Science.gov

Sample records for gene promoter sequences

  1. Honey bee promoter sequences for targeted gene expression.

    PubMed

    Schulte, C; Leboulle, G; Otte, M; Grünewald, B; Gehne, N; Beye, M

    2013-08-01

    The honey bee, Apis mellifera, displays a rich behavioural repertoire, social organization and caste differentiation, and has an interesting mode of sex determination, but we still know little about its underlying genetic programs. We lack stable transgenic tools in honey bees that would allow genetic control of gene activity in stable transgenic lines. As an initial step towards a transgenic method, we identified promoter sequences in the honey bee that can drive constitutive, tissue-specific and cold shock-induced gene expression. We identified the promoter sequences of Am-actin5c, elp2l, Am-hsp83 and Am-hsp70 and showed that, except for the elp2l sequence, the identified sequences were able to drive reporter gene expression in Sf21 cells. We further demonstrated through electroporation experiments that the putative neuron-specific elp2l promoter sequence can direct gene expression in the honey bee brain. The identification of these promoter sequences is an important initial step in studying the function of genes with transgenic experiments in the honey bee, an organism with a rich set of interesting phenotypes. PMID:23668189

  2. Characterization of promoter sequence of toll-like receptor genes in Vechur cattle

    PubMed Central

    Lakshmi, R.; Jayavardhanan, K. K.; Aravindakshan, T. V.

    2016-01-01

    Aim: To analyze the promoter sequence of toll-like receptor (TLR) genes in Vechur cattle, an indigenous breed of Kerala with the sequence of Bos taurus and access the differences that could be attributed to innate immune responses against bovine mastitis. Materials and Methods: Blood samples were collected from Jugular vein of Vechur cattle, maintained at Vechur cattle conservation center of Kerala Veterinary and Animal Sciences University, using an acid-citrate-dextrose anticoagulant. The genomic DNA was extracted, and polymerase chain reaction was carried out to amplify the promoter region of TLRs. The amplified product of TLR2, 4, and 9 promoter regions was sequenced by Sanger enzymatic DNA sequencing technique. Results: The sequence of promoter region of TLR2 of Vechur cattle with the B. taurus sequence present in GenBank showed 98% similarity and revealed variants for four sequence motifs. The sequence of the promoter region of TLR4 of Vechur cattle revealed 99% similarity with that of B. taurus sequence but not reveals significant variant in motifregions. However, two heterozygous loci were observed from the chromatogram. Promoter sequence of TLR9 gene also showed 99% similarity to B. taurus sequence and revealed variants for four sequence motifs. Conclusion: The results of this study indicate that significant variation in the promoter of TLR2 and 9 genes in Vechur cattle breed and may potentially link the influence the innate immunity response against mastitis diseases. PMID:27397987

  3. Interference in transcription of overexpressed genes by promoter-proximal downstream sequences

    PubMed Central

    Turchinovich, A.; Surowy, H. M.; Tonevitsky, A. G.; Burwinkel, B.

    2016-01-01

    Despite a high sequence homology among four human RNAi-effectors Argonaute proteins and their coding sequences, the efficiency of ectopic overexpression of AGO3 and AGO4 coding sequences in human cells is greatly reduced as compared to AGO1 and AGO2. While investigating this phenomenon, we documented the existence of previously uncharacterized mechanism of gene expression regulation, which is manifested in greatly varying basal transcription levels from the RNApolII promoters depending on the promoter-proximal downstream sequences. Specifically, we show that distinct overexpression of Argonaute coding sequences cannot be explained by mRNA degradation in the cytoplasm or nucleus, and exhibits on transcriptional level. Furthermore, the first 1000–2000 nt located immediately downstream the promoter had the most critical influence on ectopic gene overexpression. The transcription inhibiting effect, associated with those downstream sequences, subsided with increasing distance to the promoter and positively correlated with promoter strength. We hypothesize that the same mechanism, which we named promoter proximal inhibition (PPI), could generally contribute to basal transcription levels of genes, and could be mainly responsible for the essence of difficult-to-express recombinant proteins. Finally, our data reveal that expression of recombinant proteins in human cells can be greatly enhanced by using more permissive promoter adjacent downstream sequences. PMID:27485701

  4. Computational Analyses of Simple Sequence Repeats on Human Tissue Specific Genes Promoters

    NASA Astrophysics Data System (ADS)

    FeiFei, Zhao; XiuJun, Gong; XinMi, Liu; LiFeng, Dong

    Promoter region of gene closely related with tissue specific expression and SSRs (simple sequence repeats) have been shown to have a variety of effects on an organism. This paper used a heuristic method to find SSRs and compared the most frequently SSRs on promoter region of both human tissues specific genes and human housekeeping genes. We used kidney and testis tissue as examples to show the final results. Especially, we found that (AGG)n is kidney specific SSR and (GCG)n is testis specific SSR. We also analyzed the SSRs frequency density distribution on different promoter regions of both tissue specific genes and housekeeping genes, and we found the density of housekeeping genes on core-promoter region is much higher than on other promoter regions.

  5. Identification of the promoter sequences involved in the cell specific expression of the rat somatostatin gene.

    PubMed Central

    Andrisani, O M; Hayes, T E; Roos, B; Dixon, J E

    1987-01-01

    DNA sequences containing the 5' flanking region of the rat somatostatin gene were linked to the coding sequence of the bacterial chloramphenicol acetyl transferase gene. This recombinant plasmid is active in expressing CAT activity in the neuronally derived, somatostatin producing CA-77 cell line. Deletion analyses of the somatostatin promoter show that the sequences proximal to position -60, relative to the cap site are required for expression of this promoter. A 4 base pair deletion of residues -46 through -43 within the somatostatin promoter results in a down mutation in vivo suggesting the existence of an element critical for the expression of the promoter in CA-77 cells. In addition, the somatostatin recombinant and its 5' deletion constructs preferentially express CAT activity in CA-77 cells, whereas only basal level of expression is observed in HeLa, BSC40, and RIN-5F cell lines, pointing to the cell specific nature of this promoter. Images PMID:2886975

  6. Functional analysis and nucleotide sequence of the promoter region of the murine hck gene.

    PubMed Central

    Lock, P; Stanley, E; Holtzman, D A; Dunn, A R

    1990-01-01

    The structure and function of the promoter region and exon 1 of the murine hck gene have been characterized in detail. RNase protection analysis has established that hck transcripts initiate from heterogeneous start sites located within the hck gene. Fusion gene constructs containing hck 5'-flanking sequences and the bacterial Neor gene have been introduced into the hematopoietic cell lines FDC-P1 and WEHI-265 by using a self-inactivating retroviral vector. The transcriptional start sites of the fusion gene are essentially identical to those of the endogenous hck gene. Analysis of infected WEHI-265 cell lines treated with bacterial lipopolysaccharide (LPS) reveals a 3- to 5-fold elevation in the levels of endogenous hck mRNA and a 1.4- to 2.6-fold increase in the level of Neor fusion gene transcripts, indicating that hck 5'-flanking sequences are capable of conferring LPS responsiveness on the Neor gene. The 5'-flanking region of the hck gene contains sequences similar to an element which is thought to be involved in the LPS responsiveness of the class II major histocompatibility gene A alpha k. A subset of these sequences are also found in the 5'-flanking regions of other LPS-responsive genes. Moreover, this motif is related to the consensus binding sequence of NF-kappa B, a transcription factor which is known to be regulated by LPS. Images PMID:2388619

  7. Unconventional Sequence Requirement for Viral Late Gene Core Promoters of Murine Gammaherpesvirus 68

    PubMed Central

    Wong-Ho, Elaine; Davis, Zoe H.; Zhang, Bingqing; Huang, Jian; Gong, Hao; Deng, Hongyu; Liu, Fenyong; Glaunsinger, Britt; Sun, Ren

    2014-01-01

    Infection with the human gammaherpesviruses, Epstein-Barr virus (EBV) and Kaposi's sarcoma-associated herpesvirus (KSHV), is associated with several cancers. During lytic replication of herpesviruses, viral genes are expressed in an ordered cascade. However, the mechanism by which late gene expression is regulated has not been well characterized in gammaherpesviruses. In this study, we have investigated the cis element that mediates late gene expression during de novo lytic infection with murine gammaherpesvirus 68 (MHV-68). A reporter system was established and used to assess the activity of viral late gene promoters upon infection with MHV-68. It was found that the viral origin of lytic replication, orilyt, must be on the reporter plasmid to support activation of the late gene promoter. Furthermore, the DNA sequence required for the activation of late gene promoters was mapped to a core element containing a distinct TATT box and its neighboring sequences. The critical nucleotides of the TATT box region were determined by systematic mutagenesis in the reporter system, and the significance of these nucleotides was confirmed in the context of the viral genome. In addition, EBV and KSHV late gene core promoters could be activated by MHV-68 lytic replication, indicating that the mechanisms controlling late gene expression are conserved among gammaherpesviruses. Therefore, our results on MHV-68 establish a solid foundation for mechanistic studies of late gene regulation. PMID:24403583

  8. MicroRNA-373 induces expression of genes with complementary promoter sequences.

    PubMed

    Place, Robert F; Li, Long-Cheng; Pookot, Deepa; Noonan, Emily J; Dahiya, Rajvir

    2008-02-01

    Recent studies have shown that microRNA (miRNA) regulates gene expression by repressing translation or directing sequence-specific degradation of complementary mRNA. Here, we report new evidence in which miRNA may also function to induce gene expression. By scanning gene promoters in silico for sequences complementary to known miRNAs, we identified a putative miR-373 target site in the promoter of E-cadherin. Transfection of miR-373 and its precursor hairpin RNA (pre-miR-373) into PC-3 cells readily induced E-cadherin expression. Knockdown experiments confirmed that induction of E-cadherin by pre-miR-373 required the miRNA maturation protein Dicer. Further analysis revealed that cold-shock domain-containing protein C2 (CSDC2), which possesses a putative miR-373 target site within its promoter, was also readily induced in response to miR-373 and pre-miR-373. Furthermore, enrichment of RNA polymerase II was detected at both E-cadherin and CSDC2 promoters after miR-373 transfection. Mismatch mutations to miR-373 indicated that gene induction was specific to the miR-373 sequence. Transfection of promoter-specific dsRNAs revealed that the concurrent induction of E-cadherin and CSDC2 by miR-373 required the miRNA target sites in both promoters. In conclusion, we have identified a miRNA that targets promoter sequences and induces gene expression. These findings reveal a new mode by which miRNAs may regulate gene expression.

  9. Regulation of transcription of the adenovirus EII promoter by gene products: Absence of sequence specificity

    SciTech Connect

    Kingston, R.E.; Kaufman, R.J.; Sharp, P.A.

    1984-10-01

    During adenovirus infection, the EII promoter is positively regulated by products of the EIa region. The authors have studied this regulation by fusing a DNA segment containing the adenovirus EII promoter to a dihydrofolate reductase cDNA segment. Expression of this hybrid gene is stimulated in trans when cell lines containing an integrated copy are either transfected with plasmids carrying the EIa region or infected with adenovirus. This suggests that EIa activity regulates transcription of the EII promoter in the absence of other viral proteins and that this stimulation can occur when the EII promoter is organized in cellular chromatin. Transcription from the EII promoter is initiated at two sites in cell lines lacking EIa activity. Introduction of the EIa region preferentially stimulated transcription from one of these two sites. A sensitive, stable cotransfection assay was used to test for specific EII sequences required for stimulation. EIa activity stimulates all mutaant promoters; the most extensive deletion retained only 18 base pairs of sequences upstream of the initiation site. They suggest that regulation of a promoter by the EIa region does not depend on the presence of a set of specific sequences, but instead reflects a characteristic of promoters that have been exogenously introduced into cells. Insertion of the 72-base-pair repeat of simian-virus 40 in cis enhances transcription from the EII promoter. The stimulatory effects of EIa activity and of the simian virus 40 sequence are additive and appear to differ mechanistically.

  10. Conserved regulatory elements of the promoter sequence of the gene rpoH of enteric bacteria

    PubMed Central

    Ramírez-Santos, Jesús; Collado-Vides, Julio; García-Varela, Martin; Gómez-Eichelmann, M. Carmen

    2001-01-01

    The rpoH regulatory region of different members of the enteric bacteria family was sequenced or downloaded from GenBank and compared. In addition, the transcriptional start sites of rpoH of Yersinia frederiksenii and Proteus mirabilis, two distant members of this family, were determined. Sequences similar to the σ70 promoters P1, P4 and P5, to the σE promoter P3 and to boxes DnaA1, DnaA2, cAMP receptor protein (CRP) boxes CRP1, CRP2 and box CytR present in Escherichia coli K12, were identified in sequences of closely related bacteria such as: E.coli, Shigella flexneri, Salmonella enterica serovar Typhimurium, Citrobacter freundii, Enterobacter cloacae and Klebsiella pneumoniae. In more distant bacteria, Y.frederiksenii and P.mirabilis, the rpoH regulatory region has a distal P1-like σ70 promoter and two proximal promoters: a heat-induced σE-like promoter and a σ70 promoter. Sequences similar to the regulatory boxes were not identified in these bacteria. This study suggests that the general pattern of transcription of the rpoH gene in enteric bacteria includes a distal σ70 promoter, >200 nt upstream of the initiation codon, and two proximal promoters: a heat-induced σE-like promoter and a σ70 promoter. A second proximal σ70 promoter under catabolite-regulation is probably present only in bacteria closely related to E.coli. PMID:11139607

  11. ZNF143 provides sequence specificity to secure chromatin interactions at gene promoters

    PubMed Central

    Bailey, Swneke D.; Zhang, Xiaoyang; Desai, Kinjal; Aid, Malika; Corradin, Olivia; Cowper-Sal·lari, Richard; Akhtar-Zaidi, Batool; Scacheri, Peter C.; Haibe-Kains, Benjamin; Lupien, Mathieu

    2015-01-01

    Chromatin interactions connect distal regulatory elements to target gene promoters guiding stimulus- and lineage-specific transcription. Few factors securing chromatin interactions have so far been identified. Here by integrating chromatin interaction maps with the large collection of transcription factor binding profiles provided by the ENCODE project, we demonstrate that the zinc-finger protein ZNF143 preferentially occupies anchors of chromatin interactions connecting promoters with distal regulatory elements. It binds directly to promoters and associates with lineage-specific chromatin interactions and gene expression. Silencing ZNF143 or modulating its DNA-binding affinity using single nucleotide polymorphisms (SNPs) as a surrogate of site-directed mutagenesis reveals the sequence dependency of chromatin interactions at gene promoters. We also find that chromatin interactions alone do not regulate gene expression. Together, our results identify ZNF143 as a novel chromatin-looping factor that contributes to the architectural foundation of the genome by providing sequence specificity at promoters connected with distal regulatory elements. PMID:25645053

  12. Genome-wide discovery of cis-elements in promoter sequences using gene expression.

    PubMed

    Troukhan, Maxim; Tatarinova, Tatiana; Bouck, John; Flavell, Richard B; Alexandrov, Nickolai N

    2009-04-01

    The availability of complete or nearly complete genome sequences, a large number of 5' expressed sequence tags, and significant public expression data allow for a more accurate identification of cis-elements regulating gene expression. We have implemented a global approach that takes advantage of available expression data, genomic sequences, and transcript information to predict cis-elements associated with specific expression patterns. The key components of our approach are: (1) precise identification of transcription start sites, (2) specific locations of cis-elements relative to the transcription start site, and (3) assessment of statistical significance for all sequence motifs. By applying our method to promoters of Arabidopsis thaliana and Mus musculus, we have identified motifs that affect gene expression under specific environmental conditions or in certain tissues. We also found that the presence of the TATA box is associated with increased variability of gene expression. Strong correlation between our results and experimentally determined motifs shows that the method is capable of predicting new functionally important cis-elements in promoter sequences. PMID:19231992

  13. Promoter-like sequences regulating transcriptional activity in neurexin and neuroligin genes.

    PubMed

    Runkel, Fabian; Rohlmann, Astrid; Reissner, Carsten; Brand, Stefan-Martin; Missler, Markus

    2013-10-01

    Synapse function requires the cell-adhesion molecules neurexins (Nrxn) and neuroligins (Nlgn). Although these molecules are essential for neurotransmission and prefer distinct isoform combinations for interaction, little is known about their transcriptional regulation. Here, we started to explore this important aspect because expression of Nrxn1-3 and Nlgn1-3 genes is altered in mice lacking the transcriptional regulator methyl-CpG-binding protein2 (MeCP2). Since MeCP2 can bind to methylated CpG-dinucleotides and Nrxn/Nlgn contain CpG-islands, we tested genomic sequences for transcriptional activity in reporter gene assays. We found that their influence on transcription are differentially activating or inhibiting. As we observed an activity difference between heterologous and neuronal cell lines for distinct Nrxn1 and Nlgn2 sequences, we dissected their putative promoter regions. In both genes, we identify regions in exon1 that can induce transcription, in addition to the alternative transcriptional start points in exon2. While the 5'-regions of Nrxn1 and Nlgn2 contain two CpG-rich elements that show distinct methylation frequency and binding to MeCP2, other regions may act independently of this transcriptional regulator. These data provide first insights into regulatory sequences of Nrxn and Nlgn genes that may represent an important aspect of their function at synapses in health and disease.

  14. Genetic and Functional Sequence Variants of the SIRT3 Gene Promoter in Myocardial Infarction

    PubMed Central

    Yin, Xiaoyun; Pang, Shuchao; Huang, Jian; Cui, Yinghua; Yan, Bo

    2016-01-01

    Coronary artery disease (CAD), including myocardial infarction (MI), is a common complex disease that is caused by atherosclerosis. Although a large number of genetic variants have been associated with CAD, only 10% of CAD cases could be explained. It has been proposed that low frequent and rare genetic variants may be main causes for CAD. SIRT3, a mitochondrial deacetylase, plays important roles in mitochondrial function and metabolism. Lack of SIRT3 in experimental animal leads to several age-related diseases, including cardiovascular diseases. Therefore, SIRT3 gene variants may contribute to the MI development. In this study, SIRT3 gene promoter was genetically and functionally analyzed in large cohorts of MI patients (n = 319) and ethnic-matched controls (n = 322). Total twenty-three DNA sequence variants (DSVs) were identified, including 10 single-nucleotide polymorphisms (SNPs). Six novel heterozygous DSVs, g.237307A>G, g.237270G>A, g.237023_25del, g.236653C>A, g.236628G>C, g.236557T>C, and two SNPs g.237030C>T (rs12293349) and g.237022C>G (rs369344513), were identified in nine MI patients, but in none of controls. Three SNPs, g.236473C>T (rs11246029), g.236380_81ins (rs71019893) and g.236370C>G (rs185277566), were more significantly frequent in MI patients than controls (P<0.05). These DSVs and SNPs, except g.236557T>C, significantly decreased the transcriptional activity of the SIRT3 gene promoter in cultured HEK-293 cells and H9c2 cells. Therefore, these DSVs identified in MI patients may change SIRT3 level by affecting the transcriptional activity of SIRT3 gene promoter, contributing to the MI development as a risk factor. PMID:27078640

  15. Induction and maintenance of DNA methylation in plant promoter sequences by apple latent spherical virus-induced transcriptional gene silencing.

    PubMed

    Kon, Tatsuya; Yoshikawa, Nobuyuki

    2014-01-01

    Apple latent spherical virus (ALSV) is an efficient virus-induced gene silencing vector in functional genomics analyses of a broad range of plant species. Here, an Agrobacterium-mediated inoculation (agroinoculation) system was developed for the ALSV vector, and virus-induced transcriptional gene silencing (VITGS) is described in plants infected with the ALSV vector. The cDNAs of ALSV RNA1 and RNA2 were inserted between the cauliflower mosaic virus 35S promoter and the NOS-T sequences in a binary vector pCAMBIA1300 to produce pCALSR1 and pCALSR2-XSB or pCALSR2-XSB/MN. When these vector constructs were agroinoculated into Nicotiana benthamiana plants with a construct expressing a viral silencing suppressor, the infection efficiency of the vectors was 100%. A recombinant ALSV vector carrying part of the 35S promoter sequence induced transcriptional gene silencing of the green fluorescent protein gene in a line of N. benthamiana plants, resulting in the disappearance of green fluorescence of infected plants. Bisulfite sequencing showed that cytosine residues at CG and CHG sites of the 35S promoter sequence were highly methylated in the silenced generation zero plants infected with the ALSV carrying the promoter sequence as well as in progeny. The ALSV-mediated VITGS state was inherited by progeny for multiple generations. In addition, induction of VITGS of an endogenous gene (chalcone synthase-A) was demonstrated in petunia plants infected with an ALSV vector carrying the native promoter sequence. These results suggest that ALSV-based vectors can be applied to study DNA methylation in plant genomes, and provide a useful tool for plant breeding via epigenetic modification. PMID:25426109

  16. Induction and maintenance of DNA methylation in plant promoter sequences by apple latent spherical virus-induced transcriptional gene silencing

    PubMed Central

    Kon, Tatsuya; Yoshikawa, Nobuyuki

    2014-01-01

    Apple latent spherical virus (ALSV) is an efficient virus-induced gene silencing vector in functional genomics analyses of a broad range of plant species. Here, an Agrobacterium-mediated inoculation (agroinoculation) system was developed for the ALSV vector, and virus-induced transcriptional gene silencing (VITGS) is described in plants infected with the ALSV vector. The cDNAs of ALSV RNA1 and RNA2 were inserted between the cauliflower mosaic virus 35S promoter and the NOS-T sequences in a binary vector pCAMBIA1300 to produce pCALSR1 and pCALSR2-XSB or pCALSR2-XSB/MN. When these vector constructs were agroinoculated into Nicotiana benthamiana plants with a construct expressing a viral silencing suppressor, the infection efficiency of the vectors was 100%. A recombinant ALSV vector carrying part of the 35S promoter sequence induced transcriptional gene silencing of the green fluorescent protein gene in a line of N. benthamiana plants, resulting in the disappearance of green fluorescence of infected plants. Bisulfite sequencing showed that cytosine residues at CG and CHG sites of the 35S promoter sequence were highly methylated in the silenced generation zero plants infected with the ALSV carrying the promoter sequence as well as in progeny. The ALSV-mediated VITGS state was inherited by progeny for multiple generations. In addition, induction of VITGS of an endogenous gene (chalcone synthase-A) was demonstrated in petunia plants infected with an ALSV vector carrying the native promoter sequence. These results suggest that ALSV-based vectors can be applied to study DNA methylation in plant genomes, and provide a useful tool for plant breeding via epigenetic modification. PMID:25426109

  17. Comparisons of Ribosomal Protein Gene Promoters Indicate Superiority of Heterologous Regulatory Sequences for Expressing Transgenes in Phytophthora infestans

    PubMed Central

    Khachatoorian, Careen; Judelson, Howard S.

    2015-01-01

    Molecular genetics approaches in Phytophthora research can be hampered by the limited number of known constitutive promoters for expressing transgenes and the instability of transgene activity. We have therefore characterized genes encoding the cytoplasmic ribosomal proteins of Phytophthora and studied their suitability for expressing transgenes in P. infestans. Phytophthora spp. encode a standard complement of 79 cytoplasmic ribosomal proteins. Several genes are duplicated, and two appear to be pseudogenes. Half of the genes are expressed at similar levels during all stages of asexual development, and we discovered that the majority share a novel promoter motif named the PhRiboBox. This sequence is enriched in genes associated with transcription, translation, and DNA replication, including tRNA and rRNA biogenesis. Promoters from the three P. infestans genes encoding ribosomal proteins S9, L10, and L23 and their orthologs from P. capsici were tested for their ability to drive transgenes in stable transformants of P. infestans. Five of the six promoters yielded strong expression of a GUS reporter, but the stability of expression was higher using the P. capsici promoters. With the RPS9 and RPL10 promoters of P. infestans, about half of transformants stopped making GUS over two years of culture, while their P. capsici orthologs conferred stable expression. Since cross-talk between native and transgene loci may trigger gene silencing, we encourage the use of heterologous promoters in transformation studies. PMID:26716454

  18. Comparisons of Ribosomal Protein Gene Promoters Indicate Superiority of Heterologous Regulatory Sequences for Expressing Transgenes in Phytophthora infestans.

    PubMed

    Poidevin, Laetitia; Andreeva, Kalina; Khachatoorian, Careen; Judelson, Howard S

    2015-01-01

    Molecular genetics approaches in Phytophthora research can be hampered by the limited number of known constitutive promoters for expressing transgenes and the instability of transgene activity. We have therefore characterized genes encoding the cytoplasmic ribosomal proteins of Phytophthora and studied their suitability for expressing transgenes in P. infestans. Phytophthora spp. encode a standard complement of 79 cytoplasmic ribosomal proteins. Several genes are duplicated, and two appear to be pseudogenes. Half of the genes are expressed at similar levels during all stages of asexual development, and we discovered that the majority share a novel promoter motif named the PhRiboBox. This sequence is enriched in genes associated with transcription, translation, and DNA replication, including tRNA and rRNA biogenesis. Promoters from the three P. infestans genes encoding ribosomal proteins S9, L10, and L23 and their orthologs from P. capsici were tested for their ability to drive transgenes in stable transformants of P. infestans. Five of the six promoters yielded strong expression of a GUS reporter, but the stability of expression was higher using the P. capsici promoters. With the RPS9 and RPL10 promoters of P. infestans, about half of transformants stopped making GUS over two years of culture, while their P. capsici orthologs conferred stable expression. Since cross-talk between native and transgene loci may trigger gene silencing, we encourage the use of heterologous promoters in transformation studies. PMID:26716454

  19. Sequences contained within the promoter of the human thymidine kinase gene can direct cell-cycle regulation of heterologous fusion genes.

    PubMed Central

    Kim, Y K; Wells, S; Lau, Y F; Lee, A S

    1988-01-01

    Recent evidence on the transcriptional regulation of the human thymidine kinase (TK) gene raises the possibility that cell-cycle regulatory sequences may be localized within its promoter. A hybrid gene that combines the TK 5' flanking sequence and the coding region of the bacterial neomycin-resistance gene (neo) has been constructed. Upon transfection into a hamster fibroblast cell line K12, the hybrid gene exhibits cell-cycle-dependent expression. Deletion analysis reveals that the region important for cell-cycle regulation is within -441 to -63 nucleotides from the transcriptional initiation site. This region (-441 to -63) also confers cell-cycle regulation to the herpes simplex virus thymidine kinase (HSVtk) promoter, which is not expressed in a cell-cycle manner. We conclude that the -441 to -63 sequence within the human TK promoter is important for cell-cycle-dependent expression. Images PMID:3413063

  20. Isolation and sequencing of a putative promoter region of the murine G protein beta 1 subunit (GNB1) gene.

    PubMed

    Kitanaka, Junichi; Kitanaka, Nobue; Takemura, Motohiko; Wang, Xiao-Bing; Hembree, Cambria M; Goodman, Nancy L; Uhl, George R

    2002-02-01

    The expression of the heterotrimeric GTP-binding protein beta 1 subunit gene (GNB1) is regulated by psychostimulants such as cocaine and amphetamines. Since the up-regulation appears to be one of the candidate processes of sensitization, it is necessary to elucidate the cellular and molecular mechanism of the GNB1 gene regulation for a better understanding the establishment of sensitization. In the present study, we describe the isolation and nucleotide sequence analysis of the GNB1 gene promoter region. We have isolated approximately 10 kb of the 5'-flanking region of the mouse of GNB1 gene and found potential elements involved in putative transcriptional control of the GNB1, such as AP1, AP2, Sp1, cyclic AMP response element, and nuclear factor kappa B recognition sites, within the sequences 0.3 kb upstream from the putative transcription start site. This region was highly rich in G + C content, but lacked TATA or CATT boxes. Comparing the nucleotide sequence of the cDNA clone with the human genome databases using the BLAST program a region containing putative exon 1 and promoter of the human GNB1 gene in chromosome 1 was found. The cloning and sequence analysis of an extensive portion of the 5'-flanking regulatory region of the GNB1 gene provides new insights into the factors involved in the regulation by psychostimulants of GNB1 expression. PMID:12180136

  1. Sequencing, genomic organization, and preliminary promoter analysis of a black cherry (R)-(+)-mandelonitrile lyase gene.

    PubMed

    Hu, Z; Poulton, J E

    1997-12-01

    The flavoprotein (R)-(+)-mandelonitrile lyase (MDL; EC 4.1.2.10) plays a key role in cyanogenesis in rosaceous stone fruits. An MDL gene (mdl3) and its corresponding cDNA (MDL3) were isolated from black cherry (Prunus serotina) and characterized. The mdl3 gene contains 2292 bp of the 5' flanking region, the entire coding region, and 300 bp of the 3' flanking region. The coding region is interrupted by three short introns, of which one possesses the usual GC-AG splice junction dinucleotides. This gene encodes a polypeptide of 573 amino acids that includes a putative signal sequence, 13 potential N-glycosylation sites, and a presumptive flavin adenine dinucleotide-binding site. To determine whether the 5' flanking region of the mdl3 gene is capable of driving MDL expression, it was fused to the beta-glucuronidase reporter gene for Agrobacterium-mediated transformation into tobacco. Matching endogenous MDL expression patterns, beta-glucuronidase staining was observed in maturing embryos and seeds; it also occurred in postembryonic tissues, especially in association with vascular tissues. After developing a homologous transient transformation system to facilitate identification of putative regulatory sequences, we demonstrated that 125 bp (-107 to +18) of the 5' flanking sequence of the mdl3 gene is sufficient for MDL expression in protoplasts derived from immature black cherry embryos. PMID:9414550

  2. A single nucleotide polymorphism and sequence analysis of CSN1S1 gene promoter region in Chinese Bos grunniens (yak).

    PubMed

    Bai, W L; Yin, R H; Dou, Q L; Yang, J C; Zhao, S J; Ma, Z J; Yin, R L; Luo, G B; Zhao, Z H

    2010-01-01

    The aim of this study was to investigate the polymorphism of the CSN1S1 gene promoter region in 4 Chinese yak breeds, and compare the yak CSN1S1 gene promoter region sequences with other ruminants. A Polymerase Chain Reaction-Single Strand Conformation Polymorphism protocol was developed for rapid genotyping of the yak CSN1S1 gene. One hundred fifty-eight animals from 4 Chinese yak breeds were genotyped at the CSN1S1 locus using the protocol developed. A single nucleotide polymorphism of the CSN1S1 gene promoter region has been identified in all yak breeds investigated. The polymorphism consists of a single nucleotide substitution G-->A at position 386 of the CSN1S1 gene promoter region, resulting in two alleles named, respectively, G(386) and A(386), based on the nucleotide at position 386. The allele G(386) was found to be more common in the animals investigated. The corresponding nucleotide sequences in GenBank of yak (having the same nucleotides as allele G(386) in this study), bovine, water buffalo, sheep, and goat had similarity of 99.68%, 99.35%, 97.42%, 95.14%, and 94.19%, respectively, with the yak allele A(386.).

  3. The lgtABCDE gene cluster, involved in lipooligosaccharide biosynthesis in Neisseria gonorrhoeae, contains multiple promoter sequences.

    PubMed

    Braun, Derek C; Stein, Daniel C

    2004-02-01

    Biosynthesis of the variable core domain of lipooligosaccharide (LOS) in Neisseria gonorrhoeae is mediated by glycosyl transferases encoded by lgtABCDE. Changes within homopolymeric runs within lgtA, lgtC, and lgtD affect the expression state of these genes, with the nature of the LOS expressed determined by the functionality of these genes. However, the mechanism for modulating the amount of multiple LOS chemotypes expressed in a single cell is not understood. Using mutants containing polar disruptions within the lgtABCDE locus, we determined that the expression of this locus is mediated by multiple promoters and that disruption of transcription from these promoters alters the relative levels of simultaneously expressed LOS chemotypes. Expression of the lgtABCDE locus was quantified by using xylE transcriptional fusions, and the data indicate that this locus is transcribed in trace amounts and that subtle changes in transcription result in phenotypic changes. By using rapid amplification of 5' cDNA ends, transcriptional start sites and promoter sequences were identified within lgtABCDE. Most of these promoters possessed 50 to 67% homology with the consensus gearbox promoter sequence of Escherichia coli.

  4. The lgtABCDE gene cluster, involved in lipooligosaccharide biosynthesis in Neisseria gonorrhoeae, contains multiple promoter sequences.

    PubMed

    Braun, Derek C; Stein, Daniel C

    2004-02-01

    Biosynthesis of the variable core domain of lipooligosaccharide (LOS) in Neisseria gonorrhoeae is mediated by glycosyl transferases encoded by lgtABCDE. Changes within homopolymeric runs within lgtA, lgtC, and lgtD affect the expression state of these genes, with the nature of the LOS expressed determined by the functionality of these genes. However, the mechanism for modulating the amount of multiple LOS chemotypes expressed in a single cell is not understood. Using mutants containing polar disruptions within the lgtABCDE locus, we determined that the expression of this locus is mediated by multiple promoters and that disruption of transcription from these promoters alters the relative levels of simultaneously expressed LOS chemotypes. Expression of the lgtABCDE locus was quantified by using xylE transcriptional fusions, and the data indicate that this locus is transcribed in trace amounts and that subtle changes in transcription result in phenotypic changes. By using rapid amplification of 5' cDNA ends, transcriptional start sites and promoter sequences were identified within lgtABCDE. Most of these promoters possessed 50 to 67% homology with the consensus gearbox promoter sequence of Escherichia coli. PMID:14761998

  5. Association between a polymorphic poly-T repeat sequence in the promoter of the somatostatin gene and hypertension.

    PubMed

    Tremblay, Monique; Brisson, Diane; Gaudet, Daniel

    2016-06-01

    Despite the numerous common pathways connecting blood pressure regulation to somatostatin (SST) metabolism, the SST gene has never been seen as a significant blood pressure modulator. The aim of this study was to evaluate the association between a poly-T repeat sequence (rs34872250) in the promoter of the SST gene and blood pressure, according to the obesity status. We genotyped 1918 French-Canadian subjects from a founder population. Analyses were performed according to the length of the poly-T repeat sequence on both alleles and divided into two groups, the 13/13-13/14 group and the 13/15-13/16 group. The effect of age, gender, body mass index, antihypertensive drugs and diabetic status were considered. Systolic, diastolic and mean blood pressures are significantly higher among the 13/15-13/16 group in the whole sample (P<0.05). Whereas the differences remain significant in women, they turn to be non-significant when men are considered alone. The risk of hypertension is increased in the 13/15-13/16 group, particularly among overweight/obese subjects. Systolic blood pressure is significantly higher among overweight/obese carriers of the 13/15-13/16 alleles in the whole sample (P<0.001), in men (P=0.006) and in women (P=0.002), even after correction for age and antihypertensive drugs. These results suggest that the poly-T repeat sequence polymorphism in the promoter of the SST gene is associated with significant variations of blood pressure and could modulate the risk of hypertension, particularly among women.

  6. Regulated expression of the human cytomegalovirus pp65 gene: Octamer sequence in the promoter is required for activation by viral gene products

    SciTech Connect

    Depto, A.S.; Stenberg, R.M.

    1989-03-01

    To better understand the regulation of late gene expression in human cytomegalovirus (CMV)-infected cells, the authors examined expression of the gene that codes for the 65-kilodalton lower-matrix phosphoprotein (pp65). Analysis of RNA isolated at 72 h from cells infected with CMV Towne or ts66, a DNA-negative temperature-sensitive mutant, supported the fact that pp65 is expressed at low levels prior to viral DNA replication but maximally expressed after the initiation of viral DNA replication. To investigate promoter activation in a transient expression assay, the pp65 promoter was cloned into the indicator plasmid containing the gene for chloramphenicol acetyltransferase (CAT). Transfection of the promoter-CAT construct and subsequent superinfection with CMV resulted in activation of the promoter at early times after infection. Cotransfection with plasmids capable of expressing immediate-early (IE) proteins demonstrated that the promoter was activated by IE proteins and that both IE regions 1 and 2 were necessary. These studies suggest that interactions between IE proteins and this octamer sequence may be important for the regulation and expression of this CMV gene.

  7. Definition of regulatory sequence elements in the promoter region and the first intron of the myotonic dystrophy protein kinase gene.

    PubMed

    Storbeck, C J; Sabourin, L A; Waring, J D; Korneluk, R G

    1998-04-10

    Myotonic dystrophy is the most common inherited adult neuromuscular disorder with a global frequency of 1/8000. The genetic defect is an expanding CTG trinucleotide repeat in the 3'-untranslated region of the myotonic dystrophy protein kinase gene. We present the in vitro characterization of cis regulatory elements controlling transcription of the myotonic dystrophy protein kinase gene in myoblasts and fibroblasts. The region 5' to the initiating ATG contains no consensus TATA or CCAAT box. We have mapped two transcriptional start sites by primer extension. Deletion constructs from this region fused to the bacterial chloramphenicol acetyltransferase reporter gene revealed only subtle muscle specific cis elements. The strongest promoter activity mapped to a 189-base pair fragment. This sequence contains a conserved GC box to which the transcription factor Sp1 binds. Reporter gene constructs containing a 2-kilobase pair first intron fragment of the myotonic dystrophy protein kinase gene enhances reporter activity up to 6-fold in the human rhabdomyosarcoma myoblast cell line TE32 but not in NIH 3T3 fibroblasts. Co-transfection of a MyoD expression vector with reporter constructs containing the first intron into 10 T1/2 fibroblasts resulted in a 10-20-fold enhancement of expression. Deletion analysis of four E-box elements within the first intron reveal that these elements contribute to enhancer activity similarly in TE32 myoblasts and 10 T1/2 fibroblasts. These data suggest that E-boxes within the myotonic dystrophy protein kinase first intron mediate interactions with upstream promoter elements to up-regulate transcription of this gene in myoblasts.

  8. Transcription of the Drosophila melanogaster 5S RNA gene requires an upstream promoter and four intragenic sequence elements

    SciTech Connect

    Sharp, S.J.; Garcia, A.D.

    1988-03-01

    Linker-scanning (LS) mutations were constructed spanning the length of the Drosophila melanogaster 5S RNA gene. In vitro transcription analysis of the LS 5S DNAs revealed five transcription control regions. One control region essential for the transcription initiation was identified in the 5'-flanking sequence. The major sequence determinants of this upstream promoter region were located between coordinates -39 and -26 (-30 region), but important sequences extended to the transcription start site at position 1. Since mutations in the upstream promoter did not alter the ability of 5S DNA to sequester transcription factors into a stable transcription complex, it appears that this control region involved the interaction of RNA polymerase III. Active 5S DNA transcription additionally required the four intragenic control regions (ICRs) located between coordinates 3 and 18 (ICR I), 37 and 44 (ICR II), 48 and 61 (ICR III), and 78 and 98 (ICR IV). LS mutations in each ICR decreased the ability of 5S DNA to sequester transcription factors. ICR III, ICR IV, and the spacer sequence between were similar in sequence and position to the determinant elements of the multipartite ICR of Xenopus 5S DNA. The importance of ICR III and ICR IV in transcription initiation and in sequestering transcription factors suggests the presence of an activity in D. melanogaster similar to transcription factor TFIIIA of Xenopus laevis and HeLa cells. Transcription initiation of Drosophila 5S DNA was not eliminated by LS mutations in the spacer region even though these mutations reduced the ability of the TFIIIA-like activity to bind.

  9. The promoter region of the arg3 gene in Saccharomyces cerevisiae: nucleotide sequence and regulation in an arg3-lacZ gene fusion.

    PubMed

    Crabeel, M; Huygen, R; Cunin, R; Glansdorff, N

    1983-01-01

    We have determined the DNA sequence for the 5' end of the arg3 gene of Saccharomyces cerevisiae, including part of the coding region and the 200 nucleotides immediately upstream. A promoter-deletion mutant was found to have lost all of the sequence lying normally in front of the gene except for the 33 nucleotides preceding the AUG codon. The role of the 5' domain in initiation and regulation of arg3 transcription was assessed by a gene fusion experiment. The Escherichia coli lacZ gene, was truncated of the eight amino-terminal codons substituted in vitro, on a 2mu plasmid, for the carboxy-terminal and 3'-flanking regions of arg3, leaving only the first 19 proximal codons and approximately 1600 nucleotides of the region preceding arg3 on the yeast chromosome. The fused gene was expressed in phase and was still submitted to the two mechanisms regulating the wild-type arg3 gene: the general, probably transcriptional control of amino acid biosynthesis and the specific, apparently post-transcriptional control mediated by the products of the argR genes. These results suggest a determining role for the 5' end portion of the arg3 messenger in the specific arginine-mediated control mechanism. PMID:11894927

  10. Detailed analysis of Helicobacter pylori Fur-regulated promoters reveals a Fur box core sequence and novel Fur-regulated genes.

    PubMed

    Pich, Oscar Q; Carpenter, Beth M; Gilbreath, Jeremy J; Merrell, D Scott

    2012-06-01

    In Helicobacter pylori, iron balance is controlled by the Ferric uptake regulator (Fur), an iron-sensing repressor protein that typically regulates expression of genes implicated in iron transport and storage. Herein, we carried out extensive analysis of Fur-regulated promoters and identified a 7-1-7 motif with dyad symmetry (5'-TAATAATnATTATTA-3'), which functions as the Fur box core sequence of H. pylori. Addition of this sequence to the promoter region of a typically non-Fur regulated gene was sufficient to impose Fur-dependent regulation in vivo. Moreover, mutation of this sequence within Fur-controlled promoters negated regulation. Analysis of the H. pylori chromosome for the occurrence of the Fur box established the existence of well-conserved Fur boxes in the promoters of numerous known Fur-regulated genes, and revealed novel putative Fur targets. Transcriptional analysis of the new candidate genes demonstrated Fur-dependent repression of HPG27_51, HPG27_52, HPG27_199, HPG27_445, HPG27_825 and HPG27_1063, as well as Fur-mediated activation of the cytotoxin associated gene A, cagA (HPG27_507). Furthermore, electrophoretic mobility shift assays confirmed specific binding of Fur to the promoters of each of these genes. Future experiments will determine whether loss of Fur regulation of any of these particular genes contributes to the defects in colonization exhibited by the H. pylori fur mutant.

  11. Detailed analysis of Helicobacter pylori Fur-regulated promoters reveals a Fur box core sequence and novel Fur-regulated genes.

    PubMed

    Pich, Oscar Q; Carpenter, Beth M; Gilbreath, Jeremy J; Merrell, D Scott

    2012-06-01

    In Helicobacter pylori, iron balance is controlled by the Ferric uptake regulator (Fur), an iron-sensing repressor protein that typically regulates expression of genes implicated in iron transport and storage. Herein, we carried out extensive analysis of Fur-regulated promoters and identified a 7-1-7 motif with dyad symmetry (5'-TAATAATnATTATTA-3'), which functions as the Fur box core sequence of H. pylori. Addition of this sequence to the promoter region of a typically non-Fur regulated gene was sufficient to impose Fur-dependent regulation in vivo. Moreover, mutation of this sequence within Fur-controlled promoters negated regulation. Analysis of the H. pylori chromosome for the occurrence of the Fur box established the existence of well-conserved Fur boxes in the promoters of numerous known Fur-regulated genes, and revealed novel putative Fur targets. Transcriptional analysis of the new candidate genes demonstrated Fur-dependent repression of HPG27_51, HPG27_52, HPG27_199, HPG27_445, HPG27_825 and HPG27_1063, as well as Fur-mediated activation of the cytotoxin associated gene A, cagA (HPG27_507). Furthermore, electrophoretic mobility shift assays confirmed specific binding of Fur to the promoters of each of these genes. Future experiments will determine whether loss of Fur regulation of any of these particular genes contributes to the defects in colonization exhibited by the H. pylori fur mutant. PMID:22507395

  12. Cloning and sequencing of nifBHDKENX genes of Paenibacillus massiliensis T7 and its nif promoter analysis.

    PubMed

    Zhao, Hongxin; Xie, Baoen; Chen, Sanfeng

    2006-04-01

    A 324 bp of nifH fragment was PCR amplified from Paenibacillus massiliensis T7 using the universal degenerate primers. The PCR-amplified nifH fragment was labeled with DIG and then used as a probe in Southern blot analysis. Southern blot result showed that there were two positive signals, indicating that there might be two copies of nifH in P. massiliensis T7. A total of 10254 bp DNA sequence containing purD and nifBHDKENX was obtained by five rounds of inverse-PCR amplification. The predicted proteins of nifBHDKENX had high homology with those from other nitrogen-fixing bacteria. Only one putative sigma54-dependent promoter sequence was detected upstream of the nifB gene and nifBHDKENX were likely to be organized in one operon. Assays of 3-galactosidase activity of P. massiliensis T7PB carrying a nifB-lacZ fusion under different concentrations of NH4+ and O2 showed that the expression of nifB-lacZ was strongly inhibited by O2.

  13. Maize Adh-1 promoter sequences control anaerobic regulation: addition of upstream promoter elements from constitutive genes is necessary for expression in tobacco

    PubMed Central

    Ellis, J.G.; Llewellyn, D.J.; Dennis, E.S.; Peacock, W.J.

    1987-01-01

    The promoter region of a maize alcohol dehydrogenase gene (Adh-1) was linked to a reporter gene encoding chloramphenicol acetyl transferase (CAT) and transformed stably into tobacco cells using T-DNA vectors. No CAT enzyme activity could be detected in transgenic tobacco plants unless upstream promoter elements from the octopine synthase gene or the cauliflower mosaic virus 35S promoter were supplied in addition to the maize promoter region. CAT enzyme activity and transcription of the chimaeric gene were then readily detected after anaerobic induction. The first 247 bp upstream of the translation initiation codon of the maize Adh-1 gene were sufficient to impose anaerobic regulation on the hybrid gene and S1 nuclease mapping confirmed mRNA initiation is from the normal maize Adh-1 transcription start point. ImagesFig. 1.Fig. 2.Fig. 3.Fig. 4.Fig. 5.Fig. 6. PMID:15981329

  14. Sequence analysis of the promoter regions of the classical class I gene RT1.A and two other class I genes of the rat MHC

    SciTech Connect

    Lambracht, D.; Wonigeit, K.

    1995-04-01

    Major histocompatibility complex (MHC) class I molecules present peptides to CD8+ T cells and thus play key role in immunosurveillance by T-cell-mediated mechanisms. Their expression depends on complex control mechanisms at two major levels: (1) regulation of transcription mediated through the promoter region and additional regulatory elements of the individual class I gene, and (2) availability of appropriate peptides in the endoplasmic reticulum required to stabilize the ternary complex consisting of class I {alpha} chain, {beta}{sub 2}-microglobulin ({beta}{sub 2}m), and peptide. In addition, differences in the ability of different {alpha} chains to bind {beta}{sub 2}m can influence the transport to and turnover within the cell membrane. We have now analyzed the promoter regions of class I genes of the LEW rat strain carrying the RT1{sup 1} haplotype. The analysis of three class I genes in this region has led to the identification of characteristic regulatory sequences. 20 refs., 2 figs.

  15. Promoter sequence of 3-phosphoglycerate kinase gene 1 of lactic acid-producing fungus rhizopus oryzae and a method of expressing a gene of interest in fungal species

    DOEpatents

    Gao, Johnway [Richland, WA; Skeen, Rodney S [Pendleton, OR

    2002-10-15

    The present invention provides the promoter clone discovery of phosphoglycerate kinase gene 1 of a lactic acid-producing filamentous fungal strain, Rhizopus oryzae. The isolated promoter can constitutively regulate gene expression under various carbohydrate conditions. In addition, the present invention also provides a design of an integration vector for the transformation of a foreign gene in Rhizopus oryzae.

  16. Promoter sequence of 3-phosphoglycerate kinase gene 2 of lactic acid-producing fungus rhizopus oryzae and a method of expressing a gene of interest in fungal species

    DOEpatents

    Gao, Johnway [Richland, WA; Skeen, Rodney S [Pendleton, OR

    2003-03-04

    The present invention provides the promoter clone discovery of phosphoglycerate kinase gene 2 of a lactic acid-producing filamentous fungal strain, Rhizopus oryzae. The isolated promoter can constitutively regulate gene expression under various carbohydrate conditions. In addition, the present invention also provides a design of an integration vector for the transformation of a foreign gene in Rhizopus oryzae.

  17. Structural analysis of the regulatory elements of the type-II procollagen gene. Conservation of promoter and first intron sequences between human and mouse.

    PubMed Central

    Vikkula, M; Metsäranta, M; Syvänen, A C; Ala-Kokko, L; Vuorio, E; Peltonen, L

    1992-01-01

    Transcription of the type-II procollagen gene (COL2A1) is very specifically restricted to a limited number of tissues, particularly cartilages. In order to identify transcription-control motifs we have sequenced the promoter region and the first intron of the human and mouse COL2A1 genes. With the assumption that these motifs should be well conserved during evolution, we have searched for potential elements important for the tissue-specific transcription of the COL2A1 gene by aligning the two sequences with each other and with the available rat type-II procollagen sequence for the promoter. With this approach we could identify specific evolutionarily well-conserved motifs in the promoter area. On the other hand, several suggested regulatory elements in the promoter region did not show evolutionary conservation. In the middle of the first intron we found a cluster of well-conserved transcription-control elements and we conclude that these conserved motifs most probably possess a significant function in the control of the tissue-specific transcription of the COL2A1 gene. We also describe locations of additional, highly conserved nucleotide stretches, which are good candidate regions in the search for binding sites of yet-uncharacterized cartilage-specific transcription regulators of the COL2A1 gene. PMID:1637314

  18. Cloning of mouse telomerase reverse transcriptase gene promoter and identification of proximal core promoter sequences essential for the expression of transgenes in cancer cells.

    PubMed

    Si, Shao-Yan; Song, Shu-Jun; Zhang, Jian-Zhong; Liu, Jun-Li; Liang, Shuang; Feng, Kai; Zhao, Gang; Tan, Xiao-Qing

    2011-08-01

    Telomerase is a ribonucleoprotein complex, whose function is to add motif-specific nucleotides to the end of chromosomes. Telomerase consists of three major subunits, the telomerase RNA template (hTR), the telomerase-associated protein (TEP1) and telomerase reverse transcriptase (TERT). TERT is the most important component responsible for the catalytic activity of telomerase and a rate-limiting determinant of the activity. Telomerase activities were at high levels in approximately 90% of mouse cancers or tumor-derived cell lines through TERT transcriptional up-regulation. Unlike human telomerase, telomerase activity exists in colon, liver, ovary and testis but not in brain, heart, stomach and muscle in normal mouse tissues. In this study, we prepared 5' truncations of 1086 bp fragments upstream of the initiating ATG codon of the mTERT gene to construct luciferase reporter gene plasmids, and transfected these plasmids into a normal mouse cell line and several cancer lines to identify the core promoter region essential for transcriptional activation in cancer cells by a luciferase assay. We constructed a eukaryotic expression vector of membrane-expressing staphylococcal endotoxin A (SEA) gene driven by the core promoter region of the mTERT gene and observed if the core promoter region could express the SEA gene in these cancer cells, but not in normal cells following transfection with the construct. The results showed that the transcriptional activities of each fragment of the mTERT gene promoter in the cancer cell lines Hepa1-6, B16 and CT26 were higher than those in NIH3T3 cells, and the proximal 333-bp fragment was the core promoter of the mTERT gene in the cancer cells. The proximal 333-bp fragment was able to make the SEA express on the surface of the cancer cells, but not in NIH3T3 cells. It provides a foundation for cancer targeting gene therapy by using the mTERT gene promoter. PMID:21567104

  19. Automated conserved non-coding sequence (CNS) discovery reveals differences in gene content and promoter evolution among grasses

    PubMed Central

    Turco, Gina; Schnable, James C.; Pedersen, Brent; Freeling, Michael

    2013-01-01

    Conserved non-coding sequences (CNS) are islands of non-coding sequence that, like protein coding exons, show less divergence in sequence between related species than functionless DNA. Several CNSs have been demonstrated experimentally to function as cis-regulatory regions. However, the specific functions of most CNSs remain unknown. Previous searches for CNS in plants have either anchored on exons and only identified nearby sequences or required years of painstaking manual annotation. Here we present an open source tool that can accurately identify CNSs between any two related species with sequenced genomes, including both those immediately adjacent to exons and distal sequences separated by >12 kb of non-coding sequence. We have used this tool to characterize new motifs, associate CNSs with additional functions, and identify previously undetected genes encoding RNA and protein in the genomes of five grass species. We provide a list of 15,363 orthologous CNSs conserved across all grasses tested. We were also able to identify regulatory sequences present in the common ancestor of grasses that have been lost in one or more extant grass lineages. Lists of orthologous gene pairs and associated CNSs are provided for reference inbred lines of arabidopsis, Japonica rice, foxtail millet, sorghum, brachypodium, and maize. PMID:23874343

  20. Gene conversion causing human inherited disease: evidence for involvement of non-B-DNA-forming sequences and recombination-promoting motifs in DNA breakage and repair

    PubMed Central

    Chuzhanova, Nadia; Chen, Jian-Min; Bacolla, Albino; Patrinos, George P.; Férec, Claude; Wells, Robert D.; Cooper, David N.

    2009-01-01

    A variety of DNA sequence motifs including inverted repeats, minisatellites, and the χ recombination hotspot, have been reported in association with gene conversion in human genes causing inherited disease. However, no methodical statistically-based analysis has been performed to formalize these observations. We have performed an in silico analysis of the DNA sequence tracts involved in 27 non-overlapping gene conversion events in 19 different genes reported in the context of inherited disease. We found that gene conversion events tend to occur within (C+G)- and CpG-rich regions and that sequences with the potential to form non-B-DNA structures, and which may be involved in the generation of double-strand breaks that could in turn serve to promote gene conversion, occur disproportionately within maximal converted tracts and/or short flanking regions. Maximal converted tracts were also found to be enriched (p<0.01) in a truncated version of the χ-element (a TGGTGG motif), immunoglobulin heavy chain class switch repeats, translin target sites and several novel motifs including (or overlapping) the classical meiotic recombination hotspot, CCTCCCCT. Finally, gene conversions tend to occur in genomic regions that have the potential to fold into stable hairpin conformations. These findings support the concept that recombination-inducing motifs, in association with alternative DNA conformations, can promote recombination in the human genome. PMID:19431182

  1. Functional relevance of specific interactions between herpes simplex virus type 1 ICP4 and sequences from the promoter-regulatory domain of the viral thymidine kinase gene.

    PubMed Central

    Imbalzano, A N; Shepard, A A; DeLuca, N A

    1990-01-01

    The herpes simplex virus (HSV) type 1 immediate-early regulatory protein ICP4 is required for induced expression of HSV early and late genes, yet the mechanism by which this occurs is not known. We examined the promoter and flanking sequences of the HSV early gene that encodes thymidine kinase for the ability to interact specifically with ICP4 in gel retardation assays. Protein-DNA complexes containing ICP4 were observed with several distinct regions flanking the tk promoter. cis-Acting elements that interact with cellular transcription factors were apparently not required for these interactions to form. Purified ICP4 formed protein-DNA complexes with fragments from these regions, and Southwestern (DNA-protein blot) analysis indicated that the interaction between ICP4 and these sequences can be direct. None of the tk sequences that interact with ICP4 contains a consensus binding site for ICP4 (S. W. Faber and K. W. Wilcox, Nucleic Acids Res. 14:6067-6083, 1986), reflecting the ability of ICP4 to interact with more than one DNA sequence. A mutated ICP4 protein expressed from the viral genome that retains the ability to bind to a consensus binding site but does not bind specifically to the identified sites flanking the tk promoter results in induced transcription of the tk gene. These data support hypotheses for ICP4-mediated transactivation of the tk promoter in Vero cells that do not require the intrinsic ability of ICP4 to bind specifically in or near the promoter of the tk gene. Images PMID:2159535

  2. Histone acetylation accompanied with promoter sequences displaying differential expression profiles of B-class MADS-box genes for phalaenopsis floral morphogenesis.

    PubMed

    Hsu, Chia-Chi; Wu, Pei-Shan; Chen, Tien-Chih; Yu, Chun-Wei; Tsai, Wen-Chieh; Wu, Keqiang; Wu, Wen-Luan; Chen, Wen-Huei; Chen, Hong-Hwa

    2014-01-01

    Five B-class MADS-box genes, including four APETALA3 (AP3)-like PeMADS2∼5 and one PISTILLATA (PI)-like PeMADS6, specify the spectacular flower morphology in orchids. The PI-like PeMADS6 ubiquitously expresses in all floral organs. The four AP3-like genes, resulted from two duplication events, express ubiquitously at floral primordia and early floral organ stages, but show distinct expression profiles at late floral organ primordia and floral bud stages. Here, we isolated the upstream sequences of PeMADS2∼6 and studied the regulatory mechanism for their distinct gene expression. Phylogenetic footprinting analysis of the 1.3-kb upstream sequences of AP3-like PeMADS2∼5 showed that their promoter regions have sufficiently diverged and contributed to their subfunctionalization. The amplified promoter sequences of PeMADS2∼6 could drive beta-glucuronidase (GUS) gene expression in all floral organs, similar to their expression at the floral primordia stage. The promoter sequence of PeMADS4, exclusively expressed in lip and column, showed a 1.6∼3-fold higher expression in lip/column than in sepal/petal. Furthermore, we noted a 4.9-fold increase in histone acetylation (H3K9K14ac) in the translation start region of PeMADS4 in lip as compared in petal. All these results suggest that the regulation via the upstream sequences and increased H3K9K14ac level may act synergistically to display distinct expression profiles of the AP3-like genes at late floral organ primordia stage for Phalaenopsis floral morphogenesis. PMID:25501842

  3. The Saccharomyces cerevisiae MGT1 DNA repair methyltransferase gene: its promoter and entire coding sequence, regulation and in vivo biological functions.

    PubMed Central

    Xiao, W; Samson, L

    1992-01-01

    We previously cloned a yeast DNA fragment that, when fused with the bacterial lacZ promoter, produced O6-methylguanine DNA repair methyltransferase (MGT1) activity and alkylation resistance in Escherichia coli (Xiao et al., EMBO J. 10,2179). Here we describe the isolation of the entire MGT1 gene and its promoter by sequence directed chromosome integration and walking. The MGT1 promoter was fused to a lacZ reporter gene to study how MGT1 expression is controlled. MGT1 is not induced by alkylating agents, nor is it induced by other DNA damaging agents such as UV light. However, deletion analysis defined an upstream repression sequence, whose removal dramatically increased basal level gene expression. The polypeptide deduced from the complete MGT1 sequence contained 18 more N-terminal amino acids than that previously determined; the role of these 18 amino acids, which harbored a potential nuclear localization signal, was explored. The MGT1 gene was also cloned under the GAL1 promoter, so that MTase levels could be manipulated, and we examined MGT1 function in a MTase deficient yeast strain (mgt1). The extent of resistance to both alkylation-induced mutation and cell killing directly correlated with MTase levels. Finally we show that mgt1 S.cerevisiae has a higher rate of spontaneous mutation than wild type cells, indicating that there is an endogenous source of DNA alkylation damage in these eukaryotic cells and that one of the in vivo roles of MGT1 is to limit spontaneous mutations. PMID:1641326

  4. Two short sequences in OsNAR2.1 promoter are necessary for fully activating the nitrate induced gene expression in rice roots

    PubMed Central

    Liu, Xiaoqin; Feng, Huimin; Huang, Daimin; Song, Miaoquan; Fan, Xiaorong; Xu, Guohua

    2015-01-01

    Nitrate is an essential nitrogen source and serves as a signal to control growth and gene expression in plants. In rice, OsNAR2.1 is an essential partner of multiple OsNRT2 nitrate transporters for nitrate uptake over low and high concentration range. Previously, we have reported that −311 bp upstream fragment from the translational start site in the promoter of OsNAR2.1 gene is the nitrate responsive region. To identify the cis-acting DNA elements necessary for nitrate induced gene expression, we detected the expression of beta-glucuronidase (GUS) reporter in the transgenic rice driven by the OsNAR2.1 promoter with different lengths and site mutations of the 311 bp region. We found that −129 to −1 bp region is necessary for the nitrate-induced full activation of OsNAR2.1. Besides, the site mutations showed that the 20 bp fragment between −191 and −172 bp contains an enhancer binding site necessary to fully drive the OsNAR2.1 expression. Part of the 20 bp fragment is commonly presented in the sequences of different promoters of both the nitrate induced NAR2 genes and nitrite reductase NIR1 genes from various higher plants. These findings thus reveal the presence of conserved cis-acting element for mediating nitrate responses in plants. PMID:26150107

  5. Analysis of E. coli promoter sequences.

    PubMed Central

    Harley, C B; Reynolds, R P

    1987-01-01

    We have compiled and analyzed 263 promoters with known transcriptional start points for E. coli genes. Promoter elements (-35 hexamer, -10 hexamer, and spacing between these regions) were aligned by a program which selects the arrangement consistent with the start point and statistically most homologous to a reference list of promoters. The initial reference list was that of Hawley and McClure (Nucl. Acids Res. 11, 2237-2255, 1983). Alignment of the complete list was used for reference until successive analyses did not alter the structure of the list. In the final compilation, all bases in the -35 (TTGACA) and -10 (TATAAT) hexamers were highly conserved, 92% of promoters had inter-region spacing of 17 +/- 1 bp, and 75% of the uniquely defined start points initiated 7 +/- 1 bases downstream of the -10 region. The consensus sequence of promoters with inter-region spacing of 16, 17 or 18 bp did not differ. This compilation and analysis should be useful for studies of promoter structure and function and for programs which identify potential promoter sequences. PMID:3550697

  6. Three sequence-specific DNA-protein complexes are formed with the same promoter element essential for expression of the rat somatostatin gene.

    PubMed Central

    Andrisani, O M; Pot, D A; Zhu, Z; Dixon, J E

    1988-01-01

    We identified three sequence-specific DNA-protein complexes which are formed after in vitro binding of nuclear extracts, derived from neuronal (CA-77, rat brain) or non-neuronal (HeLa) cells, to positions -70 to -29 of the rat somatostatin promoter. The protein(s) responsible for the formation of the three sequence-specific complexes was fractionated from rat brain whole cell extracts by DEAE-Sepharose chromatography. The critical contact residues of the factor(s) in each complex, as determined by methylation interference analyses, are located within positions -59 to -35, which is protected from DNase I digestion; these include the G residues of a TGACGTCA consensus also found in the cAMP-responsive human enkephalin (positions -105 to -76) and E1A-inducible adenovirus type 5 E3 (positions -72 to -42) promoters. Competition assays with these heterologous promoters reveal that the factor(s) of each complex displays approximately 50-fold greater affinity for the somatostatin promoter-binding site. Synthetic oligonucleotides spanning positions -70 to -29 of the somatostatin promoter and containing single-base substitutions of the G residues in the TGACGTCA consensus were utilized in competition assays. The G residues located in the center of the module are the most critical determinants in the formation of the three sequence-specific complexes. Deletions disrupting the TGACGTCA consensus abolish not only formation of the three complexes in vitro but also expression of the somatostatin promoter in vivo, suggesting that formation of one or more of these complexes is essential for transcription of the rat somatostatin gene. Images PMID:2898727

  7. Microsatellite polymorphism in the promoter sequence of the elongation factor 3 gene of Candida albicans as the basis for a typing system.

    PubMed Central

    Bretagne, S; Costa, J M; Besmond, C; Carsique, R; Calderone, R

    1997-01-01

    The polymorphism of a TTC/TTTC microsatellite in the promoter sequence of the elongation factor 3 gene of Candida albicans was investigated by PCR. One primer was fluorescein labeled, and PCR signals were read with an automatic sequencer. Twenty-nine reference strains and 31 independent clinical isolates were studied. Eleven different alleles were identified, giving 16 different profiles among the 60 strains tested, with a discriminatory power of 0.88. This marker is stable upon subculture, and reproducibility was achieved by automated procedures. When several microsatellite markers are available, many isolates can be rapidly and reproducibly tested for epidemiological questions, such as the prevalence of a given strain in a hospital setting and transmission between patients. PMID:9196192

  8. Sequencing of IncX-Plasmids Suggests Ubiquity of Mobile Forms of a Biofilm-Promoting Gene Cassette Recruited from Klebsiella pneumoniae

    PubMed Central

    Burmølle, Mette; Norman, Anders; Sørensen, Søren J.; Hansen, Lars Hestbjerg

    2012-01-01

    Plasmids are a highly effective means with which genetic traits that influence human health, such as virulence and antibiotic resistance, are disseminated through bacterial populations. The IncX-family is a hitherto sparsely populated group of plasmids that are able to thrive within Enterobacteriaceae. In this study, a replicon-centric screening method was used to locate strains from wastewater sludge containing plasmids belonging to the IncX-family. A transposon aided plasmid capture method was then employed to transport IncX-plasmids from their original hosts (and co-hosted plasmids) into a laboratory strain (Escherichia coli Genehogs®) for further study. The nucleotide sequences of the three newly isolated IncX-plasmids (pLN126_33, pMO17_54, pMO440_54) and the hitherto un-sequenced type-plasmid R485 revealed a remarkable occurrence of whole or partial gene cassettes that promote biofilm-formation in Klebsiella pneumonia or E. coli, in all four instances. Two of the plasmids (R485 and pLN126_33) were shown to directly induce biofilm formation in a crystal violet retention assay in E. coli. Sequence comparison revealed that all plasmid-borne forms of the type 3 fimbriae encoding gene cassette mrkABCDF were variations of a composite transposon Tn6011 first described in the E. coli IncX plasmid pOLA52. In conclusion, IncX-plasmids isolated from Enterobacteriaceae over almost 40 years and on three different continents have all been shown to carry a type 3 fimbriae gene cassette mrkABCDF stemming from pathogenic K. pneumoniae. Apart from contributing general knowledge about IncX-plasmids, this study also suggests an apparent ubiquity of a mobile form of an important virulence factor and is an illuminating example of the recruitment, evolution and dissemination of genetic traits through plasmid-mediated horizontal gene transfer. PMID:22844447

  9. Multiple regulatory mechanisms of hepatocyte growth factor expression in malignant cells with a short poly(dA) sequence in the HGF gene promoter.

    PubMed

    Sakai, Kazuko; Takeda, Masayuki; Okamoto, Isamu; Nakagawa, Kazuhiko; Nishio, Kazuto

    2015-01-01

    Hepatocyte growth factor (HGF) expression is a poor prognostic factor in various types of cancer. Expression levels of HGF have been reported to be regulated by shorter poly(dA) sequences in the promoter region. In the present study, the poly(dA) mononucleotide tract in various types of human cancer cell lines was examined and compared with the HGF expression levels in those cells. Short deoxyadenosine repeat sequences were detected in five of the 55 cell lines used in the present study. The H69, IM95, CCK-81, Sui73 and H28 cells exhibited a truncated poly(dA) sequence in which the number of poly(dA) repeats was reduced by ≥5 bp. Two of the cell lines exhibited high HGF expression, determined by reverse transcription quantitative polymerase chain reaction and enzyme-linked immunosorbent assay. The CCK-81, Sui73 and H28 cells with shorter poly(dA) sequences exhibited low HGF expression. The cause of the suppression of HGF expression in the CCK-81, Sui73 and H28 cells was clarified by two approaches, suppression by methylation and single nucleotide polymorphisms in the HGF gene. Exposure to 5-Aza-dC, an inhibitor of DNA methyltransferase 1, induced an increased expression of HGF in the CCK-81 cells, but not in the other cells. Single-nucleotide polymorphism (SNP) rs72525097 in intron 1 was detected in the Sui73 and H28 cells. Taken together, it was found that the defect of poly(dA) in the HGF promoter was present in various types of cancer, including lung, stomach, colorectal, pancreas and mesothelioma. The present study proposes the negative regulation mechanisms by methylation and SNP in intron 1 of HGF for HGF expression in cancer cells with short poly(dA).

  10. Massively parallel sequencing of phyllodes tumours of the breast reveals actionable mutations, and TERT promoter hotspot mutations and TERT gene amplification as likely drivers of progression.

    PubMed

    Piscuoglio, Salvatore; Ng, Charlotte Ky; Murray, Melissa; Burke, Kathleen A; Edelweiss, Marcia; Geyer, Felipe C; Macedo, Gabriel S; Inagaki, Akiko; Papanastasiou, Anastasios D; Martelotto, Luciano G; Marchio, Caterina; Lim, Raymond S; Ioris, Rafael A; Nahar, Pooja K; Bruijn, Ino De; Smyth, Lillian; Akram, Muzaffar; Ross, Dara; Petrini, John H; Norton, Larry; Solit, David B; Baselga, Jose; Brogi, Edi; Ladanyi, Marc; Weigelt, Britta; Reis-Filho, Jorge S

    2016-03-01

    Phyllodes tumours (PTs) are breast fibroepithelial lesions that are graded based on histological criteria as benign, borderline or malignant. PTs may recur locally. Borderline PTs and malignant PTs may metastasize to distant sites. Breast fibroepithelial lesions, including PTs and fibroadenomas, are characterized by recurrent MED12 exon 2 somatic mutations. We sought to define the repertoire of somatic genetic alterations in PTs and whether these may assist in the differential diagnosis of these lesions. We collected 100 fibroadenomas, 40 benign PTs, 14 borderline PTs and 22 malignant PTs; six, six and 13 benign, borderline and malignant PTs, respectively, and their matched normal tissue, were subjected to targeted massively parallel sequencing (MPS) using the MSK-IMPACT sequencing assay. Recurrent MED12 mutations were found in 56% of PTs; in addition, mutations affecting cancer genes (eg TP53, RB1, SETD2 and EGFR) were exclusively detected in borderline and malignant PTs. We found a novel recurrent clonal hotspot mutation in the TERT promoter (-124 C>T) in 52% and TERT gene amplification in 4% of PTs. Laser capture microdissection revealed that these mutations were restricted to the mesenchymal component of PTs. Sequencing analysis of the entire cohort revealed that the frequency of TERT alterations increased from benign (18%) to borderline (57%) and to malignant PTs (68%; p < 0.01), and TERT alterations were associated with increased levels of TERT mRNA (p < 0.001). No TERT alterations were observed in fibroadenomas. An analysis of TERT promoter sequencing and gene amplification distinguished PTs from fibroadenomas with a sensitivity and a positive predictive value of 100% (CI 95.38-100%) and 100% (CI 85.86-100%), respectively, and a sensitivity and a negative predictive value of 39% (CI 28.65-51.36%) and 68% (CI 60.21-75.78%), respectively. Our results suggest that TERT alterations may drive the progression of PTs, and may assist in the differential diagnosis

  11. Massively parallel sequencing of phyllodes tumours of the breast reveals actionable mutations, and TERT promoter hotspot mutations and TERT gene amplification as likely drivers of progression.

    PubMed

    Piscuoglio, Salvatore; Ng, Charlotte Ky; Murray, Melissa; Burke, Kathleen A; Edelweiss, Marcia; Geyer, Felipe C; Macedo, Gabriel S; Inagaki, Akiko; Papanastasiou, Anastasios D; Martelotto, Luciano G; Marchio, Caterina; Lim, Raymond S; Ioris, Rafael A; Nahar, Pooja K; Bruijn, Ino De; Smyth, Lillian; Akram, Muzaffar; Ross, Dara; Petrini, John H; Norton, Larry; Solit, David B; Baselga, Jose; Brogi, Edi; Ladanyi, Marc; Weigelt, Britta; Reis-Filho, Jorge S

    2016-03-01

    Phyllodes tumours (PTs) are breast fibroepithelial lesions that are graded based on histological criteria as benign, borderline or malignant. PTs may recur locally. Borderline PTs and malignant PTs may metastasize to distant sites. Breast fibroepithelial lesions, including PTs and fibroadenomas, are characterized by recurrent MED12 exon 2 somatic mutations. We sought to define the repertoire of somatic genetic alterations in PTs and whether these may assist in the differential diagnosis of these lesions. We collected 100 fibroadenomas, 40 benign PTs, 14 borderline PTs and 22 malignant PTs; six, six and 13 benign, borderline and malignant PTs, respectively, and their matched normal tissue, were subjected to targeted massively parallel sequencing (MPS) using the MSK-IMPACT sequencing assay. Recurrent MED12 mutations were found in 56% of PTs; in addition, mutations affecting cancer genes (eg TP53, RB1, SETD2 and EGFR) were exclusively detected in borderline and malignant PTs. We found a novel recurrent clonal hotspot mutation in the TERT promoter (-124 C>T) in 52% and TERT gene amplification in 4% of PTs. Laser capture microdissection revealed that these mutations were restricted to the mesenchymal component of PTs. Sequencing analysis of the entire cohort revealed that the frequency of TERT alterations increased from benign (18%) to borderline (57%) and to malignant PTs (68%; p < 0.01), and TERT alterations were associated with increased levels of TERT mRNA (p < 0.001). No TERT alterations were observed in fibroadenomas. An analysis of TERT promoter sequencing and gene amplification distinguished PTs from fibroadenomas with a sensitivity and a positive predictive value of 100% (CI 95.38-100%) and 100% (CI 85.86-100%), respectively, and a sensitivity and a negative predictive value of 39% (CI 28.65-51.36%) and 68% (CI 60.21-75.78%), respectively. Our results suggest that TERT alterations may drive the progression of PTs, and may assist in the differential diagnosis

  12. Mapping the transcription start points of the Staphylococcus aureus eap, emp, and vwb promoters reveals a conserved octanucleotide sequence that is essential for expression of these genes.

    PubMed

    Harraghy, Niamh; Homerova, Dagmar; Herrmann, Mathias; Kormanec, Jan

    2008-01-01

    Mapping the transcription start points of the eap, emp, and vwb promoters revealed a conserved octanucleotide sequence (COS). Deleting this sequence abolished the expression of eap, emp, and vwb. However, electrophoretic mobility shift assays gave no evidence that this sequence was a binding site for SarA or SaeR, known regulators of eap and emp.

  13. Trans-activation of transcription, from promoters containing immunoglobulin gene octamer sequences, by myeloma cell mRNA in Xenopus oocytes.

    PubMed Central

    Sweeney, G E; Old, R W

    1988-01-01

    To study factors required for immunoglobulin gene transcription hybrid promoters were made by linking octamer elements to a Xenopus albumin gene construct containing only 50bp of the albumin gene promoter. When injected into oocytes these hybrid promoters directed transcription far less efficiently than the unmodified 50bp albumin gene promoter fragment. Activity of the hybrid promoter, but not the unmodified albumin promoter, could be stimulated by preinjection of poly(A)+ RNA from NS1 myeloma cells. This stimulation may be caused by translation of the NS1 poly(A)+ RNA into transcription factors that act on the octamer. Both the reduction in transcription caused by octamer insertion and the extent of the inducibility by NS1 RNA are greater when two, rather than one, octamers are inserted. Images PMID:2898754

  14. Intergenic sequence between Arabidopsis caseinolytic protease B-cytoplasmic/heat shock protein100 and choline kinase genes functions as a heat-inducible bidirectional promoter.

