in other organisms. Consensus sigma 54 and NifA binding sites are present in the putative promoter region upstream of ORF2 in the A. brasilense sequence. The nifV gene of A. brasilense but not nifU or nifS complemented corresponding mutants strains of A. vinelandii. PMID:9503607

  18. hTERT and BIRC5 gene promoters for cancer gene therapy: A comparative study

    PubMed Central

    Shepelev, Mikhail V.; Kopantzev, Eugene P.; Vinogradova, Tatiana V.; Sverdlov, Eugene D.; Korobko, Igor V.


    Human telomerase reverse transcriptase (hTERT) and survivin (BIRC5) gene promoters are frequently used for transcriptional targeting of tumor cells, yet there is no comprehensive comparative analysis allowing rational choice of a promoter for a particular therapy. In the current study, the transcriptional activity of hTERT, human BIRC5 and mouse Birc5 promoters and their modifications were compared in 10 human cancer cell lines using the luciferase reporter gene activity assay. The results revealed that BIRC5- and hTERT-based promoters had strikingly different cell specificities with comparable activities in only 40% of cell lines. Importantly, relative hTERT and BIRC5 transcript abundance cannot be used to predict the most potent promoter. Among the hTERT-based promoters that were assessed, modification with the minimal cytomegalovirus promoter generally resulted in the most potent activity. Mouse Birc5 and modified human BIRC5 promoters were superior to the unmodified human survivin promoter; however, their tumor specificities must be investigated further. In summary, the present results emphasize the desirability for construction of more universal tumor-specific promoters to efficiently target a wide spectrum of tumor cells. PMID:27446419

  19. Phenotype Sequencing: Identifying the Genes That Cause a Phenotype Directly from Pooled Sequencing of Independent Mutants

    PubMed Central

    Harper, Marc A.; Chen, Zugen; Toy, Traci; Machado, Iara M. P.; Nelson, Stanley F.; Liao, James C.; Lee, Christopher J.


    Random mutagenesis and phenotype screening provide a powerful method for dissecting microbial functions, but their results can be laborious to analyze experimentally. Each mutant strain may contain 50–100 random mutations, necessitating extensive functional experiments to determine which one causes the selected phenotype. To solve this problem, we propose a “Phenotype Sequencing” approach in which genes causing the phenotype can be identified directly from sequencing of multiple independent mutants. We developed a new computational analysis method showing that 1. causal genes can be identified with high probability from even a modest number of mutant genomes; 2. costs can be cut many-fold compared with a conventional genome sequencing approach via an optimized strategy of library-pooling (multiple strains per library) and tag-pooling (multiple tagged libraries per sequencing lane). We have performed extensive validation experiments on a set of E. coli mutants with increased isobutanol biofuel tolerance. We generated a range of sequencing experiments varying from 3 to 32 mutant strains, with pooling on 1 to 3 sequencing lanes. Our statistical analysis of these data (4099 mutations from 32 mutant genomes) successfully identified 3 genes (acrB, marC, acrA) that have been independently validated as causing this experimental phenotype. It must be emphasized that our approach reduces mutant sequencing costs enormously. Whereas a conventional genome sequencing experiment would have cost $7,200 in reagents alone, our Phenotype Sequencing design yielded the same information value for only $1200. In fact, our smallest experiments reliably identified acrB and marC at a cost of only $110–$340. PMID:21364744

  20. Molecular cloning and analysis of a receptor-like promoter of Gbvdr3 gene in sea island cotton.


    Zhang, B-J; Zhang, H-P; Chen, Q-Z; Tang, N; Wang, L-K; Wang, R-F; Zhang, B-L


    Verticillium wilt caused by soil borne fungus Verticillium dahliae could significantly reduce cotton yield. The Ve1 homologous gene Gbvdr3 is resistant to Verticillium wilt. In order to understand of the function of the promoter Gbvdr3 in Gossypium barbadense, the promoter region of the receptor-like gene Gbvdr3 was obtained by genome walking, and the cis-element in the promoter was identified using the PLACE software in this study. The sequence analysis showed that the promoter contained elements related to stress resistance and light regulation. The cloned promoter was fused to the GUS reporter gene and transformed into Arabidopsis. GUS expression was specifically detected in roots, flowers, and seeds, suggesting that the expression of Gbvdr3 is tissue-specific. Separation and characterization analysis of the promoter of Gbvdr3 provides a platform for further research and application of this gene. Thorough understanding of the function of the Gbvdr3 promoter is important for better understanding of Gbvdr3 function. These results indicated that the promoter of Gbvdr3 was a tissue-specific promoter. PMID:27323087

  1. Strategies for Development of Functionally Equivalent Promoters with Minimum Sequence Homology for Transgene Expression in Plants: cis-Elements in a Novel DNA Context versus Domain Swapping1

    PubMed Central

    Bhullar, Simran; Chakravarthy, Suma; Advani, Sonia; Datta, Sudipta; Pental, Deepak; Burma, Pradeep Kumar


    The cauliflower mosaic virus 35S (35S) promoter has been extensively used for the constitutive expression of transgenes in dicotyledonous plants. The repetitive use of the same promoter is known to induce transgene inactivation due to promoter homology. As a way to circumvent this problem, we tested two different strategies for the development of synthetic promoters that are functionally equivalent but have a minimum sequence homology. Such promoters can be generated by (a) introducing known cis-elements in a novel or synthetic stretch of DNA or (b) “domain swapping,” wherein domains of one promoter can be replaced with functionally equivalent domains from other heterologous promoters. We evaluated the two strategies for promoter modifications using domain A (consisting of minimal promoter and subdomain A1) of the 35S promoter as a model. A set of modified 35S promoters were developed whose strength was compared with the 35S promoter per se using β-glucuronidase as the reporter gene. Analysis of the expression of the reporter gene in transient assay system showed that domain swapping led to a significant fall in promoter activity. In contrast, promoters developed by placing cis-elements in a novel DNA context showed levels of expression comparable with that of the 35S. Two promoter constructs Mod2A1T and Mod3A1T were then designed by placing the core sequences of minimal promoter and subdomain A1 in divergent DNA sequences. Transgenics developed in tobacco (Nicotiana tabacum) with the two constructs and with 35S as control were used to assess the promoter activity in different tissues of primary transformants. Mod2A1T and Mod3A1T were found to be active in all of the tissues tested, at levels comparable with that of 35S. Further, the expression of the Mod2A1T promoter in the seedlings of the T1 generation was also similar to that of the 35S promoter. The present strategy opens up the possibility of creating a set of synthetic promoters with minimum sequence

  2. Gene expression analysis using strains constructed by NHEJ-mediated one-step promoter cloning in the yeast Kluyveromyces marxianus.


    Suzuki, Ayako; Fujii, Hiroshi; Hoshida, Hisashi; Akada, Rinji


    Gene expression analysis provides valuable information to evaluate cellular state. Unlike quantitative mRNA analysis techniques like reverse-transcription PCR and microarray, expression analysis using a reporter gene has not been commonly used for multiple-gene analysis, probably due to the difficulty in preparing multiple reporter-gene constructs. To circumvent this problem, we developed a novel one-step reporter-gene construction system mediated by non-homologous end joining (NHEJ) in the yeast Kluyveromyces marxianus. As a selectable reporter gene, the ScURA3 selection marker was fused in frame with a red fluorescent gene yEmRFP (ScURA3:yEmRFP). The N-terminally truncated ScURA3:yEmRFP fragment was prepared by PCR. Promoter sequences were also prepared by PCR using primers containing the sequence of the deleted ScURA3 N-terminus to attach at their 3(') ends. The two DNA fragments were used for the transformation of a ura3(-) strain of K. marxianus, in which two DNA fragments are randomly joined and integrated into the chromosome through NHEJ. Only the correctly aligned fragments produced transformants on uracil-deficient medium and expressed red fluorescence under the control of the introduced promoters. A total of 36 gene promoters involved in glycolysis and other pathways were analyzed. Fluorescence measurements of these strains allowed real-time gene expression analysis in different culture conditions. PMID:26136515

  3. Differential interactions of promoter elements in stress responses of the Arabidopsis Adh gene.

    PubMed Central

    Dolferus, R; Jacobs, M; Peacock, W J; Dennis, E S


    The Adh (alcohol dehydrogenase, EC gene from Arabidopsis thaliana (L.) Heynh. can be induced by dehydration and cold, as well as by hypoxia. A 1-kb promoter fragment (CADH: -964 to +53) is sufficient to confer the stress induction and tissue-specific developmental expression characteristics of the Adh gene to a beta-glucuronidase reporter gene. Deletion mapping of the 5' end and site-specific mutagenesis identified four regions of the promoter essential for expression under the three stress conditions. Some sequence elements are important for response to all three stress treatments, whereas others are stress specific. The most critical region essential for expression of the Arabidopsis Adh promoter under all three environmental stresses (region IV: -172 to -141) contains sequences homologous to the GT motif (-160 to -152) and the GC motif (-147 to -144) of the maize Adh1 anaerobic responsive element. Region III (-235 to -172) contains two regions shown by R.J. Ferl and B.H. Laughner ([1989] Plant Mol Biol 12: 357-366) to bind regulatory proteins; mutation of the G-box-1 region (5'-CCACGTGG-3', -216 to -209) does not affect expression under uninduced or hypoxic conditions, but significantly reduces induction by cold stress and, to a lesser extent, by dehydration stress. Mutation of the other G-box-like sequence (G-box-2: 5'-CCAAGTGG-3', -193 to -182) does not change hypoxic response and affects cold and dehydration stress only slightly. G-box-2 mutations also promote high levels of expression under uninduced conditions. Deletion of region I (-964 to -510) results in increased expression under uninduced and all stress conditions, suggesting that this region contains a repressor binding site. Region II (-510 to -384) contains a positive regulatory element and is necessary for high expression levels under all treatments. PMID:7972489

  4. Expression of the Human Glucokinase Gene: Important Roles of the 5′ Flanking and Intron 1 Sequences

    PubMed Central

    Li, Zhixin; Mao, Yiqing; Li, Hui; Wang, Xi; Wang, Rong; Xu, Wei; Song, Rongjing; Jin, Ling; Li, Xiuli; Irwin, David M.; Niu, Gang; Tan, Huanran


    Background Glucokinase plays important tissue-specific roles in human physiology, where it acts as a sensor of blood glucose levels in the pancreas, and a few other cells of the gut and brain, and as the rate-limiting step in glucose metabolism in the liver. Liver-specific expression is driven by one of the two tissue-specific promoters, and has an absolute requirement for insulin. The sequences that mediate regulation by insulin are incompletely understood. Methodology/Principal Findings To better understand the liver-specific expression of the human glucokinase gene we compared the structures of this gene from diverse mammals. Much of the sequence located between the 5′ pancreatic beta-cell-specific and downstream liver-specific promoters of the glucokinase genes is composed of repetitive DNA elements that were inserted in parallel on different mammalian lineages. The transcriptional activity of the liver-specific promoter 5′ flanking sequences were tested with and without downstream intronic sequences in two human liver cells lines, HepG2 and L-02. While glucokinase liver-specific 5′ flanking sequences support expression in liver cell lines, a sequence located about 2000 bases 3′ to the liver-specific mRNA start site represses gene expression. Enhanced reporter gene expression was observed in both cell lines when cells were treated with fetal calf serum, but only in the L-02 cells was expression enhanced by insulin. Conclusions/Significance Our results suggest that the normal liver L-02 cell line may be a better model to understand the regulation of the liver-specific expression of the human glucokinase gene. Our results also suggest that sequences downstream of the liver-specific mRNA start site have important roles in the regulation of liver-specific glucokinase gene expression. PMID:23029263

  5. Molecular structure of uvrC gene of Escherichia coli: identification of DNA sequences required for transcription of the uvrC gene.

    PubMed Central

    Sharma, S; Dowhan, W; Moses, R E


    We have carried out experiments to identify the regulatory regions of the uvrC gene of Escherichia coli. A uvrC+ plasmid, pUV7, containing the intact transcriptional unit for the uvrC gene, was used to subclone either the structural gene or combinations of the structural gene and 5'-flanking sequences. The plasmids so constructed were tested for ability to restore UV-resistant phenotype to uvrC- cells as an indication of expression of the uvrC gene. The chromosomal DNA in plasmid pUV7 was probed for strong binding with E. coli RNA polymerase in an attempt to identify a restriction fragment which bears the regulatory sequences for the uvrC transcriptional unit. The results indicate that DNA sequences at least 0.9 Kb upstream from the structural gene, but not the 5'-proximal sequences, regulate expression of the uvrC gene. Analysis of protein synthesis encoded by plasmid pUV7 and its derivatives suggest that there may be another gene that lies between the promoter and the uvrC gene and codes for a 27,000-Mr protein. The relation of this gene to uvrC function is not clear. Images PMID:6292835

  6. Cloning and characterization of largemouth bass ( Micropterus salmoides) myostatin encoding gene and its promoter

    NASA Astrophysics Data System (ADS)

    Li, Shengjie; Bai, Junjie; Wang, Lin


    Myostatin or GDF-8, a member of the transforming growth factor-β (TGF-β) superfamily, has been demonstrated to be a negative regulator of skeletal muscle mass in mammals. In the present study, we obtained a 5.64 kb sequence of myostatin encoding gene and its promoter from largemouth bass ( Micropterus salmoides). The myostatin encoding gene consisted of three exons (488 bp, 371 bp and 1779 bp, respectively) and two introns (390 bp and 855 bp, respectively). The intron-exon boundaries were conservative in comparison with those of mammalian myostatin encoding genes, whereas the size of introns was smaller than that of mammals. Sequence analysis of 1.569 kb of the largemouth bass myostatin gene promoter region revealed that it contained two TATA boxes, one CAAT box and nine putative E-boxes. Putative muscle growth response elements for myocyte enhancer factor 2 (MEF2), serum response factor (SRF), activator protein 1 (AP1), etc., and muscle-specific Mt binding site (MTBF) were also detected. Some of the transcription factor binding sites were conserved among five teleost species. This information will be useful for studying the transcriptional regulation of myostatin in fish.

  7. Detecting sequence homology at the gene cluster level with MultiGeneBlast.


    Medema, Marnix H; Takano, Eriko; Breitling, Rainer


    The genes encoding many biomolecular systems and pathways are genomically organized in operons or gene clusters. With MultiGeneBlast, we provide a user-friendly and effective tool to perform homology searches with operons or gene clusters as basic units, instead of single genes. The contextualization offered by MultiGeneBlast allows users to get a better understanding of the function, evolutionary history, and practical applications of such genomic regions. The tool is fully equipped with applications to generate search databases from GenBank or from the user's own sequence data. Finally, an architecture search mode allows searching for gene clusters with novel configurations, by detecting genomic regions with any user-specified combination of genes. Sources, precompiled binaries, and a graphical tutorial of MultiGeneBlast are freely available from PMID:23412913

  8. Origins of Transcriptional Transition: Balance between Upstream and Downstream Regulatory Gene Sequences

    PubMed Central

    Sala, Adrien; Shoaib, Muhammad; Anufrieva, Olga; Mutharasu, Gnanavel; Yli-Harja, Olli


    ABSTRACT By measuring individual mRNA production at the single-cell level, we investigated the lac promoter’s transcriptional transition during cell growth phases. In exponential phase, variation in transition rates generates two mixed phenotypes, low and high numbers of mRNAs, by modulating their burst frequency and sizes. Independent activation of the regulatory-gene sequence does not produce bimodal populations at the mRNA level, but bimodal populations are produced when the regulatory gene is activated coordinately with the upstream and downstream region promoter sequence (URS and DRS, respectively). Time-lapse microscopy of mRNAs for lac and a variant lac promoter confirm this observation. Activation of the URS/DRS elements of the promoter reveals a counterplay behavior during cell phases. The promoter transition rate coupled with cell phases determines the mRNA and transcriptional noise. We further show that bias in partitioning of RNA does not lead to phenotypic switching. Our results demonstrate that the balance between the URS and the DRS in transcriptional regulation determines population diversity. PMID:25626902

  9. Structural features of conopeptide genes inferred from partial sequences of the Conus tribblei genome.


    Barghi, Neda; Concepcion, Gisela P; Olivera, Baldomero M; Lluisma, Arturo O


    The evolvability of venom components (in particular, the gene-encoded peptide toxins) in venomous species serves as an adaptive strategy allowing them to target new prey types or respond to changes in the prey field. The structure, organization, and expression of the venom peptide genes may provide insights into the molecular mechanisms that drive the evolution of such genes. Conus is a particularly interesting group given the high chemical diversity of their venom peptides, and the rapid evolution of the conopeptide-encoding genes. Conus genomes, however, are large and characterized by a high proportion of repetitive sequences. As a result, the structure and organization of conopeptide genes have remained poorly known. In this study, a survey of the genome of Conus tribblei was undertaken to address this gap. A partial assembly of C. tribblei genome was generated; the assembly, though consisting of a large number of fragments, accounted for 2160.5 Mb of sequence. A large number of repetitive genomic elements consisting of 642.6 Mb of retrotransposable elements, simple repeats, and novel interspersed repeats were observed. We characterized the structural organization and distribution of conotoxin genes in the genome. A significant number of conopeptide genes (estimated to be between 148 and 193) belonging to different superfamilies with complete or nearly complete exon regions were observed, ~60 % of which were expressed. The unexpressed conopeptide genes represent hidden but significant conotoxin diversity. The conotoxin genes also differed in the frequency and length of the introns. The interruption of exons by long introns in the conopeptide genes and the presence of repeats in the introns may indicate the importance of introns in facilitating recombination, evolution and diversification of conotoxins. These findings advance our understanding of the structural framework that promotes the gene-level molecular evolution of venom peptides. PMID:26423067

  10. Cloning, nucleotide sequence, and transcriptional analysis of the Pediococcus acidilactici L-(+)-lactate dehydrogenase gene.

