Sample records for gene promoter sequences

  1. Inferring gene expression from ribosomal promoter sequences, a crowdsourcing approach.


    Meyer, Pablo; Siwo, Geoffrey; Zeevi, Danny; Sharon, Eilon; Norel, Raquel; Segal, Eran; Stolovitzky, Gustavo


    The Gene Promoter Expression Prediction challenge consisted of predicting gene expression from promoter sequences in a previously unknown experimentally generated data set. The challenge was presented to the community in the framework of the sixth Dialogue for Reverse Engineering Assessments and Methods (DREAM6), a community effort to evaluate the status of systems biology modeling methodologies. Nucleotide-specific promoter activity was obtained by measuring fluorescence from promoter sequences fused upstream of a gene for yellow fluorescence protein and inserted in the same genomic site of yeast Saccharomyces cerevisiae. Twenty-one teams submitted results predicting the expression levels of 53 different promoters from yeast ribosomal protein genes. Analysis of participant predictions shows that accurate values for low-expressed and mutated promoters were difficult to obtain, although in the latter case, only when the mutation induced a large change in promoter activity compared to the wild-type sequence. As in previous DREAM challenges, we found that aggregation of participant predictions provided robust results, but did not fare better than the three best algorithms. Finally, this study not only provides a benchmark for the assessment of methods predicting activity of a specific set of promoters from their sequence, but it also shows that the top performing algorithm, which used machine-learning approaches, can be improved by the addition of biological features such as transcription factor binding sites.

  2. Inferring gene expression from ribosomal promoter sequences, a crowdsourcing approach

    PubMed Central

    Meyer, Pablo; Siwo, Geoffrey; Zeevi, Danny; Sharon, Eilon; Norel, Raquel; Segal, Eran; Stolovitzky, Gustavo; Siwo, Geoffrey; Rider, Andrew K.; Tan, Asako; Pinapati, Richard S.; Emrich, Scott; Chawla, Nitesh; Ferdig, Michael T.; Tung, Yi-An; Chen, Yong-Syuan; Chen, Mei-Ju May; Chen, Chien-Yu; Knight, Jason M.; Sahraeian, Sayed Mohammad Ebrahim; Esfahani, Mohammad Shahrokh; Dreos, Rene; Bucher, Philipp; Maier, Ezekiel; Saeys, Yvan; Szczurek, Ewa; Myšičková, Alena; Vingron, Martin; Klein, Holger; Kiełbasa, Szymon M.; Knisley, Jeff; Bonnell, Jeff; Knisley, Debra; Kursa, Miron B.; Rudnicki, Witold R.; Bhattacharjee, Madhuchhanda; Sillanpää, Mikko J.; Yeung, James; Meysman, Pieter; Rodríguez, Aminael Sánchez; Engelen, Kristof; Marchal, Kathleen; Huang, Yezhou; Mordelet, Fantine; Hartemink, Alexander; Pinello, Luca; Yuan, Guo-Cheng


    The Gene Promoter Expression Prediction challenge consisted of predicting gene expression from promoter sequences in a previously unknown experimentally generated data set. The challenge was presented to the community in the framework of the sixth Dialogue for Reverse Engineering Assessments and Methods (DREAM6), a community effort to evaluate the status of systems biology modeling methodologies. Nucleotide-specific promoter activity was obtained by measuring fluorescence from promoter sequences fused upstream of a gene for yellow fluorescence protein and inserted in the same genomic site of yeast Saccharomyces cerevisiae. Twenty-one teams submitted results predicting the expression levels of 53 different promoters from yeast ribosomal protein genes. Analysis of participant predictions shows that accurate values for low-expressed and mutated promoters were difficult to obtain, although in the latter case, only when the mutation induced a large change in promoter activity compared to the wild-type sequence. As in previous DREAM challenges, we found that aggregation of participant predictions provided robust results, but did not fare better than the three best algorithms. Finally, this study not only provides a benchmark for the assessment of methods predicting activity of a specific set of promoters from their sequence, but it also shows that the top performing algorithm, which used machine-learning approaches, can be improved by the addition of biological features such as transcription factor binding sites. PMID:23950146


    PubMed Central

    Fitzgerald, Lisa A.; Boucher, Philip T.; Yanai-Balser, Giane; Suhre, Karsten; Graves, Michael V.; Van Etten, James L.


    Three short (7 to 9 nucleotides) highly conserved nucleotide sequences were identified in the putative promoter regions (150 bp upstream and 50 bp downstream of the ATG translation start site) of three members of the genus Chlorovirus, family Phycodnaviridae. Most of these sequences occurred in similar locations within the defined promoter regions. The sequence and location of the motifs were often conserved among homologous ORFs within the Chlorovirus family. One of these conserved sequences (AATGACA) is predominately associated with genes expressed early in virus replication. PMID:18768195

  4. Honey bee promoter sequences for targeted gene expression.


    Schulte, C; Leboulle, G; Otte, M; Grünewald, B; Gehne, N; Beye, M


    The honey bee, Apis mellifera, displays a rich behavioural repertoire, social organization and caste differentiation, and has an interesting mode of sex determination, but we still know little about its underlying genetic programs. We lack stable transgenic tools in honey bees that would allow genetic control of gene activity in stable transgenic lines. As an initial step towards a transgenic method, we identified promoter sequences in the honey bee that can drive constitutive, tissue-specific and cold shock-induced gene expression. We identified the promoter sequences of Am-actin5c, elp2l, Am-hsp83 and Am-hsp70 and showed that, except for the elp2l sequence, the identified sequences were able to drive reporter gene expression in Sf21 cells. We further demonstrated through electroporation experiments that the putative neuron-specific elp2l promoter sequence can direct gene expression in the honey bee brain. The identification of these promoter sequences is an important initial step in studying the function of genes with transgenic experiments in the honey bee, an organism with a rich set of interesting phenotypes. © 2013 Royal Entomological Society.

  5. Consensus sequence for Escherichia coli heat shock gene promoters.

    PubMed Central

    Cowing, D W; Bardwell, J C; Craig, E A; Woolford, C; Hendrix, R W; Gross, C A


    We have identified promoters for the Escherichia coli heat shock operons dnaK and groE and the gene encoding heat shock protein C62.5. Transcription from each promoter is heat-inducible in vivo, and each is recognized in vitro by RNA polymerase containing sigma 32, the sigma factor encoded by rpoH (htpR) but not by RNA polymerase containing sigma 70. We compared the sequences of the heat shock promoters and propose a consensus promoter sequence, having T-N-t-C-N-C-c-C-T-T-G-A-A in the -35 region and C-C-C-C-A-T-t-T-a in the -10 region. These sequences differ from the consensus sequence recognized by holoenzyme containing sigma 70, the major sigma in E. coli. We suggest that the accumulated consensus sequences of promoters recognized by alternate forms of holoenzyme are compatible with a model in which sigma recognizes only the -10 region of the promoter. Images PMID:3887408

  6. Interference in transcription of overexpressed genes by promoter-proximal downstream sequences

    PubMed Central

    Turchinovich, A.; Surowy, H. M.; Tonevitsky, A. G.; Burwinkel, B.


    Despite a high sequence homology among four human RNAi-effectors Argonaute proteins and their coding sequences, the efficiency of ectopic overexpression of AGO3 and AGO4 coding sequences in human cells is greatly reduced as compared to AGO1 and AGO2. While investigating this phenomenon, we documented the existence of previously uncharacterized mechanism of gene expression regulation, which is manifested in greatly varying basal transcription levels from the RNApolII promoters depending on the promoter-proximal downstream sequences. Specifically, we show that distinct overexpression of Argonaute coding sequences cannot be explained by mRNA degradation in the cytoplasm or nucleus, and exhibits on transcriptional level. Furthermore, the first 1000–2000 nt located immediately downstream the promoter had the most critical influence on ectopic gene overexpression. The transcription inhibiting effect, associated with those downstream sequences, subsided with increasing distance to the promoter and positively correlated with promoter strength. We hypothesize that the same mechanism, which we named promoter proximal inhibition (PPI), could generally contribute to basal transcription levels of genes, and could be mainly responsible for the essence of difficult-to-express recombinant proteins. Finally, our data reveal that expression of recombinant proteins in human cells can be greatly enhanced by using more permissive promoter adjacent downstream sequences. PMID:27485701

  7. Comparative analysis of myostatin gene and promoter sequences of Qinchuan and Red Angus cattle.


    He, Y L; Wu, Y H; Quan, F S; Liu, Y G; Zhang, Y


    To better understand the function of the myostatin gene and its promoter region in bovine, we amplified and sequenced the myostatin gene and promoter from the blood of Qinchuan and Red Angus cattle by using polymerase chain reaction. The sequences of Qinchuan and Red Angus cattle were compared with those of other cattle breeds available in GenBank. Exon splice sites were confirmed by mRNA sequencing. Compared to the published sequence (GenBank accession No. AF320998), 69 single nucleotide polymorphisms (SNPs) were identified in the Qinchuan myostatin gene, only one of which was an insertion mutation in Qinchuan cattle. There was a 16-bp insertion in the first 705-bp intron in 3 Qinchuan cattle. A total of 7 SNPs were identified in exon 3, in which the mutation occurred in the third base of the codon and was synonymous. On comparing the Qinchuan myostatin gene sequence to that of Red Angus cattle, a total of 50 SNPs were identified in the first and third exons. In addition, there were 18 SNPs identified in the Qinchuan cattle promoter region compared with those of other cattle compared to the Red Angus cattle myostatin promoter region. breeds (GenBank accession No. AF348479), but only 14 SNPs when compared to the Red Angus cattle myostatin promoter region.

  8. Regulation of transcription of the adenovirus EII promoter by gene products: Absence of sequence specificity

    SciTech Connect

    Kingston, R.E.; Kaufman, R.J.; Sharp, P.A.


    During adenovirus infection, the EII promoter is positively regulated by products of the EIa region. The authors have studied this regulation by fusing a DNA segment containing the adenovirus EII promoter to a dihydrofolate reductase cDNA segment. Expression of this hybrid gene is stimulated in trans when cell lines containing an integrated copy are either transfected with plasmids carrying the EIa region or infected with adenovirus. This suggests that EIa activity regulates transcription of the EII promoter in the absence of other viral proteins and that this stimulation can occur when the EII promoter is organized in cellular chromatin. Transcription from the EII promoter is initiated at two sites in cell lines lacking EIa activity. Introduction of the EIa region preferentially stimulated transcription from one of these two sites. A sensitive, stable cotransfection assay was used to test for specific EII sequences required for stimulation. EIa activity stimulates all mutaant promoters; the most extensive deletion retained only 18 base pairs of sequences upstream of the initiation site. They suggest that regulation of a promoter by the EIa region does not depend on the presence of a set of specific sequences, but instead reflects a characteristic of promoters that have been exogenously introduced into cells. Insertion of the 72-base-pair repeat of simian-virus 40 in cis enhances transcription from the EII promoter. The stimulatory effects of EIa activity and of the simian virus 40 sequence are additive and appear to differ mechanistically.

  9. Sequence of the nucleocapsid gene and genome and antigenome promoters for an isolate of porpoise morbillivirus.


    Banyard, Ashley C; Grant, Rebecca J; Romero, Carlos H; Barrett, Tom


    We have determined the first complete sequence of the nucleocapsid (N) gene of the porpoise morbillivirus (PMV) as well as the genome leader and trailer sequences which encode the genome and antigenome promoters, respectively. The PMV N gene is 1686 nucleotides long with a single open reading frame (ORF) encoding a protein of 523 amino acids with a predicted molecular weight of 57.39kDa. The nucleotide sequence of the N gene shows the closest identity (89%) to that of another cetacean morbillivirus, dolphin morbillivirus (DMV). Lower degrees of identity were found with the other members of the morbilliviruses genus; 67% identity to PDV and RPV, 68% to PPRV, 69% to CDV and 70% to MV. The distance from the 3' end of the genome up to the start of the N ORF is 107 nucleotides, identical to that found in all other morbilliviruses, and encompasses the genome promoter (GP) sequence. This promoter shows the same regions of conservation as found in other morbilliviruses with repeated CXXXXX motifs at positions 79-84, 85-90, and 91-96, the same bi-partite promoter arrangement found in many paramyxoviruses. The antigenome promoter (AGP) shows a similar arrangement, indicating a high degree of conservation in these functionally important regions.

  10. Promoter sequences required for transcription of Xenopus laevis histone genes in injected frog oocyte nuclei.

    PubMed Central

    Heindl, L M; Weil, T S; Perry, M


    Amphibian oogenesis is accompanied by the accumulation of histone mRNA and proteins in the absence of ongoing DNA replication. To begin an analysis of the mechanisms by which histone gene expression is regulated during frog oogenesis and embryogenesis, we used oocyte injection to examine the upstream sequences required for transcription of genes encoding each of the five histone classes. We found that sequences necessary for maximal levels of transcription are located 100 to 200 base pairs upstream of the corresponding start sites. In this region, each promoter examined contains conserved sequence elements, several of which seem to be histone gene class specific, in addition to other, more common sequence elements believed to be used by general transcription factors. Images PMID:3221862

  11. Conserved regulatory elements of the promoter sequence of the gene rpoH of enteric bacteria

    PubMed Central

    Ramírez-Santos, Jesús; Collado-Vides, Julio; García-Varela, Martin; Gómez-Eichelmann, M. Carmen


    The rpoH regulatory region of different members of the enteric bacteria family was sequenced or downloaded from GenBank and compared. In addition, the transcriptional start sites of rpoH of Yersinia frederiksenii and Proteus mirabilis, two distant members of this family, were determined. Sequences similar to the σ70 promoters P1, P4 and P5, to the σE promoter P3 and to boxes DnaA1, DnaA2, cAMP receptor protein (CRP) boxes CRP1, CRP2 and box CytR present in Escherichia coli K12, were identified in sequences of closely related bacteria such as: E.coli, Shigella flexneri, Salmonella enterica serovar Typhimurium, Citrobacter freundii, Enterobacter cloacae and Klebsiella pneumoniae. In more distant bacteria, Y.frederiksenii and P.mirabilis, the rpoH regulatory region has a distal P1-like σ70 promoter and two proximal promoters: a heat-induced σE-like promoter and a σ70 promoter. Sequences similar to the regulatory boxes were not identified in these bacteria. This study suggests that the general pattern of transcription of the rpoH gene in enteric bacteria includes a distal σ70 promoter, >200 nt upstream of the initiation codon, and two proximal promoters: a heat-induced σE-like promoter and a σ70 promoter. A second proximal σ70 promoter under catabolite-regulation is probably present only in bacteria closely related to E.coli. PMID:11139607

  12. ZNF143 provides sequence specificity to secure chromatin interactions at gene promoters

    PubMed Central

    Bailey, Swneke D.; Zhang, Xiaoyang; Desai, Kinjal; Aid, Malika; Corradin, Olivia; Cowper-Sal·lari, Richard; Akhtar-Zaidi, Batool; Scacheri, Peter C.; Haibe-Kains, Benjamin; Lupien, Mathieu


    Chromatin interactions connect distal regulatory elements to target gene promoters guiding stimulus- and lineage-specific transcription. Few factors securing chromatin interactions have so far been identified. Here by integrating chromatin interaction maps with the large collection of transcription factor binding profiles provided by the ENCODE project, we demonstrate that the zinc-finger protein ZNF143 preferentially occupies anchors of chromatin interactions connecting promoters with distal regulatory elements. It binds directly to promoters and associates with lineage-specific chromatin interactions and gene expression. Silencing ZNF143 or modulating its DNA-binding affinity using single nucleotide polymorphisms (SNPs) as a surrogate of site-directed mutagenesis reveals the sequence dependency of chromatin interactions at gene promoters. We also find that chromatin interactions alone do not regulate gene expression. Together, our results identify ZNF143 as a novel chromatin-looping factor that contributes to the architectural foundation of the genome by providing sequence specificity at promoters connected with distal regulatory elements. PMID:25645053

  13. Genome-wide discovery of cis-elements in promoter sequences using gene expression.


    Troukhan, Maxim; Tatarinova, Tatiana; Bouck, John; Flavell, Richard B; Alexandrov, Nickolai N


    The availability of complete or nearly complete genome sequences, a large number of 5' expressed sequence tags, and significant public expression data allow for a more accurate identification of cis-elements regulating gene expression. We have implemented a global approach that takes advantage of available expression data, genomic sequences, and transcript information to predict cis-elements associated with specific expression patterns. The key components of our approach are: (1) precise identification of transcription start sites, (2) specific locations of cis-elements relative to the transcription start site, and (3) assessment of statistical significance for all sequence motifs. By applying our method to promoters of Arabidopsis thaliana and Mus musculus, we have identified motifs that affect gene expression under specific environmental conditions or in certain tissues. We also found that the presence of the TATA box is associated with increased variability of gene expression. Strong correlation between our results and experimentally determined motifs shows that the method is capable of predicting new functionally important cis-elements in promoter sequences.

  14. Characterization of the promoter and upstream activating sequence from the Pseudomonas alcaligenes lipase gene.


    Cox, M; Gerritse, G; Dankmeyer, L; Quax, W J


    Pseudomonas alcaligenes secretes a lipase with a high pH optimum, which has interesting properties for application in detergents. The expression of the lipase is strongly dependent on the presence of lipids in the growth medium such as soybean oil. The promoter of the gene was characterized and found to have resemblance to sigma54 controlled promoters, which are known to be tightly regulated. The transcription start was mapped precisely downstream of a sequence with close similarity to the -12/-24 consensus sequence of sigma54 controlled promoters. Interestingly, a hyperproducer mutant strain was isolated and found to have a C to T mutation in the -12/-24 promoter consensus region. In addition an Upstream Activating Sequence (UAS) with homology to sigma54 UAS consensus sequences was identified. It was demonstrated that an increase of the distance from the UAS to the transcription start or the deletion of the UAS results in significantly lower expression levels of lipase. A systematic mutational analysis of the UAS sequence has resulted in a variant with an increased lipase expression.

  15. Saturation Mutagenesis of the TATA Box and Upstream Activator Sequence in the Haloarchaeal bop Gene Promoter

    PubMed Central

    Baliga, Nitin S.; DasSarma, Shiladitya


    Degenerate oligonucleotides were used to randomize 21 bp of the 53-bp minimal bop promoter in three 7-bp segments, including the putative TATA box and the upstream activator sequence (UAS). The mutagenized bop promoter and the wild-type structural gene and transcriptional terminator were inserted into a shuttle plasmid capable of replication in the halophilic archaeon Halobacterium sp. strain S9. Active promoters were isolated by screening transformants of an orange (Pum− bop) Halobacterium mutant for purple (Pum+ bop+) colonies on agar plates and analyzed for bop mRNA and/or bacteriorhodopsin content. Sequence analysis yielded the consensus sequence 5′-tyT(T/a)Ta-3′, corresponding to the promoter TATA box element 30 to 25 bp 5′ of the transcription start site. A putative UAS, 5′-ACCcnactagTTnG-3′, located 52 to 39 bp 5′ of the transcription start site was found to be conserved in active promoters. This study provides direct evidence for the requirement of the TATA box and UAS for bop promoter activity. PMID:10198017

  16. Rarity of DNA sequence alterations in the promoter region of the human androgen receptor gene.


    Cabral, D F; Santos, A; Ribeiro, M L; Mesquita, J C; Carvalho-Salles, A B; Hackel, C


    The human androgen receptor (AR) gene promoter lies in a GC-rich region containing two principal sites of transcription initiation and a putative Sp1 protein-binding site, without typical "TATA" and "CAAT" boxes. It has been suggested that mutations within the 5'untranslated region (5'UTR) may contribute to the development of prostate cancer by changing the rates of gene transcription and/or translation. In order to investigate this question, the aim of the present study was to search for the presence of mutations or polymorphisms at the AR-5'UTR in 92 prostate cancer patients, where histological diagnosis of adenocarcinoma was established in specimens obtained from transurethral resection or after prostatectomy. The AR-5'UTR was amplified by PCR from genomic DNA samples of the patients and of 100 healthy male blood donors, included as controls. Conformation-sensitive gel electrophoresis was used for DNA sequence alteration screening. Only one band shift was detected in one individual from the blood donor group. Sequencing revealed a new single nucleotide deletion (T) in the most conserved portion of the promoter region at position +36 downstream from the transcription initiation site I. Although the effect of this specific mutation remains unknown, its rarity reveals the high degree of sequence conservation of the human androgen promoter region. Moreover, the absence of detectable variation within the critical 5'UTR in prostate cancer patients indicates a low probability of its involvement in prostate cancer etiology.

  17. Characterization of HSE sequences in human Hsp40 gene: structural and promoter analysis.


    Hata, M; Ohtsuka, K


    We have recently cloned a gene of Hsp40, a human homologue of bacterial DnaJ. Here we describe the structural and promoter analysis of human Hsp40 gene. Analysis of Hsp40 transcripts by 5' and 3' RACE suggested that they have different 3' ends, and primer extension studies revealed that the major transcription initiation site was localized 47 bp upstream of the ATG translation initiation codon. Promoter analysis using deletion derivatives defined a minimal region which was active in response to heat shock. The region contained the consensus heat shock element (HSE) sequences. The factor bound to these sequences was suggested to be a heat shock factor 1 (HSF1) by gel mobility supershift assay. In vivo footprinting and promoter analysis revealed that the HSEs in 5' upstream region of human Hsp40 gene were composed of eight contiguous (A/G)GAAN motifs and were essential for heat shock response. These results indicate that Hsp40 is a real heat shock protein. It is also shown that the HSE found in the first intron might not be the essential element for heat shock response.

  18. The complete sequence and promoter activity of the human A-raf-1 gene (ARAF1)

    SciTech Connect

    Lee, J.E.; Beck, T.W.; Brennscheidt, U.; Rapp, U.R. ); DeGennaro, L.J. )


    The raf proto-oncogenes encode cytoplasmic protein serine/threonine kinases, which play a critical role in cell growth and development. One of these, A-raf-1 (human gene symbol, ARAF1), which is predominantly expressed in mouse urogenital tissues, has been mapped to an evolutionarily conserved linkage group composed of ARAF1, SYN1, TIMP, and properdin located at human chromosome Xp11.2. The authors have isolated human genomic DNA clones containing the expressed gene (ARAF1) on the X chromosome and a pseudogene (ARAF2) on chromosome 7p12-q11.21. Analysis of the nucleotide sequence from the ARAF1 genomic clones demonstrated that it consists of 16 exons encoded by minimally 10,776 nucleotides. The major transcriptional start site (+1) was determined by RNase protection and primer extension assays. Promoter activity was confirmed by functional assays using DNA fragments fused to a CAT reporter gene. The ARAF1 minimal promoter, located between nucleotides -59 and +93, has a low G + C content and lacks consensus TATA and Inr sequences but shows sequence similarity at position -1 to the E box that is known to interact with USF and TFII-I transcription factors. 65 refs., 7 figs., 1 tab.

  19. Human dipeptidyl peptidase IV gene promoter: tissue-specific regulation from a TATA-less GC-rich sequence characteristic of a housekeeping gene promoter.

    PubMed Central

    Böhm, S K; Gum, J R; Erickson, R H; Hicks, J W; Kim, Y S


    The dipeptidyl peptidase IV gene encodes a plasma-membrane exopeptidase that is highly expressed in small intestine, lung and kidney. In order to better understand the mechanisms responsible for this tissue-specific expression we cloned, sequenced and functionally characterized the 5'-flanking region of the human dipeptidyl peptidase IV gene. The first 500 bases of the 5'-flanking sequence constituted an unmethylated CpG island, contained several Sp1-binding sites and lacked a consensus TATA box, all characteristics of gene promoters lacking tissue-specific expression. RNase-protection analysis using both small intestinal and Caco2 cell RNA indicated that the dipeptidyl peptidase IV transcript was initiated from no fewer than six major and 12 minor start sites. The 5'-flanking sequence also exhibited functional promoter activity in transient transfection experiments. Here, various lengths of the sequence were cloned upstream of a luciferase gene and introduced into cultured cells using lipofectin. A region located between bases -150 and -109 relative to the start of translation was found to be important for high-level promoter activity in both Caco2 and HepG2 cells. Moreover, Caco2 cells and HepG2 cells, which express high levels of dipeptidyl peptidase IV activity, exhibited much higher normalized luciferase activity after transfection than did 3T3, Jurkat or COS-7 cells, which have low enzyme levels. Sodium butyrate was found to increase both enzyme activity and normalized luciferase in HepG2 cells. Thus the dipeptidyl peptidase IV promoter possesses the ability to initiate transcription in a tissue-specific fashion in spite of having the sequence characteristics of a housekeeping gene promoter. Images Figure 3 Figure 5 Figure 6 PMID:7487939

  20. Allelic mutations in noncoding genomic sequences construct novel transcription factor binding sites that promote gene overexpression.


    Tian, Erming; Børset, Magne; Sawyer, Jeffrey R; Brede, Gaute; Våtsveen, Thea K; Hov, Håkon; Waage, Anders; Barlogie, Bart; Shaughnessy, John D; Epstein, Joshua; Sundan, Anders


    The growth and survival factor hepatocyte growth factor (HGF) is expressed at high levels in multiple myeloma (MM) cells. We report here that elevated HGF transcription in MM was traced to DNA mutations in the promoter alleles of HGF. Sequence analysis revealed a previously undiscovered single-nucleotide polymorphism (SNP) and crucial single-nucleotide variants (SNVs) in the promoters of myeloma cells that produce large amounts of HGF. The allele-specific mutations functionally reassembled wild-type sequences into the motifs that affiliate with endogenous transcription factors NFKB (nuclear factor kappa-B), MZF1 (myeloid zinc finger 1), and NRF-2 (nuclear factor erythroid 2-related factor 2). In vitro, a mutant allele that gained novel NFKB-binding sites directly responded to transcriptional signaling induced by tumor necrosis factor alpha (TNFα) to promote high levels of luciferase reporter. Given the recent discovery by genome-wide sequencing (GWS) of numerous non-coding mutations in myeloma genomes, our data provide evidence that heterogeneous SNVs in the gene regulatory regions may frequently transform wild-type alleles into novel transcription factor binding properties to aberrantly interact with dysregulated transcriptional signals in MM and other cancer cells.

  1. Sequence variations in the osteoprotegerin gene promoter in patients with postmenopausal osteoporosis.


    Arko, B; Prezelj, J; Komel, R; Kocijancic, A; Hudler, P; Marc, J


    Osteoprotegerin (OPG) is a recently discovered member of the TNF receptor superfamily that acts as an important paracrine regulator of bone remodeling. OPG knockout mice develop severe osteoporosis, whereas administration of OPG can prevent ovariectomy-induced bone loss. These findings implicate a role for OPG in the development of osteoporosis. In the present study, we screened the OPG gene promoter for sequence variations and examined their association with bone mineral density (BMD) in 103 osteoporotic postmenopausal women. Single-strand conformation polymorphism analysis followed by DNA sequencing revealed a presence of four nucleotide substitutions: 209 G-->A, 245 T-->G, 889 C-->T, and 950 T-->C. The frequencies of genotypes were as follows: GG (89.3%), GA (10.7%) for 209 G-->A polymorphism; TT (89.3%), TG (10.7%) for 245 T-->G polymorphism; and TT (25.2%), TC (53.4%), CC (21.4%) for 950 T-->C polymorphism. Substitution 889 C-->T was found in only two patients. Statistically significant association of genotypes with BMD at the lumbar spine (P = 0.005) was observed for 209 G-->A and 245 T-->G polymorphisms. Haplotype GATG was associated with lower BMD as compared with GGTT haplotype. Our results suggest that 209 G-->A and 245 T-->G polymorphisms in the OPG gene promoter may contribute to the genetic regulation of BMD.

  2. Genetic and Functional Sequence Variants of the SIRT3 Gene Promoter in Myocardial Infarction

    PubMed Central

    Yin, Xiaoyun; Pang, Shuchao; Huang, Jian; Cui, Yinghua; Yan, Bo


    Coronary artery disease (CAD), including myocardial infarction (MI), is a common complex disease that is caused by atherosclerosis. Although a large number of genetic variants have been associated with CAD, only 10% of CAD cases could be explained. It has been proposed that low frequent and rare genetic variants may be main causes for CAD. SIRT3, a mitochondrial deacetylase, plays important roles in mitochondrial function and metabolism. Lack of SIRT3 in experimental animal leads to several age-related diseases, including cardiovascular diseases. Therefore, SIRT3 gene variants may contribute to the MI development. In this study, SIRT3 gene promoter was genetically and functionally analyzed in large cohorts of MI patients (n = 319) and ethnic-matched controls (n = 322). Total twenty-three DNA sequence variants (DSVs) were identified, including 10 single-nucleotide polymorphisms (SNPs). Six novel heterozygous DSVs, g.237307A>G, g.237270G>A, g.237023_25del, g.236653C>A, g.236628G>C, g.236557T>C, and two SNPs g.237030C>T (rs12293349) and g.237022C>G (rs369344513), were identified in nine MI patients, but in none of controls. Three SNPs, g.236473C>T (rs11246029), g.236380_81ins (rs71019893) and g.236370C>G (rs185277566), were more significantly frequent in MI patients than controls (P<0.05). These DSVs and SNPs, except g.236557T>C, significantly decreased the transcriptional activity of the SIRT3 gene promoter in cultured HEK-293 cells and H9c2 cells. Therefore, these DSVs identified in MI patients may change SIRT3 level by affecting the transcriptional activity of SIRT3 gene promoter, contributing to the MI development as a risk factor. PMID:27078640

  3. Using a Solver Over the String Pattern Domain to Analyze Gene Promoter Sequences

    NASA Astrophysics Data System (ADS)

    Rigotti, Christophe; Mitašiūnaitė, Ieva; Besson, Jérémy; Meyniel, Laurène; Boulicaut, Jean-François; Gandrillon, Olivier

    This chapter illustrates how inductive querying techniques can be used to support knowledge discovery from genomic data. More precisely, it presents a data mining scenario to discover putative transcription factor binding sites in gene promoter sequences. We do not provide technical details about the used constraintbased data mining algorithms that have been previously described. Our contribution is to provide an abstract description of the scenario, its concrete instantiation and also a typical execution on real data. Our main extraction algorithm is a complete solver dedicated to the string pattern domain: it computes string patterns that satisfy a given conjunction of primitive constraints. We also discuss the processing steps necessary to turn it into a useful tool. In particular, we introduce a parameter tuning strategy, an appropriate measure to rank the patterns, and the post-processing approaches that can be and have been applied.

  4. Sequence of the S-layer gene of Thermus thermophilus HB8 and functionality of its promoter in Escherichia coli.

    PubMed Central

    Faraldo, M M; de Pedro, M A; Berenguer, J


    The nucleotide sequence of the slpA gene, which is responsible for the synthesis of the S-layer protein of Thermus thermophilus HB8, is described. This gene is transcribed as a unit in which the coding region is preceded by a 127-base-long leader mRNA sequence. The promoter region is also recognized by the RNA polymerase of Escherichia coli because of the presence of homologous -35 and -10 boxes. Homologies with other promoters from Thermus spp. are also presented. Images PMID:1429468

  5. Characterization of the rat transforming growth factor alpha gene and identification of promoter sequences.

    PubMed Central

    Blasband, A J; Rogers, K T; Chen, X R; Azizkhan, J C; Lee, D C


    We have determined the complete nucleotide sequence of rat transforming growth factor alpha (TGF alpha) mRNA and characterized the six exons that encode this transcript. These six exons span approximately 85 kilobases of genomic DNA, with exons 1 to 3 separated by particularly large introns. What had previously been thought to represent a species-specific difference in the size of the TGF alpha precursor (proTGF alpha) is now shown to be due to microheterogeneity in the splicing of exons 2 and 3. This results from a tandem duplication of the acceptor CAG and gives rise to two alternate forms (159 and 160 amino acids) of the integral membrane precursor. Exon 6, which encodes the 3' untranslated region of TGF alpha mRNA, also encodes, on the opposite strand, a small (approximately 200-nucleotide) transcript whose sequence predicts an open reading frame of 51 amino acids. Expression of this latter transcript does not appear to be coregulated with that of TGF alpha mRNA. Primer extension and S1 nuclease analyses of authentic TGF alpha transcripts revealed two major and multiple minor 5' ends which span more than 200 base pairs of DNA in a G + C-rich region that lacks canonical CCAAT or TATA sequences. The 5' ends of six independently derived cDNAs localized to five different sites in this same region. Restriction fragments that overlap these transcription start sites and extend approximately 300 base pairs in the 5' direction faithfully promote transcription in vitro with HeLa cell nuclear extracts. In addition, they direct the expression of the bacterial chloramphenicol acetyltransferase gene in transient-transfection assays. Images PMID:2325647

  6. Induction and maintenance of DNA methylation in plant promoter sequences by apple latent spherical virus-induced transcriptional gene silencing

    PubMed Central

    Kon, Tatsuya; Yoshikawa, Nobuyuki


    Apple latent spherical virus (ALSV) is an efficient virus-induced gene silencing vector in functional genomics analyses of a broad range of plant species. Here, an Agrobacterium-mediated inoculation (agroinoculation) system was developed for the ALSV vector, and virus-induced transcriptional gene silencing (VITGS) is described in plants infected with the ALSV vector. The cDNAs of ALSV RNA1 and RNA2 were inserted between the cauliflower mosaic virus 35S promoter and the NOS-T sequences in a binary vector pCAMBIA1300 to produce pCALSR1 and pCALSR2-XSB or pCALSR2-XSB/MN. When these vector constructs were agroinoculated into Nicotiana benthamiana plants with a construct expressing a viral silencing suppressor, the infection efficiency of the vectors was 100%. A recombinant ALSV vector carrying part of the 35S promoter sequence induced transcriptional gene silencing of the green fluorescent protein gene in a line of N. benthamiana plants, resulting in the disappearance of green fluorescence of infected plants. Bisulfite sequencing showed that cytosine residues at CG and CHG sites of the 35S promoter sequence were highly methylated in the silenced generation zero plants infected with the ALSV carrying the promoter sequence as well as in progeny. The ALSV-mediated VITGS state was inherited by progeny for multiple generations. In addition, induction of VITGS of an endogenous gene (chalcone synthase-A) was demonstrated in petunia plants infected with an ALSV vector carrying the native promoter sequence. These results suggest that ALSV-based vectors can be applied to study DNA methylation in plant genomes, and provide a useful tool for plant breeding via epigenetic modification. PMID:25426109

  7. Comparisons of Ribosomal Protein Gene Promoters Indicate Superiority of Heterologous Regulatory Sequences for Expressing Transgenes in Phytophthora infestans

    PubMed Central

    Khachatoorian, Careen; Judelson, Howard S.


    Molecular genetics approaches in Phytophthora research can be hampered by the limited number of known constitutive promoters for expressing transgenes and the instability of transgene activity. We have therefore characterized genes encoding the cytoplasmic ribosomal proteins of Phytophthora and studied their suitability for expressing transgenes in P. infestans. Phytophthora spp. encode a standard complement of 79 cytoplasmic ribosomal proteins. Several genes are duplicated, and two appear to be pseudogenes. Half of the genes are expressed at similar levels during all stages of asexual development, and we discovered that the majority share a novel promoter motif named the PhRiboBox. This sequence is enriched in genes associated with transcription, translation, and DNA replication, including tRNA and rRNA biogenesis. Promoters from the three P. infestans genes encoding ribosomal proteins S9, L10, and L23 and their orthologs from P. capsici were tested for their ability to drive transgenes in stable transformants of P. infestans. Five of the six promoters yielded strong expression of a GUS reporter, but the stability of expression was higher using the P. capsici promoters. With the RPS9 and RPL10 promoters of P. infestans, about half of transformants stopped making GUS over two years of culture, while their P. capsici orthologs conferred stable expression. Since cross-talk between native and transgene loci may trigger gene silencing, we encourage the use of heterologous promoters in transformation studies. PMID:26716454

  8. Comparisons of Ribosomal Protein Gene Promoters Indicate Superiority of Heterologous Regulatory Sequences for Expressing Transgenes in Phytophthora infestans.


    Poidevin, Laetitia; Andreeva, Kalina; Khachatoorian, Careen; Judelson, Howard S


    Molecular genetics approaches in Phytophthora research can be hampered by the limited number of known constitutive promoters for expressing transgenes and the instability of transgene activity. We have therefore characterized genes encoding the cytoplasmic ribosomal proteins of Phytophthora and studied their suitability for expressing transgenes in P. infestans. Phytophthora spp. encode a standard complement of 79 cytoplasmic ribosomal proteins. Several genes are duplicated, and two appear to be pseudogenes. Half of the genes are expressed at similar levels during all stages of asexual development, and we discovered that the majority share a novel promoter motif named the PhRiboBox. This sequence is enriched in genes associated with transcription, translation, and DNA replication, including tRNA and rRNA biogenesis. Promoters from the three P. infestans genes encoding ribosomal proteins S9, L10, and L23 and their orthologs from P. capsici were tested for their ability to drive transgenes in stable transformants of P. infestans. Five of the six promoters yielded strong expression of a GUS reporter, but the stability of expression was higher using the P. capsici promoters. With the RPS9 and RPL10 promoters of P. infestans, about half of transformants stopped making GUS over two years of culture, while their P. capsici orthologs conferred stable expression. Since cross-talk between native and transgene loci may trigger gene silencing, we encourage the use of heterologous promoters in transformation studies.

  9. Sequences contained within the promoter of the human thymidine kinase gene can direct cell-cycle regulation of heterologous fusion genes.

    PubMed Central

    Kim, Y K; Wells, S; Lau, Y F; Lee, A S


    Recent evidence on the transcriptional regulation of the human thymidine kinase (TK) gene raises the possibility that cell-cycle regulatory sequences may be localized within its promoter. A hybrid gene that combines the TK 5' flanking sequence and the coding region of the bacterial neomycin-resistance gene (neo) has been constructed. Upon transfection into a hamster fibroblast cell line K12, the hybrid gene exhibits cell-cycle-dependent expression. Deletion analysis reveals that the region important for cell-cycle regulation is within -441 to -63 nucleotides from the transcriptional initiation site. This region (-441 to -63) also confers cell-cycle regulation to the herpes simplex virus thymidine kinase (HSVtk) promoter, which is not expressed in a cell-cycle manner. We conclude that the -441 to -63 sequence within the human TK promoter is important for cell-cycle-dependent expression. Images PMID:3413063

  10. Sequences contained within the promoter of the human thymidine kinase gene can direct cell-cycle regulation of heterologous fusion genes

    SciTech Connect

    Kim, Yongkyu; Wells, S.; Lau, Yunfai Chris; Lee, A.S. )


    Recent evidence on the transcriptional regulation of the human thymidine kinase (TK) gene raises the possibility that cell-cycle regulatory sequences may be localized within its promoter. A hybrid gene that combines the TK 5{prime} flanking sequence and the coding region of the bacterial neomycin-resistance gene (neo) has been constructed. Upon transfection into a hamster fibroblast cell line K12, the hybrid gene exhibits cell-cycle-dependent expression. Deletion analysis reveals that the region important for cell-cycle regulation is within {minus}441 to {minus}63 nucleotides from the transcriptional initiation site. This region ({minus}441 to {minus}63) also confers cell-cycle regulation to the herpes simplex virus thymidine kinase (HSVtk) promoter, which is not expressed in a cell-cycle manner. The authors conclude that the {minus}441 to {minus}63 sequence within the human TK promoter is important for cell-cycle-dependent expression.

  11. Sequencing, genomic organization, and preliminary promoter analysis of a black cherry (R)-(+)-mandelonitrile lyase gene.


    Hu, Z; Poulton, J E


    The flavoprotein (R)-(+)-mandelonitrile lyase (MDL; EC plays a key role in cyanogenesis in rosaceous stone fruits. An MDL gene (mdl3) and its corresponding cDNA (MDL3) were isolated from black cherry (Prunus serotina) and characterized. The mdl3 gene contains 2292 bp of the 5' flanking region, the entire coding region, and 300 bp of the 3' flanking region. The coding region is interrupted by three short introns, of which one possesses the usual GC-AG splice junction dinucleotides. This gene encodes a polypeptide of 573 amino acids that includes a putative signal sequence, 13 potential N-glycosylation sites, and a presumptive flavin adenine dinucleotide-binding site. To determine whether the 5' flanking region of the mdl3 gene is capable of driving MDL expression, it was fused to the beta-glucuronidase reporter gene for Agrobacterium-mediated transformation into tobacco. Matching endogenous MDL expression patterns, beta-glucuronidase staining was observed in maturing embryos and seeds; it also occurred in postembryonic tissues, especially in association with vascular tissues. After developing a homologous transient transformation system to facilitate identification of putative regulatory sequences, we demonstrated that 125 bp (-107 to +18) of the 5' flanking sequence of the mdl3 gene is sufficient for MDL expression in protoplasts derived from immature black cherry embryos.

  12. Promoter region sequence differences in the A and G gamma globin genes of Brazilian sickle cell anemia patients.


    Barbosa, C G; Goncalves-Santos, N J; Souza-Ribeiro, S B; Moura-Neto, J P; Takahashi, D; Silva, D O; Hurtado-Guerrero, A F; Reis, M G; Goncalves, M S


    Fetal hemoglobin (HbF), encoded by the HBG2 and HBG1 genes, is the best-known genetic modulator of sickle cell anemia, varying dramatically in concentration in the blood of these patients. This variation is partially associated with polymorphisms located in the promoter region of the HBG2 and HBG1 genes. In order to explore known and unknown polymorphisms in these genes, the sequences of their promoter regions were screened in sickle cell anemia patients and correlated with both their HbF levels and their betaS-globin haplotypes. Additionally, the sequences were compared with genes from 2 healthy groups, a reference one (N = 104) and an Afro-descendant one (N = 98), to identify polymorphisms linked to the ethnic background.The reference group was composed by healthy individuals from the general population. Four polymorphisms were identified in the promoter region of HBG2 and 8 in the promoter region of HBG1 among the studied groups. Four novel single nucleotide polymorphisms (SNP) located at positions -324, -317, -309 and -307 were identified in the reference group. A deletion located between -396 and -391 in the HBG2 promoter region and the SNP -271 C-->T in the HBG1 promoter region were associated with the Central African Republic betaS-globin haplotype. In contrast, the -369 C-->G and 309 A-->G SNPs in the HBG2 promoter region were correlated to the Benin haplotype. The polymorphisms -396_-391 del HBG2, -369 SNP HBG2 and -271 SNP HBG1 correlated with HbF levels. Hence, we suggest an important role of HBG2 and HBG1 gene polymorphisms on the HbF synthesis.

  13. Structural gene for the phosphate-repressible phosphate-binding protein of Escherichia coli has its own promoter: complete nucleotide sequence of the phoS gene.

    PubMed Central

    Surin, B P; Jans, D A; Fimmel, A L; Shaw, D C; Cox, G B; Rosenberg, H


    The complete nucleotide sequence of the phoS gene, the structural gene for the phosphate-repressible, periplasmic phosphate-binding protein Escherichia coli K-12, was determined. The phosphate-binding protein is synthesized in a precursor form which includes an additional N-terminal segment containing 25 amino acid residues, with the general characteristics of a signal sequence. The amino acid sequence derived from the nucleotide sequence shows the mature protein to be composed of 321 amino acids with a calculated molecular weight of 34,427. The phoS gene is not part of an operon and is transcribed counterclockwise with respect to the E. coli genetic map. A promoter region has been identified on the basis of homology with the consensus sequence of other E. coli promoter regions. However, an alternative promoter region has been identified on the basis of homology with the promoter regions of the phoA and phoE genes, the structural genes for alkaline phosphatase and outer-membrane pore protein e, respectively. PMID:6321434

  14. Agrobacterium T-DNA integration in Arabidopsis is correlated with DNA sequence compositions that occur frequently in gene promoter regions.


    Schneeberger, Richard G; Zhang, Ke; Tatarinova, Tatiana; Troukhan, Max; Kwok, Shing F; Drais, Josh; Klinger, Kevin; Orejudos, Francis; Macy, Kimberly; Bhakta, Amit; Burns, James; Subramanian, Gopal; Donson, Jonathan; Flavell, Richard; Feldmann, Kenneth A


    Mobile insertion elements such as transposons and T-DNA generate useful genetic variation and are important tools for functional genomics studies in plants and animals. The spectrum of mutations obtained in different systems can be highly influenced by target site preferences inherent in the mechanism of DNA integration. We investigated the target site preferences of Agrobacterium T-DNA insertions in the chromosomes of the model plant Arabidopsis thaliana. The relative frequencies of insertions in genic and intergenic regions of the genome were calculated and DNA composition features associated with the insertion site flanking sequences were identified. Insertion frequencies across the genome indicate that T-strand integration is suppressed near centromeres and rDNA loci, progressively increases towards telomeres, and is highly correlated with gene density. At the gene level, T-DNA integration events show a statistically significant preference for insertion in the 5' and 3' flanking regions of protein coding sequences as well as the promoter region of RNA polymerase I transcribed rRNA gene repeats. The increased insertion frequencies in 5' upstream regions compared to coding sequences are positively correlated with gene expression activity and DNA sequence composition. Analysis of the relationship between DNA sequence composition and gene activity further demonstrates that DNA sequences with high CG-skew ratios are consistently correlated with T-DNA insertion site preference and high gene expression. The results demonstrate genomic and gene-specific preferences for T-strand integration and suggest that DNA sequences with a pronounced transition in CG- and AT-skew ratios are preferred targets for T-DNA integration.

  15. The adenovirus-2 EIIa early gene promoter: sequences required for efficient in vitro and in vivo transcription.

    PubMed Central

    Elkaim, R; Goding, C; Kédinger, C


    A series of deletion mutants extending from -250 toward the capsite has been constructed in the early promoter region of the adenovirus 2 EIIa gene and tested both in vitro, and in vivo after transfection of HeLa cells, for the ability to act as a template for transcription. A region between positions -94 and -63 upstream from the major EIIa early cap site is essential both in vivo and in vitro for efficient promoter function. By cotransfection of the EIIa deletion mutants with the EIa transcription unit it has been possible to demonstrate that deletion to position -94 does not affect induction of transcription of the EIIa early gene by the EIa transcription unit, but deletion to position -63 results in loss of detectable levels of EIIa early specific RNA. Thus, sequences upstream from position -94 of the EIIa early gene are not involved in the induction of the EIIa early gene by the EIa transcription unit. Images PMID:6314275

  16. Expression of a retroposon-like sequence upstream of the putative Trypanosoma brucei variant surface glycoprotein gene expression site promoter.

    PubMed Central

    Lodes, M J; Smiley, B L; Stadnyk, A W; Bennett, J L; Myler, P J; Stuart, K


    We have cloned the region spanning the putative promoter from two variant surface glycoprotein gene expression sites that are at each end of chromosome M4 of Trypanosoma brucei IsTat 7. Both expression sites contain a retroposon-like sequence (ESR) pseudogene whose 3' end is approximately 30 bp upstream of the putative expression site promoter. The ESRs from both expression sites share considerable sequence homology and are related to LINE-like elements, especially the T. brucei ingi retroposon. Other ESRs are located on large, but not intermediate or mini-, chromosomes in the IsTaR 1 serodeme, and the total copy number is 10 to 20, similar to that estimated for variant surface glycoprotein expression sites. No DNA rearrangements in the vicinity of the ESR and putative expression site promoter were detected following antigenic switches in the IsTaR 1 serodeme. ESR transcripts are present in bloodstream, but not procyclic, forms. Variation in transcript size and sequence between bloodstream variant antigenic types implies that only the ESR from the active expression site is transcribed. This pattern of expression reflects that of sequences downstream of the putative expression site promoter, suggesting that the region of coordinately controlled expression extends upstream of this promoter. Images PMID:8413293

  17. Novel promoter sequence required for manganese regulation of manganese peroxidase isozyme 1 gene expression in Phanerochaete chrysosporium.


    Ma, Biao; Mayfield, Mary B; Godfrey, Bruce J; Gold, Michael H


    Manganese peroxidase (MnP) is a major, extracellular component of the lignin-degrading system produced by the wood-rotting basidiomycetous fungus Phanerochaete chrysosporium. The transcription of MnP-encoding genes (mnps) in P. chrysosporium occurs as a secondary metabolic event, triggered by nutrient-nitrogen limitation. In addition, mnp expression occurs only under Mn2+ supplementation. Using a reporter system based on the enhanced green fluorescent protein gene (egfp), we have characterized the P. chrysosporium mnp1 promoter by examining the effects of deletion, replacement, and translocation mutations on mnp1 promoter-directed egfp expression. The 1,528-bp mnp1 promoter fragment drives egfp expression only under Mn2+-sufficient, nitrogen-limiting conditions, as required for endogenous MnP production. However, deletion of a 48-bp fragment, residing 521 bp upstream of the translation start codon in the mnp1 promoter, or replacement of this fragment with an unrelated sequence resulted in egfp expression under nitrogen limitation, both in the absence and presence of exogenous Mn2+. Translocation of the 48-bp fragment to a site 120 bp downstream of its original location resulted in Mn2+-dependent egfp expression under conditions similar to those observed with the wild-type mnp1 promoter. These results suggest that the 48-bp fragment contains at least one Mn2+-responsive cis element. Additional promoter-deletion experiments suggested that the Mn2+ element(s) is located within the 33-bp sequence at the 3' end of the 48-bp fragment. This is the first promoter sequence containing a Mn2+-responsive element(s) to be characterized in any eukaryotic organism. Copyright 2004 American Society for Microbiology

  18. The expression of human H2A-H2B histone gene pairs is regulated by multiple sequence elements in their joint promoters.


    Trappe, R; Doenecke, D; Albig, W


    The majority of human H2A and H2B histone genes are organized as gene pairs: 14 H2A-H2B gene pairs, one solitary H2A gene and three solitary H2B genes have been described. Two of the H2A genes and two of the H2B genes arranged within gene pairs are pseudogenes. The gene pairs are organized with divergent transcriptional orientation, and the coding regions of the respective H2A and H2B genes are separated by about 320 nucleotide pairs that form overlapping promoter regions. Comparison of promoters of H2A-H2B gene pairs has previously shown that these belong to two different groups (groups I and II) which are characterized by specific patterns of conserved sequence elements. We have constructed a reporter gene vector that allows the simultaneous analysis of both genes regulated by the divergent promoters belonging to group I or II, respectively. Firefly-luciferase and beta-galactosidase genes were taken as reporter genes. Site directed mutagenesis performed at individual promoter elements revealed that individual sequence elements within both groups of promoters functionally depend on each other and may contribute to a coordinate expression of paired H2A and H2B genes through assembly of their joint promoter into a mutually dependent promoter complex. Group II promoters are characterized by the presence of an E2F binding site upstream of the H2A gene-proximal TATA box. Immediately upstream of the E2F element, we have identified a highly conserved octanucleotide CACAGCTT (RT-1) that exists in all human group II H2A-H2B gene promoters. Protein binding studies at the RT-1 element indicate factor binding to this sequence. Site directed mutagenesis indicates that both the E2F element and the RT-1 motif are essential for full promoter activity.

  19. Regulation of vitellogenin gene expression in transgenic Caenorhabditis elegans: short sequences required for activation of the vit-2 promoter.

    PubMed Central

    MacMorris, M; Broverman, S; Greenspoon, S; Lea, K; Madej, C; Blumenthal, T; Spieth, J


    The Caenorhabditis elegans vitellogenin genes are subject to sex-, stage-, and tissue-specific regulation: they are expressed solely in the adult hermaphrodite intestine. Comparative sequence analysis of the DNA immediately upstream of these genes revealed the presence of two repeated heptameric elements, vit promoter element 1 (VPE1) and VPE2. VPE1 has the consensus sequence TGTCAAT, while VPE2, CTGATAA, shares the recognition sequence of the GATA family of transcription factors. We report here a functional analysis of the VPEs within the 5'-flanking region of the vit-2 gene using stable transgenic lines. The 247 upstream bp containing the VPEs was sufficient for high-level, regulated expression. Furthermore, none of the four deletion mutations or eight point mutations tested resulted in expression of the reporter gene in larvae, males, or inappropriate hermaphrodite tissues. Mutation of the VPE1 closest to the TATA box inactivated the promoter, in spite of the fact that four additional close matches to the VPE1 consensus sequence are present within the 5'-flanking 200 bp. Each of these upstream VPE1-like sequences could be mutated without loss of high-level transgene expression, suggesting that if these VPE1 sequences play a role in regulating vit-2, their effects are more subtle. A site-directed mutation in the overlapping VPE1 and VPE2 at -98 was sufficient to inactivate the promoter, indicating that one or both of these VPEs must be present for activation of vit-2 transcription. Similarly, a small perturbation of the VPE2 at -150 resulted in reduction of fp155 expression, while a more extensive mutation in this element eliminated expression. On the other hand, deletion of this VPE2 and all upstream DNA still permitted correctly regulated expression, although at a very low level, suggesting that this VPE2 performs an important role in activation of vit-2 expression but may not be absolutely required. The results, taken together, demonstrate that both VPE1 and

  20. Characterization of the bovine pregnancy-associated glycoprotein gene family--analysis of gene sequences, regulatory regions within the promoter and expression of selected genes.


    Telugu, Bhanu Prakash V L; Walker, Angela M; Green, Jonathan A


    The Pregnancy-associated glycoproteins (PAGs) belong to a large family of aspartic peptidases expressed exclusively in the placenta of species in the Artiodactyla order. In cattle, the PAG gene family is comprised of at least 22 transcribed genes, as well as some variants. Phylogenetic analyses have shown that the PAG family segregates into 'ancient' and 'modern' groupings. Along with sequence differences between family members, there are clear distinctions in their spatio-temporal distribution and in their relative level of expression. In this report, 1) we performed an in silico analysis of the bovine genome to further characterize the PAG gene family, 2) we scrutinized proximal promoter sequences of the PAG genes to evaluate the evolution pressures operating on them and to identify putative regulatory regions, 3) we determined relative transcript abundance of selected PAGs during pregnancy and, 4) we performed preliminary characterization of the putative regulatory elements for one of the candidate PAGs, bovine (bo) PAG-2. From our analysis of the bovine genome, we identified 18 distinct PAG genes and 14 pseudogenes. We observed that the first 500 base pairs upstream of the translational start site contained multiple regions that are conserved among all boPAGs. However, a preponderance of conserved regions, that harbor recognition sites for putative transcriptional factors (TFs), were found to be unique to the modern boPAG grouping, but not the ancient boPAGs. We gathered evidence by means of Q-PCR and screening of EST databases to show that boPAG-2 is the most abundant of all boPAG transcripts. Finally, we provided preliminary evidence for the role of ETS- and DDVL-related TFs in the regulation of the boPAG-2 gene. PAGs represent a relatively large gene family in the bovine genome. The proximal promoter regions of these genes display differences in putative TF binding sites, likely contributing to observed differences in spatial and temporal expression. We also

  1. Characterization of the bovine pregnancy-associated glycoprotein gene family – analysis of gene sequences, regulatory regions within the promoter and expression of selected genes

    PubMed Central

    Telugu, Bhanu Prakash VL; Walker, Angela M; Green, Jonathan A


    Background The Pregnancy-associated glycoproteins (PAGs) belong to a large family of aspartic peptidases expressed exclusively in the placenta of species in the Artiodactyla order. In cattle, the PAG gene family is comprised of at least 22 transcribed genes, as well as some variants. Phylogenetic analyses have shown that the PAG family segregates into 'ancient' and 'modern' groupings. Along with sequence differences between family members, there are clear distinctions in their spatio-temporal distribution and in their relative level of expression. In this report, 1) we performed an in silico analysis of the bovine genome to further characterize the PAG gene family, 2) we scrutinized proximal promoter sequences of the PAG genes to evaluate the evolution pressures operating on them and to identify putative regulatory regions, 3) we determined relative transcript abundance of selected PAGs during pregnancy and, 4) we performed preliminary characterization of the putative regulatory elements for one of the candidate PAGs, bovine (bo) PAG-2. Results From our analysis of the bovine genome, we identified 18 distinct PAG genes and 14 pseudogenes. We observed that the first 500 base pairs upstream of the translational start site contained multiple regions that are conserved among all boPAGs. However, a preponderance of conserved regions, that harbor recognition sites for putative transcriptional factors (TFs), were found to be unique to the modern boPAG grouping, but not the ancient boPAGs. We gathered evidence by means of Q-PCR and screening of EST databases to show that boPAG-2 is the most abundant of all boPAG transcripts. Finally, we provided preliminary evidence for the role of ETS- and DDVL-related TFs in the regulation of the boPAG-2 gene. Conclusion PAGs represent a relatively large gene family in the bovine genome. The proximal promoter regions of these genes display differences in putative TF binding sites, likely contributing to observed differences in spatial

  2. Resequencing the whole MYH7 gene (including the intronic, promoter, and 3' UTR sequences) in hypertrophic cardiomyopathy.


    Coto, Eliecer; Reguero, Julián R; Palacín, María; Gómez, Juan; Alonso, Belén; Iglesias, Sara; Martín, María; Tavira, Beatriz; Díaz-Molina, Beatriz; Morales, Carlos; Morís, César; Rodríguez-Lambert, José L; Corao, Ana I; Díaz, Marta; Alvarez, Victoria


    MYH7 mutations are found in ~20% of hypertrophic cardiomyopathy (HCM) patients. Currently, mutational analysis is based on the sequencing of the coding exons and a few exon-flanking intronic nucleotides, resulting in omission of single-exon deletions and mutations in internal intronic, promoter, and 3' UTR regions. We amplified and sequenced large MYH7 fragments in 60 HCM patients without previously identified sarcomere mutations. Lack of aberrant PCR fragments excluded single-exon deletions in the patients. Instead, we identified several new rare intronic variants. An intron 26 single nucleotide insertion (-5 insC) was predicted to affect pre-mRNA splicing, but allele frequencies did not differ between patients and controls (n = 150). We found several rare promoter variants in the patients compared to controls, some of which were in binding sites for transcription factors and could thus affect gene expression. Only one rare 3' UTR variant (c.*29T>C) found in the patients was absent among the controls. This nucleotide change would not affect the binding of known microRNAs. Therefore, MYH7 mutations outside the coding exon sequences would be rarely found among HCM patients. However, changes in the promoter region could be linked to the risk of developing HCM. Further research to define the functional effect of these variants on gene expression is necessary to confirm the role of the MYH7 promoter in cardiac hypertrophy. Copyright © 2012 American Society for Investigative Pathology and the Association for Molecular Pathology. Published by Elsevier Inc. All rights reserved.

  3. Sequenced Alleles of the Caenorhabditis Elegans Sex-Determining Gene Her-1 Include a Novel Class of Conditional Promoter Mutations

    PubMed Central

    Perry, M. D.; Trent, C.; Robertson, B.; Chamblin, C.; Wood, W. B.


    In the control of Caenorhabditis elegans sex determination, the her-1 gene must normally be activated to allow male development of XO animals and deactivated to allow hermaphrodite development of XX animals. The gene is regulated at the transcriptional level and has two nested male-specific transcripts. The larger of these encodes a small, novel, cysteine-rich protein responsible for masculinizing activity. Of the 32 extant mutant alleles, 30 cause partial or complete loss of masculinizing function (lf), while 2 are gain-of-function (gf) alleles resulting in abnormal masculinization of XX animals. We have identified the DNA sequence changes in each of these 32 alleles. Most affect the protein coding functions of the gene, but six are in the promoter region, including the two gf mutations. These two mutations may define a binding site for negative regulators of her-1. Three of the four remaining promoter mutations are single base changes that cause, surprisingly, temperature-sensitive loss of her-1 function. Such conditional promoter mutations have previously not been found among either prokaryotic or eukaryotic mutants analyzed at the molecular level. PMID:7828816

  4. The mglB sequence of Salmonella typhimurium LT2; promoter analysis by gene fusions and evidence for a divergently oriented gene coding for the mgl repressor.


    Benner-Luger, D; Boos, W


    The mglB gene of Salmonella typhimurium LT2 coding for the galactose-binding protein (GBP) was sequenced. We compared the deduced amino acid sequence with the GBP sequence of Escherichia coli K 12. The mature proteins differ in only 19 of 309 amino acid residues, corresponding to 94% homology. Analysis of the mglB control region by promoter-probe vectors revealed that two promoters, P1 and P2, constitute the mgl control region (Pmgl). P1 and P2 function in a synergistic way. P1 is the main promoter of the operon; its activity is 20 times the activity of P2. Both promoters are activated by the cyclic adenosine monophosphate catabolite activator protein (cAMP/CAP) complex. While P1 is inactive in the absence of the cAMP/CAP complex, there is residual activity of P2 under these conditions. Studies on the inducibility of the mglBAEC operon using multicopy plasmid promoter-probe vectors were hampered by the titration of the mgl repressor resulting in a partially constitutive expression of the mgl operon. The results indicate that only P1 is responding to induction by D-fucose. A weak promoter, PD, within the P1 region but divergent to it was found. PD is neither stimulated by the cAMP/CAP complex nor by D-fucose. We cloned the gene located downstream to PD and found it to strongly repress the expression of the mgl operon. We termed this gene mglD. The presence of D-fucose abolished the repression caused by the plasmid-encoded mglD gene product.

  5. Understanding the transcriptional regulation of cervix cancer using microarray gene expression data and promoter sequence analysis of a curated gene set.


    Srivastava, Prashant; Mangal, Manu; Agarwal, Subhash Mohan


    Cervical cancer, the malignant neoplasm of the cervix uteri is the second most common cancer among women worldwide and the top-most cancer in India. Several factors are responsible for causing cervical cancer, which alter the expression of oncogenic genes resulting in up or down-regulation of gene expression and inactivation of tumor-suppressor genes/gene products. Gene expression is regulated by interactions between transcription factors (TFs) and specific regulatory elements in the promoter regions of target genes. Thus, it is important to decipher and analyze TFs that bind to regulatory regions of diseased genes and regulate their expression. In the present study, computational methods involving the combination of gene expression data from microarray experiments and promoter sequence analysis of a curated gene set involved in the cervical cancer causation have been utilized for identifying potential regulatory elements. Consensus predictions of two approaches led to the identification of twelve TFs that might be crucial to the regulation of cervical cancer progression. Subsequently, TF enrichment and oncomine expression analysis suggested that the transcription factor family E2F played an important role for the regulation of genes involve in cervical carcinogenesis. Our results suggest that E2F possesses diagnostic/prognostic value and can act as a potential drug target in cervical cancer.

  6. CanScript, an 18-Base pair DNA sequence, boosts tumor cell-specific promoter activity: implications for targeted gene therapy.


    Huang, Yu-Hung; Cozzitorto, Joseph A; Richards, Nathan G; Eltoukhy, Ahmed A; Yeo, Charles J; Langer, Robert; Anderson, Daniel G; Brody, Jonathan R; Sawicki, Janet A


    Gene therapy protocols for the treatment of cancer often employ gene promoter sequences that are known to be over-expressed in specific tumor cell types relative to normal cells. These promoters, while specific, are often weakly active. It would be desirable to increase the activity of such promoters, while at the same time retain specificity, so that the therapeutic gene is more robustly expressed. Using a luciferase reporter DNA construct in both in vitro cell transfection assays and in vivo mouse tumor models, we have determined that in the absence of any other DNA sequence, a previously identified 18-base pair enhancer sequence called CanScript, lying upstream of the MSLN gene, has ~25% of the promoter activity of CAG, a very strong non-specific promoter/enhancer, in tumor cells in which MSLN is highly expressed. Furthermore, tandem repeat copies of CanScript enhance transcription in a dose-dependent manner and, when coupled with promoter sequences that are active in tumor cells, increase promoter activity. These findings suggest that the incorporation of CanScript into gene constructs may have application in enhancing activity of promoters used in cancer-targeting gene therapy strategies, thereby improving therapeutic efficacy.

  7. Nucleotide sequence conservation of novel and established cis-regulatory sites within the tyrosine hydroxylase gene promoter

    PubMed Central

    Wang, Meng; Banerjee, Kasturi; Baker, Harriet; Cave, John W.


    Tyrosine hydroxylase (TH) is the rate-limiting enzyme in catecholamine biosynthesis and its gene proximal promoter ( < 1 kb upstream from the transcription start site) is essential for regulating transcription in both the developing and adult nervous systems. Several putative regulatory elements within the TH proximal promoter have been reported, but evolutionary conservation of these elements has not been thoroughly investigated. Since many vertebrate species are used to model development, function and disorders of human catecholaminergic neurons, identifying evolutionarily conserved transcription regulatory mechanisms is a high priority. In this study, we align TH proximal promoter nucleotide sequences from several vertebrate species to identify evolutionarily conserved motifs. This analysis identified three elements (a TATA box, cyclic AMP response element (CRE) and a 5′-GGTGG-3′ site) that constitute the core of an ancient vertebrate TH promoter. Focusing on only eutherian mammals, two regions of high conservation within the proximal promoter were identified: a ∼250 bp region adjacent to the transcription start site and a ∼85 bp region located approximately 350 bp further upstream. Within both regions, conservation of previously reported cis-regulatory motifs and human single nucleotide variants was evaluated. Transcription reporter assays in a TH -expressing cell line demonstrated the functionality of highly conserved motifs in the proximal promoter regions and electromobility shift assays showed that brain-region specific complexes assemble on these motifs. These studies also identified a non-canonical CRE binding (CREB) protein recognition element in the proximal promoter. Together, these studies provide a detailed analysis of evolutionary conservation within the TH promoter and identify potential cis-regulatory motifs that underlie a core set of regulatory mechanisms in mammals. PMID:25774193

  8. Regulated expression of the human cytomegalovirus pp65 gene: Octamer sequence in the promoter is required for activation by viral gene products

    SciTech Connect

    Depto, A.S.; Stenberg, R.M.


    To better understand the regulation of late gene expression in human cytomegalovirus (CMV)-infected cells, the authors examined expression of the gene that codes for the 65-kilodalton lower-matrix phosphoprotein (pp65). Analysis of RNA isolated at 72 h from cells infected with CMV Towne or ts66, a DNA-negative temperature-sensitive mutant, supported the fact that pp65 is expressed at low levels prior to viral DNA replication but maximally expressed after the initiation of viral DNA replication. To investigate promoter activation in a transient expression assay, the pp65 promoter was cloned into the indicator plasmid containing the gene for chloramphenicol acetyltransferase (CAT). Transfection of the promoter-CAT construct and subsequent superinfection with CMV resulted in activation of the promoter at early times after infection. Cotransfection with plasmids capable of expressing immediate-early (IE) proteins demonstrated that the promoter was activated by IE proteins and that both IE regions 1 and 2 were necessary. These studies suggest that interactions between IE proteins and this octamer sequence may be important for the regulation and expression of this CMV gene.

  9. A novel regucalcin gene promoter region-related protein: comparison of nucleotide and amino acid sequences in vertebrate species.


    Sawada, Natsumi; Yamaguchi, Masayoshi


    The molecular cloning and sequencing of the cDNA coding for a novel regucalcin gene promoter region-related protein (RGPR-p117) from bovine, rabbit and chicken livers was investigated using rapid amplification of cDNA endo (RACE) method. Their nucleotide and amino acid sequences were compared with human, rat and mouse sequences published previously. RGPR-p117 of bovine, rabbit and chicken livers consisted of 1052, 1045, and 929 amino acid residues with calculated molecular mass of 117, 114, and 103 kDa, and estimated pI of 5.64, 5.84, and 5.59, respectively. Comparison analysis revealed that the nucleotide sequences of RGPR-p117 from mammalian species were highly-conserved in their coding region, and the homologies were at least 72.9%. The RGPR-p117 proteins in mammalian species consisted of 1045-1060 amino acids, and had 63.1-90.2% identity. Meanwhile, the nucleotide and amino acid sequences of chicken RGPR-p117 had at least 36.4 and 43.7% identities, respectively. Phylogenetic analysis showed that RGPR-p117 in six vertebrates appears to form a single cluster. Mammalian RGPR-p117 conserved a leucine zipper motif. Moreover, the analysis for subcellular localization of RGPR-p117 from six vertebrates showed the probability of nuclear localization >52.2%; the nuclear localization in rat and mouse was 78.3%. This study demonstrates a great conservation of RGPR-p117 genes throughout evolution.

  10. Identification of the transcriptional unit, structural organization, and promoter sequence of the human sex-determining region Y (SRY) gene, using a reverse genetic approach

    SciTech Connect

    Hua Su; Lau, Y.F.C. )


    Using a simple strategy involving cosmid-mediated gene transfer, cDNA library construction, and molecular characterization techniques, the authors have determined the transcriptional unit, structural organization, and promoter sequence of the human sex-determining region Y (SRY) gene, the putative testis-determining factor (TDF) gene on the human Y chromosome. By this approach, a recombinant cosmid harboring the human SRY sequence was isolated and transfected to appropriate tissue-cultured cells. Recombinant cDNA clones were isolated from a cDNA library constructed from poly (A) + RNA of the transfected cells. Comparative studies between the respective cDNAs and the genomic cosmid have provided information regarding the organization of the SRY gene and its mRNAs. The results indicate that the human SRY gene is an intronless gene, produces transcripts of 1.1 kb, and possesses promoter activities in the transfected cells at approximately 310 bp of its upstream sequences. 57 refs., 5 figs.

  11. Detection of cytosine and CpG density in proto-oncogenes and tumor suppressor genes in promoter sequences of acute myeloid leukemia.


    Dogan, Senol; Cilic, Anis; Marjanovic, Damir; Kurtovic-Kozaric, Amina


    Aberrant methylation is one of the driving forces of cancer genome development. Although the rate of methylation appears massively variable across the genome, it is mainly observed in histone modification, chromatin organization, DNA accessibility, or promoter sequence. Methylation of promoter sequence occurs mostly to cytosine nucleotides, which can affect transcription factors' binding affinities. In this study, we demonstrated that cytosine repeats (C types density), consisting of CC, CCC, CCCC, CCCCC, CCCCCC, CCCCCCC motifs and CpG islands density in 25 proto-oncogenes, tumor suppressor genes and control genes may play a role in the pathogenesis of acute myeloid leukemia. The promoter sequences were divided into a 100 nucleotide window from -500 to +100 nucleotides and 20 nucleotide window from -100 to +100. Each window is analyzed to find the higher C type and CpG islands density, which may cause the increased methylation in the promoter sequence. Our novel findings show that promoter sequence cytosine repeats and CpG density increase closer to transcription sites, especially just before and after the transcription start site (TSS). The results demonstrate that cytosine density increases while proto-oncogenes and TSG promoter sequences are closer to TSS 50.8% and 41.0% respectively, if (-500 to -200) and (-100 to +100) windows of the nucleotide sequences are compared. This proves that around TSS location has special nucleotide motifs and could be an important implication for our understanding of potential methylating locations in promoters.