    PubMed

    Mishra, Ratnesh Chandra; Grover, Anil

    2014-11-01

    In Arabidopsis (Arabidopsis thaliana), the At1g74310 locus encodes for caseinolytic protease B-cytoplasmic (ClpB-C)/heat shock protein100 protein (AtClpB-C), which is critical for the acquisition of thermotolerance, and At1g74320 encodes for choline kinase (AtCK2) that catalyzes the first reaction in the Kennedy pathway for phosphatidylcholine biosynthesis. Previous work has established that the knockout mutants of these genes display heat-sensitive phenotypes. While analyzing the AtClpB-C promoter and upstream genomic regions in this study, we noted that AtClpB-C and AtCK2 genes are head-to-head oriented on chromosome 1 of the Arabidopsis genome. Expression analysis showed that transcripts of these genes are rapidly induced in response to heat stress treatment. In stably transformed Arabidopsis plants harboring this intergenic sequence between head-to-head oriented green fluorescent protein and β-glucuronidase reporter genes, both transcripts and proteins of the two reporters were up-regulated upon heat stress. Four heat shock elements were noted in the intergenic region by in silico analysis. In the homozygous transfer DNA insertion mutant Salk_014505, 4,393-bp transfer DNA is inserted at position -517 upstream of ATG of the AtClpB-C gene. As a result, AtCk2 loses proximity to three of the four heat shock elements in the mutant line. Heat-inducible expression of the AtCK2 transcript was completely lost, whereas the expression of AtClpB-C was not affected in the mutant plants. Our results suggest that the 1,329-bp intergenic fragment functions as a heat-inducible bidirectional promoter and the region governing the heat inducibility is possibly shared between the two genes. We propose a model in which AtClpB-C shares its regulatory region with heat-induced choline kinase, which has a possible role in heat signaling.

  15. Sequences of the 5' portion of the human c-sis gene: characterization of the transcriptional promoter and regulation of expression of the protein product by 5' untranslated mRNA sequences.

    PubMed Central

    Ratner, L; Thielan, B; Collins, T

    1987-01-01

    The c-sis gene encodes the B polypeptide chain of platelet-derived growth factor (PDGF), and is expressed in a number of normal and pathological conditions. In order to study the control of synthesis of the human c-sis product, we have initiated a study of two regions of this genetic locus which regulate transcription and translation. A clone of the 5' portion of the gene was obtained which included 1361 nucleotides upstream of the RNA initiation site. Transcriptional promoter activity of this region was demonstrated in normal and transformed cells using a plasmid with the sequences upstream of the c-sis RNA initiation site fused to an indicator gene, chloramphenicol acetyl transferase. Experiments were also performed to identify other possible regulatory regions of the c-sis gene. These data demonstrated that a portion of the c-sis first exon encoding the 5' untranslated region of the c-sis mRNA inhibited synthesis of the PDGF B product in vitro. These results define regions of the c-sis gene whose activity may be important in the regulation of transcription and translation under normal conditions and in the pathogenesis several human diseases. Images PMID:3627977

  16. The amdR product and a CCAAT-binding factor bind to adjacent, possibly overlapping DNA sequences in the promoter region of the Aspergillus nidulans amdS gene.

    PubMed Central

    van Heeswijck, R; Hynes, M J

    1991-01-01

    The amdS gene of Aspergillus nidulans is regulated by a number of positively acting regulatory genes which act additively and independently. Using gel mobility shift assays with crude nuclear extracts we show here that the product of one of these regulatory genes, the amdR gene, binds to DNA fragments containing part of the promoter region of the amdS gene. This confirms the earlier prediction from DNA sequence data that amdR encodes a DNA-binding protein containing a cysteine-rich 'zinc finger' motif. In addition we detected the binding of another previously unidentified protein to an adjacent, possibly overlapping region of the amdS 5' sequence at the site of a consensus 'CCAAT-box' sequence. Replacement of the CCAAT sequence with CCTTT abolished the binding of this protein which we have designated as an A. nidulans 'CCAAT-box' binding factor (AnCF). The 'CCAAT-box' sequence appears to be involved in determining the basal level of transcription of amdS (T.G.Littlejohn and M.J.H., unpublished data). This suggests that AnCF is a transcription factor, and that the 'CCAAT-box' sequences found in the promoters of some filamentous fungal genes function as binding sites for these factors, as in other eucaryotes. Images PMID:2041742

  17. The amdR product and a CCAAT-binding factor bind to adjacent, possibly overlapping DNA sequences in the promoter region of the Aspergillus nidulans amdS gene.

    PubMed

    van Heeswijck, R; Hynes, M J

    1991-05-25

    The amdS gene of Aspergillus nidulans is regulated by a number of positively acting regulatory genes which act additively and independently. Using gel mobility shift assays with crude nuclear extracts we show here that the product of one of these regulatory genes, the amdR gene, binds to DNA fragments containing part of the promoter region of the amdS gene. This confirms the earlier prediction from DNA sequence data that amdR encodes a DNA-binding protein containing a cysteine-rich 'zinc finger' motif. In addition we detected the binding of another previously unidentified protein to an adjacent, possibly overlapping region of the amdS 5' sequence at the site of a consensus 'CCAAT-box' sequence. Replacement of the CCAAT sequence with CCTTT abolished the binding of this protein which we have designated as an A. nidulans 'CCAAT-box' binding factor (AnCF). The 'CCAAT-box' sequence appears to be involved in determining the basal level of transcription of amdS (T.G. Littlejohn and M.J.H., unpublished data). This suggests that AnCF is a transcription factor, and that the 'CCAAT-box' sequences found in the promoters of some filamentous fungal genes function as binding sites for these factors, as in other eucaryotes.

  18. Prediction of fine-tuned promoter activity from DNA sequence.

    PubMed

    Siwo, Geoffrey; Rider, Andrew; Tan, Asako; Pinapati, Richard; Emrich, Scott; Chawla, Nitesh; Ferdig, Michael

    2016-01-01

    The quantitative prediction of transcriptional activity of genes using promoter sequence is fundamental to the engineering of biological systems for industrial purposes and understanding the natural variation in gene expression. To catalyze the development of new algorithms for this purpose, the Dialogue on Reverse Engineering Assessment and Methods (DREAM) organized a community challenge seeking predictive models of promoter activity given normalized promoter activity data for 90 ribosomal protein promoters driving expression of a fluorescent reporter gene. By developing an unbiased modeling approach that performs an iterative search for predictive DNA sequence features using the frequencies of various k-mers, inferred DNA mechanical properties and spatial positions of promoter sequences, we achieved the best performer status in this challenge. The specific predictive features used in the model included the frequency of the nucleotide G, the length of polymeric tracts of T and TA, the frequencies of 6 distinct trinucleotides and 12 tetranucleotides, and the predicted protein deformability of the DNA sequence. Our method accurately predicted the activity of 20 natural variants of ribosomal protein promoters (Spearman correlation r = 0.73) as compared to 33 laboratory-mutated variants of the promoters (r = 0.57) in a test set that was hidden from participants. Notably, our model differed substantially from the rest in 2 main ways: i) it did not explicitly utilize transcription factor binding information implying that subtle DNA sequence features are highly associated with gene expression, and ii) it was entirely based on features extracted exclusively from the 100 bp region upstream from the translational start site demonstrating that this region encodes much of the overall promoter activity. The findings from this study have important implications for the engineering of predictable gene expression systems and the evolution of gene expression in naturally occurring

  19. Prediction of fine-tuned promoter activity from DNA sequence

    PubMed Central

    Siwo, Geoffrey; Rider, Andrew; Tan, Asako; Pinapati, Richard; Emrich, Scott; Chawla, Nitesh; Ferdig, Michael

    2016-01-01

    The quantitative prediction of transcriptional activity of genes using promoter sequence is fundamental to the engineering of biological systems for industrial purposes and understanding the natural variation in gene expression. To catalyze the development of new algorithms for this purpose, the Dialogue on Reverse Engineering Assessment and Methods (DREAM) organized a community challenge seeking predictive models of promoter activity given normalized promoter activity data for 90 ribosomal protein promoters driving expression of a fluorescent reporter gene. By developing an unbiased modeling approach that performs an iterative search for predictive DNA sequence features using the frequencies of various k-mers, inferred DNA mechanical properties and spatial positions of promoter sequences, we achieved the best performer status in this challenge. The specific predictive features used in the model included the frequency of the nucleotide G, the length of polymeric tracts of T and TA, the frequencies of 6 distinct trinucleotides and 12 tetranucleotides, and the predicted protein deformability of the DNA sequence. Our method accurately predicted the activity of 20 natural variants of ribosomal protein promoters (Spearman correlation r = 0.73) as compared to 33 laboratory-mutated variants of the promoters (r = 0.57) in a test set that was hidden from participants. Notably, our model differed substantially from the rest in 2 main ways: i) it did not explicitly utilize transcription factor binding information implying that subtle DNA sequence features are highly associated with gene expression, and ii) it was entirely based on features extracted exclusively from the 100 bp region upstream from the translational start site demonstrating that this region encodes much of the overall promoter activity. The findings from this study have important implications for the engineering of predictable gene expression systems and the evolution of gene expression in naturally occurring

  20. Bioinformatic Identification of Conserved Cis-Sequences in Coregulated Genes.

    PubMed

    Bülow, Lorenz; Hehl, Reinhard

    2016-01-01

    Bioinformatics tools can be employed to identify conserved cis-sequences in sets of coregulated plant genes because more and more gene expression and genomic sequence data become available. Knowledge on the specific cis-sequences, their enrichment and arrangement within promoters, facilitates the design of functional synthetic plant promoters that are responsive to specific stresses. The present chapter illustrates an example for the bioinformatic identification of conserved Arabidopsis thaliana cis-sequences enriched in drought stress-responsive genes. This workflow can be applied for the identification of cis-sequences in any sets of coregulated genes. The workflow includes detailed protocols to determine sets of coregulated genes, to extract the corresponding promoter sequences, and how to install and run a software package to identify overrepresented motifs. Further bioinformatic analyses that can be performed with the results are discussed. PMID:27557771

  1. Bayesian classification for promoter prediction in human DNA sequences

    NASA Astrophysics Data System (ADS)

    Bercher, J.-F.; Jardin, P.; Duriez, B.

    2006-11-01

    Many Computational methods are yet available for data retrieval and analysis of genomic sequences, but some functional sites are difficult to characterize. In this work, we examine the problem of promoter localization in human DNA sequences. Promoters are regulatory regions that governs the expression of genes, and their prediction is reputed difficult, so that this issue is still open. We present the Chaos Game representation (CGR) of DNA sequences which has many interesting properties, and the notion of `genomic signature' that proved relevant in phylogeny applications. Based on this notion, we develop a (naïve) bayesian classifier, evaluate its performances, and show that its adaptive implementation enable to reveal or assess core-promoter positions along a DNA sequence.

  2. Genetic basis of olfactory cognition: extremely high level of DNA sequence polymorphism in promoter regions of the human olfactory receptor genes revealed using the 1000 Genomes Project dataset

    PubMed Central

    Ignatieva, Elena V.; Levitsky, Victor G.; Yudin, Nikolay S.; Moshkin, Mikhail P.; Kolchanov, Nikolay A.

    2014-01-01

    The molecular mechanism of olfactory cognition is very complicated. Olfactory cognition is initiated by olfactory receptor proteins (odorant receptors), which are activated by olfactory stimuli (ligands). Olfactory receptors are the initial player in the signal transduction cascade producing a nerve impulse, which is transmitted to the brain. The sensitivity to a particular ligand depends on the expression level of multiple proteins involved in the process of olfactory cognition: olfactory receptor proteins, proteins that participate in signal transduction cascade, etc. The expression level of each gene is controlled by its regulatory regions, and especially, by the promoter [a region of DNA about 100–1000 base pairs long located upstream of the transcription start site (TSS)]. We analyzed single nucleotide polymorphisms using human whole-genome data from the 1000 Genomes Project and revealed an extremely high level of single nucleotide polymorphisms in promoter regions of olfactory receptor genes and HLA genes. We hypothesized that the high level of polymorphisms in olfactory receptor promoters was responsible for the diversity in regulatory mechanisms controlling the expression levels of olfactory receptor proteins. Such diversity of regulatory mechanisms may cause the great variability of olfactory cognition of numerous environmental olfactory stimuli perceived by human beings (air pollutants, human body odors, odors in culinary etc.). In turn, this variability may provide a wide range of emotional and behavioral reactions related to the vast variety of olfactory stimuli. PMID:24715883

  3. Expression analysis of a tyrosinase promoter sequence in zebrafish.

    PubMed

    Camp, Esther; Badhwar, Prerna; Mann, Graham J; Lardelli, Michael

    2003-04-01

    Sequence comparisons and functional analysis of the 5' upstream regions of tyrosinase genes have revealed the importance of cis-regulatory elements acting to control the spatiotemporal expression of tyrosinase in the melanocytes and retinal pigmented epithelium of developing embryos. To date there are no reports addressing the control of tyrosinase gene transcription in zebrafish, a vertebrate model organism of increasing importance. To exploit the tyrosinase gene as a marker in zebrafish we set out to clone its promoter and analyse its regulation during embryogenesis. Amplification of a zebrafish tyrosinase complementary DNA fragment by reverse transcriptase polymerase chain reaction allowed us to isolate and sequence a 1041 nt genomic DNA fragment that includes a transcription initiation site and 73 nt of the open reading frame. Bioinformatic analysis of this genomic sequence revealed five E-box motifs, including one CATGTG type E-box present in a putative initiation region. These are conserved positive regulatory elements in vertebrate tyrosinase promoters. We show that a region of 814 nt upstream from the translation start site of the zebrafish tyrosinase gene can drive expression in retinal pigmented epithelium in transiently transgenic zebrafish embryos but that its activity is not restricted to melanin-producing cells. This region is unable to drive transcription in human melanoma cell lines. Ectopic expression from this zebrafish tyrosinase promoter fragment is probably due to the absence of positive and negative cis-regulatory elements, such as a tyrosinase distal element, which is known to function as a pigment cell-specific enhancer.

  4. Chromatin and DNA sequences in defining promoters for transcription initiation.

    PubMed

    Müller, Ferenc; Tora, Làszlò

    2014-03-01

    One of the key events in eukaryotic gene regulation and consequent transcription is the assembly of general transcription factors and RNA polymerase II into a functional pre-initiation complex at core promoters. An emerging view of complexity arising from a variety of promoter associated DNA motifs, their binding factors and recent discoveries in characterising promoter associated chromatin properties brings an old question back into the limelight: how is a promoter defined? In addition to position-dependent DNA sequence motifs, accumulating evidence suggests that several parallel acting mechanisms are involved in orchestrating a pattern marked by the state of chromatin and general transcription factor binding in preparation for defining transcription start sites. In this review we attempt to summarise these promoter features and discuss the available evidence pointing at their interactions in defining transcription initiation in developmental contexts. This article is part of a Special Issue entitled: Chromatin and epigenetic regulation of animal development.

  5. Functional analysis of bipartite begomovirus coat protein promoter sequences

    SciTech Connect

    Lacatus, Gabriela; Sunter, Garry

    2008-06-20

    We demonstrate that the AL2 gene of Cabbage leaf curl virus (CaLCuV) activates the CP promoter in mesophyll and acts to derepress the promoter in vascular tissue, similar to that observed for Tomato golden mosaic virus (TGMV). Binding studies indicate that sequences mediating repression and activation of the TGMV and CaLCuV CP promoter specifically bind different nuclear factors common to Nicotiana benthamiana, spinach and tomato. However, chromatin immunoprecipitation demonstrates that TGMV AL2 can interact with both sequences independently. Binding of nuclear protein(s) from different crop species to viral sequences conserved in both bipartite and monopartite begomoviruses, including TGMV, CaLCuV, Pepper golden mosaic virus and Tomato yellow leaf curl virus suggests that bipartite begomoviruses bind common host factors to regulate the CP promoter. This is consistent with a model in which AL2 interacts with different components of the cellular transcription machinery that bind viral sequences important for repression and activation of begomovirus CP promoters.

  6. Sequence based structural characterization and genetic diversity analysis across coding and promoter regions of goat Toll-like receptor 5 gene.

    PubMed

    Goyal, Shubham; Dubey, P K; Sahoo, B R; Mishra, S K; Niranjan, S K; Singh, Sanjeev; Mahajan, Ritu; Kataria, R S

    2014-05-01

    The exploration of candidate immune response genes in goat may be vital in improving further our understanding about the species specific response to pathogens specifically among the ruminants. In this study, approximately 3.7 kb long genomic sequence of Toll-like receptor 5 (TLR5) covering the entire coding and 5'upstream regions of the gene, was characterized in the Indian goat breeds. Sequence analysis revealed a 2577-nucleotide long open reading frame (ORF) of goat TLR5, encoding 858 amino acids from single exon, similar to other ruminants. The domain structure analysis of goat TLR5 showed the presence of 13 leucine rich repeats (LRRs) in extracellular domain (amino acid position 1-634), single transmembrane domain (position 644-666), and a Toll/interleukin-1 receptor (position 692-837) in cytoplasmic domain, similar to other species. A total of 87 putative transcription factor binding sites were observed within the 5' upstream region of TLR5 gene in goat, 106 in cattle, and 103 in buffalo. Sixteen polymorphic sites were observed in goat TLR5 gene, out of which 10 non-synonymous SNPs were in the functionally important regions. However, none of the amino acid substitutions was found to be potentially damaging to the structure and function of the receptor protein. Further, one of the SNPs in the transmembrane region was genotyped by a TETRA-ARMS PCR in 444 goats of nine breeds from different geographical regions and having different utilities. A significant variation in allelic frequencies was observed across the milch and other types of goat breeds. The comparative modeling of goat TLR5 followed by molecular dynamics simulation gave an insight into its 3D structural arrangements. The molecular docking of Salmonella flagellin and TLR5 dimer elucidated LRRNT (N-terminal) to LRR4 as the key flagellin binding domains region in goat TLR5. The study shows that, although being highly conserved among the ruminants, comparatively high variations in goat TLR5 might give

  7. Automatic annotation of eukaryotic genes, pseudogenes and promoters

    PubMed Central

    Solovyev, Victor; Kosarev, Peter; Seledsov, Igor; Vorobyev, Denis

    2006-01-01

    Background The ENCODE gene prediction workshop (EGASP) has been organized to evaluate how well state-of-the-art automatic gene finding methods are able to reproduce the manual and experimental gene annotation of the human genome. We have used Softberry gene finding software to predict genes, pseudogenes and promoters in 44 selected ENCODE sequences representing approximately 1% (30 Mb) of the human genome. Predictions of gene finding programs were evaluated in terms of their ability to reproduce the ENCODE-HAVANA annotation. Results The Fgenesh++ gene prediction pipeline can identify 91% of coding nucleotides with a specificity of 90%. Our automatic pseudogene finder (PSF program) found 90% of the manually annotated pseudogenes and some new ones. The Fprom promoter prediction program identifies 80% of TATA promoters sequences with one false positive prediction per 2,000 base-pairs (bp) and 50% of TATA-less promoters with one false positive prediction per 650 bp. It can be used to identify transcription start sites upstream of annotated coding parts of genes found by gene prediction software. Conclusion We review our software and underlying methods for identifying these three important structural and functional genome components and discuss the accuracy of predictions, recent advances and open problems in annotating genomic sequences. We have demonstrated that our methods can be effectively used for initial automatic annotation of the eukaryotic genome. PMID:16925832

  8. Repetitive sequence variations in the promoter region of the adhesin-encoding gene sabA of Helicobacter pylori affect transcription.

    PubMed

    Harvey, Vivian C; Acio, Catherine R; Bredehoft, Amy K; Zhu, Laurence; Hallinger, Daniel R; Quinlivan-Repasi, Vanessa; Harvey, Samuel E; Forsyth, Mark H

    2014-10-01

    The pathogenesis of diseases elicited by the gastric pathogen Helicobacter pylori is partially determined by the effectiveness of adaptation to the variably acidic environment of the host stomach. Adaptation includes appropriate adherence to the gastric epithelium via outer membrane protein adhesins such as SabA. The expression of sabA is subject to regulation via phase variation in the promoter and coding regions as well as repression by the two-component system ArsRS. In this study, we investigated the role of a homopolymeric thymine [poly(T)] tract -50 to -33 relative to the sabA transcriptional start site in H. pylori strain J99. We quantified sabA expression in H. pylori J99 by quantitative reverse transcription-PCR (RT-PCR), demonstrating significant changes in sabA expression associated with experimental manipulations of poly(T) tract length. Mimicking the length increase of this tract by adding adenines instead of thymines had similar effects, while the addition of other nucleotides failed to affect sabA expression in the same manner. We hypothesize that modification of the poly(T) tract changes DNA topology, affecting regulatory protein interaction(s) or RNA polymerase binding efficiency. Additionally, we characterized the interaction between the sabA promoter region and ArsR, a response regulator affecting sabA expression. Using recombinant ArsR in electrophoretic mobility shift assays (EMSA), we localized binding to a sequence with partial dyad symmetry -20 and +38 relative to the sabA +1 site. The control of sabA expression by both ArsRS and phase variation at two distinct repeat regions suggests the control of sabA expression is both complex and vital to H. pylori infection.

  9. Genome Sequence of the Banana Plant Growth-Promoting Rhizobacterium Bacillus amyloliquefaciens BS006

    PubMed Central

    Gamez, Rocío M.; Rodríguez, Fernando; Bernal, Johan F.; Agarwala, Richa; Landsman, David

    2015-01-01

    Bacillus amyloliquefaciens is an important plant growth-promoting rhizobacterium (PGPR). We report the first whole-genome sequence of PGPR Bacillus amyloliquefaciens evaluated in Colombian banana plants. The genome sequences encode genes involved in plant growth and defense, including bacteriocins, ribosomally synthesized antibacterial peptides, in addition to genes that provide resistance to toxic compounds. PMID:26607897

  10. Genome Sequence of the Banana Plant Growth-Promoting Rhizobacterium Pseudomonas fluorescens PS006.

    PubMed

    Gamez, Rocío M; Rodríguez, Fernando; Ramírez, Sandra; Gómez, Yolanda; Agarwala, Richa; Landsman, David; Mariño-Ramírez, Leonardo

    2016-05-05

    Pseudomonas fluorescens is a well-known plant growth-promoting rhizobacterium (PGPR). We report here the first whole-genome sequence of PGPR P. fluorescens evaluated in Colombian banana plants. The genome sequences contains genes involved in plant growth and defense, including bacteriocins, 1-aminocyclopropane-1-carboxylic acid (ACC) deaminase, and genes that provide resistance to toxic compounds.

  11. Genome Sequence of the Banana Plant Growth-Promoting Rhizobacterium Pseudomonas fluorescens PS006.

    PubMed

    Gamez, Rocío M; Rodríguez, Fernando; Ramírez, Sandra; Gómez, Yolanda; Agarwala, Richa; Landsman, David; Mariño-Ramírez, Leonardo

    2016-01-01

    Pseudomonas fluorescens is a well-known plant growth-promoting rhizobacterium (PGPR). We report here the first whole-genome sequence of PGPR P. fluorescens evaluated in Colombian banana plants. The genome sequences contains genes involved in plant growth and defense, including bacteriocins, 1-aminocyclopropane-1-carboxylic acid (ACC) deaminase, and genes that provide resistance to toxic compounds. PMID:27151797

  12. Structure and sequence divergence of two archaebacterial genes.

    PubMed Central

    Cue, D; Beckler, G S; Reeve, J N; Konisky, J

    1985-01-01

    The DNA sequences of a region that includes the hisA gene of two related methanogenic archaebacteria, Methanococcus voltae and Methanococcus vannielii, have been compared. Both organisms show a similar genome organization in this region, displaying three open reading frames (ORFs) separated by regions of very high A + T content. Two of the ORFs, including ORFHisA, show significant DNA sequence homology. As might be expected for organisms having a genome that is A + T-rich, there is a high preference for A and U as the third base in codons. Although the regions upstream of the structural genes contain prokaryotic-like promoter sequences, it is not known whether they are recognized as promoters in these archaebacterial cells. A ribosome binding site, G-G-T-G, is located 6 base pairs preceding the ATG translation initiation sequence of both hisA genes. The sequences upstream of the two hisA genes show only limited sequence homology. The M. voltae intergenic region contains four tandemly arranged repetitions of an 11-base-pair sequence, whereas the M. vannielii sequence contains both direct and inverted repetitive sequences. Based on the degree of hisA sequence homology, we conclude that M. voltae and M. vannielii are less closely related taxonomically than are members of the enteric group of eubacteria. PMID:3923489

  13. Mechanism of Gene Amplification via Yeast Autonomously Replicating Sequences

    PubMed Central

    Dhar, M. K.

    2015-01-01

    The present investigation was aimed at understanding the molecular mechanism of gene amplification. Interplay of fragile sites in promoting gene amplification was also elucidated. The amplification promoting sequences were chosen from the Saccharomyces cerevisiae ARS, 5S rRNA regions of Plantago ovata and P. lagopus, proposed sites of replication pausing at Ste20 gene locus of S. cerevisiae, and the bend DNA sequences within fragile site FRA11A in humans. The gene amplification assays showed that plasmid bearing APS from yeast and human beings led to enhanced protein concentration as compared to the wild type. Both the in silico and in vitro analyses were pointed out at the strong bending potential of these APS. In addition, high mitotic stability and presence of TTTT repeats and SAR amongst these sequences encourage gene amplification. Phylogenetic analysis of S. cerevisiae ARS was also conducted. The combinatorial power of different aspects of APS analyzed in the present investigation was harnessed to reach a consensus about the factors which stimulate gene expression, in presence of these sequences. It was concluded that the mechanism of gene amplification was that AT rich tracts present in fragile sites of yeast serve as binding sites for MAR/SAR and DNA unwinding elements. The DNA protein interactions necessary for ORC activation are facilitated by DNA bending. These specific bindings at ORC promote repeated rounds of DNA replication leading to gene amplification. PMID:25685838

  14. Sequence Variability in Staphylococcal Enterotoxin Genes seb, sec, and sed

    PubMed Central

    Johler, Sophia; Sihto, Henna-Maria; Macori, Guerrino; Stephan, Roger

    2016-01-01

    Ingestion of staphylococcal enterotoxins preformed by Staphylococcus aureus in food leads to staphylococcal food poisoning, the most prevalent foodborne intoxication worldwide. There are five major staphylococcal enterotoxins: SEA, SEB, SEC, SED, and SEE. While variants of these toxins have been described and were linked to specific hosts or levels or enterotoxin production, data on sequence variation is still limited. In this study, we aim to extend the knowledge on promoter and gene variants of the major enterotoxins SEB, SEC, and SED. To this end, we determined seb, sec, and sed promoter and gene sequences of a well-characterized set of enterotoxigenic Staphylococcus aureus strains originating from foodborne outbreaks, human infections, human nasal colonization, rabbits, and cattle. New nucleotide sequence variants were detected for all three enterotoxins and a novel amino acid sequence variant of SED was detected in a strain associated with human nasal colonization. While the seb promoter and gene sequences exhibited a high degree of variability, the sec and sed promoter and gene were more conserved. Interestingly, a truncated variant of sed was detected in all tested sed harboring rabbit strains. The generated data represents a further step towards improved understanding of strain-specific differences in enterotoxin expression and host-specific variation in enterotoxin sequences. PMID:27258311

  15. Sequence Variability in Staphylococcal Enterotoxin Genes seb, sec, and sed.

    PubMed

    Johler, Sophia; Sihto, Henna-Maria; Macori, Guerrino; Stephan, Roger

    2016-01-01

    Ingestion of staphylococcal enterotoxins preformed by Staphylococcus aureus in food leads to staphylococcal food poisoning, the most prevalent foodborne intoxication worldwide. There are five major staphylococcal enterotoxins: SEA, SEB, SEC, SED, and SEE. While variants of these toxins have been described and were linked to specific hosts or levels or enterotoxin production, data on sequence variation is still limited. In this study, we aim to extend the knowledge on promoter and gene variants of the major enterotoxins SEB, SEC, and SED. To this end, we determined seb, sec, and sed promoter and gene sequences of a well-characterized set of enterotoxigenic Staphylococcus aureus strains originating from foodborne outbreaks, human infections, human nasal colonization, rabbits, and cattle. New nucleotide sequence variants were detected for all three enterotoxins and a novel amino acid sequence variant of SED was detected in a strain associated with human nasal colonization. While the seb promoter and gene sequences exhibited a high degree of variability, the sec and sed promoter and gene were more conserved. Interestingly, a truncated variant of sed was detected in all tested sed harboring rabbit strains. The generated data represents a further step towards improved understanding of strain-specific differences in enterotoxin expression and host-specific variation in enterotoxin sequences.

  16. Construction of chimeric antibodies: cloning of immunoglobulin genes including their promoter regions by PCR.

    PubMed

    Mocikat, R; Kütemeier, G; Harloff, C

    1992-03-01

    In the production of recombinant antibodies, it is necessary to have an immunoglobulin gene promoter for driving the expression of the antibody genes. Here we describe a simple PCR method that allows cloning of the immunoglobulin genes together with their own promoters despite the fact that the sequence of the upstream part of the gene is unknown.

  17. Phase-defined complete sequencing of the HLA genes by next-generation sequencing

    PubMed Central

    2013-01-01

    Background The human leukocyte antigen (HLA) region, the 3.8-Mb segment of the human genome at 6p21, has been associated with more than 100 different diseases, mostly autoimmune diseases. Due to the complex nature of HLA genes, there are difficulties in elucidating complete HLA gene sequences especially HLA gene haplotype structures by the conventional sequencing method. We propose a novel, accurate, and cost-effective method for generating phase-defined complete sequencing of HLA genes by using indexed multiplex next generation sequencing. Results A total of 33 HLA homozygous samples, 11 HLA heterozygous samples, and 3 parents-child families were subjected to phase-defined HLA gene sequencing. We applied long-range PCR to amplify six HLA genes (HLA-A, -C, -B, DRB1, -DQB1, and –DPB1) followed by transposase-based library construction and multiplex sequencing with the MiSeq sequencer. Paired-end reads (2 × 250 bp) derived from the sequencer were aligned to the six HLA gene segments of UCSC hg19 allowing at most 80 bases mismatch. For HLA homozygous samples, the six amplicons of an individual were pooled and simultaneously sequenced and mapped as an individual-tagging method. The paired-end reads were aligned to corresponding genes of UCSC hg19 and unambiguous, continuous sequences were obtained. For HLA heterozygous samples, each amplicon was separately sequenced and mapped as a gene-tagging method. After alignments, we detected informative paired-end reads harboring SNVs on both forward and reverse reads that are used to separate two chromosomes and to generate two phase-defined sequences in an individual. Consequently, we were able to determine the phase-defined HLA gene sequences from promoter to 3′-UTR and assign up to 8-digit HLA allele numbers, regardless of whether the alleles are rare or novel. Parent–child trio-based sequencing validated our sequencing and phasing methods. Conclusions Our protocol generated phased-defined sequences of the entire

  18. Identification of Human Gene Core Promoters in Silico

    PubMed Central

    Zhang, Michael Q.

    1998-01-01

    Identification of the 5′-end of human genes requires identification of functional promoter elements. In silico identification of those elements is difficult because of the hierarchical and modular nature of promoter architecture. To address this problem, I propose a new stepwise strategy based on initial localization of a functional promoter into a 1- to 2-kb (extended promoter) region from within a large genomic DNA sequence of 100 kb or larger and further localization of a transcriptional start site (TSS) into a 50- to 100-bp (corepromoter) region. Using positional dependent 5-tuple measures, a quadratic discriminant analysis (QDA) method has been implemented in a new program—CorePromoter. Our experiments indicate that when given a 1- to 2-kb extended promoter, CorePromoter will correctly localize the TSS to a 100-bp interval ∼60% of the time. [Figure 3 can be found in its entirety as an online supplement at http://www.genome.org.] PMID:9521935

  19. Definition of the ovalbumin gene promoter by transfer of an ovalglobin fusion gene into cultured cells.

    PubMed Central

    Knoll, B J; Zarucki-Schulz, T; Dean, D C; O'Malley, B W

    1983-01-01

    In order to study the initiation of transcription from the ovalbumin gene promoter, we constructed a hybrid gene (ovalglobin) in which 753 bps of ovalbumin gene 5'-flanking sequence were joined to the chicken adult beta-globin gene. When transfected into HeLa S3 cells, ovalglobin gene transcription initiated at the ovalbumin gene cap site, as measured by S1 nuclease and primer extension analysis. Deletion of 5'-flanking sequences to position -95 had little effect on transcription; deletion to -77 reduced transcription to about 20% of the wild type level and deletion to -48 reduced the level to about 2%. A deletion to -24, removing the sequence TATATAT, abolished transcription entirely. Hormonal regulation of the ovalglobin gene was observed when primary oviduct cells were used as recipients for DNA transfection. Under these conditions, addition of progesterone increased the level of ovalglobin transcripts to more than 10 times the uninduced level. Images PMID:6314256

  20. Cloning and sequence analyses of cDNAs for interferon- and virus-induced human Mx proteins reveal that they contain putative guanine nucleotide-binding sites: functional study of the corresponding gene promoter.

    PubMed Central

    Horisberger, M A; McMaster, G K; Zeller, H; Wathelet, M G; Dellis, J; Content, J

    1990-01-01

    The human protein p78 is induced and accumulated in cells treated with type I interferon or with some viruses. It is the human homolog of the mouse Mx protein involved in resistance to influenza virus. A full-length cDNA clone encoding the human p78 protein was cloned and sequenced. It contained an open reading frame of 662 amino acids, corresponding to a polypeptide with a predicted molecular weight of 75,500, in good agreement with the Mr of 78,000 determined on sodium dodecyl sulfate gels for the purified natural p78 protein. The cloned gene was expressed in vitro and corresponded in size, pI, antigenic determinant(s), and NH2 terminus sequence to the natural p78 protein. A second cDNA was cloned which encoded a 633-amino-acid protein sharing 63% homology with human p78. This p78-related protein was translated in reticulocyte lysates where it shared an antigenic determinant(s) with p78. A putative 5' regulatory region of 83 base pairs contained within the gene promoter region upstream of the presumed p78 mRNA cap site conferred human alpha interferon (IFN-alpha) inducibility to the cat reporter gene. The p78 protein accumulated to high levels in cells treated with IFN-alpha. In contrast, the p78-related protein was not expressed at detectable levels. The rate of decay of p78 levels in diploid cells after a 24-h treatment with IFN-alpha was much slower than the rate of decay of the antiviral state against influenza A virus and vesicular stomatitis virus, suggesting that the p78 protein is probably not involved in an antiviral mechanism. Furthermore, we showed that these proteins, as well as the homologous mouse Mx protein, possess three consensus elements in proper spacing, characteristic of GTP-binding proteins. Images PMID:2154602

  1. Synthetic muscle promoters: activities exceeding naturally occurring regulatory sequences

    NASA Technical Reports Server (NTRS)

    Li, X.; Eastman, E. M.; Schwartz, R. J.; Draghia-Akli, R.

    1999-01-01

    Relatively low levels of expression from naturally occurring promoters have limited the use of muscle as a gene therapy target. Myogenic restricted gene promoters display complex organization usually involving combinations of several myogenic regulatory elements. By random assembly of E-box, MEF-2, TEF-1, and SRE sites into synthetic promoter recombinant libraries, and screening of hundreds of individual clones for transcriptional activity in vitro and in vivo, several artificial promoters were isolated whose transcriptional potencies greatly exceed those of natural myogenic and viral gene promoters.

  2. The myxoma virus thymidine kinase gene: sequence and transcriptional mapping.

    PubMed

    Jackson, R J; Bults, H G

    1992-02-01

    The myxoma virus thymidine kinase (TK) gene is encoded on a 1.6 kb SacI-SalI restriction fragment located between 57.7 and 59.3 kb on the 163 kb genomic map. The nucleotide sequence of this fragment as well as 228 bp from the adjacent SalI-AA2 fragment was determined and found to encode four major open reading frames (ORFs). Three of these ORFs are similar in nucleotide sequence to ORFs L5R and J1R, and the TK gene of vaccinia virus (VV). The fourth ORF, MF8a, shows similarity to the ORFs found in the same position relative to the TK genes of Shope fibroma virus, Kenya sheep-1 virus and swine-pox virus. A search of the complete VV nucleotide sequence for regions of similarity to MF8a identified the host specificity gene C7L. Northern blot analysis of early viral RNA identified transcripts of approximately 700 nucleotides for both the TK gene and ORF MF8a. The 5' ends of the TK gene and ORF MF8a early mRNAs were mapped by primer extension to initiation sites 13 nucleotides downstream of sequences with similarity to the VV early promoter consensus. The sizes of the TK and MF8a mRNAs are consistent with transcription termination and polyadenylation occurring downstream of the sequence TTTTTNT, which is identical to the consensus sequence for the VV transcription termination signal.

  3. Nucleotide sequence of a human tRNA gene heterocluster

    SciTech Connect

    Chang, Y.N.; Pirtle, I.L.; Pirtle, R.M.

    1986-05-01

    Leucine tRNA from bovine liver was used as a hybridization probe to screen a human gene library harbored in Charon-4A of bacteriophage lambda. The human DNA inserts from plaque-pure clones were characterized by restriction endonuclease mapping and Southern hybridization techniques, using both (3'-/sup 32/P)-labeled bovine liver leucine tRNA and total tRNA as hybridization probes. An 8-kb Hind III fragment of one of these ..gamma..-clones was subcloned into the Hind III site of pBR322. Subsequent fine restriction mapping and DNA sequence analysis of this plasmid DNA indicated the presence of four tRNA genes within the 8-kb DNA fragment. A leucine tRNA gene with an anticodon of AAG and a proline tRNA gene with an anticodon of AGG are in a 1.6-kb subfragment. A threonine tRNA gene with an anticodon of UGU and an as yet unidentified tRNA gene are located in a 1.1-kb subfragment. These two different subfragments are separated by 2.8 kb. The coding regions of the three sequenced genes contain characteristic internal split promoter sequences and do not have intervening sequences. The 3'-flanking region of these three genes have typical RNA polymerase III termination sites of at least four consecutive T residues.

  4. Functional conservation of the promoter regions of vertebrate tyrosinase genes.

    PubMed

    Sato, S; Tanaka, M; Miura, H; Ikeo, K; Gojobori, T; Takeuchi, T; Yamamoto, H

    2001-11-01

    Tyrosinase is the key enzyme for synthesizing melanin pigments, which primarily determine mammalian skin coloration. Considering the important roles of pigments in the evolution and the adaptation of vertebrates, phylogenetic changes in the coding and flanking regulatory sequences of the tyrosinase gene are particularly intriguing. We have now cloned cDNA encoding tyrosinase from Japanese quail and snapping turtle. These nonmammalian cDNA are highly homologous to those of the mouse and human tyrosinases, whereas the 5' flanking sequences are far less conserved except for a few short sequence motifs. Nevertheless, we demonstrate that the 5' flanking sequences from the quail or turtle tyrosinase genes are capable of directing the expression of a fused mouse tyrosinase cDNA when introduced into cultured mouse albino melanocytes. This experimental method, which reveals the functional conservation of regulatory sequences in one cell type (the melanocyte), may be utilized to evaluate phylogenetic differences in mechanisms controlling specific gene expression in many other types of cells. We also provide evidence that the 5' flanking sequences from these nonmammalian genes are functional in vivo by producing transgenic mice. Phylogenetic changes of vertebrate tyrosinase promoters and the possible involvement of conserved sequence motifs in melanocyte-specific expression of tyrosinase are discussed. PMID:11764277

  5. Cloning, characterization and promoter analysis of S-RNase gene promoter from Chinese pear (Pyrus pyrifolia).

    PubMed

    Liu, Xue-ying; Wuyun, Ta-na; Zeng, Hong-yan

    2012-09-01

    The 5'-flanking region of the S(12)-, S(13)-, S(21)-RNase with a length of 854 bp, 1448 bp and 1137 bp were successfully isolated by TAIL-PCR from genomic DNA from 'Jinhua', 'Maogong' (Pyrus pyrifolia) and 'Yali' (Pyrus bretschneideri) genomic DNA. Sequence alignment and analysis of S(13)-, S(12)-, S(21)-RNase gene promoter sequences with S(2)-, S(3)-, S(4)-, S(5)-RNase 5'-flanking sequences indicated that a homology region of about 240 bp exists in the regions just upstream of the putative TATA boxes of the seven Chinese/Japanese pear S-RNase genes. Phylogenetic tree suggests that the homology region between the Chinese/Japanese pear and apple S-RNase gene promoter regions reflects the divergence of S-RNase gene was formed before the differentiation of subfamilies. Full length and a series of 5'-deletion fragments-GUS fusions were constructed and introduced into Arabidopsis thaliana plants. GUS activity were detected in S(12)-pro-(1 to 5)-GUS-pBll01.2 transgenic pistils and progressively decreased from S(12)-pro-1-GUS-pBI l01.2 to S(12)-pro-5-GUS-pBll01.2. No GUS activity was detected in S(12)-pro-6-GUS-pBll01.2 transgenic pistil and other tissues of non-transformants and all transgenic plants. The result suggested S(12)-RNase promoter is pistil specific expression promoter.

  6. Sequences promoting the transcription of the human XA gene overlapping P450c21A correctly predict the presence of a novel, adrenal-specific, truncated form of tenascin-X

    SciTech Connect

    Tee, Meng Kian; Thomson, A.A.; Bristow, J.; Miller, W.L.

    1995-07-20

    A compact region in the human class III major histocompatibility locus contains the human genes for the fourth component of human complement (C4) and steroid 21-hydroxylase (P450c21) in one transcriptional orientation, while the gene for the extracellular matrix protein tenascin-X (TN-X) overlaps the last exon of P450c21 on the opposite strand of DNA in the opposite transcriptional orientation. This complex locus is duplicated into A and B loci, so that the organization is 5{prime}-C4A-21A-XA-C4B-21B-XB-3{prime}. Although this duplication event truncated the 65-kb X(B) gene to a 4.5-kb XA gene, the XA gene is transcriptionally active in the adrenal cortex. To examine the basis of the tissue-specific expression of XA and C4B, we cloned the 1763-bp region that lies between the cap sites for XA and C4B and analyzed its promoter activity in both the XA and the C4 orientations. Powerful, liver-specific sequences lie within the first 75 to 138 bp from the C4B cap site, and weaker elements lie within 128 bp of the XA cap site that function in both liver and adrenal cells. Because these 128 bp upstream from the XA cap site are perfectly preserved in the XB gene encoding TN-X, we sought to determine whether a transcript similar to XA arises within the SB gene. RNase protection assays, cDNA cloning, and RT/PCR show that adrenal cells contain a novel transcript, termed short XB (XB-S), which has the same open reading frame as TN-X. Cell-free translation and immunoblotting show that this transcript encodes a novel 74-kDa XB-S protein that is identical to the carboxy-terminal 673 residues of TN-X. Because this protein consists solely of fibronectin type III repeats and a fibrinogen-like domain, it appears to correspond to an evolutionary precursor of the tenascin family of extracellular matrix proteins. 40 refs., 6 figs.

  7. The promoter of Alzheimer's disease amyloid A4 precursor gene.

    PubMed

    Salbaum, J M; Weidemann, A; Lemaire, H G; Masters, C L; Beyreuther, K

    1988-09-01

    The promoter of the gene for the human precursor of Alzheimer's disease A4 amyloid protein (PAD gene) resembles promoters of housekeeping genes. It lacks a typical TATA box and shows a high GC content of 72% in a DNA region that confers promoter activity to a reporter gene in an in vivo assay. Transcription initiates at multiple sites. Sequences homologous to the consensus binding sites of transcription factor AP-1 and the heat shock control element binding protein were found upstream of the RNA start sites. Six copies of a 9-bp-long GC-rich element are located between positions -200 and -100. A protein--DNA interaction could be mapped to this element. The 3.8 kb of the 5' region of the PAD gene include two Alu-type repetitive sequences. These findings suggest that four mechanisms may participate in the regulation of the PAD gene and could be of relevance for the progression of amyloid deposition in Alzheimer's disease.

  8. [Cloning and characterization of D-113 gene promoter from cotton].

    PubMed

    Luo, Ke-Ming; Guo, Yu-Long; Xiao, Yue-Hua; Hou, Lei; Pei, Yan

    2002-02-01

    To study the expression of late embryogenesis abundant gene in seeds, the 1,024 bp 5' flanking sequence of D-113 gene, a late embryogenesis abundant gene of Gossypium hirsutum cv. Coker 312, was cloned by PCR. The similarity compared with the sequence of Lea protein gene family published was 92.50%. There are three putative ABREs and one enhancer-like which riches A/T in the promoter. The promoter was fused to the beta-glucuronidase gene to form pLD II. Via a particle bombardment, pLD II was introduced into embryogenic calli of cotton and seeds of Brassica napus which were all treated with abscisic acid for 3d before bombardment, also into roots, stems and leafs of cotton. Transient expression was measured histochemically as spot number 24 h after bombardment. GUS sexpression was observed in the seeds of Brassica napus and the embryogenic calli of cotton, but not found in roots and leaves of cotton. Those results indicated that the expression of D-113 gene promoter was embryo specific. PMID:11902000

  9. Recognising promoter sequences using an artificial immune system

    SciTech Connect

    Cooke, D.E.; Hunt, J.E.

    1995-12-31

    We have developed an artificial immune system (AIS) which is based on the human immune system. The AIS possesses an adaptive learning mechanism which enables antibodies to emerge which can be used for classification tasks. In this paper, we describe how the AIS has been used to evolve antibodies which can classify promoter containing and promoter negative DNA sequences. The DNA sequences used for teaching were 57 nucleotides in length and contained procaryotic promoters. The system classified previously unseen DNA sequences with an accuracy of approximately 90%.

  10. Cloning of a marine cyanobacterial promoter for foreign gene expression using a promoter probe vector

    SciTech Connect

    Sode, Koji; Hatano, Naoaki; Tatara, Masahiro

    1996-06-01

    A marine cyanobacterial promoter was cloned to allow efficient foreign gene expression. This was carried out using chloramphenicol acetyl transferase (CAT) as a marker protein. For rapid and simple measurement of CAT activity, a method based on a fluorescently labeled substrate was improved by utilizing HPLC equipped with a flow-through fluorescent spectrophotometer. This method was used in conjunction with a newly constructed promoter probe vector. Cyanobacterial transformants, harboring plasmid containing a cloned 2-kbp marine cyanobacterial genomic fragment, showed a 10-fold higher CAT activity, compared with that achieved using the kanamycin-resistant gene promoter. From the sequence analysis of the cloned fragment, a putative promoter region was found. 20 refs., 7 figs., 2 tabs.

  11. In vitro mapping of Myotonic Dystrophy (DM) gene promoter

    SciTech Connect

    Storbeck, C.J.; Sabourin, L.; Baird, S.

    1994-09-01

    The Myotonic Dystrophy Kinase (DMK) gene has been cloned and shared homology to serine/threonine protein kinases. Overexpression of this gene in stably transfected mouse myoblasts has been shown to inhibit fusion into myotubes while myoblasts stably transfected with an antisense construct show increased fusion potential. These experiments, along with data showing that the DM gene is highly expressed in muscle have highlighted the possibility of DMK being involved in myogenesis. The promoter region of the DM gene lacks a consensus TATA box and CAAT box, but harbours numerous transcription binding sites. Clones containing extended 5{prime} upstream sequences (UPS) of DMK only weakly drive the reporter gene chloramphenicol acetyl transferase (CAT) when transfected into C2C12 mouse myoblasts. However, four E-boxes are present in the first intron of the DM gene and transient assays show increased expression of the CAT gene when the first intron is present downstream of these 5{prime} UPS in an orientation dependent manner. Comparison between mouse and human sequence reveals that the regions in the first intron where the E-boxes are located are highly conserved. The mapping of the promoter and the importance of the first intron in the control of DMK expression will be presented.

  12. Characterization of a barley Rubisco activase gene promoter

    SciTech Connect

    Strickland, J.A.; Rundle, S.J.; Zielinski, R. )

    1990-05-01

    Barley Rubisco Activase (Rca) is a nuclear encoded chloroplast enzyme that activates Rubisco to catalytic competence. Rca mRNA accumulation in barley is light-regulated; the 5{prime}-flanking region of a highly expressed barley Rca gene (HvRca-1) contains several sequence motifs similar to those found in the promoter of other light-regulated, nuclear genes. We have characterized the cis-acting regulatory regions of HvRca-1 by deletion analysis of the 5{prime} flanking region of a cloned gene. These constructs have been assayed in vitro by gel mobility shift assays, as well as by DNA footprinting. Putative regulatory sequences detected in vitro have also been tested in vivo by constructing chimeric genes consisting of deletion mutant promoters fused to a promoterless {beta}-glucuronidase reporter gene. Comparison of results obtained from complimentary parallel in vitro and in vivo assays of identical promoter deletions have provided information on cis-acting regulatory regions of HvRca-1.

  13. Universal light-switchable gene promoter system

    DOEpatents

    Quail, Peter H.; Huq, Enamul; Tepperman, James; Sato, Sae

    2005-02-22

    An artificial promoter system that can be fused upstream of any desired gene enabling reversible induction or repression of the expression of the gene at will in any suitable host cell or organisms by light is described. The design of the system is such that a molecule of the plant photoreceptor phytochrome is targeted to the specific DNA binding site in the promoter by a protein domain that is fused to the phytochrome and that specifically recognizes this binding site. This bound phytochrome, upon activation by light, recruits a second fusion protein consisting of a protein that binds to phytochrome only upon light activation and a transcriptional activation domain that activates expression of the gene downstream of the promoter.

  14. Nemertean toxin genes revealed through transcriptome sequencing.

    PubMed

    Whelan, Nathan V; Kocot, Kevin M; Santos, Scott R; Halanych, Kenneth M

    2014-11-27

    Nemerteans are one of few animal groups that have evolved the ability to utilize toxins for both defense and subduing prey, but little is known about specific nemertean toxins. In particular, no study has identified specific toxin genes even though peptide toxins are known from some nemertean species. Information about toxin genes is needed to better understand evolution of toxins across animals and possibly provide novel targets for pharmaceutical and industrial applications. We sequenced and annotated transcriptomes of two free-living and one commensal nemertean and annotated an additional six publicly available nemertean transcriptomes to identify putative toxin genes. Approximately 63-74% of predicted open reading frames in each transcriptome were annotated with gene names, and all species had similar percentages of transcripts annotated with each higher-level GO term. Every nemertean analyzed possessed genes with high sequence similarities to known animal toxins including those from stonefish, cephalopods, and sea anemones. One toxin-like gene found in all nemerteans analyzed had high sequence similarity to Plancitoxin-1, a DNase II hepatotoxin that may function well at low pH, which suggests that the acidic body walls of some nemerteans could work to enhance the efficacy of protein toxins. The highest number of toxin-like genes found in any one species was seven and the lowest was three. The diversity of toxin-like nemertean genes found here is greater than previously documented, and these animals are likely an ideal system for exploring toxin evolution and industrial applications of toxins.

  15. Promoter and expression studies on an Arabidopsis thaliana dehydrin gene.

    PubMed

    Rouse, D T; Marotta, R; Parish, R W

    1996-03-01

    A genomic clone of a group 2 lea/rab/dehydrin gene from Arabidopsis thaliana, Xero2/lti30, was cloned and sequenced. Promoter-GUS fusions were introduced into plants to analyse the promoter and determine expression patterns. Using root cultures, GUS expression was found to be moderately stimulated by abscisic acid (ABA), wounding, cold and dehydration. Results with an ABA-deficient mutant suggested endogenous ABA is required for these responses. Promoter deletion studies indicated multiple cis-acting elements are involved in the induction of the gene. GUS expression occurred in desiccated seeds, in all tissues of young seedlings and in roots (with the exception of the root tip), desiccated pollen grains, trichomes and the vascular tissues of leaves and stems in mature plants.

  16. Cloning and Sequencing the First HLA Gene

    PubMed Central

    Jordan, Bertrand R.

    2010-01-01

    This Perspectives article recounts the isolation and sequencing of the first human histocompatibility gene (HLA) in 1980–1981. At the time, general knowledge of the molecules of the immune system was already fairly extensive, and gene rearrangements in the immunoglobulin complex (discovered in 1976) had generated much excitement: HLA was quite obviously the next frontier. The author was able to use a homologous murine H-2 cDNA to identify putative human HLA genomic clones in a λ-phage library and thus to isolate and sequence the first human histocompatibility gene. This personal account relates the steps that led to this result, describes the highly competitive international environment, and highlights the role of location, connections, and sheer luck in such an achievement. It also puts this work in perspective with a short description of the current knowledge of histocompatibility genes and, finally, presents some reflections on the meaning of “discovery.” PMID:20457890

  17. Isolation and sequence analysis of napin seed specific promoter from Iranian Rapeseed (Brassica napus L.).

    PubMed

    Sohrabi, Maryam; Zebarjadi, Alireza; Najaphy, Abdollah; Kahrizi, Danial

    2015-06-01

    Rapeseed (Brassica napus L.) has become an important crop during the last 30years. In addition to a high lipid level, the seeds also have a significant protein content, which constitutes 20-25% of the dry seed weight. The synthesis of storage proteins is primarily controlled at transcriptional level and seed-specific expression has been shown to be conferred upon the promoter regions of many storage protein genes. Napin is one of the main storage proteins in rapeseed(')s embryo that is produced in seed developing stage. Its promoter region located at 5' upstream of the napin gene has already been isolated (GenBank number, EU416279.1). In current research, seed-specific promoter (napin) of Iranian B. napus L. was isolated from the genomic DNA and cloned into pBI121 plant binary vector to use in future researches. For this purpose, the napin promoter was amplified by PCR method using specific primers, cloned in pSK(+) vector and sequenced. Sequencing analysis showed that the cloned promoter contained all of conserved motifs such as TATA box (TATAAA), RY repeats (CATGCA), dist-B (TCAAACACC) and prox-B elements (GCCACTTGTC), G-box (CACGTG) and CAAT Motifs, which constituted the seed-specific promoter activity and according to this analysis, the seed-specific promoter activity of cloned sequence was predicted. Based on sequence distances of nucleotide sequences, our sequence had the highest similarity (99.8%) whit B. napus sequence (with EU416279.1 accession number). Finally the promoter obtained might be interesting not only as a useful tool for biotechnological application but also for fundamental research.

  18. Isolation and sequence analysis of napin seed specific promoter from Iranian Rapeseed (Brassica napus L.).

    PubMed

    Sohrabi, Maryam; Zebarjadi, Alireza; Najaphy, Abdollah; Kahrizi, Danial

    2015-06-01

    Rapeseed (Brassica napus L.) has become an important crop during the last 30years. In addition to a high lipid level, the seeds also have a significant protein content, which constitutes 20-25% of the dry seed weight. The synthesis of storage proteins is primarily controlled at transcriptional level and seed-specific expression has been shown to be conferred upon the promoter regions of many storage protein genes. Napin is one of the main storage proteins in rapeseed(')s embryo that is produced in seed developing stage. Its promoter region located at 5' upstream of the napin gene has already been isolated (GenBank number, EU416279.1). In current research, seed-specific promoter (napin) of Iranian B. napus L. was isolated from the genomic DNA and cloned into pBI121 plant binary vector to use in future researches. For this purpose, the napin promoter was amplified by PCR method using specific primers, cloned in pSK(+) vector and sequenced. Sequencing analysis showed that the cloned promoter contained all of conserved motifs such as TATA box (TATAAA), RY repeats (CATGCA), dist-B (TCAAACACC) and prox-B elements (GCCACTTGTC), G-box (CACGTG) and CAAT Motifs, which constituted the seed-specific promoter activity and according to this analysis, the seed-specific promoter activity of cloned sequence was predicted. Based on sequence distances of nucleotide sequences, our sequence had the highest similarity (99.8%) whit B. napus sequence (with EU416279.1 accession number). Finally the promoter obtained might be interesting not only as a useful tool for biotechnological application but also for fundamental research. PMID:25797503

  19. Molecular cloning and analysis of the Catsper1 gene promoter.

    PubMed

    Mata-Rocha, Minerva; Alvarado-Cuevas, Edith; Hernández-Sánchez, Javier; Cerecedo, Doris; Felix, Ricardo; Hernández-Reyes, Adriana; Tesoro-Cruz, Emiliano; Oviedo, Norma

    2013-05-01

    CatSper channels are essential for hyperactivity of sperm flagellum, progesterone-mediated chemotaxis and oocyte fertilization. Catsper genes are exclusively expressed in the testis during spermatogenesis, but the function and regulation of the corresponding promoter regions are unknown. Here, we report the cloning and characterization of the promoter regions in the human and murine Catsper1 genes. These promoter regions were identified and isolated from genomic DNA, and transcriptional activities were tested in vitro after transfection into human embryonic kidney 293, mouse Sertoli cells 1 and GC-1spg cell lines as well as by injecting plasmids directly into mouse testes. Although the human and murine Catsper1 promoters lacked a TATA box, a well-conserved CRE site was identified. Both sequences may be considered as TATAless promoters because their transcriptional activity was not affected after deletion of TATA box-like sites. Several transcription initiation sites were revealed by RNA ligase-mediated rapid amplification of the cDNA 5'-ends. We also found that the immediate upstream region and the first exon in the human CATSPER1 gene negatively regulate transcriptional activity. In the murine Catsper1 promoter, binding sites for transcription factors SRY, SOX9 and CREB were protected by the presence of nuclear testis proteins in DNAse degradation assays. Likewise, the mouse Catsper1 promoter exhibited transcriptional activity in both orientations and displayed significant expression levels in mouse testis in vivo, whereas the suppression of transcription signals in the promoter resulted in low expression levels. This study, thus, represents the first identification of the transcriptional control regions in the genes encoding the human and murine CatSper channels.

  20. Thermodynamics-based models of transcriptional regulation with gene sequence.

    PubMed

    Wang, Shuqiang; Shen, Yanyan; Hu, Jinxing

    2015-12-01

    Quantitative models of gene regulatory activity have the potential to improve our mechanistic understanding of transcriptional regulation. However, the few models available today have been based on simplistic assumptions about the sequences being modeled or heuristic approximations of the underlying regulatory mechanisms. In this work, we have developed a thermodynamics-based model to predict gene expression driven by any DNA sequence. The proposed model relies on a continuous time, differential equation description of transcriptional dynamics. The sequence features of the promoter are exploited to derive the binding affinity which is derived based on statistical molecular thermodynamics. Experimental results show that the proposed model can effectively identify the activity levels of transcription factors and the regulatory parameters. Comparing with the previous models, the proposed model can reveal more biological sense.

  1. Alternative promoters of gene MAGE4a

    SciTech Connect

    De Plaen, E.; Naerhuyzen, B.; De Smet, C.

    1997-03-01

    Gene MAGE-4 (HGMW-approved symbol MAGE4) is expressed in several types of tumors, but not in normal tissues, except testis and placenta. The 5{prime} end of this gene contains eight homologous exons spread over a 5.8-kb region. These exons are alternatively spliced to a unique second exon and a unique third exon, which encodes a protein of 317 amino acids. The analysis of transcripts found in testis, placenta, and a sarcoma cell line showed that each of the alternative first exons is used in at least one of these tissues. Various regions of the promoter of the fifth alternative exon (1.5) were cloned in a luciferase reporter plasmid, and the constructs were transfected in a sarcoma cell line that expresses MAGE-4. Two Ets motifs located between positions -70 and -29 relative to the transcription start site were found to drive 55% of the promoter activity. A region containing an Sp1 consensus binding site located upstream of the two Ets motifs was found to be responsible for 44% of the transcriptional activity. MAGE-4a promoters 1.4 and 1.6, which also contain the Sp1 and the two Ets binding motifs, supported a level of transcription comparable to that of promoter 1.5, whereas promoter 1.1, which contains only one Ets binding site, was sixfold less active. In line with observations made with gene MAGE-1 (HGMW-approved symbol MAGE1), we found that promoter 1.5 stimulated a high level of transcription in a melanoma cell line that does not express MAGE-4. This suggests that the tumor-specific expression of MAGE genes is not determined by the presence of specific transcription factors. 26 refs., 7 figs., 2 tabs.

  2. Draft Genome Sequence of a Diazotrophic, Plant Growth-Promoting Rhizobacterium of the Pseudomonas syringae Complex.

    PubMed

    Patten, Cheryl L; Jeong, Haeyoung; Blakney, Andrew J C; Wallace, Natalie

    2016-01-01

    We report here the draft genome sequence of Pseudomonas syringae GR12-2, a nitrogen-fixing, plant growth-promoting bacterium, isolated from the rhizosphere of an Arctic grass. The 6.6-Mbp genome contains 5,676 protein-coding genes, including a nitrogen-fixation island similar to that in P. stutzeri. PMID:27660794

  3. Draft Genome Sequence of a Diazotrophic, Plant Growth–Promoting Rhizobacterium of the Pseudomonas syringae Complex

    PubMed Central

    Jeong, Haeyoung; Blakney, Andrew J. C.; Wallace, Natalie

    2016-01-01

    We report here the draft genome sequence of Pseudomonas syringae GR12-2, a nitrogen-fixing, plant growth–promoting bacterium, isolated from the rhizosphere of an Arctic grass. The 6.6-Mbp genome contains 5,676 protein-coding genes, including a nitrogen-fixation island similar to that in P. stutzeri. PMID:27660794

  4. Functional study of the equine beta-casein and kappa-casein gene promoters.

    PubMed

    Lenasi, Tina; Kokalj-Vokac, Nadja; Narat, Mojca; Baldi, Antonella; Dovc, Peter

    2005-01-01

    Casein genes are expressed in a tissue-specific and highly coordinated manner. The main goals of casein gene promoter studies are to unravel cis- and trans-acting factors involved in the complex signalling pathway controlling milk production, and to explore the possibility of using these promoters for tissue-specific production of heterologous proteins in the mammary gland. Here we present a comparative study of the equine beta-casein and kappa-casein gene proximal promoters. In order to confirm the assumption that in the horse, as in other mammalian species, casein genes are organized in a cluster located on a single chromosome, we performed in situ hybridization of pro-metaphase chromosomes with two BAC clones containing different equine casein genes. Sequence analysis of the beta-casein and kappa-casein gene proximal promoters revealed binding sites for activators (STAT5, GRE, NF1, MAF) and repressors (YY1, PMF), characteristic for casein genes. The alignments of casein gene promoters revealed the highest sequence identity in the proximal promoter region between the equine and human beta-casein gene promoters. We directly compared the activity of equine beta-casein and kappa-casein gene promoters in vitro using bovine mammary gland cell line BME-UV1. In this system, the kappa-casein gene proximal promoter activated the reporter gene expression more efficiently than the beta-casein gene promoter of approximately the same length. The 810 bp of beta-casein promoter activated the reporter gene expression more efficiently than the long fragment (1920 bp) and the 1206 bp fragment of the same promoter, which included also 396 bp of 5' UTR.

  5. Nemertean Toxin Genes Revealed through Transcriptome Sequencing

    PubMed Central

    Whelan, Nathan V.; Kocot, Kevin M.; Santos, Scott R.; Halanych, Kenneth M.

    2014-01-01

    Nemerteans are one of few animal groups that have evolved the ability to utilize toxins for both defense and subduing prey, but little is known about specific nemertean toxins. In particular, no study has identified specific toxin genes even though peptide toxins are known from some nemertean species. Information about toxin genes is needed to better understand evolution of toxins across animals and possibly provide novel targets for pharmaceutical and industrial applications. We sequenced and annotated transcriptomes of two free-living and one commensal nemertean and annotated an additional six publicly available nemertean transcriptomes to identify putative toxin genes. Approximately 63–74% of predicted open reading frames in each transcriptome were annotated with gene names, and all species had similar percentages of transcripts annotated with each higher-level GO term. Every nemertean analyzed possessed genes with high sequence similarities to known animal toxins including those from stonefish, cephalopods, and sea anemones. One toxin-like gene found in all nemerteans analyzed had high sequence similarity to Plancitoxin-1, a DNase II hepatotoxin that may function well at low pH, which suggests that the acidic body walls of some nemerteans could work to enhance the efficacy of protein toxins. The highest number of toxin-like genes found in any one species was seven and the lowest was three. The diversity of toxin-like nemertean genes found here is greater than previously documented, and these animals are likely an ideal system for exploring toxin evolution and industrial applications of toxins. PMID:25432940

  6. Non-contiguous finished genome sequence of plant-growth promoting Serratia proteamaculans S4

    PubMed Central

    Goodwin, Lynne A.; Högberg, Nils; Kyrpides, Nikos C.; Alström, Sadhna; Bruce, David; Quintana, Beverly; Munk, Christine; Daligault, Hajnalka; Teshima, Hazuki; Davenport, Karen; Reitenga, Krista; Green, Lance; Chain, Patrick; Erkkila, Tracy; Gu, Wei; Zhang, Xiaojing; Xu, Yan; Kunde, Yulia; Chertkov, Olga; Han, James; Han, Cliff; Detter, John C.; Ivanova, Natalia; Pati, Amrita; Chen, Amy; Szeto, Ernest; Mavromatis, Kostas; Huntemann, Marcel; Nolan, Matt; Pitluck, Sam; Deshpande, Shweta; Markowitz, Victor; Pagani, Ioanna; Klenk, Hans-Peter; Woyke, Tanja; Finlay, Roger D.

    2013-01-01

    Serratia proteamaculans S4 (previously Serratia sp. S4), isolated from the rhizosphere of wild Equisetum sp., has the ability to stimulate plant growth and to suppress the growth of several soil-borne fungal pathogens of economically important crops. Here we present the non-contiguous, finished genome sequence of S. proteamaculans S4, which consists of a 5,324,944 bp circular chromosome and a 129,797 bp circular plasmid. The chromosome contains 5,008 predicted genes while the plasmid comprises 134 predicted genes. In total, 4,993 genes are assigned as protein-coding genes. The genome consists of 22 rRNA genes, 82 tRNA genes and 58 pseudogenes. This genome is a part of the project “Genomics of four rapeseed plant growth-promoting bacteria with antagonistic effect on plant pathogens” awarded through the 2010 DOE-JGI’s Community Sequencing Program. PMID:24501629

  7. DNA sequence of the Escherichia coli tonB gene.

    PubMed Central

    Postle, K; Good, R F

    1983-01-01

    The nucleotide sequence of a cloned section of the Escherichia coli chromosome containing the tonB gene has been determined. Transcription initiation and termination sites for tonB RNA have been determined by S1 nuclease mapping. The tonB promoter and terminator resemble other E. coli promoters and terminators; the sequence of the tonB terminator region suggests that it may function bidirectionally. The DNA sequence specifies an open translation reading frame between the 5' and 3' RNA termini whose location is consistent with the position of previously isolated tonB::IS1 mutations. The DNA sequence predicts a proline-rich protein with a calculated size of 26.1-26.6 kilodaltons (239-244 amino acids), depending on which of three potential initiation codons is utilized. The predicted NH2 terminus of tonB protein resembles the proteolytically cleaved signal sequences of E. coli periplasmic and outer membrane proteins; the overall hydrophilic character of the protein sequence suggests that the bulk of the tonB protein is not embedded within the inner or outer membrane. A significant discrepancy exists between the calculated size of tonB protein and the apparent size of 36 kilodaltons determined by sodium dodecyl sulfate/polyacrylamide gel electrophoresis. Images PMID:6310567

  8. Sequence determinants spanning -35 motif and AT-rich spacer region impacting Ehrlichia chaffeensis Sigma 70-dependent promoter activity of two differentially expressed p28 outer membrane protein genes

    PubMed Central

    Liu, Huitao; Jakkula, Laxmi U. M. R.; Von Ohlen, Tonia; Ganta, Roman R.

    2016-01-01

    Ehrlichia chaffeensis is an obligate intracellular tick-borne bacterium which causes the disease, human monocytic ehrlichiosis. Ehrlichia chaffeensis contains only two sigma factors, σ32 and σ70. It is difficult to study E. chaffeensis gene regulation due to lack of a transformation system. We developed an Escherichia coli-based transcription system to study E. chaffeensis transcriptional regulation. An E. coli strain with its σ70 repressed with trp promoter is used to express E. chaffeensis σ70. The E. coli system and our previously established in vitro transcription system were used to map transcriptional differences of two Ehrlichia genes encoding p28-outer membrane proteins 14 and 19. We mapped the -10 and -35 motifs and the AT rich spacers located between the two motifs by performing detailed mutational analysis. Mutations within the -35 motif of the genes impacted transcription differently, while -10 motif deletions had no impact. The AT-rich spacers also contributed to transcriptional differences. We further demonstrated that the domain 4.2 of E. chaffeensis σ70 is important for regulating promoter activity and the deletion of region 1.1 of E. chaffeensis σ70 causes enhancement of the promoter activity. This is the first study defining the promoters of two closely related E. chaffeensis genes. PMID:27402867

  9. Genomic organization and promoter analysis of a transcriptional repressor gene from Fenneropenaeus chinensis.

    PubMed

    Lai, Xiaofang; Shen, Shanrui; Gao, Huan; Yan, Binlun

    2015-02-01

    In this study, we cloned and sequenced genomic sequences from a Fenneropenaeus chinensis transcriptional repressor gene, FcTR. The FcTR gene is 2,671 bp in length and has four exons and three introns. The 873 bp promoter contains several transcription factor binding sites, including a TATA box and a cyclic AMP-responsive element. Promoter deletion analysis using a luciferase reporter gene identified regulatory elements. Challenge with white spot syndrome virus increased expression from the promoter-deletion constructs. These results suggest that FcTR might play an important role in the shrimp immune response.

  10. Temperature influences on the expression of GFP promoted by the upstream sequence of cpcB from Arthrospira platensis

    NASA Astrophysics Data System (ADS)

    Lu, Yongzhong; Zhang, Xuecheng

    2007-07-01

    In order to investigate the regulation mechanism of the phycocyanin gene, a series of functional analyses of the upstream sequence of cpcB gene from Arthrospira platensis were conducted in E. coli with green fluorescent protein encoding gene (gfp) as the reporter. Results showed that the gfp gene could express at a high level under the promotion of the upstream sequence, suggesting the existence of some strong promoter elements in it. The expression of GFP was influenced by temperature. Higher temperature led to higher expression level. The bioinformatics analyses followed by mutation analyses on the secondary structure of translation initiation region (TIR) revealed that RNA thermosensor might account for the temperature regulation.

  11. The complete genome sequence of the plant growth-promoting bacterium Pseudomonas sp. UW4.

    PubMed

    Duan, Jin; Jiang, Wei; Cheng, Zhenyu; Heikkila, John J; Glick, Bernard R

    2013-01-01

    The plant growth-promoting bacterium (PGPB) Pseudomonas sp. UW4, previously isolated from the rhizosphere of common reeds growing on the campus of the University of Waterloo, promotes plant growth in the presence of different environmental stresses, such as flooding, high concentrations of salt, cold, heavy metals, drought and phytopathogens. In this work, the genome sequence of UW4 was obtained by pyrosequencing and the gaps between the contigs were closed by directed PCR. The P. sp. UW4 genome contains a single circular chromosome that is 6,183,388 bp with a 60.05% G+C content. The bacterial genome contains 5,423 predicted protein-coding sequences that occupy 87.2% of the genome. Nineteen genomic islands (GIs) were predicted and thirty one complete putative insertion sequences were identified. Genes potentially involved in plant growth promotion such as indole-3-acetic acid (IAA) biosynthesis, trehalose production, siderophore production, acetoin synthesis, and phosphate solubilization were determined. Moreover, genes that contribute to the environmental fitness of UW4 were also observed including genes responsible for heavy metal resistance such as nickel, copper, cadmium, zinc, molybdate, cobalt, arsenate, and chromate. Whole-genome comparison with other completely sequenced Pseudomonas strains and phylogeny of four concatenated "housekeeping" genes (16S rRNA, gyrB, rpoB and rpoD) of 128 Pseudomonas strains revealed that UW4 belongs to the fluorescens group, jessenii subgroup. PMID:23516524

  12. The complete genome sequence of the plant growth-promoting bacterium Pseudomonas sp. UW4.

    PubMed

    Duan, Jin; Jiang, Wei; Cheng, Zhenyu; Heikkila, John J; Glick, Bernard R

    2013-01-01

    The plant growth-promoting bacterium (PGPB) Pseudomonas sp. UW4, previously isolated from the rhizosphere of common reeds growing on the campus of the University of Waterloo, promotes plant growth in the presence of different environmental stresses, such as flooding, high concentrations of salt, cold, heavy metals, drought and phytopathogens. In this work, the genome sequence of UW4 was obtained by pyrosequencing and the gaps between the contigs were closed by directed PCR. The P. sp. UW4 genome contains a single circular chromosome that is 6,183,388 bp with a 60.05% G+C content. The bacterial genome contains 5,423 predicted protein-coding sequences that occupy 87.2% of the genome. Nineteen genomic islands (GIs) were predicted and thirty one complete putative insertion sequences were identified. Genes potentially involved in plant growth promotion such as indole-3-acetic acid (IAA) biosynthesis, trehalose production, siderophore production, acetoin synthesis, and phosphate solubilization were determined. Moreover, genes that contribute to the environmental fitness of UW4 were also observed including genes responsible for heavy metal resistance such as nickel, copper, cadmium, zinc, molybdate, cobalt, arsenate, and chromate. Whole-genome comparison with other completely sequenced Pseudomonas strains and phylogeny of four concatenated "housekeeping" genes (16S rRNA, gyrB, rpoB and rpoD) of 128 Pseudomonas strains revealed that UW4 belongs to the fluorescens group, jessenii subgroup.

  13. The Complete Genome Sequence of the Plant Growth-Promoting Bacterium Pseudomonas sp. UW4

    PubMed Central

    Duan, Jin; Jiang, Wei; Cheng, Zhenyu; Heikkila, John J.; Glick, Bernard R.

    2013-01-01

    The plant growth-promoting bacterium (PGPB) Pseudomonas sp. UW4, previously isolated from the rhizosphere of common reeds growing on the campus of the University of Waterloo, promotes plant growth in the presence of different environmental stresses, such as flooding, high concentrations of salt, cold, heavy metals, drought and phytopathogens. In this work, the genome sequence of UW4 was obtained by pyrosequencing and the gaps between the contigs were closed by directed PCR. The P. sp. UW4 genome contains a single circular chromosome that is 6,183,388 bp with a 60.05% G+C content. The bacterial genome contains 5,423 predicted protein-coding sequences that occupy 87.2% of the genome. Nineteen genomic islands (GIs) were predicted and thirty one complete putative insertion sequences were identified. Genes potentially involved in plant growth promotion such as indole-3-acetic acid (IAA) biosynthesis, trehalose production, siderophore production, acetoin synthesis, and phosphate solubilization were determined. Moreover, genes that contribute to the environmental fitness of UW4 were also observed including genes responsible for heavy metal resistance such as nickel, copper, cadmium, zinc, molybdate, cobalt, arsenate, and chromate. Whole-genome comparison with other completely sequenced Pseudomonas strains and phylogeny of four concatenated “housekeeping” genes (16S rRNA, gyrB, rpoB and rpoD) of 128 Pseudomonas strains revealed that UW4 belongs to the fluorescens group, jessenii subgroup. PMID:23516524

  14. Development of an intra-molecularly shuffled efficient chimeric plant promoter from plant infecting Mirabilis mosaic virus promoter sequence.

    PubMed

    Acharya, Sefali; Sengupta, Soumika; Patro, Sunita; Purohit, Sukumar; Samal, Sabindra K; Maiti, Indu B; Dey, Nrisingha

    2014-01-01

    We developed an efficient chimeric promoter, MUASMSCP, with enhanced activity and salicylic acid (SA)/abscisic acid (ABA) inducibility, incorporating the upstream activation sequence (UAS) of Mirabilis mosaic virus full-length transcript (MUAS, -297 to -38) to the 5' end of Mirabilis mosaic virus sub-genomic transcript (MSCP, -306 to -125) promoter-fragment containing the TATA element. We compared the transient activity of the MUASMSCP promoter in tobacco/Arabidopsis protoplasts and in whole plant (Petunia hybrida) with the same that obtained from CaMV35S and MUAS35SCP promoters individually. The MUASMSCP promoter showed 1.1 and 1.5 times stronger GUS-activities over that obtained from MUAS35SCP and CaMV35S promoters respectively, in tobacco (Xanthi Brad) protoplasts. In transgenic tobacco (Nicotiana tabacum, var. Samsun NN), the MUASMSCP promoter showed 1.1 and 2.2 times stronger activities than MUAS35SCP and CaMV35S(2) promoters respectively. We observed a fair correlation between MUASMSCP-, MUAS35SCP- and CaMV35S(2)-driven GUS activities with the corresponding uidA-mRNA level in transgenic plants. X-gluc staining of transgenic germinating seed-sections and whole seedlings also support above findings. Protein-extracts made from tobacco protoplasts expressing GFP and human-IL-24 genes driven individually by the MUASMSCP promoter showed enhanced expression of the reporters compared to that obtained from the CaMV35S promoter. Furthermore, MUASMSCP-driven protoplast-derived human IL-24 showed enhanced cell inhibitory activity in DU-145 prostate cancer cells compared to that obtained from the CaMV35S promoter. We propose chimeric MUASMSCP promoter developed in the study could be useful for strong constitutive expression of transgenes in both plant/animal cells and it may become an efficient substitute for CaMV35S/CaMV35S(2) promoter.