    PubMed Central

    Garmyn, D; Ferain, T; Bernard, N; Hols, P; Delcour, J


    Recombinant plasmids containing the Pediococcus acidilactici L-(+)-lactate dehydrogenase gene (ldhL) were isolated by complementing for growth under anaerobiosis of an Escherichia coli lactate dehydrogenase-pyruvate formate lyase double mutant. The nucleotide sequence of the ldhL gene predicted a protein of 323 amino acids showing significant similarity with other bacterial L-(+)-lactate dehydrogenases and especially with that of Lactobacillus plantarum. The ldhL transcription start points in P. acidilactici were defined by primer extension, and the promoter sequence was identified as TCAAT-(17 bp)-TATAAT. This sequence is closely related to the consensus sequence of vegetative promoters from gram-positive bacteria as well as from E. coli. Northern analysis of P. acidilactici RNA showed a 1.1-kb ldhL transcript whose abundance is growth rate regulated. These data, together with the presence of a putative rho-independent transcriptional terminator, suggest that ldhL is expressed as a monocistronic transcript in P. acidilactici. PMID:7887607

  11. Mining tissue-specific contigs from peanut (Arachis hypogaea L.) for promoter cloning by deep transcriptome sequencing.


    Geng, Lili; Duan, Xiaohong; Liang, Chun; Shu, Changlong; Song, Fuping; Zhang, Jie


    Peanut (Arachis hypogaea L.), one of the most important oil legumes in the world, is heavily damaged by white grubs. Tissue-specific promoters are needed to incorporate insect resistance genes into peanut by genetic transformation to control the subterranean pests. Transcriptome sequencing is the most effective way to analyze differential gene expression in this non-model species and contribute to promoter cloning. The transcriptomes of the roots, seeds and leaves of peanut were sequenced using Illumina technology. A simple digital expression profile was established based on number of transcripts per million clean tags (TPM) from different tissues. Subsequently, 584 root-specific candidate transcript assembly contigs (TACs) and 316 seed-specific candidate TACs were identified. Among these candidate TACs, 55.3% were root-specific and 64.6% were seed-specific by semi-quantitative RT-PCR analysis. Moreover, the consistency of semi-quantitative RT-PCR with the simple digital expression profile was correlated with the length and TPM value of TACs. The results of gene ontology showed that some root-specific TACs are involved in stress resistance and respond to auxin stimulus, whereas, seed-specific candidate TACs are involved in embryo development, lipid storage and long-chain fatty acid biosynthesis. One root-specific promoter was cloned and characterized. We developed a high-yield screening system in peanut by establishing a simple digital expression profile based on Illumina sequencing. The feasible and rapid method presented by this study can be used for other non-model crops to explore tissue-specific or spatially specific promoters. PMID:25231965

  12. Promoter sequences confirm the three different evolutionary lineages described for HLA-G.


    Martinez-Laso, J; Herraiz, M A; Peñaloza, J; Barbolla, M L; Jurado, M L; Macedo, J; Vidart, J; Cervera, I


    HLA-G alleles follow a different pattern of polymorphism generation that those of the HLA classical I alleles. However, this polymorphism maintenance could have an evolutionary specific pathways based on non coding regions as introns, 14 bp deletion/insertion (exon 8) or promoter regions. For this reason, a systematic sequencing study of HLA-G promoter region was done in 36 individuals with a total of 15 different alleles. From the 12 sequences obtained, 7 were new sequences and not previously described. Results show that the sequences have three different patterns of evolution confirming the results obtained in the rest of the sequence regions (exons, introns and 3'UTR) where three different lineages were established. Only one of these lineages includes the non-human primate promoter sequences suggesting the possibility of this lineage could come directly from non-human primates while the other two could be generated after the speciation. More non-human primates MHC-G promoter sequences must be obtained to confirm this hypothesis. Expression and functional assays could be done considering the differences obtained in the promoter regions involving the HLA-G function (mRNA expression, isoforms). PMID:23220497

  13. Nucleotide sequence of the tobacco (Nicotiana tabacum) anionic peroxidase gene

    SciTech Connect

    Diaz-De-Leon, F.; Klotz, K.L.; Lagrimini, L.M. )


    Peroxidases have been implicated in numerous physiological processes including lignification (Grisebach, 1981), wound-healing (Espelie et al., 1986), phenol oxidation (Lagrimini, 1991), pathogen defense (Ye et al., 1990), and the regulation of cell elongation through the formation of interchain covalent bonds between various cell wall polymers (Fry, 1986; Goldberg et al., 1986; Bradley et al., 1992). However, a complete description of peroxidase action in vivo is not available because of the vast number of potential substrates and the existence of multiple isoenzymes. The tobacco anionic peroxidase is one of the better-characterized isoenzymes. This enzyme has been shown to oxidize a number of significant plant secondary compounds in vitro including cinnamyl alcohols, phenolic acids, and indole-3-acetic acid (Maeder, 1980; Lagrimini, 1991). A cDNA encoding the enzyme has been obtained, and this enzyme was shown to be expressed at the highest levels in lignifying tissues (xylem and tracheary elements) and also in epidermal tissue (Lagrimini et al., 1987). It was shown at this time that there were four distinct copies of the anionic peroxidase gene in tobacco (Nicotiana tabacum). A tobacco genomic DNA library was constructed in the [lambda]-phase EMBL3, from which two unique peroxidase genes were sequenced. One of these clones, [lambda]POD1, was designated as a pseudogene when the exonic sequences were found to differ from the cDNA sequences by 1%, and several frame shifts in the coding sequences indicated a dysfunctional gene (the authors' unpublished results). The other clone, [lambda]POD3, described in this manuscript, was designated as the functional tobacco anionic peroxidase gene because of 100% homology with the cDNA. Significant structural elements include an AS-2 box indicated in shoot-specific expression (Lam and Chua, 1989), a TATA box, and two intervening sequences. 10 refs., 1 tab.

  14. A characterization of the elements comprising the promoter of the mouse ribosomal protein gene RPS16.


    Hariharan, N; Perry, R P


    The elements comprising the mouse rpS16 promoter were characterized by transfection experiments with mutant genes in which various portions of the 5' flanking region and exon I were removed or substituted with extraneous DNA sequence. These experiments were carried out with otherwise intact rpS16 genes transfected into monkey kidney (COS) cells and also with chimeric rpS16-CAT gene constructs transfected into mouse plasmacytoma cells and COS cells. The locations of the functionally important elements were generally correlated with the locations of binding sites for specific nuclear factors, which were identified by gel-mobility shift analyses and methylation interference footprints. The most upstream element, which is located approximately 165 bp from the cap site, binds the Sp1 transcription factor and augments the promoter activity by 2 to 2.5-fold. In addition, there is a complex bipartite element in the -83 to -59 region, an element in the -37 to -12 region and an element in the +9 to +29 region of exon I, all of which are essential for rpS16 expression. The rpS16 promoter has a general architecture that resembles other mouse rp promoters; however, it also possesses some distinctive characteristics. PMID:2762128

  15. A Novel Protein Isoform of the Multicopy Human NAIP Gene Derives from Intragenic Alu SINE Promoters

    PubMed Central

    Romanish, Mark T.; Nakamura, Hisae; Lai, C. Benjamin; Wang, Yuzhuo; Mager, Dixie L.


    The human neuronal apoptosis inhibitory protein (NAIP) gene is no longer principally considered a member of the Inhibitor of Apoptosis Protein (IAP) family, as its domain structure and functions in innate immunity also warrant inclusion in the Nod-Like Receptor (NLR) superfamily. NAIP is located in a region of copy number variation, with one full length and four partly deleted copies in the reference human genome. We demonstrate that several of the NAIP paralogues are expressed, and that novel transcripts arise from both internal and upstream transcription start sites. Remarkably, two internal start sites initiate within Alu short interspersed element (SINE) retrotransposons, and a third novel transcription start site exists within the final intron of the GUSBP1 gene, upstream of only two NAIP copies. One Alu functions alone as a promoter in transient assays, while the other likely combines with upstream L1 sequences to form a composite promoter. The novel transcripts encode shortened open reading frames and we show that corresponding proteins are translated in a number of cell lines and primary tissues, in some cases above the level of full length NAIP. Interestingly, some NAIP isoforms lack their caspase-sequestering motifs, suggesting that they have novel functions. Moreover, given that human and mouse NAIP have previously been shown to employ endogenous retroviral long terminal repeats as promoters, exaptation of Alu repeats as additional promoters provides a fascinating illustration of regulatory innovations adopted by a single gene. PMID:19488400

  16. Alternative promoter usage and differential expression of multiple transcripts of mouse Prkar1a gene.


    Banday, Abdul Rouf; Azim, Shafquat; Tabish, Mohammad


    Prkar1a gene encodes regulatory type 1 alpha subunit (RIα) of cAMP-dependent protein kinase (PKA) in mouse. The role of this gene has been implicated in Carney complex and many cancer types that suggest its involvement in physiological processes like cell cycle regulation, growth and/or proliferation. We have identified and sequenced partial cDNA clones encoding four alternatively spliced transcripts of mouse Prkar1a gene. These transcripts have alternate 5' UTR structure which results from splicing of three exons (designated as E1a, E1b, and E1c) to canonical exon 2. The designated transcripts T1, T2, T3, and T4 contain 5' UTR exons as E1c, E1a + E1b, E1a, and E1b, respectively. The transcript T1 corresponded to earlier reported transcript in GenBank. In silico study of genomic DNA sequence revealed three distinct promoter regions namely, P1, P2, and P3 upstream of the exons E1a, E1b, and E1c, respectively. P1 is non-CpG-related promoter but P2 and P3 are CpG-related promoters; however, all three are TATA less. RT-PCR analysis demonstrated the expression of all four transcripts in late postnatal stages; however, these were differentially regulated in early postnatal stages of 0.5 day, 3 day, and 15 day mice in different tissue types. Variations in expression of Prkar1a gene transcripts suggest their regulation from multiple promoters that respond to a variety of signals arising in or out of the cell in tissue and developmental stage-specific manner. PMID:21638026

  17. Sequence variations in the FAD2 gene in seeded pumpkins.


    Ge, Y; Chang, Y; Xu, W L; Cui, C S; Qu, S P


    Seeded pumpkins are important economic crops; the seeds contain various unsaturated fatty acids, such as oleic acid and linoleic acid, which are crucial for human and animal nutrition. The fatty acid desaturase-2 (FAD2) gene encodes delta-12 desaturase, which converts oleic acid to linoleic acid. However, little is known about sequence variations in FAD2 in seeded pumpkins. Twenty-seven FAD2 clones from 27 accessions of Cucurbita moschata, Cucurbita maxima, Cucurbita pepo, and Cucurbita ficifolia were obtained (totally 1152 bp; a single gene without introns). More than 90% nucleotide identities were detected among the 27 FAD2 clones. Nucleotide substitution, rather than nucleotide insertion and deletion, led to sequence polymorphism in the 27 FAD2 clones. Furthermore, the 27 FAD2 selected clones all encoded the FAD2 enzyme (delta-12 desaturase) with amino acid sequence identities from 91.7 to 100% for 384 amino acids. The same main-function domain between 47 and 329 amino acids was identified. The four species clustered separately based on differences in the sequences that were identified using the unweighted pair group method with arithmetic mean. Geographic origin and species were found to be closely related to sequence variation in FAD2. PMID:26782391

  18. Division genes in Escherichia coli are expressed coordinately to cell septum requirements by gearbox promoters.


    Aldea, M; Garrido, T; Pla, J; Vicente, M


    The cell division ftsQAZ cluster and the ftsZ-dependent bolA morphogene of Escherichia coli are found to be driven by gearboxes, a distinct class of promoters characterized by showing an activity that is inversely dependent on growth rate. These promoters contain specific sequences upstream from the mRNA start point, and their -10 region is essential for the inverse growth rate dependence. Gearbox promoters are essential for driving ftsQAZ and bolA gene expression so that the encoded products are synthesized at constant amounts per cell independently of cell size. This mode of regulation would be expected for the expression of proteins that either play a regulatory role in cell division or form a stoichiometric component of the septum, a structure that, independently of cell size and growth rate, is produced once per cell cycle. PMID:1698623

  19. Structural characteristics of two wheat histone H2A genes encoding distinct types of variants and functional differences in their promoter activity.


    Huh, G H; Nakayama, T; Meshi, T; Iwabuchi, M


    To investigate the regulation of plant histone H2A gene expression, we isolated two H2A genes (TH254 and TH274) from wheat, which encode two variants of H2A. Both genes had an intron in the coding region. In the promoters, some characteristic sequences, such as Oct and Nona motifs, which are conserved among plant histone genes, were located in a short region (about 120 bp) upstream from the putative TATA box. Transient expression analyses of promoter activity with H2A-GUS fusion genes using tobacco protoplasts revealed novel types of positive cis-acting sequences in the TH254 promoter: a direct repeat of a 13 bp sequence (AGTTACATTATTG) and a stretch composed of an AT-rich sequence (ATATAGAAAATTAAAA) and a G-box (CACGTG). Quantitative S1 assay of the mRNA amounts from the TH254/GUS and TH274/GUS chimeric genes in stably transformed and cell cycle-synchronized tobacco cell lines showed that the promoters of both genes contained at least one cis-acting element responsible for S phase-specific expression. Histochemical analysis of transgenic tobacco plants carrying the chimeric genes showed that the promoters of the two H2A genes were active in developing seedlings and flower organs but were regulated in a different manner. PMID:9106503

  20. Genome Sequence of Bacillus mycoides B38V, a Growth-Promoting Bacterium of Sunflower.


    Ambrosini, Adriana; Sant'Anna, Fernando Hayashi; de Souza, Rocheli; Tadra-Sfeir, Michele; Faoro, Helisson; Alvarenga, Samuel M; Pedrosa, Fabio Oliveira; Souza, Emanuel Maltempi; Passaglia, Luciane M P


    Bacillus mycoides B38V is a bacterium isolated from the sunflower rhizosphere that is able to promote plant growth and N uptake. The genome of the isolate has approximately 5.80 Mb and presents sequence codifiers for plant growth-promoting characteristics, such as nitrate reduction and ammonification and iron-siderophore uptake. PMID:25838494

  1. Genome Sequence of Bacillus mycoides B38V, a Growth-Promoting Bacterium of Sunflower

    PubMed Central

    Ambrosini, Adriana; Sant’Anna, Fernando Hayashi; de Souza, Rocheli; Tadra-Sfeir, Michele; Faoro, Helisson; Alvarenga, Samuel M.; Pedrosa, Fabio Oliveira; Souza, Emanuel Maltempi


    Bacillus mycoides B38V is a bacterium isolated from the sunflower rhizosphere that is able to promote plant growth and N uptake. The genome of the isolate has approximately 5.80 Mb and presents sequence codifiers for plant growth-promoting characteristics, such as nitrate reduction and ammonification and iron-siderophore uptake. PMID:25838494

  2. Molecular cloning, sequencing analysis, and chromosomal localization of the human protease inhibitor 4 (Kallistatin) gene (P14)

    SciTech Connect

    Chai, K.X.; Chao, J.; Chao, L.; Ward, D.C.


    The gene encoding human protease inhibitor 4 (kallistatin; gene symbol PI4), a novel serine proteinase inhibitor (serpin), has been isolated and completely sequenced. The kallistatin gene is 9618 bp in length and contains five exons and four introns. The structure and organization of the kallistatin gene are similar to those of the genes encoding {alpha}{sub 1}-antichymotrypsin. The kallistatin gene is also similar to the genes encoding rat and mouse kallikrein-binding proteins. The first exon of the kallistatin gene is a noncoding 89-bp fragment, as determined by primer extension. The fifth exon, which contains 308 bp of noncoding sequence, encodes the reactive center of kallistatin. In the 5`-flanking region of the kallistatin gene, 1125 bp have been sequenced and a consensus promoter segment with potential transcription regulatory sites, including CAAT and TATA boxes, an AP-2 binding site, a GC-rich region, a cAMP response element, and an AP-1 binding site, has been identified within this region. The kallistatin gene was localized by in situ hybridization to human chromosome 14q31-132.1, close to the serpin genes encoding {alpha}{sub 1}-antichymotrypsin, protein C inhibitor, {alpha}{sub 1}-antitrypsin, and corticosteroid-binding globulin. In a genomic DNA Southern blot, kallistatin-related genes were identified in monkey, mouse, rat, bovine, dog, cat, and a ground mole. The patterns of hybridization revealed clues of human serpin evolution. 34 refs., 6 figs.