  12. Detailed analysis of Helicobacter pylori Fur-regulated promoters reveals a Fur box core sequence and novel Fur-regulated genes.


    Pich, Oscar Q; Carpenter, Beth M; Gilbreath, Jeremy J; Merrell, D Scott


    In Helicobacter pylori, iron balance is controlled by the Ferric uptake regulator (Fur), an iron-sensing repressor protein that typically regulates expression of genes implicated in iron transport and storage. Herein, we carried out extensive analysis of Fur-regulated promoters and identified a 7-1-7 motif with dyad symmetry (5'-TAATAATnATTATTA-3'), which functions as the Fur box core sequence of H. pylori. Addition of this sequence to the promoter region of a typically non-Fur regulated gene was sufficient to impose Fur-dependent regulation in vivo. Moreover, mutation of this sequence within Fur-controlled promoters negated regulation. Analysis of the H. pylori chromosome for the occurrence of the Fur box established the existence of well-conserved Fur boxes in the promoters of numerous known Fur-regulated genes, and revealed novel putative Fur targets. Transcriptional analysis of the new candidate genes demonstrated Fur-dependent repression of HPG27_51, HPG27_52, HPG27_199, HPG27_445, HPG27_825 and HPG27_1063, as well as Fur-mediated activation of the cytotoxin associated gene A, cagA (HPG27_507). Furthermore, electrophoretic mobility shift assays confirmed specific binding of Fur to the promoters of each of these genes. Future experiments will determine whether loss of Fur regulation of any of these particular genes contributes to the defects in colonization exhibited by the H. pylori fur mutant.

  13. Genomic organization and sequence of the human NRAMP gene: identification and mapping of a promoter region polymorphism.

    PubMed Central

    Blackwell, J. M.; Barton, C. H.; White, J. K.; Searle, S.; Baker, A. M.; Williams, H.; Shaw, M. A.


    BACKGROUND: Murine Nramp is a candidate for the macrophage resistance gene Ity/Lsh/Bcg. Sequence analysis of human NRAMP was undertaken to determine its role in man. MATERIALS AND METHODS: A yeast artificial chromosome carrying NRAMP was subcloned and positive clones sequenced. The transcriptional start site was mapped using 5' RACE PCR. Polymorphic variants were amplified by PCR. Linkage analysis was used to map NRAMP. RESULTS: NRAMP spans 12kb and has 15 exons encoding a 550 amino acid protein showing 85% identity (92% similarity) with Nramp. Two conserved PKC sites occur in exon 2 encoding the Pro/Ser rich SH3 binding domain, and in exon 3. Striking sequence similarities (57 and 53%) were observed with yeast mitochondrial proteins, SMF1 and SMF2, especially within putative functional domains: exon 6 encoding the second transmembrane spanning domain, site of the murine susceptibility mutation; and exon 11 encoding a conserved transport motif. No mutations comparable to the murine susceptibility mutation were found. The transcriptional initiation site mapped 148 bp 5' of the translational initiation codon. 440bp of 5' flanking sequence contained putative promoter region elements: 6 interferon-gamma response elements, 3 W-elements, 3 NF kappa B binding sites and 1 AP-1 site. Nine purine-rich GGAA core motifs for the myeloid-specific PU.1 transcription factor were identified, two combining with imperfect AP1-like sites to create PEA3 motifs. TATA, GC and CCAAT boxes were absent. A possible enhancer element containing the Z-DNA forming dinucleotide repeat t(gt),ac(gt),ac(gt),g was polymorphic (4 alleles; n = 4,9,10,11), and was used to map NRAMP to 2q35. CONCLUSIONS: This analysis provides important resources to study the role of NRAMP in human disease. Images FIG. 3 FIG. 4 PMID:8529098

  14. Cloning and sequencing of nifBHDKENX genes of Paenibacillus massiliensis T7 and its nif promoter analysis.


    Zhao, Hongxin; Xie, Baoen; Chen, Sanfeng


    A 324 bp of nifH fragment was PCR amplified from Paenibacillus massiliensis T7 using the universal degenerate primers. The PCR-amplified nifH fragment was labeled with DIG and then used as a probe in Southern blot analysis. Southern blot result showed that there were two positive signals, indicating that there might be two copies of nifH in P. massiliensis T7. A total of 10254 bp DNA sequence containing purD and nifBHDKENX was obtained by five rounds of inverse-PCR amplification. The predicted proteins of nifBHDKENX had high homology with those from other nitrogen-fixing bacteria. Only one putative sigma54-dependent promoter sequence was detected upstream of the nifB gene and nifBHDKENX were likely to be organized in one operon. Assays of 3-galactosidase activity of P. massiliensis T7PB carrying a nifB-lacZ fusion under different concentrations of NH4+ and O2 showed that the expression of nifB-lacZ was strongly inhibited by O2.

  15. Schizosaccharomyces U6 genes have a sequence within their introns that matches the B box consensus of tRNA internal promoters.


    Frendewey, D; Barta, I; Gillespie, M; Potashkin, J


    The gene for the U6 small nuclear RNA (snRNA) in the fission yeast Schizosaccharomyces pombe is interrupted by an intron whose structure is similar to those found in messenger RNA precursors (pre-mRNAs) (1). This is the only known example of a split snRNA gene from any organism--animal, plant, or yeast. To address the uniqueness of the S. pombe U6 gene, we have investigated the structures of the U6 genes from five Schizosaccharomyces strains and three other fungi. A fragment of the U6 coding sequence was amplified from the genomic DNA of each strain by the polymerase chain reaction (PCR). The sizes of the PCR products indicated that all of the fission yeast strains possess intron-containing U6 genes; whereas, the U6 genes from the other fungi appeared to be uninterrupted. The sequences of the Schizosaccharomyces U6 gene fragments revealed that each had an intron of approximately 50 base pairs in precisely the same position. In addition to the splice sites and putative branch point regions, a sequence immediately upstream of the branch point consensus was found to be conserved in all of the Schizosaccharomyces U6 genes. This sequence matches the consensus for the B box of eukaryotic tRNA promoters. These results raise the interesting possibility that synthesis of U6 RNA in fission yeast might involve the use of internal promoter elements similar to those found in other genes transcribed by RNA polymerase III.

  16. Molecular cloning, sequencing and functional study of the promoter region of the human alpha2C4-adrenergic receptor gene.


    Schaak, S; Devedjian, J C; Cayla, C; Sender, Y; Paris, H


    Screening of a human foetal brain genomic DNA library allowed us to isolate an EcoRI-EcoRI fragment containing 6 kb of the 5'-flanking region, the open reading frame and 4 kb of the 3'-flanking region of the alpha2C4 gene. Analysis of the sequenced region (4850 bp) revealed that the first 900 bp 5' to the start codon are very rich in GC (84%), contain several Sp1-binding sites and lack a consensus TATA box. The 5'- and 3'-ends of the alpha2C4 transcript were determined by RNase-protection assays carried out with a series of antisense probes. The data obtained with cellular RNA from HepG2 cells demonstrated that transcription is initiated 891 bases upstream of the translation-start site and that the polyadenylation site is located 550 bases downstream of the stop codon. These results are consistent with the existence of a non-conventional TATA box (TTAGAAA) and the presence of a unique polyadenylation signal (AATAAA). They also fit with the size of alpha2C4-RNA found by Northern-blot analysis (2.9 kb). The transcriptional activity of the alpha2C4 promoter region was investigated by transfecting several cell types with chimaeric constructs containing various fragments of the 5'-non-coding region and luciferase as a reporter gene. The activity of the construct containing the entire 5'-non-coding region appeared to depend on the host cell. Removal of the 5'-untranslated region resulted in loss of cell specificity and a concomitant increase in luciferase activity. Transfection of HepG2 and SK-N-MC cells with constructs deleted of additional 5'-flanking fragments permitted the definition of a minimal 200 bp promoter fragment containing the pseudo-TATA box and two putative SP1-binding sites.

  17. Identity between rat htf and human xbp-1 genes: determination of gene structure, target sequence, and transcription promotion function for HTF.


    Kokura, K; Kishimoto, T; Tamura, T


    Hepatocarcinogenesis-related transcription factor (HTF) was originally isolated from rats in which the expression was enhanced in hepatocellular carcinomas. Rat HTF (rHTF) is structurally similar to human X-box-binding protein-1 (hXBP-1), and both factors are unique in respective genomes. A previous study showed that hXBP-1 mRNA is detectable ubiquitously but is enriched in the human liver as rHTF. In this study, we demonstrated the analogous exon-intron organization and significant sequence homology for rhtf and hxbp-1 genes. Alignment of amino acid sequences of rHTF and hXBP-1 revealed that all the characteristic motifs in rHTF were conserved in hXBP-1. Moreover, Southern blotting patterns provided with the rHTF and hXBP-1 probes were basically the same. These two genes were thus thought to belong to the same evolutional lineage. We determined the consensus binding sequence (CRCGTCA) for rHTF by CASTing, and it was found to be nearly the same as that for hXBP-1. Transactivation ability of rHTF was also demonstrated. The rhtf gene generates two types of mRNAs (2.0 kb and 2.5 kb), both of which encode identical rHTF protein. These transcripts had distinct transcription initiation sites. The 2.0 kb promoter, that was revealed by the transient luciferase assay, contained GC-box and CAAT-box. Sequences around the transcription initiation site for the 2.0 kb transcript were similar in rhtf and hxbp-1 genes. Our observations suggest that HTF is a rat homolog of hXBP-1.

  18. Mutation analysis of TRPS1 gene including core promoter, 5'UTR, and 3'UTR regulatory sequences with insight into their organization.


    Solc, Roman; Klugerova, Michaela; Vcelak, Josef; Baxova, Alice; Kuklik, Miloslav; Vseticka, Jan; Beharka, Rastislav; Hirschfeldova, Katerina


    The TRPS1 protein is a potent regulator of proliferation, differentiation, and apoptosis. The TRPS1 gene aberrations are strongly associated with rare trichorhinophalangeal syndrome (TRPS) development. We have conducted MLPA analysis to capture deletion within the crucial 8q24.1 chromosomal region in combination with mutation analysis of TRPS1 gene including core promoter, 5'UTR, and 3'UTR sequences in nine TRPS patients. Low complexity or extent of untranslated regulatory sequences avoided them from analysis in previous studies. Amplicon based next generation sequencing used in our study bridge over these technical limitations. Finally, we have made extended in silico analysis of TRPS1 gene regulatory sequences organization. Single contiguous deletion and an intragenic deletion intervening several exons were detected. Mutation analysis revealed five TRPS1 gene aberrations (two structural rearrangements, two nonsense mutations, and one missense substitution) reaching the overall detection rate of 78%. Several polymorphic variants were detected within the analysed regulatory sequences but without proposed pathogenic effect. In silico analysis suggested alternative promoter usage and diverse expression effectivity for different TRPS1 transcripts. Haploinsufficiency of TRPS1 gene was responsible for most of the TRPS phenotype. Structure of TRPS1 gene regulatory sequences is indicative of generally low single allele expression and its tight control.

  19. A conserved 11 nucleotide sequence contains an essential promoter element of the maize mitochondrial atp1 gene.

    PubMed Central

    Rapp, W D; Stern, D B


    To determine the structure of a functional plant mitochondrial promoter, we have partially purified an RNA polymerase activity that correctly initiates transcription at the maize mitochondrial atp1 promoter in vitro. Using a series of 5' deletion constructs, we found that essential sequences are located within--19 nucleotides (nt) of the transcription initiation site. The region surrounding the initiation site includes conserved sequence motifs previously proposed to be maize mitochondrial promoter elements. Deletion of a conserved 11 nt sequence showed that it is critical for promoter function, but deletion or alteration of conserved upstream G(A/T)3-4 repeats had no effect. When the atp1 11 nt sequence was inserted into different plasmids lacking mitochondrial promoter activity, transcription was only observed for one of these constructs. We infer from these data that the functional promoter extends beyond this motif, most likely in the 5' direction. The maize mitochondrial cox3 and atp6 promoters also direct transcription initiation in this in vitro system, suggesting that it may be widely applicable for studies of mitochondrial transcription in this species. Images PMID:1372246

  20. Promoter sequence of 3-phosphoglycerate kinase gene 1 of lactic acid-producing fungus rhizopus oryzae and a method of expressing a gene of interest in fungal species


    Gao, Johnway [Richland, WA; Skeen, Rodney S [Pendleton, OR


    The present invention provides the promoter clone discovery of phosphoglycerate kinase gene 1 of a lactic acid-producing filamentous fungal strain, Rhizopus oryzae. The isolated promoter can constitutively regulate gene expression under various carbohydrate conditions. In addition, the present invention also provides a design of an integration vector for the transformation of a foreign gene in Rhizopus oryzae.

  1. Promoter sequence of 3-phosphoglycerate kinase gene 2 of lactic acid-producing fungus rhizopus oryzae and a method of expressing a gene of interest in fungal species


    Gao, Johnway [Richland, WA; Skeen, Rodney S [Pendleton, OR


    The present invention provides the promoter clone discovery of phosphoglycerate kinase gene 2 of a lactic acid-producing filamentous fungal strain, Rhizopus oryzae. The isolated promoter can constitutively regulate gene expression under various carbohydrate conditions. In addition, the present invention also provides a design of an integration vector for the transformation of a foreign gene in Rhizopus oryzae.

  2. [Gene and gene sequence patenting].


    Bergel, S D


    According to the author, the patenting of elements isolated or copied from the human body boils down to the issue of genes and gene sequences. He describes the current situation from the comparative law standpoint (U.S. and Spanish law mainly) and then esamines the biotechnology industry's position.

  3. Structural analysis of the regulatory elements of the type-II procollagen gene. Conservation of promoter and first intron sequences between human and mouse.

    PubMed Central

    Vikkula, M; Metsäranta, M; Syvänen, A C; Ala-Kokko, L; Vuorio, E; Peltonen, L


    Transcription of the type-II procollagen gene (COL2A1) is very specifically restricted to a limited number of tissues, particularly cartilages. In order to identify transcription-control motifs we have sequenced the promoter region and the first intron of the human and mouse COL2A1 genes. With the assumption that these motifs should be well conserved during evolution, we have searched for potential elements important for the tissue-specific transcription of the COL2A1 gene by aligning the two sequences with each other and with the available rat type-II procollagen sequence for the promoter. With this approach we could identify specific evolutionarily well-conserved motifs in the promoter area. On the other hand, several suggested regulatory elements in the promoter region did not show evolutionary conservation. In the middle of the first intron we found a cluster of well-conserved transcription-control elements and we conclude that these conserved motifs most probably possess a significant function in the control of the tissue-specific transcription of the COL2A1 gene. We also describe locations of additional, highly conserved nucleotide stretches, which are good candidate regions in the search for binding sites of yet-uncharacterized cartilage-specific transcription regulators of the COL2A1 gene. PMID:1637314

  4. Analysis of sequences involved in IE2 transactivation of a baculovirus immediate-early gene promoter and identification of a new regulatory motif.


    Shippam-Brett, C E; Willis, L G; Theilmann, D A


    Opep-2 is a unique baculovirus early gene that has only been identified in the Orgyia pseudotsugata multiple capsid nucleopolyhedrovirus (OpMNPV). Previous analyses have shown this gene is expressed at very early times post-infection (p.i.) but is shut down by 36-48 h p.i. The promoter of opep-2 therefore, represents a class of early genes that is temporally regulated. In this study, a detailed analysis of the opep-2 promoter is performed to analyze the role individual motifs play in early gene expression. A new 13 base pair regulatory element was identified and shown to be essential in controlling high-level expression of this gene. In addition, mutational analysis revealed that GATA and CACGTG motifs, which have been shown to bind cellular factors in Sf9 and Ld652Y cells, played minor roles in influencing opep-2 expression in the absence of other viral factors. The OpMNPV transactivator IE2 causes a significant activation of the opep-2 promoter. Cotransfection of an extensive number of promoter deletions and mutations did not show any sequence specificity for IE2 transactivation. This is the first detailed analysis of the sequence requirements for IE2 transactivation, and these results suggest that IE2 does not bind directly to specific elements in the opep-2 promoter.

  5. Swapped green algal promoters: aphVIII-based gene constructs with Chlamydomonas flanking sequences work as dominant selectable markers in Volvox and vice versa.


    Hallmann, A; Wodniok, S


    Production of transgenic organisms is a well-established, versatile course of action in molecular biology. Genetic engineering often requires heterologous, dominant antibiotic resistance genes that have been used as selectable markers in many species. However, as heterologous 5' and 3' flanking sequences often result in very low expression rates, endogenous flanking sequences, especially promoters, are mostly required and are easily obtained in model organisms, but it is much more complicated and time-consuming to get appropriate sequences from less common organisms. In this paper, we show that aminoglycoside 3'-phosphotransferase gene (aphVIII) based constructs with 3' and 5' untranslated flanking sequences (including promoters) from the multicellular green alga Volvox work in the unicellular green alga Chlamydomonas and flanking sequences from Chlamydomonas work in Volvox, at least if a low expression rate is compensated by an enforced high gene dosage. This strategy might be useful for all investigators that intend to transform species in which genomic sequences are not available, but sequences from related organisms exist.

  6. Automated conserved non-coding sequence (CNS) discovery reveals differences in gene content and promoter evolution among grasses.


    Turco, Gina; Schnable, James C; Pedersen, Brent; Freeling, Michael


    Conserved non-coding sequences (CNS) are islands of non-coding sequence that, like protein coding exons, show less divergence in sequence between related species than functionless DNA. Several CNSs have been demonstrated experimentally to function as cis-regulatory regions. However, the specific functions of most CNSs remain unknown. Previous searches for CNS in plants have either anchored on exons and only identified nearby sequences or required years of painstaking manual annotation. Here we present an open source tool that can accurately identify CNSs between any two related species with sequenced genomes, including both those immediately adjacent to exons and distal sequences separated by >12 kb of non-coding sequence. We have used this tool to characterize new motifs, associate CNSs with additional functions, and identify previously undetected genes encoding RNA and protein in the genomes of five grass species. We provide a list of 15,363 orthologous CNSs conserved across all grasses tested. We were also able to identify regulatory sequences present in the common ancestor of grasses that have been lost in one or more extant grass lineages. Lists of orthologous gene pairs and associated CNSs are provided for reference inbred lines of arabidopsis, Japonica rice, foxtail millet, sorghum, brachypodium, and maize.

  7. Gene expression promoted by the SV40 DNA targeting sequence and the hypoxia-responsive element under normoxia and hypoxia.


    Sacramento, C B; Moraes, J Z; Denapolis, P M A; Han, S W


    The main objective of the present study was to find suitable DNA-targeting sequences (DTS) for the construction of plasmid vectors to be used to treat ischemic diseases. The well-known Simian virus 40 nuclear DTS (SV40-DTS) and hypoxia-responsive element (HRE) sequences were used to construct plasmid vectors to express the human vascular endothelial growth factor gene (hVEGF). The rate of plasmid nuclear transport and consequent gene expression under normoxia (20% O2) and hypoxia (less than 5% O2) were determined. Plasmids containing the SV40-DTS or HRE sequences were constructed and used to transfect the A293T cell line (a human embryonic kidney cell line) in vitro and mouse skeletal muscle cells in vivo. Plasmid transport to the nucleus was monitored by real-time PCR, and the expression level of the hVEGF gene was measured by ELISA. The in vitro nuclear transport efficiency of the SV40-DTS plasmid was about 50% lower under hypoxia, while the HRE plasmid was about 50% higher under hypoxia. Quantitation of reporter gene expression in vitro and in vivo, under hypoxia and normoxia, confirmed that the SV40-DTS plasmid functioned better under normoxia, while the HRE plasmid was superior under hypoxia. These results indicate that the efficiency of gene expression by plasmids containing DNA binding sequences is affected by the concentration of oxygen in the medium.

  8. Combinatorial variation in coding and promoter sequences of genes at the Tri locus in Pisum sativum accounts for variation in trypsin inhibitor activity in seeds.


    Page, D; Aubert, G; Duc, G; Welham, T; Domoney, C


    Cultivars of Pisum sativum that differ with respect to the quantitative expression of trypsin/chymotrypsin inhibitor proteins in seeds have been examined in terms of the structure of the corresponding genes. The patterns of divergence in the promoter and coding sequences are described, and the divergence among these exploited for the development of facile DNA-based assays to distinguish genotypes. Quantitative effects on gene expression may be attributed to the overall gene complement and to particular promoter/coding sequence combinations, as well as to the existence of distinct active-site variants that ultimately influence protein activity. Electronic supplementary material to this paper can be obtained by using the Springer LINK server located at

  9. Identification of the transcriptional unit, structural organization, and promoter sequence of the human sex-determining region Y (SRY) gene, using a reverse genetic approach.

    PubMed Central

    Su, H; Lau, Y F


    Using a simple strategy involving cosmid-mediated gene transfer, cDNA library construction, and molecular characterization techniques, we have determined the transcriptional unit, structural organization, and promoter sequence of the human sex-determining region Y (SRY) gene, the putative testis-determining factor (TDF) gene on the human Y chromosome. By this approach, a recombinant cosmid harboring the human SRY sequence was isolated and transfected to appropriate tissue-cultured cells. Recombinant cDNA clones were isolated from a cDNA library constructed from poly (A) + RNA of the transfected cells. Comparative studies between the respective cDNAs and the genomic cosmid have provided information regarding the organization of the SRY gene and its mRNAs. The results indicate that the human SRY gene is an intronless gene, produces transcripts of 1.1 kb, and possesses promoter activities in the transfected cells at approximately 310 bp of its upstream sequences. Images Figure 1 Figure 2 Figure 4 Figure 5 PMID:8434602

  10. In silico discrimination of single nucleotide polymorphisms and pathological mutations in human gene promoter regions by means of local DNA sequence context and regularity.


    Khan, Imtiaz A; Mort, Matthew; Buckland, Paul R; O'Donovan, Michael C; Cooper, David N; Chuzhanova, Nadia A


    DNA sequence features were sought that could be used for the in silico ascertainment of the likely functional consequences of single nucleotide changes in human gene promoter regions. To identify relevant features of the local DNA sequence context, we transformed into consensus tables the nucleotide composition of sequences flanking 101 promoter SNPs of type C<-->T or A<-->G, defined empirically as being either 'functional' or 'non-functional' on the basis of a standardised reporter gene assay. The similarity of a given sequence to these consensus tables was then measured by means of the Shapiro-Senapathy score. A decision rule with the potential to discriminate between empirically ascertained functional and non-functional SNPs was proposed that potentiated discrimination between functional and non-functional SNPs with a sensitivity of 80% and a specificity of 20%. Two further datasets (viz. disease-associated SNPs of types A<-->G and C<-->T (N = 75) and pathological promoter mutations (transitions, N = 114)) were retrieved from the Human Gene Mutation Database (HGMD; and analyzed using consensus tables derived from the functional and non-functional promoter SNPs; approximately 70% were correctly recognized as being of probable functional significance. Complexity analysis was also used to quantify the regularity of the local DNA sequence environment. Functional SNPs/mutations of type C<-->T were found to occur in DNA regions characterized by lower average sequence complexity as measured with respect to symmetric elements; complexity values increased gradually from functional SNPs and pathological mutations to functional disease-associated SNPs and non-functional SNPs. This may reflect the internal axial symmetry that frequently characterizes transcription factor binding sites.

  11. Sequence Elements Upstream of the Core Promoter Are Necessary for Full Transcription of the Capsule Gene Operon in Streptococcus pneumoniae Strain D39

    PubMed Central

    Wen, Zhensong; Sertil, Odeniel; Cheng, Yongxin; Zhang, Shanshan; Liu, Xue; Wang, Wen-Ching


    Streptococcus pneumoniae is a major bacterial pathogen in humans. Its polysaccharide capsule is a key virulence factor that promotes bacterial evasion of human phagocytic killing. While S. pneumoniae produces at least 94 antigenically different types of capsule, the genes for biosynthesis of almost all capsular types are arranged in the same locus. The transcription of the capsular polysaccharide (cps) locus is not well understood. This study determined the transcriptional features of the cps locus in the type 2 virulent strain D39. The initial analysis revealed that the cps genes are cotranscribed from a major transcription start site at the −25 nucleotide (G) upstream of cps2A, the first gene in the locus. Using unmarked chromosomal truncations and a luciferase-based transcriptional reporter, we showed that the full transcription of the cps genes not only depends on the core promoter immediately upstream of cps2A, but also requires additional elements upstream of the core promoter, particularly a 59-bp sequence immediately upstream of the core promoter. Unmarked deletions of these promoter elements in the D39 genome also led to significant reduction in CPS production and virulence in mice. Lastly, common cps gene (cps2ABCD) mutants did not show significant abnormality in cps transcription, although they produced significantly less CPS, indicating that the CpsABCD proteins are involved in the encapsulation of S. pneumoniae in a posttranscriptional manner. This study has yielded important information on the transcriptional characteristics of the cps locus in S. pneumoniae. PMID:25733517

  12. Histone acetylation accompanied with promoter sequences displaying differential expression profiles of B-class MADS-box genes for phalaenopsis floral morphogenesis.


    Hsu, Chia-Chi; Wu, Pei-Shan; Chen, Tien-Chih; Yu, Chun-Wei; Tsai, Wen-Chieh; Wu, Keqiang; Wu, Wen-Luan; Chen, Wen-Huei; Chen, Hong-Hwa


    Five B-class MADS-box genes, including four APETALA3 (AP3)-like PeMADS2∼5 and one PISTILLATA (PI)-like PeMADS6, specify the spectacular flower morphology in orchids. The PI-like PeMADS6 ubiquitously expresses in all floral organs. The four AP3-like genes, resulted from two duplication events, express ubiquitously at floral primordia and early floral organ stages, but show distinct expression profiles at late floral organ primordia and floral bud stages. Here, we isolated the upstream sequences of PeMADS2∼6 and studied the regulatory mechanism for their distinct gene expression. Phylogenetic footprinting analysis of the 1.3-kb upstream sequences of AP3-like PeMADS2∼5 showed that their promoter regions have sufficiently diverged and contributed to their subfunctionalization. The amplified promoter sequences of PeMADS2∼6 could drive beta-glucuronidase (GUS) gene expression in all floral organs, similar to their expression at the floral primordia stage. The promoter sequence of PeMADS4, exclusively expressed in lip and column, showed a 1.6∼3-fold higher expression in lip/column than in sepal/petal. Furthermore, we noted a 4.9-fold increase in histone acetylation (H3K9K14ac) in the translation start region of PeMADS4 in lip as compared in petal. All these results suggest that the regulation via the upstream sequences and increased H3K9K14ac level may act synergistically to display distinct expression profiles of the AP3-like genes at late floral organ primordia stage for Phalaenopsis floral morphogenesis.

  13. Enhancement of heterologous production of eicosapentaenoic acid in Escherichia coli by substitution of promoter sequences within the biosynthesis gene cluster.


    Lee, Su-Jin; Kim, Chul Ho; Seo, Pil-Soo; Kwon, Ohsuk; Hur, Byung-Ki; Seo, Jeong-Woo


    To enhance the heterologous production of eicosapentaenoic acid (EPA) in Escherichia coli, the EPA biosynthesis gene cluster from Shewanella oneidensis MR-1 was cloned under the lacZ promoter on a high-copy number plasmid, pBluescript SK+. The production of EPA was remarkably enhanced yielding levels of up to 7.5% of the total fatty acid content in the recombinant E. coli strain by induction with IPTG, whereas the stimulation of EPA production was abolished by adding glucose into the culture medium, probably due to glucose repression acting on the promoter activity.

  14. Identification of a cis-acting element in the class I major histocompatibility complex gene promoter responsive to activation by retroviral sequences.

    PubMed Central

    Choi, S Y; van de Mark, K; Faller, D V


    The infection of cells with Moloney murine leukemia virus (M-MuLV) causes an increase in specific cellular gene products, including the major histocompatibility complex (MHC) class I antigens. This upregulation occurs through a transactivation process mediated by the long terminal repeat (LTR) of M-MuLV, and we show here that the gene activation response to the LTR requires at least one specific cis element within the MHC proximal promoter region. Nested deletions of MHC class I H-2Kb gene promoter sequence were subcloned into a chloramphenicol acetyltransferase (CAT) reporter vector and then transiently introduced into BALB/c-3T3 cells expressing M-MuLV or cotransfected into BALB/c-3T3 cells with a vector containing subgenomic portions of the virus, including the LTR. CAT activity assays demonstrated that a minimal H-2Kb gene promoter (-64 to +12) contained elements sufficient for this transactivation. DNase I footprinting assays located a protein-binding site in the region of -64 to -34 bp from the transcriptional start site, and point mutation analysis confirmed the location of this cis-acting element, designated the let response element (LRE), and defined a binding motif. This LRE is distinct from binding sites for currently known transcription factors in the class I MHC gene promoter and is conserved in the promoters of human and murine MHC class I genes. Mutation of the LRE resulted in dramatic reduction in both DNA-protein binding activity in electrophoretic mobility shift assay and in the ability of the mutated promoter to respond to retroviral transactivation. Addition of the LRE to a heterologous promoter conferred the ability to respond to retroviral transactivation. PMID:8995614

  15. A Sequence of the CIS Gene Promoter Interacts Preferentially with Two Associated STAT5A Dimers: a Distinct Biochemical Difference between STAT5A and STAT5B

    PubMed Central

    Verdier, Frédérique; Rabionet, Raquel; Gouilleux, Fabrice; Beisenherz-Huss, Christian; Varlet, Paule; Muller, Odile; Mayeux, Patrick; Lacombe, Catherine; Gisselbrecht, Sylvie; Chretien, Stany


    Two distinct genes encode the closely related signal transducer and activator of transcription proteins STAT5A and STAT5B. The molecular mechanisms of gene regulation by STAT5 and, particularly, the requirement for both STAT5 isoforms are still undetermined. Only a few STAT5 target genes, among them the CIS (cytokine-inducible SH2-containing protein) gene, have been identified. We cloned the human CIS gene and studied the human CIS gene promoter. This promoter contains four STAT binding elements organized in two pairs. By electrophoretic mobility shift assay studies using nuclear extracts of UT7 cells stimulated with erythropoietin, we showed that these four sequences bound to STAT5-containing complexes that exhibited different patterns and affinities: the three upstream STAT binding sequences bound to two distinct STAT5-containing complexes (C0 and C1) and the downstream STAT box bound only to the slower-migrating C1 band. Using nuclear extracts from COS-7 cells transfected with expression vectors for the prolactin receptor, STAT5A, and/or STAT5B, we showed that the C1 complex was composed of a STAT5 tetramer and was dependent on the presence of STAT5A. STAT5B lacked this property and bound with a stronger affinity than did STAT5A to the four STAT sequences as a homodimer (C0 complex). This distinct biochemical difference between STAT5A and STAT5B was confirmed with purified activated STAT5 recombinant proteins. Moreover, we showed that the presence on the same side of the DNA helix of a second STAT sequence increased STAT5 binding and that only half of the palindromic STAT binding sequence was sufficient for the formation of a STAT5 tetramer. Again, STAT5A was essential for this cooperative tetrameric association. This property distinguishes STAT5A from STAT5B and could be essential to explain the transcriptional regulation diversity of STAT5. PMID:9742102

  16. Exonic sequences are required for elicitor and light activation of a plant defense gene, but promoter sequences are sufficient for tissue specific expression.

    PubMed Central

    Douglas, C J; Hauffe, K D; Ites-Morales, M E; Ellard, M; Paszkowski, U; Hahlbrock, K; Dangl, J L


    The parsley 4CL-1 gene encodes 4-coumarate:CoA ligase, a key enzyme of general phenylpropanoid metabolism. As well as being transcriptionally activated by such stresses as pathogen infection, UV-irradiation, and wounding, expression of 4CL-1 is developmentally regulated. In this paper we present evidence that 4CL-1 cis-acting elements which control stress-induced and developmental expression are physically separated. The ability of a series of 4CL gene constructions to respond to elicitor and light in stably or transiently transformed parsley cells was tested. While inducible expression was observed from all templates in which the 4CL-1 structural gene was fused to the 4CL-1 promoter, fusions of the promoter to the GUS reporter gene were completely unresponsive. The element(s) required for responsiveness appear to be exonic, since 4CL-1 introns and 3' flanking DNA had no effect on inducibility. Furthermore, this unconventional regulatory mode operates in transgenic tobacco plants, where we show that a 4CL-1 promoter fragment specifies correct cell-specific expression when fused to GUS yet is unresponsive to elicitor and light. Images PMID:2050114

  17. A fusion promoter created by a new insertion sequence, IS1490, activates transcription of 2,4,5-trichlorophenoxyacetic acid catabolic genes in Burkholderia cepacia AC1100.

    PubMed Central

    Hübner, A; Hendrickson, W


    Transposition and transcriptional activation by insertion sequences in Burkholderia cepacia AC1100 were investigated. Two closely related new elements, IS1413 and IS1490, were identified and characterized. These elements are not highly related to other insertion sequences identified in AC1100 or other B. cepacia isolates. Based on their structures and the sequences of the inverted terminal repeats and the putative transposase protein, the insertion elements (IS elements) are similar to IST2 of Thiobacillus ferrooxidans and several related elements. All the IS elements that have been identified in this strain are found in multiple copies (10 to 40), and they have high-level promoter activity capable of stimulating transcription from a distance up to 500 bp from a target gene. Strain AC1100 was originally isolated after prolonged selection for the ability to utilize the herbicide 2,4,5-trichlorophenoxyacetic acid (2,4,5-T) as a sole carbon source. Three IS elements are located near the first gene of the 2,4,5-T catabolic pathway, tftA. IS1490 inserted 110 bp upstream of tftA and created a fusion promoter responsible for constitutive transcription of the gene. Our results confirm the hypothesis that IS elements play a central role in transcription of 2,4,5-T genes and likely have stimulated rapid evolution of the metabolic pathway. PMID:9098071

  18. Sequence analysis of myostatin promoter in cattle.


    Crisà, A; Marchitelli, C; Savarese, M C; Valentini, A


    Myostatin (GDF8) acts as a negative regulator of muscle growth. Mutations in the gene are responsible for the double muscling phenotype in several European cattle breeds. Here we describe the sequence of the upstream 5' region of the myostatin gene. The sequence analysis was carried out on three animals of nine European cattle breeds, with the aim to search for polymorphisms. A T/A polymorphism at -371 and a G/C polymorphism at -805 (relative to ATG) were found. PCR- RFLP was used to further screen 353 animals of the nine breeds studied and to assess the frequencies of the SNPs. The promoter region of the gene contains several binding sites for transcription factors found also in other myogenic genes. This may play an important role in the regulation of the protein and consequently on muscular development.

  19. MEF-2 and Oct-1 bind to two homologous promoter sequence elements and participate in the expression of a skeletal muscle-specific gene.


    Lakich, M M; Diagana, T T; North, D L; Whalen, R G


    The murine adult IIB myosin heavy chain (IIB MyHC) gene is expressed only in certain skeletal muscle fibers. Within the proximal promoter are two A + T-rich motifs, mAT1 and mAT2, which greatly enhance muscle-specific transcription; myogenic cells contain proteins that bind to these sequences. MEF-2 binds to both mAT1 and mAT2; a mutation abolishing its binding to mAT1 greatly diminishes the activity of the promoter. Both mAT motifs also form complexes with a protein requiring a target sequence typical of POU domain proteins, which migrate in electrophoretic mobility shift assays to the same position as a complex containing purified Oct-1 and which are supershifted by an antibody specific to Oct-1; this protein is therefore probably Oct-1. Footprinting experiments demonstrate that mAT1 is preferentially occupied by MEF-2 and mAT2 by Oct-1 and that these two proteins appear to bind cooperatively to their respective sites. Although the two mAT motifs have sequences that are very similar, they nonetheless exhibit distinct behaviors and perform differently in the activation of the promoter. The contribution of the IIB MyHC gene to specification of the myogenic phenotype is thus at least in part regulated by MEF-2 and Oct-1.

  20. Two short sequences in OsNAR2.1 promoter are necessary for fully activating the nitrate induced gene expression in rice roots

    PubMed Central

    Liu, Xiaoqin; Feng, Huimin; Huang, Daimin; Song, Miaoquan; Fan, Xiaorong; Xu, Guohua


    Nitrate is an essential nitrogen source and serves as a signal to control growth and gene expression in plants. In rice, OsNAR2.1 is an essential partner of multiple OsNRT2 nitrate transporters for nitrate uptake over low and high concentration range. Previously, we have reported that −311 bp upstream fragment from the translational start site in the promoter of OsNAR2.1 gene is the nitrate responsive region. To identify the cis-acting DNA elements necessary for nitrate induced gene expression, we detected the expression of beta-glucuronidase (GUS) reporter in the transgenic rice driven by the OsNAR2.1 promoter with different lengths and site mutations of the 311 bp region. We found that −129 to −1 bp region is necessary for the nitrate-induced full activation of OsNAR2.1. Besides, the site mutations showed that the 20 bp fragment between −191 and −172 bp contains an enhancer binding site necessary to fully drive the OsNAR2.1 expression. Part of the 20 bp fragment is commonly presented in the sequences of different promoters of both the nitrate induced NAR2 genes and nitrite reductase NIR1 genes from various higher plants. These findings thus reveal the presence of conserved cis-acting element for mediating nitrate responses in plants. PMID:26150107

  1. Promoter sequences in the RI beta subunit gene of cAMP-dependent protein kinase required for transgene expression in mouse brain.


    Clegg, C H; Haugen, H S; Boring, L F


    Neural-specific expression of the mouse regulatory type-I beta (RI beta) subunit gene of cAMP-dependent protein kinase is controlled by a fragment of genomic DNA comprised of a TATA-less promoter flanked by 1.5 kilobases of 5'-upstream sequence and a 1.8-kilobase intron. This DNA contains a complex arrangement of transcription factor binding motifs, and previous experiments have shown that many of these are recognized by proteins found in brain nuclear extract. To identify sequences critical for RI beta expression in functional neurons, we performed a deletion analysis in transgenic mice. Evidence is presented that the GC-rich proximal promoter is responsible for cell type-specific expression in vivo because RI beta DNA containing as little as 17 base pairs (bp) of 5'-upstream sequence was functional in mouse brain. One likely regulatory element coincides with the start of transcription and includes an EGR-1 motif and 3 consecutive SP1 sites within a 21-bp interval. Maximal RI beta promoter activity required the adjacent 663 bp of 5'-upstream DNA where most, but not all, of the regulatory activity was localized between position -663 and -333. A 37-bp direct repeat lies within this region that contains 2 basic helix-loop-helix binding sites, each of which are overlapped by two steroid hormone receptor half-sites, and a shared AP1 consensus sequence. Intron I sequences were also tested, and deletion of a 388-bp region containing numerous Sp1-like sequences lowered transgene activity significantly. These results have identified specific regions of the RI beta promoter that are required for the expression of this signal transduction protein in mouse neurons.

  2. i-motif structures in long cytosine-rich sequences found upstream of the promoter region of the SMARCA4 gene.


    Benabou, Sanae; Aviñó, Anna; Lyonnais, S; González, C; Eritja, Ramon; De Juan, Anna; Gargallo, Raimundo


    Cytosine-rich oligonucleotides are capable of forming complex structures known as i-motif with increasingly studied biological properties. The study of sequences prone to form i-motifs located near the promoter region of genes may be difficult because these sequences not only contain repeats of cytosine tracts of disparate length but also these may be separated by loops of varied nature and length. In this work, the formation of intramolecular i-motif structures by a long sequence located upstream of the promoter region of the SMARCA4 gene has been demonstrated. Nuclear Magnetic Resonance, Circular Dichroism, Gel Electrophoresis, Size-Exclusion Chromatography, and multivariate analysis have been used. Not only the wild sequence (5'-TC3T2GCTATC3TGTC2TGC2TCGC3T2G2TCATGA2C4-3') has been studied but also several other truncated and mutated sequences. Despite the apparent complex sequence, the results showed that the wild sequence may form a relatively stable and homogeneous unimolecular i-motif structure, both in terms of pH or temperature. The model ligand TMPyP4 destabilizes the structure, whereas the presence of 20% (w/v) PEG200 stabilized it slightly. This finding opens the door to the study of the interaction of these kind of i-motif structures with stabilizing ligands or proteins. Copyright © 2017 Elsevier B.V. and Société Française de Biochimie et Biologie Moléculaire (SFBBM). All rights reserved.

  3. Comparative and genetic analysis of the four sequenced Paenibacillus polymyxa genomes reveals a diverse metabolism and conservation of genes relevant to plant-growth promotion and competitiveness.


    Eastman, Alexander W; Heinrichs, David E; Yuan, Ze-Chun


    Members of the genus Paenibacillus are important plant growth-promoting rhizobacteria that can serve as bio-reactors. Paenibacillus polymyxa promotes the growth of a variety of economically important crops. Our lab recently completed the genome sequence of Paenibacillus polymyxa CR1. As of January 2014, four P. polymyxa genomes have been completely sequenced but no comparative genomic analyses have been reported. Here we report the comparative and genetic analyses of four sequenced P. polymyxa genomes, which revealed a significantly conserved core genome. Complex metabolic pathways and regulatory networks were highly conserved and allow P. polymyxa to rapidly respond to dynamic environmental cues. Genes responsible for phytohormone synthesis, phosphate solubilization, iron acquisition, transcriptional regulation, σ-factors, stress responses, transporters and biomass degradation were well conserved, indicating an intimate association with plant hosts and the rhizosphere niche. In addition, genes responsible for antimicrobial resistance and non-ribosomal peptide/polyketide synthesis are present in both the core and accessory genome of each strain. Comparative analyses also reveal variations in the accessory genome, including large plasmids present in strains M1 and SC2. Furthermore, a considerable number of strain-specific genes and genomic islands are irregularly distributed throughout each genome. Although a variety of plant-growth promoting traits are encoded by all strains, only P. polymyxa CR1 encodes the unique nitrogen fixation cluster found in other Paenibacillus sp. Our study revealed that genomic loci relevant to host interaction and ecological fitness are highly conserved within the P. polymyxa genomes analysed, despite variations in the accessory genome. This work suggets that plant-growth promotion by P. polymyxa is mediated largely through phytohormone production, increased nutrient availability and bio-control mechanisms. This study provides an in

  4. "Monoallelic germline methylation and sequence variant in the promoter of the RB1 gene: a possible constitutive epimutation in hereditary retinoblastoma".


    Quiñonez-Silva, Guadalupe; Dávalos-Salas, Mercedes; Recillas-Targa, Félix; Ostrosky-Wegman, Patricia; Aranda, Diego Arenas; Benítez-Bribiesca, Luis


    Retinoblastoma is a malignant tumor of the retina in children <5 years of age and occurs after two mutations in the RB1 gene. The first mutation (M1) is germinal and confers predisposition to the hereditary type, which is transmitted as an autosomal dominant highly penetrant trait, so 90 % of carriers develop retinoblastoma; however, 10 % of carriers either do not develop the tumor or develop it unilaterally. Most mutations are point mutations. Inactivation of the RB1 gene is usually caused by mutations affecting the coding region. Silencing by methylation of the RB1 promoter has been observed in retinoblastoma tumors as a second mutation (M2) and is classified as somatic epimutation. Germline methylation of the RB1 gene promoter was studied in a particular pedigree of six generations from the paternal side, with incomplete penetrance and bias towards healthy male carriers and those affected with unilateral retinoblastoma. The methylation status of the 27 CpGs dinucleotides that constitute the core of the RB1 gene promoter, analyzed by cloning and genomic sequencing after DNA sodium bisulfite conversion, demonstrated a monoallelic methylation pattern which coincides with a c. [-187T > G; -188T > G] sequence variant that is found in peripheral blood lymphocytes and tumor DNA. Unexpectedly, it was the mother who transmitted this variant to two more generations. Microsatellite markers of D chromosome showed a biparental contribution of both D13 chromosomes to the retinoblastoma phenotype, conferring double heterozygosity in the affected cases. The monoallelic genetic-epigenetic finding, the sequence variant, and methylation suggest a constitutive epimutation and probably a genetic-epigenetic hereditary predisposition for retinoblastoma in this family.

  5. Equine herpesvirus 1 gene 12, the functional homologue of herpes simplex virus VP16, transactivates via octamer sequences in the equine herpesvirus IE gene promoter.


    Elliott, G; O'Hare, P


    The HSV-1 transactivator of immediate-early (IE) gene expression, VP16, has several functional homologues among the alphaherpesviruses which have not yet been extensively studied in relation to their modes of action. To date, nothing is known of the exact sites or mechanism of interaction of the equine herpesvirus type 1 (EHV-1) homologue, the gene 12 protein, with the EHV-1 IE promoter. We show that the gene 12 protein utilises the promoter proximal region of the IE gene to induce activation and identify four potential octamer DNA binding sites within that region. Although there was divergence from its consensus, Oct-1 bound to each of these sites in an in vitro complex formation assay, and in the presence of the gene 12 product a second complex of slower migration, which was also dependent on Oct-1, was detected. When each site was inserted into a basal promoter, two conferred activation by gene 12 with a resulting increase in expression of up to 50-fold compared to basal levels. These results show that, despite the differences between the two proteins, the mechanism of interaction of the gene 12 protein with its target is analogous to that of VP16.

  6. Nuclear factor-I and activator protein-2 bind in a mutually exclusive way to overlapping promoter sequences and trans-activate the human growth hormone gene.

    PubMed Central

    Courtois, S J; Lafontaine, D A; Lemaigre, F P; Durviaux, S M; Rousseau, G G


    Transcription of the human growth hormone (hGH) gene and its regulation are controlled by trans-acting factors that bind to hGH gene promoter sequences. Several DNase I footprints have been described within 500 bp of this promoter, one of which (-289 to -267) has not yet been ascribed to a defined factor. By DNase I footprinting, gel mobility shift, and methylation interference assays with extracts from HeLa cells and GH-producing pituitary tumor (GC) cells, we show that this factor belongs to the NF-I family. When NF-I was competed out of the cell extracts, the trans-acting factor AP-2 bound to the same site as NF-I. AP-2 was present not only in HeLa cells, but also in GC cells albeit at a much lower concentration. Consistent with the mutually exclusive binding of NF-I and AP-2, their methylation interference patterns included four guanine residues that were crucial for binding of both NF-I and AP-2. Cell-free transcription from the hGH gene promoter showed that these two factors can transactivate this gene. Images PMID:2308836

  7. Characterization of rubber tree microRNA in phytohormone response using large genomic DNA libraries, promoter sequence and gene expression analysis.


    Kanjanawattanawong, Supanath; Tangphatsornruang, Sithichoke; Triwitayakorn, Kanokporn; Ruang-areerate, Panthita; Sangsrakru, Duangjai; Poopear, Supannee; Somyong, Suthasinee; Narangajavana, Jarunya


    The para rubber tree is the most widely cultivated tree species for producing natural rubber (NR) latex. Unfortunately, rubber tree characteristics such as a long life cycle, heterozygous genetic backgrounds, and poorly understood genetic profiles are the obstacles to breeding new rubber tree varieties, such as those with improved NR yields. Recent evidence has revealed the potential importance of controlling microRNA (miRNA) decay in some aspects of NR regulation. To gain a better understanding of miRNAs and their relationship with rubber tree gene regulation networks, large genomic DNA insert-containing libraries were generated to complement the incomplete draft genome sequence and applied as a new powerful tool to predict a function of interested genes. Bacterial artificial chromosome and fosmid libraries, containing a total of 120,576 clones with an average insert size of 43.35 kb, provided approximately 2.42 haploid genome equivalents of coverage based on the estimated 2.15 gb rubber tree genome. Based on these library sequences, the precursors of 1 member of rubber tree-specific miRNAs and 12 members of conserved miRNAs were successfully identified. A panel of miRNAs was characterized for phytohormone response by precisely identifying phytohormone-responsive motifs in their promoter sequences. Furthermore, the quantitative real-time PCR on ethylene stimulation of rubber trees was performed to demonstrate that the miR2118, miR159, miR164 and miR166 are responsive to ethylene, thus confirmed the prediction by genomic DNA analysis. The cis-regulatory elements identified in the promoter regions of these miRNA genes help augment our understanding of miRNA gene regulation and provide a foundation for further investigation of the regulation of rubber tree miRNAs.

  8. A granulocyte-colony-stimulating factor gene promoter element responsive to inflammatory mediators is functionally distinct from an identical sequence in the granulocyte-macrophage colony-stimulating factor gene.


    Kuczek, E S; Shannon, M F; Pell, L M; Vadas, M A


    A number of mesenchymal cells produce hemopoietic growth factors in response to inflammatory mediators in vitro and in vivo. Induced transcription from the hemopoietic growth factor genes is at least partially responsible for their increased expression. We have previously identified a sequence, cytokine (CK)-1, in the granulocyte (G)-CSF gene promoter that responds to TNF-alpha and binds a transcription factor, NF-GMa. We report here that the CK-1 sequence responds in a time- and dose-dependent manner to IL-1 beta and that the mutations which affect NF-GMa binding correlate with decreased transcriptional activity after stimulation with either TNF-alpha or IL-1 beta. The CK-1 sequence also responds to the human T lymphotrophic virus-1 transactivator, tax, so that this promoter element may contribute to the overall response of the G-CSF gene to these various agents. Although NF-GMa binding is seen in a number of cell types, the ability of the G-CSF CK-1 sequence to act as a transcriptional enhancer is specific for fibroblasts and not T cells. Furthermore, we show that an identical sequence in the granulocyte macrophage CSF gene, although apparently binding the same protein in vitro, cannot respond to any of these stimuli in either fibroblasts or T cells. Modification interference experiments, using the CK-1 region in the context of the granulocyte macrophage-CSF and G-CSF genes, indicated that the contact points for NF-GMa differ in each case and suggest that differences in sequences flanking the 10-bp CK-1 region probably leads to an altered DNA:protein conformation, which may explain the differential response of this conserved promoter element.

  9. Sequencing of IncX-plasmids suggests ubiquity of mobile forms of a biofilm-promoting gene cassette recruited from Klebsiella pneumoniae.


    Burmølle, Mette; Norman, Anders; Sørensen, Søren J; Hansen, Lars Hestbjerg


    Plasmids are a highly effective means with which genetic traits that influence human health, such as virulence and antibiotic resistance, are disseminated through bacterial populations. The IncX-family is a hitherto sparsely populated group of plasmids that are able to thrive within Enterobacteriaceae. In this study, a replicon-centric screening method was used to locate strains from wastewater sludge containing plasmids belonging to the IncX-family. A transposon aided plasmid capture method was then employed to transport IncX-plasmids from their original hosts (and co-hosted plasmids) into a laboratory strain (Escherichia coli Genehogs®) for further study. The nucleotide sequences of the three newly isolated IncX-plasmids (pLN126_33, pMO17_54, pMO440_54) and the hitherto un-sequenced type-plasmid R485 revealed a remarkable occurrence of whole or partial gene cassettes that promote biofilm-formation in Klebsiella pneumonia or E. coli, in all four instances. Two of the plasmids (R485 and pLN126_33) were shown to directly induce biofilm formation in a crystal violet retention assay in E. coli. Sequence comparison revealed that all plasmid-borne forms of the type 3 fimbriae encoding gene cassette mrkABCDF were variations of a composite transposon Tn6011 first described in the E. coli IncX plasmid pOLA52. In conclusion, IncX-plasmids isolated from Enterobacteriaceae over almost 40 years and on three different continents have all been shown to carry a type 3 fimbriae gene cassette mrkABCDF stemming from pathogenic K. pneumoniae. Apart from contributing general knowledge about IncX-plasmids, this study also suggests an apparent ubiquity of a mobile form of an important virulence factor and is an illuminating example of the recruitment, evolution and dissemination of genetic traits through plasmid-mediated horizontal gene transfer.

  10. Multiple regulatory mechanisms of hepatocyte growth factor expression in malignant cells with a short poly(dA) sequence in the HGF gene promoter.


    Sakai, Kazuko; Takeda, Masayuki; Okamoto, Isamu; Nakagawa, Kazuhiko; Nishio, Kazuto


    Hepatocyte growth factor (HGF) expression is a poor prognostic factor in various types of cancer. Expression levels of HGF have been reported to be regulated by shorter poly(dA) sequences in the promoter region. In the present study, the poly(dA) mononucleotide tract in various types of human cancer cell lines was examined and compared with the HGF expression levels in those cells. Short deoxyadenosine repeat sequences were detected in five of the 55 cell lines used in the present study. The H69, IM95, CCK-81, Sui73 and H28 cells exhibited a truncated poly(dA) sequence in which the number of poly(dA) repeats was reduced by ≥5 bp. Two of the cell lines exhibited high HGF expression, determined by reverse transcription quantitative polymerase chain reaction and enzyme-linked immunosorbent assay. The CCK-81, Sui73 and H28 cells with shorter poly(dA) sequences exhibited low HGF expression. The cause of the suppression of HGF expression in the CCK-81, Sui73 and H28 cells was clarified by two approaches, suppression by methylation and single nucleotide polymorphisms in the HGF gene. Exposure to 5-Aza-dC, an inhibitor of DNA methyltransferase 1, induced an increased expression of HGF in the CCK-81 cells, but not in the other cells. Single-nucleotide polymorphism (SNP) rs72525097 in intron 1 was detected in the Sui73 and H28 cells. Taken together, it was found that the defect of poly(dA) in the HGF promoter was present in various types of cancer, including lung, stomach, colorectal, pancreas and mesothelioma. The present study proposes the negative regulation mechanisms by methylation and SNP in intron 1 of HGF for HGF expression in cancer cells with short poly(dA).

  11. Massively parallel sequencing of phyllodes tumours of the breast reveals actionable mutations, and TERT promoter hotspot mutations and TERT gene amplification as likely drivers of progression

    PubMed Central

    Piscuoglio, Salvatore; Ng, Charlotte K Y; Murray, Melissa; Burke, Kathleen A; Edelweiss, Marcia; Geyer, Felipe C; Macedo, Gabriel S; Inagaki, Akiko; Papanastasiou, Anastasios D; Martelotto, Luciano G; Marchio, Caterina; Lim, Raymond S; Ioris, Rafael A; Nahar, Pooja K; De Bruijn, Ino; Smyth, Lillian; Akram, Muzaffar; Ross, Dara; Petrini, John H; Norton, Larry; Solit, David B; Baselga, Jose; Brogi, Edi; Ladanyi, Marc; Weigelt, Britta; Reis-Filho, Jorge S


    Phyllodes tumours (PTs) are breast fibroepithelial lesions that are graded based on histological criteria as benign, borderline or malignant. PTs may recur locally. Borderline PTs and malignant PTs may metastasize to distant sites. Breast fibroepithelial lesions, including PTs and fibroadenomas, are characterized by recurrent MED12 exon 2 somatic mutations. We sought to define the repertoire of somatic genetic alterations in PTs and whether these may assist in the differential diagnosis of these lesions. We collected 100 fibroadenomas, 40 benign PTs, 14 borderline PTs and 22 malignant PTs. Six, 6 and 13 benign, borderline and malignant PTs respectively and their matched normal tissue were subjected to targeted massively parallel sequencing (MPS) using the MSK-IMPACT sequencing assay. Recurrent MED12 mutations were found in 56% of PTs; in addition, mutations affecting cancer genes (e.g. TP53, RB1, SETD2 and EGFR) were exclusively detected in borderline and malignant PTs. We found a novel recurrent clonal hotspot mutation in the TERT promoter (−124 C>T) in 52% and TERT gene amplification in 4% of PTs. Laser capture microdissection revealed that these mutations were restricted to the mesenchymal component of PTs. Sequencing analysis of the entire cohort revealed that the frequency of TERT alterations increased from benign (18%), to borderline (57%) and to malignant PTs (68%; P<0.01), and TERT alterations were associated with increased levels of TERT mRNA (P<0.001). No TERT alterations were observed in fibroadenomas. An analysis of TERT promoter sequencing and gene amplification distinguished PTs from fibroadenomas with a sensitivity and a positive predictive value of 100% (CI 95.38%–100%) and 100% (CI 85.86%–100%), respectively, and a sensitivity and a negative predictive value of 39% (CI 28.65%–51.36%) and 68% (CI 60.21%–75.78%), respectively. Our results suggest that TERT alterations may drive the progression of PTs, and may assist in the differential

  12. Massively parallel sequencing of phyllodes tumours of the breast reveals actionable mutations, and TERT promoter hotspot mutations and TERT gene amplification as likely drivers of progression.


    Piscuoglio, Salvatore; Ng, Charlotte Ky; Murray, Melissa; Burke, Kathleen A; Edelweiss, Marcia; Geyer, Felipe C; Macedo, Gabriel S; Inagaki, Akiko; Papanastasiou, Anastasios D; Martelotto, Luciano G; Marchio, Caterina; Lim, Raymond S; Ioris, Rafael A; Nahar, Pooja K; Bruijn, Ino De; Smyth, Lillian; Akram, Muzaffar; Ross, Dara; Petrini, John H; Norton, Larry; Solit, David B; Baselga, Jose; Brogi, Edi; Ladanyi, Marc; Weigelt, Britta; Reis-Filho, Jorge S


    Phyllodes tumours (PTs) are breast fibroepithelial lesions that are graded based on histological criteria as benign, borderline or malignant. PTs may recur locally. Borderline PTs and malignant PTs may metastasize to distant sites. Breast fibroepithelial lesions, including PTs and fibroadenomas, are characterized by recurrent MED12 exon 2 somatic mutations. We sought to define the repertoire of somatic genetic alterations in PTs and whether these may assist in the differential diagnosis of these lesions. We collected 100 fibroadenomas, 40 benign PTs, 14 borderline PTs and 22 malignant PTs; six, six and 13 benign, borderline and malignant PTs, respectively, and their matched normal tissue, were subjected to targeted massively parallel sequencing (MPS) using the MSK-IMPACT sequencing assay. Recurrent MED12 mutations were found in 56% of PTs; in addition, mutations affecting cancer genes (eg TP53, RB1, SETD2 and EGFR) were exclusively detected in borderline and malignant PTs. We found a novel recurrent clonal hotspot mutation in the TERT promoter (-124 C>T) in 52% and TERT gene amplification in 4% of PTs. Laser capture microdissection revealed that these mutations were restricted to the mesenchymal component of PTs. Sequencing analysis of the entire cohort revealed that the frequency of TERT alterations increased from benign (18%) to borderline (57%) and to malignant PTs (68%; p < 0.01), and TERT alterations were associated with increased levels of TERT mRNA (p < 0.001). No TERT alterations were observed in fibroadenomas. An analysis of TERT promoter sequencing and gene amplification distinguished PTs from fibroadenomas with a sensitivity and a positive predictive value of 100% (CI 95.38-100%) and 100% (CI 85.86-100%), respectively, and a sensitivity and a negative predictive value of 39% (CI 28.65-51.36%) and 68% (CI 60.21-75.78%), respectively. Our results suggest that TERT alterations may drive the progression of PTs, and may assist in the differential diagnosis

  13. Mapping the transcription start points of the Staphylococcus aureus eap, emp, and vwb promoters reveals a conserved octanucleotide sequence that is essential for expression of these genes.


    Harraghy, Niamh; Homerova, Dagmar; Herrmann, Mathias; Kormanec, Jan


    Mapping the transcription start points of the eap, emp, and vwb promoters revealed a conserved octanucleotide sequence (COS). Deleting this sequence abolished the expression of eap, emp, and vwb. However, electrophoretic mobility shift assays gave no evidence that this sequence was a binding site for SarA or SaeR, known regulators of eap and emp.

  14. Intergenic sequence between Arabidopsis caseinolytic protease B-cytoplasmic/heat shock protein100 and choline kinase genes functions as a heat-inducible bidirectional promoter.


    Mishra, Ratnesh Chandra; Grover, Anil


    In Arabidopsis (Arabidopsis thaliana), the At1g74310 locus encodes for caseinolytic protease B-cytoplasmic (ClpB-C)/heat shock protein100 protein (AtClpB-C), which is critical for the acquisition of thermotolerance, and At1g74320 encodes for choline kinase (AtCK2) that catalyzes the first reaction in the Kennedy pathway for phosphatidylcholine biosynthesis. Previous work has established that the knockout mutants of these genes display heat-sensitive phenotypes. While analyzing the AtClpB-C promoter and upstream genomic regions in this study, we noted that AtClpB-C and AtCK2 genes are head-to-head oriented on chromosome 1 of the Arabidopsis genome. Expression analysis showed that transcripts of these genes are rapidly induced in response to heat stress treatment. In stably transformed Arabidopsis plants harboring this intergenic sequence between head-to-head oriented green fluorescent protein and β-glucuronidase reporter genes, both transcripts and proteins of the two reporters were up-regulated upon heat stress. Four heat shock elements were noted in the intergenic region by in silico analysis. In the homozygous transfer DNA insertion mutant Salk_014505, 4,393-bp transfer DNA is inserted at position -517 upstream of ATG of the AtClpB-C gene. As a result, AtCk2 loses proximity to three of the four heat shock elements in the mutant line. Heat-inducible expression of the AtCK2 transcript was completely lost, whereas the expression of AtClpB-C was not affected in the mutant plants. Our results suggest that the 1,329-bp intergenic fragment functions as a heat-inducible bidirectional promoter and the region governing the heat inducibility is possibly shared between the two genes. We propose a model in which AtClpB-C shares its regulatory region with heat-induced choline kinase, which has a possible role in heat signaling.

  15. Sequences of the 5' portion of the human c-sis gene: characterization of the transcriptional promoter and regulation of expression of the protein product by 5' untranslated mRNA sequences.

    PubMed Central

    Ratner, L; Thielan, B; Collins, T


    The c-sis gene encodes the B polypeptide chain of platelet-derived growth factor (PDGF), and is expressed in a number of normal and pathological conditions. In order to study the control of synthesis of the human c-sis product, we have initiated a study of two regions of this genetic locus which regulate transcription and translation. A clone of the 5' portion of the gene was obtained which included 1361 nucleotides upstream of the RNA initiation site. Transcriptional promoter activity of this region was demonstrated in normal and transformed cells using a plasmid with the sequences upstream of the c-sis RNA initiation site fused to an indicator gene, chloramphenicol acetyl transferase. Experiments were also performed to identify other possible regulatory regions of the c-sis gene. These data demonstrated that a portion of the c-sis first exon encoding the 5' untranslated region of the c-sis mRNA inhibited synthesis of the PDGF B product in vitro. These results define regions of the c-sis gene whose activity may be important in the regulation of transcription and translation under normal conditions and in the pathogenesis several human diseases. Images PMID:3627977

  16. Prediction of fine-tuned promoter activity from DNA sequence

    PubMed Central

    Siwo, Geoffrey; Rider, Andrew; Tan, Asako; Pinapati, Richard; Emrich, Scott; Chawla, Nitesh; Ferdig, Michael


    The quantitative prediction of transcriptional activity of genes using promoter sequence is fundamental to the engineering of biological systems for industrial purposes and understanding the natural variation in gene expression. To catalyze the development of new algorithms for this purpose, the Dialogue on Reverse Engineering Assessment and Methods (DREAM) organized a community challenge seeking predictive models of promoter activity given normalized promoter activity data for 90 ribosomal protein promoters driving expression of a fluorescent reporter gene. By developing an unbiased modeling approach that performs an iterative search for predictive DNA sequence features using the frequencies of various k-mers, inferred DNA mechanical properties and spatial positions of promoter sequences, we achieved the best performer status in this challenge. The specific predictive features used in the model included the frequency of the nucleotide G, the length of polymeric tracts of T and TA, the frequencies of 6 distinct trinucleotides and 12 tetranucleotides, and the predicted protein deformability of the DNA sequence. Our method accurately predicted the activity of 20 natural variants of ribosomal protein promoters (Spearman correlation r = 0.73) as compared to 33 laboratory-mutated variants of the promoters (r = 0.57) in a test set that was hidden from participants. Notably, our model differed substantially from the rest in 2 main ways: i) it did not explicitly utilize transcription factor binding information implying that subtle DNA sequence features are highly associated with gene expression, and ii) it was entirely based on features extracted exclusively from the 100 bp region upstream from the translational start site demonstrating that this region encodes much of the overall promoter activity. The findings from this study have important implications for the engineering of predictable gene expression systems and the evolution of gene expression in naturally occurring

  17. Prediction of fine-tuned promoter activity from DNA sequence.


    Siwo, Geoffrey; Rider, Andrew; Tan, Asako; Pinapati, Richard; Emrich, Scott; Chawla, Nitesh; Ferdig, Michael


    The quantitative prediction of transcriptional activity of genes using promoter sequence is fundamental to the engineering of biological systems for industrial purposes and understanding the natural variation in gene expression. To catalyze the development of new algorithms for this purpose, the Dialogue on Reverse Engineering Assessment and Methods (DREAM) organized a community challenge seeking predictive models of promoter activity given normalized promoter activity data for 90 ribosomal protein promoters driving expression of a fluorescent reporter gene. By developing an unbiased modeling approach that performs an iterative search for predictive DNA sequence features using the frequencies of various k-mers, inferred DNA mechanical properties and spatial positions of promoter sequences, we achieved the best performer status in this challenge. The specific predictive features used in the model included the frequency of the nucleotide G, the length of polymeric tracts of T and TA, the frequencies of 6 distinct trinucleotides and 12 tetranucleotides, and the predicted protein deformability of the DNA sequence. Our method accurately predicted the activity of 20 natural variants of ribosomal protein promoters (Spearman correlation r = 0.73) as compared to 33 laboratory-mutated variants of the promoters (r = 0.57) in a test set that was hidden from participants. Notably, our model differed substantially from the rest in 2 main ways: i) it did not explicitly utilize transcription factor binding information implying that subtle DNA sequence features are highly associated with gene expression, and ii) it was entirely based on features extracted exclusively from the 100 bp region upstream from the translational start site demonstrating that this region encodes much of the overall promoter activity. The findings from this study have important implications for the engineering of predictable gene expression systems and the evolution of gene expression in naturally occurring

  18. Contribution for new genetic markers of rheumatoid arthritis activity and severity: sequencing of the tumor necrosis factor-alpha gene promoter

    PubMed Central

    Fonseca, João Eurico; Cavaleiro, João; Teles, José; Sousa, Elsa; Andreozzi, Valeska L; Antunes, Marília; Amaral-Turkman, Maria A; Canhão, Helena; Mourão, Ana F; Lopes, Joana; Caetano-Lopes, Joana; Weinmann, Pamela; Sobral, Marta; Nero, Patrícia; Saavedra, Maria J; Malcata, Armando; Cruz, Margarida; Melo, Rui; Braña, Araceli; Miranda, Luis; Patto, José V; Barcelos, Anabela; da Silva, José Canas; Santos, Luís M; Figueiredo, Guilherme; Rodrigues, Mário; Jesus, Herberto; Quintal, Alberto; Carvalho, Teresa; da Silva, José A Pereira; Branco, Jaime; Queiroz, Mário Viana


    The objective of this study was to assess whether clinical measures of rheumatoid arthritis activity and severity were influenced by tumor necrosis factor-alpha (TNF-α) promoter genotype/haplotype markers. Each patient's disease activity was assessed by the disease activity score using 28 joint counts (DAS28) and functional capacity by the Health Assessment Questionnaire (HAQ) score. Systemic manifestations, radiological damage evaluated by the Sharp/van der Heijde (SvdH) score, disease-modifying anti-rheumatic drug use, joint surgeries, and work disability were also assessed. The promoter region of the TNF-α gene, between nucleotides -1,318 and +49, was sequenced using an automated platform. Five hundred fifty-four patients were evaluated and genotyped for 10 single-nucleotide polymorphism (SNP) markers, but 5 of these markers were excluded due to failure to fall within Hardy-Weinberg equilibrium or to monomorphism. Patients with more than 10 years of disease duration (DD) presented significant associations between the -857 SNP and systemic manifestations, as well as joint surgeries. Associations were also found between the -308 SNP and work disability in patients with more than 2 years of DD and radiological damage in patients with less than 10 years of DD. A borderline effect was found between the -238 SNP and HAQ score and radiological damage in patients with 2 to 10 years of DD. An association was also found between haplotypes and the SvdH score for those with more than 10 years of DD. An association was found between some TNF-α promoter SNPs and systemic manifestations, radiological progression, HAQ score, work disability, and joint surgeries, particularly in some classes of DD and between haplotypes and radiological progression for those with more than 10 years of DD. PMID:17408492

  19. The human {alpha}2(XI) collagen gene (COL11A2): Completion of coding information, identification of the promoter sequence, and precise localization within the major histocompatibility complex reveal overlap with the KE5 gene

    SciTech Connect

    Lui, V.C.H.; Ng, Ling Jim; Sat, E.W.Y.; Cheah, K.S.E.


    Type XI collagen, a fibril-forming collagen, is important for the integrity and development of the skeleton because mutations in the genes encoding its consituent {alpha} chains have been found in some osteochondrodysplasias. We provide data that complete information for the coding sequence of human {alpha}2(XI) procollagen, with details of the promoter region and intron-exon organization at the 5{prime} and 3{prime} ends of the gene (COL11A2), including the transcription start and polyadenylation sites. COL11A2 is 30.5 kb with a minimum of 62 exons, differing from other reported fibrillar collagen genes because the amino propeptide is encoded by 14 not 5 to 8 exons. But exon numbers for the carboxy propeptide and 3{prime}-untranslated region are conserved. The promoter region of COL11A2 lacks a TATA box but is GC-rich with two potential SP1 binding sites. Mouse {alpha}2(XI) collagen mRNAs undergo complex alternative splicing involving three amino-terminal propeptide exons but only one of these has been reported for COL11A2. We have located these missing human exons and have identified splice signals that point to additional splice variants. We have precisely mapped COL11A2 within the major histocompatibility complex on chromosome 6. The retinoid X receptor {beta} (RXR{beta}) gene is located 1.1 kb upstream of COL11A2. KE5, previously thought to be a distinct transcribed gene sequence, was mapped within COL11A2 in the alternatively spliced region, raising the question whether KE5 and COL11A2 are separate genes. 37 refs., 7 figs., 1 tab.