  15. Cloning and sequence of the human adrenodoxin reductase gene.

    PubMed Central

    Lin, D; Shi, Y F; Miller, W L

    1990-01-01

    Adrenodoxin reductase (ferrodoxin:NADP+ oxidoreductase, EC 1.18.1.2) is a flavoprotein mediating electron transport to all mitochondrial forms of cytochrome P450. We cloned the human adrenodoxin reductase gene and characterized it by restriction endonuclease mapping and DNA sequencing. The entire gene is approximately 12 kilobases long and consists of 12 exons. The first exon encodes the first 26 of the 32 amino acids of the signal peptide, and the second exon encodes the remainder of signal peptide and the apparent FAD binding site. The remaining 10 exons are clustered in a region of only 4.3 kilobases, separated from the first two exons by a large intron of about 5.6 kilobases. Two forms of human adrenodoxin reductase mRNA, differing by the presence or absence of 18 bases in the middle of the sequence, arise from alternate splicing at the 5' end of exon 7. This alternately spliced region is directly adjacent to the NADPH binding site, which is entirely contained in exon 6. The immediate 5' flanking region lacks TATA and CAAT boxes; however, this region is rich in G + C and contains six copies of the sequence GGGCGGG, resembling promoter sequences of "housekeeping" genes. RNase protection experiments show that transcription is initiated from multiple sites in the 5' flanking region, located about 21-91 base pairs upstream from the AUG translational initiation codon. Images PMID:2236061

  16. Transient expression directed by homologous and heterologous promoter and enhancer sequences in fish cells.

    PubMed Central

    Friedenreich, H; Schartl, M

    1990-01-01

    In order to construct fish specific expression vectors for studies on gene regulation in vitro and in vivo a variety of heterologous enhancers and promoters from mammals and from viruses of higher vertebrate cells were tested for expression of the bacterial chloramphenicol acetyl transferase reporter gene in three teleost fish cell lines. Several viral enhancers were found to be constitutively active at high levels. The human metallothionein promoter showed inducible expression in the presence of heavy metal ions. A fish sequence was isolated that can be used as a homologous constitutively active promoter for expression of foreign genes. Using the human growth hormone gene with an active promoter in fish cells for transient expression insufficient splicing and lack of translation were observed, pointing to limitations in the use of heterologous genes in gene transfer experiments. On the contrary, some heterologous promoters and enhancers functioned in fish cells as well as in their cell type of origin, indicating that corresponding transcription factors are sufficiently conserved between fish and human over a period of 900 million years of independent evolution. Images PMID:2356120

  17. Functional Capacity of Shiga-Toxin Promoter Sequences in Eukaryotic Cells

    PubMed Central

    Mejías, María P.; Fernández-Brando, Romina J.; Panek, Cecilia A.; Ramos, Maria V.; Fernández, Gabriela C.; Isturiz, Martín; Ghiringhelli, Pablo D.; Palermo, Marina S.

    2013-01-01

    Shiga toxins (Stx) are the main virulence factors in enterohemorrhagic Escherichia coli (EHEC) infections, causing diarrhea and hemolytic uremic syndrome (HUS). The genes encoding for Shiga toxin-2 (Stx2) are located in a bacteriophage. The toxin is formed by a single A subunit and five B subunits, each of which has its own promoter sequence. We have previously reported the expression of the B subunit within the eukaryotic environment, probably driven by their own promoter. The aim of this work was to evaluate the ability of the eukaryotic machinery to recognize stx2 sequences as eukaryotic-like promoters. Vero cells were transfected with a plasmid encoding Stx2 under its own promoter. The cytotoxic effect on these cells was similar to that observed upon incubation with purified Stx2. In addition, we showed that Stx2 expression in Stx2-insensitive BHK eukaryotic cells induced drastic morphological and cytoskeletal changes. In order to directly evaluate the capacity of the wild promoter sequences of the A and B subunits to drive protein expression in mammalian cells, GFP was cloned under eukaryotic-like putative promoter sequences. GFP expression was observed in 293T cells transfected with these constructions. These results show a novel and alternative way to synthesize Stx2 that could contribute to the global understanding of EHEC infections with immediate impact on the development of treatments or vaccines against HUS. PMID:23451160

  18. Functional domains of the Xenopus laevis 5S gene promoter.

    PubMed Central

    Pieler, T; Oei, S L; Hamm, J; Engelke, U; Erdmann, V A

    1985-01-01

    To study the fine structure of the Xenopus laevis somatic 5S gene internal control region, we have created 15 different transversions using mutagenic oligonucleotide primers. The effects of these mutations on 5S DNA transcription in vitro as well as on stable complex formation with transcription factor TF III A and TF III C in crude nuclear extracts were analyzed. Mutations in the common class III 5' promoter element (nucleotides 50-61 in the 5S gene) interfere with transcription activity and stable complex formation whenever they contradict the tDNA box A consensus sequence. The second promoter element is defined by a major sequence block (nucleotides 80-89, box C) and two additional internal residues (70 and 71) at a distance of roughly one helical turn from both the major 3' and 5' control sequences; these two 3' elements contain the primary TF III A binding domain. The remaining nucleotides (62-69 and 71-79) when mutated do not interfere with transcription activity or factor binding and thus they constitute two spacer elements within a symmetrically structured 5S gene promoter. An increase in the relative spacing of box A and box C by insertion of 3 bp between nucleotides 66 and 67 leads to a drastic reduction in transcription activity and the ability to form a stable complex with TF III A and/or TF III C. Thus, accurate spacing is essential for the proper orientation of TF III A on 5S DNA and/or TF III C binding. Images Fig. 1. Fig. 3. Fig. 4. PMID:3004969

  19. Effects of DMSO, glycerol, betaine and their combinations in detecting single nucleotide polymorphisms of epidermal growth factor receptor (EGFR) gene promoter sequence in non-small-cell lung cancer (NSCLC) patients.

    PubMed

    Jurišić, Vladimir; Obradović, Jasmina; Tošić, Natasa; Pavlović, Sonja; Kulić, Milan; Djordjević, Nataša

    2016-09-01

    The aim of the study was to examine the effects of frequently used polymerase chain reaction (PCR) additives DMSO, glycerol and betaine on amplification of GC-rich epidermal growth factor receptor (EGFR) gene promoter region, in order to detect the presence of -216G>T and -191C>A gene variations in non-small-cell lung cancer (NSCLC) patients. PCR products and restriction fragments were detected by electrophoresis on 8% polyacrylamide gel and 3% agarose gel. Our analysis shows that single used additives including DMSO in concentration of 7% and 10%, glycerol in concentration of 10%, 15% and 20%, as well as betaine in concentration of 1M, 1.5M and 2M significantly enhanced the yield and specificity of PCR reaction. In addition, the combination of 10% DMSO with 15% glycerol has shown positive effects, whereas other analyzed combinations of additives failed to amplify the EGFR promoter region. PMID:27284695

  20. Mutations of the ompK36 porin gene and promoter impact responses of sequence type 258, KPC-2-producing Klebsiella pneumoniae strains to doripenem and doripenem-colistin.

    PubMed

    Clancy, Cornelius J; Chen, Liang; Hong, Jae H; Cheng, Shaoji; Hao, Binghua; Shields, Ryan K; Farrell, Annie N; Doi, Yohei; Zhao, Yanan; Perlin, David S; Kreiswirth, Barry N; Nguyen, M Hong

    2013-11-01

    Doripenem-colistin exerts synergy against some, but not all, Klebsiella pneumoniae carbapenemase (KPC)-producing K. pneumoniae strains in vitro. We determined if doripenem MICs and/or ompK36 porin gene mutations impacted the responses of 23 sequence type 258 (ST258), KPC-2-producing strains to the combination of doripenem (8 μg/ml) and colistin (2 μg/ml) during time-kill assays. The median doripenem and colistin MICs were 32 and 4 μg/ml. Doripenem MICs did not correlate with KPC-2 expression levels. Five and 18 strains had wild-type and mutant ompK36, respectively. The most common mutations were IS5 promoter insertions (n = 7) and insertions encoding glycine and aspartic acid at amino acid (aa) positions 134 and 135 (ins aa134-135 GD; n = 8), which were associated with higher doripenem MICs than other mutations or wild-type ompK36 (all P values ≤ 0.04). Bactericidal activity (24 h) was achieved by doripenem-colistin against 12%, 43%, and 75% of ins aa134-135 GD, IS5, and wild-type/other mutants, respectively (P = 0.04). Doripenem-colistin was more active in time-kill studies than colistin at 12 and 24 h if the doripenem MIC was ≤8 μg/ml (P = 0.0007 and 0.09, respectively), but not if the MIC was >8 μg/ml (P = 0.10 and 0.16). Likewise, doripenem-colistin was more active at 12 and 24 h against the wild type/other mutants than ins aa134-135 GD or IS5 mutants (P = 0.007 and 0.0007). By multivariate analysis, the absence of ins aa134-135 GD or IS5 mutations was the only independent predictor of doripenem-colistin responses at 24 h (P = 0.002). In conclusion, ompK36 genotypes identified ST258 KPC-K. pneumoniae strains that were most likely to respond to doripenem-colistin.

  1. Comprehensive annotation of bidirectional promoters identifies co-regulation among breast and ovarian cancer genes.

    PubMed

    Yang, Mary Q; Koehly, Laura M; Elnitski, Laura L

    2007-04-20

    A "bidirectional gene pair" comprises two adjacent genes whose transcription start sites are neighboring and directed away from each other. The intervening regulatory region is called a "bidirectional promoter." These promoters are often associated with genes that function in DNA repair, with the potential to participate in the development of cancer. No connection between these gene pairs and cancer has been previously investigated. Using the database of spliced-expressed sequence tags (ESTs), we identified the most complete collection of human transcripts under the control of bidirectional promoters. A rigorous screen of the spliced EST data identified new bidirectional promoters, many of which functioned as alternative promoters or regulated novel transcripts. Additionally, we show a highly significant enrichment of bidirectional promoters in genes implicated in somatic cancer, including a substantial number of genes implicated in breast and ovarian cancers. The repeated use of this promoter structure in the human genome suggests it could regulate co-expression patterns among groups of genes. Using microarray expression data from 79 human tissues, we verify regulatory networks among genes controlled by bidirectional promoters. Subsets of these promoters contain similar combinations of transcription factor binding sites, including evolutionarily conserved ETS factor binding sites in ERBB2, FANCD2, and BRCA2. Interpreting the regulation of genes involved in co-expression networks, especially those involved in cancer, will be an important step toward defining molecular events that may contribute to disease.

  2. Mimivirus gene promoters exhibit an unprecedented conservation among all eukaryotes.

    PubMed

    Suhre, Karsten; Audic, Stéphane; Claverie, Jean-Michel

    2005-10-11

    The initial analysis of the recently sequenced genome of Acanthamoeba polyphaga Mimivirus, the largest known double-stranded DNA virus, predicted a proteome of size and complexity more akin to small parasitic bacteria than to other nucleocytoplasmic large DNA viruses and identified numerous functions never before described in a virus. It has been proposed that the Mimivirus lineage could have emerged before the individualization of cellular organisms from the three domains of life. An exhaustive in silico analysis of the noncoding moiety of all known viral genomes now uncovers the unprecedented perfect conservation of an AAAATTGA motif in close to 50% of the Mimivirus genes. This motif preferentially occurs in genes transcribed from the predicted leading strand and is associated with functions required early in the viral infectious cycle, such as transcription and protein translation. A comparison with the known promoter of unicellular eukaryotes, amoebal protists in particular, strongly suggests that the AAAATTGA motif is the structural equivalent of the TATA box core promoter element. This element is specific to the Mimivirus lineage and may correspond to an ancestral promoter structure predating the radiation of the eukaryotic kingdoms. This unprecedented conservation of core promoter regions is another exceptional feature of Mimivirus that again raises the question of its evolutionary origin.

  3. Efficient chimeric plant promoters derived from plant infecting viral promoter sequences.

    PubMed

    Acharya, Sefali; Ranjan, Rajiv; Pattanaik, Sitakanta; Maiti, Indu B; Dey, Nrisingha

    2014-02-01

    In the present study, we developed a set of three chimeric/hybrid promoters namely FSgt-PFlt, PFlt-UAS-2X and MSgt-PFlt incorporating different important domains of Figwort Mosaic Virus sub-genomic transcript promoter (FSgt, -270 to -60), Mirabilis Mosaic Virus sub-genomic transcript promoter (MSgt, -306 to -125) and Peanut Chlorotic Streak Caulimovirus full-length transcript promoter (PFlt-, -353 to +24 and PFlt-UAS, -353 to -49). We demonstrated that these chimeric/hybrid promoters can drive the expression of reporter genes in different plant species including tobacco, Arabidopsis, petunia, tomato and spinach. FSgt-PFlt, PFlt-UAS-2X and MSgt-PFlt promoters showed 4.2, 1.5 and 1.2 times stronger GUS activities compared to the activity of the CaMV35S promoter, respectively, in tobacco protoplasts. Protoplast-derived recombinant promoter driven GFP showed enhanced accumulation compared to that obtained under the CaMV35S promoter. FSgt-PFlt, PFlt-UAS-2X and MSgt-PFlt promoters showed 3.0, 1.3 and 1.0 times stronger activities than the activity of the CaMV35S² (a modified version of the CaMV35S promoter with double enhancer domain) promoter, respectively, in tobacco (Nicotiana tabacum, var. Samsun NN). Alongside, we observed a fair correlation between recombinant promoter-driven GUS accumulation with the corresponding uidA-mRNA level in transgenic tobacco. Histochemical (X-gluc) staining of whole transgenic seedlings and fluorescence images of ImaGene Green™ treated floral parts expressing the GUS under the control of recombinant promoters also support above findings. Furthermore, we confirmed that these chimeric promoters are inducible in the presence of 150 μM salicylic acid (SA) and abscisic acid (ABA). Taken altogether, we propose that SA/ABA inducible chimeric/recombinant promoters could be used for strong expression of gene(s) of interest in crop plants.

  4. Maize rbcS promoter activity depends on sequence elements not found in dicot rbcS promoters.

    PubMed Central

    Schäffner, A R; Sheen, J

    1991-01-01

    Although the molecular mechanisms of dicot photosynthetic gene regulation have been pursued actively, comparable studies of monocot regulation have been slow to come forth. We show here that monocot (maize and wheat) but not dicot (pea, tobacco, and Arabidopsis) ribulose-1,5-bisphosphate carboxylase small subunit (rbcS) gene promoters are active in maize mesophyll protoplasts. The evolutionarily conserved GT and G boxes of dicot rbcS promoters are not essential for light-responsive expression in monocot leaf cells. Instead, at least six constitutive and light-sensitive regulatory elements are likely important for maize rbcS expression. Synergism between upstream and downstream promoter elements is required. Whereas in dicots, light triggers coupled leaf development and photosynthetic gene expression, in monocots, light regulation of rbcS is uncoupled from leaf development. Light regulation of maize rbcS may be divided into direct and indirect contributions mediated by different regulatory elements. Because wheat and maize rbcS promoters show sequence homologies and similar expression patterns in monocot and dicot leaf cells, it appears likely that monocots share conserved regulatory elements irrespective of whether they utilize the C3 or C4 pathway for carbon fixation. PMID:1822995

  5. Analysis of cis-sequence of subgenomic transcript promoter from the Figwort mosaic virus and comparison of promoter activity with the cauliflower mosaic virus promoters in monocot and dicot cells.

    PubMed

    Bhattacharyya, Somnath; Dey, Nrisingha; Maiti, Indu B

    2002-12-01

    A sub-genomic transcript (Sgt) promoter was isolated from the Figwort mosaic virus (FMV) genomic clone. The FMV Sgt promoter was linked to heterologous coding sequences to form a chimeric gene construct. The 5'-3'-boundaries required for maximal activity and involvement of cis-sequences for optimal expression in plants were defined by 5'-, 3'-end deletion and internal deletion analysis of FMV Sgt promoter fragments coupled with a beta-glucuronidase reporter gene in both transient protoplast expression experiments and in transgenic plants. A 301 bp FMV Sgt promoter fragment (sequence -270 to +31 from the transcription start site; TSS) provided maximum promoter activity. The TSS of the FMV Sgt promoter was determined by primer extension analysis using total RNA from transgenic plants developed for FMV Sgt promoter: uidA fusion gene. An activator domain located upstream of the TATA box at -70 to -100 from TSS is absolutely required for promoter activity and its function is critically position-dependent with respect to TATA box. Two sequence motifs AGATTTTAAT (coordinates -100 to -91) and GTAAGCGC (coordinates -80 to -73) were found to be essential for promoter activity. The FMV Sgt promoter is less active in monocot cells; FMV Sgt promoter expression level was about 27.5-fold higher in tobacco cells compared to that in maize cells. Comparative expression analysis of FMV Sgt promoter with cauliflower mosaic virus (CaMV) 35S promoter showed that the FMV Sgt promoter is about 2-fold stronger than the CaMV 35S promoter. The FMV Sgt promoter is a constitutive promoter; expression level in seedlings was in the order: root>leaf>stem.

  6. Reporter Gene Silencing in Targeted Mouse Mutants Is Associated with Promoter CpG Island Methylation

    PubMed Central

    Kirov, Julia V.; Adkisson, Michael; Nava, A. J.; Cipollone, Andreana; Willis, Brandon; Engelhard, Eric K.; Lloyd, K. C. Kent; de Jong, Pieter; West, David B.

    2015-01-01

    Targeted mutations in mouse disrupt local chromatin structure and may lead to unanticipated local effects. We evaluated targeted gene promoter silencing in a group of six mutants carrying the tm1a Knockout Mouse Project allele containing both a LacZ reporter gene driven by the native promoter and a neo selection cassette. Messenger RNA levels of the reporter gene and targeted gene were assessed by qRT-PCR, and methylation of the promoter CpG islands and LacZ coding sequence were evaluated by sequencing of bisulfite-treated DNA. Mutants were stratified by LacZ staining into presumed Silenced and Expressed reporter genes. Silenced mutants had reduced relative quantities LacZ mRNA and greater CpG Island methylation compared with the Expressed mutant group. Within the silenced group, LacZ coding sequence methylation was significantly and positively correlated with CpG Island methylation, while promoter CpG methylation was only weakly correlated with LacZ gene mRNA. The results support the conclusion that there is promoter silencing in a subset of mutants carrying the tm1a allele. The features of targeted genes which promote local silencing when targeted remain unknown. PMID:26275310

  7. RNA Target Sequences Promote Spreading of RNA Silencing1

    PubMed Central

    Van Houdt, Helena; Bleys, Annick; Depicker, Anna

    2003-01-01

    It is generally recognized that a silencing-inducing locus can efficiently reduce the expression of genes that give rise to transcripts partially homologous to those produced by the silencing-inducing locus (primary targets). Interestingly, the expression of genes that produce transcripts without homology to the silencing-inducing locus (secondary targets) can also be decreased dramatically via transitive RNA silencing. This phenomenon requires primary target RNAs that contain sequences homologous to secondary target RNAs. Sequences upstream from the region homologous to the silencing inducer in the primary target transcripts give rise to approximately 22-nucleotide small RNAs, coinciding with the region homologous to the secondary target. The presence of these small RNAs corresponds with reduced expression of the secondary target whose transcripts are not homologous to the silencing inducer. The data suggest that in transgenic plants, targets of RNA silencing are involved in the expansion of the pool of functional small interfering RNAs. Furthermore, methylation of target genes in sequences without homology to the initial silencing inducer indicates not only that RNA silencing can expand across target RNAs but also that methylation can spread along target genes. PMID:12529532

  8. The first determination of DNA sequence of a specific gene.

    PubMed

    Inouye, Masayori

    2016-05-10

    How and when the first DNA sequence of a gene was determined? In 1977, F. Sanger came up with an innovative technology to sequence DNA by using chain terminators, and determined the entire DNA sequence of the 5375-base genome of bacteriophage φX 174 (Sanger et al., 1977). While this Sanger's achievement has been recognized as the first DNA sequencing of genes, we had determined DNA sequence of a gene, albeit a partial sequence, 11 years before the Sanger's DNA sequence (Okada et al., 1966).

  9. Yeast homologous recombination-based promoter engineering for the activation of silent natural product biosynthetic gene clusters.

    PubMed

    Montiel, Daniel; Kang, Hahk-Soo; Chang, Fang-Yuan; Charlop-Powers, Zachary; Brady, Sean F

    2015-07-21

    Large-scale sequencing of prokaryotic (meta)genomic DNA suggests that most bacterial natural product gene clusters are not expressed under common laboratory culture conditions. Silent gene clusters represent a promising resource for natural product discovery and the development of a new generation of therapeutics. Unfortunately, the characterization of molecules encoded by these clusters is hampered owing to our inability to express these gene clusters in the laboratory. To address this bottleneck, we have developed a promoter-engineering platform to transcriptionally activate silent gene clusters in a model heterologous host. Our approach uses yeast homologous recombination, an auxotrophy complementation-based yeast selection system and sequence orthogonal promoter cassettes to exchange all native promoters in silent gene clusters with constitutively active promoters. As part of this platform, we constructed and validated a set of bidirectional promoter cassettes consisting of orthogonal promoter sequences, Streptomyces ribosome binding sites, and yeast selectable marker genes. Using these tools we demonstrate the ability to simultaneously insert multiple promoter cassettes into a gene cluster, thereby expediting the reengineering process. We apply this method to model active and silent gene clusters (rebeccamycin and tetarimycin) and to the silent, cryptic pseudogene-containing, environmental DNA-derived Lzr gene cluster. Complete promoter refactoring and targeted gene exchange in this "dead" cluster led to the discovery of potent indolotryptoline antiproliferative agents, lazarimides A and B. This potentially scalable and cost-effective promoter reengineering platform should streamline the discovery of natural products from silent natural product biosynthetic gene clusters. PMID:26150486

  10. Yeast homologous recombination-based promoter engineering for the activation of silent natural product biosynthetic gene clusters.

    PubMed

    Montiel, Daniel; Kang, Hahk-Soo; Chang, Fang-Yuan; Charlop-Powers, Zachary; Brady, Sean F

    2015-07-21

    Large-scale sequencing of prokaryotic (meta)genomic DNA suggests that most bacterial natural product gene clusters are not expressed under common laboratory culture conditions. Silent gene clusters represent a promising resource for natural product discovery and the development of a new generation of therapeutics. Unfortunately, the characterization of molecules encoded by these clusters is hampered owing to our inability to express these gene clusters in the laboratory. To address this bottleneck, we have developed a promoter-engineering platform to transcriptionally activate silent gene clusters in a model heterologous host. Our approach uses yeast homologous recombination, an auxotrophy complementation-based yeast selection system and sequence orthogonal promoter cassettes to exchange all native promoters in silent gene clusters with constitutively active promoters. As part of this platform, we constructed and validated a set of bidirectional promoter cassettes consisting of orthogonal promoter sequences, Streptomyces ribosome binding sites, and yeast selectable marker genes. Using these tools we demonstrate the ability to simultaneously insert multiple promoter cassettes into a gene cluster, thereby expediting the reengineering process. We apply this method to model active and silent gene clusters (rebeccamycin and tetarimycin) and to the silent, cryptic pseudogene-containing, environmental DNA-derived Lzr gene cluster. Complete promoter refactoring and targeted gene exchange in this "dead" cluster led to the discovery of potent indolotryptoline antiproliferative agents, lazarimides A and B. This potentially scalable and cost-effective promoter reengineering platform should streamline the discovery of natural products from silent natural product biosynthetic gene clusters.

  11. Yeast homologous recombination-based promoter engineering for the activation of silent natural product biosynthetic gene clusters

    PubMed Central

    Montiel, Daniel; Kang, Hahk-Soo; Chang, Fang-Yuan; Charlop-Powers, Zachary; Brady, Sean F.

    2015-01-01

    Large-scale sequencing of prokaryotic (meta)genomic DNA suggests that most bacterial natural product gene clusters are not expressed under common laboratory culture conditions. Silent gene clusters represent a promising resource for natural product discovery and the development of a new generation of therapeutics. Unfortunately, the characterization of molecules encoded by these clusters is hampered owing to our inability to express these gene clusters in the laboratory. To address this bottleneck, we have developed a promoter-engineering platform to transcriptionally activate silent gene clusters in a model heterologous host. Our approach uses yeast homologous recombination, an auxotrophy complementation-based yeast selection system and sequence orthogonal promoter cassettes to exchange all native promoters in silent gene clusters with constitutively active promoters. As part of this platform, we constructed and validated a set of bidirectional promoter cassettes consisting of orthogonal promoter sequences, Streptomyces ribosome binding sites, and yeast selectable marker genes. Using these tools we demonstrate the ability to simultaneously insert multiple promoter cassettes into a gene cluster, thereby expediting the reengineering process. We apply this method to model active and silent gene clusters (rebeccamycin and tetarimycin) and to the silent, cryptic pseudogene-containing, environmental DNA-derived Lzr gene cluster. Complete promoter refactoring and targeted gene exchange in this “dead” cluster led to the discovery of potent indolotryptoline antiproliferative agents, lazarimides A and B. This potentially scalable and cost-effective promoter reengineering platform should streamline the discovery of natural products from silent natural product biosynthetic gene clusters. PMID:26150486

  12. Promoter elements determining weak expression of the GAL4 regulatory gene of Saccharomyces cerevisiae.

    PubMed Central

    Griggs, D W; Johnston, M

    1993-01-01

    The GAL4 gene of Saccharomyces cerevisiae (encoding the activator of transcription of the GAL genes) is poorly expressed and is repressed during growth on glucose. To determine the basis for its weak expression and to identify DNA sequences recognized by proteins that activate transcription of a gene that itself encodes an activator of transcription, we have analyzed GAL4 promoter structure. We show that the GAL4 promoter is about 90-fold weaker than the strong GAL1 promoter and at least 7-fold weaker than the feeble URA3 promoter and that this low level of GAL4 expression is primarily due to a weak promoter. By deletion mapping, the GAL4 promoter can be divided into three functional regions. Two of these regions contain positive elements; a distal region termed the UASGAL4 (upstream activation sequence) contains redundant elements that increase promoter function, and a central region termed the UESGAL4 (upstream essential sequence) is essential for even basal levels of GAL4 expression. The third element, an upstream repression sequence, mediates glucose repression of GAL4 expression and is located between the UES and the transcriptional start site. The UASGAL4 is unusual because it is not interchangable with UAS elements in other yeast promoters; it does not function as a UAS element when inserted in a CYC1 promoter, and a normally strong UAS functions poorly in place of UASGAL4 in the GAL4 promoter. Similarly, the UES element of GAL4 does not function as a TATA element in a test promoter, and consensus TATA elements do not function in place of UES elements in the GAL4 promoter. These results suggest that GAL4 contains a weak TATA-less promoter and that the proteins regulating expression of this regulatory gene may be novel and context specific. PMID:8393142

  13. Nucleotide sequence of the alpha-amylase-pullulanase gene from Clostridium thermohydrosulfuricum.

    PubMed

    Melasniemi, H; Paloheimo, M; Hemiö, L

    1990-03-01

    The nucleotide sequence of the gene (apu) encoding the thermostable alpha-amylase-pullulanase of Clostridium thermohydrosulfuricum was determined. An open reading frame of 4425 bp was present. The deduced polypeptide (Mr 165,600), including a 31 amino acid putative signal sequence, comprised 1475 amino acids, with no cysteine residues. The structural gene was preceded by the consensus promoter sequence TTGACA TATAAT, a putative regulatory sequence and a putative ribosome-binding sequence AAAGGGGG. The codon usage resembled that of Bacillus genes. The deduced sequence of the mature apu product showed similarities to various amylolytic enzymes, especially the neopullulanase of Bacillus stearothermophilus, whereas the signal sequence showed similarity to those of the alpha-amylases of B. stearothermophilus and B. subtilis. Three regions thought to be highly conserved in the primary structure of alpha-amylases could also be distinguished in the apu product, two being partly 'duplicated' in this alpha-1,4/alpha-1,6-active enzyme.

  14. Isolated yeast promoter sequence and a method of regulated heterologous expression

    DOEpatents

    Gao, Johnway; Skeen, Rodney S.; Hooker, Brian S.; Anderson, Daniel B.

    2005-05-31

    The present invention provides the promoter clone discovery of a glucoamylase gene of a starch utilizing yeast strain Schwanniomyces castellii. The isolated glucoamylase promoter is an inducible promoter, which can regulate strong gene expression in starch culture medium.

  15. High-throughput mapping of the promoters of the mouse olfactory receptor genes reveals a new type of mammalian promoter and provides insight into olfactory receptor gene regulation

    PubMed Central

    Clowney, E. Josephine; Magklara, Angeliki; Colquitt, Bradley M.; Pathak, Nidhi; Lane, Robert P.; Lomvardas, Stavros

    2011-01-01

    The olfactory receptor (OR) genes are the largest mammalian gene family and are expressed in a monogenic and monoallelic fashion in olfactory neurons. Using a high-throughput approach, we mapped the transcription start sites of 1085 of the 1400 murine OR genes and performed computational analysis that revealed potential transcription factor binding sites shared by the majority of these promoters. Our analysis produced a hierarchical model for OR promoter recognition in which unusually high AT content, a unique epigenetic signature, and a stereotypically positioned O/E site distinguish OR promoters from the rest of the murine promoters. Our computations revealed an intriguing correlation between promoter AT content and evolutionary plasticity, as the most AT-rich promoters regulate rapidly evolving gene families. Within the AT-rich promoter category the position of the TATA-box does not correlate with the transcription start site. Instead, a spike in GC composition might define the exact location of the TSS, introducing the concept of “genomic contrast” in transcriptional regulation. Finally, our experiments show that genomic neighborhood rather than promoter sequence correlates with the probability of different OR genes to be expressed in the same olfactory cell. PMID:21705439

  16. The essential helicase gene RAD3 suppresses short-sequence recombination in Saccharomyces cerevisiae.

    PubMed Central

    Bailis, A M; Maines, S; Negritto, M T

    1995-01-01

    We have isolated an allele of the essential DNA repair and transcription gene RAD3 that relaxes the restriction against recombination between short DNA sequences in Saccharomyces cerevisiae. Double-strand break repair and gene replacement events requiring recombination between short identical or mismatched sequences were stimulated in the rad3-G595R mutant cells. We also observed an increase in the physical stability of double-strand breaks in the rad3-G595R mutant cells. These results suggest that the RAD3 gene suppresses recombination involving short homologous sequences by promoting the degradation of the ends of broken DNA molecules. PMID:7623796

  17. Nucleotide sequence and temporal expression of a baculovirus regulatory gene.

    PubMed

    Guarino, L A; Summers, M D

    1987-07-01

    The nucleotide sequence of a trans-activating regulatory gene (IE-1) of the baculovirus Autographa californica nuclear polyhedrosis virus has been determined. This gene encodes a protein of 581 amino acids with a predicted molecular weight of 66,856. A DNA fragment containing the entire coding sequence of IE-1 was inserted downstream of an RNA promoter. Subsequent cell-free transcription and translation directed the synthesis of a single peptide with an apparent molecular weight of 70,000. Quantitative S1 nuclease analysis indicated that IE-1 was maximally synthesized during a 1-h virus adsorption period and that steady-state levels of IE-1 message were maintained during the first 24 h of infection. Northern blot hybridization indicated that several late transcripts which overlap the IE-1 gene were transcribed from both strands. The precise locations of the 5' and 3' ends of these overlapping transcripts were mapped using S1 nuclease. The overlapping transcripts were grouped in two transcriptional units. One unit was composed of IE-1 and overlapping gamma transcripts which initiated upstream of IE-1 and terminated downstream of IE-1. The other unit, transcribed from the opposite strand, consisted of gamma transcripts with coterminal 5' ends and extended 3' ends. The shorter, more abundant transcripts in this unit overlapped 30 to 40 bases of IE-1 at the 3' end, while the longer transcripts overlapped the entire IE-1 gene. Transcription of several early A. californica nuclear polyhedrosis virus genes, in addition to 39K, was shown to be trans-activated by IE-1, indicating that IE-1 may have a central role in the regulation of beta-gene expression. PMID:16789264

  18. Isolation and characterization of rubisco small subunit gene promoter from common wheat (Triticum aestivum L.).

    PubMed

    Mukherjee, Shalini; Stasolla, Claudio; Brûlé-Babel, Anita; Ayele, Belay T

    2015-01-01

    Choice of an appropriate promoter is critical to express target genes in intended tissues and developmental stages. However, promoters capable of directing gene expression in specific tissues and stages are not well characterized in monocot species. To identify such a promoter in wheat, this study isolated a partial sequence of the wheat small subunit of RuBisCO (TarbcS) promoter. In silico analysis revealed the presence of elements that are characteristic to rbcS promoters of other, mainly dicot, species. Transient expression of the TarbcS:GUS in immature wheat embryos and tobacco leaves but not in the wheat roots indicate the functionality of the TarbcS promoter fragment in directing the expression of target genes in green plant tissues.

  19. ARID3B Directly Regulates Ovarian Cancer Promoting Genes

    PubMed Central

    Bobbs, Alexander; Gellerman, Katrina; Hallas, William Morgan; Joseph, Stancy; Yang, Chao; Kurkewich, Jeffrey; Cowden Dahl, Karen D.

    2015-01-01

    The DNA-binding protein AT-Rich Interactive Domain 3B (ARID3B) is elevated in ovarian cancer and increases tumor growth in a xenograft model of ovarian cancer. However, relatively little is known about ARID3B's function. In this study we perform the first genome wide screen for ARID3B direct target genes and ARID3B regulated pathways. We identified and confirmed numerous ARID3B target genes by chromatin immunoprecipitation (ChIP) followed by microarray and quantitative RT-PCR. Using motif-finding algorithms, we characterized a binding site for ARID3B, which is similar to the previously known site for the ARID3B paralogue ARID3A. Functionality of this predicted site was demonstrated by ChIP analysis. We next demonstrated that ARID3B induces expression of its targets in ovarian cancer cell lines. We validated that ARID3B binds to an epidermal growth factor receptor (EGFR) enhancer and increases mRNA expression. ARID3B also binds to the promoter of Wnt5A and its receptor FZD5. FZD5 is highly expressed in ovarian cancer cell lines, and is upregulated by exogenous ARID3B. Both ARID3B and FZD5 expression increase adhesion to extracellular matrix (ECM) components including collagen IV, fibronectin and vitronectin. ARID3B-increased adhesion to collagens II and IV require FZD5. This study directly demonstrates that ARID3B binds target genes in a sequence-specific manner, resulting in increased gene expression. Furthermore, our data indicate that ARID3B regulation of direct target genes in the Wnt pathway promotes adhesion of ovarian cancer cells. PMID:26121572

  20. The mouse collagen X gene: complete nucleotide sequence, exon structure and expression pattern.

    PubMed Central

    Elima, K; Eerola, I; Rosati, R; Metsäranta, M; Garofalo, S; Perälä, M; De Crombrugghe, B; Vuorio, E

    1993-01-01

    Overlapping genomic clones covering the 7.2 kb mouse alpha 1(X) collagen gene, 0.86 kb of promoter and 1.25 kb of 3'-flanking sequences were isolated from two genomic libraries and characterized by nucleotide sequencing. Typical features of the gene include a unique three-exon structure, similar to that in the chick gene, with the entire triple-helical domain of 463 amino acids coded by a single large exon. The highest degree of amino acid and nucleotide sequence conservation was seen in the coding region for the collagenous and C-terminal non-collagenous domains between the mouse and known chick, bovine and human collagen type X sequences. More divergence between the sequences occurred in the N-terminal non-collagenous domain. Similarity between the mammalian collagen X sequences extended into the 3'-untranslated sequence, particularly near the polyadenylation site. The promoter of the mouse collagen X gene was found to contain two TATAA boxes 159 bp apart; primer extension analyses of the transcription start site revealed that both were functional. The promoter has an unusual structure with a very low G + C content of 28% between positions -220 and -1 of the upstream transcription start site. Northern and in situ hybridization analyses confirmed that the expression of the alpha 1(X) collagen gene is restricted to hypertrophic chondrocytes in tissues undergoing endochondral calcification. The detailed sequence information of the gene is useful for studies on the promoter activity of the gene and for generation of transgenic mice. Images Figure 3 Figure 5 Figure 6 PMID:8424763

  1. Characterization of tissue-specific transcription by the human synapsin I gene promoter

    SciTech Connect

    Thiel, G. Univ. of Texas, Dallas ); Greengard, P. ); Suedhof, T.C. )

    1991-04-15

    Synapsin Ia and synapsin Ib are abundant synaptic vesicle proteins that are derived by differential splicing from a single gene. To identify control elements directing the neuronal expression of synapsins Ia/b, the authors functionally analyzed the promoter region of the human synapsin I gene. A hybrid gene was constructed containing 2 kilobases of 5{prime} flanking sequence from the synapsin I gene fused to the bacterial gene chloramphenicol acetyltransferase and transfected into 12 different neuronal and nonneuronal cell lines. In general, expression of the chimeric reporter gene showed excellent correlation with endogenous expression of synapsin I in different neuronal cell lines, whereas transcription was low in all nonneuronal cell lines examined. The addition of the simian virus 40 enhancer promoted non-tissue-specific expression. Deletion mutagenesis of the synapsin I promoter revealed the presence of positive and negative sequence elements. A basal (constitutive) promoter that directs reporter gene expression in neuronal and nonneuronal cell lines was mapped to the region {minus}115 to +47. The promoter region from {minus}422 to {minus}22 contains positive elements that upon fusion with the herpes simplex virus thymidine kinase promoter potentiate its transcription in PC12 and neuroblastoma cells but not in Chinese hamster ovary cells.

  2. Enhancer activity of Helitron in sericin-1 gene promoter from Bombyx mori.

    PubMed

    Huang, Ke; Li, Chun-Feng; Wu, Jie; Wei, Jun-Hong; Zou, Yong; Han, Min-Jin; Zhou, Ze-Yang

    2016-06-01

    Sericin is a kind of water-soluble protein expressed specifically in the middle silk gland of Bombyx mori. When the sericin-1 gene promoter was cloned and a transgenic vector was constructed to express a foreign protein, a specific Helitron, Bmhel-8, was identified in the sericin-1 gene promoter sequence in some genotypes of Bombyx mori and Bombyx mandarina. Given that the Bmhel-8 Helitron transposon was present only in some genotypes, it could be the source of allelic variation in the sericin-1 promoter. The length of the sericin-1 promoter sequence is approximately 1063 or 643 bp. The larger size of the sequence or allele is ascribed to the presence of Bmhel-8. Silkworm genotypes can be homozygous for either the shorter or larger promoter sequence or heterozygous, containing both alleles. Bmhel-8 in the sericin-1 promoter exhibits enhancer activity, as demonstrated by a dual-luciferase reporter system in BmE cell lines. Furthermore, Bmhel-8 displays enhancer activity in a sericin-1 promoter-driven gene expression system but does not regulate the tissue-specific expression of sericin-1. PMID:27067405

  3. Discovery of conserved motifs in promoters of orthologous genes in prokaryotes.

    PubMed

    Janky, Rekin's; van Helden, Jacques

    2007-01-01

    We present a method to predict cis-acting elements for a given gene by detecting over-represented motifs in promoters of a set of ortholo gous genes in prokaryotes (single-gene, multiple-genomes approach). The method has been used successfully to detect regulatory elements at various taxonomical levels in prokaryotes. A web interface is available at the Regulatory Sequence Analysis Tools site (http://rsat.scmbb.ulb.ac.be/rsat/).

  4. Gene and translation initiation site prediction in metagenomic sequences

    SciTech Connect

    Hyatt, Philip Douglas; LoCascio, Philip F; Hauser, Loren John; Uberbacher, Edward C

    2012-01-01

    Gene prediction in metagenomic sequences remains a difficult problem. Current sequencing technologies do not achieve sufficient coverage to assemble the individual genomes in a typical sample; consequently, sequencing runs produce a large number of short sequences whose exact origin is unknown. Since these sequences are usually smaller than the average length of a gene, algorithms must make predictions based on very little data. We present MetaProdigal, a metagenomic version of the gene prediction program Prodigal, that can identify genes in short, anonymous coding sequences with a high degree of accuracy. The novel value of the method consists of enhanced translation initiation site identification, ability to identify sequences that use alternate genetic codes and confidence values for each gene call. We compare the results of MetaProdigal with other methods and conclude with a discussion of future improvements.

  5. A constitutive promoter directs expression of the nerve growth factor receptor gene

    SciTech Connect

    Sehgal, A.; Patil, N.; Chao, M.

    1988-08-01

    Expression of nerve growth factor receptor is normally restricted to cells derived from the neural crest in a developmentally regulated manner. The authors analyzed promoter sequences for the human nerve growth factor receptor gene and found that the receptor promoter resembles others which are associated with constitutively expressed genes that have housekeeping and growth-related functions. Unlike these other genes, the initiation of transcription occurred at one major site rather than at multiple sites. The constitutive nature of the nerve growth factor receptor promoter may account for the ability of this gene to be transcribed in a diverse number of heterologous cells after gene transfer. The intron-exon structure of the receptor gene indicated that structural features are precisely divided into discrete domains.

  6. A cis-regulatory sequence from a short intergenic region gives rise to a strong microbe-associated molecular pattern-responsive synthetic promoter.

    PubMed

    Lehmeyer, Mona; Hanko, Erik K R; Roling, Lena; Gonzalez, Lilian; Wehrs, Maren; Hehl, Reinhard

    2016-06-01

    The high gene density in Arabidopsis thaliana leaves only relatively short intergenic regions for potential cis-regulatory sequences. To learn more about the regulation of genes harbouring only very short upstream intergenic regions, this study investigates a recently identified novel microbe-associated molecular pattern (MAMP)-responsive cis-sequence located within the 101 bp long intergenic region upstream of the At1g13990 gene. It is shown that the cis-regulatory sequence is sufficient for MAMP-responsive reporter gene activity in the context of its native promoter. The 3' UTR of the upstream gene has a quantitative effect on gene expression. In context of a synthetic promoter, the cis-sequence is shown to achieve a strong increase in reporter gene activity as a monomer, dimer and tetramer. Mutation analysis of the cis-sequence determined the specific nucleotides required for gene expression activation. In transgenic A. thaliana the synthetic promoter harbouring a tetramer of the cis-sequence not only drives strong pathogen-responsive reporter gene expression but also shows a high background activity. The results of this study contribute to our understanding how genes with very short upstream intergenic regions are regulated and how these regions can serve as a source for MAMP-responsive cis-sequences for synthetic promoter design.

  7. A cis-regulatory sequence from a short intergenic region gives rise to a strong microbe-associated molecular pattern-responsive synthetic promoter.

    PubMed

    Lehmeyer, Mona; Hanko, Erik K R; Roling, Lena; Gonzalez, Lilian; Wehrs, Maren; Hehl, Reinhard

    2016-06-01

    The high gene density in Arabidopsis thaliana leaves only relatively short intergenic regions for potential cis-regulatory sequences. To learn more about the regulation of genes harbouring only very short upstream intergenic regions, this study investigates a recently identified novel microbe-associated molecular pattern (MAMP)-responsive cis-sequence located within the 101 bp long intergenic region upstream of the At1g13990 gene. It is shown that the cis-regulatory sequence is sufficient for MAMP-responsive reporter gene activity in the context of its native promoter. The 3' UTR of the upstream gene has a quantitative effect on gene expression. In context of a synthetic promoter, the cis-sequence is shown to achieve a strong increase in reporter gene activity as a monomer, dimer and tetramer. Mutation analysis of the cis-sequence determined the specific nucleotides required for gene expression activation. In transgenic A. thaliana the synthetic promoter harbouring a tetramer of the cis-sequence not only drives strong pathogen-responsive reporter gene expression but also shows a high background activity. The results of this study contribute to our understanding how genes with very short upstream intergenic regions are regulated and how these regions can serve as a source for MAMP-responsive cis-sequences for synthetic promoter design. PMID:26833485

  8. The complete sequence of soybean chlorotic mottle virus DNA and the identification of a novel promoter.

    PubMed

    Hasegawa, A; Verver, J; Shimada, A; Saito, M; Goldbach, R; Van Kammen, A; Miki, K; Kameya-Iwaki, M; Hibi, T

    1989-12-11

    The complete nucleotide sequence of an infectious clone of soybean chlorotic mottle virus (SoyCMV) DNA was determined and compared with those of three other caulimoviruses, cauliflower mosaic virus (CaMV), carnation etched ring virus and figwort mosaic virus. The double-stranded DNA genome of SoyCMV (8,175 bp) contained nine open reading frames (ORFs) and one large intergenic region. The primer binding sites, gene organization and size of ORFs were similar to those of the other caulimoviruses, except for ORF I, which was split into ORF Ia and Ib. The amino acid sequences deduced from each ORF showed only short, highly homologous regions in several of the corresponding ORFs of the three other caulimoviruses. A promoter fragment of 378 bp in SoyCMV ORF III showed a strong expression activity, comparable to that of the CaMV 35S promoter, in tobacco mesophyll protoplasts as determined by a beta-glucuronidase assay using electrotransfection. The fragment contained CAAT and TATA boxes but no transcriptional enhancer signal as reported for the CaMV 35S promoter. Instead, it had sequences homologous to a part of the translational enhancer signal reported for the 5'-leader sequence of tobacco mosaic virus RNA.

  9. Insulators form gene loops by interacting with promoters in Drosophila.

    PubMed

    Erokhin, Maksim; Davydova, Anna; Kyrchanova, Olga; Parshikov, Alexander; Georgiev, Pavel; Chetverina, Darya

    2011-09-01

    Chromatin insulators are regulatory elements involved in the modulation of enhancer-promoter communication. The 1A2 and Wari insulators are located immediately downstream of the Drosophila yellow and white genes, respectively. Using an assay based on the yeast GAL4 activator, we have found that both insulators are able to interact with their target promoters in transgenic lines, forming gene loops. The existence of an insulator-promoter loop is confirmed by the fact that insulator proteins could be detected on the promoter only in the presence of an insulator in the transgene. The upstream promoter regions, which are required for long-distance stimulation by enhancers, are not essential for promoter-insulator interactions. Both insulators support basal activity of the yellow and white promoters in eyes. Thus, the ability of insulators to interact with promoters might play an important role in the regulation of basal gene transcription.

  10. Type 1 plaminogen activator inhibitor gene: Functional analysis and glucocorticoid regulation of its promoter

    SciTech Connect

    Van Zonneveld, A.J.; Curriden, S.A.; Loskutoff, D.J. )

    1988-08-01

    Plasminogen activator inhibitor type 1 is an important component of the fibrinolytic system and its biosynthesis is subject to complex regulation. To study this regulation at the level of transcription, the authors have identified and sequenced the promoter of the human plasminogen activator inhibitor type 1 gene. Nuclease protection experiments were performed by using endothelial cell mRNA and the transcription initiation (cap) site was established. Sequence analysis of the 5{prime} flanking region of the gene revealed a perfect TATA box at position {minus}28 to position {minus}23, the conserved distance from the cap site. Comparative functional studies with the firefly luciferase gene as a reporter gene showed that fragments derived from this 5{prime} flanking region exhibited high promoter activity when transfected into bovine aortic endothelial cells and mouse Ltk{sup {minus}} fibroblasts but were inactive when introduced into HeLa cells. These studies indicate that the fragments contain the plasminogen activator inhibitor type 1 promoter and that it is expressed in a tissue-specific manner. Although the fragments were also silent in rat FTO2B hepatoma cells, their promoter activity could be induced up to 40-fold with the synthetic glucocorticoid dexamethasone. Promoter deletion mapping experiments and studies involving the fusion of promoter fragments to a heterologous gene indicated that dexamethasone induction is mediated by a glucocorticoid responsive element with enhancer-like properties located within the region between nucleotides {minus}305 and +75 of the plasminogen activator inhibitor type 1 gene.

  11. Allelic and haplotypic diversity of 5'promoter region of the MICA gene.

    PubMed

    Luo, Jia; Tian, Wei; Pan, FengHua; Liu, XueXiang; Li, LiXin

    2014-04-01

    In this study, the 5'promoter region of MHC class I chain-related gene A (MICA) was investigated in 104 healthy, unrelated Han individuals recruited from northern China, using PCR-sequencing method. Twelve variable sites were detected, which were in very strong linkage disequilibrium with each other. Twelve different MICA 5'promoter haplotypes were identified, among which Promoter-7 predominated (0.5529). Twenty-six extended haplotypes incorporating MICA 5'promoter and MICA exons 2-5 were observed in this population, 9 of which were in significant linkage disequilibrium (LD). Phylogenetic analysis of 5'promoter refined MICA sub-lineage structure previously constructed according to MICA coding and 3'untranslated regions. Ewens-Watterson homozygosity statistics at MICA 5'promoter region were consistent with neutral expectations. None of the five variable sites detected within the minimal promoter of MICA gene was located in the putative binding sites for transcription factor. Our study provided for the first time the sequence information about 5'promoter of MICA gene at a human population level. The data will facilitate the understanding of regulation of MICA gene expression, which represents a promising pathway for immune intervention against cancer, autoimmune disorders and infections.

  12. Complete genome sequence of the rapeseed plant-growth promoting Serratia plymuthica strain AS9

    SciTech Connect

    Neupane, Saraswoti; Hogberg, Nils; Alstrom, Sadhna; Lucas, Susan; Han, James; Lapidus, Alla L.; Cheng, Jan-Fang; Bruce, David; Goodwin, Lynne A.; Pitluck, Sam; Peters, Lin; Ovchinnikova, Galina; Lu, Megan; Han, Cliff; Detter, J. Chris; Tapia, Roxanne; Fiebig, Anne; Land, Miriam L; Hauser, Loren John; Kyrpides, Nikos C; Ivanova, N; Pagani, Ioanna; Klenk, Hans-Peter; Woyke, Tanja; Finlay, Roger D.

    2012-01-01

    Serratia plymuthica are plant-associated, plant beneficial species belonging to the family Enterobacteriaceae. The members of the genus Serratia are ubiquitous in nature and their life style varies from endophytic to free-living. S. plymuthica AS9 is of special interest for its ability to inhibit fungal pathogens of rapeseed and to promote plant growth. The genome of S. plymuthica AS9 comprises a 5,442,880 bp long circular chromosome that consists of 4,952 protein-coding genes, 87 tRNA genes and 7 rRNA operons. This genome is part of the project entitled Genomics of four rapeseed plant growth promoting bacteria with antagonistic effect on plant pathogens awarded through the 2010 DOE-JGI Community Sequencing Program (CSP2010).

  13. Complete genome sequence of the rapeseed plant-growth promoting Serratia plymuthica strain AS9

    PubMed Central

    Högberg, Nils; Alström, Sadhna; Lucas, Susan; Han, James; Lapidus, Alla; Cheng, Jan-Fang; Bruce, David; Goodwin, Lynne; Pitluck, Sam; Peters, Lin; Ovchinnikova, Galina; Lu, Megan; Han, Cliff; Detter, John C.; Tapia, Roxanne; Fiebig, Anne; Land, Miriam; Hauser, Loren; Kyrpides, Nikos C.; Ivanova, Natalia; Pagani, Ioanna; Klenk, Hans-Peter; Woyke, Tanja; Finlay, Roger D.

    2012-01-01

    Serratia plymuthica are plant-associated, plant beneficial species belonging to the family Enterobacteriaceae. The members of the genus Serratia are ubiquitous in nature and their life style varies from endophytic to free-living. S. plymuthica AS9 is of special interest for its ability to inhibit fungal pathogens of rapeseed and to promote plant growth. The genome of S. plymuthica AS9 comprises a 5,442,880 bp long circular chromosome that consists of 4,952 protein-coding genes, 87 tRNA genes and 7 rRNA operons. This genome is part of the project entitled “Genomics of four rapeseed plant growth promoting bacteria with antagonistic effect on plant pathogens” awarded through the 2010 DOE-JGI Community Sequencing Program (CSP2010). PMID:22675598

  14. Analysis of mammalian gene batteries reveals both stable ancestral cores and highly dynamic regulatory sequences

    PubMed Central

    Ettwiller, Laurence; Budd, Aidan; Spitz, François; Wittbrodt, Joachim

    2008-01-01

    Background Changes in gene regulation are suspected to comprise one of the driving forces for evolution. To address the extent of cis-regulatory changes and how they impact on gene regulatory networks across eukaryotes, we systematically analyzed the evolutionary dynamics of target gene batteries controlled by 16 different transcription factors. Results We found that gene batteries show variable conservation within vertebrates, with slow and fast evolving modules. Hence, while a key gene battery associated with the cell cycle is conserved throughout metazoans, the POU5F1 (Oct4) and SOX2 batteries in embryonic stem cells show strong conservation within mammals, with the striking exception of rodents. Within the genes composing a given gene battery, we could identify a conserved core that likely reflects the ancestral function of the corresponding transcription factor. Interestingly, we show that the association between a transcription factor and its target genes is conserved even when we exclude conserved sequence similarities of their promoter regions from our analysis. This supports the idea that turnover, either of the transcription factor binding site or its direct neighboring sequence, is a pervasive feature of proximal regulatory sequences. Conclusions Our study reveals the dynamics of evolutionary changes within metazoan gene networks, including both the composition of gene batteries and the architecture of target gene promoters. This variation provides the playground required for evolutionary innovation around conserved ancestral core functions. PMID:19087242

  15. Genome Sequencing of a Mung Bean Plant Growth Promoting Strain of P. aeruginosa with Biocontrol Ability

    PubMed Central

    Illakkiam, Devaraj; Shankar, Manoharan; Ponraj, Paramasivan; Rajendhran, Jeyaprakash

    2014-01-01

    Pseudomonas aeruginosa PGPR2 is a mung bean rhizosphere strain that produces secondary metabolites and hydrolytic enzymes contributing to excellent antifungal activity against Macrophomina phaseolina, one of the prevalent fungal pathogens of mung bean. Genome sequencing was performed using the Ion Torrent Personal Genome Machine generating 1,354,732 reads (6,772,433 sequenced bases) achieving ~25-fold coverage of the genome. Reference genome assembly using MIRA 3.4.0 yielded 198 contigs. The draft genome of PGPR2 encoded 6803 open reading frames, of which 5314 were genes with predicted functions, 1489 were genes of known functions, and 80 were RNA-coding genes. Strain specific and core genes of P. aeruginosa PGPR2 that are relevant to rhizospheric habitat were identified by pangenome analysis. Genes involved in plant growth promoting function such as synthesis of ACC deaminase, indole-3-acetic acid, trehalose, mineral scavenging siderophores, hydrogen cyanide, chitinases, acyl homoserine lactones, acetoin, 2,3-butanediol, and phytases were identified. In addition, niche-specific genes such as phosphate solubilising 3-phytase, adhesins, pathway-specific transcriptional regulators, a diguanylate cyclase involved in cellulose synthesis, a receptor for ferrienterochelin, a DEAD/DEAH-box helicase involved in stress tolerance, chemotaxis/motility determinants, an HtpX protease, and enzymes involved in the production of a chromanone derivative with potent antifungal activity were identified. PMID:25184130

  16. Excision of plastid marker genes using directly repeated DNA sequences.

    PubMed

    Mudd, Elisabeth A; Madesis, Panagiotis; Avila, Elena Martin; Day, Anil

    2014-01-01

    Excision of marker genes using DNA direct repeats makes use of the predominant homologous recombination pathways present in the plastids of algae and plants. The method is simple, efficient, and widely applicable to plants and microalgae. Marker excision frequency is dependent on the length and number of directly repeated sequences. When two repeats are used a repeat size of greater than 600 bp promotes efficient excision of the marker gene. A wide variety of sequences can be used to make the direct repeats. Only a single round of transformation is required, and there is no requirement to introduce site-specific recombinases by retransformation or sexual crosses. Selection is used to maintain the marker and ensure homoplasmy of transgenic plastid genomes. Release of selection allows the accumulation of marker-free plastid genomes generated by marker excision, which is spontaneous, random, and a unidirectional process. Positive selection is provided by linking marker excision to restoration of the coding region of an herbicide resistance gene from two overlapping but incomplete coding regions. Cytoplasmic sorting allows the segregation of cells with marker-free transgenic plastids. The marker-free shoots resulting from direct repeat-mediated excision of marker genes have been isolated by vegetative propagation of shoots in the T0 generation. Alternatively, accumulation of marker-free plastid genomes during growth, development and flowering of T0 plants allows the collection of seeds that give rise to a high proportion of marker-free T1 seedlings. The simplicity and convenience of direct repeat excision facilitates its widespread use to isolate marker-free crops. PMID:24599849

  17. Multiple Cis-Acting Sequences Contribute to Evolved Regulatory Variation for Drosophila Adh Genes

    PubMed Central

    Fang, X. M.; Brennan, M. D.

    1992-01-01

    Drosophila affinidisjuncta and Drosophila hawaiiensis are closely related species that display distinct tissue-specific expression patterns for their homologous alcohol dehydrogenase genes (Adh genes). In Drosophila melanogaster transformants, both genes are expressed at high levels in the larval and adult fat bodies, but the D. affinidisjuncta gene is expressed 10-50-fold more strongly in the larval and adult midguts and Malpighian tubules. The present study reports the mapping of cis-acting sequences contributing to the regulatory differences between these two genes in transformants. Chimeric genes were constructed and introduced into the germ line of D. melanogaster. Stage- and tissue-specific expression patterns were determined by measuring steady-state RNA levels in larvae and adults. Three portions of the promoter region make distinct contributions to the tissue-specific regulatory differences between the native genes. Sequences immediately upstream of the distal promoter have a strong effect in the adult Malpighian tubules, while sequences between the two promoters are relatively important in the larval Malpighian tubules. A third gene segment, immediately upstream of the proximal promoter, influences levels of the proximal Adh transcript in all tissues and developmental stages examined, and largely accounts for the regulatory difference in the larval and adult midguts. However, these as well as other sequences make smaller contributions to various aspects of the tissue-specific regulatory differences. In addition, some chimeric genes display aberrant RNA levels for the whole organism, suggesting close physical association between sequences involved in tissue-specific regulatory differences and those important for Adh expression in the larval and adult fat bodies. PMID:1644276

  18. The TATA-less promoter of VP1, a plant gene controlling seed germination.

    PubMed

    Carrari, F; Frankel, N; Lijavetzky, D; Benech-Arnold, R; Sánchez, R; Iusem, N D

    2001-01-01

    Vp1 is a seed-specific gene involved in the control of dormancy and germination. We here present the complete sequence of the sorghum vp1 promoter/enhancer region highlighting its main features, especially the lack of canonical TATA and CAAT boxes and the presence of elements responsive to abscisic acid and light. The region closest to the start of transcription is highly homologous to the partial proximal sequence reported for the maize vp1 promoter. This region is interrupted by a 57-nt stretch containing 14 CT microsatellite repeats. We observed a poor overall homology to the promoter from abi3 gene, the Arabidopsis counterpart bearing a similar coding sequence. However, there exists a high degree of homology (89%) between a TATA-rich 103-bp stretch of the sorghum vp1 promoter located about 700 nt upstream of the startpoint and miniature inverted transposable elements (MITEs) interspersed within the sorghum seed-specific kafirin cluster. This sorghum MITE-like element displays considerable homology (68%) to the TATA-less promoter from the sorghum NADP-malate dehydrogenase gene and lesser similarity to the Tourist, Pilgrim and Batuta MITEs previously identified within the promoter from the maize Abp1 (auxin-binding protein) gene.

  19. The TATA-less promoter of VP1, a plant gene controlling seed germination.

    PubMed

    Carrari, F; Frankel, N; Lijavetzky, D; Benech-Arnold, R; Sánchez, R; Iusem, N D

    2001-01-01

    Vp1 is a seed-specific gene involved in the control of dormancy and germination. We here present the complete sequence of the sorghum vp1 promoter/enhancer region highlighting its main features, especially the lack of canonical TATA and CAAT boxes and the presence of elements responsive to abscisic acid and light. The region closest to the start of transcription is highly homologous to the partial proximal sequence reported for the maize vp1 promoter. This region is interrupted by a 57-nt stretch containing 14 CT microsatellite repeats. We observed a poor overall homology to the promoter from abi3 gene, the Arabidopsis counterpart bearing a similar coding sequence. However, there exists a high degree of homology (89%) between a TATA-rich 103-bp stretch of the sorghum vp1 promoter located about 700 nt upstream of the startpoint and miniature inverted transposable elements (MITEs) interspersed within the sorghum seed-specific kafirin cluster. This sorghum MITE-like element displays considerable homology (68%) to the TATA-less promoter from the sorghum NADP-malate dehydrogenase gene and lesser similarity to the Tourist, Pilgrim and Batuta MITEs previously identified within the promoter from the maize Abp1 (auxin-binding protein) gene. PMID:11761708

  20. Coding sequences of functioning human genes derived entirely from mobile element sequences.

    PubMed

    Britten, Roy J

    2004-11-30

    Among all of the many examples of mobile elements or "parasitic sequences" that affect the function of the human genome, this paper describes several examples of functioning genes whose sequences have been almost completely derived from mobile elements. There are many examples where the synthetic coding sequences of observed mRNA sequences are made up of mobile element sequences, to an extent of 80% or more of the length of the coding sequences. In the examples described here, the genes have named functions, and some of these functions have been studied. It appears that each of the functioning genes was originally formed from mobile elements and that in some process of molecular evolution a coding sequence was derived that could be translated into a protein that is of some importance to human biology. In one case (AD7C), the coding sequence is 99% made up of a cluster of Alu sequences. In another example, the gene BNIP3 coding sequence is 97% made up of sequences from an apparent human endogenous retrovirus. The Syncytin gene coding sequence appears to be made from an endogenous retrovirus envelope gene. PMID:15546984

  1. Host range selection of vaccinia recombinants containing insertions of foreign genes into non-coding sequences.

    PubMed

    Smith, K A; Stallard, V; Roos, J M; Hart, C; Cormier, N; Cohen, L K; Roberts, B E; Payne, L G

    1993-01-01

    A simple yet powerful selection system was developed for the insertion of foreign genes in vaccinia virus. The selection system utilizes the vaccinia virus K1L (29K) host range gene which is located in HindIII M. This gene is necessary for growth in RK-13 cells but not in BSC40 or CV-1 cells. A vaccinia mutant (vAbT33) unable to grow on RK-13 cells was constructed having sequences at the 3' end of the K1L gene and the adjacent M2L gene deleted and replaced with the beta-galactosidase gene regulated by the BamHI F (F7L) promoter. A recombination plasmid containing the hepatitis B surface (HBs) antigen gene regulated by the M2L promoter and the complete sequence of the K1L gene was used to insert the HBs gene into vAbT33. The M2L negative K1L positive recombinant was easily isolated in two rounds of plaque purification by plating the virus on RK-13 cell monolayers. The K1L gene selection system allows the isolation of recombinants arising at frequencies as low as 1/100,000. It was noted that recombinants containing vaccinia sequence duplications (promoters) resulted in intragenomic recombinations that eliminated all sequences between the duplications. A second recombination plasmid was constructed that allowed insertion into the vaccinia genome without the loss of vaccinia coding sequences. This was achieved by insertion of the pseudorabies virus GIII gene regulated by the vaccinia H5R (40K) promoter between the translation and transcription stop signals at the 3' end of the K1L gene. The K1L gene transcription stop signal thus became the stop signal for the inserted GIII gene and an upstream transcription stop signal present in the H5R promoter fragment provided the stop signal for the K1L gene. This manipulation of the vaccinia genome had no effect on the accumulation or 5' end of the M2L gene transcripts. Although the insertion lengthened the 3' end and lowered the accumulation of K1L transcripts it altered neither the virulence nor the immunogenicity of the

  2. Genetic recombination is targeted towards gene promoter regions in dogs.

    PubMed

    Auton, Adam; Rui Li, Ying; Kidd, Jeffrey; Oliveira, Kyle; Nadel, Julie; Holloway, J Kim; Hayward, Jessica J; Cohen, Paula E; Greally, John M; Wang, Jun; Bustamante, Carlos D; Boyko, Adam R

    2013-01-01

    The identification of the H3K4 trimethylase, PRDM9, as the gene responsible for recombination hotspot localization has provided considerable insight into the mechanisms by which recombination is initiated in mammals. However, uniquely amongst mammals, canids appear to lack a functional version of PRDM9 and may therefore provide a model for understanding recombination that occurs in the absence of PRDM9, and thus how PRDM9 functions to shape the recombination landscape. We have constructed a fine-scale genetic map from patterns of linkage disequilibrium assessed using high-throughput sequence data from 51 free-ranging dogs, Canis lupus familiaris. While broad-scale properties of recombination appear similar to other mammalian species, our fine-scale estimates indicate that canine highly elevated recombination rates are observed in the vicinity of CpG rich regions including gene promoter regions, but show little association with H3K4 trimethylation marks identified in spermatocytes. By comparison to genomic data from the Andean fox, Lycalopex culpaeus, we show that biased gene conversion is a plausible mechanism by which the high CpG content of the dog genome could have occurred.

  3. Genetic Recombination Is Targeted towards Gene Promoter Regions in Dogs

    PubMed Central

    Auton, Adam; Rui Li, Ying; Kidd, Jeffrey; Oliveira, Kyle; Nadel, Julie; Holloway, J. Kim; Hayward, Jessica J.; Cohen, Paula E.; Greally, John M.; Wang, Jun; Bustamante, Carlos D.; Boyko, Adam R.

    2013-01-01

    The identification of the H3K4 trimethylase, PRDM9, as the gene responsible for recombination hotspot localization has provided considerable insight into the mechanisms by which recombination is initiated in mammals. However, uniquely amongst mammals, canids appear to lack a functional version of PRDM9 and may therefore provide a model for understanding recombination that occurs in the absence of PRDM9, and thus how PRDM9 functions to shape the recombination landscape. We have constructed a fine-scale genetic map from patterns of linkage disequilibrium assessed using high-throughput sequence data from 51 free-ranging dogs, Canis lupus familiaris. While broad-scale properties of recombination appear similar to other mammalian species, our fine-scale estimates indicate that canine highly elevated recombination rates are observed in the vicinity of CpG rich regions including gene promoter regions, but show little association with H3K4 trimethylation marks identified in spermatocytes. By comparison to genomic data from the Andean fox, Lycalopex culpaeus, we show that biased gene conversion is a plausible mechanism by which the high CpG content of the dog genome could have occurred. PMID:24348265

  4. The core promoter: At the heart of gene expression.

    PubMed

    Danino, Yehuda M; Even, Dan; Ideses, Diana; Juven-Gershon, Tamar

    2015-08-01

    The identities of different cells and tissues in multicellular organisms are determined by tightly controlled transcriptional programs that enable accurate gene expression. The mechanisms that regulate gene expression comprise diverse multiplayer molecular circuits of multiple dedicated components. The RNA polymerase II (Pol II) core promoter establishes the center of this spatiotemporally orchestrated molecular machine. Here, we discuss transcription initiation, diversity in core promoter composition, interactions of the basal transcription machinery with the core promoter, enhancer-promoter specificity, core promoter-preferential activation, enhancer RNAs, Pol II pausing, transcription termination, Pol II recycling and translation. We further discuss recent findings indicating that promoters and enhancers share similar features and may not substantially differ from each other, as previously assumed. Taken together, we review a broad spectrum of studies that highlight the importance of the core promoter and its pivotal role in the regulation of metazoan gene expression and suggest future research directions and challenges.

  5. Regions in the promoter of the yeast FBP1 gene implicated in catabolite repression may bind the product of the regulatory gene MIG1.

    PubMed

    Mercado, J J; Vincent, O; Gancedo, J M

    1991-10-01

    We have identified in the promoter of the yeast FBP1 gene two sites able to bind nuclear proteins. These sites have a nucleotide sequence strongly similar to that of sites which bind the regulatory protein MIG1 in the promoters of GAL4 and SUC2. Deletions performed in the FBP1 promoter showed that one of the sites contributes to catabolite repression of this gene. In this same promoter, another region was identified with a strong effect on the catabolite repression of FBP1. In this region a sequence similar to the consensus for the binding site of the MIG1 protein was also present.

  6. Identification and refinement of two strong constitutive promoters for gene expression system of Schizosaccharomyces pombe.

    PubMed

    Wang, Hongcheng; Wang, Haiyang; Wang, Meng; Zhang, Lei; Wang, Ren; Mei, Yanzhen; Shao, Weilan

    2014-06-01

    Fission yeast Schizosaccharomyces pombe shares various important properties with higher eukaryotes and is now considered a useful host for elevated production of mammalian proteins for medicinal applications. The full-length nmt1 promoter has been widely used as a strong promoter in S. pombe expression system. In the present study, the promoters of the eno101 and gpd3 genes in S. pombe were identified as strong constitutive promoters. For convenient applications in the plasmids of S. pombe, these promoters were refined to 276-bp eno and 273-bp gpd promoters by deleting undesired sequences and examining the expression of reporter genes including lacZ and xynA. Both the refined eno and gpd promoters provided approximately 1.5-fold higher expression of LacZ than nmt1 promoter. Furthermore, gene expression under the control of the eno or gpd promoter was not repressed by the components of YES medium while nmt1 promoter was inhibited by thiamine in yeast extract. Therefore, both eno and gpd promoters offer opportunities for efficient production of recombinant proteins by S. pombe in high cell-density fermentation.

  7. Genome-wide analysis of alternative promoters of human genes using a custom promoter tiling array

    PubMed Central

    Singer, Gregory AC; Wu, Jiejun; Yan, Pearlly; Plass, Christoph; Huang, Tim HM; Davuluri, Ramana V

    2008-01-01

    Background Independent lines of evidence suggested that a large fraction of human genes possess multiple promoters driving gene expression from distinct transcription start sites. Understanding which promoter is employed in which cellular context is required to unravel gene regulatory networks within the cell. Results We have developed a custom microarray platform that tiles roughly 35,000 alternative putative promoters from nearly 7,000 genes in the human genome. To demonstrate the utility of this array platform, we have analyzed the patterns of promoter usage in 17β-estradiol (E2)-treated and untreated MCF7 cells and show widespread usage of alternative promoters. Most intriguingly, we show that the downstream promoter in E2-sensitive multiple promoter genes tends to be very close to the 3'-terminus of the gene, suggesting exotic mechanisms of expression regulation in these genes. Conclusion The usage of alternative promoters greatly multiplies the transcriptional complexity available within the human genome. The fact that many of these promoters are incapable of driving the synthesis of a meaningful protein-encoding transcript further complicates the story. PMID:18655706

  8. Antagonistic pleiotropy involving promoter sequences in a virus

    PubMed Central

    Presloid, John B.; Ebendick-Corpus, Bonnie E.; Zárate, Selene; Novella, Isabel S.

    2008-01-01

    Selection of specialist genotypes, that is, populations with limited niche width, promotes the maintenance of diversity. Specialization to a particular environment may have a cost in other environments, including fitness tradeoffs. When the tradeoffs are the result of mutations that have a beneficial effect in the selective environment, but a deleterious effect in other environment, we have antagonistic pleiotropy. Alternatively, tradeoffs can result from the fixation of mutations that are neutral in the selective environment but have a negative effect in other environment, and thus the tradeoff is due to mutation accumulation. We tested the mechanisms underlying the fitness tradeoffs observed during adaptation to persistent infection of vesicular stomatitis virus in insect cells by sequencing the full-length genomes of twelve strains with a history of replication in a single niche (acute mammalian infection or persistent insect infection) or in temporally-heterogeneous niches, and correlated genetic and fitness changes. Ecological theory predicts a correlation between the selective environment and the niche width of the evolved populations, such that adaptation to single niches should lead to the selection of specialists and niche cycling should result in the selection of generalists. Contrary to this expectation, adaptation to one of the single niches resulted in a generalist and adaptation to a heterogeneous environment led to the selection of a specialist. Only one-third of the mutations that accumulated during persistent infection had a fitness cost that could be explained in all cases by antagonistic pleiotropy. Mutations involved in fitness tradeoffs included changes in regulatory sequences, particularly at the 3′ termini of the genomes, which contain the single promoter that controls viral transcription and replication. PMID:18644381

  9. Complete Genome Sequence of Bacillus amyloliquefaciens Strain Co1-6, a Plant Growth-Promoting Rhizobacterium of Calendula officinalis.

    PubMed

    Köberl, Martina; White, Richard A; Erschen, Sabine; Spanberger, Nora; El-Arabi, Tarek F; Jansson, Janet K; Berg, Gabriele

    2015-01-01

    The genome sequence of Bacillus amyloliquefaciens strain Co1-6, a plant growth-promoting rhizobacterium (PGPR) with broad-spectrum antagonistic activity against plant-pathogenic fungi, bacteria, and nematodes, consists of a single 3.9-Mb circular chromosome. The genome reveals genes putatively responsible for its promising biocontrol and PGP properties. PMID:26272562

  10. Complete genome sequence of Bacillus amyloliquefaciens strain Co1-6, a plant growth-promoting rhizobacterium of Calendula officinalis

    DOE PAGESBeta

    Köberl, Martina; White, Richard A.; Erschen, Sabine; Spanberger, Nora; El-Arabi, Tarek F.; Jansson, Janet K.; Berg, Gabriele

    2015-08-13

    The genome sequence of Bacillus amyloliquefaciens strain Co1-6, a plant growth-promoting rhizobacterium (PGPR) with broad-spectrum antagonistic activity against plant-pathogenic fungi, bacteria, and nematodes, consists of a single 3.9-Mb circular chromosome. The genome reveals genes putatively responsible for its promising biocontrol and PGP properties.

  11. Complete genome sequence of Bacillus amyloliquefaciens strain Co1-6, a plant growth-promoting rhizobacterium of Calendula officinalis

    SciTech Connect

    Koeberl, Martina; White, Richard A.; Erschen, Sabine; Spanberger, Nora; El-Arabi, Tarek F.; Jansson, Janet K.; Berg, Gabriele

    2015-08-13

    The genome sequence of Bacillus amyloliquefaciens strain Co1-6, a plant growth-promoting rhizobacterium (PGPR) with broad-spectrum antagonistic activities against plant pathogenic fungi, bacteria and nematodes, consists of a single 3.9 Mb circular chromosome. The genome reveals genes putatively responsible for its promising biocontrol and PGP properties.

  12. Complete Genome Sequence of Bacillus amyloliquefaciens Strain Co1-6, a Plant Growth-Promoting Rhizobacterium of Calendula officinalis.

    PubMed

    Köberl, Martina; White, Richard A; Erschen, Sabine; Spanberger, Nora; El-Arabi, Tarek F; Jansson, Janet K; Berg, Gabriele

    2015-01-01

    The genome sequence of Bacillus amyloliquefaciens strain Co1-6, a plant growth-promoting rhizobacterium (PGPR) with broad-spectrum antagonistic activity against plant-pathogenic fungi, bacteria, and nematodes, consists of a single 3.9-Mb circular chromosome. The genome reveals genes putatively responsible for its promising biocontrol and PGP properties.