  3. Nucleotide sequence of the gene encoding the major subunit of CS3 fimbriae of enterotoxigenic Escherichia coli.

    PubMed Central

    Boylan, M; Smyth, C J; Scott, J R


    The complete nucleotide sequence of a 612-base-pair DNA fragment containing the gene for the major fimbrial subunit of CS3 of enterotoxigenic Escherichia coli is presented. A possible promoter region, a ribosome-binding site, and two potential signal peptidase cleavage sites are indicated. Unlike the best-studied fimbrial proteins, the predicted CS3 sequence has no Cys residues. PMID:2903130

  4. Promoter regulatory domain identification of cassava starch synthase IIb gene in transgenic tobacco.


    Guan, Zhihui; Chen, Xin; Xie, Hairong; Wang, Wenquan


    Soluble starch synthase is a key enzyme in the starch biosynthesis pathway, and its enzyme activity significantly influences starch components in cassava storage root. However, studies on the regulation mechanism of soluble starch synthase gene are rare. In this study, we cloned the 5' flanking sequence of the MeSSIIb gene and predicted the distribution of cis-elements. The region from -453 to -1 was considered the primary core promoter by the quantitative detection of GUS activity in transgenic tobacco plants containing 5' truncated promoters fused with the GUS gene. Analysis results clarified that the region from -531 to -454 significantly repressed promoter activity. The region from -453 to -388 was a repressive domain of ethylene, and some unknown drought responsive cis-elements were located in the region from -387 to -1. These findings will provide useful information on the functional assay and transcriptional regulation mechanisms of the MeSSIIb gene. PMID:26919397

  5. Isolation and sequence analysis of the gene (cpdB) encoding periplasmic 2',3'-cyclic phosphodiesterase.

    PubMed Central

    Liu, J; Burns, D M; Beacham, I R


    The cpdB gene encodes a periplasmic 2',3'-cyclic phosphodiesterase (3'-nucleotidase). This enzyme has been purified previously and the gene is located at 96 min on the Escherichia coli chromosome. In this study the cpdB gene was cloned from ClaI-cleaved DNA, and the gene product was identified. DNA blotting experiments showed that the recombinant plasmid contains a deletion with respect to the expected genomic fragment of approximately 4 kilobases, which extends into the vector. Furthermore, the gene was absent from three other recombinant libraries. Together, these findings suggest the presence in the genome of an adjacent gene whose product is lethal when it is present on a multicopy plasmid. The nucleotide sequence of the cpdB gene was also determined. The 5' and 3' untranslated sequences contain characteristic sequences that are involved in the initiation and termination of transcription, including two possible promoters, one of which may contain two overlapping -10 sequences. A strong Shine-Dalgarno sequence is followed by an open reading frame which corresponds to a protein having a molecular weight of 70,954. The first 19 amino acid residues have the characteristics of a signal peptide. The 3' untranslated sequence contains two putative rho-independent transcription terminators having low thermodynamic stability. Images PMID:3005231

  6. Sequence Analysis and Potentials of the Native RbcS Promoter in the Development of an Alternative Eukaryotic Expression System Using Green Microalga Ankistrodesmus convolutus

    PubMed Central

    Thanh, Tran; Chi, Vu Thi Quynh; Omar, Hishamuddin; Abdullah, Mohd Puad; Napis, Suhaimi


    The availability of highly active homologous promoters is critical in the development of a transformation system and improvement of the transformation efficiency. To facilitate transformation of green microalga Ankistrodesmus convolutus which is considered as a potential candidate for many biotechnological applications, a highly-expressed native promoter sequence of ribulose-1,5-bisphosphate carboxylase/oxygenase small subunit (AcRbcS) has been used to drive the expression of β-glucuronidase (gusA) gene in this microalga. Besides the determination of the transcription start site by 5′-RACE, sequence analysis revealed that AcRbcS promoter contained consensus TATA-box and several putative cis-acting elements, including some representative light-regulatory elements (e.g., G-box, Sp1 motif and SORLIP2), which confer light responsiveness in plants, and several potential conserved motifs (e.g., CAGAC-motif, YCCYTGG-motifs and CACCACA-motif), which may be involved in light responsiveness of RbcS gene in green microalgae. Using AcRbcS promoter::gusA translational fusion, it was demonstrated that this promoter could function as a light-regulated promoter in transgenic A. convolutus, which suggested that the isolated AcRbcS promoter was a full and active promoter sequence that contained all cis-elements required for developmental and light-mediated control of gene expression, and this promoter can be used to drive the expression of heterologous genes in A. convolutus. This achievement therefore advances the development of A. convolutus as an alternative expression system for the production of recombinant proteins. This is the first report on development of gene manipulation system for unicellular green alga A. convolutus. PMID:22489117

  7. Muscle-specific activity of the skeletal troponin I promoter requires interaction between upstream regulatory sequences and elements contained within the first transcribed exon.

    PubMed Central

    Nikovits, W; Mar, J H; Ordahl, C P


    Expression of the skeletal troponin I (sTnI) gene is regulated transcriptionally in a muscle-specific fashion. We show here that the region of the sTnI gene between -160 and +61 (relative to the transcription initiation site) is able to direct expression of the bacterial chloramphenicol acetyltransferase (CAT) gene is muscle cultures at a level approximately 100 times higher than in fibroblast cultures. RNA analysis demonstrated that transcription of the CAT gene was initiated at the same site as transcription of the endogenous sTnI gene and that CAT activity levels were approximately proportional to CAT mRNA levels. Deletion analysis demonstrated that the region between nucleotides -160 and -40 contained sequences essential for full promoter activity. Surprisingly, 3' deletion analysis indicated that the first exon (-6 to +61) of the sTnI gene was also required for full activity of the sTnI promoter in skeletal muscle cells. Chimeric promoter experiments, in which segments of the sTnI and the herpes simplex virus thymidine kinase promoter were interchanged, indicated that reconstitution of a muscle-specific promoter required inclusion of both the upstream and exon I regions of the sTnI gene. Exon I, and the region immediately upstream, showed DNase protection over sequence motifs related to those found in other genes, including the tar region of human immunodeficiency virus type 1. These results demonstrate that expression of the sTnI promoter in embryonic skeletal muscle cells requires complex interaction between two separate promoter regions, one of which resides within the first 61 transcribed nucleotides of the gene. Images PMID:2355914

  8. Promoter activity and regulation of the corneal CYP4B1 gene by hypoxia.


    Mastyugin, Vladimir; Mezentsev, Alexandre; Zhang, Wen-Xiang; Ashkar, Silvia; Dunn, Michael W; Laniado-Schwartzman, Michal


    Hypoxic injury to the ocular surface provokes an inflammatory response that is mediated, in part, by corneal epithelial-derived 12-hydroxyeicosanoids. Recent studies indicate that a cytochrome P450 (CYP) monooxygenase, identified as CYP4B1, is involved in the production of these eicosanoids which exhibit potent inflammatory and angiogenic properties. We have isolated and cloned a corneal epithelial CYP4B1 full-length cDNA and demonstrated that the CYP4B1 mRNA is induced by hypoxia in vitro and in vivo. To further understand the molecular regulation that underlies the synthesis of these potent inflammatory eicosanoids in response to hypoxic injury, we isolated and cloned the CYP4B1 promoter region. GenomeWalker libraries constructed from rabbit corneal epithelial genomic DNA were used as templates for primary and nested PCR amplifications with gene- and adaptor-specific primers. A 3.41-kb DNA fragment of the 5'-flanking region of the CYP4B1 promoter was isolated, cloned, sequenced, and analyzed by computer software for the presence of known cis-acting elements. Analysis of the promoter sequence revealed the presence of consensus DNA binding sequences for factors known to activate gene transcription in response to hypoxia including HIF-1, NFkappaB, and AP-1. Transient transfection of luciferase reporter (pGL3-Basic) vectors containing different lengths of the CYP4B1 promoter fragment demonstrated hypoxia-induced transcription in rabbit corneal epithelial (RCE) cells. Electrophoretic mobility shift assay (EMSA) revealed a marked induction of nuclear binding activity for the labeled HIF-1 probe from the CYP4B1 promoter in nuclear extracts of cells exposed to hypoxia. This binding activity was due to sequence-specific binding to the HIF-1 oligonucleotide probe as shown by competition with excess unlabeled probe for the HIF-1 but not with unlabeled NFkappaB probe. The nuclear binding activity of AP-1 and NFkappaB probes from the CYP4B1 promoter was also enhanced in

  9. Sequence elements in the human osteocalcin gene confer basal activation and inducible response to hormonal vitamin D sub 3

    SciTech Connect

    Kerner, S.A.; Scott, R.A.; Pike, J.W. )


    Osteoblast-specific expression of the bone protein osteocalcin is controlled at the transcriptional level by the steroid hormone 1{alpha},25-dihydroxyvitamin D{sub 3}. As this protein may represent a marker for bone activity in human disease, the authors examined the regulation of its expression at the molecular level by evaluating human osteocalcin gene promoter function. They describe regions within the promoter that contribute to basal expression of the gene in osteoblast-like cells in culture. Further, they define a 21-base-pair DNA element with the sequence 5{prime}-GTGACTCACCGGGTGAACGGG-3{prime}, which acts in cis to mediate 1{alpha},25-dihydroxyvitamin D{sub 3} inducibility of the osteocalcin gene. This response element bears sequence similarity with other short DNA segments, particularly those for estrogen and thyroid hormone, which act together with their respective trans-acting receptors to modulate gene transcription.

  10. Informational structure of genetic sequences and nature of gene splicing

    NASA Astrophysics Data System (ADS)

    Trifonov, E. N.


    Only about 1/20 of DNA of higher organisms codes for proteins, by means of classical triplet code. The rest of DNA sequences is largely silent, with unclear functions, if any. The triplet code is not the only code (message) carried by the sequences. There are three levels of molecular communication, where the same sequence ``talks'' to various bimolecules, while having, respectively, three different appearances: DNA, RNA and protein. Since the molecular structures and, hence, sequence specific preferences of these are substantially different, the original DNA sequence has to carry simultaneously three types of sequence patterns (codes, messages), thus, being a composite structure in which one had the same letter (nucleotide) is frequently involved in several overlapping codes of different nature. This multiplicity and overlapping of the codes is a unique feature of the Gnomic, language of genetic sequences. The coexisting codes have to be degenerate in various degrees to allow an optimal and concerted performance of all the encoded functions. There is an obvious conflict between the best possible performance of a given function and necessity to compromise the quality of a given sequence pattern in favor of other patterns. It appears that the major role of various changes in the sequences on their ``ontogenetic'' way from DNA to RNA to protein, like RNA editing and splicing, or protein post-translational modifications is to resolve such conflicts. New data are presented strongly indicating that the gene splicing is such a device to resolve the conflict between the code of DNA folding in chromatin and the triplet code for protein synthesis.

  11. Inactivation of gene expression in plants as a consequence of specific sequence duplication.

    PubMed Central

    Flavell, R B


    Numerous examples now exist in plants where the insertion of multiple copies of a transgene leads to loss of expression of some or all copies of the transgene. Where the transgene contains sequences homologous to an endogenous gene, expression of both transgene and endogenous gene is sometimes found to be impaired. Several examples of these phenomena displaying different features are reviewed. Possible explanations for the observed phenomena are outlined, drawing on known cellular processes in Drosophila, fungi, and mammals as well as plants. It is hypothesized that duplicated sequences can, under certain circumstances, become involved in cycles of hybrid chromatin formation or other processes that generate the potential for modification of inherited chromatin structure and cytosine methylation patterns. These epigenetic changes could lead to altered transcription rates or altered efficiencies of mRNA maturation and export from the nucleus. Where the loss of gene expression is posttranscriptional, antisense RNA could be formed on accumulated, inefficiently processed RNAs by an RNA-dependent RNA polymerase or from a chromosomal promoter and cause the observed loss of homologous mRNAs and possibly the modification of homologous genes. It is suggested that the mechanisms evolved to help silence the many copies of transposable elements in plants. Multicopy genes that are part of the normal gene catalog of a plant species must have evolved to avoid these silencing mechanisms or their consequences. PMID:8170935

  12. Genomic Organization and Identification of Promoter Regions for the BDNF Gene in the Pond Turtle Trachemys scripta elegans

    PubMed Central

    Zheng, Zhaoqing; Keifer, Joyce


    Brain-derived neurotrophic factor (BDNF) is an important regulator of neuronal development and synaptic function. The BDNF gene undergoes significant activity-dependent regulation during learning. Here, we identified the BDNF promoter regions, transcription start sites, and potential regulatory sequences for BDNF exons I–III that may contribute to activity-dependent gene and protein expression in the pond turtle Trachemys scripta elegans (tBDNF). By using transfection of BDNF promoter/luciferase plasmid constructs into human neuroblastoma SHSY5Y cells and mouse embryonic fibroblast NIH3T3 cells, we identified the basal regulatory activity of promoter sequences located upstream of each tBDNF exon, designated as pBDNFI–III. Further, through chromatin immunoprecipitation (ChIP) assays, we detected CREB binding directly to exon I and exon III promoters, while BHLHB2, but not CREB, binds within the exon II promoter. Elucidation of the promoter regions and regulatory protein binding sites in the tBDNF gene is essential for understanding the regulatory mechanisms that control tBDNF gene expression. PMID:24443176

  13. Complete sequence and gene organization of the Nosema spodopterae rRNA gene.


    Tsai, Shu-Jen; Huang, Wei-Fone; Wang, Chung-Hsiung


    By sequencing the entire ribosomal RNA (rRNA) gene of Nosema spodopterae, we show here that its gene organization follows a pattern similar to the Nosema type species, Nosema bombycis, i.e. 5'-large subunit rRNA (2,497 bp)-internal transcribed spacer (185 bp)-small subunit rRNA (1,232 bp)-intergenic spacer (277 bp)-5S rRNA (114 bp)-3'. Gene sequences and the secondary structures of large subunit rRNA, small subunit rRNA, and 5S rRNA are compared with the known corresponding sequences and structures of closely related microsporidia. The results suggest that the Nosema genus may be heterogeneous and that the rRNA gene organization may be a useful characteristic for determining which species are closely related to the type species. PMID:15702980

  14. Analysis of tomato gene promoters activated in syncytia induced in tomato and potato hairy roots by Globodera rostochiensis.


    Wiśniewska, A; Dąbrowska-Bronk, J; Szafrański, K; Fudali, S; Święcicka, M; Czarny, M; Wilkowska, A; Morgiewicz, K; Matusiak, J; Sobczak, M; Filipecki, M


    The potato cyst nematode (Globodera rostochiensis) induces feeding sites (syncytia) in tomato and potato roots. In a previous study, 135 tomato genes up-regulated during G. rostochiensis migration and syncytium development were identified. Five genes (CYP97A29, DFR, FLS, NIK and PMEI) were chosen for further study to examine their roles in plant-nematode interactions. The promoters of these genes were isolated and potential cis regulatory elements in their sequences were characterized using bioinformatics tools. Promoter fusions with the β-glucuronidase gene were constructed and introduced into tomato and potato genomes via transformation with Agrobacterium rhizogenes to produce hairy roots. The analysed promoters displayed different activity patterns in nematode-infected and uninfected transgenic hairy roots. PMID:23129482

  15. Integrating bioinformatic resources to predict transcription factors interacting with cis-sequences conserved in co-regulated genes

    PubMed Central


    Background Using motif detection programs it is fairly straightforward to identify conserved cis-sequences in promoters of co-regulated genes. In contrast, the identification of the transcription factors (TFs) interacting with these cis-sequences is much more elaborate. To facilitate this, we explore the possibility of using several bioinformatic and experimental approaches for TF identification. This starts with the selection of co-regulated gene sets and leads first to the prediction and then to the experimental validation of TFs interacting with cis-sequences conserved in the promoters of these co-regulated genes. Results Using the PathoPlant database, 32 up-regulated gene groups were identified with microarray data for drought-responsive gene expression from Arabidopsis thaliana. Application of the binding site estimation suite of tools (BEST) discovered 179 conserved sequence motifs within the corresponding promoters. Using the STAMP web-server, 49 sequence motifs were classified into 7 motif families for which similarities with known cis-regulatory sequences were identified. All motifs were subjected to a footprintDB analysis to predict interacting DNA binding domains from plant TF families. Predictions were confirmed by using a yeast-one-hybrid approach to select interacting TFs belonging to the predicted TF families. TF-DNA interactions were further experimentally validated in yeast and with a Physcomitrella patens transient expression system, leading to the discovery of several novel TF-DNA interactions. Conclusions The present work demonstrates the successful integration of several bioinformatic resources with experimental approaches to predict and validate TFs interacting with conserved sequence motifs in co-regulated genes. PMID:24773781

  16. [Cloning, sequence analysis and expression of N-acetylglutamate kinase gene in Corynebacterium crenatum].


    Hao, Ning; Zhao, Zhi; Wang, Yu; Zhang, Ying-zi; Ding, Jiu-yuan


    N-Acetylglutamate kinase (EC;NAGK) genes from wild-type Corynebacterium crenatum AS 1.542 and a L-arginine-producing mutant C. crenatum 971.1 were cloned and sequenced. Analysis of argB sequences revealed that only one ORF existed, which used ATG as the initiation codon and coded a peptide of 317 amino acids with a calculated molecular weight of 33.6kDa. Only one nucleotide difference was found in the structure gene and the difference did not cause a change of amino acid by comparison of the gene sequences between the wild type C. crenatum AS 1.542 and the mutant 971.1. The ORF sequence of argB from C. crenatum AS 1.542 showed homologies of 99.89%, 76.62%, 37.94% to those from Corynebacterium glutamicum ATCC 13032, Corynebacterium efficient YS-314 and Escherichia coli k12. And the amino acid sequence deduced from ORF displayed homologies of 100%, 78.55%, 25.25% to those from microorganisms above, respectively. An internal promoter was found in the upstream of the argB gene from C. crenatum. The argB gene from C. crenatum AS 1.542 was expressed both in C. crenatum AS 1.542 and 971.1. The NAGK activity of transformed C. crenatum AS 1.542 was greatly increased by the induction of IPTG. The NAGK activity of transformed C. crenatum 971.1 was almost twice as much as that of C. crenatum 971.1 under the same induction. The amplification of the NAGK activity yielded 25% increase of L-arginine production in C. crenatum 971.1. PMID:16579472

  17. Mapping of a replication origin within the promoter region of two unlinked, abundantly transcribed actin genes of Physarum polycephalum.


