Science.gov

Sample records for gene promoter sequences

  1. Interference in transcription of overexpressed genes by promoter-proximal downstream sequences

    PubMed Central

    Turchinovich, A.; Surowy, H. M.; Tonevitsky, A. G.; Burwinkel, B.

    2016-01-01

    Despite a high sequence homology among four human RNAi-effectors Argonaute proteins and their coding sequences, the efficiency of ectopic overexpression of AGO3 and AGO4 coding sequences in human cells is greatly reduced as compared to AGO1 and AGO2. While investigating this phenomenon, we documented the existence of previously uncharacterized mechanism of gene expression regulation, which is manifested in greatly varying basal transcription levels from the RNApolII promoters depending on the promoter-proximal downstream sequences. Specifically, we show that distinct overexpression of Argonaute coding sequences cannot be explained by mRNA degradation in the cytoplasm or nucleus, and exhibits on transcriptional level. Furthermore, the first 1000–2000 nt located immediately downstream the promoter had the most critical influence on ectopic gene overexpression. The transcription inhibiting effect, associated with those downstream sequences, subsided with increasing distance to the promoter and positively correlated with promoter strength. We hypothesize that the same mechanism, which we named promoter proximal inhibition (PPI), could generally contribute to basal transcription levels of genes, and could be mainly responsible for the essence of difficult-to-express recombinant proteins. Finally, our data reveal that expression of recombinant proteins in human cells can be greatly enhanced by using more permissive promoter adjacent downstream sequences. PMID:27485701

  2. Regulation of transcription of the adenovirus EII promoter by gene products: Absence of sequence specificity

    SciTech Connect

    Kingston, R.E.; Kaufman, R.J.; Sharp, P.A.

    1984-10-01

    During adenovirus infection, the EII promoter is positively regulated by products of the EIa region. The authors have studied this regulation by fusing a DNA segment containing the adenovirus EII promoter to a dihydrofolate reductase cDNA segment. Expression of this hybrid gene is stimulated in trans when cell lines containing an integrated copy are either transfected with plasmids carrying the EIa region or infected with adenovirus. This suggests that EIa activity regulates transcription of the EII promoter in the absence of other viral proteins and that this stimulation can occur when the EII promoter is organized in cellular chromatin. Transcription from the EII promoter is initiated at two sites in cell lines lacking EIa activity. Introduction of the EIa region preferentially stimulated transcription from one of these two sites. A sensitive, stable cotransfection assay was used to test for specific EII sequences required for stimulation. EIa activity stimulates all mutaant promoters; the most extensive deletion retained only 18 base pairs of sequences upstream of the initiation site. They suggest that regulation of a promoter by the EIa region does not depend on the presence of a set of specific sequences, but instead reflects a characteristic of promoters that have been exogenously introduced into cells. Insertion of the 72-base-pair repeat of simian-virus 40 in cis enhances transcription from the EII promoter. The stimulatory effects of EIa activity and of the simian virus 40 sequence are additive and appear to differ mechanistically.

  3. Promoter sequences required for transcription of Xenopus laevis histone genes in injected frog oocyte nuclei.

    PubMed Central

    Heindl, L M; Weil, T S; Perry, M

    1988-01-01

    Amphibian oogenesis is accompanied by the accumulation of histone mRNA and proteins in the absence of ongoing DNA replication. To begin an analysis of the mechanisms by which histone gene expression is regulated during frog oogenesis and embryogenesis, we used oocyte injection to examine the upstream sequences required for transcription of genes encoding each of the five histone classes. We found that sequences necessary for maximal levels of transcription are located 100 to 200 base pairs upstream of the corresponding start sites. In this region, each promoter examined contains conserved sequence elements, several of which seem to be histone gene class specific, in addition to other, more common sequence elements believed to be used by general transcription factors. Images PMID:3221862

  4. ZNF143 provides sequence specificity to secure chromatin interactions at gene promoters

    PubMed Central

    Bailey, Swneke D.; Zhang, Xiaoyang; Desai, Kinjal; Aid, Malika; Corradin, Olivia; Cowper-Sal·lari, Richard; Akhtar-Zaidi, Batool; Scacheri, Peter C.; Haibe-Kains, Benjamin; Lupien, Mathieu

    2015-01-01

    Chromatin interactions connect distal regulatory elements to target gene promoters guiding stimulus- and lineage-specific transcription. Few factors securing chromatin interactions have so far been identified. Here by integrating chromatin interaction maps with the large collection of transcription factor binding profiles provided by the ENCODE project, we demonstrate that the zinc-finger protein ZNF143 preferentially occupies anchors of chromatin interactions connecting promoters with distal regulatory elements. It binds directly to promoters and associates with lineage-specific chromatin interactions and gene expression. Silencing ZNF143 or modulating its DNA-binding affinity using single nucleotide polymorphisms (SNPs) as a surrogate of site-directed mutagenesis reveals the sequence dependency of chromatin interactions at gene promoters. We also find that chromatin interactions alone do not regulate gene expression. Together, our results identify ZNF143 as a novel chromatin-looping factor that contributes to the architectural foundation of the genome by providing sequence specificity at promoters connected with distal regulatory elements. PMID:25645053

  5. Genome-wide discovery of cis-elements in promoter sequences using gene expression.

    PubMed

    Troukhan, Maxim; Tatarinova, Tatiana; Bouck, John; Flavell, Richard B; Alexandrov, Nickolai N

    2009-04-01

    The availability of complete or nearly complete genome sequences, a large number of 5' expressed sequence tags, and significant public expression data allow for a more accurate identification of cis-elements regulating gene expression. We have implemented a global approach that takes advantage of available expression data, genomic sequences, and transcript information to predict cis-elements associated with specific expression patterns. The key components of our approach are: (1) precise identification of transcription start sites, (2) specific locations of cis-elements relative to the transcription start site, and (3) assessment of statistical significance for all sequence motifs. By applying our method to promoters of Arabidopsis thaliana and Mus musculus, we have identified motifs that affect gene expression under specific environmental conditions or in certain tissues. We also found that the presence of the TATA box is associated with increased variability of gene expression. Strong correlation between our results and experimentally determined motifs shows that the method is capable of predicting new functionally important cis-elements in promoter sequences.

  6. Characterization of the promoter and upstream activating sequence from the Pseudomonas alcaligenes lipase gene.

    PubMed

    Cox, M; Gerritse, G; Dankmeyer, L; Quax, W J

    2001-03-09

    Pseudomonas alcaligenes secretes a lipase with a high pH optimum, which has interesting properties for application in detergents. The expression of the lipase is strongly dependent on the presence of lipids in the growth medium such as soybean oil. The promoter of the gene was characterized and found to have resemblance to sigma54 controlled promoters, which are known to be tightly regulated. The transcription start was mapped precisely downstream of a sequence with close similarity to the -12/-24 consensus sequence of sigma54 controlled promoters. Interestingly, a hyperproducer mutant strain was isolated and found to have a C to T mutation in the -12/-24 promoter consensus region. In addition an Upstream Activating Sequence (UAS) with homology to sigma54 UAS consensus sequences was identified. It was demonstrated that an increase of the distance from the UAS to the transcription start or the deletion of the UAS results in significantly lower expression levels of lipase. A systematic mutational analysis of the UAS sequence has resulted in a variant with an increased lipase expression.

  7. Rarity of DNA sequence alterations in the promoter region of the human androgen receptor gene.

    PubMed

    Cabral, D F; Santos, A; Ribeiro, M L; Mesquita, J C; Carvalho-Salles, A B; Hackel, C

    2004-12-01

    The human androgen receptor (AR) gene promoter lies in a GC-rich region containing two principal sites of transcription initiation and a putative Sp1 protein-binding site, without typical "TATA" and "CAAT" boxes. It has been suggested that mutations within the 5'untranslated region (5'UTR) may contribute to the development of prostate cancer by changing the rates of gene transcription and/or translation. In order to investigate this question, the aim of the present study was to search for the presence of mutations or polymorphisms at the AR-5'UTR in 92 prostate cancer patients, where histological diagnosis of adenocarcinoma was established in specimens obtained from transurethral resection or after prostatectomy. The AR-5'UTR was amplified by PCR from genomic DNA samples of the patients and of 100 healthy male blood donors, included as controls. Conformation-sensitive gel electrophoresis was used for DNA sequence alteration screening. Only one band shift was detected in one individual from the blood donor group. Sequencing revealed a new single nucleotide deletion (T) in the most conserved portion of the promoter region at position +36 downstream from the transcription initiation site I. Although the effect of this specific mutation remains unknown, its rarity reveals the high degree of sequence conservation of the human androgen promoter region. Moreover, the absence of detectable variation within the critical 5'UTR in prostate cancer patients indicates a low probability of its involvement in prostate cancer etiology.

  8. Human dipeptidyl peptidase IV gene promoter: tissue-specific regulation from a TATA-less GC-rich sequence characteristic of a housekeeping gene promoter.

    PubMed Central

    Böhm, S K; Gum, J R; Erickson, R H; Hicks, J W; Kim, Y S

    1995-01-01

    The dipeptidyl peptidase IV gene encodes a plasma-membrane exopeptidase that is highly expressed in small intestine, lung and kidney. In order to better understand the mechanisms responsible for this tissue-specific expression we cloned, sequenced and functionally characterized the 5'-flanking region of the human dipeptidyl peptidase IV gene. The first 500 bases of the 5'-flanking sequence constituted an unmethylated CpG island, contained several Sp1-binding sites and lacked a consensus TATA box, all characteristics of gene promoters lacking tissue-specific expression. RNase-protection analysis using both small intestinal and Caco2 cell RNA indicated that the dipeptidyl peptidase IV transcript was initiated from no fewer than six major and 12 minor start sites. The 5'-flanking sequence also exhibited functional promoter activity in transient transfection experiments. Here, various lengths of the sequence were cloned upstream of a luciferase gene and introduced into cultured cells using lipofectin. A region located between bases -150 and -109 relative to the start of translation was found to be important for high-level promoter activity in both Caco2 and HepG2 cells. Moreover, Caco2 cells and HepG2 cells, which express high levels of dipeptidyl peptidase IV activity, exhibited much higher normalized luciferase activity after transfection than did 3T3, Jurkat or COS-7 cells, which have low enzyme levels. Sodium butyrate was found to increase both enzyme activity and normalized luciferase in HepG2 cells. Thus the dipeptidyl peptidase IV promoter possesses the ability to initiate transcription in a tissue-specific fashion in spite of having the sequence characteristics of a housekeeping gene promoter. Images Figure 3 Figure 5 Figure 6 PMID:7487939

  9. Genetic and Functional Sequence Variants of the SIRT3 Gene Promoter in Myocardial Infarction

    PubMed Central

    Yin, Xiaoyun; Pang, Shuchao; Huang, Jian; Cui, Yinghua; Yan, Bo

    2016-01-01

    Coronary artery disease (CAD), including myocardial infarction (MI), is a common complex disease that is caused by atherosclerosis. Although a large number of genetic variants have been associated with CAD, only 10% of CAD cases could be explained. It has been proposed that low frequent and rare genetic variants may be main causes for CAD. SIRT3, a mitochondrial deacetylase, plays important roles in mitochondrial function and metabolism. Lack of SIRT3 in experimental animal leads to several age-related diseases, including cardiovascular diseases. Therefore, SIRT3 gene variants may contribute to the MI development. In this study, SIRT3 gene promoter was genetically and functionally analyzed in large cohorts of MI patients (n = 319) and ethnic-matched controls (n = 322). Total twenty-three DNA sequence variants (DSVs) were identified, including 10 single-nucleotide polymorphisms (SNPs). Six novel heterozygous DSVs, g.237307A>G, g.237270G>A, g.237023_25del, g.236653C>A, g.236628G>C, g.236557T>C, and two SNPs g.237030C>T (rs12293349) and g.237022C>G (rs369344513), were identified in nine MI patients, but in none of controls. Three SNPs, g.236473C>T (rs11246029), g.236380_81ins (rs71019893) and g.236370C>G (rs185277566), were more significantly frequent in MI patients than controls (P<0.05). These DSVs and SNPs, except g.236557T>C, significantly decreased the transcriptional activity of the SIRT3 gene promoter in cultured HEK-293 cells and H9c2 cells. Therefore, these DSVs identified in MI patients may change SIRT3 level by affecting the transcriptional activity of SIRT3 gene promoter, contributing to the MI development as a risk factor. PMID:27078640

  10. Using a Solver Over the String Pattern Domain to Analyze Gene Promoter Sequences

    NASA Astrophysics Data System (ADS)

    Rigotti, Christophe; Mitašiūnaitė, Ieva; Besson, Jérémy; Meyniel, Laurène; Boulicaut, Jean-François; Gandrillon, Olivier

    This chapter illustrates how inductive querying techniques can be used to support knowledge discovery from genomic data. More precisely, it presents a data mining scenario to discover putative transcription factor binding sites in gene promoter sequences. We do not provide technical details about the used constraintbased data mining algorithms that have been previously described. Our contribution is to provide an abstract description of the scenario, its concrete instantiation and also a typical execution on real data. Our main extraction algorithm is a complete solver dedicated to the string pattern domain: it computes string patterns that satisfy a given conjunction of primitive constraints. We also discuss the processing steps necessary to turn it into a useful tool. In particular, we introduce a parameter tuning strategy, an appropriate measure to rank the patterns, and the post-processing approaches that can be and have been applied.

  11. Sequence of the S-layer gene of Thermus thermophilus HB8 and functionality of its promoter in Escherichia coli.

    PubMed Central

    Faraldo, M M; de Pedro, M A; Berenguer, J

    1992-01-01

    The nucleotide sequence of the slpA gene, which is responsible for the synthesis of the S-layer protein of Thermus thermophilus HB8, is described. This gene is transcribed as a unit in which the coding region is preceded by a 127-base-long leader mRNA sequence. The promoter region is also recognized by the RNA polymerase of Escherichia coli because of the presence of homologous -35 and -10 boxes. Homologies with other promoters from Thermus spp. are also presented. Images PMID:1429468

  12. Characterization of the rat transforming growth factor alpha gene and identification of promoter sequences.

    PubMed Central

    Blasband, A J; Rogers, K T; Chen, X R; Azizkhan, J C; Lee, D C

    1990-01-01

    We have determined the complete nucleotide sequence of rat transforming growth factor alpha (TGF alpha) mRNA and characterized the six exons that encode this transcript. These six exons span approximately 85 kilobases of genomic DNA, with exons 1 to 3 separated by particularly large introns. What had previously been thought to represent a species-specific difference in the size of the TGF alpha precursor (proTGF alpha) is now shown to be due to microheterogeneity in the splicing of exons 2 and 3. This results from a tandem duplication of the acceptor CAG and gives rise to two alternate forms (159 and 160 amino acids) of the integral membrane precursor. Exon 6, which encodes the 3' untranslated region of TGF alpha mRNA, also encodes, on the opposite strand, a small (approximately 200-nucleotide) transcript whose sequence predicts an open reading frame of 51 amino acids. Expression of this latter transcript does not appear to be coregulated with that of TGF alpha mRNA. Primer extension and S1 nuclease analyses of authentic TGF alpha transcripts revealed two major and multiple minor 5' ends which span more than 200 base pairs of DNA in a G + C-rich region that lacks canonical CCAAT or TATA sequences. The 5' ends of six independently derived cDNAs localized to five different sites in this same region. Restriction fragments that overlap these transcription start sites and extend approximately 300 base pairs in the 5' direction faithfully promote transcription in vitro with HeLa cell nuclear extracts. In addition, they direct the expression of the bacterial chloramphenicol acetyltransferase gene in transient-transfection assays. Images PMID:2325647

  13. Induction and maintenance of DNA methylation in plant promoter sequences by apple latent spherical virus-induced transcriptional gene silencing

    PubMed Central

    Kon, Tatsuya; Yoshikawa, Nobuyuki

    2014-01-01

    Apple latent spherical virus (ALSV) is an efficient virus-induced gene silencing vector in functional genomics analyses of a broad range of plant species. Here, an Agrobacterium-mediated inoculation (agroinoculation) system was developed for the ALSV vector, and virus-induced transcriptional gene silencing (VITGS) is described in plants infected with the ALSV vector. The cDNAs of ALSV RNA1 and RNA2 were inserted between the cauliflower mosaic virus 35S promoter and the NOS-T sequences in a binary vector pCAMBIA1300 to produce pCALSR1 and pCALSR2-XSB or pCALSR2-XSB/MN. When these vector constructs were agroinoculated into Nicotiana benthamiana plants with a construct expressing a viral silencing suppressor, the infection efficiency of the vectors was 100%. A recombinant ALSV vector carrying part of the 35S promoter sequence induced transcriptional gene silencing of the green fluorescent protein gene in a line of N. benthamiana plants, resulting in the disappearance of green fluorescence of infected plants. Bisulfite sequencing showed that cytosine residues at CG and CHG sites of the 35S promoter sequence were highly methylated in the silenced generation zero plants infected with the ALSV carrying the promoter sequence as well as in progeny. The ALSV-mediated VITGS state was inherited by progeny for multiple generations. In addition, induction of VITGS of an endogenous gene (chalcone synthase-A) was demonstrated in petunia plants infected with an ALSV vector carrying the native promoter sequence. These results suggest that ALSV-based vectors can be applied to study DNA methylation in plant genomes, and provide a useful tool for plant breeding via epigenetic modification. PMID:25426109

  14. Comparisons of Ribosomal Protein Gene Promoters Indicate Superiority of Heterologous Regulatory Sequences for Expressing Transgenes in Phytophthora infestans.

    PubMed

    Poidevin, Laetitia; Andreeva, Kalina; Khachatoorian, Careen; Judelson, Howard S

    2015-01-01

    Molecular genetics approaches in Phytophthora research can be hampered by the limited number of known constitutive promoters for expressing transgenes and the instability of transgene activity. We have therefore characterized genes encoding the cytoplasmic ribosomal proteins of Phytophthora and studied their suitability for expressing transgenes in P. infestans. Phytophthora spp. encode a standard complement of 79 cytoplasmic ribosomal proteins. Several genes are duplicated, and two appear to be pseudogenes. Half of the genes are expressed at similar levels during all stages of asexual development, and we discovered that the majority share a novel promoter motif named the PhRiboBox. This sequence is enriched in genes associated with transcription, translation, and DNA replication, including tRNA and rRNA biogenesis. Promoters from the three P. infestans genes encoding ribosomal proteins S9, L10, and L23 and their orthologs from P. capsici were tested for their ability to drive transgenes in stable transformants of P. infestans. Five of the six promoters yielded strong expression of a GUS reporter, but the stability of expression was higher using the P. capsici promoters. With the RPS9 and RPL10 promoters of P. infestans, about half of transformants stopped making GUS over two years of culture, while their P. capsici orthologs conferred stable expression. Since cross-talk between native and transgene loci may trigger gene silencing, we encourage the use of heterologous promoters in transformation studies.

  15. Sequences contained within the promoter of the human thymidine kinase gene can direct cell-cycle regulation of heterologous fusion genes.

    PubMed Central

    Kim, Y K; Wells, S; Lau, Y F; Lee, A S

    1988-01-01

    Recent evidence on the transcriptional regulation of the human thymidine kinase (TK) gene raises the possibility that cell-cycle regulatory sequences may be localized within its promoter. A hybrid gene that combines the TK 5' flanking sequence and the coding region of the bacterial neomycin-resistance gene (neo) has been constructed. Upon transfection into a hamster fibroblast cell line K12, the hybrid gene exhibits cell-cycle-dependent expression. Deletion analysis reveals that the region important for cell-cycle regulation is within -441 to -63 nucleotides from the transcriptional initiation site. This region (-441 to -63) also confers cell-cycle regulation to the herpes simplex virus thymidine kinase (HSVtk) promoter, which is not expressed in a cell-cycle manner. We conclude that the -441 to -63 sequence within the human TK promoter is important for cell-cycle-dependent expression. Images PMID:3413063

  16. Sequences contained within the promoter of the human thymidine kinase gene can direct cell-cycle regulation of heterologous fusion genes

    SciTech Connect

    Kim, Yongkyu; Wells, S.; Lau, Yunfai Chris; Lee, A.S. )

    1988-08-01

    Recent evidence on the transcriptional regulation of the human thymidine kinase (TK) gene raises the possibility that cell-cycle regulatory sequences may be localized within its promoter. A hybrid gene that combines the TK 5{prime} flanking sequence and the coding region of the bacterial neomycin-resistance gene (neo) has been constructed. Upon transfection into a hamster fibroblast cell line K12, the hybrid gene exhibits cell-cycle-dependent expression. Deletion analysis reveals that the region important for cell-cycle regulation is within {minus}441 to {minus}63 nucleotides from the transcriptional initiation site. This region ({minus}441 to {minus}63) also confers cell-cycle regulation to the herpes simplex virus thymidine kinase (HSVtk) promoter, which is not expressed in a cell-cycle manner. The authors conclude that the {minus}441 to {minus}63 sequence within the human TK promoter is important for cell-cycle-dependent expression.

  17. Promoter region sequence differences in the A and G gamma globin genes of Brazilian sickle cell anemia patients.

    PubMed

    Barbosa, C G; Goncalves-Santos, N J; Souza-Ribeiro, S B; Moura-Neto, J P; Takahashi, D; Silva, D O; Hurtado-Guerrero, A F; Reis, M G; Goncalves, M S

    2010-08-01

    Fetal hemoglobin (HbF), encoded by the HBG2 and HBG1 genes, is the best-known genetic modulator of sickle cell anemia, varying dramatically in concentration in the blood of these patients. This variation is partially associated with polymorphisms located in the promoter region of the HBG2 and HBG1 genes. In order to explore known and unknown polymorphisms in these genes, the sequences of their promoter regions were screened in sickle cell anemia patients and correlated with both their HbF levels and their betaS-globin haplotypes. Additionally, the sequences were compared with genes from 2 healthy groups, a reference one (N = 104) and an Afro-descendant one (N = 98), to identify polymorphisms linked to the ethnic background.The reference group was composed by healthy individuals from the general population. Four polymorphisms were identified in the promoter region of HBG2 and 8 in the promoter region of HBG1 among the studied groups. Four novel single nucleotide polymorphisms (SNP) located at positions -324, -317, -309 and -307 were identified in the reference group. A deletion located between -396 and -391 in the HBG2 promoter region and the SNP -271 C-->T in the HBG1 promoter region were associated with the Central African Republic betaS-globin haplotype. In contrast, the -369 C-->G and 309 A-->G SNPs in the HBG2 promoter region were correlated to the Benin haplotype. The polymorphisms -396_-391 del HBG2, -369 SNP HBG2 and -271 SNP HBG1 correlated with HbF levels. Hence, we suggest an important role of HBG2 and HBG1 gene polymorphisms on the HbF synthesis.

  18. Structural gene for the phosphate-repressible phosphate-binding protein of Escherichia coli has its own promoter: complete nucleotide sequence of the phoS gene.

    PubMed Central

    Surin, B P; Jans, D A; Fimmel, A L; Shaw, D C; Cox, G B; Rosenberg, H

    1984-01-01

    The complete nucleotide sequence of the phoS gene, the structural gene for the phosphate-repressible, periplasmic phosphate-binding protein Escherichia coli K-12, was determined. The phosphate-binding protein is synthesized in a precursor form which includes an additional N-terminal segment containing 25 amino acid residues, with the general characteristics of a signal sequence. The amino acid sequence derived from the nucleotide sequence shows the mature protein to be composed of 321 amino acids with a calculated molecular weight of 34,427. The phoS gene is not part of an operon and is transcribed counterclockwise with respect to the E. coli genetic map. A promoter region has been identified on the basis of homology with the consensus sequence of other E. coli promoter regions. However, an alternative promoter region has been identified on the basis of homology with the promoter regions of the phoA and phoE genes, the structural genes for alkaline phosphatase and outer-membrane pore protein e, respectively. PMID:6321434

  19. Agrobacterium T-DNA integration in Arabidopsis is correlated with DNA sequence compositions that occur frequently in gene promoter regions.

    PubMed

    Schneeberger, Richard G; Zhang, Ke; Tatarinova, Tatiana; Troukhan, Max; Kwok, Shing F; Drais, Josh; Klinger, Kevin; Orejudos, Francis; Macy, Kimberly; Bhakta, Amit; Burns, James; Subramanian, Gopal; Donson, Jonathan; Flavell, Richard; Feldmann, Kenneth A

    2005-10-01

    Mobile insertion elements such as transposons and T-DNA generate useful genetic variation and are important tools for functional genomics studies in plants and animals. The spectrum of mutations obtained in different systems can be highly influenced by target site preferences inherent in the mechanism of DNA integration. We investigated the target site preferences of Agrobacterium T-DNA insertions in the chromosomes of the model plant Arabidopsis thaliana. The relative frequencies of insertions in genic and intergenic regions of the genome were calculated and DNA composition features associated with the insertion site flanking sequences were identified. Insertion frequencies across the genome indicate that T-strand integration is suppressed near centromeres and rDNA loci, progressively increases towards telomeres, and is highly correlated with gene density. At the gene level, T-DNA integration events show a statistically significant preference for insertion in the 5' and 3' flanking regions of protein coding sequences as well as the promoter region of RNA polymerase I transcribed rRNA gene repeats. The increased insertion frequencies in 5' upstream regions compared to coding sequences are positively correlated with gene expression activity and DNA sequence composition. Analysis of the relationship between DNA sequence composition and gene activity further demonstrates that DNA sequences with high CG-skew ratios are consistently correlated with T-DNA insertion site preference and high gene expression. The results demonstrate genomic and gene-specific preferences for T-strand integration and suggest that DNA sequences with a pronounced transition in CG- and AT-skew ratios are preferred targets for T-DNA integration.

  20. The expression of human H2A-H2B histone gene pairs is regulated by multiple sequence elements in their joint promoters.

    PubMed

    Trappe, R; Doenecke, D; Albig, W

    1999-09-03

    The majority of human H2A and H2B histone genes are organized as gene pairs: 14 H2A-H2B gene pairs, one solitary H2A gene and three solitary H2B genes have been described. Two of the H2A genes and two of the H2B genes arranged within gene pairs are pseudogenes. The gene pairs are organized with divergent transcriptional orientation, and the coding regions of the respective H2A and H2B genes are separated by about 320 nucleotide pairs that form overlapping promoter regions. Comparison of promoters of H2A-H2B gene pairs has previously shown that these belong to two different groups (groups I and II) which are characterized by specific patterns of conserved sequence elements. We have constructed a reporter gene vector that allows the simultaneous analysis of both genes regulated by the divergent promoters belonging to group I or II, respectively. Firefly-luciferase and beta-galactosidase genes were taken as reporter genes. Site directed mutagenesis performed at individual promoter elements revealed that individual sequence elements within both groups of promoters functionally depend on each other and may contribute to a coordinate expression of paired H2A and H2B genes through assembly of their joint promoter into a mutually dependent promoter complex. Group II promoters are characterized by the presence of an E2F binding site upstream of the H2A gene-proximal TATA box. Immediately upstream of the E2F element, we have identified a highly conserved octanucleotide CACAGCTT (RT-1) that exists in all human group II H2A-H2B gene promoters. Protein binding studies at the RT-1 element indicate factor binding to this sequence. Site directed mutagenesis indicates that both the E2F element and the RT-1 motif are essential for full promoter activity.

  1. Regulation of vitellogenin gene expression in transgenic Caenorhabditis elegans: short sequences required for activation of the vit-2 promoter.

    PubMed Central

    MacMorris, M; Broverman, S; Greenspoon, S; Lea, K; Madej, C; Blumenthal, T; Spieth, J

    1992-01-01

    The Caenorhabditis elegans vitellogenin genes are subject to sex-, stage-, and tissue-specific regulation: they are expressed solely in the adult hermaphrodite intestine. Comparative sequence analysis of the DNA immediately upstream of these genes revealed the presence of two repeated heptameric elements, vit promoter element 1 (VPE1) and VPE2. VPE1 has the consensus sequence TGTCAAT, while VPE2, CTGATAA, shares the recognition sequence of the GATA family of transcription factors. We report here a functional analysis of the VPEs within the 5'-flanking region of the vit-2 gene using stable transgenic lines. The 247 upstream bp containing the VPEs was sufficient for high-level, regulated expression. Furthermore, none of the four deletion mutations or eight point mutations tested resulted in expression of the reporter gene in larvae, males, or inappropriate hermaphrodite tissues. Mutation of the VPE1 closest to the TATA box inactivated the promoter, in spite of the fact that four additional close matches to the VPE1 consensus sequence are present within the 5'-flanking 200 bp. Each of these upstream VPE1-like sequences could be mutated without loss of high-level transgene expression, suggesting that if these VPE1 sequences play a role in regulating vit-2, their effects are more subtle. A site-directed mutation in the overlapping VPE1 and VPE2 at -98 was sufficient to inactivate the promoter, indicating that one or both of these VPEs must be present for activation of vit-2 transcription. Similarly, a small perturbation of the VPE2 at -150 resulted in reduction of fp155 expression, while a more extensive mutation in this element eliminated expression. On the other hand, deletion of this VPE2 and all upstream DNA still permitted correctly regulated expression, although at a very low level, suggesting that this VPE2 performs an important role in activation of vit-2 expression but may not be absolutely required. The results, taken together, demonstrate that both VPE1 and

  2. Sequenced Alleles of the Caenorhabditis Elegans Sex-Determining Gene Her-1 Include a Novel Class of Conditional Promoter Mutations

    PubMed Central

    Perry, M. D.; Trent, C.; Robertson, B.; Chamblin, C.; Wood, W. B.

    1994-01-01

    In the control of Caenorhabditis elegans sex determination, the her-1 gene must normally be activated to allow male development of XO animals and deactivated to allow hermaphrodite development of XX animals. The gene is regulated at the transcriptional level and has two nested male-specific transcripts. The larger of these encodes a small, novel, cysteine-rich protein responsible for masculinizing activity. Of the 32 extant mutant alleles, 30 cause partial or complete loss of masculinizing function (lf), while 2 are gain-of-function (gf) alleles resulting in abnormal masculinization of XX animals. We have identified the DNA sequence changes in each of these 32 alleles. Most affect the protein coding functions of the gene, but six are in the promoter region, including the two gf mutations. These two mutations may define a binding site for negative regulators of her-1. Three of the four remaining promoter mutations are single base changes that cause, surprisingly, temperature-sensitive loss of her-1 function. Such conditional promoter mutations have previously not been found among either prokaryotic or eukaryotic mutants analyzed at the molecular level. PMID:7828816

  3. Understanding the transcriptional regulation of cervix cancer using microarray gene expression data and promoter sequence analysis of a curated gene set.

    PubMed

    Srivastava, Prashant; Mangal, Manu; Agarwal, Subhash Mohan

    2014-02-10

    Cervical cancer, the malignant neoplasm of the cervix uteri is the second most common cancer among women worldwide and the top-most cancer in India. Several factors are responsible for causing cervical cancer, which alter the expression of oncogenic genes resulting in up or down-regulation of gene expression and inactivation of tumor-suppressor genes/gene products. Gene expression is regulated by interactions between transcription factors (TFs) and specific regulatory elements in the promoter regions of target genes. Thus, it is important to decipher and analyze TFs that bind to regulatory regions of diseased genes and regulate their expression. In the present study, computational methods involving the combination of gene expression data from microarray experiments and promoter sequence analysis of a curated gene set involved in the cervical cancer causation have been utilized for identifying potential regulatory elements. Consensus predictions of two approaches led to the identification of twelve TFs that might be crucial to the regulation of cervical cancer progression. Subsequently, TF enrichment and oncomine expression analysis suggested that the transcription factor family E2F played an important role for the regulation of genes involve in cervical carcinogenesis. Our results suggest that E2F possesses diagnostic/prognostic value and can act as a potential drug target in cervical cancer.

  4. Nucleotide sequence conservation of novel and established cis-regulatory sites within the tyrosine hydroxylase gene promoter

    PubMed Central

    Wang, Meng; Banerjee, Kasturi; Baker, Harriet; Cave, John W.

    2015-01-01

    Tyrosine hydroxylase (TH) is the rate-limiting enzyme in catecholamine biosynthesis and its gene proximal promoter ( < 1 kb upstream from the transcription start site) is essential for regulating transcription in both the developing and adult nervous systems. Several putative regulatory elements within the TH proximal promoter have been reported, but evolutionary conservation of these elements has not been thoroughly investigated. Since many vertebrate species are used to model development, function and disorders of human catecholaminergic neurons, identifying evolutionarily conserved transcription regulatory mechanisms is a high priority. In this study, we align TH proximal promoter nucleotide sequences from several vertebrate species to identify evolutionarily conserved motifs. This analysis identified three elements (a TATA box, cyclic AMP response element (CRE) and a 5′-GGTGG-3′ site) that constitute the core of an ancient vertebrate TH promoter. Focusing on only eutherian mammals, two regions of high conservation within the proximal promoter were identified: a ∼250 bp region adjacent to the transcription start site and a ∼85 bp region located approximately 350 bp further upstream. Within both regions, conservation of previously reported cis-regulatory motifs and human single nucleotide variants was evaluated. Transcription reporter assays in a TH -expressing cell line demonstrated the functionality of highly conserved motifs in the proximal promoter regions and electromobility shift assays showed that brain-region specific complexes assemble on these motifs. These studies also identified a non-canonical CRE binding (CREB) protein recognition element in the proximal promoter. Together, these studies provide a detailed analysis of evolutionary conservation within the TH promoter and identify potential cis-regulatory motifs that underlie a core set of regulatory mechanisms in mammals. PMID:25774193

  5. Transcription of the Drosophila melanogaster 5S RNA gene requires an upstream promoter and four intragenic sequence elements

    SciTech Connect

    Sharp, S.J.; Garcia, A.D.

    1988-03-01

    Linker-scanning (LS) mutations were constructed spanning the length of the Drosophila melanogaster 5S RNA gene. In vitro transcription analysis of the LS 5S DNAs revealed five transcription control regions. One control region essential for the transcription initiation was identified in the 5'-flanking sequence. The major sequence determinants of this upstream promoter region were located between coordinates -39 and -26 (-30 region), but important sequences extended to the transcription start site at position 1. Since mutations in the upstream promoter did not alter the ability of 5S DNA to sequester transcription factors into a stable transcription complex, it appears that this control region involved the interaction of RNA polymerase III. Active 5S DNA transcription additionally required the four intragenic control regions (ICRs) located between coordinates 3 and 18 (ICR I), 37 and 44 (ICR II), 48 and 61 (ICR III), and 78 and 98 (ICR IV). LS mutations in each ICR decreased the ability of 5S DNA to sequester transcription factors. ICR III, ICR IV, and the spacer sequence between were similar in sequence and position to the determinant elements of the multipartite ICR of Xenopus 5S DNA. The importance of ICR III and ICR IV in transcription initiation and in sequestering transcription factors suggests the presence of an activity in D. melanogaster similar to transcription factor TFIIIA of Xenopus laevis and HeLa cells. Transcription initiation of Drosophila 5S DNA was not eliminated by LS mutations in the spacer region even though these mutations reduced the ability of the TFIIIA-like activity to bind.

  6. Identification of the transcriptional unit, structural organization, and promoter sequence of the human sex-determining region Y (SRY) gene, using a reverse genetic approach

    SciTech Connect

    Hua Su; Lau, Y.F.C. )

    1993-01-01

    Using a simple strategy involving cosmid-mediated gene transfer, cDNA library construction, and molecular characterization techniques, the authors have determined the transcriptional unit, structural organization, and promoter sequence of the human sex-determining region Y (SRY) gene, the putative testis-determining factor (TDF) gene on the human Y chromosome. By this approach, a recombinant cosmid harboring the human SRY sequence was isolated and transfected to appropriate tissue-cultured cells. Recombinant cDNA clones were isolated from a cDNA library constructed from poly (A) + RNA of the transfected cells. Comparative studies between the respective cDNAs and the genomic cosmid have provided information regarding the organization of the SRY gene and its mRNAs. The results indicate that the human SRY gene is an intronless gene, produces transcripts of 1.1 kb, and possesses promoter activities in the transfected cells at approximately 310 bp of its upstream sequences. 57 refs., 5 figs.

  7. Detection of cytosine and CpG density in proto-oncogenes and tumor suppressor genes in promoter sequences of acute myeloid leukemia.

    PubMed

    Dogan, Senol; Cilic, Anis; Marjanovic, Damir; Kurtovic-Kozaric, Amina

    2017-03-21

    Aberrant methylation is one of the driving forces of cancer genome development. Although the rate of methylation appears massively variable across the genome, it is mainly observed in histone modification, chromatin organization, DNA accessibility, or promoter sequence. Methylation of promoter sequence occurs mostly to cytosine nucleotides, which can affect transcription factors' binding affinities. In this study, we demonstrated that cytosine repeats (C types density), consisting of CC, CCC, CCCC, CCCCC, CCCCCC, CCCCCCC motifs and CpG islands density in 25 proto-oncogenes, tumor suppressor genes and control genes may play a role in the pathogenesis of acute myeloid leukemia. The promoter sequences were divided into a 100 nucleotide window from -500 to +100 nucleotides and 20 nucleotide window from -100 to +100. Each window is analyzed to find the higher C type and CpG islands density, which may cause the increased methylation in the promoter sequence. Our novel findings show that promoter sequence cytosine repeats and CpG density increase closer to transcription sites, especially just before and after the transcription start site (TSS). The results demonstrate that cytosine density increases while proto-oncogenes and TSG promoter sequences are closer to TSS 50.8% and 41.0% respectively, if (-500 to -200) and (-100 to +100) windows of the nucleotide sequences are compared. This proves that around TSS location has special nucleotide motifs and could be an important implication for our understanding of potential methylating locations in promoters.

  8. Detailed analysis of Helicobacter pylori Fur-regulated promoters reveals a Fur box core sequence and novel Fur-regulated genes.

    PubMed

    Pich, Oscar Q; Carpenter, Beth M; Gilbreath, Jeremy J; Merrell, D Scott

    2012-06-01

    In Helicobacter pylori, iron balance is controlled by the Ferric uptake regulator (Fur), an iron-sensing repressor protein that typically regulates expression of genes implicated in iron transport and storage. Herein, we carried out extensive analysis of Fur-regulated promoters and identified a 7-1-7 motif with dyad symmetry (5'-TAATAATnATTATTA-3'), which functions as the Fur box core sequence of H. pylori. Addition of this sequence to the promoter region of a typically non-Fur regulated gene was sufficient to impose Fur-dependent regulation in vivo. Moreover, mutation of this sequence within Fur-controlled promoters negated regulation. Analysis of the H. pylori chromosome for the occurrence of the Fur box established the existence of well-conserved Fur boxes in the promoters of numerous known Fur-regulated genes, and revealed novel putative Fur targets. Transcriptional analysis of the new candidate genes demonstrated Fur-dependent repression of HPG27_51, HPG27_52, HPG27_199, HPG27_445, HPG27_825 and HPG27_1063, as well as Fur-mediated activation of the cytotoxin associated gene A, cagA (HPG27_507). Furthermore, electrophoretic mobility shift assays confirmed specific binding of Fur to the promoters of each of these genes. Future experiments will determine whether loss of Fur regulation of any of these particular genes contributes to the defects in colonization exhibited by the H. pylori fur mutant.

  9. Genomic organization and sequence of the human NRAMP gene: identification and mapping of a promoter region polymorphism.

    PubMed Central

    Blackwell, J. M.; Barton, C. H.; White, J. K.; Searle, S.; Baker, A. M.; Williams, H.; Shaw, M. A.

    1995-01-01

    BACKGROUND: Murine Nramp is a candidate for the macrophage resistance gene Ity/Lsh/Bcg. Sequence analysis of human NRAMP was undertaken to determine its role in man. MATERIALS AND METHODS: A yeast artificial chromosome carrying NRAMP was subcloned and positive clones sequenced. The transcriptional start site was mapped using 5' RACE PCR. Polymorphic variants were amplified by PCR. Linkage analysis was used to map NRAMP. RESULTS: NRAMP spans 12kb and has 15 exons encoding a 550 amino acid protein showing 85% identity (92% similarity) with Nramp. Two conserved PKC sites occur in exon 2 encoding the Pro/Ser rich SH3 binding domain, and in exon 3. Striking sequence similarities (57 and 53%) were observed with yeast mitochondrial proteins, SMF1 and SMF2, especially within putative functional domains: exon 6 encoding the second transmembrane spanning domain, site of the murine susceptibility mutation; and exon 11 encoding a conserved transport motif. No mutations comparable to the murine susceptibility mutation were found. The transcriptional initiation site mapped 148 bp 5' of the translational initiation codon. 440bp of 5' flanking sequence contained putative promoter region elements: 6 interferon-gamma response elements, 3 W-elements, 3 NF kappa B binding sites and 1 AP-1 site. Nine purine-rich GGAA core motifs for the myeloid-specific PU.1 transcription factor were identified, two combining with imperfect AP1-like sites to create PEA3 motifs. TATA, GC and CCAAT boxes were absent. A possible enhancer element containing the Z-DNA forming dinucleotide repeat t(gt),ac(gt),ac(gt),g was polymorphic (4 alleles; n = 4,9,10,11), and was used to map NRAMP to 2q35. CONCLUSIONS: This analysis provides important resources to study the role of NRAMP in human disease. Images FIG. 3 FIG. 4 PMID:8529098

  10. Mutation analysis of TRPS1 gene including core promoter, 5'UTR, and 3'UTR regulatory sequences with insight into their organization.

    PubMed

    Solc, Roman; Klugerova, Michaela; Vcelak, Josef; Baxova, Alice; Kuklik, Miloslav; Vseticka, Jan; Beharka, Rastislav; Hirschfeldova, Katerina

    2017-01-01

    The TRPS1 protein is a potent regulator of proliferation, differentiation, and apoptosis. The TRPS1 gene aberrations are strongly associated with rare trichorhinophalangeal syndrome (TRPS) development. We have conducted MLPA analysis to capture deletion within the crucial 8q24.1 chromosomal region in combination with mutation analysis of TRPS1 gene including core promoter, 5'UTR, and 3'UTR sequences in nine TRPS patients. Low complexity or extent of untranslated regulatory sequences avoided them from analysis in previous studies. Amplicon based next generation sequencing used in our study bridge over these technical limitations. Finally, we have made extended in silico analysis of TRPS1 gene regulatory sequences organization. Single contiguous deletion and an intragenic deletion intervening several exons were detected. Mutation analysis revealed five TRPS1 gene aberrations (two structural rearrangements, two nonsense mutations, and one missense substitution) reaching the overall detection rate of 78%. Several polymorphic variants were detected within the analysed regulatory sequences but without proposed pathogenic effect. In silico analysis suggested alternative promoter usage and diverse expression effectivity for different TRPS1 transcripts. Haploinsufficiency of TRPS1 gene was responsible for most of the TRPS phenotype. Structure of TRPS1 gene regulatory sequences is indicative of generally low single allele expression and its tight control.

  11. A conserved 11 nucleotide sequence contains an essential promoter element of the maize mitochondrial atp1 gene.

    PubMed Central

    Rapp, W D; Stern, D B

    1992-01-01

    To determine the structure of a functional plant mitochondrial promoter, we have partially purified an RNA polymerase activity that correctly initiates transcription at the maize mitochondrial atp1 promoter in vitro. Using a series of 5' deletion constructs, we found that essential sequences are located within--19 nucleotides (nt) of the transcription initiation site. The region surrounding the initiation site includes conserved sequence motifs previously proposed to be maize mitochondrial promoter elements. Deletion of a conserved 11 nt sequence showed that it is critical for promoter function, but deletion or alteration of conserved upstream G(A/T)3-4 repeats had no effect. When the atp1 11 nt sequence was inserted into different plasmids lacking mitochondrial promoter activity, transcription was only observed for one of these constructs. We infer from these data that the functional promoter extends beyond this motif, most likely in the 5' direction. The maize mitochondrial cox3 and atp6 promoters also direct transcription initiation in this in vitro system, suggesting that it may be widely applicable for studies of mitochondrial transcription in this species. Images PMID:1372246

  12. Promoter sequence of 3-phosphoglycerate kinase gene 1 of lactic acid-producing fungus rhizopus oryzae and a method of expressing a gene of interest in fungal species

    DOEpatents

    Gao, Johnway [Richland, WA; Skeen, Rodney S [Pendleton, OR

    2002-10-15

    The present invention provides the promoter clone discovery of phosphoglycerate kinase gene 1 of a lactic acid-producing filamentous fungal strain, Rhizopus oryzae. The isolated promoter can constitutively regulate gene expression under various carbohydrate conditions. In addition, the present invention also provides a design of an integration vector for the transformation of a foreign gene in Rhizopus oryzae.

  13. Promoter sequence of 3-phosphoglycerate kinase gene 2 of lactic acid-producing fungus rhizopus oryzae and a method of expressing a gene of interest in fungal species

    DOEpatents

    Gao, Johnway [Richland, WA; Skeen, Rodney S [Pendleton, OR

    2003-03-04

    The present invention provides the promoter clone discovery of phosphoglycerate kinase gene 2 of a lactic acid-producing filamentous fungal strain, Rhizopus oryzae. The isolated promoter can constitutively regulate gene expression under various carbohydrate conditions. In addition, the present invention also provides a design of an integration vector for the transformation of a foreign gene in Rhizopus oryzae.

  14. Structural analysis of the regulatory elements of the type-II procollagen gene. Conservation of promoter and first intron sequences between human and mouse.

    PubMed Central

    Vikkula, M; Metsäranta, M; Syvänen, A C; Ala-Kokko, L; Vuorio, E; Peltonen, L

    1992-01-01

    Transcription of the type-II procollagen gene (COL2A1) is very specifically restricted to a limited number of tissues, particularly cartilages. In order to identify transcription-control motifs we have sequenced the promoter region and the first intron of the human and mouse COL2A1 genes. With the assumption that these motifs should be well conserved during evolution, we have searched for potential elements important for the tissue-specific transcription of the COL2A1 gene by aligning the two sequences with each other and with the available rat type-II procollagen sequence for the promoter. With this approach we could identify specific evolutionarily well-conserved motifs in the promoter area. On the other hand, several suggested regulatory elements in the promoter region did not show evolutionary conservation. In the middle of the first intron we found a cluster of well-conserved transcription-control elements and we conclude that these conserved motifs most probably possess a significant function in the control of the tissue-specific transcription of the COL2A1 gene. We also describe locations of additional, highly conserved nucleotide stretches, which are good candidate regions in the search for binding sites of yet-uncharacterized cartilage-specific transcription regulators of the COL2A1 gene. PMID:1637314

  15. Analysis of sequences involved in IE2 transactivation of a baculovirus immediate-early gene promoter and identification of a new regulatory motif.

    PubMed

    Shippam-Brett, C E; Willis, L G; Theilmann, D A

    2001-05-01

    Opep-2 is a unique baculovirus early gene that has only been identified in the Orgyia pseudotsugata multiple capsid nucleopolyhedrovirus (OpMNPV). Previous analyses have shown this gene is expressed at very early times post-infection (p.i.) but is shut down by 36-48 h p.i. The promoter of opep-2 therefore, represents a class of early genes that is temporally regulated. In this study, a detailed analysis of the opep-2 promoter is performed to analyze the role individual motifs play in early gene expression. A new 13 base pair regulatory element was identified and shown to be essential in controlling high-level expression of this gene. In addition, mutational analysis revealed that GATA and CACGTG motifs, which have been shown to bind cellular factors in Sf9 and Ld652Y cells, played minor roles in influencing opep-2 expression in the absence of other viral factors. The OpMNPV transactivator IE2 causes a significant activation of the opep-2 promoter. Cotransfection of an extensive number of promoter deletions and mutations did not show any sequence specificity for IE2 transactivation. This is the first detailed analysis of the sequence requirements for IE2 transactivation, and these results suggest that IE2 does not bind directly to specific elements in the opep-2 promoter.