  13. Nonessential region of bacteriophage P4: DNA sequence, transcription, gene products, and functions.

    PubMed Central

    Ghisotti, D; Finkel, S; Halling, C; Dehò, G; Sironi, G; Calendar, R

    1990-01-01

    We sequenced the leftmost 2,640 base pairs of bacteriophage P4 DNA, thus completing the sequence of the 11,627-base-pair P4 genome. The newly sequenced region encodes three nonessential genes, which are called gop, beta, and cII (in order, from left to right). The gop gene product kills Escherichia coli when the beta protein is absent; the gop and beta genes are transcribed rightward from the same promoter. The cII gene is transcribed leftward to a rho-independent terminator. Mutation of this terminator creates a temperature-sensitive phenotype, presumably owing to a defect in expression of the beta gene. Images PMID:2403440

  14. Study of carD gene sequence in clinical isolates of Mycobacterium tuberculosis.

    PubMed

    Sarmadian, Hossein; Nazari, Razieh; Zolfaghari, Mohammad Reza; Pirayandeh, Mina; Sadrnia, Maryam; Arjomandzadegan, Mohammad; Titov, Leonid P; Rajabi, Fariba; Ahmadi, Azam; Shojapoor, Mana

    2014-03-01

    Mycobacterium tuberculosis growth rate is closely coupled to rRNA transcription which is regulated through carD gene. The aim of this study was to determine the sequence of carD gene in drug susceptible and resistant clinical isolates of M. tuberculosis and designing of a PCR assay based on carD sequence for rapid detection of this bacterium.Specific primers for amplification of carD gene were carefully designed, so that whole sequence of gene could be amplified; therefore primers were positioned at the upstream (promoter of this gene and ispD gene) and downstream (in ispD gene). DNA from 41 clinical isolates of M. tuberculosis with different pattern of drug resistance was used in the study. PCR conditions and annealing temperature were designed by means of online programs. PCR products were sequenced by ABI system.PCR product of carD gene was a 524 bp fragment. This method could detect all resistant and susceptible strains of M. tuberculosis. The size of amplified fragment was similar in all investigated samples. Sequence analysis showed that there was similar sequence in all of our isolates therefore probably this gene is considered to be conservative. Translation of nucleotide mode to amino acids was showed that TRCF domain in N-terminal of protein CarD was found to be fully conservative.This is the first study on the sequence of carD gene in clinical isolates of M. tuberculosis. This conservative gene is recommended for use as a target for designing of suitable inhibitors as anti-tuberculosis drug because its importance for life of MTB. In the other hand, a PCR detection method based on detection of carD gene was recommended for rapid detection in routine test.

  15. Characterization of SSU5C promoter of a rbcS gene from duckweed (Lemna gibba).

    PubMed

    Wang, Youru; Zhang, Yong; Yang, Baoyu; Chen, Shiyun

    2011-04-01

    Photosynthesis-associated nuclear genes are able to respond to multiple environmental and developmental signals. Studies have shown that light signals coordinate with hormone signaling pathways to control photomorphogenesis. A small subunit of ribulose-1,5 bisphosphate carboxylase/oxygenase (rbcS) gene promoter was cloned from duckweed (Lemna gibba). Sequence analysis revealed this promoter is different from the previously reported rbcs promoters and is named SSU5C. Analysis of T1 transgenic tobacco plants with a reporter gene under the control of the SSU5C promoter revealed that this promoter is tissue-specific and is positively regulated by red light. Promoter deletion analysis confirmed a region from position -152 to -49 relative to the start of transcription containing boxes X, Y and Z, and is identified to be critical for phytochrome responses. Further functional analysis of constructs of box-X, Y, Z, which was respectively fused to the basal SSU5C promoter, defined boxes X, Y and Z alone are able to direct phytochrome-regulated expression, indicating that boxes Y and Z are different from those of the SSU5B promoters in L. gibba. This promoter may be used for plant gene expression in a tissue-specific manner. PMID:21080078

  16. Operator Sequence Alters Gene Expression Independently of Transcription Factor Occupancy in Bacteria

    PubMed Central

    Garcia, Hernan G.; Sanchez, Alvaro; Boedicker, James Q.; Osborne, Melisa; Gelles, Jeff; Kondev, Jane; Phillips, Rob

    2012-01-01

    SUMMARY A canonical quantitative view of transcriptional regulation holds that the only role of operator sequence is to set the probability of transcription factor binding, with operator occupancy determining the level of gene expression. In this work, we test this idea by characterizing repression in vivo and the binding of RNA polymerase in vitro in experiments where operators of various sequences were placed either upstream or downstream from the promoter in Escherichia coli. Surprisingly, we find that operators with a weaker binding affinity can yield higher repression levels than stronger operators. Repressor bound to upstream operators modulates promoter escape, and the magnitude of this modulation is not correlated with the repressor-operator binding affinity. This suggests that operator sequences may modulate transcription by altering the nature of the interaction of the bound transcription factor with the transcriptional machinery, implying a new layer of sequence dependence that must be confronted in the quantitative understanding of gene expression. PMID:22840405

  17. Sequence determinants of prokaryotic gene expression level under heat stress.

    PubMed

    Xiong, Heng; Yang, Yi; Hu, Xiao-Pan; He, Yi-Ming; Ma, Bin-Guang

    2014-11-01

    Prokaryotic gene expression is environment-dependent and temperature plays an important role in shaping the gene expression profile. Revealing the regulation mechanisms of gene expression pertaining to temperature has attracted tremendous efforts in recent years particularly owning to the yielding of transcriptome and proteome data by high-throughput techniques. However, most of the previous works concentrated on the characterization of the gene expression profile of individual organism and little effort has been made to disclose the commonality among organisms, especially for the gene sequence features. In this report, we collected the transcriptome and proteome data measured under heat stress condition from recently published literature and studied the sequence determinants for the expression level of heat-responsive genes on multiple layers. Our results showed that there indeed exist commonness and consistent patterns of the sequence features among organisms for the differentially expressed genes under heat stress condition. Some features are attributed to the requirement of thermostability while some are dominated by gene function. The revealed sequence determinants of bacterial gene expression level under heat stress complement the knowledge about the regulation factors of prokaryotic gene expression responding to the change of environmental conditions. Furthermore, comparisons to thermophilic adaption have been performed to reveal the similarity and dissimilarity of the sequence determinants for the response to heat stress and for the adaption to high habitat temperature, which elucidates the complex landscape of gene expression related to the same physical factor of temperature.

  18. Transcription of the interleukin 4 gene is regulated by multiple promoter elements

    PubMed Central

    1993-01-01

    Activation of T helper cell 1 (Th1) and Th2 results in transcription of the interleukin 2 (IL-2) and IL-4 cytokine genes, respectively. Whereas many of the regulatory elements and factors responsible for IL-2 transcription in T cells are well defined, little is known about parallel mechanisms that drive transcription of the IL-4 gene. Here we have analyzed the murine IL-4 promoter, both in vivo and in a Th2 clone. 3 kb of IL-4 upstream sequence is shown to be sufficient to achieve tissue-specific and inducible expression of a thymidine kinase reporter gene in vivo in a manner that mirrors the expression of endogenous IL-4. Tissue-specific and inducible expression is also demonstrated in a Th2 clone, but not in a B cell line. Deletional and mutational analysis of the IL-4 promoter demonstrated that sequences from -100 to -28 were necessary for a transcriptional response to Concanavalin A or anti-CD3 monoclonal antibody. An overlapping, yet smaller region, spanning the sequences from -60 to -28 bp was shown to be required for the response to ionomycin. Mutation of an 8-bp region from -43 to -35 of the IL-4 promoter completely abrogated IL-4 gene transcription in response to all stimuli tested. In addition, our results show that the effects of the immunosuppressive agent Cyclosporin A map to the same DNA sequences as the positive control elements. These results identify DNA sequences that are functionally important for the control of IL-4 gene transcription both in vivo and in vitro. Although these sequences are highly conserved in the human and murine IL-4 genes, they are largely not present in the IL-2 enhancer complex. Thus, cytokine-specific cis-acting elements may be one mechanism by which these two cytokine genes are differentially regulated. PMID:8496684

  19. [Interactions of 1A2 insulator with promoter of hsp 70 gene in Drosophila melanogaster].

    PubMed

    Chetverina, D A; Elizar'ev, P V; Georgiev, P G; Erokhin, M M

    2013-04-01

    Insulators are regulatory DNA elements that participate in the modulation of the interactions between enhancers and promoters. Depending on the situation, insulators can either stabilize or destroy the contacts between enhancers and promoters. A possible explanation for the activity of insulators is their ability to directly interact with gene promoters. In the present study, it was demonstrated that, in model systems, a 1A2 insulator could interact with the core sequence of an hsp70 promoter. In this case, the insulator protein CP190 is found on the hsp70 promoter, which depends on the presence of an insulator in the transgene. The data obtained are consistent with the model, which implies that direct contacts between insulators and promoters make a considerable contribution to the modulation of the interactions between insulators and promoters. PMID:23866619

  20. Cone specific promoter for use in gene therapy of retinal degenerative diseases.

    PubMed

    Dyka, Frank M; Boye, Sanford L; Ryals, Renee C; Chiodo, Vince A; Boye, Shannon E; Hauswirth, William W

    2014-01-01

    Achromatopsia (ACHM) is caused by a progressive loss of cone photoreceptors leading to color blindness and poor visual acuity. Animal studies and human clinical trials have shown that gene replacement therapy with adeno-associate virus (AAV) is a viable treatment option for this disease. Although there have been successful attempts to optimize capsid proteins for increased specificity, it is simpler to restrict expression via the use of cell type-specific promoters. To target cone photoreceptors, a chimeric promoter consisting of an enhancer element of interphotoreceptor retinoid-binding protein promoter and a minimal sequence of the human transducin alpha-subunit promoter (IRBPe/GNAT2) was created. Additionally, a synthetic transducin alpha-subunit promoter (synGNAT2/GNAT2) containing conserved sequence blocks located downstream of the transcriptional start was created. The strength and specificity of these promoters were evaluated in murine retina by immunohistochemistry. The results showed that the chimeric, (IRBPe/GNAT2) promoter is more efficient and specific than the synthetic, synGNAT2/GNAT2 promoter. Additionally, IRBPe/GNAT2-mediated expression was found in all cone subtypes and it was improved over existing promoters currently used for gene therapy of achromatopsia. PMID:24664760

  1. Identification of a novel first exon in the human dystrophin gene and of a new promoter located more than 500 kb upstream of the nearest known promoter

    SciTech Connect

    Yanagawa, H.; Nishio, H.; Takeshima, Y.

    1994-09-01

    The dystrophin gene, which is muted in patients with Duchenne and Becker muscular dystrophies, is the largest known human gene. Five alternative promoters have been characterized until now. Here we show that a novel dystrophin isoform with a different first exon can be produced through transcription initiation at a previously-unidentified alternative promoter. The case study presented is that of patient with Duchenne muscular dystrophy who had a deletion extending from 5{prime} end of the dystrophin gene to exon 2, including all promoters previously mapped in the 5{prime} part of the gene. Transcripts from lymphoblastoid cells were found to contain sequences corresponding to exon 3, indicating the presence of new promoter upstream of this exon. The nucleotide sequence of amplified cDNA corresponding to the 5{prime} end of the new transcript indicated that the 5{prime} end of exon 3 was extended by 9 codons, only the last (most 3{prime}) of which codes for methionine. The genomic nucleotide sequence upstream from the new exon, as determined using inverse polymerase chain reaction, revealed the presence of sequences similar to a TATA box, an octamer motif and an MEF-2 element. The identified promoter/exon did not map to intron 2, as might have been expected, but to a position more than 500 kb upstream of the most 5{prime} of the previously-identified promoters, thereby adding 500 kb to the dystrophin gene. The sequence of part of the new promoter region is very similar to that of certain medium reiteration frequency repetitive sequences. These findings may help us understand the molecular evolution of the dystrophin gene.

  2. Nucleotide sequence of SHV-2 beta-lactamase gene

    SciTech Connect

    Garbarg-Chenon, A.; Godard, V.; Labia, R.; Nicolas, J.C. )

    1990-07-01

    The nucleotide sequence of plasmid-mediated beta-lactamase SHV-2 from Salmonella typhimurium (SHV-2pHT1) was determined. The gene was very similar to chromosomally encoded beta-lactamase LEN-1 of Klebsiella pneumoniae. Compared with the sequence of the Escherichia coli SHV-2 enzyme (SHV-2E.coli) obtained by protein sequencing, the deduced amino acid sequence of SHV-2pHT1 differed by three amino acid substitutions.

  3. Streptococcus pneumoniae arginine synthesis genes promote growth and virulence in pneumococcal meningitis.

    PubMed

    Piet, Jurgen R; Geldhoff, Madelijn; van Schaik, Barbera D C; Brouwer, Matthijs C; Valls Seron, Mercedes; Jakobs, Marja E; Schipper, Kim; Pannekoek, Yvonne; Zwinderman, Aeilko H; van der Poll, Tom; van Kampen, Antoine H C; Baas, Frank; van der Ende, Arie; van de Beek, Diederik

    2014-06-01

    Streptococcus pneumoniae (pneumococcus) is a major human pathogen causing pneumonia, sepsis and bacterial meningitis. Using a clinical phenotype based approach with bacterial whole-genome sequencing we identified pneumococcal arginine biosynthesis genes to be associated with outcome in patients with pneumococcal meningitis. Pneumococci harboring these genes show increased growth in human blood and cerebrospinal fluid (CSF). Mouse models of meningitis and pneumonia showed that pneumococcal strains without arginine biosynthesis genes were attenuated in growth or cleared, from lung, blood and CSF. Thus, S. pneumoniae arginine synthesis genes promote growth and virulence in invasive pneumococcal disease.

  4. Cloning and partial characterization of the mouse glutamine:fructose-6-phosphate amidotransferase (GFAT) gene promoter.

    PubMed Central

    Sayeski, P P; Wang, D; Su, K; Han, I O; Kudlow, J E

    1997-01-01

    Glutamine:fructose-6-phosphate amidotransferase (GFAT) is the enzyme that is rate limiting in the synthesis of glucosamine and hexosamines. Glucosamine has been proposed to contribute to the glucotoxicity of diabetes. Evidence that the gene encoding GFAT is transcriptionally regulated prompted us to clone and characterize its promoter. The position of the mouse GFAT promoter relative to the translational start site was located by primer extension and found to be 149 bp upstream of the translational start site. A 1.9 kb SacI fragment of the GFAT gene was found to contain the promoter and 88 bp of sequence downstream of the transcriptional start site. This promoter segment could drive expression of a luciferase reporter gene, could confer correct transcriptional initiation to the reporter and could confer the EGF-responsiveness previously observed in the native gene. The mouse GFAT promoter lacks a canonical TATA box and has several GC boxes within a highly GC-rich region. Deletional analysis of the promoter indicated that a proximal element extending to -120 relative to the transcriptional start site could confer reporter expression at a level of 57% of the 1.9 kb construct. Detailed analysis of this proximal region by DNase I footprinting, electrophoretic mobility shift assays and site-directed mutagenesis indicated that Sp1 binds to three elements in this proximal promoter segment and plays a vital role in regulation of transcription from this gene. PMID:9060444

  5. Insect and wound induced GUS gene expression from a Beta vulgaris proteinase inhibitor gene promoter

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Inducible gene promoters that are specifically activated by pathogen invasion or insect pest attack are needed for effective expression of resistance genes to control plant diseases. In the present study, a promoter from a serine proteinase inhibitor gene (BvSTI) shown to be up-regulated in resist...

  6. Alu sequence involvement in transcriptional insulation of the keratin 18 gene in transgenic mice.

    PubMed Central

    Thorey, I S; Ceceña, G; Reynolds, W; Oshima, R G

    1993-01-01

    The human keratin 18 (K18) gene is expressed in a variety of adult simple epithelial tissues, including liver, intestine, lung, and kidney, but is not normally found in skin, muscle, heart, spleen, or most of the brain. Transgenic animals derived from the cloned K18 gene express the transgene in appropriate tissues at levels directly proportional to the copy number and independently of the sites of integration. We have investigated in transgenic mice the dependence of K18 gene expression on the distal 5' and 3' flanking sequences and upon the RNA polymerase III promoter of an Alu repetitive DNA transcription unit immediately upstream of the K18 promoter. Integration site-independent expression of tandemly duplicated K18 transgenes requires the presence of either an 825-bp fragment of the 5' flanking sequence or the 3.5-kb 3' flanking sequence. Mutation of the RNA polymerase III promoter of the Alu element within the 825-bp fragment abolishes copy number-dependent expression in kidney but does not abolish integration site-independent expression when assayed in the absence of the 3' flanking sequence of the K18 gene. The characteristics of integration site-independent expression and copy number-dependent expression are separable. In addition, the formation of the chromatin state of the K18 gene, which likely restricts the tissue-specific expression of this gene, is not dependent upon the distal flanking sequences of the 10-kb K18 gene but rather may depend on internal regulatory regions of the gene. Images PMID:7692231

  7. Structural analysis and promoter characterization of the human collagenase-3 gene (MMP13)

    SciTech Connect

    Pendas, A.M.; Balbin, M.; Llano, E.

    1997-03-01

    Human collagenase-3 (MMP13) is a recently identified member of the matrix metalloproteinase (MMP) family that is expressed in breast carcinomas and in articular cartilage from arthritic patients. In this work we have isolated and characterized genomic clones coding for human collagenase-3. This gene is composed of 10 exons and 9 introns and spans over 12.5 kb. The overall organization of the collagenase-3 gene is similar to that of other MMP genes clustered at chromosome 11q22, including fibroblast collagenase (MMP-1), matrilysin (MMP-7), and macrophage metalloelastase (MMP-12), but is more distantly related to genes coding for stromelysin-3 (MMP-11), gelatinase-A (MMP-2), and gelatinase-B (MMP-9), which map outside of this gene cluster. Nucleotide sequence analysis of about 1 kb of the 5{prime}-flanking region of the collagenase-3 gene revealed the presence of a TATA box, an AP-1 motif, a PEA-3 consensus sequence, an osteoblast specific element (OSE-2), and a TGF-{beta} inhibitory element. Transient transfection experiments in HeLa and COS-1 cells with chloramphenicol acetyltransferase (CAT)-containing constructs showed that the AP-1 site is functional and responsible for the observed inducibility of the reporter gene by the tumor promoter 12-O-tetradecanoylphorbol-13-acetate (TPA). However, and in contrast to other MMP genes, no significative synergistic effect on CAT activity between the AP-1 and PEA-3 elements found in the collagenase-3 gene promoter was found. DNA binding analysis with nuclear extracts from HeLa cells revealed the formation of specific complexes between collagenase-3 promoter sequences containing the AP-1 site and nuclear proteins. The presence of this AP-1 functional site, which is able to confer responsiveness to a variety of tumor promoters and oncogene products, may contribute to explaining the high-level expression of collagenase-3 in breast carcinomas and degenerative joint diseases. 48 refs., 5 figs., 2 tabs.

  8. A viral satellite DNA vector-induced transcriptional gene silencing via DNA methylation of gene promoter in Nicotiana benthamiana.

    PubMed

    Ju, Zheng; Wang, Lei; Cao, Dongyan; Zuo, Jinhua; Zhu, Hongliang; Fu, Daqi; Luo, Yunbo; Zhu, Benzhong

    2016-09-01

    Virus-induced gene silencing (VIGS) has been widely used for plant functional genomics study at the post-transcriptional level using various DNA or RNA viral vectors. However, while virus-induced transcriptional gene silencing (VITGS) via DNA methylation of gene promoter was achieved using several plant RNA viral vectors, it has not yet been done using a satellite DNA viral vector. In this study, a viral satellite DNA associated with tomato yellow leaf curl China virus (TYLCCNV), which has been modified as a VIGS vector in previous research, was developed as a VITGS vector. Firstly, the viral satellite DNA VIGS vector was further optimized to a more convenient p1.7A+2mβ vector with high silencing efficiency of the phytoene desaturase (PDS) gene in Nicotiana benthamiana plants. Secondly, the constructed VITGS vector (TYLCCNV:35S), which carried a portion of the cauliflower mosaic virus 35S promoter, could successfully induce heritable transcriptional gene silencing (TGS) of the green fluorescent protein (GFP) gene in the 35S-GFP transgenic N. benthamiana line 16c plants. Moreover, bisulfite sequencing results revealed higher methylated cytosine residues at CG, CHG and CHH sites of the 35S promoter sequence in TYLCCNV:35S-inoculated plants than in TYLCCNV-inoculated line 16c plants (control). Overall, these results demonstrated that the viral satellite DNA vector could be used as an effective VITGS vector to study DNA methylation in plant genomes. PMID:27422476

  9. Single molecule targeted sequencing for cancer gene mutation detection.

    PubMed

    Gao, Yan; Deng, Liwei; Yan, Qin; Gao, Yongqian; Wu, Zengding; Cai, Jinsen; Ji, Daorui; Li, Gailing; Wu, Ping; Jin, Huan; Zhao, Luyang; Liu, Song; Ge, Liangjin; Deem, Michael W; He, Jiankui

    2016-01-01

    With the rapid decline in cost of sequencing, it is now affordable to examine multiple genes in a single disease-targeted clinical test using next generation sequencing. Current targeted sequencing methods require a separate step of targeted capture enrichment during sample preparation before sequencing. Although there are fast sample preparation methods available in market, the library preparation process is still relatively complicated for physicians to use routinely. Here, we introduced an amplification-free Single Molecule Targeted Sequencing (SMTS) technology, which combined targeted capture and sequencing in one step. We demonstrated that this technology can detect low-frequency mutations using artificially synthesized DNA sample. SMTS has several potential advantages, including simple sample preparation thus no biases and errors are introduced by PCR reaction. SMTS has the potential to be an easy and quick sequencing technology for clinical diagnosis such as cancer gene mutation detection, infectious disease detection, inherited condition screening and noninvasive prenatal diagnosis. PMID:27193446

  10. Single molecule targeted sequencing for cancer gene mutation detection

    PubMed Central

    Gao, Yan; Deng, Liwei; Yan, Qin; Gao, Yongqian; Wu, Zengding; Cai, Jinsen; Ji, Daorui; Li, Gailing; Wu, Ping; Jin, Huan; Zhao, Luyang; Liu, Song; Ge, Liangjin; Deem, Michael W.; He, Jiankui

    2016-01-01

    With the rapid decline in cost of sequencing, it is now affordable to examine multiple genes in a single disease-targeted clinical test using next generation sequencing. Current targeted sequencing methods require a separate step of targeted capture enrichment during sample preparation before sequencing. Although there are fast sample preparation methods available in market, the library preparation process is still relatively complicated for physicians to use routinely. Here, we introduced an amplification-free Single Molecule Targeted Sequencing (SMTS) technology, which combined targeted capture and sequencing in one step. We demonstrated that this technology can detect low-frequency mutations using artificially synthesized DNA sample. SMTS has several potential advantages, including simple sample preparation thus no biases and errors are introduced by PCR reaction. SMTS has the potential to be an easy and quick sequencing technology for clinical diagnosis such as cancer gene mutation detection, infectious disease detection, inherited condition screening and noninvasive prenatal diagnosis. PMID:27193446

  11. Functional analysis of promoters in the nisin gene cluster of Lactococcus lactis.

    PubMed Central

    de Ruyter, P G; Kuipers, O P; Beerthuyzen, M M; van Alen-Boerrigter, I; de Vos, W M

    1996-01-01

    The promoters in the nisin gene cluster nisABTCIPRKFEG of Lactococcus lactis were characterized by primer extension and transcriptional fusions to the Escherichia coli promoterless beta-glucuronidase gene (gusA). Three promoters preceding the nisA, nisR, and nisF genes, which all give rise to gusA expression in the nisin-producing strain L. lactis NZ9700, were identified. The transcriptional autoregulation of nisA by signal transduction involving the sensor histidine kinase NisK and the response regulator NisR has been demonstrated previously (0. P. Kuipers, M. M. Beerthuyzen, P. G. G. A. de Ruyter, E. J. Luesink, and W. M. de Vos, J. Biol. Chem. 270: 27299-27304, 1995), and therefore the possible nisin-dependent expression of gusA under control of the nisR and nisF promoters was also investigated. The nisR promoter was shown to direct nisin-independent gusA expression in L. lactis MG 1363, which is a nisin-transposon- and plasmid-free strain. L. lactis NZ9800, which does not produce nisin because of a deletion in the nisA gene, containing the nisF-gusA fusion plasmid, gave rise to beta-glucuronidase production only after induction by nisin. A similar regulation was found in L. lactis NZ3900, which contains a single copy of the nisR and nisK genes but no other genes of the nisin gene cluster. In contrast, when the nisK gene was disrupted, no beta-glucuronidase activity directed by the nisF promoter could be detected even after induction with nisin. These results show that, like the nisA promoter, the nisF promoter is nisin inducible. The nisF and nisA promoter sequences have significant similarities and contain a conserved region that could be important for transcriptional control. PMID:8655538

  12. Characterization of the human p53 gene promoter

    SciTech Connect

    Tuck, S.P.; Crawford, L.

    1989-05-01

    Transcriptional deregulation of the p53 gene may play an important part in the genesis of some tumors. The authors report here an accurate determination of the transcriptional start sites of the human p53 gene and show that the majority of p53 mRNA molecules do not contain a postulated stem-loop structure at their 5' ends. Recombinant plasmids of the human p53 promoter-leader region fused to the bacterial chloramphenicol acetyltransferase gene (cat) were constructed. After transfection into rodent or human cells, a 350-base-pair fragment spanning the promoter region conferred 4% of the CAT activity mediated by the simian virus 40 early promoter/enhancer. They monitored the efficiency with which 15 3' and 5' promoter deletion constructs initiated transcription. Their results show that an 85-base-pair fragment, previously thought to have resided in exon 1, is that is required for full promoter activity.

  13. Common DNA structural features exhibited by eukaryotic ribosomal gene promoters.

    PubMed Central

    Marilley, M; Pasero, P

    1996-01-01

    Nucleotide sequences of DNA regions containing eukaryotic ribosomal promoters were analysed using strategies designed to reveal sequence-directed structural features. DNA curvature, duplex stability and pattern of twist angle variation were studied by computer modelling. Although ribosomal promoters are known to lack sequence homology (unless very closely related species are considered), investigation of these structural characteristics uncovered striking homologies in all the taxonomic groups examined so far. This wide conservation of DNA structures, while DNA sequence is not conserved, suggests that the determined structures are fundamental for ribosomal promoter function. Moreover, this result agrees well with the recent observations showing that RNA polymerase I transcription factors have not evolved as intensively as previously suspected. PMID:8710487

  14. Genome Sequence of the Plant Growth Promoting Endophytic Bacterium Enterobacter sp. 638

    PubMed Central

    Taghavi, Safiyh; van der Lelie, Daniel; Hoffman, Adam; Zhang, Yian-Biao; Walla, Michael D.; Vangronsveld, Jaco; Newman, Lee; Monchy, Sébastien

    2010-01-01

    Enterobacter sp. 638 is an endophytic plant growth promoting gamma-proteobacterium that was isolated from the stem of poplar (Populus trichocarpa×deltoides cv. H11-11), a potentially important biofuel feed stock plant. The Enterobacter sp. 638 genome sequence reveals the presence of a 4,518,712 bp chromosome and a 157,749 bp plasmid (pENT638-1). Genome annotation and comparative genomics allowed the identification of an extended set of genes specific to the plant niche adaptation of this bacterium. This includes genes that code for putative proteins involved in survival in the rhizosphere (to cope with oxidative stress or uptake of nutrients released by plant roots), root adhesion (pili, adhesion, hemagglutinin, cellulose biosynthesis), colonization/establishment inside the plant (chemiotaxis, flagella, cellobiose phosphorylase), plant protection against fungal and bacterial infections (siderophore production and synthesis of the antimicrobial compounds 4-hydroxybenzoate and 2-phenylethanol), and improved poplar growth and development through the production of the phytohormones indole acetic acid, acetoin, and 2,3-butanediol. Metabolite analysis confirmed by quantitative RT–PCR showed that, the production of acetoin and 2,3-butanediol is induced by the presence of sucrose in the growth medium. Interestingly, both the genetic determinants required for sucrose metabolism and the synthesis of acetoin and 2,3-butanediol are clustered on a genomic island. These findings point to a close interaction between Enterobacter sp. 638 and its poplar host, where the availability of sucrose, a major plant sugar, affects the synthesis of plant growth promoting phytohormones by the endophytic bacterium. The availability of the genome sequence, combined with metabolome and transcriptome analysis, will provide a better understanding of the synergistic interactions between poplar and its growth promoting endophyte Enterobacter sp. 638. This information can be further exploited to

  15. RNA Replication from the Simian Virus 5 Antigenomic Promoter Requires Three Sequence-Dependent Elements Separated by Sequence-Independent Spacer Regions

    PubMed Central

    Keller, Michael A.; Murphy, Susan K.; Parks, Griffith D.

    2001-01-01

    We have previously shown for the paramyxovirus simian virus 5 (SV5) that a functional promoter for RNA replication requires proper spacing between two discontinuous elements: a 19-base segment at the 3′ terminus (conserved region I [CRI]) and an 18-base internal region (CRII) that is contained within the coding region of the L protein gene. In the work described here, we have used a reverse-genetics system to determine if the 53-base segment between CRI and CRII contains additional sequence-specific signals required for optimal replication or if this segment functions solely as a sequence-independent spacer region. A series of copyback defective interfering minigenome analogs were constructed to contain substitutions of nonviral sequences in place of bases 21 to 72 of the antigenomic promoter, and the relative level of RNA replication was measured by Northern blot analysis. The results from our mutational analysis indicate that in addition to CRI and CRII, optimal replication from the SV5 antigenomic promoter requires a third sequence-dependent element located 51 to 66 bases from the 3′ end of the RNA. Minigenome RNA replication was not affected by changes in the either the position of this element in relation to CRI and CRII or the predicted hexamer phase of NP encapsidation. Thus, optimal RNA replication from the SV5 antigenomic promoter requires three sequence-dependent elements, CRI, CRII and bases 51 to 66. PMID:11264390

  16. Interferon. gamma. response region in the promoter of the human DPA gene

    SciTech Connect

    Yang, Zhi; Sugawara, Minoru; Ponath, P.D.; Wessendorf, L.; Banerji, J.; Li, Yi; Strominger, J.L. )

    1990-12-01

    The interferon {gamma} (IFN-{gamma}) response region of the human class II major histocompatibility complex gene, DPA, has been localized to a 52-base-pair (bp) DNA fragment in the proximal promotor at {minus}107 to {minus}55 bp after transfection into HeLa cells of a series of 5{prime}, 3{prime}, and gap deletion mutants linked to a reporter gene, human growth hormone, as well as of synthetic oligonucleotides fused to the heterologous promoter thymidine kinase. The 52-mer sequence contains the X and Y box elements conserved in all class II genes; their presence is indispensable for IFN-{gamma} inducibility. Furthermore, an additional 5 bp immediately 5{prime} of the X box of the DPA gene are necessary and sufficient for IFN-{gamma} induction. This region may contain an IFN-{gamma} response element. A closely related sequence has also been found in the vicinity of the critical deletion sites of three other well-studied class II gene promoters, all of which require a much longer sequence 5{prime} of the X box. A fourth element, the W element, located about 15 bp 5{prime} of the X box in all class II genes, is clearly of little importance in IFN-{gamma} inducibility of the DPA gene.

  17. Absence of mutation at the 5'-upstream promoter region of the TPM4 gene from cardiac mutant axolotl (Ambystoma mexicanum).

    PubMed

    Denz, Christopher R; Zhang, Chi; Jia, Pingping; Du, Jianfeng; Huang, Xupei; Dube, Syamalima; Thomas, Anish; Poiesz, Bernard J; Dube, Dipak K

    2011-09-01

    Tropomyosins are a family of actin-binding proteins that show cell-specific diversity by a combination of multiple genes and alternative RNA splicing. Of the 4 different tropomyosin genes, TPM4 plays a pivotal role in myofibrillogenesis as well as cardiac contractility in amphibians. In this study, we amplified and sequenced the upstream regulatory region of the TPM4 gene from both normal and mutant axolotl hearts. To identify the cis-elements that are essential for the expression of the TPM4, we created various deletion mutants of the TPM4 promoter DNA, inserted the deleted segments into PGL3 vector, and performed promoter-reporter assay using luciferase as the reporter gene. Comparison of sequences of the promoter region of the TPM4 gene from normal and mutant axolotl revealed no mutations in the promoter sequence of the mutant TPM4 gene. CArG box elements that are generally involved in controlling the expression of several other muscle-specific gene promoters were not found in the upstream regulatory region of the TPM4 gene. In deletion experiments, loss of activity of the reporter gene was noted upon deletion which was then restored upon further deletion suggesting the presence of both positive and negative cis-elements in the upstream regulatory region of the TPM4 gene. We believe that this is the first axolotl promoter that has ever been cloned and studied with clear evidence that it functions in mammalian cell lines. Although striated muscle-specific cis-acting elements are absent from the promoter region of TPM4 gene, our results suggest the presence of positive and negative cis-elements in the promoter region, which in conjunction with positive and negative trans-elements may be involved in regulating the expression of TPM4 gene in a tissue-specific manner.

  18. Characterization and activity enhancement of the phloem-specific pumpkin PP2 gene promoter.

    PubMed

    Guo, Hongnian; Chen, Xiaoying; Zhang, Haili; Fang, Rongxiang; Yuan, Zhengqiang; Zhang, Zhenshan; Tian, Yingchuan

    2004-12-01

    The promoter of the pumpkin (Cucurbita moschata) PP2 gene (designated NP) was isolated from the restriction enzyme-digested genomic DNA pool by genome walking and its activity and phloem specificity were examined in transgenic tobacco plants by using GUS as a reporter. Deletion analysis of the promoter revealed that the 473-bp fragment (-465 to + 8 relative to the transcription start site; designated as NPII) exhibited similar activity as the full-length NP promoter and retained its phloem specificity. Furthermore, the sequence from -465 to -171 was shown to contain positive regulatory cis-elements for the promoter activity. An enhanced NP promoter was constructed by duplicating the sequence -465 to -85, and its activity in phloem tissue was shown to be higher than that of the Commelina Yellow Mottle Virus (CoYMV) promoter or a chimeric promoter consisting of the double enhancer sequence from the Cauliflower Mosaic Virus (CaMV) 35S promoter fused upstream to the NPII fragment.

  19. Expression mediated by three partial sequences of the human tyrosine hydroxylase promoter in vivo

    PubMed Central

    Rolland, Anne-Sophie; Kareva, Tatyana; Yarygina, Olga; Kholodilov, Nikolai; Burke, Robert E

    2016-01-01

    The use of viral vectors to transfect postmitotic neurons has provided an important research tool, and it offers promise for treatment of neurologic disease. The utility of vectors is enhanced by the use of selective promoters that permit control of the cellular site of expression. One potential clinical application is in the neurorestorative treatment of Parkinson’s disease by the induction of new axon growth. However, many of the genes with an ability to restore axons have oncogenic potential. Therefore, clinical safety would be enhanced by restriction of expression to neurons affected by the disease, particularly dopamine neurons. To achieve this goal we have evaluated in vivo three partial sequences of the promoter for human tyrosine hydroxylase, the rate limiting enzyme in catecholamine synthesis. All sequences induced expression in dopamine neurons. None of them induced expression in glia or in nondopaminergic neurons in striatum or cortex. We conclude that these sequences have potential use for targeting dopamine neurons in research and clinical applications. PMID:27689101

  20. Structural basis of Ets1 cooperative binding to palindromic sequences on stromelysin-1 promoter DNA

    SciTech Connect

    Babayeva, Nigar D.; Wilder, Phillip J.; Shiina, Masaaki; Mino, Koshiki; Desler, Michelle; Ogata, Kazuhiro; Rizzino, Angie; Tahirov, Tahir H.

    2010-09-03

    Ets1 is a member of the Ets family of transcription factors. Ets1 is autoinhibited and its activation requires heterodimerization with a partner protein or DNA-mediated homodimerization for cooperative DNA binding. In the latter case, Ets1 molecules bind to palindromic sequences in which two Ets-binding sites (EBS) are separated by four base pairs, for example in the promoters of stromelysin-1 and p53. Interestingly, counteraction of autoinhibition requires the autoinhibitory region encoded by exon VII of the gene. The structural basis for the requirement of autoinhibitory sequences for Ets1 binding to palindromic EBS still remains unresolved. Here we report the crystal structure of two Ets1 molecules bound to an EBS palindrome of the stromelysin-1 promoter DNA, providing a plausible explanation for the requirement of exon VII-encoded sequences for Ets1 cooperative DNA binding. The proposed mechanism was verified both in vitro by surface plasmon resonance and in vivo by transcription-based assays.

  1. Expression mediated by three partial sequences of the human tyrosine hydroxylase promoter in vivo.

    PubMed

    Rolland, Anne-Sophie; Kareva, Tatyana; Yarygina, Olga; Kholodilov, Nikolai; Burke, Robert E

    2016-01-01

    The use of viral vectors to transfect postmitotic neurons has provided an important research tool, and it offers promise for treatment of neurologic disease. The utility of vectors is enhanced by the use of selective promoters that permit control of the cellular site of expression. One potential clinical application is in the neurorestorative treatment of Parkinson's disease by the induction of new axon growth. However, many of the genes with an ability to restore axons have oncogenic potential. Therefore, clinical safety would be enhanced by restriction of expression to neurons affected by the disease, particularly dopamine neurons. To achieve this goal we have evaluated in vivo three partial sequences of the promoter for human tyrosine hydroxylase, the rate limiting enzyme in catecholamine synthesis. All sequences induced expression in dopamine neurons. None of them induced expression in glia or in nondopaminergic neurons in striatum or cortex. We conclude that these sequences have potential use for targeting dopamine neurons in research and clinical applications. PMID:27689101

  2. DNA sequences that activate isocitrate lyase gene expression during late embryogenesis and during postgerminative growth.

    PubMed Central

    Zhang, J Z; Santes, C M; Engel, M L; Gasser, C S; Harada, J J

    1996-01-01

    We analyzed DNA sequences that regulate the expression of an isocitrate lyase gene from Brassica napus L. during late embryogenesis and during postgerminative growth to determine whether glyoxysomal function is induced by a common mechanism at different developmental stages. beta-Glucuronidase constructs were used both in transient expression assays in B. napus and in transgenic Arabidopsis thaliana to identify the segments of the isocitrate lyase 5' flanking region that influence promoter activity. DNA sequences that play the principal role in activating the promoter during post-germinative growth are located more than 1,200 bp upstream of the gene. Distinct DNA sequences that were sufficient for high-level expression during late embryogenesis but only low-level expression during postgerminative growth were also identified. Other parts of the 5' flanking region increased promoter activity both in developing seed and in seedlings. We conclude that a combination of elements is involved in regulating the isocitrate lyase gene and that distinct DNA sequences play primary roles in activating the gene in embryos and in seedlings. These findings suggest that different signals contribute to the induction of glyoxysomal function during these two developmental stages. We also showed that some of the constructs were expressed differently in transient expression assays and in transgenic plants. PMID:8934622

  3. A sunflower helianthinin gene upstream sequence ensemble contains an enhancer and sites of nuclear protein interaction.

    PubMed Central

    Jordano, J; Almoguera, C; Thomas, T L

    1989-01-01

    Genes encoding helianthinin, the major seed protein in sunflower, are highly regulated. We have identified putative cis-acting and trans-acting elements that may function in the control of helianthinin expression. A 404-base pair DNA fragment on the sunflower helianthinin gene HaG3D, located 322 base pairs from the transcriptional start site, enhanced beta-glucuronidase expression in transgenic tobacco embryos. Sequences within this fragment were found to bind nuclear proteins present in both sunflower embryo and hypocotyl nuclear extracts. The binding site was localized by phenanthroline-copper ion footprinting experiments to A/T-rich sequences located from -705 to -654. Binding competition experiments revealed that these sunflower proteins also bind to upstream promoter sequences from another helianthinin gene (HaG3A) and two other plant embryo-specific genes, carrot DcG3 and French bean phaseolin. However, sequences of the cauliflower mosaic virus 35S promoter/enhancer complex failed to compete for its binding. Phenanthroline-copper ion footprinting experiments showed that the binding sites for the sunflower proteins in HaG3A (-1463 to -1514 and -702 to -653) and in phaseolin (-671 to -627) are also very A/T-rich, have similar sizes, and are located at similar distances from their respective promoters. PMID:2535527

  4. Evolution of gene sequence in response to chromosomal location.

    PubMed

    Díaz-Castillo, Carlos; Golic, Kent G

    2007-09-01

    Evolutionary forces acting on the repetitive DNA of heterochromatin are not constrained by the same considerations that apply to protein-coding genes. Consequently, such sequences are subject to rapid evolutionary change. By examining the Troponin C gene family of Drosophila melanogaster, which has euchromatic and heterochromatic members, we find that protein-coding genes also evolve in response to their chromosomal location. The heterochromatic members of the family show a reduced CG content and increased variation in DNA sequence. We show that the CG reduction applies broadly to the protein-coding sequences of genes located at the heterochromatin:euchromatin interface, with a very strong correlation between CG content and the distance from centric heterochromatin. We also observe a similar trend in the transition from telomeric heterochromatin to euchromatin. We propose that the methylation of DNA is one of the forces driving this sequence evolution.

  5. Genetic analysis of the TBX3 gene promoter in ventricular septal defects.

    PubMed

    Chen, Dongfeng; Qiao, Yanli; Meng, Haihong; Pang, Shuchao; Huang, Wenhui; Zhang, Hongyu; Yan, Bo

    2013-01-10

    Congenital heart disease (CHD) is the most common birth defect in humans. Genetic causes and underlying molecular mechanisms for CHD remain largely unknown. T-box transcription factor 3 (TBX3) plays a critical role in the developing heart in a dose-dependent manner. TBX3 represses chamber myocardial gene expression. Mutations in TBX3 gene have been associated to ulnar-mammary syndrome with multiple developmental defects, including cardiac defects. We hypothesized that the sequence variants within TBX3 gene promoter that change TBX3 levels may mediate CHD development. In this study, TBX3 gene promoter was genetically analyzed in large cohorts of patients with ventricular septal defect (VSD) (n=325) and ethnic-matched healthy controls (n=359). Seven sequence variants, including two single-nucleotide polymorphisms (g.3863 C>T and g.4095G>T), three novel deletions (g.4433_4435del, g.4672_4675del and g.4820_4821del) and two novel insertions (g.3913_3914ins and g.4735_4736ins), were identified. Five of the seven variants were identified in VSD patients and controls with similar frequencies. Two other variants were found only in controls. These variants, which were observed in high frequencies, did not modify or interrupt the critical binding site for basic transcription factors. Taken together, these results suggested that the sequence variants within the TBX3 gene promoter did not contribute to VSD etiology. PMID:23116943

  6. Nucleosome Stability Distinguishes Two Different Promoter Types at All Protein-Coding Genes in Yeast.

    PubMed

    Kubik, Slawomir; Bruzzone, Maria Jessica; Jacquet, Philippe; Falcone, Jean-Luc; Rougemont, Jacques; Shore, David

    2015-11-01

    Previous studies indicate that eukaryotic promoters display a stereotypical chromatin landscape characterized by a well-positioned +1 nucleosome near the transcription start site and an upstream -1 nucleosome that together demarcate a nucleosome-free (or -depleted) region. Here we present evidence that there are two distinct types of promoters distinguished by the resistance of the -1 nucleosome to micrococcal nuclease digestion. These different architectures are characterized by two sequence motifs that are broadly deployed at one set of promoters where a nuclease-sensitive ("fragile") nucleosome forms, but concentrated in a narrower, nucleosome-free region at all other promoters. The RSC nucleosome remodeler acts through the motifs to establish stable +1 and -1 nucleosome positions, while binding of a small set of general regulatory (pioneer) factors at fragile nucleosome promoters plays a key role in their destabilization. We propose that the fragile nucleosome promoter architecture is adapted for regulation of highly expressed, growth-related genes.

  7. Patterns of sequence conservation in presynaptic neural genes

    PubMed Central

    Hadley, Dexter; Murphy, Tara; Valladares, Otto; Hannenhalli, Sridhar; Ungar, Lyle; Kim, Junhyong; Bućan, Maja

    2006-01-01

    Background The neuronal synapse is a fundamental functional unit in the central nervous system of animals. Because synaptic function is evolutionarily conserved, we reasoned that functional sequences of genes and related genomic elements known to play important roles in neurotransmitter release would also be conserved. Results Evolutionary rate analysis revealed that presynaptic proteins evolve slowly, although some members of large gene families exhibit accelerated evolutionary rates relative to other family members. Comparative sequence analysis of 46 megabases spanning 150 presynaptic genes identified more than 26,000 elements that are highly conserved in eight vertebrate species, as well as a small subset of sequences (6%) that are shared among unrelated presynaptic genes. Analysis of large gene families revealed that upstream and intronic regions of closely related family members are extremely divergent. We also identified 504 exceptionally long conserved elements (≥360 base pairs, ≥80% pair-wise identity between human and other mammals) in intergenic and intronic regions of presynaptic genes. Many of these elements form a highly stable stem-loop RNA structure and consequently are candidates for novel regulatory elements, whereas some conserved noncoding elements are shown to correlate with specific gene expression profiles. The SynapseDB online database integrates these findings and other functional genomic resources for synaptic genes. Conclusion Highly conserved elements in nonprotein coding regions of 150 presynaptic genes represent sequences that may be involved in the transcriptional or post-transcriptional regulation of these genes. Furthermore, comparative sequence analysis will facilitate selection of genes and noncoding sequences for future functional studies and analysis of variation studies in neurodevelopmental and psychiatric disorders. PMID:17096848

  8. Different promoter affinities account for specificity in MYC-dependent gene regulation

    PubMed Central

    Lorenzin, Francesca; Benary, Uwe; Baluapuri, Apoorva; Walz, Susanne; Jung, Lisa Anna; von Eyss, Björn; Kisker, Caroline; Wolf, Jana; Eilers, Martin; Wolf, Elmar

    2016-01-01

    Enhanced expression of the MYC transcription factor is observed in the majority of tumors. Two seemingly conflicting models have been proposed for its function: one proposes that MYC enhances expression of all genes, while the other model suggests gene-specific regulation. Here, we have explored the hypothesis that specific gene expression profiles arise since promoters differ in affinity for MYC and high-affinity promoters are fully occupied by physiological levels of MYC. We determined cellular MYC levels and used RNA- and ChIP-sequencing to correlate promoter occupancy with gene expression at different concentrations of MYC. Mathematical modeling showed that binding affinities for interactions of MYC with DNA and with core promoter-bound factors, such as WDR5, are sufficient to explain promoter occupancies observed in vivo. Importantly, promoter affinity stratifies different biological processes that are regulated by MYC, explaining why tumor-specific MYC levels induce specific gene expression programs and alter defined biological properties of cells. DOI: http://dx.doi.org/10.7554/eLife.15161.001 PMID:27460974

  9. ZBTB20 is a sequence-specific transcriptional repressor of alpha-fetoprotein gene.

    PubMed

    Zhang, Hai; Cao, Dongmei; Zhou, Luting; Zhang, Ye; Guo, Xiaoqin; Li, Hui; Chen, Yuxia; Spear, Brett T; Wu, Jia-Wei; Xie, Zhifang; Zhang, Weiping J

    2015-07-15

    Alpha-fetoprotein (AFP) represents a classical model system to study developmental gene regulation in mammalian cells. We previously reported that liver ZBTB20 is developmentally regulated and plays a central role in AFP postnatal repression. Here we show that ZBTB20 is a sequence-specific transcriptional repressor of AFP. By ELISA-based DNA-protein binding assay and conventional gel shift assay, we successfully identified a ZBTB20-binding site at -104/-86 of mouse AFP gene, flanked by two HNF1 sites and two C/EBP sites in the proximal promoter. Importantly, mutation of the core sequence in this site fully abolished its binding to ZBTB20 in vitro, as well as the repression of AFP promoter activity by ZBTB20. The unique ZBTB20 site was highly conserved in rat and human AFP genes, but absent in albumin genes. These help to explain the autonomous regulation of albumin and AFP genes in the liver after birth. Furthermore, we demonstrated that transcriptional repression of AFP gene by ZBTB20 was liver-specific. ZBTB20 was dispensable for AFP silencing in other tissues outside liver. Our data define a cognate ZBTB20 site in AFP promoter which mediates the postnatal repression of AFP gene in the liver.

  10. Nucleotide sequence of the regulatory locus controlling expression of bacterial genes for bioluminescence.

    PubMed Central

    Engebrecht, J; Silverman, M

    1987-01-01

    Production of light by the marine bacterium Vibrio fischeri and by recombinant hosts containing cloned lux genes is controlled by the density of the culture. Density-dependent regulation of lux gene expression has been shown to require a locus consisting of the luxR and luxI genes and two closely linked divergent promoters. As part of a genetic analysis to understand the regulation of bioluminescence, we have sequenced the region of DNA containing this control circuit. Open reading frames corresponding to luxR and luxI were identified; transcription start sites were defined by S1 nuclease mapping and sequences resembling promoter elements were located. Images PMID:3697093

  11. Characterization and nucleotide sequence of a chicken gene encoding an opal suppressor tRNA and its flanking DNA segments.

    PubMed Central

    Hatfield, D L; Dudock, B S; Eden, F C

    1983-01-01

    A naturally occurring opal suppressor serine tRNA has been purified from chicken liver and used as a probe to isolate the corresponding gene from a library of chicken DNA in bacteriophage lambda. This minor tRNA is encoded by a single-copy gene that is not part of a tRNA gene cluster. DNA sequence analysis of the gene and its flanking DNA segments shows that the gene is encoded in an 87-base-pair segment without intervening sequences and specifies a tRNA that reads the termination codon UGA. This gene has additional nucleotides in the 5' internal promoter region but has a normal 3' internal promoter sequence and the usual termination signal. Images PMID:6308662

  12. Diversity and characterization of polymorphic 5' promoter haplotypes of MICA and MICB genes.

    PubMed

    Cox, S T; Madrigal, J A; Saudemont, A

    2014-09-01

    The major histocompatibility complex (MHC) class I-related chain A (MICA) and B (MICB) are ligands for the natural killer group 2, member D (NKG2D) activating receptor expressed on natural killer (NK) cells, natural killer T (NKT) cells, CD8+ T cells and γδ T cells. Natural killer group 2, member D (NKG2D) ligand expression is stress-related and upregulated by infected or oncogenic cells leading to cytolysis. MICA and MICB genes display considerable polymorphism among individuals and studies have investigated allelic association with disease and relevance of MICA in transplantation, with variable success. It is now known that promoters of MICA and MICB are polymorphic with some polymorphisms associating with reduced expression. We sequenced International Histocompatibility Workshop (IHW) cell line DNA to determine promoter types and alleles encoded by exons 2-6. We found 8 of 12 known MICA promoter polymorphisms and although promoter P7 dominated, other promoters associated with the same allele. For example, MICA*002:01 had promoters P3, P4 or P7 and the common MICA*008:01/04 type had P1, P6 or P7. Similarly, we sequenced 8 of 12 known MICB promoter haplotypes. Some coding region defined MICB alleles had a single promoter, for example, MICB*002:01 and promoter P9, whereas the promiscuous MICB*005 allele had promoters P1, P2, P5, P6, P10 or P12. The results indicate potential for variation in expression of MICA and MICB ligands between individuals with the same allelic types. If differential expression by polymorphic MICA and MICB promoters is confirmed by functional studies, involvement of these genes in disease susceptibility or adverse transplantation outcomes may require knowledge of both promoter and allelic types to make meaningful conclusions.

  13. First draft genome sequencing of indole acetic acid producing and plant growth promoting fungus Preussia sp. BSL10.

    PubMed

    Khan, Abdul Latif; Asaf, Sajjad; Khan, Abdur Rahim; Al-Harrasi, Ahmed; Al-Rawahi, Ahmed; Lee, In-Jung

    2016-05-10

    Preussia sp. BSL10, family Sporormiaceae, was actively producing phytohormone (indole-3-acetic acid) and extra-cellular enzymes (phosphatases and glucosidases). The fungus was also promoting the growth of arid-land tree-Boswellia sacra. Looking at such prospects of this fungus, we sequenced its draft genome for the first time. The Illumina based sequence analysis reveals an approximate genome size of 31.4Mbp for Preussia sp. BSL10. Based on ab initio gene prediction, total 32,312 coding sequences were annotated consisting of 11,967 coding genes, pseudogenes, and 221 tRNA genes. Furthermore, 321 carbohydrate-active enzymes were predicted and classified into many functional families. PMID:26995610

  14. Flagellin gene sequence variation in the genus Pseudomonas.

    PubMed

    Bellingham, N F; Morgan, J A; Saunders, J R; Winstanley, C

    2001-07-01

    Flagellin gene (fliC) sequences from 18 strains of Pseudomonas sensu stricto representing 8 different species, and 9 representative fliC sequences from other members of the gamma sub-division of proteobacteria, were compared. Analysis was performed on N-terminal, C-terminal and whole fliC sequences. The fliC analyses confirmed the inferred relationship between P. mendocina, P. oleovorans and P. aeruginosa based on 16S rRNA sequence comparisons. In addition, the analyses indicated that P. putida PRS2000 was closely related to P. fluorescens SBW25 and P. fluorescens NCIMB 9046T, but suggested that P. putida PaW8 and P. putida PRS2000 were more closely related to other Pseudomonas spp. than they were to each other. There were a number of inconsistencies in inferred evolutionary relationships between strains, depending on the analysis performed. In particular, whole flagellin gene comparisons often differed from those obtained using N- and C-terminal sequences. However, there were also inconsistencies between the terminal region analyses, suggesting that phylogenetic relationships inferred on the basis of fliC sequence should be treated with caution. Although the central domain of fliC is highly variable between Pseudomonas strains, there was evidence of sequence similarities between the central domains of different Pseudomonas fliC sequences. This indicates the possibility of recombination in the central domain of fliC genes within Pseudomonas species, and between these genes and those from other bacteria. PMID:11518318

  15. GeneTack database: genes with frameshifts in prokaryotic genomes and eukaryotic mRNA sequences.

    PubMed

    Antonov, Ivan; Baranov, Pavel; Borodovsky, Mark

    2013-01-01

    Database annotations of prokaryotic genomes and eukaryotic mRNA sequences pay relatively low attention to frame transitions that disrupt protein-coding genes. Frame transitions (frameshifts) could be caused by sequencing errors or indel mutations inside protein-coding regions. Other observed frameshifts are related to recoding events (that evolved to control expression of some genes). Earlier, we have developed an algorithm and software program GeneTack for ab initio frameshift finding in intronless genes. Here, we describe a database (freely available at http://topaz.gatech.edu/GeneTack/db.html) containing genes with frameshifts (fs-genes) predicted by GeneTack. The database includes 206 991 fs-genes from 1106 complete prokaryotic genomes and 45 295 frameshifts predicted in mRNA sequences from 100 eukaryotic genomes. The whole set of fs-genes was grouped into clusters based on sequence similarity between fs-proteins (conceptually translated fs-genes), conservation of the frameshift position and frameshift direction (-1, +1). The fs-genes can be retrieved by similarity search to a given query sequence via a web interface, by fs-gene cluster browsing, etc. Clusters of fs-genes are characterized with respect to their likely origin, such as pseudogenization, phase variation, etc. The largest clusters contain fs-genes with programed frameshifts (related to recoding events).

  16. Conserved cis-regulatory modules in promoters of genes encoding wheat high-molecular-weight glutenin subunits

    PubMed Central

    Ravel, Catherine; Fiquet, Samuel; Boudet, Julie; Dardevet, Mireille; Vincent, Jonathan; Merlino, Marielle; Michard, Robin; Martre, Pierre

    2014-01-01

    The concentration and composition of the gliadin and glutenin seed storage proteins (SSPs) in wheat flour are the most important determinants of its end-use value. In cereals, the synthesis of SSPs is predominantly regulated at the transcriptional level by a complex network involving at least five cis-elements in gene promoters. The high-molecular-weight glutenin subunits (HMW-GS) are encoded by two tightly linked genes located on the long arms of group 1 chromosomes. Here, we sequenced and annotated the HMW-GS gene promoters of 22 electrophoretic wheat alleles to identify putative cis-regulatory motifs. We focused on 24 motifs known to be involved in SSP gene regulation. Most of them were identified in at least one HMW-GS gene promoter sequence. A common regulatory framework was observed in all the HMW-GS gene promoters, as they shared conserved cis-regulatory modules (CCRMs) including all the five motifs known to regulate the transcription of SSP genes. This common regulatory framework comprises a composite box made of the GATA motifs and GCN4-like Motifs (GLMs) and was shown to be functional as the GLMs are able to bind a bZIP transcriptional factor SPA (Storage Protein Activator). In addition to this regulatory framework, each HMW-GS gene promoter had additional motifs organized differently. The promoters of most highly expressed x-type HMW-GS genes contain an additional box predicted to bind R2R3-MYB transcriptional factors. However, the differences in annotation between promoter alleles could not be related to their level of expression. In summary, we identified a common modular organization of HMW-GS gene promoters but the lack of correlation between the cis-motifs of each HMW-GS gene promoter and their level of expression suggests that other cis-elements or other mechanisms regulate HMW-GS gene expression. PMID:25429295

  17. Methylation Status of Vitamin D Receptor Gene Promoter in Benign and Malignant Adrenal Tumors

    PubMed Central

    Pilon, Catia; Rebellato, Andrea; Urbanet, Riccardo; Guzzardo, Vincenza; Cappellesso, Rocco; Sasano, Hironobu; Fassina, Ambrogio

    2015-01-01

    We previously showed a decreased expression of vitamin D receptor (VDR) mRNA/protein in a small group of adrenocortical carcinoma (ACC) tissues, suggesting the loss of a protective role of VDR against malignant cell growth in this cancer type. Downregulation of VDR gene expression may result from epigenetics events, that is, methylation of cytosine nucleotide of CpG islands in VDR gene promoter. We analyzed methylation of CpG sites in the VDR gene promoter in normal adrenals and adrenocortical tumor samples. Methylation of CpG-rich 5′ regions was assessed by bisulfite sequencing PCR using bisulfite-treated DNA from archival microdissected paraffin-embedded adrenocortical tissues. Three normal adrenals and 23 various adrenocortical tumor samples (15 adenomas and 8 carcinomas) were studied. Methylation in the promoter region of VDR gene was found in 3/8 ACCs, while no VDR gene methylation was observed in normal adrenals and adrenocortical adenomas. VDR mRNA and protein levels were lower in ACCs than in benign tumors, and VDR immunostaining was weak or negative in ACCs, including all 3 methylated tissue samples. The association between VDR gene promoter methylation and reduced VDR gene expression is not a rare event in ACC, suggesting that VDR epigenetic inactivation may have a role in adrenocortical carcinogenesis. PMID:26843863

  18. Methylation loss at H19 imprinted gene correlates with methylenetetrahydrofolate reductase gene promoter hypermethylation in semen samples from infertile males.

    PubMed

    Rotondo, John C; Selvatici, Rita; Di Domenico, Maura; Marci, Roberto; Vesce, Fortunato; Tognon, Mauro; Martini, Fernanda

    2013-09-01

    Aberrant methylation at the H19 paternal imprinted gene has been identified in different cohorts of infertile males. The causes of H19 methylation errors are poorly understood. In this study, we investigated the methylation status of the H19 gene in semen DNA samples from infertile males affected by MTHFR gene promoter hypermethylation. DNA from normal and abnormal semen samples harbouring MTHFR gene promoter hypermethylated, hmMTHFR-nor and hmMTHFR-abn, and without MTHFR methylation, MTHFR-nor and MTHFR-abn, were investigated for methylation status in the H19 locus using bisulfite-treated DNA PCR, followed by cloning and sequencing. The prevalence of H19 hypomethylated clones was 20% in hmMTHFR-nor and 0% in MTHFR-nor semen samples (p<0.05), and 28% in hmMTHFR-abn compared with 16% in MTHFR-abn semen samples (p>0.05). These results underscore the association between H19 methylation defects and hypermethylation of the MTHFR gene promoter in normal semen samples and suggest that aberrant methylation at H19 may occur in the normal sperm of infertile males affected by MTHFR gene dysfunction. These findings provide new insights into the mechanisms causing abnormal methylation in imprinted genes and, in turn, male infertility.

  19. The 5'-flanking regions of three pea legumin genes: comparison of the DNA sequences.

    PubMed Central

    Lycett, G W; Croy, R R; Shirsat, A H; Richards, D M; Boulter, D

    1985-01-01

    Approximately 1200 nucleotides of sequence data from the promoter and 5'-flanking regions of each of three pea (Pisum sativum L.) legumin genes (legA, legB and legC) are presented. The promoter regions of all three genes were found to be identical including the "TATA box", and "CAAT box', and sequences showing homology to the SV40 enhancers. The legA sequence begins to diverge from the others about 300bp from the start codon, whereas the other two genes remain identical for another 550bp. The regions of partial homology exhibit deletions or insertions and some short, comparatively well conserved sequences. The significance of these features is discussed in terms of evolutionary mechanisms and their possible functional roles. The legC gene contains a region that may potentially form either of two mutually exclusive stem-loop structures, one of which has a stem 42bp long, which suggests that it could be fairly stable. We suggest that a mechanism of switching between such alternative structures may play some role in gene control or may represent the insertion of a transposable element. PMID:2997721

  20. Structure and sequence divergence of two archaebacterial genes

    SciTech Connect

    Cue, D.; Beckler, G.S.; Reeve, J.N.; Konisky, J.

    1985-06-01

    The DNA sequences of a region that includes the hisA gene of two related methanogenic archaebacteria, Methanococcus voltae and Methanococcus vannielii, have been compared. Both organisms show a similar genome organization in this region, displaying three open reading frames (ORFs) separated by regions of very high A+T content. Two of the ORFs, including ORFHisA, show significant DNA sequence homology. As might be expected for organisms having a genome that is A+T-rich, there is a high preference for A and U as the third base in codons. A ribosome binding site, G-G-T-G, is located 6 base pairs preceding the ATG translation initiation sequence of both hisA genes. The sequences upstream of the two hisA genes show only limited sequence homology. The M. voltae intergenic region contains four tandemly arranged repetitions of an 11-base-pair sequence, whereas the M. vannielii sequence contains both direct and inverted repetitive sequences. Based on the degree of hisA sequence homology, the authors conclude that M. voltae and M. vannielii are less closely related taxonomically than are members of the enteric group of eubacteria.

  1. Functional analysis of the transcriptional promoter for the CYP1A1 gene.

    PubMed Central

    Jones, K W; Whitlock, J P

    1990-01-01

    In mouse hepatoma cells, the environmental contaminant 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD) increases the transcription rate of the CYP1A1 gene, which encodes a cytochrome P-450 enzyme. In this study, we analyzed the DNA region immediately upstream of the CYP1A1 gene. A domain that extends upstream to nucleotide--166 was found to function as a transcriptional promoter. The promoter was silent when uncoupled from the dioxin-responsive enhancer located farther upstream. DNase footprinting experiments indicated that nuclear proteins interact with distinct domains of the promoter in a TCDD-independent fashion. Mutational analyses indicated that the CYP1A1 promoter contains at least three functional domains, including a TATAAA sequence, a CCAAT box transcription factor/nuclear factor I-like recognition motif, and a guanine-rich G box. Images PMID:2398886

  2. Limited specificity of promoter constructs for gene therapy in osteosarcoma.

    PubMed

    Pollmann, Annika; Kabisch, Hartmut; Block, Andreas; Müller, Jürgen; Hellwinkel, Olaf J C

    2004-10-01

    Osteosarcoma (OS), a malignant bone neoplasia in childhood, has poor prognosis if metastases appear in the lung. A novel therapeutic approach could consist in a gene therapeutic treatment of OS metastases. However, if promiscuous viral vectors are applied for the delivery of potentially toxic transgenes, their misdelivery into normal tissues could cause severe complications. This problem could be circumvented by application of OS-specific promoters for transgene expression control. We analysed the function of promoters described to be tumour-, osteosarcoma- or osteoblast-specific. Expression rates driven by osteoblast- specific fragments from the collagen1A1-promoter, the human Osteocalcin-promoter, the bone-sialoprotein promoter and the beta-catenin promoter depending on vitamin supplementation were analysed in five OS cell lines, in normal lung fibroblasts and in a non-osteoblastic prostate cancer cell line (LNCaP) by dual luciferase assays. In addition, an unspecific but doxycyclin-repressible promoter construct (pAd.3r-luc) was examined. We found that all constructs were active in OS cell lines to varying extents. The complete human Osteocalcin promoter and the bone-sialoprotein promoter were partially induced by vitamin D3 or C respectively while the pAd.3r-luc activity could be shut down by doxycyclin. In contrast, the human Osteocalcin-promoter was not activated by vitamin D3 in LNCaP cells; its action remained relatively low. Interestingly, excepting the beta-catenin promoter, we measured strong activities of all promoters in lung fibroblast cells. Our study demonstrates that promoter activity should be evaluated not only for the target cells of the gene therapeutic approaches, but also for neighbouring normal tissues. Unspecific but repressible promoters could represent an alternative. PMID:15375610

  3. Evading the annotation bottleneck: using sequence similarity to search non-sequence gene data

    PubMed Central

    Gilchrist, Michael J; Christensen, Mikkel B; Harland, Richard; Pollet, Nicolas; Smith, James C; Ueno, Naoto; Papalopulu, Nancy

    2008-01-01

    Background Non-sequence gene data (images, literature, etc.) can be found in many different public databases. Access to these data is mostly by text based methods using gene names; however, gene annotation is neither complete, nor fully systematic between organisms, and is also not generally stable over time. This provides some challenges for text based access, especially for cross-species searches. We propose a method for non-sequence data retrieval based on sequence similarity, which removes dependence on annotation and text searches. This work was motivated by the need to provide better access to large numbers of in situ images, and the observation that such image data were usually associated with a specific gene sequence. Sequence similarity searches are found in existing gene oriented databases, but mostly give indirect access to non-sequence data via navigational links. Results Three applications were built to explore the proposed method: accessing image data, literature and gene names. Searches are initiated with the sequence of the user's gene of interest, which is searched against a database of sequences associated with the target data. The matching (non-sequence) target data are returned directly to the user's browser, organised by sequence similarity. The method worked well for the intended application in image data management. Comparison with text based searches of the image data set showed the accuracy of the method. Applied to literature searches it facilitated retrieval of mostly high relevance references. Applied to gene name data it provided a useful analysis of name variation of related genes within and between species. Conclusion This method makes a powerful and useful addition to existing methods for searching gene data based on text retrieval or curated gene lists. In particular the method facilitates cross-species comparisons, and enables the handling of novel or otherwise un-annotated genes. Applications using the method are quick and easy to

  4. Three promoters regulate the transcriptional activity of the human holocarboxylase synthetase gene1,2

    PubMed Central

    Xia, Mengna; Malkaram, Sridhar A.; Zempleni, Janos

    2013-01-01

    Holocarboxylase synthetase (HLCS) is the only protein biotin ligase in the human proteome. HLCS-dependent biotinylation of carboxylases plays crucial roles in macronutrient metabolism. HLCS appears to be an essential part of multiprotein complexes in the chromatin that cause gene repression and contribute toward genome stability. Consistent with these essential functions, HLCS knockdown causes strong phenotypes including shortened life span and low stress resistance in Drosophila melanogaster, and de-repression of long-terminal repeats in humans, other mammalian cell lines, and Drosophila. Despite previous observations that the expression of HLCS depends on biotin status in rats and in human cell lines, little is known about the regulation of HLCS expression. The goal of this study was to identify promoters that regulate the expression of the human HLCS gene. Initially, the human HLCS locus was interrogated in silico using predictors of promoters including sequences of HLCS mRNA and expressed sequence tags, CpG islands, histone marks denoting transcriptionally poised chromatin, transcription factor binding sites, and DNaseI hypersensitive regions. Our predictions revealed three putative HLCS promoters, denoted P1, P2, and P3. Promoters lacked a TATA box, which is typical for housekeeping genes. When the three promoters were cloned into a luciferase reporter plasmid, reporter gene activity was at least three times background noise in human breast, colon, and kidney cell lines; activities consistently followed the pattern P1> >P3>P2. Promoter activity depended on the concentration of biotin in culture media, but the effect was moderate. We conclude that we have identified promoters in the human HLCS gene. PMID:24075901

  5. Transcriptional promoter of the human alpha 1(V) collagen gene (COL5A1).

    PubMed Central

    Lee, S; Greenspan, D S

    1995-01-01

    We have characterized the 5' region of the human alpha 1(V) collagen gene (COL5A1). The transcriptional promoter is shown to have a number of features characteristic of the promoters of 'housekeeping' and growth-control-related genes. It lacks obvious TATA and CAAT boxes, has multiple transcription start sites, has a high GC content, lies within a well-defined CpG island and has a number of consensus sites for the potential binding of transcription factor Sp1. This type of promoter structure, while unusual for a collagen gene, is consistent with the broad distribution of expression of COL5A1 and is reminiscent of the promoter structures of the genes encoding type VI collagen, which has a similarly broad distribution of expression. Stepwise deletion of COL5A1 5' sequences, placed upstream of a heterologous reporter gene, yielded a gradual decrease in promoter activity, indicating that the COL5A1 promoter is composed of an array of cis-acting elements. A minimal promoter region contained within the 212 bp immediately upstream of the major transcription start site contained no consensus sequences for the binding of known transcription factors, but gel mobility shift assays showed this region to bind nuclear factors, including Sp1, at a number of sites. The major transcription start site is flanked by an upstream 34-bp oligopurine/oligopyrimidine stretch, or 'GAGA' box, and a downstream 56-bp GAGA box which contains a 10-bp mirror repeat and is sensitive to cleavage with S1 nuclease. Images Figure 1 Figure 3 Figure 4 Figure 6 PMID:7646438

  6. A short upstream promoter region mediates transcriptional regulation of the mouse doublecortin gene in differentiating neurons

    PubMed Central

    2010-01-01

    Background Doublecortin (Dcx), a MAP (Microtubule-Associated Protein), is transiently expressed in migrating and differentiating neurons and thereby characterizes neuronal precursors and neurogenesis in developing and adult neurogenesis. In addition, reduced Dcx expression during development has been related to appearance of brain pathologies. Here, we attempt to unveil the molecular mechanisms controlling Dcx gene expression by studying its transcriptional regulation during neuronal differentiation. Results To determine and analyze important regulatory sequences of the Dcx promoter, we studied a putative regulatory region upstream from the mouse Dcx coding region (pdcx2kb) and several deletions thereof. These different fragments were used in vitro and in vivo to drive reporter gene expression. We demonstrated, using transient expression experiments, that pdcx2kb is sufficient to control specific reporter gene expression in cerebellar cells and in the developing brain (E14.5). We determined the temporal profile of Dcx promoter activity during neuronal differentiation of mouse embryonic stem cells (mESC) and found that transcriptional activation of the Dcx gene varies along with neuronal differentiation of mESC. Deletion experiments and sequence comparison of Dcx promoters across rodents, human and chicken revealed the importance of a highly conserved sequence in the proximal region of the promoter required for specific and strong expression in neuronal precursors and young neuronal cells. Further analyses revealed the presence in this short sequence of several conserved, putative transcription factor binding sites: LEF/TCF (Lymphoid Enhancer Factor/T-Cell Factor) which are effectors of the canonical Wnt pathway; HNF6/OC2 (Hepatocyte Nuclear Factor-6/Oncecut-2) members of the ONECUT family and NF-Y/CAAT (Nuclear Factor-Y). Conclusions Studies of Dcx gene regulatory sequences using native, deleted and mutated constructs suggest that fragments located upstream of the

  7. Draft Genome Sequence of Burkholderia ambifaria RZ2MS16, a Plant Growth-Promoting Rhizobacterium Isolated from Guarana, a Tropical Plant.

    PubMed

    Batista, Bruna Durante; Taniguti, Lucas Mitsuo; Monteiro-Vitorello, Claudia Barros; Azevedo, João Lúcio; Quecine, Maria Carolina

    2016-01-01

    Burkholderia ambifaria strain RZ2MS16 was isolated from the rhizosphere of Amazon guarana in Brazil. This bacterium exhibits a remarkable capacity to promote the growth of corn and soybean. Here, we report the draft genome sequence of RZ2MS16 and some genes related to multiple traits involved in plant growth promotion. PMID:26988044

  8. Draft Genome Sequence of Burkholderia ambifaria RZ2MS16, a Plant Growth-Promoting Rhizobacterium Isolated from Guarana, a Tropical Plant

    PubMed Central

    Batista, Bruna Durante; Taniguti, Lucas Mitsuo; Monteiro-Vitorello, Claudia Barros; Azevedo, João Lúcio

    2016-01-01

    Burkholderia ambifaria strain RZ2MS16 was isolated from the rhizosphere of Amazon guarana in Brazil. This bacterium exhibits a remarkable capacity to promote the growth of corn and soybean. Here, we report the draft genome sequence of RZ2MS16 and some genes related to multiple traits involved in plant growth promotion. PMID:26988044

  9. Draft Genome Sequence of Burkholderia ambifaria RZ2MS16, a Plant Growth-Promoting Rhizobacterium Isolated from Guarana, a Tropical Plant.

    PubMed

    Batista, Bruna Durante; Taniguti, Lucas Mitsuo; Monteiro-Vitorello, Claudia Barros; Azevedo, João Lúcio; Quecine, Maria Carolina

    2016-03-17

    Burkholderia ambifaria strain RZ2MS16 was isolated from the rhizosphere of Amazon guarana in Brazil. This bacterium exhibits a remarkable capacity to promote the growth of corn and soybean. Here, we report the draft genome sequence of RZ2MS16 and some genes related to multiple traits involved in plant growth promotion.

  10. PHF8 and REST/NRSF co-occupy gene promoters to regulate proximal gene expression.

    PubMed

    Wang, Juan; Lin, Xueqiu; Wang, Su; Wang, Chenfei; Wang, Qixuan; Duan, Xikun; Lu, Peng; Wang, Qian; Wang, Chengyang; Liu, X Shirley; Huang, Jinyan

    2014-01-01

    Chromatin regulators play an important role in the development of human diseases. In this study, we focused on Plant Homeo Domain Finger protein 8 (PHF8), a chromatin regulator that has attracted special concern recently. PHF8 is a histone lysine demethylase ubiquitously expressed in nuclei. Mutations of PHF8 are associated with X-linked mental retardation. It usually functions as a transcriptional co-activator by associating with H3K4me3 and RNA polymerase II. We found that PHF8 may associate with another regulator, REST/NRSF, predominately at promoter regions via studying several published PHF8 chromatin immunoprecipitation-sequencing (ChIP-Seq) datasets. Our analysis suggested that PHF8 not only activates but may also repress gene expression. PMID:24852203

  11. Analysis of Sequences Regulating Larval Expression of the Adh Gene of Drosophila Melanogaster

    PubMed Central

    Shen, NLL.; Hotaling, E. C.; Subrahmanyam, G.; Martin, P. F.; Sofer, W.