    Bénard, M; Lagnel, C; Pallotta, D; Pierron, G


    We analyzed the replication of two unlinked actin genes, ardB and ardC , which are abundantly transcribed in the naturally synchronous plasmodium of the slime mold Physarum polycephalum. Detection and size measurements of single-stranded nascent replication intermediates (RIs) demonstrate that these two genes are concomitantly replicated at the onset of the 3-h S phase and tightly linked to replication origins. Appearance of RIs on neutral-neutral two-dimensional gels at specific time points in early S phase and analysis of their structure confirmed these results and further established that, in both cases, an efficient, site-specific, bidirectional origin of replication is localized within the promoter region of the gene. We also determined similar elongation rates for the divergent replication forks of the ardC gene replicon. Finally, taking advantage of a restriction fragment length polymorphism, we studied allelic replicons and demonstrate similar localizations and a simultaneous firing of allelic replication origins. Computer search revealed a low level of homology between the promoters of ardB and ardC and, most notably, the absence of DNA sequences similar to the yeast autonomously replicating sequence consensus sequence in these Physarum origin regions. Our results with the ardB and ardC actin genes support the model of early replicating origins located within the promoter regions of abundantly transcribed genes in P. polycephalum. PMID:8622700

  18. Functional analysis of the promoter region of the human phosphotyrosine phosphatase activator gene: Yin Yang 1 is essential for core promoter activity.

    PubMed Central

    Janssens, V; Van Hoof, C; De Baere, I; Merlevede, W; Goris, J


    The phosphotyrosine phosphatase activator (PTPA) has been isolated as an in vitro regulator of protein phosphatase 2A. Human PTPA is encoded by a single gene, the structure and chromosomal localization of which have been determined in our previous work. Here we describe the further isolation, sequencing and functional characterization of the PTPA promoter region. In agreement with its ubiquitous expression, the PTPA promoter displays several characteristics of housekeeping genes: it lacks both a TATA-box and a CAAT-box, it is very GC-rich and it contains an unmethylated CpG island surrounding the transcription initiation site. Transient transfection experiments in different cell types with several truncated chimaeric luciferase reporter gene plasmids revealed the importance of the region between positions -67 and -39 for basal promoter activity. This region coincides remarkably well with the determined CpG island. Further analysis of this region demonstrated the presence of a Yin Yang 1 (YY1) binding motif at positions -52 to -44. Binding of YY1 to this sequence is demonstrated in bandshift and DNase I footprinting experiments. Another YY1 binding motif is found in the 5' untranslated region, at positions +27 to +35. Mutations in either of these sites, abolishing YY1 binding in vitro, have differential effects on promoter activity. Point mutations in both sites completely abolish promoter activity. Moreover, induction of promoter activity by co-transfection with a YY1 expression plasmid is fully dependent upon the presence of both intact YY1 binding sites. Thus YY1 apparently mediates basal transcription of the human PTPA gene through two binding sites within its proximal promoter. PMID:10585862

  19. Nucleotide sequence of Bacillus phage Nf terminal protein gene.

    PubMed Central

    Leavitt, M C; Ito, J


    The nucleotide sequence of Bacillus phage Nf gene E has been determined. Gene E codes for phage terminal protein which is the primer necessary for the initiation of DNA replication. The deduced amino acid sequence of Nf terminal protein is approximately 66% homologous with the terminal proteins of Bacillus phages PZA and luminal diameter 29, and shows similar hydropathy and secondary structure predictions. A serine which has been identified as the residue which covalently links the protein to the 5' end of the genome in luminal diameter 29, is conserved in all three phages. The hydropathic and secondary structural environment of this serine is similar in these phage terminal proteins and also similar to the linking serine of adenovirus terminal protein. PMID:3601672

  20. Molecular cloning and characterization of GbDXS and GbGGPPS gene promoters from Ginkgo biloba.


    Xu, F; Huang, X H; Li, L L; Deng, G; Cheng, H; Rong, X F; Li, J B; Cheng, S Y


    Ginkgolides are key pharmaceutical components in Ginkgo biloba leaves. 1-Deoxy-D-xylulose-5-phosphate synthase (GbDXS) and geranylgeranyl pyrophosphate (GbGGPPS) genes are critical genes involved in ginkgolide biosynthesis. In this study, the promoters of GbDXS and GGPPS, with 676 and 570 bp in length, respectively, were cloned by chromosome walking. The cis-elements of GbDXS and GbGGPPS promoters were predicted and analyzed by the plant cis-acting regulatory element (CARE) database. We found some major cis-elements in the sequence of GbDXS and GbGGPPS promoters. The GbDXS promoter has 3 TATA boxes, 10 CAAT boxes, 6 GATA boxes, and 1 I box. The GbGGPPS promoter has 1 TATA box, 6 CAAT boxes, 6 GATA boxes, and 4 I boxes. Furthermore, some stress-related cis-elements in the promoters of GbDXS and GbGGPPS were found to be light-regulated elements, including sequences over-represented in light-induced promoters (SORLIP1- AT), GATA box, and I box, a gibberellin-responsive element (WRKY), salicylic acid-induced (GT-1), cold- and dehydration-responsive (MYC-Core), and copper-inducible (CURE-Core). Further analyses of these cis-elements will aid in elucidating the molecular mechanisms regulating the expression of the GbDXS and GbGGPPS genes during ginkgolide accumulation in G. biloba. PMID:23408416

  1. Nucleotide sequence of ompV, the gene for a major Vibrio cholerae outer membrane protein.


    Pohlner, J; Meyer, T F; Jalajakumari, M B; Manning, P A


    The nucleotide sequence of the ompV gene of Vibrio cholerae was determined. The product of the gene is a 28,000 dalton protein which, after the removal of a 19 amino acid signal sequence, produces a mature outer membrane protein of 26,000 daltons. The cleavage site was determined by amino-terminal amino acid sequencing of the purified mature protein. The DNA upstream of the gene shows the presence of a typical promoter region as judged from the Escherichia coli consensus information; however, the Shine-Dalgarno sequence is associated with a region capable of forming a secondary structure in the mRNA. The formation of this structure would inhibit binding of the mRNA to the ribosome and reduce translation. It is proposed that this structure is recognized by a positive activator in V. cholerae and because of its absence in E. coli ompV is poorly expressed. The distribution of rare codons within ompV suggests that they may serve to slow down the translation of particular domains such that the nascent polypeptide has an opportunity to take up its conformation without interference from the later formed regions. Such a mechanism could aid localization of the protein if export were by a contranslational secretion system. PMID:3031428

  2. TERT promoter mutations and gene amplification: promoting TERT expression in Merkel cell carcinoma.


    Xie, Hong; Liu, Tiantian; Wang, Na; Björnhagen, Viveca; Höög, Anders; Larsson, Catharina; Lui, Weng-Onn; Xu, Dawei


    Telomerase activation through the induction of its catalytic component TERT is essential in carcinogenesis. The regulatory mechanism and clinical significance underlying cancer-specific TERT expression have been extensively investigated in various human malignancies, but little is known about these in Merkel cell carcinoma (MCC), an aggressive neuroendocrine skin tumor. Here we addressed these issues by determining TERT promoter mutations, gene amplification, mRNA expression and association with clinical variables in MCC. TERT mRNA was expressed in 6/6 MCC cell lines and 41 of 43 tumors derived from 35 MCC patients. Telomerase activity was detectable in all 6 cell lines and 11 tumors analyzed. TERT promoter mutations were identified in 1/6 cell lines and 4/35 (11.4%) MCC cases. The mutation exhibited UV signature and occurred in sun-exposed areas. Increased TERT gene copy numbers were observed in 1/6 cell lines and 11/14 (79%) tumors, and highly correlated with its mRNA expression (r = 0.7419, P = 0.0024). Shorter overall survival was significantly associated with higher TERT mRNA levels in MCC patients (P = 0.032). Collectively, TERT expression and telomerase activity is widespread in MCC, and may be attributable to TERT promoter mutations and gene amplification. Higher TERT expression predicts poor patient outcomes. PMID:25301727

  3. Characterization of type IV pilus genes in plant growth-promoting Pseudomonas putida WCS358.

    PubMed Central

    de Groot, A; Heijnen, I; de Cock, H; Filloux, A; Tommassen, J


    In a search for factors that could contribute to the ability of the plant growth-stimulating Pseudomonas putida WCS358 to colonize plant roots, the organism was analyzed for the presence of genes required for pilus biosynthesis. The pilD gene of Pseudomonas aeruginosa, which has also been designated xcpA, is involved in protein secretion and in the biogenesis of type IV pili. It encodes a peptidase that processes the precursors of the pilin subunits and of several components of the secretion apparatus. Prepilin processing activity could be demonstrated in P. putida WCS358, suggesting that this nonpathogenic strain may contain type IV pili as well. A DNA fragment containing the pilD (xcpA) gene of P. putida was cloned and found to complement a pilD (xcpA) mutation in P. aeruginosa. Nucleotide sequencing revealed, next to the pilD (xcpA) gene, the presence of two additional genes, pilA and pilC, that are highly homologous to genes involved in the biogenesis of type IV pili. The pilA gene encodes the pilin subunit, and pilC is an accessory gene, required for the assembly of the subunits into pili. In comparison with the pil gene cluster in P. aeruginosa, a gene homologous to pilB is lacking in the P. putida gene cluster. Pili were not detected on the cell surface of P. putida itself, not even when pilA was expressed from the tac promoter on a plasmid, indicating that not all the genes required for pilus biogenesis were expressed under the conditions tested. Expression of pilA of P. putida in P. aeruginosa resulted in the production of pili containing P. putida PilA subunits. Images PMID:7905475

  4. Analysis of the sexual development-promoting region of Schizophyllum commune TRP1 gene.


    Sen, Kikuo; Kinoshita, Hideki; Tazuke, Kazuyuki; Maki, Yoshinori; Yoshiura, Yumi; Yakushi, Toshiharu; Shibai, Hiroshiro; Kurosawa, Shin-Ichi


    This study aims to elucidate the mechanism of sexual development of basidiomycetous mushrooms from mating to fruit body formation. Sequencing analysis showed the TRP1 gene of basidiomycete Schizophyllum commune encoded an enzyme with three catalytic regions of GAT (glutamine amidotransferase), IGPS (indole-3-glycerol phosphate synthase), and PRAI (5-phosphoribosyl anthranilate isomerase); among these three regions, the trp1 mutant (Trp(-)) had a missense mutation (L→F) of a 338th amino acid residue of the TRP1 protein within the IGPS region. To investigate the function of IGPS region related to sexual development, dikaryons with high, usual, and no expression of the IGPS region of TRP1 gene were made. The dikaryotic mycelia with high expression of the IGPS formed mature fruit bodies earlier than those with usual and no expression of the IGPS. These results showed that the IGPS region in TRP1 gene promoted sexual development of S. commune. PMID:27296855

  5. Mapping and validation of Xanthomonas citri subsp citri genes regulated by putative plant-inducible promoter box (PIP-box).


    Carvalho, F M S; Oliveira, J C F; Laia, M L; Jacob, T R; Ferreira, R M; Ferro, M I T; Tezza, R I D; Zingaretti, S M; Silva, C F; Ferro, J A


    Citrus canker, caused by the Gram-negative bacterium Xanthomonas citri subsp citri (Xac), is a major disease affecting citriculture worldwide, because of the susceptibility of the host and the lack of efficient control methods. Previous studies have reported that some genes of phytopathogenic bacteria possess a consensus nucleotide sequence (TTCGC...N15...TTCGC) designated the "plant-inducible-promoter box" (PIP box) located in the promoter region, which is responsible for activating the expression of pathogenicity and virulence factors when the pathogen is in contact with the host plant. In this study, we mapped and investigated the expression of 104 Xac genes associated with the PIP box sequences using a macroarray analysis. Xac gene expression was observed during in vitro (Xac grown for 12 or 20 h in XAM1 induction medium) or in vivo (bacteria grown in orange leaves for 3 to 5 days) infection conditions. Xac grown in non-induction NB liquid medium was used as the control. cDNA was isolated from bacteria grown under the different conditions and hybridized to the macroarray, and 32 genes differentially expressed during the infection period (in vitro or in vivo induction) were identified. The macroarray results were validated for some of the genes through semi-quantitative RT-PCR, and the functionality of the PIP box-containing promoter was demonstrated by activating b-glucuronidase reporter gene activity by the PIP box-containing promoter region during Xac-citrus host interaction. PMID:27173329

  6. Draft Genome Sequence of Pantoea ananatis Strain AMG521, a Rice Plant Growth-Promoting Bacterial Endophyte Isolated from the Guadalquivir Marshes in Southern Spain.


    Megías, Esaú; Megías, Manuel; Ollero, Francisco Javier; Hungria, Mariangela


    The rice endophyte Pantoea ananatis AMG521 shows several plant growth-promoting properties and promotes rice yield increases. Its draft genome was estimated at 4,891,568 bp with 4,704 coding sequences (CDS). The genome encodes genes for N-acylhomoserine lactone (AHL) synthases, AHL hydrolases, hyperadherence (yidQ, yidP, and yidR), fusaric acid resistance, and oxidation of lignin, highlighting its biotechnological potential. PMID:26893418

  7. Draft Genome Sequence of Pantoea ananatis Strain AMG521, a Rice Plant Growth-Promoting Bacterial Endophyte Isolated from the Guadalquivir Marshes in Southern Spain

    PubMed Central

    Megías, Esaú; Megías, Manuel; Ollero, Francisco Javier


    The rice endophyte Pantoea ananatis AMG521 shows several plant growth-promoting properties and promotes rice yield increases. Its draft genome was estimated at 4,891,568 bp with 4,704 coding sequences (CDS). The genome encodes genes for N-acylhomoserine lactone (AHL) synthases, AHL hydrolases, hyperadherence (yidQ, yidP, and yidR), fusaric acid resistance, and oxidation of lignin, highlighting its biotechnological potential. PMID:26893418

  8. Isolation and Analysis of the Cppsy Gene and Promoter from Chlorella protothecoides CS-41

    PubMed Central

    Li, Meiya; Cui, Yan; Gan, Zhibing; Shi, Chunlei; Shi, Xianming


    Phytoene synthase (PSY) catalyzes the condensation of two molecules of geranylgeranyl pyrophosphate to form phytoene, the first colorless carotene in the carotenoid biosynthesis pathway. So it is regarded as the crucial enzyme for carotenoid production, and has unsurprisingly been involved in genetic engineering studies of carotenoid production. In this study, the psy gene from Chlorella protothecoides CS-41, designated Cppsy, was cloned using rapid amplification of cDNA ends. The full-length DNA was 2488 bp, and the corresponding cDNA was 1143 bp, which encoded 380 amino acids. Computational analysis suggested that this protein belongs to the Isoprenoid_Biosyn_C1 superfamily. It contained the consensus sequence, including three predicted substrate-Mg2+ binding sites. The Cppsy gene promoter was also cloned and characterized. Analysis revealed several candidate motifs for the promoter, which exhibited light- and methyl jasmonate (MeJA)-responsive characteristics, as well as some typical domains universally discovered in promoter sequences, such as the TATA-box and CAAT-box. Light- and MeJA treatment showed that the Cppsy expression level was significantly enhanced by light and MeJA. These results provide a basis for genetically modifying the carotenoid biosynthesis pathway in C. protothecoides. PMID:26516871

  9. Isolation and Analysis of the Cppsy Gene and Promoter from Chlorella protothecoides CS-41.


    Li, Meiya; Cui, Yan; Gan, Zhibing; Shi, Chunlei; Shi, Xianming


    Phytoene synthase (PSY) catalyzes the condensation of two molecules of geranylgeranyl pyrophosphate to form phytoene, the first colorless carotene in the carotenoid biosynthesis pathway. So it is regarded as the crucial enzyme for carotenoid production, and has unsurprisingly been involved in genetic engineering studies of carotenoid production. In this study, the psy gene from Chlorella protothecoides CS-41, designated Cppsy, was cloned using rapid amplification of cDNA ends. The full-length DNA was 2488 bp, and the corresponding cDNA was 1143 bp, which encoded 380 amino acids. Computational analysis suggested that this protein belongs to the Isoprenoid_Biosyn_C1 superfamily. It contained the consensus sequence, including three predicted substrate-Mg(2+) binding sites. The Cppsy gene promoter was also cloned and characterized. Analysis revealed several candidate motifs for the promoter, which exhibited light- and methyl jasmonate (MeJA)-responsive characteristics, as well as some typical domains universally discovered in promoter sequences, such as the TATA-box and CAAT-box. Light- and MeJA treatment showed that the Cppsy expression level was significantly enhanced by light and MeJA. These results provide a basis for genetically modifying the carotenoid biosynthesis pathway in C. protothecoides. PMID:26516871

  10. Structural and functional analysis of the human CD45 gene (PTPRC) upstream region: evidence for a functional promoter within the first intron of the gene

    PubMed Central

    Timón, M; Beverley, P C L


    Expression of the leucocyte common antigen (CD45) in mammals is restricted to the nucleated lineages of haematopoietic cells. It appears in early progenitors in the bone marrow and is expressed at the surface of these cells throughout their differentiation. However, at least in T cells, the pattern of expression switches between different isoforms during the successive stages of differentiation in the thymus and after activation in the periphery. In order to understand the mechanisms controlling the transcription of the human CD45 gene, 2·7 kbp of the 5′-flanking region were sequenced and analysed for their ability to direct expression of a reporter gene. The only region with promoter activity was localized within the first intron of the gene. This promoter shows no tissue specificity but could be enhanced by a heterologous enhancer. Mobility shift assays showed complex but specific protein binding. The sequence in this region lacks similarity with known promoters or initiators but is highly conserved in evolution. No transcription initiation could be detected within or downstream of this region, suggesting that this might be a new type of RNA polymerase II promoter able to drive transcription from an upstream sequence. An additional exon was also found upstream of exon 1. The two exons 1 (1a and 1b) are mutually exclusive and both are spliced to exon 2. This makes the structure of the 5′ region of the human CD45 gene identical to its mouse homologue. PMID:11260323

  11. Phosphoglycerate kinase gene from Zymomonas mobilis: cloning sequencing, and localization within the gap operon

    SciTech Connect

    Conway, T.; Ingram, L.O.