  16. [Gene and gene sequence patenting].

    PubMed

    Bergel, S D

    1998-01-01

    According to the author, the patenting of elements isolated or copied from the human body boils down to the issue of genes and gene sequences. He describes the current situation from the comparative law standpoint (U.S. and Spanish law mainly) and then esamines the biotechnology industry's position.

  17. Swapped green algal promoters: aphVIII-based gene constructs with Chlamydomonas flanking sequences work as dominant selectable markers in Volvox and vice versa.

    PubMed

    Hallmann, A; Wodniok, S

    2006-06-01

    Production of transgenic organisms is a well-established, versatile course of action in molecular biology. Genetic engineering often requires heterologous, dominant antibiotic resistance genes that have been used as selectable markers in many species. However, as heterologous 5' and 3' flanking sequences often result in very low expression rates, endogenous flanking sequences, especially promoters, are mostly required and are easily obtained in model organisms, but it is much more complicated and time-consuming to get appropriate sequences from less common organisms. In this paper, we show that aminoglycoside 3'-phosphotransferase gene (aphVIII) based constructs with 3' and 5' untranslated flanking sequences (including promoters) from the multicellular green alga Volvox work in the unicellular green alga Chlamydomonas and flanking sequences from Chlamydomonas work in Volvox, at least if a low expression rate is compensated by an enforced high gene dosage. This strategy might be useful for all investigators that intend to transform species in which genomic sequences are not available, but sequences from related organisms exist.

  18. Gene expression promoted by the SV40 DNA targeting sequence and the hypoxia-responsive element under normoxia and hypoxia.

    PubMed

    Sacramento, C B; Moraes, J Z; Denapolis, P M A; Han, S W

    2010-08-01

    The main objective of the present study was to find suitable DNA-targeting sequences (DTS) for the construction of plasmid vectors to be used to treat ischemic diseases. The well-known Simian virus 40 nuclear DTS (SV40-DTS) and hypoxia-responsive element (HRE) sequences were used to construct plasmid vectors to express the human vascular endothelial growth factor gene (hVEGF). The rate of plasmid nuclear transport and consequent gene expression under normoxia (20% O2) and hypoxia (less than 5% O2) were determined. Plasmids containing the SV40-DTS or HRE sequences were constructed and used to transfect the A293T cell line (a human embryonic kidney cell line) in vitro and mouse skeletal muscle cells in vivo. Plasmid transport to the nucleus was monitored by real-time PCR, and the expression level of the hVEGF gene was measured by ELISA. The in vitro nuclear transport efficiency of the SV40-DTS plasmid was about 50% lower under hypoxia, while the HRE plasmid was about 50% higher under hypoxia. Quantitation of reporter gene expression in vitro and in vivo, under hypoxia and normoxia, confirmed that the SV40-DTS plasmid functioned better under normoxia, while the HRE plasmid was superior under hypoxia. These results indicate that the efficiency of gene expression by plasmids containing DNA binding sequences is affected by the concentration of oxygen in the medium.

  19. Combinatorial variation in coding and promoter sequences of genes at the Tri locus in Pisum sativum accounts for variation in trypsin inhibitor activity in seeds.

    PubMed

    Page, D; Aubert, G; Duc, G; Welham, T; Domoney, C

    2002-05-01

    Cultivars of Pisum sativum that differ with respect to the quantitative expression of trypsin/chymotrypsin inhibitor proteins in seeds have been examined in terms of the structure of the corresponding genes. The patterns of divergence in the promoter and coding sequences are described, and the divergence among these exploited for the development of facile DNA-based assays to distinguish genotypes. Quantitative effects on gene expression may be attributed to the overall gene complement and to particular promoter/coding sequence combinations, as well as to the existence of distinct active-site variants that ultimately influence protein activity. Electronic supplementary material to this paper can be obtained by using the Springer LINK server located at http://dx.doi.org/10.1007/s00438-002-0667-4.

  20. Identification of the transcriptional unit, structural organization, and promoter sequence of the human sex-determining region Y (SRY) gene, using a reverse genetic approach.

    PubMed Central

    Su, H; Lau, Y F

    1993-01-01

    Using a simple strategy involving cosmid-mediated gene transfer, cDNA library construction, and molecular characterization techniques, we have determined the transcriptional unit, structural organization, and promoter sequence of the human sex-determining region Y (SRY) gene, the putative testis-determining factor (TDF) gene on the human Y chromosome. By this approach, a recombinant cosmid harboring the human SRY sequence was isolated and transfected to appropriate tissue-cultured cells. Recombinant cDNA clones were isolated from a cDNA library constructed from poly (A) + RNA of the transfected cells. Comparative studies between the respective cDNAs and the genomic cosmid have provided information regarding the organization of the SRY gene and its mRNAs. The results indicate that the human SRY gene is an intronless gene, produces transcripts of 1.1 kb, and possesses promoter activities in the transfected cells at approximately 310 bp of its upstream sequences. Images Figure 1 Figure 2 Figure 4 Figure 5 PMID:8434602

  1. In silico discrimination of single nucleotide polymorphisms and pathological mutations in human gene promoter regions by means of local DNA sequence context and regularity.

    PubMed

    Khan, Imtiaz A; Mort, Matthew; Buckland, Paul R; O'Donovan, Michael C; Cooper, David N; Chuzhanova, Nadia A

    2006-01-01

    DNA sequence features were sought that could be used for the in silico ascertainment of the likely functional consequences of single nucleotide changes in human gene promoter regions. To identify relevant features of the local DNA sequence context, we transformed into consensus tables the nucleotide composition of sequences flanking 101 promoter SNPs of type C<-->T or A<-->G, defined empirically as being either 'functional' or 'non-functional' on the basis of a standardised reporter gene assay. The similarity of a given sequence to these consensus tables was then measured by means of the Shapiro-Senapathy score. A decision rule with the potential to discriminate between empirically ascertained functional and non-functional SNPs was proposed that potentiated discrimination between functional and non-functional SNPs with a sensitivity of 80% and a specificity of 20%. Two further datasets (viz. disease-associated SNPs of types A<-->G and C<-->T (N = 75) and pathological promoter mutations (transitions, N = 114)) were retrieved from the Human Gene Mutation Database (HGMD; http://www.hgmd.org/) and analyzed using consensus tables derived from the functional and non-functional promoter SNPs; approximately 70% were correctly recognized as being of probable functional significance. Complexity analysis was also used to quantify the regularity of the local DNA sequence environment. Functional SNPs/mutations of type C<-->T were found to occur in DNA regions characterized by lower average sequence complexity as measured with respect to symmetric elements; complexity values increased gradually from functional SNPs and pathological mutations to functional disease-associated SNPs and non-functional SNPs. This may reflect the internal axial symmetry that frequently characterizes transcription factor binding sites.

  2. Histone acetylation accompanied with promoter sequences displaying differential expression profiles of B-class MADS-box genes for phalaenopsis floral morphogenesis.

    PubMed

    Hsu, Chia-Chi; Wu, Pei-Shan; Chen, Tien-Chih; Yu, Chun-Wei; Tsai, Wen-Chieh; Wu, Keqiang; Wu, Wen-Luan; Chen, Wen-Huei; Chen, Hong-Hwa

    2014-01-01

    Five B-class MADS-box genes, including four APETALA3 (AP3)-like PeMADS2∼5 and one PISTILLATA (PI)-like PeMADS6, specify the spectacular flower morphology in orchids. The PI-like PeMADS6 ubiquitously expresses in all floral organs. The four AP3-like genes, resulted from two duplication events, express ubiquitously at floral primordia and early floral organ stages, but show distinct expression profiles at late floral organ primordia and floral bud stages. Here, we isolated the upstream sequences of PeMADS2∼6 and studied the regulatory mechanism for their distinct gene expression. Phylogenetic footprinting analysis of the 1.3-kb upstream sequences of AP3-like PeMADS2∼5 showed that their promoter regions have sufficiently diverged and contributed to their subfunctionalization. The amplified promoter sequences of PeMADS2∼6 could drive beta-glucuronidase (GUS) gene expression in all floral organs, similar to their expression at the floral primordia stage. The promoter sequence of PeMADS4, exclusively expressed in lip and column, showed a 1.6∼3-fold higher expression in lip/column than in sepal/petal. Furthermore, we noted a 4.9-fold increase in histone acetylation (H3K9K14ac) in the translation start region of PeMADS4 in lip as compared in petal. All these results suggest that the regulation via the upstream sequences and increased H3K9K14ac level may act synergistically to display distinct expression profiles of the AP3-like genes at late floral organ primordia stage for Phalaenopsis floral morphogenesis.

  3. Enhancement of heterologous production of eicosapentaenoic acid in Escherichia coli by substitution of promoter sequences within the biosynthesis gene cluster.

    PubMed

    Lee, Su-Jin; Kim, Chul Ho; Seo, Pil-Soo; Kwon, Ohsuk; Hur, Byung-Ki; Seo, Jeong-Woo

    2008-12-01

    To enhance the heterologous production of eicosapentaenoic acid (EPA) in Escherichia coli, the EPA biosynthesis gene cluster from Shewanella oneidensis MR-1 was cloned under the lacZ promoter on a high-copy number plasmid, pBluescript SK+. The production of EPA was remarkably enhanced yielding levels of up to 7.5% of the total fatty acid content in the recombinant E. coli strain by induction with IPTG, whereas the stimulation of EPA production was abolished by adding glucose into the culture medium, probably due to glucose repression acting on the promoter activity.

  4. Identification of a cis-acting element in the class I major histocompatibility complex gene promoter responsive to activation by retroviral sequences.

    PubMed Central

    Choi, S Y; van de Mark, K; Faller, D V

    1997-01-01

    The infection of cells with Moloney murine leukemia virus (M-MuLV) causes an increase in specific cellular gene products, including the major histocompatibility complex (MHC) class I antigens. This upregulation occurs through a transactivation process mediated by the long terminal repeat (LTR) of M-MuLV, and we show here that the gene activation response to the LTR requires at least one specific cis element within the MHC proximal promoter region. Nested deletions of MHC class I H-2Kb gene promoter sequence were subcloned into a chloramphenicol acetyltransferase (CAT) reporter vector and then transiently introduced into BALB/c-3T3 cells expressing M-MuLV or cotransfected into BALB/c-3T3 cells with a vector containing subgenomic portions of the virus, including the LTR. CAT activity assays demonstrated that a minimal H-2Kb gene promoter (-64 to +12) contained elements sufficient for this transactivation. DNase I footprinting assays located a protein-binding site in the region of -64 to -34 bp from the transcriptional start site, and point mutation analysis confirmed the location of this cis-acting element, designated the let response element (LRE), and defined a binding motif. This LRE is distinct from binding sites for currently known transcription factors in the class I MHC gene promoter and is conserved in the promoters of human and murine MHC class I genes. Mutation of the LRE resulted in dramatic reduction in both DNA-protein binding activity in electrophoretic mobility shift assay and in the ability of the mutated promoter to respond to retroviral transactivation. Addition of the LRE to a heterologous promoter conferred the ability to respond to retroviral transactivation. PMID:8995614

  5. A Sequence of the CIS Gene Promoter Interacts Preferentially with Two Associated STAT5A Dimers: a Distinct Biochemical Difference between STAT5A and STAT5B

    PubMed Central

    Verdier, Frédérique; Rabionet, Raquel; Gouilleux, Fabrice; Beisenherz-Huss, Christian; Varlet, Paule; Muller, Odile; Mayeux, Patrick; Lacombe, Catherine; Gisselbrecht, Sylvie; Chretien, Stany

    1998-01-01

    Two distinct genes encode the closely related signal transducer and activator of transcription proteins STAT5A and STAT5B. The molecular mechanisms of gene regulation by STAT5 and, particularly, the requirement for both STAT5 isoforms are still undetermined. Only a few STAT5 target genes, among them the CIS (cytokine-inducible SH2-containing protein) gene, have been identified. We cloned the human CIS gene and studied the human CIS gene promoter. This promoter contains four STAT binding elements organized in two pairs. By electrophoretic mobility shift assay studies using nuclear extracts of UT7 cells stimulated with erythropoietin, we showed that these four sequences bound to STAT5-containing complexes that exhibited different patterns and affinities: the three upstream STAT binding sequences bound to two distinct STAT5-containing complexes (C0 and C1) and the downstream STAT box bound only to the slower-migrating C1 band. Using nuclear extracts from COS-7 cells transfected with expression vectors for the prolactin receptor, STAT5A, and/or STAT5B, we showed that the C1 complex was composed of a STAT5 tetramer and was dependent on the presence of STAT5A. STAT5B lacked this property and bound with a stronger affinity than did STAT5A to the four STAT sequences as a homodimer (C0 complex). This distinct biochemical difference between STAT5A and STAT5B was confirmed with purified activated STAT5 recombinant proteins. Moreover, we showed that the presence on the same side of the DNA helix of a second STAT sequence increased STAT5 binding and that only half of the palindromic STAT binding sequence was sufficient for the formation of a STAT5 tetramer. Again, STAT5A was essential for this cooperative tetrameric association. This property distinguishes STAT5A from STAT5B and could be essential to explain the transcriptional regulation diversity of STAT5. PMID:9742102

  6. Exonic sequences are required for elicitor and light activation of a plant defense gene, but promoter sequences are sufficient for tissue specific expression.

    PubMed Central

    Douglas, C J; Hauffe, K D; Ites-Morales, M E; Ellard, M; Paszkowski, U; Hahlbrock, K; Dangl, J L

    1991-01-01

    The parsley 4CL-1 gene encodes 4-coumarate:CoA ligase, a key enzyme of general phenylpropanoid metabolism. As well as being transcriptionally activated by such stresses as pathogen infection, UV-irradiation, and wounding, expression of 4CL-1 is developmentally regulated. In this paper we present evidence that 4CL-1 cis-acting elements which control stress-induced and developmental expression are physically separated. The ability of a series of 4CL gene constructions to respond to elicitor and light in stably or transiently transformed parsley cells was tested. While inducible expression was observed from all templates in which the 4CL-1 structural gene was fused to the 4CL-1 promoter, fusions of the promoter to the GUS reporter gene were completely unresponsive. The element(s) required for responsiveness appear to be exonic, since 4CL-1 introns and 3' flanking DNA had no effect on inducibility. Furthermore, this unconventional regulatory mode operates in transgenic tobacco plants, where we show that a 4CL-1 promoter fragment specifies correct cell-specific expression when fused to GUS yet is unresponsive to elicitor and light. Images PMID:2050114

  7. A fusion promoter created by a new insertion sequence, IS1490, activates transcription of 2,4,5-trichlorophenoxyacetic acid catabolic genes in Burkholderia cepacia AC1100.

    PubMed Central

    Hübner, A; Hendrickson, W

    1997-01-01

    Transposition and transcriptional activation by insertion sequences in Burkholderia cepacia AC1100 were investigated. Two closely related new elements, IS1413 and IS1490, were identified and characterized. These elements are not highly related to other insertion sequences identified in AC1100 or other B. cepacia isolates. Based on their structures and the sequences of the inverted terminal repeats and the putative transposase protein, the insertion elements (IS elements) are similar to IST2 of Thiobacillus ferrooxidans and several related elements. All the IS elements that have been identified in this strain are found in multiple copies (10 to 40), and they have high-level promoter activity capable of stimulating transcription from a distance up to 500 bp from a target gene. Strain AC1100 was originally isolated after prolonged selection for the ability to utilize the herbicide 2,4,5-trichlorophenoxyacetic acid (2,4,5-T) as a sole carbon source. Three IS elements are located near the first gene of the 2,4,5-T catabolic pathway, tftA. IS1490 inserted 110 bp upstream of tftA and created a fusion promoter responsible for constitutive transcription of the gene. Our results confirm the hypothesis that IS elements play a central role in transcription of 2,4,5-T genes and likely have stimulated rapid evolution of the metabolic pathway. PMID:9098071

  8. Sequence analysis of myostatin promoter in cattle.

    PubMed

    Crisà, A; Marchitelli, C; Savarese, M C; Valentini, A

    2003-01-01

    Myostatin (GDF8) acts as a negative regulator of muscle growth. Mutations in the gene are responsible for the double muscling phenotype in several European cattle breeds. Here we describe the sequence of the upstream 5' region of the myostatin gene. The sequence analysis was carried out on three animals of nine European cattle breeds, with the aim to search for polymorphisms. A T/A polymorphism at -371 and a G/C polymorphism at -805 (relative to ATG) were found. PCR- RFLP was used to further screen 353 animals of the nine breeds studied and to assess the frequencies of the SNPs. The promoter region of the gene contains several binding sites for transcription factors found also in other myogenic genes. This may play an important role in the regulation of the protein and consequently on muscular development.

  9. Two short sequences in OsNAR2.1 promoter are necessary for fully activating the nitrate induced gene expression in rice roots

    PubMed Central

    Liu, Xiaoqin; Feng, Huimin; Huang, Daimin; Song, Miaoquan; Fan, Xiaorong; Xu, Guohua

    2015-01-01

    Nitrate is an essential nitrogen source and serves as a signal to control growth and gene expression in plants. In rice, OsNAR2.1 is an essential partner of multiple OsNRT2 nitrate transporters for nitrate uptake over low and high concentration range. Previously, we have reported that −311 bp upstream fragment from the translational start site in the promoter of OsNAR2.1 gene is the nitrate responsive region. To identify the cis-acting DNA elements necessary for nitrate induced gene expression, we detected the expression of beta-glucuronidase (GUS) reporter in the transgenic rice driven by the OsNAR2.1 promoter with different lengths and site mutations of the 311 bp region. We found that −129 to −1 bp region is necessary for the nitrate-induced full activation of OsNAR2.1. Besides, the site mutations showed that the 20 bp fragment between −191 and −172 bp contains an enhancer binding site necessary to fully drive the OsNAR2.1 expression. Part of the 20 bp fragment is commonly presented in the sequences of different promoters of both the nitrate induced NAR2 genes and nitrite reductase NIR1 genes from various higher plants. These findings thus reveal the presence of conserved cis-acting element for mediating nitrate responses in plants. PMID:26150107

  10. Equine herpesvirus 1 gene 12, the functional homologue of herpes simplex virus VP16, transactivates via octamer sequences in the equine herpesvirus IE gene promoter.

    PubMed

    Elliott, G; O'Hare, P

    1995-10-20

    The HSV-1 transactivator of immediate-early (IE) gene expression, VP16, has several functional homologues among the alphaherpesviruses which have not yet been extensively studied in relation to their modes of action. To date, nothing is known of the exact sites or mechanism of interaction of the equine herpesvirus type 1 (EHV-1) homologue, the gene 12 protein, with the EHV-1 IE promoter. We show that the gene 12 protein utilises the promoter proximal region of the IE gene to induce activation and identify four potential octamer DNA binding sites within that region. Although there was divergence from its consensus, Oct-1 bound to each of these sites in an in vitro complex formation assay, and in the presence of the gene 12 product a second complex of slower migration, which was also dependent on Oct-1, was detected. When each site was inserted into a basal promoter, two conferred activation by gene 12 with a resulting increase in expression of up to 50-fold compared to basal levels. These results show that, despite the differences between the two proteins, the mechanism of interaction of the gene 12 protein with its target is analogous to that of VP16.

  11. Nuclear factor-I and activator protein-2 bind in a mutually exclusive way to overlapping promoter sequences and trans-activate the human growth hormone gene.

    PubMed Central

    Courtois, S J; Lafontaine, D A; Lemaigre, F P; Durviaux, S M; Rousseau, G G

    1990-01-01

    Transcription of the human growth hormone (hGH) gene and its regulation are controlled by trans-acting factors that bind to hGH gene promoter sequences. Several DNase I footprints have been described within 500 bp of this promoter, one of which (-289 to -267) has not yet been ascribed to a defined factor. By DNase I footprinting, gel mobility shift, and methylation interference assays with extracts from HeLa cells and GH-producing pituitary tumor (GC) cells, we show that this factor belongs to the NF-I family. When NF-I was competed out of the cell extracts, the trans-acting factor AP-2 bound to the same site as NF-I. AP-2 was present not only in HeLa cells, but also in GC cells albeit at a much lower concentration. Consistent with the mutually exclusive binding of NF-I and AP-2, their methylation interference patterns included four guanine residues that were crucial for binding of both NF-I and AP-2. Cell-free transcription from the hGH gene promoter showed that these two factors can transactivate this gene. Images PMID:2308836

  12. Characterization of rubber tree microRNA in phytohormone response using large genomic DNA libraries, promoter sequence and gene expression analysis.

    PubMed

    Kanjanawattanawong, Supanath; Tangphatsornruang, Sithichoke; Triwitayakorn, Kanokporn; Ruang-areerate, Panthita; Sangsrakru, Duangjai; Poopear, Supannee; Somyong, Suthasinee; Narangajavana, Jarunya

    2014-10-01

    The para rubber tree is the most widely cultivated tree species for producing natural rubber (NR) latex. Unfortunately, rubber tree characteristics such as a long life cycle, heterozygous genetic backgrounds, and poorly understood genetic profiles are the obstacles to breeding new rubber tree varieties, such as those with improved NR yields. Recent evidence has revealed the potential importance of controlling microRNA (miRNA) decay in some aspects of NR regulation. To gain a better understanding of miRNAs and their relationship with rubber tree gene regulation networks, large genomic DNA insert-containing libraries were generated to complement the incomplete draft genome sequence and applied as a new powerful tool to predict a function of interested genes. Bacterial artificial chromosome and fosmid libraries, containing a total of 120,576 clones with an average insert size of 43.35 kb, provided approximately 2.42 haploid genome equivalents of coverage based on the estimated 2.15 gb rubber tree genome. Based on these library sequences, the precursors of 1 member of rubber tree-specific miRNAs and 12 members of conserved miRNAs were successfully identified. A panel of miRNAs was characterized for phytohormone response by precisely identifying phytohormone-responsive motifs in their promoter sequences. Furthermore, the quantitative real-time PCR on ethylene stimulation of rubber trees was performed to demonstrate that the miR2118, miR159, miR164 and miR166 are responsive to ethylene, thus confirmed the prediction by genomic DNA analysis. The cis-regulatory elements identified in the promoter regions of these miRNA genes help augment our understanding of miRNA gene regulation and provide a foundation for further investigation of the regulation of rubber tree miRNAs.

  13. Sequencing of IncX-plasmids suggests ubiquity of mobile forms of a biofilm-promoting gene cassette recruited from Klebsiella pneumoniae.

    PubMed

    Burmølle, Mette; Norman, Anders; Sørensen, Søren J; Hansen, Lars Hestbjerg

    2012-01-01

    Plasmids are a highly effective means with which genetic traits that influence human health, such as virulence and antibiotic resistance, are disseminated through bacterial populations. The IncX-family is a hitherto sparsely populated group of plasmids that are able to thrive within Enterobacteriaceae. In this study, a replicon-centric screening method was used to locate strains from wastewater sludge containing plasmids belonging to the IncX-family. A transposon aided plasmid capture method was then employed to transport IncX-plasmids from their original hosts (and co-hosted plasmids) into a laboratory strain (Escherichia coli Genehogs®) for further study. The nucleotide sequences of the three newly isolated IncX-plasmids (pLN126_33, pMO17_54, pMO440_54) and the hitherto un-sequenced type-plasmid R485 revealed a remarkable occurrence of whole or partial gene cassettes that promote biofilm-formation in Klebsiella pneumonia or E. coli, in all four instances. Two of the plasmids (R485 and pLN126_33) were shown to directly induce biofilm formation in a crystal violet retention assay in E. coli. Sequence comparison revealed that all plasmid-borne forms of the type 3 fimbriae encoding gene cassette mrkABCDF were variations of a composite transposon Tn6011 first described in the E. coli IncX plasmid pOLA52. In conclusion, IncX-plasmids isolated from Enterobacteriaceae over almost 40 years and on three different continents have all been shown to carry a type 3 fimbriae gene cassette mrkABCDF stemming from pathogenic K. pneumoniae. Apart from contributing general knowledge about IncX-plasmids, this study also suggests an apparent ubiquity of a mobile form of an important virulence factor and is an illuminating example of the recruitment, evolution and dissemination of genetic traits through plasmid-mediated horizontal gene transfer.

  14. Multiple regulatory mechanisms of hepatocyte growth factor expression in malignant cells with a short poly(dA) sequence in the HGF gene promoter.

    PubMed

    Sakai, Kazuko; Takeda, Masayuki; Okamoto, Isamu; Nakagawa, Kazuhiko; Nishio, Kazuto

    2015-01-01

    Hepatocyte growth factor (HGF) expression is a poor prognostic factor in various types of cancer. Expression levels of HGF have been reported to be regulated by shorter poly(dA) sequences in the promoter region. In the present study, the poly(dA) mononucleotide tract in various types of human cancer cell lines was examined and compared with the HGF expression levels in those cells. Short deoxyadenosine repeat sequences were detected in five of the 55 cell lines used in the present study. The H69, IM95, CCK-81, Sui73 and H28 cells exhibited a truncated poly(dA) sequence in which the number of poly(dA) repeats was reduced by ≥5 bp. Two of the cell lines exhibited high HGF expression, determined by reverse transcription quantitative polymerase chain reaction and enzyme-linked immunosorbent assay. The CCK-81, Sui73 and H28 cells with shorter poly(dA) sequences exhibited low HGF expression. The cause of the suppression of HGF expression in the CCK-81, Sui73 and H28 cells was clarified by two approaches, suppression by methylation and single nucleotide polymorphisms in the HGF gene. Exposure to 5-Aza-dC, an inhibitor of DNA methyltransferase 1, induced an increased expression of HGF in the CCK-81 cells, but not in the other cells. Single-nucleotide polymorphism (SNP) rs72525097 in intron 1 was detected in the Sui73 and H28 cells. Taken together, it was found that the defect of poly(dA) in the HGF promoter was present in various types of cancer, including lung, stomach, colorectal, pancreas and mesothelioma. The present study proposes the negative regulation mechanisms by methylation and SNP in intron 1 of HGF for HGF expression in cancer cells with short poly(dA).

  15. Massively parallel sequencing of phyllodes tumours of the breast reveals actionable mutations, and TERT promoter hotspot mutations and TERT gene amplification as likely drivers of progression

    PubMed Central

    Piscuoglio, Salvatore; Ng, Charlotte K Y; Murray, Melissa; Burke, Kathleen A; Edelweiss, Marcia; Geyer, Felipe C; Macedo, Gabriel S; Inagaki, Akiko; Papanastasiou, Anastasios D; Martelotto, Luciano G; Marchio, Caterina; Lim, Raymond S; Ioris, Rafael A; Nahar, Pooja K; De Bruijn, Ino; Smyth, Lillian; Akram, Muzaffar; Ross, Dara; Petrini, John H; Norton, Larry; Solit, David B; Baselga, Jose; Brogi, Edi; Ladanyi, Marc; Weigelt, Britta; Reis-Filho, Jorge S

    2015-01-01

    Phyllodes tumours (PTs) are breast fibroepithelial lesions that are graded based on histological criteria as benign, borderline or malignant. PTs may recur locally. Borderline PTs and malignant PTs may metastasize to distant sites. Breast fibroepithelial lesions, including PTs and fibroadenomas, are characterized by recurrent MED12 exon 2 somatic mutations. We sought to define the repertoire of somatic genetic alterations in PTs and whether these may assist in the differential diagnosis of these lesions. We collected 100 fibroadenomas, 40 benign PTs, 14 borderline PTs and 22 malignant PTs. Six, 6 and 13 benign, borderline and malignant PTs respectively and their matched normal tissue were subjected to targeted massively parallel sequencing (MPS) using the MSK-IMPACT sequencing assay. Recurrent MED12 mutations were found in 56% of PTs; in addition, mutations affecting cancer genes (e.g. TP53, RB1, SETD2 and EGFR) were exclusively detected in borderline and malignant PTs. We found a novel recurrent clonal hotspot mutation in the TERT promoter (−124 C>T) in 52% and TERT gene amplification in 4% of PTs. Laser capture microdissection revealed that these mutations were restricted to the mesenchymal component of PTs. Sequencing analysis of the entire cohort revealed that the frequency of TERT alterations increased from benign (18%), to borderline (57%) and to malignant PTs (68%; P<0.01), and TERT alterations were associated with increased levels of TERT mRNA (P<0.001). No TERT alterations were observed in fibroadenomas. An analysis of TERT promoter sequencing and gene amplification distinguished PTs from fibroadenomas with a sensitivity and a positive predictive value of 100% (CI 95.38%–100%) and 100% (CI 85.86%–100%), respectively, and a sensitivity and a negative predictive value of 39% (CI 28.65%–51.36%) and 68% (CI 60.21%–75.78%), respectively. Our results suggest that TERT alterations may drive the progression of PTs, and may assist in the differential

  16. Intergenic sequence between Arabidopsis caseinolytic protease B-cytoplasmic/heat shock protein100 and choline kinase genes functions as a heat-inducible bidirectional promoter.

    PubMed

    Mishra, Ratnesh Chandra; Grover, Anil

    2014-11-01

    In Arabidopsis (Arabidopsis thaliana), the At1g74310 locus encodes for caseinolytic protease B-cytoplasmic (ClpB-C)/heat shock protein100 protein (AtClpB-C), which is critical for the acquisition of thermotolerance, and At1g74320 encodes for choline kinase (AtCK2) that catalyzes the first reaction in the Kennedy pathway for phosphatidylcholine biosynthesis. Previous work has established that the knockout mutants of these genes display heat-sensitive phenotypes. While analyzing the AtClpB-C promoter and upstream genomic regions in this study, we noted that AtClpB-C and AtCK2 genes are head-to-head oriented on chromosome 1 of the Arabidopsis genome. Expression analysis showed that transcripts of these genes are rapidly induced in response to heat stress treatment. In stably transformed Arabidopsis plants harboring this intergenic sequence between head-to-head oriented green fluorescent protein and β-glucuronidase reporter genes, both transcripts and proteins of the two reporters were up-regulated upon heat stress. Four heat shock elements were noted in the intergenic region by in silico analysis. In the homozygous transfer DNA insertion mutant Salk_014505, 4,393-bp transfer DNA is inserted at position -517 upstream of ATG of the AtClpB-C gene. As a result, AtCk2 loses proximity to three of the four heat shock elements in the mutant line. Heat-inducible expression of the AtCK2 transcript was completely lost, whereas the expression of AtClpB-C was not affected in the mutant plants. Our results suggest that the 1,329-bp intergenic fragment functions as a heat-inducible bidirectional promoter and the region governing the heat inducibility is possibly shared between the two genes. We propose a model in which AtClpB-C shares its regulatory region with heat-induced choline kinase, which has a possible role in heat signaling.

  17. Sequences of the 5' portion of the human c-sis gene: characterization of the transcriptional promoter and regulation of expression of the protein product by 5' untranslated mRNA sequences.

    PubMed Central

    Ratner, L; Thielan, B; Collins, T

    1987-01-01

    The c-sis gene encodes the B polypeptide chain of platelet-derived growth factor (PDGF), and is expressed in a number of normal and pathological conditions. In order to study the control of synthesis of the human c-sis product, we have initiated a study of two regions of this genetic locus which regulate transcription and translation. A clone of the 5' portion of the gene was obtained which included 1361 nucleotides upstream of the RNA initiation site. Transcriptional promoter activity of this region was demonstrated in normal and transformed cells using a plasmid with the sequences upstream of the c-sis RNA initiation site fused to an indicator gene, chloramphenicol acetyl transferase. Experiments were also performed to identify other possible regulatory regions of the c-sis gene. These data demonstrated that a portion of the c-sis first exon encoding the 5' untranslated region of the c-sis mRNA inhibited synthesis of the PDGF B product in vitro. These results define regions of the c-sis gene whose activity may be important in the regulation of transcription and translation under normal conditions and in the pathogenesis several human diseases. Images PMID:3627977

  18. Housekeeping genes tend to show reduced upstream sequence conservation

    PubMed Central

    Farré, Domènec; Bellora, Nicolás; Mularoni, Loris; Messeguer, Xavier; Albà, M Mar

    2007-01-01

    Background Understanding the constraints that operate in mammalian gene promoter sequences is of key importance to understand the evolution of gene regulatory networks. The level of promoter conservation varies greatly across orthologous genes, denoting differences in the strength of the evolutionary constraints. Here we test the hypothesis that the number of tissues in which a gene is expressed is related in a significant manner to the extent of promoter sequence conservation. Results We show that mammalian housekeeping genes, expressed in all or nearly all tissues, show significantly lower promoter sequence conservation, especially upstream of position -500 with respect to the transcription start site, than genes expressed in a subset of tissues. In addition, we evaluate the effect of gene function, CpG island content and protein evolutionary rate on promoter sequence conservation. Finally, we identify a subset of transcription factors that bind to motifs that are specifically over-represented in housekeeping gene promoters. Conclusion This is the first report that shows that the promoters of housekeeping genes show reduced sequence conservation with respect to genes expressed in a more tissue-restricted manner. This is likely to be related to simpler gene expression, requiring a smaller number of functional cis-regulatory motifs. PMID:17626644

  19. Human ethanol-inducible P450IIE1: complete gene sequence, promoter characterization, chromosome mapping, and cDNA-directed expression

    SciTech Connect

    Umeno, M.; McBride, W.; Yang, C.S.; Gelboin, H.V.; Gonzalez, F.J.

    1988-12-13

    The human P450IIE1 gene, coding for an ethanol-inducible nitrosamine-metabolizing P-450, was isolated from a lambdaEMBL3 genomic library and completely sequenced. The human gene spanned 11413 base pairs and contained nine exons and a typical TATA box. Upstream and downstream DNAs of 2788 and 559 base pairs were also sequenced and compared to the rat gene. Significant areas of sequence similarity were observed within 140 base pairs upstream of the transcription start site in the rat and human genes. Human DNA 539 base pairs upstream of the transcription start site was inserted into the expression vector pSVOAL..delta..5', and luciferase activity was detected when the constructs were introduced into a rat hepatoma cell line. The activity was over 100-fold lower than that of pRSVL, a Rous sarcoma virus LTR-driven luciferase gene. By use of panel of rodent-human cell hybrids, the gene was mapped to chromosome 10 (CYP2E locus). A full-length cDNA, constructed with the first exon of the genomic clone and a partial cDNA clone, was expressed in COS cells and found to code for N-nitrosodimethylamine demethylase activity.

  20. Cloning and sequence analysis of myostatin promoter in sheep.

    PubMed

    Du, Rong; Chen, Yong-Fu; An, Xiao-Rong; Yang, Xing-Yuan; Ma, Yi; Zhang, Lei; Yuan, Xiao-Li; Chen, Li-Mei; Qin, Jian

    2005-12-01

    To better understand the structure and function of the myostatin's gene promoter region in sheep, we cloned and sequenced a 1.517 kb fragment containing the 5'-regulatory region of the sheep myostatin gene (GenBank accession number is AY918121). The promoter sequence consists of three TATA boxes, one CAAT box, and eight putative E-boxes. Some putative muscle growth response elements for Octamer-binding factor 1(Octamer), Activator protein 1(AP1), Growth factor independence 1 zinc finger protein (Gfi-1B), Myocyte enhancer factor 2 (MEF2), Muscle-specific Mt binding site (MTBF), Glucocorticoid response elements (GRE) and Progesterone receptor binding site (PRE) were detected. Some of the motifs are conserved as compared to with that in the goat, bovine and porcine myostatin promoters. However, some differences were also found.

  1. Activation of the major immediate early gene of human cytomegalovirus by cis-acting elements in the promoter-regulatory sequence and by virus-specific trans-acting components.

    PubMed Central

    Stinski, M F; Roehr, T J

    1985-01-01

    Upstream of the major immediate early gene of human cytomegalovirus (Towne) is a strong promoter-regulatory region that promotes the synthesis of 1.95-kilobase mRNA (D. R. Thomsen, R. M. Stenberg, W. F. Goins, and M. F. Stinski, Proc. Natl. Acad. Sci. U.S.A. 81:659-663, 1984; M. F. Stinski, D. R. Thomsen, R. M. Stenberg, and L. C. Goldstein, J. Virol. 46:1-14, 1983). The wild-type promoter-regulatory region as well as deletions within this region were ligated upstream of the thymidine kinase, chloramphenicol acetyltransferase, or ovalbumin genes. These gene chimeras were constructed to investigate the role of the regulatory sequences in enhancing downstream expression. The regulatory region extends to approximately 465 nucleotides upstream of the cap site for the initiation of transcription. The extent and type of regulatory sequences upstream of the promoter influences the level of in vitro transcription as well as the amount of in vivo expression of the downstream gene. The regulatory elements for cis-activation appear to be repeated several times within the regulatory region. A direct correlation was established between the distribution of the 19 (5' CCCCAGTTGACGTCAATGGG 3')- and 18 (5' CACTAACGGGACTTTCCAA 3')-nucleotide repeats and the level of downstream expression. In contrast, the 16 (5' CTTGGCAGTACATCAA 3')-nucleotide repeat is not necessary for the enhancement of downstream expression. In a domain associated with the 19- or 18-nucleotide repeats are elements that can be activated in trans by a human cytomegalovirus-specified component but not a herpes simplex virus-specified component. Therefore, the regulatory sequences of the major immediate early gene of human cytomegalovirus have an important role in interacting with cellular and virus-specific factors of the transcription complex to enhance downstream expression of this critical viral gene. Images PMID:2991567

  2. Pertussis toxin promoter sequences involved in modulation.

    PubMed Central

    Gross, R; Rappuoli, R

    1989-01-01

    Previous analysis of the pertussis toxin (PT) promoter has shown that expression of PT requires a trans-activating factor encoded by the vir locus and a 170-base-pair DNA sequence upstream from the transcription start site containing a 21-base-pair direct repeat sequence crucial trans-activation (R. Gross and R. Rappuoli, Proc. Natl. Acad. Sci. USA 85:3913-3917, 1988). In this paper we extend the analysis to the modulative response to environmental stimuli. We show that modulation acts at the transcriptional level and occurs only in phase I bacteria. Modulation also requires a functional vir locus and the same promoter region of 170 base pairs. We show that, in addition to the previously identified direct repeat, even the sequences downstream from position -117 are required for trans-activation and modulation and that the deletion of four cytosine residues at position -31 causes the inactivation of the promoter. The kinetics of the change in transcription show that the PT promoter can be shut off very rapidly by adding 50 mM MgSO4 to the medium, whereas resumption of transcription after removal of the modulative agents from the medium is slow. Images PMID:2544567

  3. Effective Feature Selection for Classification of Promoter Sequences.

    PubMed

    K, Kouser; P G, Lavanya; Rangarajan, Lalitha; K, Acharya Kshitish

    2016-01-01

    Exploring novel computational methods in making sense of biological data has not only been a necessity, but also productive. A part of this trend is the search for more efficient in silico methods/tools for analysis of promoters, which are parts of DNA sequences that are involved in regulation of expression of genes into other functional molecules. Promoter regions vary greatly in their function based on the sequence of nucleotides and the arrangement of protein-binding short-regions called motifs. In fact, the regulatory nature of the promoters seems to be largely driven by the selective presence and/or the arrangement of these motifs. Here, we explore computational classification of promoter sequences based on the pattern of motif distributions, as such classification can pave a new way of functional analysis of promoters and to discover the functionally crucial motifs. We make use of Position Specific Motif Matrix (PSMM) features for exploring the possibility of accurately classifying promoter sequences using some of the popular classification techniques. The classification results on the complete feature set are low, perhaps due to the huge number of features. We propose two ways of reducing features. Our test results show improvement in the classification output after the reduction of features. The results also show that decision trees outperform SVM (Support Vector Machine), KNN (K Nearest Neighbor) and ensemble classifier LibD3C, particularly with reduced features. The proposed feature selection methods outperform some of the popular feature transformation methods such as PCA and SVD. Also, the methods proposed are as accurate as MRMR (feature selection method) but much faster than MRMR. Such methods could be useful to categorize new promoters and explore regulatory mechanisms of gene expressions in complex eukaryotic species.

  4. Effective Feature Selection for Classification of Promoter Sequences

    PubMed Central

    K., Kouser; P. G., Lavanya; Rangarajan, Lalitha; K., Acharya Kshitish

    2016-01-01

    Exploring novel computational methods in making sense of biological data has not only been a necessity, but also productive. A part of this trend is the search for more efficient in silico methods/tools for analysis of promoters, which are parts of DNA sequences that are involved in regulation of expression of genes into other functional molecules. Promoter regions vary greatly in their function based on the sequence of nucleotides and the arrangement of protein-binding short-regions called motifs. In fact, the regulatory nature of the promoters seems to be largely driven by the selective presence and/or the arrangement of these motifs. Here, we explore computational classification of promoter sequences based on the pattern of motif distributions, as such classification can pave a new way of functional analysis of promoters and to discover the functionally crucial motifs. We make use of Position Specific Motif Matrix (PSMM) features for exploring the possibility of accurately classifying promoter sequences using some of the popular classification techniques. The classification results on the complete feature set are low, perhaps due to the huge number of features. We propose two ways of reducing features. Our test results show improvement in the classification output after the reduction of features. The results also show that decision trees outperform SVM (Support Vector Machine), KNN (K Nearest Neighbor) and ensemble classifier LibD3C, particularly with reduced features. The proposed feature selection methods outperform some of the popular feature transformation methods such as PCA and SVD. Also, the methods proposed are as accurate as MRMR (feature selection method) but much faster than MRMR. Such methods could be useful to categorize new promoters and explore regulatory mechanisms of gene expressions in complex eukaryotic species. PMID:27978541

  5. Functional analysis of bipartite begomovirus coat protein promoter sequences

    SciTech Connect

    Lacatus, Gabriela; Sunter, Garry

    2008-06-20

    We demonstrate that the AL2 gene of Cabbage leaf curl virus (CaLCuV) activates the CP promoter in mesophyll and acts to derepress the promoter in vascular tissue, similar to that observed for Tomato golden mosaic virus (TGMV). Binding studies indicate that sequences mediating repression and activation of the TGMV and CaLCuV CP promoter specifically bind different nuclear factors common to Nicotiana benthamiana, spinach and tomato. However, chromatin immunoprecipitation demonstrates that TGMV AL2 can interact with both sequences independently. Binding of nuclear protein(s) from different crop species to viral sequences conserved in both bipartite and monopartite begomoviruses, including TGMV, CaLCuV, Pepper golden mosaic virus and Tomato yellow leaf curl virus suggests that bipartite begomoviruses bind common host factors to regulate the CP promoter. This is consistent with a model in which AL2 interacts with different components of the cellular transcription machinery that bind viral sequences important for repression and activation of begomovirus CP promoters.

  6. Interaction of two sequence-specific single-stranded DNA-binding proteins with an essential region of the beta-casein gene promoter is regulated by lactogenic hormones.

    PubMed Central

    Altiok, S; Groner, B

    1993-01-01

    Transcription of the beta-casein gene in mammary epithelial cells is regulated by the lactogenic hormones insulin, glucocorticoids, and prolactin. The DNA sequence elements in the promoter which confer the action of the hormones on the transcriptional machinery and the nuclear proteins binding to this region have been investigated. We found that 221 nucleotides of promoter sequence 5' of the RNA start site are sufficient to mediate the induction of a chloramphenicol acetyltransferase reporter gene in transfected HC11 mammary epithelial cells. Deletion of 5' sequences to position -183 results in a construct with enhanced basal activity which still retains inducibility. A -170 beta-casein promoter-chloramphenicol acetyltransferase construct has very low transcriptional activity, which indicates the presence of a negative regulatory in the region between -221 and -183 and a positive regulatory element between -183 and -170. Band shift analysis showed that the promoter region between -194 and -163 specifically binds two nuclear proteins. The proteins are sequence-specific, single-stranded DNA-binding proteins which exclusively recognize the upper DNA strand and most likely play a repressing role in transcription. DNA binding activity of these nuclear proteins was observed only in nuclear extracts from mammary glands of mice in late pregnancy and postlactation, not during lactation. Hormonal control of the DNA binding activity of these proteins was also observed in the mammary epithelial cell line HC11. Mixing experiments showed that extracts from mammary tissue of lactating mice and from lactogenic hormone-treated HC11 cells contain an activity which can suppress the DNA binding of the single-stranded DNA-binding proteins.2+ identical specificity to the single-stranded DNA. Images PMID:8246951

  7. Updated Sequence Information for TEM β-Lactamase Genes

    PubMed Central

    Goussard, Sylvie; Courvalin, Patrice

    1999-01-01

    The sequences of the promoter regions and of the structural genes for 13 penicillinase, extended-spectrum, and inhibitor-resistant TEM-type β-lactamases have been determined, and an updated blaTEM gene nomenclature is proposed. PMID:9925535

  8. Genome Sequence of the Banana Plant Growth-Promoting Rhizobacterium Pseudomonas fluorescens PS006

    PubMed Central

    Gamez, Rocío M.; Rodríguez, Fernando; Ramírez, Sandra; Gómez, Yolanda; Agarwala, Richa; Landsman, David

    2016-01-01

    Pseudomonas fluorescens is a well-known plant growth-promoting rhizobacterium (PGPR). We report here the first whole-genome sequence of PGPR P. fluorescens evaluated in Colombian banana plants. The genome sequences contains genes involved in plant growth and defense, including bacteriocins, 1-aminocyclopropane-1-carboxylic acid (ACC) deaminase, and genes that provide resistance to toxic compounds. PMID:27151797

  9. Characterization of human TCR Vbeta gene promoter. Role of the dodecamer motif in promoter activity.

    PubMed

    Deng, X; Sun, G R; Zheng, Q; Li, Y

    1998-09-11

    During T-lymphocyte development, the T-cell antigen receptor (TCR) gene expression is controlled by its promoter and enhancer elements and regulated in tissue- and development stage-specific manner. To uncover the promoter function and to define positive and negative regulatory elements in TCR gene promoters, the promoter activities from 13 human TCR Vbeta genes were determined by the transient transfection system and luciferase reporter assay. Although most of the TCR Vbeta gene promoters that we tested are inactive by themselves, some promoters were found to be constitutively strong. Among them, Vbeta6.7 is the strongest. 5'-Deletion and fragmentation experiments have narrowed the full promoter activity of Vbeta6.7 to a fragment of 147 base pairs immediately 5' to the transcription initiation site. A decanucleotide motif with the consensus sequence AGTGAYRTCA has been found to be conserved in most TCR Vbeta gene promoters. There are three such decamer motifs in the promoter region of Vbeta6.7, and the contribution of each such motif to the promoter activity has been examined. Further site-directed mutagenesis analyses showed that: 1) when two Ts in the decamer were mutated, the promoter activity was totally abolished; 2) when two additional nucleotides 3' to the end of decamer were mutated, the promoter activity was decreased to two-thirds of the full level; and 3) when the element with the sequence AGTGATGTCACT was inserted into other promoters, the original weak promoters become very strong. Taken together, our data suggest that the positive regulatory element in Vbeta6.7 should be considered a dodecamer rather than a decamer and that it confers strong basal transcriptional activity on TCR Vbeta genes.