    1991-01-01

    The effects of a series of eight, 50 base pair internal deletions in the 5' region upstream of the proximal transcription start site of the Adh gene of Drosophila melanogaster were examined in a quantitative assay. Mixtures of two plasmids, one bearing a deleted gene, the other with an intact reference gene, were injected into alcohol dehydrogenase-negative embryos. Third instar larvae of the injected generation were assayed for relative alcohol dehydrogenase enzyme activity. Quantitative analysis of the eight deletions indicated that two regions were required for any detectable enzyme activity and one region was required for appropriate tissue specificity. The remaining five deletions significantly decreased, but did not eliminate activity. When the deleted genes were placed on a plasmid with an intact reference gene, activities of all but one deletion were restored to levels equivalent to that of the intact reference gene (regardless of orientation). This restoration of activity did not occur when the regulatory region of the intact gene was replaced with the Hsp70 heat shock promoter nor when the 50-base pair deletion encompassed the region that includes the TATA sequence. The fact that seven of the eight deleted genes express activity in the presence of a reference gene on the same plasmid suggests that the deleted gene is controlled by regulatory elements in the reference gene. Further, these regulatory elements exhibit no preference for their own, more proximate, promoter. PMID:1752419

  12. Complete mitogenome sequences of four flatfishes (Pleuronectiformes) reveal a novel gene arrangement of L-strand coding genes

    PubMed Central

    2013-01-01

    Background Few mitochondrial gene rearrangements are found in vertebrates and large-scale changes in these genomes occur even less frequently. It is difficult, therefore, to propose a mechanism to account for observed changes in mitogenome structure. Mitochondrial gene rearrangements are usually explained by the recombination model or tandem duplication and random loss model. Results In this study, the complete mitochondrial genomes of four flatfishes, Crossorhombus azureus (blue flounder), Grammatobothus krempfi, Pleuronichthys cornutus, and Platichthys stellatus were determined. A striking finding is that eight genes in the C. azureus mitogenome are located in a novel position, differing from that of available vertebrate mitogenomes. Specifically, the ND6 and seven tRNA genes (the Q, A, C, Y, S1, E, P genes) encoded by the L-strand have been translocated to a position between tRNA-T and tRNA-F though the original order of the genes is maintained. Conclusions These special features are used to suggest a mechanism for C. azureus mitogenome rearrangement. First, a dimeric molecule was formed by two monomers linked head-to-tail, then one of the two sets of promoters lost function and the genes controlled by the disabled promoters became pseudogenes, non-coding sequences, and even were lost from the genome. This study provides a new gene-rearrangement model that accounts for the events of gene-rearrangement in a vertebrate mitogenome. PMID:23962312

  13. The regions of sequence variation in caulimovirus gene VI.

    PubMed

    Sanger, M; Daubert, S; Goodman, R M

    1991-06-01

    The sequence of gene VI from figwort mosaic virus (FMV) clone x4 was determined and compared with that previously published for FMV clone DxS. Both clones originated from the same virus isolation, but the virus used to clone DxS was propagated extensively in a host of a different family prior to cloning whereas that used to clone x4 was not. Differences in the amino acid sequence inferred from the DNA sequences occurred in two clusters. An N-terminal conserved region preceded two regions of variation separated by a central conserved region. Variation in cauliflower mosaic virus (CaMV) gene VI sequences, all of which were derived from virus isolates from hosts from one host family, was similar to that seen in the FMV comparison, though the extent of variation was less. Alignment of gene VI domains from FMV and CaMV revealed regions of amino acid sequence identical in both viruses within the conserved regions. The similarity in the pattern of conserved and variable domains of these two viruses suggests common host-interactive functions in caulimovirus gene VI homologues, and possibly an analogy between caulimoviruses and certain animal viruses in the influence of the host on sequence variability of viral genes.

  14. Nucleotide sequence of the gene encoding the nitrogenase iron protein of Thiobacillus ferrooxidans

    SciTech Connect

    Pretorius, I.M.; Rawlings, D.E.; O'Neill, E.G.; Jones, W.A.; Kirby, R.; Woods, D.R.

    1987-01-01

    The DNA sequence was determined for the cloned Thiobacillus ferrooxidans nifH and part of the nifD genes. The DNA chains were radiolabeled with (..cap alpha..-/sup 32/P)dCTP (3000 Ci/mmol) or (..cap alpha..-/sup 35/S)dCTP (400 Ci/mmol). A putative T. ferrooxidans nifH promoter was identified whose sequences showed perfect consensus with those of the Klebsiella pneumoniae nif promoter. Two putative consensus upstream activator sequences were also identified. The amino acid sequence was deduced from the DNA sequence. In a comparison of nifH DNA sequences from T. ferrooxidans and eight other nitrogen-fixing microbes, a Rhizobium sp. isolated from Parasponia andersonii showed the greatest homology (74%) and Clostridium pasteurianum (nifH1) showed the least homology (54%). In the comparison of the amino acid sequences of the Fe proteins, the Rhizobium sp. and Rhizobium japonicum showed the greatest homology (both 86%) and C. pasteurianum (nifH1 gene product) demonstrated the least homology (56%) to the T. ferrooxidans Fe protein.

  15. Cloning and nucleotide sequence of the hemA gene of Agrobacterium radiobacter.

    PubMed

    Drolet, M; Sasarman, A

    1991-04-01

    The hemA gene of Agrobacterium radiobacter ATCC4718 was identified by hybridization with a hemA probe from Rhizobium meliloti and cloned by complementation of a hemA mutant of Escherichia coli K12. E. coli hemA transformants carrying the hemA gene of Agrobacterium showed delta-aminolevulinic acid synthetase (delta-ALAS) activity in vitro. The hemA gene was carried on a 4.4 kb EcoRI fragment which could be reduced to a 2.6 kb EcoRI-SstI fragment without affecting its complementing or delta-ALAS activity. The sequence of the hemA gene showed an open reading frame of 1215 nucleotides, which could code for a protein of 44,361 Da. This is very close to the molecular weight of the HemA protein obtained using an in vitro coupled transcription-translation system (45,000 Da). Comparison of amino acid sequences of the delta-ALAS of A. radiobacter and Bradyrhizobium japonicum showed strong homology between the two enzymes; less, but still significant, homology was observed when A. radiobacter and human delta-ALAS were compared. Primer extension experiments enabled us to identify two promoters for the hemA gene of A. radiobacter. One of these promoters shows some similarity to the first promoter of the hemA gene of R. meliloti.

  16. Expression of human histo-blood group ABO genes is dependent upon DNA methylation of the promoter region.

    PubMed

    Kominato, Y; Hata, Y; Takizawa, H; Tsuchiya, T; Tsukada, J; Yamamoto, F

    1999-12-24

    We have investigated the regulatory role of DNA methylation in the expression of the human histo-blood group ABO genes. The ABO gene promoter region contains a CpG island whose methylation status correlates well with gene expression in the cell lines tested. The CpG island was found hypomethylated in some cell lines that expressed ABO genes, whereas the other cell lines that did not express ABO genes were hypermethylated. Whereas constitutive transcriptional activity of the ABO gene promoter was demonstrated in both expressor and nonexpressor cell lines by transient transfection of reporter constructs containing the ABO gene promoter sequence, HhaI methylase-catalyzed in vitro methylation of the promoter region prior to DNA transfection suppressed the promoter activity when introduced into the expressor gastric cancer cell line KATOIII cells. On the other hand, in the nonexpressor gastric cancer cell line MKN28 cells, treatment with DNA methyltransferase inhibitor 5-aza-2'-deoxycytidine resulted in demethylation of the ABO gene promoter and appearance of A-transferase messages, as well as A-antigens synthesized by A-transferase. Taken together, these studies suggest that DNA methylation of the ABO gene promoter may play an important role in the regulation of ABO gene expression. PMID:10601288

  17. Cloning and sequencing of the gene for human. beta. -casein

    SciTech Connect

    Loennerdal, B.; Bergstroem, S.; Andersson, Y.; Hialmarsson, K.; Sundgyist, A.; Hernell, O. )

    1990-02-26

    Human {beta}-casein is a major protein in human milk. This protein is part of the casein micelle and has been suggested to have several physiological functions in the newborn. Since there is limited information on {beta}casein and the factors that affect its concentration in human milk, the authors have isolated and sequenced the gene for this protein. A human mammary gland cDNA library (Clontech) in gt 11 was screened by plaque hy-hybridization using a 42-mer synthetic {sup 32}p-labelled oligo-nucleotide. Positive clones were identified and isolated, DNA was prepared and the gene isolated by cleavage with EcoR1. Following subcloning (PUC18), restriction mapping and Southern blotting, DNA for sequencing was prepared. The gene was sequenced by the dideoxy method. Human {beta}-casein has 212 amino acids and the amino acid sequence deducted from the nucleotide sequence is to 91% identical to the published sequence for human {beta}-casein show a high degree of conservation at the leader peptide and the highly phosphorylated sequences, but also deletions and divergence at several positions. These results provide insight into the structure of the human {beta}-casein gene and will facilitate studies on factors affecting its expression.

  18. Structure and sequence of the gene encoding human keratocan.

    PubMed

    Tasheva, E S; Funderburgh, J L; Funderburgh, M L; Corpuz, L M; Conrad, G W

    1999-01-01

    Keratocan is one of the three major keratan sulfate proteoglycans characteristically expressed in cornea. We have isolated cDNA and genomic clones and determined the sequence of the entire human keratocan (Kera) gene. The gene is spread over 7.65 kb of DNA and contains three exons. An open reading frame starting at the beginning of the second exon encodes a protein of 352 aa. The amino acid sequence of keratocan shows high identity among mammalian species. This evolutionary conservation between the keratocan proteins as well as the restricted expression of Kera gene in cornea suggests that this molecule might be important in developing and maintaining corneal transparency.

  19. Coelacanth genome sequence reveals the evolutionary history of vertebrate genes.

    PubMed

    Noonan, James P; Grimwood, Jane; Danke, Joshua; Schmutz, Jeremy; Dickson, Mark; Amemiya, Chris T; Myers, Richard M

    2004-12-01

    The coelacanth is one of the nearest living relatives of tetrapods. However, a teleost species such as zebrafish or Fugu is typically used as the outgroup in current tetrapod comparative sequence analyses. Such studies are complicated by the fact that teleost genomes have undergone a whole-genome duplication event, as well as individual gene-duplication events. Here, we demonstrate the value of coelacanth genome sequence by complete sequencing and analysis of the protocadherin gene cluster of the Indonesian coelacanth, Latimeria menadoensis. We found that coelacanth has 49 protocadherin cluster genes organized in the same three ordered subclusters, alpha, beta, and gamma, as the 54 protocadherin cluster genes in human. In contrast, whole-genome and tandem duplications have generated two zebrafish protocadherin clusters comprised of at least 97 genes. Additionally, zebrafish protocadherins are far more prone to homogenizing gene conversion events than coelacanth protocadherins, suggesting that recombination- and duplication-driven plasticity may be a feature of teleost genomes. Our results indicate that coelacanth provides the ideal outgroup sequence against which tetrapod genomes can be measured. We therefore present L. menadoensis as a candidate for whole-genome sequencing.

  20. Non-essential repeats in the promoter region of a Brassica rapa acyl carrier protein gene expressed in developing embryos.

    PubMed

    Scherer, D; Sato, A; McCarter, D W; Radke, S E; Kridl, J C; Knauf, V C

    1992-02-01

    A genomic clone of an acyl carrier protein gene (Bcg4-4) which is highly expressed in developing embryos of Brassica rapa was isolated and sequenced. The promoter and transcription terminator regions of Bcg4-4 were used to express a beta-glucuronidase reporter gene in transgenic rapeseed. Deletion of repeated domains in the promoter region did not lower beta-glucuronidase expression in seeds.

  1. SxtA gene sequence analysis of dinoflagellate Alexandrium minutum

    NASA Astrophysics Data System (ADS)

    Norshaha, Safida Anira; Latib, Norhidayu Abdul; Usup, Gires; Yusof, Nurul Yuziana Mohd

    2015-09-01

    The dinoflagellate Alexandrium minutum is typically known for the production of potent neurotoxins such as saxitoxin, affecting the health of human seafood consumers via paralytic shellfish poisoning (PSP). These phenomena is related to the harmful algal blooms (HABs) that is believed to be influenced by environmental and nutritional factors. Previous study has revealed that SxtA gene is a starting gene that involved in the saxitoxin production pathway. The aim of this study was to analyse the sequence of the sxtA gene in A. minutum. The dinoflagellates culture was cultured at temperature 26°C with 16:8-hour light:dark photocycle. After the samples were harvested, RNA was extracted, complementary DNA (cDNA) was synthesised and amplified by polymerase chain reaction (PCR). The PCR products were then purified and cloned before sequenced. The SxtA sequence obtained was then analyzed in order to identify the presence of SxtA gene in Alexandrium minutum.

  2. Lactase gene promoter fragments mediate differential spatial and temporal expression patterns in transgenic mice.

    PubMed

    Wang, Zhi; Maravelias, Charalambos; Sibley, Eric

    2006-04-01

    Lactase gene expression is spatiotemporally regulated during mammalian gut development. We hypothesize that distinct DNA control regions specify appropriate spatial and temporal patterning of lactase gene expression. In order to define regions of the lactase promoter involved in mediating intestine-specific and spatiotemporal restricted expression, transgenic mice harboring 100 bp, 1.3- and 2.0- kb fragments of the 5' flanking region of the rat lactase gene cloned upstream of a luciferase reporter were characterized. The 100-bp lactase promoter-reporter transgenic mouse line expressed maximal luciferase activity in the intestine with a posterior shift in spatial restriction and ectopic expression in the stomach and lung. The temporal pattern of expression mediated by the 1.3-kb promoter?reporter transgene increases with postnatal maturation in contrast with the postnatal decline mediated by the 2.0-kb promoter-reporter transgene and the endogenous lactase gene. The differential transgene expression patterns mediated by the lactase promoter fragments suggests that intestine-specific spatial and temporal control elements reside in distinct regions of the DNA sequences upstream of the lactase gene transcription start-site.

  3. Wound-response regulation of the sweet potato sporamin gene promoter region.

    PubMed

    Wang, Shu-Jen; Lan, Yi-Ching; Chen, Shih-Fung; Chen, Yih-Ming; Yeh, Kai-Wun

    2002-02-01

    Sporamin, a tuberous storage protein of sweet potato, was systemically expressed in leaves and stems by wound stimulation. In an effort to demonstrate the regulatory mechanism of wound response on the sporamin gene, a 1.25 kb sporamin promoter was isolated for studying the wound-induced signal transduction. Two wound response-like elements, a G box-like element and a GCC core-like sequence were found in this promoter. A construct containing the sporamin promoter fused to a beta-glucuronidase (GUS) gene was transferred into tobacco plants by Agrobacterium-mediated transformation. The wound-induced high level of GUS activity was observed in stems and leaves of transgenic tobacco, but not in roots. This expression pattern was similar to that of the sporamin gene in sweet potatoes. Exogenous application of methyl jasmonate (MeJA) activated the sporamin promoter in leaves and stems of sweet potato and transgenic tobacco plants. A competitive inhibitor of ethylene (2,5-norbornadiene; NBD) down-regulated the effect of MeJA on sporamin gene expression. In contrast, salicylic acid (SA), an inhibitor of the octadecanoid pathway, strongly suppressed the sporamin promoter function that was stimulated by wound and MeJA treatments. In conclusion, wound-response expression of the sporamin gene in aerial parts of plants is regulated by the octadecanoid signal pathway.

  4. Isolation and Functional Characterization of a Lycopene β-cyclase Gene Promoter from Citrus

    PubMed Central

    Lu, Suwen; Zhang, Yin; Zheng, Xiongjie; Zhu, Kaijie; Xu, Qiang; Deng, Xiuxin

    2016-01-01

    Lycopene β-cyclases are key enzymes located at the branch point of the carotenoid biosynthesis pathway. However, the transcriptional regulatory mechanisms of LCYb1 in citrus with abundant carotenoid accumulation are still unclear. To understand the molecular basis of CsLCYb1 expression, we isolated and functionally characterized the 5′ upstream sequences of CsLCYb1 from citrus. The full-length CsLCYb1 promoter and a series of its 5′ deletions were fused to the β-glucuronidase (GUS) reporter gene and transferred into different plants (tomato, Arabidopsis and citrus callus) to test the promoter activities. The results of all transgenic species showed that the 1584 bp upstream region from the translational start site displayed maximal promoter activity, and the minimal promoter containing 746 bp upstream sequences was sufficient for strong basal promoter activity. Furthermore, the CsLCYb1 promoter activity was developmentally and tissue-specially regulated in transgenic Arabidopsis, and it was affected by multiple hormones and environmental cues in transgenic citrus callus under various treatments. Finer deletion analysis identified an enhancer element existing as a tandem repeat in the promoter region between -574 to -513 bp and conferring strong promoter activity. The copy numbers of the enhancer element differed among various citrus species, leading to the development of a derived simple sequence repeat marker to distinguish different species. In conclusion, this study elucidates the expression characteristics of the LCYb1 promoter from citrus and further identifies a novel enhancer element required for the promoter activity. The characterized promoter fragment would be an ideal candidate for genetic engineering and seeking of upstream trans-acting elements.

  5. Isolation and Functional Characterization of a Lycopene β-cyclase Gene Promoter from Citrus.

    PubMed

    Lu, Suwen; Zhang, Yin; Zheng, Xiongjie; Zhu, Kaijie; Xu, Qiang; Deng, Xiuxin

    2016-01-01

    Lycopene β-cyclases are key enzymes located at the branch point of the carotenoid biosynthesis pathway. However, the transcriptional regulatory mechanisms of LCYb1 in citrus with abundant carotenoid accumulation are still unclear. To understand the molecular basis of CsLCYb1 expression, we isolated and functionally characterized the 5' upstream sequences of CsLCYb1 from citrus. The full-length CsLCYb1 promoter and a series of its 5' deletions were fused to the β-glucuronidase (GUS) reporter gene and transferred into different plants (tomato, Arabidopsis and citrus callus) to test the promoter activities. The results of all transgenic species showed that the 1584 bp upstream region from the translational start site displayed maximal promoter activity, and the minimal promoter containing 746 bp upstream sequences was sufficient for strong basal promoter activity. Furthermore, the CsLCYb1 promoter activity was developmentally and tissue-specially regulated in transgenic Arabidopsis, and it was affected by multiple hormones and environmental cues in transgenic citrus callus under various treatments. Finer deletion analysis identified an enhancer element existing as a tandem repeat in the promoter region between -574 to -513 bp and conferring strong promoter activity. The copy numbers of the enhancer element differed among various citrus species, leading to the development of a derived simple sequence repeat marker to distinguish different species. In conclusion, this study elucidates the expression characteristics of the LCYb1 promoter from citrus and further identifies a novel enhancer element required for the promoter activity. The characterized promoter fragment would be an ideal candidate for genetic engineering and seeking of upstream trans-acting elements. PMID:27679644

  6. Isolation and Functional Characterization of a Lycopene β-cyclase Gene Promoter from Citrus

    PubMed Central

    Lu, Suwen; Zhang, Yin; Zheng, Xiongjie; Zhu, Kaijie; Xu, Qiang; Deng, Xiuxin

    2016-01-01

    Lycopene β-cyclases are key enzymes located at the branch point of the carotenoid biosynthesis pathway. However, the transcriptional regulatory mechanisms of LCYb1 in citrus with abundant carotenoid accumulation are still unclear. To understand the molecular basis of CsLCYb1 expression, we isolated and functionally characterized the 5′ upstream sequences of CsLCYb1 from citrus. The full-length CsLCYb1 promoter and a series of its 5′ deletions were fused to the β-glucuronidase (GUS) reporter gene and transferred into different plants (tomato, Arabidopsis and citrus callus) to test the promoter activities. The results of all transgenic species showed that the 1584 bp upstream region from the translational start site displayed maximal promoter activity, and the minimal promoter containing 746 bp upstream sequences was sufficient for strong basal promoter activity. Furthermore, the CsLCYb1 promoter activity was developmentally and tissue-specially regulated in transgenic Arabidopsis, and it was affected by multiple hormones and environmental cues in transgenic citrus callus under various treatments. Finer deletion analysis identified an enhancer element existing as a tandem repeat in the promoter region between -574 to -513 bp and conferring strong promoter activity. The copy numbers of the enhancer element differed among various citrus species, leading to the development of a derived simple sequence repeat marker to distinguish different species. In conclusion, this study elucidates the expression characteristics of the LCYb1 promoter from citrus and further identifies a novel enhancer element required for the promoter activity. The characterized promoter fragment would be an ideal candidate for genetic engineering and seeking of upstream trans-acting elements. PMID:27679644

  7. Analysis of simple sequence repeats in mammalian cell cycle genes.

    PubMed

    Trivedi, Seema; Wills, Christopher; Metzgar, David

    2014-01-01

    Simple sequence repeats (SSRs), or microsatellites are hyper-mutable and can lead to disorders. Here we explore SSR distribution in cell cycle-associated genes [grouped into: checkpoint; regulation; replication, repair, and recombination (RRR); and transition] in humans and orthologues of eight mammals. Among the gene groups studied, transition genes have the highest SSR density. Trinucleotide repeats are not abundant and introns have higher repeat density than exons. Many repeats in human genes are conserved; however, CG motifs are conserved only in regulation genes. SSR variability in cell cycle genes represents a genetic Achilles' heel, yet SSRs are common in all groups of genes. This tolerance many be due to i) positions in introns where they do not disrupt gene function, ii) essential roles in regulation, iii) specific value of adaptability, and/or iv) lack of negative selection pressure. Present study may be useful for further exploration of their medical relevance and potential functionality.

  8. Data on meq gene sequence analysis of Ludhiana MDV isolates.

    PubMed

    Gupta, Mridula; Deka, Dipak; Ramneek

    2016-12-01

    The data described are related to the article entitled "Sequence Analysis of Meq oncogene among Indian isolates of Marek׳s Disease Herpesvirus" M. Gupta, D. Deka, Ramneek, 2016. Seven meq genes of Ludhiana Marek׳s disease virus (MDV) field isolates were PCR amplified by using proof reading Platinum Pfx DNA polymerase enzyme, sequenced and then analyzed for the distinct polymorphisms and point mutations. The sequences were named as LDH 1758, LDH 2003, LDH 2483, LDH 2614, LDH 2700, LDH 2929 and LDH 3262. At this point, their deduced Meq amino acid sequences were compared with GenBank available already sequenced meq genes worldwide in their deduced amino acid form to study their identity/similarity with each other. PMID:27656677

  9. Repression of the murine interferon alpha 11 gene: identification of negatively acting sequences.

    PubMed Central

    Civas, A; Dion, M; Vodjdani, G; Doly, J

    1991-01-01

    The uninducible murine interferon alpha 11 gene (Mu IFN-alpha 11) shows strong homology with the highly inducible Mu IFN-alpha 4 gene in the promoter region. Negative regulatory sequences located between positions -470 and -145 were characterized in the Mu IFN-alpha 11 promoter. The removal of these sequences leads to virus-inducibility of Mu IFN-alpha 11 while their insertion in Mu IFN-alpha 4 corresponding region significantly reduced the inducibility of Mu IFN-alpha 4 promoter. On the other hand, the virus-responsive element (VRE) of the Mu IFN-alpha 11 differs by a single nucleotide substitution at position -78 from the VRE alpha 4. Constructions carrying either VRE alpha 11 or VRE alpha 4 upstream a heterologous promoter displayed different virus inducibilities. The -78 A/G substitution affects the inducibility by decreasing the affinity of VRE-binding trans-regulators. Our results suggest that the combined effect of the negative regulatory sequences and of the mutation in the VRE alpha 11, completely silences the Mu IFN-alpha 11 gene. PMID:1886773

  10. Promoter methylation of candidate genes associated with familial testicular cancer.

    PubMed

    Mirabello, Lisa; Kratz, Christian P; Savage, Sharon A; Greene, Mark H

    2012-01-01

    Recent genomic studies have identified risk SNPs in or near eight genes associated with testicular germ cell tumors (TGCT). Mouse models suggest a role for Dnd1 epigenetics in TGCT susceptibility, and we have recently reported that transgenerational inheritance of epigenetic events may be associated with familial TGCT risk. We now investigate whether aberrant promoter methylation of selected candidate genes is associated with familial TGCT risk. Pyrosequencing assays were designed to evaluate CpG methylation in the promoters of selected genes in peripheral blood DNA from 153 TGCT affecteds and 116 healthy male relatives from 101 multiple-case families. Wilcoxon rank-sum tests and logistic regression models were used to investigate associations between promoter methylation and TGCT. We also quantified gene product expression of these genes, using quantitative PCR. We observed increased PDE11A, SPRY4 and BAK1 promoter methylation, and decreased KITLG promoter methylation, in familial TGCT cases versus healthy male family controls. A significant upward risk trend was observed for PDE11A when comparing the middle and highest tertiles of methylation to the lowest [odds ratio (OR) =1.55, 95% confidence intervals (CI) 0.82-2.93, and 1.94, 95% CI 1.03-3.66], respectively; P(trend)=0.042). A significant inverse association was observed for KITLG when comparing the middle and lowest tertiles to the highest (OR=2.15, 95% CI 1.12-4.11, and 2.15, 95% CI 1.12-4.14, respectively; P(trend)=0.031). There was a weak inverse correlation between promoter methylation and KITLG expression. Our results suggest that familial TGCT susceptibility may be associated with promoter methylation of previously-identified TGCT risk-modifying genes. Larger studies are warranted. PMID:23050052

  11. Annotation of gene promoters by integrative data-mining of ChIP-seq Pol-II enrichment data

    PubMed Central

    2010-01-01

    Background Use of alternative gene promoters that drive widespread cell-type, tissue-type or developmental gene regulation in mammalian genomes is a common phenomenon. Chromatin immunoprecipitation methods coupled with DNA microarray (ChIP-chip) or massive parallel sequencing (ChIP-seq) are enabling genome-wide identification of active promoters in different cellular conditions using antibodies against Pol-II. However, these methods produce enrichment not only near the gene promoters but also inside the genes and other genomic regions due to the non-specificity of the antibodies used in ChIP. Further, the use of these methods is limited by their high cost and strong dependence on cellular type and context. Methods We trained and tested different state-of-art ensemble and meta classification methods for identification of Pol-II enriched promoter and Pol-II enriched non-promoter sequences, each of length 500 bp. The classification models were trained and tested on a bench-mark dataset, using a set of 39 different feature variables that are based on chromatin modification signatures and various DNA sequence features. The best performing model was applied on seven published ChIP-seq Pol-II datasets to provide genome wide annotation of mouse gene promoters. Results We present a novel algorithm based on supervised learning methods to discriminate promoter associated Pol-II enrichment from enrichment elsewhere in the genome in ChIP-chip/seq profiles. We accumulated a dataset of 11,773 promoter and 46,167 non-promoter sequences, each of length 500 bp, generated from RNA Pol-II ChIP-seq data of five tissues (Brain, Kidney, Liver, Lung and Spleen). We evaluated the classification models in building the best predictor and found that Bagging and Random Forest based approaches give the best accuracy. We implemented the algorithm on seven different published ChIP-seq datasets to provide a comprehensive set of promoter annotations for both protein-coding and non-coding genes in

  12. Biased distribution of DNA uptake sequences towards genome maintenance genes.

    PubMed

    Davidsen, Tonje; Rødland, Einar A; Lagesen, Karin; Seeberg, Erling; Rognes, Torbjørn; Tønjum, Tone

    2004-01-01

    Repeated sequence signatures are characteristic features of all genomic DNA. We have made a rigorous search for repeat genomic sequences in the human pathogens Neisseria meningitidis, Neisseria gonorrhoeae and Haemophilus influenzae and found that by far the most frequent 9-10mers residing within coding regions are the DNA uptake sequences (DUS) required for natural genetic transformation. More importantly, we found a significantly higher density of DUS within genes involved in DNA repair, recombination, restriction-modification and replication than in any other annotated gene group in these organisms. Pasteurella multocida also displayed high frequencies of a putative DUS identical to that previously identified in H.influenzae and with a skewed distribution towards genome maintenance genes, indicating that this bacterium might be transformation competent under certain conditions. These results imply that the high frequency of DUS in genome maintenance genes is conserved among phylogenetically divergent species and thus are of significant biological importance. Increased DUS density is expected to enhance DNA uptake and the over-representation of DUS in genome maintenance genes might reflect facilitated recovery of genome preserving functions. For example, transient and beneficial increase in genome instability can be allowed during pathogenesis simply through loss of antimutator genes, since these DUS-containing sequences will be preferentially recovered. Furthermore, uptake of such genes could provide a mechanism for facilitated recovery from DNA damage after genotoxic stress. PMID:14960717

  13. Identification of learning and memory genes in canine; promoter investigation and determining the selective pressure.

    PubMed

    Seifi Moroudi, Reihane; Masoudi, Ali Akbar; Vaez Torshizi, Rasoul; Zandi, Mohammad

    2014-12-01

    One of the important behaviors of dogs is trainability which is affected by learning and memory genes. These kinds of the genes have not yet been identified in dogs. In the current research, these genes were found in animal models by mining the biological data and scientific literatures. The proteins of these genes were obtained from the UniProt database in dogs and humans. Not all homologous proteins perform similar functions, thus comparison of these proteins was studied in terms of protein families, domains, biological processes, molecular functions, and cellular location of metabolic pathways in Interpro, KEGG, Quick Go and Psort databases. The results showed that some of these proteins have the same performance in the rat or mouse, dog, and human. It is anticipated that the protein of these genes may be effective in learning and memory in dogs. Then, the expression pattern of the recognized genes was investigated in the dog hippocampus using the existing information in the GEO profile. The results showed that BDNF, TAC1 and CCK genes are expressed in the dog hippocampus, therefore, these genes could be strong candidates associated with learning and memory in dogs. Subsequently, due to the importance of the promoter regions in gene function, this region was investigated in the above genes. Analysis of the promoter indicated that the HNF-4 site of BDNF gene and the transcription start site of CCK gene is exposed to methylation. Phylogenetic analysis of protein sequences of these genes showed high similarity in each of these three genes among the studied species. The dN/dS ratio for BDNF, TAC1 and CCK genes indicates a purifying selection during the evolution of the genes.

  14. Linker scanner mutagenesis of the Xenopus laevis ribosomal gene promoter.

    PubMed Central

    Reeder, R H; Pennock, D; McStay, B; Roan, J; Tolentino, E; Walker, P

    1987-01-01

    We have assayed a series of linker scanner mutants which cover the Xenopus laevis ribosomal gene promoter at approximately ten base pair intervals. All of these mutations adversely affect promoter activity with the exception of one mutation which stimulates activity. Thus, none are neutral. We show that most of the mutations can be partially rescued by ligating a block of enhancer elements upstream of the promoter. In addition, we have made extracts from liver nuclei which produce DNaseI protection footprints over the promoter. Analysis of both strands reveals a prominent footprinting domain from about -5 to -30. However, lesser changes in the digestion pattern are detected over most of the promoter. Previously published analyses have suggested that this promoter might be composed of three functional domains. The experiments presented here suggest that either 1) the three putative domains are so closely arranged that the boundaries are difficult to discern, or 2) the situation is more complex. Images PMID:3658698

  15. Novel strong tissue specific promoter for gene expression in human germ cells

    PubMed Central

    2010-01-01

    Background Tissue specific promoters may be utilized for a variety of applications, including programmed gene expression in cell types, tissues and organs of interest, for developing different cell culture models or for use in gene therapy. We report a novel, tissue-specific promoter that was identified and engineered from the native upstream regulatory region of the human gene NDUFV1 containing an endogenous retroviral sequence. Results Among seven established human cell lines and five primary cultures, this modified NDUFV1 upstream sequence (mNUS) was active only in human undifferentiated germ-derived cells (lines Tera-1 and EP2102), where it demonstrated high promoter activity (~twice greater than that of the SV40 early promoter, and comparable to the routinely used cytomegaloviral promoter). To investigate the potential applicability of the mNUS promoter for biotechnological needs, a construct carrying a recombinant cytosine deaminase (RCD) suicide gene under the control of mNUS was tested in cell lines of different tissue origin. High cytotoxic effect of RCD with a cell-death rate ~60% was observed only in germ-derived cells (Tera-1), whereas no effect was seen in a somatic, kidney-derived control cell line (HEK293). In further experiments, we tested mNUS-driven expression of a hyperactive Sleeping Beauty transposase (SB100X). The mNUS-SB100X construct mediated stable transgene insertions exclusively in germ-derived cells, thereby providing further evidence of tissue-specificity of the mNUS promoter. Conclusions We conclude that mNUS may be used as an efficient promoter for tissue-specific gene expression in human germ-derived cells in many applications. Our data also suggest that the 91 bp-long sequence located exactly upstream NDUFV1 transcriptional start site plays a crucial role in the activity of this gene promoter in vitro in the majority of tested cell types (10/12), and an important role - in the rest two cell lines. PMID:20716342

  16. Analysis of Polymorphisms in the Lactotransferrin Gene Promoter and Dental Caries

    PubMed Central

    Brancher, João Armando; Pecharki, Giovana Daniela; Doetzer, Andrea Duarte; Medeiros, Kamilla Gabriella dos Santos; Cordeiro Júnior, Carlos Alberto; Sotomaior, Vanessa Santos; Bauer, Peter; Trevilatto, Paula Cristina

    2011-01-01

    Regarding host aspects, there has been strong evidence for a genetic component in the etiology of caries. The salivary protein lactotransferrin (LTF) exhibits antibacterial activity, but there is no study investigating the association of polymorphisms in the promoter region of LTF gene with caries. The objective of this study was firstly to search the promoter region of the human LTF gene for variations and, if existent, to investigate the association of the identified polymorphisms with dental caries in 12-year-old students. From 687 unrelated, 12-year-old, both sex students, 50 individuals were selected and divided into two groups of extreme phenotypes according to caries experience: 25 students without (DMFT = 0) and 25 with caries experience (DMFT ≥ 4). The selection of individuals with extreme phenotypes augments the chances to find gene variations which could be associated with such phenotypes. LTF gene-putative promoter region (+39 to −1143) of the selected 50 individuals was analyzed by high-resolution melting technique. Fifteen students, 8 without (DMFT = 0) and 7 with caries experience (mean DMFT = 6.28), presented deviations of the pattern curve suggestive of gene variations and were sequenced. However, no polymorphisms were identified in the putative promoter region of the LTF gene. PMID:22190933

  17. Rous sarcoma virus contains sequences which permit expression of the gag gene in Escherichia coli.

    PubMed Central

    Mermer, B; Malamy, M; Coffin, J M

    1983-01-01

    Several aspects of Rous sarcoma virus gene expression, including transcription, translation, and protein processing, can occur within Escherichia coli containing cloned viral DNA. The viral long terminal repeat contains a bacterial promoter, and viral sequences at or near the authentic viral initiation codon permit the initiation of translation. These signals can direct the synthesis in E. coli of the viral gag gene precursor Pr76 or, when fused to a portion of the lacZ gene, a gag-beta-galactosidase fusion protein. Pr76 is processed into gag structural proteins in E. coli in a process which is dependent upon the gag product p15. These observations suggest that E. coli can be used for the introduction and analysis of mutations in sequences relevant to viral gene expression. Images PMID:6316124

  18. Structural and functional analysis of a promoter of the human granulin/epithelin gene.

    PubMed Central

    Bhandari, V; Daniel, R; Lim, P S; Bateman, A

    1996-01-01

    Granulins (grns) or epithelins (epis) are peptides with molecular masses of approx. 6 kDa that modulate the growth of cells. The precursor for the grns/epis, which might itself be biologically active, is a secreted glycoprotein containing multiple repeats of the grn/epi motif. Grn/epi mRNA occurs widely in vivo, particularly in tissues rich in epithelial and haematopoietic cells. To understand better the role of the gene products for grn/epi it is important to determine the patterns of grn/epi gene expression and how this is regulated. To assist in this we have obtained the 5' sequence of the human grn/epi gene, and using chimaeras of the grn/epi -5' sequence and the chloramphenicol acetyltransferase gene we have shown a strong promoter activity associated with the 5' sequence of the human grn/epi gene. We have further delineated regions of the 5' sequence that confer high-level expression on the chimaeric gene. PMID:8912679

  19. Morquio A syndrome: Cloning, sequence, and structure of the human N-acetylgalactosamine 6-sulfatase (GALNS) gene

    SciTech Connect

    Morris, C.P.; Guo, Xiao-Hui; Apostolou, S.

    1994-08-01

    Deficiency of the lysosomal enzyme, N-acetylgalactosamine 6-sulfatase (GALNS;EC 3.1.6.4), results in the storage of the glycosaminoglycans, keratan sulfate and chrondroitin 6-sulfate, which leads to the lysosomal storage disorder Morquio A syndrome. Four overlapping genomic clones derived from a chromosome 16-specific gridded cosmid library containing the entire GALNS gene were isolated. The structure of the gene and the sequence of the exon/intron boundaries and the 5{prime} promoter region were determined. The GALNS gene is split into 14 exons spanning approximately 40 kb. The potential promoter for GALNS lacks a TATA box but contains GC box consensus sequences, consistent with its role as a housekeeping gene. The GALNS gene contains an Alu repeat in intron 5 and a VNTR-like sequence in intron 6. 12 refs., 3 figs., 1 tab.

  20. The human myelin oligodendrocyte glycoprotein (MOG) gene: Complete nucleotide sequence and structural characterization

    SciTech Connect

    Paule Roth, M.; Malfroy, L.; Offer, C.; Sevin, J.; Enault, G.; Borot, N.; Pontarotti, P.; Coppin, H.

    1995-07-20

    Human myelin oligodendrocyte glycoprotein (MOG), a myelin component of the central nervous system, is a candidate target antigen for autoimmune-mediated demyelination. We have isolated and sequenced part of a cosmid clone that contains the entire human MOG gene. The primary nuclear transcript, extending from the putative start of transcription to the site of poly(A) addition, is 15,561 nucleotides in length. The human MOG gene contains 8 exons, separated by 7 introns; canonical intron/exon boundary sites are observed at each junction. The introns vary in size from 242 to 6484 bp and contain numerous repetitive DNA elements, including 14 Alu sequences within 3 introns. Another Alu element is located in the 3{prime}-untranslated region of the gene. Alu sequences were classified with respect to subfamily assignment. Seven hundred sixty-three nucleotides 5{prime} of the transcription start and 1214 nucleotides 3{prime} of the poly(A) addition sites were also sequenced. The 5{prime}-flanking region revealed the presence of several consensus sequences that could be relevant in the transcription of the MOG gene, in particular binding sites in common with other myelin gene promoters. Two polymorphic intragenic dinucleotide (CA){sub n} and tetranucleotide (TAAA){sub n} repeats were identified and may provide genetic marker tools for association and linkage studies. 50 refs., 3 figs., 3 tabs.

  1. Nucleotide sequence and revised map location of the arn gene from bacteriophage T4.

    PubMed

    Kim, B C; Kim, K; Park, E H; Lim, C J

    1997-10-31

    Non-glucosylated (Glu-) T-even phage DNAs are restricted by Escherichia coli RgIA and RgIB endonucleases with different specificities. RgIB endonuclease activity is strongly inhibited by anti-restriction endonuclease (Arn) encoded by the bacteriophage T4 genome. The nucleotide sequence of the arn gene encoding Arn was determined. The product of the cloned arn gene was overexpressed by the T7 RNA polymerase/promoter system, and its molecular size is consistent with that predicted from the open reading frame of the arn gene. The arn gene is located between the asiA gene and motA gene in the region of 161,300-161,578 nucleotides.

  2. Analysis of Pseudomonas putida alkane-degradation gene clusters and flanking insertion sequences: evolution and regulation of the alk genes.

    PubMed

    van Beilen, J B; Panke, S; Lucchini, S; Franchini, A G; Röthlisberger, M; Witholt, B

    2001-06-01

    The Pseudomonas putida GPo1 (commonly known as Pseudomonas oleovorans GPo1) alkBFGHJKL and alkST gene clusters, which encode proteins involved in the conversion of n-alkanes to fatty acids, are located end to end on the OCT plasmid, separated by 9.7 kb of DNA. This DNA segment encodes, amongst others, a methyl-accepting transducer protein (AlkN) that may be involved in chemotaxis to alkanes. In P. putida P1, the alkBFGHJKL and alkST gene clusters are flanked by almost identical copies of the insertion sequence ISPpu4, constituting a class 1 transposon. Other insertion sequences flank and interrupt the alk genes in both strains. Apart from the coding regions of the GPo1 and P1 alk genes (80-92% sequence identity), only the alkB and alkS promoter regions are conserved. Competition experiments suggest that highly conserved inverted repeats in the alkB and alkS promoter regions bind ALKS: PMID:11390693

  3. Identification and Analysis of Regulatory Elements in Porcine Bone Morphogenetic Protein 15 Gene Promoter.

    PubMed

    Wan, Qianhui; Wang, Yaxian; Wang, Huayan

    2015-10-27

    Bone morphogenetic protein 15 (BMP15) is secreted by the mammalian oocytes and is indispensable for ovarian follicular development, ovulation, and fertility. To determine the regulation mechanism of BMP15 gene, the regulatory sequence of porcine BMP15 was investigated in this study. The cloned BMP15 promoter retains the cell-type specificity, and is activated in cells derived from ovarian tissue. The luciferase assays in combination with a series of deletion of BMP15 promoter sequence show that the -427 to -376 bp region of BMP15 promoter is the primary regulatory element, in which there are a number of transcription factor binding sites, including LIM homeobox 8 (LHX8), newborn ovary homeobox gene (NOBOX), and paired-like homeodomain transcription factor 1 (PITX1). Determination of tissue-specific expression reveals that LHX8, but not PITX1 and NOBOX, is exclusively expressed in pig ovary tissue and is translocated into the cell nuclei. Overexpression of LHX8 in Chinese hamster ovary (CHO) cells could significantly promote BMP15 promoter activation. This study confirms a key regulatory element that is located in the proximal region of BMP15 promoter and is regulated by the LHX8 factor.

  4. Identification and Analysis of Regulatory Elements in Porcine Bone Morphogenetic Protein 15 Gene Promoter

    PubMed Central

    Wan, Qianhui; Wang, Yaxian; Wang, Huayan

    2015-01-01

    Bone morphogenetic protein 15 (BMP15) is secreted by the mammalian oocytes and is indispensable for ovarian follicular development, ovulation, and fertility. To determine the regulation mechanism of BMP15 gene, the regulatory sequence of porcine BMP15 was investigated in this study. The cloned BMP15 promoter retains the cell-type specificity, and is activated in cells derived from ovarian tissue. The luciferase assays in combination with a series of deletion of BMP15 promoter sequence show that the −427 to −376 bp region of BMP15 promoter is the primary regulatory element, in which there are a number of transcription factor binding sites, including LIM homeobox 8 (LHX8), newborn ovary homeobox gene (NOBOX), and paired-like homeodomain transcription factor 1 (PITX1). Determination of tissue-specific expression reveals that LHX8, but not PITX1 and NOBOX, is exclusively expressed in pig ovary tissue and is translocated into the cell nuclei. Overexpression of LHX8 in Chinese hamster ovary (CHO) cells could significantly promote BMP15 promoter activation. This study confirms a key regulatory element that is located in the proximal region of BMP15 promoter and is regulated by the LHX8 factor. PMID:26516845

  5. Genome Sequence of the Plant Growth Promoting Endophytic Bacterium Enterobacter sp. 638

    SciTech Connect

    Taghavi, S.; van der Lelie, D.; Hoffman, A.; Zhang, Y.-B.; Walla, M. D.; Vangronsveld, J.; Newman, L.; Monchy, S.

    2010-05-13

    Enterobacter sp. 638 is an endophytic plant growth promoting gamma-proteobacterium that was isolated from the stem of poplar (Populus trichocarpa x deltoides cv. H11-11), a potentially important biofuel feed stock plant. The Enterobacter sp. 638 genome sequence reveals the presence of a 4,518,712 bp chromosome and a 157,749 bp plasmid (pENT638-1). Genome annotation and comparative genomics allowed the identification of an extended set of genes specific to the plant niche adaptation of this bacterium. This includes genes that code for putative proteins involved in survival in the rhizosphere (to cope with oxidative stress or uptake of nutrients released by plant roots), root adhesion (pili, adhesion, hemagglutinin, cellulose biosynthesis), colonization/establishment inside the plant (chemiotaxis, flagella, cellobiose phosphorylase), plant protection against fungal and bacterial infections (siderophore production and synthesis of the antimicrobial compounds 4-hydroxybenzoate and 2-phenylethanol), and improved poplar growth and development through the production of the phytohormones indole acetic acid, acetoin, and 2,3-butanediol. Metabolite analysis confirmed by quantitative RT-PCR showed that, the production of acetoin and 2,3-butanediol is induced by the presence of sucrose in the growth medium. Interestingly, both the genetic determinants required for sucrose metabolism and the synthesis of acetoin and 2,3-butanediol are clustered on a genomic island. These findings point to a close interaction between Enterobacter sp. 638 and its poplar host, where the availability of sucrose, a major plant sugar, affects the synthesis of plant growth promoting phytohormones by the endophytic bacterium. The availability of the genome sequence, combined with metabolome and transcriptome analysis, will provide a better understanding of the synergistic interactions between poplar and its growth promoting endophyte Enterobacter sp. 638. This information can be further exploited to

  6. Characterization of the Promoter Region of Biosynthetic Enzyme Genes Involved in Berberine Biosynthesis in Coptis japonica

    PubMed Central

    Yamada, Yasuyuki; Yoshimoto, Tadashi; Yoshida, Sayumi T.; Sato, Fumihiko

    2016-01-01

    The presence of alkaloids is rather specific to certain plant species. However, berberine, an isoquinoline alkaloid, is relatively broadly distributed in the plant kingdom. Thus, berberine biosynthesis has been intensively investigated, especially using Coptis japonica cell cultures. Almost all biosynthetic enzyme genes have already been characterized at the molecular level. Particularly, two transcription factors (TFs), a plant-specific WRKY-type TF, CjWRKY1, and a basic helix-loop-helix TF, CjbHLH1, were shown to comprehensively regulate berberine biosynthesis in C. japonica cells. In this study, we characterized the promoter region of some biosynthetic enzyme genes and associated cis-acting elements involved in the transcriptional regulation via two TFs. The promoter regions of three berberine biosynthetic enzyme genes (CYP80B2, 4′OMT and CYP719A1) were isolated, and their promoter activities were dissected by a transient assay involving the sequentially truncated promoter::luciferase (LUC) reporter constructs. Furthermore, transactivation activities of CjWRKY1 were determined using the truncated promoter::LUC reporter constructs or constructs with mutated cis-elements. These results suggest the involvement of a putative W-box in the regulation of biosynthetic enzyme genes. Direct binding of CjWRKY1 to the W-box DNA sequence was also confirmed by an electrophoresis mobility shift assay and by a chromatin immunoprecipitation assay. In addition, CjbHLH1 also activated transcription from truncated 4′OMT and CYP719A1 promoters independently of CjWRKY1, suggesting the involvement of a putative E-box. Unexpected transcriptional activation of biosynthetic enzyme genes via a non-W-box sequence and by CjWRKY1 as well as the possible involvement of a GCC-box in berberine biosynthesis in C. japonica are discussed. PMID:27642289

  7. Characterization of the Promoter Region of Biosynthetic Enzyme Genes Involved in Berberine Biosynthesis in Coptis japonica.

    PubMed

    Yamada, Yasuyuki; Yoshimoto, Tadashi; Yoshida, Sayumi T; Sato, Fumihiko

    2016-01-01

    The presence of alkaloids is rather specific to certain plant species. However, berberine, an isoquinoline alkaloid, is relatively broadly distributed in the plant kingdom. Thus, berberine biosynthesis has been intensively investigated, especially using Coptis japonica cell cultures. Almost all biosynthetic enzyme genes have already been characterized at the molecular level. Particularly, two transcription factors (TFs), a plant-specific WRKY-type TF, CjWRKY1, and a basic helix-loop-helix TF, CjbHLH1, were shown to comprehensively regulate berberine biosynthesis in C. japonica cells. In this study, we characterized the promoter region of some biosynthetic enzyme genes and associated cis-acting elements involved in the transcriptional regulation via two TFs. The promoter regions of three berberine biosynthetic enzyme genes (CYP80B2, 4'OMT and CYP719A1) were isolated, and their promoter activities were dissected by a transient assay involving the sequentially truncated promoter::luciferase (LUC) reporter constructs. Furthermore, transactivation activities of CjWRKY1 were determined using the truncated promoter::LUC reporter constructs or constructs with mutated cis-elements. These results suggest the involvement of a putative W-box in the regulation of biosynthetic enzyme genes. Direct binding of CjWRKY1 to the W-box DNA sequence was also confirmed by an electrophoresis mobility shift assay and by a chromatin immunoprecipitation assay. In addition, CjbHLH1 also activated transcription from truncated 4'OMT and CYP719A1 promoters independently of CjWRKY1, suggesting the involvement of a putative E-box. Unexpected transcriptional activation of biosynthetic enzyme genes via a non-W-box sequence and by CjWRKY1 as well as the possible involvement of a GCC-box in berberine biosynthesis in C. japonica are discussed. PMID:27642289

  8. Characterization of the Promoter Region of Biosynthetic Enzyme Genes Involved in Berberine Biosynthesis in Coptis japonica

    PubMed Central

    Yamada, Yasuyuki; Yoshimoto, Tadashi; Yoshida, Sayumi T.; Sato, Fumihiko

    2016-01-01

    The presence of alkaloids is rather specific to certain plant species. However, berberine, an isoquinoline alkaloid, is relatively broadly distributed in the plant kingdom. Thus, berberine biosynthesis has been intensively investigated, especially using Coptis japonica cell cultures. Almost all biosynthetic enzyme genes have already been characterized at the molecular level. Particularly, two transcription factors (TFs), a plant-specific WRKY-type TF, CjWRKY1, and a basic helix-loop-helix TF, CjbHLH1, were shown to comprehensively regulate berberine biosynthesis in C. japonica cells. In this study, we characterized the promoter region of some biosynthetic enzyme genes and associated cis-acting elements involved in the transcriptional regulation via two TFs. The promoter regions of three berberine biosynthetic enzyme genes (CYP80B2, 4′OMT and CYP719A1) were isolated, and their promoter activities were dissected by a transient assay involving the sequentially truncated promoter::luciferase (LUC) reporter constructs. Furthermore, transactivation activities of CjWRKY1 were determined using the truncated promoter::LUC reporter constructs or constructs with mutated cis-elements. These results suggest the involvement of a putative W-box in the regulation of biosynthetic enzyme genes. Direct binding of CjWRKY1 to the W-box DNA sequence was also confirmed by an electrophoresis mobility shift assay and by a chromatin immunoprecipitation assay. In addition, CjbHLH1 also activated transcription from truncated 4′OMT and CYP719A1 promoters independently of CjWRKY1, suggesting the involvement of a putative E-box. Unexpected transcriptional activation of biosynthetic enzyme genes via a non-W-box sequence and by CjWRKY1 as well as the possible involvement of a GCC-box in berberine biosynthesis in C. japonica are discussed.

  9. Insights into corn genes derived from large-scale cDNA sequencing.

    PubMed

    Alexandrov, Nickolai N; Brover, Vyacheslav V; Freidin, Stanislav; Troukhan, Maxim E; Tatarinova, Tatiana V; Zhang, Hongyu; Swaller, Timothy J; Lu, Yu-Ping; Bouck, John; Flavell, Richard B; Feldmann, Kenneth A

    2009-01-01

    We present a large portion of the transcriptome of Zea mays, including ESTs representing 484,032 cDNA clones from 53 libraries and 36,565 fully sequenced cDNA clones, out of which 31,552 clones are non-redundant. These and other previously sequenced transcripts have been aligned with available genome sequences and have provided new insights into the characteristics of gene structures and promoters within this major crop species. We found that although the average number of introns per gene is about the same in corn and Arabidopsis, corn genes have more alternatively spliced isoforms. Examination of the nucleotide composition of coding regions reveals that corn genes, as well as genes of other Poaceae (Grass family), can be divided into two classes according to the GC content at the third position in the amino acid encoding codons. Many of the transcripts that have lower GC content at the third position have dicot homologs but the high GC content transcripts tend to be more specific to the grasses. The high GC content class is also enriched with intronless genes. Together this suggests that an identifiable class of genes in plants is associated with the Poaceae divergence. Furthermore, because many of these genes appear to be derived from ancestral genes that do not contain introns, this evolutionary divergence may be the result of horizontal gene transfer from species not only with different codon usage but possibly that did not have introns, perhaps outside of the plant kingdom. By comparing the cDNAs described herein with the non-redundant set of corn mRNAs in GenBank, we estimate that there are about 50,000 different protein coding genes in Zea. All of the sequence data from this study have been submitted to DDBJ/GenBank/EMBL under accession numbers EU940701-EU977132 (FLI cDNA) and FK944382-FL482108 (EST). PMID:18937034

  10. DNA sequence, products, and transcriptional pattern of the genes involved in production of the DNA replication inhibitor microcin B17.

    PubMed

    Genilloud, O; Moreno, F; Kolter, R

    1989-02-01

    The 3.8-kilobase segment of plasmid DNA that contains the genes required for production of the DNA replication inhibitor microcin B17 was sequenced. The sequence contains four open reading frames which were shown to be translated in vivo by the construction of fusions to lacZ. The location of these open reading frames fits well with the location of the four microcin B17 production genes, mcbABCD, identified previously through genetic complementation. The products of the four genes have been identified, and the observed molecular weights of the proteins agree with those predicted from the nucleotide sequence. The transcription of these genes was studied by using fusions to lacZ and physical mapping of mRNA start sites. Three promoters were identified in this region. The major promoter for all the genes is a growth phase-regulated OmpR-dependent promoter located upstream of mcbA. A second promoter is located within mcbC and is responsible for a low-level basal expression of mcbD. A third promoter, located within mcbD, promotes transcription in the reverse direction starting within mcbD and extending through mcbC. The resulting mRNA appears to be an untranslated antisense transcript that could play a regulatory role in the expression of these genes.

  11. Efficient expression of protein coding genes from the murine U1 small nuclear RNA promoters.

    PubMed Central

    Bartlett, J S; Sethna, M; Ramamurthy, L; Gowen, S A; Samulski, R J; Marzluff, W F

    1996-01-01

    Few promoters are active at high levels in all cells. Of these, the majority encode structural RNAs transcribed by RNA polymerases I or III and are not accessible for the expression of proteins. An exception are the small nuclear RNAs (snRNAs) transcribed by RNA polymerase II. Although snRNA biosynthesis is unique and thought not to be compatible with synthesis of functional mRNA, we have tested these promoters for their ability to express functional mRNAs. We have used the murine U1a and U1b snRNA gene promoters to express the Escherichia coli lacZ gene and the human alpha-globin gene from either episomal or integrated templates by transfection, or infection into a variety of mammalian cell types. Equivalent expression of beta-galactosidase was obtained from < 250 nucleotides of 5'-flanking sequence containing the complete promoter of either U1 snRNA gene or from the 750-nt cytomegalovirus promoter and enhancer regions. The mRNA was accurately initiated at the U1 start site, efficiently spliced and polyadenylylated, and localized to polyribosomes. Recombinant adenovirus containing the U1b-lacZ chimeric gene transduced and expressed beta-galactosidase efficiently in human 293 cells and airway epithelial cells in culture. Viral vectors containing U1 snRNA promoters may be an attractive alternative to vectors containing viral promoters for persistent high-level expression of therapeutic genes or proteins. Images Fig. 2 Fig. 3 Fig. 4 Fig. 5 PMID:8799116

  12. Maximal Expression of the Evolutionarily Conserved Slit2 Gene Promoter Requires Sp1.

    PubMed

    Saunders, Jacquelyn; Wisidagama, D Roonalika; Morford, Travis; Malone, Cindy S

    2016-08-01

    Slit2 is a neural axon guidance and chemorepellent protein that stimulates motility in a variety of cell types. The role of Slit2 in neural development and neoplastic growth and migration has been well established, while the genetic mechanisms underlying regulation of the Slit2 gene have not. We identified the core and proximal promoter of Slit2 by mapping multiple transcriptional start sites, analyzing transcriptional activity, and confirming sequence homology for the Slit2 proximal promoter among a number of species. Deletion series and transient transfection identified the Slit2 proximal promoter as within 399 base pairs upstream of the start of transcription. A crucial region for full expression of the Slit2 proximal promoter lies between 399 base pairs and 296 base pairs upstream of the start of transcription. Computer modeling identified three transcription factor-binding consensus sites within this region, of which only site-directed mutagenesis of one of the two identified Sp1 consensus sites inhibited transcriptional activity of the Slit2 proximal promoter (-399 to +253). Bioinformatics analysis of the Slit2 proximal promoter -399 base pair to -296 base pair region shows high sequence conservation over twenty-two species, and that this region follows an expected pattern of sequence divergence through evolution.

  13. The Mouse Solitary Odorant Receptor Gene Promoters as Models for the Study of Odorant Receptor Gene Choice

    PubMed Central

    Degl'Innocenti, Andrea

    2016-01-01

    Background In vertebrates, several anatomical regions located within the nasal cavity mediate olfaction. Among these, the main olfactory epithelium detects most conventional odorants. Olfactory sensory neurons, provided with cilia exposed to the air, detect volatile chemicals via an extremely large family of seven-transmembrane chemoreceptors named odorant receptors. Their genes are expressed in a monogenic and monoallelic fashion: a single allele of a single odorant receptor gene is transcribed in a given mature neuron, through a still uncharacterized molecular mechanism known as odorant receptor gene choice. Aim Odorant receptor genes are typically arranged in genomic clusters, but a few are isolated (we call them solitary) from the others within a region broader than 1 Mb upstream and downstream with respect to their transcript's coordinates. The study of clustered genes is problematic, because of redundancy and ambiguities in their regulatory elements: we propose to use the solitary genes as simplified models to understand odorant receptor gene choice. Procedures Here we define number and identity of the solitary genes in the mouse genome (C57BL/6J), and assess the conservation of the solitary status in some mammalian orthologs. Furthermore, we locate their putative promoters, predict their homeodomain binding sites (commonly present in the promoters of odorant receptor genes) and compare candidate promoter sequences with those of wild-caught mice. We also provide expression data from histological sections. Results In the mouse genome there are eight intact solitary genes: Olfr19 (M12), Olfr49, Olfr266, Olfr267, Olfr370, Olfr371, Olfr466, Olfr1402; five are conserved as solitary in rat. These genes are all expressed in the main olfactory epithelium of three-day-old mice. The C57BL/6J candidate promoter of Olfr370 has considerably varied compared to its wild-type counterpart. Within the putative promoter for Olfr266 a homeodomain binding site is predicted. As a

  14. Computational Genomics: From Genome Sequence To Global Gene Regulation

    NASA Astrophysics Data System (ADS)

    Li, Hao

    2000-03-01

    As various genome projects are shifting to the post-sequencing phase, it becomes a big challenge to analyze the sequence data and extract biological information using computational tools. In the past, computational genomics has mainly focused on finding new genes and mapping out their biological functions. With the rapid accumulation of experimental data on genome-wide gene activities, it is now possible to understand how genes are regulated on a genomic scale. A major mechanism for gene regulation is to control the level of transcription, which is achieved by regulatory proteins that bind to short DNA sequences - the regulatory elements. We have developed a new approach to identifying regulatory elements in genomes. The approach formalizes how one would proceed to decipher a ``text'' consisting of a long string of letters written in an unknown language that did not delineate words. The algorithm is based on a statistical mechanics model in which the sequence is segmented probabilistically into ``words'' and a ``dictionary'' of ``words'' is built concurrently. For the control regions in the yeast genome, we built a ``dictionary'' of about one thousand words which includes many known as well as putative regulatory elements. I will discuss how we can use this dictionary to search for genes that are likely to be regulated in a similar fashion and to analyze gene expression data generated from DNA micro-array experiments.

  15. Genome sequence of the plant growth-promoting rhizobacterium Pseudomonas putida S11.

    PubMed

    Ponraj, Paramasivan; Shankar, Manoharan; Ilakkiam, Devaraj; Rajendhran, Jeyaprakash; Gunasekaran, Paramasamy

    2012-11-01

    Here we report the genome sequence of a plant growth-promoting rhizobacterium, Pseudomonas putida S11. The length of the draft genome sequence is approximately 5,970,799 bp, with a G+C content of 62.4%. The genome contains 6,076 protein-coding sequences.

  16. Integration of bioinformatics and synthetic promoters leads to the discovery of novel elicitor-responsive cis-regulatory sequences in Arabidopsis.

    PubMed

    Koschmann, Jeannette; Machens, Fabian; Becker, Marlies; Niemeyer, Julia; Schulze, Jutta; Bülow, Lorenz; Stahl, Dietmar J; Hehl, Reinhard

    2012-09-01

    A combination of bioinformatic tools, high-throughput gene expression profiles, and the use of synthetic promoters is a powerful approach to discover and evaluate novel cis-sequences in response to specific stimuli. With Arabidopsis (Arabidopsis thaliana) microarray data annotated to the PathoPlant database, 732 different queries with a focus on fungal and oomycete pathogens were performed, leading to 510 up-regulated gene groups. Using the binding site estimation suite of tools, BEST, 407 conserved sequence motifs were identified in promoter regions of these coregulated gene sets. Motif similarities were determined with STAMP, classifying the 407 sequence motifs into 37 families. A comparative analysis of these 37 families with the AthaMap, PLACE, and AGRIS databases revealed similarities to known cis-elements but also led to the discovery of cis-sequences not yet implicated in pathogen response. Using a parsley (Petroselinum crispum) protoplast system and a modified reporter gene vector with an internal transformation control, 25 elicitor-responsive cis-sequences from 10 different motif families were identified. Many of the elicitor-responsive cis-sequences also drive reporter gene expression in an Agrobacterium tumefaciens infection assay in Nicotiana benthamiana. This work significantly increases the number of known elicitor-responsive cis-sequences and demonstrates the successful integration of a diverse set of bioinformatic resources combined with synthetic promoter analysis for data mining and functional screening in plant-pathogen interaction. PMID:22744985

  17. Integration of Bioinformatics and Synthetic Promoters Leads to the Discovery of Novel Elicitor-Responsive cis-Regulatory Sequences in Arabidopsis1[C][W][OA

    PubMed Central

    Koschmann, Jeannette; Machens, Fabian; Becker, Marlies; Niemeyer, Julia; Schulze, Jutta; Bülow, Lorenz; Stahl, Dietmar J.; Hehl, Reinhard

    2012-01-01

    A combination of bioinformatic tools, high-throughput gene expression profiles, and the use of synthetic promoters is a powerful approach to discover and evaluate novel cis-sequences in response to specific stimuli. With Arabidopsis (Arabidopsis thaliana) microarray data annotated to the PathoPlant database, 732 different queries with a focus on fungal and oomycete pathogens were performed, leading to 510 up-regulated gene groups. Using the binding site estimation suite of tools, BEST, 407 conserved sequence motifs were identified in promoter regions of these coregulated gene sets. Motif similarities were determined with STAMP, classifying the 407 sequence motifs into 37 families. A comparative analysis of these 37 families with the AthaMap, PLACE, and AGRIS databases revealed similarities to known cis-elements but also led to the discovery of cis-sequences not yet implicated in pathogen response. Using a parsley (Petroselinum crispum) protoplast system and a modified reporter gene vector with an internal transformation control, 25 elicitor-responsive cis-sequences from 10 different motif families were identified. Many of the elicitor-responsive cis-sequences also drive reporter gene expression in an Agrobacterium tumefaciens infection assay in Nicotiana benthamiana. This work significantly increases the number of known elicitor-responsive cis-sequences and demonstrates the successful integration of a diverse set of bioinformatic resources combined with synthetic promoter analysis for data mining and functional screening in plant-pathogen interaction. PMID:22744985

  18. Diverse nucleotide compositions and sequence fluctuation in Rubisco protein genes

    NASA Astrophysics Data System (ADS)

    Holden, Todd; Dehipawala, S.; Cheung, E.; Bienaime, R.; Ye, J.; Tremberger, G., Jr.; Schneider, P.; Lieberman, D.; Cheung, T.

    2011-10-01

    The Rubisco protein-enzyme is arguably the most abundance protein on Earth. The biology dogma of transcription and translation necessitates the study of the Rubisco genes and Rubisco-like genes in various species. Stronger correlation of fractal dimension of the atomic number fluctuation along a DNA sequence with Shannon entropy has been observed in the studied Rubisco-like gene sequences, suggesting a more diverse evolutionary pressure and constraints in the Rubisco sequences. The strategy of using metal for structural stabilization appears to be an ancient mechanism, with data from the porphobilinogen deaminase gene in Capsaspora owczarzaki and Monosiga brevicollis. Using the chi-square distance probability, our analysis supports the conjecture that the more ancient Rubisco-like sequence in Microcystis aeruginosa would have experienced very different evolutionary pressure and bio-chemical constraint as compared to Bordetella bronchiseptica, the two microbes occupying either end of the correlation graph. Our exploratory study would indicate that high fractal dimension Rubisco sequence would support high carbon dioxide rate via the Michaelis- Menten coefficient; with implication for the control of the whooping cough pathogen Bordetella bronchiseptica, a microbe containing a high fractal dimension Rubisco-like sequence (2.07). Using the internal comparison of chi-square distance probability for 16S rRNA (~ E-22) versus radiation repair Rec-A gene (~ E-05) in high GC content Deinococcus radiodurans, our analysis supports the conjecture that high GC content microbes containing Rubisco-like sequence are likely to include an extra-terrestrial origin, relative to Deinococcus radiodurans. Similar photosynthesis process that could utilize host star radiation would not compete with radiation resistant process from the biology dogma perspective in environments such as Mars and exoplanets.

  19. Tissue-specific expression and promoter analysis of the tobacco Itp1 gene.

    PubMed Central

    Canevascini, S; Caderas, D; Mandel, T; Fleming, A J; Dupuis, I; Kuhlemeier, C

    1996-01-01

    The Nicotiana tabacum Itp1 gene (Ntltp1) encodes a small basic protein that belongs to a class of putative lipid transfer proteins. These proteins transfer lipids between membranes in vitro, but their in vivo function remains hotly debated. This gene also serves as an important early marker for epidermis differentiation. We report here the analysis of the spatial and developmental activity of the Ntltp1 promoter, and we define a sequence element required for epidermis-specific expression. Transgenic plants were created containing 1346 bp of the Ntltp1 promoter fused upstream of the beta-glucuronidase (GUS) gene. In the mature aerial tissues, GUS activity was detected predominantly in the epidermis, whereas in younger aerial tissues, such as the shoot apical meristem and floral meristem, GUS expression was not restricted to the tunica layer. Unexpectedly, GUS activity was also detected in young roots particularly in the root epidermis. Furthermore, the Ntltp1 promoter displayed a tissue and developmental specific pattern of activity during germination. These results suggest that the Ntltp1 gene is highly expressed in regions of the plant that are vulnerable to pathogen attack and are thus consistent with the proposed function of lipid transfer proteins in plant defense. Deletions of the promoter from its 5' end revealed that the 148 bp preceding the translational start site are sufficient for epidermis-specific expression. Sequence comparison identified an eight-nucleotide palindromic sequence CTAGCTAG in the leader of Ntltp1, which is conserved in a number of other Itp genes. By gel retardation analysis, the presence of specific DNA-protein complexes in this region was demonstrated. The characterization of these factors may lead to the identification of factors that control early events in epidermis differentiation. PMID:8883375

  20. Promoter Identification and Transcription Analysis of Penicillin-Binding Protein Genes in Streptococcus pneumoniae R6

    PubMed Central

    Peters, Katharina; Pipo, Julia; Schweizer, Inga; Hakenbeck, Regine

    2016-01-01

    Penicillin-binding proteins (PBPs) are membrane-associated enzymes, which are involved in the last two steps of peptidoglycan biosynthesis, and some of them are key players in cell division. Furthermore, they are targets of β-lactams, the most widely used antibiotics. Nevertheless, very little is known about the expression and regulation of PBP genes. Using transcriptional mapping, we now determined the promoter regions of PBP genes from the laboratory strain Streptococcus pneumoniae R6 and examined the expression profile of these six promoters. The extended −10 region is highly conserved and complies with a σA-type promoter consensus sequence. In contrast, the −35 region is poorly conserved, indicating the possibility for differential PBP regulation. All PBP promoters were constitutively expressed and highly active during the exponential and early stationary growth phase. However, the individual expression of PBP promoters varied approximately fourfold, with pbp1a being the highest and pbp3 the lowest. Furthermore, the deletion of one nucleotide in the spacer region of the PBP3 promoter reduced pbp3 expression ∼10-fold. The addition of cefotaxime above the minimal inhibitory concentration (MIC) did not affect PBP expression in the penicillin-sensitive R6 strain. No evidence for regulation of S. pneumoniae PBP genes was obtained. PMID:27409661

  1. IS406 and IS407, two gene-activating insertion sequences for Pseudomonas cepacia.

    PubMed

    Wood, M S; Byrne, A; Lessie, T G

    1991-08-30

    We have determined the nucleotide sequences of IS406 (1368 bp) and IS407 (1236 bp), two insertion sequence (IS) elements isolated from Pseudomonas cepacia 249 on the basis of their abilities to activate the expression of the lac genes of Tn951. IS406 and IS407 when inserted into the lac promoter/operator region of Tn951 generated, respectively, duplications of 8 and 4 bp of target DNA. IS406 had 41-bp terminal inverted repeat (IR) sequences with eleven mismatches. IR-L (left) contained a 12-bp motif present at the ends of Tn2501. In other respects, IS406 was distinct from previously described bacterial IS elements listed in the GenBank and EMBL databases. IS407 had 49-bp terminal IRs with 18 mismatches. IR-R (right) contained an outwardly directed sigma 70-like promoter. IS407 was closely related to IS476 and ISR1 from Xanthomonas and Rhizobium sp., respectively. PMID:1718819

  2. Zebrafish U6 small nuclear RNA gene promoters contain a SPH element in an unusual location.

    PubMed

    Halbig, Kari M; Lekven, Arne C; Kunkel, Gary R

    2008-09-15

    Promoters for vertebrate small nuclear RNA (snRNA) genes contain a relatively simple array of transcriptional control elements, divided into proximal and distal regions. Most of these genes are transcribed by RNA polymerase II (e.g., U1, U2), whereas the U6 gene is transcribed by RNA polymerase III. Previously identified vertebrate U6 snRNA gene promoters consist of a proximal sequence element (PSE) and TATA element in the proximal region, plus a distal region with octamer (OCT) and SphI postoctamer homology (SPH) elements. We have found that zebrafish U6 snRNA promoters contain the SPH element in a novel proximal position immediately upstream of the TATA element. The zebrafish SPH element is recognized by SPH-binding factor/selenocysteine tRNA gene transcription activating factor/zinc finger protein 143 (SBF/Staf/ZNF143) in vitro. Furthermore, a zebrafish U6 promoter with a defective SPH element is inefficiently transcribed when injected into embryos.

  3. Illumina MiSeq sequencing disfavours a sequence motif in the GFP reporter gene.

    PubMed

    Van den Hoecke, Silvie; Verhelst, Judith; Saelens, Xavier

    2016-01-01

    Green fluorescent protein (GFP) is one of the most used reporter genes. We have used next-generation sequencing (NGS) to analyse the genetic diversity of a recombinant influenza A virus that expresses GFP and found a remarkable coverage dip in the GFP coding sequence. This coverage dip was present when virus-derived RT-PCR product or the parental plasmid DNA was used as starting material for NGS and regardless of whether Nextera XT transposase or Covaris shearing was used for DNA fragmentation. Therefore, the sequence coverage dip in the GFP coding sequence was not the result of emerging GFP mutant viruses or a bias introduced by Nextera XT fragmentation. Instead, we found that the Illumina MiSeq sequencing method disfavours the 'CCCGCC' motif in the GFP coding sequence. PMID:27193250

  4. Illumina MiSeq sequencing disfavours a sequence motif in the GFP reporter gene

    PubMed Central

    Van den Hoecke, Silvie; Verhelst, Judith; Saelens, Xavier

    2016-01-01

    Green fluorescent protein (GFP) is one of the most used reporter genes. We have used next-generation sequencing (NGS) to analyse the genetic diversity of a recombinant influenza A virus that expresses GFP and found a remarkable coverage dip in the GFP coding sequence. This coverage dip was present when virus-derived RT-PCR product or the parental plasmid DNA was used as starting material for NGS and regardless of whether Nextera XT transposase or Covaris shearing was used for DNA fragmentation. Therefore, the sequence coverage dip in the GFP coding sequence was not the result of emerging GFP mutant viruses or a bias introduced by Nextera XT fragmentation. Instead, we found that the Illumina MiSeq sequencing method disfavours the ‘CCCGCC’ motif in the GFP coding sequence. PMID:27193250

  5. Different regulatory sequences control creatine kinase-M gene expression in directly injected skeletal and cardiac muscle.

    PubMed Central

    Vincent, C K; Gualberto, A; Patel, C V; Walsh, K

    1993-01-01

    Regulatory sequences of the M isozyme of the creatine kinase (MCK) gene have been extensively mapped in skeletal muscle, but little is known about the sequences that control cardiac-specific expression. The promoter and enhancer sequences required for MCK gene expression were assayed by the direct injection of plasmid DNA constructs into adult rat cardiac and skeletal muscle. A 700-nucleotide fragment containing the enhancer and promoter of the rabbit MCK gene activated the expression of a downstream reporter gene in both muscle tissues. Deletion of the enhancer significantly decreased expression in skeletal muscle but had no detectable effect on expression in cardiac muscle. Further deletions revealed a CArG sequence motif at position -179 within the promoter that was essential for cardiac-specific expression. The CArG element of the MCK promoter bound to the recombinant serum response factor and YY1, transcription factors which control expression from structurally similar elements in the skeletal actin and c-fos promoters. MCK-CArG-binding activities that were similar or identical to serum response factor and YY1 were also detected in extracts from adult cardiac muscle. These data suggest that the MCK gene is controlled by different regulatory programs in adult cardiac and skeletal muscle. Images PMID:8423791

  6. Rational design of translational pausing without altering the amino acid sequence dramatically promotes soluble protein expression: a strategic demonstration.

    PubMed

    Chen, Wei; Jin, Jingjie; Gu, Wei; Wei, Bo; Lei, Yun; Xiong, Sheng; Zhang, Gong

    2014-11-10

    The production of many pharmaceutical and industrial proteins in prokaryotic hosts is hindered by the insolubility of industrial expression products resulting from misfolding. Even with a correct primary sequence, an improper translation elongation rate in a heterologous expression system is an important cause of misfolding. In silico analysis revealed that most of the endogenous Escherichia coli genes display translational pausing sites that promote correct folding, and almost 1/5 genes have pausing sites at the 3'-termini of their coding sequence. Therefore, we established a novel strategy to efficiently promote the expression of soluble and active proteins without altering the amino acid sequence or expression conditions. This strategy uses the rational design of translational pausing based on structural information solely through synonymous substitutions, i.e. no change on the amino acids sequence. We demonstrated this strategy on a promising antiviral candidate, Cyanovirin-N (CVN), which could not be efficiently expressed in any previously reported system. By introducing silent mutations, we increased the soluble expression level in E. coli by 2000-fold without altering the CVN protein sequence, and the specific activity was slightly higher for the optimized CVN than for the wild-type variant. This strategy introduces new possibilities for the production of bioactive recombinant proteins.