  20. Sequence polymorphism in the HLA-B promoter region

    SciTech Connect

    Yao, Z.; Volgger, A.; Scholz, S.


    Transcription of major histocompatibility complex class I genes is controlled by the class I regulatory complex in the 5{prime} flanked region. To investigate the molecular basis of this region, we studied the polymorphism of the promoter of the HLA-B locus extending from the ATG transcription initiation signal to -284 base pairs (bp) which includes a number of cis-acting elements: interferon response sequence (IRS), enhancer A and enhancer B. Genomic DNA from 35 homozygous cell lines from the 10th International Histocompatibility Workshop and from eight heterozygous panel members was amplified using two primers designed to specifically amplify the HLA-B locus. The double-stranded polymerase chain reaction products were sequenced using the cycle sequencing technique and an ABI 373A automatic sequencer. Promoter sequences of thirty-one different HLA-B alleles were determined in this study. Within the 284 bp upstream of the ATG signal, base substitutions were observed in 23 different nucleotide positions. Our study shows a high degree of polymorphism of the HLA-B promoter region, but conserved sequences of the known cis-acting elements with the exception of enhancer B in which there are two base substitutions for B7 and B42 (position -93 and position -95). The 23 polymorphic sites can be grouped into 12 different HLA-B promoter types (groups A to M) for 31 HLA-B locus alleles. Some of the groups of alleles sharing the same promoter sequence such as, for example, group A with B51, B52, B53, and B35, might have been predicted on the basis of serological similarity and/or exon 2,3 sequence. In other groups, such as G (B18, B37, B27), it could not have been anticipated from serological experience that B18 and B27 carry the same promoter. Several sequencing errors were detected in the HLA-B promoter sequences published previously. 32 refs., 4 tabs.

  1. Promoter Analyses of CCN Genes.


    Eguchi, Takanori; Kubota, Satoshi; Takigawa, Masaharu


    Promoter analysis is the most basics in the analysis of gene regulation. Luciferase gene is the most commonly used reporter gene in promoter analysis. Luciferase is an enzyme that is used when firefly and Renilla reniformis (sea pansy) emit light. The first experimental step in this reporter gene assay is to connect a particular DNA segment to a luciferase gene. The second step is to transfect the reporter construct into the cells. Thereafter, stable luciferase will be produced with the help of transcriptional machinery, mRNA transporters, and translational machinery in the cells. Luciferase assay measures the quantity of light that is emitted by luciferin-luciferase reaction. Consistent with the fact that CCN2 expression has been shown to be altered by a variety of stimuli, the CCN2 promoter region also haa been shown to be bound and regulated by multiple transcription factors such as Smad, MMP3, NF-κB, AP1, TCF/LEF, and Sox9.

  2. Human ethanol-inducible P450IIE1: complete gene sequence, promoter characterization, chromosome mapping, and cDNA-directed expression

    SciTech Connect

    Umeno, M.; McBride, W.; Yang, C.S.; Gelboin, H.V.; Gonzalez, F.J.


    The human P450IIE1 gene, coding for an ethanol-inducible nitrosamine-metabolizing P-450, was isolated from a lambdaEMBL3 genomic library and completely sequenced. The human gene spanned 11413 base pairs and contained nine exons and a typical TATA box. Upstream and downstream DNAs of 2788 and 559 base pairs were also sequenced and compared to the rat gene. Significant areas of sequence similarity were observed within 140 base pairs upstream of the transcription start site in the rat and human genes. Human DNA 539 base pairs upstream of the transcription start site was inserted into the expression vector', and luciferase activity was detected when the constructs were introduced into a rat hepatoma cell line. The activity was over 100-fold lower than that of pRSVL, a Rous sarcoma virus LTR-driven luciferase gene. By use of panel of rodent-human cell hybrids, the gene was mapped to chromosome 10 (CYP2E locus). A full-length cDNA, constructed with the first exon of the genomic clone and a partial cDNA clone, was expressed in COS cells and found to code for N-nitrosodimethylamine demethylase activity.

  3. Multi-locus sequence typing of Escherichia coli isolates with acquired ampC genes and ampC promoter mutations.


    Lewis, Jonathan A; Moore, Philippa C L; Arnold, Dawn L; Lawrance, Lynne M


    Multi-locus sequence typing was used to reveal a high degree of diversity amongst the E. coli isolates with AmpC plasmid genes, and a high prevalence of the -32 mutation present. Copyright © 2016 Elsevier Inc. All rights reserved.

  4. A conserved noncoding sequence can function as a spermatocyte-specific enhancer and a bidirectional promoter for a ubiquitously expressed gene and a testis-specific long noncoding RNA.


    Kurihara, Misuzu; Shiraishi, Akira; Satake, Honoo; Kimura, Atsushi P


    Tissue-specific gene expression is tightly regulated by various elements such as promoters, enhancers, and long noncoding RNAs (lncRNAs). In the present study, we identified a conserved noncoding sequence (CNS1) as a novel enhancer for the spermatocyte-specific mouse testicular cell adhesion molecule 1 (Tcam1) gene. CNS1 was located 3.4kb upstream of the Tcam1 gene and associated with histone H3K4 mono-methylation in testicular germ cells. By the in vitro reporter gene assay, CNS1 could enhance Tcam1 promoter activity only in GC-2spd(ts) cells, which were derived from mouse spermatocytes. When we integrated the 6.9-kb 5'-flanking sequence of Tcam1 with or without a deletion of CNS1 linked to the enhanced green fluorescent protein gene into the chromatin of GC-2spd(ts) cells, CNS1 significantly enhanced Tcam1 promoter activity. These results indicate that CNS1 could function as a spermatocyte-specific enhancer. Interestingly, CNS1 also showed high bidirectional promoter activity in the reporter assay, and consistent with this, the Smarcd2 gene and lncRNA, designated lncRNA-Tcam1, were transcribed from adjacent regions of CNS1. While Smarcd2 was ubiquitously expressed, lncRNA-Tcam1 expression was restricted to testicular germ cells, although this lncRNA did not participate in Tcam1 activation. Ubiquitous Smarcd2 expression was correlated to CpG hypo-methylation of CNS1 and partially controlled by Sp1. However, for lncRNA-Tcam1 transcription, the strong association with histone acetylation and histone H3K4 tri-methylation also appeared to be required. The present data suggest that CNS1 is a spermatocyte-specific enhancer for the Tcam1 gene and a bidirectional promoter of Smarcd2 and lncRNA-Tcam1. Copyright © 2014 Elsevier Ltd. All rights reserved.

  5. Polymorphism in regulatory gene sequences

    PubMed Central

    Mitchison, N A


    The extensive polymorphism revealed in non-coding gene-regulatory sequences, particularly in the immune system, suggests that this type of genetic variation is functionally and evolutionarily far more important than has been suspected, and provides a lead to new therapeutic strategies. PMID:11178274

  6. Cloning and sequence analysis of myostatin promoter in sheep.


    Du, Rong; Chen, Yong-Fu; An, Xiao-Rong; Yang, Xing-Yuan; Ma, Yi; Zhang, Lei; Yuan, Xiao-Li; Chen, Li-Mei; Qin, Jian


    To better understand the structure and function of the myostatin's gene promoter region in sheep, we cloned and sequenced a 1.517 kb fragment containing the 5'-regulatory region of the sheep myostatin gene (GenBank accession number is AY918121). The promoter sequence consists of three TATA boxes, one CAAT box, and eight putative E-boxes. Some putative muscle growth response elements for Octamer-binding factor 1(Octamer), Activator protein 1(AP1), Growth factor independence 1 zinc finger protein (Gfi-1B), Myocyte enhancer factor 2 (MEF2), Muscle-specific Mt binding site (MTBF), Glucocorticoid response elements (GRE) and Progesterone receptor binding site (PRE) were detected. Some of the motifs are conserved as compared to with that in the goat, bovine and porcine myostatin promoters. However, some differences were also found.

  7. Activation of the major immediate early gene of human cytomegalovirus by cis-acting elements in the promoter-regulatory sequence and by virus-specific trans-acting components.

    PubMed Central

    Stinski, M F; Roehr, T J


    Upstream of the major immediate early gene of human cytomegalovirus (Towne) is a strong promoter-regulatory region that promotes the synthesis of 1.95-kilobase mRNA (D. R. Thomsen, R. M. Stenberg, W. F. Goins, and M. F. Stinski, Proc. Natl. Acad. Sci. U.S.A. 81:659-663, 1984; M. F. Stinski, D. R. Thomsen, R. M. Stenberg, and L. C. Goldstein, J. Virol. 46:1-14, 1983). The wild-type promoter-regulatory region as well as deletions within this region were ligated upstream of the thymidine kinase, chloramphenicol acetyltransferase, or ovalbumin genes. These gene chimeras were constructed to investigate the role of the regulatory sequences in enhancing downstream expression. The regulatory region extends to approximately 465 nucleotides upstream of the cap site for the initiation of transcription. The extent and type of regulatory sequences upstream of the promoter influences the level of in vitro transcription as well as the amount of in vivo expression of the downstream gene. The regulatory elements for cis-activation appear to be repeated several times within the regulatory region. A direct correlation was established between the distribution of the 19 (5' CCCCAGTTGACGTCAATGGG 3')- and 18 (5' CACTAACGGGACTTTCCAA 3')-nucleotide repeats and the level of downstream expression. In contrast, the 16 (5' CTTGGCAGTACATCAA 3')-nucleotide repeat is not necessary for the enhancement of downstream expression. In a domain associated with the 19- or 18-nucleotide repeats are elements that can be activated in trans by a human cytomegalovirus-specified component but not a herpes simplex virus-specified component. Therefore, the regulatory sequences of the major immediate early gene of human cytomegalovirus have an important role in interacting with cellular and virus-specific factors of the transcription complex to enhance downstream expression of this critical viral gene. Images PMID:2991567

  8. Pertussis toxin promoter sequences involved in modulation.

    PubMed Central

    Gross, R; Rappuoli, R


    Previous analysis of the pertussis toxin (PT) promoter has shown that expression of PT requires a trans-activating factor encoded by the vir locus and a 170-base-pair DNA sequence upstream from the transcription start site containing a 21-base-pair direct repeat sequence crucial trans-activation (R. Gross and R. Rappuoli, Proc. Natl. Acad. Sci. USA 85:3913-3917, 1988). In this paper we extend the analysis to the modulative response to environmental stimuli. We show that modulation acts at the transcriptional level and occurs only in phase I bacteria. Modulation also requires a functional vir locus and the same promoter region of 170 base pairs. We show that, in addition to the previously identified direct repeat, even the sequences downstream from position -117 are required for trans-activation and modulation and that the deletion of four cytosine residues at position -31 causes the inactivation of the promoter. The kinetics of the change in transcription show that the PT promoter can be shut off very rapidly by adding 50 mM MgSO4 to the medium, whereas resumption of transcription after removal of the modulative agents from the medium is slow. Images PMID:2544567

  9. Effective Feature Selection for Classification of Promoter Sequences

    PubMed Central

    K., Kouser; P. G., Lavanya; Rangarajan, Lalitha; K., Acharya Kshitish


    Exploring novel computational methods in making sense of biological data has not only been a necessity, but also productive. A part of this trend is the search for more efficient in silico methods/tools for analysis of promoters, which are parts of DNA sequences that are involved in regulation of expression of genes into other functional molecules. Promoter regions vary greatly in their function based on the sequence of nucleotides and the arrangement of protein-binding short-regions called motifs. In fact, the regulatory nature of the promoters seems to be largely driven by the selective presence and/or the arrangement of these motifs. Here, we explore computational classification of promoter sequences based on the pattern of motif distributions, as such classification can pave a new way of functional analysis of promoters and to discover the functionally crucial motifs. We make use of Position Specific Motif Matrix (PSMM) features for exploring the possibility of accurately classifying promoter sequences using some of the popular classification techniques. The classification results on the complete feature set are low, perhaps due to the huge number of features. We propose two ways of reducing features. Our test results show improvement in the classification output after the reduction of features. The results also show that decision trees outperform SVM (Support Vector Machine), KNN (K Nearest Neighbor) and ensemble classifier LibD3C, particularly with reduced features. The proposed feature selection methods outperform some of the popular feature transformation methods such as PCA and SVD. Also, the methods proposed are as accurate as MRMR (feature selection method) but much faster than MRMR. Such methods could be useful to categorize new promoters and explore regulatory mechanisms of gene expressions in complex eukaryotic species. PMID:27978541

  10. Effective Feature Selection for Classification of Promoter Sequences.


    K, Kouser; P G, Lavanya; Rangarajan, Lalitha; K, Acharya Kshitish


    Exploring novel computational methods in making sense of biological data has not only been a necessity, but also productive. A part of this trend is the search for more efficient in silico methods/tools for analysis of promoters, which are parts of DNA sequences that are involved in regulation of expression of genes into other functional molecules. Promoter regions vary greatly in their function based on the sequence of nucleotides and the arrangement of protein-binding short-regions called motifs. In fact, the regulatory nature of the promoters seems to be largely driven by the selective presence and/or the arrangement of these motifs. Here, we explore computational classification of promoter sequences based on the pattern of motif distributions, as such classification can pave a new way of functional analysis of promoters and to discover the functionally crucial motifs. We make use of Position Specific Motif Matrix (PSMM) features for exploring the possibility of accurately classifying promoter sequences using some of the popular classification techniques. The classification results on the complete feature set are low, perhaps due to the huge number of features. We propose two ways of reducing features. Our test results show improvement in the classification output after the reduction of features. The results also show that decision trees outperform SVM (Support Vector Machine), KNN (K Nearest Neighbor) and ensemble classifier LibD3C, particularly with reduced features. The proposed feature selection methods outperform some of the popular feature transformation methods such as PCA and SVD. Also, the methods proposed are as accurate as MRMR (feature selection method) but much faster than MRMR. Such methods could be useful to categorize new promoters and explore regulatory mechanisms of gene expressions in complex eukaryotic species.

  11. Functional analysis of bipartite begomovirus coat protein promoter sequences

    SciTech Connect

    Lacatus, Gabriela; Sunter, Garry


    We demonstrate that the AL2 gene of Cabbage leaf curl virus (CaLCuV) activates the CP promoter in mesophyll and acts to derepress the promoter in vascular tissue, similar to that observed for Tomato golden mosaic virus (TGMV). Binding studies indicate that sequences mediating repression and activation of the TGMV and CaLCuV CP promoter specifically bind different nuclear factors common to Nicotiana benthamiana, spinach and tomato. However, chromatin immunoprecipitation demonstrates that TGMV AL2 can interact with both sequences independently. Binding of nuclear protein(s) from different crop species to viral sequences conserved in both bipartite and monopartite begomoviruses, including TGMV, CaLCuV, Pepper golden mosaic virus and Tomato yellow leaf curl virus suggests that bipartite begomoviruses bind common host factors to regulate the CP promoter. This is consistent with a model in which AL2 interacts with different components of the cellular transcription machinery that bind viral sequences important for repression and activation of begomovirus CP promoters.

  12. Yeast DNA sequences initiating gene expression in Escherichia coli.


    Lewin, Astrid; Tran, Thi Tuyen; Jacob, Daniela; Mayer, Martin; Freytag, Barbara; Appel, Bernd


    DNA transfer between pro- and eukaryotes occurs either during natural horizontal gene transfer or as a result of the employment of gene technology. We analysed the capacity of DNA sequences from a eukaryotic donor organism (Saccharomyces cerevisiae) to serve as promoter region in a prokaryotic recipient (Escherichia coli) by creating fusions between promoterless luxAB genes from Vibrio harveyi and random DNA sequences from S. cerevisiae and measuring the luminescence of transformed E. coli. Fifty-four out of 100 randomly analysed S. cerevisiae DNA sequences caused considerable gene expression in E. coli. Determination of transcription start sites within six selected yeast sequences in E. coli confirmed the existence of bacterial -10 and -35 consensus sequences at appropriate distances upstream from transcription initiation sites. Our results demonstrate that the probability of transcription of transferred eukaryotic DNA in bacteria is extremely high and does not require the insertion of the transferred DNA behind a promoter of the recipient genome.

  13. Sequencing and functional analysis of the SNRPN promoter: in vitro methylation abolishes promoter activity.


    Huq, A H; Sutcliffe, J S; Nakao, M; Shen, Y; Gibbs, R A; Beaudet, A L


    The gene encoding the small nuclear ribonucleoprotein-associated polypeptide N (SNRPN) maps to the Prader-Willi syndrome critical region on chromosome 15 and is expressed preferentially from the paternal allele. A CpG island encompassing the first exon of SNRPN is methylated on the inactive maternal allele. DNA sequence was determined for a cosmid containing the first three exons of SNRPN and extending 20 kb upstream and 15 kb downstream from the CpG island. This region is extremely rich in Alu elements and other repetitive sequences and contains a single CpG island, which includes numerous short direct repeat sequences. Functional analysis of the first exon revealed strong promoter activity for a 260-bp fragment extending 207 bp upstream from the exon. In vitro methylation of this 260-bp fragment abolished promoter activity completely, suggesting that the silencing of the maternal SNRPN allele may be a direct consequence of methylation of the promoter region.

  14. Interaction of two sequence-specific single-stranded DNA-binding proteins with an essential region of the beta-casein gene promoter is regulated by lactogenic hormones.

    PubMed Central

    Altiok, S; Groner, B


    Transcription of the beta-casein gene in mammary epithelial cells is regulated by the lactogenic hormones insulin, glucocorticoids, and prolactin. The DNA sequence elements in the promoter which confer the action of the hormones on the transcriptional machinery and the nuclear proteins binding to this region have been investigated. We found that 221 nucleotides of promoter sequence 5' of the RNA start site are sufficient to mediate the induction of a chloramphenicol acetyltransferase reporter gene in transfected HC11 mammary epithelial cells. Deletion of 5' sequences to position -183 results in a construct with enhanced basal activity which still retains inducibility. A -170 beta-casein promoter-chloramphenicol acetyltransferase construct has very low transcriptional activity, which indicates the presence of a negative regulatory in the region between -221 and -183 and a positive regulatory element between -183 and -170. Band shift analysis showed that the promoter region between -194 and -163 specifically binds two nuclear proteins. The proteins are sequence-specific, single-stranded DNA-binding proteins which exclusively recognize the upper DNA strand and most likely play a repressing role in transcription. DNA binding activity of these nuclear proteins was observed only in nuclear extracts from mammary glands of mice in late pregnancy and postlactation, not during lactation. Hormonal control of the DNA binding activity of these proteins was also observed in the mammary epithelial cell line HC11. Mixing experiments showed that extracts from mammary tissue of lactating mice and from lactogenic hormone-treated HC11 cells contain an activity which can suppress the DNA binding of the single-stranded DNA-binding proteins.2+ identical specificity to the single-stranded DNA. Images PMID:8246951

  15. Identification of regulatory sequence elements within the transcription promoter region of NpABC1, a gene encoding a plant ABC transporter induced by diterpenes.


    Grec, Sébastien; Vanham, Delphine; de Ribaucourt, Jeoffrey Christyn; Purnelle, Bénédicte; Boutry, Marc


    Expression of NpABC1, a gene encoding a plasma membrane ATP binding cassette (ABC) transporter in Nicotiana plumbaginifolia, is induced by sclareol, an antifungal diterpene produced at the leaf surface, as well as by sclareolide, a close analog. A genomic fragment including the 1282-bp region upstream of the NpABC1 transcription start was fused to the reporter beta-glucuronidase (gus) gene and introduced into N. tabacum BY2 cells for stable transformation. A 25-fold increase in gus expression was observed when cells were treated with sclareolide and some other terpenes. The combined use of 5'-deletion promoter analysis, gel mobility shift assays, DNase I footprinting, and site-directed mutagenesis allowed us to identify three cis-elements (sclareol box 1 (SB1), SB2, and SB3) located, respectively, within nucleotides -827 to -802, -278 to -243, and -216 to -190 upstream of the NpABC1 transcription start. In vivo evaluation of these elements on sclareolide-induced expression showed that mutation of SB1 reduced expression by twofold, while that of SB2 had no effect. On the other hand, SB3 had a marked effect as it completely abolished sclareolide-mediated expression. NpABC1-gus expression was not induced by the stress signals, salicylic acid and ethylene, but was mediated, to some extent, by methyl jasmonate, which is known to promote diterpene synthesis.

  16. Sequence-specific binding of protein factors to two independent promoter regions of the acidic tobacco pathogenesis-related-1 protein gene (PR-1).


    Hagiwara, H; Matsuoka, M; Ohshima, M; Watanabe, M; Hosokawa, D; Ohashi, Y


    Gel shift mobility analysis, using the proximal 0.3 kb fragment of the tobacco pathogenesis-related protein 1a gene (PR-1a) and nuclear extracts from healthy Samsun NN tobacco leaves, which do not produce PR-1 proteins, showed a broad shifted signal with low mobility. This signal was not detected with nuclear proteins from the interspecific hybrid of Nicotiana glutinosa x Nicotiana debneyi, which constitutively produces the PR-1a protein. Similar shifted signals were detected with both proximal and distal regions of the 0.3 kb fragment using nuclear proteins from healthy Samsun NN tobacco, but not with proteins from the interspecific hybrid. Further experiments, performed using 5' or 3' truncated fragments of the 0.3 kb fragment, identified two independent binding sites: a distal site between -179 and -168 bp from the transcription start site, and a proximal site between -61 and -37 bp. Footprint analysis revealed two protected sequences, a distal region between -184 and -172 bp, and a proximal region between -68 and -51 bp. These results indicate the presence of regulatory factor(s) for expression of the acidic PR-1a gene. The possibility of negative regulation of the gene is discussed.

  17. Updated Sequence Information for TEM β-Lactamase Genes

    PubMed Central

    Goussard, Sylvie; Courvalin, Patrice


    The sequences of the promoter regions and of the structural genes for 13 penicillinase, extended-spectrum, and inhibitor-resistant TEM-type β-lactamases have been determined, and an updated blaTEM gene nomenclature is proposed. PMID:9925535

  18. Repetitive sequence environment distinguishes housekeeping genes

    PubMed Central

    Eller, C. Daniel; Regelson, Moira; Merriman, Barry; Nelson, Stan; Horvath, Steve; Marahrens, York


    Housekeeping genes are expressed across a wide variety of tissues. Since repetitive sequences have been reported to influence the expression of individual genes, we employed a novel approach to determine whether housekeeping genes can be distinguished from tissue-specific genes their repetitive sequence context. We show that Alu elements are more highly concentrated around housekeeping genes while various longer (>400-bp) repetitive sequences ("repeats"), including Long Interspersed Nuclear Element 1 (LINE-1) elements, are excluded from these regions. We further show that isochore membership does not distinguish housekeeping genes from tissue-specific genes and that repetitive sequence environment distinguishes housekeeping genes from tissue-specific genes in every isochore. The distinct repetitive sequence environment, in combination with other previously published sequence properties of housekeeping genes, were used to develop a method of predicting housekeeping genes on the basis of DNA sequence alone. Using expression across tissue types as a measure of success, we demonstrate that repetitive sequence environment is by far the most important sequence feature identified to date for distinguishing housekeeping genes. PMID:17141428

  19. Repetitive Sequence Variations in the Promoter Region of the Adhesin-Encoding Gene sabA of Helicobacter pylori Affect Transcription

    PubMed Central

    Harvey, Vivian C.; Acio, Catherine R.; Bredehoft, Amy K.; Zhu, Laurence; Hallinger, Daniel R.; Quinlivan-Repasi, Vanessa; Harvey, Samuel E.


    The pathogenesis of diseases elicited by the gastric pathogen Helicobacter pylori is partially determined by the effectiveness of adaptation to the variably acidic environment of the host stomach. Adaptation includes appropriate adherence to the gastric epithelium via outer membrane protein adhesins such as SabA. The expression of sabA is subject to regulation via phase variation in the promoter and coding regions as well as repression by the two-component system ArsRS. In this study, we investigated the role of a homopolymeric thymine [poly(T)] tract −50 to −33 relative to the sabA transcriptional start site in H. pylori strain J99. We quantified sabA expression in H. pylori J99 by quantitative reverse transcription-PCR (RT-PCR), demonstrating significant changes in sabA expression associated with experimental manipulations of poly(T) tract length. Mimicking the length increase of this tract by adding adenines instead of thymines had similar effects, while the addition of other nucleotides failed to affect sabA expression in the same manner. We hypothesize that modification of the poly(T) tract changes DNA topology, affecting regulatory protein interaction(s) or RNA polymerase binding efficiency. Additionally, we characterized the interaction between the sabA promoter region and ArsR, a response regulator affecting sabA expression. Using recombinant ArsR in electrophoretic mobility shift assays (EMSA), we localized binding to a sequence with partial dyad symmetry −20 and +38 relative to the sabA +1 site. The control of sabA expression by both ArsRS and phase variation at two distinct repeat regions suggests the control of sabA expression is both complex and vital to H. pylori infection. PMID:25022855

  20. Genome Sequence of the Banana Plant Growth-Promoting Rhizobacterium Bacillus amyloliquefaciens BS006

    PubMed Central

    Gamez, Rocío M.; Rodríguez, Fernando; Bernal, Johan F.; Agarwala, Richa; Landsman, David


    Bacillus amyloliquefaciens is an important plant growth-promoting rhizobacterium (PGPR). We report the first whole-genome sequence of PGPR Bacillus amyloliquefaciens evaluated in Colombian banana plants. The genome sequences encode genes involved in plant growth and defense, including bacteriocins, ribosomally synthesized antibacterial peptides, in addition to genes that provide resistance to toxic compounds. PMID:26607897

  1. Genome Sequence of the Banana Plant Growth-Promoting Rhizobacterium Pseudomonas fluorescens PS006

    PubMed Central

    Gamez, Rocío M.; Rodríguez, Fernando; Ramírez, Sandra; Gómez, Yolanda; Agarwala, Richa; Landsman, David


    Pseudomonas fluorescens is a well-known plant growth-promoting rhizobacterium (PGPR). We report here the first whole-genome sequence of PGPR P. fluorescens evaluated in Colombian banana plants. The genome sequences contains genes involved in plant growth and defense, including bacteriocins, 1-aminocyclopropane-1-carboxylic acid (ACC) deaminase, and genes that provide resistance to toxic compounds. PMID:27151797

  2. Core promoter sequence in yeast is a major determinant of expression level

    PubMed Central

    Lubliner, Shai; Regev, Ifat; Lotan-Pompan, Maya; Edelheit, Sarit; Weinberger, Adina; Segal, Eran


    The core promoter is the regulatory sequence to which RNA polymerase is recruited and where it acts to initiate transcription. Here, we present the first comprehensive study of yeast core promoters, providing massively parallel measurements of core promoter activity and of TSS locations and relative usage for thousands of native and designed sequences. We found core promoter activity to be highly correlated to the activity of the entire promoter and that sequence variation in different core promoter regions substantially tunes its activity in a predictable way. We also show that location, orientation, and flanking bases critically affect TATA element function, that transcription initiation in highly active core promoters is focused within a narrow region, that poly(dA:dT) orientation has a functional consequence at the 3′ end of promoters, and that orthologous core promoters across yeast species have conserved activities. Our results demonstrate the importance of core promoters in the quantitative study of gene regulation. PMID:25969468

  3. The BCL2 gene is regulated by a special AT-rich sequence binding protein 1-mediated long range chromosomal interaction between the promoter and the distal element located within the 3′-UTR

    PubMed Central

    Gong, Feiran; Sun, Luan; Wang, Zongdan; Shi, Junfeng; Li, Wei; Wang, Sumeng; Han, Xiao; Sun, Yujie


    The 279-bp major breakpoint region (mbr) within the 3′-untranslated region (3′-UTR) of the BCL2 gene is a binding site of special AT-rich sequence binding protein 1 (SATB1) that is well known to participate in the long-range regulation of gene transcription. Our previous studies have revealed that the mbr could regulate BCL2 transcription over a 200-kb distance and this regulatory function was closely related to SATB1. This study is to explore the underlying mechanism and its relevance to cellular apoptosis. With chromosome conformation capture (3C) and chromatin immunoprecipitation (ChIP) assays we demonstrated that the mbr could physically interact with BCL2 promoter through SATB1-mediated chromatin looping, which was required for epigenetic modifications of the promoter, CREB accessibility and high expression of the BCL2 gene. During early apoptosis, SATB1 was a key regulator of BCL2 expression. Inhibition of SATB1 cleavage by treatment of cells with a caspase-6 inhibitor or overexpression of mutant SATB1 that was resistant to caspase-6, inhibited disassembly of the SATB1-mediated chromatin loop and restored the BCL2 mRNA level in Jurkat cells. These data revealed a novel mechanism of BCL2 regulation and mechanistically link SATB1-mediated long-range interaction with the regulation of a gene controlling apoptosis pathway for the first time. PMID:21310710

  4. Characterization of human TCR Vbeta gene promoter. Role of the dodecamer motif in promoter activity.


    Deng, X; Sun, G R; Zheng, Q; Li, Y


    During T-lymphocyte development, the T-cell antigen receptor (TCR) gene expression is controlled by its promoter and enhancer elements and regulated in tissue- and development stage-specific manner. To uncover the promoter function and to define positive and negative regulatory elements in TCR gene promoters, the promoter activities from 13 human TCR Vbeta genes were determined by the transient transfection system and luciferase reporter assay. Although most of the TCR Vbeta gene promoters that we tested are inactive by themselves, some promoters were found to be constitutively strong. Among them, Vbeta6.7 is the strongest. 5'-Deletion and fragmentation experiments have narrowed the full promoter activity of Vbeta6.7 to a fragment of 147 base pairs immediately 5' to the transcription initiation site. A decanucleotide motif with the consensus sequence AGTGAYRTCA has been found to be conserved in most TCR Vbeta gene promoters. There are three such decamer motifs in the promoter region of Vbeta6.7, and the contribution of each such motif to the promoter activity has been examined. Further site-directed mutagenesis analyses showed that: 1) when two Ts in the decamer were mutated, the promoter activity was totally abolished; 2) when two additional nucleotides 3' to the end of decamer were mutated, the promoter activity was decreased to two-thirds of the full level; and 3) when the element with the sequence AGTGATGTCACT was inserted into other promoters, the original weak promoters become very strong. Taken together, our data suggest that the positive regulatory element in Vbeta6.7 should be considered a dodecamer rather than a decamer and that it confers strong basal transcriptional activity on TCR Vbeta genes.

  5. Cloning of penaeidin gene promoter in tiger shrimp (Penaeus monodon).


    Ho, Shih-Hu; Song, Yen-Ling


    Penaeidins belong to a family of antimicrobial peptides that are expressed in the hemocytes of penaeid shrimps. Using an extender PCR method and a nested PCR, we cloned two types of genomic fragment flanking the 5' end of penaeidin gene in tiger shrimp (Penaeus monodon): Type536 and Type411 sequences. Both fragments contained TATA box, GATA, dorsal and AP-1 motifs and were ligated to an expression vector with a luciferase reporter gene. The constructs were then delivered into Drosophila S2 cell line. The promoter functions of the two fragments were determined using a luciferase expression assay. The study demonstrated that Type411 sequence performed higher transcriptional activity than Type536. Alignment of the upstream sequences of penaeidin genes in P. monodon and Litopenaeus vannamei showed that the promoter regions were obviously more diverse than the 5'UTRs. Phylogenetic analysis indicated the presence of two types of promoters that are not species-specific in the two shrimps.

  6. Compilation and analysis of Escherichia coli promoter DNA sequences.

    PubMed Central

    Hawley, D K; McClure, W R


    The DNA sequence of 168 promoter regions (-50 to +10) for Escherichia coli RNA polymerase were compiled. The complete listing was divided into two groups depending upon whether or not the promoter had been defined by genetic (promoter mutations) or biochemical (5' end determination) criteria. A consensus promoter sequence based on homologies among 112 well-defined promoters was determined that was in substantial agreement with previous compilations. In addition, we have tabulated 98 promoter mutations. Nearly all of the altered base pairs in the mutants conform to the following general rule: down-mutations decrease homology and up-mutations increase homology to the consensus sequence. PMID:6344016

  7. CanScript, an 18-Base pair DNA sequence, boosts tumor cell-specific promoter activity

    PubMed Central

    Huang, Yu-Hung; Cozzitorto, Joseph A; Richards, Nathan G; Eltoukhy, Ahmed A; Yeo, Charles J; Langer, Robert; Anderson, Daniel G; Brody, Jonathan R


    Gene therapy protocols for the treatment of cancer often employ gene promoter sequences that are known to be overexpressed in specific tumor cell types relative to normal cells. These promoters, while specific, are often weakly active. It would be desirable to increase the activity of such promoters, while at the same time retain specificity, so that the therapeutic gene is more robustly expressed. Using a luciferase reporter DNA construct in both in vitro cell transfection assays and in vivo mouse tumor models, we have determined that in the absence of any other DNA sequence, a previously identified 18-base pair enhancer sequence called CanScript, lying upstream of the MSLN gene, has ∼25% of the promoter activity of CAG, a very strong non-specific promoter/enhancer, in tumor cells in which MSLN is highly expressed. Furthermore, tandem repeat copies of CanScript enhance transcription in a dose-dependent manner and, when coupled with promoter sequences that are active in tumor cells, increase promoter activity. These findings suggest that the incorporation of CanScript into gene constructs may have application in enhancing activity of promoters used in cancer-targeting gene therapy strategies, thereby improving therapeutic efficacy. PMID:20798601

  8. Core promoter functions in the regulation of gene expression of Drosophila dorsal target genes.


    Zehavi, Yonathan; Kuznetsov, Olga; Ovadia-Shochat, Avital; Juven-Gershon, Tamar


    Developmental processes are highly dependent on transcriptional regulation by RNA polymerase II. The RNA polymerase II core promoter is the ultimate target of a multitude of transcription factors that control transcription initiation. Core promoters consist of core promoter motifs, e.g. the initiator, TATA box, and the downstream core promoter element (DPE), which confer specific properties to the core promoter. Here, we explored the importance of core promoter functions in the dorsal-ventral developmental gene regulatory network. This network includes multiple genes that are activated by different nuclear concentrations of Dorsal, an NFκB homolog transcription factor, along the dorsal-ventral axis. We show that over two-thirds of Dorsal target genes contain DPE sequence motifs, which is significantly higher than the proportion of DPE-containing promoters in Drosophila genes. We demonstrate that multiple Dorsal target genes are evolutionarily conserved and functionally dependent on the DPE. Furthermore, we have analyzed the activation of key Dorsal target genes by Dorsal, as well as by another Rel family transcription factor, Relish, and the dependence of their activation on the DPE motif. Using hybrid enhancer-promoter constructs in Drosophila cells and embryo extracts, we have demonstrated that the core promoter composition is an important determinant of transcriptional activity of Dorsal target genes. Taken together, our results provide evidence for the importance of core promoter composition in the regulation of Dorsal target genes.

  9. Regulatory sequences for expressing genes in oomycete fungi.


    Judelson, H S; Tyler, B M; Michelmore, R W


    Promoter and terminator sequences from a range of species were tested for activity in the oomycetes, a group of lower fungi that bear an uncertain taxonomic affinity to other organisms and in which little is known of the sequences required for transcription. Transient assays, using the reporter gene beta-glucuronidase (GUS), were used to examine the function of these promoters and terminators in the plant pathogens Phytophthora infestans and P. megasperma f. sp. glycinea, and in the saprophytic water mold, Achlya ambisexualis. Oomycete promoters, isolated from the ham34 and hsp70 genes of Bremia lactucae and the actin gene of P. megasperma f. sp. glycinea, resulted in high levels of GUS accumulation in each of the three oomycetes. In contrast, little or no activity was detected when promoters from higher fungi (four ascomycetes and one basidiomycete), plants, and animals were tested. The terminator from the ham34 gene resulted in much higher levels of GUS accumulation than did others, although an oomycete terminator was not absolutely required for expression. Transcript mapping of RNA from stable transformants confirmed accurate initiation from the B. lactucae hsp70 promoter and termination within 3' ham34 sequences in P. infestans. Our results indicate that the transcriptional machinery of the oomycetes differs significantly from that of the higher fungi, but that enough conservation exists within the class to allow vectors developed from one oomycete species to be used for others.

  10. Prevalence of transcription promoters within archaeal operons and coding sequences

    PubMed Central

    Koide, Tie; Reiss, David J; Bare, J Christopher; Pang, Wyming Lee; Facciotti, Marc T; Schmid, Amy K; Pan, Min; Marzolf, Bruz; Van, Phu T; Lo, Fang-Yin; Pratap, Abhishek; Deutsch, Eric W; Peterson, Amelia; Martin, Dan; Baliga, Nitin S


    Despite the knowledge of complex prokaryotic-transcription mechanisms, generalized rules, such as the simplified organization of genes into operons with well-defined promoters and terminators, have had a significant role in systems analysis of regulatory logic in both bacteria and archaea. Here, we have investigated the prevalence of alternate regulatory mechanisms through genome-wide characterization of transcript structures of ∼64% of all genes, including putative non-coding RNAs in Halobacterium salinarum NRC-1. Our integrative analysis of transcriptome dynamics and protein–DNA interaction data sets showed widespread environment-dependent modulation of operon architectures, transcription initiation and termination inside coding sequences, and extensive overlap in 3′ ends of transcripts for many convergently transcribed genes. A significant fraction of these alternate transcriptional events correlate to binding locations of 11 transcription factors and regulators (TFs) inside operons and annotated genes—events usually considered spurious or non-functional. Using experimental validation, we illustrate the prevalence of overlapping genomic signals in archaeal transcription, casting doubt on the general perception of rigid boundaries between coding sequences and regulatory elements. PMID:19536208

  11. Disease gene identification strategies for exome sequencing

    PubMed Central

    Gilissen, Christian; Hoischen, Alexander; Brunner, Han G; Veltman, Joris A


    Next generation sequencing can be used to search for Mendelian disease genes in an unbiased manner by sequencing the entire protein-coding sequence, known as the exome, or even the entire human genome. Identifying the pathogenic mutation amongst thousands to millions of genomic variants is a major challenge, and novel variant prioritization strategies are required. The choice of these strategies depends on the availability of well-phenotyped patients and family members, the mode of inheritance, the severity of the disease and its population frequency. In this review, we discuss the current strategies for Mendelian disease gene identification by exome resequencing. We conclude that exome strategies are successful and identify new Mendelian disease genes in approximately 60% of the projects. Improvements in bioinformatics as well as in sequencing technology will likely increase the success rate even further. Exome sequencing is likely to become the most commonly used tool for Mendelian disease gene identification for the coming years. PMID:22258526

  12. Regulatory sequence of cupin family gene


    Hood, Elizabeth; Teoh, Thomas


    This invention is in the field of plant biology and agriculture and relates to novel seed specific promoter regions. The present invention further provide methods of producing proteins and other products of interest and methods of controlling expression of nucleic acid sequences of interest using the seed specific promoter regions.

  13. Sequence signatures extracted from proximal promoters can be used to predict distal enhancers

    PubMed Central


    Background Gene expression is controlled by proximal promoters and distal regulatory elements such as enhancers. While the activity of some promoters can be invariant across tissues, enhancers tend to be highly tissue-specific. Results We compiled sets of tissue-specific promoters based on gene expression profiles of 79 human tissues and cell types. Putative transcription factor binding sites within each set of sequences were used to train a support vector machine classifier capable of distinguishing tissue-specific promoters from control sequences. We obtained reliable classifiers for 92% of the tissues, with an area under the receiver operating characteristic curve between 60% (for subthalamic nucleus promoters) and 98% (for heart promoters). We next used these classifiers to identify tissue-specific enhancers, scanning distal non-coding sequences in the loci of the 200 most highly and lowly expressed genes. Thirty percent of reliable classifiers produced consistent enhancer predictions, with significantly higher densities in the loci of the most highly expressed compared to lowly expressed genes. Liver enhancer predictions were assessed in vivo using the hydrodynamic tail vein injection assay. Fifty-eight percent of the predictions yielded significant enhancer activity in the mouse liver, whereas a control set of five sequences was completely negative. Conclusions We conclude that promoters of tissue-specific genes often contain unambiguous tissue-specific signatures that can be learned and used for the de novo prediction of enhancers. PMID:24156763

  14. Draft Genome Sequence of Multitrait Plant Growth-Promoting Bacillus sp. Strain RZ2MS9

    PubMed Central

    Batista, Bruna Durante; Taniguti, Lucas Mitsuo; Almeida, Jaqueline Raquel; Azevedo, João Lúcio


    Bacillus sp. strain RZ2MS9 is a multitrait soybean and maize growth-promoting bacterium isolated in Brazil from guarana’s rhizosphere. Here, we present the draft genome sequence of RZ2MS9 and its genes involved in many features related to plant growth promotion. PMID:28007854

  15. Genome sequence of the plant growth-promoting rhizobacterium Bacillus sp. strain JS.


    Song, Ju Yeon; Kim, Hyun A; Kim, Ji-Seoung; Kim, Seon-Young; Jeong, Haeyoung; Kang, Sung Gyun; Kim, Byung Kwon; Kwon, Soon-Kyeong; Lee, Choong Hoon; Yu, Dong Su; Kim, Beom Seok; Kim, Sun-Hyung; Kwon, Suk Yoon; Kim, Jihyun F


    Volatile and nonvolatile compounds emitted from the plant growth-promoting rhizobacterium Bacillus sp. strain JS enhance the growth of tobacco and lettuce. Here, we report the high-quality genome sequence of this bacterium. Its 4.1-Mb genome reveals a number of genes whose products are possibly involved in promotion of plant growth or antibiosis.

  16. Synaptotagmin gene content of the sequenced genomes.


    Craxton, Molly


    Synaptotagmins exist as a large gene family in mammals. There is much interest in the function of certain family members which act crucially in the regulated synaptic vesicle exocytosis required for efficient neurotransmission. Knowledge of the functions of other family members is relatively poor and the presence of Synaptotagmin genes in plants indicates a role for the family as a whole which is wider than neurotransmission. Identification of the Synaptotagmin genes within completely sequenced genomes can provide the entire Synaptotagmin gene complement of each sequenced organism. Defining the detailed structures of all the Synaptotagmin genes and their encoded products can provide a useful resource for functional studies and a deeper understanding of the evolution of the gene family. The current rapid increase in the number of sequenced genomes from different branches of the tree of life, together with the public deposition of evolutionarily diverse transcript sequences make such studies worthwhile. I have compiled a detailed list of the Synaptotagmin genes of Caenorhabditis, Anopheles, Drosophila, Ciona, Danio, Fugu, Mus, Homo, Arabidopsis and Oryza by examining genomic and transcript sequences from public sequence databases together with some transcript sequences obtained by cDNA library screening and RT-PCR. I have compared all of the genes and investigated the relationship between plant Synaptotagmins and their non-Synaptotagmin counterparts. I have identified and compared 98 Synaptotagmin genes from 10 sequenced genomes. Detailed comparison of transcript sequences reveals abundant and complex variation in Synaptotagmin gene expression and indicates the presence of Synaptotagmin genes in all animals and land plants. Amino acid sequence comparisons indicate patterns of conservation and diversity in function. Phylogenetic analysis shows the origin of Synaptotagmins in multicellular eukaryotes and their great diversification in animals. Synaptotagmins occur in

  17. Synthetic muscle promoters: activities exceeding naturally occurring regulatory sequences

    NASA Technical Reports Server (NTRS)

    Li, X.; Eastman, E. M.; Schwartz, R. J.; Draghia-Akli, R.


    Relatively low levels of expression from naturally occurring promoters have limited the use of muscle as a gene therapy target. Myogenic restricted gene promoters display complex organization usually involving combinations of several myogenic regulatory elements. By random assembly of E-box, MEF-2, TEF-1, and SRE sites into synthetic promoter recombinant libraries, and screening of hundreds of individual clones for transcriptional activity in vitro and in vivo, several artificial promoters were isolated whose transcriptional potencies greatly exceed those of natural myogenic and viral gene promoters.

  18. Synthetic muscle promoters: activities exceeding naturally occurring regulatory sequences

    NASA Technical Reports Server (NTRS)

    Li, X.; Eastman, E. M.; Schwartz, R. J.; Draghia-Akli, R.


    Relatively low levels of expression from naturally occurring promoters have limited the use of muscle as a gene therapy target. Myogenic restricted gene promoters display complex organization usually involving combinations of several myogenic regulatory elements. By random assembly of E-box, MEF-2, TEF-1, and SRE sites into synthetic promoter recombinant libraries, and screening of hundreds of individual clones for transcriptional activity in vitro and in vivo, several artificial promoters were isolated whose transcriptional potencies greatly exceed those of natural myogenic and viral gene promoters.

  19. SINE retrotransposons cause epigenetic reprogramming of adjacent gene promoters.


    Estécio, Marcos R H; Gallegos, Juan; Dekmezian, Mhair; Lu, Yue; Liang, Shoudan; Issa, Jean-Pierre J


    Almost half of the human genome and as much as 40% of the mouse genome is composed of repetitive DNA sequences. The majority of these repeats are retrotransposons of the SINE and LINE families, and such repeats are generally repressed by epigenetic mechanisms. It has been proposed that these elements can act as methylation centers from which DNA methylation spreads into gene promoters in cancer. Contradictory to a methylation center function, we have found that retrotransposons are enriched near promoter CpG islands that stay methylation-free in cancer. Clearly, it is important to determine which influence, if any, these repetitive elements have on nearby gene promoters. Using an in vitro system, we confirm here that SINE B1 elements can influence the activity of downstream gene promoters, with acquisition of DNA methylation and loss of activating histone marks, thus resulting in a repressed state. SINE sequences themselves did not immediately acquire DNA methylation but were marked by H3K9me2 and H3K27me3. Moreover, our bisulfite sequencing data did not support that gain of DNA methylation in gene promoters occurred by methylation spreading from SINE B1 repeats. Genome-wide analysis of SINE repeats distribution showed that their enrichment is directly correlated with the presence of USF1, USF2, and CTCF binding, proteins with insulator function. In summary, our work supports the concept that SINE repeats interfere negatively with gene expression and that their presence near gene promoters is counter-selected, except when the promoter is protected by an insulator element.

  20. Intergenic Sequence between Arabidopsis Caseinolytic Protease B-Cytoplasmic/Heat Shock Protein100 and Choline Kinase Genes Functions as a Heat-Inducible Bidirectional Promoter1[C][W][OPEN

    PubMed Central

    Mishra, Ratnesh Chandra; Grover, Anil


    In Arabidopsis (Arabidopsis thaliana), the At1g74310 locus encodes for caseinolytic protease B-cytoplasmic (ClpB-C)/heat shock protein100 protein (AtClpB-C), which is critical for the acquisition of thermotolerance, and At1g74320 encodes for choline kinase (AtCK2) that catalyzes the first reaction in the Kennedy pathway for phosphatidylcholine biosynthesis. Previous work has established that the knockout mutants of these genes display heat-sensitive phenotypes. While analyzing the AtClpB-C promoter and upstream genomic regions in this study, we noted that AtClpB-C and AtCK2 genes are head-to-head oriented on chromosome 1 of the Arabidopsis genome. Expression analysis showed that transcripts of these genes are rapidly induced in response to heat stress treatment. In stably transformed Arabidopsis plants harboring this intergenic sequence between head-to-head oriented green fluorescent protein and β-glucuronidase reporter genes, both transcripts and proteins of the two reporters were up-regulated upon heat stress. Four heat shock elements were noted in the intergenic region by in silico analysis. In the homozygous transfer DNA insertion mutant Salk_014505, 4,393-bp transfer DNA is inserted at position −517 upstream of ATG of the AtClpB-C gene. As a result, AtCk2 loses proximity to three of the four heat shock elements in the mutant line. Heat-inducible expression of the AtCK2 transcript was completely lost, whereas the expression of AtClpB-C was not affected in the mutant plants. Our results suggest that the 1,329-bp intergenic fragment functions as a heat-inducible bidirectional promoter and the region governing the heat inducibility is possibly shared between the two genes. We propose a model in which AtClpB-C shares its regulatory region with heat-induced choline kinase, which has a possible role in heat signaling. PMID:25281707

  1. Nucleotide sequence of a human tRNA gene heterocluster

    SciTech Connect

    Chang, Y.N.; Pirtle, I.L.; Pirtle, R.M.


    Leucine tRNA from bovine liver was used as a hybridization probe to screen a human gene library harbored in Charon-4A of bacteriophage lambda. The human DNA inserts from plaque-pure clones were characterized by restriction endonuclease mapping and Southern hybridization techniques, using both (3'-/sup 32/P)-labeled bovine liver leucine tRNA and total tRNA as hybridization probes. An 8-kb Hind III fragment of one of these ..gamma..-clones was subcloned into the Hind III site of pBR322. Subsequent fine restriction mapping and DNA sequence analysis of this plasmid DNA indicated the presence of four tRNA genes within the 8-kb DNA fragment. A leucine tRNA gene with an anticodon of AAG and a proline tRNA gene with an anticodon of AGG are in a 1.6-kb subfragment. A threonine tRNA gene with an anticodon of UGU and an as yet unidentified tRNA gene are located in a 1.1-kb subfragment. These two different subfragments are separated by 2.8 kb. The coding regions of the three sequenced genes contain characteristic internal split promoter sequences and do not have intervening sequences. The 3'-flanking region of these three genes have typical RNA polymerase III termination sites of at least four consecutive T residues.


    USDA-ARS?s Scientific Manuscript database

    The abundance of expressed gene and protein sequences available in the biological information databases facilitates comparison of protein homologies. A high degree of sequence similarity typically implies homology regarding structure and function and may provide clues to antibody cross-react...

  3. Characterizations of Hirudo medicinalis DNA promoters for targeted gene expression.


    Baker, Michael W; Macagno, Eduardo R


    The expression of exogenous genes in neurons and other cells has become a powerful means for studying the function of encoded proteins. We report here on the isolation and functional analysis of three Hirudo medicinalis actin gene promoters and the 5' UTR of a leech elongation factor-1alpha (HmEF-1alpha) gene. In situ hybridization labeling revealed that the EF-1alpha gene and one of the actins had pan-neuronal expression, whereas, the other two actin genes were expressed by the embryo's body wall musculature. Comparative analysis shows that they all display many features typical of actin and EF-1alpha promoters from other species, including canonical TATA box sequences and predicted general transcription factor binding sites (such as CCATT, CarB boxes and CG-rich regions). The ability of these 5' UTR sequences to drive expression of the enhanced green fluorescent protein (EGFP), leech cytoplasmic actin and leech synaptobrevin was examined. Direct intracellular nuclear, but not cytoplasmic, microinjection of each of the promoter sequences was found to produce reliably cellular expression of the reporter construct in both neuronal and muscle cells. These results introduce reliable and effective methods to selectively express genes in individual cells of the leech in vivo during embryonic development.

  4. Definition of the ovalbumin gene promoter by transfer of an ovalglobin fusion gene into cultured cells.

    PubMed Central

    Knoll, B J; Zarucki-Schulz, T; Dean, D C; O'Malley, B W


    In order to study the initiation of transcription from the ovalbumin gene promoter, we constructed a hybrid gene (ovalglobin) in which 753 bps of ovalbumin gene 5'-flanking sequence were joined to the chicken adult beta-globin gene. When transfected into HeLa S3 cells, ovalglobin gene transcription initiated at the ovalbumin gene cap site, as measured by S1 nuclease and primer extension analysis. Deletion of 5'-flanking sequences to position -95 had little effect on transcription; deletion to -77 reduced transcription to about 20% of the wild type level and deletion to -48 reduced the level to about 2%. A deletion to -24, removing the sequence TATATAT, abolished transcription entirely. Hormonal regulation of the ovalglobin gene was observed when primary oviduct cells were used as recipients for DNA transfection. Under these conditions, addition of progesterone increased the level of ovalglobin transcripts to more than 10 times the uninduced level. Images PMID:6314256

  5. Characterization of late gene promoters of Chlamydia trachomatis.

    PubMed Central

    Fahr, M J; Douglas, A L; Xia, W; Hatch, T P


    Chlamydiae possess an intracellular developmental cycle defined by the orderly interconversion of infectious, metabolically inactive elementary bodies and noninfectious, dividing reticulate bodies. Only a few stage-specific genes have been cloned and sequenced, including the late-stage cysteine-rich protein operon and two late-stage genes encoding histone-like proteins. The aims of this study were to identify additional late-stage genes of Chlamydia trachomatis, analyze the upstream DNA sequence of late genes, and determine the sigma factor requirement of late genes. Stage-specific RNA, made by chlamydiae isolated from host cells, was used to probe C. trachomatis genomic libraries. Two new late genes, designated ltuA and ltuB, were identified, cloned, and sequenced. The predicted peptides encoded by ltuA and ltuB do not bear strong homology to known proteins, and the function of the new late genes is not known. The 5' ends of the transcripts of ltuA, ltuB, the cysteine-rich protein operon, and the two histone-like genes (hctA and hctB) were mapped, and a consensus -10 promoter region of TATAAT was derived from their upstream DNA sequences. In vitro transcription from templates encoding the promoter regions of ltuA, ltuB, and hctA cloned into the transcription assay vector pUC19-spf was found to be strongly stimulated by the addition of recombinant chlamydial sigma 66, while transcription from the putative hctB promoter region cloned in pUC19-spf was not detected in either the presence or absence of added sigma 66. These results suggest that the transcription of at least some chlamydial late-stage genes is dependent on sigma 66, which is homologous to the major sigma factors of other eubacteria. PMID:7543468

  6. Expression and export of a Ruminococcus albus cellulase in Butyrivibrio fibrisolvens through the use of an alternative gene promoter and signal sequence.


    Kobayashi, Yasuo; Taguchi, Hidenori; Goto, Takashi N; Koike, Satoshi; Ohmiya, Kunio


    Ruminococcal cellulase (Ruminococcus albus F-40 endoglucanase EgI) was successfully expressed in Butyrivibrio fibrisolvens OB156C, using the erm promoter from pAMbeta1. A newly identified signal peptide coding region of xynA from B. fibrisolvens 49 allowed efficient translocation of the foreign EgI into the extracellular fraction. First, B. fibrisolvens xynA with or without its own putative signal peptide (XynA SP) coding region was cloned into a shuttle vector to transform B. fibrisolvens OB156C. Both plasmids caused a 2- to 2.4-fold increase in xylanase activity. The transformant expressing XynA with the signal peptide showed a significantly higher proportion of activity in the extracellular fraction than the transformant with XynA lacking the signal peptide (75% vs. 19%), demonstrating the significance of XynA SP in the translocation of the expressed enzyme. Second, using the XynA SP coding region, secretion of EgI was attempted in B. fibrisolvens. Since the signal peptide of R. albus EgI did not function in B. fibrisolvens, it was replaced with the XynA SP. A high activity variant of EgI containing the XynA SP was transcribed using the erm promoter, resulting in a 27-fold increase in endoglucanase activity, most of which (>93%) was in the extracellular fraction of the B. fibrisolvens transformant. EgI without the XynA SP was scarcely detected in the extracellular fraction (<10%).

  7. Cloning and analysis of rat osteoclast inhibitory lectin gene promoter.


    Quan, Jin-Xing; Zheng, Fang; Li, Xiao-Xia; Hu, Li-Ling; Sun, Zi-Yang; Jiao, Yan-Li; Wang, Bao-Li


    Osteoclast inhibitory lectin (OCIL) is a novel regulator of bone remodeling, however, little is known concerning how OCIL is regulated to date. In this study, approximately 4.4 kb of the 5'-flanking sequence of rat OCIL gene was cloned into the promoter-less reporter vector pGL3-basic and transiently transfected into three different cell lines. The differences in the levels of luciferase activity paralleled well with the levels of OCIL mRNA expression in these cells, suggesting that the regulation of rat OCIL gene expression occurs mainly at the transcriptional level. Additional luciferase assays using a series of constructs containing unidirectionally deleted fragments showed that the construct-1819/pGL3 (-1819 to +118) exhibited the highest luciferase activity, suggesting the presence of functional promoter in this region. The region from -4370 to -2805 might contain negative regulatory elements, while the region from -1819 to -1336 might have important positive regulatory elements that enhance OCIL transcription. Sequence analysis of the promoter revealed the absence of both TATA and CAAT boxes. However, in the proximal promoter region (-81 to +118), several potential transcription factor binding sites that may be responsible for the basal transcriptional activity of rat OCIL promoter were observed. The promoter contains several potential Sp1 binding sites, and cotransfection of a shRNA expression plasmid that knockdowns Sp1 significantly reduced OCIL promoter activity and endogenous gene expression and moreover, overexpressing Sp7, a Sp1 family member that also binds to Sp1 binding sequence, increased OCIL promoter activity and gene expression, suggesting a role of Sp1 family proteins in regulation of OCIL transcription.

  8. Gene Discovery through Expressed Sequence Tag Sequencing in Trypanosoma cruzi

    PubMed Central

    Verdun, Ramiro E.; Di Paolo, Nelson; Urmenyi, Turan P.; Rondinelli, Edson; Frasch, Alberto C. C.; Sanchez, Daniel O.


    Analysis of expressed sequence tags (ESTs) constitutes a useful approach for gene identification that, in the case of human pathogens, might result in the identification of new targets for chemotherapy and vaccine development. As part of the Trypanosoma cruzi genome project, we have partially sequenced the 5′ ends of 1,949 clones to generate ESTs. The clones were randomly selected from a normalized CL Brener epimastigote cDNA library. A total of 14.6% of the clones were homologous to previously identified T. cruzi genes, while 18.4% had significant matches to genes from other organisms in the database. A total of 67% of the ESTs had no matches in the database, and thus, some of them might be T. cruzi-specific genes. Functional groups of those sequences with matches in the database were constructed according to their putative biological functions. The two largest categories were protein synthesis (23.3%) and cell surface molecules (10.8%). The information reported in this paper should be useful for researchers in the field to analyze genes and proteins of their own interest. PMID:9784549

  9. Sequences promoting the transcription of the human XA gene overlapping P450c21A correctly predict the presence of a novel, adrenal-specific, truncated form of tenascin-X

    SciTech Connect

    Tee, Meng Kian; Thomson, A.A.; Bristow, J.; Miller, W.L.


    A compact region in the human class III major histocompatibility locus contains the human genes for the fourth component of human complement (C4) and steroid 21-hydroxylase (P450c21) in one transcriptional orientation, while the gene for the extracellular matrix protein tenascin-X (TN-X) overlaps the last exon of P450c21 on the opposite strand of DNA in the opposite transcriptional orientation. This complex locus is duplicated into A and B loci, so that the organization is 5{prime}-C4A-21A-XA-C4B-21B-XB-3{prime}. Although this duplication event truncated the 65-kb X(B) gene to a 4.5-kb XA gene, the XA gene is transcriptionally active in the adrenal cortex. To examine the basis of the tissue-specific expression of XA and C4B, we cloned the 1763-bp region that lies between the cap sites for XA and C4B and analyzed its promoter activity in both the XA and the C4 orientations. Powerful, liver-specific sequences lie within the first 75 to 138 bp from the C4B cap site, and weaker elements lie within 128 bp of the XA cap site that function in both liver and adrenal cells. Because these 128 bp upstream from the XA cap site are perfectly preserved in the XB gene encoding TN-X, we sought to determine whether a transcript similar to XA arises within the SB gene. RNase protection assays, cDNA cloning, and RT/PCR show that adrenal cells contain a novel transcript, termed short XB (XB-S), which has the same open reading frame as TN-X. Cell-free translation and immunoblotting show that this transcript encodes a novel 74-kDa XB-S protein that is identical to the carboxy-terminal 673 residues of TN-X. Because this protein consists solely of fibronectin type III repeats and a fibrinogen-like domain, it appears to correspond to an evolutionary precursor of the tenascin family of extracellular matrix proteins. 40 refs., 6 figs.

  10. Regulatory sequences of duck hepatitis B virus C gene transcription.

    PubMed Central

    Schneider, R; Will, H


    The regulatory elements involved in transcription of the C gene of duck hepatitis B virus (DHBV) were investigated. Several DHBV DNA fragments were assayed for C gene promoter, enhancer, and silencer activity by using a chloramphenicol acetyltransferase (CAT) reporter gene and transfection of established liver and nonliver cell lines. A major transcript initiating at nucleotide positions 2532 and 2533 and three minor transcripts initiating at positions 2453/2454 and 2461 were identified in cells containing these constructs. These positions correspond to the 5' end of the C mRNA and were close to that of the pre-C mRNAs, respectively, found in infected livers. The pre-C mRNAs were only detected when sequences located between the initiation sites of the pre-C and C mRNAs were deleted. These sequences downregulated, in an orientation-independent fashion, a heterologous promoter and were found to contain a consensus motif common to negative transcriptional regulatory elements previously characterized in other cellular and viral genes. C gene promoter activity was only observed in highly differentiated liver cells and was dependent on a short DHBV DNA fragment containing an enhancer core consensus motif. These data indicate that transcription of the DHBV C gene is regulated by positive, negative, and differentiation factor-responsive elements. Images PMID:1920612

  11. Leptin gene promoter DNA methylation in WNIN obese mutant rats.


    Kalashikam, Rajender Rao; Inagadapa, Padmavathi J N; Thomas, Anju Elizabeth; Jeyapal, Sugeetha; Giridharan, Nappan Veettil; Raghunath, Manchala


    Obesity has become an epidemic in worldwide population. Leptin gene defect could be one of the causes for obesity. Two mutant obese rats WNIN/Ob and WNIN/GROb, isolated at National Centre for Laboratory Animal Sciences (NCLAS), Hyderabad, India, were found to be leptin resistant. The present study aims to understand the regulatory mechanisms underlying the resistance by promoter DNA methylation of leptin gene in these mutant obese rats. Male obese mutant homozygous, carrier and heterozygous rats of WNIN/Ob and WNIN/GROb strain of 6 months old were studied to check the leptin gene expression (RT-PCR) and promoter DNA methylation (MassARRAY Compact system, SEQUENOM) of leptin gene by invivo and insilico approach. Homozygous WNIN/Ob and WNIN/GROb showed significantly higher leptin gene expression compared to carrier and lean counterparts. Leptin gene promoter DNA sequence region was analyzed ranging from transcription start site (TSS) to-550 bp length and found four CpGs in this sequence among them only three CpG loci (-309, -481, -502) were methylated in these WNIN mutant rat phenotypes. The increased percentage of methylation in WNIN mutant lean and carrier phenotypes is positively correlated with transcription levels. Thus genetic variation may have effect on methylation percentages and subsequently on the regulation of leptin gene expression which may lead to obesity in these obese mutant rat strains.

  12. Comparative analysis of ADS gene promoter in seven Artemisia species.


    Ranjbar, Mojtaba; Naghavi, Mohammad Reza; Alizadeh, Hoshang


    Artemisinin is the most effective antimalarial drug that is derived from Artemisia annua. Amorpha-4,11-diene synthase (ADS) controls the first committed step in artemisinin biosynthesis. The ADS gene expression is regulated by transcription factors which bind to the cis-acting elements on the ADS promoter and are probably responsible for the ADS gene expression difference in the Artemisia species. To identify the elements that are significantly involved in ADS gene expression, the ADS gene promoter of the seven Artemisia species was isolated and comparative analysis was performed on the ADS promoter sequences of these species. Results revealed that some of the cis-elements were unique or in terms of number were more in the high artemisinin producer species, A. annua, than the other species. We have reported that the light-responsive elements, W-box, CAAT-box, 5'-UTR py-rich stretch, TATA-box sequence and tandem repeat sequences have been identified as important factors in the increased expression of ADS gene.

  13. Nascent RNA sequencing reveals widespread pausing and divergent initiation at human promoters.


    Core, Leighton J; Waterfall, Joshua J; Lis, John T


    RNA polymerases are highly regulated molecular machines. We present a method (global run-on sequencing, GRO-seq) that maps the position, amount, and orientation of transcriptionally engaged RNA polymerases genome-wide. In this method, nuclear run-on RNA molecules are subjected to large-scale parallel sequencing and mapped to the genome. We show that peaks of promoter-proximal polymerase reside on approximately 30% of human genes, transcription extends beyond pre-messenger RNA 3' cleavage, and antisense transcription is prevalent. Additionally, most promoters have an engaged polymerase upstream and in an orientation opposite to the annotated gene. This divergent polymerase is associated with active genes but does not elongate effectively beyond the promoter. These results imply that the interplay between polymerases and regulators over broad promoter regions dictates the orientation and efficiency of productive transcription.

  14. Cloning, characterization and promoter analysis of S-RNase gene promoter from Chinese pear (Pyrus pyrifolia).


    Liu, Xue-ying; Wuyun, Ta-na; Zeng, Hong-yan


    The 5'-flanking region of the S(12)-, S(13)-, S(21)-RNase with a length of 854 bp, 1448 bp and 1137 bp were successfully isolated by TAIL-PCR from genomic DNA from 'Jinhua', 'Maogong' (Pyrus pyrifolia) and 'Yali' (Pyrus bretschneideri) genomic DNA. Sequence alignment and analysis of S(13)-, S(12)-, S(21)-RNase gene promoter sequences with S(2)-, S(3)-, S(4)-, S(5)-RNase 5'-flanking sequences indicated that a homology region of about 240 bp exists in the regions just upstream of the putative TATA boxes of the seven Chinese/Japanese pear S-RNase genes. Phylogenetic tree suggests that the homology region between the Chinese/Japanese pear and apple S-RNase gene promoter regions reflects the divergence of S-RNase gene was formed before the differentiation of subfamilies. Full length and a series of 5'-deletion fragments-GUS fusions were constructed and introduced into Arabidopsis thaliana plants. GUS activity were detected in S(12)-pro-(1 to 5)-GUS-pBll01.2 transgenic pistils and progressively decreased from S(12)-pro-1-GUS-pBI l01.2 to S(12)-pro-5-GUS-pBll01.2. No GUS activity was detected in S(12)-pro-6-GUS-pBll01.2 transgenic pistil and other tissues of non-transformants and all transgenic plants. The result suggested S(12)-RNase promoter is pistil specific expression promoter.

  15. Sequence analysis of porothramycin biosynthetic gene cluster.


    Najmanova, Lucie; Ulanova, Dana; Jelinkova, Marketa; Kamenik, Zdenek; Kettnerova, Eliska; Koberska, Marketa; Gazak, Radek; Radojevic, Bojana; Janata, Jiri


    The biosynthetic gene cluster of porothramycin, a sequence-selective DNA alkylating compound, was identified in the genome of producing strain Streptomyces albus subsp. albus (ATCC 39897) and sequentially characterized. A 39.7 kb long DNA region contains 27 putative genes, 18 of them revealing high similarity with homologous genes from biosynthetic gene cluster of closely related pyrrolobenzodiazepine (PBD) compound anthramycin. However, considering the structures of both compounds, the number of differences in the gene composition of compared biosynthetic gene clusters was unexpectedly high, indicating participation of alternative enzymes in biosynthesis of both porothramycin precursors, anthranilate, and branched L-proline derivative. Based on the sequence analysis of putative NRPS modules Por20 and Por21, we suppose that in porothramycin biosynthesis, the methylation of anthranilate unit occurs prior to the condensation reaction, while modifications of branched proline derivative, oxidation, and dimethylation of the side chain occur on already condensed PBD core. Corresponding two specific methyltransferase encoding genes por26 and por25 were identified in the porothramycin gene cluster. Surprisingly, also methyltransferase gene por18 homologous to orf19 from anthramycin biosynthesis was detected in porothramycin gene cluster even though the appropriate biosynthetic step is missing, as suggested by ultra high-performance liquid chromatography-diode array detection-mass spectrometry (UHPLC-DAD-MS) analysis of the product in the S. albus culture broth.

  16. Promoter mapping and cell cycle regulation of flagellin gene transcription in Caulobacter crescentus.

    PubMed Central

    Minnich, S A; Newton, A


    Caulobacter crescentus contains a 25- and a 27-kDa flagellin, which are assembled into the flagellar filament, and a 29-kDa flagellin, which is related in sequence but is of unknown function. We have used DNA sequence analysis and nuclease S1 assays to map the in vivo transcription start sites of the three flagellin genes and to study their regulation. These experiments lead to several conclusions. First, copies of the 29-, 25-, and 27-kDa flagellin genes are organized in a tandem array in the flaEY gene cluster of C. crescentus. Second, flagellin genes are under transcriptional control and each gene is expressed with a characteristic periodicity in the cell cycle. Third, flagellin gene promoters contain conserved nucleotide sequence elements at -13, -24, and -100 that are homologous to the fla genes in the hook gene cluster. The -13 and -24 sequences conform to a fla gene promoter consensus sequence (C/TTGGCC/GC-N5-TTGC) that is similar in sequence to the -12, -24 consensus sequence of the Klebsiella pneumonia nif gene promoters. Fourth, the sequence element at approximately -100 in the 25- and the 27-kDa flagellin genes is homologous to a 19-base-pair sequence [designated previously as II-1; see Chen, L.-S., Mullin, D. M. & Newton, A. (1986) Proc. Natl. Acad. Sci. USA 83, 2860-2864]at -101 in the promoter of transcription unit II of the hook gene cluster; the two flagellin genes, like the fla genes examined in the hook gene cluster that contain the -100 element, are under positive control by transcription unit III of the hook gene cluster. This result supports a model in which the timing of fla gene transcription in the C. crescentus cell cycle is determined in part by a cascade of trans-acting regulatory gene products. Images PMID:3469658

  17. Cloning and nucleotide sequence of the Lactobacillus casei lactate dehydrogenase gene.

    PubMed Central

    Kim, S F; Baek, S J; Pack, M Y


    An allosteric L-(+)-lactate dehydrogenase gene of Lactobacillus casei ATCC 393 was cloned in Escherichia coli, and the nucleotide sequence of the gene was determined. The gene was composed of an open reading frame of 981 bp, starting with a GTG codon and ending with a TAA codon. The sequences for the promoter and ribosome binding site were identified, and a sequence for a structure resembling a rho-independent transcription terminator was also found. Images PMID:1768113

  18. Cloning and Sequencing the First HLA Gene

    PubMed Central

    Jordan, Bertrand R.