  10. Cloning of penaeidin gene promoter in tiger shrimp (Penaeus monodon).

    PubMed

    Ho, Shih-Hu; Song, Yen-Ling

    2009-07-01

    Penaeidins belong to a family of antimicrobial peptides that are expressed in the hemocytes of penaeid shrimps. Using an extender PCR method and a nested PCR, we cloned two types of genomic fragment flanking the 5' end of penaeidin gene in tiger shrimp (Penaeus monodon): Type536 and Type411 sequences. Both fragments contained TATA box, GATA, dorsal and AP-1 motifs and were ligated to an expression vector with a luciferase reporter gene. The constructs were then delivered into Drosophila S2 cell line. The promoter functions of the two fragments were determined using a luciferase expression assay. The study demonstrated that Type411 sequence performed higher transcriptional activity than Type536. Alignment of the upstream sequences of penaeidin genes in P. monodon and Litopenaeus vannamei showed that the promoter regions were obviously more diverse than the 5'UTRs. Phylogenetic analysis indicated the presence of two types of promoters that are not species-specific in the two shrimps.

  11. Compilation and analysis of Escherichia coli promoter DNA sequences.

    PubMed Central

    Hawley, D K; McClure, W R

    1983-01-01

    The DNA sequence of 168 promoter regions (-50 to +10) for Escherichia coli RNA polymerase were compiled. The complete listing was divided into two groups depending upon whether or not the promoter had been defined by genetic (promoter mutations) or biochemical (5' end determination) criteria. A consensus promoter sequence based on homologies among 112 well-defined promoters was determined that was in substantial agreement with previous compilations. In addition, we have tabulated 98 promoter mutations. Nearly all of the altered base pairs in the mutants conform to the following general rule: down-mutations decrease homology and up-mutations increase homology to the consensus sequence. PMID:6344016

  12. Programming gene expression with combinatorial promoters

    PubMed Central

    Cox, Robert Sidney; Surette, Michael G; Elowitz, Michael B

    2007-01-01

    Promoters control the expression of genes in response to one or more transcription factors (TFs). The architecture of a promoter is the arrangement and type of binding sites within it. To understand natural genetic circuits and to design promoters for synthetic biology, it is essential to understand the relationship between promoter function and architecture. We constructed a combinatorial library of random promoter architectures. We characterized 288 promoters in Escherichia coli, each containing up to three inputs from four different TFs. The library design allowed for multiple −10 and −35 boxes, and we observed varied promoter strength over five decades. To further analyze the functional repertoire, we defined a representation of promoter function in terms of regulatory range, logic type, and symmetry. Using these results, we identified heuristic rules for programming gene expression with combinatorial promoters. PMID:18004278

  13. Core promoter functions in the regulation of gene expression of Drosophila dorsal target genes.

    PubMed

    Zehavi, Yonathan; Kuznetsov, Olga; Ovadia-Shochat, Avital; Juven-Gershon, Tamar

    2014-04-25

    Developmental processes are highly dependent on transcriptional regulation by RNA polymerase II. The RNA polymerase II core promoter is the ultimate target of a multitude of transcription factors that control transcription initiation. Core promoters consist of core promoter motifs, e.g. the initiator, TATA box, and the downstream core promoter element (DPE), which confer specific properties to the core promoter. Here, we explored the importance of core promoter functions in the dorsal-ventral developmental gene regulatory network. This network includes multiple genes that are activated by different nuclear concentrations of Dorsal, an NFκB homolog transcription factor, along the dorsal-ventral axis. We show that over two-thirds of Dorsal target genes contain DPE sequence motifs, which is significantly higher than the proportion of DPE-containing promoters in Drosophila genes. We demonstrate that multiple Dorsal target genes are evolutionarily conserved and functionally dependent on the DPE. Furthermore, we have analyzed the activation of key Dorsal target genes by Dorsal, as well as by another Rel family transcription factor, Relish, and the dependence of their activation on the DPE motif. Using hybrid enhancer-promoter constructs in Drosophila cells and embryo extracts, we have demonstrated that the core promoter composition is an important determinant of transcriptional activity of Dorsal target genes. Taken together, our results provide evidence for the importance of core promoter composition in the regulation of Dorsal target genes.

  14. Draft Genome Sequence of Multitrait Plant Growth-Promoting Bacillus sp. Strain RZ2MS9

    PubMed Central

    Batista, Bruna Durante; Taniguti, Lucas Mitsuo; Almeida, Jaqueline Raquel; Azevedo, João Lúcio

    2016-01-01

    Bacillus sp. strain RZ2MS9 is a multitrait soybean and maize growth-promoting bacterium isolated in Brazil from guarana’s rhizosphere. Here, we present the draft genome sequence of RZ2MS9 and its genes involved in many features related to plant growth promotion. PMID:28007854

  15. Genome sequence of the plant growth-promoting rhizobacterium Bacillus sp. strain JS.

    PubMed

    Song, Ju Yeon; Kim, Hyun A; Kim, Ji-Seoung; Kim, Seon-Young; Jeong, Haeyoung; Kang, Sung Gyun; Kim, Byung Kwon; Kwon, Soon-Kyeong; Lee, Choong Hoon; Yu, Dong Su; Kim, Beom Seok; Kim, Sun-Hyung; Kwon, Suk Yoon; Kim, Jihyun F

    2012-07-01

    Volatile and nonvolatile compounds emitted from the plant growth-promoting rhizobacterium Bacillus sp. strain JS enhance the growth of tobacco and lettuce. Here, we report the high-quality genome sequence of this bacterium. Its 4.1-Mb genome reveals a number of genes whose products are possibly involved in promotion of plant growth or antibiosis.

  16. Disease gene identification strategies for exome sequencing

    PubMed Central

    Gilissen, Christian; Hoischen, Alexander; Brunner, Han G; Veltman, Joris A

    2012-01-01

    Next generation sequencing can be used to search for Mendelian disease genes in an unbiased manner by sequencing the entire protein-coding sequence, known as the exome, or even the entire human genome. Identifying the pathogenic mutation amongst thousands to millions of genomic variants is a major challenge, and novel variant prioritization strategies are required. The choice of these strategies depends on the availability of well-phenotyped patients and family members, the mode of inheritance, the severity of the disease and its population frequency. In this review, we discuss the current strategies for Mendelian disease gene identification by exome resequencing. We conclude that exome strategies are successful and identify new Mendelian disease genes in approximately 60% of the projects. Improvements in bioinformatics as well as in sequencing technology will likely increase the success rate even further. Exome sequencing is likely to become the most commonly used tool for Mendelian disease gene identification for the coming years. PMID:22258526

  17. Synthetic muscle promoters: activities exceeding naturally occurring regulatory sequences

    NASA Technical Reports Server (NTRS)

    Li, X.; Eastman, E. M.; Schwartz, R. J.; Draghia-Akli, R.

    1999-01-01

    Relatively low levels of expression from naturally occurring promoters have limited the use of muscle as a gene therapy target. Myogenic restricted gene promoters display complex organization usually involving combinations of several myogenic regulatory elements. By random assembly of E-box, MEF-2, TEF-1, and SRE sites into synthetic promoter recombinant libraries, and screening of hundreds of individual clones for transcriptional activity in vitro and in vivo, several artificial promoters were isolated whose transcriptional potencies greatly exceed those of natural myogenic and viral gene promoters.

  18. Intergenic Sequence between Arabidopsis Caseinolytic Protease B-Cytoplasmic/Heat Shock Protein100 and Choline Kinase Genes Functions as a Heat-Inducible Bidirectional Promoter1[C][W][OPEN

    PubMed Central

    Mishra, Ratnesh Chandra; Grover, Anil

    2014-01-01

    In Arabidopsis (Arabidopsis thaliana), the At1g74310 locus encodes for caseinolytic protease B-cytoplasmic (ClpB-C)/heat shock protein100 protein (AtClpB-C), which is critical for the acquisition of thermotolerance, and At1g74320 encodes for choline kinase (AtCK2) that catalyzes the first reaction in the Kennedy pathway for phosphatidylcholine biosynthesis. Previous work has established that the knockout mutants of these genes display heat-sensitive phenotypes. While analyzing the AtClpB-C promoter and upstream genomic regions in this study, we noted that AtClpB-C and AtCK2 genes are head-to-head oriented on chromosome 1 of the Arabidopsis genome. Expression analysis showed that transcripts of these genes are rapidly induced in response to heat stress treatment. In stably transformed Arabidopsis plants harboring this intergenic sequence between head-to-head oriented green fluorescent protein and β-glucuronidase reporter genes, both transcripts and proteins of the two reporters were up-regulated upon heat stress. Four heat shock elements were noted in the intergenic region by in silico analysis. In the homozygous transfer DNA insertion mutant Salk_014505, 4,393-bp transfer DNA is inserted at position −517 upstream of ATG of the AtClpB-C gene. As a result, AtCk2 loses proximity to three of the four heat shock elements in the mutant line. Heat-inducible expression of the AtCK2 transcript was completely lost, whereas the expression of AtClpB-C was not affected in the mutant plants. Our results suggest that the 1,329-bp intergenic fragment functions as a heat-inducible bidirectional promoter and the region governing the heat inducibility is possibly shared between the two genes. We propose a model in which AtClpB-C shares its regulatory region with heat-induced choline kinase, which has a possible role in heat signaling. PMID:25281707

  19. Definition of the ovalbumin gene promoter by transfer of an ovalglobin fusion gene into cultured cells.

    PubMed Central

    Knoll, B J; Zarucki-Schulz, T; Dean, D C; O'Malley, B W

    1983-01-01

    In order to study the initiation of transcription from the ovalbumin gene promoter, we constructed a hybrid gene (ovalglobin) in which 753 bps of ovalbumin gene 5'-flanking sequence were joined to the chicken adult beta-globin gene. When transfected into HeLa S3 cells, ovalglobin gene transcription initiated at the ovalbumin gene cap site, as measured by S1 nuclease and primer extension analysis. Deletion of 5'-flanking sequences to position -95 had little effect on transcription; deletion to -77 reduced transcription to about 20% of the wild type level and deletion to -48 reduced the level to about 2%. A deletion to -24, removing the sequence TATATAT, abolished transcription entirely. Hormonal regulation of the ovalglobin gene was observed when primary oviduct cells were used as recipients for DNA transfection. Under these conditions, addition of progesterone increased the level of ovalglobin transcripts to more than 10 times the uninduced level. Images PMID:6314256

  20. Cloning and analysis of rat osteoclast inhibitory lectin gene promoter.

    PubMed

    Quan, Jin-Xing; Zheng, Fang; Li, Xiao-Xia; Hu, Li-Ling; Sun, Zi-Yang; Jiao, Yan-Li; Wang, Bao-Li

    2009-03-01

    Osteoclast inhibitory lectin (OCIL) is a novel regulator of bone remodeling, however, little is known concerning how OCIL is regulated to date. In this study, approximately 4.4 kb of the 5'-flanking sequence of rat OCIL gene was cloned into the promoter-less reporter vector pGL3-basic and transiently transfected into three different cell lines. The differences in the levels of luciferase activity paralleled well with the levels of OCIL mRNA expression in these cells, suggesting that the regulation of rat OCIL gene expression occurs mainly at the transcriptional level. Additional luciferase assays using a series of constructs containing unidirectionally deleted fragments showed that the construct-1819/pGL3 (-1819 to +118) exhibited the highest luciferase activity, suggesting the presence of functional promoter in this region. The region from -4370 to -2805 might contain negative regulatory elements, while the region from -1819 to -1336 might have important positive regulatory elements that enhance OCIL transcription. Sequence analysis of the promoter revealed the absence of both TATA and CAAT boxes. However, in the proximal promoter region (-81 to +118), several potential transcription factor binding sites that may be responsible for the basal transcriptional activity of rat OCIL promoter were observed. The promoter contains several potential Sp1 binding sites, and cotransfection of a shRNA expression plasmid that knockdowns Sp1 significantly reduced OCIL promoter activity and endogenous gene expression and moreover, overexpressing Sp7, a Sp1 family member that also binds to Sp1 binding sequence, increased OCIL promoter activity and gene expression, suggesting a role of Sp1 family proteins in regulation of OCIL transcription.

  1. Nucleotide sequence of a human tRNA gene heterocluster

    SciTech Connect

    Chang, Y.N.; Pirtle, I.L.; Pirtle, R.M.

    1986-05-01

    Leucine tRNA from bovine liver was used as a hybridization probe to screen a human gene library harbored in Charon-4A of bacteriophage lambda. The human DNA inserts from plaque-pure clones were characterized by restriction endonuclease mapping and Southern hybridization techniques, using both (3'-/sup 32/P)-labeled bovine liver leucine tRNA and total tRNA as hybridization probes. An 8-kb Hind III fragment of one of these ..gamma..-clones was subcloned into the Hind III site of pBR322. Subsequent fine restriction mapping and DNA sequence analysis of this plasmid DNA indicated the presence of four tRNA genes within the 8-kb DNA fragment. A leucine tRNA gene with an anticodon of AAG and a proline tRNA gene with an anticodon of AGG are in a 1.6-kb subfragment. A threonine tRNA gene with an anticodon of UGU and an as yet unidentified tRNA gene are located in a 1.1-kb subfragment. These two different subfragments are separated by 2.8 kb. The coding regions of the three sequenced genes contain characteristic internal split promoter sequences and do not have intervening sequences. The 3'-flanking region of these three genes have typical RNA polymerase III termination sites of at least four consecutive T residues.

  2. Sequences promoting the transcription of the human XA gene overlapping P450c21A correctly predict the presence of a novel, adrenal-specific, truncated form of tenascin-X

    SciTech Connect

    Tee, Meng Kian; Thomson, A.A.; Bristow, J.; Miller, W.L.

    1995-07-20

    A compact region in the human class III major histocompatibility locus contains the human genes for the fourth component of human complement (C4) and steroid 21-hydroxylase (P450c21) in one transcriptional orientation, while the gene for the extracellular matrix protein tenascin-X (TN-X) overlaps the last exon of P450c21 on the opposite strand of DNA in the opposite transcriptional orientation. This complex locus is duplicated into A and B loci, so that the organization is 5{prime}-C4A-21A-XA-C4B-21B-XB-3{prime}. Although this duplication event truncated the 65-kb X(B) gene to a 4.5-kb XA gene, the XA gene is transcriptionally active in the adrenal cortex. To examine the basis of the tissue-specific expression of XA and C4B, we cloned the 1763-bp region that lies between the cap sites for XA and C4B and analyzed its promoter activity in both the XA and the C4 orientations. Powerful, liver-specific sequences lie within the first 75 to 138 bp from the C4B cap site, and weaker elements lie within 128 bp of the XA cap site that function in both liver and adrenal cells. Because these 128 bp upstream from the XA cap site are perfectly preserved in the XB gene encoding TN-X, we sought to determine whether a transcript similar to XA arises within the SB gene. RNase protection assays, cDNA cloning, and RT/PCR show that adrenal cells contain a novel transcript, termed short XB (XB-S), which has the same open reading frame as TN-X. Cell-free translation and immunoblotting show that this transcript encodes a novel 74-kDa XB-S protein that is identical to the carboxy-terminal 673 residues of TN-X. Because this protein consists solely of fibronectin type III repeats and a fibrinogen-like domain, it appears to correspond to an evolutionary precursor of the tenascin family of extracellular matrix proteins. 40 refs., 6 figs.

  3. Cloning, characterization and promoter analysis of S-RNase gene promoter from Chinese pear (Pyrus pyrifolia).

    PubMed

    Liu, Xue-ying; Wuyun, Ta-na; Zeng, Hong-yan

    2012-09-01

    The 5'-flanking region of the S(12)-, S(13)-, S(21)-RNase with a length of 854 bp, 1448 bp and 1137 bp were successfully isolated by TAIL-PCR from genomic DNA from 'Jinhua', 'Maogong' (Pyrus pyrifolia) and 'Yali' (Pyrus bretschneideri) genomic DNA. Sequence alignment and analysis of S(13)-, S(12)-, S(21)-RNase gene promoter sequences with S(2)-, S(3)-, S(4)-, S(5)-RNase 5'-flanking sequences indicated that a homology region of about 240 bp exists in the regions just upstream of the putative TATA boxes of the seven Chinese/Japanese pear S-RNase genes. Phylogenetic tree suggests that the homology region between the Chinese/Japanese pear and apple S-RNase gene promoter regions reflects the divergence of S-RNase gene was formed before the differentiation of subfamilies. Full length and a series of 5'-deletion fragments-GUS fusions were constructed and introduced into Arabidopsis thaliana plants. GUS activity were detected in S(12)-pro-(1 to 5)-GUS-pBll01.2 transgenic pistils and progressively decreased from S(12)-pro-1-GUS-pBI l01.2 to S(12)-pro-5-GUS-pBll01.2. No GUS activity was detected in S(12)-pro-6-GUS-pBll01.2 transgenic pistil and other tissues of non-transformants and all transgenic plants. The result suggested S(12)-RNase promoter is pistil specific expression promoter.

  4. Nascent RNA sequencing reveals widespread pausing and divergent initiation at human promoters.

    PubMed

    Core, Leighton J; Waterfall, Joshua J; Lis, John T

    2008-12-19

    RNA polymerases are highly regulated molecular machines. We present a method (global run-on sequencing, GRO-seq) that maps the position, amount, and orientation of transcriptionally engaged RNA polymerases genome-wide. In this method, nuclear run-on RNA molecules are subjected to large-scale parallel sequencing and mapped to the genome. We show that peaks of promoter-proximal polymerase reside on approximately 30% of human genes, transcription extends beyond pre-messenger RNA 3' cleavage, and antisense transcription is prevalent. Additionally, most promoters have an engaged polymerase upstream and in an orientation opposite to the annotated gene. This divergent polymerase is associated with active genes but does not elongate effectively beyond the promoter. These results imply that the interplay between polymerases and regulators over broad promoter regions dictates the orientation and efficiency of productive transcription.

  5. Gene Discovery through Expressed Sequence Tag Sequencing in Trypanosoma cruzi

    PubMed Central

    Verdun, Ramiro E.; Di Paolo, Nelson; Urmenyi, Turan P.; Rondinelli, Edson; Frasch, Alberto C. C.; Sanchez, Daniel O.

    1998-01-01

    Analysis of expressed sequence tags (ESTs) constitutes a useful approach for gene identification that, in the case of human pathogens, might result in the identification of new targets for chemotherapy and vaccine development. As part of the Trypanosoma cruzi genome project, we have partially sequenced the 5′ ends of 1,949 clones to generate ESTs. The clones were randomly selected from a normalized CL Brener epimastigote cDNA library. A total of 14.6% of the clones were homologous to previously identified T. cruzi genes, while 18.4% had significant matches to genes from other organisms in the database. A total of 67% of the ESTs had no matches in the database, and thus, some of them might be T. cruzi-specific genes. Functional groups of those sequences with matches in the database were constructed according to their putative biological functions. The two largest categories were protein synthesis (23.3%) and cell surface molecules (10.8%). The information reported in this paper should be useful for researchers in the field to analyze genes and proteins of their own interest. PMID:9784549

  6. Cloning of a marine cyanobacterial promoter for foreign gene expression using a promoter probe vector

    SciTech Connect

    Sode, Koji; Hatano, Naoaki; Tatara, Masahiro

    1996-06-01

    A marine cyanobacterial promoter was cloned to allow efficient foreign gene expression. This was carried out using chloramphenicol acetyl transferase (CAT) as a marker protein. For rapid and simple measurement of CAT activity, a method based on a fluorescently labeled substrate was improved by utilizing HPLC equipped with a flow-through fluorescent spectrophotometer. This method was used in conjunction with a newly constructed promoter probe vector. Cyanobacterial transformants, harboring plasmid containing a cloned 2-kbp marine cyanobacterial genomic fragment, showed a 10-fold higher CAT activity, compared with that achieved using the kanamycin-resistant gene promoter. From the sequence analysis of the cloned fragment, a putative promoter region was found. 20 refs., 7 figs., 2 tabs.

  7. Firefly luciferase gene contains a cryptic promoter

    PubMed Central

    Vopálenský, Václav; Mašek, Tomáš; Horváth, Ondřej; Vicenová, Blanka; Mokrejš, Martin; Pospíšek, Martin

    2008-01-01

    A firefly luciferase (FLuc) counts among the most popular reporters of present-day molecular and cellular biology. In this study, we report a cryptic promoter activity in the luc+ gene, which is the most frequently used version of the firefly luciferase. The FLuc coding region displays cryptic promoter activity both in mammalian and yeast cells. In human CCL13 and Huh7 cells, cryptic transcription from the luc+ gene is 10–16 times weaker in comparison to the strong immediate-early cytomegalovirus promoter. Additionally, we discuss a possible impact of the FLuc gene cryptic promoter on experimental results especially in some fields of the RNA-oriented research, for example, in analysis of translation initiation or analysis of miRNA/siRNA function. Specifically, we propose how this newly described cryptic promoter activity within the FLuc gene might contribute to the previous determination of the strength of the cryptic promoter found in the cDNA corresponding to the hepatitis C virus internal ribosome entry site. Our findings should appeal to the researchers to be more careful when designing firefly luciferase-based assays as well as open the possibility of performing some experiments with the hepatitis C virus internal ribosome entry site, which could not be considered until now. PMID:18697919

  8. In vitro mapping of Myotonic Dystrophy (DM) gene promoter

    SciTech Connect

    Storbeck, C.J.; Sabourin, L.; Baird, S.

    1994-09-01

    The Myotonic Dystrophy Kinase (DMK) gene has been cloned and shared homology to serine/threonine protein kinases. Overexpression of this gene in stably transfected mouse myoblasts has been shown to inhibit fusion into myotubes while myoblasts stably transfected with an antisense construct show increased fusion potential. These experiments, along with data showing that the DM gene is highly expressed in muscle have highlighted the possibility of DMK being involved in myogenesis. The promoter region of the DM gene lacks a consensus TATA box and CAAT box, but harbours numerous transcription binding sites. Clones containing extended 5{prime} upstream sequences (UPS) of DMK only weakly drive the reporter gene chloramphenicol acetyl transferase (CAT) when transfected into C2C12 mouse myoblasts. However, four E-boxes are present in the first intron of the DM gene and transient assays show increased expression of the CAT gene when the first intron is present downstream of these 5{prime} UPS in an orientation dependent manner. Comparison between mouse and human sequence reveals that the regions in the first intron where the E-boxes are located are highly conserved. The mapping of the promoter and the importance of the first intron in the control of DMK expression will be presented.

  9. Promoter sequences and algorithmical methods for identifying them.

    PubMed

    Vanet, A; Marsan, L; Sagot, M F

    1999-01-01

    This paper presents a survey of currently available mathematical models and algorithmical methods for trying to identify promoter sequences. The methods concern both searching in a genome for a previously defined consensus and extracting a consensus from a set of sequences. Such methods were often tailored for either eukaryotes or prokaryotes although this does not preclude use of the same method for both types of organisms. The survey therefore covers all methods; however, emphasis is placed on prokaryotic promoter sequence identification. Illustrative applications of the main extracting algorithms are given for three bacteria.

  10. Characterization of a barley Rubisco activase gene promoter

    SciTech Connect

    Strickland, J.A.; Rundle, S.J.; Zielinski, R. )

    1990-05-01

    Barley Rubisco Activase (Rca) is a nuclear encoded chloroplast enzyme that activates Rubisco to catalytic competence. Rca mRNA accumulation in barley is light-regulated; the 5{prime}-flanking region of a highly expressed barley Rca gene (HvRca-1) contains several sequence motifs similar to those found in the promoter of other light-regulated, nuclear genes. We have characterized the cis-acting regulatory regions of HvRca-1 by deletion analysis of the 5{prime} flanking region of a cloned gene. These constructs have been assayed in vitro by gel mobility shift assays, as well as by DNA footprinting. Putative regulatory sequences detected in vitro have also been tested in vivo by constructing chimeric genes consisting of deletion mutant promoters fused to a promoterless {beta}-glucuronidase reporter gene. Comparison of results obtained from complimentary parallel in vitro and in vivo assays of identical promoter deletions have provided information on cis-acting regulatory regions of HvRca-1.

  11. Universal light-switchable gene promoter system

    DOEpatents

    Quail, Peter H.; Huq, Enamul; Tepperman, James; Sato, Sae

    2005-02-22

    An artificial promoter system that can be fused upstream of any desired gene enabling reversible induction or repression of the expression of the gene at will in any suitable host cell or organisms by light is described. The design of the system is such that a molecule of the plant photoreceptor phytochrome is targeted to the specific DNA binding site in the promoter by a protein domain that is fused to the phytochrome and that specifically recognizes this binding site. This bound phytochrome, upon activation by light, recruits a second fusion protein consisting of a protein that binds to phytochrome only upon light activation and a transcriptional activation domain that activates expression of the gene downstream of the promoter.

  12. Cloning and Sequencing the First HLA Gene

    PubMed Central

    Jordan, Bertrand R.

    2010-01-01

    This Perspectives article recounts the isolation and sequencing of the first human histocompatibility gene (HLA) in 1980–1981. At the time, general knowledge of the molecules of the immune system was already fairly extensive, and gene rearrangements in the immunoglobulin complex (discovered in 1976) had generated much excitement: HLA was quite obviously the next frontier. The author was able to use a homologous murine H-2 cDNA to identify putative human HLA genomic clones in a λ-phage library and thus to isolate and sequence the first human histocompatibility gene. This personal account relates the steps that led to this result, describes the highly competitive international environment, and highlights the role of location, connections, and sheer luck in such an achievement. It also puts this work in perspective with a short description of the current knowledge of histocompatibility genes and, finally, presents some reflections on the meaning of “discovery.” PMID:20457890

  13. PlantProm: a database of plant promoter sequences

    PubMed Central

    Shahmuradov, Ilham A.; Gammerman, Alex J.; Hancock, John M.; Bramley, Peter M.; Solovyev, Victor V.

    2003-01-01

    PlantProm DB, a plant promoter database, is an annotated, non-redundant collection of proximal promoter sequences for RNA polymerase II with experimentally determined transcription start site(s), TSS, from various plant species. The first release (2002.01) of PlantProm DB contains 305 entries including 71, 220 and 14 promoters from monocot, dicot and other plants, respectively. It provides DNA sequence of the promoter regions (−200 : +51) with TSS on the fixed position +201, taxonomic/promoter type classification of promoters and Nucleotide Frequency Matrices (NFM) for promoter elements: TATA-box, CCAAT-box and TSS-motif (Inr). Analysis of TSS-motifs revealed that their composition is different in dicots and monocots, as well as for TATA and TATA-less promoters. The database serves as learning set in developing plant promoter prediction programs. One such program (TSSP) based on discriminant analysis has been created by Softberry Inc. and the application of a support ftp: vector machine approach for promoter identification is under development. PlantProm DB is available at http://mendel.cs.rhul.ac.uk/ and http://www.softberry.com/. PMID:12519961

  14. A calcium-sensitive promoter construct for gene therapy.

    PubMed

    Merlet, E; Lipskaia, L; Marchand, A; Hadri, L; Mougenot, N; Atassi, F; Liang, L; Hatem, S N; Hajjar, R J; Lompré, A-M

    2013-03-01

    Targeting diseased cells is a challenging issue in both pharmacological and biological therapeutics. Gene therapy is emerging as a novel approach for treating rare diseases and for illnesses for which there is no other alternative. An important limitation of gene therapy has been the off-target effects and therefore efforts have been focused on increasing the specificity of gene transfer to the targeted organ. Here, we describe a promoter containing six nuclear factor of activated T cells (NFAT) consensus sequences, which is as efficient as the cytomegalovirus (CMV) promoter to drive expression in vascular smooth muscle cells both in vitro and in vivo. In contrast to the CMV promoter it is activated in a Ca(2+)-dependent manner after endoplasmic reticulum depletion and allows the transgene expression only in proliferative/diseased cells. Overexpression of sarco/endoplasmic reticulum (SR/ER) Ca(2+) ATPase 2a under the control of this NFAT promoter inhibits restenosis after angioplasty in rats. In conclusion, this promoter may be useful for gene therapy in vascular proliferative diseases and other diseases involving upregulation of the NFAT pathway.

  15. Thermodynamics-based models of transcriptional regulation with gene sequence.

    PubMed

    Wang, Shuqiang; Shen, Yanyan; Hu, Jinxing

    2015-12-01

    Quantitative models of gene regulatory activity have the potential to improve our mechanistic understanding of transcriptional regulation. However, the few models available today have been based on simplistic assumptions about the sequences being modeled or heuristic approximations of the underlying regulatory mechanisms. In this work, we have developed a thermodynamics-based model to predict gene expression driven by any DNA sequence. The proposed model relies on a continuous time, differential equation description of transcriptional dynamics. The sequence features of the promoter are exploited to derive the binding affinity which is derived based on statistical molecular thermodynamics. Experimental results show that the proposed model can effectively identify the activity levels of transcription factors and the regulatory parameters. Comparing with the previous models, the proposed model can reveal more biological sense.

  16. Draft Genome Sequence of a Diazotrophic, Plant Growth–Promoting Rhizobacterium of the Pseudomonas syringae Complex

    PubMed Central

    Jeong, Haeyoung; Blakney, Andrew J. C.; Wallace, Natalie

    2016-01-01

    We report here the draft genome sequence of Pseudomonas syringae GR12-2, a nitrogen-fixing, plant growth–promoting bacterium, isolated from the rhizosphere of an Arctic grass. The 6.6-Mbp genome contains 5,676 protein-coding genes, including a nitrogen-fixation island similar to that in P. stutzeri. PMID:27660794

  17. Draft Genome Sequence of a Diazotrophic, Plant Growth-Promoting Rhizobacterium of the Pseudomonas syringae Complex.

    PubMed

    Patten, Cheryl L; Jeong, Haeyoung; Blakney, Andrew J C; Wallace, Natalie

    2016-09-22

    We report here the draft genome sequence of Pseudomonas syringae GR12-2, a nitrogen-fixing, plant growth-promoting bacterium, isolated from the rhizosphere of an Arctic grass. The 6.6-Mbp genome contains 5,676 protein-coding genes, including a nitrogen-fixation island similar to that in P. stutzeri.

  18. Genome sequence of the plant growth-promoting rhizobacterium Bacillus sp. strain 916.

    PubMed

    Wang, Xiaoyu; Luo, Chuping; Chen, Zhiyi

    2012-10-01

    Bacillus sp. strain 916, isolated from the soil, showed strong activity against Rhizoctonia solani. Here, we present the high-quality draft genome sequence of Bacillus sp. strain 916. Its 3.9-Mb genome reveals a number of genes whose products are possibly involved in promotion of plant growth or antibiosis.

  19. Nucleotide sequence of the rrnG ribosomal RNA promoter region of Escherichia coli.

    PubMed Central

    Shen, W F; Squires, C; Squires, C L

    1982-01-01

    The primary structure of the promoter region for a ribosomal RNA transcription unit (rrnG) of Escherichia coli K12 has been determined. The sequence was obtained from 1 1.5 kbp EcoRI fragment derived from the hybrid plasmid pLC23-30. This fragment contains 455 bp preceding P1 of the rrnG promoter region and 674 bp of the rrnG 16S RNA gene. The sequence before the rrnG promoter region contains an open reading frame (ORF-BG) followed by a possible hairpin structure that resembles other known transcription terminators. The sequence of the rrnG promoter region is similar but not identical to that of rrnA and rrnB. Several minor differences between the sequences of the 16S RNA genes of rrnG and rrnB were also noted. In addition, sequences were found that could generate special structures involving the promoter regions of rrn loci. Such structures are described and their possible involvement in the regulation of ribosomal RNA synthesis is discussed. PMID:6285294

  20. A Leader Intron of a Soybean Elongation Factor 1A (eEF1A) Gene Interacts with Proximal Promoter Elements to Regulate Gene Expression in Synthetic Promoters.

    PubMed

    Zhang, Ning; McHale, Leah K; Finer, John J

    2016-01-01

    Introns, especially the first intron in the 5' untranslated region (5'UTR), can significantly impact gene expression via intron-mediated enhancement (IME). In this study, we demonstrate the leader intron of a soybean elongation factor 1A (eEF1A) gene (GmScreamM8) was essential for the high activity of the native promoter. Furthermore, the interaction of the GmScreamM8 leader intron with regulatory element sequences from several soybean eEF1A promoters was studied using synthetic promoters, which consisted of element tetramers upstream of a core promoter used to regulate a green fluorescent protein (gfp) reporter gene. Element tetramers, placed upstream of a GmScreamM8 core promoter, showed very high activity using both transient expression in lima bean cotyledons and stable expression in soybean hairy roots, only if the native leader intron was included, suggesting an interaction between intronic sequences and promoter elements. Partial deletions of the leader intron showed that a 222 bp intronic sequence significantly contributed to very high levels of GFP expression. Generation of synthetic intron variants with a monomeric or trimeric repeat of the 222 bp intronic sequence, yielded almost two-fold higher expression compared to the original intron, while partial deletion of the 222 bp intronic repeated sequence significantly decreased gene expression, indicating that this intronic sequence was essential for the intron-element interaction enhancement.

  1. A Leader Intron of a Soybean Elongation Factor 1A (eEF1A) Gene Interacts with Proximal Promoter Elements to Regulate Gene Expression in Synthetic Promoters

    PubMed Central

    Zhang, Ning; McHale, Leah K.; Finer, John J.

    2016-01-01

    Introns, especially the first intron in the 5’ untranslated region (5’UTR), can significantly impact gene expression via intron-mediated enhancement (IME). In this study, we demonstrate the leader intron of a soybean elongation factor 1A (eEF1A) gene (GmScreamM8) was essential for the high activity of the native promoter. Furthermore, the interaction of the GmScreamM8 leader intron with regulatory element sequences from several soybean eEF1A promoters was studied using synthetic promoters, which consisted of element tetramers upstream of a core promoter used to regulate a green fluorescent protein (gfp) reporter gene. Element tetramers, placed upstream of a GmScreamM8 core promoter, showed very high activity using both transient expression in lima bean cotyledons and stable expression in soybean hairy roots, only if the native leader intron was included, suggesting an interaction between intronic sequences and promoter elements. Partial deletions of the leader intron showed that a 222 bp intronic sequence significantly contributed to very high levels of GFP expression. Generation of synthetic intron variants with a monomeric or trimeric repeat of the 222 bp intronic sequence, yielded almost two-fold higher expression compared to the original intron, while partial deletion of the 222 bp intronic repeated sequence significantly decreased gene expression, indicating that this intronic sequence was essential for the intron-element interaction enhancement. PMID:27806110

  2. Non-contiguous finished genome sequence of plant-growth promoting Serratia proteamaculans S4.

    PubMed

    Neupane, Saraswoti; Goodwin, Lynne A; Högberg, Nils; Kyrpides, Nikos C; Alström, Sadhna; Bruce, David; Quintana, Beverly; Munk, Christine; Daligault, Hajnalka; Teshima, Hazuki; Davenport, Karen; Reitenga, Krista; Green, Lance; Chain, Patrick; Erkkila, Tracy; Gu, Wei; Zhang, Xiaojing; Xu, Yan; Kunde, Yulia; Chertkov, Olga; Han, James; Han, Cliff; Detter, John C; Ivanova, Natalia; Pati, Amrita; Chen, Amy; Szeto, Ernest; Mavromatis, Kostas; Huntemann, Marcel; Nolan, Matt; Pitluck, Sam; Deshpande, Shweta; Markowitz, Victor; Pagani, Ioanna; Klenk, Hans-Peter; Woyke, Tanja; Finlay, Roger D

    2013-07-30

    Serratia proteamaculans S4 (previously Serratia sp. S4), isolated from the rhizosphere of wild Equisetum sp., has the ability to stimulate plant growth and to suppress the growth of several soil-borne fungal pathogens of economically important crops. Here we present the non-contiguous, finished genome sequence of S. proteamaculans S4, which consists of a 5,324,944 bp circular chromosome and a 129,797 bp circular plasmid. The chromosome contains 5,008 predicted genes while the plasmid comprises 134 predicted genes. In total, 4,993 genes are assigned as protein-coding genes. The genome consists of 22 rRNA genes, 82 tRNA genes and 58 pseudogenes. This genome is a part of the project "Genomics of four rapeseed plant growth-promoting bacteria with antagonistic effect on plant pathogens" awarded through the 2010 DOE-JGI's Community Sequencing Program.

  3. Non-contiguous finished genome sequence of plant-growth promoting Serratia proteamaculans S4

    PubMed Central

    Goodwin, Lynne A.; Högberg, Nils; Kyrpides, Nikos C.; Alström, Sadhna; Bruce, David; Quintana, Beverly; Munk, Christine; Daligault, Hajnalka; Teshima, Hazuki; Davenport, Karen; Reitenga, Krista; Green, Lance; Chain, Patrick; Erkkila, Tracy; Gu, Wei; Zhang, Xiaojing; Xu, Yan; Kunde, Yulia; Chertkov, Olga; Han, James; Han, Cliff; Detter, John C.; Ivanova, Natalia; Pati, Amrita; Chen, Amy; Szeto, Ernest; Mavromatis, Kostas; Huntemann, Marcel; Nolan, Matt; Pitluck, Sam; Deshpande, Shweta; Markowitz, Victor; Pagani, Ioanna; Klenk, Hans-Peter; Woyke, Tanja; Finlay, Roger D.

    2013-01-01

    Serratia proteamaculans S4 (previously Serratia sp. S4), isolated from the rhizosphere of wild Equisetum sp., has the ability to stimulate plant growth and to suppress the growth of several soil-borne fungal pathogens of economically important crops. Here we present the non-contiguous, finished genome sequence of S. proteamaculans S4, which consists of a 5,324,944 bp circular chromosome and a 129,797 bp circular plasmid. The chromosome contains 5,008 predicted genes while the plasmid comprises 134 predicted genes. In total, 4,993 genes are assigned as protein-coding genes. The genome consists of 22 rRNA genes, 82 tRNA genes and 58 pseudogenes. This genome is a part of the project “Genomics of four rapeseed plant growth-promoting bacteria with antagonistic effect on plant pathogens” awarded through the 2010 DOE-JGI’s Community Sequencing Program. PMID:24501629

  4. Nemertean Toxin Genes Revealed through Transcriptome Sequencing

    PubMed Central

    Whelan, Nathan V.; Kocot, Kevin M.; Santos, Scott R.; Halanych, Kenneth M.

    2014-01-01

    Nemerteans are one of few animal groups that have evolved the ability to utilize toxins for both defense and subduing prey, but little is known about specific nemertean toxins. In particular, no study has identified specific toxin genes even though peptide toxins are known from some nemertean species. Information about toxin genes is needed to better understand evolution of toxins across animals and possibly provide novel targets for pharmaceutical and industrial applications. We sequenced and annotated transcriptomes of two free-living and one commensal nemertean and annotated an additional six publicly available nemertean transcriptomes to identify putative toxin genes. Approximately 63–74% of predicted open reading frames in each transcriptome were annotated with gene names, and all species had similar percentages of transcripts annotated with each higher-level GO term. Every nemertean analyzed possessed genes with high sequence similarities to known animal toxins including those from stonefish, cephalopods, and sea anemones. One toxin-like gene found in all nemerteans analyzed had high sequence similarity to Plancitoxin-1, a DNase II hepatotoxin that may function well at low pH, which suggests that the acidic body walls of some nemerteans could work to enhance the efficacy of protein toxins. The highest number of toxin-like genes found in any one species was seven and the lowest was three. The diversity of toxin-like nemertean genes found here is greater than previously documented, and these animals are likely an ideal system for exploring toxin evolution and industrial applications of toxins. PMID:25432940

  5. Alternative promoters of gene MAGE4a

    SciTech Connect

    De Plaen, E.; Naerhuyzen, B.; De Smet, C.

    1997-03-01

    Gene MAGE-4 (HGMW-approved symbol MAGE4) is expressed in several types of tumors, but not in normal tissues, except testis and placenta. The 5{prime} end of this gene contains eight homologous exons spread over a 5.8-kb region. These exons are alternatively spliced to a unique second exon and a unique third exon, which encodes a protein of 317 amino acids. The analysis of transcripts found in testis, placenta, and a sarcoma cell line showed that each of the alternative first exons is used in at least one of these tissues. Various regions of the promoter of the fifth alternative exon (1.5) were cloned in a luciferase reporter plasmid, and the constructs were transfected in a sarcoma cell line that expresses MAGE-4. Two Ets motifs located between positions -70 and -29 relative to the transcription start site were found to drive 55% of the promoter activity. A region containing an Sp1 consensus binding site located upstream of the two Ets motifs was found to be responsible for 44% of the transcriptional activity. MAGE-4a promoters 1.4 and 1.6, which also contain the Sp1 and the two Ets binding motifs, supported a level of transcription comparable to that of promoter 1.5, whereas promoter 1.1, which contains only one Ets binding site, was sixfold less active. In line with observations made with gene MAGE-1 (HGMW-approved symbol MAGE1), we found that promoter 1.5 stimulated a high level of transcription in a melanoma cell line that does not express MAGE-4. This suggests that the tumor-specific expression of MAGE genes is not determined by the presence of specific transcription factors. 26 refs., 7 figs., 2 tabs.

  6. Tissue-specific activity of the pro-opiomelanocortin gene promoter

    SciTech Connect

    Jeannotte, L.; Trifiro, M.A.; Plante, R.K.; Chamberland, M.; Drouin, J.

    1987-11-01

    The pro-opiomelanocortin (POMC) gene is specifically expressed in corticotroph cells of the anterior pituitary. To define the POMC promoter sequences responsible for tissue-specific expression, we assessed POMC promoter activity by gene transfer into POMC-expressing pituitary tumor cells (AtT-20) and fibroblast L cells. The rat POMC promoter was only efficiently utilized and correctly transcribed in AtT-20 cells. 5'-End deletion analysis revealed two promoter regions for activity in AtT-20 cells. When tested by fusion to a heterologuous promoter, DNA fragments corresponding to both regions exhibited tissue-specific activity, suggesting the presence of at least two tissue-specific DNA sequence elements within the promoter. In summary, POMC promoter sequences from -480 to -34 base pairs appear sufficient to mimic the specificity of anterior pituitary expression.

  7. The Complete Genome Sequence of the Plant Growth-Promoting Bacterium Pseudomonas sp. UW4

    PubMed Central

    Duan, Jin; Jiang, Wei; Cheng, Zhenyu; Heikkila, John J.; Glick, Bernard R.

    2013-01-01

    The plant growth-promoting bacterium (PGPB) Pseudomonas sp. UW4, previously isolated from the rhizosphere of common reeds growing on the campus of the University of Waterloo, promotes plant growth in the presence of different environmental stresses, such as flooding, high concentrations of salt, cold, heavy metals, drought and phytopathogens. In this work, the genome sequence of UW4 was obtained by pyrosequencing and the gaps between the contigs were closed by directed PCR. The P. sp. UW4 genome contains a single circular chromosome that is 6,183,388 bp with a 60.05% G+C content. The bacterial genome contains 5,423 predicted protein-coding sequences that occupy 87.2% of the genome. Nineteen genomic islands (GIs) were predicted and thirty one complete putative insertion sequences were identified. Genes potentially involved in plant growth promotion such as indole-3-acetic acid (IAA) biosynthesis, trehalose production, siderophore production, acetoin synthesis, and phosphate solubilization were determined. Moreover, genes that contribute to the environmental fitness of UW4 were also observed including genes responsible for heavy metal resistance such as nickel, copper, cadmium, zinc, molybdate, cobalt, arsenate, and chromate. Whole-genome comparison with other completely sequenced Pseudomonas strains and phylogeny of four concatenated “housekeeping” genes (16S rRNA, gyrB, rpoB and rpoD) of 128 Pseudomonas strains revealed that UW4 belongs to the fluorescens group, jessenii subgroup. PMID:23516524

  8. High-fidelity promoter profiling reveals widespread alternative promoter usage and transposon-driven developmental gene expression.

    PubMed

    Batut, Philippe; Dobin, Alexander; Plessy, Charles; Carninci, Piero; Gingeras, Thomas R

    2013-01-01

    Many eukaryotic genes possess multiple alternative promoters with distinct expression specificities. Therefore, comprehensively annotating promoters and deciphering their individual regulatory dynamics is critical for gene expression profiling applications and for our understanding of regulatory complexity. We introduce RAMPAGE, a novel promoter activity profiling approach that combines extremely specific 5'-complete cDNA sequencing with an integrated data analysis workflow, to address the limitations of current techniques. RAMPAGE features a streamlined protocol for fast and easy generation of highly multiplexed sequencing libraries, offers very high transcription start site specificity, generates accurate and reproducible promoter expression measurements, and yields extensive transcript connectivity information through paired-end cDNA sequencing. We used RAMPAGE in a genome-wide study of promoter activity throughout 36 stages of the life cycle of Drosophila melanogaster, and describe here a comprehensive data set that represents the first available developmental time-course of promoter usage. We found that >40% of developmentally expressed genes have at least two promoters and that alternative promoters generally implement distinct regulatory programs. Transposable elements, long proposed to play a central role in the evolution of their host genomes through their ability to regulate gene expression, contribute at least 1300 promoters shaping the developmental transcriptome of D. melanogaster. Hundreds of these promoters drive the expression of annotated genes, and transposons often impart their own expression specificity upon the genes they regulate. These observations provide support for the theory that transposons may drive regulatory innovation through the distribution of stereotyped cis-regulatory modules throughout their host genomes.

  9. Identification and structural analysis of a ribosomal RNA gene promoter from Thiobacillus ferrooxidans.

    PubMed

    Takamiya, M; Salazar, O; Vargas, D; Jedlicki, E; Orellana, O

    1990-10-15

    The 5'-terminus of a rRNA operon (rrnT2) from Thiobacillus ferrooxidans was characterized. The rRNA promoters from this microorganism were identified by means of a functional assay in Escherichia coli. DNA sequencing of the promoter region, upstream the 16 S rRNA gene, showed the presence of a consensus sequence for bacterial ribosomal promoters. Other features such as a 'discriminator' sequence, antiterminator elements and an upstream hexanucleotide common to several rRNA operons were also found. Two other putative transcription promoters were also identified.

  10. Construction of gene expression system in hop (Humulus lupulus) lupulin gland using valerophenone synthase promoter.

    PubMed

    Okada, Yukio; Saeki, Kazuo; Inaba, Akira; Suda, Narushi; Kaneko, Takafumi; Ito, Kazutoshi

    2003-09-01

    The promoter region of the valerophenone synthase (VPS) gene was isolated from hop (Humulus lupulus). VPS, a member of the chalcone synthase (CHS) super-family, catalyzes the biosynthesis reaction of the hop resin that significantly accumulates in the cone's secretory gland called the "lupulin gland". The typical H-box and G-box sequences, which exist in many plants' CHS promoters and act as cis-elements for tissue specificity, UV-light induction, etc., were not found in the isolated VPS promoter, although the H-box-like sequence (CCTTACC, CCTAACC) and the core sequence (ACGT) of the G-box were observed. The transformation experiment using the VPS promoter-UIDA gene fusion revealed that the promoter acts not only in the lupulin gland but also in the glands of leaf and stem. On the other hand, the VPS promoter activity was not induced by UV-irradiation.