  7. Isolation and characterization of an Arabidopsis biotin carboxylase gene and its promoter.

    PubMed

    Bao, X; Shorrosh, B S; Ohlrogge, J B

    1997-11-01

    In the plastids of most plants, acetyl-CoA carboxylase (ACCase; EC 6.4.1.2) is a multisubunit complex consisting of biotin carboxylase (BC), biotin-carboxyl carrier protien (BCCP), and carboxytransferase (alpha-CT, beta-CT) subunits. To better understand the regulation of this enzyme, we have isolated and sequenced a BC genomic clone from Arabidopsis and partially characterized its promoter. Fifteen introns were identified. The deduced amino acid sequence of the mature BC protein is highly conserved between Arabidopsis and tobacco (92.6% identity). BC expression was evaluated using northern blots and BC/GUS fusion constructs in transgenic Arabidopsis. GUS activity in the BC/GUS transgenics as well as transcript level of the native gene were both found to be higher in silique and flower than in root and leaf. Analysis of tobacco suspension cells transformed with truncated BC promoter/GUS gene fusions indicated the region from -140 to +147 contained necessary promoter elements which supported basal gene expression. A positive regulatory region was found to be located between -2100 and -140, whereas a negative element was possibly located in the first intron. In addition, several conserved regulatory elements were identified in the BC promoter. Surprisingly, although BC is a low-abundance protein, the expression of BC/GUS fusion constructs was similar to 35S/GUS constructs.

  8. Role of -35 sequence and its cooperativity with vir-box for the expression of virE gene.

    PubMed

    Han, S S; Jeon, G A; Sim, W S

    1999-10-31

    To elucidate the role of the -35 sequence and its cooperativity with vir box in the expression of the virE gene, various mutants were constructed by either site-directed mutation or deletional mutation of the virE promoter. The expression level of pHBAV, a mutant where its putative -35 sequences (CCGAGT) have been substituted with the consensus -35 sequences of the Escherichia coli promoter (TTGACA), was increased by 386%. pECHV, containing the conserved -35 sequence but lacking the vir box and the 5'-half of the imperfect dyad symmetry region (DSR) showed an increase of 286% in its promoter activity. pESHV, containing the conserved -35 sequence but lacking the complete 5'-upstream region from the mid-region of imperfect DSR, exhibited 244% of the native virE promoter activity. pHBCA, containing the conserved -35 sequence but destroying the vir box, was constructed by substitution of A, C, T at the positions -62, -63, and -65 on the vir-box to T, A, C, respectively. These mutations increased promoter activities by 319%. On the other hand, when the vir box was mutated from imperfect DSR to almost perfect DSR with T to A and G to T substitutions at -60 and -61 positions of the virE promoter containing the conserved -35 sequence (pHBNA), a higher activity of 671% was observed. These results demonstrate that when the putative -35 sequence of virE promoter is replaced with the consensus -35 sequence, the virE gene can be expressed independently without the binding of VirG protein to the vir-box and/or the induction of acetosyringone. Moreover, the presence of an almost perfect dyad symmetry of the vir-box can increase the expression of virE synergistically with the consensus -35 sequence. PMID:10597040

  9. Helicobacter pylori cagA Promoter Region Sequences Influence CagA Expression and Interleukin 8 Secretion.

    PubMed

    Ferreira, Rui M; Pinto-Ribeiro, Ines; Wen, Xiaogang; Marcos-Pinto, Ricardo; Dinis-Ribeiro, Mário; Carneiro, Fátima; Figueiredo, Ceu

    2016-02-15

    Heterogeneity at the Helicobacter pylori cagA gene promoter region has been linked to variation in CagA expression and gastric histopathology. Here, we characterized the cagA promoter and expression in 46 H. pylori strains from Portugal. Our results confirm the relationship between cagA promoter region variation and protein expression originally observed in strains from Colombia. We observed that individuals with intestinal metaplasia were all infected with H. pylori strains containing a specific cagA motif. Additionally, we provided novel functional evidence that strain-specific sequences in the cagA promoter region and CagA expression levels influence interleukin 8 secretion by the host gastric epithelial cells.

  10. Clustering of Cancer Cell Lines Using A Promoter- Targeted Liquid Hybridization Capture-Based Bisulfite Sequencing Approach.

    PubMed

    Gao, Fei; Wang, Junwen; Ji, Guanyu; Liu, Siyang; Yao, Yu; Wang, Tong; Wu, Honglong; Xia, Yudong; Gong, Desheng; Jiang, Hui; Yang, Huanming; Zhang, Xiuqing

    2015-08-01

    DNA methylation plays a significant role in assuring cell identity, thus potentiating its application in molecular classification of cancers in respect to tissue-origins or clinically and etiologically distinct subtypes. In this study, we optimized our liquid hybridization capture-based bisulfite sequencing (LHC-BS) approach on the gene promoter regions of 11 cell lines. Our results indicated that promoter methylomes could not only cluster cancer cell lines with respect to tissue origins but also differentiate cancer subtypes based on CpG island methylator phenotype (CIMP). Promoter-targeted LHC-BS as means for comprehensive screening and classifying cancer cells with promoter methylomes provided a powerful strategy for further complex clinical studies. PMID:26269607

  11. Clustering of Cancer Cell Lines Using A Promoter- Targeted Liquid Hybridization Capture-Based Bisulfite Sequencing Approach.

    PubMed

    Gao, Fei; Wang, Junwen; Ji, Guanyu; Liu, Siyang; Yao, Yu; Wang, Tong; Wu, Honglong; Xia, Yudong; Gong, Desheng; Jiang, Hui; Yang, Huanming; Zhang, Xiuqing

    2015-08-01

    DNA methylation plays a significant role in assuring cell identity, thus potentiating its application in molecular classification of cancers in respect to tissue-origins or clinically and etiologically distinct subtypes. In this study, we optimized our liquid hybridization capture-based bisulfite sequencing (LHC-BS) approach on the gene promoter regions of 11 cell lines. Our results indicated that promoter methylomes could not only cluster cancer cell lines with respect to tissue origins but also differentiate cancer subtypes based on CpG island methylator phenotype (CIMP). Promoter-targeted LHC-BS as means for comprehensive screening and classifying cancer cells with promoter methylomes provided a powerful strategy for further complex clinical studies.

  12. Synergistic modular promoter and gene optimization to push cellulase secretion by Pichia pastoris beyond existing benchmarks.

    PubMed

    Mellitzer, Andrea; Ruth, Claudia; Gustafsson, Claes; Welch, Mark; Birner-Grünberger, Ruth; Weis, Roland; Purkarthofer, Thomas; Glieder, Anton

    2014-12-10

    Although successfully used for heterologous gene expression for more than twenty years, general knowledge about all factors influencing protein expression by Pichia pastoris is still lacking. For high titers of protein clones are optimized individually for each target protein. Optimization efforts in this study were focused on the DNA level, evaluating a set of 48 different individual synthetic genes (TrCBH2) coding for the same protein sequence of a Trichoderma reesei cellulase in combination with three different promoter sequences: PGAP (constitutive) and the synthetic AOX1 promoter variants PDeS (derepressed) and PEn (enhanced, inducible). Expression of active secreted enzyme varied from undetectable to ∼300% of the best known gene, as determined by secreted enzyme activity analyses of supernatants from 96 well plate and bioreactor cultivations. Finally, the best optimized gene and new promoters were combined to engineer highly productive P. pastoris CBH2 expression strains. Although no methanol was used for induction a final titer of more than 18g/l of secreted protein was produced under controlled conditions in small scale bioreactor cultivations after 60-70h of growth limiting glycerol feed. This is the highest concentration of secreted enzyme in P. pastoris published so far and single parts of the expression cassette could be independently optimized showing additive effects for improvements in protein production by P. pastoris.

  13. Sequence and gene expression evolution of paralogous genes in willows.

    PubMed

    Harikrishnan, Srilakshmy L; Pucholt, Pascal; Berlin, Sofia

    2015-12-22

    Whole genome duplications (WGD) have had strong impacts on species diversification by triggering evolutionary novelties, however, relatively little is known about the balance between gene loss and forces involved in the retention of duplicated genes originating from a WGD. We analyzed putative Salicoid duplicates in willows, originating from the Salicoid WGD, which took place more than 45 Mya. Contigs were constructed by de novo assembly of RNA-seq data derived from leaves and roots from two genotypes. Among the 48,508 contigs, 3,778 pairs were, based on fourfold synonymous third-codon transversion rates and syntenic positions, predicted to be Salicoid duplicates. Both copies were in most cases expressed in both tissues and 74% were significantly differentially expressed. Mean Ka/Ks was 0.23, suggesting that the Salicoid duplicates are evolving by purifying selection. Gene Ontology enrichment analyses showed that functions related to DNA- and nucleic acid binding were over-represented among the non-differentially expressed Salicoid duplicates, while functions related to biosynthesis and metabolism were over-represented among the differentially expressed Salicoid duplicates. We propose that the differentially expressed Salicoid duplicates are regulatory neo- and/or subfunctionalized, while the non-differentially expressed are dose sensitive, hence, functionally conserved. Multiple evolutionary processes, thus drive the retention of Salicoid duplicates in willows.

  14. Sequence and gene expression evolution of paralogous genes in willows

    PubMed Central

    Harikrishnan, Srilakshmy L.; Pucholt, Pascal; Berlin, Sofia

    2015-01-01

    Whole genome duplications (WGD) have had strong impacts on species diversification by triggering evolutionary novelties, however, relatively little is known about the balance between gene loss and forces involved in the retention of duplicated genes originating from a WGD. We analyzed putative Salicoid duplicates in willows, originating from the Salicoid WGD, which took place more than 45 Mya. Contigs were constructed by de novo assembly of RNA-seq data derived from leaves and roots from two genotypes. Among the 48,508 contigs, 3,778 pairs were, based on fourfold synonymous third-codon transversion rates and syntenic positions, predicted to be Salicoid duplicates. Both copies were in most cases expressed in both tissues and 74% were significantly differentially expressed. Mean Ka/Ks was 0.23, suggesting that the Salicoid duplicates are evolving by purifying selection. Gene Ontology enrichment analyses showed that functions related to DNA- and nucleic acid binding were over-represented among the non-differentially expressed Salicoid duplicates, while functions related to biosynthesis and metabolism were over-represented among the differentially expressed Salicoid duplicates. We propose that the differentially expressed Salicoid duplicates are regulatory neo- and/or subfunctionalized, while the non-differentially expressed are dose sensitive, hence, functionally conserved. Multiple evolutionary processes, thus drive the retention of Salicoid duplicates in willows. PMID:26689951

  15. A conserved intronic U1 snRNP-binding sequence promotes trans-splicing in Drosophila.

    PubMed

    Gao, Jun-Li; Fan, Yu-Jie; Wang, Xiu-Ye; Zhang, Yu; Pu, Jia; Li, Liang; Shao, Wei; Zhan, Shuai; Hao, Jianjiang; Xu, Yong-Zhen

    2015-04-01

    Unlike typical cis-splicing, trans-splicing joins exons from two separate transcripts to produce chimeric mRNA and has been detected in most eukaryotes. Trans-splicing in trypanosomes and nematodes has been characterized as a spliced leader RNA-facilitated reaction; in contrast, its mechanism in higher eukaryotes remains unclear. Here we investigate mod(mdg4), a classic trans-spliced gene in Drosophila, and report that two critical RNA sequences in the middle of the last 5' intron, TSA and TSB, promote trans-splicing of mod(mdg4). In TSA, a 13-nucleotide (nt) core motif is conserved across Drosophila species and is essential and sufficient for trans-splicing, which binds U1 small nuclear RNP (snRNP) through strong base-pairing with U1 snRNA. In TSB, a conserved secondary structure acts as an enhancer. Deletions of TSA and TSB using the CRISPR/Cas9 system result in developmental defects in flies. Although it is not clear how the 5' intron finds the 3' introns, compensatory changes in U1 snRNA rescue trans-splicing of TSA mutants, demonstrating that U1 recruitment is critical to promote trans-splicing in vivo. Furthermore, TSA core-like motifs are found in many other trans-spliced Drosophila genes, including lola. These findings represent a novel mechanism of trans-splicing, in which RNA motifs in the 5' intron are sufficient to bring separate transcripts into close proximity to promote trans-splicing. PMID:25838544

  16. A conserved intronic U1 snRNP-binding sequence promotes trans-splicing in Drosophila.

    PubMed

    Gao, Jun-Li; Fan, Yu-Jie; Wang, Xiu-Ye; Zhang, Yu; Pu, Jia; Li, Liang; Shao, Wei; Zhan, Shuai; Hao, Jianjiang; Xu, Yong-Zhen

    2015-04-01

    Unlike typical cis-splicing, trans-splicing joins exons from two separate transcripts to produce chimeric mRNA and has been detected in most eukaryotes. Trans-splicing in trypanosomes and nematodes has been characterized as a spliced leader RNA-facilitated reaction; in contrast, its mechanism in higher eukaryotes remains unclear. Here we investigate mod(mdg4), a classic trans-spliced gene in Drosophila, and report that two critical RNA sequences in the middle of the last 5' intron, TSA and TSB, promote trans-splicing of mod(mdg4). In TSA, a 13-nucleotide (nt) core motif is conserved across Drosophila species and is essential and sufficient for trans-splicing, which binds U1 small nuclear RNP (snRNP) through strong base-pairing with U1 snRNA. In TSB, a conserved secondary structure acts as an enhancer. Deletions of TSA and TSB using the CRISPR/Cas9 system result in developmental defects in flies. Although it is not clear how the 5' intron finds the 3' introns, compensatory changes in U1 snRNA rescue trans-splicing of TSA mutants, demonstrating that U1 recruitment is critical to promote trans-splicing in vivo. Furthermore, TSA core-like motifs are found in many other trans-spliced Drosophila genes, including lola. These findings represent a novel mechanism of trans-splicing, in which RNA motifs in the 5' intron are sufficient to bring separate transcripts into close proximity to promote trans-splicing.

  17. A conserved intronic U1 snRNP-binding sequence promotes trans-splicing in Drosophila

    PubMed Central

    Gao, Jun-Li; Fan, Yu-Jie; Wang, Xiu-Ye; Zhang, Yu; Pu, Jia; Li, Liang; Shao, Wei; Zhan, Shuai; Hao, Jianjiang

    2015-01-01

    Unlike typical cis-splicing, trans-splicing joins exons from two separate transcripts to produce chimeric mRNA and has been detected in most eukaryotes. Trans-splicing in trypanosomes and nematodes has been characterized as a spliced leader RNA-facilitated reaction; in contrast, its mechanism in higher eukaryotes remains unclear. Here we investigate mod(mdg4), a classic trans-spliced gene in Drosophila, and report that two critical RNA sequences in the middle of the last 5′ intron, TSA and TSB, promote trans-splicing of mod(mdg4). In TSA, a 13-nucleotide (nt) core motif is conserved across Drosophila species and is essential and sufficient for trans-splicing, which binds U1 small nuclear RNP (snRNP) through strong base-pairing with U1 snRNA. In TSB, a conserved secondary structure acts as an enhancer. Deletions of TSA and TSB using the CRISPR/Cas9 system result in developmental defects in flies. Although it is not clear how the 5′ intron finds the 3′ introns, compensatory changes in U1 snRNA rescue trans-splicing of TSA mutants, demonstrating that U1 recruitment is critical to promote trans-splicing in vivo. Furthermore, TSA core-like motifs are found in many other trans-spliced Drosophila genes, including lola. These findings represent a novel mechanism of trans-splicing, in which RNA motifs in the 5′ intron are sufficient to bring separate transcripts into close proximity to promote trans-splicing. PMID:25838544

  18. The nucleotide sequence of the equine herpesvirus 4 gC gene homologue.

    PubMed

    Nicolson, L; Onions, D E

    1990-11-01

    The genomic position of an equine herpesvirus 4 (EHV-4) gene homologue of the herpes simplex virus 1 (HSV-1) gC gene was determined by Southern analysis and DNA sequencing. The gene lies within a 2-kbp Bg/II-EcoRI fragment mapping between 0.15 and 0.17 within the long unique component of the EHV-4 genome and is transcribed from right to left. Putative promoter elements were identified upstream of the 1455-bp open reading frame which encodes a 485-amino-acid protein of unglycosylated molecular weight 52,513. Computer-assisted analysis of the primary sequence predicts the protein possesses a domain structure characteristic of a type 1 integral membrane glycoprotein. Four domains were distinguished--(i) an N-terminal signal sequence, (ii) a large extracellular domain containing 11 putative N-linked glycosylation sites, (iii) a hydrophobic transmembrane domain, and (iv) a C-terminal charged domain. Comparison of the predicted amino acid sequence to that of other herpesvirus glycoproteins indicated identities of between 22 and 29% with HSV-1 gC, HSV-2 gC, VZV gpV, PRV gIII, BHV-1 gIII, and MDV A antigen and of 79% with EHV-1 gp13. A gene with no apparent homologue in HSV-1 or VZV maps immediately downstream of the EHV-4 gC gene homologue. PMID:2171212

  19. [Cloning and regulation of pig estrogen related receptor β gene (ESRRB) promoter].

    PubMed

    Yang, Yang; Wang, Yaxian; Du, Lixia; Wang, Huayan

    2015-04-01

    The estrogen related receptor family member Esrrb (Estrogen related receptor β) is a gene that expresses in the early stage of embryo and plays an important role in the core pluripotent network. Its function has been analyzed in human and mouse, although no report so far related to pig. Therefore, to explore its mechanism of transcriptional regulation and expression pattern, we cloned a 3.3 kb pig ESRRB promoter by PCR and constructed the green fluorescence protein (GFP) reporter vector pE3.3. We used these vectors to study the ESRRB expression pattern in 293T, Hela and C2C12. Sequence was analyzed for regulatory elements that share homology to known transcription factor binding sites by TFSEARCH and JASPER program. Some pluripotency related genes such as SMAD, STAT3, MYC, KLF4 and ESRRB have been found within the 3.3 kb sequence by co-transfected pig ESRRB promoter and these potential regulators. We found that ESRRB only expressed in 293T and SMAD could activate ESRRB expression obviously. To determine the core promoter region, a series of ESRRB promoter fragments with gradually truncated 5'-end were produced by PCR and inserted into pGL3-Basic vector. After transient transfection into 293T, dual luciferase assay was used to measure these promoter activities. The result suggested that the core promoter of pig ESRRB located within -25 bp to -269 bp region. These results suggest that these transcription factor binding sites and the core promoter region may be essential for transcriptional regulation of pig ESRRB gene. PMID:26380406

  20. Dinoflagellate 17S rRNA sequence inferred from the gene sequence: Evolutionary implications.

    PubMed

    Herzog, M; Maroteaux, L

    1986-11-01

    We present the complete sequence of the nuclear-encoded small-ribosomal-subunit RNA inferred from the cloned gene sequence of the dinoflagellate Prorocentrum micans. The dinoflagellate 17S rRNA sequence of 1798 nucleotides is contained in a family of 200 tandemly repeated genes per haploid genome. A tentative model of the secondary structure of P. micans 17S rRNA is presented. This sequence is compared with the small-ribosomal-subunit rRNA of Xenopus laevis (Animalia), Saccharomyces cerevisiae (Fungi), Zea mays (Planta), Dictyostelium discoideum (Protoctista), and Halobacterium volcanii (Monera). Although the secondary structure of the dinoflagellate 17S rRNA presents most of the eukaryotic characteristics, it contains sufficient archaeobacterial-like structural features to reinforce the view that dinoflagellates branch off very early from the eukaryotic lineage.

  1. Dinoflagellate 17S rRNA sequence inferred from the gene sequence: Evolutionary implications

    PubMed Central

    Herzog, Michel; Maroteaux, Luc

    1986-01-01

    We present the complete sequence of the nuclear-encoded small-ribosomal-subunit RNA inferred from the cloned gene sequence of the dinoflagellate Prorocentrum micans. The dinoflagellate 17S rRNA sequence of 1798 nucleotides is contained in a family of 200 tandemly repeated genes per haploid genome. A tentative model of the secondary structure of P. micans 17S rRNA is presented. This sequence is compared with the small-ribosomal-subunit rRNA of Xenopus laevis (Animalia), Saccharomyces cerevisiae (Fungi), Zea mays (Planta), Dictyostelium discoideum (Protoctista), and Halobacterium volcanii (Monera). Although the secondary structure of the dinoflagellate 17S rRNA presents most of the eukaryotic characteristics, it contains sufficient archaeobacterial-like structural features to reinforce the view that dinoflagellates branch off very early from the eukaryotic lineage. PMID:16578795

  2. Dinoflagellate 17S rRNA sequence inferred from the gene sequence: Evolutionary implications.

    PubMed

    Herzog, M; Maroteaux, L

    1986-11-01

    We present the complete sequence of the nuclear-encoded small-ribosomal-subunit RNA inferred from the cloned gene sequence of the dinoflagellate Prorocentrum micans. The dinoflagellate 17S rRNA sequence of 1798 nucleotides is contained in a family of 200 tandemly repeated genes per haploid genome. A tentative model of the secondary structure of P. micans 17S rRNA is presented. This sequence is compared with the small-ribosomal-subunit rRNA of Xenopus laevis (Animalia), Saccharomyces cerevisiae (Fungi), Zea mays (Planta), Dictyostelium discoideum (Protoctista), and Halobacterium volcanii (Monera). Although the secondary structure of the dinoflagellate 17S rRNA presents most of the eukaryotic characteristics, it contains sufficient archaeobacterial-like structural features to reinforce the view that dinoflagellates branch off very early from the eukaryotic lineage. PMID:16578795

  3. Chymotrypsin protease inhibitor gene family in rice: Genomic organization and evidence for the presence of a bidirectional promoter shared between two chymotrypsin protease inhibitor genes.

    PubMed

    Singh, Amanjot; Sahi, Chandan; Grover, Anil

    2009-01-01

    Protease inhibitors play important roles in stress and developmental responses of plants. Rice genome contains 17 putative members in chymotrypsin protease inhibitor (ranging in size from 7.21 to 11.9 kDa) gene family with different predicted localization sites. Full-length cDNA encoding for a putative subtilisin-chymotrypsin protease inhibitor (OCPI2) was obtained from Pusa basmati 1 (indica) rice seedlings. 620 bp-long OCPI2 cDNA contained 219 bp-long ORF, coding for 72 amino acid-long 7.7 kDa subtilisin-chymotrypsin protease inhibitor (CPI) cytoplasmic protein. Expression analysis by semi-quantitative RT-PCR analysis showed that OCPI2 transcript is induced by varied stresses including salt, ABA, low temperature and mechanical injury in both root and shoot tissues of the seedlings. Transgenic rice plants produced with OCPI2 promoter-gus reporter gene showed that this promoter directs high salt- and ABA-regulated expression of the GUS gene. Another CPI gene (OCPI1) upstream to OCPI2 (with 1126 bp distance between the transcription initiation sites of the two genes; transcription in the reverse orientation) was noted in genome sequence of rice genome. A vector that had GFP and GUS reporter genes in opposite orientations driven by 1881 bp intergenic sequence between the OCPI2 and OCPI1 (encompassing the region between the translation initiation sites of the two genes) was constructed and shot in onion epidermal cells by particle bombardment. Expression of both GFP and GUS from the same epidermal cell showed that this sequence represents a bidirectional promoter. Examples illustrating gene pairs showing co-expression of two divergent neighboring genes sharing a bidirectional promoter have recently been extensively worked out in yeast and human systems. We provide an example of a gene pair constituted of two homologous genes showing co-expression governed by a bidirectional promoter in rice. PMID:18952157

  4. Repression of the Drosophila proliferating-cell nuclear antigen gene promoter by zerknuellt protein

    SciTech Connect

    Yamaguchi, Masamitsu; Hirose, Fumiko; Nishida, Yasuyoshi; Matsukage, Akio )

    1991-10-01

    A 631-bp fragment containing the 5{prime}-flanking region of the Drosophila melanogaster proliferating-cell nuclear antigen (PCNA) gene was placed upstream of the chloramphenicol acetyltransferase (CAT) gene of a CAT vector. A transient expression assay of CAT activity in Drosophila Kc cells transfected with this plasmid and a set of 5{prime}-deletion derivatives revealed that the promoter function resided within a 192-bp region. Cotransfection with a zerknuellt (zen)-expressing plasmid specifically repressed CAT expression. However, cotransfection with expression plasmids for a nonfunctional zen mutation, even skipped, or bicoid showed no significant effect on CAT expression. RNase protection analysis revealed that the repression by zen was at the transcription step. The target sequence of zen was mapped within the 34-bp region of the PCNA gene promoter, even though it lacked zen protein-binding sites. Transgenic flies carrying the PCNA gene regulatory region fused with lacZ were established. These results indicate that zen indirectly represses PCNA gene expression, probably by regulating the expression of some transcription factor(s) that binds to the PCNA gene promoter.

  5. Perylene and coronene derivatives binding to G-rich promoter oncogene sequences efficiently reduce their expression in cancer cells.

    PubMed

    Micheli, Emanuela; Altieri, Alessandro; Cianni, Lorenzo; Cingolani, Chiara; Iachettini, Sara; Bianco, Armandodoriano; Leonetti, Carlo; Cacchione, Stefano; Biroccio, Annamaria; Franceschin, Marco; Rizzo, Angela

    2016-06-01

    A novel approach to cancer therapeutics is emerging in the field of G-quadruplex (G4) ligands, small molecules designed to stabilize four-stranded structures that can form at telomeres as well as in other genomic sequences, including oncogene promoter sequences, 5'-UTR regions and introns. In this study, we investigated the binding activity of perylene and coronene derivatives PPL3C, CORON and EMICORON to G4 structures formed within the promoter regions of two important cancer-related genes, c-MYC and BCL-2, and their biochemical effects on gene and protein expression. In order to fully characterize the ability of the selected ligands to bind and stabilize the G4 structures originated by the c-MYC and BCL-2 promoter sequences, we performed electrospray ionization mass spectrometry (ESI-MS), Fluorescence Resonance Energy Transfer (FRET) measurements, Circular Dichroism (CD) spectra and polymerase stop assay. Altogether our results showed that the ligands had a high capacity in binding and stabilizing the G4 structures within the c-MYC and BCL-2 promoter sequences in vitro. Notably, when we evaluated by quantitative real-time PCR and western blotting analysis, the effects of treatment with the different G4 ligands on c-MYC and BCL2 expression in a human melanoma cell line, EMICORON appeared the most effective compound in reducing the mRNA and protein levels of both genes. These results encourage to consider EMICORON as a promising example of multimodal class of an antineoplastic drug, affecting different tumor crucial pathways simultaneously: telomere maintenance (as previously described), cell proliferation and apoptosis via down-regulation of both c-MYC and BCL-2 (this paper).

  6. Repressive BMP2 gene regulatory elements near the BMP2 promoter

    SciTech Connect

    Jiang, Shan; Chandler, Ronald L.; Fritz, David T.; Mortlock, Douglas P.; Rogers, Melissa B.

    2010-02-05

    The level of bone morphogenetic protein 2 (BMP2) profoundly influences essential cell behaviors such as proliferation, differentiation, apoptosis, and migration. The spatial and temporal pattern of BMP2 synthesis, particular in diverse embryonic cells, is highly varied and dynamic. We have identified GC-rich sequences within the BMP2 promoter region that strongly repress gene expression. These elements block the activity of a highly conserved, osteoblast enhancer in response to FGF2 treatment. Both positive and negative gene regulatory elements control BMP2 synthesis. Detecting and mapping the repressive motifs is essential because they impede the identification of developmentally regulated enhancers necessary for normal BMP2 patterns and concentration.

  7. Analysis of tissue-specific region in sericin 1 gene promoter of Bombyx mori

    SciTech Connect

    Liu Yan; Yu Lian; Guo Xiuyang; Guo Tingqing; Wang Shengpeng; Lu Changde . E-mail: cdlu@sibs.ac.cn

    2006-03-31

    The gene encoding sericin 1 (Ser1) of silkworm (Bombyx mori) is specifically expressed in the middle silk gland cells. To identify element involved in this transcription-dependent spatial restriction, truncation of the 5' terminal from the sericin 1 (Ser1) promoter is studied in vivo. A 209 bp DNA sequence upstream of the transcriptional start site (-586 to -378) is found to be responsible for promoting tissue-specific transcription. Analysis of this 209 bp region by overlapping deletion studies showed that a 25 bp region (-500 to -476) suppresses the ectopic expression of the Ser1 promoter. An unknown factor abundant in fat body nuclear extracts is shown to bind to this 25 bp fragment. These results suggest that this 25 bp region and the unknown factor are necessary for determining the tissue-specificity of the Ser1 promoter.

  8. Design of a zinc finger protein binding a sequence upstream of the A20 gene

    PubMed Central

    Wei, Yong; Ying, Dajun; Hou, Chunli; Cui, Xiaoping; Zhu, Chuhong

    2008-01-01

    Background Artificial transcription factors (ATFs) are composed of DNA-binding and functional domains. These domains can be fused together to create proteins that can bind a chosen DNA sequence. To construct a valid ATF, it is necessary to design suitable DNA-binding and functional domains. The Cys2-His2 zinc finger motif is the ideal structural scaffold on which to construct a sequence-specific protein. A20 is a cytoplasmic zinc finger protein that inhibits nuclear factor kappa-B activity and tumor necrosis factor (TNF)-mediated programmed cell death. A20 has been shown to prevent TNF-induced cytotoxicity in a variety of cell types including fibroblasts, B lymphocytes, WEHI 164 cells, NIH 3T3 cells and endothelial cells. Results In order to design a zinc finger protein (ZFP) structural domain that binds specific target sequences in the A20 gene promoter region, the structure and sequence composition of this promoter were analyzed by bioinformatics methods. The target sequences in the A20 promoter were submitted to the on-line ZF Tools server of the Barbas Laboratory, Scripps Research Institute (TSRI), to obtain a specific 18 bp target sequence and also the amino acid sequence of a ZFP that would bind to it. Sequence characterization and structural modeling of the predicted ZFP were performed by bioinformatics methods. The optimized DNA sequence of this artificial ZFP was recombined into the eukaryotic expression vector pIRES2-EGFP to construct pIRES2-EGFP/ZFP-flag recombinants, and the expression and biological activity of the ZFP were analyzed by RT-PCR, western blotting and EMSA, respectively. The ZFP was designed successfully and exhibited biological activity. Conclusion It is feasible to design specific zinc finger proteins by bioinformatics methods. PMID:18366681

  9. Nucleotide sequence and structural organization of the human vasopressin pituitary receptor (V3) gene.

    PubMed

    René, P; Lenne, F; Ventura, M A; Bertagna, X; de Keyzer, Y

    2000-01-01

    In the pituitary, vasopressin triggers ACTH release through a specific receptor subtype, termed V3 or V1b. We cloned the V3 cDNA and showed that its expression was almost exclusive to pituitary corticotrophs and some corticotroph tumors. To study the determinants of this tissue specificity, we have now cloned the gene for the human (h) V3 receptor and characterized its structure. It is composed of two exons, spanning 10kb, with the coding region interrupted between transmembrane domains 6 and 7. We established that the transcription initiation site is located 498 nucleotides upstream of the initiator codon and showed that two polyadenylation sites may be used, while the most frequent is the most downstream. Sequence analysis of the promoter region showed no TATA box but identified consensus binding motifs for Sp1, CREB, and half sites of the estrogen receptor binding site. However comparison with another corticotroph-specific gene, proopiomelanocortin, did not identify common regulatory elements in the two promoters except for a short GC-rich region. Unexpectedly, hV3 gene analysis revealed that a formerly cloned 'artifactual' hV3 cDNA indeed corresponded to a spliced antisense transcript, overlapping the 5' part of the coding sequence in exon 1 and the promoter region. This transcript, hV3rev, was detected in normal pituitary and in many corticotroph tumors expressing hV3 sense mRNA and may therefore play a role in hV3 gene expression.

  10. Conditional promoters for analysis of essential genes in Zymoseptoria tritici.

    PubMed

    Kilaru, S; Ma, W; Schuster, M; Courbot, M; Steinberg, G

    2015-06-01

    Development of new fungicides, needed for sustainable control of fungal plant pathogens, requires identification of novel anti-fungal targets. Essential fungal-specific proteins are good candidates, but due to their importance, gene deletion mutants are not viable. Consequently, their cellular role often remains elusive. This hindrance can be overcome by the use of conditional mutants, where expression is controlled by an inducible/repressible promoter. Here, we introduce 5 inducible/repressible promoter systems to study essential genes in the wheat pathogen Zymoseptoria tritici. We fused the gene for enhanced green-fluorescent protein (egfp) to the promoter region of Z. tritici nitrate reductase (Pnar1; induced by nitrogen and repressed by ammonium), 1,4-β-endoxylanase A (Pex1A; induced by xylose and repressed by maltodextrin), l-arabinofuranosidase B (PlaraB; induced by arabinose and repressed by glucose), galactose-1-phosphate uridylyltransferase 7 (Pgal7; induced by galactose and repressed by glucose) and isocitrate lyase (Picl1; induced by sodium acetate and repressed by glucose). This was followed by quantitative analysis of cytoplasmic reporter fluorescence under induced and repressed conditions. We show that Pnar1, PlaraB and Pex1A drive very little or no egfp expression when repressed, but induce moderate protein production when induced. In contrast, Pgal7 and Picl1 show considerable egfp expression when repressed, and were strongly induced in the presence of their inducers. Normalising the expression levels of all promoters to that of the α-tubulin promoter Ptub2 revealed that PlaraB was the weakest promoter (∼20% of Ptub2), whereas Picl1 strongly expressed the reporter (∼250% of Ptub2). The use of these tools promises a better understanding of essential genes, which will help developing novel control strategies that protect wheat from Z. tritici. PMID:26092803

  11. Cloning and Functional Analysis of the Promoter of an Ascorbate Oxidase Gene from Gossypium hirsutum.

    PubMed

    Xin, Shan; Tao, Chengcheng; Li, Hongbin

    2016-01-01

    Apoplastic ascorbate oxidase (AO) plays significant roles in plant cell growth. However, the mechanism of underlying the transcriptional regulation of AO in Gossypium hirsutum remains unclear. Here, we obtained a 1,920-bp promoter sequence from the Gossypium hirsutum ascorbate oxidase (GhAO1) gene, and this GhAO1 promoter included a number of known cis-elements. Promoter activity analysis in overexpressing pGhAO1::GFP-GUS tobacco (Nicotiana benthamiana) showed that the GhAO1 promoter exhibited high activity, driving strong reporter gene expression in tobacco trichomes, leaves and roots. Promoter 5'-deletion analysis demonstrated that truncated GhAO1 promoters with serial 5'-end deletions had different GUS activities. A 360-bp fragment was sufficient to activate GUS expression. The P-1040 region had less GUS activity than the P-720 region, suggesting that the 320-bp region from nucleotide -720 to -1040 might include a cis-element acting as a silencer. Interestingly, an auxin-responsive cis-acting element (TGA-element) was uncovered in the promoter. To analyze the function of the TGA-element, tobacco leaves transformed with promoters with different 5' truncations were treated with indole-3-acetic acid (IAA). Tobacco leaves transformed with the promoter regions containing the TGA-element showed significantly increased GUS activity after IAA treatment, implying that the fragment spanning nucleotides -1760 to -1600 (which includes the TGA-element) might be a key component for IAA responsiveness. Analyses of the AO promoter region and AO expression pattern in Gossypium arboreum (Ga, diploid cotton with an AA genome), Gossypium raimondii (Gr, diploid cotton with a DD genome) and Gossypium hirsutum (Gh, tetraploid cotton with an AADD genome) indicated that AO promoter activation and AO transcription were detected together only in D genome/sub-genome (Gr and Gh) cotton. Taken together, these results suggest that the 1,920-bp GhAO1 promoter is a functional sequence with a

  12. Cloning and Functional Analysis of the Promoter of an Ascorbate Oxidase Gene from Gossypium hirsutum

    PubMed Central

    Xin, Shan; Tao, Chengcheng; Li, Hongbin

    2016-01-01

    Apoplastic ascorbate oxidase (AO) plays significant roles in plant cell growth. However, the mechanism of underlying the transcriptional regulation of AO in Gossypium hirsutum remains unclear. Here, we obtained a 1,920-bp promoter sequence from the Gossypium hirsutum ascorbate oxidase (GhAO1) gene, and this GhAO1 promoter included a number of known cis-elements. Promoter activity analysis in overexpressing pGhAO1::GFP-GUS tobacco (Nicotiana benthamiana) showed that the GhAO1 promoter exhibited high activity, driving strong reporter gene expression in tobacco trichomes, leaves and roots. Promoter 5’-deletion analysis demonstrated that truncated GhAO1 promoters with serial 5’-end deletions had different GUS activities. A 360-bp fragment was sufficient to activate GUS expression. The P-1040 region had less GUS activity than the P-720 region, suggesting that the 320-bp region from nucleotide -720 to -1040 might include a cis-element acting as a silencer. Interestingly, an auxin-responsive cis-acting element (TGA-element) was uncovered in the promoter. To analyze the function of the TGA-element, tobacco leaves transformed with promoters with different 5’ truncations were treated with indole-3-acetic acid (IAA). Tobacco leaves transformed with the promoter regions containing the TGA-element showed significantly increased GUS activity after IAA treatment, implying that the fragment spanning nucleotides -1760 to -1600 (which includes the TGA-element) might be a key component for IAA responsiveness. Analyses of the AO promoter region and AO expression pattern in Gossypium arboreum (Ga, diploid cotton with an AA genome), Gossypium raimondii (Gr, diploid cotton with a DD genome) and Gossypium hirsutum (Gh, tetraploid cotton with an AADD genome) indicated that AO promoter activation and AO transcription were detected together only in D genome/sub-genome (Gr and Gh) cotton. Taken together, these results suggest that the 1,920-bp GhAO1 promoter is a functional sequence

  13. Cloning and functional analysis of human acyl coenzyme A: Cholesterol acyltransferase1 gene P1 promoter.

    PubMed

    Ge, Jing; Cheng, Bei; Qi, Benling; Peng, Wen; Wen, Hui; Bai, Lijuan; Liu, Yun; Zhai, Wei

    2016-07-01

    Acyl-coenzyme A: cholesterol acyltransferase 1 (ACAT1) catalyzes the conversion of free cholesterol (FC) to cholesterol ester. The human ACAT1 gene P1 promoter has been cloned. However, the activity and specificity of the ACAT1 gene P1 promoter in diverse cell types remains unclear. The P1 promoter fragment was digested with KpnI/XhoI from a P1 promoter cloning vector, and was subcloned into the multiple cloning site of the Firefly luciferase vector pGL3‑Enhancer to obtain the construct P1E‑1. According to the analysis of biological information, the P1E‑1 plasmid was used to generate deletions of the ACAT1 gene P1 promoter with varying 5' ends and an identical 3' end at +65 by polymerase chain reaction (PCR). All the 5'‑deletion constructs of the P1 promoter were identified by PCR, restriction enzyme digestion mapping and DNA sequencing. The transcriptional activity of each construct was detected after transient transfection into THP‑1, HepG2, HEK293 and Hela cells using DEAE‑dextran and Lipofectamine 2000 liposome transfection reagent. Results showed that the transcriptional activity of the ACAT1 gene P1 promoter and deletions of P1 promoter in THP‑1 and HepG2 cells was higher than that in HEK293 and HeLa cells. Moreover, the transcriptional activity of P1E‑9 was higher compared with those of other deletions in THP‑1, HepG2, HEK293 and HeLa cells. These findings indicate that the transcriptional activity of the P1 promoter and the effects of deletions vary with different cell lines. Thus, the P1 promoter may drive ACAT1 gene expression with cell‑type specificity. In addition, the core sequence of ACAT1 gene P1 promoter was suggested to be between -125 and +65 bp. PMID:27220725

  14. The structure and complete nucleotide sequence of the human cyclophilin 40 (PPID) gene

    SciTech Connect

    Yokoi, Haruhiko; Shimizu, Yukiko; Anazawa, Hideharu

    1996-08-01

    Cyclophilin 40 is a recently identified member of the cyclophilin family that is found in an unactivated steroid hormone receptor complex. Cyclophilin 40 possesses a region homologous to FKBP59, a member of the FK506-binding protein family that is also a component of the receptor complex. We report the isolation and sequencing of the entire human cyclophilin 40 (hCyP40) gene (human gene symbol PPID). The gene contains 10 exons (43 to 698 bp) and 9 introns encompassing 14.2 kb. The exon organization of the cyclophilin-like region is not similar to that of the human cyclophilin A gene (PPIA), suggesting their early divergence in evolution. Determination of the sequence of the 5{prime} end of the hCyP40 mRNA by an {open_quotes}anchor-ligation PCR{close_quotes} procedure showed that transcription is initiated from a cluster of sites about 80 bp upstream from the first in-frame ATG. The immediate 5{prime}-flanking region of the gene lacks typical TATA and CAAT boxes, but is GC-rich and contains Sp1 sites, features characteristic of promoters associated with housekeeping genes. The hCyP40 gene was mapped to chromosome 4 by PCR with genomic DNA from somatic cell hybrids. As shown by {open_quotes}Zoo blot{close_quotes} analysis, the cylophilin 40 gene appears to be highly conserved throughout evolution. 47 refs., 4 figs., 1 tab.

  15. Sequence evolution and expression regulation of stress-responsive genes in natural populations of wild tomato.

    PubMed

    Fischer, Iris; Steige, Kim A; Stephan, Wolfgang; Mboup, Mamadou

    2013-01-01

    The wild tomato species Solanum chilense and S. peruvianum are a valuable non-model system for studying plant adaptation since they grow in diverse environments facing many abiotic constraints. Here we investigate the sequence evolution of regulatory regions of drought and cold responsive genes and their expression regulation. The coding regions of these genes were previously shown to exhibit signatures of positive selection. Expression profiles and sequence evolution of regulatory regions of members of the Asr (ABA/water stress/ripening induced) gene family and the dehydrin gene pLC30-15 were analyzed in wild tomato populations from contrasting environments. For S. chilense, we found that Asr4 and pLC30-15 appear to respond much faster to drought conditions in accessions from very dry environments than accessions from more mesic locations. Sequence analysis suggests that the promoter of Asr2 and the downstream region of pLC30-15 are under positive selection in some local populations of S. chilense. By investigating gene expression differences at the population level we provide further support of our previous conclusions that Asr2, Asr4, and pLC30-15 are promising candidates for functional studies of adaptation. Our analysis also demonstrates the power of the candidate gene approach in evolutionary biology research and highlights the importance of wild Solanum species as a genetic resource for their cultivated relatives.

  16. Spliced synthetic genes as internal controls in RNA sequencing experiments.

    PubMed

    Hardwick, Simon A; Chen, Wendy Y; Wong, Ted; Deveson, Ira W; Blackburn, James; Andersen, Stacey B; Nielsen, Lars K; Mattick, John S; Mercer, Tim R

    2016-09-01

    RNA sequencing (RNA-seq) can be used to assemble spliced isoforms, quantify expressed genes and provide a global profile of the transcriptome. However, the size and diversity of the transcriptome, the wide dynamic range in gene expression and inherent technical biases confound RNA-seq analysis. We have developed a set of spike-in RNA standards, termed 'sequins' (sequencing spike-ins), that represent full-length spliced mRNA isoforms. Sequins have an entirely artificial sequence with no homology to natural reference genomes, but they align to gene loci encoded on an artificial in silico chromosome. The combination of multiple sequins across a range of concentrations emulates alternative splicing and differential gene expression, and it provides scaling factors for normalization between samples. We demonstrate the use of sequins in RNA-seq experiments to measure sample-specific biases and determine the limits of reliable transcript assembly and quantification in accompanying human RNA samples. In addition, we have designed a complementary set of sequins that represent fusion genes arising from rearrangements of the in silico chromosome to aid in cancer diagnosis. RNA sequins provide a qualitative and quantitative reference with which to navigate the complexity of the human transcriptome. PMID:27502218

  17. Sequence Validation of Candidates for Selectively Important Genes in Sunflower

    PubMed Central

    Chapman, Mark A.; Mandel, Jennifer R.; Burke, John M.

    2013-01-01

    Analyses aimed at identifying genes that have been targeted by past selection provide a powerful means for investigating the molecular basis of adaptive differentiation. In the case of crop plants, such studies have the potential to not only shed light on important evolutionary processes, but also to identify genes of agronomic interest. In this study, we test for evidence of positive selection at the DNA sequence level in a set of candidate genes previously identified in a genome-wide scan for genotypic evidence of selection during the evolution of cultivated sunflower. In the majority of cases, we were able to confirm the effects of selection in shaping diversity at these loci. Notably, the genes that were found to be under selection via our sequence-based analyses were devoid of variation in the cultivated sunflower gene pool. This result confirms a possible strategy for streamlining the search for adaptively-important loci process by pre-screening the derived population to identify the strongest candidates before sequencing them in the ancestral population. PMID:23991009

  18. Nucleotide sequence of the vaccinia virus hemagglutinin gene.

    PubMed

    Shida, H

    1986-04-30

    Vaccinia virus hemagglutinin (HA) is expressed at late time of infection cycle, and it is nonessential for virus growth. Location of the HA structural gene was determined by hybrid-arrested and hybrid-selected translation methods at the right terminus of the HindIII A fragment. The position of the HA gene was confirmed by the production of the complete HA protein in the cells transfected with the plasmid containing that region. Examination of this nucleotide sequence revealed the positions of cleavage sites for a number of restriction endonucleases. The deduced amino acid sequence revealed that the HA protein is a member of typical surface membrane glycoproteins. Comparison of the nucleotide sequence upstream of the HA coding region with corresponding region of other late genes suggested the existence of the consensus decanucleotides TTCATTTa/tGT between 34 to 18 bp upstream to the initiation codon followed by a cluster of A or T, a unique feature of the late genes of vaccinia virus. These results in conjunction with the ease of isolating HA- mutants provide a basis for a new site suitable for inserting foreign genes.

  19. Specific interactions between transcription factors and the promoter-regulatory region of the human cytomegalovirus major immediate-early gene

    SciTech Connect

    Ghazal, P.; Lubon, H.; Hennighausen, L. )

    1988-03-01

    Repeat sequence motifs as well as unique sequences between nucleotides {minus}150 and {minus}22 of the human cytomegalovirus immediate-early 1 gene interact in vitro with nuclear proteins. The authors show that a transcriptional element between nucleotides {minus}91 and {minus}65 stimulated promoter activity in vivo and in vitro by binding specific cellular transcription factors. Finally, a common sequence motif, (T)TGG/AC, present in 15 of the determined binding sites suggests a particular class of nuclear factors associated with the immediate-early 1 gene.

  20. Glycoprotein Gene Sequence Variation in Rhesus Monkey Rhadinovirus

    PubMed Central

    Shin, Young C.; Jones, Leandro R.; Manrique, Julieta; Lauer, William; Carville, Angela; Mansfield, Keith G.; Desrosiers, Ronald C.

    2010-01-01

    Gene sequences for seven glycoproteins from 20 independent isolates of rhesus monkey rhadinovirus (RRV) and of the corresponding seven glycoprotein genes from nine strains of the Kaposi’s sarcoma-associated herpesvirus (KSHV) were obtained and analyzed. Phylogenetic analysis revealed two discrete groupings of RRV gH sequences, two discrete groupings of RRV gL sequences and two discrete groupings of RRV gB sequences. We called these phylogenetic groupings gHa, gHb, gLa, gLb, gBa and gBb. gHa was always paired with gLa and gHb was always paired with gLb for any individual RRV isolate. Since gH and gL are known to be interacting partners, these results suggest the need of matching sequence types for function of these cooperating proteins. gB phylogenetic grouping was not associated with gH/gL phylogenetic grouping. Our results demonstrate two distinct, distantly-related phylogenetic groupings of gH and gL of RRV despite a remarkable degree of sequence conservation within each individual phylogenetic group. PMID:20172576

  1. Site-specific methylation of the rat prolactin and growth hormone promoters correlates with gene expression.

    PubMed Central

    Ngô, V; Gourdji, D; Laverrière, J N

    1996-01-01

    The methylation patterns of the rat prolactin (rPRL) (positions -440 to -20) and growth hormone (rGH) (positions -360 to -110) promoters were analyzed by bisulfite genomic sequencing. Two normal tissues, the anterior pituitary and the liver, and three rat pituitary GH3 cell lines that differ considerably in their abilities to express both genes were tested. High levels of rPRL gene expression were correlated with hypomethylation of the CpG dinucleotides located at positions -277 and -97, near or within positive cis-acting regulatory elements. For the nine CpG sites analyzed in the rGH promoter, an overall hypomethylation-expression coupling was also observed for the anterior pituitary, the liver, and two of the cell lines. The effect of DNA methylation was tested by measuring the transient expression of the chloramphenicol acetyltransferase reporter gene driven by a regionally methylated rPRL promoter. CpG methylation resulted in a decrease in the activity of the rPRL promoter which was proportional to the number of modified CpG sites. The extent of the inhibition was also found to be dependent on the position of methylated sites. Taken together, these data suggest that site-specific methylation may modulate the action of transcription factors that dictate the tissue-specific expression of the rPRL and rGH genes in vivo. PMID:8668139

  2. Optimizing promoters and secretory signal sequences for producing ethanol from inulin by recombinant Saccharomyces cerevisiae carrying Kluyveromyces marxianus inulinase.

    PubMed

    Hong, Soo-Jeong; Kim, Hyo Jin; Kim, Jin-Woo; Lee, Dae-Hee; Seo, Jin-Ho

    2015-02-01

    Inulin is a polyfructan that is abundant in plants such as Jerusalem artichoke, chicory and dahlia. Inulinase can easily hydrolyze inulin to fructose, which is consumed by microorganisms. Generally, Saccharomyces cerevisiae, an industrial workhorse strain for bioethanol production, is known for not having inulinase activity. The inulinase gene from Kluyveromyces marxianus (KmINU), with the ability of converting inulin to fructose, was introduced into S. cerevisiae D452-2. The inulinase gene was fused to three different types of promoter (GPD, PGK1, truncated HXT7) and secretory signal sequence (KmINU, MFα1, SUC2) to generate nine expression cassettes. The inulin fermentation performance of the nine transformants containing different promoter and signal sequence combinations for inulinase production were compared to select an optimized expression system for efficient inulin fermentation. Among the nine inulinase-producing transformants, the S. cerevisiae carrying the PGK1 promoter and MFα1 signal sequence (S. cerevisiae D452-2/p426PM) showed not only the highest specific KmINU activity, but also the best inulin fermentation capability. Finally, a batch fermentation of the selected S. cerevisiae D452-2/p426PM in a bioreactor with 188.2 g/L inulin was performed to produce 80.2 g/L ethanol with 0.43 g ethanol/g inulin of ethanol yield and 1.22 g/L h of ethanol productivity.

  3. Optimizing promoters and secretory signal sequences for producing ethanol from inulin by recombinant Saccharomyces cerevisiae carrying Kluyveromyces marxianus inulinase.

    PubMed

    Hong, Soo-Jeong; Kim, Hyo Jin; Kim, Jin-Woo; Lee, Dae-Hee; Seo, Jin-Ho

    2015-02-01

    Inulin is a polyfructan that is abundant in plants such as Jerusalem artichoke, chicory and dahlia. Inulinase can easily hydrolyze inulin to fructose, which is consumed by microorganisms. Generally, Saccharomyces cerevisiae, an industrial workhorse strain for bioethanol production, is known for not having inulinase activity. The inulinase gene from Kluyveromyces marxianus (KmINU), with the ability of converting inulin to fructose, was introduced into S. cerevisiae D452-2. The inulinase gene was fused to three different types of promoter (GPD, PGK1, truncated HXT7) and secretory signal sequence (KmINU, MFα1, SUC2) to generate nine expression cassettes. The inulin fermentation performance of the nine transformants containing different promoter and signal sequence combinations for inulinase production were compared to select an optimized expression system for efficient inulin fermentation. Among the nine inulinase-producing transformants, the S. cerevisiae carrying the PGK1 promoter and MFα1 signal sequence (S. cerevisiae D452-2/p426PM) showed not only the highest specific KmINU activity, but also the best inulin fermentation capability. Finally, a batch fermentation of the selected S. cerevisiae D452-2/p426PM in a bioreactor with 188.2 g/L inulin was performed to produce 80.2 g/L ethanol with 0.43 g ethanol/g inulin of ethanol yield and 1.22 g/L h of ethanol productivity. PMID:25142154

  4. Characterisation of a DNA sequence element that directs Dictyostelium stalk cell-specific gene expression.

    PubMed

    Ceccarelli, A; Zhukovskaya, N; Kawata, T; Bozzaro, S; Williams, J

    2000-12-01

    The ecmB gene of Dictyostelium is expressed at culmination both in the prestalk cells that enter the stalk tube and in ancillary stalk cell structures such as the basal disc. Stalk tube-specific expression is regulated by sequence elements within the cap-site proximal part of the promoter, the stalk tube (ST) promoter region. Dd-STATa, a member of the STAT transcription factor family, binds to elements present in the ST promoter-region and represses transcription prior to entry into the stalk tube. We have characterised an activatory DNA sequence element, that lies distal to the repressor elements and that is both necessary and sufficient for expression within the stalk tube. We have mapped this activator to a 28 nucleotide region (the 28-mer) within which we have identified a GA-containing sequence element that is required for efficient gene transcription. The Dd-STATa protein binds to the 28-mer in an in vitro binding assay, and binding is dependent upon the GA-containing sequence. However, the ecmB gene is expressed in a Dd-STATa null mutant, therefore Dd-STATa cannot be responsible for activating the 28-mer in vivo. Instead, we identified a distinct 28-mer binding activity in nuclear extracts from the Dd-STATa null mutant, the activity of this GA binding activity being largely masked in wild type extracts by the high affinity binding of the Dd-STATa protein. We suggest, that in addition to the long range repression exerted by binding to the two known repressor sites, Dd-STATa inhibits transcription by direct competition with this putative activator for binding to the GA sequence.

  5. Polymorphic core promoter GA-repeats alter gene expression of the early embryonic developmental genes.

    PubMed

    Valipour, E; Kowsari, A; Bayat, H; Banan, M; Kazeminasab, S; Mohammadparast, S; Ohadi, M

    2013-12-01

    Protein complexes that bind to 'GAGA' DNA elements are necessary to replace nucleosomes to create a local chromatin environment that facilitates a variety of site-specific regulatory responses. Three to four elements are required for the disruption of a preassembled nucleosome. We have previously identified human protein-coding gene core promoters that are composed of exceptionally long GA-repeats. The functional implication of those GA-repeats is beginning to emerge in the core promoter of the human SOX5 gene, which is involved in multiple developmental processes. In the current study, we analyze the functional implication of GA-repeats in the core promoter of two additional genes, MECOM and GABRA3, whose expression is largely limited to embryogenesis. We report a significant difference in gene expression as a result of different alleles across those core promoters in the HEK-293 cell line. Across-species homology check for the GABRA3 GA-repeats revealed that those repeats are evolutionary conserved in mouse and primates (p<1 × 10(-8)). The MECOM core promoter GA-repeats are also conserved in numerous species, of which human has the longest repeat and complexity. We propose a novel role for GA-repeat core promoters to regulate gene expression in the genes involved in development and evolution.

  6. Simultaneous gene inactivation and promoter reporting in cyanobacteria.

    PubMed

    Chen, Kangming; Xu, Xinyi; Gu, Liping; Hildreth, Michael; Zhou, Ruanbao

    2015-02-01

    homolog, and a previously unknown function of gene all2508. Thus, gene expression and phenotypic analysis of mutants can be achieved simultaneously by targeted gene inactivation using the pZR606-based system. This combined approach for targeted gene inactivation and its promoter reporting with GFP may be broadly applicable to the study of gene function in other prokaryotic organisms. PMID:25434810

  7. Promoter DNA Hypermethylation and Gene Repression in Undifferentiated Arabidopsis Cells

    PubMed Central

    Berdasco, María; Alcázar, Rubén; García-Ortiz, María Victoria; Ballestar, Esteban; Fernández, Agustín F.; Roldán-Arjona, Teresa; Tiburcio, Antonio F.; Altabella, Teresa; Buisine, Nicolas; Quesneville, Hadi; Baudry, Antoine; Lepiniec, Loïc; Alaminos, Miguel; Rodríguez, Roberto; Lloyd, Alan; Colot, Vincent; Bender, Judith; Canal, María Jesús; Esteller, Manel; Fraga, Mario F.

    2008-01-01

    Maintaining and acquiring the pluripotent cell state in plants is critical to tissue regeneration and vegetative multiplication. Histone-based epigenetic mechanisms are important for regulating this undifferentiated state. Here we report the use of genetic and pharmacological experimental approaches to show that Arabidopsis cell suspensions and calluses specifically repress some genes as a result of promoter DNA hypermethylation. We found that promoters of the MAPK12, GSTU10 and BXL1 genes become hypermethylated in callus cells and that hypermethylation also affects the TTG1, GSTF5, SUVH8, fimbrin and CCD7 genes in cell suspensions. Promoter hypermethylation in undifferentiated cells was associated with histone hypoacetylation and primarily occurred at CpG sites. Accordingly, we found that the process specifically depends on MET1 and DRM2 methyltransferases, as demonstrated with DNA methyltransferase mutants. Our results suggest that promoter DNA methylation may be another important epigenetic mechanism for the establishment and/or maintenance of the undifferentiated state in plant cells. PMID:18827894

  8. Tissue-specific regulation of the mouse Pkhd1 (ARPKD) gene promoter

    PubMed Central

    Williams, Scott S.; Cobo-Stark, Patricia; Hajarnis, Sachin; Aboudehen, Karam; Shao, Xinli; Richardson, James A.; Patel, Vishal

    2014-01-01

    Autosomal recessive polycystic kidney disease, an inherited disorder characterized by the formation of cysts in renal collecting ducts and biliary dysgenesis, is caused by mutations of the polycystic kidney and hepatic disease 1 (PKHD1) gene. Expression of PKHD1 is tissue specific and developmentally regulated. Here, we show that a 2.0-kb genomic fragment containing the proximal promoter of mouse Pkhd1 directs tissue-specific expression of a lacZ reporter gene in transgenic mice. LacZ is expressed in renal collecting ducts beginning during embryonic development but is not expressed in extrarenal tissues. The Pkhd1 promoter contains a binding site for the transcription factor hepatocyte nuclear factor (HNF)-1β, which is required for activity in transfected cells. Mutation of the HNF-1β-binding site abolishes the expression of the lacZ reporter gene in renal collecting ducts. Transgenes containing the 2.0-kb promoter and 2.7 kb of additional genomic sequence extending downstream to the second exon are expressed in the kidney, intrahepatic bile ducts, and male reproductive tract. This pattern overlaps with the endogenous expression of Pkhd1 and coincides with sites of expression of HNF-1β. We conclude that the proximal 2.0-kb promoter is sufficient for tissue-specific expression of Pkhd1 in renal collecting ducts in vivo and that HNF-1β is required for Pkhd1 promoter activity in collecting ducts. Additional genomic sequences located from exons 1-2 or elsewhere in the gene locus are required for expression in extrarenal tissues. PMID:24899057

  9. The electron transfer flavoprotein fixABCX gene products from Azospirillum brasilense show a NifA-dependent promoter regulation.

    PubMed

    Sperotto, Raul Antonio; Gross, Jeferson; Vedoy, Cleber; Passaglia, Luciane Maria Pereira; Schrank, Irene Silveira

    2004-10-01

    The complete nucleotide sequence of the A. brasilense fixA, fixB, fixC, and fixX genes is reported here. Sequence similarities between the protein sequences deduced from fixABCX genes and many electron transfer flavoproteins (ETFs) have been noted. Comparison of the amino acid sequences of both subunits of ETF with the A. brasilense fixA and fixB gene products exhibits an identity of 30%. The amino acid sequence of the other two genes, fixC and fixX, revealed similarity with the membrane-bound electron transfer flavoprotein ubiquinone oxidoreductase (ETF-QO). Using site-directed mutagenesis, mutations were introduced in the fixA promoter element of the A. brasilense fixABCX operon and chimeric p fixA-lacZ reporter gene fusions were constructed. The activation of the fixA promoter of A. brasilense is dependent upon the presence of the NifA protein being approximately 7 times less active than the A. brasilense nifH promoter. These results indicate that NifA from Klebsiella pneumoniae activates the fix promoter of A. brasilense and provide further evidence in support of the regulatory model of NifA activation in A. brasilense. Although no specific function has been assigned to the fixABCX gene products they are apparently required for symbiotic nitrogen fixation. An electron-transferring capacity in the nitrogen fixation pathway has been suggested for the fix gene products based on sequence homologies to the ETFs and ETF-QO proteins and by the absence of orthologous electron transfer proteins NifJ and NifF in A. brasilense.

  10. Gene identification in prokaryotic genomes, phages, metagenomes, and EST sequences with GeneMarkS suite.

    PubMed

    Borodovsky, Mark; Lomsadze, Alex

    2014-01-01

    This unit describes how to use several gene-finding programs from the GeneMark line developed for finding protein-coding ORFs in genomic DNA of prokaryotic species, in genomic DNA of eukaryotic species with intronless genes, in genomes of viruses and phages, and in prokaryotic metagenomic sequences, as well as in EST sequences with spliced-out introns. These bioinformatics tools were demonstrated to have state-of-the-art accuracy, and have been frequently used for gene annotation in novel nucleotide sequences. An additional advantage of these sequence-analysis tools is that the problem of algorithm parameterization is solved automatically, with parameters estimated by iterative self-training (unsupervised training). PMID:24510847

  11. Phenotype Sequencing: Identifying the Genes That Cause a Phenotype Directly from Pooled Sequencing of Independent Mutants

    PubMed Central

    Harper, Marc A.; Chen, Zugen; Toy, Traci; Machado, Iara M. P.; Nelson, Stanley F.; Liao, James C.; Lee, Christopher J.

    2011-01-01

    Random mutagenesis and phenotype screening provide a powerful method for dissecting microbial functions, but their results can be laborious to analyze experimentally. Each mutant strain may contain 50–100 random mutations, necessitating extensive functional experiments to determine which one causes the selected phenotype. To solve this problem, we propose a “Phenotype Sequencing” approach in which genes causing the phenotype can be identified directly from sequencing of multiple independent mutants. We developed a new computational analysis method showing that 1. causal genes can be identified with high probability from even a modest number of mutant genomes; 2. costs can be cut many-fold compared with a conventional genome sequencing approach via an optimized strategy of library-pooling (multiple strains per library) and tag-pooling (multiple tagged libraries per sequencing lane). We have performed extensive validation experiments on a set of E. coli mutants with increased isobutanol biofuel tolerance. We generated a range of sequencing experiments varying from 3 to 32 mutant strains, with pooling on 1 to 3 sequencing lanes. Our statistical analysis of these data (4099 mutations from 32 mutant genomes) successfully identified 3 genes (acrB, marC, acrA) that have been independently validated as causing this experimental phenotype. It must be emphasized that our approach reduces mutant sequencing costs enormously. Whereas a conventional genome sequencing experiment would have cost $7,200 in reagents alone, our Phenotype Sequencing design yielded the same information value for only $1200. In fact, our smallest experiments reliably identified acrB and marC at a cost of only $110–$340. PMID:21364744

  12. Cell Cycle–Specified Fluctuation of Nucleosome Occupancy at Gene Promoters

    PubMed Central

    Hogan, Gregory J; Lee, Cheol-Koo; Lieb, Jason D

    2006-01-01

    The packaging of DNA into nucleosomes influences the accessibility of underlying regulatory information. Nucleosome occupancy and positioning are best characterized in the budding yeast Saccharomyces cerevisiae, albeit in asynchronous cell populations or on individual promoters such as PHO5 and GAL1–10. Using FAIRE (formaldehyde-assisted isolation of regulatory elements) and whole-genome microarrays, we examined changes in nucleosome occupancy throughout the mitotic cell cycle in synchronized populations of S. cerevisiae. Perhaps surprisingly, nucleosome occupancy did not exhibit large, global variation between cell cycle phases. However, nucleosome occupancy at the promoters of cell cycle–regulated genes was reduced specifically at the cell cycle phase in which that gene exhibited peak expression, with the notable exception of S-phase genes. We present data that establish FAIRE as a high-throughput method for assaying nucleosome occupancy. For the first time in any system, nucleosome occupancy was mapped genome-wide throughout the cell cycle. Fluctuation of nucleosome occupancy at promoters of most cell cycle–regulated genes provides independent evidence that periodic expression of these genes is controlled mainly at the level of transcription. The promoters of G2/M genes are distinguished from other cell cycle promoters by an unusually low baseline nucleosome occupancy throughout the cell cycle. This observation, coupled with the maintenance throughout the cell cycle of the stereotypic nucleosome occupancy states between coding and non-coding loci, suggests that the largest component of variation in nucleosome occupancy is “hard wired,” perhaps at the level of DNA sequence. PMID:17002501

  13. Chicken ovalbumin upstream promoter transcription factor II regulates renin gene expression.

    PubMed

    Mayer, Sandra; Roeser, Marc; Lachmann, Peter; Ishii, Sumiyashi; Suh, Jae Mi; Harlander, Sabine; Desch, Michael; Brunssen, Coy; Morawietz, Henning; Tsai, Sophia Y; Tsai, Ming-Jer; Hohenstein, Bernd; Hugo, Christian; Todorov, Vladimir T

    2012-07-13

    This study aimed to investigate the possible involvement of the orphan nuclear receptor chicken ovalbumin upstream promoter transcription factor II (COUP-TFII) in the regulation of renin gene expression. COUP-TFII colocalized with renin in the juxtaglomerular cells of the kidney, which are the main source of renin in vivo. Protein-DNA binding studies demonstrated that COUP-TFII binds to an imperfect direct repeat COUP-TFII recognition sequence (termed hereafter proxDR) in the proximal renin promoter. Because cAMP signaling plays a central role in the control of the renin gene expression, we suggested that COUP-TFII may modulate this cAMP effect. Accordingly, knockdown of COUP-TFII in the clonal renin-producing cell lines As4.1 and Calu-6 diminished the stimulation of the renin mRNA expression by cAMP agonists. In addition, the mutation of the proxDR element in renin promoter reporter gene constructs abrogated the inducibility by cAMP. The proxDR sequence was found to be necessary for the function of a proximal renin promoter cAMP-response element (CRE). Knockdown of COUP-TFII or cAMP-binding protein (CREB), which is the archetypal transcription factor binding to CRE, decreased the basal renin gene expression. However, the deficiency of COUP-TFII did not further diminish the renin expression when CREB was knocked down. In agreement with the cell culture studies, mutant mice deficient in COUP-TFII have lower renin expression than their control strain. Altogether our data show that COUP-TFII is involved in the control of renin gene expression.

  14. Matrix metalloproteinase-3 gene promoter polymorphisms: A potential risk factor for pelvic organ prolapse

    PubMed Central

    Karachalios, Charalampos; Bakas, Panagiotis; Kaparos, Georgios; Demeridou, Styliani; Liapis, Ilias; Grigoriadis, Charalampos; Liapis, Aggelos

    2016-01-01

    Pelvic organ prolapse (POP) is a common multifactorial condition. Matrix metalloproteinases (MMPs) are enzymes capable of breaking down various connective tissue elements. Single-nucleotide polymorphisms (SNPs) in regulatory areas of MMP-encoding genes can alter their transcription rate, and therefore the possible effect on pelvic floor supporting structures. The insertion of an adenine (A) base in the promoter of the MMP-3 gene at position −1612/−1617 produces a sequence of six adenines (6A), whereas the other allele has five (5A). The aim of the present study was to investigate the possible association of MMP-3 gene promoter SNPs with the risk of POP. The patient group comprised 80 women with clinically significant POP [Stage II, III or IV; POP quantification (POP-Q) system]. The control group consisted of 80 females without any or important pelvic floor support defects (Stages 0 or I; POP-Q system). All the participants underwent the same preoperative evaluation. SNP detection was determined with whole blood sample DNA analysis by quantitative polymerase chain reaction (PCR) in LightCycler® PCR platforms, using the technique of sequence-specific hybridization probe-binding assays and melting temperature curve analysis. The results showed there was no statistically significant difference between 5A/5A, 5A/6A and 6A/6A MMP-3 gene promoter variants in the two study groups (P=0.4758). Therefore, MMP-3 gene promoter SNPs alone is insufficient to increase the genetic susceptibility to POP development. PMID:27588175

  15. Chicken Ovalbumin Upstream Promoter Transcription Factor II Regulates Renin Gene Expression*

    PubMed Central

    Mayer, Sandra; Roeser, Marc; Lachmann, Peter; Ishii, Sumiyashi; Suh, Jae Mi; Harlander, Sabine; Desch, Michael; Brunssen, Coy; Morawietz, Henning; Tsai, Sophia Y.; Tsai, Ming-Jer; Hohenstein, Bernd; Hugo, Christian; Todorov, Vladimir T.

    2012-01-01

    This study aimed to investigate the possible involvement of the orphan nuclear receptor chicken ovalbumin upstream promoter transcription factor II (COUP-TFII) in the regulation of renin gene expression. COUP-TFII colocalized with renin in the juxtaglomerular cells of the kidney, which are the main source of renin in vivo. Protein-DNA binding studies demonstrated that COUP-TFII binds to an imperfect direct repeat COUP-TFII recognition sequence (termed hereafter proxDR) in the proximal renin promoter. Because cAMP signaling plays a central role in the control of the renin gene expression, we suggested that COUP-TFII may modulate this cAMP effect. Accordingly, knockdown of COUP-TFII in the clonal renin-producing cell lines As4.1 and Calu-6 diminished the stimulation of the renin mRNA expression by cAMP agonists. In addition, the mutation of the proxDR element in renin promoter reporter gene constructs abrogated the inducibility by cAMP. The proxDR sequence was found to be necessary for the function of a proximal renin promoter cAMP-response element (CRE). Knockdown of COUP-TFII or cAMP-binding protein (CREB), which is the archetypal transcription factor binding to CRE, decreased the basal renin gene expression. However, the deficiency of COUP-TFII did not further diminish the renin expression when CREB was knocked down. In agreement with the cell culture studies, mutant mice deficient in COUP-TFII have lower renin expression than their control strain. Altogether our data show that COUP-TFII is involved in the control of renin gene expression. PMID:22645148

  16. Functional molecular analysis of a circadian clock gene timeless promoter from the Drosophilid fly Chymomyza costata.

    PubMed

    Kobelková, Alena; Bajgar, Adam; Dolezel, David

    2010-12-01

    The circadian transcription of the tim gene is tightly regulated by the protein complex dCLK/CYC, which directly interacts with a series of closely spaced E-box and E-box-like elements in the Drosophila timeless promoter. The tim promoter from D. melanogaster has been studied in detail both in tissue cultures and in living flies yet has never been investigated in other species. This article presents a detailed functional analysis of the tim promoter from the drosophilid fly, Chymomyza costata, in Drosophila tissue cultures. A comparison of tim promoters from wt and npd-mutants confirmed that the 1855 bp deletion in the latter removes crucial regulatory cis-elements as well as the minimal promoter, being subsequently responsible for the lack of tim mRNA expression. Deletion and substitution mutations of the wt tim promoter showed that the region containing the canonical E-box, TER-box, and 2 incomplete E-box sequences is essential for CLK/CYC-mediated expression, while the PERR element appears to be a repressor in S2 cells. Furthermore, the expression of the circadian genes timeless, period , vrille, and doubletime was quantified in C. costata adults. Striking differences were found in expression profiles for tim, per, and vri between wild-type and npd-mutant individuals.

  17. Functional redundancy of promoter elements ensures efficient transcription of the human 7SK gene in vivo.

    PubMed

    Boyd, D C; Turner, P C; Watkins, N J; Gerster, T; Murphy, S

    1995-11-10

    Deletion and mutation studies of the human 7SK gene transfected into HeLa cells have identified three functional regions of the promoter corresponding to the TATA box at -25, the proximal sequence element (PSE) between -49 and -65 and the distal sequence element (DSE) between -243 and -210. These elements show sequence homology to equivalent regions in other snRNA genes and are functionally analogous. Unlike the DSEs of many snRNA genes however, the 7SK DSE does not contain a consensus binding site for the transcription factor Oct-1 but rather, contains two non-consensus Oct-1 binding sites that can function independently of one another to enhance transcription. Unusually, the 7SK PSE can retain function even after extensive mutation and removal of the conserved TGACC of the PSE has little effect in the context of the whole promoter. However, the same mutation abolishes transcription in the absence of the DSE suggesting that protein/protein interactions between DSE and PSE binding factors can compensate for a mutant PSE. Mutation of the 7SK TATA box allows snRNA type transcription by RNA polymerase II to occur and this is enhanced by the DSE, indicating that both the DSE and the PSE can also function with pol II. In addition, mutation of the TATA box does not abolish pol III dependent transcription, suggesting that other sequence elements may also play a role in the determination of polymerase specificity. Although the human 7SK gene is transcribed efficiently in Xenopus oocytes, analysis of the 7SK wild-type gene and mutants in Xenopus oocytes gives significantly different results from the analysis in HeLa cells indicating that the recognition of functional elements is not the same in the two systems.

  18. The artificial zinc finger coding gene 'Jazz' binds the utrophin promoter and activates transcription.

    PubMed

    Corbi, N; Libri, V; Fanciulli, M; Tinsley, J M; Davies, K E; Passananti, C

    2000-06-01

    Up-regulation of utrophin gene expression is recognized as a plausible therapeutic approach in the treatment of Duchenne muscular dystrophy (DMD). We have designed and engineered new zinc finger-based transcription factors capable of binding and activating transcription from the promoter of the dystrophin-related gene, utrophin. Using the recognition 'code' that proposes specific rules between zinc finger primary structure and potential DNA binding sites, we engineered a new gene named 'Jazz' that encodes for a three-zinc finger peptide. Jazz belongs to the Cys2-His2 zinc finger type and was engineered to target the nine base pair DNA sequence: 5'-GCT-GCT-GCG-3', present in the promoter region of both the human and mouse utrophin gene. The entire zinc finger alpha-helix region, containing the amino acid positions that are crucial for DNA binding, was specifically chosen on the basis of the contacts more frequently represented in the available list of the 'code'. Here we demonstrate that Jazz protein binds specifically to the double-stranded DNA target, with a dissociation constant of about 32 nM. Band shift and super-shift experiments confirmed the high affinity and specificity of Jazz protein for its DNA target. Moreover, we show that chimeric proteins, named Gal4-Jazz and Sp1-Jazz, are able to drive the transcription of a test gene from the human utrophin promoter.

  19. The combination of a synthetic promoter and a CMV promoter improves foreign gene expression efficiency in myocytes.

    PubMed

    Jianwei, Dai; Qianqian, Zhang; Songcai, Liu; Mingjun, Zhang; Xiaohui, Ren; Linlin, Hao; Qingyan, Jiang; Yongliang, Zhang

    2012-04-15

    Skeletal muscle is becoming an attractive target tissue for gene therapy. Nevertheless, the low level of gene therapeutic expression in this tissue is the major limitation to it becoming an ideal target for gene transfer. The promoter is important element for gene transcription; however, the gene expression efficiencies and specificities of viral promoters and skeletal muscle-specific promotors are in themselves limiting factors. In this study, we established a dual-promoters system in skeletal muscle using a cytomegalovirus (CMV) promoter and a skeletal muscle-specific synthetic promoter. Mouse myoblast cell line C2C12 cells were transfected with the system. We demonstrated that the dual-promoters system could significantly improve exogenous gene expression rate in vitro when compared with a single CMV promoter system and a skeletal muscle-specific synthetic promoter system in C2C12 cell line, by 69.48% and 41.93%, respectively. Next, we evaluated the system efficiency in vivo, the results showed that the dual-promoters system increased gene expression in mice 1.23-fold and 1.60-fold, respectively compared with expression controlled by the two single promoter vectors. Finally, we tested the dual-promoters system in growth hormone-releasing hormone (GHRH) gene therapy, and revealed that when these two promoters co-drove the GHRH gene expression in vivo animal growth was enhanced significantly. All these results indicate that use of the dual-promoter vector was more efficient for gene expression in skeletal muscle tissue than use of the single promoter vectors. These finding could, hopefully, lead to the development of a high efficiency expression system in myocytes and form an ideal approach for gene therapy.