    The Zymomonas mobilis gene encoding phosphoglycerate kinase (EC, pgk, has been cloned into Escherichia coli and sequenced. It consists of 336 amino acids, including the N-terminal methionine, with a molecular weight of 47,384. This promoterless gene is located 225 base pairs downstream from the gap gene and is part of the gap operon. Previous studies have shown that the specific activities of glyceraldehyde-3-phosphate dehydrogenase and phosphoglycerate kinase do not change coordinately in Z. mobilis, although the two enzymes appear to be under the control of a common promoter. The translated amino acid sequence for the Z. mobilis phosphoglycerte kinase is less conserved than those of eucaryotic genes. A comparison of known sequences for phosphoglycerate kinase revealed a high degree of conservation of structure with 102 amino acid positions being retained by all. In general, the amino acid positions at the boundaries of ..beta..-sheet and ..cap alpha..-helical regions and those connecting these regions were more highly conserved than the amino acid positions within regions of secondary structure.

  12. Identification and characterization of rhizospheric microbial diversity by 16S ribosomal RNA gene sequencing.


    Naveed, Muhammad; Mubeen, Samavia; Khan, SamiUllah; Ahmed, Iftikhar; Khalid, Nauman; Suleria, Hafiz Ansar Rasul; Bano, Asghari; Mumtaz, Abdul Samad


    In the present study, samples of rhizosphere and root nodules were collected from different areas of Pakistan to isolate plant growth promoting rhizobacteria. Identification of bacterial isolates was made by 16S rRNA gene sequence analysis and taxonomical confirmation on EzTaxon Server. The identified bacterial strains were belonged to 5 genera i.e. Ensifer, Bacillus, Pseudomona, Leclercia and Rhizobium. Phylogenetic analysis inferred from 16S rRNA gene sequences showed the evolutionary relationship of bacterial strains with the respective genera. Based on phylogenetic analysis, some candidate novel species were also identified. The bacterial strains were also characterized for morphological, physiological, biochemical tests and glucose dehydrogenase (gdh) gene that involved in the phosphate solublization using cofactor pyrroloquinolone quinone (PQQ). Seven rhizoshperic and 3 root nodulating stains are positive for gdh gene. Furthermore, this study confirms a novel association between microbes and their hosts like field grown crops, leguminous and non-leguminous plants. It was concluded that a diverse group of bacterial population exist in the rhizosphere and root nodules that might be useful in evaluating the mechanisms behind plant microbial interactions and strains QAU-63 and QAU-68 have sequence similarity of 97 and 95% which might be declared as novel after further taxonomic characterization. PMID:25477935

  13. Identification and characterization of rhizospheric microbial diversity by 16S ribosomal RNA gene sequencing

    PubMed Central

    Naveed, Muhammad; Mubeen, Samavia; khan, SamiUllah; Ahmed, Iftikhar; Khalid, Nauman; Suleria, Hafiz Ansar Rasul; Bano, Asghari; Mumtaz, Abdul Samad


    In the present study, samples of rhizosphere and root nodules were collected from different areas of Pakistan to isolate plant growth promoting rhizobacteria. Identification of bacterial isolates was made by 16S rRNA gene sequence analysis and taxonomical confirmation on EzTaxon Server. The identified bacterial strains were belonged to 5 genera i.e. Ensifer, Bacillus, Pseudomona, Leclercia and Rhizobium. Phylogenetic analysis inferred from 16S rRNA gene sequences showed the evolutionary relationship of bacterial strains with the respective genera. Based on phylogenetic analysis, some candidate novel species were also identified. The bacterial strains were also characterized for morphological, physiological, biochemical tests and glucose dehydrogenase (gdh) gene that involved in the phosphate solublization using cofactor pyrroloquinolone quinone (PQQ). Seven rhizoshperic and 3 root nodulating stains are positive for gdh gene. Furthermore, this study confirms a novel association between microbes and their hosts like field grown crops, leguminous and non-leguminous plants. It was concluded that a diverse group of bacterial population exist in the rhizosphere and root nodules that might be useful in evaluating the mechanisms behind plant microbial interactions and strains QAU-63 and QAU-68 have sequence similarity of 97 and 95% which might be declared as novel after further taxonomic characterization. PMID:25477935

  14. Aberrant Gene Promoter Methylation Associated with Sporadic Multiple Colorectal Cancer

    PubMed Central

    Gonzalo, Victoria; Lozano, Juan José; Muñoz, Jenifer; Balaguer, Francesc; Pellisé, Maria; de Miguel, Cristina Rodríguez; Andreu, Montserrat; Jover, Rodrigo; Llor, Xavier; Giráldez, M. Dolores; Ocaña, Teresa; Serradesanferm, Anna; Alonso-Espinaco, Virginia; Jimeno, Mireya; Cuatrecasas, Miriam; Sendino, Oriol; Castellví-Bel, Sergi; Castells, Antoni


    Background Colorectal cancer (CRC) multiplicity has been mainly related to polyposis and non-polyposis hereditary syndromes. In sporadic CRC, aberrant gene promoter methylation has been shown to play a key role in carcinogenesis, although little is known about its involvement in multiplicity. To assess the effect of methylation in tumor multiplicity in sporadic CRC, hypermethylation of key tumor suppressor genes was evaluated in patients with both multiple and solitary tumors, as a proof-of-concept of an underlying epigenetic defect. Methodology/Principal Findings We examined a total of 47 synchronous/metachronous primary CRC from 41 patients, and 41 gender, age (5-year intervals) and tumor location-paired patients with solitary tumors. Exclusion criteria were polyposis syndromes, Lynch syndrome and inflammatory bowel disease. DNA methylation at the promoter region of the MGMT, CDKN2A, SFRP1, TMEFF2, HS3ST2 (3OST2), RASSF1A and GATA4 genes was evaluated by quantitative methylation specific PCR in both tumor and corresponding normal appearing colorectal mucosa samples. Overall, patients with multiple lesions exhibited a higher degree of methylation in tumor samples than those with solitary tumors regarding all evaluated genes. After adjusting for age and gender, binomial logistic regression analysis identified methylation of MGMT2 (OR, 1.48; 95% CI, 1.10 to 1.97; p = 0.008) and RASSF1A (OR, 2.04; 95% CI, 1.01 to 4.13; p = 0.047) as variables independently associated with tumor multiplicity, being the risk related to methylation of any of these two genes 4.57 (95% CI, 1.53 to 13.61; p = 0.006). Moreover, in six patients in whom both tumors were available, we found a correlation in the methylation levels of MGMT2 (r = 0.64, p = 0.17), SFRP1 (r = 0.83, 0.06), HPP1 (r = 0.64, p = 0.17), 3OST2 (r = 0.83, p = 0.06) and GATA4 (r = 0.6, p = 0.24). Methylation in normal appearing colorectal mucosa from patients with multiple

  15. Evaluation of gene-finding programs on mammalian sequences.


    Rogic, S; Mackworth, A K; Ouellette, F B


    We present an independent comparative analysis of seven recently developed gene-finding programs: FGENES, GeneMark.hmm, Genie, Genescan, HMMgene, Morgan, and MZEF. For evaluation purposes we developed a new, thoroughly filtered, and biologically validated dataset of mammalian genomic sequences that does not overlap with the training sets of the programs analyzed. Our analysis shows that the new generation of programs has substantially better results than the programs analyzed in previous studies. The accuracy of the programs was also examined as a function of various sequence and prediction features, such as G + C content of the sequence, length and type of exons, signal type, and score of the exon prediction. This approach pinpoints the strengths and weaknesses of each individual program as well as those of computational gene-finding in general. The dataset used in this analysis (HMR195) as well as the tables with the complete results are available at PMID:11337477

  16. Full-length minor ampullate spidroin gene sequence.


    Chen, Gefei; Liu, Xiangqin; Zhang, Yunlong; Lin, Senzhu; Yang, Zijiang; Johansson, Jan; Rising, Anna; Meng, Qing


    Spider silk includes seven protein based fibers and glue-like substances produced by glands in the spider's abdomen. Minor ampullate silk is used to make the auxiliary spiral of the orb-web and also for wrapping prey, has a high tensile strength and does not supercontract in water. So far, only partial cDNA sequences have been obtained for minor ampullate spidroins (MiSps). Here we describe the first MiSp full-length gene sequence from the spider species Araneus ventricosus, using a multidimensional PCR approach. Comparative analysis of the sequence reveals regulatory elements, as well as unique spidroin gene and protein architecture including the presence of an unusually large intron. The spliced full-length transcript of MiSp gene is 5440 bp in size and encodes 1766 amino acid residues organized into conserved nonrepetitive N- and C-terminal domains and a central predominantly repetitive region composed of four units that are iterated in a non regular manner. The repeats are more conserved within A. ventricosus MiSp than compared to repeats from homologous proteins, and are interrupted by two nonrepetitive spacer regions, which have 100% identity even at the nucleotide level. PMID:23251707

  17. Full-Length Minor Ampullate Spidroin Gene Sequence

    PubMed Central

    Chen, Gefei; Liu, Xiangqin; Zhang, Yunlong; Lin, Senzhu; Yang, Zijiang; Johansson, Jan; Rising, Anna; Meng, Qing


    Spider silk includes seven protein based fibers and glue-like substances produced by glands in the spider's abdomen. Minor ampullate silk is used to make the auxiliary spiral of the orb-web and also for wrapping prey, has a high tensile strength and does not supercontract in water. So far, only partial cDNA sequences have been obtained for minor ampullate spidroins (MiSps). Here we describe the first MiSp full-length gene sequence from the spider species Araneus ventricosus, using a multidimensional PCR approach. Comparative analysis of the sequence reveals regulatory elements, as well as unique spidroin gene and protein architecture including the presence of an unusually large intron. The spliced full-length transcript of MiSp gene is 5440 bp in size and encodes 1766 amino acid residues organized into conserved nonrepetitive N- and C-terminal domains and a central predominantly repetitive region composed of four units that are iterated in a non regular manner. The repeats are more conserved within A. ventricosus MiSp than compared to repeats from homologous proteins, and are interrupted by two nonrepetitive spacer regions, which have 100% identity even at the nucleotide level. PMID:23251707

  18. Characterization of the Human Insulin-induced Gene 2 (INSIG2) Promoter

    PubMed Central

    Fernández-Alvarez, Ana; Soledad Alvarez, María; Cucarella, Carme; Casado, Marta


    Insulin-induced gene 2 (INSIG2) and its homolog INSIG1 encode closely related endoplasmic reticulum proteins that regulate the proteolytic activation of sterol regulatory element-binding proteins, transcription factors that activate the synthesis of cholesterol and fatty acids in animal cells. Several studies have been carried out to identify INSIG2 genetic variants associated with metabolic diseases. However, few data have been published regarding the regulation of INSIG2 gene expression. Two Insig2 transcripts have been described in rodents through the use of different promoters that produce different noncoding first exons that splice into a common second exon. Herein we report the cloning and characterization of the human INSIG2 promoter and the detection of an INSIG2-specific transcript homologous to the Insig2b mouse variant in human liver. Deletion analyses on 3 kb of 5′-flanking DNA of the human INSIG2 gene revealed the functional importance of a 350-bp region upstream of the transcription start site. Mutated analyses, chromatin immunoprecipitation assays, and RNA interference analyses unveiled the significance of an Ets-consensus motif in the proximal region and the interaction of the Ets family member SAP1a (serum response factor (SRF) accessory protein-1a) with this region of the human INSIG2 promoter. Moreover, our findings suggest that insulin activated the human INSIG2 promoter in a process mediated by phosphorylated SAP1a. Overall, these results map the functional elements in the human INSIG2 promoter sequence and suggest an unexpected regulation of INSIG2 gene expression in human liver. PMID:20145255

  19. Novel polymorphisms of the APOA2 gene and its promoter region affect body traits in cattle.


    Zhou, Yang; Li, Caixia; Cai, Hanfang; Xu, Yao; Lan, Xianyong; Lei, Chuzhao; Chen, Hong


    Apolipoprotein A-II (APOA2) is one of the major constituents of high-density lipoprotein and plays a critical role in lipid metabolism and obesity. However, similar research for the bovine APOA2 gene is lacking. In this study, polymorphisms of the bovine APOA2 gene and its promoter region were detected in 1021 cows from four breeds by sequencing and PCR-RFLP methods. Totally, we detected six novel mutations which included one mutation in the promoter region, two mutations in the exons and three mutations in the introns. There were four polymorphisms within APOA2 gene were analyzed. The allele A, T, T and G frequencies of the four loci were predominant in the four breeds when in separate or combinations analysis which suggested cows with those alleles to be more adapted to the steppe environment. The association analysis indicated three SVs in Nangyang cows, two SVs in Qinchun cows and the 9 haplotypes in Nangyang cows were significantly associated with body traits (P<0.05 or P<0.01). The results of this study suggested the bovine APOA2 gene may be a strong candidate gene for body traits in the cattle breeding program. PMID:24004543

  20. Complete genome sequence of Bacillus amyloliquefaciens strain Co1-6, a plant growth-promoting rhizobacterium of Calendula officinalis

    SciTech Connect

    Köberl, Martina; White, Richard A.; Erschen, Sabine; Spanberger, Nora; El-Arabi, Tarek F.; Jansson, Janet K.; Berg, Gabriele


    The genome sequence of Bacillus amyloliquefaciens strain Co1-6, a plant growth-promoting rhizobacterium (PGPR) with broad-spectrum antagonistic activity against plant-pathogenic fungi, bacteria, and nematodes, consists of a single 3.9-Mb circular chromosome. The genome reveals genes putatively responsible for its promising biocontrol and PGP properties.

  1. Genome Sequence of Enterobacter radicincitans DSM16656T, a Plant Growth-Promoting Endophyte

    PubMed Central

    Witzel, Katja; Gwinn-Giglio, Michelle; Nadendla, Suvarna; Shefchek, Kent


    Enterobacter radicincitans sp. nov. DSM16656T represents a new species of the genus Enterobacter which is a biological nitrogen-fixing endophytic bacterium with growth-promoting effects on a variety of crop and model plant species. The presence of genes for nitrogen fixation, phosphorous mobilization, and phytohormone production reflects this microbe's potential plant growth-promoting activity. PMID:22965092

  2. Cloning and sequencing of a Bacteroides ruminicola B(1)4 endoglucanase gene.

    PubMed Central

    Matsushita, O; Russell, J B; Wilson, D B


    Bacteroides ruminicola B(1)4, a noncellulolytic rumen bacterium, produces an endoglucanase (carboxymethylcellulase [CMCase]) that is excreted into the culture supernatant. Cultures grown on glucose, fructose, maltose, mannose, and cellobiose had high specific activities of CMCase (greater than 3 mmol of reducing sugar per mg of protein per min), but its synthesis was repressed by sucrose. B. rumincola did not grow on either ball-milled or acid-swollen cellulose even though the CMCase could hydrolyze swollen cellulose. The CMCase gene was cloned into Escherichia coli, and its nucleotide sequence contained a single open reading frame coding for a protein of 40,481 daltons. The enzyme was overproduced in E. coli under the control of the tac promoter and purified to homogeneity. The N-terminal sequence, amino acid composition, and molecular weight of the purified enzyme were similar to the values predicted from the open reading frame of the DNA sequence. However, the CMCase present in B. ruminicola was found to have a monomer molecular weight of 88,000 by Western immunoblotting. This discrepancy appeared to have resulted from our having cloned only part of the CMCase gene into E. coli. The amino acid sequence of the CMCase showed homology to sequences of beta-glucanases from Ruminococcus albus and Clostridium thermocellum. Images PMID:2361940

  3. Sequence and transcriptional start site of the Pseudomonas aeruginosa outer membrane porin protein F gene.

    PubMed Central

    Duchêne, M; Schweizer, A; Lottspeich, F; Krauss, G; Marget, M; Vogel, K; von Specht, B U; Domdey, H


    Porin F is one of the major proteins of the outer membrane of Pseudomonas aeruginosa. It forms water-filled pores of variable size. Porin F is a candidate for a vaccine against P. aeruginosa because it antigenically cross-reacts in all serotype strains of the International Antigenic Typing Scheme. We have isolated the gene for porin F from a lambda EMBL3 bacteriophage library by using oligodeoxynucleotide hybridization probes and have determined its nucleotide sequence. Different peptide sequences obtained from isolated porin F confirmed the deduced protein sequence. The mature protein consists of 326 amino acid residues and has a molecular weight of 35,250. The precursor contains an N-terminal signal peptide of 24 amino acid residues. S1 protection and primer extension experiments, together with Northern (RNA) blots, indicate that the mRNA coding for porin F is monocistronic with short untranslated regions of about 58 bases at the 5' end and about 47 bases at the 3' end. The sequences in the -10 and -35 regions upstream of the transcriptional start site are closely related to the Escherichia coli promoter consensus sequences, which explains why the porin F gene is expressed in E. coli under the control of its own promoter. The amino acid sequence of porin F is not homologous to the different E. coli porins OmpF, OmpC, LamB, and PhoE. On the other hand, a highly homologous region of 30 amino acids between the OmpA proteins of different enteric bacteria and porin F of P. aeruginosa was detected. The core region of the homology to E. coli OmpA had 11 of 12 amino acid residues in common. Images PMID:2447060