  11. Mutations of the ompK36 porin gene and promoter impact responses of sequence type 258, KPC-2-producing Klebsiella pneumoniae strains to doripenem and doripenem-colistin.

    PubMed

    Clancy, Cornelius J; Chen, Liang; Hong, Jae H; Cheng, Shaoji; Hao, Binghua; Shields, Ryan K; Farrell, Annie N; Doi, Yohei; Zhao, Yanan; Perlin, David S; Kreiswirth, Barry N; Nguyen, M Hong

    2013-11-01

    Doripenem-colistin exerts synergy against some, but not all, Klebsiella pneumoniae carbapenemase (KPC)-producing K. pneumoniae strains in vitro. We determined if doripenem MICs and/or ompK36 porin gene mutations impacted the responses of 23 sequence type 258 (ST258), KPC-2-producing strains to the combination of doripenem (8 μg/ml) and colistin (2 μg/ml) during time-kill assays. The median doripenem and colistin MICs were 32 and 4 μg/ml. Doripenem MICs did not correlate with KPC-2 expression levels. Five and 18 strains had wild-type and mutant ompK36, respectively. The most common mutations were IS5 promoter insertions (n = 7) and insertions encoding glycine and aspartic acid at amino acid (aa) positions 134 and 135 (ins aa134-135 GD; n = 8), which were associated with higher doripenem MICs than other mutations or wild-type ompK36 (all P values ≤ 0.04). Bactericidal activity (24 h) was achieved by doripenem-colistin against 12%, 43%, and 75% of ins aa134-135 GD, IS5, and wild-type/other mutants, respectively (P = 0.04). Doripenem-colistin was more active in time-kill studies than colistin at 12 and 24 h if the doripenem MIC was ≤8 μg/ml (P = 0.0007 and 0.09, respectively), but not if the MIC was >8 μg/ml (P = 0.10 and 0.16). Likewise, doripenem-colistin was more active at 12 and 24 h against the wild type/other mutants than ins aa134-135 GD or IS5 mutants (P = 0.007 and 0.0007). By multivariate analysis, the absence of ins aa134-135 GD or IS5 mutations was the only independent predictor of doripenem-colistin responses at 24 h (P = 0.002). In conclusion, ompK36 genotypes identified ST258 KPC-K. pneumoniae strains that were most likely to respond to doripenem-colistin.

  12. Efficient chimeric plant promoters derived from plant infecting viral promoter sequences.

    PubMed

    Acharya, Sefali; Ranjan, Rajiv; Pattanaik, Sitakanta; Maiti, Indu B; Dey, Nrisingha

    2014-02-01

    In the present study, we developed a set of three chimeric/hybrid promoters namely FSgt-PFlt, PFlt-UAS-2X and MSgt-PFlt incorporating different important domains of Figwort Mosaic Virus sub-genomic transcript promoter (FSgt, -270 to -60), Mirabilis Mosaic Virus sub-genomic transcript promoter (MSgt, -306 to -125) and Peanut Chlorotic Streak Caulimovirus full-length transcript promoter (PFlt-, -353 to +24 and PFlt-UAS, -353 to -49). We demonstrated that these chimeric/hybrid promoters can drive the expression of reporter genes in different plant species including tobacco, Arabidopsis, petunia, tomato and spinach. FSgt-PFlt, PFlt-UAS-2X and MSgt-PFlt promoters showed 4.2, 1.5 and 1.2 times stronger GUS activities compared to the activity of the CaMV35S promoter, respectively, in tobacco protoplasts. Protoplast-derived recombinant promoter driven GFP showed enhanced accumulation compared to that obtained under the CaMV35S promoter. FSgt-PFlt, PFlt-UAS-2X and MSgt-PFlt promoters showed 3.0, 1.3 and 1.0 times stronger activities than the activity of the CaMV35S² (a modified version of the CaMV35S promoter with double enhancer domain) promoter, respectively, in tobacco (Nicotiana tabacum, var. Samsun NN). Alongside, we observed a fair correlation between recombinant promoter-driven GUS accumulation with the corresponding uidA-mRNA level in transgenic tobacco. Histochemical (X-gluc) staining of whole transgenic seedlings and fluorescence images of ImaGene Green™ treated floral parts expressing the GUS under the control of recombinant promoters also support above findings. Furthermore, we confirmed that these chimeric promoters are inducible in the presence of 150 μM salicylic acid (SA) and abscisic acid (ABA). Taken altogether, we propose that SA/ABA inducible chimeric/recombinant promoters could be used for strong expression of gene(s) of interest in crop plants.

  13. Functional activity of the two promoters of the myosin alkali light chain gene in primary muscle cell cultures: comparison with other muscle gene promoters and other culture systems.

    PubMed Central

    Daubas, P; Klarsfeld, A; Garner, I; Pinset, C; Cox, R; Buckingham, M

    1988-01-01

    Proximal upstream flanking sequences of the mouse myosin alkali light chain gene encoding MLC1F and MLC3F, the mouse alpha-cardiac actin gene and the chicken gene for the alpha-subunit of the acetylcholine receptor were linked to the bacterial chloramphenicol acetyl transferase (CAT) gene and transfected into primary cultures derived from mouse skeletal muscle or into myogenic cell lines. We demonstrate that the mouse MLC1F/MLC3F gene has two functional promoters. In primary muscle cultures, a 1200 bp sequence flanking exon 1 (MLC1F) and a 438 bp sequence flanking exon 2 (MLC3F) direct CAT activity in myotubes, but not in myoblasts or in non myogenic 3T6 and CV1 cells. Developmentally regulated expression is also seen with the alpha-cardiac actin (320 bp) and acetylcholine receptor alpha-subunit (850 bp) upstream sequences in the primary culture system. Transfection experiments with myogenic cell lines show different results with a given promoter construct, reflecting possible differences in the levels of regulatory factors between lines. Different muscle gene promoters behave differently in a given cell line, suggesting different regulatory factor requirements between these promoters. Images PMID:2894633

  14. Members of the nuclear factor 1 family and hepatocyte nuclear factor 4 bind to overlapping sequences of the L-II element on the rat pyruvate kinase L gene promoter and regulate its expression.

    PubMed

    Yamada, K; Tanaka, T; Noguchi, T

    1997-06-15

    The L-II element (-149 to -126 bp) in the enhancer unit of the rat pyruvate kinase L (PKL) gene is required for cell-type-specific transcription and induction by carbohydrates. This element was found to bind multiple nuclear proteins with different heat stabilities. A heat-labile factor was shown to be hepatocyte nuclear factor (HNF) 4 by the electrophoretic mobility-shift assay (EMSA) using various competitor DNAs and anti-HNF4 serum. A heat-stable factor was purified from rat liver nuclear extract and was resolved as two protein bands migrating at about 33 kDa on SDS/polyacrylamide gels. Peptide sequence analysis revealed that these proteins were nuclear factor (NF) 1-L and NF1/Red1. The heat-stable factor was also identified as a member of the NF1 family by using various competitor DNAs and anti-NF1 serum in an EMSA. In addition, we found that a factor bound to the accessory site of the rat S14 gene, which is necessary for carbohydrate responsiveness of this gene, was also a member of the NF1 family, raising the possibility that the NF1 family is involved in the carbohydrate regulation of gene transcription by interactions with other proteins. The NF1 family members and HNF4 interacted with overlapping sequences of the L-II element, wherein the 5' half-site was more critical for NF1 binding, and the 3' site was more important for HNF4 binding. Co-transfection of a vector expressing either NF1-L or NF1/Red1 repressed the transcription of the PKL enhancer unit-chloramphenicol acetyltransferase (CAT) fusion gene in HepG2 cells, whereas co-transfection of a vector expressing HNF4 activated the transcription of the same reporter gene. Furthermore NF1 family members antagonized the effect of HNF4 on PKL enhancer unit-CAT fusion gene expression when both expression plasmids were co-transfected. We conclude that NF1 family members and HNF4 regulate transcription of the PKL gene in an opposing manner by binding overlapping sequences of the L-II element.

  15. Analysis of cis-sequence of subgenomic transcript promoter from the Figwort mosaic virus and comparison of promoter activity with the cauliflower mosaic virus promoters in monocot and dicot cells.

    PubMed

    Bhattacharyya, Somnath; Dey, Nrisingha; Maiti, Indu B

    2002-12-01

    A sub-genomic transcript (Sgt) promoter was isolated from the Figwort mosaic virus (FMV) genomic clone. The FMV Sgt promoter was linked to heterologous coding sequences to form a chimeric gene construct. The 5'-3'-boundaries required for maximal activity and involvement of cis-sequences for optimal expression in plants were defined by 5'-, 3'-end deletion and internal deletion analysis of FMV Sgt promoter fragments coupled with a beta-glucuronidase reporter gene in both transient protoplast expression experiments and in transgenic plants. A 301 bp FMV Sgt promoter fragment (sequence -270 to +31 from the transcription start site; TSS) provided maximum promoter activity. The TSS of the FMV Sgt promoter was determined by primer extension analysis using total RNA from transgenic plants developed for FMV Sgt promoter: uidA fusion gene. An activator domain located upstream of the TATA box at -70 to -100 from TSS is absolutely required for promoter activity and its function is critically position-dependent with respect to TATA box. Two sequence motifs AGATTTTAAT (coordinates -100 to -91) and GTAAGCGC (coordinates -80 to -73) were found to be essential for promoter activity. The FMV Sgt promoter is less active in monocot cells; FMV Sgt promoter expression level was about 27.5-fold higher in tobacco cells compared to that in maize cells. Comparative expression analysis of FMV Sgt promoter with cauliflower mosaic virus (CaMV) 35S promoter showed that the FMV Sgt promoter is about 2-fold stronger than the CaMV 35S promoter. The FMV Sgt promoter is a constitutive promoter; expression level in seedlings was in the order: root>leaf>stem.

  16. Gene expression profile of human bone marrow stromal cells: high-throughput expressed sequence tag sequencing analysis.

    PubMed

    Jia, Libin; Young, Marian F; Powell, John; Yang, Liming; Ho, Nicola C; Hotchkiss, Robert; Robey, Pamela Gehron; Francomano, Clair A

    2002-01-01

    Human bone marrow stromal cells (HBMSC) are pluripotent cells with the potential to differentiate into osteoblasts, chondrocytes, myelosupportive stroma, and marrow adipocytes. We used high-throughput DNA sequencing analysis to generate 4258 single-pass sequencing reactions (known as expressed sequence tags, or ESTs) obtained from the 5' (97) and 3' (4161) ends of human cDNA clones from a HBMSC cDNA library. Our goal was to obtain tag sequences from the maximum number of possible genes and to deposit them in the publicly accessible database for ESTs (dbEST of the National Center for Biotechnology Information). Comparisons of our EST sequencing data with nonredundant human mRNA and protein databases showed that the ESTs represent 1860 gene clusters. The EST sequencing data analysis showed 60 novel genes found only in this cDNA library after BLAST analysis against 3.0 million ESTs in NCBI's dbEST database. The BLAST search also showed the identified ESTs that have close homology to known genes, which suggests that these may be newly recognized members of known gene families. The gene expression profile of this cell type is revealed by analyzing both the frequency with which a message is encountered and the functional categorization of expressed sequences. Comparing an EST sequence with the human genomic sequence database enables assignment of an EST to a specific chromosomal region (a process called digital gene localization) and often enables immediate partial determination of intron/exon boundaries within the genomic structure. It is expected that high-throughput EST sequencing and data mining analysis will greatly promote our understanding of gene expression in these cells and of growth and development of the skeleton.

  17. Structure of the BoLA-DRB3 gene and promoter.

    PubMed

    Russell, G C; Smith, J A; Oliver, R A

    2004-06-01

    The cattle major histocompatibility complex (MHC) class II DR gene product is a heterodimer encoded by the BoLA-DRA and -DRB3 genes. Several groups have isolated cDNA and genomic clones for these genes, but their full genomic organization has not been described. We used a combination of long-range polymerase chain reaction (PCR), cloning and sequencing to define the organization of the DRB3 gene on existing genomic clones and in genomic DNA. We estimate the size of the coding region to be 11.4 kbp. Sequencing of full-length PCR clones from two different haplotypes confirmed that they carried complete DRB3 genes and allowed the design of probes and primers to isolate and characterize the DRB3 promoter and 3' end. Fragments carrying the 5' end of the DRB3 gene and its promoter were identified on bacterial artificial chromosome (BAC) clones carrying the BoLA-DR genes. A 10-kbp promoter fragment was subcloned from one clone and a 1.7-kbp region including exon 1 and the promoter was sequenced. A 3-kbp fragment encoding exons 4-6 and the entire 3' untranslated region of the DRB3 gene was isolated from lambda clone A1 and sequenced. This provides us with improved characterization of the DRB3*0101 and DRB3*2002 alleles, and also subcloned 5' and 3' flanking regions of the polymorphic DRB3 gene for use in functional studies.

  18. Amy as a reporter gene for promoter activity in Nocardia lactamdurans: comparison of promoters of the cephamycin cluster.

    PubMed Central

    Chary, V K; de la Fuente, J L; Liras, P; Martin, J F

    1997-01-01

    Promoter probe vectors containing the pA origin of replication and the Streptomyces griseus promoterless amy gene (encoding alpha-amylase) as reporter have been constructed to study transcription initiation regions in Nocardia lactamdurans. In some of the promoter probe vectors the phage fd terminator has been introduced to avoid readthrough expression from upstream sequences. By using these vectors, four different transcription initiation regions of the cephamycin gene cluster have been studied in N. lactamdurans. The bla gene encoding a beta-lactamase has a relatively strong promoter. Two other separate promoters corresponding to the lat and cefD genes (encoding, respectively, lysine-6-aminotransferase and isopenicillin N-epimerase) showed weak transcription initiation ability. These two promoters are arranged in a bidirectional transcription initiation region located in the center of the cephamycin gene cluster. The cmcH gene (encoding 3-hydroxymethylcephem carbamoyltransferase) upstream region did not contain a functional promoter, suggesting that cmcH is transcribed as a part of a polycistronic mRNA. The native amy promoter is used very efficiently in N. lactamdurans, resulting in secretion of high levels of extracellular alpha-amylase. PMID:9251185

  19. Relating Promoter Sequences to the Proteins that Bind to Them: A Comparison Study.

    NASA Astrophysics Data System (ADS)

    Glass, Kimberly

    2007-03-01

    Chromatin Immunoprecipitation (ChIP-on-ChIP) microarray data reveals that the proteins H3K9dimethyl and RNA-Polymerase II are exclusive regarding their binding to the promoter region of genes. When comparing the base pair sequences of the promoters that bind to Pol2 versus H3K9, striking differences appear. The mononucleotides have fundamentally different behaviors in each group. In addition, motifs that cluster before the transcriptional start site also generally have a strong enrichment in one group compared to the other. Using this knowledge a model can be developed that allows one to calculate a probability that a promoter will bind to either H3K9 or Pol2 based on its base pair sequence.

  20. Eukaryotic genomes may exhibit up to 10 generic classes of gene promoters

    PubMed Central

    2012-01-01

    Background The main function of gene promoters appears to be the integration of different gene products in their biological pathways in order to maintain homeostasis. Generally, promoters have been classified in two major classes, namely TATA and CpG. Nevertheless, many genes using the same combinatorial formation of transcription factors have different gene expression patterns. Accordingly, we tried to ask ourselves some fundamental questions: Why certain genes have an overall predisposition for higher gene expression levels than others? What causes such a predisposition? Is there a structural relationship of these sequences in different tissues? Is there a strong phylogenetic relationship between promoters of closely related species? Results In order to gain valuable insights into different promoter regions, we obtained a series of image-based patterns which allowed us to identify 10 generic classes of promoters. A comprehensive analysis was undertaken for promoter sequences from Arabidopsis thaliana, Drosophila melanogaster, Homo sapiens and Oryza sativa, and a more extensive analysis of tissue-specific promoters in humans. We observed a clear preference for these species to use certain classes of promoters for specific biological processes. Moreover, in humans, we found that different tissues use distinct classes of promoters, reflecting an emerging promoter network. Depending on the tissue type, comparisons made between these classes of promoters reveal a complementarity between their patterns whereas some other classes of promoters have been observed to occur in competition. Furthermore, we also noticed the existence of some transitional states between these classes of promoters that may explain certain evolutionary mechanisms, which suggest a possible predisposition for specific levels of gene expression and perhaps for a different number of factors responsible for triggering gene expression. Our conclusions are based on comprehensive data from three

  1. Inverted duplication of histone genes in chicken and disposition of regulatory sequences.

    PubMed Central

    Wang, S W; Robins, A J; d'Andrea, R; Wells, J R

    1985-01-01

    Sequence analysis of an 8.4 kb fragment containing five chicken histone genes shows that an H4-H2A gene pair is duplicated and inverted around a central H3 gene. A left and right region, each of 2.1 kb are 97% homologous and the boundaries of homology coincide with ten base pair repeats. These boundary regions also contain highly conserved gene promoter elements, suggesting that interaction of transcriptional machinery with histone genes may be connected with recombination in promoter regions, resulting in the inverted duplication structure seen in this cluster. PMID:4000938

  2. The first determination of DNA sequence of a specific gene.

    PubMed

    Inouye, Masayori

    2016-05-10

    How and when the first DNA sequence of a gene was determined? In 1977, F. Sanger came up with an innovative technology to sequence DNA by using chain terminators, and determined the entire DNA sequence of the 5375-base genome of bacteriophage φX 174 (Sanger et al., 1977). While this Sanger's achievement has been recognized as the first DNA sequencing of genes, we had determined DNA sequence of a gene, albeit a partial sequence, 11 years before the Sanger's DNA sequence (Okada et al., 1966).

  3. Tandem promoters determine regulation of the Klebsiella pneumoniae glutamine synthetase (glnA) gene.

    PubMed Central

    Dixon, R

    1984-01-01

    Transcription of the structural gene for glutamine synthetase (glnA) in Klebsiella pneumoniae is controlled by the nitrogen regulatory genes ntrA, ntrB and ntrC. The nucleotide sequence of the regulatory region upstream of the glnA gene is reported here. High resolution S1 mapping of in vivo transcripts indicates that the regulatory region contains tandem promoters separated by 100 nucleotides. Measurements of beta-galactosidase activities determined in vivo from glnA-lac fusions suggest that the upstream promoter (for RNA2) is negatively regulated by the ntrBC gene products whereas transcription from the downstream promoter (for RNA1) is positively activated by the ntrA gene product in the presence of either the ntrBC or the nifA genes. The nucleotide sequence of the upstream promoter resembles the consensus sequence for E. coli promoters, whereas the downstream promoter shows homology with the nitrogen fixation (nif) promoters of K. pneumoniae. Images PMID:6149519

  4. Nucleotide Sequence of the Akv env Gene

    PubMed Central

    Lenz, Jack; Crowther, Robert; Straceski, Anthony; Haseltine, William

    1982-01-01

    The sequence of 2,191 nucleotides encoding the env gene of murine retrovirus Akv was determined by using a molecular clone of the Akv provirus. Deduction of the encoded amino acid sequence showed that a single open reading frame encodes a 638-amino acid precursor to gp70 and p15E. In addition, there is a typical leader sequence preceding the amino terminus of gp70. The locations of potential glycosylation sites and other structural features indicate that the entire gp70 molecule and most of p15E are located on the outer side of the membrane. Internal cleavage of the env precursor to generate gp70 and p15E occurs immediately adjacent to several basic amino acids at the carboxyl terminus of gp70. This cleavage generates a region of 42 uncharged, relatively hydrophobic amino acids at the amino terminus of p15E, which is located in a position analogous to the hydrophobic membrane fusion sequence of influenza virus hemagglutinin. The mature polypeptides are predicted to associate with the membrane via a region of 30 uncharged, mostly hydrophobic amino acids located near the carboxyl terminus of p15E. Distal to this membrane association region is a sequence of 35 amino acids at the carboxyl terminus of the env precursor, which is predicted to be located on the inner side of the membrane. By analogy to Moloney murine leukemia virus, a proteolytic cleavage in this region removes the terminal 19 amino acids, thus generating the carboxyl terminus of p15E. This leaves 15 amino acids at the carboxyl terminus of p15E on the inner side of the membrane in a position to interact with virion cores during budding. The precise location and order of the large RNase T1-resistant oligonucleotides in the env region were determined and compared with those from several leukemogenic viruses of AKR origin. This permitted a determination of how the differences in the leukemogenic viruses affect the primary structure of the env gene products. PMID:6283170

  5. Isolated yeast promoter sequence and a method of regulated heterologous expression

    DOEpatents

    Gao, Johnway; Skeen, Rodney S.; Hooker, Brian S.; Anderson, Daniel B.

    2005-05-31

    The present invention provides the promoter clone discovery of a glucoamylase gene of a starch utilizing yeast strain Schwanniomyces castellii. The isolated glucoamylase promoter is an inducible promoter, which can regulate strong gene expression in starch culture medium.

  6. Reporter Gene Silencing in Targeted Mouse Mutants Is Associated with Promoter CpG Island Methylation

    PubMed Central

    Kirov, Julia V.; Adkisson, Michael; Nava, A. J.; Cipollone, Andreana; Willis, Brandon; Engelhard, Eric K.; Lloyd, K. C. Kent; de Jong, Pieter; West, David B.

    2015-01-01

    Targeted mutations in mouse disrupt local chromatin structure and may lead to unanticipated local effects. We evaluated targeted gene promoter silencing in a group of six mutants carrying the tm1a Knockout Mouse Project allele containing both a LacZ reporter gene driven by the native promoter and a neo selection cassette. Messenger RNA levels of the reporter gene and targeted gene were assessed by qRT-PCR, and methylation of the promoter CpG islands and LacZ coding sequence were evaluated by sequencing of bisulfite-treated DNA. Mutants were stratified by LacZ staining into presumed Silenced and Expressed reporter genes. Silenced mutants had reduced relative quantities LacZ mRNA and greater CpG Island methylation compared with the Expressed mutant group. Within the silenced group, LacZ coding sequence methylation was significantly and positively correlated with CpG Island methylation, while promoter CpG methylation was only weakly correlated with LacZ gene mRNA. The results support the conclusion that there is promoter silencing in a subset of mutants carrying the tm1a allele. The features of targeted genes which promote local silencing when targeted remain unknown. PMID:26275310

  7. The control region of the metH gene of Salmonella typhimurium LT2: an atypical met promoter.

    PubMed

    Urbanowski, M L; Stauffer, G V

    1988-12-15

    The control region of the Salmonella typhimurium metH gene was sequenced and the transcription start point was determined by S1 nuclease mapping experiments. Activation of the metH gene by the metR gene product was shown to occur at the level of transcription. The translation start site was determined by amino acid sequence analysis of the amino terminus of a chimeric Met-Lac fusion protein encoded by a metH-lacZ gene fusion. Analysis of the nucleotide sequence of the metH promoter region showed that two sequence elements, present in the promoters of all other met biosynthetic genes thus far examined, are not present in the metH promoter region, namely, the repeated MetJ repressor recognition sequence 5'-AGACGTCT-3' and a highly conserved sequence 5'-TGGA----TAAAC-3' of unknown function.

  8. Mouse Vk gene classification by nucleic acid sequence similarity.

    PubMed

    Strohal, R; Helmberg, A; Kroemer, G; Kofler, R

    1989-01-01

    Analyses of immunoglobulin (Ig) variable (V) region gene usage in the immune response, estimates of V gene germline complexity, and other nucleic acid hybridization-based studies depend on the extent to which such genes are related (i.e., sequence similarity) and their organization in gene families. While mouse Igh heavy chain V region (VH) gene families are relatively well-established, a corresponding systematic classification of Igk light chain V region (Vk) genes has not been reported. The present analysis, in the course of which we reviewed the known extent of the Vk germline gene repertoire and Vk gene usage in a variety of responses to foreign and self antigens, provides a classification of mouse Vk genes in gene families composed of members with greater than 80% overall nucleic acid sequence similarity. This classification differed in several aspects from that of VH genes: only some Vk gene families were as clearly separated (by greater than 25% sequence dissimilarity) as typical VH gene families; most Vk gene families were closely related and, in several instances, members from different families were very similar (greater than 80%) over large sequence portions; frequently, classification by nucleic acid sequence similarity diverged from existing classifications based on amino-terminal protein sequence similarity. Our data have implications for Vk gene analyses by nucleic acid hybridization and describe potentially important differences in sequence organization between VH and Vk genes.

  9. 5' sequences are important positive and negative determinants of the longevity of Chlamydomonas chloroplast gene transcripts.

    PubMed Central

    Salvador, M L; Klein, U; Bogorad, L

    1993-01-01

    We have found that sequences in the 5' leader of the Chlamydomonas chloroplast rbcL gene, when fused 5' to foreign genes, destabilize transcripts of these chimeric genes in the chloroplast of transgenic Chlamydomonas but that 5' sequences of the rbcL structural gene prevent this destabilization. Transcripts of the chloroplast rbcL gene are about equally abundant at all times in Chlamydomonas reinhardtii growing on an alternating 12-h light/12-h dark cycle. However, Chlamydomonas chloroplast transformants, harboring chimeric genes containing the same rbcL promoter with 63 or 92 bp of the rbcL 5' leader sequence fused upstream of the Escherichia coli uidA (beta-glucuronidase, GUS) gene, accumulated GUS transcripts only in the dark. Transcripts disappeared rapidly upon illumination of the cells. The same phenomenon was exhibited by transcripts of chimeric genes in which the GUS gene coding sequence was replaced by other unrelated genes. The precipitous light-induced drop in GUS transcript abundance was found to be due to an approximately 16-fold increase in the rate of degradation of GUS transcripts in light rather than to a decrease in the rate of transcription of the GUS gene. Transcripts of a chimeric rbcL-GUS construct in which the leader sequence of the rbcL gene was replaced by 103 bp of the leader sequence of the atpB gene were stable in illuminated cells. The destabilizing effect of the rbcL 5' leader sequence was reversed by adding 257 bp of the 5' coding region of the rbcL gene. The results show that chloroplast transcript levels in illuminated Chlamydomonas cells--and perhaps in other cases--can be determined, at least to some extent, by sequences and interactions of sequences transcribed from the 5' ends of genes. Images PMID:8434017

  10. Yeast homologous recombination-based promoter engineering for the activation of silent natural product biosynthetic gene clusters.

    PubMed

    Montiel, Daniel; Kang, Hahk-Soo; Chang, Fang-Yuan; Charlop-Powers, Zachary; Brady, Sean F

    2015-07-21

    Large-scale sequencing of prokaryotic (meta)genomic DNA suggests that most bacterial natural product gene clusters are not expressed under common laboratory culture conditions. Silent gene clusters represent a promising resource for natural product discovery and the development of a new generation of therapeutics. Unfortunately, the characterization of molecules encoded by these clusters is hampered owing to our inability to express these gene clusters in the laboratory. To address this bottleneck, we have developed a promoter-engineering platform to transcriptionally activate silent gene clusters in a model heterologous host. Our approach uses yeast homologous recombination, an auxotrophy complementation-based yeast selection system and sequence orthogonal promoter cassettes to exchange all native promoters in silent gene clusters with constitutively active promoters. As part of this platform, we constructed and validated a set of bidirectional promoter cassettes consisting of orthogonal promoter sequences, Streptomyces ribosome binding sites, and yeast selectable marker genes. Using these tools we demonstrate the ability to simultaneously insert multiple promoter cassettes into a gene cluster, thereby expediting the reengineering process. We apply this method to model active and silent gene clusters (rebeccamycin and tetarimycin) and to the silent, cryptic pseudogene-containing, environmental DNA-derived Lzr gene cluster. Complete promoter refactoring and targeted gene exchange in this "dead" cluster led to the discovery of potent indolotryptoline antiproliferative agents, lazarimides A and B. This potentially scalable and cost-effective promoter reengineering platform should streamline the discovery of natural products from silent natural product biosynthetic gene clusters.

  11. Selective AR Modulators that Distinguish Proliferative from Differentiative Gene Promoters

    DTIC Science & Technology

    2015-08-01

    AWARD NUMBER: W81XWH-14-1-0292 TITLE: Selective AR Modulators that Distinguish Proliferative from Differentiative Gene Promoters PRINCIPAL...30 Jul 2014 - 29 Jul 2015 4. TITLE AND SUBTITLE Selective AR Modulators that Distinguish Proliferative from Differentiative Gene Promoters 5a...differ in androgen response elements (AREs), with genes driving proliferation relying on consensus inverted repeats (cARE) and genes promoting

  12. The lux genes in Photobacterium leiognathi are closely linked with genes corresponding in sequence to riboflavin synthesis genes.

    PubMed

    Lee, C Y; Meighen, E A

    1992-07-31

    Three open reading frames (ORFs) have been found in the region downstream of the luxG gene in the Photobacterium leiognathi lux operon. These genes (ORF I, II, and III) are not only closely linked to the lux operon and transcribed in the same direction but also show the same organization and code for proteins homologous in sequence to the gene products of ribB, ribA, and ribH of Bacillus subtilis, respectively. The Photobacterium leiognathi gene (ORF II) corresponding to ribA was expressed in Escherichia coli in the bacteriophage T7 promoter-RNA polymerase system and a 40 kDa 35S-labeled polypeptide has been detected on SDS-PAGE. Expression of DNA extending from luxBEG to ORF II inserted between a strong promoter and a reporter gene and transferred by conjugation into Vibrio harveyi did not affect the expression of the reporter gene. The results provide evidence that neither promoter nor terminator sites were present in the DNA between the luxG and ORF II indicating that these genes might be part of the lux operon.

  13. Next-generation sequencing-based 5' rapid amplification of cDNA ends for alternative promoters.

    PubMed

    Perera, Bambarendage P U; Kim, Joomyeong

    2016-02-01

    Mammalian genomes contain many unknown alternative first exons and promoters. Thus, we have modified the existing 5'RACE (5' rapid amplification of cDNA ends) approach into a next-generation sequencing (NGS)-based new protocol that can identify these alternative promoters. This protocol has incorporated two main ideas: (i) 5'RACE starting from the known second exons of genes and (ii) NGS-based sequencing of the subsequent cDNA products. This protocol also provides a bioinformatics strategy that processes the sequence reads from NGS runs. This protocol has successfully identified several alternative promoters for an imprinted gene, PEG3. Overall, this NGS-based 5'RACE protocol is a sensitive and reliable method for detecting low-abundant transcripts and promoters.

  14. High-throughput mapping of the promoters of the mouse olfactory receptor genes reveals a new type of mammalian promoter and provides insight into olfactory receptor gene regulation

    PubMed Central

    Clowney, E. Josephine; Magklara, Angeliki; Colquitt, Bradley M.; Pathak, Nidhi; Lane, Robert P.; Lomvardas, Stavros

    2011-01-01

    The olfactory receptor (OR) genes are the largest mammalian gene family and are expressed in a monogenic and monoallelic fashion in olfactory neurons. Using a high-throughput approach, we mapped the transcription start sites of 1085 of the 1400 murine OR genes and performed computational analysis that revealed potential transcription factor binding sites shared by the majority of these promoters. Our analysis produced a hierarchical model for OR promoter recognition in which unusually high AT content, a unique epigenetic signature, and a stereotypically positioned O/E site distinguish OR promoters from the rest of the murine promoters. Our computations revealed an intriguing correlation between promoter AT content and evolutionary plasticity, as the most AT-rich promoters regulate rapidly evolving gene families. Within the AT-rich promoter category the position of the TATA-box does not correlate with the transcription start site. Instead, a spike in GC composition might define the exact location of the TSS, introducing the concept of “genomic contrast” in transcriptional regulation. Finally, our experiments show that genomic neighborhood rather than promoter sequence correlates with the probability of different OR genes to be expressed in the same olfactory cell. PMID:21705439

  15. Sequences and expression of pyruvate dehydrogenase genes from Pseudomonas aeruginosa.

    PubMed Central

    Rae, J L; Cutfield, J F; Lamont, I L

    1997-01-01

    A mutant of Pseudomonas aeruginosa, OT2100, which appeared to be defective in the production of the fluorescent yellow-green siderophore pyoverdine had been isolated previously following transposon mutagenesis (T. R. Merriman and I. L. Lamont, Gene 126:17-23, 1993). DNA from either side of the transposon insertion site was cloned, and the sequence was determined. The mutated gene had strong identity with the dihydrolipoamide acetyltransferase (E2) components of pyruvate dehydrogenase (PDH) from other bacterial species. Enzyme assays revealed that the mutant was defective in the E2 subunit of PDH, preventing assembly of a functional complex. PDH activity in OT2100 cell extracts was restored when extract from an E1 mutant was added. On the basis of this evidence, OT2100 was identified as an aceB or E2 mutant. A second gene, aceA, which is likely to encode the E1 component of PDH, was identified upstream from aceB. Transcriptional analysis revealed that aceA and aceB are expressed as a 5-kb polycistronic transcript from a promoter upstream of aceA. An intergenic region of 146 bp was located between aceA and aceB, and a 2-kb aceB transcript that originated from a promoter in the intergenic region was identified. DNA fragments upstream of aceA and aceB were shown to have promoter activities in P. aeruginosa, although only the aceA promoter was active in Escherichia coli. It is likely that the apparent pyoverdine-deficient phenotype of mutant OT2100 is a consequence of acidification of the growth medium due to accumulation of pyruvic acid in the absence of functional PDH. PMID:9171401

  16. Characterization of sequence elements from Malvastrum yellow vein betasatellite regulating promoter activity and DNA replication

    PubMed Central

    2012-01-01

    Background Many monopartite begomoviruses are associated with betasatellites, but only several promoters from which were isolated and studied. In this study, the βC1 promoter from Malvastrum yellow vein betasatellite (MYVB) was characterized and important sequence elements were identified to modulate promoter activity and replication of MYVB. Results A 991 nucleotide (nt) fragment upstream of the translation start site of the βC1 open reading frame of MYVB and a series of deletions within this fragment were constructed and fused to the β-glucuronidase (GUS) and green fluorescent protein (GFP) reporter genes, respectively. Agrobacterium-mediated transient expression assays showed that the 991 nt fragment was functional and that a 28 nt region (between −390 nt and −418 nt), which includes a 5′UTR Py-rich stretch motif, was important for promoter activity. Replication assays using Nicotiana benthamiana leaf discs and whole plants showed that deletion of the 5′UTR Py-rich stretch impaired viral satellite replication in the presence of the helper virus. Transgenic assays demonstrated that the 991 nt fragment conferred a constitutive expression pattern in transgenic tobacco plants and that a 214 nt fragment at the 3'-end of this sequence was sufficient to drive this expression pattern. Conclusion Our results showed that the βC1 promoter of MYVB displayed a constitutive expression pattern and a 5′UTR Py-rich stretch motif regulated both βC1 promoter activity and MYVB replication. PMID:23057573

  17. The mouse collagen X gene: complete nucleotide sequence, exon structure and expression pattern.

    PubMed Central

    Elima, K; Eerola, I; Rosati, R; Metsäranta, M; Garofalo, S; Perälä, M; De Crombrugghe, B; Vuorio, E

    1993-01-01

    Overlapping genomic clones covering the 7.2 kb mouse alpha 1(X) collagen gene, 0.86 kb of promoter and 1.25 kb of 3'-flanking sequences were isolated from two genomic libraries and characterized by nucleotide sequencing. Typical features of the gene include a unique three-exon structure, similar to that in the chick gene, with the entire triple-helical domain of 463 amino acids coded by a single large exon. The highest degree of amino acid and nucleotide sequence conservation was seen in the coding region for the collagenous and C-terminal non-collagenous domains between the mouse and known chick, bovine and human collagen type X sequences. More divergence between the sequences occurred in the N-terminal non-collagenous domain. Similarity between the mammalian collagen X sequences extended into the 3'-untranslated sequence, particularly near the polyadenylation site. The promoter of the mouse collagen X gene was found to contain two TATAA boxes 159 bp apart; primer extension analyses of the transcription start site revealed that both were functional. The promoter has an unusual structure with a very low G + C content of 28% between positions -220 and -1 of the upstream transcription start site. Northern and in situ hybridization analyses confirmed that the expression of the alpha 1(X) collagen gene is restricted to hypertrophic chondrocytes in tissues undergoing endochondral calcification. The detailed sequence information of the gene is useful for studies on the promoter activity of the gene and for generation of transgenic mice. Images Figure 3 Figure 5 Figure 6 PMID:8424763

  18. Promoter G-quadruplex sequences are targets for base oxidation and strand cleavage during hypoxia-induced transcription.

    PubMed

    Clark, David W; Phang, Tzu; Edwards, Michael G; Geraci, Mark W; Gillespie, Mark N

    2012-07-01

    The G-quadruplex, a non-B DNA motif that forms in certain G-rich sequences, is often located near transcription start sites in growth regulatory genes. Multiple lines of evidence show that reactive oxygen species generated as second messengers during physiologic signaling target specific DNA sequences for oxidative base modifications. Because guanine repeats are uniquely sensitive to oxidative damage, and G4 sequences are known "hot spots" for genetic mutation and DNA translocation, we hypothesized that G4 sequences are targeted for oxidative base modifications in hypoxic signaling. Approximately 25% of hypoxia-regulated genes in pulmonary artery endothelial cells harbored G4 sequences within their promoters. Chromatin immunoprecipitation showed that common base oxidation product 8-oxoguanine was selectively introduced into G4s, in promoters of hypoxia up-, down-, and nonregulated genes. Additionally, base excision DNA repair (BER) enzymes were recruited, and transient strand breaks formed in these sequences. Transcription factor Sp1, constitutively bound to G4 sequences in normoxia, was evicted as 8-oxoguanine accumulated during hypoxic exposure. Blocking hypoxia-induced oxidant production prevented both base modifications and decreased Sp1 binding. These findings suggest that oxidant stress in hypoxia causes oxidative base modifications, recruitment of BER enzymes, and transient strand breaks in G4 promoter sequences potentially altering G4 integrity and function.

  19. Mutations in two regions upstream of the A gamma globin gene canonical promoter affect gene expression.

    PubMed Central

    Lloyd, J A; Lee, R F; Lingrel, J B

    1989-01-01

    Two regions upstream of the human fetal (A gamma) globin gene, which interact with protein factors from K562 and HeLa nuclear extracts, have functional significance in gene expression. One binding site (site I) is at a position -290 to -267 bp upstream of the transcription initiation site, the other (site II) is at -182 to -168 bp. Site II includes the octamer sequence (ATGCAAAT) found in an immunoglobulin enhancer and the histone H2b gene promoter. A point mutation (T----C) at -175, within the octamer sequence, is characteristic of a naturally occurring HPFH (hereditary persistence of fetal hemoglobin), and decreases factor binding to an oligonucleotide containing the octamer motif. Expression assays using a A gamma globin promoter-CAT (chloramphenicol acetyl transferase) fusion gene show that the point mutation at -175 increases expression in erythroid, but not non-erythroid cells when compared to a wild-type construct. This correlates with the actual effect of the HPFH mutation in humans. This higher expression may result from a mechanism more complex than reduced binding of a negative regulator. A site I clustered-base substitution gives gamma-CAT activity well below wild-type, suggesting that this factor is a positive regulator. Images PMID:2472607

  20. Isolation and characterization of rubisco small subunit gene promoter from common wheat (Triticum aestivum L.).

    PubMed

    Mukherjee, Shalini; Stasolla, Claudio; Brûlé-Babel, Anita; Ayele, Belay T

    2015-01-01

    Choice of an appropriate promoter is critical to express target genes in intended tissues and developmental stages. However, promoters capable of directing gene expression in specific tissues and stages are not well characterized in monocot species. To identify such a promoter in wheat, this study isolated a partial sequence of the wheat small subunit of RuBisCO (TarbcS) promoter. In silico analysis revealed the presence of elements that are characteristic to rbcS promoters of other, mainly dicot, species. Transient expression of the TarbcS:GUS in immature wheat embryos and tobacco leaves but not in the wheat roots indicate the functionality of the TarbcS promoter fragment in directing the expression of target genes in green plant tissues.

  1. Gene and translation initiation site prediction in metagenomic sequences

    SciTech Connect

    Hyatt, Philip Douglas; LoCascio, Philip F; Hauser, Loren John; Uberbacher, Edward C

    2012-01-01

    Gene prediction in metagenomic sequences remains a difficult problem. Current sequencing technologies do not achieve sufficient coverage to assemble the individual genomes in a typical sample; consequently, sequencing runs produce a large number of short sequences whose exact origin is unknown. Since these sequences are usually smaller than the average length of a gene, algorithms must make predictions based on very little data. We present MetaProdigal, a metagenomic version of the gene prediction program Prodigal, that can identify genes in short, anonymous coding sequences with a high degree of accuracy. The novel value of the method consists of enhanced translation initiation site identification, ability to identify sequences that use alternate genetic codes and confidence values for each gene call. We compare the results of MetaProdigal with other methods and conclude with a discussion of future improvements.

  2. Promoter sequences direct cytoplasmic localization and translation of mRNAs during starvation in yeast.

    PubMed

    Zid, Brian M; O'Shea, Erin K

    2014-10-02

    A universal feature of the response to stress and nutrient limitation is transcriptional upregulation of genes that encode proteins important for survival. Under many such conditions, the overall protein synthesis level is reduced, thereby dampening the stress response at the level of protein expression. For example, during glucose starvation in Saccharomyces cerevisiae (yeast), translation is rapidly repressed, yet the transcription of many stress- and glucose-repressed genes is increased. Here we show, using ribosomal profiling and microscopy, that this transcriptionally upregulated gene set consists of two classes: one class produces messenger RNAs that are translated during glucose starvation and are diffusely localized in the cytoplasm, including many heat-shock protein mRNAs; and the other class produces mRNAs that are not efficiently translated during glucose starvation and are concentrated in foci that co-localize with P bodies and stress granules, a class that is enriched for mRNAs involved in glucose metabolism. Surprisingly, the information specifying the differential localization and protein production of these two classes of mRNA is encoded in the promoter sequence: promoter responsiveness to heat-shock factor 1 (Hsf1) specifies diffuse cytoplasmic localization and higher protein production on glucose starvation. Thus, promoter sequences can influence not only the levels of mRNAs but also the subcellular localization of mRNAs and the efficiency with which they are translated, enabling cells to tailor protein production to the environmental conditions.

  3. Isolation and characterization of oil palm constitutive promoter derived from ubiquitin extension protein (uep1) gene.

    PubMed

    Masura, Subhi Siti; Parveez, Ghulam Kadir Ahmad; Ismail, Ismanizan

    2010-09-30

    The ubiquitin extension protein (uep1) gene was identified as a constitutively expressed gene in oil palm. We have isolated and characterized the 5' region of the oil palm uep1 gene, which contains an 828 bp sequence upstream of the uep1 translational start site. Construction of a pUEP1 transformation vector, which contains gusA reporter gene under the control of uep1 promoter, was carried out for functional analysis of the promoter through transient expression studies. It was found that the 5' region of uep1 functions as a constitutive promoter in oil palm and could drive GUS expression in all tissues tested, including embryogenic calli, embryoid, immature embryo, young leaflet from mature palm, green leaf, mesocarp and meristematic tissues (shoot tip). This promoter could also be used in dicot systems as it was demonstrated to be capable of driving gusA gene expression in tobacco.

  4. ARID3B Directly Regulates Ovarian Cancer Promoting Genes

    PubMed Central

    Bobbs, Alexander; Gellerman, Katrina; Hallas, William Morgan; Joseph, Stancy; Yang, Chao; Kurkewich, Jeffrey; Cowden Dahl, Karen D.

    2015-01-01

    The DNA-binding protein AT-Rich Interactive Domain 3B (ARID3B) is elevated in ovarian cancer and increases tumor growth in a xenograft model of ovarian cancer. However, relatively little is known about ARID3B's function. In this study we perform the first genome wide screen for ARID3B direct target genes and ARID3B regulated pathways. We identified and confirmed numerous ARID3B target genes by chromatin immunoprecipitation (ChIP) followed by microarray and quantitative RT-PCR. Using motif-finding algorithms, we characterized a binding site for ARID3B, which is similar to the previously known site for the ARID3B paralogue ARID3A. Functionality of this predicted site was demonstrated by ChIP analysis. We next demonstrated that ARID3B induces expression of its targets in ovarian cancer cell lines. We validated that ARID3B binds to an epidermal growth factor receptor (EGFR) enhancer and increases mRNA expression. ARID3B also binds to the promoter of Wnt5A and its receptor FZD5. FZD5 is highly expressed in ovarian cancer cell lines, and is upregulated by exogenous ARID3B. Both ARID3B and FZD5 expression increase adhesion to extracellular matrix (ECM) components including collagen IV, fibronectin and vitronectin. ARID3B-increased adhesion to collagens II and IV require FZD5. This study directly demonstrates that ARID3B binds target genes in a sequence-specific manner, resulting in increased gene expression. Furthermore, our data indicate that ARID3B regulation of direct target genes in the Wnt pathway promotes adhesion of ovarian cancer cells. PMID:26121572

  5. [Nucleotide sequence of HLA-DQA1 promoter region (QAP) in a lung cancer patient].

    PubMed

    Qiu, C; Zhou, W; Song, C

    1996-06-01

    The HLA-DQA1 allele and nucleotide sequence of HLA-DQA1 promoter region (QAP) in a patient with IDDM complicated lung cancer have been identified by PCR/SSCP, PCR/SSCP and PCR/sequencing. The results showed that: (1) All of the lung cancer patient and his family members carried HLA-DQA1* 0301/0501 alleles. (2) a single base substitution G-->A at position -155 and deletion CAA at position -161 to -163 occurred in the patient. These results suggest that the mutation of HLA-DQA1 promoter region may modulate HLA-DQA1 gene expression by trans-acting factors binding to variant cis-acting elements and may be responsible for pathogenesis of lung cancer.

  6. Control sites in the sequence at the beginning of T7 gene 1.

    PubMed Central

    McConnell, D J

    1979-01-01

    The DNA sequence of the fragment Hind.30, 378 bases long, from the beginning of gene 1 of T7 is presented. It contains the C promoter, two in vitro transcriptional terminator sites and a sequence of 171 bases which probably codes for the N terminus of the T7 RNA polymerase. The sequence also codes for the RNase III cleavage site before gene 1. The overlaps with the transcriptional terminators, The RNA transcript of the sequence about the terminators can be arranged in a set of alternative double-stranded hairpin structures. It is suggested that conversion between these structures may have a role in termination; this may be influenced by interactions with ribosomes and RNase III. The region of the C promoter between genes 0.7 and 1 thus contains several sites which may be involved in the control of transcription and translation. Images PMID:493111

  7. Functional analysis of BADH gene promoter from Suaeda liaotungensis K.

    PubMed

    Zhang, Yi; Yin, Hui; Li, Dan; Zhu, Weiwei; Li, Qiuli

    2008-03-01

    A 1,993 bp region upstream of the gene encoding the betaine aldehyde dehydrogenase (BADH) was isolated from Suaeda liaotungensis K., and the analysis of the promoter sequence has revealed the existence of several putative cis-elements by the PLACE database. In this study, according to the characteristic of the BADH promoter, five chimeric constructs varied in the length of promoter fragments from -1,993, -1,466, -1,084, -573 and -300 to +62 bp relative to the transcriptional start site were placed to the upstream of the beta-glucuronidase (GUS) coding region and transferred to Nicotiana tabacum L.cv.89 by Agrobacterium tumefaciens-mediated leaf-disc transformation. The functional properties of each promoter fragment were examined by GUS histochemical staining and fluorescence quantitative analyses in the transgenic tobacco leaves treated with different NaCl concentrations for 48 h. The results show that healthy transgenic plants had decreased GUS activity in leaves, whereas a higher GUS activity was observed when the transgenic plants were challenged with sodium chloride (NaCl). Induction levels were proportional to the concentration of NaCl treatment, allowing fine-tuning of protein expression. GUS enzyme activity was enhanced 6.3-fold in transgenic tobacco leaves containing -300 bp promoter fragment in the presence of 400 mmol/l NaCl compared to the noninductive leaves. This suggests that the smallest promoter fragment (-300 to +62 bp) possesses all the essential cis-acting elements and is sufficient for NaCl induction.