  20. EST sequencing and gene expression profiling of cultivated peanut (Arachis hypogaea L.).

    PubMed

    Bi, Yu-Ping; Liu, Wei; Xia, Han; Su, Lei; Zhao, Chuan-Zhi; Wan, Shu-Bo; Wang, Xing-Jun

    2010-10-01

    Peanut (Arachis hypogaea L.) is one of the most important oil crops in the world. However, biotechnological based improvement of peanut is far behind many other crops. It is critical and urgent to establish the biotechnological platform for peanut germplasm innovation. In this study, a peanut seed cDNA library was constructed to establish the biotechnological platform for peanut germplasm innovation. About 17,000 expressed sequence tags (ESTs) were sequenced and used for further investigation. Among which, 12.5% were annotated as metabolic related and 4.6% encoded transcription or post-transcription factors. ESTs encoding storage protein and enzymes related to protein degradation accounted for 28.8% and formed the largest group of the annotated ESTs. ESTs that encoded stress responsive proteins and pathogen-related proteins accounted for 5.6%. ESTs that encoded unknown proteins or showed no hit in the GenBank nr database accounted for 20.1% and 13.9%, respectively. A total number of 5066 EST sequences were selected to make a cDNA microarray. Expression analysis revealed that these sequences showed diverse expression patterns in peanut seeds, leaves, stems, roots, flowers, and gynophores. We also analyzed the gene expression pattern during seed development. Genes that were upregulated (≥twofold) at 15, 25, 35, and 45 days after pegging (DAP) were found and compared with 70 DAP. The potential value of these genes and their promoters in the peanut gene engineering study is discussed.

  1. Whole dystrophin gene analysis by next-generation sequencing: a comprehensive genetic diagnosis of Duchenne and Becker muscular dystrophy.

    PubMed

    Wang, Yan; Yang, Yao; Liu, Jing; Chen, Xiao-Chun; Liu, Xin; Wang, Chun-Zhi; He, Xi-Yu

    2014-10-01

    Duchenne/Becker muscular dystrophies are the most frequent inherited neuromuscular diseases caused by mutations of the dystrophin gene. However, approximately 30% of patients with the disease do not receive a molecular diagnosis because of the complex mutational spectrum and the large size of the gene. The introduction and use of next-generation sequencing have advanced clinical genetic research and might be a suitable method for the detection of various types of mutations in the dystrophin gene. To identify the mutational spectrum using a single platform, whole dystrophin gene sequencing was performed using next-generation sequencing. The entire dystrophin gene, including all exons, introns and promoter regions, was target enriched using a DMD whole gene enrichment kit. The enrichment libraries were sequenced on an Illumina HiSeq 2000 sequencer using paired read 100 bp sequencing. We studied 26 patients: 21 had known large deletion/duplications and 5 did not have detectable large deletion/duplications by multiplex ligation-dependent probe amplification technology (MLPA). We applied whole dystrophin gene analysis by next-generation sequencing to the five patients who did not have detectable large deletion/duplications and to five randomly chosen patients from the 21 who did have large deletion/duplications. The sequencing data covered almost 100% of the exonic region of the dystrophin gene by ≥10 reads with a mean read depth of 147. Five small mutations were identified in the first five patients, of which four variants were unreported in the dmd.nl database. The deleted or duplicated exons and the breakpoints in the five large deletion/duplication patients were precisely identified. Whole dystrophin gene sequencing by next-generation sequencing may be a useful tool for the genetic diagnosis of Duchenne and Becker muscular dystrophies.

  2. Identification of a p53-response element in the promoter of the proline oxidase gene

    SciTech Connect

    Maxwell, Steve A. Kochevar, Gerald J.

    2008-05-02

    Proline oxidase (POX) is a p53-induced proapoptotic gene. We investigated whether p53 could bind directly to the POX gene promoter. Chromatin immunoprecipitation (ChIP) assays detected p53 bound to POX upstream gene sequences. In support of the ChIP results, sequence analysis of the POX gene and its 5' flanking sequences revealed a potential p53-binding site, GGGCTTGTCTTCGTGTGACTTCTGTCT, located at 1161 base pairs (bp) upstream of the transcriptional start site. A 711-bp DNA fragment containing the candidate p53-binding site exhibited reporter gene activity that was induced by p53. In contrast, the same DNA region lacking the candidate p53-binding site did not show significant p53-response activity. Electrophoretic mobility shift assay (EMSA) in ACHN renal carcinoma cell nuclear lysates confirmed that p53 could bind to the 711-bp POX DNA fragment. We concluded from these experiments that a p53-binding site is positioned at -1161 to -1188 bp upstream of the POX transcriptional start site.

  3. Cloning and sequencing of the leu C and npr M genes and a putative spo IV gene from Bacillus megaterium DSM319.

    PubMed

    Meinhardt, F; Busskamp, M; Wittchen, K D

    1994-05-01

    The leuC gene, encoding 3-isopropylmalate dehydrogenase, the nprM gene (neutral protease) and a sporulation gene coding for a putative spoIV protein (spoIV) from Bacillus megaterium DSM 319 were cloned and the nucleotide sequences were determined. The leuC gene is 1101 bp in length, preceded by a ribosome binding site; no promoter consensus sequence could be found. The nucleotide sequence from nprM when compared to the recently published gene from B. megaterium ATCC 14581 exhibited only a 17-base pair deviation. From a sporulation mutant isolated after transposon-mutagenesis with transposon Tn917 the insertion site of the transposon was cloned and adjacent chromosomal fragments were characterized. An open reading frame that encodes for a putative spo protein of 247 amino-acid residues was identified. PMID:7764969

  4. Identification of the promoter region and genetic mutations of the porcine GALP gene.

    PubMed

    Su, Lina; Mei, Shuqi; Tao, Hu; Peng, Xianwen; Sun, Xiaojie; Wu, Huayu; Zhang, Xuying; Qiao, Mu; Li, Fenge

    2013-04-01

    Galanin-like peptide (GALP) gene, encoding a member of the galanin family of neuropeptides involved in reproduction, was differentially expressed in PMSG-hCG stimulated pre-ovulatory ovarian follicles of Chinese Taihu and Large White sows in our previous study. In the present study, promoter region and genetic mutations of the porcine GALP gene were determined. A 1,322 bp contig in 5'-flanking region was predicted to contain 5 potential transcription promoters by Neural Network Promoter Prediction version 2.2. 5'-deletion expression in both CHO and hela cells showed that there were a negative regulatory element at -852 to -803 bp and a positive regulatory element at -1,318 to -1,269 bp. Comparative sequence analyses of Chinese Taihu and Large White GALP gene sequence revealed the c.*27C>G mutation in the 3'-UTR and the c.88-1225C>G mutation in intron 1, which can be detected by HhaI and AluI PCR-RFLP, respectively. The association analysis with litter size traits showed that at both loci CC and GG genotypes were different for NBA for all parities in DIV pigs (P < 0.05). However, two SNPs were not in significant linkage disequilibrium analyzed using SHEsis online software, and could be used in pig breeding individually.

  5. Strategies for Development of Functionally Equivalent Promoters with Minimum Sequence Homology for Transgene Expression in Plants: cis-Elements in a Novel DNA Context versus Domain Swapping1

    PubMed Central

    Bhullar, Simran; Chakravarthy, Suma; Advani, Sonia; Datta, Sudipta; Pental, Deepak; Burma, Pradeep Kumar

    2003-01-01

    The cauliflower mosaic virus 35S (35S) promoter has been extensively used for the constitutive expression of transgenes in dicotyledonous plants. The repetitive use of the same promoter is known to induce transgene inactivation due to promoter homology. As a way to circumvent this problem, we tested two different strategies for the development of synthetic promoters that are functionally equivalent but have a minimum sequence homology. Such promoters can be generated by (a) introducing known cis-elements in a novel or synthetic stretch of DNA or (b) “domain swapping,” wherein domains of one promoter can be replaced with functionally equivalent domains from other heterologous promoters. We evaluated the two strategies for promoter modifications using domain A (consisting of minimal promoter and subdomain A1) of the 35S promoter as a model. A set of modified 35S promoters were developed whose strength was compared with the 35S promoter per se using β-glucuronidase as the reporter gene. Analysis of the expression of the reporter gene in transient assay system showed that domain swapping led to a significant fall in promoter activity. In contrast, promoters developed by placing cis-elements in a novel DNA context showed levels of expression comparable with that of the 35S. Two promoter constructs Mod2A1T and Mod3A1T were then designed by placing the core sequences of minimal promoter and subdomain A1 in divergent DNA sequences. Transgenics developed in tobacco (Nicotiana tabacum) with the two constructs and with 35S as control were used to assess the promoter activity in different tissues of primary transformants. Mod2A1T and Mod3A1T were found to be active in all of the tissues tested, at levels comparable with that of 35S. Further, the expression of the Mod2A1T promoter in the seedlings of the T1 generation was also similar to that of the 35S promoter. The present strategy opens up the possibility of creating a set of synthetic promoters with minimum sequence

  6. Cloning and characterization of the promoter regions from the parent and paralogous creatine transporter genes.

    PubMed

    Ndika, Joseph D T; Lusink, Vera; Beaubrun, Claudine; Kanhai, Warsha; Martinez-Munoz, Cristina; Jakobs, Cornelis; Salomons, Gajja S

    2014-01-10

    Interconversion between phosphocreatine and creatine, catalyzed by creatine kinase is crucial in the supply of ATP to tissues with high energy demand. Creatine's importance has been established by its use as an ergogenic aid in sport, as well as the development of intellectual disability in patients with congenital creatine deficiency. Creatine biosynthesis is complemented by dietary creatine uptake. Intracellular transport of creatine is carried out by a creatine transporter protein (CT1/CRT/CRTR) encoded by the SLC6A8 gene. Most tissues express this gene, with highest levels detected in skeletal muscle and kidney. There are lower levels of the gene detected in colon, brain, heart, testis and prostate. The mechanism(s) by which this regulation occurs is still poorly understood. A duplicated unprocessed pseudogene of SLC6A8-SLC6A10P has been mapped to chromosome 16p11.2 (contains the entire SLC6A8 gene, plus 2293 bp of 5'flanking sequence and its entire 3'UTR). Expression of SLC6A10P has so far only been shown in human testis and brain. It is still unclear as to what is the function of SLC6A10P. In a patient with autism, a chromosomal breakpoint that intersects the 5'flanking region of SLC6A10P was identified; suggesting that SLC6A10P is a non-coding RNA involved in autism. Our aim was to investigate the presence of cis-acting factor(s) that regulate expression of the creatine transporter, as well as to determine if these factors are functionally conserved upstream of the creatine transporter pseudogene. Via gene-specific PCR, cloning and functional luciferase assays we identified a 1104 bp sequence proximal to the mRNA start site of the SLC6A8 gene with promoter activity in five cell types. The corresponding 5'flanking sequence (1050 bp) on the pseudogene also had promoter activity in all 5 cell lines. Surprisingly the pseudogene promoter was stronger than that of its parent gene in 4 of the cell lines tested. To the best of our knowledge, this is the first

  7. A library of synthetic transcription activator-like effector-activated promoters for coordinated orthogonal gene expression in plants

    PubMed Central

    Brückner, Kathleen; Schäfer, Petra; Weber, Ernst; Grützner, Ramona; Marillonnet, Sylvestre; Tissier, Alain

    2015-01-01

    A library of synthetic promoters containing the binding site of a single designer transcription activator-like effector (dTALE) was constructed. The promoters contain a constant sequence, consisting of an 18-base long dTALE-binding site and a TATA box, flanked by degenerate sequences of 49 bases downstream and 19 bases upstream. Forty-three of these promoters were sequenced and tested in transient assays in Nicotiana benthamiana using a GUS reporter gene. The strength of expression of the promoters ranged from around 5% to almost 100% of the viral 35S promoter activity. We then demonstrated the utility of these promoters for metabolic engineering by transiently expressing three genes for the production of a plant diterpenoid in N. benthamiana. The simplicity of the promoter structure shows great promise for the development of genetic circuits, with wide potential applications in plant synthetic biology and metabolic engineering. PMID:25846505

  8. Twist1 Directly Regulates Genes That Promote Cell Proliferation and Migration in Developing Heart Valves

    PubMed Central

    Lee, Mary P.; Yutzey, Katherine E.

    2011-01-01

    Twist1, a basic helix-loop-helix transcription factor, is expressed in mesenchymal precursor populations during embryogenesis and in metastatic cancer cells. In the developing heart, Twist1 is highly expressed in endocardial cushion (ECC) valve mesenchymal cells and is down regulated during valve differentiation and remodeling. Previous studies demonstrated that Twist1 promotes cell proliferation, migration, and expression of primitive extracellular matrix (ECM) molecules in ECC mesenchymal cells. Furthermore, Twist1 expression is induced in human pediatric and adult diseased heart valves. However, the Twist1 downstream target genes that mediate increased cell proliferation and migration during early heart valve development remain largely unknown. Candidate gene and global gene profiling approaches were used to identify transcriptional targets of Twist1 during heart valve development. Candidate target genes were analyzed for evolutionarily conserved regions (ECRs) containing E-box consensus sequences that are potential Twist1 binding sites. ECRs containing conserved E-box sequences were identified for Twist1 responsive genes Tbx20, Cdh11, Sema3C, Rab39b, and Gadd45a. Twist1 binding to these sequences in vivo was determined by chromatin immunoprecipitation (ChIP) assays, and binding was detected in ECCs but not late stage remodeling valves. In addition identified Twist1 target genes are highly expressed in ECCs and have reduced expression during heart valve remodeling in vivo, which is consistent with the expression pattern of Twist1. Together these analyses identify multiple new genes involved in cell proliferation and migration that are differentially expressed in the developing heart valves, are responsive to Twist1 transcriptional function, and contain Twist1-responsive regulatory sequences. PMID:22242143

  9. Mining tissue-specific contigs from peanut (Arachis hypogaea L.) for promoter cloning by deep transcriptome sequencing.

    PubMed

    Geng, Lili; Duan, Xiaohong; Liang, Chun; Shu, Changlong; Song, Fuping; Zhang, Jie

    2014-10-01

    Peanut (Arachis hypogaea L.), one of the most important oil legumes in the world, is heavily damaged by white grubs. Tissue-specific promoters are needed to incorporate insect resistance genes into peanut by genetic transformation to control the subterranean pests. Transcriptome sequencing is the most effective way to analyze differential gene expression in this non-model species and contribute to promoter cloning. The transcriptomes of the roots, seeds and leaves of peanut were sequenced using Illumina technology. A simple digital expression profile was established based on number of transcripts per million clean tags (TPM) from different tissues. Subsequently, 584 root-specific candidate transcript assembly contigs (TACs) and 316 seed-specific candidate TACs were identified. Among these candidate TACs, 55.3% were root-specific and 64.6% were seed-specific by semi-quantitative RT-PCR analysis. Moreover, the consistency of semi-quantitative RT-PCR with the simple digital expression profile was correlated with the length and TPM value of TACs. The results of gene ontology showed that some root-specific TACs are involved in stress resistance and respond to auxin stimulus, whereas, seed-specific candidate TACs are involved in embryo development, lipid storage and long-chain fatty acid biosynthesis. One root-specific promoter was cloned and characterized. We developed a high-yield screening system in peanut by establishing a simple digital expression profile based on Illumina sequencing. The feasible and rapid method presented by this study can be used for other non-model crops to explore tissue-specific or spatially specific promoters.

  10. Mining tissue-specific contigs from peanut (Arachis hypogaea L.) for promoter cloning by deep transcriptome sequencing.

    PubMed

    Geng, Lili; Duan, Xiaohong; Liang, Chun; Shu, Changlong; Song, Fuping; Zhang, Jie

    2014-10-01

    Peanut (Arachis hypogaea L.), one of the most important oil legumes in the world, is heavily damaged by white grubs. Tissue-specific promoters are needed to incorporate insect resistance genes into peanut by genetic transformation to control the subterranean pests. Transcriptome sequencing is the most effective way to analyze differential gene expression in this non-model species and contribute to promoter cloning. The transcriptomes of the roots, seeds and leaves of peanut were sequenced using Illumina technology. A simple digital expression profile was established based on number of transcripts per million clean tags (TPM) from different tissues. Subsequently, 584 root-specific candidate transcript assembly contigs (TACs) and 316 seed-specific candidate TACs were identified. Among these candidate TACs, 55.3% were root-specific and 64.6% were seed-specific by semi-quantitative RT-PCR analysis. Moreover, the consistency of semi-quantitative RT-PCR with the simple digital expression profile was correlated with the length and TPM value of TACs. The results of gene ontology showed that some root-specific TACs are involved in stress resistance and respond to auxin stimulus, whereas, seed-specific candidate TACs are involved in embryo development, lipid storage and long-chain fatty acid biosynthesis. One root-specific promoter was cloned and characterized. We developed a high-yield screening system in peanut by establishing a simple digital expression profile based on Illumina sequencing. The feasible and rapid method presented by this study can be used for other non-model crops to explore tissue-specific or spatially specific promoters. PMID:25231965

  11. Isolation and functional analysis of the promoter of the amphioxus Hsp70a gene.

    PubMed

    Li, Dingliang; Li, Guang; Wang, Kunru; Liu, Xin; Li, Weiye; Chen, Xinhua; Wang, Yiquan

    2012-11-15

    Amphioxus is a promising laboratorial model animal for studying the evolutionary and developmental mechanisms that appeared during the invertebrate-chordate to vertebrate transition. However, the main drawback for the use of amphioxus as a model organism is the lack of well-developed technical approaches. Conditional gene expression, as performed with thermal control, is a very useful strategy in gene function studies. To make this method possible in amphioxus studies, here we report the isolation and characterization of an amphioxus Hsp70 gene (Hsp70a) and its promoter in Chinese amphioxus (Branchiostoma belcheri). Hsp70a showed very low expression at normal temperatures but was robustly induced in animals upon heat shock. The basal cis-acting elements (CAAT and TATA), as well as four heat shock elements (HSEs), were found within the regulatory region (-1031 to -11 upstream from the start codon), but surprisingly most of the elements were located in the 5'UTR region (-252 to -10). Reporter constructs, including sequences from both the transcription start site (TSS) and ATG were tested for transient expression in EPC cells and microinjected zebrafish embryos. Results suggested that the 5'UTR region, which includes a TATA box at -92bp, a CAAT box at -152bp, and three HSE elements (-212 to -106), represents the core hsp promoter sequence of the B. belcheri Hsp70a gene. Therefore in this study we identified an effectively thermo-inducible promoter in amphioxus that could be used for the establishment of a conditional gene expression system in which the target gene can be regulated in a temporal- or tissue-specific way in amphioxus.

  12. Nucleotide sequence of the tobacco (Nicotiana tabacum) anionic peroxidase gene

    SciTech Connect

    Diaz-De-Leon, F.; Klotz, K.L.; Lagrimini, L.M. )

    1993-03-01

    Peroxidases have been implicated in numerous physiological processes including lignification (Grisebach, 1981), wound-healing (Espelie et al., 1986), phenol oxidation (Lagrimini, 1991), pathogen defense (Ye et al., 1990), and the regulation of cell elongation through the formation of interchain covalent bonds between various cell wall polymers (Fry, 1986; Goldberg et al., 1986; Bradley et al., 1992). However, a complete description of peroxidase action in vivo is not available because of the vast number of potential substrates and the existence of multiple isoenzymes. The tobacco anionic peroxidase is one of the better-characterized isoenzymes. This enzyme has been shown to oxidize a number of significant plant secondary compounds in vitro including cinnamyl alcohols, phenolic acids, and indole-3-acetic acid (Maeder, 1980; Lagrimini, 1991). A cDNA encoding the enzyme has been obtained, and this enzyme was shown to be expressed at the highest levels in lignifying tissues (xylem and tracheary elements) and also in epidermal tissue (Lagrimini et al., 1987). It was shown at this time that there were four distinct copies of the anionic peroxidase gene in tobacco (Nicotiana tabacum). A tobacco genomic DNA library was constructed in the [lambda]-phase EMBL3, from which two unique peroxidase genes were sequenced. One of these clones, [lambda]POD1, was designated as a pseudogene when the exonic sequences were found to differ from the cDNA sequences by 1%, and several frame shifts in the coding sequences indicated a dysfunctional gene (the authors' unpublished results). The other clone, [lambda]POD3, described in this manuscript, was designated as the functional tobacco anionic peroxidase gene because of 100% homology with the cDNA. Significant structural elements include an AS-2 box indicated in shoot-specific expression (Lam and Chua, 1989), a TATA box, and two intervening sequences. 10 refs., 1 tab.

  13. Sequence variations in the FAD2 gene in seeded pumpkins.

    PubMed

    Ge, Y; Chang, Y; Xu, W L; Cui, C S; Qu, S P

    2015-12-21

    Seeded pumpkins are important economic crops; the seeds contain various unsaturated fatty acids, such as oleic acid and linoleic acid, which are crucial for human and animal nutrition. The fatty acid desaturase-2 (FAD2) gene encodes delta-12 desaturase, which converts oleic acid to linoleic acid. However, little is known about sequence variations in FAD2 in seeded pumpkins. Twenty-seven FAD2 clones from 27 accessions of Cucurbita moschata, Cucurbita maxima, Cucurbita pepo, and Cucurbita ficifolia were obtained (totally 1152 bp; a single gene without introns). More than 90% nucleotide identities were detected among the 27 FAD2 clones. Nucleotide substitution, rather than nucleotide insertion and deletion, led to sequence polymorphism in the 27 FAD2 clones. Furthermore, the 27 FAD2 selected clones all encoded the FAD2 enzyme (delta-12 desaturase) with amino acid sequence identities from 91.7 to 100% for 384 amino acids. The same main-function domain between 47 and 329 amino acids was identified. The four species clustered separately based on differences in the sequences that were identified using the unweighted pair group method with arithmetic mean. Geographic origin and species were found to be closely related to sequence variation in FAD2.

  14. Sequence variations in the FAD2 gene in seeded pumpkins.

    PubMed

    Ge, Y; Chang, Y; Xu, W L; Cui, C S; Qu, S P

    2015-01-01

    Seeded pumpkins are important economic crops; the seeds contain various unsaturated fatty acids, such as oleic acid and linoleic acid, which are crucial for human and animal nutrition. The fatty acid desaturase-2 (FAD2) gene encodes delta-12 desaturase, which converts oleic acid to linoleic acid. However, little is known about sequence variations in FAD2 in seeded pumpkins. Twenty-seven FAD2 clones from 27 accessions of Cucurbita moschata, Cucurbita maxima, Cucurbita pepo, and Cucurbita ficifolia were obtained (totally 1152 bp; a single gene without introns). More than 90% nucleotide identities were detected among the 27 FAD2 clones. Nucleotide substitution, rather than nucleotide insertion and deletion, led to sequence polymorphism in the 27 FAD2 clones. Furthermore, the 27 FAD2 selected clones all encoded the FAD2 enzyme (delta-12 desaturase) with amino acid sequence identities from 91.7 to 100% for 384 amino acids. The same main-function domain between 47 and 329 amino acids was identified. The four species clustered separately based on differences in the sequences that were identified using the unweighted pair group method with arithmetic mean. Geographic origin and species were found to be closely related to sequence variation in FAD2. PMID:26782391

  15. hTERT and BIRC5 gene promoters for cancer gene therapy: A comparative study

    PubMed Central

    Shepelev, Mikhail V.; Kopantzev, Eugene P.; Vinogradova, Tatiana V.; Sverdlov, Eugene D.; Korobko, Igor V.

    2016-01-01

    Human telomerase reverse transcriptase (hTERT) and survivin (BIRC5) gene promoters are frequently used for transcriptional targeting of tumor cells, yet there is no comprehensive comparative analysis allowing rational choice of a promoter for a particular therapy. In the current study, the transcriptional activity of hTERT, human BIRC5 and mouse Birc5 promoters and their modifications were compared in 10 human cancer cell lines using the luciferase reporter gene activity assay. The results revealed that BIRC5- and hTERT-based promoters had strikingly different cell specificities with comparable activities in only 40% of cell lines. Importantly, relative hTERT and BIRC5 transcript abundance cannot be used to predict the most potent promoter. Among the hTERT-based promoters that were assessed, modification with the minimal cytomegalovirus promoter generally resulted in the most potent activity. Mouse Birc5 and modified human BIRC5 promoters were superior to the unmodified human survivin promoter; however, their tumor specificities must be investigated further. In summary, the present results emphasize the desirability for construction of more universal tumor-specific promoters to efficiently target a wide spectrum of tumor cells. PMID:27446419

  16. Protein-DNA interactions in the promoter region of the amyloid precursor protein (APP) gene in human neocortex.

    PubMed

    Lukiw, W J; Rogaev, E I; Wong, L; Vaula, G; McLachlan, D R; St George Hyslop, P

    1994-03-01

    We have investigated protein-DNA interactions in the proximal promoter of the human amyloid precursor protein (APP) gene in temporal lobe neocortical nuclei isolated from control and Alzheimer disease (AD) affected brains. We report that the human APP 5' promoter sequence from -203 to +55 bp, which has been previously reported to contain essential regulatory elements for APP gene transcription, lies in a deoxyribonuclease I, micrococcal nuclease- and restriction endonuclease-sensitive, G+C-rich nucleosome-free gap flanked both 5' and 3' by typical nucleosome structures. As analyzed by electrophoretic mobility shift assay, this extended internucleosomal linker DNA is heavily occupied by nuclear protein factors, and interacts differentially with nuclear protein extracts obtained from HeLa and human brain neocortical nuclei. This suggests that the chromatin conformation of the APP gene promoter may vary in different cell types, and may correlate with differences in APP gene expression. Human recombinant transcription factors AP1, SP1 and TFIID (but not AP2 or brain histones H1, H2B and H4) interact with the -203 to +55 bp of the human APP promoter sequence. Only minor differences were observed in the chromatin structure of the immediate APP promoter between non-AD and AD affected neocortical nuclei, suggesting either that post-transcriptional processes, or that regulatory elements lying elsewhere in the APP gene may be important in the aberrant accumulation of the APP gene product.

  17. The Arabidopsis root transcriptome by serial analysis of gene expression. Gene identification using the genome sequence.

    PubMed

    Fizames, Cécile; Muños, Stéphane; Cazettes, Céline; Nacry, Philippe; Boucherez, Jossia; Gaymard, Frédéric; Piquemal, David; Delorme, Valérie; Commes, Thérèse; Doumas, Patrick; Cooke, Richard; Marti, Jacques; Sentenac, Hervé; Gojon, Alain

    2004-01-01

    Large-scale identification of genes expressed in roots of the model plant Arabidopsis was performed by serial analysis of gene expression (SAGE), on a total of 144,083 sequenced tags, representing at least 15,964 different mRNAs. For tag to gene assignment, we developed a computational approach based on 26,620 genes annotated from the complete sequence of the genome. The procedure selected warrants the identification of the genes corresponding to the majority of the tags found experimentally, with a high level of reliability, and provides a reference database for SAGE studies in Arabidopsis. This new resource allowed us to characterize the expression of more than 3,000 genes, for which there is no expressed sequence tag (EST) or cDNA in the databases. Moreover, 85% of the tags were specific for one gene. To illustrate this advantage of SAGE for functional genomics, we show that our data allow an unambiguous analysis of most of the individual genes belonging to 12 different ion transporter multigene families. These results indicate that, compared with EST-based tag to gene assignment, the use of the annotated genome sequence greatly improves gene identification in SAGE studies. However, more than 6,000 different tags remained with no gene match, suggesting that a significant proportion of transcripts present in the roots originate from yet unknown or wrongly annotated genes. The root transcriptome characterized in this study markedly differs from those obtained in other organs, and provides a unique resource for investigating the functional specificities of the root system. As an example of the use of SAGE for transcript profiling in Arabidopsis, we report here the identification of 270 genes differentially expressed between roots of plants grown either with NO3- or NH4NO3 as N source.

  18. Differential interactions of promoter elements in stress responses of the Arabidopsis Adh gene.

    PubMed Central

    Dolferus, R; Jacobs, M; Peacock, W J; Dennis, E S

    1994-01-01

    The Adh (alcohol dehydrogenase, EC 1.1.1.1.) gene from Arabidopsis thaliana (L.) Heynh. can be induced by dehydration and cold, as well as by hypoxia. A 1-kb promoter fragment (CADH: -964 to +53) is sufficient to confer the stress induction and tissue-specific developmental expression characteristics of the Adh gene to a beta-glucuronidase reporter gene. Deletion mapping of the 5' end and site-specific mutagenesis identified four regions of the promoter essential for expression under the three stress conditions. Some sequence elements are important for response to all three stress treatments, whereas others are stress specific. The most critical region essential for expression of the Arabidopsis Adh promoter under all three environmental stresses (region IV: -172 to -141) contains sequences homologous to the GT motif (-160 to -152) and the GC motif (-147 to -144) of the maize Adh1 anaerobic responsive element. Region III (-235 to -172) contains two regions shown by R.J. Ferl and B.H. Laughner ([1989] Plant Mol Biol 12: 357-366) to bind regulatory proteins; mutation of the G-box-1 region (5'-CCACGTGG-3', -216 to -209) does not affect expression under uninduced or hypoxic conditions, but significantly reduces induction by cold stress and, to a lesser extent, by dehydration stress. Mutation of the other G-box-like sequence (G-box-2: 5'-CCAAGTGG-3', -193 to -182) does not change hypoxic response and affects cold and dehydration stress only slightly. G-box-2 mutations also promote high levels of expression under uninduced conditions. Deletion of region I (-964 to -510) results in increased expression under uninduced and all stress conditions, suggesting that this region contains a repressor binding site. Region II (-510 to -384) contains a positive regulatory element and is necessary for high expression levels under all treatments. PMID:7972489

  19. Structural features of conopeptide genes inferred from partial sequences of the Conus tribblei genome.

    PubMed

    Barghi, Neda; Concepcion, Gisela P; Olivera, Baldomero M; Lluisma, Arturo O

    2016-02-01

    The evolvability of venom components (in particular, the gene-encoded peptide toxins) in venomous species serves as an adaptive strategy allowing them to target new prey types or respond to changes in the prey field. The structure, organization, and expression of the venom peptide genes may provide insights into the molecular mechanisms that drive the evolution of such genes. Conus is a particularly interesting group given the high chemical diversity of their venom peptides, and the rapid evolution of the conopeptide-encoding genes. Conus genomes, however, are large and characterized by a high proportion of repetitive sequences. As a result, the structure and organization of conopeptide genes have remained poorly known. In this study, a survey of the genome of Conus tribblei was undertaken to address this gap. A partial assembly of C. tribblei genome was generated; the assembly, though consisting of a large number of fragments, accounted for 2160.5 Mb of sequence. A large number of repetitive genomic elements consisting of 642.6 Mb of retrotransposable elements, simple repeats, and novel interspersed repeats were observed. We characterized the structural organization and distribution of conotoxin genes in the genome. A significant number of conopeptide genes (estimated to be between 148 and 193) belonging to different superfamilies with complete or nearly complete exon regions were observed, ~60 % of which were expressed. The unexpressed conopeptide genes represent hidden but significant conotoxin diversity. The conotoxin genes also differed in the frequency and length of the introns. The interruption of exons by long introns in the conopeptide genes and the presence of repeats in the introns may indicate the importance of introns in facilitating recombination, evolution and diversification of conotoxins. These findings advance our understanding of the structural framework that promotes the gene-level molecular evolution of venom peptides. PMID:26423067

  20. Structural features of conopeptide genes inferred from partial sequences of the Conus tribblei genome.

    PubMed

    Barghi, Neda; Concepcion, Gisela P; Olivera, Baldomero M; Lluisma, Arturo O

    2016-02-01

    The evolvability of venom components (in particular, the gene-encoded peptide toxins) in venomous species serves as an adaptive strategy allowing them to target new prey types or respond to changes in the prey field. The structure, organization, and expression of the venom peptide genes may provide insights into the molecular mechanisms that drive the evolution of such genes. Conus is a particularly interesting group given the high chemical diversity of their venom peptides, and the rapid evolution of the conopeptide-encoding genes. Conus genomes, however, are large and characterized by a high proportion of repetitive sequences. As a result, the structure and organization of conopeptide genes have remained poorly known. In this study, a survey of the genome of Conus tribblei was undertaken to address this gap. A partial assembly of C. tribblei genome was generated; the assembly, though consisting of a large number of fragments, accounted for 2160.5 Mb of sequence. A large number of repetitive genomic elements consisting of 642.6 Mb of retrotransposable elements, simple repeats, and novel interspersed repeats were observed. We characterized the structural organization and distribution of conotoxin genes in the genome. A significant number of conopeptide genes (estimated to be between 148 and 193) belonging to different superfamilies with complete or nearly complete exon regions were observed, ~60 % of which were expressed. The unexpressed conopeptide genes represent hidden but significant conotoxin diversity. The conotoxin genes also differed in the frequency and length of the introns. The interruption of exons by long introns in the conopeptide genes and the presence of repeats in the introns may indicate the importance of introns in facilitating recombination, evolution and diversification of conotoxins. These findings advance our understanding of the structural framework that promotes the gene-level molecular evolution of venom peptides.

  1. Origin of a novel protein-coding gene family with similar signal sequence in Schistosoma japonicum

    PubMed Central

    2012-01-01

    Background Evolution of novel protein-coding genes is the bedrock of adaptive evolution. Recently, we identified six protein-coding genes with similar signal sequence from Schistosoma japonicum egg stage mRNA using signal sequence trap (SST). To find the mechanism underlying the origination of these genes with similar core promoter regions and signal sequence, we adopted an integrated approach utilizing whole genome, transcriptome and proteome database BLAST queries, other bioinformatics tools, and molecular analyses. Results Our data, in combination with database analyses showed evidences of expression of these genes both at the mRNA and protein levels exclusively in all developmental stages of S. japonicum. The signal sequence motif was identified in 27 distinct S. japonicum UniGene entries with multiple mRNA transcripts, and in 34 genome contigs distributed within 18 scaffolds with evidence of genome-wide dispersion. No homolog of these genes or similar domain was found in deposited data from any other organism. We observed preponderance of flanking repetitive elements (REs), albeit partial copies, especially of the RTE-like and Perere class at either side of the duplication source locus. The role of REs as major mediators of DNA-level recombination leading to dispersive duplication is discussed with evidence from our analyses. We also identified a stepwise pathway towards functional selection in evolving genes by alternative splicing. Equally, the possible transcription models of some protein-coding representatives of the duplicons are presented with evidence of expression in vitro. Conclusion Our findings contribute to the accumulating evidence of the role of REs in the generation of evolutionary novelties in organisms’ genomes. PMID:22716200

  2. Cloning and characterization of largemouth bass ( Micropterus salmoides) myostatin encoding gene and its promoter

    NASA Astrophysics Data System (ADS)

    Li, Shengjie; Bai, Junjie; Wang, Lin

    2008-08-01

    Myostatin or GDF-8, a member of the transforming growth factor-β (TGF-β) superfamily, has been demonstrated to be a negative regulator of skeletal muscle mass in mammals. In the present study, we obtained a 5.64 kb sequence of myostatin encoding gene and its promoter from largemouth bass ( Micropterus salmoides). The myostatin encoding gene consisted of three exons (488 bp, 371 bp and 1779 bp, respectively) and two introns (390 bp and 855 bp, respectively). The intron-exon boundaries were conservative in comparison with those of mammalian myostatin encoding genes, whereas the size of introns was smaller than that of mammals. Sequence analysis of 1.569 kb of the largemouth bass myostatin gene promoter region revealed that it contained two TATA boxes, one CAAT box and nine putative E-boxes. Putative muscle growth response elements for myocyte enhancer factor 2 (MEF2), serum response factor (SRF), activator protein 1 (AP1), etc., and muscle-specific Mt binding site (MTBF) were also detected. Some of the transcription factor binding sites were conserved among five teleost species. This information will be useful for studying the transcriptional regulation of myostatin in fish.

  3. Identification and cell type specificity of the tyrosine hydroxylase gene promoter.

    PubMed Central

    Harrington, C A; Lewis, E J; Krzemien, D; Chikaraishi, D M

    1987-01-01

    Genomic DNA encoding the rat tyrosine hydroxylase (TH) gene was isolated from a lambda phage library using a nick-translated fragment from a cDNA clone for rat TH. We have determined the initiation site for TH RNA synthesis and have sequenced 1100 bases of the primary transcript and 5' flanking region. The 5' end of the transcript is the same in several rat tissues in which TH is expressed as well as in rat pheochromocytoma cells (PC). RNA prepared from PC cells that had been stimulated with dexamethasone also mapped to the same transcription start site. Sequence upstream from the initiation site contains the canonical TATA box, but no apparent CAAT box. When a portion of the 5' flanking region of the TH gene (-773 to + 27) is fused to the chloramphenicol acetyltransferase (CAT) gene, it promotes expression of CAT in pheochromocytoma cells and GH4 cells, but not in two neural tumour lines, RT4-D and B103, nor in several non neural cell lines. This suggests that this region of the TH gene has features that confer tissue-restricted expression on the TH promoter. Images PMID:2882469

  4. Pollen- and anther-specific chi promoters from petunia: tandem promoter regulation of the chiA gene.

    PubMed

    van Tunen, A J; Mur, L A; Brouns, G S; Rienstra, J D; Koes, R E; Mol, J N

    1990-05-01

    We have analyzed the spatial and temporal activities of chalcone flavanone isomerase (chi) A and B gene promoters from petunia. To study the tandem promoter regulation of chiA, various chiA promoter fragments were fused with the beta-glucuronidase (GUS) reporter gene. Analysis of transgenic plants containing these chimeric genes provided definitive proof that the chiA coding region is regulated by two distinct promoters (designated PA1 and PA2). We also showed that both promoters can function independently and that the chiA PA1 promoter is expressed in limb (epidermal and parenchyma cells), tube (inner epidermal and parenchyma cells), seed (seed coat, endosperm, and embryo), sepal, leaf, and stem. The use of chiA and chiB promoters in the regulation of anther- and pollen-specific gene expression has been studied. By analyzing transgenic plants containing chimeric genes consisting of chiA and B promoter fragments and the GUS reporter gene, we were able to identify a 0.44-kilobase chiA PA2 promoter fragment that drives pollen-specific gene expression and a 1.75-kilobase chiB PB promoter fragment that confers anther-specific (pollen and tapetum cells) expression to the GUS gene.

  5. Telencephalic embryonic subtractive sequences: a unique collection of neurodevelopmental genes.

    PubMed

    Bulfone, Alessandro; Carotenuto, Pietro; Faedo, Andrea; Aglio, Veruska; Garzia, Livia; Bello, Anna Maria; Basile, Andrea; Andrè, Alessandra; Cocchia, Massimo; Guardiola, Ombretta; Ballabio, Andrea; Rubenstein, John L R; Zollo, Massimo

    2005-08-17

    The vertebrate telencephalon is composed of many architectonically and functionally distinct areas and structures, with billions of neurons that are precisely connected. This complexity is fine-tuned during development by numerous genes. To identify genes involved in the regulation of telencephalic development, a specific subset of differentially expressed genes was characterized. Here, we describe a set of cDNAs encoded by genes preferentially expressed during development of the mouse telencephalon that was identified through a functional genomics approach. Of 832 distinct transcripts found, 223 (27%) are known genes. Of the remaining, 228 (27%) correspond to expressed sequence tags of unknown function, 58 (7%) are homologs or orthologs of known genes, and 323 (39%) correspond to novel rare transcripts, including 48 (14%) new putative noncoding RNAs. As an example of this latter group of novel precursor transcripts of micro-RNAs, telencephalic embryonic subtractive sequence (TESS) 24.E3 was functionally characterized, and one of its targets was identified: the zinc finger transcription factor ZFP9. The TESS transcriptome has been annotated, mapped for chromosome loci, and arrayed for its gene expression profiles during neural development and differentiation (in Neuro2a and neural stem cells). Within this collection, 188 genes were also characterized on embryonic and postnatal tissue by in situ hybridization, demonstrating that most are specifically expressed in the embryonic CNS. The full information has been organized into a searchable database linked to other genomic resources, allowing easy access to those who are interested in the dissection of the molecular basis of telencephalic development.

  6. The uteroglobin gene region: hormonal regulation, repetitive elements and complete nucleotide sequence of the gene.

    PubMed Central

    Suske, G; Wenz, M; Cato, A C; Beato, M

    1983-01-01

    Differential uteroglobin induction represents an appropriate model for the molecular analysis of the mechanism by which steroid hormones control gene expression in mammals. We have analyzed the structure and hormonal regulation of a 35 Kb region of genomic DNA in which the uteroglobin gene is located. The complete sequence of 3,700 nucleotides including the uteroglobin gene and its flanking regions has been determined, and the limits of the gene established by S1 nuclease mapping. Several regions containing repeated sequences were mapped by blot hybridization, one of which is located within the large intron in the uteroglobin gene. Analysis of the RNAs extracted from endometrium, lung and liver, after treatment with estrogen and/or progesterone shows that within the 35 Kb region, the uteroglobin gene is the only DNA segment whose transcription into stable RNA is induced by progesterone. Images PMID:6304644

  7. Informational structure of genetic sequences and nature of gene splicing

    NASA Astrophysics Data System (ADS)

    Trifonov, E. N.

    1991-10-01

    Only about 1/20 of DNA of higher organisms codes for proteins, by means of classical triplet code. The rest of DNA sequences is largely silent, with unclear functions, if any. The triplet code is not the only code (message) carried by the sequences. There are three levels of molecular communication, where the same sequence ``talks'' to various bimolecules, while having, respectively, three different appearances: DNA, RNA and protein. Since the molecular structures and, hence, sequence specific preferences of these are substantially different, the original DNA sequence has to carry simultaneously three types of sequence patterns (codes, messages), thus, being a composite structure in which one had the same letter (nucleotide) is frequently involved in several overlapping codes of different nature. This multiplicity and overlapping of the codes is a unique feature of the Gnomic, language of genetic sequences. The coexisting codes have to be degenerate in various degrees to allow an optimal and concerted performance of all the encoded functions. There is an obvious conflict between the best possible performance of a given function and necessity to compromise the quality of a given sequence pattern in favor of other patterns. It appears that the major role of various changes in the sequences on their ``ontogenetic'' way from DNA to RNA to protein, like RNA editing and splicing, or protein post-translational modifications is to resolve such conflicts. New data are presented strongly indicating that the gene splicing is such a device to resolve the conflict between the code of DNA folding in chromatin and the triplet code for protein synthesis.

  8. From expression cloning to gene modeling: The development of Xenopus gene sequence resources

    PubMed Central

    Gilchrist, Michael J

    2012-01-01

    The Xenopus community has made concerted efforts over the last 10–12 years systematically to improve the available sequence information for this amphibian model organism ideally suited to the study of early development in vertebrates. Here I review progress in the collection of both sequence data and physical clone reagents for protein coding genes. I conclude that we have cDNA sequences for around 50% and full-length clones for about 35% of the genes in Xenopus tropicalis, and similar numbers but a smaller proportion for Xenopus laevis. In addition, I demonstrate that the gaps in the current genome assembly create problems for the computational elucidation of gene sequences, and suggest some ways to ameliorate the effects of this. genesis 50:143–154, 2012. © 2012 Wiley Periodicals, Inc. PMID:22344767

  9. Alternative promoter usage and differential expression of multiple transcripts of mouse Prkar1a gene.

    PubMed

    Banday, Abdul Rouf; Azim, Shafquat; Tabish, Mohammad

    2011-11-01

    Prkar1a gene encodes regulatory type 1 alpha subunit (RIα) of cAMP-dependent protein kinase (PKA) in mouse. The role of this gene has been implicated in Carney complex and many cancer types that suggest its involvement in physiological processes like cell cycle regulation, growth and/or proliferation. We have identified and sequenced partial cDNA clones encoding four alternatively spliced transcripts of mouse Prkar1a gene. These transcripts have alternate 5' UTR structure which results from splicing of three exons (designated as E1a, E1b, and E1c) to canonical exon 2. The designated transcripts T1, T2, T3, and T4 contain 5' UTR exons as E1c, E1a + E1b, E1a, and E1b, respectively. The transcript T1 corresponded to earlier reported transcript in GenBank. In silico study of genomic DNA sequence revealed three distinct promoter regions namely, P1, P2, and P3 upstream of the exons E1a, E1b, and E1c, respectively. P1 is non-CpG-related promoter but P2 and P3 are CpG-related promoters; however, all three are TATA less. RT-PCR analysis demonstrated the expression of all four transcripts in late postnatal stages; however, these were differentially regulated in early postnatal stages of 0.5 day, 3 day, and 15 day mice in different tissue types. Variations in expression of Prkar1a gene transcripts suggest their regulation from multiple promoters that respond to a variety of signals arising in or out of the cell in tissue and developmental stage-specific manner. PMID:21638026

  10. Arabidopsis meiotic crossover hotspots overlap with H2A.Z nucleosomes at gene promoters

    PubMed Central

    Choi, Kyuha; Zhao, Xiaohui; Kelly, Krystyna A.; Venn, Oliver; Higgins, James D.; Yelina, Nataliya E.; Hardcastle, Thomas J.; Ziolkowski, Piotr A.; Copenhaver, Gregory P.; Franklin, F. Chris H.; McVean, Gil; Henderson, Ian R.

    2013-01-01

    PRDM9 directs human meiotic crossover hotspots to intergenic sequence motifs, whereas budding yeast hotspots overlap low nucleosome density regions in gene promoters. To investigate hotspots in plants, which lack PRDM9, we used coalescent analysis of Arabidopsis genetic variation. Crossovers increase towards gene promoters and terminators, and hotspots are associated with active chromatin modifications, including H2A.Z, histone H3K4me3, low nucleosome density and low DNA methylation. Hotspot-enriched A-rich and CTT-repeat DNA motifs occur upstream and downstream of transcriptional start respectively. Crossovers are asymmetric around promoters and highest over CTT-motifs and H2A.Z-nucleosomes. Pollen-typing, segregation and cytogenetic analysis show decreased crossovers in the arp6 H2A.Z deposition mutant, at multiple scales. During meiosis H2A.Z and DMC1/RAD51 recombinases form overlapping chromosomal foci. As arp6 reduces DMC1/RAD51 foci, H2A.Z may promote formation or processing of meiotic DNA double-strand breaks. We propose that gene chromatin ancestrally designates hotspots within eukaryotes and PRDM9 is a derived state within vertebrates. PMID:24056716

  11. A characterization of the elements comprising the promoter of the mouse ribosomal protein gene RPS16.

    PubMed

    Hariharan, N; Perry, R P

    1989-07-11

    The elements comprising the mouse rpS16 promoter were characterized by transfection experiments with mutant genes in which various portions of the 5' flanking region and exon I were removed or substituted with extraneous DNA sequence. These experiments were carried out with otherwise intact rpS16 genes transfected into monkey kidney (COS) cells and also with chimeric rpS16-CAT gene constructs transfected into mouse plasmacytoma cells and COS cells. The locations of the functionally important elements were generally correlated with the locations of binding sites for specific nuclear factors, which were identified by gel-mobility shift analyses and methylation interference footprints. The most upstream element, which is located approximately 165 bp from the cap site, binds the Sp1 transcription factor and augments the promoter activity by 2 to 2.5-fold. In addition, there is a complex bipartite element in the -83 to -59 region, an element in the -37 to -12 region and an element in the +9 to +29 region of exon I, all of which are essential for rpS16 expression. The rpS16 promoter has a general architecture that resembles other mouse rp promoters; however, it also possesses some distinctive characteristics. PMID:2762128

  12. Determination of the promoter region of an early vaccinia virus gene encoding thymidine kinase.

    PubMed

    Weir, J P; Moss, B

    1987-05-01

    Nine recombinant vaccinia viruses that contain overlapping segments of the putative promoter region of the vaccinia virus thymidine kinase (TK) gene linked to DNA coding for the prokaryotic enzyme chloramphenicol acetyltransferase (CAT) were constructed. In each case, the RNA start site and 5 bp of DNA downstream were retained. No significant difference in CAT expression occurred as the deletion was extended from 352 to 32 bp before the RNA start site. Deletion of a further 10 bp, however, led to complete cessation of early promoter activity. Primer extension analysis of the 5' ends of the transcripts verified that the natural TK RNA start site was still used when only 32 bp of upstream DNA remained. Loss of early promoter activity was previously found when deletions were extended from 31 to 24 bp before the RNA start site of another vaccinia gene that is expressed constitutively throughout infection (M.A. Cochran, C. Puckett, and B. Moss, 1985, Proc. Natl. Acad. Sci. USA 82, 19-23). Sequence similarities in the promoter regions of these two genes were noted.

  13. Division genes in Escherichia coli are expressed coordinately to cell septum requirements by gearbox promoters.

    PubMed

    Aldea, M; Garrido, T; Pla, J; Vicente, M

    1990-11-01

    The cell division ftsQAZ cluster and the ftsZ-dependent bolA morphogene of Escherichia coli are found to be driven by gearboxes, a distinct class of promoters characterized by showing an activity that is inversely dependent on growth rate. These promoters contain specific sequences upstream from the mRNA start point, and their -10 region is essential for the inverse growth rate dependence. Gearbox promoters are essential for driving ftsQAZ and bolA gene expression so that the encoded products are synthesized at constant amounts per cell independently of cell size. This mode of regulation would be expected for the expression of proteins that either play a regulatory role in cell division or form a stoichiometric component of the septum, a structure that, independently of cell size and growth rate, is produced once per cell cycle.

  14. Isolation and sequence analysis of the gene (cpdB) encoding periplasmic 2',3'-cyclic phosphodiesterase.

    PubMed Central

    Liu, J; Burns, D M; Beacham, I R

    1986-01-01

    The cpdB gene encodes a periplasmic 2',3'-cyclic phosphodiesterase (3'-nucleotidase). This enzyme has been purified previously and the gene is located at 96 min on the Escherichia coli chromosome. In this study the cpdB gene was cloned from ClaI-cleaved DNA, and the gene product was identified. DNA blotting experiments showed that the recombinant plasmid contains a deletion with respect to the expected genomic fragment of approximately 4 kilobases, which extends into the vector. Furthermore, the gene was absent from three other recombinant libraries. Together, these findings suggest the presence in the genome of an adjacent gene whose product is lethal when it is present on a multicopy plasmid. The nucleotide sequence of the cpdB gene was also determined. The 5' and 3' untranslated sequences contain characteristic sequences that are involved in the initiation and termination of transcription, including two possible promoters, one of which may contain two overlapping -10 sequences. A strong Shine-Dalgarno sequence is followed by an open reading frame which corresponds to a protein having a molecular weight of 70,954. The first 19 amino acid residues have the characteristics of a signal peptide. The 3' untranslated sequence contains two putative rho-independent transcription terminators having low thermodynamic stability. Images PMID:3005231

  15. Molecular cloning, sequencing analysis, and chromosomal localization of the human protease inhibitor 4 (Kallistatin) gene (P14)

    SciTech Connect

    Chai, K.X.; Chao, J.; Chao, L.; Ward, D.C.

    1994-09-15

    The gene encoding human protease inhibitor 4 (kallistatin; gene symbol PI4), a novel serine proteinase inhibitor (serpin), has been isolated and completely sequenced. The kallistatin gene is 9618 bp in length and contains five exons and four introns. The structure and organization of the kallistatin gene are similar to those of the genes encoding {alpha}{sub 1}-antichymotrypsin. The kallistatin gene is also similar to the genes encoding rat and mouse kallikrein-binding proteins. The first exon of the kallistatin gene is a noncoding 89-bp fragment, as determined by primer extension. The fifth exon, which contains 308 bp of noncoding sequence, encodes the reactive center of kallistatin. In the 5`-flanking region of the kallistatin gene, 1125 bp have been sequenced and a consensus promoter segment with potential transcription regulatory sites, including CAAT and TATA boxes, an AP-2 binding site, a GC-rich region, a cAMP response element, and an AP-1 binding site, has been identified within this region. The kallistatin gene was localized by in situ hybridization to human chromosome 14q31-132.1, close to the serpin genes encoding {alpha}{sub 1}-antichymotrypsin, protein C inhibitor, {alpha}{sub 1}-antitrypsin, and corticosteroid-binding globulin. In a genomic DNA Southern blot, kallistatin-related genes were identified in monkey, mouse, rat, bovine, dog, cat, and a ground mole. The patterns of hybridization revealed clues of human serpin evolution. 34 refs., 6 figs.

  16. Nucleotide sequence of Bacillus phage Nf terminal protein gene.

    PubMed Central

    Leavitt, M C; Ito, J

    1987-01-01

    The nucleotide sequence of Bacillus phage Nf gene E has been determined. Gene E codes for phage terminal protein which is the primer necessary for the initiation of DNA replication. The deduced amino acid sequence of Nf terminal protein is approximately 66% homologous with the terminal proteins of Bacillus phages PZA and luminal diameter 29, and shows similar hydropathy and secondary structure predictions. A serine which has been identified as the residue which covalently links the protein to the 5' end of the genome in luminal diameter 29, is conserved in all three phages. The hydropathic and secondary structural environment of this serine is similar in these phage terminal proteins and also similar to the linking serine of adenovirus terminal protein. PMID:3601672

  17. Novel muscle-specific enhancer sequences upstream of the cardiac actin gene.

    PubMed Central

    Biben, C; Kirschbaum, B J; Garner, I; Buckingham, M

    1994-01-01

    A DNase I-hypersensitive site analysis of the 5'-flanking region of the mouse alpha-cardiac actin gene with muscle cell lines derived from C3H mice shows the presence of two such sites, at about -5 and -7 kb. When tested for activity in cultured cells with homologous and heterologous promoters, both sequences act as muscle-specific enhancers. Transcription from the proximal promoter of the alpha-cardiac actin gene is increased 100-fold with either enhancer. The activity of the distal enhancer in C2/7 myotubes is confined to an 800-bp fragment, which contains multiple E boxes. In transfection assays, this sequence does not give detectable transactivation by any of the myogenic factors even though one of the E boxes is functionally important. Bandshift assays showed that MyoD and myogenin can bind to this E box. However, additional sequences are also required for activity. We conclude that in the case of this muscle enhancer, myogenic factors alone are not sufficient to activate transcription either directly via an E box or indirectly through activation of genes encoding other muscle factors. In BALB/c mice, in which cardiac actin mRNA levels are 8- to 10-fold lower, the alpha-cardiac actin locus is perturbed by a 9.5-kb insertion (I. Garner, A. J. Minty, S. Alonso, P. J. Barton, and M. E. Buckingham, EMBO J. 5:2559-2567, 1986). This is located at -6.5 kb, between the two enhancers. The insertion therefore distances the distal enhancer from the promoter and from the proximal enhancer of the bona fide cardiac actin gene, probably thus perturbing transcriptional activity. Images PMID:8164695

  18. Promoter regulatory domain identification of cassava starch synthase IIb gene in transgenic tobacco.

    PubMed

    Guan, Zhihui; Chen, Xin; Xie, Hairong; Wang, Wenquan

    2016-05-01

    Soluble starch synthase is a key enzyme in the starch biosynthesis pathway, and its enzyme activity significantly influences starch components in cassava storage root. However, studies on the regulation mechanism of soluble starch synthase gene are rare. In this study, we cloned the 5' flanking sequence of the MeSSIIb gene and predicted the distribution of cis-elements. The region from -453 to -1 was considered the primary core promoter by the quantitative detection of GUS activity in transgenic tobacco plants containing 5' truncated promoters fused with the GUS gene. Analysis results clarified that the region from -531 to -454 significantly repressed promoter activity. The region from -453 to -388 was a repressive domain of ethylene, and some unknown drought responsive cis-elements were located in the region from -387 to -1. These findings will provide useful information on the functional assay and transcriptional regulation mechanisms of the MeSSIIb gene. PMID:26919397

  19. Full-Length Minor Ampullate Spidroin Gene Sequence

    PubMed Central

    Chen, Gefei; Liu, Xiangqin; Zhang, Yunlong; Lin, Senzhu; Yang, Zijiang; Johansson, Jan; Rising, Anna; Meng, Qing

    2012-01-01

    Spider silk includes seven protein based fibers and glue-like substances produced by glands in the spider's abdomen. Minor ampullate silk is used to make the auxiliary spiral of the orb-web and also for wrapping prey, has a high tensile strength and does not supercontract in water. So far, only partial cDNA sequences have been obtained for minor ampullate spidroins (MiSps). Here we describe the first MiSp full-length gene sequence from the spider species Araneus ventricosus, using a multidimensional PCR approach. Comparative analysis of the sequence reveals regulatory elements, as well as unique spidroin gene and protein architecture including the presence of an unusually large intron. The spliced full-length transcript of MiSp gene is 5440 bp in size and encodes 1766 amino acid residues organized into conserved nonrepetitive N- and C-terminal domains and a central predominantly repetitive region composed of four units that are iterated in a non regular manner. The repeats are more conserved within A. ventricosus MiSp than compared to repeats from homologous proteins, and are interrupted by two nonrepetitive spacer regions, which have 100% identity even at the nucleotide level. PMID:23251707

  20. Understanding mechanisms underlying human gene expression variation with RNA sequencing

    PubMed Central

    Pickrell, Joseph K.; Marioni, John C.; Pai, Athma A.; Degner, Jacob F.; Engelhardt, Barbara E.; Nkadori, Everlyne; Veyrieras, Jean-Baptiste; Stephens, Matthew; Gilad, Yoav; Pritchard, Jonathan K.

    2011-01-01

    Understanding the genetic mechanisms underlying natural variation in gene expression is a central goal of both medical and evolutionary genetics, and studies of expression quantitative trait loci (eQTLs) have become an important tool for achieving this goal1. Although all eQTL studies so far have assayed messenger RNA levels using expression microarrays, recent advances in RNA sequencing enable the analysis of transcript variation at unprecedented resolution. We sequenced RNA from 69 lymphoblastoid cell lines derived from unrelated Nigerian individuals that have been extensively genotyped by the International HapMap Project2. By pooling data from all individuals, we generated a map of the transcriptional landscape of these cells, identifying extensive use of unannotated untranslated regions and more than 100 new putative protein-coding exons. Using the genotypes from the HapMap project, we identified more than a thousand genes at which genetic variation influences overall expression levels or splicing. We demonstrate that eQTLs near genes generally act by a mechanism involving allele-specific expression, and that variation that influences the inclusion of an exon is enriched within and near the consensus splice sites. Our results illustrate the power of high-throughput sequencing for the joint analysis of variation in transcription, splicing and allele-specific expression across individuals. PMID:20220758

  1. Full-length minor ampullate spidroin gene sequence.

    PubMed

    Chen, Gefei; Liu, Xiangqin; Zhang, Yunlong; Lin, Senzhu; Yang, Zijiang; Johansson, Jan; Rising, Anna; Meng, Qing

    2012-01-01

    Spider silk includes seven protein based fibers and glue-like substances produced by glands in the spider's abdomen. Minor ampullate silk is used to make the auxiliary spiral of the orb-web and also for wrapping prey, has a high tensile strength and does not supercontract in water. So far, only partial cDNA sequences have been obtained for minor ampullate spidroins (MiSps). Here we describe the first MiSp full-length gene sequence from the spider species Araneus ventricosus, using a multidimensional PCR approach. Comparative analysis of the sequence reveals regulatory elements, as well as unique spidroin gene and protein architecture including the presence of an unusually large intron. The spliced full-length transcript of MiSp gene is 5440 bp in size and encodes 1766 amino acid residues organized into conserved nonrepetitive N- and C-terminal domains and a central predominantly repetitive region composed of four units that are iterated in a non regular manner. The repeats are more conserved within A. ventricosus MiSp than compared to repeats from homologous proteins, and are interrupted by two nonrepetitive spacer regions, which have 100% identity even at the nucleotide level. PMID:23251707

  2. Cloning, nucleotide sequence, and expression of Achromobacter protease I gene.

    PubMed

    Ohara, T; Makino, K; Shinagawa, H; Nakata, A; Norioka, S; Sakiyama, F

    1989-12-01

    Achromobacter protease I (API) is a lysine-specific serine protease which hydrolyzes specifically the lysyl peptide bond. A gene coding for API was cloned from Achromobacter lyticus M497-1. Nucleotide sequence of the cloned DNA fragment revealed that the gene coded for a single polypeptide chain of 653 amino acids. The N-terminal 205 amino acids, including signal peptide and the threonine/serine-rich C-terminal 180 amino acids are flanking the 268 amino acid-mature protein which was identified by protein sequencing. Escherichia coli carrying a plasmid containing the cloned API gene overproduced and secreted a protein of Mr 50,000 (API') into the periplasm. This protein exhibited a distinct endopeptidase activity specific for lysyl bonds as well. The N-terminal amino acid sequence of API' was the same as mature API, suggesting that the enzyme retained the C-terminal extended peptide chain. The present experiments indicate that API, an extracellular protease produced by gram-negative bacteria, is synthesized in vivo as a precursor protein bearing long extended peptide chains at both N and C termini. PMID:2684982

  3. Integrating bioinformatic resources to predict transcription factors interacting with cis-sequences conserved in co-regulated genes

    PubMed Central

    2014-01-01

    Background Using motif detection programs it is fairly straightforward to identify conserved cis-sequences in promoters of co-regulated genes. In contrast, the identification of the transcription factors (TFs) interacting with these cis-sequences is much more elaborate. To facilitate this, we explore the possibility of using several bioinformatic and experimental approaches for TF identification. This starts with the selection of co-regulated gene sets and leads first to the prediction and then to the experimental validation of TFs interacting with cis-sequences conserved in the promoters of these co-regulated genes. Results Using the PathoPlant database, 32 up-regulated gene groups were identified with microarray data for drought-responsive gene expression from Arabidopsis thaliana. Application of the binding site estimation suite of tools (BEST) discovered 179 conserved sequence motifs within the corresponding promoters. Using the STAMP web-server, 49 sequence motifs were classified into 7 motif families for which similarities with known cis-regulatory sequences were identified. All motifs were subjected to a footprintDB analysis to predict interacting DNA binding domains from plant TF families. Predictions were confirmed by using a yeast-one-hybrid approach to select interacting TFs belonging to the predicted TF families. TF-DNA interactions were further experimentally validated in yeast and with a Physcomitrella patens transient expression system, leading to the discovery of several novel TF-DNA interactions. Conclusions The present work demonstrates the successful integration of several bioinformatic resources with experimental approaches to predict and validate TFs interacting with conserved sequence motifs in co-regulated genes. PMID:24773781

  4. Human retinoblastoma susceptibility gene: cloning, identification, and sequence.

    PubMed

    Lee, W H; Bookstein, R; Hong, F; Young, L J; Shew, J Y; Lee, E Y

    1987-03-13

    Recent evidence indicates the existence of a genetic locus in chromosome region 13q14 that confers susceptibility to retinoblastoma, a cancer of the eye in children. A gene encoding a messenger RNA (mRNA) of 4.6 kilobases (kb), located in the proximity of esterase D, was identified as the retinoblastoma susceptibility (RB) gene on the basis of chromosomal location, homozygous deletion, and tumor-specific alterations in expression. Transcription of this gene was abnormal in six of six retinoblastomas examined: in two tumors, RB mRNA was not detectable, while four others expressed variable quantities of RB mRNA with decreased molecular size of about 4.0 kb. In contrast, full-length RB mRNA was present in human fetal retina and placenta, and in other tumors such as neuroblastoma and medulloblastoma. DNA from retinoblastoma cells had a homozygous gene deletion in one case and hemizygous deletion in another case, while the remainder were not grossly different from normal human control DNA. The gene contains at least 12 exons distributed in a region of over 100 kb. Sequence analysis of complementary DNA clones yielded a single long open reading frame that could encode a hypothetical protein of 816 amino acids. A computer-assisted search of a protein sequence database revealed no closely related proteins. Features of the predicted amino acid sequence include potential metal-binding domains similar to those found in nucleic acid-binding proteins. These results provide a framework for further study of recessive genetic mechanisms in human cancers.

  5. Cloning and sequencing of the major intracellular serine protease gene of Bacillus subtilis.

    PubMed Central

    Koide, Y; Nakamura, A; Uozumi, T; Beppu, T

    1986-01-01

    A Bacillus subtilis 2.7-kilobase DNA fragment containing an intracellular protease gene was cloned into Escherichia coli. The transformants produced an intracellular protease of approximately 35,000 Mr whose activity was inhibited by both phenylmethylsulfonyl fluoride and EDTA. Introduction of the fragment on a multicopy vector, pUB110, into B. subtilis caused a marked increase in the level of the intracellular protease. The nucleotide sequence of the cloned fragment showed the presence of an open reading frame for a possible proenzyme of the major intracellular serine protease (ISP-I) of B. subtilis with an NH2-terminal 17- or 20-amino-acid extension. The total amino acid sequence of the protease deduced from the nucleotide sequence showed considerable homology with that of an extracellular serine protease, subtilisin. The transcriptional initiation site of the ISP-I gene was identified by nuclease S1 mapping. No typical conserved sequence for promoters was found upstream of the open reading frame. An ISP-I-negative mutant of B. subtilis was constructed by integration of artificially deleted gene into the chromosome. The mutant sporulated normally in a nutritionally rich medium but showed decreased sporulation in a synthetic medium. The chloramphenicol resistance determinant of a plasmid integrated at the ISP-I locus was mapped by PBS1 transduction and was found to be closely linked to metC (99.5%). Images PMID:3087947

  6. Cloning, sequencing, and expression of the gene for NADH-sensitive citrate synthase of Pseudomonas aeruginosa.

    PubMed Central

    Donald, L J; Molgat, G F; Duckworth, H W

    1989-01-01

    The structural gene for the allosteric citrate synthase of Pseudomonas aeruginosa has been cloned from a genomic library by using the Escherichia coli citrate synthase gene as a hybridization probe under conditions of reduced stringency. Subcloning of portions of the original 10-kilobase-pair (kbp) clone led to isolation of the structural gene, with its promoter, within a 2,083-bp length of DNA flanked by sites for KpnI and BamHI. The nucleotide sequence of this fragment is presented; the inferred amino acid sequence was 70 and 76% identical, respectively, with the citrate synthase sequences from E. coli and Acinetobacter anitratum, two other gram-negative bacteria. DEAE-cellulose chromatography of P. aeruginosa citrate synthase from an E. coli host harboring the cloned P. aeruginosa gene gave three peaks of activity. All three enzyme peaks had subunit molecular weights of 48,000; the proteins were identical by immunological criteria and very similar in kinetics of substrate saturation and NADH inhibition. Because the cloned gene contained only one open reading frame large enough to encode a polypeptide of such a size, the three peaks must represent different forms of the same protein. A portion of the cloned P. aeruginosa gene was used as a hybridization probe under stringent conditions to identify highly homologous sequences in genomic DNA of a second strain classified as P. aeruginosa and isolates of P. putida, P. stutzeri, and P. alcaligenes. When crude extracts of each of these four isolates were mixed with antiserum raised against purified P. aeruginosa citrate synthase, however, only the P. alcaligenes extract cross-reacted. Images PMID:2507528

  7. Complete genome sequence of Bacillus amyloliquefaciens strain Co1-6, a plant growth-promoting rhizobacterium of Calendula officinalis

    SciTech Connect

    Köberl, Martina; White, Richard A.; Erschen, Sabine; Spanberger, Nora; El-Arabi, Tarek F.; Jansson, Janet K.; Berg, Gabriele

    2015-08-13

    The genome sequence of Bacillus amyloliquefaciens strain Co1-6, a plant growth-promoting rhizobacterium (PGPR) with broad-spectrum antagonistic activity against plant-pathogenic fungi, bacteria, and nematodes, consists of a single 3.9-Mb circular chromosome. The genome reveals genes putatively responsible for its promising biocontrol and PGP properties.

  8. Identification and characterization of rhizospheric microbial diversity by 16S ribosomal RNA gene sequencing

    PubMed Central

    Naveed, Muhammad; Mubeen, Samavia; khan, SamiUllah; Ahmed, Iftikhar; Khalid, Nauman; Suleria, Hafiz Ansar Rasul; Bano, Asghari; Mumtaz, Abdul Samad

    2014-01-01

    In the present study, samples of rhizosphere and root nodules were collected from different areas of Pakistan to isolate plant growth promoting rhizobacteria. Identification of bacterial isolates was made by 16S rRNA gene sequence analysis and taxonomical confirmation on EzTaxon Server. The identified bacterial strains were belonged to 5 genera i.e. Ensifer, Bacillus, Pseudomona, Leclercia and Rhizobium. Phylogenetic analysis inferred from 16S rRNA gene sequences showed the evolutionary relationship of bacterial strains with the respective genera. Based on phylogenetic analysis, some candidate novel species were also identified. The bacterial strains were also characterized for morphological, physiological, biochemical tests and glucose dehydrogenase (gdh) gene that involved in the phosphate solublization using cofactor pyrroloquinolone quinone (PQQ). Seven rhizoshperic and 3 root nodulating stains are positive for gdh gene. Furthermore, this study confirms a novel association between microbes and their hosts like field grown crops, leguminous and non-leguminous plants. It was concluded that a diverse group of bacterial population exist in the rhizosphere and root nodules that might be useful in evaluating the mechanisms behind plant microbial interactions and strains QAU-63 and QAU-68 have sequence similarity of 97 and 95% which might be declared as novel after further taxonomic characterization. PMID:25477935

  9. Identification and characterization of rhizospheric microbial diversity by 16S ribosomal RNA gene sequencing.

    PubMed

    Naveed, Muhammad; Mubeen, Samavia; Khan, SamiUllah; Ahmed, Iftikhar; Khalid, Nauman; Suleria, Hafiz Ansar Rasul; Bano, Asghari; Mumtaz, Abdul Samad

    2014-01-01

    In the present study, samples of rhizosphere and root nodules were collected from different areas of Pakistan to isolate plant growth promoting rhizobacteria. Identification of bacterial isolates was made by 16S rRNA gene sequence analysis and taxonomical confirmation on EzTaxon Server. The identified bacterial strains were belonged to 5 genera i.e. Ensifer, Bacillus, Pseudomona, Leclercia and Rhizobium. Phylogenetic analysis inferred from 16S rRNA gene sequences showed the evolutionary relationship of bacterial strains with the respective genera. Based on phylogenetic analysis, some candidate novel species were also identified. The bacterial strains were also characterized for morphological, physiological, biochemical tests and glucose dehydrogenase (gdh) gene that involved in the phosphate solublization using cofactor pyrroloquinolone quinone (PQQ). Seven rhizoshperic and 3 root nodulating stains are positive for gdh gene. Furthermore, this study confirms a novel association between microbes and their hosts like field grown crops, leguminous and non-leguminous plants. It was concluded that a diverse group of bacterial population exist in the rhizosphere and root nodules that might be useful in evaluating the mechanisms behind plant microbial interactions and strains QAU-63 and QAU-68 have sequence similarity of 97 and 95% which might be declared as novel after further taxonomic characterization.

  10. SIRT1 gene expression upon genotoxic damage is regulated by APE1 through nCaRE-promoter elements

    PubMed Central

    Antoniali, Giulia; Lirussi, Lisa; D'Ambrosio, Chiara; Dal Piaz, Fabrizio; Vascotto, Carlo; Casarano, Elena; Marasco, Daniela; Scaloni, Andrea; Fogolari, Federico; Tell, Gianluca

    2014-01-01

    Apurinic/apyrimidinic endonuclease 1 (APE1) is a multifunctional protein contributing to genome stability via repair of DNA lesions via the base excision repair pathway. It also plays a role in gene expression regulation and RNA metabolism. Another, poorly characterized function is its ability to bind to negative calcium responsive elements (nCaRE) of some gene promoters. The presence of many functional nCaRE sequences regulating gene transcription can be envisioned, given their conservation within ALU repeats. To look for functional nCaRE sequences within the human genome, we performed bioinformatic analyses and identified 57 genes potentially regulated by APE1. We focused on sirtuin-1 (SIRT1) deacetylase due to its involvement in cell stress, including senescence, apoptosis, and tumorigenesis, and its role in the deacetylation of APE1 after genotoxic stress. The human SIRT1 promoter presents two nCaRE elements stably bound by APE1 through its N-terminus. We demonstrate that APE1 is part of a multiprotein complex including hOGG1, Ku70, and RNA Pol II, which is recruited on SIRT1 promoter to regulate SIRT1 gene functions during early response to oxidative stress. These findings provide new insights into the role of nCaRE sequences in the transcriptional regulation of mammalian genes. PMID:24356447

  11. Mapping of a replication origin within the promoter region of two unlinked, abundantly transcribed actin genes of Physarum polycephalum.

    PubMed

    Bénard, M; Lagnel, C; Pallotta, D; Pierron, G

    1996-03-01

    We analyzed the replication of two unlinked actin genes, ardB and ardC , which are abundantly transcribed in the naturally synchronous plasmodium of the slime mold Physarum polycephalum. Detection and size measurements of single-stranded nascent replication intermediates (RIs) demonstrate that these two genes are concomitantly replicated at the onset of the 3-h S phase and tightly linked to replication origins. Appearance of RIs on neutral-neutral two-dimensional gels at specific time points in early S phase and analysis of their structure confirmed these results and further established that, in both cases, an efficient, site-specific, bidirectional origin of replication is localized within the promoter region of the gene. We also determined similar elongation rates for the divergent replication forks of the ardC gene replicon. Finally, taking advantage of a restriction fragment length polymorphism, we studied allelic replicons and demonstrate similar localizations and a simultaneous firing of allelic replication origins. Computer search revealed a low level of homology between the promoters of ardB and ardC and, most notably, the absence of DNA sequences similar to the yeast autonomously replicating sequence consensus sequence in these Physarum origin regions. Our results with the ardB and ardC actin genes support the model of early replicating origins located within the promoter regions of abundantly transcribed genes in P. polycephalum. PMID:8622700

  12. Second-generation sequencing for gene discovery in the Brassicaceae.

    PubMed

    Hayward, Alice; Vighnesh, Guru; Delay, Christina; Samian, Mohd Rafizan; Manoli, Sahana; Stiller, Jiri; McKenzie, Megan; Edwards, David; Batley, Jacqueline

    2012-08-01

    The Brassicaceae contains the most diverse collection of agriculturally important crop species of all plant families. Yet, this is one of the few families that do not form functional symbiotic associations with mycorrhizal fungi in the soil for improved nutrient acquisition. The genes involved in this symbiosis were more recently recruited by legumes for symbiotic association with nitrogen-fixing rhizobia bacteria. This study applied second-generation sequencing (SGS) and analysis tools to discover that two such genes, NSP1 (Nodulation Signalling Pathway 1) and NSP2, remain conserved in diverse members of the Brassicaceae despite the absence of these symbioses. We demonstrate the utility of SGS data for the discovery of putative gene homologs and their analysis in complex polyploid crop genomes with little prior sequence information. Furthermore, we show how this data can be applied to enhance downstream reverse genetics analyses. We hypothesize that Brassica NSP genes may function in the root in other plant-microbe interaction pathways that were recruited for mycorrhizal and rhizobial symbioses during evolution.