  4. Identification of novel functional sequence variants in the gene for peptidase inhibitor 3

    PubMed Central

    Chowdhury, Mahboob A; Kuivaniemi, Helena; Romero, Roberto; Edwin, Samuel; Chaiworapongsa, Tinnakorn; Tromp, Gerard


    Background Peptidase inhibitor 3 (PI3) inhibits neutrophil elastase and proteinase-3, and has a potential role in skin and lung diseases as well as in cancer. Genome-wide expression profiling of chorioamniotic membranes revealed decreased expression of PI3 in women with preterm premature rupture of membranes. To elucidate the molecular mechanisms contributing to the decreased expression in amniotic membranes, the PI3 gene was searched for sequence variations and the functional significance of the identified promoter variants was studied. Methods Single nucleotide polymorphisms (SNPs) were identified by direct sequencing of PCR products spanning a region from 1,173 bp upstream to 1,266 bp downstream of the translation start site. Fourteen SNPs were genotyped from 112 and nine SNPs from 24 unrelated individuals. Putative transcription factor binding sites as detected by in silico search were verified by electrophoretic mobility shift assay (EMSA) using nuclear extract from Hela and amnion cell nuclear extract. Deviation from Hardy-Weinberg equilibrium (HWE) was tested by χ2 goodness-of-fit test. Haplotypes were estimated using expectation maximization (EM) algorithm. Results Twenty-three sequence variations were identified by direct sequencing of polymerase chain reaction (PCR) products covering 2,439 nt of the PI3 gene (-1,173 nt of promoter sequences and all three exons). Analysis of 112 unrelated individuals showed that 20 variants had minor allele frequencies (MAF) ranging from 0.02 to 0.46 representing "true polymorphisms", while three had MAF ≤ 0.01. Eleven variants were in the promoter region; several putative transcription factor binding sites were found at these sites by database searches. Differential binding of transcription factors was demonstrated at two polymorphic sites by electrophoretic mobility shift assays, both in amniotic and HeLa cell nuclear extracts. Differential binding of the transcription factor GATA1 at -689C>G site was confirmed by a

  5. Characterization of a putative cis-regulatory element that controls transcriptional activity of the pig uroplakin II gene promoter

    SciTech Connect

    Kwon, Deug-Nam; Park, Mi-Ryung; Park, Jong-Yi; Cho, Ssang-Goo; Park, Chankyu; Oh, Jae-Wook; Song, Hyuk; Kim, Jae-Hwan; Kim, Jin-Hoi


    Highlights: {yields} The sequences of -604 to -84 bp of the pUPII promoter contained the region of a putative negative cis-regulatory element. {yields} The core promoter was located in the 5F-1. {yields} Transcription factor HNF4 can directly bind in the pUPII core promoter region, which plays a critical role in controlling promoter activity. {yields} These features of the pUPII promoter are fundamental to development of a target-specific vector. -- Abstract: Uroplakin II (UPII) is a one of the integral membrane proteins synthesized as a major differentiation product of mammalian urothelium. UPII gene expression is bladder specific and differentiation dependent, but little is known about its transcription response elements and molecular mechanism. To identify the cis-regulatory elements in the pig UPII (pUPII) gene promoter region, we constructed pUPII 5' upstream region deletion mutants and demonstrated that each of the deletion mutants participates in controlling the expression of the pUPII gene in human bladder carcinoma RT4 cells. We also identified a new core promoter region and putative negative cis-regulatory element within a minimal promoter region. In addition, we showed that hepatocyte nuclear factor 4 (HNF4) can directly bind in the pUPII core promoter (5F-1) region, which plays a critical role in controlling promoter activity. Transient cotransfection experiments showed that HNF4 positively regulates pUPII gene promoter activity. Thus, the binding element and its binding protein, HNF4 transcription factor, may be involved in the mechanism that specifically regulates pUPII gene transcription.

  6. Promoter analysis and expression of a phospholipase D gene from castor bean.

    PubMed Central

    Xu, L; Zheng, S; Zheng, L; Wang, X


    The expression of a castor bean (Ricinus communis L.) phospholipase D (PLD; EC gene has been studied by examining its promoter activity in transgenic tobacco (Nicotiana tabacum) carrying a PLD promoter-glucuronidase transgene and by monitoring the levels of PLD mRNA in castor bean. Sequence and the 5' truncation analyses revealed that the 5' flanking region from nucleotide -1200 to -730 is required for the regulation and basal function of the PLD promoter. The PLD promoter in vegetative tissues is highly active in the rapidly growing regions such as the shoot apex and the secondary meristem producing axillary buds and vascular tissues of young leaves and stems. The PLD promoter activity in floral tissues was high in stigma, ovary, and pollen grains, but low in petals, sepals, the epidermis of anthers, styles, and filaments. The PLD promoter activity was enhanced by abscisic acid. Northern-blot analysis of PLD in castor bean showed that the PLD mRNA levels were high in young and metabolically more active tissues such as expanding leaves, hypocotyl hooks, developing seeds, and young seedlings, and they decreased in mature tissues such as fully expanded leaves and developed seeds. These patterns of expression suggest a role of PLD in rapid cell growth, proliferation, and reproduction. PMID:9342861

  7. Expression patterns and promoter activity of the cold-regulated gene ci21A of potato.

    PubMed Central

    Schneider, A; Salamini, F; Gebhardt, C


    Storage of potato (Solanum tuberosum) tubers at 4 degrees C is associated with the accumulation of several transcripts. DNA sequence analysis of cDNA clone CI21, which corresponds to one of the cold-induced transcripts, revealed high homology to transcripts of tomato (Lycopersicon esculentum) and wild potato (Solanum chacoense) induced by ripening and water stress. Two homologous, nonallelic genes, ci21A and ci21B, were isolated and sequenced. Northern blot analysis showed that CI21 transcripts were present at the highest levels in cold-stored tubers, at lower levels in stems and roots, and at the lowest levels in leaves and tubers stored at room temperature. Treatment with abscisic acid, heat, and a high concentration of salt had no marked effect on CI21 transcript levels in tubers and leaves. Drought was the only stress treatment that induced CI21 transcripts in leaves, but it did not do so in tubers. Western blot analysis detected CI21 protein only in tubers. Chimeric gene constructs between the putative ci21A promoter region and the uidA reporter gene were tested in transgenic potato plants for induction of beta-glucuronidase activity by low temperature. A 2-fold increase of beta-glucuronidase activity in response to tuber storage at 4 degrees C was observed for fragments between 380 and 2000 bp of the ci21A promoter region. PMID:9046587

  8. Mutation of either G box or I box sequences profoundly affects expression from the Arabidopsis rbcS-1A promoter.

    PubMed Central

    Donald, R G; Cashmore, A R


    A deletion analysis of the Arabidopsis thaliana rbcS-1A promoter defined a 196 bp region (-320 to -125) sufficient to confer light-regulated expression on a heterologous Arabidopsis alcohol dehydrogenase (Adh) reporter gene in transgenic Nicotiana tabacum (tobacco) leaves. This region, which contains DNA sequences I, G and GT boxes, with homology to other ribulose-1,5-bisphosphate carboxylase small subunit (RBCS) gene promoter sequences, directed expression independent of orientation and relative position in the Adh promoter. Site-specific mutagenesis of these conserved sequences and subsequent expression analysis in transgenic tobacco showed that both G box and I box mutations in the context of the full (-1700 to +21) rbcS-1A promoter substantially reduced the expression of Adh and beta-glucuronidase (GUS) reporter genes. The G box has previously been shown to specifically bind in vitro a factor isolated from nuclear extracts of tomato and Arabidopsis. This factor (GBF) is distinct from the factor GT-1 which binds to adjacent GT boxes in the pea rbcS-3A promoter. Multiple mutations in putative Arabidopsis rbcS-1A promoter GT boxes had no pronounced affect on expression, possibly due to a redundancy of these sites. Experiments in which rbcS-1A promoter fragments were fused to truncated 35S CaMV (cauliflower mosaic virus) promoter--GUS reporter constructs showed that cis-acting CaMV promoter elements could partially restore expression to G-box-mutated rbcS-1A sequences. Images Fig. 1. Fig. 2. Fig. 4. Fig. 5. Fig. 6. PMID:2347304

  9. Second-generation sequencing for gene discovery in the Brassicaceae.


    Hayward, Alice; Vighnesh, Guru; Delay, Christina; Samian, Mohd Rafizan; Manoli, Sahana; Stiller, Jiri; McKenzie, Megan; Edwards, David; Batley, Jacqueline


    The Brassicaceae contains the most diverse collection of agriculturally important crop species of all plant families. Yet, this is one of the few families that do not form functional symbiotic associations with mycorrhizal fungi in the soil for improved nutrient acquisition. The genes involved in this symbiosis were more recently recruited by legumes for symbiotic association with nitrogen-fixing rhizobia bacteria. This study applied second-generation sequencing (SGS) and analysis tools to discover that two such genes, NSP1 (Nodulation Signalling Pathway 1) and NSP2, remain conserved in diverse members of the Brassicaceae despite the absence of these symbioses. We demonstrate the utility of SGS data for the discovery of putative gene homologs and their analysis in complex polyploid crop genomes with little prior sequence information. Furthermore, we show how this data can be applied to enhance downstream reverse genetics analyses. We hypothesize that Brassica NSP genes may function in the root in other plant-microbe interaction pathways that were recruited for mycorrhizal and rhizobial symbioses during evolution. PMID:22765874

  10. Characterization of novel promoter and enhancer elements of the mouse homologue of the Dent disease gene, CLCN5, implicated in X-linked hereditary nephrolithiasis.


    Tanaka, K; Fisher, S E; Craig, I W


    The murine homologue of the human chloride channel gene, CLCN5, defects in which are responsible for Dent disease, has been cloned and characterized. We isolated the entire coding region of mouse Clcn5 cDNA and approximately 45 kb of genomic sequence embracing the gene. To study its transcriptional control, the 5' upstream sequences of the mouse Clcn5 gene were cloned into a luciferase reporter vector. Deletion analysis of 1.5 kb of the 5' flanking sequence defined an active promoter region within 128 bp of the putative transcription start site, which is associated with a TATA motif but lacks a CAAT consensus. Within this sequence, there is a motif with homology to a purine-rich sequence responsible for the kidney-specific promoter activity of the rat CLC-K1 gene, another member of the chloride-channel gene family expressed in kidney. An enhancer element that confers a 10- to 20-fold increase in the promoter activity of the mouse Clcn5 gene was found within the first intron. The organization of the human CLCN5 and mouse Clcn5 gene structures is highly conserved, and the sequence of the murine protein is 98% similar to that of human, with its highest expression seen in the kidney. This study thus provides the first identification of the transcriptional control region of, and the basis for an understanding of the regulatory mechanism that controls, this kidney-specific, chloride-channel gene. PMID:10373326

  11. Complete Genome Sequence of the Rhizobacterium Pseudomonas trivialis Strain IHBB745 with Multiple Plant Growth-Promoting Activities and Tolerance to Desiccation and Alkalinity.


    Gulati, Arvind; Swarnkar, Mohit Kumar; Vyas, Pratibha; Rahi, Praveen; Thakur, Rishu; Thakur, Namika; Singh, Anil Kumar


    The complete genome sequence of 6.45 Mb is reported here for Pseudomonas trivialis strain IHBB745 (MTCC 5336), which is an efficient, stress-tolerant, and broad-spectrum plant growth-promoting rhizobacterium. The gene-coding clusters predicted the genes for phosphate solubilization, siderophore production, 1-aminocyclopropane-1-carboxylate (ACC) deaminase activity, indole-3-acetic acid (IAA) production, and stress response. PMID:26337878

  12. Functional characterization of the Ginkgo biloba chalcone synthase gene promoter in transgenic tobacco.


    Li, L L; Cheng, H; Yuan, H H; Xu, F; Cheng, S Y; Cao, F L


    The regulative sequence (2273 bp) of the chalcone synthase gene promoter of biloba was cloned by genomic walking. A 2273-bp promoter 5' upstream translation start site of GbCHS was cloned and designated as GbCHSP. pBI121+CHSP:GUS and pBI121-35S:GUS were constructed and transformed into tobacco by LBA4404. We found that GbCHSP could drive transient expression of GUS in tobacco and differentially expressed in root, stem and leaf tissues of this plant. GUS activity regulated by the CHSP promoter were located in tissues (apical meristems) at the growing points of roots and stems. pBI121+CHSP:GUS could be induced by wounding, copper, UV-B, abscisic acid, and ethephon treatments of transgenic seedlings. This activity was weakly inhibited by gibberellin. Deletion analysis of the CHSP promoter in transgenic tobacco showed that CHSP1 complete promoter conferred a GUS expression and activity similar to that of 35 S(CaMV). GUS activity dropped dramatically when there were CHSP4, CHSP5 constructs and was almost totally absent when the CHSP6 construct was present. We conclude that the upstream sequence -1548 to -306 of GbCHSP is the main region for transcriptional regulation of the CHS gene and that it is activated by hormone and stress factors in G. biloba. These results will help us to understand the transcriptional regulatory mechanisms involved in GbCHS expression and flavonoid accumulation in G. biloba. PMID:24841790

  13. NELF and GAGA Factor Are Linked to Promoter-Proximal Pausing at Many Genes in Drosophila▿ †

    PubMed Central

    Lee, Chanhyo; Li, Xiaoyong; Hechmer, Aaron; Eisen, Michael; Biggin, Mark D.; Venters, Bryan J.; Jiang, Cizhong; Li, Jian; Pugh, B. Franklin; Gilmour, David S.


    Recent analyses of RNA polymerase II (Pol II) revealed that Pol II is concentrated at the promoters of many active and inactive genes. NELF causes Pol II to pause in the promoter-proximal region of the hsp70 gene in Drosophila melanogaster. In this study, genome-wide location analysis (chromatin immunoprecipitation-microarray chip [ChIP-chip] analysis) revealed that NELF is concentrated at the 5′ ends of 2,111 genes in Drosophila cells. Permanganate genomic footprinting was used to determine if paused Pol II colocalized with NELF. Forty-six of 56 genes with NELF were found to have paused Pol II. Pol II pauses 30 to 50 nucleotides downstream from transcription start sites. Analysis of DNA sequences in the vicinity of paused Pol II identified a conserved DNA sequence that probably associates with TFIID but detected no evidence of RNA secondary structures or other conserved sequences that might directly control elongation. ChIP-chip experiments indicate that GAGA factor associates with 39% of the genes that have NELF. Surprisingly, NELF associates with almost one-half of the most highly expressed genes, indicating that NELF is not necessarily a repressor of gene expression. NELF-associated pausing of Pol II might be an obligatory but sometimes transient checkpoint during the transcription cycle. PMID:18332113

  14. Complete MHC haplotype sequencing for common disease gene mapping.


    Stewart, C Andrew; Horton, Roger; Allcock, Richard J N; Ashurst, Jennifer L; Atrazhev, Alexey M; Coggill, Penny; Dunham, Ian; Forbes, Simon; Halls, Karen; Howson, Joanna M M; Humphray, Sean J; Hunt, Sarah; Mungall, Andrew J; Osoegawa, Kazutoyo; Palmer, Sophie; Roberts, Anne N; Rogers, Jane; Sims, Sarah; Wang, Yu; Wilming, Laurens G; Elliott, John F; de Jong, Pieter J; Sawcer, Stephen; Todd, John A; Trowsdale, John; Beck, Stephan


    The future systematic mapping of variants that confer susceptibility to common diseases requires the construction of a fully informative polymorphism map. Ideally, every base pair of the genome would be sequenced in many individuals. Here, we report 4.75 Mb of contiguous sequence for each of two common haplotypes of the major histocompatibility complex (MHC), to which susceptibility to >100 diseases has been mapped. The autoimmune disease-associated-haplotypes HLA-A3-B7-Cw7-DR15 and HLA-A1-B8-Cw7-DR3 were sequenced in their entirety through a bacterial artificial chromosome (BAC) cloning strategy using the consanguineous cell lines PGF and COX, respectively. The two sequences were annotated to encompass all described splice variants of expressed genes. We defined the complete variation content of the two haplotypes, revealing >18,000 variations between them. Average SNP densities ranged from less than one SNP per kilobase to >60. Acquisition of complete and accurate sequence data over polymorphic regions such as the MHC from large-insert cloned DNA provides a definitive resource for the construction of informative genetic maps, and avoids the limitation of chromosome regions that are refractory to PCR amplification. PMID:15140828

  15. In vivo selection for metastasis promoting genes in the mouse.


    Gumireddy, Kiranmai; Sun, Fangxian; Klein-Szanto, Andres J; Gibbins, Jonathan M; Gimotty, Phyllis A; Saunders, Aleister J; Schultz, Peter G; Huang, Qihong


    Here, we report the identification of a metastasis promoting factor by a forward genetic screen in mice. A retroviral cDNA library was introduced into the nonmetastatic cancer cell line 168FARN, which was then orthotopically transplanted into mouse mammary fat pads, followed by selection for cells that metastasize to the lung. The genes encoding the disulfide isomerase ERp5 and beta-catenin were found to promote breast cancer invasion and metastasis. Disulfide isomerases (thiol isomerases), which catalyze disulfide bond formation, reduction, and isomerization, have not previously been implicated in cancer cell signaling and tumor metastasis. Overexpression of ERp5 promotes both in vitro migration and invasion and in vivo metastasis of breast cancer cells. These effects were shown to involve activation of ErbB2 and phosphoinositide 3-kinase (PI3K) pathways through dimerization of ErbB2. Activation of ErbB2 and PI3K subsequently stimulates RhoA and beta-catenin, which mediate the migration and invasion of tumor cells. Inhibition of ErbB2 and PI3K reverses the phenotypes induced by ERp5. Finally, ERp5 was shown to be up-regulated in human surgical samples of invasive breast cancers. These data identify a link between disulfide isomerases and tumor development, and provide a mechanism that modulates ErbB2 and PI3K signaling in the promotion of cancer progression. PMID:17420453

  16. In vivo selection for metastasis promoting genes in the mouse

    PubMed Central

    Gumireddy, Kiranmai; Sun, Fangxian; Klein-Szanto, Andres J.; Gibbins, Jonathan M.; Gimotty, Phyllis A.; Saunders, Aleister J.; Schultz, Peter G.; Huang, Qihong


    Here, we report the identification of a metastasis promoting factor by a forward genetic screen in mice. A retroviral cDNA library was introduced into the nonmetastatic cancer cell line 168FARN, which was then orthotopically transplanted into mouse mammary fat pads, followed by selection for cells that metastasize to the lung. The genes encoding the disulfide isomerase ERp5 and β-catenin were found to promote breast cancer invasion and metastasis. Disulfide isomerases (thiol isomerases), which catalyze disulfide bond formation, reduction, and isomerization, have not previously been implicated in cancer cell signaling and tumor metastasis. Overexpression of ERp5 promotes both in vitro migration and invasion and in vivo metastasis of breast cancer cells. These effects were shown to involve activation of ErbB2 and phosphoinositide 3-kinase (PI3K) pathways through dimerization of ErbB2. Activation of ErbB2 and PI3K subsequently stimulates RhoA and β-catenin, which mediate the migration and invasion of tumor cells. Inhibition of ErbB2 and PI3K reverses the phenotypes induced by ERp5. Finally, ERp5 was shown to be up-regulated in human surgical samples of invasive breast cancers. These data identify a link between disulfide isomerases and tumor development, and provide a mechanism that modulates ErbB2 and PI3K signaling in the promotion of cancer progression. PMID:17420453

  17. High-affinity homologous peptide nucleic acid probes for targeting a quadruplex-forming sequence from a MYC promoter element.