  8. The complete sequence of soybean chlorotic mottle virus DNA and the identification of a novel promoter.

    PubMed

    Hasegawa, A; Verver, J; Shimada, A; Saito, M; Goldbach, R; Van Kammen, A; Miki, K; Kameya-Iwaki, M; Hibi, T

    1989-12-11

    The complete nucleotide sequence of an infectious clone of soybean chlorotic mottle virus (SoyCMV) DNA was determined and compared with those of three other caulimoviruses, cauliflower mosaic virus (CaMV), carnation etched ring virus and figwort mosaic virus. The double-stranded DNA genome of SoyCMV (8,175 bp) contained nine open reading frames (ORFs) and one large intergenic region. The primer binding sites, gene organization and size of ORFs were similar to those of the other caulimoviruses, except for ORF I, which was split into ORF Ia and Ib. The amino acid sequences deduced from each ORF showed only short, highly homologous regions in several of the corresponding ORFs of the three other caulimoviruses. A promoter fragment of 378 bp in SoyCMV ORF III showed a strong expression activity, comparable to that of the CaMV 35S promoter, in tobacco mesophyll protoplasts as determined by a beta-glucuronidase assay using electrotransfection. The fragment contained CAAT and TATA boxes but no transcriptional enhancer signal as reported for the CaMV 35S promoter. Instead, it had sequences homologous to a part of the translational enhancer signal reported for the 5'-leader sequence of tobacco mosaic virus RNA.

  9. Identification and sequence analyses of the granulin gene of Choristoneura fumiferana granulovirus.

    PubMed

    Bah, A; Bergeron, J; Arella, M; Lucarotti, C J; Guertin, C

    1997-01-01

    The nucleotide sequence of the granulin gene of Choristoneura fumiferana granulovirus (CfGV) was determined. The gene encodes a protein of 248 amino acids with a predicted Mr of 29.299 kDa. The granulin genes of Trichoplusia ni, Pieris brassicae and Cryptophlebia leucotreta granuloviruses showed homologies ranging from 76.7-80.5% for nucleotide sequences and 84.2-88.3% for amino acid sequences when compared to CfGV. The secondary structure of CfGV granulin protein, including the hydrophilic (polar) and hydrophobic (basic) regions, was predicted and found to be similar to other granulins. A very late baculovirus promoter motif, ATAAG, was found within the putative promoter region of the CfGV granulin gene.

  10. Complete genome sequence of the rapeseed plant-growth promoting Serratia plymuthica strain AS9.

    PubMed

    Neupane, Saraswoti; Högberg, Nils; Alström, Sadhna; Lucas, Susan; Han, James; Lapidus, Alla; Cheng, Jan-Fang; Bruce, David; Goodwin, Lynne; Pitluck, Sam; Peters, Lin; Ovchinnikova, Galina; Lu, Megan; Han, Cliff; Detter, John C; Tapia, Roxanne; Fiebig, Anne; Land, Miriam; Hauser, Loren; Kyrpides, Nikos C; Ivanova, Natalia; Pagani, Ioanna; Klenk, Hans-Peter; Woyke, Tanja; Finlay, Roger D

    2012-03-19

    Serratia plymuthica are plant-associated, plant beneficial species belonging to the family Enterobacteriaceae. The members of the genus Serratia are ubiquitous in nature and their life style varies from endophytic to free-living. S. plymuthica AS9 is of special interest for its ability to inhibit fungal pathogens of rapeseed and to promote plant growth. The genome of S. plymuthica AS9 comprises a 5,442,880 bp long circular chromosome that consists of 4,952 protein-coding genes, 87 tRNA genes and 7 rRNA operons. This genome is part of the project entitled "Genomics of four rapeseed plant growth promoting bacteria with antagonistic effect on plant pathogens" awarded through the 2010 DOE-JGI Community Sequencing Program (CSP2010).

  11. Complete genome sequence of the rapeseed plant-growth promoting Serratia plymuthica strain AS9

    SciTech Connect

    Neupane, Saraswoti; Hogberg, Nils; Alstrom, Sadhna; Lucas, Susan; Han, James; Lapidus, Alla L.; Cheng, Jan-Fang; Bruce, David; Goodwin, Lynne A.; Pitluck, Sam; Peters, Lin; Ovchinnikova, Galina; Lu, Megan; Han, Cliff; Detter, J. Chris; Tapia, Roxanne; Fiebig, Anne; Land, Miriam L; Hauser, Loren John; Kyrpides, Nikos C; Ivanova, N; Pagani, Ioanna; Klenk, Hans-Peter; Woyke, Tanja; Finlay, Roger D.

    2012-01-01

    Serratia plymuthica are plant-associated, plant beneficial species belonging to the family Enterobacteriaceae. The members of the genus Serratia are ubiquitous in nature and their life style varies from endophytic to free-living. S. plymuthica AS9 is of special interest for its ability to inhibit fungal pathogens of rapeseed and to promote plant growth. The genome of S. plymuthica AS9 comprises a 5,442,880 bp long circular chromosome that consists of 4,952 protein-coding genes, 87 tRNA genes and 7 rRNA operons. This genome is part of the project entitled Genomics of four rapeseed plant growth promoting bacteria with antagonistic effect on plant pathogens awarded through the 2010 DOE-JGI Community Sequencing Program (CSP2010).

  12. Complete genome sequence of the rapeseed plant-growth promoting Serratia plymuthica strain AS9

    PubMed Central

    Högberg, Nils; Alström, Sadhna; Lucas, Susan; Han, James; Lapidus, Alla; Cheng, Jan-Fang; Bruce, David; Goodwin, Lynne; Pitluck, Sam; Peters, Lin; Ovchinnikova, Galina; Lu, Megan; Han, Cliff; Detter, John C.; Tapia, Roxanne; Fiebig, Anne; Land, Miriam; Hauser, Loren; Kyrpides, Nikos C.; Ivanova, Natalia; Pagani, Ioanna; Klenk, Hans-Peter; Woyke, Tanja; Finlay, Roger D.

    2012-01-01

    Serratia plymuthica are plant-associated, plant beneficial species belonging to the family Enterobacteriaceae. The members of the genus Serratia are ubiquitous in nature and their life style varies from endophytic to free-living. S. plymuthica AS9 is of special interest for its ability to inhibit fungal pathogens of rapeseed and to promote plant growth. The genome of S. plymuthica AS9 comprises a 5,442,880 bp long circular chromosome that consists of 4,952 protein-coding genes, 87 tRNA genes and 7 rRNA operons. This genome is part of the project entitled “Genomics of four rapeseed plant growth promoting bacteria with antagonistic effect on plant pathogens” awarded through the 2010 DOE-JGI Community Sequencing Program (CSP2010). PMID:22675598

  13. High sequence turnover in the regulatory regions of the developmental gene hunchback in insects.

    PubMed

    Hancock, J M; Shaw, P J; Bonneton, F; Dover, G A

    1999-02-01

    Extensive sequence analysis of the developmental gene hunchback and its 5' and 3' regulatory regions in Drosophila melanogaster, Drosophila virilis, Musca domestica, and Tribolium castaneum, using a variety of computer algorithms, reveals regions of high sequence simplicity probably generated by slippage-like mechanisms of turnover. No regions are entirely refractory to the action of slippage, although the density and composition of simple sequence motifs varies from region to region. Interestingly, the 5' and 3' flanking regions share short repetitive motifs despite their separation by the gene itself, and the motifs are different in composition from those in the exons and introns. Furthermore, there are high levels of conservation of motifs in equivalent orthologous regions. Detailed sequence analysis of the P2 promoter and DNA footprinting assays reveal that the number, orientation, sequence, spacing, and protein-binding affinities of the BICOID-binding sites varies between species and that the 'P2' promoter, the nanos response element in the 3' untranslated region, and several conserved boxes of sequence in the gene (e.g., the two zinc-finger regions) are surrounded by cryptically-simple-sequence DNA. We argue that high sequence turnover and genetic redundancy permit both the general maintenance of promoter functions through the establishment of coevolutionary (compensatory) changes in cis- and trans-acting genetic elements and, at the same time, the possibility of subtle changes in the regulation of hunchback in the different species.

  14. Genome Sequencing of a Mung Bean Plant Growth Promoting Strain of P. aeruginosa with Biocontrol Ability

    PubMed Central

    Illakkiam, Devaraj; Shankar, Manoharan; Ponraj, Paramasivan; Rajendhran, Jeyaprakash

    2014-01-01

    Pseudomonas aeruginosa PGPR2 is a mung bean rhizosphere strain that produces secondary metabolites and hydrolytic enzymes contributing to excellent antifungal activity against Macrophomina phaseolina, one of the prevalent fungal pathogens of mung bean. Genome sequencing was performed using the Ion Torrent Personal Genome Machine generating 1,354,732 reads (6,772,433 sequenced bases) achieving ~25-fold coverage of the genome. Reference genome assembly using MIRA 3.4.0 yielded 198 contigs. The draft genome of PGPR2 encoded 6803 open reading frames, of which 5314 were genes with predicted functions, 1489 were genes of known functions, and 80 were RNA-coding genes. Strain specific and core genes of P. aeruginosa PGPR2 that are relevant to rhizospheric habitat were identified by pangenome analysis. Genes involved in plant growth promoting function such as synthesis of ACC deaminase, indole-3-acetic acid, trehalose, mineral scavenging siderophores, hydrogen cyanide, chitinases, acyl homoserine lactones, acetoin, 2,3-butanediol, and phytases were identified. In addition, niche-specific genes such as phosphate solubilising 3-phytase, adhesins, pathway-specific transcriptional regulators, a diguanylate cyclase involved in cellulose synthesis, a receptor for ferrienterochelin, a DEAD/DEAH-box helicase involved in stress tolerance, chemotaxis/motility determinants, an HtpX protease, and enzymes involved in the production of a chromanone derivative with potent antifungal activity were identified. PMID:25184130

  15. Enhancer-core-promoter specificity separates developmental and housekeeping gene regulation.

    PubMed

    Zabidi, Muhammad A; Arnold, Cosmas D; Schernhuber, Katharina; Pagani, Michaela; Rath, Martina; Frank, Olga; Stark, Alexander

    2015-02-26

    Gene transcription in animals involves the assembly of RNA polymerase II at core promoters and its cell-type-specific activation by enhancers that can be located more distally. However, how ubiquitous expression of housekeeping genes is achieved has been less clear. In particular, it is unknown whether ubiquitously active enhancers exist and how developmental and housekeeping gene regulation is separated. An attractive hypothesis is that different core promoters might exhibit an intrinsic specificity to certain enhancers. This is conceivable, as various core promoter sequence elements are differentially distributed between genes of different functions, including elements that are predominantly found at either developmentally regulated or at housekeeping genes. Here we show that thousands of enhancers in Drosophila melanogaster S2 and ovarian somatic cells (OSCs) exhibit a marked specificity to one of two core promoters--one derived from a ubiquitously expressed ribosomal protein gene and another from a developmentally regulated transcription factor--and confirm the existence of these two classes for five additional core promoters from genes with diverse functions. Housekeeping enhancers are active across the two cell types, while developmental enhancers exhibit strong cell-type specificity. Both enhancer classes differ in their genomic distribution, the functions of neighbouring genes, and the core promoter elements of these neighbouring genes. In addition, we identify two transcription factors--Dref and Trl--that bind and activate housekeeping versus developmental enhancers, respectively. Our results provide evidence for a sequence-encoded enhancer-core-promoter specificity that separates developmental and housekeeping gene regulatory programs for thousands of enhancers and their target genes across the entire genome.

  16. Cell-type preference of immunoglobulin kappa and lambda gene promoters.

    PubMed Central

    Picard, D; Schaffner, W

    1985-01-01

    Immunoglobulin gene constant regions are known to be associated with strictly tissue-specific enhancer elements. Until recently the promoter of the variable region, which becomes linked to the constant region by somatic rearrangement, could have been viewed as a passive recipient of the enhancer stimulus. Here we show that the promoters of the immunoglobulin kappa and lambda light chain genes are approximately 20-30 times more active in lymphoid cells than in non-lymphoid cells. To avoid the problem of differential mRNA stability upon transfection of immunoglobulin genes into non-lymphoid cells we have constructed chimeric genes. All kappa mRNA sequences were progressively deleted to fuse the kappa gene promoter to a globin gene coding body. A similar chimeric gene was constructed with the promoter of the lambda gene. The cell-type preference of the promoter may be exploited during B-lymphocyte differentiation to regulate the immunoglobulin gene promoter independently from the enhancer. Images Fig. 2. Fig. 4. Fig. 5. Fig. 6. PMID:2998757

  17. Draft Genome Sequence of Plant Growth-Promoting Drought-Tolerant Bacillus sp. Strain CMAA 1363 Isolated from the Brazilian Caatinga Biome.

    PubMed

    Kavamura, Vanessa Nessner; Santos, Suikinai Nobre; Taketani, Rodrigo Gouvêa; Vasconcellos, Rafael Leandro Figueiredo; Melo, Itamar Soares

    2017-02-02

    The strain of Bacillus sp. CMAA 1363 was isolated from the Brazilian Caatinga biome and showed plant growth-promoting traits and ability to promote maize growth under drought stress. Sequencing revealed genes involved in stress response and plant growth promotion. These genomic features might aid in the protection of plants against the negative effects imposed by drought.

  18. Draft Genome Sequence of Plant Growth-Promoting Drought-Tolerant Bacillus sp. Strain CMAA 1363 Isolated from the Brazilian Caatinga Biome

    PubMed Central

    Santos, Suikinai Nobre; Taketani, Rodrigo Gouvêa; Vasconcellos, Rafael Leandro Figueiredo; Melo, Itamar Soares

    2017-01-01

    ABSTRACT The strain of Bacillus sp. CMAA 1363 was isolated from the Brazilian Caatinga biome and showed plant growth-promoting traits and ability to promote maize growth under drought stress. Sequencing revealed genes involved in stress response and plant growth promotion. These genomic features might aid in the protection of plants against the negative effects imposed by drought. PMID:28153893

  19. Presence of STA gene sequences in brewer's yeast genome.

    PubMed

    Balogh, I; Maráz, A

    1996-06-01

    STA genes are responsible for producing extracellular glucoamylase enzymes in Saccharomyces cerevisiae var. diastaticus. These genes exist in three forms, which are located on three different chromosomes. The nucleotide sequences of the STA genes are highly homologous. A sporulation-specific glucoamylase gene called SGA1 exists in every Saccharomyces cerevisiae strain, this also having a partly homologous DNA sequence with the STA genes. In this study S. cerevisiae var. diastaticus and brewer's yeast strains were characterized by pulsed-field gel electrophoresis. In many cases chromosome length polymorphism (CLP) was found. The chromosomes were hybridized with a DNA probe which was homologous with STA genes and the SGA1 gene. Presence of the SGA1 gene was detected in each strain used. Four brewing yeasts were found to have homologous sequences with the STA3 gene on chromosome XIV despite the fact that these strains were not able to produce extracellular glucoamylase enzyme.

  20. Human DNA polymerase alpha gene: sequences controlling expression in cycling and serum-stimulated cells.

    PubMed Central

    Pearson, B E; Nasheuer, H P; Wang, T S

    1991-01-01

    We have investigated the DNA polymerase alpha promoter sequence requirements for the expression of a heterologous gene in actively cycling cells and following serum addition to serum-deprived cells. An 11.4-kb genomic clone that spans the 5' end of this gene and includes 1.62 kb of sequence upstream from the translation start site was isolated. The transcription start site was mapped at 46 +/- 1 nucleotides upstream from the translation start site. The upstream sequence is GC rich and lacks a TATA sequence but has a CCAAT sequence on the opposite strand. Analysis of a set of deletion constructs in transient transfection assays demonstrated that efficient expression of the reporter in cycling cells requires 248 bp of sequence upstream from the cap site. Clustered within these 248 nucleotides are sequences similar to consensus sequences for Sp1-, Ap1-, Ap2-, and E2F-binding sites. The CCAAT sequence and the potential E2F- and Ap1-binding sites are shown to be protected from DNase I digestion by partially purified nuclear proteins. The DNA polymerase alpha promoter can confer upon the reporter an appropriate, late response to serum addition. No single sequence element could be shown to confer serum inducibility. Rather, multiple sequence elements appear to mediate the full serum response. Images PMID:2005899

  1. Antagonistic pleiotropy involving promoter sequences in a virus

    PubMed Central

    Presloid, John B.; Ebendick-Corpus, Bonnie E.; Zárate, Selene; Novella, Isabel S.

    2008-01-01

    Selection of specialist genotypes, that is, populations with limited niche width, promotes the maintenance of diversity. Specialization to a particular environment may have a cost in other environments, including fitness tradeoffs. When the tradeoffs are the result of mutations that have a beneficial effect in the selective environment, but a deleterious effect in other environment, we have antagonistic pleiotropy. Alternatively, tradeoffs can result from the fixation of mutations that are neutral in the selective environment but have a negative effect in other environment, and thus the tradeoff is due to mutation accumulation. We tested the mechanisms underlying the fitness tradeoffs observed during adaptation to persistent infection of vesicular stomatitis virus in insect cells by sequencing the full-length genomes of twelve strains with a history of replication in a single niche (acute mammalian infection or persistent insect infection) or in temporally-heterogeneous niches, and correlated genetic and fitness changes. Ecological theory predicts a correlation between the selective environment and the niche width of the evolved populations, such that adaptation to single niches should lead to the selection of specialists and niche cycling should result in the selection of generalists. Contrary to this expectation, adaptation to one of the single niches resulted in a generalist and adaptation to a heterogeneous environment led to the selection of a specialist. Only one-third of the mutations that accumulated during persistent infection had a fitness cost that could be explained in all cases by antagonistic pleiotropy. Mutations involved in fitness tradeoffs included changes in regulatory sequences, particularly at the 3′ termini of the genomes, which contain the single promoter that controls viral transcription and replication. PMID:18644381

  2. Isolation and characterization of CMO gene promoter from halophyte Suaeda liaotungensis K.

    PubMed

    Li, Qiuli; Yin, Hui; Li, Dan; Zhu, Hongfei; Zhang, Yi; Zhu, Weiwei

    2007-04-01

    The 5'-flanking proximal region of stress-induced gene encoding choline monooxygenase (CMO) was isolated by Adaptor-PCR and TAIL-PCR from halophyte Suaeda liaotungensis K. A total of 2,204 bp DNA sequence was obtained. The transcription start site, which is located at 128 bp upstream to the start ATG, was predicted by the TSSP-TCM program. The functional elements were analysed by PLACE program. The obtained SlCMO gene promoter contains the basic elements: TATA-box, CAAT-box, and stress-induced elements, for example, salt responsive element (GAAAAA), cold responsive elements (CANNTG), ABA (Abscisic Acid) responsive elements (NAACAA), water stress element (CGGTTG), and WUN responsive elements (GTTAGGTTC). Isolation and analysis of the promoter of the CMO gene from S. liaotungensis lays a foundation for characterising the stress-induced promoter elements, studying the relationship between the structure and function of the promoter, and investigating the molecular mechanism of CMO gene regulation.

  3. Evidence for a novel mitochondrial promoter preceding the cox2 gene of perennial teosintes.

    PubMed Central

    Newton, K J; Winberg, B; Yamato, K; Lupold, S; Stern, D B

    1995-01-01

    We have characterized two promoters of the cytochrome oxidase subunit 2 (cox2) gene in Zea perennis mitochondria present in maize lines. Initiation at a site 907 bases upstream of the start codon results in the major approximately 1900 nt cox2 transcript. A sequence just upstream of this site conforms to the consensus described for maize mitochondrial promoters and its transcription is correctly initiated in a maize mitochondrial in vitro transcription extract. A second transcription initiation site (-347) is used only when the dominant allele of a nuclear gene, Mct, is present and its use results in an additional, shorter major transcript. Sequences flanking the Mct-dependent transcription initiation site, which we have termed the conditional promoter of cox2 (cpc), do not fit the maize mitochondrial promoter consensus and do not function in the maize in vitro transcription extract. The cpc region does not hybridize with mitochondrial, chloroplast or nuclear DNAs from most maize or teosinte lines. However, the cpc sequence is found in the same position upstream of the cox2 gene in Zea diploperennis mtDNA and it has striking similarity to the previously reported 'ORF of unknown origin' fused to the ATPase subunit 6 gene in maize CMS-C mitochondria. cpc appears to represent a new type of mitochondrial promoter. Further analysis of both conditional and constitutive promoters should help us to better understand the control of transcription in plant mitochondria. Images PMID:7859746

  4. Complete genome sequence of Bacillus amyloliquefaciens strain Co1-6, a plant growth-promoting rhizobacterium of Calendula officinalis

    DOE PAGES

    Köberl, Martina; White, Richard A.; Erschen, Sabine; ...

    2015-08-13

    The genome sequence of Bacillus amyloliquefaciens strain Co1-6, a plant growth-promoting rhizobacterium (PGPR) with broad-spectrum antagonistic activity against plant-pathogenic fungi, bacteria, and nematodes, consists of a single 3.9-Mb circular chromosome. The genome reveals genes putatively responsible for its promising biocontrol and PGP properties.

  5. Complete Genome Sequence of Paenibacillus polymyxa YC0573, a Plant Growth–Promoting Rhizobacterium with Antimicrobial Activity

    PubMed Central

    Liu, Hu; Wang, Chengqiang; Li, Yuhuan; Liu, Kai; Hou, Qihui; Xu, Wenfeng; Fan, Lingchao; Zhao, Jian; Gou, Jianyu

    2017-01-01

    ABSTRACT Paenibacillus polymyxa strain YC0573 is a plant growth–promoting rhizobacterium with antimicrobial activity, which was isolated from tobacco rhizosphere. Here, we report the complete genome sequence of P. polymyxa YC0573. Antifungal and antibacterial genes were discovered. PMID:28183775

  6. Complete genome sequence of Bacillus amyloliquefaciens strain Co1-6, a plant growth-promoting rhizobacterium of Calendula officinalis

    SciTech Connect

    Koeberl, Martina; White, Richard A.; Erschen, Sabine; Spanberger, Nora; El-Arabi, Tarek F.; Jansson, Janet K.; Berg, Gabriele

    2015-08-13

    The genome sequence of Bacillus amyloliquefaciens strain Co1-6, a plant growth-promoting rhizobacterium (PGPR) with broad-spectrum antagonistic activities against plant pathogenic fungi, bacteria and nematodes, consists of a single 3.9 Mb circular chromosome. The genome reveals genes putatively responsible for its promising biocontrol and PGP properties.

  7. Complete Genome Sequence of Bacillus amyloliquefaciens Strain Co1-6, a Plant Growth-Promoting Rhizobacterium of Calendula officinalis

    PubMed Central

    White, Richard A.; Erschen, Sabine; Spanberger, Nora; El-Arabi, Tarek F.; Jansson, Janet K.; Berg, Gabriele

    2015-01-01

    The genome sequence of Bacillus amyloliquefaciens strain Co1-6, a plant growth-promoting rhizobacterium (PGPR) with broad-spectrum antagonistic activity against plant-pathogenic fungi, bacteria, and nematodes, consists of a single 3.9-Mb circular chromosome. The genome reveals genes putatively responsible for its promising biocontrol and PGP properties. PMID:26272562

  8. Complete Genome Sequence of Paenibacillus polymyxa YC0136, a Plant Growth–Promoting Rhizobacterium Isolated from Tobacco Rhizosphere

    PubMed Central

    Liu, Hu; Liu, Kai; Li, Yuhuan; Wang, Chengqiang; Hou, Qihui; Xu, Wenfeng; Fan, Lingchao; Zhao, Jian; Gou, Jianyu

    2017-01-01

    ABSTRACT Paenibacillus polymyxa strain YC0136 is a plant growth–promoting rhizobacterium with antimicrobial activity, which was isolated from tobacco rhizosphere. Here, we report the complete genome sequence of P. polymyxa YC0136. Several genes with antifungal and antibacterial activity were discovered. PMID:28183774

  9. Nucleotide sequence of the coat protein gene of canine parvovirus.

    PubMed Central

    Rhode, S L

    1985-01-01

    The nucleotide sequence of the canine parvovirus (CPV2) from map units 33 to 95 has been determined. This includes the entire coat protein gene and noncoding sequences at the 3' end of the gene, exclusive of the terminal inverted repeat. The predicted capsid protein structures are discussed and compared with those of the rodent parvoviruses H-1 and MVM. PMID:3989914

  10. Culex tarsalis Vitellogenin Gene Promoters Investigated In Silico and In Vivo Using Transgenic Drosophila melanogaster

    PubMed Central

    Chen, Song; Rasgon, Jason L.

    2014-01-01

    Introduction Genetic modification, or transgenesis, is a powerful technique to investigate the molecular interactions between vector-borne pathogens and their arthropod hosts, as well as a potential novel approach for vector-borne disease control. Transgenesis requires the use of specific regulatory regions, or promoters, to drive expression of genes of interest in desired target tissues. In mosquitoes, the vast majority of described promoters are from Anopheles and Aedes mosquitoes. Results Culex tarsalis is one of the most important vectors of arboviruses (including West Nile virus) in North America, yet it has not been the subject of molecular genetic study. In order to facilitate molecular genetic work in this important vector species, we isolated four fat body-specific promoter sequences located upstream of the Cx. tarsalis vitellogenin genes (Vg1a, Vg1b, Vg2a and Vg2b). Sequences were analyzed in silico to identify requisite cis-acting elements. The ability for promoter sequences to drive expression of green fluorescent protein (GFP) in vivo was investigated using transgenic Drosophila melanogaster. All four promoters were able to drive GFP expression but there was dramatic variation between promoters and between individual Drosophila lines, indicating significant position effects. The highest expression was observed in line Vg2bL3, which was >300-fold higher than the lowest line Vg1aL2. Conclusions These new promoters will be useful for driving expression of genes of interest in transgenic Cx. tarsalis and perhaps other insects. PMID:24586476

  11. Genetic Recombination Is Targeted towards Gene Promoter Regions in Dogs

    PubMed Central

    Auton, Adam; Rui Li, Ying; Kidd, Jeffrey; Oliveira, Kyle; Nadel, Julie; Holloway, J. Kim; Hayward, Jessica J.; Cohen, Paula E.; Greally, John M.; Wang, Jun; Bustamante, Carlos D.; Boyko, Adam R.

    2013-01-01

    The identification of the H3K4 trimethylase, PRDM9, as the gene responsible for recombination hotspot localization has provided considerable insight into the mechanisms by which recombination is initiated in mammals. However, uniquely amongst mammals, canids appear to lack a functional version of PRDM9 and may therefore provide a model for understanding recombination that occurs in the absence of PRDM9, and thus how PRDM9 functions to shape the recombination landscape. We have constructed a fine-scale genetic map from patterns of linkage disequilibrium assessed using high-throughput sequence data from 51 free-ranging dogs, Canis lupus familiaris. While broad-scale properties of recombination appear similar to other mammalian species, our fine-scale estimates indicate that canine highly elevated recombination rates are observed in the vicinity of CpG rich regions including gene promoter regions, but show little association with H3K4 trimethylation marks identified in spermatocytes. By comparison to genomic data from the Andean fox, Lycalopex culpaeus, we show that biased gene conversion is a plausible mechanism by which the high CpG content of the dog genome could have occurred. PMID:24348265

  12. Genetic recombination is targeted towards gene promoter regions in dogs.

    PubMed

    Auton, Adam; Rui Li, Ying; Kidd, Jeffrey; Oliveira, Kyle; Nadel, Julie; Holloway, J Kim; Hayward, Jessica J; Cohen, Paula E; Greally, John M; Wang, Jun; Bustamante, Carlos D; Boyko, Adam R

    2013-01-01

    The identification of the H3K4 trimethylase, PRDM9, as the gene responsible for recombination hotspot localization has provided considerable insight into the mechanisms by which recombination is initiated in mammals. However, uniquely amongst mammals, canids appear to lack a functional version of PRDM9 and may therefore provide a model for understanding recombination that occurs in the absence of PRDM9, and thus how PRDM9 functions to shape the recombination landscape. We have constructed a fine-scale genetic map from patterns of linkage disequilibrium assessed using high-throughput sequence data from 51 free-ranging dogs, Canis lupus familiaris. While broad-scale properties of recombination appear similar to other mammalian species, our fine-scale estimates indicate that canine highly elevated recombination rates are observed in the vicinity of CpG rich regions including gene promoter regions, but show little association with H3K4 trimethylation marks identified in spermatocytes. By comparison to genomic data from the Andean fox, Lycalopex culpaeus, we show that biased gene conversion is a plausible mechanism by which the high CpG content of the dog genome could have occurred.

  13. Identification and refinement of two strong constitutive promoters for gene expression system of Schizosaccharomyces pombe.

    PubMed

    Wang, Hongcheng; Wang, Haiyang; Wang, Meng; Zhang, Lei; Wang, Ren; Mei, Yanzhen; Shao, Weilan

    2014-06-01

    Fission yeast Schizosaccharomyces pombe shares various important properties with higher eukaryotes and is now considered a useful host for elevated production of mammalian proteins for medicinal applications. The full-length nmt1 promoter has been widely used as a strong promoter in S. pombe expression system. In the present study, the promoters of the eno101 and gpd3 genes in S. pombe were identified as strong constitutive promoters. For convenient applications in the plasmids of S. pombe, these promoters were refined to 276-bp eno and 273-bp gpd promoters by deleting undesired sequences and examining the expression of reporter genes including lacZ and xynA. Both the refined eno and gpd promoters provided approximately 1.5-fold higher expression of LacZ than nmt1 promoter. Furthermore, gene expression under the control of the eno or gpd promoter was not repressed by the components of YES medium while nmt1 promoter was inhibited by thiamine in yeast extract. Therefore, both eno and gpd promoters offer opportunities for efficient production of recombinant proteins by S. pombe in high cell-density fermentation.

  14. The core promoter: At the heart of gene expression.

    PubMed

    Danino, Yehuda M; Even, Dan; Ideses, Diana; Juven-Gershon, Tamar

    2015-08-01

    The identities of different cells and tissues in multicellular organisms are determined by tightly controlled transcriptional programs that enable accurate gene expression. The mechanisms that regulate gene expression comprise diverse multiplayer molecular circuits of multiple dedicated components. The RNA polymerase II (Pol II) core promoter establishes the center of this spatiotemporally orchestrated molecular machine. Here, we discuss transcription initiation, diversity in core promoter composition, interactions of the basal transcription machinery with the core promoter, enhancer-promoter specificity, core promoter-preferential activation, enhancer RNAs, Pol II pausing, transcription termination, Pol II recycling and translation. We further discuss recent findings indicating that promoters and enhancers share similar features and may not substantially differ from each other, as previously assumed. Taken together, we review a broad spectrum of studies that highlight the importance of the core promoter and its pivotal role in the regulation of metazoan gene expression and suggest future research directions and challenges.

  15. Identification of regulatory sequences in the gene for 5-aminolevulinate synthase from rat.

    PubMed

    Braidotti, G; Borthwick, I A; May, B K

    1993-01-15

    The housekeeping enzyme 5-aminolevulinate synthase (ALAS) regulates the supply of heme for respiratory cytochromes. Here we report on the isolation of a genomic clone for the rat ALAS gene. The 5'-flanking region was fused to the chloramphenicol acetyltransferase gene and transient expression analysis revealed the presence of both positive and negative cis-acting sequences. Expression was substantially increased by the inclusion of the first intron located in the 5'-untranslated region. Sequence analysis of the promoter identified two elements at positions -59 and -88 bp with strong similarity to the binding site for nuclear respiratory factor 1 (NRF-1). Gel shift analysis revealed that both NRF-1 elements formed nucleoprotein complexes which could be abolished by an authentic NRF-1 oligomer. Mutagenesis of each NRF-1 motif in the ALAS promoter gave substantially lowered levels of chloramphenicol acetyltransferase expression, whereas mutagenesis of both NRF-1 motifs resulted in the almost complete loss of expression. These results establish that the NRF-1 motifs in the ALAS promoter are critical for promoter activity. NRF-1 binding sites have been identified in the promoters of several nuclear genes encoding mitochondrial proteins concerned with oxidative phosphorylation. The present studies suggest that NRF-1 may co-ordinate the supply of mitochondrial heme with the synthesis of respiratory cytochromes by regulating expression of ALAS. In erythroid cells, NRF-1 may be less important for controlling heme levels since an erythroid ALAS gene is strongly expressed and the promoter for this gene apparently lacks NRF-1 binding sites.

  16. [Cloning and analysis of promoter of pig copper zinc superoxide dismutase gene (CuZnSOD)].

    PubMed

    Shi, Yuan; Chen, Wei; Zeng, Yongqing; Zhu, Honglei; Xu, Zhenggang; Zhang, Zhe; Yang, Yun; Zhang, Tianyang

    2014-02-01

    Pig copper zinc superoxide dismutase (CuZnSOD) is an important antioxidant enzyme. Some studies focused on the function of CuZnSOD gene, but the transcriptional regulation of the CuZnSOD gene is not yet fully elucidated. Therefore, the aims of the study were to determine the core promoter region and to explore its mechanism of transcriptional regulation. The 853 bp DNA sequence of 5'-flanking promoter was amplified by performing PCR. A series of CuZnSOD promoter fragments with gradually truncated 5'-end were produced by nested PCR and inserted into pGL3-Basic vector. The activities of the promoters were measured by the dual-luciferase assay system after transient transfection into the NIH/3T3 cells. The results demonstrated that there were 2 potential transcription start sites in the regions from initiation codon to -87 bp and -266 bp, respectively. The region from -383 bp to +67 bp in CuZnSOD gene promoter showed higher activity than other regions, and further deletion analysis demonstrated that the region from -75 bp to -32 bp contained an essential promoter sequence for pig CuZnSOD gene transcription. In addition, several potential transcription factor binding sites were predicted with bioinformatics method. These results suggest that these transcription factor binding sites may be involved in the transcriptional regulation of CuZnSOD gene.

  17. High nucleosome occupancy is encoded at X-linked gene promoters in C. elegans

    PubMed Central

    Ercan, Sevinç; Lubling, Yaniv; Segal, Eran; Lieb, Jason D.

    2011-01-01

    We mapped nucleosome occupancy by paired-end Illumina sequencing in C. elegans embryonic cells, adult somatic cells, and a mix of adult somatic and germ cells. In all three samples, the nucleosome occupancy of gene promoters on the X chromosome differed from autosomal promoters. While both X and autosomal promoters exhibit a typical nucleosome-depleted region upstream of transcript start sites and a well-positioned +1 nucleosome, X-linked gene promoters on average exhibit higher nucleosome occupancy relative to autosomal promoters. We show that the difference between X and autosomes does not depend on the somatic dosage compensation machinery. Instead, the chromatin difference at promoters is partly encoded by DNA sequence, because a model trained on nucleosome sequence preferences from S. cerevisiae in vitro data recapitulate nearly completely the experimentally observed difference between X and autosomal promoters. The model predictions also correlate very well with experimentally determined occupancy values genome-wide. The nucleosome occupancy differences observed on X promoters may bear on mechanisms of X chromosome dosage compensation in the soma, and chromosome-wide repression of X in the germline. PMID:21177966

  18. Sequence determinants of prokaryotic gene expression level under heat stress.

    PubMed

    Xiong, Heng; Yang, Yi; Hu, Xiao-Pan; He, Yi-Ming; Ma, Bin-Guang

    2014-11-01

    Prokaryotic gene expression is environment-dependent and temperature plays an important role in shaping the gene expression profile. Revealing the regulation mechanisms of gene expression pertaining to temperature has attracted tremendous efforts in recent years particularly owning to the yielding of transcriptome and proteome data by high-throughput techniques. However, most of the previous works concentrated on the characterization of the gene expression profile of individual organism and little effort has been made to disclose the commonality among organisms, especially for the gene sequence features. In this report, we collected the transcriptome and proteome data measured under heat stress condition from recently published literature and studied the sequence determinants for the expression level of heat-responsive genes on multiple layers. Our results showed that there indeed exist commonness and consistent patterns of the sequence features among organisms for the differentially expressed genes under heat stress condition. Some features are attributed to the requirement of thermostability while some are dominated by gene function. The revealed sequence determinants of bacterial gene expression level under heat stress complement the knowledge about the regulation factors of prokaryotic gene expression responding to the change of environmental conditions. Furthermore, comparisons to thermophilic adaption have been performed to reveal the similarity and dissimilarity of the sequence determinants for the response to heat stress and for the adaption to high habitat temperature, which elucidates the complex landscape of gene expression related to the same physical factor of temperature.

  19. Searching gene and protein sequence databases.

    PubMed

    Barsalou, T; Brutlag, D L

    1991-01-01

    A large-scale effort to map and sequence the human genome is now under way. Crucial to the success of this research is a group of computer programs that analyze and compare data on molecular sequences. This article describes the classic algorithms for similarity searching and sequence alignment. Because good performance of these algorithms is critical to searching very large and growing databases, we analyze the running times of the algorithms and discuss recent improvements in this area.

  20. Heterologous gene expression driven by carbonic anhydrase gene promoter in Dunaliella salina

    NASA Astrophysics Data System (ADS)

    Yurong, Chai; Yumin, Lu; Tianyun, Wang; Weihong, Hou; Lexun, Xue

    2006-12-01

    Dunaliella salina, a halotolerant unicellular green alga without a rigid cell wall, can live in salinities ranging from 0.05 to 5 mol/L NaCl. These features of D. salina make it an ideal host for the production of antibodies, oral vaccine, and commercially valuable polypeptides. To produce high level of heterologous proteins from D. salina, highly efficient promoters are required to drive expression of target genes under controlled condition. In the present study, we cloned a 5' franking region of 1.4 kb from the carbonic anhydrase ( CAH) gene of D. salina by genomic walking and PCR. The fragment was ligated to the pMD18-T vector and characterized. Sequence analysis indicated that this region contained conserved motifs, including a TATA- like box and CAAT-box. Tandem (GT)n repeats that had a potential role of transcriptional control, were also found in this region. The transcription start site (TSS) of the CAH gene was determined by 5' RACE and nested PCR method. Transformation assays showed that the 1.4 kb fragment was able to drive expression of the selectable bar (bialaphos resistance) gene when the fusion was transformed into D. salina by biolistics. Northern blotting hybridizations showed that the bar transcript was most abundant in cells grown in 2 mol/L NaCl, and less abundant in 0.5 mol/L NaCl, indicating that expression of the bar gene was induced at high salinity. These results suggest the potential use of the CAH gene promoter to induce the expression of heterologous genes in D. salina under varied salt condition.

  1. Characterization of SSU5C promoter of a rbcS gene from duckweed (Lemna gibba).

    PubMed

    Wang, Youru; Zhang, Yong; Yang, Baoyu; Chen, Shiyun

    2011-04-01

    Photosynthesis-associated nuclear genes are able to respond to multiple environmental and developmental signals. Studies have shown that light signals coordinate with hormone signaling pathways to control photomorphogenesis. A small subunit of ribulose-1,5 bisphosphate carboxylase/oxygenase (rbcS) gene promoter was cloned from duckweed (Lemna gibba). Sequence analysis revealed this promoter is different from the previously reported rbcs promoters and is named SSU5C. Analysis of T1 transgenic tobacco plants with a reporter gene under the control of the SSU5C promoter revealed that this promoter is tissue-specific and is positively regulated by red light. Promoter deletion analysis confirmed a region from position -152 to -49 relative to the start of transcription containing boxes X, Y and Z, and is identified to be critical for phytochrome responses. Further functional analysis of constructs of box-X, Y, Z, which was respectively fused to the basal SSU5C promoter, defined boxes X, Y and Z alone are able to direct phytochrome-regulated expression, indicating that boxes Y and Z are different from those of the SSU5B promoters in L. gibba. This promoter may be used for plant gene expression in a tissue-specific manner.

  2. Nucleotide sequence of SHV-2 beta-lactamase gene

    SciTech Connect

    Garbarg-Chenon, A.; Godard, V.; Labia, R.; Nicolas, J.C. )

    1990-07-01

    The nucleotide sequence of plasmid-mediated beta-lactamase SHV-2 from Salmonella typhimurium (SHV-2pHT1) was determined. The gene was very similar to chromosomally encoded beta-lactamase LEN-1 of Klebsiella pneumoniae. Compared with the sequence of the Escherichia coli SHV-2 enzyme (SHV-2E.coli) obtained by protein sequencing, the deduced amino acid sequence of SHV-2pHT1 differed by three amino acid substitutions.

  3. Optimization of gene sequences under constant mutational pressure and selection

    NASA Astrophysics Data System (ADS)

    Kowalczuk, M.; Gierlik, A.; Mackiewicz, P.; Cebrat, S.; Dudek, M. R.

    1999-12-01

    We have analyzed the influence of constant mutational pressure and selection on the nucleotide composition of DNA sequences of various size, which were represented by the genes of the Borrelia burgdorferi genome. With the help of MC simulations we have found that longer DNA sequences accumulate much less base substitutions per sequence length than short sequences. This leads us to the conclusion that the accuracy of replication may determine the size of genome.

  4. Multiple promoter elements govern expression of the human ornithine decarboxylase gene in colon carcinoma cells.

    PubMed Central

    Moshier, J A; Osborne, D L; Skunca, M; Dosescu, J; Gilbert, J D; Fitzgerald, M C; Polidori, G; Wagner, R L; Friezner Degen, S J; Luk, G D

    1992-01-01

    Overexpression of the ornithine decarboxylase (ODC) gene may be important to the development and maintenance of colonic neoplasms, as well as tumors in general. In this study, we examined the promoter elements governing constitutive expression of the human ODC gene in HCT 116 human colon carcinoma cells and, for comparison, K562 human erythro-leukemia cells. It was determined by functional analysis that the promoter elements responsible reside within the 378 bp immediately upstream from the transcription start site. Within this sequence, there are at least three regions that modulate the efficiency of the ODC promoter cooperatively. Both DNA bandshift and footprint assays demonstrated all three regions to be rich in sites that bind to nuclear proteins isolated from HCT 116 and K562 cells; the protein binding pattern of non-transformed, diploid fibroblasts was found to be much less complex. Several of the protein binding sequences have little or no homology to common regulatory elements. We suggest that the constitutive activity of the ODC gene in HCT 116 colon carcinoma cells, and perhaps transformed cells in general, involves a complex interaction of multiple regulatory sequences and their associated nuclear proteins. Finally, the saturation of the promoter in these transformed cell lines suggests that high levels of protein binding in the ODC promoter may contribute to elevated constitutive expression of this gene. Images PMID:1598217

  5. Role of the promoter in the regulation of the thymidine kinase gene

    SciTech Connect

    Travali, S.; Lipson, K.E.; Jaskulski, D.; Lauret, E.; Baserga, R.

    1988-04-01

    To identify the regulatory elements of the human thymidine kinase (TK) gene, the authors established stable cell lines carrying different chimeric constructs of the TK gene. Their results can be summarized as follows. (i) When the TK coding sequence is under the control of the calcyclin promoter (a promoter that is activated when G/sub o/ cells are stimulated by growth factors), TK mRNA levels are higher in G/sub 1/-arrested cells than in proliferating cells: (ii) when the TK coding sequence is under the control of the promoter of heat shock protein HSP70, steady-state levels of TK mRNA are highest after heat shock, regardless of the position of the cells in the cell cycle; (iii) the bacterial CAT gene under the control of the human TK promoter is maximally expressed in the S phase; (iv) the TK cDNA driven by the simian virus 40 promoter is also maximally expressed in the S phase; and (v) TK enzyme activity is always at a maximum in the S phase, even when the levels of TK mRNA are highest in nonproliferating cells. The authors conclude that although the TK coding sequence may also play some role, the TK promoter has an important role in the cell cycle regulation of TK mRNA levels.

  6. Evaluation of a novel promoter from Populus trichocarpa for mature xylem tissue specific gene delivery.

    PubMed

    Nguyen, Van Phap; Cho, Jin-Seong; Choi, Young-Im; Lee, Sang-Won; Han, Kyung-Hwan; Ko, Jae-Heung

    2016-07-01

    Wood (i.e., secondary xylem) is an important raw material for many industrial applications. Mature xylem (MX) tissue-specific genetic modification offers an effective means to improve the chemical and physical properties of the wood. Here, we describe a promoter that drives strong gene expression in a MX tissue-specific manner. Using whole-transcriptome genechip analyses of different tissue types of poplar, we identified five candidate genes that had strong expression in the MX tissue. The putative promoter sequences of the five MX-specific genes were evaluated for their promoter activity in both transgenic Arabidopsis and poplar. Among them, we found the promoter of Potri.013G007900.1 (called the PtrMX3 promoter) had the strongest activity in MX and thus was further characterized. In the stem and root tissues of transgenic Arabidopsis plants, the PtrMX3 promoter activity was found exclusively in MX tissue. MX-specific activity of the promoter was reproduced in the stem tissue of transgenic poplar plants. The PtrMX3 promoter activity was not influenced by abiotic stresses or exogenously applied growth regulators, indicating the PtrMX3 promoter is bona fide MX tissue-specific. Our study provides a strong MX-specific promoter for MX-specific modifications of woody biomass.

  7. The putative promoter for a metacyclic VSG gene in African trypanosomes.

    PubMed

    Nagoshi, Y L; Alarcon, C M; Donelson, J E

    1995-06-01

    During their metacyclic developmental stage, African trypanosomes are coated with one of 12-15 variant surface glycoproteins (VSGs) that define different metacyclic variant antigen types (MVATs). The MVAT VSG genes are located near telomeres of large chromosomes and are expressed without rearrangement in the metacyclic stage. We have cloned and examined the telomere-linked MVAT5 VSG gene and its upstream expression site associated gene (ESAG I) which are separated by 4.5 kb. Within this 4.5-kb intergenic region is an 87-bp sequence that serves as a strong promoter for a luciferase reporter gene in transient transfection assays. This 87-bp sequence is similar, but not identical, to the promoter for another MVAT VSG gene. UV irradiation experiments were used to detect RNA synthesis from this MVAT5 promoter in bloodstream trypanosomes expressing an unrelated VSG. We propose that this sequence is a specific promoter for the MVAT5 VSG mRNA that occurs in about 10% of the trypanosome population during the metacyclic stage of the parasites' life cycle.

  8. Regulation of the promoter of rat apolipoprotein A-I gene in cultured cells

    SciTech Connect

    Chao, Y.; Pan, T.; Wu, T.; Hao, Q.; Yamin, T.; Kroon, P.A.