    This Perspectives article recounts the isolation and sequencing of the first human histocompatibility gene (HLA) in 1980–1981. At the time, general knowledge of the molecules of the immune system was already fairly extensive, and gene rearrangements in the immunoglobulin complex (discovered in 1976) had generated much excitement: HLA was quite obviously the next frontier. The author was able to use a homologous murine H-2 cDNA to identify putative human HLA genomic clones in a λ-phage library and thus to isolate and sequence the first human histocompatibility gene. This personal account relates the steps that led to this result, describes the highly competitive international environment, and highlights the role of location, connections, and sheer luck in such an achievement. It also puts this work in perspective with a short description of the current knowledge of histocompatibility genes and, finally, presents some reflections on the meaning of “discovery.” PMID:20457890

  19. Cloning of a marine cyanobacterial promoter for foreign gene expression using a promoter probe vector

    SciTech Connect

    Sode, Koji; Hatano, Naoaki; Tatara, Masahiro


    A marine cyanobacterial promoter was cloned to allow efficient foreign gene expression. This was carried out using chloramphenicol acetyl transferase (CAT) as a marker protein. For rapid and simple measurement of CAT activity, a method based on a fluorescently labeled substrate was improved by utilizing HPLC equipped with a flow-through fluorescent spectrophotometer. This method was used in conjunction with a newly constructed promoter probe vector. Cyanobacterial transformants, harboring plasmid containing a cloned 2-kbp marine cyanobacterial genomic fragment, showed a 10-fold higher CAT activity, compared with that achieved using the kanamycin-resistant gene promoter. From the sequence analysis of the cloned fragment, a putative promoter region was found. 20 refs., 7 figs., 2 tabs.

  20. Firefly luciferase gene contains a cryptic promoter

    PubMed Central

    Vopálenský, Václav; Mašek, Tomáš; Horváth, Ondřej; Vicenová, Blanka; Mokrejš, Martin; Pospíšek, Martin


    A firefly luciferase (FLuc) counts among the most popular reporters of present-day molecular and cellular biology. In this study, we report a cryptic promoter activity in the luc+ gene, which is the most frequently used version of the firefly luciferase. The FLuc coding region displays cryptic promoter activity both in mammalian and yeast cells. In human CCL13 and Huh7 cells, cryptic transcription from the luc+ gene is 10–16 times weaker in comparison to the strong immediate-early cytomegalovirus promoter. Additionally, we discuss a possible impact of the FLuc gene cryptic promoter on experimental results especially in some fields of the RNA-oriented research, for example, in analysis of translation initiation or analysis of miRNA/siRNA function. Specifically, we propose how this newly described cryptic promoter activity within the FLuc gene might contribute to the previous determination of the strength of the cryptic promoter found in the cDNA corresponding to the hepatitis C virus internal ribosome entry site. Our findings should appeal to the researchers to be more careful when designing firefly luciferase-based assays as well as open the possibility of performing some experiments with the hepatitis C virus internal ribosome entry site, which could not be considered until now. PMID:18697919

  1. Promoter sequences and algorithmical methods for identifying them.


    Vanet, A; Marsan, L; Sagot, M F


    This paper presents a survey of currently available mathematical models and algorithmical methods for trying to identify promoter sequences. The methods concern both searching in a genome for a previously defined consensus and extracting a consensus from a set of sequences. Such methods were often tailored for either eukaryotes or prokaryotes although this does not preclude use of the same method for both types of organisms. The survey therefore covers all methods; however, emphasis is placed on prokaryotic promoter sequence identification. Illustrative applications of the main extracting algorithms are given for three bacteria.

  2. Thermodynamics-based models of transcriptional regulation with gene sequence.


    Wang, Shuqiang; Shen, Yanyan; Hu, Jinxing


    Quantitative models of gene regulatory activity have the potential to improve our mechanistic understanding of transcriptional regulation. However, the few models available today have been based on simplistic assumptions about the sequences being modeled or heuristic approximations of the underlying regulatory mechanisms. In this work, we have developed a thermodynamics-based model to predict gene expression driven by any DNA sequence. The proposed model relies on a continuous time, differential equation description of transcriptional dynamics. The sequence features of the promoter are exploited to derive the binding affinity which is derived based on statistical molecular thermodynamics. Experimental results show that the proposed model can effectively identify the activity levels of transcription factors and the regulatory parameters. Comparing with the previous models, the proposed model can reveal more biological sense.

  3. In vitro mapping of Myotonic Dystrophy (DM) gene promoter

    SciTech Connect

    Storbeck, C.J.; Sabourin, L.; Baird, S.


    The Myotonic Dystrophy Kinase (DMK) gene has been cloned and shared homology to serine/threonine protein kinases. Overexpression of this gene in stably transfected mouse myoblasts has been shown to inhibit fusion into myotubes while myoblasts stably transfected with an antisense construct show increased fusion potential. These experiments, along with data showing that the DM gene is highly expressed in muscle have highlighted the possibility of DMK being involved in myogenesis. The promoter region of the DM gene lacks a consensus TATA box and CAAT box, but harbours numerous transcription binding sites. Clones containing extended 5{prime} upstream sequences (UPS) of DMK only weakly drive the reporter gene chloramphenicol acetyl transferase (CAT) when transfected into C2C12 mouse myoblasts. However, four E-boxes are present in the first intron of the DM gene and transient assays show increased expression of the CAT gene when the first intron is present downstream of these 5{prime} UPS in an orientation dependent manner. Comparison between mouse and human sequence reveals that the regions in the first intron where the E-boxes are located are highly conserved. The mapping of the promoter and the importance of the first intron in the control of DMK expression will be presented.

  4. Characterization of a barley Rubisco activase gene promoter

    SciTech Connect

    Strickland, J.A.; Rundle, S.J.; Zielinski, R. )


    Barley Rubisco Activase (Rca) is a nuclear encoded chloroplast enzyme that activates Rubisco to catalytic competence. Rca mRNA accumulation in barley is light-regulated; the 5{prime}-flanking region of a highly expressed barley Rca gene (HvRca-1) contains several sequence motifs similar to those found in the promoter of other light-regulated, nuclear genes. We have characterized the cis-acting regulatory regions of HvRca-1 by deletion analysis of the 5{prime} flanking region of a cloned gene. These constructs have been assayed in vitro by gel mobility shift assays, as well as by DNA footprinting. Putative regulatory sequences detected in vitro have also been tested in vivo by constructing chimeric genes consisting of deletion mutant promoters fused to a promoterless {beta}-glucuronidase reporter gene. Comparison of results obtained from complimentary parallel in vitro and in vivo assays of identical promoter deletions have provided information on cis-acting regulatory regions of HvRca-1.

  5. Universal light-switchable gene promoter system


    Quail, Peter H.; Huq, Enamul; Tepperman, James; Sato, Sae


    An artificial promoter system that can be fused upstream of any desired gene enabling reversible induction or repression of the expression of the gene at will in any suitable host cell or organisms by light is described. The design of the system is such that a molecule of the plant photoreceptor phytochrome is targeted to the specific DNA binding site in the promoter by a protein domain that is fused to the phytochrome and that specifically recognizes this binding site. This bound phytochrome, upon activation by light, recruits a second fusion protein consisting of a protein that binds to phytochrome only upon light activation and a transcriptional activation domain that activates expression of the gene downstream of the promoter.

  6. PlantProm: a database of plant promoter sequences

    PubMed Central

    Shahmuradov, Ilham A.; Gammerman, Alex J.; Hancock, John M.; Bramley, Peter M.; Solovyev, Victor V.


    PlantProm DB, a plant promoter database, is an annotated, non-redundant collection of proximal promoter sequences for RNA polymerase II with experimentally determined transcription start site(s), TSS, from various plant species. The first release (2002.01) of PlantProm DB contains 305 entries including 71, 220 and 14 promoters from monocot, dicot and other plants, respectively. It provides DNA sequence of the promoter regions (−200 : +51) with TSS on the fixed position +201, taxonomic/promoter type classification of promoters and Nucleotide Frequency Matrices (NFM) for promoter elements: TATA-box, CCAAT-box and TSS-motif (Inr). Analysis of TSS-motifs revealed that their composition is different in dicots and monocots, as well as for TATA and TATA-less promoters. The database serves as learning set in developing plant promoter prediction programs. One such program (TSSP) based on discriminant analysis has been created by Softberry Inc. and the application of a support ftp: vector machine approach for promoter identification is under development. PlantProm DB is available at and PMID:12519961

  7. Nemertean toxin genes revealed through transcriptome sequencing.


    Whelan, Nathan V; Kocot, Kevin M; Santos, Scott R; Halanych, Kenneth M


    Nemerteans are one of few animal groups that have evolved the ability to utilize toxins for both defense and subduing prey, but little is known about specific nemertean toxins. In particular, no study has identified specific toxin genes even though peptide toxins are known from some nemertean species. Information about toxin genes is needed to better understand evolution of toxins across animals and possibly provide novel targets for pharmaceutical and industrial applications. We sequenced and annotated transcriptomes of two free-living and one commensal nemertean and annotated an additional six publicly available nemertean transcriptomes to identify putative toxin genes. Approximately 63-74% of predicted open reading frames in each transcriptome were annotated with gene names, and all species had similar percentages of transcripts annotated with each higher-level GO term. Every nemertean analyzed possessed genes with high sequence similarities to known animal toxins including those from stonefish, cephalopods, and sea anemones. One toxin-like gene found in all nemerteans analyzed had high sequence similarity to Plancitoxin-1, a DNase II hepatotoxin that may function well at low pH, which suggests that the acidic body walls of some nemerteans could work to enhance the efficacy of protein toxins. The highest number of toxin-like genes found in any one species was seven and the lowest was three. The diversity of toxin-like nemertean genes found here is greater than previously documented, and these animals are likely an ideal system for exploring toxin evolution and industrial applications of toxins. © The Author(s) 2014. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  8. Nemertean Toxin Genes Revealed through Transcriptome Sequencing

    PubMed Central

    Whelan, Nathan V.; Kocot, Kevin M.; Santos, Scott R.; Halanych, Kenneth M.


    Nemerteans are one of few animal groups that have evolved the ability to utilize toxins for both defense and subduing prey, but little is known about specific nemertean toxins. In particular, no study has identified specific toxin genes even though peptide toxins are known from some nemertean species. Information about toxin genes is needed to better understand evolution of toxins across animals and possibly provide novel targets for pharmaceutical and industrial applications. We sequenced and annotated transcriptomes of two free-living and one commensal nemertean and annotated an additional six publicly available nemertean transcriptomes to identify putative toxin genes. Approximately 63–74% of predicted open reading frames in each transcriptome were annotated with gene names, and all species had similar percentages of transcripts annotated with each higher-level GO term. Every nemertean analyzed possessed genes with high sequence similarities to known animal toxins including those from stonefish, cephalopods, and sea anemones. One toxin-like gene found in all nemerteans analyzed had high sequence similarity to Plancitoxin-1, a DNase II hepatotoxin that may function well at low pH, which suggests that the acidic body walls of some nemerteans could work to enhance the efficacy of protein toxins. The highest number of toxin-like genes found in any one species was seven and the lowest was three. The diversity of toxin-like nemertean genes found here is greater than previously documented, and these animals are likely an ideal system for exploring toxin evolution and industrial applications of toxins. PMID:25432940

  9. Draft Genome Sequence of Plant Growth-Promoting Rhizobacterium Pantoea sp. Strain AS-PWVM4.


    Khatri, Indu; Kaur, Sukhvir; Devi, Usha; Kumar, Navinder; Sharma, Deepak; Subramanian, Srikrishna; Saini, Adesh K


    Nonpathogenic Pantoea spp. have been shown to confer biofertilizer and biocontrol activities, indicating their potential for increasing crop yield. Herein, we provide the high-quality genome sequence of Pantoea sp. strain AS-PWVM4, a Gram-negative motile plant growth-promoting rhizobacterium isolated from a pomegranate plant. The 4.9-Mb genome contains genes related to plant growth promotion and the synthesis of siderophores.

  10. A calcium-sensitive promoter construct for gene therapy.


    Merlet, E; Lipskaia, L; Marchand, A; Hadri, L; Mougenot, N; Atassi, F; Liang, L; Hatem, S N; Hajjar, R J; Lompré, A-M


    Targeting diseased cells is a challenging issue in both pharmacological and biological therapeutics. Gene therapy is emerging as a novel approach for treating rare diseases and for illnesses for which there is no other alternative. An important limitation of gene therapy has been the off-target effects and therefore efforts have been focused on increasing the specificity of gene transfer to the targeted organ. Here, we describe a promoter containing six nuclear factor of activated T cells (NFAT) consensus sequences, which is as efficient as the cytomegalovirus (CMV) promoter to drive expression in vascular smooth muscle cells both in vitro and in vivo. In contrast to the CMV promoter it is activated in a Ca(2+)-dependent manner after endoplasmic reticulum depletion and allows the transgene expression only in proliferative/diseased cells. Overexpression of sarco/endoplasmic reticulum (SR/ER) Ca(2+) ATPase 2a under the control of this NFAT promoter inhibits restenosis after angioplasty in rats. In conclusion, this promoter may be useful for gene therapy in vascular proliferative diseases and other diseases involving upregulation of the NFAT pathway.

  11. Draft Genome Sequence of a Diazotrophic, Plant Growth–Promoting Rhizobacterium of the Pseudomonas syringae Complex

    PubMed Central

    Jeong, Haeyoung; Blakney, Andrew J. C.; Wallace, Natalie


    We report here the draft genome sequence of Pseudomonas syringae GR12-2, a nitrogen-fixing, plant growth–promoting bacterium, isolated from the rhizosphere of an Arctic grass. The 6.6-Mbp genome contains 5,676 protein-coding genes, including a nitrogen-fixation island similar to that in P. stutzeri. PMID:27660794

  12. Draft Genome Sequence of a Diazotrophic, Plant Growth-Promoting Rhizobacterium of the Pseudomonas syringae Complex.


    Patten, Cheryl L; Jeong, Haeyoung; Blakney, Andrew J C; Wallace, Natalie


    We report here the draft genome sequence of Pseudomonas syringae GR12-2, a nitrogen-fixing, plant growth-promoting bacterium, isolated from the rhizosphere of an Arctic grass. The 6.6-Mbp genome contains 5,676 protein-coding genes, including a nitrogen-fixation island similar to that in P. stutzeri.

  13. Genome sequence of the plant growth-promoting rhizobacterium Bacillus sp. strain 916.


    Wang, Xiaoyu; Luo, Chuping; Chen, Zhiyi


    Bacillus sp. strain 916, isolated from the soil, showed strong activity against Rhizoctonia solani. Here, we present the high-quality draft genome sequence of Bacillus sp. strain 916. Its 3.9-Mb genome reveals a number of genes whose products are possibly involved in promotion of plant growth or antibiosis.

  14. Nucleotide sequence of the rrnG ribosomal RNA promoter region of Escherichia coli.

    PubMed Central

    Shen, W F; Squires, C; Squires, C L


    The primary structure of the promoter region for a ribosomal RNA transcription unit (rrnG) of Escherichia coli K12 has been determined. The sequence was obtained from 1 1.5 kbp EcoRI fragment derived from the hybrid plasmid pLC23-30. This fragment contains 455 bp preceding P1 of the rrnG promoter region and 674 bp of the rrnG 16S RNA gene. The sequence before the rrnG promoter region contains an open reading frame (ORF-BG) followed by a possible hairpin structure that resembles other known transcription terminators. The sequence of the rrnG promoter region is similar but not identical to that of rrnA and rrnB. Several minor differences between the sequences of the 16S RNA genes of rrnG and rrnB were also noted. In addition, sequences were found that could generate special structures involving the promoter regions of rrn loci. Such structures are described and their possible involvement in the regulation of ribosomal RNA synthesis is discussed. PMID:6285294

  15. DNA sequence of the Escherichia coli tonB gene.

    PubMed Central

    Postle, K; Good, R F


    The nucleotide sequence of a cloned section of the Escherichia coli chromosome containing the tonB gene has been determined. Transcription initiation and termination sites for tonB RNA have been determined by S1 nuclease mapping. The tonB promoter and terminator resemble other E. coli promoters and terminators; the sequence of the tonB terminator region suggests that it may function bidirectionally. The DNA sequence specifies an open translation reading frame between the 5' and 3' RNA termini whose location is consistent with the position of previously isolated tonB::IS1 mutations. The DNA sequence predicts a proline-rich protein with a calculated size of 26.1-26.6 kilodaltons (239-244 amino acids), depending on which of three potential initiation codons is utilized. The predicted NH2 terminus of tonB protein resembles the proteolytically cleaved signal sequences of E. coli periplasmic and outer membrane proteins; the overall hydrophilic character of the protein sequence suggests that the bulk of the tonB protein is not embedded within the inner or outer membrane. A significant discrepancy exists between the calculated size of tonB protein and the apparent size of 36 kilodaltons determined by sodium dodecyl sulfate/polyacrylamide gel electrophoresis. Images PMID:6310567

  16. Non-contiguous finished genome sequence of plant-growth promoting Serratia proteamaculans S4

    PubMed Central

    Goodwin, Lynne A.; Högberg, Nils; Kyrpides, Nikos C.; Alström, Sadhna; Bruce, David; Quintana, Beverly; Munk, Christine; Daligault, Hajnalka; Teshima, Hazuki; Davenport, Karen; Reitenga, Krista; Green, Lance; Chain, Patrick; Erkkila, Tracy; Gu, Wei; Zhang, Xiaojing; Xu, Yan; Kunde, Yulia; Chertkov, Olga; Han, James; Han, Cliff; Detter, John C.; Ivanova, Natalia; Pati, Amrita; Chen, Amy; Szeto, Ernest; Mavromatis, Kostas; Huntemann, Marcel; Nolan, Matt; Pitluck, Sam; Deshpande, Shweta; Markowitz, Victor; Pagani, Ioanna; Klenk, Hans-Peter; Woyke, Tanja; Finlay, Roger D.


    Serratia proteamaculans S4 (previously Serratia sp. S4), isolated from the rhizosphere of wild Equisetum sp., has the ability to stimulate plant growth and to suppress the growth of several soil-borne fungal pathogens of economically important crops. Here we present the non-contiguous, finished genome sequence of S. proteamaculans S4, which consists of a 5,324,944 bp circular chromosome and a 129,797 bp circular plasmid. The chromosome contains 5,008 predicted genes while the plasmid comprises 134 predicted genes. In total, 4,993 genes are assigned as protein-coding genes. The genome consists of 22 rRNA genes, 82 tRNA genes and 58 pseudogenes. This genome is a part of the project “Genomics of four rapeseed plant growth-promoting bacteria with antagonistic effect on plant pathogens” awarded through the 2010 DOE-JGI’s Community Sequencing Program. PMID:24501629

  17. Non-contiguous finished genome sequence of plant-growth promoting Serratia proteamaculans S4.


    Neupane, Saraswoti; Goodwin, Lynne A; Högberg, Nils; Kyrpides, Nikos C; Alström, Sadhna; Bruce, David; Quintana, Beverly; Munk, Christine; Daligault, Hajnalka; Teshima, Hazuki; Davenport, Karen; Reitenga, Krista; Green, Lance; Chain, Patrick; Erkkila, Tracy; Gu, Wei; Zhang, Xiaojing; Xu, Yan; Kunde, Yulia; Chertkov, Olga; Han, James; Han, Cliff; Detter, John C; Ivanova, Natalia; Pati, Amrita; Chen, Amy; Szeto, Ernest; Mavromatis, Kostas; Huntemann, Marcel; Nolan, Matt; Pitluck, Sam; Deshpande, Shweta; Markowitz, Victor; Pagani, Ioanna; Klenk, Hans-Peter; Woyke, Tanja; Finlay, Roger D


    Serratia proteamaculans S4 (previously Serratia sp. S4), isolated from the rhizosphere of wild Equisetum sp., has the ability to stimulate plant growth and to suppress the growth of several soil-borne fungal pathogens of economically important crops. Here we present the non-contiguous, finished genome sequence of S. proteamaculans S4, which consists of a 5,324,944 bp circular chromosome and a 129,797 bp circular plasmid. The chromosome contains 5,008 predicted genes while the plasmid comprises 134 predicted genes. In total, 4,993 genes are assigned as protein-coding genes. The genome consists of 22 rRNA genes, 82 tRNA genes and 58 pseudogenes. This genome is a part of the project "Genomics of four rapeseed plant growth-promoting bacteria with antagonistic effect on plant pathogens" awarded through the 2010 DOE-JGI's Community Sequencing Program.

  18. Molecular cloning and analysis of the Catsper1 gene promoter.


    Mata-Rocha, Minerva; Alvarado-Cuevas, Edith; Hernández-Sánchez, Javier; Cerecedo, Doris; Felix, Ricardo; Hernández-Reyes, Adriana; Tesoro-Cruz, Emiliano; Oviedo, Norma


    CatSper channels are essential for hyperactivity of sperm flagellum, progesterone-mediated chemotaxis and oocyte fertilization. Catsper genes are exclusively expressed in the testis during spermatogenesis, but the function and regulation of the corresponding promoter regions are unknown. Here, we report the cloning and characterization of the promoter regions in the human and murine Catsper1 genes. These promoter regions were identified and isolated from genomic DNA, and transcriptional activities were tested in vitro after transfection into human embryonic kidney 293, mouse Sertoli cells 1 and GC-1spg cell lines as well as by injecting plasmids directly into mouse testes. Although the human and murine Catsper1 promoters lacked a TATA box, a well-conserved CRE site was identified. Both sequences may be considered as TATAless promoters because their transcriptional activity was not affected after deletion of TATA box-like sites. Several transcription initiation sites were revealed by RNA ligase-mediated rapid amplification of the cDNA 5'-ends. We also found that the immediate upstream region and the first exon in the human CATSPER1 gene negatively regulate transcriptional activity. In the murine Catsper1 promoter, binding sites for transcription factors SRY, SOX9 and CREB were protected by the presence of nuclear testis proteins in DNAse degradation assays. Likewise, the mouse Catsper1 promoter exhibited transcriptional activity in both orientations and displayed significant expression levels in mouse testis in vivo, whereas the suppression of transcription signals in the promoter resulted in low expression levels. This study, thus, represents the first identification of the transcriptional control regions in the genes encoding the human and murine CatSper channels.

  19. A Leader Intron of a Soybean Elongation Factor 1A (eEF1A) Gene Interacts with Proximal Promoter Elements to Regulate Gene Expression in Synthetic Promoters

    PubMed Central

    Zhang, Ning; McHale, Leah K.; Finer, John J.


    Introns, especially the first intron in the 5’ untranslated region (5’UTR), can significantly impact gene expression via intron-mediated enhancement (IME). In this study, we demonstrate the leader intron of a soybean elongation factor 1A (eEF1A) gene (GmScreamM8) was essential for the high activity of the native promoter. Furthermore, the interaction of the GmScreamM8 leader intron with regulatory element sequences from several soybean eEF1A promoters was studied using synthetic promoters, which consisted of element tetramers upstream of a core promoter used to regulate a green fluorescent protein (gfp) reporter gene. Element tetramers, placed upstream of a GmScreamM8 core promoter, showed very high activity using both transient expression in lima bean cotyledons and stable expression in soybean hairy roots, only if the native leader intron was included, suggesting an interaction between intronic sequences and promoter elements. Partial deletions of the leader intron showed that a 222 bp intronic sequence significantly contributed to very high levels of GFP expression. Generation of synthetic intron variants with a monomeric or trimeric repeat of the 222 bp intronic sequence, yielded almost two-fold higher expression compared to the original intron, while partial deletion of the 222 bp intronic repeated sequence significantly decreased gene expression, indicating that this intronic sequence was essential for the intron-element interaction enhancement. PMID:27806110

  20. A Leader Intron of a Soybean Elongation Factor 1A (eEF1A) Gene Interacts with Proximal Promoter Elements to Regulate Gene Expression in Synthetic Promoters.


    Zhang, Ning; McHale, Leah K; Finer, John J


    Introns, especially the first intron in the 5' untranslated region (5'UTR), can significantly impact gene expression via intron-mediated enhancement (IME). In this study, we demonstrate the leader intron of a soybean elongation factor 1A (eEF1A) gene (GmScreamM8) was essential for the high activity of the native promoter. Furthermore, the interaction of the GmScreamM8 leader intron with regulatory element sequences from several soybean eEF1A promoters was studied using synthetic promoters, which consisted of element tetramers upstream of a core promoter used to regulate a green fluorescent protein (gfp) reporter gene. Element tetramers, placed upstream of a GmScreamM8 core promoter, showed very high activity using both transient expression in lima bean cotyledons and stable expression in soybean hairy roots, only if the native leader intron was included, suggesting an interaction between intronic sequences and promoter elements. Partial deletions of the leader intron showed that a 222 bp intronic sequence significantly contributed to very high levels of GFP expression. Generation of synthetic intron variants with a monomeric or trimeric repeat of the 222 bp intronic sequence, yielded almost two-fold higher expression compared to the original intron, while partial deletion of the 222 bp intronic repeated sequence significantly decreased gene expression, indicating that this intronic sequence was essential for the intron-element interaction enhancement.

  1. Viral promoters can initiate expression of toxin genes introduced into Escherichia coli.


    Lewin, Astrid; Mayer, Martin; Chusainow, Janet; Jacob, Daniela; Appel, Bernd


    The expression of recombinant proteins in eukaryotic cells requires the fusion of the coding region to a promoter functional in the eukaryotic cell line. Viral promoters are very often used for this purpose. The preceding cloning procedures are usually performed in Escherichia coli and it is therefore of interest if the foreign promoter results in an expression of the gene in bacteria. In the case molecules toxic for humans are to be expressed, this knowledge is indispensable for the specification of safety measures. We selected five frequently used viral promoters and quantified their activity in E. coli with a reporter system. Only the promoter from the thymidine kinase gene from HSV1 showed no activity, while the polyhedrin promoter from baculovirus, the early immediate CMV promoter, the early SV40 promoter and the 5' LTR promoter from HIV-1 directed gene expression in E. coli. The determination of transcription start sites in the immediate early CMV promoter and the polyhedrin promoter confirmed the existence of bacterial -10 and -35 consensus sequences. The importance of this heterologous gene expression for safety considerations was further supported by analysing fusions between the aforementioned promoters and a promoter-less cytotoxin gene. According to our results a high percentage of viral promoters have the ability of initiating gene expression in E. coli. The degree of such heterologous gene expression can be sufficient for the expression of toxin genes and must therefore be considered when defining safety measures for the handling of corresponding genetically modified organisms.

  2. Viral promoters can initiate expression of toxin genes introduced into Escherichia coli

    PubMed Central

    Lewin, Astrid; Mayer, Martin; Chusainow, Janet; Jacob, Daniela; Appel, Bernd


    Background The expression of recombinant proteins in eukaryotic cells requires the fusion of the coding region to a promoter functional in the eukaryotic cell line. Viral promoters are very often used for this purpose. The preceding cloning procedures are usually performed in Escherichia coli and it is therefore of interest if the foreign promoter results in an expression of the gene in bacteria. In the case molecules toxic for humans are to be expressed, this knowledge is indispensable for the specification of safety measures. Results We selected five frequently used viral promoters and quantified their activity in E. coli with a reporter system. Only the promoter from the thymidine kinase gene from HSV1 showed no activity, while the polyhedrin promoter from baculovirus, the early immediate CMV promoter, the early SV40 promoter and the 5' LTR promoter from HIV-1 directed gene expression in E. coli. The determination of transcription start sites in the immediate early CMV promoter and the polyhedrin promoter confirmed the existence of bacterial -10 and -35 consensus sequences. The importance of this heterologous gene expression for safety considerations was further supported by analysing fusions between the aforementioned promoters and a promoter-less cytotoxin gene. Conclusion According to our results a high percentage of viral promoters have the ability of initiating gene expression in E. coli. The degree of such heterologous gene expression can be sufficient for the expression of toxin genes and must therefore be considered when defining safety measures for the handling of corresponding genetically modified organisms. PMID:15967027

  3. Promoter region of mouse Tcrg genes

    SciTech Connect

    Ishimi, Y.; Huang, Y.Y.; Ohta, S.


    The mouse T-cell receptor (Tcr){gamma} chain is characterized by a specific expression of V gene segments in the thymus corresponding to consecutive developmental stages; i.e., the Vg5 in fetal, Vg6 in neonatal, and Vg4 and Vg7 in adult. The order of the Vg gene usage correlates with the localization of the Vg gene segment on the chromosome; i.e., the Vg5 gene, being most proximal to the Jg1, is used first, followed by the Vg segments away from the Jg1 in a sequential manner. Since they all rearrange to the same Jg1 gene segment, the sequences in the coding region and/or in the 5{prime} upstream region are responsible for the stage-specific transcription. Also, Goldman and co-workers reported the germline transcription of Vg genes preceding their rearrangement. Therefore, the stage-specific transcription may be involved in the regulation of the stage-specific rearrangement; we sequenced and analyzed the 5{prime} flanking regions of the Vg5, Vg6, Vg4, and Vg7 genes to study the transcriptional relation. 18 refs., 2 figs., 1 tab.

  4. Extensive Methylation of Promoter Sequences Silences Lentiviral Transgene Expression During Stem Cell Differentiation In Vivo

    PubMed Central

    Herbst, Friederike; Ball, Claudia R; Tuorto, Francesca; Nowrouzi, Ali; Wang, Wei; Zavidij, Oksana; Dieter, Sebastian M; Fessler, Sylvia; van der Hoeven, Franciscus; Kloz, Ulrich; Lyko, Frank; Schmidt, Manfred; von Kalle, Christof; Glimm, Hanno


    Lentiviral vectors (LV) are widely used to stably transfer genes into target cells investigating or treating gene functions. In addition, gene transfer into early murine embryos may be improved to efficiently generate transgenic mice. We applied lentiviral gene transfer to generate a mouse model transgenic for SET binding protein-1 (Setbp1) and enhanced green fluorescent protein (eGFP). Neither transgenic founders nor their vector-positive offspring transcribed or expressed the transgenes. Bisulfite sequencing of the internal spleen focus-forming virus (SFFV) promoter demonstrated extensive methylation of all analyzed CpGs in the transgenic mice. To analyze the impact of Setbp1 on epigenetic silencing, embryonic stem cells (ESC) were differentiated into cardiomyocytes (CM) in vitro. In contrast to human promoters in LV, virally derived promoter sequences were strongly methylated during differentiation, independent of the transgene. Moreover, the commonly used SFFV promoter (SFFVp) was highly methylated with remarkable strength and frequency during hematopoietic differentiation in vivo in LV but less in γ-retroviral (γ-RV) backbones. In summary, we conclude that LV using an internal SFFVp are not suitable to generate transgenic mice or perform constitutive expression studies in differentiating cells. Choosing the appropriate promoter is also crucial to allow stable transgene expression in clinical gene therapy. PMID:22434137

  5. Transcriptome sequencing revealed significant alteration of cortical promoter usage and splicing in schizophrenia.


    Wu, Jing Qin; Wang, Xi; Beveridge, Natalie J; Tooney, Paul A; Scott, Rodney J; Carr, Vaughan J; Cairns, Murray J


    While hybridization based analysis of the cortical transcriptome has provided important insight into the neuropathology of schizophrenia, it represents a restricted view of disease-associated gene activity based on predetermined probes. By contrast, sequencing technology can provide un-biased analysis of transcription at nucleotide resolution. Here we use this approach to investigate schizophrenia-associated cortical gene expression. The data was generated from 76 bp reads of RNA-Seq, aligned to the reference genome and assembled into transcripts for quantification of exons, splice variants and alternative promoters in postmortem superior temporal gyrus (STG/BA22) from 9 male subjects with schizophrenia and 9 matched non-psychiatric controls. Differentially expressed genes were then subjected to further sequence and functional group analysis. The output, amounting to more than 38 Gb of sequence, revealed significant alteration of gene expression including many previously shown to be associated with schizophrenia. Gene ontology enrichment analysis followed by functional map construction identified three functional clusters highly relevant to schizophrenia including neurotransmission related functions, synaptic vesicle trafficking, and neural development. Significantly, more than 2000 genes displayed schizophrenia-associated alternative promoter usage and more than 1000 genes showed differential splicing (FDR<0.05). Both types of transcriptional isoforms were exemplified by reads aligned to the neurodevelopmentally significant doublecortin-like kinase 1 (DCLK1) gene. This study provided the first deep and un-biased analysis of schizophrenia-associated transcriptional diversity within the STG, and revealed variants with important implications for the complex pathophysiology of schizophrenia.

  6. Alternative promoters of gene MAGE4a

    SciTech Connect

    De Plaen, E.; Naerhuyzen, B.; De Smet, C.


    Gene MAGE-4 (HGMW-approved symbol MAGE4) is expressed in several types of tumors, but not in normal tissues, except testis and placenta. The 5{prime} end of this gene contains eight homologous exons spread over a 5.8-kb region. These exons are alternatively spliced to a unique second exon and a unique third exon, which encodes a protein of 317 amino acids. The analysis of transcripts found in testis, placenta, and a sarcoma cell line showed that each of the alternative first exons is used in at least one of these tissues. Various regions of the promoter of the fifth alternative exon (1.5) were cloned in a luciferase reporter plasmid, and the constructs were transfected in a sarcoma cell line that expresses MAGE-4. Two Ets motifs located between positions -70 and -29 relative to the transcription start site were found to drive 55% of the promoter activity. A region containing an Sp1 consensus binding site located upstream of the two Ets motifs was found to be responsible for 44% of the transcriptional activity. MAGE-4a promoters 1.4 and 1.6, which also contain the Sp1 and the two Ets binding motifs, supported a level of transcription comparable to that of promoter 1.5, whereas promoter 1.1, which contains only one Ets binding site, was sixfold less active. In line with observations made with gene MAGE-1 (HGMW-approved symbol MAGE1), we found that promoter 1.5 stimulated a high level of transcription in a melanoma cell line that does not express MAGE-4. This suggests that the tumor-specific expression of MAGE genes is not determined by the presence of specific transcription factors. 26 refs., 7 figs., 2 tabs.

  7. The evolution of Runx genes I. A comparative study of sequences from phylogenetically diverse model organisms

    PubMed Central

    Rennert, Jessica; Coffman, James A; Mushegian, Arcady R; Robertson, Anthony J


    Background Runx genes encode proteins defined by the highly conserved Runt DNA-binding domain. Studies of Runx genes and proteins in model organisms indicate that they are key transcriptional regulators of animal development. However, little is known about Runx gene evolution. Results A phylogenetically broad sampling of publicly available Runx gene sequences was collected. In addition to the published sequences from mouse, sea urchin, Drosophila melanogaster and Caenorhabditis elegans, we collected several previously uncharacterised Runx sequences from public genome sequence databases. Among deuterostomes, mouse and pufferfish each contain three Runx genes, while the tunicate Ciona intestinalis and the sea urchin Strongylocentrotus purpuratus were each found to have only one Runx gene. Among protostomes, C. elegans has a single Runx gene, while Anopheles gambiae has three and D. melanogaster has four, including two genes that have not been previously described. Comparative sequence analysis reveals two highly conserved introns, one within and one just downstream of the Runt domain. All vertebrate Runx genes utilize two alternative promoters. Conclusions In the current public sequence database, the Runt domain is found only in bilaterians, suggesting that it may be a metazoan invention. Bilaterians appear to ancestrally contain a single Runx gene, suggesting that the multiple Runx genes in vertebrates and insects arose by independent duplication events within those respective lineages. At least two introns were present in the primordial bilaterian Runx gene. Alternative promoter usage arose prior to the duplication events that gave rise to three Runx genes in vertebrates. PMID:12659662

  8. Sequence and detailed organization of the human caveolin-1 and -2 genes located near the D7S522 locus (7q31.1). Methylation of a CpG island in the 5' promoter region of the caveolin-1 gene in human breast cancer cell lines.


    Engelman, J A; Zhang, X L; Lisanti, M P


    The CA microsatellite repeat marker, D7S522, is located at the center of a approximately 1000 kb smallest common deleted region that is lost in many forms of human cancer. It has been proposed that a putative tumor suppressor gene lies in close proximity to D7S522, within this smallest common deleted region. However, the genes located in proximity to D7S522 have remained elusive. Recently, we identified five independent BAC clones (approximately 100-200 kb) containing D7S522 and the human genes encoding caveolins 1 and 2. Here, we present the detailed organization of the caveolin locus and its relationship to D7S522, as deduced using a shot-gun sequencing approach. We derived two adjacent contigs for a total coverage of approximately 250 kb. Analysis of these contigs reveals that D7S522 is located approximately 67 kb upstream of the caveolin-2 gene and that the caveolin-2 gene is located approximately 19 kb upstream of the caveolin-1 gene, providing for the first time a detailed genetic map of this region. Further sequence analysis reveals many interesting features of the caveolin genes; these include the intron-exon boundaries and several previously unrecognized CA repeats that lie within or in close proximity to the caveolin genes. The first and second exons of both caveolin genes are embedded within CpG islands. These results suggest that regulation of caveolin gene expression may be controlled, in part, by methylation of these CpG regions. In support of this notion, we show here that the CGs in the 5' promoter region of the caveolin-1 gene are functionally methylated in two human breast cancer cell lines (MCF7 and T-47D) that fail to express the caveolin-1 protein. In contrast, the same CGs in cultured normal human mammary epithelial cells (NHMECs) are non-methylated and these cells express high levels of the caveolin-1 protein. Comparison of the human locus with the same locus in the pufferfish Fugu rubripes reveals that the overall organization of the

  9. Predicting promoter activities of primary human DNA sequences

    PubMed Central

    Irie, Takuma; Park, Sung-Joon; Yamashita, Riu; Seki, Masahide; Yada, Tetsushi; Sugano, Sumio; Nakai, Kenta; Suzuki, Yutaka


    We developed a computer program that can predict the intrinsic promoter activities of primary human DNA sequences. We observed promoter activity using a quantitative luciferase assay and generated a prediction model using multiple linear regression. Our program achieved a prediction accuracy correlation coefficient of 0.87 between the predicted and observed promoter activities. We evaluated the prediction accuracy of the program using massive sequencing analysis of transcriptional start sites in vivo. We found that it is still difficult to predict transcript levels in a strictly quantitative manner in vivo; however, it was possible to select active promoters in a given cell from the other silent promoters. Using this program, we analyzed the transcriptional landscape of the entire human genome. We demonstrate that many human genomic regions have potential promoter activity, and the expression of some previously uncharacterized putatively non-protein-coding transcripts can be explained by our prediction model. Furthermore, we found that nucleosomes occasionally formed open chromatin structures with RNA polymerase II recruitment where the program predicted significant promoter activities, although no transcripts were observed. PMID:21486745

  10. The Complete Genome Sequence of the Plant Growth-Promoting Bacterium Pseudomonas sp. UW4

    PubMed Central

    Duan, Jin; Jiang, Wei; Cheng, Zhenyu; Heikkila, John J.; Glick, Bernard R.


    The plant growth-promoting bacterium (PGPB) Pseudomonas sp. UW4, previously isolated from the rhizosphere of common reeds growing on the campus of the University of Waterloo, promotes plant growth in the presence of different environmental stresses, such as flooding, high concentrations of salt, cold, heavy metals, drought and phytopathogens. In this work, the genome sequence of UW4 was obtained by pyrosequencing and the gaps between the contigs were closed by directed PCR. The P. sp. UW4 genome contains a single circular chromosome that is 6,183,388 bp with a 60.05% G+C content. The bacterial genome contains 5,423 predicted protein-coding sequences that occupy 87.2% of the genome. Nineteen genomic islands (GIs) were predicted and thirty one complete putative insertion sequences were identified. Genes potentially involved in plant growth promotion such as indole-3-acetic acid (IAA) biosynthesis, trehalose production, siderophore production, acetoin synthesis, and phosphate solubilization were determined. Moreover, genes that contribute to the environmental fitness of UW4 were also observed including genes responsible for heavy metal resistance such as nickel, copper, cadmium, zinc, molybdate, cobalt, arsenate, and chromate. Whole-genome comparison with other completely sequenced Pseudomonas strains and phylogeny of four concatenated “housekeeping” genes (16S rRNA, gyrB, rpoB and rpoD) of 128 Pseudomonas strains revealed that UW4 belongs to the fluorescens group, jessenii subgroup. PMID:23516524

  11. Conservation of nif- and species-specific domains within repeated promoter sequences from fast-growing Rhizobium species.

    PubMed Central

    Schofield, P R; Watson, J M


    In the fast-growing Rhizobium species, repeated DNA sequences, which include the promoter region of the nif HDK operon have been described. These repeated sequences are promoters which specifically activate transcription in the endosymbiotic state. Hybridization analysis of these sequences from R. trifolii has revealed that they may be involved in the species-specific activation of the various genes whose transcription they promote. Comparative analysis of various copies of these repeated sequences, from R. trifolii (the clover symbiont) and R. meliloti (the alfalfa symbiont), reveals the presence of domains of intra- and interspecific conservation within the promoter regions. We suggest that these promoter elements represent sites which are involved in the species-specific and general, nif-specific activation of Rhizobium symbiotic genes. PMID:3892479

  12. Tissue-specific activity of the pro-opiomelanocortin gene promoter

    SciTech Connect

    Jeannotte, L.; Trifiro, M.A.; Plante, R.K.; Chamberland, M.; Drouin, J.


    The pro-opiomelanocortin (POMC) gene is specifically expressed in corticotroph cells of the anterior pituitary. To define the POMC promoter sequences responsible for tissue-specific expression, we assessed POMC promoter activity by gene transfer into POMC-expressing pituitary tumor cells (AtT-20) and fibroblast L cells. The rat POMC promoter was only efficiently utilized and correctly transcribed in AtT-20 cells. 5'-End deletion analysis revealed two promoter regions for activity in AtT-20 cells. When tested by fusion to a heterologuous promoter, DNA fragments corresponding to both regions exhibited tissue-specific activity, suggesting the presence of at least two tissue-specific DNA sequence elements within the promoter. In summary, POMC promoter sequences from -480 to -34 base pairs appear sufficient to mimic the specificity of anterior pituitary expression.

  13. High-fidelity promoter profiling reveals widespread alternative promoter usage and transposon-driven developmental gene expression

    PubMed Central

    Batut, Philippe; Dobin, Alexander; Plessy, Charles; Carninci, Piero; Gingeras, Thomas R.


    Many eukaryotic genes possess multiple alternative promoters with distinct expression specificities. Therefore, comprehensively annotating promoters and deciphering their individual regulatory dynamics is critical for gene expression profiling applications and for our understanding of regulatory complexity. We introduce RAMPAGE, a novel promoter activity profiling approach that combines extremely specific 5′-complete cDNA sequencing with an integrated data analysis workflow, to address the limitations of current techniques. RAMPAGE features a streamlined protocol for fast and easy generation of highly multiplexed sequencing libraries, offers very high transcription start site specificity, generates accurate and reproducible promoter expression measurements, and yields extensive transcript connectivity information through paired-end cDNA sequencing. We used RAMPAGE in a genome-wide study of promoter activity throughout 36 stages of the life cycle of Drosophila melanogaster, and describe here a comprehensive data set that represents the first available developmental time-course of promoter usage. We found that >40% of developmentally expressed genes have at least two promoters and that alternative promoters generally implement distinct regulatory programs. Transposable elements, long proposed to play a central role in the evolution of their host genomes through their ability to regulate gene expression, contribute at least 1300 promoters shaping the developmental transcriptome of D. melanogaster. Hundreds of these promoters drive the expression of annotated genes, and transposons often impart their own expression specificity upon the genes they regulate. These observations provide support for the theory that transposons may drive regulatory innovation through the distribution of stereotyped cis-regulatory modules throughout their host genomes. PMID:22936248

  14. High-fidelity promoter profiling reveals widespread alternative promoter usage and transposon-driven developmental gene expression.


    Batut, Philippe; Dobin, Alexander; Plessy, Charles; Carninci, Piero; Gingeras, Thomas R


    Many eukaryotic genes possess multiple alternative promoters with distinct expression specificities. Therefore, comprehensively annotating promoters and deciphering their individual regulatory dynamics is critical for gene expression profiling applications and for our understanding of regulatory complexity. We introduce RAMPAGE, a novel promoter activity profiling approach that combines extremely specific 5'-complete cDNA sequencing with an integrated data analysis workflow, to address the limitations of current techniques. RAMPAGE features a streamlined protocol for fast and easy generation of highly multiplexed sequencing libraries, offers very high transcription start site specificity, generates accurate and reproducible promoter expression measurements, and yields extensive transcript connectivity information through paired-end cDNA sequencing. We used RAMPAGE in a genome-wide study of promoter activity throughout 36 stages of the life cycle of Drosophila melanogaster, and describe here a comprehensive data set that represents the first available developmental time-course of promoter usage. We found that >40% of developmentally expressed genes have at least two promoters and that alternative promoters generally implement distinct regulatory programs. Transposable elements, long proposed to play a central role in the evolution of their host genomes through their ability to regulate gene expression, contribute at least 1300 promoters shaping the developmental transcriptome of D. melanogaster. Hundreds of these promoters drive the expression of annotated genes, and transposons often impart their own expression specificity upon the genes they regulate. These observations provide support for the theory that transposons may drive regulatory innovation through the distribution of stereotyped cis-regulatory modules throughout their host genomes.

  15. Identification and structural analysis of a ribosomal RNA gene promoter from Thiobacillus ferrooxidans.


    Takamiya, M; Salazar, O; Vargas, D; Jedlicki, E; Orellana, O


    The 5'-terminus of a rRNA operon (rrnT2) from Thiobacillus ferrooxidans was characterized. The rRNA promoters from this microorganism were identified by means of a functional assay in Escherichia coli. DNA sequencing of the promoter region, upstream the 16 S rRNA gene, showed the presence of a consensus sequence for bacterial ribosomal promoters. Other features such as a 'discriminator' sequence, antiterminator elements and an upstream hexanucleotide common to several rRNA operons were also found. Two other putative transcription promoters were also identified.

  16. Polymorphisms in the leptin gene promoter in Brazilian beef herds.


    Guimarães, R C; Azevedo, J S N; Corrêa, S C; Campelo, J E G; Barbosa, E M; Gonçalves, E C; Silva Filho, E


    Brazil is the world's largest producer of beef cattle; however, the quality of its herds needs to be improved. The use of molecular markers as auxiliary tools in selecting animals for reproduction with high pattern for beef production would significantly improve the quality of the final beef product in Brazil. The leptin gene has been demonstrated to be an excellent candidate gene for bovine breeding. The objective of this study was to sequence and compare the leptin gene promoter of Brazil's important cattle breeds in order to identify polymorphisms in it. Blood samples of the Nellore, Guzerat, Tabapuã, and Senepol breeds were collected for genomic DNA extraction. The genomic DNA was used as a template for polymerase chain reaction (PCR) to amplify a 1575-bp fragment, which in turn was sequenced, aligned, and compared between animals of different breeds. Twenty-three single nucleotide polymorphic sites, including transitions and transversions, were detected at positions -1457, -1452, -1446, -1397, -1392, -1361, -1238, -963,-901, -578, -516, -483, -478, -470, -432, -430, -292, -282, -272, -211, -202, -170, and -147. Additionally, two insertion sites at positions -680 and -416 and two deletion sites at positions -1255 and -1059 were detected. As the promoter region of the leptin gene has been demonstrated to vary among breeds, these variations must be tested for their use as potential molecular markers for artificial selection of animals for enhanced beef production in different systems of bovine production in Brazil.

  17. Functional Capacity of Shiga-Toxin Promoter Sequences in Eukaryotic Cells

    PubMed Central

    Mejías, María P.; Fernández-Brando, Romina J.; Panek, Cecilia A.; Ramos, Maria V.; Fernández, Gabriela C.; Isturiz, Martín; Ghiringhelli, Pablo D.; Palermo, Marina S.


    Shiga toxins (Stx) are the main virulence factors in enterohemorrhagic Escherichia coli (EHEC) infections, causing diarrhea and hemolytic uremic syndrome (HUS). The genes encoding for Shiga toxin-2 (Stx2) are located in a bacteriophage. The toxin is formed by a single A subunit and five B subunits, each of which has its own promoter sequence. We have previously reported the expression of the B subunit within the eukaryotic environment, probably driven by their own promoter. The aim of this work was to evaluate the ability of the eukaryotic machinery to recognize stx2 sequences as eukaryotic-like promoters. Vero cells were transfected with a plasmid encoding Stx2 under its own promoter. The cytotoxic effect on these cells was similar to that observed upon incubation with purified Stx2. In addition, we showed that Stx2 expression in Stx2-insensitive BHK eukaryotic cells induced drastic morphological and cytoskeletal changes. In order to directly evaluate the capacity of the wild promoter sequences of the A and B subunits to drive protein expression in mammalian cells, GFP was cloned under eukaryotic-like putative promoter sequences. GFP expression was observed in 293T cells transfected with these constructions. These results show a novel and alternative way to synthesize Stx2 that could contribute to the global understanding of EHEC infections with immediate impact on the development of treatments or vaccines against HUS. PMID:23451160

  18. Functional capacity of Shiga-toxin promoter sequences in eukaryotic cells.


    Bentancor, Leticia V; Bilen, Marcos F; Mejías, María P; Fernández-Brando, Romina J; Panek, Cecilia A; Ramos, Maria V; Fernández, Gabriela C; Isturiz, Martín; Ghiringhelli, Pablo D; Palermo, Marina S


    Shiga toxins (Stx) are the main virulence factors in enterohemorrhagic Escherichia coli (EHEC) infections, causing diarrhea and hemolytic uremic syndrome (HUS). The genes encoding for Shiga toxin-2 (Stx2) are located in a bacteriophage. The toxin is formed by a single A subunit and five B subunits, each of which has its own promoter sequence. We have previously reported the expression of the B subunit within the eukaryotic environment, probably driven by their own promoter. The aim of this work was to evaluate the ability of the eukaryotic machinery to recognize stx2 sequences as eukaryotic-like promoters. Vero cells were transfected with a plasmid encoding Stx2 under its own promoter. The cytotoxic effect on these cells was similar to that observed upon incubation with purified Stx2. In addition, we showed that Stx2 expression in Stx2-insensitive BHK eukaryotic cells induced drastic morphological and cytoskeletal changes. In order to directly evaluate the capacity of the wild promoter sequences of the A and B subunits to drive protein expression in mammalian cells, GFP was cloned under eukaryotic-like putative promoter sequences. GFP expression was observed in 293T cells transfected with these constructions. These results show a novel and alternative way to synthesize Stx2 that could contribute to the global understanding of EHEC infections with immediate impact on the development of treatments or vaccines against HUS.

  19. Nucleotide sequence of the chicken 5-aminolevulinate synthase gene.

    PubMed Central

    Maguire, D J; Day, A R; Borthwick, I A; Srivastava, G; Wigley, P L; May, B K; Elliott, W H


    5-Aminolevulinate synthase, the first and rate-controlling enzyme of heme biosynthesis, is regulated in the liver by the end-product heme. To study this negative control mechanism, we have isolated the chicken gene for ALA-synthase and determined the nucleotide sequence. The structural gene is 6.9 kb long and contains 10 exons. The transcriptional start site for ALA-synthase was determined by primer extension analysis. A fragment of 291 bp from the 5' flanking region including 34 bp of the first exon shows promoter activity when introduced upstream of a chicken histone H2B gene and injected into the nuclei of Xenopus laevis oocytes. Images PMID:3005973

  20. Nucleotide Sequence of the Protective Antigen Gene of Bacillus Anthracis

    DTIC Science & Technology


    which appear to encode a sIgnal peptide having characteristics in common with those of other secreted proteins. A consensus TATAAT sequence was located ...UNCLASSIFIED 4144MIT? @.MICATION OF TWOS Ph" r~ .Ewa ..4 20. ABSTRACT (cont) was located seven bp upstream of the ATG initiation codon. The codon usage f.’r...TATAAT seqc. e was located at the putative -10 promoter site. A Shine-Dalgarno site similar to that found in genes of other Bacillus sp. was located seven

  1. EBNA1 regulates cellular gene expression by binding cellular promoters.


    Canaan, Allon; Haviv, Izhak; Urban, Alexander E; Schulz, Vincent P; Hartman, Steve; Zhang, Zhengdong; Palejev, Dean; Deisseroth, Albert B; Lacy, Jill; Snyder, Michael; Gerstein, Mark; Weissman, Sherman M


    Epstein-Barr virus (EBV) is associated with several types of lymphomas and epithelial tumors including Burkitt's lymphoma (BL), HIV-associated lymphoma, posttransplant lymphoproliferative disorder, and nasopharyngeal carcinoma. EBV nuclear antigen 1 (EBNA1) is expressed in all EBV associated tumors and is required for latency and transformation. EBNA1 initiates latent viral replication in B cells, maintains the viral genome copy number, and regulates transcription of other EBV-encoded latent genes. These activities are mediated through the ability of EBNA1 to bind viral-DNA. To further elucidate the role of EBNA1 in the host cell, we have examined the effect of EBNA1 on cellular gene expression by microarray analysis using the B cell BJAB and the epithelial 293 cell lines transfected with EBNA1. Analysis of the data revealed distinct profiles of cellular gene changes in BJAB and 293 cell lines. Subsequently, chromatin immune-precipitation revealed a direct binding of EBNA1 to cellular promoters. We have correlated EBNA1 bound promoters with changes in gene expression. Sequence analysis of the 100 promoters most enriched revealed a DNA motif that differs from the EBNA1 binding site in the EBV genome.

  2. Mutations of the ompK36 porin gene and promoter impact responses of sequence type 258, KPC-2-producing Klebsiella pneumoniae strains to doripenem and doripenem-colistin.


    Clancy, Cornelius J; Chen, Liang; Hong, Jae H; Cheng, Shaoji; Hao, Binghua; Shields, Ryan K; Farrell, Annie N; Doi, Yohei; Zhao, Yanan; Perlin, David S; Kreiswirth, Barry N; Nguyen, M Hong


    Doripenem-colistin exerts synergy against some, but not all, Klebsiella pneumoniae carbapenemase (KPC)-producing K. pneumoniae strains in vitro. We determined if doripenem MICs and/or ompK36 porin gene mutations impacted the responses of 23 sequence type 258 (ST258), KPC-2-producing strains to the combination of doripenem (8 μg/ml) and colistin (2 μg/ml) during time-kill assays. The median doripenem and colistin MICs were 32 and 4 μg/ml. Doripenem MICs did not correlate with KPC-2 expression levels. Five and 18 strains had wild-type and mutant ompK36, respectively. The most common mutations were IS5 promoter insertions (n = 7) and insertions encoding glycine and aspartic acid at amino acid (aa) positions 134 and 135 (ins aa134-135 GD; n = 8), which were associated with higher doripenem MICs than other mutations or wild-type ompK36 (all P values ≤ 0.04). Bactericidal activity (24 h) was achieved by doripenem-colistin against 12%, 43%, and 75% of ins aa134-135 GD, IS5, and wild-type/other mutants, respectively (P = 0.04). Doripenem-colistin was more active in time-kill studies than colistin at 12 and 24 h if the doripenem MIC was ≤8 μg/ml (P = 0.0007 and 0.09, respectively), but not if the MIC was >8 μg/ml (P = 0.10 and 0.16). Likewise, doripenem-colistin was more active at 12 and 24 h against the wild type/other mutants than ins aa134-135 GD or IS5 mutants (P = 0.007 and 0.0007). By multivariate analysis, the absence of ins aa134-135 GD or IS5 mutations was the only independent predictor of doripenem-colistin responses at 24 h (P = 0.002). In conclusion, ompK36 genotypes identified ST258 KPC-K. pneumoniae strains that were most likely to respond to doripenem-colistin.

  3. Hypermethylation of the caveolin-1 gene promoter in prostate cancer.


    Cui, J; Rohr, L R; Swanson, G; Speights, V O; Maxwell, T; Brothman, A R


    Hypermethylation of CpG islands in the promoter regions of tumor suppressor genes is one mechanism of tumorigenesis. Caveolin-1 (Cav-1), a gene coding for the structural component of cellular caveolae, is involved in cell signaling and has been proposed to be a tumor suppressor gene in several malignancies. This gene maps to 7q31.1, a site known to be deleted in some prostate tumors. We chose to examine the methylation status of the promoter region of Cav-1 to determine whether this gene could function as a tumor suppressor in prostate cancer Genomic DNA from both tumor and normal prostate epithelial cells was obtained from paraffin-embedded prostate sections by laser capture microdissection (LCM). The methylation status of 24 CpG sites at the 5' promoter region of Cav-1 was analyzed by bisulfite-direct-sequencing after amplification by PCR using primers specific for bisulfate modified DNA. Immunohistochemistry staining with a cav-1-specific antibody was also performed to evaluate the expression of the gene Twenty of the 22 (90.9%) informative cases showed promoter hypermethylation in the tumor cell population when compared with adjacent normal prostate cells with an average Methylation Index (potential frequency of total possible methylated Cs) from tumor cells equal to 0.426 vs. 0.186 for normal cells (P = 0.001). While no association with Gleason grade was found, overall increased methylation correlated with PSA failure (P = 0.016), suggestive of clinical recurrence. Elevated immunoreactivity with a Cav-1 antibody was observed in tumor cells from 7 of 26 prostate samples tested; this was associated with a Gleason score but not correlated with PSA failure or Methylation Index CpG sites at the 5' promoter of Cav-1 are more methylated in tumor than in adjacent normal prostate cells. Hypermethylation of the Cav-1 promoter supports the notion that Cav-1 may function as a tumor suppressor gene in prostate cancer and evidence is presented suggesting that methylation

  4. Construction of gene expression system in hop (Humulus lupulus) lupulin gland using valerophenone synthase promoter.


    Okada, Yukio; Saeki, Kazuo; Inaba, Akira; Suda, Narushi; Kaneko, Takafumi; Ito, Kazutoshi


    The promoter region of the valerophenone synthase (VPS) gene was isolated from hop (Humulus lupulus). VPS, a member of the chalcone synthase (CHS) super-family, catalyzes the biosynthesis reaction of the hop resin that significantly accumulates in the cone's secretory gland called the "lupulin gland". The typical H-box and G-box sequences, which exist in many plants' CHS promoters and act as cis-elements for tissue specificity, UV-light induction, etc., were not found in the isolated VPS promoter, although the H-box-like sequence (CCTTACC, CCTAACC) and the core sequence (ACGT) of the G-box were observed. The transformation experiment using the VPS promoter-UIDA gene fusion revealed that the promoter acts not only in the lupulin gland but also in the glands of leaf and stem. On the other hand, the VPS promoter activity was not induced by UV-irradiation.

  5. Gene expression profile of human bone marrow stromal cells: high-throughput expressed sequence tag sequencing analysis.


    Jia, Libin; Young, Marian F; Powell, John; Yang, Liming; Ho, Nicola C; Hotchkiss, Robert; Robey, Pamela Gehron; Francomano, Clair A


    Human bone marrow stromal cells (HBMSC) are pluripotent cells with the potential to differentiate into osteoblasts, chondrocytes, myelosupportive stroma, and marrow adipocytes. We used high-throughput DNA sequencing analysis to generate 4258 single-pass sequencing reactions (known as expressed sequence tags, or ESTs) obtained from the 5' (97) and 3' (4161) ends of human cDNA clones from a HBMSC cDNA library. Our goal was to obtain tag sequences from the maximum number of possible genes and to deposit them in the publicly accessible database for ESTs (dbEST of the National Center for Biotechnology Information). Comparisons of our EST sequencing data with nonredundant human mRNA and protein databases showed that the ESTs represent 1860 gene clusters. The EST sequencing data analysis showed 60 novel genes found only in this cDNA library after BLAST analysis against 3.0 million ESTs in NCBI's dbEST database. The BLAST search also showed the identified ESTs that have close homology to known genes, which suggests that these may be newly recognized members of known gene families. The gene expression profile of this cell type is revealed by analyzing both the frequency with which a message is encountered and the functional categorization of expressed sequences. Comparing an EST sequence with the human genomic sequence database enables assignment of an EST to a specific chromosomal region (a process called digital gene localization) and often enables immediate partial determination of intron/exon boundaries within the genomic structure. It is expected that high-throughput EST sequencing and data mining analysis will greatly promote our understanding of gene expression in these cells and of growth and development of the skeleton.

  6. A new idea for simple and rapid monitoring of gene expression: requirement of nucleotide sequences encoding an N-terminal HA tag in the T7 promoter-driven expression in E. coli.


    Moon, Jeong-Mi; Kim, Goo-Young; Rhim, Hyangshuk


    Mammalian expression vectors are used to overexpress genes of interest in mammalian cells. High temperature requirement protein A1 (HtrA1), used as a specific target, was expressed from the pHA-M-HtrA1 plasmid in HEK293T cells, inducing cell death. Expression of HtrA1 was driven by the pHA-M-HtrA1 mammalian expression vector in E. coli resulting in growth suppression of E. coli in an HtrA1 serine protease-dependent manner. By using various combinations of promoters, target genes and N-terminal tags, the T7 promoter and N-terminal HA tag in the mammalian expression vector were shown to be responsible for expression of target genes in E. coli. Thus the pHA-M-HtrA1 plasmid can be used as a novel, rapid pre-test system for expression and cytotoxicity of the specific target gene in E. coli before assessing its functions in mammalian cells.

  7. Efficient chimeric plant promoters derived from plant infecting viral promoter sequences.


    Acharya, Sefali; Ranjan, Rajiv; Pattanaik, Sitakanta; Maiti, Indu B; Dey, Nrisingha


    In the present study, we developed a set of three chimeric/hybrid promoters namely FSgt-PFlt, PFlt-UAS-2X and MSgt-PFlt incorporating different important domains of Figwort Mosaic Virus sub-genomic transcript promoter (FSgt, -270 to -60), Mirabilis Mosaic Virus sub-genomic transcript promoter (MSgt, -306 to -125) and Peanut Chlorotic Streak Caulimovirus full-length transcript promoter (PFlt-, -353 to +24 and PFlt-UAS, -353 to -49). We demonstrated that these chimeric/hybrid promoters can drive the expression of reporter genes in different plant species including tobacco, Arabidopsis, petunia, tomato and spinach. FSgt-PFlt, PFlt-UAS-2X and MSgt-PFlt promoters showed 4.2, 1.5 and 1.2 times stronger GUS activities compared to the activity of the CaMV35S promoter, respectively, in tobacco protoplasts. Protoplast-derived recombinant promoter driven GFP showed enhanced accumulation compared to that obtained under the CaMV35S promoter. FSgt-PFlt, PFlt-UAS-2X and MSgt-PFlt promoters showed 3.0, 1.3 and 1.0 times stronger activities than the activity of the CaMV35S² (a modified version of the CaMV35S promoter with double enhancer domain) promoter, respectively, in tobacco (Nicotiana tabacum, var. Samsun NN). Alongside, we observed a fair correlation between recombinant promoter-driven GUS accumulation with the corresponding uidA-mRNA level in transgenic tobacco. Histochemical (X-gluc) staining of whole transgenic seedlings and fluorescence images of ImaGene Green™ treated floral parts expressing the GUS under the control of recombinant promoters also support above findings. Furthermore, we confirmed that these chimeric promoters are inducible in the presence of 150 μM salicylic acid (SA) and abscisic acid (ABA). Taken altogether, we propose that SA/ABA inducible chimeric/recombinant promoters could be used for strong expression of gene(s) of interest in crop plants.

  8. Functional activity of the two promoters of the myosin alkali light chain gene in primary muscle cell cultures: comparison with other muscle gene promoters and other culture systems.

    PubMed Central

    Daubas, P; Klarsfeld, A; Garner, I; Pinset, C; Cox, R; Buckingham, M


    Proximal upstream flanking sequences of the mouse myosin alkali light chain gene encoding MLC1F and MLC3F, the mouse alpha-cardiac actin gene and the chicken gene for the alpha-subunit of the acetylcholine receptor were linked to the bacterial chloramphenicol acetyl transferase (CAT) gene and transfected into primary cultures derived from mouse skeletal muscle or into myogenic cell lines. We demonstrate that the mouse MLC1F/MLC3F gene has two functional promoters. In primary muscle cultures, a 1200 bp sequence flanking exon 1 (MLC1F) and a 438 bp sequence flanking exon 2 (MLC3F) direct CAT activity in myotubes, but not in myoblasts or in non myogenic 3T6 and CV1 cells. Developmentally regulated expression is also seen with the alpha-cardiac actin (320 bp) and acetylcholine receptor alpha-subunit (850 bp) upstream sequences in the primary culture system. Transfection experiments with myogenic cell lines show different results with a given promoter construct, reflecting possible differences in the levels of regulatory factors between lines. Different muscle gene promoters behave differently in a given cell line, suggesting different regulatory factor requirements between these promoters. Images PMID:2894633

  9. The first determination of DNA sequence of a specific gene.


    Inouye, Masayori


    How and when the first DNA sequence of a gene was determined? In 1977, F. Sanger came up with an innovative technology to sequence DNA by using chain terminators, and determined the entire DNA sequence of the 5375-base genome of bacteriophage φX 174 (Sanger et al., 1977). While this Sanger's achievement has been recognized as the first DNA sequencing of genes, we had determined DNA sequence of a gene, albeit a partial sequence, 11 years before the Sanger's DNA sequence (Okada et al., 1966).

  10. Nucleotide Sequence of the Akv env Gene

    PubMed Central

    Lenz, Jack; Crowther, Robert; Straceski, Anthony; Haseltine, William


    The sequence of 2,191 nucleotides encoding the env gene of murine retrovirus Akv was determined by using a molecular clone of the Akv provirus. Deduction of the encoded amino acid sequence showed that a single open reading frame encodes a 638-amino acid precursor to gp70 and p15E. In addition, there is a typical leader sequence preceding the amino terminus of gp70. The locations of potential glycosylation sites and other structural features indicate that the entire gp70 molecule and most of p15E are located on the outer side of the membrane. Internal cleavage of the env precursor to generate gp70 and p15E occurs immediately adjacent to several basic amino acids at the carboxyl terminus of gp70. This cleavage generates a region of 42 uncharged, relatively hydrophobic amino acids at the amino terminus of p15E, which is located in a position analogous to the hydrophobic membrane fusion sequence of influenza virus hemagglutinin. The mature polypeptides are predicted to associate with the membrane via a region of 30 uncharged, mostly hydrophobic amino acids located near the carboxyl terminus of p15E. Distal to this membrane association region is a sequence of 35 amino acids at the carboxyl terminus of the env precursor, which is predicted to be located on the inner side of the membrane. By analogy to Moloney murine leukemia virus, a proteolytic cleavage in this region removes the terminal 19 amino acids, thus generating the carboxyl terminus of p15E. This leaves 15 amino acids at the carboxyl terminus of p15E on the inner side of the membrane in a position to interact with virion cores during budding. The precise location and order of the large RNase T1-resistant oligonucleotides in the env region were determined and compared with those from several leukemogenic viruses of AKR origin. This permitted a determination of how the differences in the leukemogenic viruses affect the primary structure of the env gene products. PMID:6283170

  11. Inverted duplication of histone genes in chicken and disposition of regulatory sequences.

    PubMed Central

    Wang, S W; Robins, A J; d'Andrea, R; Wells, J R


    Sequence analysis of an 8.4 kb fragment containing five chicken histone genes shows that an H4-H2A gene pair is duplicated and inverted around a central H3 gene. A left and right region, each of 2.1 kb are 97% homologous and the boundaries of homology coincide with ten base pair repeats. These boundary regions also contain highly conserved gene promoter elements, suggesting that interaction of transcriptional machinery with histone genes may be connected with recombination in promoter regions, resulting in the inverted duplication structure seen in this cluster. PMID:4000938

  12. Analysis of cis-sequence of subgenomic transcript promoter from the Figwort mosaic virus and comparison of promoter activity with the cauliflower mosaic virus promoters in monocot and dicot cells.


    Bhattacharyya, Somnath; Dey, Nrisingha; Maiti, Indu B


    A sub-genomic transcript (Sgt) promoter was isolated from the Figwort mosaic virus (FMV) genomic clone. The FMV Sgt promoter was linked to heterologous coding sequences to form a chimeric gene construct. The 5'-3'-boundaries required for maximal activity and involvement of cis-sequences for optimal expression in plants were defined by 5'-, 3'-end deletion and internal deletion analysis of FMV Sgt promoter fragments coupled with a beta-glucuronidase reporter gene in both transient protoplast expression experiments and in transgenic plants. A 301 bp FMV Sgt promoter fragment (sequence -270 to +31 from the transcription start site; TSS) provided maximum promoter activity. The TSS of the FMV Sgt promoter was determined by primer extension analysis using total RNA from transgenic plants developed for FMV Sgt promoter: uidA fusion gene. An activator domain located upstream of the TATA box at -70 to -100 from TSS is absolutely required for promoter activity and its function is critically position-dependent with respect to TATA box. Two sequence motifs AGATTTTAAT (coordinates -100 to -91) and GTAAGCGC (coordinates -80 to -73) were found to be essential for promoter activity. The FMV Sgt promoter is less active in monocot cells; FMV Sgt promoter expression level was about 27.5-fold higher in tobacco cells compared to that in maize cells. Comparative expression analysis of FMV Sgt promoter with cauliflower mosaic virus (CaMV) 35S promoter showed that the FMV Sgt promoter is about 2-fold stronger than the CaMV 35S promoter. The FMV Sgt promoter is a constitutive promoter; expression level in seedlings was in the order: root>leaf>stem.