    Roy, Subhadeep; Tanious, Farial A; Wilson, W David; Ly, Danith H; Armitage, Bruce A


    Guanine-rich DNA and RNA sequences are known to fold into secondary structures known as G-quadruplexes. Recent biochemical evidence along with the discovery of an increasing number of sequences in functionally important regions of the genome capable of forming G-quadruplexes strongly indicates important biological roles for these structures. Thus, molecular probes that can selectively target quadruplex-forming sequences (QFSs) are envisioned as tools to delineate biological functions of quadruplexes as well as potential therapeutic agents. Guanine-rich peptide nucleic acids have been previously shown to hybridize to homologous DNA or RNA sequences forming PNA-DNA (or RNA) quadruplexes. For this paper we studied the hybridization of an eight-mer G-rich PNA to a quadruplex-forming sequence derived from the promoter region of the MYC proto-oncogene. UV melting analysis, fluorescence assays, and surface plasmon resonance experiments reveal that this PNA binds to the MYC QFS in a 2:1 stoichiometry and with an average binding constant Ka = (2.0 +/- 0.2) x 10(8) M(-1) or Kd = 5.0 nM. In addition, experiments carried out with short DNA targets revealed a dependence of the affinity on the sequence of bases in the loop region of the DNA. A structural model for the hybrid quadruplex is proposed, and implications for gene targeting by G-rich PNAs are discussed. PMID:17718513

  18. Two closely linked but separable promoters for human neuronal nitric oxide synthase gene transcription.

    PubMed Central

    Xie, J; Roddy, P; Rife, T K; Murad, F; Young, A P


    In this report we demonstrate that the human cerebellum contains neuronal nitric oxide synthase (nNOS) mRNAs with two distinct 5'-untranslated regions that are encoded through use of closely linked but separate promoters. nNOS cDNA clones were shown to contain different 5' terminal exons spliced to a common exon 2. Genomic cloning and sequence analysis demonstrate that the unique exons are positioned within 300 bp of each other but separated from exon 2 by an intron that is at least 20 kb in length. A CpG island engulfs the downstream 5'-terminal exon. In contrast, most of the upstream exon resides outside of this CpG island. Interestingly, the upstream exon includes a GT dinucleotide repeat. A fusion gene with a 414-bp nNOS genomic fragment that includes a portion of the upstream 5'-terminal exon and its immediate 5'-flanking DNA is expressed in transfected HeLa cells. Also expressed is a fusion gene that contains the luciferase reporter under transcriptional control by a 308-bp genomic fragment that includes the region separating both 5'-terminal exons. These results indicate that expression of these exons is subject to transcriptional control by separate promoters. However, the proximity of these promoters raise the possibility that complex interactions may be involved in regulating nNOS gene expression at these sites. Images Fig. 1 Fig. 4 PMID:7532307

  19. Promoter analysis of the membrane protein gp64 gene of the cellular slime mold Polysphondylium pallidum.


    Takaoka, N; Fukuzawa, M; Saito, T; Sakaitani, T; Ochiai, H


    We cloned a genomic fragment of the membrane protein gp64 gene of the cellular slime mold Polysphondylium pallidum by inverse PCR. Primer extension analysis identified a major transcription start site 65 bp upstream of the translation start codon. The promoter region of the gp64 gene contains sequences homologous to a TATA box at position -47 to -37 and to an initiator (Inr, PyPyCAPyPyPyPy) at position -3 to +5 from the transcription start site. Successively truncated segments of the promoter were tested for their ability to drive expression of the beta-galactosidase reporter gene in transformed cells; also the difference in activity between growth conditions was compared. The results indicated that there are two positive vegetative regulatory elements extending between -187 and -62 bp from the transcription start site of the gp64 promoter; also their activity was two to three times higher in the cells grown with bacteria in shaken suspension than in the cells grown in an axenic medium. PMID:10542319

  20. DNA sequence of a gene encoding a BALB/c mouse Ld transplantation antigen.


    Moore, K W; Sher, B T; Sun, Y H; Eakle, K A; Hood, L


    The sequence of a gene, denoted 27.5, encoding a transplantation antigen for the BALB/c mouse has been determined. Gene transfer studies and comparison of the translated sequence with the partial amino acid sequence of the Ld transplantation antigen establish that gene 27.5 encodes an Ld polypeptide. A comparison of the gene 27.5 sequence with several complementary DNA sequences suggests that the BALB/c mouse may contain a number of closely related L-like genes. Gene 27.5 has eight exons that correlate with the structural domains of the transplantation antigen. PMID:7058332

  1. Loss of the NKX3.1 tumorsuppressor promotes the TMPRSS2-ERG fusion gene expression in prostate cancer

    PubMed Central


    Background In normal prostate epithelium the TMPRSS2 gene encoding a type II serine protease is directly regulated by male hormones through the androgen receptor. In prostate cancer ERG protooncogene frequently gains hormonal control by seizing gene regulatory elements of TMPRSS2 through genomic fusion events. Although, the androgenic activation of TMPRSS2 gene has been established, little is known about other elements that may interact with TMPRSS2 promoter sequences to modulate ERG expression in TMPRSS2-ERG gene fusion context. Methods Comparative genomic analyses of the TMPRSS2 promoter upstream sequences and pathway analyses were performed by the Genomatix Software. NKX3.1 and ERG genes expressions were evaluated by immunoblot or by quantitative Real-Time PCR (qRT-PCR) assays in response to siRNA knockdown or heterologous expression. QRT-PCR assay was used for monitoring the gene expression levels of NKX3.1-regulated genes. Transcriptional regulatory function of NKX3.1 was assessed by luciferase assay. Recruitment of NKX3.1 to its cognate elements was monitored by Chromatin Immunoprecipitation assay. Results Comparative analysis of the TMPRSS2 promoter upstream sequences among different species revealed the conservation of binding sites for the androgen inducible NKX3.1 tumor suppressor. Defects of NKX3.1, such as, allelic loss, haploinsufficiency, attenuated expression or decreased protein stability represent established pathways in prostate tumorigenesis. We found that NKX3.1 directly binds to TMPRSS2 upstream sequences and negatively regulates the expression of the ERG protooncogene through the TMPRSS2-ERG gene fusion. Conclusions These observations imply that the frequently noted loss-of-function of NKX3.1 cooperates with the activation of TMPRSS2-ERG fusions in prostate tumorigenesis. PMID:24418414

  2. Identification of Rhopalosiphum Padi Virus 5' Untranslated Region Sequences Required for Cryptic Promoter Activity and Internal Ribosome Entry.


    Liu, Ming-Kun; Lin, Jie-Zue; Jinn, Tzyy-Rong; Chan, Hong-Lin; Wu, Tzong-Yuan


    The 579-nucleotide 5' untranslated region (5'UTR) of the Rhopalosiphum padi virus (RhPV) possesses a cross-kingdom internal ribosome entry site (IRES) activity that functions in insect, mammalian, and plant-derived in vitro translation systems, and six TAAG motifs within the DNA fragment encoding the RhPV 5'UTR were previously found to confer the RhPV 5'UTR with late promoter activity in baculovirus. In the present study, various truncated RhPV 5'UTR sequences were produced, and among them, a fragment of 110 bp ranging from nucleotides 309 to 418 was identified to be the shortest fragment responsible for the late promoter activity in baculovirus infected Sf21 cells. This 110 bp fragment contains a TAAG tandem repeat that retains more than 60% of the late promoter activity of the full length RhPV 5'UTR sequence. Further, IRES activity remained unchanged in all truncated RhPV 5'UTR constructs. Taken together, this novel 110 bp fragment having late promoter activity in baculovirus as well as IRES activity in mammalian cell, renders it a useful tool for the development of a "shuttle" bi-cistronic baculovirus gene expression and/or delivery vector. PMID:26184188

  3. Gene Expression of Axon Growth Promoting Factors in the Deer Antler

    PubMed Central

    Pita-Thomas, Wolfgang; Fernández-Martos, Carmen; Yunta, Mónica; Maza, Rodrigo M.; Navarro-Ruiz, Rosa; Lopez-Rodríguez, Marcos Javier; Reigada, David; Nieto-Sampedro, Manuel; Nieto-Diaz, Manuel


    The annual regeneration cycle of deer (Cervidae, Artiodactyla) antlers represents a unique model of epimorphic regeneration and rapid growth in adult mammals. Regenerating antlers are innervated by trigeminal sensory axons growing through the velvet, the modified form of skin that envelopes the antler, at elongation velocities that reach one centimetre per day in the common deer (Cervus elaphus). Several axon growth promoters like NT-3, NGF or IGF-1 have been described in the antler. To increase the knowledge on the axon growth environment, we have combined different gene-expression techniques to identify and characterize the expression of promoting molecules not previously described in the antler velvet. Cross-species microarray analyses of deer samples on human arrays allowed us to build up a list of 90 extracellular or membrane molecules involved in axon growth that were potentially being expressed in the antler. Fifteen of these genes were analysed using PCR and sequencing techniques to confirm their expression in the velvet and to compare it with the expression in other antler and skin samples. Expression of 8 axon growth promoters was confirmed in the velvet, 5 of them not previously described in the antler. In conclusion, our work shows that antler velvet provides growing axons with a variety of promoters of axon growth, sharing many of them with deer's normal and pedicle skin. PMID:21187928

  4. Divergence of human [alpha]-chain constant region gene sequences: A novel recombinant [alpha]2 gene

    SciTech Connect

    Chintalacharuvu, K. R.; Morrison, S.L. ); Raines, M. )


    IgA is the major Ig synthesized in humans and provides the first line of defense at the mucosal surfaces. The constant region of IgA heavy chain is encoded by the [alpha] gene on chromosome 14. Previous studies have indicated the presence of two [alpha] genes, [alpha]1 and [alpha]2 existing in two allotypic forms, [alpha]2 m(1) and [alpha]2 m(2). Here the authors report the cloning and complete nucleotide sequence determination of a novel human [alpha] gene. Nucleotide sequence comparison with the published [alpha] sequences suggests that the gene arose as a consequence of recombination or gene conversion between the two [alpha]2 alleles. The authors have expressed the gene as a chimeric protein in myeloma cells indicating that it encodes a functional protein. The novel IgA resembles IgA2 m(2) in that disulfide bonds link H and L chains. This novel recombinant gene provides insights into the mechanisms of generation of different constant regions and suggests that within human populations, multiple alleles of [alpha] may be present providing IgAs of different structures.

  5. Deduction of upstream sequences of Xanthomonas campestris flagellar genes responding to transcription activation by FleQ

    SciTech Connect

    Hu, R.-M.; Yang, T.-C.; Yang, S.-H.; Tseng, Y.-H. . E-mail:


    Xanthomonas campestris pv. campestris (Xcc), a close relative to Pseudomonas aeruginosa, is the pathogen causing black rot in cruciferous plants. In P. aeruginosa, FleQ serves as a cognate activator of {sigma}{sup 54} in transcription from several {sigma}{sup 54}-dependent promoters of flagellar genes. These P. aeruginosa promoters have been analyzed for FleQ-binding sequences; however, no consensus was deduced. Xcc, although lacks fleSR, has a fleQ homologue residing among over 40 contiguously clustered flagellar genes. A fleQ mutant, Xc17fleQ, constructed by insertional mutation is deficient in FleQ protein, non-flagellated, and immobile. Transcriptional fusion assays on six putative {sigma}{sup 54}-dependent promoters of the flagellar genes, fliE, fliQ, fliL, flgG, flgB, and flhF, indicated that each of them is also FleQ dependent. Each of these promoters has a sequence with weak consensus to 5'-gaaacCCgccgCcgctTt-3', immediately upstream of the predicted {sigma}{sup 54}-binding site, with an imperfect inverted repeat containing a GC-rich center flanked by several A and T at 5'- and 3'-ends, respectively. Replacing this region in fliE promoter with a HindIII recognition sequence abolished the transcription, indicating that this region responds to transcription activation by FleQ.

  6. Technology development for gene discovery and full-length sequencing

    SciTech Connect

    Marcelo Bento Soares


    In previous years, with support from the U.S. Department of Energy, we developed methods for construction of normalized and subtracted cDNA libraries, and constructed hundreds of high-quality libraries for production of Expressed Sequence Tags (ESTs). Our clones were made widely available to the scientific community through the IMAGE Consortium, and millions of ESTs were produced from our libraries either by collaborators or by our own sequencing laboratory at the University of Iowa. During this grant period, we focused on (1) the development of a method for preferential cloning of tissue-specific and/or rare transcripts, (2) its utilization to expedite EST-based gene discovery for the NIH Mouse Brain Molecular Anatomy Project, (3) further development and optimization of a method for construction of full-length-enriched cDNA libraries, and (4) modification of a plasmid vector to maximize efficiency of full-length cDNA sequencing by the transposon-mediated approach. It is noteworthy that the technology developed for preferential cloning of rare mRNAs enabled identification of over 2,000 mouse transcripts differentially expressed in the hippocampus. In addition, the method that we optimized for construction of full-length-enriched cDNA libraries was successfully utilized for the production of approximately fifty libraries from the developing mouse nervous system, from which over 2,500 full-ORF-containing cDNAs have been identified and accurately sequenced in their entirety either by our group or by the NIH-Mammalian Gene Collection Program Sequencing Team.

  7. Hypoxia-induced protein binding to O2-responsive sequences on the tyrosine hydroxylase gene.


    Norris, M L; Millhorn, D E


    We reported recently that the gene that encodes tyrosine hydroxylase (TH), the rate-limiting enzyme in the biosynthesis of catecholamines, is regulated by hypoxia in the dopaminergic cells of the mammalian carotid body (Czyzyk-Krzeska, M. F., Bayliss, D. A., Lawson, E. E. & Millhorn, D. E. (1992) J. Neurochem. 58, 1538-1546) and in pheochromocytoma (PC12) cells (Czyzyk-Krzeska, M. F., Furnari, B. A., Lawson, E. E. & Millhorn, D. E. (1994) J. Biol. Chem. 269, 760-764). Regulation of this gene during low O2 conditions occurs at both the level of transcription and RNA stability. Increased transcription during hypoxia is regulated by a region of the proximal promoter that extends from -284 to + 27 bases, relative to transcription start site. The present study was undertaken to further characterize the sequences that confer O2 responsiveness of the TH gene and to identify hypoxia-induced protein interactions with these sequences. Results from chloramphenicol acetyltransferase assays identified a region between bases -284 and -150 that contains the essential sequences for O2 regulation. This region contains a number of regulatory elements including AP1, AP2, and HIF-1. Gel shift assays revealed enhanced protein interactions at the AP1 and HIF-1 elements of the native gene. Further investigations using supershift and shift-Western analysis showed that c-Fos and JunB bind to the AP1 element during hypoxia and that these protein levels are stimulated by hypoxia. Mutation of the AP1 sequence prevented stimulation of transcription of the TH-chloramphenicol acetyltransferase reporter gene by hypoxia. PMID:7559551

  8. Serine Hydroxymethyltransferase 1 and 2: Gene Sequence Variation and Functional Genomic Characterization

    PubMed Central

    Hebbring, Scott J.; Chai, Yubo; Ji, Yuan; Abo, Ryan P.; Jenkins, Gregory D.; Fridley, Brooke; Zhang, Jianping; Eckloff, Bruce W.; Wieben, Eric D.; Weinshilboum, Richard M.