    1987-05-01

    In order to study the regulation of the promoter of apolipoprotein (apo) A-I gene, they joined the 5' end of rat apo A-I gene (1.9 Kb) to the coding region of bacterial chloramphenicol acetyltransferase (CAT) gene. The chimeric gene produced high levels of CAT activity in both mouse L cells and Hep G2 cells in transient expression assays. Ethanol increased the levels of rat apo A-I promoter activity in both cells. However, dexamethasone increased rat apo A-I promoter activity only in Hep G2 cells. Similar results were obtained in stable expression cell lines. Nucleotide deletion experiments showed DNA sequences between -149 and -469 base pairs upstream from the rat apo A-I transcription site are required for the high level of expression and that the regulatory sequences are located further upstream. These data demonstrated that the 5' end of rat apo A-I gene contains sequences which are responsible for the regulation of apo A-I expression by ethanol and dexamethasone and that the expression and regulation of rat apo A-I promoter are cell specific.

  9. Identification of a novel first exon in the human dystrophin gene and of a new promoter located more than 500 kb upstream of the nearest known promoter

    SciTech Connect

    Yanagawa, H.; Nishio, H.; Takeshima, Y.

    1994-09-01

    The dystrophin gene, which is muted in patients with Duchenne and Becker muscular dystrophies, is the largest known human gene. Five alternative promoters have been characterized until now. Here we show that a novel dystrophin isoform with a different first exon can be produced through transcription initiation at a previously-unidentified alternative promoter. The case study presented is that of patient with Duchenne muscular dystrophy who had a deletion extending from 5{prime} end of the dystrophin gene to exon 2, including all promoters previously mapped in the 5{prime} part of the gene. Transcripts from lymphoblastoid cells were found to contain sequences corresponding to exon 3, indicating the presence of new promoter upstream of this exon. The nucleotide sequence of amplified cDNA corresponding to the 5{prime} end of the new transcript indicated that the 5{prime} end of exon 3 was extended by 9 codons, only the last (most 3{prime}) of which codes for methionine. The genomic nucleotide sequence upstream from the new exon, as determined using inverse polymerase chain reaction, revealed the presence of sequences similar to a TATA box, an octamer motif and an MEF-2 element. The identified promoter/exon did not map to intron 2, as might have been expected, but to a position more than 500 kb upstream of the most 5{prime} of the previously-identified promoters, thereby adding 500 kb to the dystrophin gene. The sequence of part of the new promoter region is very similar to that of certain medium reiteration frequency repetitive sequences. These findings may help us understand the molecular evolution of the dystrophin gene.

  10. Cone specific promoter for use in gene therapy of retinal degenerative diseases.

    PubMed

    Dyka, Frank M; Boye, Sanford L; Ryals, Renee C; Chiodo, Vince A; Boye, Shannon E; Hauswirth, William W

    2014-01-01

    Achromatopsia (ACHM) is caused by a progressive loss of cone photoreceptors leading to color blindness and poor visual acuity. Animal studies and human clinical trials have shown that gene replacement therapy with adeno-associate virus (AAV) is a viable treatment option for this disease. Although there have been successful attempts to optimize capsid proteins for increased specificity, it is simpler to restrict expression via the use of cell type-specific promoters. To target cone photoreceptors, a chimeric promoter consisting of an enhancer element of interphotoreceptor retinoid-binding protein promoter and a minimal sequence of the human transducin alpha-subunit promoter (IRBPe/GNAT2) was created. Additionally, a synthetic transducin alpha-subunit promoter (synGNAT2/GNAT2) containing conserved sequence blocks located downstream of the transcriptional start was created. The strength and specificity of these promoters were evaluated in murine retina by immunohistochemistry. The results showed that the chimeric, (IRBPe/GNAT2) promoter is more efficient and specific than the synthetic, synGNAT2/GNAT2 promoter. Additionally, IRBPe/GNAT2-mediated expression was found in all cone subtypes and it was improved over existing promoters currently used for gene therapy of achromatopsia.

  11. Alu sequence involvement in transcriptional insulation of the keratin 18 gene in transgenic mice.

    PubMed Central

    Thorey, I S; Ceceña, G; Reynolds, W; Oshima, R G

    1993-01-01

    The human keratin 18 (K18) gene is expressed in a variety of adult simple epithelial tissues, including liver, intestine, lung, and kidney, but is not normally found in skin, muscle, heart, spleen, or most of the brain. Transgenic animals derived from the cloned K18 gene express the transgene in appropriate tissues at levels directly proportional to the copy number and independently of the sites of integration. We have investigated in transgenic mice the dependence of K18 gene expression on the distal 5' and 3' flanking sequences and upon the RNA polymerase III promoter of an Alu repetitive DNA transcription unit immediately upstream of the K18 promoter. Integration site-independent expression of tandemly duplicated K18 transgenes requires the presence of either an 825-bp fragment of the 5' flanking sequence or the 3.5-kb 3' flanking sequence. Mutation of the RNA polymerase III promoter of the Alu element within the 825-bp fragment abolishes copy number-dependent expression in kidney but does not abolish integration site-independent expression when assayed in the absence of the 3' flanking sequence of the K18 gene. The characteristics of integration site-independent expression and copy number-dependent expression are separable. In addition, the formation of the chromatin state of the K18 gene, which likely restricts the tissue-specific expression of this gene, is not dependent upon the distal flanking sequences of the 10-kb K18 gene but rather may depend on internal regulatory regions of the gene. Images PMID:7692231

  12. DNA sequence and expression of the 36-kilodalton outer membrane protein gene of Brucella abortus.

    PubMed Central

    Ficht, T A; Bearden, S W; Sowa, B A; Adams, L G

    1989-01-01

    The cloning of the gene(s) encoding a 36-kilodalton (kDa) cell envelope protein of Brucella abortus has been previously described (T. A. Ficht, S. W. Bearden, B. A. Sowa, and L. G. Adams, Infect, Immun. 56:2036-2046, 1988). In an attempt to define the nature of the previously described duplication at this locus we have sequenced 3,500 base pairs of genomic DNA encompassing this region. The duplication represented two similar open reading frames which shared more than 85% homology at the nucleotide level but differed primarily because of the absence of 108 nucleotides from one of the two gene copies. These two genes were read from opposite strands and potentially encoded proteins which are 96% homologous. The predicted gene products were identical over the first 100 amino acids, including 22-amino-acid-long signal sequences. The amino acid composition of the predicted proteins was similar to that obtained for the Brucella porin isolated by Verstreate et al. (D. R. Verstreate, M. T. Creasy, N. T. Caveney, C. L. Baldwin, M. W. Blab, and A. J. Winter, Infect. Immun. 35:979-989, 1982) and presumably represented two copies of the porin gene, tentatively identified as omp 2a (silent) and omp 2b (expressed). The homology between the two genes extended to and included Shine-Dalgarno sequences 7 base pairs upstream from the ATG start codons. Homology at the 3' ends extended only as far as the termination codon, but both genes had putative rho-independent transcription termination sites. Localization of the promoters proved more difficult, since the canonical procaryotic sequences could not be identified in the region upstream of either gene. Promoter activity was demonstrated by ligation to a promoterless lacZ gene in pMC1871. However, only one active promoter could be identified by using this system. A 36-kDa protein was synthesized in E. coli with the promoter in the native orientation and was identical in size to the protein produced in laboratory-grown B. abortus. When

  13. Genome Sequence of the Plant Growth Promoting Endophytic Bacterium Enterobacter sp. 638

    PubMed Central

    Taghavi, Safiyh; van der Lelie, Daniel; Hoffman, Adam; Zhang, Yian-Biao; Walla, Michael D.; Vangronsveld, Jaco; Newman, Lee; Monchy, Sébastien

    2010-01-01

    Enterobacter sp. 638 is an endophytic plant growth promoting gamma-proteobacterium that was isolated from the stem of poplar (Populus trichocarpa×deltoides cv. H11-11), a potentially important biofuel feed stock plant. The Enterobacter sp. 638 genome sequence reveals the presence of a 4,518,712 bp chromosome and a 157,749 bp plasmid (pENT638-1). Genome annotation and comparative genomics allowed the identification of an extended set of genes specific to the plant niche adaptation of this bacterium. This includes genes that code for putative proteins involved in survival in the rhizosphere (to cope with oxidative stress or uptake of nutrients released by plant roots), root adhesion (pili, adhesion, hemagglutinin, cellulose biosynthesis), colonization/establishment inside the plant (chemiotaxis, flagella, cellobiose phosphorylase), plant protection against fungal and bacterial infections (siderophore production and synthesis of the antimicrobial compounds 4-hydroxybenzoate and 2-phenylethanol), and improved poplar growth and development through the production of the phytohormones indole acetic acid, acetoin, and 2,3-butanediol. Metabolite analysis confirmed by quantitative RT–PCR showed that, the production of acetoin and 2,3-butanediol is induced by the presence of sucrose in the growth medium. Interestingly, both the genetic determinants required for sucrose metabolism and the synthesis of acetoin and 2,3-butanediol are clustered on a genomic island. These findings point to a close interaction between Enterobacter sp. 638 and its poplar host, where the availability of sucrose, a major plant sugar, affects the synthesis of plant growth promoting phytohormones by the endophytic bacterium. The availability of the genome sequence, combined with metabolome and transcriptome analysis, will provide a better understanding of the synergistic interactions between poplar and its growth promoting endophyte Enterobacter sp. 638. This information can be further exploited to

  14. Single molecule targeted sequencing for cancer gene mutation detection

    PubMed Central

    Gao, Yan; Deng, Liwei; Yan, Qin; Gao, Yongqian; Wu, Zengding; Cai, Jinsen; Ji, Daorui; Li, Gailing; Wu, Ping; Jin, Huan; Zhao, Luyang; Liu, Song; Ge, Liangjin; Deem, Michael W.; He, Jiankui

    2016-01-01

    With the rapid decline in cost of sequencing, it is now affordable to examine multiple genes in a single disease-targeted clinical test using next generation sequencing. Current targeted sequencing methods require a separate step of targeted capture enrichment during sample preparation before sequencing. Although there are fast sample preparation methods available in market, the library preparation process is still relatively complicated for physicians to use routinely. Here, we introduced an amplification-free Single Molecule Targeted Sequencing (SMTS) technology, which combined targeted capture and sequencing in one step. We demonstrated that this technology can detect low-frequency mutations using artificially synthesized DNA sample. SMTS has several potential advantages, including simple sample preparation thus no biases and errors are introduced by PCR reaction. SMTS has the potential to be an easy and quick sequencing technology for clinical diagnosis such as cancer gene mutation detection, infectious disease detection, inherited condition screening and noninvasive prenatal diagnosis. PMID:27193446

  15. Functional analysis of the human somatic angiotensin I-converting enzyme gene promoter.

    PubMed

    Testut, P; Soubrier, F; Corvol, P; Hubert, C

    1993-08-01

    Angiotensin I-converting enzyme (ACE) is a key enzyme in the regulation of systemic blood pressure and plays a major role in the renin-angiotensin and bradykinin-kinin systems, at the luminal surface of the vascular endothelia. To identify the promoter region, the transcription regulatory elements and the cell specificity of the ACE gene, five successive DNA deletions of the 5' upstream region (-1214, -754, -472, -343, -132 bp relative to the start site of transcription) were isolated and fused in sense and antisense orientations to the bacterial chloramphenicol acetyltransferase (CAT) reporter gene in the promoterless plasmid pBLCAT3. Promoter activities were measured in transient transfection assays using three different cell lines from rabbit endothelium (RE), human embryocarcinoma (Tera-1) and hepatocarcinoma cells (HepG2). All five fragments of the ACE promoter region directed expression of the CAT gene when transfected into the endothelial and the embryocarcinoma cells, which contain endogenous ACE mRNA and express ACE activity. In contrast only minimal levels of promoter activity were obtained on transfection into hepatocarcinoma cells in which endogenous ACE mRNA and ACE activity were not detected. Transfection of RE and Tera-1 cells demonstrated that promoter activity was defined by the length of the ACE promoter sequence inserted into the construct. The 132 bases located upstream from the transcription start site were sufficient to confer ACE promoter activity, whereas the sequences upstream from -472 bp and between -343 bp and -132 bp were responsible for a decrease of promoter activity. Furthermore, the minimal 132 bp of the ACE promoter contains elements which direct cell-specific CAT expression. In addition, the DNA transfection study in the presence of dexamethasone suggested that the potential glucocorticoid regulatory elements, located in the sequence of the ACE promoter, are not functional.

  16. Functional analysis of the human somatic angiotensin I-converting enzyme gene promoter.

    PubMed Central

    Testut, P; Soubrier, F; Corvol, P; Hubert, C

    1993-01-01

    Angiotensin I-converting enzyme (ACE) is a key enzyme in the regulation of systemic blood pressure and plays a major role in the renin-angiotensin and bradykinin-kinin systems, at the luminal surface of the vascular endothelia. To identify the promoter region, the transcription regulatory elements and the cell specificity of the ACE gene, five successive DNA deletions of the 5' upstream region (-1214, -754, -472, -343, -132 bp relative to the start site of transcription) were isolated and fused in sense and antisense orientations to the bacterial chloramphenicol acetyltransferase (CAT) reporter gene in the promoterless plasmid pBLCAT3. Promoter activities were measured in transient transfection assays using three different cell lines from rabbit endothelium (RE), human embryocarcinoma (Tera-1) and hepatocarcinoma cells (HepG2). All five fragments of the ACE promoter region directed expression of the CAT gene when transfected into the endothelial and the embryocarcinoma cells, which contain endogenous ACE mRNA and express ACE activity. In contrast only minimal levels of promoter activity were obtained on transfection into hepatocarcinoma cells in which endogenous ACE mRNA and ACE activity were not detected. Transfection of RE and Tera-1 cells demonstrated that promoter activity was defined by the length of the ACE promoter sequence inserted into the construct. The 132 bases located upstream from the transcription start site were sufficient to confer ACE promoter activity, whereas the sequences upstream from -472 bp and between -343 bp and -132 bp were responsible for a decrease of promoter activity. Furthermore, the minimal 132 bp of the ACE promoter contains elements which direct cell-specific CAT expression. In addition, the DNA transfection study in the presence of dexamethasone suggested that the potential glucocorticoid regulatory elements, located in the sequence of the ACE promoter, are not functional. Images Figure 1 Figure 3 PMID:8394696

  17. Genomic organization and 5{prime}-flanking DNA sequence of the murine stomatin gene (Epb72)

    SciTech Connect

    Gallagher, P.G.; Turetsky, T.; Mentzer, W.C. |

    1996-06-15

    Stomatin is a poorly understood integral membrane protein that is absent from the erythrocyte membranes of many patients with hereditary stomatocytosis. This report describes the cloning of the murine stomatin chromosomal gene, determination of its genomic structure, and characterization of the 5{prime}-flanking genomic DNA sequences. The stomatin gene is encoded by seven exons spread over {approximately}25 kb of genomic DNA. There is no concordance between the exon structure of the stomatin gene and the locations of three domains predicted on the basis of protein structure. Inspection of the 5{prime}-flanking DNA sequences reveals features of a TATA-less housekeeping gene promoter and consensus sequences for a number of potential DNA-binding proteins. 12 refs., 2 figs., 1 tab.

  18. Gene Slider: sequence logo interactive data-visualization for education and research.

    PubMed

    Waese, Jamie; Pasha, Asher; Wang, Ting Ting; van Weringh, Anna; Guttman, David S; Provart, Nicholas J

    2016-12-01

    Gene Slider helps visualize the conservation and entropy of orthologous DNA and protein sequences by presenting them as one long sequence logo that can be zoomed in and out of, from an overview of the entire sequence down to just a few residues at a time. A search function enables users to find motifs such as cis-elements in promoter regions by simply 'drawing' a sequence logo representation of the desired motif as a query. In addition to displaying user-supplied FASTA files, our demonstration version of Gene Slider loads and displays a rich database of 90 000+ conserved non-coding regions across the Brassicaceae indexed to the TAIR10 Col-0 Arabidopsis thaliana sequence. It also displays transcription factor binding sites, enabling easy identification of regions that are both conserved across multiple species and may contain transcription factor binding sites.

  19. Efficiency of ligation-mediated PCR and TAIL-PCR methods for isolation of RbcS promoter sequences from green microalgae Ankistrodesmus convolutus.

    PubMed

    Thanh, Tran; Chi, Vu Thi Quynh; Abdullah, Mohd Puad; Omar, Hishamuddin; Napis, Suhaimi

    2012-01-01

    Isolation of promoter sequences from known gene sequences is a tedious task in genome-related research. An efficient method of obtaining the promoter sequences is necessary in order to successfully use targeted promoters for genetic manipulations. Here, efficiency and usefulness of two PCR-based methods, namely: ligation-mediated PCR and thermal asymmetric interlaced (TAIL) PCR, for isolation of promoter sequences of the ribulose-1,5-bisphosphate carboxylase/oxygenase small subunit (RbcS) gene from green microalgae Ankistrodesmus convolutus (A. convolutus) were evaluated. The results showed that the amplification efficiency of TAIL-PCR was higher than that of the ligation-mediated PCR method, i.e. the amplified promoter fragments of 1.2 and 0.8 kb in length or promoter sequences of 813 and 606 bp (after eliminating the unreadable sequences). The use of TAIL-PCR described here presents a low cost and efficient strategy for the isolation of promoter sequences of known genes, especially in GC-rich regions, and species with little or no available genome information such as A. convolutus.

  20. Expression mediated by three partial sequences of the human tyrosine hydroxylase promoter in vivo

    PubMed Central

    Rolland, Anne-Sophie; Kareva, Tatyana; Yarygina, Olga; Kholodilov, Nikolai; Burke, Robert E

    2016-01-01

    The use of viral vectors to transfect postmitotic neurons has provided an important research tool, and it offers promise for treatment of neurologic disease. The utility of vectors is enhanced by the use of selective promoters that permit control of the cellular site of expression. One potential clinical application is in the neurorestorative treatment of Parkinson’s disease by the induction of new axon growth. However, many of the genes with an ability to restore axons have oncogenic potential. Therefore, clinical safety would be enhanced by restriction of expression to neurons affected by the disease, particularly dopamine neurons. To achieve this goal we have evaluated in vivo three partial sequences of the promoter for human tyrosine hydroxylase, the rate limiting enzyme in catecholamine synthesis. All sequences induced expression in dopamine neurons. None of them induced expression in glia or in nondopaminergic neurons in striatum or cortex. We conclude that these sequences have potential use for targeting dopamine neurons in research and clinical applications. PMID:27689101

  1. Insect and wound induced GUS gene expression from a Beta vulgaris proteinase inhibitor gene promoter

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Inducible gene promoters that are specifically activated by pathogen invasion or insect pest attack are needed for effective expression of resistance genes to control plant diseases. In the present study, a promoter from a serine proteinase inhibitor gene (BvSTI) shown to be up-regulated in resist...

  2. Structural analysis and promoter characterization of the human collagenase-3 gene (MMP13)

    SciTech Connect

    Pendas, A.M.; Balbin, M.; Llano, E.

    1997-03-01

    Human collagenase-3 (MMP13) is a recently identified member of the matrix metalloproteinase (MMP) family that is expressed in breast carcinomas and in articular cartilage from arthritic patients. In this work we have isolated and characterized genomic clones coding for human collagenase-3. This gene is composed of 10 exons and 9 introns and spans over 12.5 kb. The overall organization of the collagenase-3 gene is similar to that of other MMP genes clustered at chromosome 11q22, including fibroblast collagenase (MMP-1), matrilysin (MMP-7), and macrophage metalloelastase (MMP-12), but is more distantly related to genes coding for stromelysin-3 (MMP-11), gelatinase-A (MMP-2), and gelatinase-B (MMP-9), which map outside of this gene cluster. Nucleotide sequence analysis of about 1 kb of the 5{prime}-flanking region of the collagenase-3 gene revealed the presence of a TATA box, an AP-1 motif, a PEA-3 consensus sequence, an osteoblast specific element (OSE-2), and a TGF-{beta} inhibitory element. Transient transfection experiments in HeLa and COS-1 cells with chloramphenicol acetyltransferase (CAT)-containing constructs showed that the AP-1 site is functional and responsible for the observed inducibility of the reporter gene by the tumor promoter 12-O-tetradecanoylphorbol-13-acetate (TPA). However, and in contrast to other MMP genes, no significative synergistic effect on CAT activity between the AP-1 and PEA-3 elements found in the collagenase-3 gene promoter was found. DNA binding analysis with nuclear extracts from HeLa cells revealed the formation of specific complexes between collagenase-3 promoter sequences containing the AP-1 site and nuclear proteins. The presence of this AP-1 functional site, which is able to confer responsiveness to a variety of tumor promoters and oncogene products, may contribute to explaining the high-level expression of collagenase-3 in breast carcinomas and degenerative joint diseases. 48 refs., 5 figs., 2 tabs.

  3. Evolution of Brain Active Gene Promoters in Human Lineage Towards the Increased Plasticity of Gene Regulation.

    PubMed

    Gunbin, Konstantin V; Ponomarenko, Mikhail P; Suslov, Valentin V; Gusev, Fedor; Fedonin, Gennady G; Rogaev, Evgeny I

    2017-02-24

    Adaptability to a variety of environmental conditions is a prominent feature of Homo sapiens. We hypothesize that this feature can be explained by evolutionary changes in gene promoters active in the brain prefrontal cortex leading to a more flexible gene regulation network. The genotype-dependent range of gene expression can be broader in humans than in other higher primates. Thus, we searched for specific signatures of evolutionary changes in promoter architectures of multiple hominid genes, including the genes active in human cortical neurons that may indicate an increase of variability of gene expression rather than just changes in the level of expression, such as downregulation or upregulation of the genes. We performed a whole-genome search for genetic-based alterations that may impact gene regulation "flexibility" in a process of hominids evolution, such as (i) CpG dinucleotide content, (ii) predicted nucleosome-DNA dissociation constant, and (iii) predicted affinities for TATA-binding protein (TBP) in gene promoters. We tested all putative promoter regions across the human genome and especially gene promoters in active chromatin state in neurons of prefrontal cortex, the brain region critical for abstract thinking and social and behavioral adaptation. Our data imply that the origin of modern man has been associated with an increase of flexibility of promoter-driven gene regulation in brain. In contrast, after splitting from the ancestral lineages of H. sapiens, the evolution of ape species is characterized by reduced flexibility of gene promoter functioning, underlying reduced variability of the gene expression.

  4. DNA sequences that activate isocitrate lyase gene expression during late embryogenesis and during postgerminative growth.

    PubMed Central

    Zhang, J Z; Santes, C M; Engel, M L; Gasser, C S; Harada, J J

    1996-01-01

    We analyzed DNA sequences that regulate the expression of an isocitrate lyase gene from Brassica napus L. during late embryogenesis and during postgerminative growth to determine whether glyoxysomal function is induced by a common mechanism at different developmental stages. beta-Glucuronidase constructs were used both in transient expression assays in B. napus and in transgenic Arabidopsis thaliana to identify the segments of the isocitrate lyase 5' flanking region that influence promoter activity. DNA sequences that play the principal role in activating the promoter during post-germinative growth are located more than 1,200 bp upstream of the gene. Distinct DNA sequences that were sufficient for high-level expression during late embryogenesis but only low-level expression during postgerminative growth were also identified. Other parts of the 5' flanking region increased promoter activity both in developing seed and in seedlings. We conclude that a combination of elements is involved in regulating the isocitrate lyase gene and that distinct DNA sequences play primary roles in activating the gene in embryos and in seedlings. These findings suggest that different signals contribute to the induction of glyoxysomal function during these two developmental stages. We also showed that some of the constructs were expressed differently in transient expression assays and in transgenic plants. PMID:8934622

  5. Trait-associated sequence variation in the bovine growth hormone receptor 1A promoter does not affect promoter activity in vitro.

    PubMed

    Zhou, Y; Jiang, H

    2005-04-01

    Growth hormone (GH) plays a central role in growth and metabolism in cattle by binding to growth hormone receptor (GHR) and stimulating production of insulin-like growth factor 1 (IGF1). Two sequence variations in the promoter transcribing a major GHR mRNA variant, GHR 1A mRNA, have been reported to be associated with quantitative differences in growth rate or blood concentration of IGF1 in cattle. One such variation is in the length of a TG-repeat, being 11 or 16-20; the other variation is in the nucleotide 155 bp upstream from the transcription start site, being G or A. In this study, we determined whether these sequence variations would affect the activity of GHR 1A promoter. We cloned GHR 1A promoters bearing different sequence variations and linked each of them to a reporter gene. Transient transfection analyses revealed that these promoter-reporter constructs did not differ in reporter gene expression. Cotransfection analyses demonstrated that they also did not differ in activation by hepatocyte nuclear factor 4alpha, hepatocyte nuclear factor 4gamma and nuclear receptor subfamily 2 group F member 2, known transcription factors for bovine GHR 1A promoter. These in vitro results, together with a previous observation that neither the nucleotide 155 bp upstream from the transcription start site nor the TG-repeat was part of the GHR 1A promoter region interacting with nuclear proteins from bovine liver, do not support a cause-effect relationship between the reported sequence variations and the associated changes in growth rate or blood IGF1 concentration in cattle.

  6. Hematopoietic gene promoters subjected to a group-combinatorial study of DNA samples: identification of a megakaryocytic selective DNA signature

    PubMed Central

    Hazony, Yehonathan; Lu, Jun; St. Hilaire, Cynthia; Ravid, Katya

    2006-01-01

    Identification of common sub-sequences for a group of functionally related DNA sequences can shed light on the role of such elements in cell-specific gene expression. In the megakaryocytic lineage, no one single unique transcription factor was described as linage specific, raising the possibility that a cluster of gene promoter sequences presents a unique signature. Here, the megakaryocytic gene promoter group, which consists of both human and mouse 5′ non-coding regions, served as a case study. A methodology for group-combinatorial search has been implemented as a customized software platform. It extracts the longest common sequences for a group of related DNA sequences and allows for single gaps of varying length, as well as double- and multiple-gap sequences. The results point to common DNA sequences in a group of genes that is selectively expressed in megakaryocytes, and which does not appear in a large group of control, random and specific sequences. This suggests a role for a combination of these sequences in cell-specific gene expression in the megakaryocytic lineage. The data also point to an intrinsic cross-species difference in the organization of 5′ non-coding sequences within the mammalian genomes. This methodology may be used for the identification of regulatory sequences in other lineages. PMID:16936310

  7. Dependence of the E. coli promoter strength and physical parameters upon the nucleotide sequence

    PubMed Central

    Berezhnoy, Andrey Y.; Shckorbatov, Yuriy G.

    2005-01-01

    The energy of interaction between complementary nucleotides in promoter sequences of E. coli was calculated and visualized. The graphic method for presentation of energy properties of promoter sequences was elaborated on. Data obtained indicated that energy distribution through the length of promoter sequence results in picture with minima at −35, −8 and +7 regions corresponding to areas with elevated AT (adenine-thymine) content. The most important difference from the random sequences area is related to −8. Four promoter groups and their energy properties were revealed. The promoters with minimal and maximal energy of interaction between complementary nucleotides have low strengths, the strongest promoters correspond to promoter clusters characterized by intermediate energy values. PMID:16252339

  8. Absence of mutation at the 5'-upstream promoter region of the TPM4 gene from cardiac mutant axolotl (Ambystoma mexicanum).

    PubMed

    Denz, Christopher R; Zhang, Chi; Jia, Pingping; Du, Jianfeng; Huang, Xupei; Dube, Syamalima; Thomas, Anish; Poiesz, Bernard J; Dube, Dipak K

    2011-09-01

    Tropomyosins are a family of actin-binding proteins that show cell-specific diversity by a combination of multiple genes and alternative RNA splicing. Of the 4 different tropomyosin genes, TPM4 plays a pivotal role in myofibrillogenesis as well as cardiac contractility in amphibians. In this study, we amplified and sequenced the upstream regulatory region of the TPM4 gene from both normal and mutant axolotl hearts. To identify the cis-elements that are essential for the expression of the TPM4, we created various deletion mutants of the TPM4 promoter DNA, inserted the deleted segments into PGL3 vector, and performed promoter-reporter assay using luciferase as the reporter gene. Comparison of sequences of the promoter region of the TPM4 gene from normal and mutant axolotl revealed no mutations in the promoter sequence of the mutant TPM4 gene. CArG box elements that are generally involved in controlling the expression of several other muscle-specific gene promoters were not found in the upstream regulatory region of the TPM4 gene. In deletion experiments, loss of activity of the reporter gene was noted upon deletion which was then restored upon further deletion suggesting the presence of both positive and negative cis-elements in the upstream regulatory region of the TPM4 gene. We believe that this is the first axolotl promoter that has ever been cloned and studied with clear evidence that it functions in mammalian cell lines. Although striated muscle-specific cis-acting elements are absent from the promoter region of TPM4 gene, our results suggest the presence of positive and negative cis-elements in the promoter region, which in conjunction with positive and negative trans-elements may be involved in regulating the expression of TPM4 gene in a tissue-specific manner.

  9. Identification of plant promoter constituents by analysis of local distribution of short sequences

    PubMed Central

    Yamamoto, Yoshiharu Y; Ichida, Hiroyuki; Matsui, Minami; Obokata, Junichi; Sakurai, Tetsuya; Satou, Masakazu; Seki, Motoaki; Shinozaki, Kazuo; Abe, Tomoko

    2007-01-01

    Background Plant promoter architecture is important for understanding regulation and evolution of the promoters, but our current knowledge about plant promoter structure, especially with respect to the core promoter, is insufficient. Several promoter elements including TATA box, and several types of transcriptional regulatory elements have been found to show local distribution within promoters, and this feature has been successfully utilized for extraction of promoter constituents from human genome. Results LDSS (Local Distribution of Short Sequences) profiles of short sequences along the plant promoter have been analyzed in silico, and hundreds of hexamer and octamer sequences have been identified as having localized distributions within promoters of Arabidopsis thaliana and rice. Based on their localization patterns, the identified sequences could be classified into three groups, pyrimidine patch (Y Patch), TATA box, and REG (Regulatory Element Group). Sequences of the TATA box group are consistent with the ones reported in previous studies. The REG group includes more than 200 sequences, and half of them correspond to known cis-elements. The other REG subgroups, together with about a hundred uncategorized sequences, are suggested to be novel cis-regulatory elements. Comparison of LDSS-positive sequences between Arabidopsis and rice has revealed moderate conservation of elements and common promoter architecture. In addition, a dimer motif named the YR Rule (C/T A/G) has been identified at the transcription start site (-1/+1). This rule also fits both Arabidopsis and rice promoters. Conclusion LDSS was successfully applied to plant genomes and hundreds of putative promoter elements have been extracted as LDSS-positive octamers. Identified promoter architecture of monocot and dicot are well conserved, but there are moderate variations in the utilized sequences. PMID:17346352

  10. Characterization of the sporophyte-preferential gene promoter from the red alga Porphyra yezoensis using transient gene expression.

    PubMed

    Uji, Toshiki; Mizuta, Hiroyuki; Saga, Naotsune

    2013-04-01

    The life cycle of plants entails an alternation of generations, the diploid sporophyte and haploid gametophyte stages. There is little information about the characteristics of gene expression during each phase of marine macroalgae. Promoter analysis is a useful method for understanding transcriptional regulation; however, there is no report of promoter analyses in marine macroalgae. In this study, with the aim of elucidating the differences in the transcriptional regulatory mechanisms between the gametophyte and sporophyte stages in the marine red alga Porphyra yezoensis, we isolated the promoter from the sporophyte preferentially expressed gene PyKPA1, which encodes a sodium pump, and analyzed its promoter using a transient gene expression system with a synthetic β-glucuronidase (PyGUS) reporter. The deletion of -1432 to -768 relative to the transcription start site resulted in decreased GUS activity in sporophytes. In contrast, deletion from -767 to -527 increased GUS activity in gametophytes. Gain-of-function analyses showed that the -1432 to -760 region enhanced the GUS activity of a heterologous promoter in sporophytes, whereas the -767 to -510 region repressed it in gametophytes. Further mutation and gain-of-function analyses of the -767 to -510 region revealed that a 20-bp GC-rich sequence (-633 to -614) is responsible for the gametophyte-specific repressed expression. These results showed that the sporophyte-specific positive regulatory region and gametophyte-specific negative regulatory sequence play a crucial role in the preferential expression of PyKPA1 in P. yezoensis sporophytes.

  11. A strong promoter, PMagpd, provides a tool for high gene expression in entomopathogenic fungus, Metarhizium acridum.

    PubMed

    Cao, Yueqing; Jiao, Run; Xia, Yuxian

    2012-03-01

    A glyceraldehyde-3-phosphate dehydrogenase gene (gpd) promoter (PMagpd) was obtained from Metarhizium acridum and its active region analyzed by 5'-deletion strategy using β-glucuronidase (GUS) as a reporter. Sequence analysis revealed that typical regulatory elements of PMagpd were included in the 1.7 kb region upstream of the start codon of the Magpd gene. Deletion of the region from -1,691 bp to -1,463 bp, where the gpd box is harbored, did not significantly affect the PMagpd activity. Deletions of the regions upstream of -946 bp and upstream of -684 bp caused a major decrease of GUS activity. Compared with PgpdA (2.2 kb) in Aspergillus nidulans, PMagpd (1.4 kb) had a shorter sequence and significantly higher activity in M. acridum. This study provides an applicable promoter for over-expression of target genes in M. acridum.

  12. Analysis of a cloned colicin Ib gene: complete nucleotide sequence and implications for regulation of expression.

    PubMed Central

    Varley, J M; Boulnois, G J

    1984-01-01

    The complete nucleotide sequence of a 2,971 base pair EcoRI fragment carrying the structural gene for colicin Ib has been determined. The length of the gene is 1,881 nucleotides which is predicted to produce a protein of 626 amino acids and of molecular weight 71,364. The structural gene is flanked by likely promoter and terminator signals and in between the promoter and the ribosome binding site is an inverted repeat sequence which resembles other sequences known to bind the LexA protein. Further analysis of the 5' flanking sequences revealed a second region which may act either as a second LexA binding site and/or in the binding of cyclic AMP receptor protein. Comparison of the predicted amino acid sequence of colicin Ib with that of colicins A and E1 reveals localised homology. The implications of these similarities in the proteins and of regulation of the colicin Ib structural gene are discussed. Images PMID:6091036

  13. Upstream promoter sequences and αCTD mediate stable DNA wrapping within the RNA polymerase–promoter open complex

    PubMed Central

    Cellai, Sara; Mangiarotti, Laura; Vannini, Nicola; Naryshkin, Nikolai; Kortkhonjia, Ekaterine; Ebright, Richard H; Rivetti, Claudio

    2007-01-01

    We show that the extent of stable DNA wrapping by Escherichia coli RNA polymerase (RNAP) in the RNAP–promoter open complex depends on the sequence of the promoter and, in particular, on the sequence of the upstream region of the promoter. We further show that the extent of stable DNA wrapping depends on the presence of the RNAP α-subunit carboxy-terminal domain and on the presence and length of the RNAP α-subunit interdomain linker. Our results indicate that the extensive stable DNA wrapping observed previously in the RNAP–promoter open complex at the λ PR promoter is not a general feature of RNAP–promoter open complexes. PMID:17290289

  14. Upstream promoter sequences and alphaCTD mediate stable DNA wrapping within the RNA polymerase-promoter open complex.

    PubMed

    Cellai, Sara; Mangiarotti, Laura; Vannini, Nicola; Naryshkin, Nikolai; Kortkhonjia, Ekaterine; Ebright, Richard H; Rivetti, Claudio

    2007-03-01

    We show that the extent of stable DNA wrapping by Escherichia coli RNA polymerase (RNAP) in the RNAP-promoter open complex depends on the sequence of the promoter and, in particular, on the sequence of the upstream region of the promoter. We further show that the extent of stable DNA wrapping depends on the presence of the RNAP alpha-subunit carboxy-terminal domain and on the presence and length of the RNAP alpha-subunit interdomain linker. Our results indicate that the extensive stable DNA wrapping observed previously in the RNAP-promoter open complex at the lambda P(R) promoter is not a general feature of RNAP-promoter open complexes.

  15. Direct repeat sequences in the Streptomyces chitinase-63 promoter direct both glucose repression and chitin induction

    PubMed Central

    Ni, Xiangyang; Westpheling, Janet

    1997-01-01

    The chi63 promoter directs glucose-sensitive, chitin-dependent transcription of a gene involved in the utilization of chitin as carbon source. Analysis of 5′ and 3′ deletions of the promoter region revealed that a 350-bp segment is sufficient for wild-type levels of expression and regulation. The analysis of single base changes throughout the promoter region, introduced by random and site-directed mutagenesis, identified several sequences to be important for activity and regulation. Single base changes at −10, −12, −32, −33, −35, and −37 upstream of the transcription start site resulted in loss of activity from the promoter, suggesting that bases in these positions are important for RNA polymerase interaction. The sequences centered around −10 (TATTCT) and −35 (TTGACC) in this promoter are, in fact, prototypical of eubacterial promoters. Overlapping the RNA polymerase binding site is a perfect 12-bp direct repeat sequence. Some base changes within this direct repeat resulted in constitutive expression, suggesting that this sequence is an operator for negative regulation. Other base changes resulted in loss of glucose repression while retaining the requirement for chitin induction, suggesting that this sequence is also involved in glucose repression. The fact that cis-acting mutations resulted in glucose resistance but not inducer independence rules out the possibility that glucose repression acts exclusively by inducer exclusion. The fact that mutations that affect glucose repression and chitin induction fall within the same direct repeat sequence module suggests that the direct repeat sequence facilitates both chitin induction and glucose repression. PMID:9371809

  16. Different promoter affinities account for specificity in MYC-dependent gene regulation

    PubMed Central

    Lorenzin, Francesca; Benary, Uwe; Baluapuri, Apoorva; Walz, Susanne; Jung, Lisa Anna; von Eyss, Björn; Kisker, Caroline; Wolf, Jana; Eilers, Martin; Wolf, Elmar

    2016-01-01

    Enhanced expression of the MYC transcription factor is observed in the majority of tumors. Two seemingly conflicting models have been proposed for its function: one proposes that MYC enhances expression of all genes, while the other model suggests gene-specific regulation. Here, we have explored the hypothesis that specific gene expression profiles arise since promoters differ in affinity for MYC and high-affinity promoters are fully occupied by physiological levels of MYC. We determined cellular MYC levels and used RNA- and ChIP-sequencing to correlate promoter occupancy with gene expression at different concentrations of MYC. Mathematical modeling showed that binding affinities for interactions of MYC with DNA and with core promoter-bound factors, such as WDR5, are sufficient to explain promoter occupancies observed in vivo. Importantly, promoter affinity stratifies different biological processes that are regulated by MYC, explaining why tumor-specific MYC levels induce specific gene expression programs and alter defined biological properties of cells. DOI: http://dx.doi.org/10.7554/eLife.15161.001 PMID:27460974

  17. Structure and sequence divergence of two archaebacterial genes

    SciTech Connect

    Cue, D.; Beckler, G.S.; Reeve, J.N.; Konisky, J.

    1985-06-01

    The DNA sequences of a region that includes the hisA gene of two related methanogenic archaebacteria, Methanococcus voltae and Methanococcus vannielii, have been compared. Both organisms show a similar genome organization in this region, displaying three open reading frames (ORFs) separated by regions of very high A+T content. Two of the ORFs, including ORFHisA, show significant DNA sequence homology. As might be expected for organisms having a genome that is A+T-rich, there is a high preference for A and U as the third base in codons. A ribosome binding site, G-G-T-G, is located 6 base pairs preceding the ATG translation initiation sequence of both hisA genes. The sequences upstream of the two hisA genes show only limited sequence homology. The M. voltae intergenic region contains four tandemly arranged repetitions of an 11-base-pair sequence, whereas the M. vannielii sequence contains both direct and inverted repetitive sequences. Based on the degree of hisA sequence homology, the authors conclude that M. voltae and M. vannielii are less closely related taxonomically than are members of the enteric group of eubacteria.

  18. GeneTack database: genes with frameshifts in prokaryotic genomes and eukaryotic mRNA sequences.

    PubMed

    Antonov, Ivan; Baranov, Pavel; Borodovsky, Mark

    2013-01-01

    Database annotations of prokaryotic genomes and eukaryotic mRNA sequences pay relatively low attention to frame transitions that disrupt protein-coding genes. Frame transitions (frameshifts) could be caused by sequencing errors or indel mutations inside protein-coding regions. Other observed frameshifts are related to recoding events (that evolved to control expression of some genes). Earlier, we have developed an algorithm and software program GeneTack for ab initio frameshift finding in intronless genes. Here, we describe a database (freely available at http://topaz.gatech.edu/GeneTack/db.html) containing genes with frameshifts (fs-genes) predicted by GeneTack. The database includes 206 991 fs-genes from 1106 complete prokaryotic genomes and 45 295 frameshifts predicted in mRNA sequences from 100 eukaryotic genomes. The whole set of fs-genes was grouped into clusters based on sequence similarity between fs-proteins (conceptually translated fs-genes), conservation of the frameshift position and frameshift direction (-1, +1). The fs-genes can be retrieved by similarity search to a given query sequence via a web interface, by fs-gene cluster browsing, etc. Clusters of fs-genes are characterized with respect to their likely origin, such as pseudogenization, phase variation, etc. The largest clusters contain fs-genes with programed frameshifts (related to recoding events).

  19. The 5'-flanking regions of three pea legumin genes: comparison of the DNA sequences.

    PubMed Central

    Lycett, G W; Croy, R R; Shirsat, A H; Richards, D M; Boulter, D

    1985-01-01

    Approximately 1200 nucleotides of sequence data from the promoter and 5'-flanking regions of each of three pea (Pisum sativum L.) legumin genes (legA, legB and legC) are presented. The promoter regions of all three genes were found to be identical including the "TATA box", and "CAAT box', and sequences showing homology to the SV40 enhancers. The legA sequence begins to diverge from the others about 300bp from the start codon, whereas the other two genes remain identical for another 550bp. The regions of partial homology exhibit deletions or insertions and some short, comparatively well conserved sequences. The significance of these features is discussed in terms of evolutionary mechanisms and their possible functional roles. The legC gene contains a region that may potentially form either of two mutually exclusive stem-loop structures, one of which has a stem 42bp long, which suggests that it could be fairly stable. We suggest that a mechanism of switching between such alternative structures may play some role in gene control or may represent the insertion of a transposable element. PMID:2997721

  20. Interplay of Promoter Usage and Intragenic CpG Content: Impact on GFP Reporter Gene Expression.

    PubMed

    Krinner, Simone; Heitzer, Asli; Asbach, Benedikt; Wagner, Ralf

    2015-12-01

    Successful therapeutic protein production in vitro and in vivo requires efficient and long-term transgene expression supported by optimized vector and transgene cis-regulatory sequence elements. This study provides a comparative analysis of CpG-rich, highly expressed, versus CpG-depleted, poorly expressed green fluorescent protein (GFP) reporter transgenes, transcribed by various promoters in two different cell systems. Long-term GFP expression from a defined locus in stable Chinese hamster ovary cells was clearly influenced by the combination of transgene CpG content and promoter usage, as shown by differential silencing effects on selection pressure removal among the cytomegalovirus (CMV) promoter and elongation factor (EF)-1α promoter. Whereas a high intragenic CpG content promoted local DNA methylation, CpG depletion rather accelerated transgene loss and increased the local chromatin density. On lentiviral transfer of various expression modules into epigenetically sensitive P19 embryonic pluripotent carcinoma cells, CMV promoter usage led to rapid gene silencing irrespective of the intragenic CpG content. In contrast, EF-1α promoter-controlled constructs showed delayed silencing activity and high-level transgene expression, in particular when the CpG-rich GFP reporter was used. Notably, GFP silencing in P19 cells could be prevented completely by the bidirectional, dual divergently transcribed A2UCOE (ubiquitously acting chromatin-opening element derived from the human HNRPA2B1-CBX3 locus) promoter. Because the level of GFP expression by the A2UCOE promoter was entirely unaffected by the intragenic CpG level, we suggest that A2UCOE can overcome chromatin compaction resulting from intragenic CpG depletion due to its ascribed chromatin-opening abilities. Our analyses provide insights into the interplay of the intragenic CpG content with promoter sequences and regulatory sequence elements, thus contributing toward the design of therapeutic transgene expression

  1. Draft Genome Sequence of Burkholderia ambifaria RZ2MS16, a Plant Growth-Promoting Rhizobacterium Isolated from Guarana, a Tropical Plant.

    PubMed

    Batista, Bruna Durante; Taniguti, Lucas Mitsuo; Monteiro-Vitorello, Claudia Barros; Azevedo, João Lúcio; Quecine, Maria Carolina

    2016-03-17

    Burkholderia ambifaria strain RZ2MS16 was isolated from the rhizosphere of Amazon guarana in Brazil. This bacterium exhibits a remarkable capacity to promote the growth of corn and soybean. Here, we report the draft genome sequence of RZ2MS16 and some genes related to multiple traits involved in plant growth promotion.

  2. Draft Genome Sequence of Burkholderia ambifaria RZ2MS16, a Plant Growth-Promoting Rhizobacterium Isolated from Guarana, a Tropical Plant

    PubMed Central

    Batista, Bruna Durante; Taniguti, Lucas Mitsuo; Monteiro-Vitorello, Claudia Barros; Azevedo, João Lúcio

    2016-01-01

    Burkholderia ambifaria strain RZ2MS16 was isolated from the rhizosphere of Amazon guarana in Brazil. This bacterium exhibits a remarkable capacity to promote the growth of corn and soybean. Here, we report the draft genome sequence of RZ2MS16 and some genes related to multiple traits involved in plant growth promotion. PMID:26988044

  3. Inferring gene structures in genomic sequences using pattern recognition and expressed sequence tags.

    PubMed

    Xu, Y; Mural, R J; Uberbacher, E C

    1997-01-01

    Computational methods for gene identification in genomic sequences typically have two phases: coding region prediction and gene parsing. While there are many effective methods for predicting coding regions (exons), parsing the predicted exons into proper gene structures, to a large extent, remains an unsolved problem. This paper presents an algorithm for inferring gene structures from predicted exon candidates, based on Expressed Sequence Tags (ESTs) and biological intuition/rules. The algorithm first finds all the related ESTs in the EST database (dbEST) for each predicted exon, and infers the boundaries of one or a series of genes based on the available EST information and biological rules. Then it constructs gene models within each pair of gene boundaries, that are most consistent with the EST information. By exploiting EST information and biological rules, the algorithm can (1) model complicated multiple gene structures, including embedded genes, (2) identify falsely-predicted exons and locate missed exons, and (3) make more accurate exon boundary predictions. The algorithm has been implemented and tested on long genomic sequences with a number of genes. Test results show that very accurate (predicted) gene models can be expected when related ESTs exist for the predicted exons.

  4. Inferring gene structures in genomic sequences using pattern recognition and expressed sequence tags

    SciTech Connect

    Xu, Y.; Mural, R.; Uberbacher, E.