  13. GeneMachine: gene prediction and sequence annotation.


    Makalowska, I; Ryan, J F; Baxevanis, A D


    A number of free-standing programs have been developed in order to help researchers find potential coding regions and deduce gene structure for long stretches of what is essentially 'anonymous DNA'. As these programs apply inherently different criteria to the question of what is and is not a coding region, multiple algorithms should be used in the course of positional cloning and positional candidate projects to assure that all potential coding regions within a previously-identified critical region are identified. We have developed a gene identification tool called GeneMachine which allows users to query multiple exon and gene prediction programs in an automated fashion. BLAST searches are also performed in order to see whether a previously-characterized coding region corresponds to a region in the query sequence. A suite of Perl programs and modules are used to run MZEF, GENSCAN, GRAIL 2, FGENES, RepeatMasker, Sputnik, and BLAST. The results of these runs are then parsed and written into ASN.1 format. Output files can be opened using NCBI Sequin, in essence using Sequin as both a workbench and as a graphical viewer. The main feature of GeneMachine is that the process is fully automated; the user is only required to launch GeneMachine and then open the resulting file with Sequin. Annotations can then be made to these results prior to submission to GenBank, thereby increasing the intrinsic value of these data. GeneMachine is freely-available for download at A public Web interface to the GeneMachine server for academic and not-for-profit users is available at The Web supplement to this paper may be found at

  14. Complete genome sequence of the drought resistance-promoting endophyte Klebsiella sp. LTGPAF-6F.


    Zhang, Lei; Zhong, Jun; Liu, Hao; Xin, Kaiyun; Chen, Chaoqiong; Li, Qiqi; Wei, Yahong; Wang, Yao; Chen, Fei; Shen, Xihui


    Bacterial endophytes with capacity to promote plant growth and improve plant tolerance against biotic and abiotic stresses have importance in agricultural practice and phytoremediation. A plant growth-promoting endophyte named Klebsiella sp. LTGPAF-6F, which was isolated from the roots of the desert plant Alhagi sparsifolia in north-west China, exhibits the ability to enhance the growth of wheat under drought stress. The complete genome sequence of this strain consists of one circular chromosome and two circular plasmids. From the genome, we identified genes related to the plant growth promotion and stress tolerance, such as nitrogen fixation, production of indole-3-acetic acid, acetoin, 2,3-butanediol, spermidine and trehalose. This genome sequence provides a basis for understanding the beneficial interactions between LTGPAF-6F and host plants, and will facilitate its applications as biotechnological agents in agriculture. Copyright © 2017 Elsevier B.V. All rights reserved.

  15. Relating Promoter Sequences to the Proteins that Bind to Them: A Comparison Study.

    NASA Astrophysics Data System (ADS)

    Glass, Kimberly


    Chromatin Immunoprecipitation (ChIP-on-ChIP) microarray data reveals that the proteins H3K9dimethyl and RNA-Polymerase II are exclusive regarding their binding to the promoter region of genes. When comparing the base pair sequences of the promoters that bind to Pol2 versus H3K9, striking differences appear. The mononucleotides have fundamentally different behaviors in each group. In addition, motifs that cluster before the transcriptional start site also generally have a strong enrichment in one group compared to the other. Using this knowledge a model can be developed that allows one to calculate a probability that a promoter will bind to either H3K9 or Pol2 based on its base pair sequence.

  16. Mouse Vk gene classification by nucleic acid sequence similarity.


    Strohal, R; Helmberg, A; Kroemer, G; Kofler, R


    Analyses of immunoglobulin (Ig) variable (V) region gene usage in the immune response, estimates of V gene germline complexity, and other nucleic acid hybridization-based studies depend on the extent to which such genes are related (i.e., sequence similarity) and their organization in gene families. While mouse Igh heavy chain V region (VH) gene families are relatively well-established, a corresponding systematic classification of Igk light chain V region (Vk) genes has not been reported. The present analysis, in the course of which we reviewed the known extent of the Vk germline gene repertoire and Vk gene usage in a variety of responses to foreign and self antigens, provides a classification of mouse Vk genes in gene families composed of members with greater than 80% overall nucleic acid sequence similarity. This classification differed in several aspects from that of VH genes: only some Vk gene families were as clearly separated (by greater than 25% sequence dissimilarity) as typical VH gene families; most Vk gene families were closely related and, in several instances, members from different families were very similar (greater than 80%) over large sequence portions; frequently, classification by nucleic acid sequence similarity diverged from existing classifications based on amino-terminal protein sequence similarity. Our data have implications for Vk gene analyses by nucleic acid hybridization and describe potentially important differences in sequence organization between VH and Vk genes.

  17. Structure of the BoLA-DRB3 gene and promoter.


    Russell, G C; Smith, J A; Oliver, R A


    The cattle major histocompatibility complex (MHC) class II DR gene product is a heterodimer encoded by the BoLA-DRA and -DRB3 genes. Several groups have isolated cDNA and genomic clones for these genes, but their full genomic organization has not been described. We used a combination of long-range polymerase chain reaction (PCR), cloning and sequencing to define the organization of the DRB3 gene on existing genomic clones and in genomic DNA. We estimate the size of the coding region to be 11.4 kbp. Sequencing of full-length PCR clones from two different haplotypes confirmed that they carried complete DRB3 genes and allowed the design of probes and primers to isolate and characterize the DRB3 promoter and 3' end. Fragments carrying the 5' end of the DRB3 gene and its promoter were identified on bacterial artificial chromosome (BAC) clones carrying the BoLA-DR genes. A 10-kbp promoter fragment was subcloned from one clone and a 1.7-kbp region including exon 1 and the promoter was sequenced. A 3-kbp fragment encoding exons 4-6 and the entire 3' untranslated region of the DRB3 gene was isolated from lambda clone A1 and sequenced. This provides us with improved characterization of the DRB3*0101 and DRB3*2002 alleles, and also subcloned 5' and 3' flanking regions of the polymorphic DRB3 gene for use in functional studies.

  18. Evaluation of whole exome sequencing by targeted gene sequencing and Sanger sequencing.


    Chang, Ya-Sian; Huang, Hsien-Da; Yeh, Kun-Tu; Chang, Jan-Gowth


    Targeted gene sequencing (TGS) and whole exome sequencing (WES) are being used in clinical testing in laboratories. We compared the performances of TGS and WES using the same DNA samples. DNA was extracted from 10 endometrial tumor tissue specimens. Sequencing were performed with an Illumina HiSeq 2000. We randomly selected variants to confirm through Sanger sequencing or mutant-enriched PCR with Sanger sequencing. We found that the variants identified in both TGS and WES were true positives (47/47), regardless of the sequencing depth. Most variants found in TGS only were true positives (34/40), and most of the variants found by WES only were false positives (8/18). From these results, we suggest that the sequencing depth may not play important role in the accuracy of NGS-based methods. After analysis, we found that WES had a sensitivity of 72.70%, specificity of 96.27%, precision of 99.44%, and accuracy of 75.03%. The results of NGS-based methods must currently be validated, especially for important reported variants regardless of the methods used, and for the use of WES in cancers a higher false negative rate must be considered. More sensitive methods should be used to confirm the NGS results in uneven cancer tissues. Copyright © 2017 Elsevier B.V. All rights reserved.

  19. 5' sequences are important positive and negative determinants of the longevity of Chlamydomonas chloroplast gene transcripts.

    PubMed Central

    Salvador, M L; Klein, U; Bogorad, L


    We have found that sequences in the 5' leader of the Chlamydomonas chloroplast rbcL gene, when fused 5' to foreign genes, destabilize transcripts of these chimeric genes in the chloroplast of transgenic Chlamydomonas but that 5' sequences of the rbcL structural gene prevent this destabilization. Transcripts of the chloroplast rbcL gene are about equally abundant at all times in Chlamydomonas reinhardtii growing on an alternating 12-h light/12-h dark cycle. However, Chlamydomonas chloroplast transformants, harboring chimeric genes containing the same rbcL promoter with 63 or 92 bp of the rbcL 5' leader sequence fused upstream of the Escherichia coli uidA (beta-glucuronidase, GUS) gene, accumulated GUS transcripts only in the dark. Transcripts disappeared rapidly upon illumination of the cells. The same phenomenon was exhibited by transcripts of chimeric genes in which the GUS gene coding sequence was replaced by other unrelated genes. The precipitous light-induced drop in GUS transcript abundance was found to be due to an approximately 16-fold increase in the rate of degradation of GUS transcripts in light rather than to a decrease in the rate of transcription of the GUS gene. Transcripts of a chimeric rbcL-GUS construct in which the leader sequence of the rbcL gene was replaced by 103 bp of the leader sequence of the atpB gene were stable in illuminated cells. The destabilizing effect of the rbcL 5' leader sequence was reversed by adding 257 bp of the 5' coding region of the rbcL gene. The results show that chloroplast transcript levels in illuminated Chlamydomonas cells--and perhaps in other cases--can be determined, at least to some extent, by sequences and interactions of sequences transcribed from the 5' ends of genes. Images PMID:8434017

  20. Amy as a reporter gene for promoter activity in Nocardia lactamdurans: comparison of promoters of the cephamycin cluster.

    PubMed Central

    Chary, V K; de la Fuente, J L; Liras, P; Martin, J F


    Promoter probe vectors containing the pA origin of replication and the Streptomyces griseus promoterless amy gene (encoding alpha-amylase) as reporter have been constructed to study transcription initiation regions in Nocardia lactamdurans. In some of the promoter probe vectors the phage fd terminator has been introduced to avoid readthrough expression from upstream sequences. By using these vectors, four different transcription initiation regions of the cephamycin gene cluster have been studied in N. lactamdurans. The bla gene encoding a beta-lactamase has a relatively strong promoter. Two other separate promoters corresponding to the lat and cefD genes (encoding, respectively, lysine-6-aminotransferase and isopenicillin N-epimerase) showed weak transcription initiation ability. These two promoters are arranged in a bidirectional transcription initiation region located in the center of the cephamycin gene cluster. The cmcH gene (encoding 3-hydroxymethylcephem carbamoyltransferase) upstream region did not contain a functional promoter, suggesting that cmcH is transcribed as a part of a polycistronic mRNA. The native amy promoter is used very efficiently in N. lactamdurans, resulting in secretion of high levels of extracellular alpha-amylase. PMID:9251185

  1. CaMV-35S promoter sequence-specific DNA methylation in lettuce.


    Okumura, Azusa; Shimada, Asahi; Yamasaki, Satoshi; Horino, Takuya; Iwata, Yuji; Koizumi, Nozomu; Nishihara, Masahiro; Mishiba, Kei-ichiro


    We found 35S promoter sequence-specific DNA methylation in lettuce. Additionally, transgenic lettuce plants having a modified 35S promoter lost methylation, suggesting the modified sequence is subjected to the methylation machinery. We previously reported that cauliflower mosaic virus 35S promoter-specific DNA methylation in transgenic gentian (Gentiana triflora × G. scabra) plants occurs irrespective of the copy number and the genomic location of T-DNA, and causes strong gene silencing. To confirm whether 35S-specific methylation can occur in other plant species, transgenic lettuce (Lactuca sativa L.) plants with a single copy of the 35S promoter-driven sGFP gene were produced and analyzed. Among 10 lines of transgenic plants, 3, 4, and 3 lines showed strong, weak, and no expression of sGFP mRNA, respectively. Bisulfite genomic sequencing of the 35S promoter region showed hypermethylation at CpG and CpWpG (where W is A or T) sites in 9 of 10 lines. Gentian-type de novo methylation pattern, consisting of methylated cytosines at CpHpH (where H is A, C, or T) sites, was also observed in the transgenic lettuce lines, suggesting that lettuce and gentian share similar methylation machinery. Four of five transgenic lettuce lines having a single copy of a modified 35S promoter, which was modified in the proposed core target of de novo methylation in gentian, exhibited 35S hypomethylation, indicating that the modified sequence may be the target of the 35S-specific methylation machinery.

  2. Eukaryotic genomes may exhibit up to 10 generic classes of gene promoters

    PubMed Central


    Background The main function of gene promoters appears to be the integration of different gene products in their biological pathways in order to maintain homeostasis. Generally, promoters have been classified in two major classes, namely TATA and CpG. Nevertheless, many genes using the same combinatorial formation of transcription factors have different gene expression patterns. Accordingly, we tried to ask ourselves some fundamental questions: Why certain genes have an overall predisposition for higher gene expression levels than others? What causes such a predisposition? Is there a structural relationship of these sequences in different tissues? Is there a strong phylogenetic relationship between promoters of closely related species? Results In order to gain valuable insights into different promoter regions, we obtained a series of image-based patterns which allowed us to identify 10 generic classes of promoters. A comprehensive analysis was undertaken for promoter sequences from Arabidopsis thaliana, Drosophila melanogaster, Homo sapiens and Oryza sativa, and a more extensive analysis of tissue-specific promoters in humans. We observed a clear preference for these species to use certain classes of promoters for specific biological processes. Moreover, in humans, we found that different tissues use distinct classes of promoters, reflecting an emerging promoter network. Depending on the tissue type, comparisons made between these classes of promoters reveal a complementarity between their patterns whereas some other classes of promoters have been observed to occur in competition. Furthermore, we also noticed the existence of some transitional states between these classes of promoters that may explain certain evolutionary mechanisms, which suggest a possible predisposition for specific levels of gene expression and perhaps for a different number of factors responsible for triggering gene expression. Our conclusions are based on comprehensive data from three

  3. The lux genes in Photobacterium leiognathi are closely linked with genes corresponding in sequence to riboflavin synthesis genes.


    Lee, C Y; Meighen, E A


    Three open reading frames (ORFs) have been found in the region downstream of the luxG gene in the Photobacterium leiognathi lux operon. These genes (ORF I, II, and III) are not only closely linked to the lux operon and transcribed in the same direction but also show the same organization and code for proteins homologous in sequence to the gene products of ribB, ribA, and ribH of Bacillus subtilis, respectively. The Photobacterium leiognathi gene (ORF II) corresponding to ribA was expressed in Escherichia coli in the bacteriophage T7 promoter-RNA polymerase system and a 40 kDa 35S-labeled polypeptide has been detected on SDS-PAGE. Expression of DNA extending from luxBEG to ORF II inserted between a strong promoter and a reporter gene and transferred by conjugation into Vibrio harveyi did not affect the expression of the reporter gene. The results provide evidence that neither promoter nor terminator sites were present in the DNA between the luxG and ORF II indicating that these genes might be part of the lux operon.

  4. Isolated yeast promoter sequence and a method of regulated heterologous expression


    Gao, Johnway; Skeen, Rodney S.; Hooker, Brian S.; Anderson, Daniel B.


    The present invention provides the promoter clone discovery of a glucoamylase gene of a starch utilizing yeast strain Schwanniomyces castellii. The isolated glucoamylase promoter is an inducible promoter, which can regulate strong gene expression in starch culture medium.

  5. Tandem promoters determine regulation of the Klebsiella pneumoniae glutamine synthetase (glnA) gene.

    PubMed Central

    Dixon, R


    Transcription of the structural gene for glutamine synthetase (glnA) in Klebsiella pneumoniae is controlled by the nitrogen regulatory genes ntrA, ntrB and ntrC. The nucleotide sequence of the regulatory region upstream of the glnA gene is reported here. High resolution S1 mapping of in vivo transcripts indicates that the regulatory region contains tandem promoters separated by 100 nucleotides. Measurements of beta-galactosidase activities determined in vivo from glnA-lac fusions suggest that the upstream promoter (for RNA2) is negatively regulated by the ntrBC gene products whereas transcription from the downstream promoter (for RNA1) is positively activated by the ntrA gene product in the presence of either the ntrBC or the nifA genes. The nucleotide sequence of the upstream promoter resembles the consensus sequence for E. coli promoters, whereas the downstream promoter shows homology with the nitrogen fixation (nif) promoters of K. pneumoniae. Images PMID:6149519

  6. Hyaluronate synthase: cloning and sequencing of the gene from Streptococcus sp.


    Lansing, M; Lellig, S; Mausolf, A; Martini, I; Crescenzi, F; O'Regan, M; Prehm, P


    The complete nucleotide sequence of hyaluronate synthase from Streptococcus sp. and its flanking regions is presented. The gene locus was designated has. Southern-blotting results suggested that the gene was conserved in hyaluronate-producing streptococci. A putative translation-initiation codon was identified and the open reading frame consists of 1566 bp, specifying a protein of 56 kDa. Sequences resembling the promoter and ribosome-binding site of Gram-positive organisms are found upstream of the synthase. The predicted amino-acid sequence reveals the presence of a 35-residue signal peptide. The sequence has some similarity to bacterial peptide-binding proteins.

  7. Sequences and expression of pyruvate dehydrogenase genes from Pseudomonas aeruginosa.

    PubMed Central

    Rae, J L; Cutfield, J F; Lamont, I L


    A mutant of Pseudomonas aeruginosa, OT2100, which appeared to be defective in the production of the fluorescent yellow-green siderophore pyoverdine had been isolated previously following transposon mutagenesis (T. R. Merriman and I. L. Lamont, Gene 126:17-23, 1993). DNA from either side of the transposon insertion site was cloned, and the sequence was determined. The mutated gene had strong identity with the dihydrolipoamide acetyltransferase (E2) components of pyruvate dehydrogenase (PDH) from other bacterial species. Enzyme assays revealed that the mutant was defective in the E2 subunit of PDH, preventing assembly of a functional complex. PDH activity in OT2100 cell extracts was restored when extract from an E1 mutant was added. On the basis of this evidence, OT2100 was identified as an aceB or E2 mutant. A second gene, aceA, which is likely to encode the E1 component of PDH, was identified upstream from aceB. Transcriptional analysis revealed that aceA and aceB are expressed as a 5-kb polycistronic transcript from a promoter upstream of aceA. An intergenic region of 146 bp was located between aceA and aceB, and a 2-kb aceB transcript that originated from a promoter in the intergenic region was identified. DNA fragments upstream of aceA and aceB were shown to have promoter activities in P. aeruginosa, although only the aceA promoter was active in Escherichia coli. It is likely that the apparent pyoverdine-deficient phenotype of mutant OT2100 is a consequence of acidification of the growth medium due to accumulation of pyruvic acid in the absence of functional PDH. PMID:9171401

  8. Promoter sequence, expression, and fine chromosomal mapping of the human gene (MLP) encoding the MARCKS-like protein: identification of neighboring and linked polymorphic loci for MLP and MACS and use in the evaluation of human neural tube defects.


    Stumpo, D J; Eddy, R L; Haley, L L; Sait, S; Shows, T B; Lai, W S; Young, W S; Speer, M C; Dehejia, A; Polymeropoulos, M; Blackshear, P J


    The MARCKS-like protein (MLP), also known as F52, MacMARCKS, or MARCKS-related protein, is a widely distributed substrate for protein kinase C (PKC). Recent studies using gene disruption in vivo have demonstrated the importance of both MARCKS and MLP to the development of the central nervous system; specifically, mice lacking either protein exhibit a high frequency of neural tube defects. We isolated a genomic clone for human MLP and discovered a directly linked polymorphism (MLP1) useful for genetic linkage analysis. The MLP promoter was 71% identical over 433 bp to that of the corresponding mouse gene, Mlp, with conservation of many putative transcription factor-binding sites; it was only 36% identical over 433 bp to the promoter of the human gene, MACS, which encodes the MLP homologue MARCKS. This 433-bp fragment drove expression of an MLP-beta-galactosidase transgene in a tissue-specific and developmental expression pattern that was similar to that observed for the endogenous gene, as shown by in situ hybridization histochemistry. In contrast to MACS, the MLP and Mlp promoters contain a TATA box approximately 40 bp 5' of the presumed transcription initiation site. MLP was localized to chromosome 1p34-->1pter by analysis of human-mouse somatic cell hybrid DNA and to 1p34 by fluorescence in situ hybridization. Radiation hybrid mapping of MLP placed it between genetic markers D1S511 (LOD > 3.0) and WI9232. MACS was localized to 6q21 between D6S266 (LOD > 3.0) and AFM268uh5 by the same technique. We tested the novel MLP1 polymorphism and the MACS flanking markers in a series of 43 Caucasian simplex families in which the affected child had a lumbosacral myelomeningocele. We found no evidence of linkage disequilibrium, suggesting that these loci were not major genes for spina bifida in these families. Nonetheless, the identification of linked and neighboring polymorphisms for MACS and MLP should permit similar genetic studies in other groups of patients with neural

  9. Reporter Gene Silencing in Targeted Mouse Mutants Is Associated with Promoter CpG Island Methylation

    PubMed Central

    Kirov, Julia V.; Adkisson, Michael; Nava, A. J.; Cipollone, Andreana; Willis, Brandon; Engelhard, Eric K.; Lloyd, K. C. Kent; de Jong, Pieter; West, David B.


    Targeted mutations in mouse disrupt local chromatin structure and may lead to unanticipated local effects. We evaluated targeted gene promoter silencing in a group of six mutants carrying the tm1a Knockout Mouse Project allele containing both a LacZ reporter gene driven by the native promoter and a neo selection cassette. Messenger RNA levels of the reporter gene and targeted gene were assessed by qRT-PCR, and methylation of the promoter CpG islands and LacZ coding sequence were evaluated by sequencing of bisulfite-treated DNA. Mutants were stratified by LacZ staining into presumed Silenced and Expressed reporter genes. Silenced mutants had reduced relative quantities LacZ mRNA and greater CpG Island methylation compared with the Expressed mutant group. Within the silenced group, LacZ coding sequence methylation was significantly and positively correlated with CpG Island methylation, while promoter CpG methylation was only weakly correlated with LacZ gene mRNA. The results support the conclusion that there is promoter silencing in a subset of mutants carrying the tm1a allele. The features of targeted genes which promote local silencing when targeted remain unknown. PMID:26275310

  10. Reporter Gene Silencing in Targeted Mouse Mutants Is Associated with Promoter CpG Island Methylation.


    Kirov, Julia V; Adkisson, Michael; Nava, A J; Cipollone, Andreana; Willis, Brandon; Engelhard, Eric K; Lloyd, K C Kent; de Jong, Pieter; West, David B


    Targeted mutations in mouse disrupt local chromatin structure and may lead to unanticipated local effects. We evaluated targeted gene promoter silencing in a group of six mutants carrying the tm1a Knockout Mouse Project allele containing both a LacZ reporter gene driven by the native promoter and a neo selection cassette. Messenger RNA levels of the reporter gene and targeted gene were assessed by qRT-PCR, and methylation of the promoter CpG islands and LacZ coding sequence were evaluated by sequencing of bisulfite-treated DNA. Mutants were stratified by LacZ staining into presumed Silenced and Expressed reporter genes. Silenced mutants had reduced relative quantities LacZ mRNA and greater CpG Island methylation compared with the Expressed mutant group. Within the silenced group, LacZ coding sequence methylation was significantly and positively correlated with CpG Island methylation, while promoter CpG methylation was only weakly correlated with LacZ gene mRNA. The results support the conclusion that there is promoter silencing in a subset of mutants carrying the tm1a allele. The features of targeted genes which promote local silencing when targeted remain unknown.

  11. Transcriptome Sequencing Revealed Significant Alteration of Cortical Promoter Usage and Splicing in Schizophrenia

    PubMed Central

    Wu, Jing Qin; Wang, Xi; Beveridge, Natalie J.; Tooney, Paul A.; Scott, Rodney J.; Carr, Vaughan J.; Cairns, Murray J.


    Background While hybridization based analysis of the cortical transcriptome has provided important insight into the neuropathology of schizophrenia, it represents a restricted view of disease-associated gene activity based on predetermined probes. By contrast, sequencing technology can provide un-biased analysis of transcription at nucleotide resolution. Here we use this approach to investigate schizophrenia-associated cortical gene expression. Methodology/Principal Findings The data was generated from 76 bp reads of RNA-Seq, aligned to the reference genome and assembled into transcripts for quantification of exons, splice variants and alternative promoters in postmortem superior temporal gyrus (STG/BA22) from 9 male subjects with schizophrenia and 9 matched non-psychiatric controls. Differentially expressed genes were then subjected to further sequence and functional group analysis. The output, amounting to more than 38 Gb of sequence, revealed significant alteration of gene expression including many previously shown to be associated with schizophrenia. Gene ontology enrichment analysis followed by functional map construction identified three functional clusters highly relevant to schizophrenia including neurotransmission related functions, synaptic vesicle trafficking, and neural development. Significantly, more than 2000 genes displayed schizophrenia-associated alternative promoter usage and more than 1000 genes showed differential splicing (FDR<0.05). Both types of transcriptional isoforms were exemplified by reads aligned to the neurodevelopmentally significant doublecortin-like kinase 1 (DCLK1) gene. Conclusions This study provided the first deep and un-biased analysis of schizophrenia-associated transcriptional diversity within the STG, and revealed variants with important implications for the complex pathophysiology of schizophrenia. PMID:22558445

  12. The control region of the metH gene of Salmonella typhimurium LT2: an atypical met promoter.


    Urbanowski, M L; Stauffer, G V


    The control region of the Salmonella typhimurium metH gene was sequenced and the transcription start point was determined by S1 nuclease mapping experiments. Activation of the metH gene by the metR gene product was shown to occur at the level of transcription. The translation start site was determined by amino acid sequence analysis of the amino terminus of a chimeric Met-Lac fusion protein encoded by a metH-lacZ gene fusion. Analysis of the nucleotide sequence of the metH promoter region showed that two sequence elements, present in the promoters of all other met biosynthetic genes thus far examined, are not present in the metH promoter region, namely, the repeated MetJ repressor recognition sequence 5'-AGACGTCT-3' and a highly conserved sequence 5'-TGGA----TAAAC-3' of unknown function.

  13. Computational inference of grammars for larger-than-gene structures from annotated gene sequences.


    Tsafnat, Guy; Schaeffer, Jaron; Clayphan, Andrew; Iredell, Jon R; Partridge, Sally R; Coiera, Enrico


    Larger than gene structures (LGS) are DNA segments that include at least one gene and often other segments such as inverted repeats and gene promoters. Mobile genetic elements (MGE) such as integrons are LGS that play an important role in horizontal gene transfer, primarily in Gram-negative organisms. Known LGS have a profound effect on organism virulence, antibiotic resistance and other properties of the organism due to the number of genes involved. Expert-compiled grammars have been shown to be an effective computational representation of LGS, well suited to automating annotation, and supporting de novo gene discovery. However, development of LGS grammars by experts is labour intensive and restricted to known LGS. This study uses computational grammar inference methods to automate LGS discovery. We compare the ability of six algorithms to infer LGS grammars from DNA sequences annotated with genes and other short sequences. We compared the predictive power of learned grammars against an expert-developed grammar for gene cassette arrays found in Class 1, 2 and 3 integrons, which are modular LGS containing up to 9 of about 240 cassette types. Using a Bayesian generalization algorithm our inferred grammar was able to predict > 95% of MGE structures in a corpus of 1760 sequences obtained from Genbank (F-score 75%). Even with 100% noise added to the training and test sets, we obtained an F-score of 68%, indicating that the method is robust and has the potential to predict de novo LGS structures when the underlying gene features are known.

  14. DNA entropy reveals a significant difference in complexity between housekeeping and tissue specific gene promoters.


    Thomas, David; Finan, Chris; Newport, Melanie J; Jones, Susan


    The complexity of DNA can be quantified using estimates of entropy. Variation in DNA complexity is expected between the promoters of genes with different transcriptional mechanisms; namely housekeeping (HK) and tissue specific (TS). The former are transcribed constitutively to maintain general cellular functions, and the latter are transcribed in restricted tissue and cells types for specific molecular events. It is known that promoter features in the human genome are related to tissue specificity, but this has been difficult to quantify on a genomic scale. If entropy effectively quantifies DNA complexity, calculating the entropies of HK and TS gene promoters as profiles may reveal significant differences. Entropy profiles were calculated for a total dataset of 12,003 human gene promoters and for 501 housekeeping (HK) and 587 tissue specific (TS) human gene promoters. The mean profiles show the TS promoters have a significantly lower entropy (p<2.2e-16) than HK gene promoters. The entropy distributions for the 3 datasets show that promoter entropies could be used to identify novel HK genes. Functional features comprise DNA sequence patterns that are non-random and hence they have lower entropies. The lower entropy of TS gene promoters can be explained by a higher density of positive and negative regulatory elements, required for genes with complex spatial and temporary expression. Copyright © 2015 Elsevier Ltd. All rights reserved.

  15. Metals promote sequences of the reverse Krebs cycle.


    Muchowska, Kamila B; Varma, Sreejith J; Chevallot-Beroux, Elodie; Lethuillier-Karl, Lucas; Li, Guang; Moran, Joseph


    The reverse tricarboxylic acid (rTCA) cycle (also known as the reverse Krebs cycle) is a central anabolic biochemical pathway whose origins are proposed to trace back to geochemistry, long before the advent of enzymes, RNA or cells, and whose imprint remains intimately embedded in the structure of core metabolism. If it existed, a primordial version of the rTCA cycle would necessarily have been catalysed by naturally occurring minerals at the earliest stage of the transition from geochemistry to biochemistry. Here, we report non-enzymatic promotion of multiple reactions of the rTCA cycle in consecutive sequence, whereby 6 of its 11 reactions were promoted by Zn(2+), Cr(3+) and Fe(0) in an acidic aqueous solution. Two distinct three-reaction sequences were achieved under a common set of conditions. Selectivity was observed for reduction reactions producing rTCA cycle intermediates compared with those leading off-cycle. Reductive amination of ketoacids to furnish amino acids was observed under similar conditions. The emerging reaction network supports the feasibility of primitive anabolism in an acidic, metal-rich reducing environment.The reverse Krebs cycle is a potential primordial anabolic pathway central to biochemistry. Here, the authors show that more than half of the cycle can be promoted by metals and metal ions without enzymes.

  16. Yeast homologous recombination-based promoter engineering for the activation of silent natural product biosynthetic gene clusters.


    Montiel, Daniel; Kang, Hahk-Soo; Chang, Fang-Yuan; Charlop-Powers, Zachary; Brady, Sean F


    Large-scale sequencing of prokaryotic (meta)genomic DNA suggests that most bacterial natural product gene clusters are not expressed under common laboratory culture conditions. Silent gene clusters represent a promising resource for natural product discovery and the development of a new generation of therapeutics. Unfortunately, the characterization of molecules encoded by these clusters is hampered owing to our inability to express these gene clusters in the laboratory. To address this bottleneck, we have developed a promoter-engineering platform to transcriptionally activate silent gene clusters in a model heterologous host. Our approach uses yeast homologous recombination, an auxotrophy complementation-based yeast selection system and sequence orthogonal promoter cassettes to exchange all native promoters in silent gene clusters with constitutively active promoters. As part of this platform, we constructed and validated a set of bidirectional promoter cassettes consisting of orthogonal promoter sequences, Streptomyces ribosome binding sites, and yeast selectable marker genes. Using these tools we demonstrate the ability to simultaneously insert multiple promoter cassettes into a gene cluster, thereby expediting the reengineering process. We apply this method to model active and silent gene clusters (rebeccamycin and tetarimycin) and to the silent, cryptic pseudogene-containing, environmental DNA-derived Lzr gene cluster. Complete promoter refactoring and targeted gene exchange in this "dead" cluster led to the discovery of potent indolotryptoline antiproliferative agents, lazarimides A and B. This potentially scalable and cost-effective promoter reengineering platform should streamline the discovery of natural products from silent natural product biosynthetic gene clusters.

  17. Next-generation sequencing-based 5' rapid amplification of cDNA ends for alternative promoters.


    Perera, Bambarendage P U; Kim, Joomyeong


    Mammalian genomes contain many unknown alternative first exons and promoters. Thus, we have modified the existing 5'RACE (5' rapid amplification of cDNA ends) approach into a next-generation sequencing (NGS)-based new protocol that can identify these alternative promoters. This protocol has incorporated two main ideas: (i) 5'RACE starting from the known second exons of genes and (ii) NGS-based sequencing of the subsequent cDNA products. This protocol also provides a bioinformatics strategy that processes the sequence reads from NGS runs. This protocol has successfully identified several alternative promoters for an imprinted gene, PEG3. Overall, this NGS-based 5'RACE protocol is a sensitive and reliable method for detecting low-abundant transcripts and promoters.

  18. A structurally novel salt-regulated promoter of duplicated carbonic anhydrase gene 1 from Dunaliella salina.


    Li, Jie; Lu, Yumin; Xue, Lexun; Xie, Hua


    It has been demonstrated that the duplicated carbonic anhydrase is induced by salt in the Dunaliella salina (D. salina) and duplicated carbonic anhydrase 1 (DCA1) is a member of carbonic anhydrase family. The purpose of this study was to identify whether both the DCA1 gene and its promoter from D. salina are salt-inducible. In this study, the results of real time RT-PCR showed that the transcripts of DCA1 were induced by gradient concentration of sodium chloride. Subsequently, a structurally novel promoter containing highly repeated GT/AC sequences of the DCA1 gene was isolated, which was able to drive a stable expression of the foreign bar gene in transformed cells of D. salina, and the gradient concentrations of sodium chloride in media paralleled regulations in the levels of both proteins and mRNA of the bar gene driven by the DCA1 promoter. Furthermore, analysis of GUS activities revealed that the salt-inducible expression of the external gus gene was regulated by the promoter fragments containing highly repeated GT sequences, but not by the promoter fragments deleting highly repeated GT sequences. The findings above-mentioned suggest that the highly repeated GT sequence in the DCA1 promoter is involved in the salt-inducible regulation in D. salina and may be a novel salt-inducible element.

  19. The mouse collagen X gene: complete nucleotide sequence, exon structure and expression pattern.

    PubMed Central

    Elima, K; Eerola, I; Rosati, R; Metsäranta, M; Garofalo, S; Perälä, M; De Crombrugghe, B; Vuorio, E


    Overlapping genomic clones covering the 7.2 kb mouse alpha 1(X) collagen gene, 0.86 kb of promoter and 1.25 kb of 3'-flanking sequences were isolated from two genomic libraries and characterized by nucleotide sequencing. Typical features of the gene include a unique three-exon structure, similar to that in the chick gene, with the entire triple-helical domain of 463 amino acids coded by a single large exon. The highest degree of amino acid and nucleotide sequence conservation was seen in the coding region for the collagenous and C-terminal non-collagenous domains between the mouse and known chick, bovine and human collagen type X sequences. More divergence between the sequences occurred in the N-terminal non-collagenous domain. Similarity between the mammalian collagen X sequences extended into the 3'-untranslated sequence, particularly near the polyadenylation site. The promoter of the mouse collagen X gene was found to contain two TATAA boxes 159 bp apart; primer extension analyses of the transcription start site revealed that both were functional. The promoter has an unusual structure with a very low G + C content of 28% between positions -220 and -1 of the upstream transcription start site. Northern and in situ hybridization analyses confirmed that the expression of the alpha 1(X) collagen gene is restricted to hypertrophic chondrocytes in tissues undergoing endochondral calcification. The detailed sequence information of the gene is useful for studies on the promoter activity of the gene and for generation of transgenic mice. Images Figure 3 Figure 5 Figure 6 PMID:8424763

  20. Gene and translation initiation site prediction in metagenomic sequences

    SciTech Connect

    Hyatt, Philip Douglas; LoCascio, Philip F; Hauser, Loren John; Uberbacher, Edward C


    Gene prediction in metagenomic sequences remains a difficult problem. Current sequencing technologies do not achieve sufficient coverage to assemble the individual genomes in a typical sample; consequently, sequencing runs produce a large number of short sequences whose exact origin is unknown. Since these sequences are usually smaller than the average length of a gene, algorithms must make predictions based on very little data. We present MetaProdigal, a metagenomic version of the gene prediction program Prodigal, that can identify genes in short, anonymous coding sequences with a high degree of accuracy. The novel value of the method consists of enhanced translation initiation site identification, ability to identify sequences that use alternate genetic codes and confidence values for each gene call. We compare the results of MetaProdigal with other methods and conclude with a discussion of future improvements.

  1. High-throughput mapping of the promoters of the mouse olfactory receptor genes reveals a new type of mammalian promoter and provides insight into olfactory receptor gene regulation

    PubMed Central

    Clowney, E. Josephine; Magklara, Angeliki; Colquitt, Bradley M.; Pathak, Nidhi; Lane, Robert P.; Lomvardas, Stavros


    The olfactory receptor (OR) genes are the largest mammalian gene family and are expressed in a monogenic and monoallelic fashion in olfactory neurons. Using a high-throughput approach, we mapped the transcription start sites of 1085 of the 1400 murine OR genes and performed computational analysis that revealed potential transcription factor binding sites shared by the majority of these promoters. Our analysis produced a hierarchical model for OR promoter recognition in which unusually high AT content, a unique epigenetic signature, and a stereotypically positioned O/E site distinguish OR promoters from the rest of the murine promoters. Our computations revealed an intriguing correlation between promoter AT content and evolutionary plasticity, as the most AT-rich promoters regulate rapidly evolving gene families. Within the AT-rich promoter category the position of the TATA-box does not correlate with the transcription start site. Instead, a spike in GC composition might define the exact location of the TSS, introducing the concept of “genomic contrast” in transcriptional regulation. Finally, our experiments show that genomic neighborhood rather than promoter sequence correlates with the probability of different OR genes to be expressed in the same olfactory cell. PMID:21705439

  2. Characterization of sequence elements from Malvastrum yellow vein betasatellite regulating promoter activity and DNA replication

    PubMed Central


    Background Many monopartite begomoviruses are associated with betasatellites, but only several promoters from which were isolated and studied. In this study, the βC1 promoter from Malvastrum yellow vein betasatellite (MYVB) was characterized and important sequence elements were identified to modulate promoter activity and replication of MYVB. Results A 991 nucleotide (nt) fragment upstream of the translation start site of the βC1 open reading frame of MYVB and a series of deletions within this fragment were constructed and fused to the β-glucuronidase (GUS) and green fluorescent protein (GFP) reporter genes, respectively. Agrobacterium-mediated transient expression assays showed that the 991 nt fragment was functional and that a 28 nt region (between −390 nt and −418 nt), which includes a 5′UTR Py-rich stretch motif, was important for promoter activity. Replication assays using Nicotiana benthamiana leaf discs and whole plants showed that deletion of the 5′UTR Py-rich stretch impaired viral satellite replication in the presence of the helper virus. Transgenic assays demonstrated that the 991 nt fragment conferred a constitutive expression pattern in transgenic tobacco plants and that a 214 nt fragment at the 3'-end of this sequence was sufficient to drive this expression pattern. Conclusion Our results showed that the βC1 promoter of MYVB displayed a constitutive expression pattern and a 5′UTR Py-rich stretch motif regulated both βC1 promoter activity and MYVB replication. PMID:23057573

  3. Human Prolactin Gene Promoter Regulation by Estrogen: Convergence with Tumor Necrosis Factor-α Signaling

    PubMed Central

    Adamson, A. D.; Friedrichsen, S.; Semprini, S.; Harper, C. V.; Mullins, J. J.; White, M. R. H.; Davis, J. R. E.


    Estrogens have been implicated in the regulation of prolactin gene expression in man, although previous studies have not defined the molecular mechanism whereby estradiol activates the human prolactin gene promoter (hPrl). We found that estradiol induced a reproducible 1.8-fold activation of the hPrl gene promoter, using pituitary GH3 cells stably transfected with a 5000-bp hPrl promoter fragment linked to luciferase reporter gene. This activation was blocked by treatment with estrogen receptor (ER) antagonists 4-hydroxytamoxifen and ICI-182,780. Promoter deletion and mutagenesis experiments identified a functional estrogen response element (ERE) sequence 1189 bp upstream of the transcription start site that was responsible for estrogen-mediated promoter activation. This site differed from the consensus ERE sequence by two base pairs, one in each half-site. This ERE was identified to be functional through binding ERα in EMSAs. Chromatin immunoprecipitation assays confirmed ERα binding to this sequence in vivo in the absence of ligand, with increased recruitment when cells were cultured in the presence of estradiol. When cells were treated with both estradiol and TNFα, we observed synergistic activation of the hPrl promoter, which was mediated by the –1189-bp ERE. Mutagenesis of this ERE abolished the promoter-activating effect not only of estradiol but also of TNFα. These data suggest a novel, promoter-specific signaling interaction between estrogen and TNFα signaling, which is likely to be important for prolactin regulation in vivo. PMID:18006630

  4. Hypermethylated promoter region of DR3, the death receptor 3 gene, in rheumatoid arthritis synovial cells.


    Takami, Nozomi; Osawa, Kayo; Miura, Yasushi; Komai, Koichiro; Taniguchi, Mariko; Shiraishi, Masahiko; Sato, Keizo; Iguchi, Tetsuhiro; Shiozawa, Kazuko; Hashiramoto, Akira; Shiozawa, Shunichi


    To examine the promoter activity and protein expression of the death receptor 3 gene DR3, a member of the apoptosis-inducing Fas gene family, with particular reference to the methylation status of its promoter region in rheumatoid arthritis (RA). Genomic DNA was prepared from peripheral blood mononuclear cells obtained from healthy individuals and from patients with RA and synovial cells obtained from patients with RA and osteoarthritis. The methylation status of the DR3 promoter was analyzed by bisulfite genomic sequencing and methylation-specific polymerase chain reaction techniques. Gene promoter activity and protein expression were examined using the luciferase reporter and Western blotting techniques. The promoter region of the DR3 gene contained many CpG motifs, including one CpG island that was specifically hypermethylated in synovial cells from patients with RA. Promoter assays showed that the promoter CpG island was essential for the transactivation of the DR3 gene and that forced hypermethylation of the CpG island with the bacterial methylase Sss I in vitro resulted in inhibition of the DR3 gene expression. Furthermore, the expression of DR-3 protein was down-modulated in association with methylation of the promoter CpG island in RA synovial cells. The CpG island in the DR3 gene promoter was specifically methylated to down-modulate the expression of DR-3 protein in rheumatoid synovial cells, which may provide resistance to apoptosis in RA synovial cells.

  5. Control sites in the sequence at the beginning of T7 gene 1.

    PubMed Central

    McConnell, D J


    The DNA sequence of the fragment Hind.30, 378 bases long, from the beginning of gene 1 of T7 is presented. It contains the C promoter, two in vitro transcriptional terminator sites and a sequence of 171 bases which probably codes for the N terminus of the T7 RNA polymerase. The sequence also codes for the RNase III cleavage site before gene 1. The overlaps with the transcriptional terminators, The RNA transcript of the sequence about the terminators can be arranged in a set of alternative double-stranded hairpin structures. It is suggested that conversion between these structures may have a role in termination; this may be influenced by interactions with ribosomes and RNase III. The region of the C promoter between genes 0.7 and 1 thus contains several sites which may be involved in the control of transcription and translation. Images PMID:493111

  6. Promoter G-quadruplex sequences are targets for base oxidation and strand cleavage during hypoxia-induced transcription.


    Clark, David W; Phang, Tzu; Edwards, Michael G; Geraci, Mark W; Gillespie, Mark N


    The G-quadruplex, a non-B DNA motif that forms in certain G-rich sequences, is often located near transcription start sites in growth regulatory genes. Multiple lines of evidence show that reactive oxygen species generated as second messengers during physiologic signaling target specific DNA sequences for oxidative base modifications. Because guanine repeats are uniquely sensitive to oxidative damage, and G4 sequences are known "hot spots" for genetic mutation and DNA translocation, we hypothesized that G4 sequences are targeted for oxidative base modifications in hypoxic signaling. Approximately 25% of hypoxia-regulated genes in pulmonary artery endothelial cells harbored G4 sequences within their promoters. Chromatin immunoprecipitation showed that common base oxidation product 8-oxoguanine was selectively introduced into G4s, in promoters of hypoxia up-, down-, and nonregulated genes. Additionally, base excision DNA repair (BER) enzymes were recruited, and transient strand breaks formed in these sequences. Transcription factor Sp1, constitutively bound to G4 sequences in normoxia, was evicted as 8-oxoguanine accumulated during hypoxic exposure. Blocking hypoxia-induced oxidant production prevented both base modifications and decreased Sp1 binding. These findings suggest that oxidant stress in hypoxia causes oxidative base modifications, recruitment of BER enzymes, and transient strand breaks in G4 promoter sequences potentially altering G4 integrity and function.

  7. Synthetic introns help identify sequences in the 5' UTR intron of the Glycine max polyubiquitin (Gmubi) promoter that give increased promoter activity.


    Grant, Trudi N L; De La Torre, Carola M; Zhang, Ning; Finer, John J


    Specific sequences within the leader intron of a soybean polyubiquitin gene stimulated gene expression when placed either within a synthetic intron or upstream of a core promoter. The intron in the 5' untranslated region of the soybean polyubiquitin promoter, Gmubi, seems to contribute to the high activity of this promoter. To identify the stimulatory sequences within the intron, ten different sequential intronic sequences of 40 nt were isolated, cloned as tetrameric repeats and placed upstream of a minimal cauliflower mosaic virus 35S (35S) core promoter, which was used to control expression of the green fluorescent protein. Intron fragment tetramers were also cloned within a modified, native intron, creating a Synthetic INtron Cassette (SINC), which was then placed downstream of Gmubi and 35S core promoters. Intron fragment tetramers and SINC constructs were evaluated using transient expression in lima bean cotyledons and stable expression in soybean hairy roots. Intron fragments, used as tetramers upstream of the 35S core promoter, yielded up to 80 times higher expression than the core promoter in transient expression analyses and ten times higher expression in stably transformed hairy roots. Tetrameric intronic fragments, cloned downstream of the Gmubi and 35S core promoters and within the synthetic intron, also yielded increased transient and stable GFP expression that was up to 4 times higher than Gmubi alone and up to 40 times higher than the 35S core promoter alone. These intron fragments contain sequences that seem to act as promoter regulatory elements and may contribute to the increased expression observed with this native strong promoter. Intron regulatory elements and synthetic introns may provide additional tools for increasing transgene expression in plants.

  8. Compensation for differences in gene copy number among yeast ribosomal proteins is encoded within their promoters

    PubMed Central

    Zeevi, Danny; Sharon, Eilon; Lotan-Pompan, Maya; Lubling, Yaniv; Shipony, Zohar; Raveh-Sadka, Tali; Keren, Leeat; Levo, Michal; Weinberger, Adina; Segal, Eran


    Coordinate regulation of ribosomal protein (RP) genes is key for controlling cell growth. In yeast, it is unclear how this regulation achieves the required equimolar amounts of the different RP components, given that some RP genes exist in duplicate copies, while others have only one copy. Here, we tested whether the solution to this challenge is partly encoded within the DNA sequence of the RP promoters, by fusing 110 different RP promoters to a fluorescent gene reporter, allowing us to robustly detect differences in their promoter activities that are as small as ∼10%. We found that single-copy RP promoters have significantly higher activities, suggesting that proper RP stoichiometry is indeed partly encoded within the RP promoters. Notably, we also partially uncovered how this regulation is encoded by finding that RP promoters with higher activity have more nucleosome-disfavoring sequences and characteristic spatial organizations of these sequences and of binding sites for key RP regulators. Mutations in these elements result in a significant decrease of RP promoter activity. Thus, our results suggest that intrinsic (DNA-dependent) nucleosome organization may be a key mechanism by which genomes encode biologically meaningful promoter activities. Our approach can readily be applied to uncover how transcriptional programs of other promoters are encoded. PMID:22009988

  9. Identification and sequence analyses of the granulin gene of Choristoneura fumiferana granulovirus.


    Bah, A; Bergeron, J; Arella, M; Lucarotti, C J; Guertin, C


    The nucleotide sequence of the granulin gene of Choristoneura fumiferana granulovirus (CfGV) was determined. The gene encodes a protein of 248 amino acids with a predicted Mr of 29.299 kDa. The granulin genes of Trichoplusia ni, Pieris brassicae and Cryptophlebia leucotreta granuloviruses showed homologies ranging from 76.7-80.5% for nucleotide sequences and 84.2-88.3% for amino acid sequences when compared to CfGV. The secondary structure of CfGV granulin protein, including the hydrophilic (polar) and hydrophobic (basic) regions, was predicted and found to be similar to other granulins. A very late baculovirus promoter motif, ATAAG, was found within the putative promoter region of the CfGV granulin gene.

  10. Promoter sequences direct cytoplasmic localization and translation of mRNAs during starvation in yeast.


    Zid, Brian M; O'Shea, Erin K


    A universal feature of the response to stress and nutrient limitation is transcriptional upregulation of genes that encode proteins important for survival. Under many such conditions, the overall protein synthesis level is reduced, thereby dampening the stress response at the level of protein expression. For example, during glucose starvation in Saccharomyces cerevisiae (yeast), translation is rapidly repressed, yet the transcription of many stress- and glucose-repressed genes is increased. Here we show, using ribosomal profiling and microscopy, that this transcriptionally upregulated gene set consists of two classes: one class produces messenger RNAs that are translated during glucose starvation and are diffusely localized in the cytoplasm, including many heat-shock protein mRNAs; and the other class produces mRNAs that are not efficiently translated during glucose starvation and are concentrated in foci that co-localize with P bodies and stress granules, a class that is enriched for mRNAs involved in glucose metabolism. Surprisingly, the information specifying the differential localization and protein production of these two classes of mRNA is encoded in the promoter sequence: promoter responsiveness to heat-shock factor 1 (Hsf1) specifies diffuse cytoplasmic localization and higher protein production on glucose starvation. Thus, promoter sequences can influence not only the levels of mRNAs but also the subcellular localization of mRNAs and the efficiency with which they are translated, enabling cells to tailor protein production to the environmental conditions.

  11. High sequence turnover in the regulatory regions of the developmental gene hunchback in insects.


    Hancock, J M; Shaw, P J; Bonneton, F; Dover, G A


    Extensive sequence analysis of the developmental gene hunchback and its 5' and 3' regulatory regions in Drosophila melanogaster, Drosophila virilis, Musca domestica, and Tribolium castaneum, using a variety of computer algorithms, reveals regions of high sequence simplicity probably generated by slippage-like mechanisms of turnover. No regions are entirely refractory to the action of slippage, although the density and composition of simple sequence motifs varies from region to region. Interestingly, the 5' and 3' flanking regions share short repetitive motifs despite their separation by the gene itself, and the motifs are different in composition from those in the exons and introns. Furthermore, there are high levels of conservation of motifs in equivalent orthologous regions. Detailed sequence analysis of the P2 promoter and DNA footprinting assays reveal that the number, orientation, sequence, spacing, and protein-binding affinities of the BICOID-binding sites varies between species and that the 'P2' promoter, the nanos response element in the 3' untranslated region, and several conserved boxes of sequence in the gene (e.g., the two zinc-finger regions) are surrounded by cryptically-simple-sequence DNA. We argue that high sequence turnover and genetic redundancy permit both the general maintenance of promoter functions through the establishment of coevolutionary (compensatory) changes in cis- and trans-acting genetic elements and, at the same time, the possibility of subtle changes in the regulation of hunchback in the different species.

  12. Mutations in two regions upstream of the A gamma globin gene canonical promoter affect gene expression.

    PubMed Central

    Lloyd, J A; Lee, R F; Lingrel, J B


    Two regions upstream of the human fetal (A gamma) globin gene, which interact with protein factors from K562 and HeLa nuclear extracts, have functional significance in gene expression. One binding site (site I) is at a position -290 to -267 bp upstream of the transcription initiation site, the other (site II) is at -182 to -168 bp. Site II includes the octamer sequence (ATGCAAAT) found in an immunoglobulin enhancer and the histone H2b gene promoter. A point mutation (T----C) at -175, within the octamer sequence, is characteristic of a naturally occurring HPFH (hereditary persistence of fetal hemoglobin), and decreases factor binding to an oligonucleotide containing the octamer motif. Expression assays using a A gamma globin promoter-CAT (chloramphenicol acetyl transferase) fusion gene show that the point mutation at -175 increases expression in erythroid, but not non-erythroid cells when compared to a wild-type construct. This correlates with the actual effect of the HPFH mutation in humans. This higher expression may result from a mechanism more complex than reduced binding of a negative regulator. A site I clustered-base substitution gives gamma-CAT activity well below wild-type, suggesting that this factor is a positive regulator. Images PMID:2472607

  13. [Nucleotide sequence of HLA-DQA1 promoter region (QAP) in a lung cancer patient].


    Qiu, C; Zhou, W; Song, C


    The HLA-DQA1 allele and nucleotide sequence of HLA-DQA1 promoter region (QAP) in a patient with IDDM complicated lung cancer have been identified by PCR/SSCP, PCR/SSCP and PCR/sequencing. The results showed that: (1) All of the lung cancer patient and his family members carried HLA-DQA1* 0301/0501 alleles. (2) a single base substitution G-->A at position -155 and deletion CAA at position -161 to -163 occurred in the patient. These results suggest that the mutation of HLA-DQA1 promoter region may modulate HLA-DQA1 gene expression by trans-acting factors binding to variant cis-acting elements and may be responsible for pathogenesis of lung cancer.

  14. Isolation and characterization of rubisco small subunit gene promoter from common wheat (Triticum aestivum L.).


    Mukherjee, Shalini; Stasolla, Claudio; Brûlé-Babel, Anita; Ayele, Belay T


    Choice of an appropriate promoter is critical to express target genes in intended tissues and developmental stages. However, promoters capable of directing gene expression in specific tissues and stages are not well characterized in monocot species. To identify such a promoter in wheat, this study isolated a partial sequence of the wheat small subunit of RuBisCO (TarbcS) promoter. In silico analysis revealed the presence of elements that are characteristic to rbcS promoters of other, mainly dicot, species. Transient expression of the TarbcS:GUS in immature wheat embryos and tobacco leaves but not in the wheat roots indicate the functionality of the TarbcS promoter fragment in directing the expression of target genes in green plant tissues.

  15. The complete sequence of soybean chlorotic mottle virus DNA and the identification of a novel promoter.


    Hasegawa, A; Verver, J; Shimada, A; Saito, M; Goldbach, R; Van Kammen, A; Miki, K; Kameya-Iwaki, M; Hibi, T


    The complete nucleotide sequence of an infectious clone of soybean chlorotic mottle virus (SoyCMV) DNA was determined and compared with those of three other caulimoviruses, cauliflower mosaic virus (CaMV), carnation etched ring virus and figwort mosaic virus. The double-stranded DNA genome of SoyCMV (8,175 bp) contained nine open reading frames (ORFs) and one large intergenic region. The primer binding sites, gene organization and size of ORFs were similar to those of the other caulimoviruses, except for ORF I, which was split into ORF Ia and Ib. The amino acid sequences deduced from each ORF showed only short, highly homologous regions in several of the corresponding ORFs of the three other caulimoviruses. A promoter fragment of 378 bp in SoyCMV ORF III showed a strong expression activity, comparable to that of the CaMV 35S promoter, in tobacco mesophyll protoplasts as determined by a beta-glucuronidase assay using electrotransfection. The fragment contained CAAT and TATA boxes but no transcriptional enhancer signal as reported for the CaMV 35S promoter. Instead, it had sequences homologous to a part of the translational enhancer signal reported for the 5'-leader sequence of tobacco mosaic virus RNA.

  16. Isolation and characterization of oil palm constitutive promoter derived from ubiquitin extension protein (uep1) gene.


    Masura, Subhi Siti; Parveez, Ghulam Kadir Ahmad; Ismail, Ismanizan


    The ubiquitin extension protein (uep1) gene was identified as a constitutively expressed gene in oil palm. We have isolated and characterized the 5' region of the oil palm uep1 gene, which contains an 828 bp sequence upstream of the uep1 translational start site. Construction of a pUEP1 transformation vector, which contains gusA reporter gene under the control of uep1 promoter, was carried out for functional analysis of the promoter through transient expression studies. It was found that the 5' region of uep1 functions as a constitutive promoter in oil palm and could drive GUS expression in all tissues tested, including embryogenic calli, embryoid, immature embryo, young leaflet from mature palm, green leaf, mesocarp and meristematic tissues (shoot tip). This promoter could also be used in dicot systems as it was demonstrated to be capable of driving gusA gene expression in tobacco.

  17. Sequence signatures involved in targeting the male-specific lethal complex to X-chromosomal genes in Drosophila melanogaster

    PubMed Central


    Background In Drosophila melanogaster, the dosage-compensation system that equalizes X-linked gene expression between males and females, thereby assuring that an appropriate balance is maintained between the expression of genes on the X chromosome(s) and the autosomes, is at least partially mediated by the Male-Specific Lethal (MSL) complex. This complex binds to genes with a preference for exons on the male X chromosome with a 3' bias, and it targets most expressed genes on the X chromosome. However, a number of genes are expressed but not targeted by the complex. High affinity sites seem to be responsible for initial recruitment of the complex to the X chromosome, but the targeting to and within individual genes is poorly understood. Results We have extensively examined X chromosome sequence variation within five types of gene features (promoters, 5' UTRs, coding sequences, introns, 3' UTRs) and intergenic sequences, and assessed its potential involvement in dosage compensation. Presented results show that: the X chromosome has a distinct sequence composition within its gene features; some of the detected variation correlates with genes targeted by the MSL-complex; the insulator protein BEAF-32 preferentially binds upstream of MSL-bound genes; BEAF-32 and MOF co-localizes in promoters; and that bound genes have a distinct sequence composition that shows a 3' bias within coding sequence. Conclusions Although, many strongly bound genes are close to a high affinity site neither our promoter motif nor our coding sequence signatures show any correlation to HAS. Based on the results presented here, we believe that there are sequences in the promoters and coding sequences of targeted genes that have the potential to direct the secondary spreading of the MSL-complex to nearby genes. PMID:22424303

  18. Sequence signatures involved in targeting the Male-Specific Lethal complex to X-chromosomal genes in Drosophila melanogaster.


    Philip, Philge; Pettersson, Fredrik; Stenberg, Per


    In Drosophila melanogaster, the dosage-compensation system that equalizes X-linked gene expression between males and females, thereby assuring that an appropriate balance is maintained between the expression of genes on the X chromosome(s) and the autosomes, is at least partially mediated by the Male-Specific Lethal (MSL) complex. This complex binds to genes with a preference for exons on the male X chromosome with a 3' bias, and it targets most expressed genes on the X chromosome. However, a number of genes are expressed but not targeted by the complex. High affinity sites seem to be responsible for initial recruitment of the complex to the X chromosome, but the targeting to and within individual genes is poorly understood. We have extensively examined X chromosome sequence variation within five types of gene features (promoters, 5' UTRs, coding sequences, introns, 3' UTRs) and intergenic sequences, and assessed its potential involvement in dosage compensation. Presented results show that: the X chromosome has a distinct sequence composition within its gene features; some of the detected variation correlates with genes targeted by the MSL-complex; the insulator protein BEAF-32 preferentially binds upstream of MSL-bound genes; BEAF-32 and MOF co-localizes in promoters; and that bound genes have a distinct sequence composition that shows a 3' bias within coding sequence. Although, many strongly bound genes are close to a high affinity site neither our promoter motif nor our coding sequence signatures show any correlation to HAS. Based on the results presented here, we believe that there are sequences in the promoters and coding sequences of targeted genes that have the potential to direct the secondary spreading of the MSL-complex to nearby genes.

  19. Functional analysis of BADH gene promoter from Suaeda liaotungensis K.


    Zhang, Yi; Yin, Hui; Li, Dan; Zhu, Weiwei; Li, Qiuli


    A 1,993 bp region upstream of the gene encoding the betaine aldehyde dehydrogenase (BADH) was isolated from Suaeda liaotungensis K., and the analysis of the promoter sequence has revealed the existence of several putative cis-elements by the PLACE database. In this study, according to the characteristic of the BADH promoter, five chimeric constructs varied in the length of promoter fragments from -1,993, -1,466, -1,084, -573 and -300 to +62 bp relative to the transcriptional start site were placed to the upstream of the beta-glucuronidase (GUS) coding region and transferred to Nicotiana tabacum by Agrobacterium tumefaciens-mediated leaf-disc transformation. The functional properties of each promoter fragment were examined by GUS histochemical staining and fluorescence quantitative analyses in the transgenic tobacco leaves treated with different NaCl concentrations for 48 h. The results show that healthy transgenic plants had decreased GUS activity in leaves, whereas a higher GUS activity was observed when the transgenic plants were challenged with sodium chloride (NaCl). Induction levels were proportional to the concentration of NaCl treatment, allowing fine-tuning of protein expression. GUS enzyme activity was enhanced 6.3-fold in transgenic tobacco leaves containing -300 bp promoter fragment in the presence of 400 mmol/l NaCl compared to the noninductive leaves. This suggests that the smallest promoter fragment (-300 to +62 bp) possesses all the essential cis-acting elements and is sufficient for NaCl induction.

  20. Complete genome sequence of the rapeseed plant-growth promoting Serratia plymuthica strain AS9

    PubMed Central

    Högberg, Nils; Alström, Sadhna; Lucas, Susan; Han, James; Lapidus, Alla; Cheng, Jan-Fang; Bruce, David; Goodwin, Lynne; Pitluck, Sam; Peters, Lin; Ovchinnikova, Galina; Lu, Megan; Han, Cliff; Detter, John C.; Tapia, Roxanne; Fiebig, Anne; Land, Miriam; Hauser, Loren; Kyrpides, Nikos C.; Ivanova, Natalia; Pagani, Ioanna; Klenk, Hans-Peter; Woyke, Tanja; Finlay, Roger D.


    Serratia plymuthica are plant-associated, plant beneficial species belonging to the family Enterobacteriaceae. The members of the genus Serratia are ubiquitous in nature and their life style varies from endophytic to free-living. S. plymuthica AS9 is of special interest for its ability to inhibit fungal pathogens of rapeseed and to promote plant growth. The genome of S. plymuthica AS9 comprises a 5,442,880 bp long circular chromosome that consists of 4,952 protein-coding genes, 87 tRNA genes and 7 rRNA operons. This genome is part of the project entitled “Genomics of four rapeseed plant growth promoting bacteria with antagonistic effect on plant pathogens” awarded through the 2010 DOE-JGI Community Sequencing Program (CSP2010). PMID:22675598

  1. Complete genome sequence of the rapeseed plant-growth promoting Serratia plymuthica strain AS9.


    Neupane, Saraswoti; Högberg, Nils; Alström, Sadhna; Lucas, Susan; Han, James; Lapidus, Alla; Cheng, Jan-Fang; Bruce, David; Goodwin, Lynne; Pitluck, Sam; Peters, Lin; Ovchinnikova, Galina; Lu, Megan; Han, Cliff; Detter, John C; Tapia, Roxanne; Fiebig, Anne; Land, Miriam; Hauser, Loren; Kyrpides, Nikos C; Ivanova, Natalia; Pagani, Ioanna; Klenk, Hans-Peter; Woyke, Tanja; Finlay, Roger D


    Serratia plymuthica are plant-associated, plant beneficial species belonging to the family Enterobacteriaceae. The members of the genus Serratia are ubiquitous in nature and their life style varies from endophytic to free-living. S. plymuthica AS9 is of special interest for its ability to inhibit fungal pathogens of rapeseed and to promote plant growth. The genome of S. plymuthica AS9 comprises a 5,442,880 bp long circular chromosome that consists of 4,952 protein-coding genes, 87 tRNA genes and 7 rRNA operons. This genome is part of the project entitled "Genomics of four rapeseed plant growth promoting bacteria with antagonistic effect on plant pathogens" awarded through the 2010 DOE-JGI Community Sequencing Program (CSP2010).

  2. Complete genome sequence of the rapeseed plant-growth promoting Serratia plymuthica strain AS9

    SciTech Connect

    Neupane, Saraswoti; Hogberg, Nils; Alstrom, Sadhna; Lucas, Susan; Han, James; Lapidus, Alla L.; Cheng, Jan-Fang; Bruce, David; Goodwin, Lynne A.; Pitluck, Sam; Peters, Lin; Ovchinnikova, Galina; Lu, Megan; Han, Cliff; Detter, J. Chris; Tapia, Roxanne; Fiebig, Anne; Land, Miriam L; Hauser, Loren John; Kyrpides, Nikos C; Ivanova, N; Pagani, Ioanna; Klenk, Hans-Peter; Woyke, Tanja; Finlay, Roger D.


    Serratia plymuthica are plant-associated, plant beneficial species belonging to the family Enterobacteriaceae. The members of the genus Serratia are ubiquitous in nature and their life style varies from endophytic to free-living. S. plymuthica AS9 is of special interest for its ability to inhibit fungal pathogens of rapeseed and to promote plant growth. The genome of S. plymuthica AS9 comprises a 5,442,880 bp long circular chromosome that consists of 4,952 protein-coding genes, 87 tRNA genes and 7 rRNA operons. This genome is part of the project entitled Genomics of four rapeseed plant growth promoting bacteria with antagonistic effect on plant pathogens awarded through the 2010 DOE-JGI Community Sequencing Program (CSP2010).

  3. Presence of STA gene sequences in brewer's yeast genome.


    Balogh, I; Maráz, A


    STA genes are responsible for producing extracellular glucoamylase enzymes in Saccharomyces cerevisiae var. diastaticus. These genes exist in three forms, which are located on three different chromosomes. The nucleotide sequences of the STA genes are highly homologous. A sporulation-specific glucoamylase gene called SGA1 exists in every Saccharomyces cerevisiae strain, this also having a partly homologous DNA sequence with the STA genes. In this study S. cerevisiae var. diastaticus and brewer's yeast strains were characterized by pulsed-field gel electrophoresis. In many cases chromosome length polymorphism (CLP) was found. The chromosomes were hybridized with a DNA probe which was homologous with STA genes and the SGA1 gene. Presence of the SGA1 gene was detected in each strain used. Four brewing yeasts were found to have homologous sequences with the STA3 gene on chromosome XIV despite the fact that these strains were not able to produce extracellular glucoamylase enzyme.

  4. Candidate gene analysis and exome sequencing confirm LBX1 as a susceptibility gene for idiopathic scoliosis.


    Grauers, Anna; Wang, Jingwen; Einarsdottir, Elisabet; Simony, Ane; Danielsson, Aina; Åkesson, Kristina; Ohlin, Acke; Halldin, Klas; Grabowski, Pawel; Tenne, Max; Laivuori, Hannele; Dahlman, Ingrid; Andersen, Mikkel; Christensen, Steen Bach; Karlsson, Magnus K; Jiao, Hong; Kere, Juha; Gerdhem, Paul


    Idiopathic scoliosis is a spinal deformity affecting approximately 3% of otherwise healthy children or adolescents. The etiology is still largely unknown but has an important genetic component. Genome-wide association studies have identified a number of common genetic variants that are significantly associated with idiopathic scoliosis in Asian and Caucasian populations, rs11190870 close to the LBX1 gene being the most replicated finding. The aim of the present study was to investigate the genetics of idiopathic scoliosis in a Scandinavian cohort by performing a candidate gene study of four variants previously shown to be associated with idiopathic scoliosis and exome sequencing of idiopathic scoliosis patients with a severe phenotype to identify possible novel scoliosis risk variants. This was a case control study. A total of 1,739 patients with idiopathic scoliosis and 1,812 controls were included. The outcome measure was idiopathic scoliosis. The variants rs10510181, rs11190870, rs12946942, and rs6570507 were genotyped in 1,739 patients with idiopathic scoliosis and 1,812 controls. Exome sequencing was performed on pooled samples from 100 surgically treated idiopathic scoliosis patients. Novel or rare missense, nonsense, or splice site variants were selected for individual genotyping in the 1,739 cases and 1,812 controls. In addition, the 5'UTR, noncoding exon and promoter regions of LBX1, not covered by exome sequencing, were Sanger sequenced in the 100 pooled samples. Of the four candidate genes, an intergenic variant, rs11190870, downstream of the LBX1 gene, showed a highly significant association to idiopathic scoliosis in 1,739 cases and 1,812 controls (p=7.0×10(-18)). We identified 20 novel variants by exome sequencing after filtration and an initial genotyping validation. However, we could not verify any association to idiopathic scoliosis in the large cohort of 1,739 cases and 1,812 controls. We did not find any variants in the 5'UTR, noncoding exon and

  5. New inducible promoter for gene expression and synthetic biology in Yarrowia lipolytica.


    Trassaert, Marion; Vandermies, Marie; Carly, Fréderic; Denies, Olivia; Thomas, Stéphane; Fickers, Patrick; Nicaud, Jean-Marc


    The oleaginous yeast Yarrowia lipolytica is increasingly used as alternative cell factory for the production of recombinant proteins. At present, several promoters with different strengths have been developed based either on the constitutive pTEF promoter or on oleic acid inducible promoters such as pPOX2 and pLIP2. Although these promoters are highly efficient, there is still a lack of versatile inducible promoters for gene expression in Y. lipolytica. We have isolated and characterized the promoter of the EYK1 gene coding for an erythrulose kinase. pEYK1 induction was found to be impaired in media supplemented with glucose and glycerol, while the presence of erythritol and erythrulose strongly increased the promoter induction level. Promoter characterization and mutagenesis allowed the identification of the upstream activating sequence UAS1EYK1. New hybrid promoters containing tandem repeats of either UAS1XPR2 or UAS1EYK1 were developed showing higher expression levels than the native pEYK1 promoter. Furthermore, promoter strength was improved in a strain carrying a deletion in the EYK1 gene, allowing thus the utilization of erythritol and erythrulose as free inducer. Novel tunable and regulated promoters with applications in the field of heterologous protein production, metabolic engineering, and synthetic biology have been developed, thus filling the gap of the absence of versatile inducible promoter in the yeast Y. lipolytica.