    Serine hydroxymethyltransferase (SHMT) catalyzes the transfer of a beta carbon from serine to tetrahydrofolate (THF) to form glycine and 5,10-methylene-THF. This reaction plays an important role in neurotransmitter synthesis and metabolism. We set out to resequence SHMT1 and SHMT2, followed by functional genomic studies. We identified 87 and 60 polymorphisms in SHMT1 and SHMT2, respectively. We observed no significant functional effect of the 13 nonsynonymous SNPs in these genes, either on catalytic activity or protein quantity. We imputed additional variants across the two genes using “1000 Genomes” data, and identified 14 variants that were significantly associated (p-value < 1.0E-10) with SHMT1 mRNA expression in lymphoblastoid cell lines. Many of these SNPs were also significantly correlated with basal SHMT1 protein expression in 268 human liver biopsy samples. Reporter gene assays suggested that the SHMT1 promoter SNP, rs669340, contributed to this variation. Finally, SHMT1 and SHMT2 expression were significantly correlated with those of other Folate and Methionine Cycle genes at both the mRNA and protein levels. These experiments represent a comprehensive study of SHMT1 and SHMT2 gene sequence variation and its functional implications. In addition, we obtained preliminary indications that these genes may be co-regulated with other Folate and Methionine Cycle genes. PMID:22220685

  9. Molecular cloning and activity analysis of a seed-specific FAD2-1B gene promoter from Glycine max.


    Zhao, Y; Sha, W; Wang, Q Y; Zhai, Y; Zhao, Y; Shao, S L


    Microsomal omega-6 fatty acid desaturase (FAD2-1B) is an enzyme that regulates the polyunsaturated fatty acid content in soybeans (Glycine max). In this study, the FAD2-1B gene was determined to be highly expressed in soybean seeds using quantitative real-time PCR(qRT-PCR). To investigate the expression pattern and activity of the FAD2-1B promoter, a 1929 bp 5'-upstream genomic DNA fragment, named PF, was isolated according to the soybean genomic sequence. Sequence analysis revealed the presence of many motifs related to seed-specific promoters in the PF fragment, such as E-box, SEF4, Skn-1 motif, AACACA, AATAAA and so on. Tobacco transgenics carrying the gus reporter gene driven by the PF and/or 35S promoters were confirmed by PCR and RT-PCR. qRT-PCR and histochemical GUS assays showed that the PF promoter could regulate gus gene accumulation in seeds and the expression level was higher than in other organs. In the meantime, it exhibited similar activity to the 35S promoter in seeds, which could be associated with seed-related cis-elements found in the 1-248 bp, 451-932 bp, and 1627-1803 bp regions of the promoter. PMID:26386665

  10. Ets transcription factors bind and transactivate the core promoter of the von Willebrand factor gene.


    Schwachtgen, J L; Janel, N; Barek, L; Duterque-Coquillaud, M; Ghysdael, J; Meyer, D; Kerbiriou-Nabias, D


    von Willebrand factor (vWF) gene expression is restricted to endothelial cells and megakaryocytes. Previous results demonstrated that basal transcription of the human vWF gene is mediated through a promoter located between base pairs -89 and +19 (cap site: +1) which is functional in endothelial and non endothelial cells. Two DNA repeats TTTCCTTT correlating with inverted consensus binding sites for the Ets family of transcription factors are present in the -56/-36 sequence. In order to analyse whether these DNA elements are involved in transcription, human umbilical vein endothelial cells (HUVEC), bovine calf pulmonary endothelial cell line (CPAE), HeLa and COS cells were transfected with constructs containing deletions of the -89/+19 fragment, linked to the chloramphenicol acetyl transferase (CAT) reporter gene. The -60/+19 region exhibits significant promoter activity in HUVEC and CPAE cells only. The -42/+19 fragment is not active. Mutations of the -60/+19 promoter fragment in the 5' (-56/-49) Ets binding site abolish transcription in endothelial cells whereas mutations in the 3' (-43/-36) site does not. The -60/-33 fragment forms three complexes with proteins from HUVEC nuclear extracts in electrophoretic mobility shift assay which are dependent on the presence of the 5' Ets binding site. Binding of recombinant Ets-1 protein to the -60/-33 fragment gives a complex which also depends on the 5' site. The -60/+19 vWF gene core promoter is transactivated in HeLa cells by cotransfecting with Ets-1 or Erg (Ets-related gene) expression plasmids. In contrast to the wild type construct, transcription of the 5' site mutants is not increased by these expressed proteins. The results indicate that the promoter activity of the -60/+19 region of the vWF gene depends on transcription factors of the Ets family of which several members like Ets-1, Ets-2 and Erg are expressed in endothelium. Cotransfection of Ets-1 and Erg expression plasmids is sufficient to induce the -60/+19 v

  11. Nuclear gene sequences from a late pleistocene sloth coprolite.


    Poinar, Hendrik; Kuch, Melanie; McDonald, Gregory; Martin, Paul; Pääbo, Svante


    The determination of nuclear DNA sequences from ancient remains would open many novel opportunities such as the resolution of phylogenies, the sexing of hominid and animal remains, and the characterization of genes involved in phenotypic traits. However, to date, single-copy nuclear DNA sequences from fossils have been determined only from bones and teeth of woolly mammoths preserved in the permafrost. Since the best preserved ancient nucleic acids tend to stem from cold environments, this has led to the assumption that nuclear DNA would be retrievable only from frozen remains. We have previously shown that Pleistocene coprolites stemming from the extinct Shasta sloth (Nothrotheriops shastensis, Megatheriidae) contain mitochondrial (mt) DNA from the animal that produced them as well as chloroplast (cp) DNA from the ingested plants. Recent attempts to resolve the phylogeny of two families of extinct sloths by using strictly mitochondrial DNA has been inconclusive. We have prepared DNA extracts from a ground sloth coprolite from Gypsum Cave, Nevada, and quantitated the number of mtDNA copies for three different fragment lengths by using real-time PCR. We amplified one multicopy and three single-copy nuclear gene fragments and used the concatenated sequence to resolve the phylogeny. These results show that ancient single-copy nuclear DNA can be recovered from warm, arid climates. Thus, nuclear DNA preservation is not restricted to cold climates. PMID:12842016

  12. Next Generation Sequencing in Predicting Gene Function in Podophyllotoxin Biosynthesis*

    PubMed Central

    Marques, Joaquim V.; Kim, Kye-Won; Lee, Choonseok; Costa, Michael A.; May, Gregory D.; Crow, John A.; Davin, Laurence B.; Lewis, Norman G.


    Podophyllum species are sources of (−)-podophyllotoxin, an aryltetralin lignan used for semi-synthesis of various powerful and extensively employed cancer-treating drugs. Its biosynthetic pathway, however, remains largely unknown, with the last unequivocally demonstrated intermediate being (−)-matairesinol. Herein, massively parallel sequencing of Podophyllum hexandrum and Podophyllum peltatum transcriptomes and subsequent bioinformatics analyses of the corresponding assemblies were carried out. Validation of the assembly process was first achieved through confirmation of assembled sequences with those of various genes previously established as involved in podophyllotoxin biosynthesis as well as other candidate biosynthetic pathway genes. This contribution describes characterization of two of the latter, namely the cytochrome P450s, CYP719A23 from P. hexandrum and CYP719A24 from P. peltatum. Both enzymes were capable of converting (−)-matairesinol into (−)-pluviatolide by catalyzing methylenedioxy bridge formation and did not act on other possible substrates tested. Interestingly, the enzymes described herein were highly similar to methylenedioxy bridge-forming enzymes from alkaloid biosynthesis, whereas candidates more similar to lignan biosynthetic enzymes were catalytically inactive with the substrates employed. This overall strategy has thus enabled facile further identification of enzymes putatively involved in (−)-podophyllotoxin biosynthesis and underscores the deductive power of next generation sequencing and bioinformatics to probe and deduce medicinal plant biosynthetic pathways. PMID:23161544

  13. Human retinoblastoma susceptibility gene: cloning, identification, and sequence

    SciTech Connect

    Lee, W.; Bookstein, R.; Hong, F.; Young, L.; Shew, J.; Lee, E.Y.P.


    Recent evidence indicates the existence of a genetic locus in chromosome region 13q14 that confers susceptibility to retinoblastoma, a cancer of the eye in children. A gene encoding a messenger RNA of 4.6 kilobases (kb), located in the proximity of esterase D, was identified as the retinoblastoma susceptibility (RB) gene on the basis of chromosomal location, homozygous deletion, and tumor-specific alterations in expression. Transcription of this gene was abnormal in six of six retinoblastomas examined: in two tumors, RB mRNA was not detectable, while four others expressed variable quantities of RB mRNA with decreased molecular size of about 4.0 kb. In contrast, full-length RB mRNA was present in human fetal retina and placenta, and in other tumors such as neuroblastoma and medulloblastoma. DNA from retinoblastoma cells had a homozygous gene deletion in one case and hemizygous deletion in another case, while the remainder were not grossly different from normal human control DNA. The gene contains at least 12 exons distributed in a region of over 100 kb. Sequence analysis of complementary DNA clones yielded a single long open reading frame that could encode a hypothetical protein of 816 amino acids.

  14. Deep sequencing reveals 50 novel genes for recessive cognitive disorders.


    Najmabadi, Hossein; Hu, Hao; Garshasbi, Masoud; Zemojtel, Tomasz; Abedini, Seyedeh Sedigheh; Chen, Wei; Hosseini, Masoumeh; Behjati, Farkhondeh; Haas, Stefan; Jamali, Payman; Zecha, Agnes; Mohseni, Marzieh; Püttmann, Lucia; Vahid, Leyla Nouri; Jensen, Corinna; Moheb, Lia Abbasi; Bienek, Melanie; Larti, Farzaneh; Mueller, Ines; Weissmann, Robert; Darvish, Hossein; Wrogemann, Klaus; Hadavi, Valeh; Lipkowitz, Bettina; Esmaeeli-Nieh, Sahar; Wieczorek, Dagmar; Kariminejad, Roxana; Firouzabadi, Saghar Ghasemi; Cohen, Monika; Fattahi, Zohreh; Rost, Imma; Mojahedi, Faezeh; Hertzberg, Christoph; Dehghan, Atefeh; Rajab, Anna; Banavandi, Mohammad Javad Soltani; Hoffer, Julia; Falah, Masoumeh; Musante, Luciana; Kalscheuer, Vera; Ullmann, Reinhard; Kuss, Andreas Walter; Tzschach, Andreas; Kahrizi, Kimia; Ropers, H Hilger


    Common diseases are often complex because they are genetically heterogeneous, with many different genetic defects giving rise to clinically indistinguishable phenotypes. This has been amply documented for early-onset cognitive impairment, or intellectual disability, one of the most complex disorders known and a very important health care problem worldwide. More than 90 different gene defects have been identified for X-chromosome-linked intellectual disability alone, but research into the more frequent autosomal forms of intellectual disability is still in its infancy. To expedite the molecular elucidation of autosomal-recessive intellectual disability, we have now performed homozygosity mapping, exon enrichment and next-generation sequencing in 136 consanguineous families with autosomal-recessive intellectual disability from Iran and elsewhere. This study, the largest published so far, has revealed additional mutations in 23 genes previously implicated in intellectual disability or related neurological disorders, as well as single, probably disease-causing variants in 50 novel candidate genes. Proteins encoded by several of these genes interact directly with products of known intellectual disability genes, and many are involved in fundamental cellular processes such as transcription and translation, cell-cycle control, energy metabolism and fatty-acid synthesis, which seem to be pivotal for normal brain development and function. PMID:21937992

  15. Cloning, sequencing, gene organization, and localization of the human ribosomal protein RPL23A gene

    SciTech Connect

    Fan, Wufang; Christensen, M.; Eichler, E.


    The intron-containing gene for human ribosomal protein RPL23A has been cloned, sequenced, and localized. The gene is approximately 4.0 kb in length and contains five exons and four introns. All splice sites exactly match the AG/GT consensus rule. The transcript is about 0.6 kb and is detected in all tissues examined. In adult tissues, the RPL23A transcript is dramatically more abundant in pancreas, skeletal muscle, and heart, while much less abundant in kidney, brain, placenta, lung, and liver. A full-length cDNA clone of 576 nt was identified, and the nucleotide sequence was found to match the exon sequence precisely. The open reading frame encodes a polypeptide of 156 amino acids, which is absolutely conserved with the rat RPL23A protein. In the 5{prime} flanking region of the gene, a canonical TATA sequence and a defined CAAT box were found for the first time in a mammalian ribosomal protein gene. The intron-containing RPL23A gene was mapped to cytogenetic band 17q11 by fluorescence in situ hybridization. 33 refs., 4 figs.

  16. Identification of Driver Genes in Hepatocellular Carcinoma by Exome Sequencing

    PubMed Central

    Cleary, Sean P.; Jeck, William R.; Zhao, Xiaobei; Chen, Kui; Selitsky, Sara R.; Savich, Gleb L.; Tan, Ting-Xu; Wu, Michael C.; Getz, Gad; Lawrence, Michael S.; Parker, Joel S.; Li, Jinyu; Powers, Scott; Kim, Hyeja; Fischer, Sandra; Guindi, Maha; Ghanekar, Anand; Chiang, Derek Y.


    Genetic alterations in specific driver genes lead to disruption of cellular pathways and are critical events in the instigation and progression of hepatocellular carcinoma. As a prerequisite for individualized cancer treatment, we sought to characterize the landscape of recurrent somatic mutations in hepatocellular carcinoma. We performed whole exome sequencing on 87 hepatocellular carcinomas and matched normal adjacent tissues to anaverage coverage of 59x. The overall mutation rate was roughly 2 mutations per Mb, with a median of 45 non-synonymous mutations that altered the amino acid sequence (range 2 to 381). We found recurrent mutations in several genes with high transcript levels: TP53 (18%), CTNNB1 (10%), KEAP1 (8%), C16orf62 (8%), MLL4(7%) and RAC2 (5%). Significantly affected gene families include the nucleotide-binding domain and leucine rich repeat containing family, calcium channel subunits, and histone methyltransferases. In particular, the MLL family of methyltransferases for histone H3 lysine 4 were mutated in 20% of tumors. Conclusion The NFE2L2-KEAP1 and MLL pathways are recurrently mutated in multiple cohorts of hepatocellular carcinoma. PMID:23728943

  17. Inducible in vivo DNA footprints define sequences necessary for UV light activation of the parsley chalcone synthase gene.

    PubMed Central

    Schulze-Lefert, P; Dangl, J L; Becker-André, M; Hahlbrock, K; Schulz, W


    We began characterization of the protein--DNA interactions necessary for UV light induced transcriptional activation of the gene encoding chalcone synthase (CHS), a key plant defense enzyme. Three light dependent in vivo footprints appear on a 90 bp stretch of the CHS promoter with a time course correlated with the onset of CHS transcription. We define a minimal light responsive promoter by functional analysis of truncated CHS promoter fusions with a reporter gene in transient expression experiments in parsley protoplasts. Two of the three footprinted sequence 'boxes' reside within the minimal promoter. Replacement of 10 bp within either of these 'boxes' leads to complete loss of light responsiveness. We conclude that these sequences define the necessary cis elements of the minimal CHS promoter's light responsive element. One of the functionally defined 'boxes' is homologous to an element implicated in regulation of genes involved in photosynthesis. These data represent the first example in a plant defense gene of an induced change in protein--DNA contacts necessary for transcriptional activation. Also, our data argue strongly that divergent light induced biosynthetic pathways share common regulatory units. Images PMID:2566481

  18. Isolation and characterization of a chalcone isomerase gene promoter from potato cultivars.


    Chen, M; Zhu, W J; You, X; Liu, Y D; Kaleri, G M; Yang, Q


    Chalcone isomerase (CHI) is a key enzyme involved in anthocyanin metabolism. Previous research on CHI has mainly focused on cDNA cloning and gene expression. In the current study, the 1425-bp potato CHI promoter (PCP) was isolated from four potato cultivars (Heijingang, Zhongshu 7, Désirée, and Favorita) using PCR and DNA sequencing. The PCP contained many cis-regulatory elements (CREs) related to anthocyanin metabolism, tissue specificity, light response, stress, and hormone induction. Of the PCP CREs identified, 19 were common to those found in the higher plants examined, based on plant CRE databases. Multiple sequence alignment showed six single nucleotide variation sites in PCP among the potato cultivars examined, resulting in changes in the number of CREs connected with tissue specificity, anthocyanin metabolism, and light response. The 665-bp PCP fragments from Favorita and 1425-bp PCP fragments from Heijingang were used to construct plant expression vectors, which may be a useful tool for biological engineering. A transient expression assay demonstrated that the two PCP fragments from Heijingang could direct the expression of a green fluorescent protein gene in onion epidermis and a β-glucuronidase gene in all potato tuber tissues with different colors, suggesting that the single nucleotide variation in the PCP did not affect its activity, and that silencing of the CHI gene in Favorita may be attributed to other regulatory factors. PMID:26782538

  19. Sequence analysis of the equine ACTN3 gene in Australian horse breeds.


    Thomas, K C; Hamilton, N A; North, K N; Houweling, P J


    The sarcomeric α-actinins, encoded by the