    1997-02-01

    Computational methods for gene identification in genomic sequences typically have two phases: coding region prediction and gene parsing. While there are many effective methods for predicting coding regions (exons), parsing the predicted exons into proper gene structures, to a large extent, remains an unsolved problem. This paper presents an algorithm for inferring gene structures from predicted exon candidates, based on Expressed Sequence Tags (ESTs) and biological intuition/rules. The algorithm first finds all the related ESTs in the EST database (dbEST) for each predicted exon, and infers the boundaries of one or a series of genes based on the available EST information and biological rules. Then it constructs gene models within each pair of gene boundaries, that are most consistent with the EST information. By exploiting EST information and biological rules, the algorithm can (1) model complicated multiple gene structures, including embedded genes, (2) identify falsely-predicted exons and locate missed exons, and (3) make more accurate exon boundary predictions. The algorithm has been implemented and tested on long genomic sequences with a number of genes. Test results show that very accurate (predicted) gene models can be expected when related ESTs exist for the predicted exons.

  5. Functional analysis of the promoter of the heat shock cognate 70 gene of the Pacific white shrimp, Litopenaeus vannamei.

    PubMed

    Zhao, Cui; Zhang, Xiaojun; Li, Fuhua; Huan, Pin; Xiang, Jianhai

    2013-01-01

    Current knowledge on cis-regulatory elements of immune genes of the Pacific white shrimp (Litopenaeus vannamei) is poor. In this study, we identified the promoter of the heat shock cognate protein 70 (HSC70) gene of L. vannamei (lvhsc70). The promoter activity of lvhsc70 promoter was analyzed in insect sf9 cell lines. First, the putative promoter sequence was proved to be able to drive the expression of reporter EGFP gene successfully. Then serial deletion experiments were conducted to investigate functional transcription elements in the promoter region. The results revealed that both positive and negative transcription elements existed in this region. These results are quite different from the previous report on the promoter of HSC70 gene in Penaeus monodon (pmhsc70), where only positive transcription elements were indicated. The sequences that are not conserved between the promoters of lvhsc70 and pmhsc70 might contribute to the differences. Finally, we tested the effect of a putative "NF-κb binding site" in the promoter and, surprisingly, found that deletion of this site would result in a significantly enhancement of the expression of reporter genes, while the underlying mechanisms remain unrevealed. Our results would provide supports for future studies to identify the functional transcription elements in the lvhsc70 promoter and to expand our knowledge on regulation of innate immune genes in penaeid shrimp.

  6. (Gene sequencing by scanning molecular exciton microscopy)

    SciTech Connect

    Not Available

    1991-01-01

    This report details progress made in setting up a laboratory for optical microscopy of genes. The apparatus including a fluorescence microscope, a scanning optical microscope, various spectrometers, and supporting computers is described. Results in developing photon and exciton tips, and in preparing samples are presented. (GHH)

  7. A novel DNA replication origin identified in the human heat shock protein 70 gene promoter.

    PubMed Central

    Taira, T; Iguchi-Ariga, S M; Ariga, H

    1994-01-01

    A general and sensitive method for the mapping of initiation sites of DNA replication in vivo, developed by Vassilev and Johnson, has revealed replication origins in the region of simian virus 40 ori, in the regions upstream from the human c-myc gene and downstream from the Chinese hamster dihydrofolate reductase gene, and in the enhancer region of the mouse immunoglobulin heavy-chain gene. Here we report that the region containing the promoter of the human heat shock protein 70 (hsp70) gene was identified as a DNA replication origin in HeLa cells by this method. Several segments of the region were cloned into pUC19 and examined for autonomously replicating sequence (ARS) activity. The plasmids carrying the segments replicated episomally and semiconservatively when transfected into HeLa cells. The segments of ARS activity contained the sequences previously identified as binding sequences for a c-myc protein complex (T. Taira, Y. Negishi, F. Kihara, S. M. M. Iguchi-Ariga, and H. Ariga, Biochem. Biophys. Acta 1130:166-174, 1992). Mutations introduced within the c-myc protein complex binding sequences abolished the ARS activity. Moreover, the ARS plasmids stably replicated at episomal state for a long time in established cell lines. The results suggest that the promoter region of the human hsp70 gene plays a role in DNA replication as well as in transcription. Images PMID:8065368

  8. The downstream regulatory sequence of the adenovirus type 2 major late promoter is functionally redundant.

    PubMed Central

    Li, X C; Huang, W L; Flint, S J

    1992-01-01

    Mutagenesis of promoter sequences and oligonucleotide competition assays have been used to demonstrate the late-phase-specific stimulation of the adenovirus type 2 major late promoter is mediated by functionally redundant elements located between positions +75 and +125. These octamer motif-related sequences are recognized by multiple factors. Images PMID:1501301

  9. Gene regulation: ancient microRNA target sequences in plants.

    PubMed

    Floyd, Sandra K; Bowman, John L

    2004-04-01

    MicroRNAs are an abundant class of small RNAs that are thought to regulate the expression of protein-coding genes in plants and animals. Here we show that the target sequence of two microRNAs, known to regulate genes in the class-III homeodomain-leucine zipper (HD-Zip) gene family of the flowering plant Arabidopsis, is conserved in homologous sequences from all lineages of land plants, including bryophytes, lycopods, ferns and seed plants. We also find that the messenger RNAs from these genes are cleaved within the same microRNA-binding site in representatives of each land-plant group, as they are in Arabidopsis. Our results indicate not only that microRNAs mediate gene regulation in non-flowering as well as flowering plants, but also that the regulation of this class of plant genes dates back more than 400 million years.

  10. The regions of sequence variation in caulimovirus gene VI.

    PubMed

    Sanger, M; Daubert, S; Goodman, R M

    1991-06-01

    The sequence of gene VI from figwort mosaic virus (FMV) clone x4 was determined and compared with that previously published for FMV clone DxS. Both clones originated from the same virus isolation, but the virus used to clone DxS was propagated extensively in a host of a different family prior to cloning whereas that used to clone x4 was not. Differences in the amino acid sequence inferred from the DNA sequences occurred in two clusters. An N-terminal conserved region preceded two regions of variation separated by a central conserved region. Variation in cauliflower mosaic virus (CaMV) gene VI sequences, all of which were derived from virus isolates from hosts from one host family, was similar to that seen in the FMV comparison, though the extent of variation was less. Alignment of gene VI domains from FMV and CaMV revealed regions of amino acid sequence identical in both viruses within the conserved regions. The similarity in the pattern of conserved and variable domains of these two viruses suggests common host-interactive functions in caulimovirus gene VI homologues, and possibly an analogy between caulimoviruses and certain animal viruses in the influence of the host on sequence variability of viral genes.

  11. Nucleotide sequence of the gene encoding the nitrogenase iron protein of Thiobacillus ferrooxidans

    SciTech Connect

    Pretorius, I.M.; Rawlings, D.E.; O'Neill, E.G.; Jones, W.A.; Kirby, R.; Woods, D.R.

    1987-01-01

    The DNA sequence was determined for the cloned Thiobacillus ferrooxidans nifH and part of the nifD genes. The DNA chains were radiolabeled with (..cap alpha..-/sup 32/P)dCTP (3000 Ci/mmol) or (..cap alpha..-/sup 35/S)dCTP (400 Ci/mmol). A putative T. ferrooxidans nifH promoter was identified whose sequences showed perfect consensus with those of the Klebsiella pneumoniae nif promoter. Two putative consensus upstream activator sequences were also identified. The amino acid sequence was deduced from the DNA sequence. In a comparison of nifH DNA sequences from T. ferrooxidans and eight other nitrogen-fixing microbes, a Rhizobium sp. isolated from Parasponia andersonii showed the greatest homology (74%) and Clostridium pasteurianum (nifH1) showed the least homology (54%). In the comparison of the amino acid sequences of the Fe proteins, the Rhizobium sp. and Rhizobium japonicum showed the greatest homology (both 86%) and C. pasteurianum (nifH1 gene product) demonstrated the least homology (56%) to the T. ferrooxidans Fe protein.

  12. Conserved cis-regulatory modules in promoters of genes encoding wheat high-molecular-weight glutenin subunits

    PubMed Central

    Ravel, Catherine; Fiquet, Samuel; Boudet, Julie; Dardevet, Mireille; Vincent, Jonathan; Merlino, Marielle; Michard, Robin; Martre, Pierre

    2014-01-01

    The concentration and composition of the gliadin and glutenin seed storage proteins (SSPs) in wheat flour are the most important determinants of its end-use value. In cereals, the synthesis of SSPs is predominantly regulated at the transcriptional level by a complex network involving at least five cis-elements in gene promoters. The high-molecular-weight glutenin subunits (HMW-GS) are encoded by two tightly linked genes located on the long arms of group 1 chromosomes. Here, we sequenced and annotated the HMW-GS gene promoters of 22 electrophoretic wheat alleles to identify putative cis-regulatory motifs. We focused on 24 motifs known to be involved in SSP gene regulation. Most of them were identified in at least one HMW-GS gene promoter sequence. A common regulatory framework was observed in all the HMW-GS gene promoters, as they shared conserved cis-regulatory modules (CCRMs) including all the five motifs known to regulate the transcription of SSP genes. This common regulatory framework comprises a composite box made of the GATA motifs and GCN4-like Motifs (GLMs) and was shown to be functional as the GLMs are able to bind a bZIP transcriptional factor SPA (Storage Protein Activator). In addition to this regulatory framework, each HMW-GS gene promoter had additional motifs organized differently. The promoters of most highly expressed x-type HMW-GS genes contain an additional box predicted to bind R2R3-MYB transcriptional factors. However, the differences in annotation between promoter alleles could not be related to their level of expression. In summary, we identified a common modular organization of HMW-GS gene promoters but the lack of correlation between the cis-motifs of each HMW-GS gene promoter and their level of expression suggests that other cis-elements or other mechanisms regulate HMW-GS gene expression. PMID:25429295

  13. The nucleotide sequence of the human beta-globin gene.

    PubMed

    Lawn, R M; Efstratiadis, A; O'Connell, C; Maniatis, T

    1980-10-01

    We report the complete nucleotide sequence of the human beta-globin gene. The purpose of this study is to obtain information necessary to study the evolutionary relationships between members of the human beta-like globin gene family and to provide the basis for comparing normal beta-globin genes with those obtained from the DNA of individuals with genetic defects in hemoglobin expression.

  14. Methylation Status of Vitamin D Receptor Gene Promoter in Benign and Malignant Adrenal Tumors

    PubMed Central

    Pilon, Catia; Rebellato, Andrea; Urbanet, Riccardo; Guzzardo, Vincenza; Cappellesso, Rocco; Sasano, Hironobu; Fassina, Ambrogio

    2015-01-01

    We previously showed a decreased expression of vitamin D receptor (VDR) mRNA/protein in a small group of adrenocortical carcinoma (ACC) tissues, suggesting the loss of a protective role of VDR against malignant cell growth in this cancer type. Downregulation of VDR gene expression may result from epigenetics events, that is, methylation of cytosine nucleotide of CpG islands in VDR gene promoter. We analyzed methylation of CpG sites in the VDR gene promoter in normal adrenals and adrenocortical tumor samples. Methylation of CpG-rich 5′ regions was assessed by bisulfite sequencing PCR using bisulfite-treated DNA from archival microdissected paraffin-embedded adrenocortical tissues. Three normal adrenals and 23 various adrenocortical tumor samples (15 adenomas and 8 carcinomas) were studied. Methylation in the promoter region of VDR gene was found in 3/8 ACCs, while no VDR gene methylation was observed in normal adrenals and adrenocortical adenomas. VDR mRNA and protein levels were lower in ACCs than in benign tumors, and VDR immunostaining was weak or negative in ACCs, including all 3 methylated tissue samples. The association between VDR gene promoter methylation and reduced VDR gene expression is not a rare event in ACC, suggesting that VDR epigenetic inactivation may have a role in adrenocortical carcinogenesis. PMID:26843863

  15. Coelacanth genome sequence reveals the evolutionary history of vertebrate genes.

    PubMed

    Noonan, James P; Grimwood, Jane; Danke, Joshua; Schmutz, Jeremy; Dickson, Mark; Amemiya, Chris T; Myers, Richard M

    2004-12-01

    The coelacanth is one of the nearest living relatives of tetrapods. However, a teleost species such as zebrafish or Fugu is typically used as the outgroup in current tetrapod comparative sequence analyses. Such studies are complicated by the fact that teleost genomes have undergone a whole-genome duplication event, as well as individual gene-duplication events. Here, we demonstrate the value of coelacanth genome sequence by complete sequencing and analysis of the protocadherin gene cluster of the Indonesian coelacanth, Latimeria menadoensis. We found that coelacanth has 49 protocadherin cluster genes organized in the same three ordered subclusters, alpha, beta, and gamma, as the 54 protocadherin cluster genes in human. In contrast, whole-genome and tandem duplications have generated two zebrafish protocadherin clusters comprised of at least 97 genes. Additionally, zebrafish protocadherins are far more prone to homogenizing gene conversion events than coelacanth protocadherins, suggesting that recombination- and duplication-driven plasticity may be a feature of teleost genomes. Our results indicate that coelacanth provides the ideal outgroup sequence against which tetrapod genomes can be measured. We therefore present L. menadoensis as a candidate for whole-genome sequencing.

  16. Noncoding RNA gene detection using comparative sequence analysis

    PubMed Central

    Rivas, Elena; Eddy, Sean R

    2001-01-01

    Background Noncoding RNA genes produce transcripts that exert their function without ever producing proteins. Noncoding RNA gene sequences do not have strong statistical signals, unlike protein coding genes. A reliable general purpose computational genefinder for noncoding RNA genes has been elusive. Results We describe a comparative sequence analysis algorithm for detecting novel structural RNA genes. The key idea is to test the pattern of substitutions observed in a pairwise alignment of two homologous sequences. A conserved coding region tends to show a pattern of synonymous substitutions, whereas a conserved structural RNA tends to show a pattern of compensatory mutations consistent with some base-paired secondary structure. We formalize this intuition using three probabilistic "pair-grammars": a pair stochastic context free grammar modeling alignments constrained by structural RNA evolution, a pair hidden Markov model modeling alignments constrained by coding sequence evolution, and a pair hidden Markov model modeling a null hypothesis of position-independent evolution. Given an input pairwise sequence alignment (e.g. from a BLASTN comparison of two related genomes) we classify the alignment into the coding, RNA, or null class according to the posterior probability of each class. Conclusions We have implemented this approach as a program, QRNA, which we consider to be a prototype structural noncoding RNA genefinder. Tests suggest that this approach detects noncoding RNA genes with a fair degree of reliability. PMID:11801179

  17. SxtA gene sequence analysis of dinoflagellate Alexandrium minutum

    NASA Astrophysics Data System (ADS)

    Norshaha, Safida Anira; Latib, Norhidayu Abdul; Usup, Gires; Yusof, Nurul Yuziana Mohd

    2015-09-01

    The dinoflagellate Alexandrium minutum is typically known for the production of potent neurotoxins such as saxitoxin, affecting the health of human seafood consumers via paralytic shellfish poisoning (PSP). These phenomena is related to the harmful algal blooms (HABs) that is believed to be influenced by environmental and nutritional factors. Previous study has revealed that SxtA gene is a starting gene that involved in the saxitoxin production pathway. The aim of this study was to analyse the sequence of the sxtA gene in A. minutum. The dinoflagellates culture was cultured at temperature 26°C with 16:8-hour light:dark photocycle. After the samples were harvested, RNA was extracted, complementary DNA (cDNA) was synthesised and amplified by polymerase chain reaction (PCR). The PCR products were then purified and cloned before sequenced. The SxtA sequence obtained was then analyzed in order to identify the presence of SxtA gene in Alexandrium minutum.

  18. Promoter region of the human platelet-derived growth factor A-chain gene

    SciTech Connect

    Takimoto, Yasuo; Wang, Zhao Yi; Kobler, K.; Deuel, T.F. )

    1991-03-01

    The platelet-derived growth factor (PDGF) A- and B-chain genes are widely expressed in mammalian tissues and their homodimeric gene products appear to regulate the autocrine growth of both normal and transformed cells. In this study, we analyzed the 5{prime} flanking sequences of the human PDGF A-chain gene to seek elements important to regulating its transcription. The promoter reigon was exceptionally G + C-rich and contained a TATA box but no CAAT box. The transcription start site was identified 845 base pairs 5{prime} to the translation initiation site by S1 nuclease mapping and by primer extension. Both in vitro transcription and transient expression of the chloramphenicol acetyltransferase gene linked to the PDGF A-chain 5{prime} flanking sequences established that the putative promoter region was active, and RNase H mapping established that the three characteristic mRNAs used the same transcription start site, which was used in normal endothelial cells and in two human tumor cell lines that express high levels of A-chain transcripts. The results extablished an exceptionally G + C-rich promoter region and a single transcription start site active for each of the three mRNAs of the PDGF A-chain gene. DNA sites of potential importance in mediating the activation of the PDGF A-chain gene in normal cells and in transformed cell lines expressing high levels of PDGF A-chain were identified.

  19. Promoter region of the human platelet-derived growth factor A-chain gene.

    PubMed Central

    Takimoto, Y; Wang, Z Y; Kobler, K; Deuel, T F

    1991-01-01

    The platelet-derived growth factor (PDGF) A- and B-chain genes are widely expressed in mammalian tissues and their homodimeric gene products appear to regulate the autocrine growth of both normal and transformed cells. In this study, we analyzed the 5' flanking sequences of the human PDGF A-chain gene to seek elements important to regulating its transcription. The promoter region was exceptionally G + C-rich and contained a "TATA box" but no "CAAT box." The transcription start site was identified 845 base pairs 5' to the translation initiation site by S1 nuclease mapping and by primer extension. Both in vitro transcription and transient expression of the chloramphenicol acetyltransferase gene linked to the PDGF A-chain 5' flanking sequences established that the putative promoter region was active, and RNase H mapping established that the three characteristic mRNAs (1.9, 2.3, and 2.8 kilobases) used the same transcription start site, which was used in normal endothelial cells and in two human tumor cell lines that express high levels of A-chain transcripts. The results established an exceptionally G + C-rich promoter region and a single transcription start site active for each of the three mRNAs of the PDGF A-chain gene. DNA sites of potential importance in mediating the activation of the PDGF A-chain gene in normal cells and in transformed cell lines expressing high levels of PDGF A chain were identified. Images PMID:1848007

  20. Sequence and analysis of the gene for bacteriophage T3 RNA polymerase.

    PubMed Central

    McGraw, N J; Bailey, J N; Cleaves, G R; Dembinski, D R; Gocke, C R; Joliffe, L K; MacWright, R S; McAllister, W T

    1985-01-01

    The RNA polymerases encoded by bacteriophages T3 and T7 have similar structures, but exhibit nearly exclusive template specificities. We have determined the nucleotide sequence of the region of T3 DNA that encodes the T3 RNA polymerase (the gene 1.0 region), and have compared this sequence with the corresponding region of T7 DNA. The predicted amino acid sequence of the T3 RNA polymerase exhibits very few changes when compared to the T7 enzyme (82% of the residues are identical). Significant differences appear to cluster in three distinct regions in the amino-terminal half of the protein. Analysis of the data from both enzymes suggests features that may be important for polymerase function. In particular, a region that differs between the T3 and T7 enzymes exhibits significant homology to the bi-helical domain that is common to many sequence-specific DNA binding proteins. The region that flanks the structural gene contains a number of regulatory elements including: a promoter for the E. coli RNA polymerase, a potential processing site for RNase III and a promoter for the T3 polymerase. The promoter for the T3 RNA polymerase is located only 12 base pairs distal to the stop codon for the structural gene. PMID:3903658

  1. Functional analysis of the Myostatin gene promoter in sheep.

    PubMed

    Du, Rong; An, XiaoRong; Chen, YongFu; Qin, Jian

    2007-10-01

    Compared with the understanding for the functional mechanism of the myostatin gene, little is known about the regulatory mechanism of the myostatin gene transcription and expression. To better understand the function of the myostatin gene promoter (MSTNpro) in the transcriptional regulation of the myostatin gene and to further investigate the transcriptional regulation mechanism of the myostatin gene, the promoter region of the myostatin gene in sheep has been cloned in our recent study (AY918121). In this study, the wild (W) type MSTNPro(W)-EGFP vectors and E-box (E) (CANNTG) mutant (M) type MSTNPro(E(3+5+7)M)-EGFP vectors were constructed and the transcriptional regulation activities were compared by detecting the fluorescent strength of EGFP (enhanced green fluorescent protein) in C2C12 myoblasts (or myotubes) and sheep fibroblasts transfected with the vectors. Results showed that the 0.3-1.2 kb sheep myostatin promoter could activate the transcription and expression of EGFP gene in C2C12 myoblasts to different extent and the 1.2 kb promoter was the strongest. However, fluorescence was not observed in the sheep fibroblasts transfected with the 1.2 kb sheep myostatin promoter. These results suggested that the specific nature of the myostatin gene expression in skeletal muscle was attributed to the specific nature of the myostatin promoter activity. The increasing growth density of C2C12 myoblasts inhibited the transcriptional regulation activity of the wild type sheep myostatin promoter by a mechanism of feedback. The transcriptional regulation activity of the 1.2 kb wild type sheep myostatin promoter increased significantly after C2C12 myoblasts were differentiated, while the activity of 1.2 kb E(3+5+7)-mutant type myostatin promoter had no obvious change. This result suggested that MyoD may be responsible for the difference of the myostatin gene transcription and expression between growing and differentiating conditions by binding to E-box of the myostatin

  2. Nucleotide sequence of the pyruvate decarboxylase gene from Zymomonas mobilis.

    PubMed

    Neale, A D; Scopes, R K; Wettenhall, R E; Hoogenraad, N J

    1987-02-25

    Pyruvate decarboxylase (EC 4.1.1.1), the penultimate enzyme in the alcoholic fermentation pathway of Zymomonas mobilis, converts pyruvate to acetaldehyde and carbon dioxide. The complete nucleotide sequence of the structural gene encoding pyruvate decarboxylase from Zymomonas mobilis has been determined. The coding region is 1704 nucleotides long and encodes a polypeptide of 567 amino acids with a calculated subunit mass of 60,790 daltons. The amino acid sequence was confirmed by comparison with the amino acid sequence of a selection of tryptic fragments of the enzyme. The amino acid composition obtained from the nucleotide sequence is in good agreement with that obtained experimentally.

  3. A short upstream promoter region mediates transcriptional regulation of the mouse doublecortin gene in differentiating neurons

    PubMed Central

    2010-01-01

    Background Doublecortin (Dcx), a MAP (Microtubule-Associated Protein), is transiently expressed in migrating and differentiating neurons and thereby characterizes neuronal precursors and neurogenesis in developing and adult neurogenesis. In addition, reduced Dcx expression during development has been related to appearance of brain pathologies. Here, we attempt to unveil the molecular mechanisms controlling Dcx gene expression by studying its transcriptional regulation during neuronal differentiation. Results To determine and analyze important regulatory sequences of the Dcx promoter, we studied a putative regulatory region upstream from the mouse Dcx coding region (pdcx2kb) and several deletions thereof. These different fragments were used in vitro and in vivo to drive reporter gene expression. We demonstrated, using transient expression experiments, that pdcx2kb is sufficient to control specific reporter gene expression in cerebellar cells and in the developing brain (E14.5). We determined the temporal profile of Dcx promoter activity during neuronal differentiation of mouse embryonic stem cells (mESC) and found that transcriptional activation of the Dcx gene varies along with neuronal differentiation of mESC. Deletion experiments and sequence comparison of Dcx promoters across rodents, human and chicken revealed the importance of a highly conserved sequence in the proximal region of the promoter required for specific and strong expression in neuronal precursors and young neuronal cells. Further analyses revealed the presence in this short sequence of several conserved, putative transcription factor binding sites: LEF/TCF (Lymphoid Enhancer Factor/T-Cell Factor) which are effectors of the canonical Wnt pathway; HNF6/OC2 (Hepatocyte Nuclear Factor-6/Oncecut-2) members of the ONECUT family and NF-Y/CAAT (Nuclear Factor-Y). Conclusions Studies of Dcx gene regulatory sequences using native, deleted and mutated constructs suggest that fragments located upstream of the

  4. Promoters for the human beta-hexosaminidase genes, HEXA and HEXB.

    PubMed

    Norflus, F; Yamanaka, S; Proia, R L

    1996-02-01

    Human lysosomal beta-hexosaminidases are encoded by two genes, HEXA and HEXB, specifying an alpha- and a beta-subunit, respectively. The subunits dimerize to form beta-hexosaminidase A (alpha beta), beta-hexosaminidase B (beta beta), and beta-hexosaminidase S (alpha alpha). This enzyme system has the capacity to degrade a variety of cellular substrates: oligosaccharides, glycosaminoglycans, and glycolipids containing beta-linked N-acetylglucosaminyl or N-galactosaminyl residues. Mutations in either the HEXA gene or HEXB gene lead to an accumulation of GM2 ganglioside in neurons, resulting in the severe neurodegenerative disorders termed the GM2 gangliosidoses. To identify the DNA elements responsible for hexosaminidase expression, we ligated the 5'-flanking sequences of both the human and mouse hexosaminidase genes to a chloramphenicol acetyltransferase (CAT) gene. The resulting plasmids were transfected into NIH-3T3 cells and CAT activity was determined as a measure of promoter strength. By 5' deletion analysis, it was found that essential sequences for HEXA expression resided within a 40-bp region between 100 bp and 60 bp upstream of the ATG initiation codon. This area contained two potential estrogen response element half-sites as well as potential binding sites for transcription factors NF-E1 and AP-2. Similarly, important HEXB promoter sequences were localized to a 60-bp region between 150 bp and 90 bp upstream of the ATG codon. By performing scanning mutagenesis on a 60-bp region within the 150-bp HEXB construct, we defined an essential promoter element of 12 bp that contained two potential AP-1 sites. The mouse Hexa and Hexb 5'-flanking sequences were found to contain regions similar in sequence, location, and activity to the essential promoter elements defined in the cognate human genes. No sequence similarity was found, however, between 5'-flanking regions of the HEXA and HEXB genes. These essential promoter elements represent potential sites for HEXA and

  5. Coupling sequencing by hybridization (SBH) with gel sequencing for an inexpensive analysis of genes and genomes

    SciTech Connect

    Drmanac, S.; Labat, I.; Hauser, B.; Drmanac, R.

    1996-11-01

    The speed and cost of DNA sequencing are bottlenecks in the analysis of genes end genomes. Sequencing by hybridization (SBH) is a versatile method with several applications which can accelerated DNA screening, mapping and sequencing. Requirements, achievements and problems in the development of the SBH format 1 (DNA samples arrayed) are presented and schemes for its synergetic coupling with gel sequencing techniques are discussed. It appears that by one hybridization machine with 24 boxes and four ABI gel sequencers 100- 300 Mb of DNA sequence can be determined per year. Various genetic studies based on computer assisted analysis of large collections of partial or complete DNA sequences (`sequenetics`) may be achieved in this century.

  6. Genome Sequence of the Plant Growth Promoting Endophytic Bacterium Enterobacter sp. 638

    SciTech Connect

    Taghavi, S.; van der Lelie, D.; Hoffman, A.; Zhang, Y.-B.; Walla, M. D.; Vangronsveld, J.; Newman, L.; Monchy, S.

    2010-05-13

    Enterobacter sp. 638 is an endophytic plant growth promoting gamma-proteobacterium that was isolated from the stem of poplar (Populus trichocarpa x deltoides cv. H11-11), a potentially important biofuel feed stock plant. The Enterobacter sp. 638 genome sequence reveals the presence of a 4,518,712 bp chromosome and a 157,749 bp plasmid (pENT638-1). Genome annotation and comparative genomics allowed the identification of an extended set of genes specific to the plant niche adaptation of this bacterium. This includes genes that code for putative proteins involved in survival in the rhizosphere (to cope with oxidative stress or uptake of nutrients released by plant roots), root adhesion (pili, adhesion, hemagglutinin, cellulose biosynthesis), colonization/establishment inside the plant (chemiotaxis, flagella, cellobiose phosphorylase), plant protection against fungal and bacterial infections (siderophore production and synthesis of the antimicrobial compounds 4-hydroxybenzoate and 2-phenylethanol), and improved poplar growth and development through the production of the phytohormones indole acetic acid, acetoin, and 2,3-butanediol. Metabolite analysis confirmed by quantitative RT-PCR showed that, the production of acetoin and 2,3-butanediol is induced by the presence of sucrose in the growth medium. Interestingly, both the genetic determinants required for sucrose metabolism and the synthesis of acetoin and 2,3-butanediol are clustered on a genomic island. These findings point to a close interaction between Enterobacter sp. 638 and its poplar host, where the availability of sucrose, a major plant sugar, affects the synthesis of plant growth promoting phytohormones by the endophytic bacterium. The availability of the genome sequence, combined with metabolome and transcriptome analysis, will provide a better understanding of the synergistic interactions between poplar and its growth promoting endophyte Enterobacter sp. 638. This information can be further exploited to

  7. Inter-specific sequence conservation and intra-individual sequence variation in a spider silk gene.

    PubMed

    Tai, Pei-Ling; Hwang, Guang-Yuh; Tso, I-Min

    2004-10-01

    Currently, studies on major ampullate spidroin 1 (MaSp1) genes of non-orb weaving spiders are few, and it is not clear whether genes of these organisms exhibit the same characteristics as those of orb-weavers. In addition, many studies have proposed that MaSp1 might be a single gene with allelic variants, but supporting evidence is still lacking. In this study, we compared partial DNA and amino acid sequences of MaSp1 cloned from different spider guilds. We also cloned partial MaSp1 sequences from genomic DNA and cDNA of the same individuals of spiders using the same primer combination to see if different molecular forms existed. In the repetitive region of partial MaSp1 sequences obtained, GGX, GA and poly-A motifs were present in all Araneomorphae and Mygalomorpae species examined. An extreme similarity in MaSp1 non-repetitive portions was found in sequences of ecribellate, cribellate and Mygalomorphae web-builders and such a result suggested that this sequence might exhibit an important function. A comparison of sequences amplified from the same individual showed that substitutions in amino acids occurred in both repetitive and non-repetitive regions, with a much higher variation in the former. These results suggest that the MaSp1 of Araneomorphae spiders exhibits several forms in an individual spider and it might be either a multiple gene or a single gene with a multiple exon/intron organization.

  8. Sequence requirements for transcriptional arrest in exon 1 of the human adenosine deaminase gene

    SciTech Connect

    Zhi Chen; Kellems, R.E.; Innis, J.W. ); Sun, Minghua; Wright, D.A. )

    1991-12-01

    The authors have previously demonstrated that a transcriptional arrest site exists in exon 1 of the human adenosine deaminase (ADA) gene and that this site may play a role in ADA gene expression. Sequences involved in this process are not known precisely. To further define the template requirements for transcriptional arrest within exon 1 of the human ADA gene, various ADA templates were constructed and their abilities to confer transcriptional arrest were determined following injection into Xenopus oocytes. The exon 1 transcriptional arrest signal functioned downstream of several RNA polymerase II promoters and an RNA polymerase II promoter, implying that the transcriptional arrest site in exon 1 of the ADA gene is promoter independent. They identified a 43-bp DNA fragment which functions as a transcriptional arrest signal. Additional studies showed that the transcriptional arrest site functioned only in the naturally occurring orientation. Therefore, they have identified a 43-bp DNA fragment which functions as a transcriptional arrest signal in an orientation-dependent and promoter-independent manner. On the basis of the authors findings, they hypothesize that tissue-specific expression of the ADA gene is governed by factors that function as antiterminators to promote transcriptional readthrough of the exon 1 transcriptional arrest site.

  9. DNA sequence of 15 base pairs is sufficient to mediate both glucocorticoid and progesterone induction of gene expression

    SciTech Connect

    Straehle, U.; Klock, G.; Schuetz, G.

    1987-11-01

    To define the recognition sequence of the glucocorticoid receptor and its relationship with that of the progesterone receptor, oligonucleotides derived from the glucocorticoid response element of the tyrosine aminotransferase gene were tested upstream of a heterologous promoter for their capacity to mediate effects of these two steroids. The authors show that a 15-base-pair sequence with partial symmetry is sufficient to confer glucocorticoid inducibility on the promoter of the herpes simplex virus thymidine kinase gene. The same 15-base-pair sequence mediates induction by progesterone. Point mutations in the recognition sequence affect inducibility by glucocorticoids and progesterone similarly. Together with the strong conservation of the sequence of the DNA-binding domain of the two receptors, these data suggest that both proteins recognize a sequence that is similar, if not the same.

  10. Two distinct factors interact with the promoter regions of several liver-specific genes.

    PubMed Central

    Hardon, E M; Frain, M; Paonessa, G; Cortese, R

    1988-01-01

    A segment of the human alpha 1-antitrypsin (alpha 1AT) 5'-flanking region comprising nucleotides -137 to -37 from the start of transcription is sufficient to drive liver-specific transcription from the homologous alpha 1AT promoter and from the heterologous SV40 promoter. In this paper we characterize two proteins, LF-A1 and LF-B1, whose ability to bind wild-type and mutant alpha 1AT promoter segments correlates with the ability of these segments to activate transcription in vivo. DNase I protection and methylation interference analysis reveals that LF-A1 recognizes sequences present in the regulatory region of the human alpha 1-antitrypsin, apolipoprotein A1 and haptoglobin-related genes. These sequences share a common 5' TGG/A A/C CC 3' motif. LF-B1 binds to the palindrome 5' TGGTTAAT/ATTCACCA 3' which is present in the human alpha 1-antitrypsin gene between positions -78 and -62 from the start of transcription. LF-B1 also recognizes a related sequence present in the human albumin gene between -66 and -50. These results suggest that LF-A1 and LF-B1 are common positive trans-acting factors which are required for the expression of several genes in the hepatocyte. Images PMID:2844524

  11. Isolation and Functional Characterization of a Lycopene β-cyclase Gene Promoter from Citrus

    PubMed Central

    Lu, Suwen; Zhang, Yin; Zheng, Xiongjie; Zhu, Kaijie; Xu, Qiang; Deng, Xiuxin

    2016-01-01

    Lycopene β-cyclases are key enzymes located at the branch point of the carotenoid biosynthesis pathway. However, the transcriptional regulatory mechanisms of LCYb1 in citrus with abundant carotenoid accumulation are still unclear. To understand the molecular basis of CsLCYb1 expression, we isolated and functionally characterized the 5′ upstream sequences of CsLCYb1 from citrus. The full-length CsLCYb1 promoter and a series of its 5′ deletions were fused to the β-glucuronidase (GUS) reporter gene and transferred into different plants (tomato, Arabidopsis and citrus callus) to test the promoter activities. The results of all transgenic species showed that the 1584 bp upstream region from the translational start site displayed maximal promoter activity, and the minimal promoter containing 746 bp upstream sequences was sufficient for strong basal promoter activity. Furthermore, the CsLCYb1 promoter activity was developmentally and tissue-specially regulated in transgenic Arabidopsis, and it was affected by multiple hormones and environmental cues in transgenic citrus callus under various treatments. Finer deletion analysis identified an enhancer element existing as a tandem repeat in the promoter region between -574 to -513 bp and conferring strong promoter activity. The copy numbers of the enhancer element differed among various citrus species, leading to the development of a derived simple sequence repeat marker to distinguish different species. In conclusion, this study elucidates the expression characteristics of the LCYb1 promoter from citrus and further identifies a novel enhancer element required for the promoter activity. The characterized promoter fragment would be an ideal candidate for genetic engineering and seeking of upstream trans-acting elements. PMID:27679644

  12. Cloning and characterization of the human trefoil factor 3 gene promoter.

    PubMed

    Sun, Yong; Wang, Liangxi; Zhou, Yifang; Mao, Xuefei; Deng, Xiangdong

    2014-01-01

    Human trefoil factor 3 (hTFF3) is a small-molecule peptide with potential medicinal value. Its main pharmacological function is to alleviate gastrointestinal mucosal injuries caused by various factors and promote the repair of damaged mucosa. However, how its transcription is regulated is not yet known. The aim of this study was to clone the hTFF3 gene promoter region, identify the core promoter and any transcription factors that bind to the promoter, and begin to clarify the regulation of its expression. The 5' flanking sequence of the hTFF3 gene was cloned from human whole blood genomic DNA by PCR. Truncated promoter fragments with different were cloned and inserted into the pGL3-Basic vector to determine the position of the core hTFF3 promoter. Transcription element maintaining basic transcriptional activity was assessed by mutation techniques. Protein-DNA interactions were analyzed by chromatin immunoprecipitation (ChIP). RNA interference and gene over-expression were performed to assay the effect of transcription factor on the hTFF3 expression. The results showed that approximately 1,826 bp of the fragment upstream of hTFF3 was successfully amplified, and its core promoter region was determined to be from -300 bp to -280 bp through analysis of truncated mutants. Mutation analysis confirmed that the sequence required to maintain basic transcriptional activity was accurately positioned from -300 bp to -296 bp. Bioinformatic analysis indicated that this area contained a Sp1 binding site. Sp1 binding to the hTFF3 promoter was confirmed by ChIP experiments. Sp1 over-expression and interference experiments showed that Sp1 enhanced the transcriptional activity of the hTFF3 promoter and increased hTFF3 expression. This study demonstrated that Sp1 plays an important role in maintaining the transcription of hTFF3.

  13. Lactase gene promoter fragments mediate differential spatial and temporal expression patterns in transgenic mice.

    PubMed

    Wang, Zhi; Maravelias, Charalambos; Sibley, Eric

    2006-04-01

    Lactase gene expression is spatiotemporally regulated during mammalian gut development. We hypothesize that distinct DNA control regions specify appropriate spatial and temporal patterning of lactase gene expression. In order to define regions of the lactase promoter involved in mediating intestine-specific and spatiotemporal restricted expression, transgenic mice harboring 100 bp, 1.3- and 2.0- kb fragments of the 5' flanking region of the rat lactase gene cloned upstream of a luciferase reporter were characterized. The 100-bp lactase promoter-reporter transgenic mouse line expressed maximal luciferase activity in the intestine with a posterior shift in spatial restriction and ectopic expression in the stomach and lung. The temporal pattern of expression mediated by the 1.3-kb promoter?reporter transgene increases with postnatal maturation in contrast with the postnatal decline mediated by the 2.0-kb promoter-reporter transgene and the endogenous lactase gene. The differential transgene expression patterns mediated by the lactase promoter fragments suggests that intestine-specific spatial and temporal control elements reside in distinct regions of the DNA sequences upstream of the lactase gene transcription start-site.

  14. Identification of an upstream regulatory sequence that mediates the transcription of mox genes in Methylobacterium extorquens AM1.

    PubMed

    Zhang, Meng; FitzGerald, Kelly A; Lidstrom, Mary E

    2005-11-01

    A multiple A-tract sequence has been identified in the promoter regions for the mxaF, pqqA, mxaW, mxbD and mxcQ genes involved in methanol oxidation in Methylobacterium extorquens AM1, a facultative methylotroph. Site-directed mutagenesis was exploited to delete or change this conserved sequence. Promoter-xylE transcriptional fusions were used to assess promoter activity in these mutants. A fiftyfold drop in the XylE activity was observed for the mxaF and pqqA promoters without this sequence, and a five- to sixfold drop in the XylE activity was observed for the mxbD and mxcQ promoters without this sequence. Mutants were generated in the chromosomal copies in which this sequence was either deleted or altered, and these mutants were unable to grow on methanol. When one of these sequences was added to Plac of Escherichia coli, which is a weak constitutive promoter in M. extorquens AM1, the activity increased two- to threefold. These results suggest that this sequence is essential for normal expression of these genes in M. extorquens AM1, and may serve as a general enhancer element for genetic constructs in this bacterium.

  15. DNA sequence of the araBAD promoter in Escherichia coli B/r.

    PubMed

    Greenfield, L; Boone, T; Wilcox, G

    1978-10-01

    The L-arabinose operon in Escherichia coli is a model system for the study of the control of gene expression. Maximal expression of the araBAD operon requires two positive control components: the araC protein-L-arabinose complex and the cyclic AMP receptor protein-cyclic AMP complex. Both araC protein and cyclic AMP receptor protein are required for the initiation of transcription of araBAD mRNA. We have used the plasmid pBR322 as a vector for cloning DNA fragments that contain the araBAD promoter. The cloned ara fragments were identified by both physical and genetic tests. A restriction map was constructed and the DNA sequence of the promoter was determined. The promoter contains a site that is similar to the RNA polymerase recognition sites in the galactose and lactose operons. It also contains a region similar to the known cyclic AMP receptor protein binding sites in the galactose and lactose operons.

  16. Insights into corn genes derived from large-scale cDNA sequencing.

    PubMed

    Alexandrov, Nickolai N; Brover, Vyacheslav V; Freidin, Stanislav; Troukhan, Maxim E; Tatarinova, Tatiana V; Zhang, Hongyu; Swaller, Timothy J; Lu, Yu-Ping; Bouck, John; Flavell, Richard B; Feldmann, Kenneth A

    2009-01-01

    We present a large portion of the transcriptome of Zea mays, including ESTs representing 484,032 cDNA clones from 53 libraries and 36,565 fully sequenced cDNA clones, out of which 31,552 clones are non-redundant. These and other previously sequenced transcripts have been aligned with available genome sequences and have provided new insights into the characteristics of gene structures and promoters within this major crop species. We found that although the average number of introns per gene is about the same in corn and Arabidopsis, corn genes have more alternatively spliced isoforms. Examination of the nucleotide composition of coding regions reveals that corn genes, as well as genes of other Poaceae (Grass family), can be divided into two classes according to the GC content at the third position in the amino acid encoding codons. Many of the transcripts that have lower GC content at the third position have dicot homologs but the high GC content transcripts tend to be more specific to the grasses. The high GC content class is also enriched with intronless genes. Together this suggests that an identifiable class of genes in plants is associated with the Poaceae divergence. Furthermore, because many of these genes appear to be derived from ancestral genes that do not contain introns, this evolutionary divergence may be the result of horizontal gene transfer from species not only with different codon usage but possibly that did not have introns, perhaps outside of the plant kingdom. By comparing the cDNAs described herein with the non-redundant set of corn mRNAs in GenBank, we estimate that there are about 50,000 different protein coding genes in Zea. All of the sequence data from this study have been submitted to DDBJ/GenBank/EMBL under accession numbers EU940701-EU977132 (FLI cDNA) and FK944382-FL482108 (EST).

  17. DNA sequence, products, and transcriptional pattern of the genes involved in production of the DNA replication inhibitor microcin B17.

    PubMed Central

    Genilloud, O; Moreno, F; Kolter, R

    1989-01-01

    The 3.8-kilobase segment of plasmid DNA that contains the genes required for production of the DNA replication inhibitor microcin B17 was sequenced. The sequence contains four open reading frames which were shown to be translated in vivo by the construction of fusions to lacZ. The location of these open reading frames fits well with the location of the four microcin B17 production genes, mcbABCD, identified previously through genetic complementation. The products of the four genes have been identified, and the observed molecular weights of the proteins agree with those predicted from the nucleotide sequence. The transcription of these genes was studied by using fusions to lacZ and physical mapping of mRNA start sites. Three promoters were identified in this region. The major promoter for all the genes is a growth phase-regulated OmpR-dependent promoter located upstream of mcbA. A second promoter is located within mcbC and is responsible for a low-level basal expression of mcbD. A third promoter, located within mcbD, promotes transcription in the reverse direction starting within mcbD and extending through mcbC. The resulting mRNA appears to be an untranslated antisense transcript that could play a regulatory role in the expression of these genes. Images PMID:2644225

  18. Multiplexed CRISPR/Cas9- and TAR-Mediated Promoter Engineering of Natural Product Biosynthetic Gene Clusters in Yeast.

    PubMed

    Kang, Hahk-Soo; Charlop-Powers, Zachary; Brady, Sean F

    2016-09-16

    The use of DNA sequencing to guide the discovery of natural products has emerged as a new paradigm for revealing chemistries encoded in bacterial genomes. A major obstacle to implementing this approach to natural product discovery is the transcriptional silence of biosynthetic gene clusters under laboratory growth conditions. Here we describe an improved yeast-based promoter engineering platform (mCRISTAR) that combines CRISPR/Cas9 and TAR to enable single-marker multiplexed promoter engineering of large gene clusters. mCRISTAR highlights the first application of the CRISPR/Cas9 system to multiplexed promoter engineering of natural product biosynthetic gene clusters. In this method, CRISPR/Cas9 is used to induce DNA double-strand breaks in promoter regions of biosynthetic gene clusters, and the resulting operon fragments are reassembled by TAR using synthetic gene-cluster-specific promoter cassettes. mCRISTAR uses a CRISPR array to simplify the construction of a CRISPR plasmid for multiplex CRISPR and a single auxotrophic selection to improve the inefficiency of using a CRISPR array for multiplex gene cluster refactoring. mCRISTAR is a simple and generic method for multiplexed replacement of promoters in biosynthetic gene clusters that will facilitate the discovery of natural products from the rapidly growing collection of gene clusters found in microbial genome and metagenome sequencing projects.

  19. Sequence diversity of mating-type genes in Phaeosphaeria avenaria.

    PubMed

    Ueng, Peter P; Dai, Qun; Cui, Kai-rong; Czembor, Paweł C; Cunfer, Barry M; Tsang, H; Arseniuk, Edward; Bergstrom, Gary C

    2003-05-01

    Phaeosphaeria avenaria, one of the causal agents of stagonospora leaf blotch diseases in cereals, is composed of two subspecies, P. avenaria f. sp. triticea (Pat) and P. avenaria f. sp. avenaria (Paa). The Pat subspecies was grouped into Pat1-Pat3, based on restriction fragment length polymorphism (RFLP) and ribosomal DNA (rDNA) internal transcribed spacer (ITS) sequences in previous studies. Mating-type genes and their potential use in phylogeny and molecular classification were studied by DNA hybridization and PCR amplification. The majority of Pat1 isolates reported to be homothallic and producing sexual reproduction structures on cultural media had only the MAT1-1 gene. Minor sequence variations were found in the conserved region of MAT1-1 gene in Pat1 isolates. However, both mating-type genes, MAT1-1 and MAT1-2, were identified in P. avenaria isolates represented by ATCC12277 from oats (Paa) and the Pat2 isolates from foxtail barley ( Hordeum jubatum L.). Cluster analyses based on mating-type gene conserved regions revealed that cereal Phaeosphaeria is not phylogenetically closely related to other ascomycetes, including Mycosphaerella graminicola (anamorph Septoria tritici). The sequence diversity of mating-type genes in Pat and Paa supports our previous phylogenetic relationship and molecular classification based on RFLP fingerprinting and rDNA ITS sequences.

  20. Identification of learning and memory genes in canine; promoter investigation and determining the selective pressure.

    PubMed

    Seifi Moroudi, Reihane; Masoudi, Ali Akbar; Vaez Torshizi, Rasoul; Zandi, Mohammad

    2014-12-01

    One of the important behaviors of dogs is trainability which is affected by learning and memory genes. These kinds of the genes have not yet been identified in dogs. In the current research, these genes were found in animal models by mining the biological data and scientific literatures. The proteins of these genes were obtained from the UniProt database in dogs and humans. Not all homologous proteins perform similar functions, thus comparison of these proteins was studied in terms of protein families, domains, biological processes, molecular functions, and cellular location of metabolic pathways in Interpro, KEGG, Quick Go and Psort databases. The results showed that some of these proteins have the same performance in the rat or mouse, dog, and human. It is anticipated that the protein of these genes may be effective in learning and memory in dogs. Then, the expression pattern of the recognized genes was investigated in the dog hippocampus using the existing information in the GEO profile. The results showed that BDNF, TAC1 and CCK genes are expressed in the dog hippocampus, therefore, these genes could be strong candidates associated with learning and memory in dogs. Subsequently, due to the importance of the promoter regions in gene function, this region was investigated in the above genes. Analysis of the promoter indicated that the HNF-4 site of BDNF gene and the transcription start site of CCK gene is exposed to methylation. Phylogenetic analysis of protein sequences of these genes showed high similarity in each of these three genes among the studied species. The dN/dS ratio for BDNF, TAC1 and CCK genes indicates a purifying selection during the evolution of the genes.