  6. Human DNA polymerase alpha gene: sequences controlling expression in cycling and serum-stimulated cells.

    PubMed Central

    Pearson, B E; Nasheuer, H P; Wang, T S


    We have investigated the DNA polymerase alpha promoter sequence requirements for the expression of a heterologous gene in actively cycling cells and following serum addition to serum-deprived cells. An 11.4-kb genomic clone that spans the 5' end of this gene and includes 1.62 kb of sequence upstream from the translation start site was isolated. The transcription start site was mapped at 46 +/- 1 nucleotides upstream from the translation start site. The upstream sequence is GC rich and lacks a TATA sequence but has a CCAAT sequence on the opposite strand. Analysis of a set of deletion constructs in transient transfection assays demonstrated that efficient expression of the reporter in cycling cells requires 248 bp of sequence upstream from the cap site. Clustered within these 248 nucleotides are sequences similar to consensus sequences for Sp1-, Ap1-, Ap2-, and E2F-binding sites. The CCAAT sequence and the potential E2F- and Ap1-binding sites are shown to be protected from DNase I digestion by partially purified nuclear proteins. The DNA polymerase alpha promoter can confer upon the reporter an appropriate, late response to serum addition. No single sequence element could be shown to confer serum inducibility. Rather, multiple sequence elements appear to mediate the full serum response. Images PMID:2005899

  7. Genome Sequencing of a Mung Bean Plant Growth Promoting Strain of P. aeruginosa with Biocontrol Ability

    PubMed Central

    Illakkiam, Devaraj; Shankar, Manoharan; Ponraj, Paramasivan; Rajendhran, Jeyaprakash


    Pseudomonas aeruginosa PGPR2 is a mung bean rhizosphere strain that produces secondary metabolites and hydrolytic enzymes contributing to excellent antifungal activity against Macrophomina phaseolina, one of the prevalent fungal pathogens of mung bean. Genome sequencing was performed using the Ion Torrent Personal Genome Machine generating 1,354,732 reads (6,772,433 sequenced bases) achieving ~25-fold coverage of the genome. Reference genome assembly using MIRA 3.4.0 yielded 198 contigs. The draft genome of PGPR2 encoded 6803 open reading frames, of which 5314 were genes with predicted functions, 1489 were genes of known functions, and 80 were RNA-coding genes. Strain specific and core genes of P. aeruginosa PGPR2 that are relevant to rhizospheric habitat were identified by pangenome analysis. Genes involved in plant growth promoting function such as synthesis of ACC deaminase, indole-3-acetic acid, trehalose, mineral scavenging siderophores, hydrogen cyanide, chitinases, acyl homoserine lactones, acetoin, 2,3-butanediol, and phytases were identified. In addition, niche-specific genes such as phosphate solubilising 3-phytase, adhesins, pathway-specific transcriptional regulators, a diguanylate cyclase involved in cellulose synthesis, a receptor for ferrienterochelin, a DEAD/DEAH-box helicase involved in stress tolerance, chemotaxis/motility determinants, an HtpX protease, and enzymes involved in the production of a chromanone derivative with potent antifungal activity were identified. PMID:25184130

  8. Enhancer-core-promoter specificity separates developmental and housekeeping gene regulation.


    Zabidi, Muhammad A; Arnold, Cosmas D; Schernhuber, Katharina; Pagani, Michaela; Rath, Martina; Frank, Olga; Stark, Alexander


    Gene transcription in animals involves the assembly of RNA polymerase II at core promoters and its cell-type-specific activation by enhancers that can be located more distally. However, how ubiquitous expression of housekeeping genes is achieved has been less clear. In particular, it is unknown whether ubiquitously active enhancers exist and how developmental and housekeeping gene regulation is separated. An attractive hypothesis is that different core promoters might exhibit an intrinsic specificity to certain enhancers. This is conceivable, as various core promoter sequence elements are differentially distributed between genes of different functions, including elements that are predominantly found at either developmentally regulated or at housekeeping genes. Here we show that thousands of enhancers in Drosophila melanogaster S2 and ovarian somatic cells (OSCs) exhibit a marked specificity to one of two core promoters--one derived from a ubiquitously expressed ribosomal protein gene and another from a developmentally regulated transcription factor--and confirm the existence of these two classes for five additional core promoters from genes with diverse functions. Housekeeping enhancers are active across the two cell types, while developmental enhancers exhibit strong cell-type specificity. Both enhancer classes differ in their genomic distribution, the functions of neighbouring genes, and the core promoter elements of these neighbouring genes. In addition, we identify two transcription factors--Dref and Trl--that bind and activate housekeeping versus developmental enhancers, respectively. Our results provide evidence for a sequence-encoded enhancer-core-promoter specificity that separates developmental and housekeeping gene regulatory programs for thousands of enhancers and their target genes across the entire genome.

  9. Nucleotide sequence of the coat protein gene of canine parvovirus.

    PubMed Central

    Rhode, S L


    The nucleotide sequence of the canine parvovirus (CPV2) from map units 33 to 95 has been determined. This includes the entire coat protein gene and noncoding sequences at the 3' end of the gene, exclusive of the terminal inverted repeat. The predicted capsid protein structures are discussed and compared with those of the rodent parvoviruses H-1 and MVM. PMID:3989914

  10. Cell-type preference of immunoglobulin kappa and lambda gene promoters.

    PubMed Central

    Picard, D; Schaffner, W


    Immunoglobulin gene constant regions are known to be associated with strictly tissue-specific enhancer elements. Until recently the promoter of the variable region, which becomes linked to the constant region by somatic rearrangement, could have been viewed as a passive recipient of the enhancer stimulus. Here we show that the promoters of the immunoglobulin kappa and lambda light chain genes are approximately 20-30 times more active in lymphoid cells than in non-lymphoid cells. To avoid the problem of differential mRNA stability upon transfection of immunoglobulin genes into non-lymphoid cells we have constructed chimeric genes. All kappa mRNA sequences were progressively deleted to fuse the kappa gene promoter to a globin gene coding body. A similar chimeric gene was constructed with the promoter of the lambda gene. The cell-type preference of the promoter may be exploited during B-lymphocyte differentiation to regulate the immunoglobulin gene promoter independently from the enhancer. Images Fig. 2. Fig. 4. Fig. 5. Fig. 6. PMID:2998757

  11. Draft Genome Sequence of Plant Growth-Promoting Drought-Tolerant Bacillus sp. Strain CMAA 1363 Isolated from the Brazilian Caatinga Biome

    PubMed Central

    Santos, Suikinai Nobre; Taketani, Rodrigo Gouvêa; Vasconcellos, Rafael Leandro Figueiredo; Melo, Itamar Soares


    ABSTRACT The strain of Bacillus sp. CMAA 1363 was isolated from the Brazilian Caatinga biome and showed plant growth-promoting traits and ability to promote maize growth under drought stress. Sequencing revealed genes involved in stress response and plant growth promotion. These genomic features might aid in the protection of plants against the negative effects imposed by drought. PMID:28153893

  12. Draft Genome Sequence of Plant Growth-Promoting Drought-Tolerant Bacillus sp. Strain CMAA 1363 Isolated from the Brazilian Caatinga Biome.


    Kavamura, Vanessa Nessner; Santos, Suikinai Nobre; Taketani, Rodrigo Gouvêa; Vasconcellos, Rafael Leandro Figueiredo; Melo, Itamar Soares


    The strain of Bacillus sp. CMAA 1363 was isolated from the Brazilian Caatinga biome and showed plant growth-promoting traits and ability to promote maize growth under drought stress. Sequencing revealed genes involved in stress response and plant growth promotion. These genomic features might aid in the protection of plants against the negative effects imposed by drought.

  13. Promoter Sequence Determines the Relationship between Expression Level and Noise

    PubMed Central

    Sloot, Peter M. A.; Kaandorp, Jaap A.; Segal, Eran


    The ability of cells to accurately control gene expression levels in response to extracellular cues is limited by the inherently stochastic nature of transcriptional regulation. A change in transcription factor (TF) activity results in changes in the expression of its targets, but the way in which cell-to-cell variability in expression (noise) changes as a function of TF activity, and whether targets of the same TF behave similarly, is not known. Here, we measure expression and noise as a function of TF activity for 16 native targets of the transcription factor Zap1 that are regulated by it through diverse mechanisms. For most activated and repressed Zap1 targets, noise decreases as expression increases. Kinetic modeling suggests that this is due to two distinct Zap1-mediated mechanisms that both change the frequency of transcriptional bursts. Notably, we found that another mechanism of repression by Zap1, which is encoded in the promoter DNA, likely decreases the size of transcriptional bursts, producing a unique transcriptional state characterized by low expression and low noise. In addition, we find that further reduction in noise is achieved when a single TF both activates and represses a single target gene. Our results suggest a global principle whereby at low TF concentrations, the dominant source of differences in expression between promoters stems from differences in burst frequency, whereas at high TF concentrations differences in burst size dominate. Taken together, we show that the precise amount by which noise changes with expression is specific to the regulatory mechanism of transcription and translation that acts at each gene. PMID:23565060

  14. The effect of sequencing errors on metagenomic gene prediction.


    Hoff, Katharina J


    Gene prediction is an essential step in the annotation of metagenomic sequencing reads. Since most metagenomic reads cannot be assembled into long contigs, specialized statistical gene prediction tools have been developed for short and anonymous DNA fragments, e.g. MetaGeneAnnotator and Orphelia. While conventional gene prediction methods have been subject to a benchmark study on real sequencing reads with typical errors, such a comparison has not been conducted for specialized tools, yet. Their gene prediction accuracy was mostly measured on error free DNA fragments. In this study, Sanger and pyrosequencing reads were simulated on the basis of models that take all types of sequencing errors into account. All metagenomic gene prediction tools showed decreasing accuracy with increasing sequencing error rates. Performance results on an established metagenomic benchmark dataset are also reported. In addition, we demonstrate that ESTScan, a tool for sequencing error compensation in eukaryotic expressed sequence tags, outperforms some metagenomic gene prediction tools on reads with high error rates although it was not designed for the task at hand. This study fills an important gap in metagenomic gene prediction research. Specialized methods are evaluated and compared with respect to sequencing error robustness. Results indicate that the integration of error-compensating methods into metagenomic gene prediction tools would be beneficial to improve metagenome annotation quality.

  15. Antagonistic pleiotropy involving promoter sequences in a virus

    PubMed Central

    Presloid, John B.; Ebendick-Corpus, Bonnie E.; Zárate, Selene; Novella, Isabel S.


    Selection of specialist genotypes, that is, populations with limited niche width, promotes the maintenance of diversity. Specialization to a particular environment may have a cost in other environments, including fitness tradeoffs. When the tradeoffs are the result of mutations that have a beneficial effect in the selective environment, but a deleterious effect in other environment, we have antagonistic pleiotropy. Alternatively, tradeoffs can result from the fixation of mutations that are neutral in the selective environment but have a negative effect in other environment, and thus the tradeoff is due to mutation accumulation. We tested the mechanisms underlying the fitness tradeoffs observed during adaptation to persistent infection of vesicular stomatitis virus in insect cells by sequencing the full-length genomes of twelve strains with a history of replication in a single niche (acute mammalian infection or persistent insect infection) or in temporally-heterogeneous niches, and correlated genetic and fitness changes. Ecological theory predicts a correlation between the selective environment and the niche width of the evolved populations, such that adaptation to single niches should lead to the selection of specialists and niche cycling should result in the selection of generalists. Contrary to this expectation, adaptation to one of the single niches resulted in a generalist and adaptation to a heterogeneous environment led to the selection of a specialist. Only one-third of the mutations that accumulated during persistent infection had a fitness cost that could be explained in all cases by antagonistic pleiotropy. Mutations involved in fitness tradeoffs included changes in regulatory sequences, particularly at the 3′ termini of the genomes, which contain the single promoter that controls viral transcription and replication. PMID:18644381

  16. Phylogenetic relationships of rhizobia based on citrate synthase gene sequences.


    Hernández-Lucas, Ismael; Rogel-Hernández, Marco Antonio; Segovia, Lorenzo; Rojas-Jiménez, Keilor; Martínez-Romero, Esperanza


    Partial nucleotide sequences of the citrate synthase (gltA) gene from different rhizobia genera were determined. Tree topologies based on this housekeeping gene were similar to that obtained using 16S rRNA sequences. However gltA appeared to be more reliable at determining phylogenetic relationships of closely related taxa. We propose gltA sequences as an additional tool to be used in molecular phylogenetic studies.

  17. The Interferon Stimulated Gene 54 Promotes Apoptosis*

    PubMed Central

    Stawowczyk, Marcin; Van Scoy, Sarah; Kumar, K. Prasanna; Reich, Nancy C.


    The ability of interferons (IFNs) to inhibit viral replication and cellular proliferation is well established, but the specific contribution of each IFN-stimulated gene (ISG) to these biological responses remains to be completely understood. In this report we demonstrate that ISG54, also known as IFN-induced protein with tetratricopeptide repeats 2 (IFIT2), is a mediator of apoptosis. Expression of ISG54, independent of IFN stimulation, elicits apoptotic cell death. Cell death and apoptosis were quantified by propidium iodide uptake and annexin-V staining, respectively. The activation of caspase-3, a key mediator of the execution phase of apoptosis, was clearly apparent in cells expressing ISG54. The anti-apoptotic B cell lymphoma-xl (Bcl-xl) protein inhibited the apoptotic effects of ISG54 as did the anti-apoptotic adenoviral E1B-19K protein. In addition, ISG54 was not able to promote cell death in the absence of pro-apoptotic Bcl family members, Bax and Bak. Analyses of binding partners of ISG54 revealed association with two homologous proteins, ISG56/IFIT1 and ISG60/IFIT3. In addition, ISG60 binding negatively regulates the apoptotic effects of ISG54. The results reveal a previously unidentified role of ISG54 in the induction of apoptosis via a mitochondrial pathway and shed new light on the mechanism by which IFN elicits anti-viral and anti-cancer effects. PMID:21190939

  18. Seed storage protein gene promoters contain conserved DNA motifs in Brassicaceae, Fabaceae and Poaceae

    PubMed Central

    Fauteux, François; Strömvik, Martina V


    Background Accurate computational identification of cis-regulatory motifs is difficult, particularly in eukaryotic promoters, which typically contain multiple short and degenerate DNA sequences bound by several interacting factors. Enrichment in combinations of rare motifs in the promoter sequence of functionally or evolutionarily related genes among several species is an indicator of conserved transcriptional regulatory mechanisms. This provides a basis for the computational identification of cis-regulatory motifs. Results We have used a discriminative seeding DNA motif discovery algorithm for an in-depth analysis of 54 seed storage protein (SSP) gene promoters from three plant families, namely Brassicaceae (mustards), Fabaceae (legumes) and Poaceae (grasses) using backgrounds based on complete sets of promoters from a representative species in each family, namely Arabidopsis (Arabidopsis thaliana (L.) Heynh.), soybean (Glycine max (L.) Merr.) and rice (Oryza sativa L.) respectively. We have identified three conserved motifs (two RY-like and one ACGT-like) in Brassicaceae and Fabaceae SSP gene promoters that are similar to experimentally characterized seed-specific cis-regulatory elements. Fabaceae SSP gene promoter sequences are also enriched in a novel, seed-specific E2Fb-like motif. Conserved motifs identified in Poaceae SSP gene promoters include a GCN4-like motif, two prolamin-box-like motifs and an Skn-1-like motif. Evidence of the presence of a variant of the TATA-box is found in the SSP gene promoters from the three plant families. Motifs discovered in SSP gene promoters were used to score whole-genome sets of promoters from Arabidopsis, soybean and rice. The highest-scoring promoters are associated with genes coding for different subunits or precursors of seed storage proteins. Conclusion Seed storage protein gene promoter motifs are conserved in diverse species, and different plant families are characterized by a distinct combination of conserved motifs

  19. USP7/HAUSP promotes the sequence-specific DNA binding activity of p53.


    Sarkari, Feroz; Sheng, Yi; Frappier, Lori


    The p53 tumor suppressor invokes cellular responses to stressful stimuli by coordinating distinct gene expression programs. This function relies heavily on the ability of p53 to function as a transcription factor by binding promoters of target genes in a sequence specific manner. The DNA binding activity of the core domain of p53 is subject to regulation via post-translational modifications of the C-terminal region. Here we show that the ubiquitin specific protease, USP7 or HAUSP, known to stabilize p53, also regulates the sequence-specific DNA binding mediated by the core domain of p53 in vitro. This regulation is contingent upon interaction between USP7 and the C-terminal regulatory region of p53. However, our data suggest that this effect is not mediated through the N-terminal domain of USP7 previously shown to bind p53, but rather involves the USP7 C-terminal domain and is independent of the deubiquitylation activity of USP7. Consistent with our in vitro observations, we found that overexpression of catalytically inactive USP7 in cells promotes p53 binding to its target sequences and p21 expression, without increasing the levels of p53 protein. We also found that the USP7 C-terminal domain was sufficient for p21 induction. Our results suggest a novel mode of regulation of p53 function by USP7, which is independent of USP7 deubiquitylating activity.

  20. USP7/HAUSP Promotes the Sequence-Specific DNA Binding Activity of p53

    PubMed Central

    Sarkari, Feroz; Sheng, Yi; Frappier, Lori


    The p53 tumor suppressor invokes cellular responses to stressful stimuli by coordinating distinct gene expression programs. This function relies heavily on the ability of p53 to function as a transcription factor by binding promoters of target genes in a sequence specific manner. The DNA binding activity of the core domain of p53 is subject to regulation via post-translational modifications of the C-terminal region. Here we show that the ubiquitin specific protease, USP7 or HAUSP, known to stabilize p53, also regulates the sequence-specific DNA binding mediated by the core domain of p53 in vitro. This regulation is contingent upon interaction between USP7 and the C-terminal regulatory region of p53. However, our data suggest that this effect is not mediated through the N-terminal domain of USP7 previously shown to bind p53, but rather involves the USP7 C-terminal domain and is independent of the deubiquitylation activity of USP7. Consistent with our in vitro observations, we found that overexpression of catalytically inactive USP7 in cells promotes p53 binding to its target sequences and p21 expression, without increasing the levels of p53 protein. We also found that the USP7 C-terminal domain was sufficient for p21 induction. Our results suggest a novel mode of regulation of p53 function by USP7, which is independent of USP7 deubiquitylating activity. PMID:20885946

  1. Identification of regulatory sequences in the gene for 5-aminolevulinate synthase from rat.


    Braidotti, G; Borthwick, I A; May, B K


    The housekeeping enzyme 5-aminolevulinate synthase (ALAS) regulates the supply of heme for respiratory cytochromes. Here we report on the isolation of a genomic clone for the rat ALAS gene. The 5'-flanking region was fused to the chloramphenicol acetyltransferase gene and transient expression analysis revealed the presence of both positive and negative cis-acting sequences. Expression was substantially increased by the inclusion of the first intron located in the 5'-untranslated region. Sequence analysis of the promoter identified two elements at positions -59 and -88 bp with strong similarity to the binding site for nuclear respiratory factor 1 (NRF-1). Gel shift analysis revealed that both NRF-1 elements formed nucleoprotein complexes which could be abolished by an authentic NRF-1 oligomer. Mutagenesis of each NRF-1 motif in the ALAS promoter gave substantially lowered levels of chloramphenicol acetyltransferase expression, whereas mutagenesis of both NRF-1 motifs resulted in the almost complete loss of expression. These results establish that the NRF-1 motifs in the ALAS promoter are critical for promoter activity. NRF-1 binding sites have been identified in the promoters of several nuclear genes encoding mitochondrial proteins concerned with oxidative phosphorylation. The present studies suggest that NRF-1 may co-ordinate the supply of mitochondrial heme with the synthesis of respiratory cytochromes by regulating expression of ALAS. In erythroid cells, NRF-1 may be less important for controlling heme levels since an erythroid ALAS gene is strongly expressed and the promoter for this gene apparently lacks NRF-1 binding sites.

  2. Searching gene and protein sequence databases.


    Barsalou, T; Brutlag, D L


    A large-scale effort to map and sequence the human genome is now under way. Crucial to the success of this research is a group of computer programs that analyze and compare data on molecular sequences. This article describes the classic algorithms for similarity searching and sequence alignment. Because good performance of these algorithms is critical to searching very large and growing databases, we analyze the running times of the algorithms and discuss recent improvements in this area.

  3. Study of carD gene sequence in clinical isolates of Mycobacterium tuberculosis.


    Sarmadian, Hossein; Nazari, Razieh; Zolfaghari, Mohammad Reza; Pirayandeh, Mina; Sadrnia, Maryam; Arjomandzadegan, Mohammad; Titov, Leonid P; Rajabi, Fariba; Ahmadi, Azam; Shojapoor, Mana


    Mycobacterium tuberculosis growth rate is closely coupled to rRNA transcription which is regulated through carD gene. The aim of this study was to determine the sequence of carD gene in drug susceptible and resistant clinical isolates of M. tuberculosis and designing of a PCR assay based on carD sequence for rapid detection of this bacterium.Specific primers for amplification of carD gene were carefully designed, so that whole sequence of gene could be amplified; therefore primers were positioned at the upstream (promoter of this gene and ispD gene) and downstream (in ispD gene). DNA from 41 clinical isolates of M. tuberculosis with different pattern of drug resistance was used in the study. PCR conditions and annealing temperature were designed by means of online programs. PCR products were sequenced by ABI system.PCR product of carD gene was a 524 bp fragment. This method could detect all resistant and susceptible strains of M. tuberculosis. The size of amplified fragment was similar in all investigated samples. Sequence analysis showed that there was similar sequence in all of our isolates therefore probably this gene is considered to be conservative. Translation of nucleotide mode to amino acids was showed that TRCF domain in N-terminal of protein CarD was found to be fully conservative.This is the first study on the sequence of carD gene in clinical isolates of M. tuberculosis. This conservative gene is recommended for use as a target for designing of suitable inhibitors as anti-tuberculosis drug because its importance for life of MTB. In the other hand, a PCR detection method based on detection of carD gene was recommended for rapid detection in routine test.

  4. Characterization of the mouse tartrate-resistant acid phosphatase (TRAP) gene promoter.


    Reddy, S V; Hundley, J E; Windle, J J; Alcantara, O; Linn, R; Leach, R J; Boldt, D H; Roodman, G D


    Tartrate-resistant acid phosphatase (TRAP) is an iron-binding protein that is highly expressed in osteoclasts. To characterize the regulation of TRAP gene expression, progressive 5' and 3' deletions of a 1.8 kb fragment containing the 5'-flanking sequence were fused to a luciferase reporter gene. Two nonoverlapping regions of this 1.8 kb fragment had promoter activity. The upstream promoter (P1) was located within the region from -881 bp to -463 bp relative to the ATG, while the downstream promoter (P2) was located between -363 bp to -1 bp in a region we have previously shown to be an intron in transcripts originating from the upstream promoter. A putative repressor region for the P2 promoter at -1846 bp to -1240 bp and a putative enhancer region at -962 bp to -881 bp relative to the ATG were identified. PCR analysis of promoter-specific transcription of the TRAP gene in various murine tissues showed that both promoters were active in several tissues. Transferrin-bound iron increased P1 promoter activity 2.5-fold and hemin decreased P1 promoter activity, but neither had any effect on P2 activity. These data show that the transcriptional regulation of the TRAP gene is complex and that iron may play a key role in TRAP gene regulation.

  5. Complete genome sequence of Bacillus amyloliquefaciens strain Co1-6, a plant growth-promoting rhizobacterium of Calendula officinalis

    SciTech Connect

    Koeberl, Martina; White, Richard A.; Erschen, Sabine; Spanberger, Nora; El-Arabi, Tarek F.; Jansson, Janet K.; Berg, Gabriele


    The genome sequence of Bacillus amyloliquefaciens strain Co1-6, a plant growth-promoting rhizobacterium (PGPR) with broad-spectrum antagonistic activities against plant pathogenic fungi, bacteria and nematodes, consists of a single 3.9 Mb circular chromosome. The genome reveals genes putatively responsible for its promising biocontrol and PGP properties.

  6. Draft Genome Sequence of Aquitalea magnusonii Strain H3, a Plant Growth-Promoting Bacterium of Duckweed (Lemna minor).


    Ishizawa, Hidehiro; Kuroda, Masashi; Ike, Michihiko


    Aquitalea magnusonii strain H3 is a promising plant growth-promoting bacterium for duckweed. Here, we report the draft genome sequence of strain H3 comprising 4,750,601 bp in 73 contigs. Several genes associated with plant root colonization were identified. Copyright © 2017 Ishizawa et al.

  7. Draft Genome Sequence of Aquitalea magnusonii Strain H3, a Plant Growth-Promoting Bacterium of Duckweed (Lemna minor)

    PubMed Central

    Ishizawa, Hidehiro; Kuroda, Masashi


    ABSTRACT Aquitalea magnusonii strain H3 is a promising plant growth-promoting bacterium for duckweed. Here, we report the draft genome sequence of strain H3 comprising 4,750,601 bp in 73 contigs. Several genes associated with plant root colonization were identified. PMID:28818906

  8. Complete Genome Sequence of Paenibacillus polymyxa YC0136, a Plant Growth–Promoting Rhizobacterium Isolated from Tobacco Rhizosphere

    PubMed Central

    Liu, Hu; Liu, Kai; Li, Yuhuan; Wang, Chengqiang; Hou, Qihui; Xu, Wenfeng; Fan, Lingchao; Zhao, Jian; Gou, Jianyu


    ABSTRACT Paenibacillus polymyxa strain YC0136 is a plant growth–promoting rhizobacterium with antimicrobial activity, which was isolated from tobacco rhizosphere. Here, we report the complete genome sequence of P. polymyxa YC0136. Several genes with antifungal and antibacterial activity were discovered. PMID:28183774

  9. Complete Genome Sequence of Paenibacillus polymyxa YC0573, a Plant Growth–Promoting Rhizobacterium with Antimicrobial Activity

    PubMed Central

    Liu, Hu; Wang, Chengqiang; Li, Yuhuan; Liu, Kai; Hou, Qihui; Xu, Wenfeng; Fan, Lingchao; Zhao, Jian; Gou, Jianyu


    ABSTRACT Paenibacillus polymyxa strain YC0573 is a plant growth–promoting rhizobacterium with antimicrobial activity, which was isolated from tobacco rhizosphere. Here, we report the complete genome sequence of P. polymyxa YC0573. Antifungal and antibacterial genes were discovered. PMID:28183775

  10. Complete genome sequence of Bacillus amyloliquefaciens strain Co1-6, a plant growth-promoting rhizobacterium of Calendula officinalis


    Köberl, Martina; White, Richard A.; Erschen, Sabine; ...


    The genome sequence of Bacillus amyloliquefaciens strain Co1-6, a plant growth-promoting rhizobacterium (PGPR) with broad-spectrum antagonistic activity against plant-pathogenic fungi, bacteria, and nematodes, consists of a single 3.9-Mb circular chromosome. The genome reveals genes putatively responsible for its promising biocontrol and PGP properties.

  11. Sequence determinants of prokaryotic gene expression level under heat stress.


    Xiong, Heng; Yang, Yi; Hu, Xiao-Pan; He, Yi-Ming; Ma, Bin-Guang


    Prokaryotic gene expression is environment-dependent and temperature plays an important role in shaping the gene expression profile. Revealing the regulation mechanisms of gene expression pertaining to temperature has attracted tremendous efforts in recent years particularly owning to the yielding of transcriptome and proteome data by high-throughput techniques. However, most of the previous works concentrated on the characterization of the gene expression profile of individual organism and little effort has been made to disclose the commonality among organisms, especially for the gene sequence features. In this report, we collected the transcriptome and proteome data measured under heat stress condition from recently published literature and studied the sequence determinants for the expression level of heat-responsive genes on multiple layers. Our results showed that there indeed exist commonness and consistent patterns of the sequence features among organisms for the differentially expressed genes under heat stress condition. Some features are attributed to the requirement of thermostability while some are dominated by gene function. The revealed sequence determinants of bacterial gene expression level under heat stress complement the knowledge about the regulation factors of prokaryotic gene expression responding to the change of environmental conditions. Furthermore, comparisons to thermophilic adaption have been performed to reveal the similarity and dissimilarity of the sequence determinants for the response to heat stress and for the adaption to high habitat temperature, which elucidates the complex landscape of gene expression related to the same physical factor of temperature. Copyright © 2014 Elsevier B.V. All rights reserved.

  12. Evidence for a novel mitochondrial promoter preceding the cox2 gene of perennial teosintes.

    PubMed Central

    Newton, K J; Winberg, B; Yamato, K; Lupold, S; Stern, D B


    We have characterized two promoters of the cytochrome oxidase subunit 2 (cox2) gene in Zea perennis mitochondria present in maize lines. Initiation at a site 907 bases upstream of the start codon results in the major approximately 1900 nt cox2 transcript. A sequence just upstream of this site conforms to the consensus described for maize mitochondrial promoters and its transcription is correctly initiated in a maize mitochondrial in vitro transcription extract. A second transcription initiation site (-347) is used only when the dominant allele of a nuclear gene, Mct, is present and its use results in an additional, shorter major transcript. Sequences flanking the Mct-dependent transcription initiation site, which we have termed the conditional promoter of cox2 (cpc), do not fit the maize mitochondrial promoter consensus and do not function in the maize in vitro transcription extract. The cpc region does not hybridize with mitochondrial, chloroplast or nuclear DNAs from most maize or teosinte lines. However, the cpc sequence is found in the same position upstream of the cox2 gene in Zea diploperennis mtDNA and it has striking similarity to the previously reported 'ORF of unknown origin' fused to the ATPase subunit 6 gene in maize CMS-C mitochondria. cpc appears to represent a new type of mitochondrial promoter. Further analysis of both conditional and constitutive promoters should help us to better understand the control of transcription in plant mitochondria. Images PMID:7859746

  13. Isolation and characterization of CMO gene promoter from halophyte Suaeda liaotungensis K.


    Li, Qiuli; Yin, Hui; Li, Dan; Zhu, Hongfei; Zhang, Yi; Zhu, Weiwei


    The 5'-flanking proximal region of stress-induced gene encoding choline monooxygenase (CMO) was isolated by Adaptor-PCR and TAIL-PCR from halophyte Suaeda liaotungensis K. A total of 2,204 bp DNA sequence was obtained. The transcription start site, which is located at 128 bp upstream to the start ATG, was predicted by the TSSP-TCM program. The functional elements were analysed by PLACE program. The obtained SlCMO gene promoter contains the basic elements: TATA-box, CAAT-box, and stress-induced elements, for example, salt responsive element (GAAAAA), cold responsive elements (CANNTG), ABA (Abscisic Acid) responsive elements (NAACAA), water stress element (CGGTTG), and WUN responsive elements (GTTAGGTTC). Isolation and analysis of the promoter of the CMO gene from S. liaotungensis lays a foundation for characterising the stress-induced promoter elements, studying the relationship between the structure and function of the promoter, and investigating the molecular mechanism of CMO gene regulation.

  14. Optimization of gene sequences under constant mutational pressure and selection

    NASA Astrophysics Data System (ADS)

    Kowalczuk, M.; Gierlik, A.; Mackiewicz, P.; Cebrat, S.; Dudek, M. R.


    We have analyzed the influence of constant mutational pressure and selection on the nucleotide composition of DNA sequences of various size, which were represented by the genes of the Borrelia burgdorferi genome. With the help of MC simulations we have found that longer DNA sequences accumulate much less base substitutions per sequence length than short sequences. This leads us to the conclusion that the accuracy of replication may determine the size of genome.

  15. Nucleotide sequence of SHV-2 beta-lactamase gene

    SciTech Connect

    Garbarg-Chenon, A.; Godard, V.; Labia, R.; Nicolas, J.C. )


    The nucleotide sequence of plasmid-mediated beta-lactamase SHV-2 from Salmonella typhimurium (SHV-2pHT1) was determined. The gene was very similar to chromosomally encoded beta-lactamase LEN-1 of Klebsiella pneumoniae. Compared with the sequence of the Escherichia coli SHV-2 enzyme (SHV-2E.coli) obtained by protein sequencing, the deduced amino acid sequence of SHV-2pHT1 differed by three amino acid substitutions.

  16. Precise Regulation of Gene Expression Dynamics Favors Complex Promoter Architectures

    PubMed Central

    Müller, Dirk; Stelling, Jörg


    Promoters process signals through recruitment of transcription factors and RNA polymerase, and dynamic changes in promoter activity constitute a major noise source in gene expression. However, it is barely understood how complex promoter architectures determine key features of promoter dynamics. Here, we employ prototypical promoters of yeast ribosomal protein genes as well as simplified versions thereof to analyze the relations among promoter design, complexity, and function. These promoters combine the action of a general regulatory factor with that of specific transcription factors, a common motif of many eukaryotic promoters. By comprehensively analyzing stationary and dynamic promoter properties, this model-based approach enables us to pinpoint the structural characteristics underlying the observed behavior. Functional tradeoffs impose constraints on the promoter architecture of ribosomal protein genes. We find that a stable scaffold in the natural design results in low transcriptional noise and strong co-regulation of target genes in the presence of gene silencing. This configuration also exhibits superior shut-off properties, and it can serve as a tunable switch in living cells. Model validation with independent experimental data suggests that the models are sufficiently realistic. When combined, our results offer a mechanistic explanation for why specific factors are associated with low protein noise in vivo. Many of these findings hold for a broad range of model parameters and likely apply to other eukaryotic promoters of similar structure. PMID:19180182

  17. Genetic recombination is targeted towards gene promoter regions in dogs.


    Auton, Adam; Rui Li, Ying; Kidd, Jeffrey; Oliveira, Kyle; Nadel, Julie; Holloway, J Kim; Hayward, Jessica J; Cohen, Paula E; Greally, John M; Wang, Jun; Bustamante, Carlos D; Boyko, Adam R


    The identification of the H3K4 trimethylase, PRDM9, as the gene responsible for recombination hotspot localization has provided considerable insight into the mechanisms by which recombination is initiated in mammals. However, uniquely amongst mammals, canids appear to lack a functional version of PRDM9 and may therefore provide a model for understanding recombination that occurs in the absence of PRDM9, and thus how PRDM9 functions to shape the recombination landscape. We have constructed a fine-scale genetic map from patterns of linkage disequilibrium assessed using high-throughput sequence data from 51 free-ranging dogs, Canis lupus familiaris. While broad-scale properties of recombination appear similar to other mammalian species, our fine-scale estimates indicate that canine highly elevated recombination rates are observed in the vicinity of CpG rich regions including gene promoter regions, but show little association with H3K4 trimethylation marks identified in spermatocytes. By comparison to genomic data from the Andean fox, Lycalopex culpaeus, we show that biased gene conversion is a plausible mechanism by which the high CpG content of the dog genome could have occurred.

  18. Genetic Recombination Is Targeted towards Gene Promoter Regions in Dogs

    PubMed Central

    Auton, Adam; Rui Li, Ying; Kidd, Jeffrey; Oliveira, Kyle; Nadel, Julie; Holloway, J. Kim; Hayward, Jessica J.; Cohen, Paula E.; Greally, John M.; Wang, Jun; Bustamante, Carlos D.; Boyko, Adam R.


    The identification of the H3K4 trimethylase, PRDM9, as the gene responsible for recombination hotspot localization has provided considerable insight into the mechanisms by which recombination is initiated in mammals. However, uniquely amongst mammals, canids appear to lack a functional version of PRDM9 and may therefore provide a model for understanding recombination that occurs in the absence of PRDM9, and thus how PRDM9 functions to shape the recombination landscape. We have constructed a fine-scale genetic map from patterns of linkage disequilibrium assessed using high-throughput sequence data from 51 free-ranging dogs, Canis lupus familiaris. While broad-scale properties of recombination appear similar to other mammalian species, our fine-scale estimates indicate that canine highly elevated recombination rates are observed in the vicinity of CpG rich regions including gene promoter regions, but show little association with H3K4 trimethylation marks identified in spermatocytes. By comparison to genomic data from the Andean fox, Lycalopex culpaeus, we show that biased gene conversion is a plausible mechanism by which the high CpG content of the dog genome could have occurred. PMID:24348265

  19. Identification and refinement of two strong constitutive promoters for gene expression system of Schizosaccharomyces pombe.


    Wang, Hongcheng; Wang, Haiyang; Wang, Meng; Zhang, Lei; Wang, Ren; Mei, Yanzhen; Shao, Weilan


    Fission yeast Schizosaccharomyces pombe shares various important properties with higher eukaryotes and is now considered a useful host for elevated production of mammalian proteins for medicinal applications. The full-length nmt1 promoter has been widely used as a strong promoter in S. pombe expression system. In the present study, the promoters of the eno101 and gpd3 genes in S. pombe were identified as strong constitutive promoters. For convenient applications in the plasmids of S. pombe, these promoters were refined to 276-bp eno and 273-bp gpd promoters by deleting undesired sequences and examining the expression of reporter genes including lacZ and xynA. Both the refined eno and gpd promoters provided approximately 1.5-fold higher expression of LacZ than nmt1 promoter. Furthermore, gene expression under the control of the eno or gpd promoter was not repressed by the components of YES medium while nmt1 promoter was inhibited by thiamine in yeast extract. Therefore, both eno and gpd promoters offer opportunities for efficient production of recombinant proteins by S. pombe in high cell-density fermentation.

  20. The core promoter: At the heart of gene expression.


    Danino, Yehuda M; Even, Dan; Ideses, Diana; Juven-Gershon, Tamar


    The identities of different cells and tissues in multicellular organisms are determined by tightly controlled transcriptional programs that enable accurate gene expression. The mechanisms that regulate gene expression comprise diverse multiplayer molecular circuits of multiple dedicated components. The RNA polymerase II (Pol II) core promoter establishes the center of this spatiotemporally orchestrated molecular machine. Here, we discuss transcription initiation, diversity in core promoter composition, interactions of the basal transcription machinery with the core promoter, enhancer-promoter specificity, core promoter-preferential activation, enhancer RNAs, Pol II pausing, transcription termination, Pol II recycling and translation. We further discuss recent findings indicating that promoters and enhancers share similar features and may not substantially differ from each other, as previously assumed. Taken together, we review a broad spectrum of studies that highlight the importance of the core promoter and its pivotal role in the regulation of metazoan gene expression and suggest future research directions and challenges.

  1. Complete nucleotide sequence of primitive vertebrate immunoglobulin light chain genes.

    PubMed Central

    Shamblott, M J; Litman, G W


    Antibody to Heterodontus francisci (horned shark) immunoglobulin light chain was used to screen a spleen cDNA expression library, and recombinant clones encoding light chain genes were isolated. The complete sequences of the mature coding regions of two light chain genes in this phylogenetically distant vertebrate have been determined and are reported here. Comparisons of the sequences are consistent with the presence of mammalian-like framework and complementarity-determining regions. The predicted amino acid sequences of the genes are more related to mammalian lambda than to kappa light chains. The nucleotide sequences of the genes are most related to mammalian T-cell antigen receptor beta chain. Heterodontus light chain genes may reflect characteristics of the common ancestor of immunoglobulin and T-cell antigen receptors before its evolutionary diversification. PMID:2499889

  2. Complete nucleotide sequence of primitive vertebrate immunoglobulin light chain genes.


    Shamblott, M J; Litman, G W


    Antibody to Heterodontus francisci (horned shark) immunoglobulin light chain was used to screen a spleen cDNA expression library, and recombinant clones encoding light chain genes were isolated. The complete sequences of the mature coding regions of two light chain genes in this phylogenetically distant vertebrate have been determined and are reported here. Comparisons of the sequences are consistent with the presence of mammalian-like framework and complementarity-determining regions. The predicted amino acid sequences of the genes are more related to mammalian lambda than to kappa light chains. The nucleotide sequences of the genes are most related to mammalian T-cell antigen receptor beta chain. Heterodontus light chain genes may reflect characteristics of the common ancestor of immunoglobulin and T-cell antigen receptors before its evolutionary diversification.

  3. Regulation of sesquiterpene cyclase gene expression. Characterization of an elicitor- and pathogen-inducible promoter.

    PubMed Central

    Yin, S; Mei, L; Newman, J; Back, K; Chappell, J


    The promoter for a tobacco (Nicotiana tabacum) sesquiterpene cyclase gene, a key regulatory step in sesquiterpene phytoalexin biosynthesis, has been analyzed. The EAS4 promoter was fused to the beta-glucuronidase (GUS) reporter gene, and the temporal and spatial expression patterns of GUS activity were examined in stably transformed plants and in transient expression assays using electroporated protoplasts of tobacco. No GUS activity was observed in any tissues under normal growth conditions. A low level of GUS activity was detected in wounded leaf, root, and stem tissues, whereas a much higher level was observed when these tissues were challenged with elicitors or microbial pathogens. The GUS expression pattern directed by the EAS4 promoter was identical to the induction patterns observed for the endogenous sesquiterpene cyclase genes. Neither exogenous salicylic acid nor methyl jasmonate induced GUS expression; and H2O2 induced GUS expression to only a limited extent. Although the EAS4 promoter contains cis-sequences resembling previously identified transcriptional control motifs, other cis-sequences important for quantitative and qualitative gene expression were identified by deletion and gain-of-function analyses. The EAS4 promoter differs from previously described pathogen-/elicitor-inducible promoters because it only supports inducible gene expression and directs unique spatial expression patterns. PMID:9342864

  4. [Cloning and analysis of promoter of pig copper zinc superoxide dismutase gene (CuZnSOD)].


    Shi, Yuan; Chen, Wei; Zeng, Yongqing; Zhu, Honglei; Xu, Zhenggang; Zhang, Zhe; Yang, Yun; Zhang, Tianyang


    Pig copper zinc superoxide dismutase (CuZnSOD) is an important antioxidant enzyme. Some studies focused on the function of CuZnSOD gene, but the transcriptional regulation of the CuZnSOD gene is not yet fully elucidated. Therefore, the aims of the study were to determine the core promoter region and to explore its mechanism of transcriptional regulation. The 853 bp DNA sequence of 5'-flanking promoter was amplified by performing PCR. A series of CuZnSOD promoter fragments with gradually truncated 5'-end were produced by nested PCR and inserted into pGL3-Basic vector. The activities of the promoters were measured by the dual-luciferase assay system after transient transfection into the NIH/3T3 cells. The results demonstrated that there were 2 potential transcription start sites in the regions from initiation codon to -87 bp and -266 bp, respectively. The region from -383 bp to +67 bp in CuZnSOD gene promoter showed higher activity than other regions, and further deletion analysis demonstrated that the region from -75 bp to -32 bp contained an essential promoter sequence for pig CuZnSOD gene transcription. In addition, several potential transcription factor binding sites were predicted with bioinformatics method. These results suggest that these transcription factor binding sites may be involved in the transcriptional regulation of CuZnSOD gene.

  5. High nucleosome occupancy is encoded at X-linked gene promoters in C. elegans

    PubMed Central

    Ercan, Sevinç; Lubling, Yaniv; Segal, Eran; Lieb, Jason D.


    We mapped nucleosome occupancy by paired-end Illumina sequencing in C. elegans embryonic cells, adult somatic cells, and a mix of adult somatic and germ cells. In all three samples, the nucleosome occupancy of gene promoters on the X chromosome differed from autosomal promoters. While both X and autosomal promoters exhibit a typical nucleosome-depleted region upstream of transcript start sites and a well-positioned +1 nucleosome, X-linked gene promoters on average exhibit higher nucleosome occupancy relative to autosomal promoters. We show that the difference between X and autosomes does not depend on the somatic dosage compensation machinery. Instead, the chromatin difference at promoters is partly encoded by DNA sequence, because a model trained on nucleosome sequence preferences from S. cerevisiae in vitro data recapitulate nearly completely the experimentally observed difference between X and autosomal promoters. The model predictions also correlate very well with experimentally determined occupancy values genome-wide. The nucleosome occupancy differences observed on X promoters may bear on mechanisms of X chromosome dosage compensation in the soma, and chromosome-wide repression of X in the germline. PMID:21177966

  6. Heterologous gene expression driven by carbonic anhydrase gene promoter in Dunaliella salina

    NASA Astrophysics Data System (ADS)

    Yurong, Chai; Yumin, Lu; Tianyun, Wang; Weihong, Hou; Lexun, Xue


    Dunaliella salina, a halotolerant unicellular green alga without a rigid cell wall, can live in salinities ranging from 0.05 to 5 mol/L NaCl. These features of D. salina make it an ideal host for the production of antibodies, oral vaccine, and commercially valuable polypeptides. To produce high level of heterologous proteins from D. salina, highly efficient promoters are required to drive expression of target genes under controlled condition. In the present study, we cloned a 5' franking region of 1.4 kb from the carbonic anhydrase ( CAH) gene of D. salina by genomic walking and PCR. The fragment was ligated to the pMD18-T vector and characterized. Sequence analysis indicated that this region contained conserved motifs, including a TATA- like box and CAAT-box. Tandem (GT)n repeats that had a potential role of transcriptional control, were also found in this region. The transcription start site (TSS) of the CAH gene was determined by 5' RACE and nested PCR method. Transformation assays showed that the 1.4 kb fragment was able to drive expression of the selectable bar (bialaphos resistance) gene when the fusion was transformed into D. salina by biolistics. Northern blotting hybridizations showed that the bar transcript was most abundant in cells grown in 2 mol/L NaCl, and less abundant in 0.5 mol/L NaCl, indicating that expression of the bar gene was induced at high salinity. These results suggest the potential use of the CAH gene promoter to induce the expression of heterologous genes in D. salina under varied salt condition.

  7. Single molecule targeted sequencing for cancer gene mutation detection

    PubMed Central

    Gao, Yan; Deng, Liwei; Yan, Qin; Gao, Yongqian; Wu, Zengding; Cai, Jinsen; Ji, Daorui; Li, Gailing; Wu, Ping; Jin, Huan; Zhao, Luyang; Liu, Song; Ge, Liangjin; Deem, Michael W.; He, Jiankui


    With the rapid decline in cost of sequencing, it is now affordable to examine multiple genes in a single disease-targeted clinical test using next generation sequencing. Current targeted sequencing methods require a separate step of targeted capture enrichment during sample preparation before sequencing. Although there are fast sample preparation methods available in market, the library preparation process is still relatively complicated for physicians to use routinely. Here, we introduced an amplification-free Single Molecule Targeted Sequencing (SMTS) technology, which combined targeted capture and sequencing in one step. We demonstrated that this technology can detect low-frequency mutations using artificially synthesized DNA sample. SMTS has several potential advantages, including simple sample preparation thus no biases and errors are introduced by PCR reaction. SMTS has the potential to be an easy and quick sequencing technology for clinical diagnosis such as cancer gene mutation detection, infectious disease detection, inherited condition screening and noninvasive prenatal diagnosis. PMID:27193446

  8. Alu sequence involvement in transcriptional insulation of the keratin 18 gene in transgenic mice.

    PubMed Central

    Thorey, I S; Ceceña, G; Reynolds, W; Oshima, R G


    The human keratin 18 (K18) gene is expressed in a variety of adult simple epithelial tissues, including liver, intestine, lung, and kidney, but is not normally found in skin, muscle, heart, spleen, or most of the brain. Transgenic animals derived from the cloned K18 gene express the transgene in appropriate tissues at levels directly proportional to the copy number and independently of the sites of integration. We have investigated in transgenic mice the dependence of K18 gene expression on the distal 5' and 3' flanking sequences and upon the RNA polymerase III promoter of an Alu repetitive DNA transcription unit immediately upstream of the K18 promoter. Integration site-independent expression of tandemly duplicated K18 transgenes requires the presence of either an 825-bp fragment of the 5' flanking sequence or the 3.5-kb 3' flanking sequence. Mutation of the RNA polymerase III promoter of the Alu element within the 825-bp fragment abolishes copy number-dependent expression in kidney but does not abolish integration site-independent expression when assayed in the absence of the 3' flanking sequence of the K18 gene. The characteristics of integration site-independent expression and copy number-dependent expression are separable. In addition, the formation of the chromatin state of the K18 gene, which likely restricts the tissue-specific expression of this gene, is not dependent upon the distal flanking sequences of the 10-kb K18 gene but rather may depend on internal regulatory regions of the gene. Images PMID:7692231

  9. DNA sequence and expression of the 36-kilodalton outer membrane protein gene of Brucella abortus.

    PubMed Central

    Ficht, T A; Bearden, S W; Sowa, B A; Adams, L G


    The cloning of the gene(s) encoding a 36-kilodalton (kDa) cell envelope protein of Brucella abortus has been previously described (T. A. Ficht, S. W. Bearden, B. A. Sowa, and L. G. Adams, Infect, Immun. 56:2036-2046, 1988). In an attempt to define the nature of the previously described duplication at this locus we have sequenced 3,500 base pairs of genomic DNA encompassing this region. The duplication represented two similar open reading frames which shared more than 85% homology at the nucleotide level but differed primarily because of the absence of 108 nucleotides from one of the two gene copies. These two genes were read from opposite strands and potentially encoded proteins which are 96% homologous. The predicted gene products were identical over the first 100 amino acids, including 22-amino-acid-long signal sequences. The amino acid composition of the predicted proteins was similar to that obtained for the Brucella porin isolated by Verstreate et al. (D. R. Verstreate, M. T. Creasy, N. T. Caveney, C. L. Baldwin, M. W. Blab, and A. J. Winter, Infect. Immun. 35:979-989, 1982) and presumably represented two copies of the porin gene, tentatively identified as omp 2a (silent) and omp 2b (expressed). The homology between the two genes extended to and included Shine-Dalgarno sequences 7 base pairs upstream from the ATG start codons. Homology at the 3' ends extended only as far as the termination codon, but both genes had putative rho-independent transcription termination sites. Localization of the promoters proved more difficult, since the canonical procaryotic sequences could not be identified in the region upstream of either gene. Promoter activity was demonstrated by ligation to a promoterless lacZ gene in pMC1871. However, only one active promoter could be identified by using this system. A 36-kDa protein was synthesized in E. coli with the promoter in the native orientation and was identical in size to the protein produced in laboratory-grown B. abortus. When

  10. Characterization of SSU5C promoter of a rbcS gene from duckweed (Lemna gibba).


    Wang, Youru; Zhang, Yong; Yang, Baoyu; Chen, Shiyun


    Photosynthesis-associated nuclear genes are able to respond to multiple environmental and developmental signals. Studies have shown that light signals coordinate with hormone signaling pathways to control photomorphogenesis. A small subunit of ribulose-1,5 bisphosphate carboxylase/oxygenase (rbcS) gene promoter was cloned from duckweed (Lemna gibba). Sequence analysis revealed this promoter is different from the previously reported rbcs promoters and is named SSU5C. Analysis of T1 transgenic tobacco plants with a reporter gene under the control of the SSU5C promoter revealed that this promoter is tissue-specific and is positively regulated by red light. Promoter deletion analysis confirmed a region from position -152 to -49 relative to the start of transcription containing boxes X, Y and Z, and is identified to be critical for phytochrome responses. Further functional analysis of constructs of box-X, Y, Z, which was respectively fused to the basal SSU5C promoter, defined boxes X, Y and Z alone are able to direct phytochrome-regulated expression, indicating that boxes Y and Z are different from those of the SSU5B promoters in L. gibba. This promoter may be used for plant gene expression in a tissue-specific manner.

  11. Gene Slider: sequence logo interactive data-visualization for education and research.


    Waese, Jamie; Pasha, Asher; Wang, Ting Ting; van Weringh, Anna; Guttman, David S; Provart, Nicholas J


    Gene Slider helps visualize the conservation and entropy of orthologous DNA and protein sequences by presenting them as one long sequence logo that can be zoomed in and out of, from an overview of the entire sequence down to just a few residues at a time. A search function enables users to find motifs such as cis-elements in promoter regions by simply 'drawing' a sequence logo representation of the desired motif as a query. In addition to displaying user-supplied FASTA files, our demonstration version of Gene Slider loads and displays a rich database of 90 000+ conserved non-coding regions across the Brassicaceae indexed to the TAIR10 Col-0 Arabidopsis thaliana sequence. It also displays transcription factor binding sites, enabling easy identification of regions that are both conserved across multiple species and may contain transcription factor binding sites.

  12. Genomic organization and 5{prime}-flanking DNA sequence of the murine stomatin gene (Epb72)

    SciTech Connect

    Gallagher, P.G.; Turetsky, T.; Mentzer, W.C. |


    Stomatin is a poorly understood integral membrane protein that is absent from the erythrocyte membranes of many patients with hereditary stomatocytosis. This report describes the cloning of the murine stomatin chromosomal gene, determination of its genomic structure, and characterization of the 5{prime}-flanking genomic DNA sequences. The stomatin gene is encoded by seven exons spread over {approximately}25 kb of genomic DNA. There is no concordance between the exon structure of the stomatin gene and the locations of three domains predicted on the basis of protein structure. Inspection of the 5{prime}-flanking DNA sequences reveals features of a TATA-less housekeeping gene promoter and consensus sequences for a number of potential DNA-binding proteins. 12 refs., 2 figs., 1 tab.

  13. Multiple promoter elements govern expression of the human ornithine decarboxylase gene in colon carcinoma cells.

    PubMed Central

    Moshier, J A; Osborne, D L; Skunca, M; Dosescu, J; Gilbert, J D; Fitzgerald, M C; Polidori, G; Wagner, R L; Friezner Degen, S J; Luk, G D


    Overexpression of the ornithine decarboxylase (ODC) gene may be important to the development and maintenance of colonic neoplasms, as well as tumors in general. In this study, we examined the promoter elements governing constitutive expression of the human ODC gene in HCT 116 human colon carcinoma cells and, for comparison, K562 human erythro-leukemia cells. It was determined by functional analysis that the promoter elements responsible reside within the 378 bp immediately upstream from the transcription start site. Within this sequence, there are at least three regions that modulate the efficiency of the ODC promoter cooperatively. Both DNA bandshift and footprint assays demonstrated all three regions to be rich in sites that bind to nuclear proteins isolated from HCT 116 and K562 cells; the protein binding pattern of non-transformed, diploid fibroblasts was found to be much less complex. Several of the protein binding sequences have little or no homology to common regulatory elements. We suggest that the constitutive activity of the ODC gene in HCT 116 colon carcinoma cells, and perhaps transformed cells in general, involves a complex interaction of multiple regulatory sequences and their associated nuclear proteins. Finally, the saturation of the promoter in these transformed cell lines suggests that high levels of protein binding in the ODC promoter may contribute to elevated constitutive expression of this gene. Images PMID:1598217

  14. Role of the promoter in the regulation of the thymidine kinase gene

    SciTech Connect

    Travali, S.; Lipson, K.E.; Jaskulski, D.; Lauret, E.; Baserga, R.


    To identify the regulatory elements of the human thymidine kinase (TK) gene, the authors established stable cell lines carrying different chimeric constructs of the TK gene. Their results can be summarized as follows. (i) When the TK coding sequence is under the control of the calcyclin promoter (a promoter that is activated when G/sub o/ cells are stimulated by growth factors), TK mRNA levels are higher in G/sub 1/-arrested cells than in proliferating cells: (ii) when the TK coding sequence is under the control of the promoter of heat shock protein HSP70, steady-state levels of TK mRNA are highest after heat shock, regardless of the position of the cells in the cell cycle; (iii) the bacterial CAT gene under the control of the human TK promoter is maximally expressed in the S phase; (iv) the TK cDNA driven by the simian virus 40 promoter is also maximally expressed in the S phase; and (v) TK enzyme activity is always at a maximum in the S phase, even when the levels of TK mRNA are highest in nonproliferating cells. The authors conclude that although the TK coding sequence may also play some role, the TK promoter has an important role in the cell cycle regulation of TK mRNA levels.

  15. RNA Replication from the Simian Virus 5 Antigenomic Promoter Requires Three Sequence-Dependent Elements Separated by Sequence-Independent Spacer Regions

    PubMed Central

    Keller, Michael A.; Murphy, Susan K.; Parks, Griffith D.


    We have previously shown for the paramyxovirus simian virus 5 (SV5) that a functional promoter for RNA replication requires proper spacing between two discontinuous elements: a 19-base segment at the 3′ terminus (conserved region I [CRI]) and an 18-base internal region (CRII) that is contained within the coding region of the L protein gene. In the work described here, we have used a reverse-genetics system to determine if the 53-base segment between CRI and CRII contains additional sequence-specific signals required for optimal replication or if this segment functions solely as a sequence-independent spacer region. A series of copyback defective interfering minigenome analogs were constructed to contain substitutions of nonviral sequences in place of bases 21 to 72 of the antigenomic promoter, and the relative level of RNA replication was measured by Northern blot analysis. The results from our mutational analysis indicate that in addition to CRI and CRII, optimal replication from the SV5 antigenomic promoter requires a third sequence-dependent element located 51 to 66 bases from the 3′ end of the RNA. Minigenome RNA replication was not affected by changes in the either the position of this element in relation to CRI and CRII or the predicted hexamer phase of NP encapsidation. Thus, optimal RNA replication from the SV5 antigenomic promoter requires three sequence-dependent elements, CRI, CRII and bases 51 to 66. PMID:11264390

  16. Evaluation of a novel promoter from Populus trichocarpa for mature xylem tissue specific gene delivery.


    Nguyen, Van Phap; Cho, Jin-Seong; Choi, Young-Im; Lee, Sang-Won; Han, Kyung-Hwan; Ko, Jae-Heung


    Wood (i.e., secondary xylem) is an important raw material for many industrial applications. Mature xylem (MX) tissue-specific genetic modification offers an effective means to improve the chemical and physical properties of the wood. Here, we describe a promoter that drives strong gene expression in a MX tissue-specific manner. Using whole-transcriptome genechip analyses of different tissue types of poplar, we identified five candidate genes that had strong expression in the MX tissue. The putative promoter sequences of the five MX-specific genes were evaluated for their promoter activity in both transgenic Arabidopsis and poplar. Among them, we found the promoter of Potri.013G007900.1 (called the PtrMX3 promoter) had the strongest activity in MX and thus was further characterized. In the stem and root tissues of transgenic Arabidopsis plants, the PtrMX3 promoter activity was found exclusively in MX tissue. MX-specific activity of the promoter was reproduced in the stem tissue of transgenic poplar plants. The PtrMX3 promoter activity was not influenced by abiotic stresses or exogenously applied growth regulators, indicating the PtrMX3 promoter is bona fide MX tissue-specific. Our study provides a strong MX-specific promoter for MX-specific modifications of woody biomass.

  17. The putative promoter for a metacyclic VSG gene in African trypanosomes.


    Nagoshi, Y L; Alarcon, C M; Donelson, J E


    During their metacyclic developmental stage, African trypanosomes are coated with one of 12-15 variant surface glycoproteins (VSGs) that define different metacyclic variant antigen types (MVATs). The MVAT VSG genes are located near telomeres of large chromosomes and are expressed without rearrangement in the metacyclic stage. We have cloned and examined the telomere-linked MVAT5 VSG gene and its upstream expression site associated gene (ESAG I) which are separated by 4.5 kb. Within this 4.5-kb intergenic region is an 87-bp sequence that serves as a strong promoter for a luciferase reporter gene in transient transfection assays. This 87-bp sequence is similar, but not identical, to the promoter for another MVAT VSG gene. UV irradiation experiments were used to detect RNA synthesis from this MVAT5 promoter in bloodstream trypanosomes expressing an unrelated VSG. We propose that this sequence is a specific promoter for the MVAT5 VSG mRNA that occurs in about 10% of the trypanosome population during the metacyclic stage of the parasites' life cycle.

  18. Regulation of the promoter of rat apolipoprotein A-I gene in cultured cells

    SciTech Connect

    Chao, Y.; Pan, T.; Wu, T.; Hao, Q.; Yamin, T.; Kroon, P.A.


    In order to study the regulation of the promoter of apolipoprotein (apo) A-I gene, they joined the 5' end of rat apo A-I gene (1.9 Kb) to the coding region of bacterial chloramphenicol acetyltransferase (CAT) gene. The chimeric gene produced high levels of CAT activity in both mouse L cells and Hep G2 cells in transient expression assays. Ethanol increased the levels of rat apo A-I promoter activity in both cells. However, dexamethasone increased rat apo A-I promoter activity only in Hep G2 cells. Similar results were obtained in stable expression cell lines. Nucleotide deletion experiments showed DNA sequences between -149 and -469 base pairs upstream from the rat apo A-I transcription site are required for the high level of expression and that the regulatory sequences are located further upstream. These data demonstrated that the 5' end of rat apo A-I gene contains sequences which are responsible for the regulation of apo A-I expression by ethanol and dexamethasone and that the expression and regulation of rat apo A-I promoter are cell specific.

  19. Cone specific promoter for use in gene therapy of retinal degenerative diseases.


    Dyka, Frank M; Boye, Sanford L; Ryals, Renee C; Chiodo, Vince A; Boye, Shannon E; Hauswirth, William W


    Achromatopsia (ACHM) is caused by a progressive loss of cone photoreceptors leading to color blindness and poor visual acuity. Animal studies and human clinical trials have shown that gene replacement therapy with adeno-associate virus (AAV) is a viable treatment option for this disease. Although there have been successful attempts to optimize capsid proteins for increased specificity, it is simpler to restrict expression via the use of cell type-specific promoters. To target cone photoreceptors, a chimeric promoter consisting of an enhancer element of interphotoreceptor retinoid-binding protein promoter and a minimal sequence of the human transducin alpha-subunit promoter (IRBPe/GNAT2) was created. Additionally, a synthetic transducin alpha-subunit promoter (synGNAT2/GNAT2) containing conserved sequence blocks located downstream of the transcriptional start was created. The strength and specificity of these promoters were evaluated in murine retina by immunohistochemistry. The results showed that the chimeric, (IRBPe/GNAT2) promoter is more efficient and specific than the synthetic, synGNAT2/GNAT2 promoter. Additionally, IRBPe/GNAT2-mediated expression was found in all cone subtypes and it was improved over existing promoters currently used for gene therapy of achromatopsia.

  20. Cone Specific Promoter for Use in Gene Therapy of Retinal Degenerative Diseases

    PubMed Central

    Dyka, Frank M.; Boye, Sanford L.; Ryals, Renee C.; Chiodo, Vince A.; Boye, Shannon E.; Hauswirth, William W.


    Achromatopsia (ACHM) is caused by a progressive loss of cone photoreceptors leading to color blindness and poor visual acuity. Animal studies and human clinical trials have shown that gene replacement therapy with adeno-associate virus (AAV) is a viable treatment option for this disease. Although there have been successful attempts to optimize capsid proteins for increased specificity, it is simpler to restrict expression via the use of cell type-specific promoters. To target cone photoreceptors, a chimeric promoter consisting of an enhancer element of inter-photoreceptor retinoid-binding protein promoter and a minimal sequence of the human transducin alpha-subunit promoter (IRBPe/GNAT2) was created. Additionally, a synthetic transducin alpha-subunit promoter (synGNAT2/GNAT2) containing conserved sequence blocks located downstream of the transcriptional start was created. The strength and specificity of these promoters were evaluated in murine retina by immunohistochemistry. The results showed that the chimeric, (IRBPe/GNAT2) promoter is more efficient and specific than the synthetic, synGNAT2/GNAT2 promoter. Additionally, IRBPe/GNAT2-mediated expression was found in all cone subtypes and it was improved over existing promoters currently used for gene therapy of achromatopsia. PMID:24664760

  1. Identification of a novel first exon in the human dystrophin gene and of a new promoter located more than 500 kb upstream of the nearest known promoter

    SciTech Connect

    Yanagawa, H.; Nishio, H.; Takeshima, Y.


    The dystrophin gene, which is muted in patients with Duchenne and Becker muscular dystrophies, is the largest known human gene. Five alternative promoters have been characterized until now. Here we show that a novel dystrophin isoform with a different first exon can be produced through transcription initiation at a previously-unidentified alternative promoter. The case study presented is that of patient with Duchenne muscular dystrophy who had a deletion extending from 5{prime} end of the dystrophin gene to exon 2, including all promoters previously mapped in the 5{prime} part of the gene. Transcripts from lymphoblastoid cells were found to contain sequences corresponding to exon 3, indicating the presence of new promoter upstream of this exon. The nucleotide sequence of amplified cDNA corresponding to the 5{prime} end of the new transcript indicated that the 5{prime} end of exon 3 was extended by 9 codons, only the last (most 3{prime}) of which codes for methionine. The genomic nucleotide sequence upstream from the new exon, as determined using inverse polymerase chain reaction, revealed the presence of sequences similar to a TATA box, an octamer motif and an MEF-2 element. The identified promoter/exon did not map to intron 2, as might have been expected, but to a position more than 500 kb upstream of the most 5{prime} of the previously-identified promoters, thereby adding 500 kb to the dystrophin gene. The sequence of part of the new promoter region is very similar to that of certain medium reiteration frequency repetitive sequences. These findings may help us understand the molecular evolution of the dystrophin gene.

  2. Genome Sequence of the Plant Growth Promoting Endophytic Bacterium Enterobacter sp. 638

    PubMed Central

    Taghavi, Safiyh; van der Lelie, Daniel; Hoffman, Adam; Zhang, Yian-Biao; Walla, Michael D.; Vangronsveld, Jaco; Newman, Lee; Monchy, Sébastien


    Enterobacter sp. 638 is an endophytic plant growth promoting gamma-proteobacterium that was isolated from the stem of poplar (Populus trichocarpa×deltoides cv. H11-11), a potentially important biofuel feed stock plant. The Enterobacter sp. 638 genome sequence reveals the presence of a 4,518,712 bp chromosome and a 157,749 bp plasmid (pENT638-1). Genome annotation and comparative genomics allowed the identification of an extended set of genes specific to the plant niche adaptation of this bacterium. This includes genes that code for putative proteins involved in survival in the rhizosphere (to cope with oxidative stress or uptake of nutrients released by plant roots), root adhesion (pili, adhesion, hemagglutinin, cellulose biosynthesis), colonization/establishment inside the plant (chemiotaxis, flagella, cellobiose phosphorylase), plant protection against fungal and bacterial infections (siderophore production and synthesis of the antimicrobial compounds 4-hydroxybenzoate and 2-phenylethanol), and improved poplar growth and development through the production of the phytohormones indole acetic acid, acetoin, and 2,3-butanediol. Metabolite analysis confirmed by quantitative RT–PCR showed that, the production of acetoin and 2,3-butanediol is induced by the presence of sucrose in the growth medium. Interestingly, both the genetic determinants required for sucrose metabolism and the synthesis of acetoin and 2,3-butanediol are clustered on a genomic island. These findings point to a close interaction between Enterobacter sp. 638 and its poplar host, where the availability of sucrose, a major plant sugar, affects the synthesis of plant growth promoting phytohormones by the endophytic bacterium. The availability of the genome sequence, combined with metabolome and transcriptome analysis, will provide a better understanding of the synergistic interactions between poplar and its growth promoting endophyte Enterobacter sp. 638. This information can be further exploited to

  3. RAMPAGE: promoter activity profiling by paired-end sequencing of 5'-complete cDNAs.


    Batut, Philippe; Gingeras, Thomas R


    RNA annotation and mapping of promoters for analysis of gene expression (RAMPAGE) is a method that harnesses highly specific sequencing of 5'-complete complementary DNAs to identify transcription start sites (TSSs) genome-wide. Although TSS mapping has historically relied on detection of 5'-complete cDNAs, current genome-wide approaches typically have limited specificity and provide only scarce information regarding transcript structure. RAMPAGE allows for highly stringent selection of 5'-complete molecules, thus allowing base-resolution TSS identification with a high signal-to-noise ratio. Paired-end sequencing of medium-length cDNAs yields transcript structure information that is essential to interpreting the relationship of TSSs to annotated genes and transcripts. As opposed to standard RNA-seq, RAMPAGE explicitly yields accurate and highly reproducible expression level estimates for individual promoters. Moreover, this approach offers a streamlined 2- to 3-day protocol that is optimized for extensive sample multiplexing, and is therefore adapted for large-scale projects. This method has been applied successfully to human and Drosophila samples, and in principle should be applicable to any eukaryotic system. Copyright © 2013 John Wiley & Sons, Inc.

  4. Efficiency of ligation-mediated PCR and TAIL-PCR methods for isolation of RbcS promoter sequences from green microalgae Ankistrodesmus convolutus.


    Thanh, Tran; Chi, Vu Thi Quynh; Abdullah, Mohd Puad; Omar, Hishamuddin; Napis, Suhaimi


    Isolation of promoter sequences from known gene sequences is a tedious task in genome-related research. An efficient method of obtaining the promoter sequences is necessary in order to successfully use targeted promoters for genetic manipulations. Here, efficiency and usefulness of two PCR-based methods, namely: ligation-mediated PCR and thermal asymmetric interlaced (TAIL) PCR, for isolation of promoter sequences of the ribulose-1,5-bisphosphate carboxylase/oxygenase small subunit (RbcS) gene from green microalgae Ankistrodesmus convolutus (A. convolutus) were evaluated. The results showed that the amplification efficiency of TAIL-PCR was higher than that of the ligation-mediated PCR method, i.e. the amplified promoter fragments of 1.2 and 0.8 kb in length or promoter sequences of 813 and 606 bp (after eliminating the unreadable sequences). The use of TAIL-PCR described here presents a low cost and efficient strategy for the isolation of promoter sequences of known genes, especially in GC-rich regions, and species with little or no available genome information such as A. convolutus.

  5. DNA sequences that activate isocitrate lyase gene expression during late embryogenesis and during postgerminative growth.

    PubMed Central

    Zhang, J Z; Santes, C M; Engel, M L; Gasser, C S; Harada, J J


    We analyzed DNA sequences that regulate the expression of an isocitrate lyase gene from Brassica napus L. during late embryogenesis and during postgerminative growth to determine whether glyoxysomal function is induced by a common mechanism at different developmental stages. beta-Glucuronidase constructs were used both in transient expression assays in B. napus and in transgenic Arabidopsis thaliana to identify the segments of the isocitrate lyase 5' flanking region that influence promoter activity. DNA sequences that play the principal role in activating the promoter during post-germinative growth are located more than 1,200 bp upstream of the gene. Distinct DNA sequences that were sufficient for high-level expression during late embryogenesis but only low-level expression during postgerminative growth were also identified. Other parts of the 5' flanking region increased promoter activity both in developing seed and in seedlings. We conclude that a combination of elements is involved in regulating the isocitrate lyase gene and that distinct DNA sequences play primary roles in activating the gene in embryos and in seedlings. These findings suggest that different signals contribute to the induction of glyoxysomal function during these two developmental stages. We also showed that some of the constructs were expressed differently in transient expression assays and in transgenic plants. PMID:8934622

  6. Degenerative primer design and gene sequencing validation for select turkey genes.


    Hutsko, Stephanie L; Lilburn, Michael S; Wick, Macdonald


    We successfully designed and validated degenerative primers for turkey genes MUC2, RPS13, TBP and TFF2 based on chicken sequences in order to use gene transcription analysis to evaluate (quantify) the mucin transcription to probiotic supplementation in turkeys. Primers were designed for the genes MUC2, TFF2, RPS13 and TBP using a degenerative primer design method based on the available Gallus gallus sequences. All primer sets, which produced a single PCR amplicon of the expected sizes, were cloned into the TOPO(®) vector and then transformed into TOP 10(®) competent cells. Plasmid DNA isolation was performed on the TOP10(®) cell culture and sent for sequencing. Sequences were analyzed using NCBI BLAST. All genes sequenced had over 90% homology with both the chicken and predicted turkey sequences. The sequences were used to design new 100% homologous primer sets for the genes of interest. © 2016 Poultry Science Association Inc.