  13. Second-generation sequencing for gene discovery in the Brassicaceae.

    PubMed

    Hayward, Alice; Vighnesh, Guru; Delay, Christina; Samian, Mohd Rafizan; Manoli, Sahana; Stiller, Jiri; McKenzie, Megan; Edwards, David; Batley, Jacqueline

    2012-08-01

    The Brassicaceae contains the most diverse collection of agriculturally important crop species of all plant families. Yet, this is one of the few families that do not form functional symbiotic associations with mycorrhizal fungi in the soil for improved nutrient acquisition. The genes involved in this symbiosis were more recently recruited by legumes for symbiotic association with nitrogen-fixing rhizobia bacteria. This study applied second-generation sequencing (SGS) and analysis tools to discover that two such genes, NSP1 (Nodulation Signalling Pathway 1) and NSP2, remain conserved in diverse members of the Brassicaceae despite the absence of these symbioses. We demonstrate the utility of SGS data for the discovery of putative gene homologs and their analysis in complex polyploid crop genomes with little prior sequence information. Furthermore, we show how this data can be applied to enhance downstream reverse genetics analyses. We hypothesize that Brassica NSP genes may function in the root in other plant-microbe interaction pathways that were recruited for mycorrhizal and rhizobial symbioses during evolution. PMID:22765874

  14. Sequence and transcriptional start site of the Pseudomonas aeruginosa outer membrane porin protein F gene.

    PubMed Central

    Duchêne, M; Schweizer, A; Lottspeich, F; Krauss, G; Marget, M; Vogel, K; von Specht, B U; Domdey, H

    1988-01-01

    Porin F is one of the major proteins of the outer membrane of Pseudomonas aeruginosa. It forms water-filled pores of variable size. Porin F is a candidate for a vaccine against P. aeruginosa because it antigenically cross-reacts in all serotype strains of the International Antigenic Typing Scheme. We have isolated the gene for porin F from a lambda EMBL3 bacteriophage library by using oligodeoxynucleotide hybridization probes and have determined its nucleotide sequence. Different peptide sequences obtained from isolated porin F confirmed the deduced protein sequence. The mature protein consists of 326 amino acid residues and has a molecular weight of 35,250. The precursor contains an N-terminal signal peptide of 24 amino acid residues. S1 protection and primer extension experiments, together with Northern (RNA) blots, indicate that the mRNA coding for porin F is monocistronic with short untranslated regions of about 58 bases at the 5' end and about 47 bases at the 3' end. The sequences in the -10 and -35 regions upstream of the transcriptional start site are closely related to the Escherichia coli promoter consensus sequences, which explains why the porin F gene is expressed in E. coli under the control of its own promoter. The amino acid sequence of porin F is not homologous to the different E. coli porins OmpF, OmpC, LamB, and PhoE. On the other hand, a highly homologous region of 30 amino acids between the OmpA proteins of different enteric bacteria and porin F of P. aeruginosa was detected. The core region of the homology to E. coli OmpA had 11 of 12 amino acid residues in common. Images PMID:2447060

  15. Cloning and sequencing the genes encoding goldfish and carp ependymin.

    PubMed

    Adams, D S; Shashoua, V E

    1994-04-20

    Ependymins (EPNs) are brain glycoproteins thought to function in optic nerve regeneration and long-term memory consolidation. To date, epn genes have been characterized in two orders of teleost fish. In this study, polymerase chain reactions (PCR) were used to amplify the complete 1.6-kb epn genes, gf-I and cc-I, from genomic DNA of Cypriniformes, goldfish and carp, respectively. Amplified bands were cloned and sequenced. Each gene consists of six exons and five introns. The exon portion of gf-I encodes a predicted 215-amino-acid (aa) protein previously characterized as GF-I, while cc-I encodes a predicted 215-aa protein 95% homologous to GF-I.

  16. Characterization of type IV pilus genes in plant growth-promoting Pseudomonas putida WCS358.

    PubMed Central

    de Groot, A; Heijnen, I; de Cock, H; Filloux, A; Tommassen, J

    1994-01-01

    In a search for factors that could contribute to the ability of the plant growth-stimulating Pseudomonas putida WCS358 to colonize plant roots, the organism was analyzed for the presence of genes required for pilus biosynthesis. The pilD gene of Pseudomonas aeruginosa, which has also been designated xcpA, is involved in protein secretion and in the biogenesis of type IV pili. It encodes a peptidase that processes the precursors of the pilin subunits and of several components of the secretion apparatus. Prepilin processing activity could be demonstrated in P. putida WCS358, suggesting that this nonpathogenic strain may contain type IV pili as well. A DNA fragment containing the pilD (xcpA) gene of P. putida was cloned and found to complement a pilD (xcpA) mutation in P. aeruginosa. Nucleotide sequencing revealed, next to the pilD (xcpA) gene, the presence of two additional genes, pilA and pilC, that are highly homologous to genes involved in the biogenesis of type IV pili. The pilA gene encodes the pilin subunit, and pilC is an accessory gene, required for the assembly of the subunits into pili. In comparison with the pil gene cluster in P. aeruginosa, a gene homologous to pilB is lacking in the P. putida gene cluster. Pili were not detected on the cell surface of P. putida itself, not even when pilA was expressed from the tac promoter on a plasmid, indicating that not all the genes required for pilus biogenesis were expressed under the conditions tested. Expression of pilA of P. putida in P. aeruginosa resulted in the production of pili containing P. putida PilA subunits. Images PMID:7905475

  17. Modifications to the INSM1 promoter to preserve specificity and activity for use in adenoviral gene therapy of neuroendocrine carcinomas.

    PubMed

    Akerstrom, V; Chen, C; Lan, M S; Breslin, M B

    2012-12-01

    The INSM1 gene encodes a transcriptional repressor that is exclusively expressed in neuronal and neuroendocrine tissue during embryonic development that is re-activated in neuroendocrine tumors. Using the 1.7 kbp INSM1 promoter, an adenoviral HSV thymidine kinase gene therapy was tested for the treatment of neuroendocrine tumors. An unforeseen interference on the INSM1 promoter specificity from the adenoviral genome was observed. Attempts were made to protect the INSM1 promoter from the influence of essential adenoviral sequences and to further enhance the tissue specificity of the INSM1 promoter region. Using the chicken β-globin HS4 insulator sequence, we eliminated off-target tissue expression from the Ad-INSM1 promoter-luciferase2 constructs in vivo. In addition, inclusion of two copies of the mouse nicotinic acetylcholine receptor (n(AchR)) neuronal-restrictive silencer element (NRSE) reduced nonspecific activation of the INSM1 promoter both in vitro and in vivo. Further, inclusion of both the HS4 insulator with the n(AchR) 2 × NRSE modification showed a two log increase in luciferase activity measured from the NCI-H1155 xenograft tumors compared with the original adenovirus construct. The alterations increase the therapeutic potential of adenoviral INSM1 promoter-driven suicide gene therapy for the treatment of a variety of neuroendocrine tumors. PMID:23079673

  18. Analysis of the sexual development-promoting region of Schizophyllum commune TRP1 gene.

    PubMed

    Sen, Kikuo; Kinoshita, Hideki; Tazuke, Kazuyuki; Maki, Yoshinori; Yoshiura, Yumi; Yakushi, Toshiharu; Shibai, Hiroshiro; Kurosawa, Shin-Ichi

    2016-10-01

    This study aims to elucidate the mechanism of sexual development of basidiomycetous mushrooms from mating to fruit body formation. Sequencing analysis showed the TRP1 gene of basidiomycete Schizophyllum commune encoded an enzyme with three catalytic regions of GAT (glutamine amidotransferase), IGPS (indole-3-glycerol phosphate synthase), and PRAI (5-phosphoribosyl anthranilate isomerase); among these three regions, the trp1 mutant (Trp(-)) had a missense mutation (L→F) of a 338th amino acid residue of the TRP1 protein within the IGPS region. To investigate the function of IGPS region related to sexual development, dikaryons with high, usual, and no expression of the IGPS region of TRP1 gene were made. The dikaryotic mycelia with high expression of the IGPS formed mature fruit bodies earlier than those with usual and no expression of the IGPS. These results showed that the IGPS region in TRP1 gene promoted sexual development of S. commune. PMID:27296855

  19. Analysis of the sexual development-promoting region of Schizophyllum commune TRP1 gene.

    PubMed

    Sen, Kikuo; Kinoshita, Hideki; Tazuke, Kazuyuki; Maki, Yoshinori; Yoshiura, Yumi; Yakushi, Toshiharu; Shibai, Hiroshiro; Kurosawa, Shin-Ichi

    2016-10-01

    This study aims to elucidate the mechanism of sexual development of basidiomycetous mushrooms from mating to fruit body formation. Sequencing analysis showed the TRP1 gene of basidiomycete Schizophyllum commune encoded an enzyme with three catalytic regions of GAT (glutamine amidotransferase), IGPS (indole-3-glycerol phosphate synthase), and PRAI (5-phosphoribosyl anthranilate isomerase); among these three regions, the trp1 mutant (Trp(-)) had a missense mutation (L→F) of a 338th amino acid residue of the TRP1 protein within the IGPS region. To investigate the function of IGPS region related to sexual development, dikaryons with high, usual, and no expression of the IGPS region of TRP1 gene were made. The dikaryotic mycelia with high expression of the IGPS formed mature fruit bodies earlier than those with usual and no expression of the IGPS. These results showed that the IGPS region in TRP1 gene promoted sexual development of S. commune.

  20. Isolation and Analysis of the Cppsy Gene and Promoter from Chlorella protothecoides CS-41.

    PubMed

    Li, Meiya; Cui, Yan; Gan, Zhibing; Shi, Chunlei; Shi, Xianming

    2015-10-28

    Phytoene synthase (PSY) catalyzes the condensation of two molecules of geranylgeranyl pyrophosphate to form phytoene, the first colorless carotene in the carotenoid biosynthesis pathway. So it is regarded as the crucial enzyme for carotenoid production, and has unsurprisingly been involved in genetic engineering studies of carotenoid production. In this study, the psy gene from Chlorella protothecoides CS-41, designated Cppsy, was cloned using rapid amplification of cDNA ends. The full-length DNA was 2488 bp, and the corresponding cDNA was 1143 bp, which encoded 380 amino acids. Computational analysis suggested that this protein belongs to the Isoprenoid_Biosyn_C1 superfamily. It contained the consensus sequence, including three predicted substrate-Mg(2+) binding sites. The Cppsy gene promoter was also cloned and characterized. Analysis revealed several candidate motifs for the promoter, which exhibited light- and methyl jasmonate (MeJA)-responsive characteristics, as well as some typical domains universally discovered in promoter sequences, such as the TATA-box and CAAT-box. Light- and MeJA treatment showed that the Cppsy expression level was significantly enhanced by light and MeJA. These results provide a basis for genetically modifying the carotenoid biosynthesis pathway in C. protothecoides.

  1. Isolation and Analysis of the Cppsy Gene and Promoter from Chlorella protothecoides CS-41

    PubMed Central

    Li, Meiya; Cui, Yan; Gan, Zhibing; Shi, Chunlei; Shi, Xianming

    2015-01-01

    Phytoene synthase (PSY) catalyzes the condensation of two molecules of geranylgeranyl pyrophosphate to form phytoene, the first colorless carotene in the carotenoid biosynthesis pathway. So it is regarded as the crucial enzyme for carotenoid production, and has unsurprisingly been involved in genetic engineering studies of carotenoid production. In this study, the psy gene from Chlorella protothecoides CS-41, designated Cppsy, was cloned using rapid amplification of cDNA ends. The full-length DNA was 2488 bp, and the corresponding cDNA was 1143 bp, which encoded 380 amino acids. Computational analysis suggested that this protein belongs to the Isoprenoid_Biosyn_C1 superfamily. It contained the consensus sequence, including three predicted substrate-Mg2+ binding sites. The Cppsy gene promoter was also cloned and characterized. Analysis revealed several candidate motifs for the promoter, which exhibited light- and methyl jasmonate (MeJA)-responsive characteristics, as well as some typical domains universally discovered in promoter sequences, such as the TATA-box and CAAT-box. Light- and MeJA treatment showed that the Cppsy expression level was significantly enhanced by light and MeJA. These results provide a basis for genetically modifying the carotenoid biosynthesis pathway in C. protothecoides. PMID:26516871

  2. Genetic and functional analysis of the von Hippel-Lindau (VHL) tumour suppressor gene promoter

    PubMed Central

    Zatyka, M; Morrissey, C; Kuzmin, I; Lerman, M; Latif, F; Richards, F; Maher, E

    2002-01-01

    The VHL gatekeeper tumour suppressor gene is inactivated in the familial cancer syndrome von Hippel-Lindau disease and in most sporadic clear cell renal cell carcinomas. Recently the VHL gene product has been identified as a specific component of a SCF-like complex, which regulates proteolytic degradation of the hypoxia inducible transcription factors HIF-1 and HIF-2. pVHL is critical for normal development and mRNA expression studies suggest a role in nephrogenesis. Despite the importance of VHL in oncogenesis and development, little is known about the regulation of VHL expression. To investigate VHL promoter activity, we performed comparative sequence analysis of human, primate, and rodent 5‘ VHL sequences. We then proceeded to deletion analysis of regions showing significant evolutionary conservation between human and rat promoter sequences, and defined two positive and one negative regulatory regions. Analysis of specific putative transcription factor binding sites identified a functional Sp1 site, which was shown to be a regulatory element. Overlapping Sp1/AP2 sites were also identified and candidate E2F1 binding sites evaluated. Three binding sites for as yet unidentified transcription factors were mapped also. These investigations provide a basis for elucidating the regulation of VHL expression in development, the molecular pathology of epigenetic silencing of VHL in tumourigenesis, and suggest a possible link between Sp1, VHL, and nephrogenesis. PMID:12114475

  3. Novel polymorphisms of the APOA2 gene and its promoter region affect body traits in cattle.

    PubMed

    Zhou, Yang; Li, Caixia; Cai, Hanfang; Xu, Yao; Lan, Xianyong; Lei, Chuzhao; Chen, Hong

    2013-12-01

    Apolipoprotein A-II (APOA2) is one of the major constituents of high-density lipoprotein and plays a critical role in lipid metabolism and obesity. However, similar research for the bovine APOA2 gene is lacking. In this study, polymorphisms of the bovine APOA2 gene and its promoter region were detected in 1021 cows from four breeds by sequencing and PCR-RFLP methods. Totally, we detected six novel mutations which included one mutation in the promoter region, two mutations in the exons and three mutations in the introns. There were four polymorphisms within APOA2 gene were analyzed. The allele A, T, T and G frequencies of the four loci were predominant in the four breeds when in separate or combinations analysis which suggested cows with those alleles to be more adapted to the steppe environment. The association analysis indicated three SVs in Nangyang cows, two SVs in Qinchun cows and the 9 haplotypes in Nangyang cows were significantly associated with body traits (P<0.05 or P<0.01). The results of this study suggested the bovine APOA2 gene may be a strong candidate gene for body traits in the cattle breeding program. PMID:24004543

  4. Mapping and validation of Xanthomonas citri subsp citri genes regulated by putative plant-inducible promoter box (PIP-box).

    PubMed

    Carvalho, F M S; Oliveira, J C F; Laia, M L; Jacob, T R; Ferreira, R M; Ferro, M I T; Tezza, R I D; Zingaretti, S M; Silva, C F; Ferro, J A

    2016-01-01

    Citrus canker, caused by the Gram-negative bacterium Xanthomonas citri subsp citri (Xac), is a major disease affecting citriculture worldwide, because of the susceptibility of the host and the lack of efficient control methods. Previous studies have reported that some genes of phytopathogenic bacteria possess a consensus nucleotide sequence (TTCGC...N15...TTCGC) designated the "plant-inducible-promoter box" (PIP box) located in the promoter region, which is responsible for activating the expression of pathogenicity and virulence factors when the pathogen is in contact with the host plant. In this study, we mapped and investigated the expression of 104 Xac genes associated with the PIP box sequences using a macroarray analysis. Xac gene expression was observed during in vitro (Xac grown for 12 or 20 h in XAM1 induction medium) or in vivo (bacteria grown in orange leaves for 3 to 5 days) infection conditions. Xac grown in non-induction NB liquid medium was used as the control. cDNA was isolated from bacteria grown under the different conditions and hybridized to the macroarray, and 32 genes differentially expressed during the infection period (in vitro or in vivo induction) were identified. The macroarray results were validated for some of the genes through semi-quantitative RT-PCR, and the functionality of the PIP box-containing promoter was demonstrated by activating b-glucuronidase reporter gene activity by the PIP box-containing promoter region during Xac-citrus host interaction. PMID:27173329

  5. araB Gene and nucleotide sequence of the araC gene of Erwinia carotovora.

    PubMed Central

    Lei, S P; Lin, H C; Heffernan, L; Wilcox, G

    1985-01-01

    The araB and araC genes of Erwinia carotovora were expressed in Escherichia coli and Salmonella typhimurium. The araB and araC genes in E. coli, E. carotovora, and S. typhimurium were transcribed in divergent directions. In E. carotovora, the araB and araC genes were separated by 3.5 kilobase pairs, whereas in E. coli and S. typhimurium they were separated by 147 base pairs. The nucleotide sequence of the E. carotovora araC gene was determined. The predicted sequence of AraC protein of E. carotovora was 18 and 29 amino acids longer than that of AraC protein of E. coli and S. typhimurium, respectively. The DNA sequence of the araC gene of E. carotovora was 58% homologous to that of E. coli and 59% homologous to that of S. typhimurium, with respect to the common region they share. The predicted amino acid sequence of AraC protein was 57% homologous to that of E. coli and 58% homologous to that of S. typhimurium. The 5' noncoding regions of the araB and araC genes of E. carotovora had little homology to either of the other two species. Images PMID:3902795

  6. Gene promoter of apoptosis inhibitory protein IAP2: identification of enhancer elements and activation by severe hypoxia.

    PubMed Central

    Dong, Zheng; Nishiyama, Junichiro; Yi, Xiaolan; Venkatachalam, Manjeri A; Denton, Michael; Gu, Sumin; Li, Senlin; Qiang, Mei

    2002-01-01

    Inhibitors of apoptosis (IAPs) antagonize cell death and regulate the cell cycle. One mechanism controlling IAP expression is translation initiation through the internal ribosome entry sites. Alternatively, IAP expression can be regulated at the transcription level. We showed recently the activation of IAP2 transcription by severe hypoxia. To pursue this regulation, we have cloned the full-length cDNA of rat IAP2, and have isolated and analysed the promoter regions of this gene. The cDNA encodes a protein of 589 amino acids, exhibiting structural features of IAP. In rat tissues, a major IAP2 transcript of approximately 3.5 kb was detected. We subsequently isolated 3.3 kb of the proximal 5'-flanking regions of this gene, which showed significant promoter activity. Of interest, 5' sequential deletion of the promoter sequence identified an enhancer of approximately 200 bp. Deletion of cAMP-response-element-binding protein (CREB) sites in the enhancer sequence diminished its activity. Finally, the IAP2 gene promoter was activated significantly by severe hypoxia and not by CoCl(2) or desferrioxamine, pharmacological inducers of hypoxia-inducible factor-1. In conclusion, in this study we have cloned the full-length cDNA of rat IAP2, and for the first time we have isolated and analysed promoter sequences of this gene, leading to the identification of enhancer elements. Moreover, we have demonstrated activation of the gene promoter by severe hypoxia, a condition shown to induce IAP2. These findings provide a basis for further investigation of gene regulation of IAP2, a protein with multiple functions. PMID:12023884

  7. Complete Genome Sequence of the Rhizobacterium Pseudomonas trivialis Strain IHBB745 with Multiple Plant Growth-Promoting Activities and Tolerance to Desiccation and Alkalinity

    PubMed Central

    Swarnkar, Mohit Kumar; Vyas, Pratibha; Rahi, Praveen; Thakur, Rishu; Thakur, Namika; Singh, Anil Kumar

    2015-01-01

    The complete genome sequence of 6.45 Mb is reported here for Pseudomonas trivialis strain IHBB745 (MTCC 5336), which is an efficient, stress-tolerant, and broad-spectrum plant growth-promoting rhizobacterium. The gene-coding clusters predicted the genes for phosphate solubilization, siderophore production, 1-aminocyclopropane-1-carboxylate (ACC) deaminase activity, indole-3-acetic acid (IAA) production, and stress response. PMID:26337878

  8. Complete Genome Sequence of the Rhizobacterium Pseudomonas trivialis Strain IHBB745 with Multiple Plant Growth-Promoting Activities and Tolerance to Desiccation and Alkalinity.

    PubMed

    Gulati, Arvind; Swarnkar, Mohit Kumar; Vyas, Pratibha; Rahi, Praveen; Thakur, Rishu; Thakur, Namika; Singh, Anil Kumar

    2015-01-01

    The complete genome sequence of 6.45 Mb is reported here for Pseudomonas trivialis strain IHBB745 (MTCC 5336), which is an efficient, stress-tolerant, and broad-spectrum plant growth-promoting rhizobacterium. The gene-coding clusters predicted the genes for phosphate solubilization, siderophore production, 1-aminocyclopropane-1-carboxylate (ACC) deaminase activity, indole-3-acetic acid (IAA) production, and stress response. PMID:26337878

  9. Interaction of CCAAT/enhancer-binding protein alpha and beta with the rat caeruloplasmin gene promoter.

    PubMed Central

    Bingle, C D; Fleming, R E; Gitlin, J D

    1993-01-01

    To determine the mechanisms of expression of the rat caeruloplasmin gene, the promoter region was analysed by DNAase I footprinting. Using nuclear extract from rat liver, a prominent site of protein-DNA interaction was detected from -93 to -48 upstream of the caeruloplasmin gene transcription start and sequence analysis of this region revealed three potential CCAAT/enhancer-binding protein (C/EBP) consensus elements. Mobility-shift analysis using an oligonucleotide encoding this region identified specific binding of proteins from rat liver nuclear extract, and some of these complexes were supershifted using antisera to the C/EBP alpha and beta family members. Mobility-shift studies using a polypeptide encoding the DNA-binding domain of C/EBP alpha also revealed a specific interaction with this region of the caeruloplasmin promoter, and DNAase I footprinting using this polypeptide protected the identical region from -93 to -48. Co-transfection of expression plasmids encoding C/EBP alpha or a related leucine-zipper factor D-binding protein (DBP) revealed a C/EBP-specific increase in reporter gene activity in HepG2 cells transfected with caeruloplasmin-chloramphenicol acetyltransferase containing the -93 to -48 region. A similar result was obtained when these constructs were co-transfected into mouse L cells which were shown not to express the endogenous caeruloplasmin gene. Taken together, these data indicate a role for C/EBP alpha and beta in mediating transcription from the caeruloplasmin gene promoter and suggest that this region of the promoter is not responsible for tissue-specific expression. Images Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 PMID:8373362

  10. Detection and sequence analysis of accessory gene regulator genes of Staphylococcus pseudintermedius isolates

    PubMed Central

    Chitra, M. Ananda; Jayanthy, C.; Nagarajan, B.

    2015-01-01

    Background: Staphylococcus pseudintermedius (SP) is the major pathogenic species of dogs involved in a wide variety of skin and soft tissue infections. The accessory gene regulator (agr) locus of Staphylococcus aureus has been extensively studied, and it influences the expression of many virulence genes. It encodes a two-component signal transduction system that leads to down-regulation of surface proteins and up-regulation of secreted proteins during in vitro growth of S. aureus. The objective of this study was to detect and sequence analyzing the AgrA, B, and D of SP isolated from canine skin infections. Materials and Methods: In this study, we have isolated and identified SP from canine pyoderma and otitis cases by polymerase chain reaction (PCR) and confirmed by PCR-restriction fragment length polymorphism. Primers for SP agrA and agrBD genes were designed using online primer designing software and BLAST searched for its specificity. Amplification of the agr genes was carried out for 53 isolates of SP by PCR and sequencing of agrA, B, and D were carried out for five isolates and analyzed using DNAstar and Mega5.2 software. Results: A total of 53 (59%) SP isolates were obtained from 90 samples. 15 isolates (28%) were confirmed to be methicillin-resistant SP (MRSP) with the detection of the mecA gene. Accessory gene regulator A, B, and D genes were detected in all the SP isolates. Complete nucleotide sequences of the above three genes for five isolates were submitted to GenBank, and their accession numbers are from KJ133557 to KJ133571. AgrA amino acid sequence analysis showed that it is mainly made of alpha-helices and is hydrophilic in nature. AgrB is a transmembrane protein, and AgrD encodes the precursor of the autoinducing peptide (AIP). Sequencing of the agrD gene revealed that the 5 canine SP strains tested could be divided into three Agr specificity groups (RIPTSTGFF, KIPTSTGFF, and RIPISTGFF) based on the putative AIP produced by each strain. The AIP of

  11. Tetrachloroethene Dehalogenase from Dehalospirillum multivorans: Cloning, Sequencing of the Encoding Genes, and Expression of the pceA Gene in Escherichia coli

    PubMed Central

    Neumann, Anke; Wohlfarth, Gert; Diekert, Gabriele

    1998-01-01

    The genes encoding tetrachloroethene reductive dehalogenase, a corrinoid-Fe/S protein, of Dehalospirillum multivorans were cloned and sequenced. The pceA gene is upstream of pceB and overlaps it by 4 bp. The presence of a ς70-like promoter sequence upstream of pceA and of a ρ-independent terminator downstream of pceB indicated that both genes are cotranscribed. This assumption is supported by reverse transcriptase PCR data. The pceA and pceB genes encode putative 501- and 74-amino-acid proteins, respectively, with calculated molecular masses of 55,887 and 8,354 Da, respectively. Four peptides obtained after trypsin treatment of tetrachloroethene (PCE) dehalogenase were found in the deduced amino acid sequence of pceA. The N-terminal amino acid sequence of the PCE dehalogenase isolated from D. multivorans was found 30 amino acids downstream of the N terminus of the deduced pceA product. The pceA gene contained a nucleotide stretch highly similar to binding motifs for two Fe4S4 clusters or for one Fe4S4 cluster and one Fe3S4 cluster. A consensus sequence for the binding of a corrinoid was not found in pceA. No significant similarities to genes in the databases were detected in sequence comparisons. The pceB gene contained two membrane-spanning helices as indicated by two hydrophobic stretches in the hydropathic plot. Sequence comparisons of pceB revealed no sequence similarities to genes present in the databases. Only in the presence of pUBS 520 supplying the recombinant bacteria with high levels of the rare Escherichia coli tRNA4Arg was pceA expressed, albeit nonfunctionally, in recombinant E. coli BL21 (DE3). PMID:9696761

  12. Technology development for gene discovery and full-length sequencing

    SciTech Connect

    Marcelo Bento Soares

    2004-07-19

    In previous years, with support from the U.S. Department of Energy, we developed methods for construction of normalized and subtracted cDNA libraries, and constructed hundreds of high-quality libraries for production of Expressed Sequence Tags (ESTs). Our clones were made widely available to the scientific community through the IMAGE Consortium, and millions of ESTs were produced from our libraries either by collaborators or by our own sequencing laboratory at the University of Iowa. During this grant period, we focused on (1) the development of a method for preferential cloning of tissue-specific and/or rare transcripts, (2) its utilization to expedite EST-based gene discovery for the NIH Mouse Brain Molecular Anatomy Project, (3) further development and optimization of a method for construction of full-length-enriched cDNA libraries, and (4) modification of a plasmid vector to maximize efficiency of full-length cDNA sequencing by the transposon-mediated approach. It is noteworthy that the technology developed for preferential cloning of rare mRNAs enabled identification of over 2,000 mouse transcripts differentially expressed in the hippocampus. In addition, the method that we optimized for construction of full-length-enriched cDNA libraries was successfully utilized for the production of approximately fifty libraries from the developing mouse nervous system, from which over 2,500 full-ORF-containing cDNAs have been identified and accurately sequenced in their entirety either by our group or by the NIH-Mammalian Gene Collection Program Sequencing Team.

  13. Characterization of a putative cis-regulatory element that controls transcriptional activity of the pig uroplakin II gene promoter

    SciTech Connect

    Kwon, Deug-Nam; Park, Mi-Ryung; Park, Jong-Yi; Cho, Ssang-Goo; Park, Chankyu; Oh, Jae-Wook; Song, Hyuk; Kim, Jae-Hwan; Kim, Jin-Hoi

    2011-07-01

    Highlights: {yields} The sequences of -604 to -84 bp of the pUPII promoter contained the region of a putative negative cis-regulatory element. {yields} The core promoter was located in the 5F-1. {yields} Transcription factor HNF4 can directly bind in the pUPII core promoter region, which plays a critical role in controlling promoter activity. {yields} These features of the pUPII promoter are fundamental to development of a target-specific vector. -- Abstract: Uroplakin II (UPII) is a one of the integral membrane proteins synthesized as a major differentiation product of mammalian urothelium. UPII gene expression is bladder specific and differentiation dependent, but little is known about its transcription response elements and molecular mechanism. To identify the cis-regulatory elements in the pig UPII (pUPII) gene promoter region, we constructed pUPII 5' upstream region deletion mutants and demonstrated that each of the deletion mutants participates in controlling the expression of the pUPII gene in human bladder carcinoma RT4 cells. We also identified a new core promoter region and putative negative cis-regulatory element within a minimal promoter region. In addition, we showed that hepatocyte nuclear factor 4 (HNF4) can directly bind in the pUPII core promoter (5F-1) region, which plays a critical role in controlling promoter activity. Transient cotransfection experiments showed that HNF4 positively regulates pUPII gene promoter activity. Thus, the binding element and its binding protein, HNF4 transcription factor, may be involved in the mechanism that specifically regulates pUPII gene transcription.

  14. The Interrelationship between Promoter Strength, Gene Expression, and Growth Rate

    PubMed Central

    Klesmith, Justin R.; Detwiler, Emily E.; Tomek, Kyle J.; Whitehead, Timothy A.

    2014-01-01

    In exponentially growing bacteria, expression of heterologous protein impedes cellular growth rates. Quantitative understanding of the relationship between expression and growth rate will advance our ability to forward engineer bacteria, important for metabolic engineering and synthetic biology applications. Recently, a work described a scaling model based on optimal allocation of ribosomes for protein translation. This model quantitatively predicts a linear relationship between microbial growth rate and heterologous protein expression with no free parameters. With the aim of validating this model, we have rigorously quantified the fitness cost of gene expression by using a library of synthetic constitutive promoters to drive expression of two separate proteins (eGFP and amiE) in E. coli in different strains and growth media. In all cases, we demonstrate that the fitness cost is consistent with the previous findings. We expand upon the previous theory by introducing a simple promoter activity model to quantitatively predict how basal promoter strength relates to growth rate and protein expression. We then estimate the amount of protein expression needed to support high flux through a heterologous metabolic pathway and predict the sizable fitness cost associated with enzyme production. This work has broad implications across applied biological sciences because it allows for prediction of the interplay between promoter strength, protein expression, and the resulting cost to microbial growth rates. PMID:25286161

  15. The interrelationship between promoter strength, gene expression, and growth rate.

    PubMed

    Bienick, Matthew S; Young, Katherine W; Klesmith, Justin R; Detwiler, Emily E; Tomek, Kyle J; Whitehead, Timothy A

    2014-01-01

    In exponentially growing bacteria, expression of heterologous protein impedes cellular growth rates. Quantitative understanding of the relationship between expression and growth rate will advance our ability to forward engineer bacteria, important for metabolic engineering and synthetic biology applications. Recently, a work described a scaling model based on optimal allocation of ribosomes for protein translation. This model quantitatively predicts a linear relationship between microbial growth rate and heterologous protein expression with no free parameters. With the aim of validating this model, we have rigorously quantified the fitness cost of gene expression by using a library of synthetic constitutive promoters to drive expression of two separate proteins (eGFP and amiE) in E. coli in different strains and growth media. In all cases, we demonstrate that the fitness cost is consistent with the previous findings. We expand upon the previous theory by introducing a simple promoter activity model to quantitatively predict how basal promoter strength relates to growth rate and protein expression. We then estimate the amount of protein expression needed to support high flux through a heterologous metabolic pathway and predict the sizable fitness cost associated with enzyme production. This work has broad implications across applied biological sciences because it allows for prediction of the interplay between promoter strength, protein expression, and the resulting cost to microbial growth rates.

  16. DNA sequence of a gene encoding a BALB/c mouse Ld transplantation antigen.

    PubMed

    Moore, K W; Sher, B T; Sun, Y H; Eakle, K A; Hood, L

    1982-02-01

    The sequence of a gene, denoted 27.5, encoding a transplantation antigen for the BALB/c mouse has been determined. Gene transfer studies and comparison of the translated sequence with the partial amino acid sequence of the Ld transplantation antigen establish that gene 27.5 encodes an Ld polypeptide. A comparison of the gene 27.5 sequence with several complementary DNA sequences suggests that the BALB/c mouse may contain a number of closely related L-like genes. Gene 27.5 has eight exons that correlate with the structural domains of the transplantation antigen. PMID:7058332

  17. Divergence of human [alpha]-chain constant region gene sequences: A novel recombinant [alpha]2 gene

    SciTech Connect

    Chintalacharuvu, K. R.; Morrison, S.L. ); Raines, M. )

    1994-06-01

    IgA is the major Ig synthesized in humans and provides the first line of defense at the mucosal surfaces. The constant region of IgA heavy chain is encoded by the [alpha] gene on chromosome 14. Previous studies have indicated the presence of two [alpha] genes, [alpha]1 and [alpha]2 existing in two allotypic forms, [alpha]2 m(1) and [alpha]2 m(2). Here the authors report the cloning and complete nucleotide sequence determination of a novel human [alpha] gene. Nucleotide sequence comparison with the published [alpha] sequences suggests that the gene arose as a consequence of recombination or gene conversion between the two [alpha]2 alleles. The authors have expressed the gene as a chimeric protein in myeloma cells indicating that it encodes a functional protein. The novel IgA resembles IgA2 m(2) in that disulfide bonds link H and L chains. This novel recombinant gene provides insights into the mechanisms of generation of different constant regions and suggests that within human populations, multiple alleles of [alpha] may be present providing IgAs of different structures.

  18. Role of promoter DNA sequence variations on the binding of EGR1 transcription factor.

    PubMed

    Mikles, David C; Schuchardt, Brett J; Bhat, Vikas; McDonald, Caleb B; Farooq, Amjad

    2014-05-01

    In response to a wide variety of stimuli such as growth factors and hormones, EGR1 transcription factor is rapidly induced and immediately exerts downstream effects central to the maintenance of cellular homeostasis. Herein, our biophysical analysis reveals that DNA sequence variations within the target gene promoters tightly modulate the energetics of binding of EGR1 and that nucleotide substitutions at certain positions are much more detrimental to EGR1-DNA interaction than others. Importantly, the reduction in binding affinity poorly correlates with the loss of enthalpy and gain of entropy-a trend indicative of a complex interplay between underlying thermodynamic factors due to the differential role of water solvent upon nucleotide substitution. We also provide a rationale for the physical basis of the effect of nucleotide substitutions on the EGR1-DNA interaction at atomic level. Taken together, our study bears important implications on understanding the molecular determinants of a key protein-DNA interaction at the cross-roads of human health and disease.

  19. Next generation sequencing in predicting gene function in podophyllotoxin biosynthesis.

    PubMed

    Marques, Joaquim V; Kim, Kye-Won; Lee, Choonseok; Costa, Michael A; May, Gregory D; Crow, John A; Davin, Laurence B; Lewis, Norman G

    2013-01-01

    Podophyllum species are sources of (-)-podophyllotoxin, an aryltetralin lignan used for semi-synthesis of various powerful and extensively employed cancer-treating drugs. Its biosynthetic pathway, however, remains largely unknown, with the last unequivocally demonstrated intermediate being (-)-matairesinol. Herein, massively parallel sequencing of Podophyllum hexandrum and Podophyllum peltatum transcriptomes and subsequent bioinformatics analyses of the corresponding assemblies were carried out. Validation of the assembly process was first achieved through confirmation of assembled sequences with those of various genes previously established as involved in podophyllotoxin biosynthesis as well as other candidate biosynthetic pathway genes. This contribution describes characterization of two of the latter, namely the cytochrome P450s, CYP719A23 from P. hexandrum and CYP719A24 from P. peltatum. Both enzymes were capable of converting (-)-matairesinol into (-)-pluviatolide by catalyzing methylenedioxy bridge formation and did not act on other possible substrates tested. Interestingly, the enzymes described herein were highly similar to methylenedioxy bridge-forming enzymes from alkaloid biosynthesis, whereas candidates more similar to lignan biosynthetic enzymes were catalytically inactive with the substrates employed. This overall strategy has thus enabled facile further identification of enzymes putatively involved in (-)-podophyllotoxin biosynthesis and underscores the deductive power of next generation sequencing and bioinformatics to probe and deduce medicinal plant biosynthetic pathways.

  20. Next Generation Sequencing in Predicting Gene Function in Podophyllotoxin Biosynthesis*

    PubMed Central

    Marques, Joaquim V.; Kim, Kye-Won; Lee, Choonseok; Costa, Michael A.; May, Gregory D.; Crow, John A.; Davin, Laurence B.; Lewis, Norman G.

    2013-01-01

    Podophyllum species are sources of (−)-podophyllotoxin, an aryltetralin lignan used for semi-synthesis of various powerful and extensively employed cancer-treating drugs. Its biosynthetic pathway, however, remains largely unknown, with the last unequivocally demonstrated intermediate being (−)-matairesinol. Herein, massively parallel sequencing of Podophyllum hexandrum and Podophyllum peltatum transcriptomes and subsequent bioinformatics analyses of the corresponding assemblies were carried out. Validation of the assembly process was first achieved through confirmation of assembled sequences with those of various genes previously established as involved in podophyllotoxin biosynthesis as well as other candidate biosynthetic pathway genes. This contribution describes characterization of two of the latter, namely the cytochrome P450s, CYP719A23 from P. hexandrum and CYP719A24 from P. peltatum. Both enzymes were capable of converting (−)-matairesinol into (−)-pluviatolide by catalyzing methylenedioxy bridge formation and did not act on other possible substrates tested. Interestingly, the enzymes described herein were highly similar to methylenedioxy bridge-forming enzymes from alkaloid biosynthesis, whereas candidates more similar to lignan biosynthetic enzymes were catalytically inactive with the substrates employed. This overall strategy has thus enabled facile further identification of enzymes putatively involved in (−)-podophyllotoxin biosynthesis and underscores the deductive power of next generation sequencing and bioinformatics to probe and deduce medicinal plant biosynthetic pathways. PMID:23161544

  1. Hypoxia-induced protein binding to O2-responsive sequences on the tyrosine hydroxylase gene.

    PubMed

    Norris, M L; Millhorn, D E

    1995-10-01

    We reported recently that the gene that encodes tyrosine hydroxylase (TH), the rate-limiting enzyme in the biosynthesis of catecholamines, is regulated by hypoxia in the dopaminergic cells of the mammalian carotid body (Czyzyk-Krzeska, M. F., Bayliss, D. A., Lawson, E. E. & Millhorn, D. E. (1992) J. Neurochem. 58, 1538-1546) and in pheochromocytoma (PC12) cells (Czyzyk-Krzeska, M. F., Furnari, B. A., Lawson, E. E. & Millhorn, D. E. (1994) J. Biol. Chem. 269, 760-764). Regulation of this gene during low O2 conditions occurs at both the level of transcription and RNA stability. Increased transcription during hypoxia is regulated by a region of the proximal promoter that extends from -284 to + 27 bases, relative to transcription start site. The present study was undertaken to further characterize the sequences that confer O2 responsiveness of the TH gene and to identify hypoxia-induced protein interactions with these sequences. Results from chloramphenicol acetyltransferase assays identified a region between bases -284 and -150 that contains the essential sequences for O2 regulation. This region contains a number of regulatory elements including AP1, AP2, and HIF-1. Gel shift assays revealed enhanced protein interactions at the AP1 and HIF-1 elements of the native gene. Further investigations using supershift and shift-Western analysis showed that c-Fos and JunB bind to the AP1 element during hypoxia and that these protein levels are stimulated by hypoxia. Mutation of the AP1 sequence prevented stimulation of transcription of the TH-chloramphenicol acetyltransferase reporter gene by hypoxia. PMID:7559551

  2. NELF and GAGA Factor Are Linked to Promoter-Proximal Pausing at Many Genes in Drosophila▿ †

    PubMed Central

    Lee, Chanhyo; Li, Xiaoyong; Hechmer, Aaron; Eisen, Michael; Biggin, Mark D.; Venters, Bryan J.; Jiang, Cizhong; Li, Jian; Pugh, B. Franklin; Gilmour, David S.

    2008-01-01

    Recent analyses of RNA polymerase II (Pol II) revealed that Pol II is concentrated at the promoters of many active and inactive genes. NELF causes Pol II to pause in the promoter-proximal region of the hsp70 gene in Drosophila melanogaster. In this study, genome-wide location analysis (chromatin immunoprecipitation-microarray chip [ChIP-chip] analysis) revealed that NELF is concentrated at the 5′ ends of 2,111 genes in Drosophila cells. Permanganate genomic footprinting was used to determine if paused Pol II colocalized with NELF. Forty-six of 56 genes with NELF were found to have paused Pol II. Pol II pauses 30 to 50 nucleotides downstream from transcription start sites. Analysis of DNA sequences in the vicinity of paused Pol II identified a conserved DNA sequence that probably associates with TFIID but detected no evidence of RNA secondary structures or other conserved sequences that might directly control elongation. ChIP-chip experiments indicate that GAGA factor associates with 39% of the genes that have NELF. Surprisingly, NELF associates with almost one-half of the most highly expressed genes, indicating that NELF is not necessarily a repressor of gene expression. NELF-associated pausing of Pol II might be an obligatory but sometimes transient checkpoint during the transcription cycle. PMID:18332113

  3. Proximal promoter elements of the human zeta-globin gene confer embryonic-specific expression on a linked reporter gene in transgenic mice.

    PubMed

    Pondel, M D; Sharpe, J A; Clark, S; Pearson, L; Wood, W G; Proudfoot, N J

    1996-11-01

    We have investigated the transcriptional regulation of the human embryonic zeta-globin gene promoter. First, we examined the effect that deletion of sequences 5' to zeta-globin's CCAAT box have on zeta-promoter activity in erythroid cell lines. Deletions of sequences between -116 and -556 (cap = 0) had little effect while further deletion to -84 reduced zeta-promoter activity by only 2-3-fold in both transiently and stably transfected erythroid cells. Constructs containing 67, 84 and 556 bp of zeta-globin 5' flanking region linked to a beta-galactosidase reporter gene (lacZ) and hypersensitive site -40 (HS-40) of the human alpha-globin gene cluster were then employed for the generation of transgenic mice. LacZ expression from all constructs, including a 67 bp zeta-globin promoter, was erythroid-specific and most active between 8.5 and 10.5 days post-fertilisation. By 16.5 days gestation, lacZ expression dropped 40-100-fold. These results suggest that embryonic-specific activation of the human zeta-globin promoter is conferred by a 67 bp zeta-promoter fragment containing only a CCAAT and TATA box. PMID:8932366

  4. Serine Hydroxymethyltransferase 1 and 2: Gene Sequence Variation and Functional Genomic Characterization

    PubMed Central

    Hebbring, Scott J.; Chai, Yubo; Ji, Yuan; Abo, Ryan P.; Jenkins, Gregory D.; Fridley, Brooke; Zhang, Jianping; Eckloff, Bruce W.; Wieben, Eric D.; Weinshilboum, Richard M.

    2012-01-01

    Serine hydroxymethyltransferase (SHMT) catalyzes the transfer of a beta carbon from serine to tetrahydrofolate (THF) to form glycine and 5,10-methylene-THF. This reaction plays an important role in neurotransmitter synthesis and metabolism. We set out to resequence SHMT1 and SHMT2, followed by functional genomic studies. We identified 87 and 60 polymorphisms in SHMT1 and SHMT2, respectively. We observed no significant functional effect of the 13 nonsynonymous SNPs in these genes, either on catalytic activity or protein quantity. We imputed additional variants across the two genes using “1000 Genomes” data, and identified 14 variants that were significantly associated (p-value < 1.0E-10) with SHMT1 mRNA expression in lymphoblastoid cell lines. Many of these SNPs were also significantly correlated with basal SHMT1 protein expression in 268 human liver biopsy samples. Reporter gene assays suggested that the SHMT1 promoter SNP, rs669340, contributed to this variation. Finally, SHMT1 and SHMT2 expression were significantly correlated with those of other Folate and Methionine Cycle genes at both the mRNA and protein levels. These experiments represent a comprehensive study of SHMT1 and SHMT2 gene sequence variation and its functional implications. In addition, we obtained preliminary indications that these genes may be co-regulated with other Folate and Methionine Cycle genes. PMID:22220685

  5. Serine hydroxymethyltransferase 1 and 2: gene sequence variation and functional genomic characterization.

    PubMed

    Hebbring, Scott J; Chai, Yubo; Ji, Yuan; Abo, Ryan P; Jenkins, Gregory D; Fridley, Brooke; Zhang, Jianping; Eckloff, Bruce W; Wieben, Eric D; Weinshilboum, Richard M

    2012-03-01

    Serine hydroxymethyltransferase (SHMT) catalyzes the transfer of a β-carbon from serine to tetrahydrofolate to form glycine and 5,10-methylene-tetrahydrofolate. This reaction plays an important role in neurotransmitter synthesis and metabolism. We set out to resequence SHMT1 and SHMT2, followed by functional genomic studies. We identified 87 and 60 polymorphisms in SHMT1 and SHMT2, respectively. We observed no significant functional effect of the 13 non-synonymous single-nucleotide polymorphism (SNPs) in these genes, either on catalytic activity or protein quantity. We imputed additional variants across the two genes using '1000 Genomes' data, and identified 14 variants that were significantly associated (p<1.0E-10) with SHMT1 messenger RNA expression in lymphoblastoid cell lines. Many of these SNPs were also significantly correlated with basal SHMT1 protein expression in 268 human liver biopsy samples. Reporter gene assays suggested that the SHMT1 promoter SNP, rs669340, contributed to this variation. Finally, SHMT1 and SHMT2 expression were significantly correlated with those of other Folate and Methionine Cycle genes at both the messenger RNA and protein levels. These experiments represent a comprehensive study of SHMT1 and SHMT2 gene sequence variation and its functional implications. In addition, we obtained preliminary indications that these genes may be co-regulated with other Folate and Methionine Cycle genes.

  6. Aly/ REF, a factor for mRNA transport, activates RH gene promoter function.

    PubMed

    Suganuma, Hiroshi; Kumada, Maki; Omi, Toshinori; Gotoh, Takaya; Lkhagvasuren, Munkhtulga; Okuda, Hiroshi; Kamesaki, Toyomi; Kajii, Eiji; Iwamoto, Sadahiko

    2005-06-01

    The rhesus (Rh) blood group antigens are of considerable importance in transfusion medicine as well as in newborn or autoimmune hemolytic diseases due to their high antigenicity. We identified a major DNaseI hypersensitive site at the 5' flanking regions of both RHD and RHCE exon 1. A 34 bp fragment located at -191 to -158 from a translation start position, and containing the TCCCCTCCC sequence, was involved in enhancing promoter activity, which was assessed by luciferase reporter gene assay. A biotin-labelled 34 bp probe isolated an mRNA transporter protein, Aly/REF. The specific binding of Aly/REF to RH promoter in erythroid was confirmed by chromatin immunoprecipitation assay. The silencing of Aly/REF by siRNA reduced not only the RH promoter activity of the reporter gene but also transcription from the native genome. These facts provide second proof of Aly/REF as a transcription coactivator, initially identified as a coactivator for the TCRalpha enhancer function. Aly/REF might be a novel transcription cofactor for erythroid-specific genes.

  7. Promoter analysis of the membrane protein gp64 gene of the cellular slime mold Polysphondylium pallidum.

    PubMed

    Takaoka, N; Fukuzawa, M; Saito, T; Sakaitani, T; Ochiai, H

    1999-10-28

    We cloned a genomic fragment of the membrane protein gp64 gene of the cellular slime mold Polysphondylium pallidum by inverse PCR. Primer extension analysis identified a major transcription start site 65 bp upstream of the translation start codon. The promoter region of the gp64 gene contains sequences homologous to a TATA box at position -47 to -37 and to an initiator (Inr, PyPyCAPyPyPyPy) at position -3 to +5 from the transcription start site. Successively truncated segments of the promoter were tested for their ability to drive expression of the beta-galactosidase reporter gene in transformed cells; also the difference in activity between growth conditions was compared. The results indicated that there are two positive vegetative regulatory elements extending between -187 and -62 bp from the transcription start site of the gp64 promoter; also their activity was two to three times higher in the cells grown with bacteria in shaken suspension than in the cells grown in an axenic medium. PMID:10542319

  8. TATA box polymorphisms in human gene promoters and associated hereditary pathologies.

    PubMed

    Savinkova, L K; Ponomarenko, M P; Ponomarenko, P M; Drachkova, I A; Lysova, M V; Arshinova, T V; Kolchanov, N A

    2009-02-01

    TATA-binding protein (TBP) is the first basal factor that recognizes and binds a TATA box on TATA-containing gene promoters transcribed by RNA polymerase II. Data available in the literature are indicative of admissible variability of the TATA box. The TATA box flanking sequences can influence TBP affinity as well as the level of basal and activated transcription. The possibility of mediated involvement in in vivo gene expression regulation of the TBP interactions with variant TATA boxes is supported by data on TATA box polymorphisms and associated human hereditary pathologies. A table containing data on TATA element polymorphisms in human gene promoters (about 40 mutations have been described), associated with particular pathologies, their short functional characteristics, and manifestation mechanisms of TATA-box SNPs is presented. Four classes of polymorphisms are considered: TATA box polymorphisms that weaken and enhance promoter, polymorphisms causing TATA box emergence and disappearance, and human virus TATA box polymorphisms. The described examples are indicative of the polymorphism-associated severe pathologies like thalassemia, the increased risk of hepatocellular carcinoma, sensitivity to H. pylori infection, oral cavity and lung cancers, arterial hypertension, etc. PMID:19267666

  9. Gene Expression of Axon Growth Promoting Factors in the Deer Antler

    PubMed Central

    Pita-Thomas, Wolfgang; Fernández-Martos, Carmen; Yunta, Mónica; Maza, Rodrigo M.; Navarro-Ruiz, Rosa; Lopez-Rodríguez, Marcos Javier; Reigada, David; Nieto-Sampedro, Manuel; Nieto-Diaz, Manuel

    2010-01-01

    The annual regeneration cycle of deer (Cervidae, Artiodactyla) antlers represents a unique model of epimorphic regeneration and rapid growth in adult mammals. Regenerating antlers are innervated by trigeminal sensory axons growing through the velvet, the modified form of skin that envelopes the antler, at elongation velocities that reach one centimetre per day in the common deer (Cervus elaphus). Several axon growth promoters like NT-3, NGF or IGF-1 have been described in the antler. To increase the knowledge on the axon growth environment, we have combined different gene-expression techniques to identify and characterize the expression of promoting molecules not previously described in the antler velvet. Cross-species microarray analyses of deer samples on human arrays allowed us to build up a list of 90 extracellular or membrane molecules involved in axon growth that were potentially being expressed in the antler. Fifteen of these genes were analysed using PCR and sequencing techniques to confirm their expression in the velvet and to compare it with the expression in other antler and skin samples. Expression of 8 axon growth promoters was confirmed in the velvet, 5 of them not previously described in the antler. In conclusion, our work shows that antler velvet provides growing axons with a variety of promoters of axon growth, sharing many of them with deer's normal and pedicle skin. PMID:21187928

  10. Cloning, sequencing, gene organization, and localization of the human ribosomal protein RPL23A gene

    SciTech Connect

    Fan, Wufang; Christensen, M.; Eichler, E.

    1997-12-01

    The intron-containing gene for human ribosomal protein RPL23A has been cloned, sequenced, and localized. The gene is approximately 4.0 kb in length and contains five exons and four introns. All splice sites exactly match the AG/GT consensus rule. The transcript is about 0.6 kb and is detected in all tissues examined. In adult tissues, the RPL23A transcript is dramatically more abundant in pancreas, skeletal muscle, and heart, while much less abundant in kidney, brain, placenta, lung, and liver. A full-length cDNA clone of 576 nt was identified, and the nucleotide sequence was found to match the exon sequence precisely. The open reading frame encodes a polypeptide of 156 amino acids, which is absolutely conserved with the rat RPL23A protein. In the 5{prime} flanking region of the gene, a canonical TATA sequence and a defined CAAT box were found for the first time in a mammalian ribosomal protein gene. The intron-containing RPL23A gene was mapped to cytogenetic band 17q11 by fluorescence in situ hybridization. 33 refs., 4 figs.

  11. Regulation of gene expression in the protozoan parasite Entamoeba invadens: identification of core promoter elements and promoters with stage-specific expression patterns.

    PubMed

    Manna, Dipak; Ehrenkaufer, Gretchen M; Singh, Upinder

    2014-10-01

    Developmental switching between life-cycle stages is a common feature among many pathogenic organisms. Entamoeba histolytica is an important human pathogen and is a leading parasitic cause of death globally. During its life cycle, Entamoeba converts between cysts (essential for disease transmission) and trophozoites (responsible for tissue invasion). Despite being central to its biology, the triggers that are involved in the developmental pathways of this parasite are not well understood. In order to define the transcriptional network associated with stage conversion we used Entamoeba invadens which serves as a model system for Entamoeba developmental biology, and performed RNA sequencing at different developmental time points. In this study RNA-Seq data was utilised to define basal transcriptional control elements as well as to identify promoters which regulate stage-specific gene expression patterns. We discovered that the 5' and 3' untranslated regions of E. invadens genes are short, a median of 20 nucleotides (nt) and 26 nt respectively. Bioinformatics analysis of DNA sequences proximate to the start and stop codons identified two conserved motifs: (i) E. invadens Core Promoter Motif - GAAC-Like (EiCPM-GL) (GAACTACAAA), and (ii) E. invadens 3'-U-Rich Motif (Ei3'-URM) (TTTGTT) in the 5' and 3' flanking regions, respectively. Electrophoretic mobility shift assays demonstrated that both motifs specifically bind nuclear protein(s) from E. invadens trophozoites. Additionally, we identified select genes with stage-specific expression patterns and analysed the ability of each gene promoter to drive a luciferase reporter gene during the developmental cycle. This approach confirmed three trophozoite-specific, four encystation-specific and two excystation-specific promoters. This work lays the framework for use of stage-specific promoters to express proteins of interest in a particular life-cycle stage, adding to the molecular toolbox for genetic manipulation of E

  12. Complete genome sequence of Bifidobacterium longum KCTC 12200BP, a probiotic strain promoting the intestinal health.

    PubMed

    Kwon, Soon-Kyeong; Kwak, Min-Jung; Seo, Jae-Gu; Chung, Myung Jun; Kim, Jihyun F

    2015-11-20

    Bifidobacteria constitute a major group of beneficial intestinal bacteria, and are therefore often used to formulate probiotic products in combination with lactic acid bacteria. The availability of bifidobacterial genome sequences has broadened our knowledge on health-promoting factors as well as their safety assessments. Here, we present the complete genome sequence of Bifidobacterium longum CBT BG7 that consists of a 2.45-Mb chromosome and a plasmid.

  13. Molecular mechanisms underlying the regulation of the MFG-E8 gene promoter activity in physiological and inflammatory conditions

    PubMed Central

    Wang, Xiao; Bu, Heng-Fu; Liu, Shirley XL; De Plaen, Isabelle G.; Tan, Xiao-Di

    2015-01-01

    Milk fat globule-EGF factor 8 (MFG-E8) is expressed by macrophages and plays an important role in attenuating inflammation and maintaining tissue homeostasis. Previously, we and others found that LPS inhibits MFG-E8 gene expression in macrophages. Here, we characterized the 5′-flanking region of the mouse MFG-E8 gene. To functionally analyze the upstream regulatory region of the MFG-E8 gene, a series of luciferase reporter gene constructs containing deleted or mutated regulatory elements were prepared. Using the luciferase assay, we revealed that Sp1 binding motifs within the proximal promoter region were necessary for full activity of the MFG-E8 promoter, whereas AP-1 like binding sequence at −372 played a role in governing the promoter activity at a homeostatic level. With chromatin immunoprecipitation assay, we showed that Sp1 and c-Jun physically interact with the MFG-E8 promoter region in vivo. In addition, Sp1 was found to regulate the MFG-E8 promoter activity positively and c-Jun negatively. Furthermore, we demonstrated that LPS inhibited MFG-E8 promoter activity via targeting Sp1 and AP-1-like motifs in the 5′-flanking region. Collectively, our data indicate that Sp1 and AP-1-related factors are involved in the regulation of MFG-E8 gene transcription by targeting their binding sites in the 5′-flanking region under physiological and inflammatory states. PMID:25711369

  14. Intervening sequences in an Archaea DNA polymerase gene.

    PubMed

    Perler, F B; Comb, D G; Jack, W E; Moran, L S; Qiang, B; Kucera, R B; Benner, J; Slatko, B E; Nwankwo, D O; Hempstead, S K

    1992-06-15

    The DNA polymerase gene from the Archaea Thermococcus litoralis has been cloned and expressed in Escherichia coli. It is split by two intervening sequences (IVSs) that form one continuous open reading frame with the three polymerase exons. To our knowledge, neither IVS is similar to previously described introns. However, the deduced amino acid sequences of both IVSs are similar to open reading frames present in mobile group I introns. The second IVS (IVS2) encodes an endonuclease, I-Tli I, that cleaves at the exon 2-exon 3 junction after IVS2 has been deleted. IVS2 self-splices in E. coli to yield active polymerase, but processing is abolished if the IVS2 reading frame is disrupted. Silent changes in the DNA sequence at the exon 2-IVS2 junction that maintain the original protein sequence do not inhibit splicing. These data suggest that protein rather than mRNA splicing may be responsible for production of the mature polymerase. PMID:1608969

  15. A special-purpose processor for gene sequence analysis.

    PubMed

    Fagin, B; Watt, J G; Gross, R

    1993-04-01

    Advances in computational biology have occurred primarily in the areas of software and algorithm development; new designs of hardware to support biological computing are extremely scarce. This is due, we believe, to the presence of a non-trivial knowledge gap between molecular biologists and computer designers. The existence of this gap is unfortunate, as it has long been known that for certain problems, special-purpose computers can achieve significant cost/performance gains over general-purpose machines. We describe one such computer here: a custom accelerator for gene sequence analysis. The accelerator implements a version of the Needleman-Wunsch algorithm for nucleotide sequence alignment. Sequence lengths are constrained only by available memory; the product of sequence lengths in the current implementation can be up to 2(22). The machine is implemented as two NuBus boards connected to a Mac IIf/x, using a mixture of TTL and FPGA technology clocked at 10 MHz. The boards are completely functional, and yield a 15-fold performance improvement over an unassisted host.

  16. Cloning, sequencing, and expression of the cold-inducible hutU gene from the antarctic psychrotrophic bacterium Pseudomonas syringae.

    PubMed

    Janiyani, Kamala L; Ray, M K

    2002-01-01

    A promoter-fusion study with a Tn 5-based promoter probe vector had earlier found that the hutU gene which encodes the enzyme urocanase for the histidine utilization pathway is upregulated at a lower temperature (4 degrees C) in the Antarctic psychrotrophic bacterium Pseudomonas syringae. To examine the characteristics of the urocanase gene and its promoter elements from the psychrotroph, the complete hutU and its upstream region from P. syringae were cloned, sequenced, and analyzed in the present study. Northern blot and primer extension analyses suggested that the hutU gene is inducible upon a downshift of temperature (22 to 4 degrees C) and that there is more than one transcription initiation site. One of the initiation sites was specific to the cells grown at 4 degrees C, which was different from the common initiation sites observed at both 4 and 22 degrees C. Although no typical promoter consensus sequences were observed in the flanking region of the transcription initiation sites, there was a characteristic CAAAA sequence at the -10 position of the promoters. Additionally, the location of the transcription and translation initiation sites suggested that the hutU mRNA contains a long 5'-untranslated region, a characteristic feature of many cold-inducible genes of mesophilic bacteria. A comparison of deduced amino acid sequences of urocanase from various bacteria, including the mesophilic and psychrotrophic Pseudomonas spp., suggests that there is a high degree of similarity between the enzymes. The enzyme sequence contains a signature motif (GXGX(2)GX(10)G) of the Rossmann fold for dinucleotide (NAD(+)) binding and two conserved cysteine residues in and around the active site. The psychrotrophic enzyme, however, has an extended N-terminal end.

  17. Mutational analysis of sequences downstream of the TATA box of the herpes simplex virus type 1 major capsid protein (VP5/UL19) promoter.

    PubMed Central

    Huang, C J; Goodart, S A; Rice, M K; Guzowski, J F; Wagner, E K

    1993-01-01

    Transient expression assays with the herpes simplex virus type 1 (HSV-1) promoter/leader controlling the beta gamma (leaky-late) VP5 (UL19) mRNA encoding the major capsid protein showed that no more than 36 to 72 bases of VP5 leader are required for full-level expression. Constructs lacking the viral leader and the transcription initiation site expressed the reporter gene at about 20% of the maximum level. We confirmed this observation by using recombinant viruses in which VP5 promoter/leader deletions controlling the bacterial beta-galactosidase gene were inserted into the nonessential glycoprotein C (UL44) locus of the genome. Sequences within +36 are required for full-level expression, and removal of all leader sequences including the cap site resulted in a 10-fold decrease in reporter mRNA accumulation. The removal of the leader sequence had a measurable effect upon the kinetics of reporter mRNA accumulation, but insertion of the entire VP5 leader and cap site into a construct in which the reporter gene was controlled by the kinetically early (beta) dUTPase (UL50) promoter did not result in any significant change in the kinetics of dUTPase promoter expression. These results suggest that DNA sequences both 5' and 3' of the TATA box are important determinants of the beta gamma kinetics and levels of VP5 mRNA accumulation in the infected cell. Images PMID:8394439

  18. Molecular cloning and activity analysis of a seed-specific FAD2-1B gene promoter from Glycine max.

    PubMed

    Zhao, Y; Sha, W; Wang, Q Y; Zhai, Y; Zhao, Y; Shao, S L

    2015-01-01

    Microsomal omega-6 fatty acid desaturase (FAD2-1B) is an enzyme that regulates the polyunsaturated fatty acid content in soybeans (Glycine max). In this study, the FAD2-1B gene was determined to be highly expressed in soybean seeds using quantitative real-time PCR(qRT-PCR). To investigate the expression pattern and activity of the FAD2-1B promoter, a 1929 bp 5'-upstream genomic DNA fragment, named PF, was isolated according to the soybean genomic sequence. Sequence analysis revealed the presence of many motifs related to seed-specific promoters in the PF fragment, such as E-box, SEF4, Skn-1 motif, AACACA, AATAAA and so on. Tobacco transgenics carrying the gus reporter gene driven by the PF and/or 35S promoters were confirmed by PCR and RT-PCR. qRT-PCR and histochemical GUS assays showed that the PF promoter could regulate gus gene accumulation in seeds and the expression level was higher than in other organs. In the meantime, it exhibited similar activity to the 35S promoter in seeds, which could be associated with seed-related cis-elements found in the 1-248 bp, 451-932 bp, and 1627-1803 bp regions of the promoter. PMID:26386665

  19. Sequence analysis of the equine ACTN3 gene in Australian horse breeds.

    PubMed

    Thomas, K C; Hamilton, N A; North, K N; Houweling, P J

    2014-03-15

    The sarcomeric α-actinins, encoded by the genes ACTN2 and ACTN3, are major structural components of the Z-line and have high sequence similarity. α-Actinin-2 is present in all skeletal muscle fibres, while α-actinin-3 has developed specialized expression in only type 2 (fast, glycolytic) fibres. A common single nucleotide polymorphism (SNP) in the human ACTN3 gene (R577X) has been found to influence muscle performance in elite athletes and the normal population. For this reason, equine ACTN3 (eACTN3) is considered to be a possible candidate that may influence horse performance. In this study, the intron/exon boundaries and entire coding region of eACTN3 have been sequenced in five Australian horse breeds (Thoroughbred, Arabian, Standardbred, Clydsdale and Shire) and compared to the eACTN3 GenBank sequence. A total of 34 SNPs were identified, of which 26 were intronic and eight exonic. All exonic SNPs were synonymous; however, five intronic SNPs showed significant differences between breeds. A total of 72 horses were genotyped for a SNP located in the promoter region of the eACTN3 gene (g. 1104 G>A) which differed significantly between breed groups. We hypothesize that this polymorphism influences eACTN3 expression and with further studies may provide a novel marker of horse performance in the future.

  20. Isolation, hyperexpression, and sequencing of the aceA gene encoding isocitrate lyase in Escherichia coli.

    PubMed Central

    Matsuoka, M; McFadden, B A

    1988-01-01

    A structural gene for isocitrate lyase was isolated from a cosmid containing an ace locus of the Escherichia coli chromosome. Cloning and expression under control of the tac promoter in a multicopy plasmid showed that a 1.7-kilobase-pair DNA segment was sufficient for complementation of an aceA deletion mutation and overproduction of isocitrate lyase. DNA sequence analysis of the cloned gene and N-terminal protein sequencing of the cloned and wild-type enzymes revealed an entire aceA gene which encodes a 429-amino-acid residue polypeptide whose C-terminus is histidine. The deduced amino acid sequence for the 47.2-kilodalton subunit of E. coli isocitrate lyase could be aligned with that for the 64.8-kilodalton subunit of the castor bean enzyme with 39% identity except for limited N- and C-terminal regions and a 103-residue stretch that was unique for the plant enzyme and started approximately in the middle of that peptide. Images PMID:3049537

  1. Sequence analysis of the equine ACTN3 gene in Australian horse breeds.

    PubMed

    Thomas, K C; Hamilton, N A; North, K N; Houweling, P J

    2014-03-15

    The sarcomeric α-actinins, encoded by the genes ACTN2 and ACTN3, are major structural components of the Z-line and have high sequence similarity. α-Actinin-2 is present in all skeletal muscle fibres, while α-actinin-3 has developed specialized expression in only type 2 (fast, glycolytic) fibres. A common single nucleotide polymorphism (SNP) in the human ACTN3 gene (R577X) has been found to influence muscle performance in elite athletes and the normal population. For this reason, equine ACTN3 (eACTN3) is considered to be a possible candidate that may influence horse performance. In this study, the intron/exon boundaries and entire coding region of eACTN3 have been sequenced in five Australian horse breeds (Thoroughbred, Arabian, Standardbred, Clydsdale and Shire) and compared to the eACTN3 GenBank sequence. A total of 34 SNPs were identified, of which 26 were intronic and eight exonic. All exonic SNPs were synonymous; however, five intronic SNPs showed significant differences between breeds. A total of 72 horses were genotyped for a SNP located in the promoter region of the eACTN3 gene (g. 1104 G>A) which differed significantly between breed groups. We hypothesize that this polymorphism influences eACTN3 expression and with further studies may provide a novel marker of horse performance in the future. PMID:24440781

  2. Sequence of the site-specific recombinase gene cin and of its substrates serving in the inversion of the C segment of bacteriophage P1.

    PubMed Central

    Hiestand-Nauer, R; Iida, S

    1983-01-01

    Inversion of the 4.2-kb C segment flanked by 0.6-kb inverted repeats on the bacteriophage P1 genome is mediated by the P1-encoded site-specific cin recombinase. The cin gene lies adjacent to the C segment and the C inversion cross-over sites cixL and cixR are at the external ends of the inverted repeats. We have sequenced the DNA containing the cin gene and these cix sites. The cin structural gene consists of 561 nucleotides and terminates at the inverted repeat end where the cixL site is located. Only two nucleotides in the cixL region differ from those in the cixR and they are within the cin TAA stop codon. The cin promoter was localized by transposon mutagenesis within a 0.1-kb segment, which contains probable promoter sequences overlapping with a 'pseudo-cix' sequence cixPp. In a particular mutant, integration of an IS1-flanked transposon into the cin control region promoted weak expression of the cin gene. The cin and cix sequences show homology with corresponding, functionally related sequences for H inversion in Salmonella and with cross-over sites for G inversion in phage Mu. Based on a comparison of the DNA sequences and of the gene organizations, a possible evolutionary relationship between these three inversion systems and the possible significance of the cixPp sequence in the cin promoter are discussed. Images Fig. 2. PMID:6315399

  3. International interlaboratory study comparing single organism 16S rRNA gene sequencing data: Beyond consensus sequence comparisons.

    PubMed

    Olson, Nathan D; Lund, Steven P; Zook, Justin M; Rojas-Cornejo, Fabiola; Beck, Brian; Foy, Carole; Huggett, Jim; Whale, Alexandra S; Sui, Zhiwei; Baoutina, Anna; Dobeson, Michael; Partis, Lina; Morrow, Jayne B

    2015-03-01

    This study presents the results from an interlaboratory sequencing study for which we developed a novel high-resolution method for comparing data from different sequencing platforms for a multi-copy, paralogous gene. The combination of PCR amplification and 16S ribosomal RNA gene (16S rRNA) sequencing has revolutionized bacteriology by enabling rapid identification, frequently without the need for culture. To assess variability between laboratories in sequencing 16S rRNA, six laboratories sequenced the gene encoding the 16S rRNA from Escherichia coli O157:H7 strain EDL933 and Listeria monocytogenes serovar 4b strain NCTC11994. Participants performed sequencing methods and protocols available in their laboratories: Sanger sequencing, Roche 454 pyrosequencing(®), or Ion Torrent PGM(®). The sequencing data were evaluated on three levels: (1) identity of biologically conserved position, (2) ratio of 16S rRNA gene copies featuring identified variants, and (3) the collection of variant combinations in a set of 16S rRNA gene copies. The same set of biologically conserved positions was identified for each sequencing method. Analytical methods using Bayesian and maximum likelihood statistics were developed to estimate variant copy ratios, which describe the ratio of nucleotides at each identified biologically variable position, as well as the likely set of variant combinations present in 16S rRNA gene copies. Our results indicate that estimated variant copy ratios at biologically variable positions were only reproducible for high throughput sequencing methods. Furthermore, the likely variant combination set was only reproducible with increased sequencing depth and longer read lengths. We also demonstrate novel methods for evaluating variable positions when comparing multi-copy gene sequence data from multiple laboratories generated using multiple sequencing technologies. PMID:27077030

  4. International interlaboratory study comparing single organism 16S rRNA gene sequencing data: Beyond consensus sequence comparisons.

    PubMed

    Olson, Nathan D; Lund, Steven P; Zook, Justin M; Rojas-Cornejo, Fabiola; Beck, Brian; Foy, Carole; Huggett, Jim; Whale, Alexandra S; Sui, Zhiwei; Baoutina, Anna; Dobeson, Michael; Partis, Lina; Morrow, Jayne B

    2015-03-01

    This study presents the results from an interlaboratory sequencing study for which we developed a novel high-resolution method for comparing data from different sequencing platforms for a multi-copy, paralogous gene. The combination of PCR amplification and 16S ribosomal RNA gene (16S rRNA) sequencing has revolutionized bacteriology by enabling rapid identification, frequently without the need for culture. To assess variability between laboratories in sequencing 16S rRNA, six laboratories sequenced the gene encoding the 16S rRNA from Escherichia coli O157:H7 strain EDL933 and Listeria monocytogenes serovar 4b strain NCTC11994. Participants performed sequencing methods and protocols available in their laboratories: Sanger sequencing, Roche 454 pyrosequencing(®), or Ion Torrent PGM(®). The sequencing data were evaluated on three levels: (1) identity of biologically conserved position, (2) ratio of 16S rRNA gene copies featuring identified variants, and (3) the collection of variant combinations in a set of 16S rRNA gene copies. The same set of biologically conserved positions was identified for each sequencing method. Analytical methods using Bayesian and maximum likelihood statistics were developed to estimate variant copy ratios, which describe the ratio of nucleotides at each identified biologically variable position, as well as the likely set of variant combinations present in 16S rRNA gene copies. Our results indicate that estimated variant copy ratios at biologically variable positions were only reproducible for high throughput sequencing methods. Furthermore, the likely variant combination set was only reproducible with increased sequencing depth and longer read lengths. We also demonstrate novel methods for evaluating variable positions when comparing multi-copy gene sequence data from multiple laboratories generated using multiple sequencing technologies.

  5. Complete genome sequence of Kibdelosporangium phytohabitans KLBMP 1111(T), a plant growth promoting endophytic actinomycete isolated from oil-seed plant Jatropha curcas L.

    PubMed

    Qin, Sheng; Feng, Wei-Wei; Xing, Ke; Bai, Juan-Luan; Yuan, Bo; Liu, Wei-Jie; Jiang, Ji-Hong

    2015-12-20

    Kibdelosporangium phytohabitans KLBMP 1111(T) is a plant growth promoting endophytic actinomycete isolated from the oil-seed plant Jatropha curcas L. collected from dry-hot valley, in Sichuan, China. The complete genome sequence of this actinomycete consists of one chromosome (11,759,770bp) with no plasmid. From the genome, we identified gene clusters responsible for polyketide and nonribosomal peptide synthesis of natural products, and genes related to the plant growth promoting, such as zeatin, 1-aminocyclopropane-1-carboxylate deaminase (ACCD) and siderophore. The complete genome information may be useful to understand the beneficial interactions between K. phytohabitans KLBMP 1111(T) and host plants. PMID:26516119

  6. Characterization of the mouse TFF1 (pS2) gene promoter region.

    PubMed

    Terada, T; Sakagami, R; Tabuchi, Y; Maeda, M

    2001-02-01

    Trefoil peptides (TFFs) with a unique trefoil domain(s) are presumed to function in protection and repair of the gastrointestinal epithelial layer. Three peptide family members are differently distributed in the mouse gastrointestinal tract: TFF1/pS2 specifically in stomach, TFF2/SP mainly in stomach, pancreas and duodenum, and TFF3/ITF in intestine. We cloned and sequenced the mouse TFF1 gene 5'-upstream region by means of the genomic walking procedure. The cloned region was ligated to the luciferase reporter gene and then introduced into mouse gastric surface mucous GSM10 cells which express TFF1 and TFF2. The minimum promoter was located in the region containing the TATA-box between -39 and the transcriptional start site. Further upstream regions stimulated (-2192-- -1630bp, -641-- -243bp, -137-- -39bp) and inhibited (-1630-- -641bp, -243-- -137 bp) luciferase gene expression. These regions as well as short segments conserved in the mouse and human 5'-upstream sequences may be important for modulation of the mRNA level of the TFF1 gene.

  7. Isolation and characterization of a chalcone isomerase gene promoter from potato cultivars.

    PubMed

    Chen, M; Zhu, W J; You, X; Liu, Y D; Kaleri, G M; Yang, Q

    2015-01-01

    Chalcone isomerase (CHI) is a key enzyme involved in anthocyanin metabolism. Previous research on CHI has mainly focused on cDNA cloning and gene expression. In the current study, the 1425-bp potato CHI promoter (PCP) was isolated from four potato cultivars (Heijingang, Zhongshu 7, Désirée, and Favorita) using PCR and DNA sequencing. The PCP contained many cis-regulatory elements (CREs) related to anthocyanin metabolism, tissue specificity, light response, stress, and hormone induction. Of the PCP CREs identified, 19 were common to those found in the higher plants examined, based on plant CRE databases. Multiple sequence alignment showed six single nucleotide variation sites in PCP among the potato cultivars examined, resulting in changes in the number of CREs connected with tissue specificity, anthocyanin metabolism, and light response. The 665-bp PCP fragments from Favorita and 1425-bp PCP fragments from Heijingang were used to construct plant expression vectors, which may be a useful tool for biological engineering. A transient expression assay demonstrated that the two PCP fragments from Heijingang could direct the expression of a green fluorescent protein gene in onion epidermis and a β-glucuronidase gene in all potato tuber tissues with different colors, suggesting that the single nucleotide variation in the PCP did not affect its activity, and that silencing of the CHI gene in Favorita may be attributed to other regulatory factors. PMID:26782538

  8. Core promoter-specific gene regulation: TATA box selectivity and Initiator-dependent bi-directionality of serum response factor-activated transcription.

    PubMed

    Xu, Muyu; Gonzalez-Hurtado, Elsie; Martinez, Ernest

    2016-04-01

    Gene-specifi