  7. Functional analysis of the human somatic angiotensin I-converting enzyme gene promoter.


    Testut, P; Soubrier, F; Corvol, P; Hubert, C


    Angiotensin I-converting enzyme (ACE) is a key enzyme in the regulation of systemic blood pressure and plays a major role in the renin-angiotensin and bradykinin-kinin systems, at the luminal surface of the vascular endothelia. To identify the promoter region, the transcription regulatory elements and the cell specificity of the ACE gene, five successive DNA deletions of the 5' upstream region (-1214, -754, -472, -343, -132 bp relative to the start site of transcription) were isolated and fused in sense and antisense orientations to the bacterial chloramphenicol acetyltransferase (CAT) reporter gene in the promoterless plasmid pBLCAT3. Promoter activities were measured in transient transfection assays using three different cell lines from rabbit endothelium (RE), human embryocarcinoma (Tera-1) and hepatocarcinoma cells (HepG2). All five fragments of the ACE promoter region directed expression of the CAT gene when transfected into the endothelial and the embryocarcinoma cells, which contain endogenous ACE mRNA and express ACE activity. In contrast only minimal levels of promoter activity were obtained on transfection into hepatocarcinoma cells in which endogenous ACE mRNA and ACE activity were not detected. Transfection of RE and Tera-1 cells demonstrated that promoter activity was defined by the length of the ACE promoter sequence inserted into the construct. The 132 bases located upstream from the transcription start site were sufficient to confer ACE promoter activity, whereas the sequences upstream from -472 bp and between -343 bp and -132 bp were responsible for a decrease of promoter activity. Furthermore, the minimal 132 bp of the ACE promoter contains elements which direct cell-specific CAT expression. In addition, the DNA transfection study in the presence of dexamethasone suggested that the potential glucocorticoid regulatory elements, located in the sequence of the ACE promoter, are not functional.

  8. Functional analysis of the human somatic angiotensin I-converting enzyme gene promoter.

    PubMed Central

    Testut, P; Soubrier, F; Corvol, P; Hubert, C


    Angiotensin I-converting enzyme (ACE) is a key enzyme in the regulation of systemic blood pressure and plays a major role in the renin-angiotensin and bradykinin-kinin systems, at the luminal surface of the vascular endothelia. To identify the promoter region, the transcription regulatory elements and the cell specificity of the ACE gene, five successive DNA deletions of the 5' upstream region (-1214, -754, -472, -343, -132 bp relative to the start site of transcription) were isolated and fused in sense and antisense orientations to the bacterial chloramphenicol acetyltransferase (CAT) reporter gene in the promoterless plasmid pBLCAT3. Promoter activities were measured in transient transfection assays using three different cell lines from rabbit endothelium (RE), human embryocarcinoma (Tera-1) and hepatocarcinoma cells (HepG2). All five fragments of the ACE promoter region directed expression of the CAT gene when transfected into the endothelial and the embryocarcinoma cells, which contain endogenous ACE mRNA and express ACE activity. In contrast only minimal levels of promoter activity were obtained on transfection into hepatocarcinoma cells in which endogenous ACE mRNA and ACE activity were not detected. Transfection of RE and Tera-1 cells demonstrated that promoter activity was defined by the length of the ACE promoter sequence inserted into the construct. The 132 bases located upstream from the transcription start site were sufficient to confer ACE promoter activity, whereas the sequences upstream from -472 bp and between -343 bp and -132 bp were responsible for a decrease of promoter activity. Furthermore, the minimal 132 bp of the ACE promoter contains elements which direct cell-specific CAT expression. In addition, the DNA transfection study in the presence of dexamethasone suggested that the potential glucocorticoid regulatory elements, located in the sequence of the ACE promoter, are not functional. Images Figure 1 Figure 3 PMID:8394696

  9. Expression mediated by three partial sequences of the human tyrosine hydroxylase promoter in vivo

    PubMed Central

    Rolland, Anne-Sophie; Kareva, Tatyana; Yarygina, Olga; Kholodilov, Nikolai; Burke, Robert E


    The use of viral vectors to transfect postmitotic neurons has provided an important research tool, and it offers promise for treatment of neurologic disease. The utility of vectors is enhanced by the use of selective promoters that permit control of the cellular site of expression. One potential clinical application is in the neurorestorative treatment of Parkinson’s disease by the induction of new axon growth. However, many of the genes with an ability to restore axons have oncogenic potential. Therefore, clinical safety would be enhanced by restriction of expression to neurons affected by the disease, particularly dopamine neurons. To achieve this goal we have evaluated in vivo three partial sequences of the promoter for human tyrosine hydroxylase, the rate limiting enzyme in catecholamine synthesis. All sequences induced expression in dopamine neurons. None of them induced expression in glia or in nondopaminergic neurons in striatum or cortex. We conclude that these sequences have potential use for targeting dopamine neurons in research and clinical applications. PMID:27689101

  10. Two 10-bp regions are critical for phytochrome regulation of a Lemna gibba Lhcb gene promoter.

    PubMed Central

    Kehoe, D M; Degenhardt, J; Winicov, I; Tobin, E M


    Two small regions of the promoter of an Lhcb gene encoding a light-harvesting chlorophyll a/b protein were identified as essential in conferring phytochrome responsiveness by using a transient expression assay. Initially, 5' deletion analysis of cabAB19, an Lhcb2 gene of Lemna, showed that sequences within the region from -174 to -104 relative to the start of transcription were necessary for phytochrome regulation. Internal deletion and substitution mutants were used to demonstrate that no additional phytochrome-responsive regions exist between -1600 and -174 in this promoter. A 171-bp fragment of the promoter extending from -239 to -69 was sufficient to impart phytochrome responsiveness to a minimal ubiquitin promoter that was not itself regulated by light. Specific binding of Lemna proteins to the region necessary for phytochrome responsiveness was demonstrated using in vitro polyacrylamide gel mobility shift assays and 1,10-phenanthroline copper ion footprinting. Further analysis of the region from -174 to -104 demonstrated that mutations in two separate 10-bp sequences, from -134 to -125 and from -114 to -105, could abolish phytochrome responsiveness; thus, there are two unique regions that are necessary for phytochrome regulation of this gene. One of these regions contains a CCAAT motif and the other a GATA motif. These motifs are conserved in the promoters of many Lhcb genes and may be important elements in the phytochrome responsiveness of this gene family. PMID:7919982

  11. Structure and sequence divergence of two archaebacterial genes

    SciTech Connect

    Cue, D.; Beckler, G.S.; Reeve, J.N.; Konisky, J.


    The DNA sequences of a region that includes the hisA gene of two related methanogenic archaebacteria, Methanococcus voltae and Methanococcus vannielii, have been compared. Both organisms show a similar genome organization in this region, displaying three open reading frames (ORFs) separated by regions of very high A+T content. Two of the ORFs, including ORFHisA, show significant DNA sequence homology. As might be expected for organisms having a genome that is A+T-rich, there is a high preference for A and U as the third base in codons. A ribosome binding site, G-G-T-G, is located 6 base pairs preceding the ATG translation initiation sequence of both hisA genes. The sequences upstream of the two hisA genes show only limited sequence homology. The M. voltae intergenic region contains four tandemly arranged repetitions of an 11-base-pair sequence, whereas the M. vannielii sequence contains both direct and inverted repetitive sequences. Based on the degree of hisA sequence homology, the authors conclude that M. voltae and M. vannielii are less closely related taxonomically than are members of the enteric group of eubacteria.

  12. Insect and wound induced GUS gene expression from a Beta vulgaris proteinase inhibitor gene promoter

    USDA-ARS?s Scientific Manuscript database

    Inducible gene promoters that are specifically activated by pathogen invasion or insect pest attack are needed for effective expression of resistance genes to control plant diseases. In the present study, a promoter from a serine proteinase inhibitor gene (BvSTI) shown to be up-regulated in resist...

  13. Structural analysis and promoter characterization of the human collagenase-3 gene (MMP13)

    SciTech Connect

    Pendas, A.M.; Balbin, M.; Llano, E.


    Human collagenase-3 (MMP13) is a recently identified member of the matrix metalloproteinase (MMP) family that is expressed in breast carcinomas and in articular cartilage from arthritic patients. In this work we have isolated and characterized genomic clones coding for human collagenase-3. This gene is composed of 10 exons and 9 introns and spans over 12.5 kb. The overall organization of the collagenase-3 gene is similar to that of other MMP genes clustered at chromosome 11q22, including fibroblast collagenase (MMP-1), matrilysin (MMP-7), and macrophage metalloelastase (MMP-12), but is more distantly related to genes coding for stromelysin-3 (MMP-11), gelatinase-A (MMP-2), and gelatinase-B (MMP-9), which map outside of this gene cluster. Nucleotide sequence analysis of about 1 kb of the 5{prime}-flanking region of the collagenase-3 gene revealed the presence of a TATA box, an AP-1 motif, a PEA-3 consensus sequence, an osteoblast specific element (OSE-2), and a TGF-{beta} inhibitory element. Transient transfection experiments in HeLa and COS-1 cells with chloramphenicol acetyltransferase (CAT)-containing constructs showed that the AP-1 site is functional and responsible for the observed inducibility of the reporter gene by the tumor promoter 12-O-tetradecanoylphorbol-13-acetate (TPA). However, and in contrast to other MMP genes, no significative synergistic effect on CAT activity between the AP-1 and PEA-3 elements found in the collagenase-3 gene promoter was found. DNA binding analysis with nuclear extracts from HeLa cells revealed the formation of specific complexes between collagenase-3 promoter sequences containing the AP-1 site and nuclear proteins. The presence of this AP-1 functional site, which is able to confer responsiveness to a variety of tumor promoters and oncogene products, may contribute to explaining the high-level expression of collagenase-3 in breast carcinomas and degenerative joint diseases. 48 refs., 5 figs., 2 tabs.

  14. Analysis of a cloned colicin Ib gene: complete nucleotide sequence and implications for regulation of expression.

    PubMed Central

    Varley, J M; Boulnois, G J


    The complete nucleotide sequence of a 2,971 base pair EcoRI fragment carrying the structural gene for colicin Ib has been determined. The length of the gene is 1,881 nucleotides which is predicted to produce a protein of 626 amino acids and of molecular weight 71,364. The structural gene is flanked by likely promoter and terminator signals and in between the promoter and the ribosome binding site is an inverted repeat sequence which resembles other sequences known to bind the LexA protein. Further analysis of the 5' flanking sequences revealed a second region which may act either as a second LexA binding site and/or in the binding of cyclic AMP receptor protein. Comparison of the predicted amino acid sequence of colicin Ib with that of colicins A and E1 reveals localised homology. The implications of these similarities in the proteins and of regulation of the colicin Ib structural gene are discussed. Images PMID:6091036

  15. Inferring gene structures in genomic sequences using pattern recognition and expressed sequence tags

    SciTech Connect

    Xu, Y.; Mural, R.; Uberbacher, E.


    Computational methods for gene identification in genomic sequences typically have two phases: coding region prediction and gene parsing. While there are many effective methods for predicting coding regions (exons), parsing the predicted exons into proper gene structures, to a large extent, remains an unsolved problem. This paper presents an algorithm for inferring gene structures from predicted exon candidates, based on Expressed Sequence Tags (ESTs) and biological intuition/rules. The algorithm first finds all the related ESTs in the EST database (dbEST) for each predicted exon, and infers the boundaries of one or a series of genes based on the available EST information and biological rules. Then it constructs gene models within each pair of gene boundaries, that are most consistent with the EST information. By exploiting EST information and biological rules, the algorithm can (1) model complicated multiple gene structures, including embedded genes, (2) identify falsely-predicted exons and locate missed exons, and (3) make more accurate exon boundary predictions. The algorithm has been implemented and tested on long genomic sequences with a number of genes. Test results show that very accurate (predicted) gene models can be expected when related ESTs exist for the predicted exons.

  16. Inferring gene structures in genomic sequences using pattern recognition and expressed sequence tags.


    Xu, Y; Mural, R J; Uberbacher, E C


    Computational methods for gene identification in genomic sequences typically have two phases: coding region prediction and gene parsing. While there are many effective methods for predicting coding regions (exons), parsing the predicted exons into proper gene structures, to a large extent, remains an unsolved problem. This paper presents an algorithm for inferring gene structures from predicted exon candidates, based on Expressed Sequence Tags (ESTs) and biological intuition/rules. The algorithm first finds all the related ESTs in the EST database (dbEST) for each predicted exon, and infers the boundaries of one or a series of genes based on the available EST information and biological rules. Then it constructs gene models within each pair of gene boundaries, that are most consistent with the EST information. By exploiting EST information and biological rules, the algorithm can (1) model complicated multiple gene structures, including embedded genes, (2) identify falsely-predicted exons and locate missed exons, and (3) make more accurate exon boundary predictions. The algorithm has been implemented and tested on long genomic sequences with a number of genes. Test results show that very accurate (predicted) gene models can be expected when related ESTs exist for the predicted exons.

  17. (Gene sequencing by scanning molecular exciton microscopy)

    SciTech Connect

    Not Available


    This report details progress made in setting up a laboratory for optical microscopy of genes. The apparatus including a fluorescence microscope, a scanning optical microscope, various spectrometers, and supporting computers is described. Results in developing photon and exciton tips, and in preparing samples are presented. (GHH)

  18. The 5'-flanking regions of three pea legumin genes: comparison of the DNA sequences.

    PubMed Central

    Lycett, G W; Croy, R R; Shirsat, A H; Richards, D M; Boulter, D


    Approximately 1200 nucleotides of sequence data from the promoter and 5'-flanking regions of each of three pea (Pisum sativum L.) legumin genes (legA, legB and legC) are presented. The promoter regions of all three genes were found to be identical including the "TATA box", and "CAAT box', and sequences showing homology to the SV40 enhancers. The legA sequence begins to diverge from the others about 300bp from the start codon, whereas the other two genes remain identical for another 550bp. The regions of partial homology exhibit deletions or insertions and some short, comparatively well conserved sequences. The significance of these features is discussed in terms of evolutionary mechanisms and their possible functional roles. The legC gene contains a region that may potentially form either of two mutually exclusive stem-loop structures, one of which has a stem 42bp long, which suggests that it could be fairly stable. We suggest that a mechanism of switching between such alternative structures may play some role in gene control or may represent the insertion of a transposable element. PMID:2997721

  19. Evolution of Brain Active Gene Promoters in Human Lineage Towards the Increased Plasticity of Gene Regulation.


    Gunbin, Konstantin V; Ponomarenko, Mikhail P; Suslov, Valentin V; Gusev, Fedor; Fedonin, Gennady G; Rogaev, Evgeny I


    Adaptability to a variety of environmental conditions is a prominent feature of Homo sapiens. We hypothesize that this feature can be explained by evolutionary changes in gene promoters active in the brain prefrontal cortex leading to a more flexible gene regulation network. The genotype-dependent range of gene expression can be broader in humans than in other higher primates. Thus, we searched for specific signatures of evolutionary changes in promoter architectures of multiple hominid genes, including the genes active in human cortical neurons that may indicate an increase of variability of gene expression rather than just changes in the level of expression, such as downregulation or upregulation of the genes. We performed a whole-genome search for genetic-based alterations that may impact gene regulation "flexibility" in a process of hominids evolution, such as (i) CpG dinucleotide content, (ii) predicted nucleosome-DNA dissociation constant, and (iii) predicted affinities for TATA-binding protein (TBP) in gene promoters. We tested all putative promoter regions across the human genome and especially gene promoters in active chromatin state in neurons of prefrontal cortex, the brain region critical for abstract thinking and social and behavioral adaptation. Our data imply that the origin of modern man has been associated with an increase of flexibility of promoter-driven gene regulation in brain. In contrast, after splitting from the ancestral lineages of H. sapiens, the evolution of ape species is characterized by reduced flexibility of gene promoter functioning, underlying reduced variability of the gene expression.

  20. Trait-associated sequence variation in the bovine growth hormone receptor 1A promoter does not affect promoter activity in vitro.


    Zhou, Y; Jiang, H


    Growth hormone (GH) plays a central role in growth and metabolism in cattle by binding to growth hormone receptor (GHR) and stimulating production of insulin-like growth factor 1 (IGF1). Two sequence variations in the promoter transcribing a major GHR mRNA variant, GHR 1A mRNA, have been reported to be associated with quantitative differences in growth rate or blood concentration of IGF1 in cattle. One such variation is in the length of a TG-repeat, being 11 or 16-20; the other variation is in the nucleotide 155 bp upstream from the transcription start site, being G or A. In this study, we determined whether these sequence variations would affect the activity of GHR 1A promoter. We cloned GHR 1A promoters bearing different sequence variations and linked each of them to a reporter gene. Transient transfection analyses revealed that these promoter-reporter constructs did not differ in reporter gene expression. Cotransfection analyses demonstrated that they also did not differ in activation by hepatocyte nuclear factor 4alpha, hepatocyte nuclear factor 4gamma and nuclear receptor subfamily 2 group F member 2, known transcription factors for bovine GHR 1A promoter. These in vitro results, together with a previous observation that neither the nucleotide 155 bp upstream from the transcription start site nor the TG-repeat was part of the GHR 1A promoter region interacting with nuclear proteins from bovine liver, do not support a cause-effect relationship between the reported sequence variations and the associated changes in growth rate or blood IGF1 concentration in cattle.

  1. Hematopoietic gene promoters subjected to a group-combinatorial study of DNA samples: identification of a megakaryocytic selective DNA signature

    PubMed Central

    Hazony, Yehonathan; Lu, Jun; St. Hilaire, Cynthia; Ravid, Katya


    Identification of common sub-sequences for a group of functionally related DNA sequences can shed light on the role of such elements in cell-specific gene expression. In the megakaryocytic lineage, no one single unique transcription factor was described as linage specific, raising the possibility that a cluster of gene promoter sequences presents a unique signature. Here, the megakaryocytic gene promoter group, which consists of both human and mouse 5′ non-coding regions, served as a case study. A methodology for group-combinatorial search has been implemented as a customized software platform. It extracts the longest common sequences for a group of related DNA sequences and allows for single gaps of varying length, as well as double- and multiple-gap sequences. The results point to common DNA sequences in a group of genes that is selectively expressed in megakaryocytes, and which does not appear in a large group of control, random and specific sequences. This suggests a role for a combination of these sequences in cell-specific gene expression in the megakaryocytic lineage. The data also point to an intrinsic cross-species difference in the organization of 5′ non-coding sequences within the mammalian genomes. This methodology may be used for the identification of regulatory sequences in other lineages. PMID:16936310

  2. Genetic rearrangements and gene amplification in Escherichia coli: DNA sequences at the junctures of amplified gene fusions.


    Whoriskey, S K; Nghiem, V H; Leong, P M; Masson, J M; Miller, J H


    We describe gene fusions that result from genetic duplications of 5-20 kb, which are amplified 50- to 100-fold. Because one end point of the fusion lies within the sequenced lacI gene, the new junctures created by the duplications are readily identified. Using a procedure for dideoxy sequencing of double-stranded DNA, we show that the duplications occur almost exclusively at short sequence repeats (less than 15 bp), sometimes involving broken homologies, in the 30 cases examined. Most of the duplications place the lacI-Z encoded hybrid repressor-beta-galactosidase protein under the control of a downstream promoter, resulting in the production of a more complex hybrid protein with beta-galactosidase activity. In some cases the fusion occurs with the lacY or the lacA gene, which suggests that silent promoters can be uncovered by gene fusion and subsequent amplification. In some ways this system represents a bacterial analog to chromosomal rearrangements of oncogenes in higher cells, since here the expression of a silent gene is the result of a genetic rearrangement that is followed by amplification during selected growth.

  3. Dependence of the E. coli promoter strength and physical parameters upon the nucleotide sequence

    PubMed Central

    Berezhnoy, Andrey Y.; Shckorbatov, Yuriy G.


    The energy of interaction between complementary nucleotides in promoter sequences of E. coli was calculated and visualized. The graphic method for presentation of energy properties of promoter sequences was elaborated on. Data obtained indicated that energy distribution through the length of promoter sequence results in picture with minima at −35, −8 and +7 regions corresponding to areas with elevated AT (adenine-thymine) content. The most important difference from the random sequences area is related to −8. Four promoter groups and their energy properties were revealed. The promoters with minimal and maximal energy of interaction between complementary nucleotides have low strengths, the strongest promoters correspond to promoter clusters characterized by intermediate energy values. PMID:16252339

  4. Cis-regulatory elements affecting the Nanos gene promoter in the germline stem cells.


    Ali, Ijaz; ur Rehman, Muti; Rashid, Farzana; Khan, Sanaullah; Iqbal, Aqib; Laixin, Xia; ud din Ahmed, Naeem; Swati, A Zahoor


    Drosophila Nanos gene plays an important role in stem cell maintenance and body patterning. With the purpose of understanding the cis-regulatory machinery involved in the transcription of the nanos gene in the germline stem cells, we examined its promoter fragment from +97 to -708 relative to the transcription start site and identified enhancer elements located between position -108 and +97. Experiments with transgenic flies revealed that the minimal promoter (from -108 to +20) is sufficient in the germline stem cells for the GFP expression in transgenic Drosophila. Moreover, the flag-tagged nanos protein blotting experiments revealed that a short promoter fragment plus some sequences of the nos 5'UTR spanning -108 to +97 could efficiently drive the expression of the flag-tagged [Nos-mRNA-nos3'UTR] transgene in transgenic flies indicating that the cis-regulatory elements located between positions -108 and +97 of the nanos promoter are sufficient to fully transcribe the nanos mRNA. Deletion of the identified cis-acting sequences from the promoter rendered it non-functional as it could no longer transcribe the nanos mRNA in transgenic flies thus revealing the importance of these sequences for the transcription of the nanos gene. Copyright 2009 Elsevier B.V. All rights reserved.

  5. Characterization of the human p53 gene promoter

    SciTech Connect

    Tuck, S.P.; Crawford, L.


    Transcriptional deregulation of the p53 gene may play an important part in the genesis of some tumors. The authors report here an accurate determination of the transcriptional start sites of the human p53 gene and show that the majority of p53 mRNA molecules do not contain a postulated stem-loop structure at their 5' ends. Recombinant plasmids of the human p53 promoter-leader region fused to the bacterial chloramphenicol acetyltransferase gene (cat) were constructed. After transfection into rodent or human cells, a 350-base-pair fragment spanning the promoter region conferred 4% of the CAT activity mediated by the simian virus 40 early promoter/enhancer. They monitored the efficiency with which 15 3' and 5' promoter deletion constructs initiated transcription. Their results show that an 85-base-pair fragment, previously thought to have resided in exon 1, is that is required for full promoter activity.

  6. Gene regulation: ancient microRNA target sequences in plants.


    Floyd, Sandra K; Bowman, John L


    MicroRNAs are an abundant class of small RNAs that are thought to regulate the expression of protein-coding genes in plants and animals. Here we show that the target sequence of two microRNAs, known to regulate genes in the class-III homeodomain-leucine zipper (HD-Zip) gene family of the flowering plant Arabidopsis, is conserved in homologous sequences from all lineages of land plants, including bryophytes, lycopods, ferns and seed plants. We also find that the messenger RNAs from these genes are cleaved within the same microRNA-binding site in representatives of each land-plant group, as they are in Arabidopsis. Our results indicate not only that microRNAs mediate gene regulation in non-flowering as well as flowering plants, but also that the regulation of this class of plant genes dates back more than 400 million years.

  7. Identification of plant promoter constituents by analysis of local distribution of short sequences

    PubMed Central

    Yamamoto, Yoshiharu Y; Ichida, Hiroyuki; Matsui, Minami; Obokata, Junichi; Sakurai, Tetsuya; Satou, Masakazu; Seki, Motoaki; Shinozaki, Kazuo; Abe, Tomoko


    Background Plant promoter architecture is important for understanding regulation and evolution of the promoters, but our current knowledge about plant promoter structure, especially with respect to the core promoter, is insufficient. Several promoter elements including TATA box, and several types of transcriptional regulatory elements have been found to show local distribution within promoters, and this feature has been successfully utilized for extraction of promoter constituents from human genome. Results LDSS (Local Distribution of Short Sequences) profiles of short sequences along the plant promoter have been analyzed in silico, and hundreds of hexamer and octamer sequences have been identified as having localized distributions within promoters of Arabidopsis thaliana and rice. Based on their localization patterns, the identified sequences could be classified into three groups, pyrimidine patch (Y Patch), TATA box, and REG (Regulatory Element Group). Sequences of the TATA box group are consistent with the ones reported in previous studies. The REG group includes more than 200 sequences, and half of them correspond to known cis-elements. The other REG subgroups, together with about a hundred uncategorized sequences, are suggested to be novel cis-regulatory elements. Comparison of LDSS-positive sequences between Arabidopsis and rice has revealed moderate conservation of elements and common promoter architecture. In addition, a dimer motif named the YR Rule (C/T A/G) has been identified at the transcription start site (-1/+1). This rule also fits both Arabidopsis and rice promoters. Conclusion LDSS was successfully applied to plant genomes and hundreds of putative promoter elements have been extracted as LDSS-positive octamers. Identified promoter architecture of monocot and dicot are well conserved, but there are moderate variations in the utilized sequences. PMID:17346352

  8. The regions of sequence variation in caulimovirus gene VI.


    Sanger, M; Daubert, S; Goodman, R M


    The sequence of gene VI from figwort mosaic virus (FMV) clone x4 was determined and compared with that previously published for FMV clone DxS. Both clones originated from the same virus isolation, but the virus used to clone DxS was propagated extensively in a host of a different family prior to cloning whereas that used to clone x4 was not. Differences in the amino acid sequence inferred from the DNA sequences occurred in two clusters. An N-terminal conserved region preceded two regions of variation separated by a central conserved region. Variation in cauliflower mosaic virus (CaMV) gene VI sequences, all of which were derived from virus isolates from hosts from one host family, was similar to that seen in the FMV comparison, though the extent of variation was less. Alignment of gene VI domains from FMV and CaMV revealed regions of amino acid sequence identical in both viruses within the conserved regions. The similarity in the pattern of conserved and variable domains of these two viruses suggests common host-interactive functions in caulimovirus gene VI homologues, and possibly an analogy between caulimoviruses and certain animal viruses in the influence of the host on sequence variability of viral genes.

  9. The nucleotide sequence of the human beta-globin gene.


    Lawn, R M; Efstratiadis, A; O'Connell, C; Maniatis, T


    We report the complete nucleotide sequence of the human beta-globin gene. The purpose of this study is to obtain information necessary to study the evolutionary relationships between members of the human beta-like globin gene family and to provide the basis for comparing normal beta-globin genes with those obtained from the DNA of individuals with genetic defects in hemoglobin expression.

  10. Methylation status of the promoter region of the human frizzled 9 gene in acute myeloid leukemia.


    Zhang, Yingjie; Jiang, Qi; Kong, Xiaolin; Yang, Lili; Hu, Wanzhen; Lv, Chengfang; Li, Yinghua


    The FZD9 gene is located at chromosome 7q11.23, and has been indicated to be a tumor suppressor gene. The present study examined the involvement of FZD9 promoter methylation in the downregulation of FZD9 expression in leukemia cells. The expression of the FZD9 gene was absent in various leukemic cell lines, while it was restored following treatment with DNA demethylating agent 5‑aza‑2'‑deoxycytidine. Bisulfite sequencing analysis of the FZD9 promoter region showed that it was partially methylated in cell lines in which FZD9 gene was not expressed. Thus, DNA methylation in the promoter region may lead to inactivation of the FZD9 gene, which may represent and aberration associated with leukemia, since DNA was not methylated in normal peripheral blood mononuclear cells. Methylation‑specific polymerase chain reaction analysis revealed that the promoter region of the FZD9 gene was frequently methylated in primary or relapse acute myeloid leukemia (52.9%; excluding acute promyelocytic leukemia); however, methylation was infrequent in B‑cell acute lymphocytic leukemia (5.6%). In conclusion, the present study indicated that the methylation profile of the FZD9 gene corresponded to that of a candidate tumor‑suppressor gene in acute myeloid leukemia.

  11. Nucleotide sequence of the gene encoding the nitrogenase iron protein of Thiobacillus ferrooxidans

    SciTech Connect

    Pretorius, I.M.; Rawlings, D.E.; O'Neill, E.G.; Jones, W.A.; Kirby, R.; Woods, D.R.


    The DNA sequence was determined for the cloned Thiobacillus ferrooxidans nifH and part of the nifD genes. The DNA chains were radiolabeled with (..cap alpha..-/sup 32/P)dCTP (3000 Ci/mmol) or (..cap alpha..-/sup 35/S)dCTP (400 Ci/mmol). A putative T. ferrooxidans nifH promoter was identified whose sequences showed perfect consensus with those of the Klebsiella pneumoniae nif promoter. Two putative consensus upstream activator sequences were also identified. The amino acid sequence was deduced from the DNA sequence. In a comparison of nifH DNA sequences from T. ferrooxidans and eight other nitrogen-fixing microbes, a Rhizobium sp. isolated from Parasponia andersonii showed the greatest homology (74%) and Clostridium pasteurianum (nifH1) showed the least homology (54%). In the comparison of the amino acid sequences of the Fe proteins, the Rhizobium sp. and Rhizobium japonicum showed the greatest homology (both 86%) and C. pasteurianum (nifH1 gene product) demonstrated the least homology (56%) to the T. ferrooxidans Fe protein.

  12. Direct repeat sequences in the Streptomyces chitinase-63 promoter direct both glucose repression and chitin induction

    PubMed Central

    Ni, Xiangyang; Westpheling, Janet


    The chi63 promoter directs glucose-sensitive, chitin-dependent transcription of a gene involved in the utilization of chitin as carbon source. Analysis of 5′ and 3′ deletions of the promoter region revealed that a 350-bp segment is sufficient for wild-type levels of expression and regulation. The analysis of single base changes throughout the promoter region, introduced by random and site-directed mutagenesis, identified several sequences to be important for activity and regulation. Single base changes at −10, −12, −32, −33, −35, and −37 upstream of the transcription start site resulted in loss of activity from the promoter, suggesting that bases in these positions are important for RNA polymerase interaction. The sequences centered around −10 (TATTCT) and −35 (TTGACC) in this promoter are, in fact, prototypical of eubacterial promoters. Overlapping the RNA polymerase binding site is a perfect 12-bp direct repeat sequence. Some base changes within this direct repeat resulted in constitutive expression, suggesting that this sequence is an operator for negative regulation. Other base changes resulted in loss of glucose repression while retaining the requirement for chitin induction, suggesting that this sequence is also involved in glucose repression. The fact that cis-acting mutations resulted in glucose resistance but not inducer independence rules out the possibility that glucose repression acts exclusively by inducer exclusion. The fact that mutations that affect glucose repression and chitin induction fall within the same direct repeat sequence module suggests that the direct repeat sequence facilitates both chitin induction and glucose repression. PMID:9371809

  13. Noncoding RNA gene detection using comparative sequence analysis

    PubMed Central

    Rivas, Elena; Eddy, Sean R


    Background Noncoding RNA genes produce transcripts that exert their function without ever producing proteins. Noncoding RNA gene sequences do not have strong statistical signals, unlike protein coding genes. A reliable general purpose computational genefinder for noncoding RNA genes has been elusive. Results We describe a comparative sequence analysis algorithm for detecting novel structural RNA genes. The key idea is to test the pattern of substitutions observed in a pairwise alignment of two homologous sequences. A conserved coding region tends to show a pattern of synonymous substitutions, whereas a conserved structural RNA tends to show a pattern of compensatory mutations consistent with some base-paired secondary structure. We formalize this intuition using three probabilistic "pair-grammars": a pair stochastic context free grammar modeling alignments constrained by structural RNA evolution, a pair hidden Markov model modeling alignments constrained by coding sequence evolution, and a pair hidden Markov model modeling a null hypothesis of position-independent evolution. Given an input pairwise sequence alignment (e.g. from a BLASTN comparison of two related genomes) we classify the alignment into the coding, RNA, or null class according to the posterior probability of each class. Conclusions We have implemented this approach as a program, QRNA, which we consider to be a prototype structural noncoding RNA genefinder. Tests suggest that this approach detects noncoding RNA genes with a fair degree of reliability. PMID:11801179

  14. Coelacanth genome sequence reveals the evolutionary history of vertebrate genes.


    Noonan, James P; Grimwood, Jane; Danke, Joshua; Schmutz, Jeremy; Dickson, Mark; Amemiya, Chris T; Myers, Richard M


    The coelacanth is one of the nearest living relatives of tetrapods. However, a teleost species such as zebrafish or Fugu is typically used as the outgroup in current tetrapod comparative sequence analyses. Such studies are complicated by the fact that teleost genomes have undergone a whole-genome duplication event, as well as individual gene-duplication events. Here, we demonstrate the value of coelacanth genome sequence by complete sequencing and analysis of the protocadherin gene cluster of the Indonesian coelacanth, Latimeria menadoensis. We found that coelacanth has 49 protocadherin cluster genes organized in the same three ordered subclusters, alpha, beta, and gamma, as the 54 protocadherin cluster genes in human. In contrast, whole-genome and tandem duplications have generated two zebrafish protocadherin clusters comprised of at least 97 genes. Additionally, zebrafish protocadherins are far more prone to homogenizing gene conversion events than coelacanth protocadherins, suggesting that recombination- and duplication-driven plasticity may be a feature of teleost genomes. Our results indicate that coelacanth provides the ideal outgroup sequence against which tetrapod genomes can be measured. We therefore present L. menadoensis as a candidate for whole-genome sequencing.

  15. Sequence and organization analyses of a Zygosaccharomyces rouxii DNA fragment containing the HIS3 gene.


    Sychrova, H; Braun, V; Souciet, J L


    The nucleotide sequence of a 3.4 kb fragment containing the HIS3 gene of the osmotolerant yeast Zygosaccharomyces rouxii has been determined. The fragment was cloned from a Z. rouxii genomic DNA library by complementation of a Saccharomyces cerevisiae his3 mutant strain. The sequenced DNA fragment contained three open reading frames; the middle one (678 bp long, predicting a protein of 226 amino acids) shared a high degree of similarity with HIS3 genes of other yeast species. In the promoter region of the putative ZrHIS3 gene, a T(c) element required for constitutive transcription was found. The GenBank Accession No. of the sequenced DNA region is Y18561. Copyright 2000 John Wiley & Sons, Ltd.

  16. Absence of mutation at the 5'-upstream promoter region of the TPM4 gene from cardiac mutant axolotl (Ambystoma mexicanum).


    Denz, Christopher R; Zhang, Chi; Jia, Pingping; Du, Jianfeng; Huang, Xupei; Dube, Syamalima; Thomas, Anish; Poiesz, Bernard J; Dube, Dipak K


    Tropomyosins are a family of actin-binding proteins that show cell-specific diversity by a combination of multiple genes and alternative RNA splicing. Of the 4 different tropomyosin genes, TPM4 plays a pivotal role in myofibrillogenesis as well as cardiac contractility in amphibians. In this study, we amplified and sequenced the upstream regulatory region of the TPM4 gene from both normal and mutant axolotl hearts. To identify the cis-elements that are essential for the expression of the TPM4, we created various deletion mutants of the TPM4 promoter DNA, inserted the deleted segments into PGL3 vector, and performed promoter-reporter assay using luciferase as the reporter gene. Comparison of sequences of the promoter region of the TPM4 gene from normal and mutant axolotl revealed no mutations in the promoter sequence of the mutant TPM4 gene. CArG box elements that are generally involved in controlling the expression of several other muscle-specific gene promoters were not found in the upstream regulatory region of the TPM4 gene. In deletion experiments, loss of activity of the reporter gene was noted upon deletion which was then restored upon further deletion suggesting the presence of both positive and negative cis-elements in the upstream regulatory region of the TPM4 gene. We believe that this is the first axolotl promoter that has ever been cloned and studied with clear evidence that it functions in mammalian cell lines. Although striated muscle-specific cis-acting elements are absent from the promoter region of TPM4 gene, our results suggest the presence of positive and negative cis-elements in the promoter region, which in conjunction with positive and negative trans-elements may be involved in regulating the expression of TPM4 gene in a tissue-specific manner.

  17. Hyaluronate synthase: cloning and sequencing of the gene from Streptococcus sp.

    PubMed Central

    Lansing, M; Lellig, S; Mausolf, A; Martini, I; Crescenzi, F; O'Regan, M; Prehm, P


    The complete nucleotide sequence of hyaluronate synthase from Streptococcus sp. and its flanking regions is presented. The gene locus was designated has. Southern-blotting results suggested that the gene was conserved in hyaluronate-producing streptococci. A putative translation-initiation codon was identified and the open reading frame consists of 1566 bp, specifying a protein of 56 kDa. Sequences resembling the promoter and ribosome-binding site of Gram-positive organisms are found upstream of the synthase. The predicted amino-acid sequence reveals the presence of a 35-residue signal peptide. The sequence has some similarity to bacterial peptide-binding proteins. Images Figure 1 Figure 3 PMID:8424756

  18. Characterization of the sporophyte-preferential gene promoter from the red alga Porphyra yezoensis using transient gene expression.


    Uji, Toshiki; Mizuta, Hiroyuki; Saga, Naotsune


    The life cycle of plants entails an alternation of generations, the diploid sporophyte and haploid gametophyte stages. There is little information about the characteristics of gene expression during each phase of marine macroalgae. Promoter analysis is a useful method for understanding transcriptional regulation; however, there is no report of promoter analyses in marine macroalgae. In this study, with the aim of elucidating the differences in the transcriptional regulatory mechanisms between the gametophyte and sporophyte stages in the marine red alga Porphyra yezoensis, we isolated the promoter from the sporophyte preferentially expressed gene PyKPA1, which encodes a sodium pump, and analyzed its promoter using a transient gene expression system with a synthetic β-glucuronidase (PyGUS) reporter. The deletion of -1432 to -768 relative to the transcription start site resulted in decreased GUS activity in sporophytes. In contrast, deletion from -767 to -527 increased GUS activity in gametophytes. Gain-of-function analyses showed that the -1432 to -760 region enhanced the GUS activity of a heterologous promoter in sporophytes, whereas the -767 to -510 region repressed it in gametophytes. Further mutation and gain-of-function analyses of the -767 to -510 region revealed that a 20-bp GC-rich sequence (-633 to -614) is responsible for the gametophyte-specific repressed expression. These results showed that the sporophyte-specific positive regulatory region and gametophyte-specific negative regulatory sequence play a crucial role in the preferential expression of PyKPA1 in P. yezoensis sporophytes.

  19. SxtA gene sequence analysis of dinoflagellate Alexandrium minutum

    NASA Astrophysics Data System (ADS)

    Norshaha, Safida Anira; Latib, Norhidayu Abdul; Usup, Gires; Yusof, Nurul Yuziana Mohd


    The dinoflagellate Alexandrium minutum is typically known for the production of potent neurotoxins such as saxitoxin, affecting the health of human seafood consumers via paralytic shellfish poisoning (PSP). These phenomena is related to the harmful algal blooms (HABs) that is believed to be influenced by environmental and nutritional factors. Previous study has revealed that SxtA gene is a starting gene that involved in the saxitoxin production pathway. The aim of this study was to analyse the sequence of the sxtA gene in A. minutum. The dinoflagellates culture was cultured at temperature 26°C with 16:8-hour light:dark photocycle. After the samples were harvested, RNA was extracted, complementary DNA (cDNA) was synthesised and amplified by polymerase chain reaction (PCR). The PCR products were then purified and cloned before sequenced. The SxtA sequence obtained was then analyzed in order to identify the presence of SxtA gene in Alexandrium minutum.

  20. Upstream promoter sequences and αCTD mediate stable DNA wrapping within the RNA polymerase–promoter open complex

    PubMed Central

    Cellai, Sara; Mangiarotti, Laura; Vannini, Nicola; Naryshkin, Nikolai; Kortkhonjia, Ekaterine; Ebright, Richard H; Rivetti, Claudio


    We show that the extent of stable DNA wrapping by Escherichia coli RNA polymerase (RNAP) in the RNAP–promoter open complex depends on the sequence of the promoter and, in particular, on the sequence of the upstream region of the promoter. We further show that the extent of stable DNA wrapping depends on the presence of the RNAP α-subunit carboxy-terminal domain and on the presence and length of the RNAP α-subunit interdomain linker. Our results indicate that the extensive stable DNA wrapping observed previously in the RNAP–promoter open complex at the λ PR promoter is not a general feature of RNAP–promoter open complexes. PMID:17290289

  1. Upstream promoter sequences and alphaCTD mediate stable DNA wrapping within the RNA polymerase-promoter open complex.


    Cellai, Sara; Mangiarotti, Laura; Vannini, Nicola; Naryshkin, Nikolai; Kortkhonjia, Ekaterine; Ebright, Richard H; Rivetti, Claudio


    We show that the extent of stable DNA wrapping by Escherichia coli RNA polymerase (RNAP) in the RNAP-promoter open complex depends on the sequence of the promoter and, in particular, on the sequence of the upstream region of the promoter. We further show that the extent of stable DNA wrapping depends on the presence of the RNAP alpha-subunit carboxy-terminal domain and on the presence and length of the RNAP alpha-subunit interdomain linker. Our results indicate that the extensive stable DNA wrapping observed previously in the RNAP-promoter open complex at the lambda P(R) promoter is not a general feature of RNAP-promoter open complexes.

  2. Promoter RNA links transcriptional regulation of inflammatory pathway genes

    PubMed Central

    Matsui, Masayuki; Chu, Yongjun; Zhang, Huiying; Gagnon, Keith T.; Shaikh, Sarfraz; Kuchimanchi, Satya; Manoharan, Muthiah; Corey, David R.; Janowski, Bethany A.


    Although many long non-coding RNAs (lncRNAs) have been discovered, their function and their association with RNAi factors in the nucleus have remained obscure. Here, we identify RNA transcripts that overlap the cyclooxygenase-2 (COX-2) promoter and contain two adjacent binding sites for an endogenous miRNA, miR-589. We find that miR-589 binds the promoter RNA and activates COX-2 transcription. In addition to miR-589, fully complementary duplex RNAs that target the COX-2 promoter transcript activate COX-2 transcription. Activation by small RNA requires RNAi factors argonaute-2 (AGO2) and GW182, but does not require AGO2-mediated cleavage of the promoter RNA. Instead, the promoter RNA functions as a scaffold. Binding of AGO2 protein/small RNA complexes to the promoter RNA triggers gene activation. Gene looping allows interactions between the promoters of COX-2 and phospholipase A2 (PLA2G4A), an adjacent pro-inflammatory pathway gene that produces arachidonic acid, the substrate for COX-2 protein. miR-589 and fully complementary small RNAs regulate both COX-2 and PLA2G4A gene expression, revealing an unexpected connection between key steps of the eicosanoid signaling pathway. The work demonstrates the potential for RNA to coordinate locus-dependent assembly of related genes to form functional operons through cis-looping. PMID:23999091

  3. Functional characterization of genetic polymorphisms identified in the promoter region of the bovine PEPS gene.


    Ju, Zhihua; Zheng, Xue; Huang, Jinming; Qi, Chao; Zhang, Yan; Li, Jianbin; Zhong, Jifeng; Wang, Changfa


    Peptidase S (PEPS) is a metallopeptidase that cleaves N-terminal residues from proteins and peptides. PEPS is used as a cell maintenance enzyme with critical roles in peptide turnover. The promoter region located upstream of the initiation site plays an important role in regulating gene expression. Polymorphism in the promoter region can alter gene expression and lead to biological changes. In the current study, polymorphisms in the promoter region of the PEPS gene were investigated. Polymerase chain reaction (PCR)-restriction fragment length polymorphism and DNA sequencing methods were used to screen sequence variations in the promoter region of DNA samples from 743 Chinese Holstein cattle. Two polymorphisms (g. -534 T>C and g. -2545 G>A) were identified and eight haplotypes were classified by haplotype analysis. The two genetic polymorphisms and haplotypes were associated with fat percentage and somatic cell score in Chinese Holstein cattle. The results of real-time PCR showed that cow kidneys exhibit the highest PEPS expression level. Moreover, bioinformatics analysis predicted that the single-nucleotide polymorphism g. -534 T>C is located in the core promoter region and in the transcription factor binding sites. The promoter activities of the polymorphism of -543 T>C were measured by luciferase assay in the human kidney epithelial cell line 293T. Transcriptional activity is significantly lower in cell lines transfected with the reporter construct containing 2.5 kb upstream fragments with -543 C than in those with wild-type -543 T. The results indicated that genetic variation at locus -543 influences PEPS promoter activity. The genetic variation in the promoter region of PEPS gene may regulate PEPS gene transcription and might have consequences at a regulatory level.

  4. A strong promoter, PMagpd, provides a tool for high gene expression in entomopathogenic fungus, Metarhizium acridum.


    Cao, Yueqing; Jiao, Run; Xia, Yuxian


    A glyceraldehyde-3-phosphate dehydrogenase gene (gpd) promoter (PMagpd) was obtained from Metarhizium acridum and its active region analyzed by 5'-deletion strategy using β-glucuronidase (GUS) as a reporter. Sequence analysis revealed that typical regulatory elements of PMagpd were included in the 1.7 kb region upstream of the start codon of the Magpd gene. Deletion of the region from -1,691 bp to -1,463 bp, where the gpd box is harbored, did not significantly affect the PMagpd activity. Deletions of the regions upstream of -946 bp and upstream of -684 bp caused a major decrease of GUS activity. Compared with PgpdA (2.2 kb) in Aspergillus nidulans, PMagpd (1.4 kb) had a shorter sequence and significantly higher activity in M. acridum. This study provides an applicable promoter for over-expression of target genes in M. acridum.

  5. Nucleotide sequence of the pyruvate decarboxylase gene from Zymomonas mobilis.


    Neale, A D; Scopes, R K; Wettenhall, R E; Hoogenraad, N J


    Pyruvate decarboxylase (EC, the penultimate enzyme in the alcoholic fermentation pathway of Zymomonas mobilis, converts pyruvate to acetaldehyde and carbon dioxide. The complete nucleotide sequence of the structural gene encoding pyruvate decarboxylase from Zymomonas mobilis has been determined. The coding region is 1704 nucleotides long and encodes a polypeptide of 567 amino acids with a calculated subunit mass of 60,790 daltons. The amino acid sequence was confirmed by comparison with the amino acid sequence of a selection of tryptic fragments of the enzyme. The amino acid composition obtained from the nucleotide sequence is in good agreement with that obtained experimentally.

  6. Draft Genome Sequence of Burkholderia ambifaria RZ2MS16, a Plant Growth-Promoting Rhizobacterium Isolated from Guarana, a Tropical Plant.


    Batista, Bruna Durante; Taniguti, Lucas Mitsuo; Monteiro-Vitorello, Claudia Barros; Azevedo, João Lúcio; Quecine, Maria Carolina


    Burkholderia ambifaria strain RZ2MS16 was isolated from the rhizosphere of Amazon guarana in Brazil. This bacterium exhibits a remarkable capacity to promote the growth of corn and soybean. Here, we report the draft genome sequence of RZ2MS16 and some genes related to multiple traits involved in plant growth promotion. Copyright © 2016 Batista et al.

  7. Draft Genome Sequence of Burkholderia ambifaria RZ2MS16, a Plant Growth-Promoting Rhizobacterium Isolated from Guarana, a Tropical Plant

    PubMed Central

    Batista, Bruna Durante; Taniguti, Lucas Mitsuo; Monteiro-Vitorello, Claudia Barros; Azevedo, João Lúcio


    Burkholderia ambifaria strain RZ2MS16 was isolated from the rhizosphere of Amazon guarana in Brazil. This bacterium exhibits a remarkable capacity to promote the growth of corn and soybean. Here, we report the draft genome sequence of RZ2MS16 and some genes related to multiple traits involved in plant growth promotion. PMID:26988044

  8. Cloning, sequence analysis and yeast expression of the egl1 gene from Trichoderma longibrachiatum.


    González, R; Ramón, D; Pérez-González, J A


    A gene (egl1) encoding an endoglucanase (EGL1) from Trichoderma longibrachiatum has been cloned and sequenced. This gene, homologous to the T. reesei egl1 gene, differs from it in the length of the introns (particularly the first one) and encoded protein. A cDNA fragment obtained by the rapid amplification of cDNA ends method, which takes advantage of the polymerase chain reaction, has been expressed in yeast under control of the cyc-gal inducible promoter and yeast clones able to secrete active enzyme have been obtained.

  9. Different promoter affinities account for specificity in MYC-dependent gene regulation

    PubMed Central

    Lorenzin, Francesca; Benary, Uwe; Baluapuri, Apoorva; Walz, Susanne; Jung, Lisa Anna; von Eyss, Björn; Kisker, Caroline; Wolf, Jana; Eilers, Martin; Wolf, Elmar


    Enhanced expression of the MYC transcription factor is observed in the majority of tumors. Two seemingly conflicting models have been proposed for its function: one proposes that MYC enhances expression of all genes, while the other model suggests gene-specific regulation. Here, we have explored the hypothesis that specific gene expression profiles arise since promoters differ in affinity for MYC and high-affinity promoters are fully occupied by physiological levels of MYC. We determined cellular MYC levels and used RNA- and ChIP-sequencing to correlate promoter occupancy with gene expression at different concentrations of MYC. Mathematical modeling showed that binding affinities for interactions of MYC with DNA and with core promoter-bound factors, such as WDR5, are sufficient to explain promoter occupancies observed in vivo. Importantly, promoter affinity stratifies different biological processes that are regulated by MYC, explaining why tumor-specific MYC levels induce specific gene expression programs and alter defined biological properties of cells. DOI: PMID:27460974

  10. Molecular analysis of G+C-rich upstream sequences regulating transcription of the human carbonic anhydrase II gene.

    PubMed Central

    Shapiro, L H; Venta, P J; Tashian, R E


    The upstream promoter sequences of the human carbonic anhydrase II (CA II) gene have been studied by 5' deletion analysis. Promoter activity was assayed by transfection and chloramphenicol acetyltransferase assay in both human HeLa cells and murine L cells. This investigation showed that the CA II promoter is comparable in activity to that of the simian virus 40 early-region promoter and enhancer and that the CA II upstream sequences exert a different pattern of control in the two cell lines. Images PMID:2830500

  11. Coupling sequencing by hybridization (SBH) with gel sequencing for an inexpensive analysis of genes and genomes

    SciTech Connect

    Drmanac, S.; Labat, I.; Hauser, B.; Drmanac, R.


    The speed and cost of DNA sequencing are bottlenecks in the analysis of genes end genomes. Sequencing by hybridization (SBH) is a versatile method with several applications which can accelerated DNA screening, mapping and sequencing. Requirements, achievements and problems in the development of the SBH format 1 (DNA samples arrayed) are presented and schemes for its synergetic coupling with gel sequencing techniques are discussed. It appears that by one hybridization machine with 24 boxes and four ABI gel sequencers 100- 300 Mb of DNA sequence can be determined per year. Various genetic studies based on computer assisted analysis of large collections of partial or complete DNA sequences (`sequenetics`) may be achieved in this century.

  12. Sequence and analysis of the gene for bacteriophage T3 RNA polymerase.

    PubMed Central

    McGraw, N J; Bailey, J N; Cleaves, G R; Dembinski, D R; Gocke, C R; Joliffe, L K; MacWright, R S; McAllister, W T


    The RNA polymerases encoded by bacteriophages T3 and T7 have similar structures, but exhibit nearly exclusive template specificities. We have determined the nucleotide sequence of the region of T3 DNA that encodes the T3 RNA polymerase (the gene 1.0 region), and have compared this sequence with the corresponding region of T7 DNA. The predicted amino acid sequence of the T3 RNA polymerase exhibits very few changes when compared to the T7 enzyme (82% of the residues are identical). Significant differences appear to cluster in three distinct regions in the amino-terminal half of the protein. Analysis of the data from both enzymes suggests features that may be important for polymerase function. In particular, a region that differs between the T3 and T7 enzymes exhibits significant homology to the bi-helical domain that is common to many sequence-specific DNA binding proteins. The region that flanks the structural gene contains a number of regulatory elements including: a promoter for the E. coli RNA polymerase, a potential processing site for RNase III and a promoter for the T3 polymerase. The promoter for the T3 RNA polymerase is located only 12 base pairs distal to the stop codon for the structural gene. PMID:3903658

  13. The downstream regulatory sequence of the adenovirus type 2 major late promoter is functionally redundant.

    PubMed Central

    Li, X C; Huang, W L; Flint, S J


    Mutagenesis of promoter sequences and oligonucleotide competition assays have been used to demonstrate the late-phase-specific stimulation of the adenovirus type 2 major late promoter is mediated by functionally redundant elements located between positions +75 and +125. These octamer motif-related sequences are recognized by multiple factors. Images PMID:1501301

  14. Inter-specific sequence conservation and intra-individual sequence variation in a spider silk gene.


    Tai, Pei-Ling; Hwang, Guang-Yuh; Tso, I-Min


    Currently, studies on major ampullate spidroin 1 (MaSp1) genes of non-orb weaving spiders are few, and it is not clear whether genes of these organisms exhibit the same characteristics as those of orb-weavers. In addition, many studies have proposed that MaSp1 might be a single gene with allelic variants, but supporting evidence is still lacking. In this study, we compared partial DNA and amino acid sequences of MaSp1 cloned from different spider guilds. We also cloned partial MaSp1 sequences from genomic DNA and cDNA of the same individuals of spiders using the same primer combination to see if different molecular forms existed. In the repetitive region of partial MaSp1 sequences obtained, GGX, GA and poly-A motifs were present in all Araneomorphae and Mygalomorpae species examined. An extreme similarity in MaSp1 non-repetitive portions was found in sequences of ecribellate, cribellate and Mygalomorphae web-builders and such a result suggested that this sequence might exhibit an important function. A comparison of sequences amplified from the same individual showed that substitutions in amino acids occurred in both repetitive and non-repetitive regions, with a much higher variation in the former. These results suggest that the MaSp1 of Araneomorphae spiders exhibits several forms in an individual spider and it might be either a multiple gene or a single gene with a multiple exon/intron organization.

  15. Interplay of Promoter Usage and Intragenic CpG Content: Impact on GFP Reporter Gene Expression.


    Krinner, Simone; Heitzer, Asli; Asbach, Benedikt; Wagner, Ralf


    Successful therapeutic protein production in vitro and in vivo requires efficient and long-term transgene expression supported by optimized vector and transgene cis-regulatory sequence elements. This study provides a comparative analysis of CpG-rich, highly expressed, versus CpG-depleted, poorly expressed green fluorescent protein (GFP) reporter transgenes, transcribed by various promoters in two different cell systems. Long-term GFP expression from a defined locus in stable Chinese hamster ovary cells was clearly influenced by the combination of transgene CpG content and promoter usage, as shown by differential silencing effects on selection pressure removal among the cytomegalovirus (CMV) promoter and elongation factor (EF)-1α promoter. Whereas a high intragenic CpG content promoted local DNA methylation, CpG depletion rather accelerated transgene loss and increased the local chromatin density. On lentiviral transfer of various expression modules into epigenetically sensitive P19 embryonic pluripotent carcinoma cells, CMV promoter usage led to rapid gene silencing irrespective of the intragenic CpG content. In contrast, EF-1α promoter-controlled constructs showed delayed silencing activity and high-level transgene expression, in particular when the CpG-rich GFP reporter was used. Notably, GFP silencing in P19 cells could be prevented completely by the bidirectional, dual divergently transcribed A2UCOE (ubiquitously acting chromatin-opening element derived from the human HNRPA2B1-CBX3 locus) promoter. Because the level of GFP expression by the A2UCOE promoter was entirely unaffected by the intragenic CpG level, we suggest that A2UCOE can overcome chromatin compaction resulting from intragenic CpG depletion due to its ascribed chromatin-opening abilities. Our analyses provide insights into the interplay of the intragenic CpG content with promoter sequences and regulatory sequence elements, thus contributing toward the design of therapeutic transgene expression

  16. Core histone genes of Giardia intestinalis: genomic organization, promoter structure, and expression.


    Yee, Janet; Tang, Anita; Lau, Wei-Ling; Ritter, Heather; Delport, Dewald; Page, Melissa; Adam, Rodney D; Müller, Miklós; Wu, Gang


    Giardia intestinalis is a protist found in freshwaters worldwide, and is the most common cause of parasitic diarrhea in humans. The phylogenetic position of this parasite is still much debated. Histones are small, highly conserved proteins that associate tightly with DNA to form chromatin within the nucleus. There are two classes of core histone genes in higher eukaryotes: DNA replication-independent histones and DNA replication-dependent ones. We identified two copies each of the core histone H2a, H2b and H3 genes, and three copies of the H4 gene, at separate locations on chromosomes 3, 4 and 5 within the genome of Giardia intestinalis, but no gene encoding a H1 linker histone could be recognized. The copies of each gene share extensive DNA sequence identities throughout their coding and 5' noncoding regions, which suggests these copies have arisen from relatively recent gene duplications or gene conversions. The transcription start sites are at triplet A sequences 1-27 nucleotides upstream of the translation start codon for each gene. We determined that a 50 bp region upstream from the start of the histone H4 coding region is the minimal promoter, and a highly conserved 15 bp sequence called the histone motif (him) is essential for its activity. The Giardia core histone genes are constitutively expressed at approximately equivalent levels and their mRNAs are polyadenylated. Competition gel-shift experiments suggest that a factor within the protein complex that binds him may also be a part of the protein complexes that bind other promoter elements described previously in Giardia. In contrast to other eukaryotes, the Giardia genome has only a single class of core histone genes that encode replication-independent histones. Our inability to locate a gene encoding the linker histone H1 leads us to speculate that the H1 protein may not be required for the compaction of Giardia's small and gene-rich genome.

  17. Functional analysis of the promoter of the heat shock cognate 70 gene of the Pacific white shrimp, Litopenaeus vannamei.


    Zhao, Cui; Zhang, Xiaojun; Li, Fuhua; Huan, Pin; Xiang, Jianhai


    Current knowledge on cis-regulatory elements of immune genes of the Pacific white shrimp (Litopenaeus vannamei) is poor. In this study, we identified the promoter of the heat shock cognate protein 70 (HSC70) gene of L. vannamei (lvhsc70). The promoter activity of lvhsc70 promoter was analyzed in insect sf9 cell lines. First, the putative promoter sequence was proved to be able to drive the expression of reporter EGFP gene successfully. Then serial deletion experiments were conducted to investigate functional transcription elements in the promoter region. The results revealed that both positive and negative transcription elements existed in this region. These results are quite different from the previous report on the promoter of HSC70 gene in Penaeus monodon (pmhsc70), where only positive transcription elements were indicated. The sequences that are not conserved between the promoters of lvhsc70 and pmhsc70 might contribute to the differences. Finally, we tested the effect of a putative "NF-κb binding site" in the promoter and, surprisingly, found that deletion of this site would result in a significantly enhancement of the expression of reporter genes, while the underlying mechanisms remain unrevealed. Our results would provide supports for future studies to identify the functional transcription elements in the lvhsc70 promoter and to expand our knowledge on regulation of innate immune genes in penaeid shrimp.

  18. Conserved Curvature of RNA Polymerase I Core Promoter Beyond rRNA Genes: The Case of the Tritryps

    PubMed Central

    Smircich, Pablo; Duhagon, María Ana; Garat, Beatriz


    In trypanosomatids, the RNA polymerase I (RNAPI)-dependent promoters controlling the ribosomal RNA (rRNA) genes have been well identified. Although the RNAPI transcription machinery recognizes the DNA conformation instead of the DNA sequence of promoters, no conformational study has been reported for these promoters. Here we present the in silico analysis of the intrinsic DNA curvature of the rRNA gene core promoters in Trypanosoma brucei, Trypanosoma cruzi, and Leishmania major. We found that, in spite of the absence of sequence conservation, these promoters hold conformational properties similar to other eukaryotic rRNA promoters. Our results also indicated that the intrinsic DNA curvature pattern is conserved within the Leishmania genus and also among strains of T. cruzi and T. brucei. Furthermore, we analyzed the impact of point mutations on the intrinsic curvature and their impact on the promoter activity. Furthermore, we found that the core promoters of protein-coding genes transcribed by RNAPI in T. brucei show the same conserved conformational characteristics. Overall, our results indicate that DNA intrinsic curvature of the rRNA gene core promoters is conserved in these ancient eukaryotes and such conserved curvature might be a requirement of RNAPI machinery for transcription of not only rRNA genes but also protein-coding genes. PMID:26718450

  19. Combinatorial control of temporal gene expression in the Drosophila wing by enhancers and core promoters

    PubMed Central


    Background The transformation of a developing epithelium into an adult structure is a complex process, which often involves coordinated changes in cell proliferation, metabolism, adhesion, and shape. To identify genetic mechanisms that control epithelial differentiation, we analyzed the temporal patterns of gene expression during metamorphosis of the Drosophila wing. Results We found that a striking number of genes, approximately 50% of the Drosophila transcriptome, exhibited changes in expression during a time course of wing development. While cis-acting enhancer sequences clearly correlated with these changes, a stronger correlation was discovered between core-promoter types and the dynamic patterns of gene expression within this differentiating tissue. In support of the hypothesis that core-promoter type influences the dynamics of expression, expression levels of several TATA-box binding protein associated factors (TAFs) and other core promoter-associated components changed during this developmental time course, and a testes-specific TAF (tTAF) played a critical role in timing cellular differentiation within the wing. Conclusions Our results suggest that the combinatorial control of gene expression via cis-acting enhancer sequences and core-promoter types, determine the complex changes in gene expression that drive morphogenesis and terminal differentiation of the Drosophila wing epithelium. PMID:22992320

  20. Nucleotide sequence and structure of the human apolipoprotein E gene.

    PubMed Central

    Paik, Y K; Chang, D J; Reardon, C A; Davies, G E; Mahley, R W; Taylor, J M


    The gene for human apolipoprotein E (apo-E) was selected from a library of cloned genomic DNA by screening with a specific cDNA hybridization probe, and its structure was characterized. The complete nucleotide sequence of the gene as well as 856 nucleotides of the 5' flanking region and 629 nucleotides of the 3' flanking region were determined. Analysis of the sequence showed that the mRNA-encoding region of the apo-E gene consists of four exons separated by three introns. In comparison to the structure of the mRNA, the introns are located in the 5' noncoding region, in the codon for glycine at position -4 of the signal peptide region, and in the codon for arginine at position +61 of the mature protein. The overall lengths of the apo-E gene and its corresponding mRNA are 3597 and 1163 nucleotides, respectively; a mature plasma protein of 299 amino acids is produced by this gene. Examination of the 5' terminus of the gene by S1 nuclease mapping shows apparent multiple transcription initiation sites. The proximal 5' flanking region contains a "TATA box" element as well as two nearby inverted repeat elements. In addition, there are four Alu family sequences associated with the apo-E gene: an Alu sequence located near each end of the gene and two Alu sequences located in the second intron. This knowledge of the structure permits a molecular approach to characterizing the regulation of the apo-E gene. Images PMID:2987927

  1. A novel DNA replication origin identified in the human heat shock protein 70 gene promoter.

    PubMed Central

    Taira, T; Iguchi-Ariga, S M; Ariga, H


    A general and sensitive method for the mapping of initiation sites of DNA replication in vivo, developed by Vassilev and Johnson, has revealed replication origins in the region of simian virus 40 ori, in the regions upstream from the human c-myc gene and downstream from the Chinese hamster dihydrofolate reductase gene, and in the enhancer region of the mouse immunoglobulin heavy-chain gene. Here we report that the region containing the promoter of the human heat shock protein 70 (hsp70) gene was identified as a DNA replication origin in HeLa cells by this method. Several segments of the region were cloned into pUC19 and examined for autonomously replicating sequence (ARS) activity. The plasmids carrying the segments replicated episomally and semiconservatively when transfected into HeLa cells. The segments of ARS activity contained the sequences previously identified as binding sequences for a c-myc protein complex (T. Taira, Y. Negishi, F. Kihara, S. M. M. Iguchi-Ariga, and H. Ariga, Biochem. Biophys. Acta 1130:166-174, 1992). Mutations introduced within the c-myc protein complex binding sequences abolished the ARS activity. Moreover, the ARS plasmids stably replicated at episomal state for a long time in established cell lines. The results suggest that the promoter region of the human hsp70 gene plays a role in DNA replication as well as in transcription. Images PMID:8065368

  2. Isolation and characterization of the chicken vitamin D receptor gene and its promoter.


    Lu, Z; Jehan, F; Zierold, C; DeLuca, H F


    The sequences from several independent cDNA clones encoding the chicken vitamin D receptor as well as primer extension assay have clearly delineated the 5' terminus and the transcriptional start site. Screening a chicken genomic library produced genomic clones containing vitamin D receptor (VDR) gene fragments. Restriction map of clone 8 showed that the 18.6-kb chicken VDR fragment has exons 1 and 2, intron 1, part of intron 2, and 7-kb 5' flanking region. Exons 1, 2, and 3 found in the chicken VDR gene shares low homology with its mammalian counterparts (i.e., E1A, E1B, and E1C in human). By contrast, the fourth exon and following exons for the coding region of VDR gene are highly conserved between avian and mammalian species. While the fourth exon bears the ATG sites for translation initiation in mammals, the third exon in birds has two extra ATG sites for leaky translation as determined previously. Thus, the avian VDR has more N-terminal sequence than the mammalian VDR and is found in two distinct forms. The 5' flanking region from genomic clone 8 shares considerable homology in several regions with the human and mouse VDR promoters. Moreover, the 5' flanking region of chicken VDR gene possesses promoter activity, as shown by its ability to drive the luciferase reporter gene in cell transfection assays. Like other steroid receptor promoters, the chicken VDR promoter contains no TATA box but possesses several GC boxes or SP1 sites. A series of deletional promoter constructs established that the proximal GC boxes are the major drivers of gene transcription, while the more upstream sequences have repressive elements. Copyright 2000 Wiley-Liss, Inc.

  3. Sequence requirements for transcriptional arrest in exon 1 of the human adenosine deaminase gene

    SciTech Connect

    Zhi Chen; Kellems, R.E.; Innis, J.W. ); Sun, Minghua; Wright, D.A. )


    The authors have previously demonstrated that a transcriptional arrest site exists in exon 1 of the human adenosine deaminase (ADA) gene and that this site may play a role in ADA gene expression. Sequences involved in this process are not known precisely. To further define the template requirements for transcriptional arrest within exon 1 of the human ADA gene, various ADA templates were constructed and their abilities to confer transcriptional arrest were determined following injection into Xenopus oocytes. The exon 1 transcriptional arrest signal functioned downstream of several RNA polymerase II promoters and an RNA polymerase II promoter, implying that the transcriptional arrest site in exon 1 of the ADA gene is promoter independent. They identified a 43-bp DNA fragment which functions as a transcriptional arrest signal. Additional studies showed that the transcriptional arrest site functioned only in the naturally occurring orientation. Therefore, they have identified a 43-bp DNA fragment which functions as a transcriptional arrest signal in an orientation-dependent and promoter-independent manner. On the basis of the authors findings, they hypothesize that tissue-specific expression of the ADA gene is governed by factors that function as antiterminators to promote transcriptional readthrough of the exon 1 transcriptional arrest site.

  4. DNA sequence of 15 base pairs is sufficient to mediate both glucocorticoid and progesterone induction of gene expression

    SciTech Connect

    Straehle, U.; Klock, G.; Schuetz, G.


    To define the recognition sequence of the glucocorticoid receptor and its relationship with that of the progesterone receptor, oligonucleotides derived from the glucocorticoid response element of the tyrosine aminotransferase gene were tested upstream of a heterologous promoter for their capacity to mediate effects of these two steroids. The authors show that a 15-base-pair sequence with partial symmetry is sufficient to confer glucocorticoid inducibility on the promoter of the herpes simplex virus thymidine kinase gene. The same 15-base-pair sequence mediates induction by progesterone. Point mutations in the recognition sequence affect inducibility by glucocorticoids and progesterone similarly. Together with the strong conservation of the sequence of the DNA-binding domain of the two receptors, these data suggest that both proteins recognize a sequence that is similar, if not the same.

  5. Conserved cis-regulatory modules in promoters of genes encoding wheat high-molecular-weight glutenin subunits

    PubMed Central

    Ravel, Catherine; Fiquet, Samuel; Boudet, Julie; Dardevet, Mireille; Vincent, Jonathan; Merlino, Marielle; Michard, Robin; Martre, Pierre


    The concentration and composition of the gliadin and glutenin seed storage proteins (SSPs) in wheat flour are the most important determinants of its end-use value. In cereals, the synthesis of SSPs is predominantly regulated at the transcriptional level by a complex network involving at least five cis-elements in gene promoters. The high-molecular-weight glutenin subunits (HMW-GS) are encoded by two tightly linked genes located on the long arms of group 1 chromosomes. Here, we sequenced and annotated the HMW-GS gene promoters of 22 electrophoretic wheat alleles to identify putative cis-regulatory motifs. We focused on 24 motifs known to be involved in SSP gene regulation. Most of them were identified in at least one HMW-GS gene promoter sequence. A common regulatory framework was observed in all the HMW-GS gene promoters, as they shared conserved cis-regulatory modules (CCRMs) including all the five motifs known to regulate the transcription of SSP genes. This common regulatory framework comprises a composite box made of the GATA motifs and GCN4-like Motifs (GLMs) and was shown to be functional as the GLMs are able to bind a bZIP transcriptional factor SPA (Storage Protein Activator). In addition to this regulatory framework, each HMW-GS gene promoter had additional motifs organized differently. The promoters of most highly expressed x-type HMW-GS genes contain an additional box predicted to bind R2R3-MYB transcriptional factors. However, the differences in annotation between promoter alleles could not be related to their level of expression. In summary, we identified a common modular organization of HMW-GS gene promoters but the lack of correlation between the cis-motifs of each HMW-GS gene promoter and their level of expression suggests that other cis-elements or other mechanisms regulate HMW-GS gene expression. PMID:25429295

  6. Methylation Status of Vitamin D Receptor Gene Promoter in Benign and Malignant Adrenal Tumors

    PubMed Central

    Pilon, Catia; Rebellato, Andrea; Urbanet, Riccardo; Guzzardo, Vincenza; Cappellesso, Rocco; Sasano, Hironobu; Fassina, Ambrogio


    We previously showed a decreased expression of vitamin D receptor (VDR) mRNA/protein in a small group of adrenocortical carcinoma (ACC) tissues, suggesting the loss of a protective role of VDR against malignant cell growth in this cancer type. Downregulation of VDR gene expression may result from epigenetics events, that is, methylation of cytosine nucleotide of CpG islands in VDR gene promoter. We analyzed methylation of CpG sites in the VDR gene promoter in normal adrenals and adrenocortical tumor samples. Methylation of CpG-rich 5′ regions was assessed by bisulfite sequencing PCR using bisulfite-treated DNA from archival microdissected paraffin-embedded adrenocortical tissues. Three normal adrenals and 23 various adrenocortical tumor samples (15 adenomas and 8 carcinomas) were studied. Methylation in the promoter region of VDR gene was found in 3/8 ACCs, while no VDR gene methylation was observed in normal adrenals and adrenocortical adenomas. VDR mRNA and protein levels were lower in ACCs than in benign tumors, and VDR immunostaining was weak or negative in ACCs, including all 3 methylated tissue samples. The association between VDR gene promoter methylation and reduced VDR gene expression is not a rare event in ACC, suggesting that VDR epigenetic inactivation may have a role in adrenocortical carcinogenesis. PMID:26843863

  7. Identification of an upstream regulatory sequence that mediates the transcription of mox genes in Methylobacterium extorquens AM1.


    Zhang, Meng; FitzGerald, Kelly A; Lidstrom, Mary E


    A multiple A-tract sequence has been identified in the promoter regions for the mxaF, pqqA, mxaW, mxbD and mxcQ genes involved in methanol oxidation in Methylobacterium extorquens AM1, a facultative methylotroph. Site-directed mutagenesis was exploited to delete or change this conserved sequence. Promoter-xylE transcriptional fusions were used to assess promoter activity in these mutants. A fiftyfold drop in the XylE activity was observed for the mxaF and pqqA promoters without this sequence, and a five- to sixfold drop in the XylE activity was observed for the mxbD and mxcQ promoters without this sequence. Mutants were generated in the chromosomal copies in which this sequence was either deleted or altered, and these mutants were unable to grow on methanol. When one of these sequences was added to Plac of Escherichia coli, which is a weak constitutive promoter in M. extorquens AM1, the activity increased two- to threefold. These results suggest that this sequence is essential for normal expression of these genes in M. extorquens AM1, and may serve as a general enhancer element for genetic constructs in this bacterium.

  8. Sequence diversity of mating-type genes in Phaeosphaeria avenaria.


    Ueng, Peter P; Dai, Qun; Cui, Kai-rong; Czembor, Paweł C; Cunfer, Barry M; Tsang, H; Arseniuk, Edward; Bergstrom, Gary C


    Phaeosphaeria avenaria, one of the causal agents of stagonospora leaf blotch diseases in cereals, is composed of two subspecies, P. avenaria f. sp. triticea (Pat) and P. avenaria f. sp. avenaria (Paa). The Pat subspecies was grouped into Pat1-Pat3, based on restriction fragment length polymorphism (RFLP) and ribosomal DNA (rDNA) internal transcribed spacer (ITS) sequences in previous studies. Mating-type genes and their potential use in phylogeny and molecular classification were studied by DNA hybridization and PCR amplification. The majority of Pat1 isolates reported to be homothallic and producing sexual reproduction structures on cultural media had only the MAT1-1 gene. Minor sequence variations were found in the conserved region of MAT1-1 gene in Pat1 isolates. However, both mating-type genes, MAT1-1 and MAT1-2, were identified in P. avenaria isolates represented by ATCC12277 from oats (Paa) and the Pat2 isolates from foxtail barley ( Hordeum jubatum L.). Cluster analyses based on mating-type gene conserved regions revealed that cereal Phaeosphaeria is not phylogenetically closely related to other ascomycetes, including Mycosphaerella graminicola (anamorph Septoria tritici). The sequence diversity of mating-type genes in Pat and Paa supports our previous phylogenetic relationship and molecular classification based on RFLP fingerprinting and rDNA ITS sequences.

  9. Computational Genomics: From Genome Sequence To Global Gene Regulation

    NASA Astrophysics Data System (ADS)

    Li, Hao


    As various genome projects are shifting to the post-sequencing phase, it becomes a big challenge to analyze the sequence data and extract biological information using computational tools. In the past, computational genomics has mainly focused on finding new genes and mapping out their biological functions. With the rapid accumulation of experimental data on genome-wide gene activities, it is now possible to understand how genes are regulated on a genomic scale. A major mechanism for gene regulation is to control the level of transcription, which is achieved by regulatory proteins that bind to short DNA sequences - the regulatory elements. We have developed a new approach to identifying regulatory elements in genomes. The approach formalizes how one would proceed to decipher a ``text'' consisting of a long string of letters written in an unknown language that did not delineate words. The algorithm is based on a statistical mechanics model in which the sequence is segmented probabilistically into ``words'' and a ``dictionary'' of ``words'' is built concurrently. For the control regions in the yeast genome, we built a ``dictionary'' of about one thousand words which includes many known as well as putative regulatory elements. I will discuss how we can use this dictionary to search for genes that are likely to be regulated in a similar fashion and to analyze gene expression data generated from DNA micro-array experiments.

  10. Insights into corn genes derived from large-scale cDNA sequencing.


    Alexandrov, Nickolai N; Brover, Vyacheslav V; Freidin, Stanislav; Troukhan, Maxim E; Tatarinova, Tatiana V; Zhang, Hongyu; Swaller, Timothy J; Lu, Yu-Ping; Bouck, John; Flavell, Richard B; Feldmann, Kenneth A


    We present a large portion of the transcriptome of Zea mays, including ESTs representing 484,032 cDNA clones from 53 libraries and 36,565 fully sequenced cDNA clones, out of which 31,552 clones are non-redundant. These and other previously sequenced transcripts have been aligned with available genome sequences and have provided new insights into the characteristics of gene structures and promoters within this major crop species. We found that although the average number of introns per gene is about the same in corn and Arabidopsis, corn genes have more alternatively spliced isoforms. Examination of the nucleotide composition of coding regions reveals that corn genes, as well as genes of other Poaceae (Grass family), can be divided into two classes according to the GC content at the third position in the amino acid encoding codons. Many of the transcripts that have lower GC content at the third position have dicot homologs but the high GC content transcripts tend to be more specific to the grasses. The high GC content class is also enriched with intronless genes. Together this suggests that an identifiable class of genes in plants is associated with the Poaceae divergence. Furthermore, because many of these genes appear to be derived from ancestral genes that do not contain introns, this evolutionary divergence may be the result of horizontal gene transfer from species not only with different codon usage but possibly that did not have introns, perhaps outside of the plant kingdom. By comparing the cDNAs described herein with the non-redundant set of corn mRNAs in GenBank, we estimate that there are about 50,000 different protein coding genes in Zea. All of the sequence data from this study have been submitted to DDBJ/GenBank/EMBL under accession numbers EU940701-EU977132 (FLI cDNA) and FK944382-FL482108 (EST).

  11. Identification of a KRAB-zinc finger protein binding to the Rpe65 gene promoter.


    Lu, Zhongjian; Poliakov, Eugenia; Redmond, T Michael


    We wish to identify transcriptional factors involved in regulation binding to the proximal promoter region of the RPE65 gene that confers RPE-specific expression. We incubated human D407 RPE cell nuclear extract with double-stranded (sense 5-prime biotinylated) oligonucleotides, based on the RPE65 proximal gene promoter, bound to streptavidin-Dynabeads. Bound nuclear proteins were eluted, separated on SDS-PAGE, and analyzed by mass spectrometry. Peptide sequence was used to identify cDNA clones that were subcloned into pCDNA3.1 for expression and co-transfection into D407 cells to assess transcriptional activation of mouse Rpe65 gene promoter/reporter constructs. SiRNA interference was used to suppress ZNF492 expression. We identified a D407 nuclear protein binding to biotinylated-DNA/streptavidin beads as the product of clone KIAA1473 encoding a protein named ZNF492. ZNF492 has an open reading frame of 531 amino acids with a truncated N-terminus and lacks the usual Krüppel-associated box-A (KRAB-A) while KRAB-B remains intact and has 12 C2H2 zinc-fingers in tandem arrangement. Co-expression in D407 cells of ZNF492 protein did not activate TR1, a mouse Rpe65 gene promoter/reporter construct with 49-bp 5-prime flanking sequence, but did activate construct TR2, containing 188-bp 5-prime flanking sequence, by 2.5-fold, and the longer constructs TR4, containing 655-bp 5-prime flanking sequence, and TR5, containing 1240-bp 5-prime flanking sequence, by about 2-fold. SiRNA-mediated suppression of ZNF492 in D407 resulted in decreased Rpe65 promoter activity. We have identified ZNF492, a KRAB-zinc finger protein, by its interaction with immobilized RPE65 promoter DNA sequence. This KRAB-zinc finger protein serves as a moderate transcriptional factor for Rpe65 gene upregulation. In ZNF492, absence of KRAB-A might reduce or prevent co-repressor binding to account for the modest upregulation of Rpe65 gene expression.

  12. Sequence and analysis of the human ABL gene, the BCR gene, and regions involved in the Philadelphia chromosomal translocation

    SciTech Connect

    Burian, D.; Clifton, S.W.; Crabtree, J.


    The complete human BCR gene (152j-141 nt) on chromosome 22 and greater than 80% of the human ABL gene (179-512 nt) on chromosome 9 have been sequenced from mapped cosmid and plasmid clones via a shotgun strategy. Because these two chromosomes are translocated with breakpoints within the BCR and ABL genes in Philadelphia chromosome-positive leukemias, knowledge of these sequences also might provide insight into the validity of various theories of chromosomal rearrangements. Comparison of these genes with their cDNA sequences reveal the positions of 23 BCR exons and putative alternative BCR first and second exons, as well as the common ABL exons 2-11, respectively. Additionally, these regions include the alternative ABL first exons 1b and 1a, a new gene 5` to the first ABL exon, and an open reading frame with homology to an EST within the BCR fourth intron. Further analysis reveals an Alu homology of 38.83 and 39.35% for the BCR and ABL genes, respectively, with other repeat elements present to a lesser extent. Four new Philadelphia chromosome translocation breakpoints from chronic myelogenous leukemia patients also were sequenced, and the positions of these and several other previously sequenced breakpoints now have been mapped precisely, although no consistent breakpoint features immediately were apparent. Comparative analysis of genomic sequences encompassing the murine homologues to the human ABL exons 1b and 1a, as well as regions encompassing the ABL exons 2 and 3, reveals that although there is a high degree of homology in their corresponding exons and promoter regions, these two vertebrate species show a striking lack of homology outside these regions. 122 refs., 5 figs., 4 tabs.

  13. Promoter region of the human platelet-derived growth factor A-chain gene.

    PubMed Central

    Takimoto, Y; Wang, Z Y; Kobler, K; Deuel, T F


    The platelet-derived growth factor (PDGF) A- and B-chain genes are widely expressed in mammalian tissues and their homodimeric gene products appear to regulate the autocrine growth of both normal and transformed cells. In this study, we analyzed the 5' flanking sequences of the human PDGF A-chain gene to seek elements important to regulating its transcription. The promoter region was exceptionally G + C-rich and contained a "TATA box" but no "CAAT box." The transcription start site was identified 845 base pairs 5' to the translation initiation site by S1 nuclease mapping and by primer extension. Both in vitro transcription and transient expression of the chloramphenicol acetyltransferase gene linked to the PDGF A-chain 5' flanking sequences established that the putative promoter region was active, and RNase H mapping established that the three characteristic mRNAs (1.9, 2.3, and 2.8 kilobases) used the same transcription start site, which was used in normal endothelial cells and in two human tumor cell lines that express high levels of A-chain transcripts. The results established an exceptionally G + C-rich promoter region and a single transcription start site active for each of the three mRNAs of the PDGF A-chain gene. DNA sites of potential importance in mediating the activation of the PDGF A-chain gene in normal cells and in transformed cell lines expressing high levels of PDGF A chain were identified. Images PMID:1848007

  14. Promoter region of the human platelet-derived growth factor A-chain gene

    SciTech Connect

    Takimoto, Yasuo; Wang, Zhao Yi; Kobler, K.; Deuel, T.F. )


    The platelet-derived growth factor (PDGF) A- and B-chain genes are widely expressed in mammalian tissues and their homodimeric gene products appear to regulate the autocrine growth of both normal and transformed cells. In this study, we analyzed the 5{prime} flanking sequences of the human PDGF A-chain gene to seek elements important to regulating its transcription. The promoter reigon was exceptionally G + C-rich and contained a TATA box but no CAAT box. The transcription start site was identified 845 base pairs 5{prime} to the translation initiation site by S1 nuclease mapping and by primer extension. Both in vitro transcription and transient expression of the chloramphenicol acetyltransferase gene linked to the PDGF A-chain 5{prime} flanking sequences established that the putative promoter region was active, and RNase H mapping established that the three characteristic mRNAs used the same transcription start site, which was used in normal endothelial cells and in two human tumor cell lines that express high levels of A-chain transcripts. The results extablished an exceptionally G + C-rich promoter region and a single transcription start site active for each of the three mRNAs of the PDGF A-chain gene. DNA sites of potential importance in mediating the activation of the PDGF A-chain gene in normal cells and in transformed cell lines expressing high levels of PDGF A-chain were identified.

  15. Aberrant promoter hypermethylation of p16 gene in endometrial carcinoma.


    Hu, Zhuo-ying; Tang, Liang-dan; Zhou, Qin; Xiao, Lin; Cao, Yi


    Previous studies demonstrated that the loss of function of the p16INK4A gene is mainly caused by the hypermethylation of p16 gene promoter; however, whether or not it is associated with the incidence of endometrial carcinoma (EC) remains unclear. In the current study, we conducted a meta-analysis to investigate the effects of p16 gene promoter hypermethylation on the incidence of EC. Detailed research publications were searched from Embase, PubMed, and ISI Web of Knowledge for composition in English or Chinese. The pooled data were collected and analyzed by Review Manager 5.2. Odds ratios (ORs) were calculated and summarized respectively. Six eligible studies, including 261 patients were selected and analyzed. The pooled OR was 0.42, test for overall effect, Z = 10.19, P < 0.0001, indicating that p16 gene promoter hypermethylation was significantly correlated with the EC patients. The results of our study strongly suggest that p16 gene promoter hypermethylation is correlated with an increased risk of EC. P16 gene promoter hypermethylation plays a critical role in endometrial carcinogenesis.

  16. Genome Sequence of the Plant Growth Promoting Endophytic Bacterium Enterobacter sp. 638

    SciTech Connect

    Taghavi, S.; van der Lelie, D.; Hoffman, A.; Zhang, Y.-B.; Walla, M. D.; Vangronsveld, J.; Newman, L.; Monchy, S.


    Enterobacter sp. 638 is an endophytic plant growth promoting gamma-proteobacterium that was isolated from the stem of poplar (Populus trichocarpa x deltoides cv. H11-11), a potentially important biofuel feed stock plant. The Enterobacter sp. 638 genome sequence reveals the presence of a 4,518,712 bp chromosome and a 157,749 bp plasmid (pENT638-1). Genome annotation and comparative genomics allowed the identification of an extended set of genes specific to the plant niche adaptation of this bacterium. This includes genes that code for putative proteins involved in survival in the rhizosphere (to cope with oxidative stress or uptake of nutrients released by plant roots), root adhesion (pili, adhesion, hemagglutinin, cellulose biosynthesis), colonization/establishment inside the plant (chemiotaxis, flagella, cellobiose phosphorylase), plant protection against fungal and bacterial infections (siderophore production and synthesis of the antimicrobial compounds 4-hydroxybenzoate and 2-phenylethanol), and improved poplar growth and development through the production of the phytohormones indole acetic acid, acetoin, and 2,3-butanediol. Metabolite analysis confirmed by quantitative RT-PCR showed that, the production of acetoin and 2,3-butanediol is induced by the presence of sucrose in the growth medium. Interestingly, both the genetic determinants required for sucrose metabolism and the synthesis of acetoin and 2,3-butanediol are clustered on a genomic island. These findings point to a close interaction between Enterobacter sp. 638 and its poplar host, where the availability of sucrose, a major plant sugar, affects the synthesis of plant growth promoting phytohormones by the endophytic bacterium. The availability of the genome sequence, combined with metabolome and transcriptome analysis, will provide a better understanding of the synergistic interactions between poplar and its growth promoting endophyte Enterobacter sp. 638. This information can be further exploited to

  17. Combinatorial Pooling Enables Selective Sequencing of the Barley Gene Space

    PubMed Central

    Lonardi, Stefano; Duma, Denisa; Alpert, Matthew; Cordero, Francesca; Beccuti, Marco; Bhat, Prasanna R.; Wu, Yonghui; Ciardo, Gianfranco; Alsaihati, Burair; Ma, Yaqin; Wanamaker, Steve; Resnik, Josh; Bozdag, Serdar; Luo, Ming-Cheng; Close, Timothy J.


    For the vast majority of species – including many economically or ecologically important organisms, progress in biological research is hampered due to the lack of a reference genome sequence. Despite recent advances in sequencing technologies, several factors still limit the availability of such a critical resource. At the same time, many research groups and international consortia have already produced BAC libraries and physical maps and now are in a position to proceed with the development of whole-genome sequences organized around a physical map anchored to a genetic map. We propose a BAC-by-BAC sequencing protocol that combines combinatorial pooling design and second-generation sequencing technology to efficiently approach denovo selective genome sequencing. We show that combinatorial pooling is a cost-effective and practical alternative to exhaustive DNA barcoding when preparing sequencing libraries for hundreds or thousands of DNA samples, such as in this case gene-bearing minimum-tiling-path BAC clones. The novelty of the protocol hinges on the computational ability to efficiently compare hundred millions of short reads and assign them to the correct BAC clones (deconvolution) so that the assembly can be carried out clone-by-clone. Experimental results on simulated data for the rice genome show that the deconvolution is very accurate, and the resulting BAC assemblies have high quality. Results on real data for a gene-rich subset of the barley genome confirm that the deconvolution is accurate and the BAC assemblies have good quality. While our method cannot provide the level of completeness that one would achieve with a comprehensive whole-genome sequencing project, we show that it is quite successful in reconstructing the gene sequences within BACs. In the case of plants such as barley, this level of sequence knowledge is sufficient to support critical end-point objectives such as map-based cloning and marker-assisted breeding. PMID:23592960

  18. DNA sequence, products, and transcriptional pattern of the genes involved in production of the DNA replication inhibitor microcin B17.

    PubMed Central

    Genilloud, O; Moreno, F; Kolter, R


    The 3.8-kilobase segment of plasmid DNA that contains the genes required for production of the DNA replication inhibitor microcin B17 was sequenced. The sequence contains four open reading frames which were shown to be translated in vivo by the construction of fusions to lacZ. The location of these open reading frames fits well with the location of the four microcin B17 production genes, mcbABCD, identified previously through genetic complementation. The products of the four genes have been identified, and the observed molecular weights of the proteins agree with those predicted from the nucleotide sequence. The transcription of these genes was studied by using fusions to lacZ and physical mapping of mRNA start sites. Three promoters were identified in this region. The major promoter for all the genes is a growth phase-regulated OmpR-dependent promoter located upstream of mcbA. A second promoter is located within mcbC and is responsible for a low-level basal expression of mcbD. A third promoter, located within mcbD, promotes transcription in the reverse direction starting within mcbD and extending through mcbC. The resulting mRNA appears to be an untranslated antisense transcript that could play a regulatory role in the expression of these genes. Images PMID:2644225

  19. A short upstream promoter region mediates transcriptional regulation of the mouse doublecortin gene in differentiating neurons

    PubMed Central


    Background Doublecortin (Dcx), a MAP (Microtubule-Associated Protein), is transiently expressed in migrating and differentiating neurons and thereby characterizes neuronal precursors and neurogenesis in developing and adult neurogenesis. In addition, reduced Dcx expression during development has been related to appearance of brain pathologies. Here, we attempt to unveil the molecular mechanisms controlling Dcx gene expression by studying its transcriptional regulation during neuronal differentiation. Results To determine and analyze important regulatory sequences of the Dcx promoter, we studied a putative regulatory region upstream from the mouse Dcx coding region (pdcx2kb) and several deletions thereof. These different fragments were used in vitro and in vivo to drive reporter gene expression. We demonstrated, using transient expression experiments, that pdcx2kb is sufficient to control specific reporter gene expression in cerebellar cells and in the developing brain (E14.5). We determined the temporal profile of Dcx promoter activity during neuronal differentiation of mouse embryonic stem cells (mESC) and found that transcriptional activation of the Dcx gene varies along with neuronal differentiation of mESC. Deletion experiments and sequence comparison of Dcx promoters across rodents, human and chicken revealed the importance of a highly conserved sequence in the proximal region of the promoter required for specific and strong expression in neuronal precursors and young neuronal cells. Further analyses revealed the presence in this short sequence of several conserved, putative transcription factor binding sites: LEF/TCF (Lymphoid Enhancer Factor/T-Cell Factor) which are effectors of the canonical Wnt pathway; HNF6/OC2 (Hepatocyte Nuclear Factor-6/Oncecut-2) members of the ONECUT family and NF-Y/CAAT (Nuclear Factor-Y). Conclusions Studies of Dcx gene regulatory sequences using native, deleted and mutated constructs suggest that fragments located upstream of the

  20. Cloning, sequencing and transcriptional analysis of the Choristoneura fumiferana entomopoxvirus spheroidin gene.


    Li, X; Barrett, J W; Yuen, L; Arif, B M


    The Choristoneura fumiferana entomopoxvirus (CfEPV) spheroidin gene was identified and localized on three XbaI restriction fragments (total size 4.73 kb). The fragments were cloned and sequenced. The spheroidin gene had an open reading frame of 2997 nucleotides encoding a putative protein with a predicted size of 115 kDa. Sequence analysis indicated that the putative protein contained 14 potential N-glycosylation sites (Asn-X-Thr; Asn-X-Ser), that are probably not used since the protein migrates on SDS-PAGE as a 115 kDa band. The protein is rich in cysteine residues (34), which explains the need for reducing agents when dissolving the occlusion bodies with alkali. The spheroidin gene sequence contains motifs characteristic of the late genes of poxviruses. These include the typical TAAATG sequence at the beginning of the coding region and two early gene termination signals (TTTTTNT) in the untranslated region of the gene. The promoter region has three TAA termination signals immediately upstream of the ATG start site. Spheroidin (SPH) appears to be conserved among different EPVs. There was 82.2% identity and 97.2% similarity at the amino acid level between the SPHs of CfEPV and Amsacta moorei EPV. Less conservation was seen with the SPH from Melolontha melolontha EPV (39.8% identity and 73.4% similarity). Transcriptional analyses of the spheroidin gene by Northern blots showed that the transcript had a size of approximately 3 kb, which is in agreement with the length of the ORF. Primer extension results, anchor PCR and sequencing confirmed that there was a poly (A)17 tract at the 5' end of the spheroidin gene transcript, a structure typical of late gene transcripts of poxviruses.

  1. Functional analysis of the Myostatin gene promoter in sheep.


    Du, Rong; An, XiaoRong; Chen, YongFu; Qin, Jian


    Compared with the understanding for the functional mechanism of the myostatin gene, little is known about the regulatory mechanism of the myostatin gene transcription and expression. To better understand the function of the myostatin gene promoter (MSTNpro) in the transcriptional regulation of the myostatin gene and to further investigate the transcriptional regulation mechanism of the myostatin gene, the promoter region of the myostatin gene in sheep has been cloned in our recent study (AY918121). In this study, the wild (W) type MSTNPro(W)-EGFP vectors and E-box (E) (CANNTG) mutant (M) type MSTNPro(E(3+5+7)M)-EGFP vectors were constructed and the transcriptional regulation activities were compared by detecting the fluorescent strength of EGFP (enhanced green fluorescent protein) in C2C12 myoblasts (or myotubes) and sheep fibroblasts transfected with the vectors. Results showed that the 0.3-1.2 kb sheep myostatin promoter could activate the transcription and expression of EGFP gene in C2C12 myoblasts to different extent and the 1.2 kb promoter was the strongest. However, fluorescence was not observed in the sheep fibroblasts transfected with the 1.2 kb sheep myostatin promoter. These results suggested that the specific nature of the myostatin gene expression in skeletal muscle was attributed to the specific nature of the myostatin promoter activity. The increasing growth density of C2C12 myoblasts inhibited the transcriptional regulation activity of the wild type sheep myostatin promoter by a mechanism of feedback. The transcriptional regulation activity of the 1.2 kb wild type sheep myostatin promoter increased significantly after C2C12 myoblasts were differentiated, while the activity of 1.2 kb E(3+5+7)-mutant type myostatin promoter had no obvious change. This result suggested that MyoD may be responsible for the difference of the myostatin gene transcription and expression between growing and differentiating conditions by binding to E-box of the myostatin

  2. Promoters for the human beta-hexosaminidase genes, HEXA and HEXB.


    Norflus, F; Yamanaka, S; Proia, R L


    Human lysosomal beta-hexosaminidases are encoded by two genes, HEXA and HEXB, specifying an alpha- and a beta-subunit, respectively. The subunits dimerize to form beta-hexosaminidase A (alpha beta), beta-hexosaminidase B (beta beta), and beta-hexosaminidase S (alpha alpha). This enzyme system has the capacity to degrade a variety of cellular substrates: oligosaccharides, glycosaminoglycans, and glycolipids containing beta-linked N-acetylglucosaminyl or N-galactosaminyl residues. Mutations in either the HEXA gene or HEXB gene lead to an accumulation of GM2 ganglioside in neurons, resulting in the severe neurodegenerative disorders termed the GM2 gangliosidoses. To identify the DNA elements responsible for hexosaminidase expression, we ligated the 5'-flanking sequences of both the human and mouse hexosaminidase genes to a chloramphenicol acetyltransferase (CAT) gene. The resulting plasmids were transfected into NIH-3T3 cells and CAT activity was determined as a measure of promoter strength. By 5' deletion analysis, it was found that essential sequences for HEXA expression resided within a 40-bp region between 100 bp and 60 bp upstream of the ATG initiation codon. This area contained two potential estrogen response element half-sites as well as potential binding sites for transcription factors NF-E1 and AP-2. Similarly, important HEXB promoter sequences were localized to a 60-bp region between 150 bp and 90 bp upstream of the ATG codon. By performing scanning mutagenesis on a 60-bp region within the 150-bp HEXB construct, we defined an essential promoter element of 12 bp that contained two potential AP-1 sites. The mouse Hexa and Hexb 5'-flanking sequences were found to contain regions similar in sequence, location, and activity to the essential promoter elements defined in the cognate human genes. No sequence similarity was found, however, between 5'-flanking regions of the HEXA and HEXB genes. These essential promoter elements represent potential sites for HEXA and

  3. Illumina MiSeq sequencing disfavours a sequence motif in the GFP reporter gene

    PubMed Central

    Van den Hoecke, Silvie; Verhelst, Judith; Saelens, Xavier


    Green fluorescent protein (GFP) is one of the most used reporter genes. We have used next-generation sequencing (NGS) to analyse the genetic diversity of a recombinant influenza A virus that expresses GFP and found a remarkable coverage dip in the GFP coding sequence. This coverage dip was present when virus-derived RT-PCR product or the parental plasmid DNA was used as starting material for NGS and regardless of whether Nextera XT transposase or Covaris shearing was used for DNA fragmentation. Therefore, the sequence coverage dip in the GFP coding sequence was not the result of emerging GFP mutant viruses or a bias introduced by Nextera XT fragmentation. Instead, we found that the Illumina MiSeq sequencing method disfavours the ‘CCCGCC’ motif in the GFP coding sequence. PMID:27193250

  4. Comparative analysis of the human and mouse Hey1 promoter: Hey genes are new Notch target genes.


    Maier, M M; Gessler, M


    Hey genes (Hey1, Hey2 and HeyL) encode a new group of basic helix-loop-helix transcription factors that are related to the hairy/Enhancer of split genes. In the present study, we cloned and characterized the promoter region of the human and mouse Hey1 gene. The transcription initiation site was located 138 nucleotides upstream of the start codon. There is a minimal sequence element (nt -30 to -247) that is essential and important for basal transcription in three different cell types. Further upstream, a highly conserved sequence block (nt -324 to -646; approximately 90% human/mouse similarity) could be identified that contains several putative binding sites for transcription factors and likely represents an important regulatory region for this gene. Cotransfection experiments demonstrated that the mHey1 promoter activity is up-regulated by the activated form of all four mammalian Notch receptors via two functional RBP-Jkappa binding sites. The other members of the Hey gene family, Hey2 and HeyL, also possess RBP-Jkappa binding sites and they are similarly responsive to Notch signaling. Thus, our data clearly demonstrate that Hey genes form a new class of Notch signal transducers that should prove to be relevant in various developmental processes. Copyright 2000 Academic Press.

  5. Diverse nucleotide compositions and sequence fluctuation in Rubisco protein genes

    NASA Astrophysics Data System (ADS)

    Holden, Todd; Dehipawala, S.; Cheung, E.; Bienaime, R.; Ye, J.; Tremberger, G., Jr.; Schneider, P.; Lieberman, D.; Cheung, T.


    The Rubisco protein-enzyme is arguably the most abundance protein on Earth. The biology dogma of transcription and translation necessitates the study of the Rubisco genes and Rubisco-like genes in various species. Stronger correlation of fractal dimension of the atomic number fluctuation along a DNA sequence with Shannon entropy has been observed in the studied Rubisco-like gene sequences, suggesting a more diverse evolutionary pressure and constraints in the Rubisco sequences. The strategy of using metal for structural stabilization appears to be an ancient mechanism, with data from the porphobilinogen deaminase gene in Capsaspora owczarzaki and Monosiga brevicollis. Using the chi-square distance probability, our analysis supports the conjecture that the more ancient Rubisco-like sequence in Microcystis aeruginosa would have experienced very different evolutionary pressure and bio-chemical constraint as compared to Bordetella bronchiseptica, the two microbes occupying either end of the correlation graph. Our exploratory study would indicate that high fractal dimension Rubisco sequence would support high carbon dioxide rate via the Michaelis- Menten coefficient; with implication for the control of the whooping cough pathogen Bordetella bronchiseptica, a microbe containing a high fractal dimension Rubisco-like sequence (2.07). Using the internal comparison of chi-square distance probability for 16S rRNA (~ E-22) versus radiation repair Rec-A gene (~ E-05) in high GC content Deinococcus radiodurans, our analysis supports the conjecture that high GC content microbes containing Rubisco-like sequence are likely to include an extra-terrestrial origin, relative to Deinococcus radiodurans. Similar photosynthesis process that could utilize host star radiation would not compete with radiation resistant process from the biology dogma perspective in environments such as Mars and exoplanets.

  6. De novo generation of simple sequence during gene amplification.

    PubMed Central

    Kirschner, L S


    Mammalian cells that have undergone gene amplification and/or gene rearrangement have been used as resources to gain insight into the questions of chromosome structure and dynamics. The multidrug resistant murine cell line J7.V2-1 has been shown previously to contain two distinct forms of the highly amplified mdr2 gene, a member of the mouse gene family responsible for the multidrug resistant (MDR) phenotype [Kirschner, L. S. (1995) DNA Cell Biol. 14, 47-59]. Characterization of both forms of the gene revealed that one form corresponded to the wild-type structure of the gene, whereas the other represented a rearrangement. Investigation of this altered gene demonstrated a deletion of 1.6 kb of the wild-type sequence, and replacement of this region with a poly(AT) tract that appears to have been generated de novo. Analysis of the native sequence in this region demonstrated the absence of repetitive elements, but was notable for the presence of two long stretches of polypurine: polypyrimidine strand asymmetry. Analysis of mdr2 transcripts in this cell line revealed that nearly all of the mRNA is transcribed from the rearranged form of the gene. This message is unable to code for a functional mdr2 gene product, owing to a deletion of the fourth exon during this event. Mechanisms of the rearrangement, as well as the significance of this curious effect on transcription, are discussed. PMID:8759018

  7. Isolation and Functional Characterization of a Lycopene β-cyclase Gene Promoter from Citrus

    PubMed Central

    Lu, Suwen; Zhang, Yin; Zheng, Xiongjie; Zhu, Kaijie; Xu, Qiang; Deng, Xiuxin


    Lycopene β-cyclases are key enzymes located at the branch point of the carotenoid biosynthesis pathway. However, the transcriptional regulatory mechanisms of LCYb1 in citrus with abundant carotenoid accumulation are still unclear. To understand the molecular basis of CsLCYb1 expression, we isolated and functionally characterized the 5′ upstream sequences of CsLCYb1 from citrus. The full-length CsLCYb1 promoter and a series of its 5′ deletions were fused to the β-glucuronidase (GUS) reporter gene and transferred into different plants (tomato, Arabidopsis and citrus callus) to test the promoter activities. The results of all transgenic species showed that the 1584 bp upstream region from the translational start site displayed maximal promoter activity, and the minimal promoter containing 746 bp upstream sequences was sufficient for strong basal promoter activity. Furthermore, the CsLCYb1 promoter activity was developmentally and tissue-specially regulated in transgenic Arabidopsis, and it was affected by multiple hormones and environmental cues in transgenic citrus callus under various treatments. Finer deletion analysis identified an enhancer element existing as a tandem repeat in the promoter region between -574 to -513 bp and conferring strong promoter activity. The copy numbers of the enhancer element differed among various citrus species, leading to the development of a derived simple sequence repeat marker to distinguish different species. In conclusion, this study elucidates the expression characteristics of the LCYb1 promoter from citrus and further identifies a novel enhancer element required for the promoter activity. The characterized promoter fragment would be an ideal candidate for genetic engineering and seeking of upstream trans-acting elements. PMID:27679644

  8. Sequence and transcriptional analysis of the Streptomyces glaucescens tcmAR tetracenomycin C resistance and repressor gene loci.

    PubMed Central

    Guilfoile, P G; Hutchinson, C R


    Sequence analysis of the tcmA tetracenomycin C resistance gene from Streptomyces glaucescens GLA.O (ETH 22794) identifies one large open reading frame whose deduced product has sequence similarity to the mmr methylenomycin resistance gene from Streptomyces coelicolor, the Streptomyces rimosus tet347 (otrB) tetracycline resistance gene, and the atr1 aminotriazole resistance gene from Saccharomyces cerevisiae. These genes are thought to encode proteins that act as metabolite export pumps powered by transmembrane electrochemical gradients. A divergently transcribed gene, tcmR, is located in the region upstream of tcmA. The deduced product of tcmR resembles the repressor proteins encoded by tetR regulatory genes from Escherichia coli and the actII-orf1 gene from S. coelicolor. Transcriptional analysis of tcmA and tcmR indicates that these genes have back-to-back and overlapping promoter regions. Images PMID:1592819

  9. Cloning and characterization of the human trefoil factor 3 gene promoter.


    Sun, Yong; Wang, Liangxi; Zhou, Yifang; Mao, Xuefei; Deng, Xiangdong


    Human trefoil factor 3 (hTFF3) is a small-molecule peptide with potential medicinal value. Its main pharmacological function is to alleviate gastrointestinal mucosal injuries caused by various factors and promote the repair of damaged mucosa. However, how its transcription is regulated is not yet known. The aim of this study was to clone the hTFF3 gene promoter region, identify the core promoter and any transcription factors that bind to the promoter, and begin to clarify the regulation of its expression. The 5' flanking sequence of the hTFF3 gene was cloned from human whole blood genomic DNA by PCR. Truncated promoter fragments with different were cloned and inserted into the pGL3-Basic vector to determine the position of the core hTFF3 promoter. Transcription element maintaining basic transcriptional activity was assessed by mutation techniques. Protein-DNA interactions were analyzed by chromatin immunoprecipitation (ChIP). RNA interference and gene over-expression were performed to assay the effect of transcription factor on the hTFF3 expression. The results showed that approximately 1,826 bp of the fragment upstream of hTFF3 was successfully amplified, and its core promoter region was determined to be from -300 bp to -280 bp through analysis of truncated mutants. Mutation analysis confirmed that the sequence required to maintain basic transcriptional activity was accurately positioned from -300 bp to -296 bp. Bioinformatic analysis indicated that this area contained a Sp1 binding site. Sp1 binding to the hTFF3 promoter was confirmed by ChIP experiments. Sp1 over-expression and interference experiments showed that Sp1 enhanced the transcriptional activity of the hTFF3 promoter and increased hTFF3 expression. This study demonstrated that Sp1 plays an important role in maintaining the transcription of hTFF3.

  10. Lactase gene promoter fragments mediate differential spatial and temporal expression patterns in transgenic mice.


    Wang, Zhi; Maravelias, Charalambos; Sibley, Eric


    Lactase gene expression is spatiotemporally regulated during mammalian gut development. We hypothesize that distinct DNA control regions specify appropriate spatial and temporal patterning of lactase gene expression. In order to define regions of the lactase promoter involved in mediating intestine-specific and spatiotemporal restricted expression, transgenic mice harboring 100 bp, 1.3- and 2.0- kb fragments of the 5' flanking region of the rat lactase gene cloned upstream of a luciferase reporter were characterized. The 100-bp lactase promoter-reporter transgenic mouse line expressed maximal luciferase activity in the intestine with a posterior shift in spatial restriction and ectopic expression in the stomach and lung. The temporal pattern of expression mediated by the 1.3-kb promoter?reporter transgene increases with postnatal maturation in contrast with the postnatal decline mediated by the 2.0-kb promoter-reporter transgene and the endogenous lactase gene. The differential transgene expression patterns mediated by the lactase promoter fragments suggests that intestine-specific spatial and temporal control elements reside in distinct regions of the DNA sequences upstream of the lactase gene transcription start-site.

  11. Annotation of gene promoters by integrative data-mining of ChIP-seq Pol-II enrichment data.


    Gupta, Ravi; Wikramasinghe, Priyankara; Bhattacharyya, Anirban; Perez, Francisco A; Pal, Sharmistha; Davuluri, Ramana V


    Use of alternative gene promoters that drive widespread cell-type, tissue-type or developmental gene regulation in mammalian genomes is a common phenomenon. Chromatin immunoprecipitation methods coupled with DNA microarray (ChIP-chip) or massive parallel sequencing (ChIP-seq) are enabling genome-wide identification of active promoters in different cellular conditions using antibodies against Pol-II. However, these methods produce enrichment not only near the gene promoters but also inside the genes and other genomic regions due to the non-specificity of the antibodies used in ChIP. Further, the use of these methods is limited by their high cost and strong dependence on cellular type and context. We trained and tested different state-of-art ensemble and meta classification methods for identification of Pol-II enriched promoter and Pol-II enriched non-promoter sequences, each of length 500 bp. The classification models were trained and tested on a bench-mark dataset, using a set of 39 different feature variables that are based on chromatin modification signatures and various DNA sequence features. The best performing model was applied on seven published ChIP-seq Pol-II datasets to provide genome wide annotation of mouse gene promoters. We present a novel algorithm based on supervised learning methods to discriminate promoter associated Pol-II enrichment from enrichment elsewhere in the genome in ChIP-chip/seq profiles. We accumulated a dataset of 11,773 promoter and 46,167 non-promoter sequences, each of length 500 bp, generated from RNA Pol-II ChIP-seq data of five tissues (Brain, Kidney, Liver, Lung and Spleen). We evaluated the classification models in building the best predictor and found that Bagging and Random Forest based approaches give the best accuracy. We implemented the algorithm on seven different published ChIP-seq datasets to provide a comprehensive set of promoter annotations for both protein-coding and non-coding genes in the mouse genome. The

  12. Automated cleaning and pre-processing of immunoglobulin gene sequences from high-throughput sequencing

    PubMed Central

    Michaeli, Miri; Noga, Hila; Tabibian-Keissar, Hilla; Barshack, Iris; Mehr, Ramit


    High-throughput sequencing (HTS) yields tens of thousands to millions of sequences that require a large amount of pre-processing work to clean various artifacts. Such cleaning cannot be performed manually. Existing programs are not suitable for immunoglobulin (Ig) genes, which are variable and often highly mutated. This paper describes Ig High-Throughput Sequencing Cleaner (Ig-HTS-Cleaner), a program containing a simple cleaning procedure that successfully deals with pre-processing of Ig sequences derived from HTS, and Ig Insertion—Deletion Identifier (Ig-Indel-Identifier), a program for identifying legitimate and artifact insertions and/or deletions (indels). Our programs were designed for analyzing Ig gene sequences obtained by 454 sequencing, but they are applicable to all types of sequences and sequencing platforms. Ig-HTS-Cleaner and Ig-Indel-Identifier have been implemented in Java and saved as executable JAR files, supported on Linux and MS Windows. No special requirements are needed in order to run the programs, except for correctly constructing the input files as explained in the text. The programs' performance has been tested and validated on real and simulated data sets. PMID:23293637

  13. Sequence variation in the Tbx4 gene in marine mammals.


    Onbe, Kaori; Nishida, Shin; Sone, Emi; Kanda, Naohisa; Goto, Mutsuo; Pastene, Luis A; Tanabe, Shinsuke; Koike, Hiroko


    The amino-acid sequences of the T-domain region of the Tbx4 gene, which is required for hindlimb development, are 100% identical in humans and mice. Cetaceans have lost most of their hindlimb structure, although hindlimb buds are present in very early cetacean embryos. To examine whether the Tbx4 gene has the same function in cetaceans as in other mammals, we analyzed Tbx4 sequences from cetaceans, dugong, artiodactyls and marine carnivores. A total of 39 primers were designed using human and dog Tbx4 nucleotide sequences. Exons 3, 4, 5, 6, 7, and 8 of the Tbx4 genes from cetaceans, artiodactyls, and marine carnivores were sequenced. Non-synonymous substitution sites were detected in the T-domain regions from some cetacean species, but were not detected in those from artiodactyls, the dugong, or the carnivores. The C-terminal regions contained a number of non-synonymous substitutions. Although some indels were present, they were in groups of three nucleotides and therefore did not cause frame shifts. The dN/dS values for the T-domain and C-terminal regions of the cetacean and artiodactylous Tbx4 genes were much lower than 1, indicating that the Tbx4 gene maintains it function in cetaceans, although full expression leading to hindlimb development is suppressed.

  14. Novel strong tissue specific promoter for gene expression in human germ cells

    PubMed Central


    Background Tissue specific promoters may be utilized for a variety of applications, including programmed gene expression in cell types, tissues and organs of interest, for developing different cell culture models or for use in gene therapy. We report a novel, tissue-specific promoter that was identified and engineered from the native upstream regulatory region of the human gene NDUFV1 containing an endogenous retroviral sequence. Results Among seven established human cell lines and five primary cultures, this modified NDUFV1 upstream sequence (mNUS) was active only in human undifferentiated germ-derived cells (lines Tera-1 and EP2102), where it demonstrated high promoter activity (~twice greater than that of the SV40 early promoter, and comparable to the routinely used cytomegaloviral promoter). To investigate the potential applicability of the mNUS promoter for biotechnological needs, a construct carrying a recombinant cytosine deaminase (RCD) suicide gene under the control of mNUS was tested in cell lines of different tissue origin. High cytotoxic effect of RCD with a cell-death rate ~60% was observed only in germ-derived cells (Tera-1), whereas no effect was seen in a somatic, kidney-derived control cell line (HEK293). In further experiments, we tested mNUS-driven expression of a hyperactive Sleeping Beauty transposase (SB100X). The mNUS-SB100X construct mediated stable transgene insertions exclusively in germ-derived cells, thereby providing further evidence of tissue-specificity of the mNUS promoter. Conclusions We conclude that mNUS may be used as an efficient promoter for tissue-specific gene expression in human germ-derived cells in many applications. Our data also suggest that the 91 bp-long sequence located exactly upstream NDUFV1 transcriptional start site plays a crucial role in the activity of this gene promoter in vitro in the majority of tested cell types (10/12), and an important role - in the rest two cell lines. PMID:20716342

  15. Nucleotide sequence and transcriptional analysis of the type A2 neurotoxin gene cluster in Clostridium botulinum.


    Dineen, Sean S; Bradshaw, Marite; Karasek, Charles E; Johnson, Eric A


    The nucleotide sequences of the upstream regions of the botulinum neurotoxin type A1 (BoNT/A1) cluster of Clostridium botulinum strain NCTC 2916 and the BoNT/A2 cluster of strain Kyoto-F were determined. A novel gene, designated orfx3, was identified following the orfx2 gene in both clusters. ORF-X2 and ORF-X3 exhibit similarity to the BoNT cluster associated P-47 protein. The BoNT/A1 and BoNT/A2 clusters share a similar gene arrangement, but exhibit differences in the spacing between certain genes. Sequences with similarity to transposases were identified in these intergenic regions, suggesting that these differences arose from an ancestral insertion event. Transcriptional analysis of the BoNT/A2 cluster revealed that the genes of the cluster are primarily synthesized as three polycistronic transcripts. Two divergent polycistronic transcripts, one encoding the orfx1, orfx2, and orfx3 genes, the second encoding the p47, ntnh, and bont/a2 genes, are transcribed from conserved BoNT cluster promoters. The third polycistronic transcript, expressed at low levels, encodes the positive regulatory botR gene and the orfx genes. This is the first complete analysis of a botulinum toxin A2 cluster.

  16. Integration of Bioinformatics and Synthetic Promoters Leads to the Discovery of Novel Elicitor-Responsive cis-Regulatory Sequences in Arabidopsis1[C][W][OA

    PubMed Central

    Koschmann, Jeannette; Machens, Fabian; Becker, Marlies; Niemeyer, Julia; Schulze, Jutta; Bülow, Lorenz; Stahl, Dietmar J.; Hehl, Reinhard


    A combination of bioinformatic tools, high-throughput gene expression profiles, and the use of synthetic promoters is a powerful approach to discover and evaluate novel cis-sequences in response to specific stimuli. With Arabidopsis (Arabidopsis thaliana) microarray data annotated to the PathoPlant database, 732 different queries with a focus on fungal and oomycete pathogens were performed, leading to 510 up-regulated gene groups. Using the binding site estimation suite of tools, BEST, 407 conserved sequence motifs were identified in promoter regions of these coregulated gene sets. Motif similarities were determined with STAMP, classifying the 407 sequence motifs into 37 families. A comparative analysis of these 37 families with the AthaMap, PLACE, and AGRIS databases revealed similarities to known cis-elements but also led to the discovery of cis-sequences not yet implicated in pathogen response. Using a parsley (Petroselinum crispum) protoplast system and a modified reporter gene vector with an internal transformation control, 25 elicitor-responsive cis-sequences from 10 different motif families were identified. Many of the elicitor-responsive cis-sequences also drive reporter gene expression in an Agrobacterium tumefaciens infection assay in Nicotiana benthamiana. This work significantly increases the number of known elicitor-responsive cis-sequences and demonstrates the successful integration of a diverse set of bioinformatic resources combined with synthetic promoter analysis for data mining and functional screening in plant-pathogen interaction. PMID:22744985

  17. Identification of Promoter Regions in the Human Genome by Using a Retroviral Plasmid Library-Based Functional Reporter Gene Assay

    PubMed Central

    Khambata-Ford, Shirin; Liu, Yueyi; Gleason, Christopher; Dickson, Mark; Altman, Russ B.; Batzoglou, Serafim; Myers, Richard M.


    Attempts to identify regulatory sequences in the human genome have involved experimental and computational methods such as cross-species sequence comparisons and the detection of transcription factor binding-site motifs in coexpressed genes. Although these strategies provide information on which genomic regions are likely to be involved in gene regulation, they do not give information on their functions. We have developed a functional selection for promoter regions in the human genome that uses a retroviral plasmid library-based system. This approach enriches for and detects promoter function of isolated DNA fragments in an in vitro cell culture assay. By using this method, we have discovered likely promoters of known and predicted genes, as well as many other putative promoter regions based on the presence of features such as CpG islands. Comparison of sequences of 858 plasmid clones selected by this assay with the human genome draft sequence indicates that a significantly higher percentage of sequences align to the 500-bp segment upstream of the transcription start sites of known genes than would be expected from random genomic sequences. We also observed enrichment for putative promoter regions of genes predicted in at least two annotation databases and for clones overlapping with CpG islands. Functional validation of randomly selected clones enriched by this method showed that a large fraction of these putative promoters can drive the expression of a reporter gene in transient transfection experiments. This method promises to be a useful genome-wide function-based approach that can complement existing methods to look for promoters. PMID:12805274

  18. Dinoflagellate 17S rRNA sequence inferred from the gene sequence: Evolutionary implications

    PubMed Central

    Herzog, Michel; Maroteaux, Luc


    We present the complete sequence of the nuclear-encoded small-ribosomal-subunit RNA inferred from the cloned gene sequence of the dinoflagellate Prorocentrum micans. The dinoflagellate 17S rRNA sequence of 1798 nucleotides is contained in a family of 200 tandemly repeated genes per haploid genome. A tentative model of the secondary structure of P. micans 17S rRNA is presented. This sequence is compared with the small-ribosomal-subunit rRNA of Xenopus laevis (Animalia), Saccharomyces cerevisiae (Fungi), Zea mays (Planta), Dictyostelium discoideum (Protoctista), and Halobacterium volcanii (Monera). Although the secondary structure of the dinoflagellate 17S rRNA presents most of the eukaryotic characteristics, it contains sufficient archaeobacterial-like structural features to reinforce the view that dinoflagellates branch off very early from the eukaryotic lineage. PMID:16578795

  19. Dinoflagellate 17S rRNA sequence inferred from the gene sequence: Evolutionary implications.


    Herzog, M; Maroteaux, L


    We present the complete sequence of the nuclear-encoded small-ribosomal-subunit RNA inferred from the cloned gene sequence of the dinoflagellate Prorocentrum micans. The dinoflagellate 17S rRNA sequence of 1798 nucleotides is contained in a family of 200 tandemly repeated genes per haploid genome. A tentative model of the secondary structure of P. micans 17S rRNA is presented. This sequence is compared with the small-ribosomal-subunit rRNA of Xenopus laevis (Animalia), Saccharomyces cerevisiae (Fungi), Zea mays (Planta), Dictyostelium discoideum (Protoctista), and Halobacterium volcanii (Monera). Although the secondary structure of the dinoflagellate 17S rRNA presents most of the eukaryotic characteristics, it contains sufficient archaeobacterial-like structural features to reinforce the view that dinoflagellates branch off very early from the eukaryotic lineage.

  20. Multiplexed CRISPR/Cas9- and TAR-Mediated Promoter Engineering of Natural Product Biosynthetic Gene Clusters in Yeast.


    Kang, Hahk-Soo; Charlop-Powers, Zachary; Brady, Sean F


    The use of DNA sequencing to guide the discovery of natural products has emerged as a new paradigm for revealing chemistries encoded in bacterial genomes. A major obstacle to implementing this approach to natural product discovery is the transcriptional silence of biosynthetic gene clusters under laboratory growth conditions. Here we describe an improved yeast-based promoter engineering platform (mCRISTAR) that combines CRISPR/Cas9 and TAR to enable single-marker multiplexed promoter engineering of large gene clusters. mCRISTAR highlights the first application of the CRISPR/Cas9 system to multiplexed promoter engineering of natural product biosynthetic gene clusters. In this method, CRISPR/Cas9 is used to induce DNA double-strand breaks in promoter regions of biosynthetic gene clusters, and the resulting operon fragments are reassembled by TAR using synthetic gene-cluster-specific promoter cassettes. mCRISTAR uses a CRISPR array to simplify the construction of a CRISPR plasmid for multiplex CRISPR and a single auxotrophic selection to improve the inefficiency of using a CRISPR array for multiplex gene cluster refactoring. mCRISTAR is a simple and generic method for multiplexed replacement of promoters in biosynthetic gene clusters that will facilitate the discovery of natural products from the rapidly growing collection of gene clusters found in microbial genome and metagenome sequencing projects.

  1. Development of a fungal transformation system based on selection of sequences with promoter activity.

    PubMed Central

    Turgeon, B G; Garber, R C; Yoder, O C


    A novel strategy was used to develop a transformation system for the plant pathogenic fungus Cochliobolus heterostrophus. Sequences capable of driving the expression of a gene conferring resistance to the antibiotic hygromycin B in C. heterostrophus were selected from a library of genomic DNA fragments and used, with the selectable marker, as the basis for transformation. The library of random 0.5- to 2.0-kilobase-pair fragments of C. heterostrophus genomic DNA was inserted at the 5' end of a truncated, promoterless Escherichia coli hygromycin B phosphotransferase gene (hygB) whose product confers resistance to hygromycin B. C. heterostrophus protoplasts were transformed with the library and selected for resistance. Resistant colonies arose at low frequency. Each colony contained a transformation vector stably integrated into chromosomal DNA. When the transforming DNA was recovered from the genome and introduced into C. heterostrophus, resistant colonies appeared at higher frequency. We determined the sequences of two of the C. heterostrophus DNA fragments which had been inserted at the 5' end of hygB in the promoter library and found that both made translational fusions with hygB. One of the two fusions apparently adds 65 and the other at least 86 amino acids to the N-terminus of the hygB product. Plasmids containing hygB-C. heterostrophus promoter fusions can be used unaltered to drive hygB expression in several other filamentous ascomycetes. This approach to achieving transformation may have general utility, especially for organisms with relatively undeveloped genetics. Images PMID:2823126

  2. Identification of learning and memory genes in canine; promoter investigation and determining the selective pressure.


    Seifi Moroudi, Reihane; Masoudi, Ali Akbar; Vaez Torshizi, Rasoul; Zandi, Mohammad


    One of the important behaviors of dogs is trainability which is affected by learning and memory genes. These kinds of the genes have not yet been identified in dogs. In the current research, these genes were found in animal models by mining the biological data and scientific literatures. The proteins of these genes were obtained from the UniProt database in dogs and humans. Not all homologous proteins perform similar functions, thus comparison of these proteins was studied in terms of protein families, domains, biological processes, molecular functions, and cellular location of metabolic pathways in Interpro, KEGG, Quick Go and Psort databases. The results showed that some of these proteins have the same performance in the rat or mouse, dog, and human. It is anticipated that the protein of these genes may be effective in learning and memory in dogs. Then, the expression pattern of the recognized genes was investigated in the dog hippocampus using the existing information in the GEO profile. The results showed that BDNF, TAC1 and CCK genes are expressed in the dog hippocampus, therefore, these genes could be strong candidates associated with learning and memory in dogs. Subsequently, due to the importance of the promoter regions in gene function, this region was investigated in the above genes. Analysis of the promoter indicated that the HNF-4 site of BDNF gene and the transcription start site of CCK gene is exposed to methylation. Phylogenetic analysis of protein sequences of these genes showed high similarity in each of these three genes among the studied species. The dN/dS ratio for BDNF, TAC1 and CCK genes indicates a purifying selection during the evolution of the genes.

  3. Sequence and gene expression evolution of paralogous genes in willows

    PubMed Central

    Harikrishnan, Srilakshmy L.; Pucholt, Pascal; Berlin, Sofia


    Whole genome duplications (WGD) have had strong impacts on species diversification by triggering evolutionary novelties, however, relatively little is known about the balance between gene loss and forces involved in the retention of duplicated genes originating from a WGD. We analyzed putative Salicoid duplicates in willows, originating from the Salicoid WGD, which took place more than 45 Mya. Contigs were constructed by de novo assembly of RNA-seq data derived from leaves and roots from two genotypes. Among the 48,508 contigs, 3,778 pairs were, based on fourfold synonymous third-codon transversion rates and syntenic positions, predicted to be Salicoid duplicates. Both copies were in most cases expressed in both tissues and 74% were significantly differentially expressed. Mean Ka/Ks was 0.23, suggesting that the Salicoid duplicates are evolving by purifying selection. Gene Ontology enrichment analyses showed that functions related to DNA- and nucleic acid binding were over-represented among the non-differentially expressed Salicoid duplicates, while functions related to biosynthesis and metabolism were over-represented among the differentially expressed Salicoid duplicates. We propose that the differentially expressed Salicoid duplicates are regulatory neo- and/or subfunctionalized, while the non-differentially expressed are dose sensitive, hence, functionally conserved. Multiple evolutionary processes, thus drive the retention of Salicoid duplicates in willows. PMID:26689951

  4. Sequence and gene expression evolution of paralogous genes in willows.


    Harikrishnan, Srilakshmy L; Pucholt, Pascal; Berlin, Sofia


    Whole genome duplications (WGD) have had strong impacts on species diversification by triggering evolutionary novelties, however, relatively little is known about the balance between gene loss and forces involved in the retention of duplicated genes originating from a WGD. We analyzed putative Salicoid duplicates in willows, originating from the Salicoid WGD, which took place more than 45 Mya. Contigs were constructed by de novo assembly of RNA-seq data derived from leaves and roots from two genotypes. Among the 48,508 contigs, 3,778 pairs were, based on fourfold synonymous third-codon transversion rates and syntenic positions, predicted to be Salicoid duplicates. Both copies were in most cases expressed in both tissues and 74% were significantly differentially expressed. Mean Ka/Ks was 0.23, suggesting that the Salicoid duplicates are evolving by purifying selection. Gene Ontology enrichment analyses showed that functions related to DNA- and nucleic acid binding were over-represented among the non-differentially expressed Salicoid duplicates, while functions related to biosynthesis and metabolism were over-represented among the differentially expressed Salicoid duplicates. We propose that the differentially expressed Salicoid duplicates are regulatory neo- and/or subfunctionalized, while the non-differentially expressed are dose sensitive, hence, functionally conserved. Multiple evolutionary processes, thus drive the retention of Salicoid duplicates in willows.

  5. Isolation and characterization of the 5'-flanking sequence of the human ocular lens MIP gene.


    Wang, X Y; Ohtaka-Maruyama, C; Pisano, M M; Jaworski, C J; Chepelinsky, A B


    The MIP (major intrinsic protein) gene, a member of an ancient family of membrane channel genes, encodes the predominant fiber cell membrane protein of the ocular lens. Its specific expression in the lens fibers is temporally and spatially regulated during development. To study the regulation of expression of MIP and delineate the regulatory elements underlying its tissue specificity and ontogenic profile, we have cloned 2840 bp of the human MIP 5'-flanking sequence. The human MIP 5'-flanking sequence contains three complete Alu repetitive elements in tandem at position between nt -1699 and -2684 (nt -1699/-2684). These Alu elements appear to have had a complex evolutionary history with insertions at different times. We have fused DNA fragments containing MIP 5'-flanking sequences to the bacterial cat reporter gene encoding chloramphenicol acetyltransferase and assayed them in primary cultures of chicken lens cells. We have mapped two negative regulatory regions in the human MIP 5'-flanking sequences -1564/-1696 and -948/-1000. We demonstrated that the human MIP 5'-flanking sequence -253/+42 contains a functional promoter in lens cells but is inactive in kidney epithelial cells or mouse fibroblasts, suggesting that this sequence contains regulatory elements responsible for the lens-specific expression of MIP.

  6. Draft Genome Sequence of Bacillus atrophaeus UCMB-5137, a Plant Growth-Promoting Rhizobacterium.


    Chan, Wai Yin; Dietel, Kristin; Lapa, Svitlana V; Avdeeva, Lilija V; Borriss, Rainer; Reva, Oleg N


    Bacillus atrophaeus UCMB-5137 shows an extraordinary activity in root colonization and plant and crop protection. Its draft genome sequence comprises 21 contigs of 4.11 Mb, harboring 4,167 coding sequences (CDS). The genome carries several genes encoding antimicrobial lipopeptides and polyketides. Multiple horizontally acquired genes of possible importance for plant colonization were also found.

  7. Rational design of translational pausing without altering the amino acid sequence dramatically promotes soluble protein expression: a strategic demonstration.


    Chen, Wei; Jin, Jingjie; Gu, Wei; Wei, Bo; Lei, Yun; Xiong, Sheng; Zhang, Gong


    The production of many pharmaceutical and industrial proteins in prokaryotic hosts is hindered by the insolubility of industrial expression products resulting from misfolding. Even with a correct primary sequence, an improper translation elongation rate in a heterologous expression system is an important cause of misfolding. In silico analysis revealed that most of the endogenous Escherichia coli genes display translational pausing sites that promote correct folding, and almost 1/5 genes have pausing sites at the 3'-termini of their coding sequence. Therefore, we established a novel strategy to efficiently promote the expression of soluble and active proteins without altering the amino acid sequence or expression conditions. This strategy uses the rational design of translational pausing based on structural information solely through synonymous substitutions, i.e. no change on the amino acids sequence. We demonstrated this strategy on a promising antiviral candidate, Cyanovirin-N (CVN), which could not be efficiently expressed in any previously reported system. By introducing silent mutations, we increased the soluble expression level in E. coli by 2000-fold without altering the CVN protein sequence, and the specific activity was slightly higher for the optimized CVN than for the wild-type variant. This strategy introduces new possibilities for the production of bioactive recombinant proteins. Copyright © 2014 Elsevier B.V. All rights reserved.

  8. Characterization of the human artemis promoter by heterologous gene expression in vitro and in vivo.


    Multhaup, Megan M; Gurram, Sweta; Podetz-Pedersen, Kelly M; Karlen, Andrea D; Swanson, Debra L; Somia, Nikunj V; Hackett, Perry B; Cowan, Morton J; McIvor, R Scott


    Artemis is an endonucleolytic enzyme involved in nonhomologous double-strand break repair and V(D)J recombination. Deficiency of Artemis results in a B- T- radiosensitive severe combined immunodeficiency, which may potentially be treatable by Artemis gene transfer into hematopoietic stem cells. However, we recently found that overexpression of Artemis after lentiviral transduction resulted in global DNA damage and increased apoptosis. These results imply the necessity of effecting natural levels of Artemis expression, so we isolated a 1 kilobase DNA sequence upstream of the human Artemis gene to recover and characterize the Artemis promoter (APro). The sequence includes numerous potential transcription factor-binding sites, and several transcriptional start sites were mapped by 5' rapid amplification of cDNA ends. APro and deletion constructs conferred significant reporter gene expression in vitro that was markedly reduced in comparison to expression regulated by the human elongation factor 1-α promoter. Ex vivo lentiviral transduction of an APro-regulated green fluorescent protein (GFP) construct in mouse marrow supported GFP expression throughout hematopoeitic lineages in primary transplant recipients and was sustained in secondary recipients. The human Artemis promoter thus provides sustained and moderate levels of gene expression that will be of significant utility for therapeutic gene transfer into hematopoeitic stem cells.

  9. Characterization of the Human Artemis Promoter by Heterologous Gene Expression In Vitro and In Vivo

    PubMed Central

    Multhaup, Megan M.; Gurram, Sweta; Podetz-Pedersen, Kelly M.; Karlen, Andrea D.; Swanson, Debra L.; Somia, Nikunj V.; Hackett, Perry B.; Cowan, Morton J.


    Artemis is an endonucleolytic enzyme involved in nonhomologous double-strand break repair and V(D)J recombination. Deficiency of Artemis results in a B− T− radiosensitive severe combined immunodeficiency, which may potentially be treatable by Artemis gene transfer into hematopoietic stem cells. However, we recently found that overexpression of Artemis after lentiviral transduction resulted in global DNA damage and increased apoptosis. These results imply the necessity of effecting natural levels of Artemis expression, so we isolated a 1 kilobase DNA sequence upstream of the human Artemis gene to recover and characterize the Artemis promoter (APro). The sequence includes numerous potential transcription factor-binding sites, and several transcriptional start sites were mapped by 5′ rapid amplification of cDNA ends. APro and deletion constructs conferred significant reporter gene expression in vitro that was markedly reduced in comparison to expression regulated by the human elongation factor 1-α promoter. Ex vivo lentiviral transduction of an APro-regulated green fluorescent protein (GFP) construct in mouse marrow supported GFP expression throughout hematopoeitic lineages in primary transplant recipients and was sustained in secondary recipients. The human Artemis promoter thus provides sustained and moderate levels of gene expression that will be of significant utility for therapeutic gene transfer into hematopoeitic stem cells. PMID:21663454

  10. Phenotype sequencing: identifying the genes that cause a phenotype directly from pooled sequencing of independent mutants.


    Harper, Marc A; Chen, Zugen; Toy, Traci; Machado, Iara M P; Nelson, Stanley F; Liao, James C; Lee, Christopher J


    Random mutagenesis and phenotype screening provide a powerful method for dissecting microbial functions, but their results can be laborious to analyze experimentally. Each mutant strain may contain 50-100 random mutations, necessitating extensive functional experiments to determine which one causes the selected phenotype. To solve this problem, we propose a "Phenotype Sequencing" approach in which genes causing the phenotype can be identified directly from sequencing of multiple independent mutants. We developed a new computational analysis method showing that 1. causal genes can be identified with high probability from even a modest number of mutant genomes; 2. costs can be cut many-fold compared with a conventional genome sequencing approach via an optimized strategy of library-pooling (multiple strains per library) and tag-pooling (multiple tagged libraries per sequencing lane). We have performed extensive validation experiments on a set of E. coli mutants with increased isobutanol biofuel tolerance. We generated a range of sequencing experiments varying from 3 to 32 mutant strains, with pooling on 1 to 3 sequencing lanes. Our statistical analysis of these data (4099 mutations from 32 mutant genomes) successfully identified 3 genes (acrB, marC, acrA) that have been independently validated as causing this experimental phenotype. It must be emphasized that our approach reduces mutant sequencing costs enormously. Whereas a conventional genome sequencing experiment would have cost $7,200 in reagents alone, our Phenotype Sequencing design yielded the same information value for only $1200. In fact, our smallest experiments reliably identified acrB and marC at a cost of only $110-$340.

  11. Characterization of the Promoter Region of Biosynthetic Enzyme Genes Involved in Berberine Biosynthesis in Coptis japonica

    PubMed Central

    Yamada, Yasuyuki; Yoshimoto, Tadashi; Yoshida, Sayumi T.; Sato, Fumihiko


    The presence of alkaloids is rather specific to certain plant species. However, berberine, an isoquinoline alkaloid, is relatively broadly distributed in the plant kingdom. Thus, berberine biosynthesis has been intensively investigated, especially using Coptis japonica cell cultures. Almost all biosynthetic enzyme genes have already been characterized at the molecular level. Particularly, two transcription factors (TFs), a plant-specific WRKY-type TF, CjWRKY1, and a basic helix-loop-helix TF, CjbHLH1, were shown to comprehensively regulate berberine biosynthesis in C. japonica cells. In this study, we characterized the promoter region of some biosynthetic enzyme genes and associated cis-acting elements involved in the transcriptional regulation via two TFs. The promoter regions of three berberine biosynthetic enzyme genes (CYP80B2, 4′OMT and CYP719A1) were isolated, and their promoter activities were dissected by a transient assay involving the sequentially truncated promoter::luciferase (LUC) reporter constructs. Furthermore, transactivation activities of CjWRKY1 were determined using the truncated promoter::LUC reporter constructs or constructs with mutated cis-elements. These results suggest the involvement of a putative W-box in the regulation of biosynthetic enzyme genes. Direct binding of CjWRKY1 to the W-box DNA sequence was also confirmed by an electrophoresis mobility shift assay and by a chromatin immunoprecipitation assay. In addition, CjbHLH1 also activated transcription from truncated 4′OMT and CYP719A1 promoters independently of CjWRKY1, suggesting the involvement of a putative E-box. Unexpected transcriptional activation of biosynthetic enzyme genes via a non-W-box sequence and by CjWRKY1 as well as the possible involvement of a GCC-box in berberine biosynthesis in C. japonica are discussed. PMID:27642289

  12. Maximal Expression of the Evolutionarily Conserved Slit2 Gene Promoter Requires Sp1

    PubMed Central

    Saunders, Jacquelyn; Wisidagama, D. Roonalika; Morford, Travis; Malone, Cindy S.


    Slit2 is a neural axon guidance and chemorepellent protein that stimulates motility in a variety of cell types. The role of Slit2 in neural development and neoplastic growth and migration has been well established, while the genetic mechanisms underlying regulation of the Slit2 gene have not. We identified the core and proximal promoter of Slit2 by mapping multiple transcriptional start sites, analyzing transcriptional activity, and confirming sequence homology for the Slit2 proximal promoter among a number of species. Deletion series and transient transfection identified the Slit2 proximal promoter as within 399 base pairs upstream of the start of transcription. A crucial region for full expression of the Slit2 proximal promoter lies between 399 base pairs and 296 base pairs upstream of the start of transcription. Computer modeling identified three transcription factor binding consensus sites within this region, of which only site-directed mutagenesis of one of the two identified Sp1 consensus sites inhibited transcriptional activity of the Slit2 proximal promoter (−399 to +253). Bioinformatics analysis of the Slit2 proximal promoter −399 base pair to −296 base pair region shows high sequence conservation over twenty-two species, and that this region follows an expected pattern of sequence divergence through evolution. PMID:26456684

  13. [Nucleotide sequence of genes for alpha- and beta-subunits of luciferase from Photobacterium leiognathi].


    Illarionov, B A; Protopopova, M V; Karginov, V A; Mertvetsov, N P; Gitel'zon, I I


    Nucleotide sequence of the Photobacterium leiognathi DNA containing genes of alpha and beta subunits of luciferase has been determined. We also deduced amino acid sequence and molecular mass of luciferase and localized luciferase genes in the