  1. Cloning, sequencing and transcriptional analysis of the Choristoneura fumiferana entomopoxvirus spheroidin gene.

    PubMed

    Li, X; Barrett, J W; Yuen, L; Arif, B M

    1997-02-01

    The Choristoneura fumiferana entomopoxvirus (CfEPV) spheroidin gene was identified and localized on three XbaI restriction fragments (total size 4.73 kb). The fragments were cloned and sequenced. The spheroidin gene had an open reading frame of 2997 nucleotides encoding a putative protein with a predicted size of 115 kDa. Sequence analysis indicated that the putative protein contained 14 potential N-glycosylation sites (Asn-X-Thr; Asn-X-Ser), that are probably not used since the protein migrates on SDS-PAGE as a 115 kDa band. The protein is rich in cysteine residues (34), which explains the need for reducing agents when dissolving the occlusion bodies with alkali. The spheroidin gene sequence contains motifs characteristic of the late genes of poxviruses. These include the typical TAAATG sequence at the beginning of the coding region and two early gene termination signals (TTTTTNT) in the untranslated region of the gene. The promoter region has three TAA termination signals immediately upstream of the ATG start site. Spheroidin (SPH) appears to be conserved among different EPVs. There was 82.2% identity and 97.2% similarity at the amino acid level between the SPHs of CfEPV and Amsacta moorei EPV. Less conservation was seen with the SPH from Melolontha melolontha EPV (39.8% identity and 73.4% similarity). Transcriptional analyses of the spheroidin gene by Northern blots showed that the transcript had a size of approximately 3 kb, which is in agreement with the length of the ORF. Primer extension results, anchor PCR and sequencing confirmed that there was a poly (A)17 tract at the 5' end of the spheroidin gene transcript, a structure typical of late gene transcripts of poxviruses.

  2. Characterization of the Promoter Region of Biosynthetic Enzyme Genes Involved in Berberine Biosynthesis in Coptis japonica

    PubMed Central

    Yamada, Yasuyuki; Yoshimoto, Tadashi; Yoshida, Sayumi T.; Sato, Fumihiko

    2016-01-01

    The presence of alkaloids is rather specific to certain plant species. However, berberine, an isoquinoline alkaloid, is relatively broadly distributed in the plant kingdom. Thus, berberine biosynthesis has been intensively investigated, especially using Coptis japonica cell cultures. Almost all biosynthetic enzyme genes have already been characterized at the molecular level. Particularly, two transcription factors (TFs), a plant-specific WRKY-type TF, CjWRKY1, and a basic helix-loop-helix TF, CjbHLH1, were shown to comprehensively regulate berberine biosynthesis in C. japonica cells. In this study, we characterized the promoter region of some biosynthetic enzyme genes and associated cis-acting elements involved in the transcriptional regulation via two TFs. The promoter regions of three berberine biosynthetic enzyme genes (CYP80B2, 4′OMT and CYP719A1) were isolated, and their promoter activities were dissected by a transient assay involving the sequentially truncated promoter::luciferase (LUC) reporter constructs. Furthermore, transactivation activities of CjWRKY1 were determined using the truncated promoter::LUC reporter constructs or constructs with mutated cis-elements. These results suggest the involvement of a putative W-box in the regulation of biosynthetic enzyme genes. Direct binding of CjWRKY1 to the W-box DNA sequence was also confirmed by an electrophoresis mobility shift assay and by a chromatin immunoprecipitation assay. In addition, CjbHLH1 also activated transcription from truncated 4′OMT and CYP719A1 promoters independently of CjWRKY1, suggesting the involvement of a putative E-box. Unexpected transcriptional activation of biosynthetic enzyme genes via a non-W-box sequence and by CjWRKY1 as well as the possible involvement of a GCC-box in berberine biosynthesis in C. japonica are discussed. PMID:27642289

  3. Illumina MiSeq sequencing disfavours a sequence motif in the GFP reporter gene

    PubMed Central

    Van den Hoecke, Silvie; Verhelst, Judith; Saelens, Xavier

    2016-01-01

    Green fluorescent protein (GFP) is one of the most used reporter genes. We have used next-generation sequencing (NGS) to analyse the genetic diversity of a recombinant influenza A virus that expresses GFP and found a remarkable coverage dip in the GFP coding sequence. This coverage dip was present when virus-derived RT-PCR product or the parental plasmid DNA was used as starting material for NGS and regardless of whether Nextera XT transposase or Covaris shearing was used for DNA fragmentation. Therefore, the sequence coverage dip in the GFP coding sequence was not the result of emerging GFP mutant viruses or a bias introduced by Nextera XT fragmentation. Instead, we found that the Illumina MiSeq sequencing method disfavours the ‘CCCGCC’ motif in the GFP coding sequence. PMID:27193250

  4. Diverse nucleotide compositions and sequence fluctuation in Rubisco protein genes

    NASA Astrophysics Data System (ADS)

    Holden, Todd; Dehipawala, S.; Cheung, E.; Bienaime, R.; Ye, J.; Tremberger, G., Jr.; Schneider, P.; Lieberman, D.; Cheung, T.

    2011-10-01

    The Rubisco protein-enzyme is arguably the most abundance protein on Earth. The biology dogma of transcription and translation necessitates the study of the Rubisco genes and Rubisco-like genes in various species. Stronger correlation of fractal dimension of the atomic number fluctuation along a DNA sequence with Shannon entropy has been observed in the studied Rubisco-like gene sequences, suggesting a more diverse evolutionary pressure and constraints in the Rubisco sequences. The strategy of using metal for structural stabilization appears to be an ancient mechanism, with data from the porphobilinogen deaminase gene in Capsaspora owczarzaki and Monosiga brevicollis. Using the chi-square distance probability, our analysis supports the conjecture that the more ancient Rubisco-like sequence in Microcystis aeruginosa would have experienced very different evolutionary pressure and bio-chemical constraint as compared to Bordetella bronchiseptica, the two microbes occupying either end of the correlation graph. Our exploratory study would indicate that high fractal dimension Rubisco sequence would support high carbon dioxide rate via the Michaelis- Menten coefficient; with implication for the control of the whooping cough pathogen Bordetella bronchiseptica, a microbe containing a high fractal dimension Rubisco-like sequence (2.07). Using the internal comparison of chi-square distance probability for 16S rRNA (~ E-22) versus radiation repair Rec-A gene (~ E-05) in high GC content Deinococcus radiodurans, our analysis supports the conjecture that high GC content microbes containing Rubisco-like sequence are likely to include an extra-terrestrial origin, relative to Deinococcus radiodurans. Similar photosynthesis process that could utilize host star radiation would not compete with radiation resistant process from the biology dogma perspective in environments such as Mars and exoplanets.

  5. Draft Genome Sequence of Bacillus atrophaeus UCMB-5137, a Plant Growth-Promoting Rhizobacterium.

    PubMed

    Chan, Wai Yin; Dietel, Kristin; Lapa, Svitlana V; Avdeeva, Lilija V; Borriss, Rainer; Reva, Oleg N

    2013-06-20

    Bacillus atrophaeus UCMB-5137 shows an extraordinary activity in root colonization and plant and crop protection. Its draft genome sequence comprises 21 contigs of 4.11 Mb, harboring 4,167 coding sequences (CDS). The genome carries several genes encoding antimicrobial lipopeptides and polyketides. Multiple horizontally acquired genes of possible importance for plant colonization were also found.

  6. [A promoter responsible for over-expression of cholera toxin B subunit in cholera toxin A subunit structure gene].

    PubMed

    Cao, C; Shi, C; Li, P; Ma, Q

    1997-01-01

    A promoter sequence, which promotes the transcription of cholera toxin B subunit gene, was found in cholera toxin A subunit structure gene. The transcription starts at the adenine Located at +833, that is 456bp upstream to the A of the initiation codon ATG of cholera toxin B gene. Under the control of the promoter, cholera toxin B subunit was over-expressed as high as 200 mg/L at an optimized culture condition. The chloramphenicol acetyl transferase gene and beta-galactosidase could also be efficiently expressed under the direction of the promoter. This promoter may be responsible for the 6 fold and 7 fold higher expression level of cholera toxin B subunit than cholera toxin A subunit in V. cholerae and Escheria coli respectively. The over-expression of CTB may be useful in preparing vaccine against cholera and facilitating the construction of peptide-bearing immunogenic hybrid proteins.

  7. Nucleotide sequence and transcriptional analysis of the type A2 neurotoxin gene cluster in Clostridium botulinum.

    PubMed

    Dineen, Sean S; Bradshaw, Marite; Karasek, Charles E; Johnson, Eric A

    2004-06-01

    The nucleotide sequences of the upstream regions of the botulinum neurotoxin type A1 (BoNT/A1) cluster of Clostridium botulinum strain NCTC 2916 and the BoNT/A2 cluster of strain Kyoto-F were determined. A novel gene, designated orfx3, was identified following the orfx2 gene in both clusters. ORF-X2 and ORF-X3 exhibit similarity to the BoNT cluster associated P-47 protein. The BoNT/A1 and BoNT/A2 clusters share a similar gene arrangement, but exhibit differences in the spacing between certain genes. Sequences with similarity to transposases were identified in these intergenic regions, suggesting that these differences arose from an ancestral insertion event. Transcriptional analysis of the BoNT/A2 cluster revealed that the genes of the cluster are primarily synthesized as three polycistronic transcripts. Two divergent polycistronic transcripts, one encoding the orfx1, orfx2, and orfx3 genes, the second encoding the p47, ntnh, and bont/a2 genes, are transcribed from conserved BoNT cluster promoters. The third polycistronic transcript, expressed at low levels, encodes the positive regulatory botR gene and the orfx genes. This is the first complete analysis of a botulinum toxin A2 cluster.

  8. Helicobacter pylori cagA Promoter Region Sequences Influence CagA Expression and Interleukin 8 Secretion.

    PubMed

    Ferreira, Rui M; Pinto-Ribeiro, Ines; Wen, Xiaogang; Marcos-Pinto, Ricardo; Dinis-Ribeiro, Mário; Carneiro, Fátima; Figueiredo, Ceu

    2016-02-15

    Heterogeneity at the Helicobacter pylori cagA gene promoter region has been linked to variation in CagA expression and gastric histopathology. Here, we characterized the cagA promoter and expression in 46 H. pylori strains from Portugal. Our results confirm the relationship between cagA promoter region variation and protein expression originally observed in strains from Colombia. We observed that individuals with intestinal metaplasia were all infected with H. pylori strains containing a specific cagA motif. Additionally, we provided novel functional evidence that strain-specific sequences in the cagA promoter region and CagA expression levels influence interleukin 8 secretion by the host gastric epithelial cells.

  9. A conserved intronic U1 snRNP-binding sequence promotes trans-splicing in Drosophila.

    PubMed

    Gao, Jun-Li; Fan, Yu-Jie; Wang, Xiu-Ye; Zhang, Yu; Pu, Jia; Li, Liang; Shao, Wei; Zhan, Shuai; Hao, Jianjiang; Xu, Yong-Zhen

    2015-04-01

    Unlike typical cis-splicing, trans-splicing joins exons from two separate transcripts to produce chimeric mRNA and has been detected in most eukaryotes. Trans-splicing in trypanosomes and nematodes has been characterized as a spliced leader RNA-facilitated reaction; in contrast, its mechanism in higher eukaryotes remains unclear. Here we investigate mod(mdg4), a classic trans-spliced gene in Drosophila, and report that two critical RNA sequences in the middle of the last 5' intron, TSA and TSB, promote trans-splicing of mod(mdg4). In TSA, a 13-nucleotide (nt) core motif is conserved across Drosophila species and is essential and sufficient for trans-splicing, which binds U1 small nuclear RNP (snRNP) through strong base-pairing with U1 snRNA. In TSB, a conserved secondary structure acts as an enhancer. Deletions of TSA and TSB using the CRISPR/Cas9 system result in developmental defects in flies. Although it is not clear how the 5' intron finds the 3' introns, compensatory changes in U1 snRNA rescue trans-splicing of TSA mutants, demonstrating that U1 recruitment is critical to promote trans-splicing in vivo. Furthermore, TSA core-like motifs are found in many other trans-spliced Drosophila genes, including lola. These findings represent a novel mechanism of trans-splicing, in which RNA motifs in the 5' intron are sufficient to bring separate transcripts into close proximity to promote trans-splicing.

  10. Sequence variation in the Tbx4 gene in marine mammals.

    PubMed

    Onbe, Kaori; Nishida, Shin; Sone, Emi; Kanda, Naohisa; Goto, Mutsuo; Pastene, Luis A; Tanabe, Shinsuke; Koike, Hiroko

    2007-05-01

    The amino-acid sequences of the T-domain region of the Tbx4 gene, which is required for hindlimb development, are 100% identical in humans and mice. Cetaceans have lost most of their hindlimb structure, although hindlimb buds are present in very early cetacean embryos. To examine whether the Tbx4 gene has the same function in cetaceans as in other mammals, we analyzed Tbx4 sequences from cetaceans, dugong, artiodactyls and marine carnivores. A total of 39 primers were designed using human and dog Tbx4 nucleotide sequences. Exons 3, 4, 5, 6, 7, and 8 of the Tbx4 genes from cetaceans, artiodactyls, and marine carnivores were sequenced. Non-synonymous substitution sites were detected in the T-domain regions from some cetacean species, but were not detected in those from artiodactyls, the dugong, or the carnivores. The C-terminal regions contained a number of non-synonymous substitutions. Although some indels were present, they were in groups of three nucleotides and therefore did not cause frame shifts. The dN/dS values for the T-domain and C-terminal regions of the cetacean and artiodactylous Tbx4 genes were much lower than 1, indicating that the Tbx4 gene maintains it function in cetaceans, although full expression leading to hindlimb development is suppressed.

  11. A 350 bp region of the proximal promoter of Rds drives cell-type specific gene expression

    PubMed Central

    Cai, Xue; Conley, Shannon M.; Cheng, Tong; Al-Ubaidi, Muayyad R.; Naash, Muna I.

    2010-01-01

    RDS (retinal degeneration slow) is a photoreceptor-specific tetraspanin protein required for the biogenesis and maintenance of rod and cone outer segments. Mutations in the Rds gene are associated with multiple forms of rod- and cone-dominant retinal degeneration. To gain more insight into the mechanisms underlying the regulation of this gene the identification of regulatory sequences within the promoter of Rds was undertaken. A 3.5kb fragment of the 5′ flanking region of the mouse Rds gene was isolated and binding sites for Crx, Otx2, Nr2e3, RXR family members, Mef2C, Esrrb, NF1, AP1, and SP1 in addition to several E-boxes, GC-boxes and GAGA-boxes were identified. Crx binding sequences were conserved in all mammalian species examined. Truncation expression analysis of the Rds promoter region in Y-79 retinoblastoma cells showed maximal activity in the 350bp proximal promoter region. We also show that inclusion of more distal fragments reduced promoter activity to the basal level, and that the promoter activities are cell-type and direction specific. Co-transfection with Nrl increased promoter activity, suggesting that this gene positively regulates Rds expression. Based on these findings, a relatively small fragment of the Rds promoter may be useful in future gene transfer studies to drive gene expression in photoreceptors. PMID:20447394

  12. Dinoflagellate 17S rRNA sequence inferred from the gene sequence: Evolutionary implications

    PubMed Central

    Herzog, Michel; Maroteaux, Luc

    1986-01-01

    We present the complete sequence of the nuclear-encoded small-ribosomal-subunit RNA inferred from the cloned gene sequence of the dinoflagellate Prorocentrum micans. The dinoflagellate 17S rRNA sequence of 1798 nucleotides is contained in a family of 200 tandemly repeated genes per haploid genome. A tentative model of the secondary structure of P. micans 17S rRNA is presented. This sequence is compared with the small-ribosomal-subunit rRNA of Xenopus laevis (Animalia), Saccharomyces cerevisiae (Fungi), Zea mays (Planta), Dictyostelium discoideum (Protoctista), and Halobacterium volcanii (Monera). Although the secondary structure of the dinoflagellate 17S rRNA presents most of the eukaryotic characteristics, it contains sufficient archaeobacterial-like structural features to reinforce the view that dinoflagellates branch off very early from the eukaryotic lineage. PMID:16578795

  13. Dinoflagellate 17S rRNA sequence inferred from the gene sequence: Evolutionary implications.

    PubMed

    Herzog, M; Maroteaux, L

    1986-11-01

    We present the complete sequence of the nuclear-encoded small-ribosomal-subunit RNA inferred from the cloned gene sequence of the dinoflagellate Prorocentrum micans. The dinoflagellate 17S rRNA sequence of 1798 nucleotides is contained in a family of 200 tandemly repeated genes per haploid genome. A tentative model of the secondary structure of P. micans 17S rRNA is presented. This sequence is compared with the small-ribosomal-subunit rRNA of Xenopus laevis (Animalia), Saccharomyces cerevisiae (Fungi), Zea mays (Planta), Dictyostelium discoideum (Protoctista), and Halobacterium volcanii (Monera). Although the secondary structure of the dinoflagellate 17S rRNA presents most of the eukaryotic characteristics, it contains sufficient archaeobacterial-like structural features to reinforce the view that dinoflagellates branch off very early from the eukaryotic lineage.

  14. Perylene and coronene derivatives binding to G-rich promoter oncogene sequences efficiently reduce their expression in cancer cells.

    PubMed

    Micheli, Emanuela; Altieri, Alessandro; Cianni, Lorenzo; Cingolani, Chiara; Iachettini, Sara; Bianco, Armandodoriano; Leonetti, Carlo; Cacchione, Stefano; Biroccio, Annamaria; Franceschin, Marco; Rizzo, Angela

    2016-06-01

    A novel approach to cancer therapeutics is emerging in the field of G-quadruplex (G4) ligands, small molecules designed to stabilize four-stranded structures that can form at telomeres as well as in other genomic sequences, including oncogene promoter sequences, 5'-UTR regions and introns. In this study, we investigated the binding activity of perylene and coronene derivatives PPL3C, CORON and EMICORON to G4 structures formed within the promoter regions of two important cancer-related genes, c-MYC and BCL-2, and their biochemical effects on gene and protein expression. In order to fully characterize the ability of the selected ligands to bind and stabilize the G4 structures originated by the c-MYC and BCL-2 promoter sequences, we performed electrospray ionization mass spectrometry (ESI-MS), Fluorescence Resonance Energy Transfer (FRET) measurements, Circular Dichroism (CD) spectra and polymerase stop assay. Altogether our results showed that the ligands had a high capacity in binding and stabilizing the G4 structures within the c-MYC and BCL-2 promoter sequences in vitro. Notably, when we evaluated by quantitative real-time PCR and western blotting analysis, the effects of treatment with the different G4 ligands on c-MYC and BCL2 expression in a human melanoma cell line, EMICORON appeared the most effective compound in reducing the mRNA and protein levels of both genes. These results encourage to consider EMICORON as a promising example of multimodal class of an antineoplastic drug, affecting different tumor crucial pathways simultaneously: telomere maintenance (as previously described), cell proliferation and apoptosis via down-regulation of both c-MYC and BCL-2 (this paper).

  15. Functional analysis of polymorphisms in the promoter regions of genes on 22q11.

    PubMed

    Hoogendoorn, Bastiaan; Coleman, Sharon L; Guy, Carol A; Smith, S Kaye; O'Donovan, Michael C; Buckland, Paul R

    2004-07-01

    Segmental aneusomy, which includes chromosome 22 deletion syndrome (del(22)(q11.2q11.2)), has been associated with DiGeorge syndrome (DGS), velocardiofacial syndrome (VCFS), conotruncal anomaly face (CAF) syndrome, cat-eye syndrome (CES), der(22) syndrome, and duplication of the del(22)(q11.2q11.2) syndrome's typically deleted region. Adults with del(22)(q11.2q11.2) may develop psychiatric illnesses, including schizophrenia, schizoaffective disorder, and bipolar disorder, suggesting that lower gene dosage leads to a predisposition to these illnesses. In a bid to identify important regulatory polymorphisms (SNPs) that may emulate changes in gene dosage of the genes within the common deletion, we have analyzed the promoter region of 47 genes (44 of which encode a protein with known function) encoding proteins in and around 22q11 for sequence variants. A total of 33 of the promoters contained polymorphisms. Of those, 25 were cloned into a reporter gene vector, pGL3. The relative ability of each promoter haplotype to promote transcription of the luciferase gene was tested in each of two human cell lines (HEK293t and TE671), using a cotransfected CMV-SPAP plasmid as an internal control. Five genes (PRODH, DGCR14, GSTT2, SERPIND1, and a gene tentatively called DKFZP434P211) showed activity differences between haplotypes of greater than 1.5-fold. Of those, PRODH, which encodes proline dehydrogenase, has previously been highlighted in relation to schizophrenia, and the functional promoter polymorphism reported here may be involved in pathogenic mechanisms.

  16. Enhancer and promoter elements directing activation and glucocorticoid repression of the. cap alpha. /sub 1/-fetoprotein gene in hepatocytes

    SciTech Connect

    Guertin, M.; La Rue, H.; Bernier, D.; Wrange, O.; Chevrette, M.; Gingras, M.C.; Belanger, L.

    1988-04-01

    Mutations were introduced in 7 kilobases of 5'-flanking rat ..cap alpha../sub 1/-fetoprotein (AFP) genomic DNA, linked to the chloramphenicol acetyltransferase gene. AFP promoter activity and its repression by a glucocorticoid hormone were assessed by stable and transient expression assays. Stable transfection assays were more sensitive and accurate than transient expression assays in a Morris 7777 rat hepatoma recipient (Hepa7.6), selected for its strong AFP repression by dexamethasone. The segment of DNA encompassing a hepatocyte-constitutive chromatin DNase I-hypersensitive site at -3.7 kilobases and a liver developmental stage-specific site at -2.5 kilobases contains interacting enhancer elements sufficient for high AFP promoter activity in Hepa7.6 or HepG2 cells. Deletions and point mutations define an upstream promoter domain of AFP gene activation, operating with at least three distinct promoter-activating elements, PEI at -65 base pairs, PEII at -120 base pairs, and DE at -160 base pairs. PEI and PEII share homologies with albumin promoter sequences, PEII is a near-consensus nuclear factor I recognition sequence, and DE overlaps a glucocorticoid receptor recognition sequence. An element conferring glucocorticoid repression of AFP gene activity is located in the upstream AFP promoter domain. Receptor-binding assays indicate that this element is the glucocorticoid receptor recognition sequence which overlaps with promoter-activating element DE.

  17. Isolation and characterization of the 5'-flanking sequence of the human ocular lens MIP gene.

    PubMed

    Wang, X Y; Ohtaka-Maruyama, C; Pisano, M M; Jaworski, C J; Chepelinsky, A B

    1995-12-29

    The MIP (major intrinsic protein) gene, a member of an ancient family of membrane channel genes, encodes the predominant fiber cell membrane protein of the ocular lens. Its specific expression in the lens fibers is temporally and spatially regulated during development. To study the regulation of expression of MIP and delineate the regulatory elements underlying its tissue specificity and ontogenic profile, we have cloned 2840 bp of the human MIP 5'-flanking sequence. The human MIP 5'-flanking sequence contains three complete Alu repetitive elements in tandem at position between nt -1699 and -2684 (nt -1699/-2684). These Alu elements appear to have had a complex evolutionary history with insertions at different times. We have fused DNA fragments containing MIP 5'-flanking sequences to the bacterial cat reporter gene encoding chloramphenicol acetyltransferase and assayed them in primary cultures of chicken lens cells. We have mapped two negative regulatory regions in the human MIP 5'-flanking sequences -1564/-1696 and -948/-1000. We demonstrated that the human MIP 5'-flanking sequence -253/+42 contains a functional promoter in lens cells but is inactive in kidney epithelial cells or mouse fibroblasts, suggesting that this sequence contains regulatory elements responsible for the lens-specific expression of MIP.

  18. Sequence and gene expression evolution of paralogous genes in willows

    PubMed Central

    Harikrishnan, Srilakshmy L.; Pucholt, Pascal; Berlin, Sofia

    2015-01-01

    Whole genome duplications (WGD) have had strong impacts on species diversification by triggering evolutionary novelties, however, relatively little is known about the balance between gene loss and forces involved in the retention of duplicated genes originating from a WGD. We analyzed putative Salicoid duplicates in willows, originating from the Salicoid WGD, which took place more than 45 Mya. Contigs were constructed by de novo assembly of RNA-seq data derived from leaves and roots from two genotypes. Among the 48,508 contigs, 3,778 pairs were, based on fourfold synonymous third-codon transversion rates and syntenic positions, predicted to be Salicoid duplicates. Both copies were in most cases expressed in both tissues and 74% were significantly differentially expressed. Mean Ka/Ks was 0.23, suggesting that the Salicoid duplicates are evolving by purifying selection. Gene Ontology enrichment analyses showed that functions related to DNA- and nucleic acid binding were over-represented among the non-differentially expressed Salicoid duplicates, while functions related to biosynthesis and metabolism were over-represented among the differentially expressed Salicoid duplicates. We propose that the differentially expressed Salicoid duplicates are regulatory neo- and/or subfunctionalized, while the non-differentially expressed are dose sensitive, hence, functionally conserved. Multiple evolutionary processes, thus drive the retention of Salicoid duplicates in willows. PMID:26689951

  19. Sequence and gene expression evolution of paralogous genes in willows.

    PubMed

    Harikrishnan, Srilakshmy L; Pucholt, Pascal; Berlin, Sofia

    2015-12-22

    Whole genome duplications (WGD) have had strong impacts on species diversification by triggering evolutionary novelties, however, relatively little is known about the balance between gene loss and forces involved in the retention of duplicated genes originating from a WGD. We analyzed putative Salicoid duplicates in willows, originating from the Salicoid WGD, which took place more than 45 Mya. Contigs were constructed by de novo assembly of RNA-seq data derived from leaves and roots from two genotypes. Among the 48,508 contigs, 3,778 pairs were, based on fourfold synonymous third-codon transversion rates and syntenic positions, predicted to be Salicoid duplicates. Both copies were in most cases expressed in both tissues and 74% were significantly differentially expressed. Mean Ka/Ks was 0.23, suggesting that the Salicoid duplicates are evolving by purifying selection. Gene Ontology enrichment analyses showed that functions related to DNA- and nucleic acid binding were over-represented among the non-differentially expressed Salicoid duplicates, while functions related to biosynthesis and metabolism were over-represented among the differentially expressed Salicoid duplicates. We propose that the differentially expressed Salicoid duplicates are regulatory neo- and/or subfunctionalized, while the non-differentially expressed are dose sensitive, hence, functionally conserved. Multiple evolutionary processes, thus drive the retention of Salicoid duplicates in willows.

  20. Amplification of the groESL operon in Pseudomonas putida increases siderophore gene promoter activity.

    PubMed

    Venturi, V; Wolfs, K; Leong, J; Weisbeek, P J

    1994-10-17

    Pseudobactin 358 is the yellow-green fluorescent siderophore [microbial iron(III) transport agent] produced by Pseudomonas putida WCS358 under iron-limiting conditions. The genes encoding pseudobactin 358 biosynthesis are iron-regulated at the level of transcription. In this study, the molecular characterization is reported of a cosmid clone of WCS358 DNA that can stimulate, in an iron-dependent manner, the activity of a WCS358 siderophore gene promoter in the heterologous Pseudomonas strain A225. The functional region in the clone was identified by subcloning, transposon mutagenesis and DNA sequencing as the groESL operon of strain WCS358. This increase in promoter activity was not observed when the groESL genes of strain WCS358 were integrated via a transposon vector into the genome of Pseudomonas A225, indicating that multiple copies of the operon are necessary for the increase in siderophore gene promoter activity. Amplification of the Escherichia coli and WCS358 groESL genes also increased iron-regulated promoter activity in the parent strain WCS358. The groESL operon codes for the chaperone proteins GroES and GroEL, which are responsible for mediating the folding and assembly of many proteins.

  1. [Nucleotide sequence of genes for alpha- and beta-subunits of luciferase from Photobacterium leiognathi].

    PubMed

    Illarionov, B A; Protopopova, M V; Karginov, V A; Mertvetsov, N P; Gitel'zon, I I

    1988-03-01

    Nucleotide sequence of the Photobacterium leiognathi DNA containing genes of alpha and beta subunits of luciferase has been determined. We also deduced amino acid sequence and molecular mass of luciferase and localized luciferase genes in the sequenced DNA fragment.

  2. Gene activation properties of a mouse DNA sequence isolated by expression selection.

    PubMed Central

    von Hoyningen-Huene, V; Norbury, C; Griffiths, M; Fried, M

    1986-01-01

    The MES-1 element was previously isolated from restricted total mouse cellular DNA by "expression selection"--the ability to reactivate expression of a test gene devoid of its 5' enhancer sequences. Mes-1 has been tested in long-term transformation and short-term CAT expression assays. In both assays MES-1 is active independent of orientation and at a distance when placed 5' to the test gene. The element is active with heterologous promoters and functions efficiently in both rat and mouse cells. MES-1 activates expression by increasing transcription from the test gene's own start (cap) site. Thus the expression selection technique can be used for the isolation of DNA sequences with enhancer-like properties from total cellular DNA. Images PMID:3016657

  3. Cloning and characterisation of the glyceraldehyde 3-phosphate dehydrogenase gene of Candida bombicola and use of its promoter.

    PubMed

    Van Bogaert, Inge N A; De Maeseneire, Sofie L; Develter, Dirk; Soetaert, Wim; Vandamme, Erick J

    2008-10-01

    The glyceraldehyde-3-phosphate dehydrogenase gene (GPD) of the sophorolipid producing yeast Candida bombicola was isolated using degenerated PCR and genome walking. The obtained 3,740 bp contain the 1,008 bases of the coding sequence and 1,613 and 783 bp of the upstream and downstream regions, respectively. The corresponding protein shows high homology to the other known GPD genes and is 74% identical to the gyceraldehyde-3-phosphate dehydrogenase of Yarrowia lipolytica. The particular interest in the C. bombicola GPD gene sequence originates from the potential use of its promoter for high and constitutive expression of homologous and heterologous genes. Southern blot analysis did not give any indication for the presence of multiple GPD genes and it can therefore be expected that the promoter can be used for efficient and high expression. This hypothesis was further confirmed by the biased codon usage in the GPD gene. GDP promoter fragments of different lengths were used to construct hygromycin resistance cassettes. The constructs were used for the transformation of C. bombicola and all of them, even the ones with only 190 bp of the GPD promoter, were able to render the cells resistant to hygromycin. The efficacy of a short GPD promoter can be a convenient characteristic for the construction of compact expression cassettes or vectors for C. bombicola. The GenBank accession number of the sequence described in this article is EU315245.

  4. Nucleotide sequence and structural organization of the human vasopressin pituitary receptor (V3) gene.

    PubMed

    René, P; Lenne, F; Ventura, M A; Bertagna, X; de Keyzer, Y

    2000-01-04

    In the pituitary, vasopressin triggers ACTH release through a specific receptor subtype, termed V3 or V1b. We cloned the V3 cDNA and showed that its expression was almost exclusive to pituitary corticotrophs and some corticotroph tumors. To study the determinants of this tissue specificity, we have now cloned the gene for the human (h) V3 receptor and characterized its structure. It is composed of two exons, spanning 10kb, with the coding region interrupted between transmembrane domains 6 and 7. We established that the transcription initiation site is located 498 nucleotides upstream of the initiator codon and showed that two polyadenylation sites may be used, while the most frequent is the most downstream. Sequence analysis of the promoter region showed no TATA box but identified consensus binding motifs for Sp1, CREB, and half sites of the estrogen receptor binding site. However comparison with another corticotroph-specific gene, proopiomelanocortin, did not identify common regulatory elements in the two promoters except for a short GC-rich region. Unexpectedly, hV3 gene analysis revealed that a formerly cloned 'artifactual' hV3 cDNA indeed corresponded to a spliced antisense transcript, overlapping the 5' part of the coding sequence in exon 1 and the promoter region. This transcript, hV3rev, was detected in normal pituitary and in many corticotroph tumors expressing hV3 sense mRNA and may therefore play a role in hV3 gene expression.

  5. Structural and functional analysis of the Entamoeba histolytica EhrabB gene promoter

    PubMed Central

    Romero-Díaz, Mónica; Gómez, Consuelo; López-Reyes, Israel; Martínez, Máximo B; Orozco, Esther; Rodríguez, Mario A

    2007-01-01

    Background The Entamoeba histolytica EhrabB gene encodes for a Rab GTPase involved in phagocytosis. It is located at a virulence locus where the Ehcp112 gene is in the complementary strand at 332 bp of EhrabB start codon, suggesting a finely regulated transcription of both genes. However, the transcription regulation in this parasite is poorly understood. Results To initiate the knowledge of EhrabB gene expression regulation, here we studied the structural characteristics of its gene promoter and its control transcription elements. In silico searches of the EhrabB 5'-flanking region revealed that it contains a motif similar to the upstream regulatory element 1 (URE1) of the E. histolytica hgl5 gene. It also has sequences with homology to C/EBP and GATA1 binding sites, and heat shock elements (HSE). Primer extension experiments revealed that EhrabB has at least four transcription initiation sites. The elements at the 5'-flanking region that drive EhrabB gene expression were detected and characterized using transitory transfected trophozoites with a plasmid carrying the CAT reporter gene. EhrabB transcription is negatively regulated by a sequence located between positions -491 to -428 with respect to the first transcription initiation site. We also showed that the URE1-like motif activates EhrabB transcription. In addition, heat shock activated the EhrabB promoter in episomal constructs and lead to an increase in de novo EhrabB transcription. Conclusion The data suggest that EhrabB transcription is controlled negatively by an unidentified sequence, but it is activated by an URE1-like motif. Our analyses also revealed the presence of activator HSE that function under stress. PMID:17883848

  6. Characterization of EBV Promoters and Coding Regions by Sequencing PCR-Amplified DNA Fragments.

    PubMed

    Szenthe, Kalman; Bánáti, Ferenc

    2017-01-01

    DNA sequencing approaches originally developed in two directions, the chemical degradation method and the chain-termination method. The latter one became more widespread and a huge amount of sequencing data including whole genome sequences accumulated, based on the use of capillary sequencer systems and the application of a modified chain-termination method which proved to be relatively easy, fast, and reliable. In addition, relatively long, up to 1000 bp sequences could be obtained with a single read with high per-base accuracy. Although the recent appearance of next-generation DNA sequencing (NGS) technologies enabled high-throughput and low cost analysis of DNA, the modified chain-terminating methods are often applied in research until now. In the following, we shall present the application of capillary sequencing for the sequence characterization of viral genomes in case of partial and whole genome sequencing, and demonstrate it on the BARF1 promoter of Epstein Barr virus (EBV).

  7. Identification of the functional elements in the promoter region of human DNA topoisomerase IIIbeta gene.

    PubMed

    Cho, Young Hoon; Park, Jee Young; Han, Sang Youp; Chung, In Kwon

    2004-09-17

    In this study, we have isolated and characterized the promoter region of the human DNA topoisomerase IIIbeta (hTOP3beta) gene. The 5' RACE assay showed a short exon 1 encoding only the 35-bp untranslated region and suggested the presence of multiple transcription initiation sites. The hTOP3beta gene promoter lacks a canonical TATA box or initiation element and is moderately high in GC content. Transient expression of a luciferase reporter gene under the control of serially deleted 5'-flanking sequence identified an activator element between -141 and -119 upstream of the transcription initiation site and a second regulatory element between -91 and -71. On the basis of scanning mutations of triple nucleotides, we demonstrated that a 5'GGAACC3' element between -117 and -112 plays a critical role in the up-regulation of the basal transcription activity. Changing the 5'GGAACC3' sequence leads to markedly reduced promoter activity. Gel mobility shift assays revealed that the 5'GGAACC3' element is required for DNA binding by the transcription factor complex. These observations lead to the conclusion that the positive regulatory region including the 5'GGAACC3' core element is essential for efficient expression of the hTOP3beta gene as well as for the binding of as yet unidentified regulatory factor(s).

  8. Synergistic modular promoter and gene optimization to push cellulase secretion by Pichia pastoris beyond existing benchmarks.

    PubMed

    Mellitzer, Andrea; Ruth, Claudia; Gustafsson, Claes; Welch, Mark; Birner-Grünberger, Ruth; Weis, Roland; Purkarthofer, Thomas; Glieder, Anton

    2014-12-10

    Although successfully used for heterologous gene expression for more than twenty years, general knowledge about all factors influencing protein expression by Pichia pastoris is still lacking. For high titers of protein clones are optimized individually for each target protein. Optimization efforts in this study were focused on the DNA level, evaluating a set of 48 different individual synthetic genes (TrCBH2) coding for the same protein sequence of a Trichoderma reesei cellulase in combination with three different promoter sequences: PGAP (constitutive) and the synthetic AOX1 promoter variants PDeS (derepressed) and PEn (enhanced, inducible). Expression of active secreted enzyme varied from undetectable to ∼300% of the best known gene, as determined by secreted enzyme activity analyses of supernatants from 96 well plate and bioreactor cultivations. Finally, the best optimized gene and new promoters were combined to engineer highly productive P. pastoris CBH2 expression strains. Although no methanol was used for induction a final titer of more than 18g/l of secreted protein was produced under controlled conditions in small scale bioreactor cultivations after 60-70h of growth limiting glycerol feed. This is the highest concentration of secreted enzyme in P. pastoris published so far and single parts of the expression cassette could be independently optimized showing additive effects for improvements in protein production by P. pastoris.

  9. Chimeric DNA methyltransferases target DNA methylation to specific DNA sequences and repress expression of target genes

    PubMed Central

    Li, Fuyang; Papworth, Monika; Minczuk, Michal; Rohde, Christian; Zhang, Yingying; Ragozin, Sergei; Jeltsch, Albert

    2007-01-01

    Gene silencing by targeted DNA methylation has potential applications in basic research and therapy. To establish targeted methylation in human cell lines, the catalytic domains (CDs) of mouse Dnmt3a and Dnmt3b DNA methyltransferases (MTases) were fused to different DNA binding domains (DBD) of GAL4 and an engineered Cys2His2 zinc finger domain. We demonstrated that (i) Dense DNA methylation can be targeted to specific regions in gene promoters using chimeric DNA MTases. (ii) Site-specific methylation leads to repression of genes controlled by various cellular or viral promoters. (iii) Mutations affecting any of the DBD, MTase or target DNA sequences reduce targeted methylation and gene silencing. (iv) Targeted DNA methylation is effective in repressing Herpes Simplex Virus type 1 (HSV-1) infection in cell culture with the viral titer reduced by at least 18-fold in the presence of an MTase fused to an engineered zinc finger DBD, which binds a single site in the promoter of HSV-1 gene IE175k. In short, we show here that it is possible to direct DNA MTase activity to predetermined sites in DNA, achieve targeted gene silencing in mammalian cell lines and interfere with HSV-1 propagation. PMID:17151075

  10. Computational promoter analysis of mouse, rat and human antimicrobial peptide-coding genes

    PubMed Central

    Brahmachary, Manisha; Schönbach, Christian; Yang, Liang; Huang, Enli; Tan, Sin Lam; Chowdhary, Rajesh; Krishnan, SPT; Lin, Chin-Yo; Hume, David A; Kai, Chikatoshi; Kawai, Jun; Carninci, Piero; Hayashizaki, Yoshihide; Bajic, Vladimir B

    2006-01-01

    Background Mammalian antimicrobial peptides (AMPs) are effectors of the innate immune response. A multitude of signals coming from pathways of mammalian pathogen/pattern recognition receptors and other proteins affect the expression of AMP-coding genes (AMPcgs). For many AMPcgs the promoter elements and transcription factors that control their tissue cell-specific expression have yet to be fully identified and characterized. Results Based upon the RIKEN full-length cDNA and public sequence data derived from human, mouse and rat, we identified 178 candidate AMP transcripts derived from 61 genes belonging to 29 AMP families. However, only for 31 mouse genes belonging to 22 AMP families we were able to determine true orthologous relationships with 30 human and 15 rat sequences. We screened the promoter regions of AMPcgs in the three species for motifs by an ab initio motif finding method and analyzed the derived promoter characteristics. Promoter models were developed for alpha-defensins, penk and zap AMP families. The results suggest a core set of transcription factors (TFs) that regulate the transcription of AMPcg families in mouse, rat and human. The three most frequent core TFs groups include liver-, nervous system-specific and nuclear hormone receptors (NHRs). Out of 440 motifs analyzed, we found that three represent potentially novel TF-binding motifs enriched in promoters of AMPcgs, while the other four motifs appear to be species-specific. Conclusion Our large-scale computational analysis of promoters of 22 families of AMPcgs across three mammalian species suggests that their key transcriptional regulators are likely to be TFs of the liver-, nervous system-specific and NHR groups. The computationally inferred promoter elements and potential TF binding motifs provide a rich resource for targeted experimental validation of TF binding and signaling studies that aim at the regulation of mouse, rat or human AMPcgs. PMID:17254313

  11. Characterization and functional analysis of the human inducible nitric oxide synthase gene promoter.

    PubMed Central

    Spitsin, S. V.; Koprowski, H.; Michaels, F. H.

    1996-01-01

    BACKGROUND: Nitric oxide has a wide variety of homeostatic and pathological effects. Control of the production of nitric oxide by the inducible form of the enzyme resides in the 5' promoter region of the gene. Although control of the murine isoform has been investigated, little is known about the functional aspects of the human analog. MATERIALS AND METHODS: A 3.9-kb 5' nontranslated region of the human gene was cloned, sequenced, and several reporter constructs prepared. The promoter-reporter constructs were transfected into human or murine monocytoid cells and reporter expression quantified following cytokine activation of the cells. The production of nitric oxide was also monitored. RESULTS: Although a murine promoter-reporter functioned efficiently in both human and mouse cells, the human constructs functioned only in human cells. The activity of the mouse construct increased progressively with the addition of activating cytokines, but the human promoter-reporter did not. Although interleukin 1 beta drove expression of the human inducible nitric oxide synthase reporter, actual expression of nitric oxide required both interleukin 1 beta and interferon-gamma. CONCLUSIONS: The data indicate that despite the significant homology between the human and mouse inducible nitric oxide synthase promoter sequence, control of the two genes is quite different. In addition to being more efficient in promoter activity, the murine promoter responds increasingly to cytokines that are not effective for the human analog. It is also apparent that human inducible nitric oxide synthase is controlled at both the level of transcription and post-translationally. PMID:8726465

  12. Grainyhead and Zelda compete for binding to the promoters of the earliest-expressed Drosophila genes.

    PubMed

    Harrison, Melissa M; Botchan, Michael R; Cline, Thomas W

    2010-09-15

    Maternally contributed mRNAs and proteins control the initial stages of development following fertilization. During this time, most of the zygotic genome remains transcriptionally silent. The initiation of widespread zygotic transcription is coordinated with the degradation of maternally provided mRNAs at the maternal-to-zygotic transition (MZT). While most of the genome is silenced prior to the MZT, a small subset of zygotic genes essential for the future development of the organism is transcribed. Previous work in our laboratory and others identified the TAGteam element, a set of related heptameric DNA-sequences in the promoters of many early-expressed Drosophila genes required to drive their unusually early transcription. To understand how this unique subset of genes is regulated, we identified a TAGteam-binding factor Grainyhead (Grh). We demonstrated that Grh and the previously characterized transcriptional activator Zelda (Zld) bind to different TAGteam sequences with varying affinities, and that Grh competes with Zld for TAGteam occupancy. Moreover, overexpression of Grh in the early embryo causes defects in cell division, phenocopying Zld depletion. Our findings indicate that during early embryonic development the precise timing of gene expression is regulated by both the sequence of the TAGteam elements in the promoter and the relative levels of the transcription factors Grh and Zld.

  13. Isolation and characterization of the promoter region of the chicken N-cadherin gene.

    PubMed

    Li, B; Paradies, N E; Brackenbury, R W

    1997-05-20

    N-cadherin (CDH2) is a member of the cadherin family of Ca2(+)-dependent cell-cell adhesion molecules. To investigate mechanisms controlling CDH2 transcription, we isolated and analyzed a genomic DNA sequence containing 2.8 kb of 5' flanking region and the first two exons of chicken CDH2. Sequence analysis of the promoter region of CDH2 revealed no CCATT or TATA boxes, but showed a high overall GC content, high CpG dinucleotide content, and several consensus Sp1 and Ap2 binding sequences. When fused to the cat reporter gene in transient transfection experiments, the sequence from positions -3231 to -118 (relative to the translation start site) directed high-level expression in CDH2-expressing chicken primary retinal cells and mouse N2A cells, but was much less active in chicken embryonic fibroblast cells and mouse 3T3 cells which do not express CDH2. Similarly, this promoter fragment directed variable, but neuronal-specific, expression of reporter genes in adult transgenic mice, but failed to produce the correct pattern of expression in other tissues, implying that additional sequences further upstream and/or within introns of CDH2 may play important roles in the transcriptional control.

  14. Sequence evolution and expression regulation of stress-responsive genes in natural populations of wild tomato.

    PubMed

    Fischer, Iris; Steige, Kim A; Stephan, Wolfgang; Mboup, Mamadou

    2013-01-01

    The wild tomato species Solanum chilense and S. peruvianum are a valuable non-model system for studying plant adaptation since they grow in diverse environments facing many abiotic constraints. Here we investigate the sequence evolution of regulatory regions of drought and cold responsive genes and their expression regulation. The coding regions of these genes were previously shown to exhibit signatures of positive selection. Expression profiles and sequence evolution of regulatory regions of members of the Asr (ABA/water stress/ripening induced) gene family and the dehydrin gene pLC30-15 were analyzed in wild tomato populations from contrasting environments. For S. chilense, we found that Asr4 and pLC30-15 appear to respond much faster to drought conditions in accessions from very dry environments than accessions from more mesic locations. Sequence analysis suggests that the promoter of Asr2 and the downstream region of pLC30-15 are under positive selection in some local populations of S. chilense. By investigating gene expression differences at the population level we provide further support of our previous conclusions that Asr2, Asr4, and pLC30-15 are promising candidates for functional studies of adaptation. Our analysis also demonstrates the power of the candidate gene approach in evolutionary biology research and highlights the importance of wild Solanum species as a genetic resource for their cultivated relatives.

  15. Optimizing promoters and secretory signal sequences for producing ethanol from inulin by recombinant Saccharomyces cerevisiae carrying Kluyveromyces marxianus inulinase.

    PubMed

    Hong, Soo-Jeong; Kim, Hyo Jin; Kim, Jin-Woo; Lee, Dae-Hee; Seo, Jin-Ho

    2015-02-01

    Inulin is a polyfructan that is abundant in plants such as Jerusalem artichoke, chicory and dahlia. Inulinase can easily hydrolyze inulin to fructose, which is consumed by microorganisms. Generally, Saccharomyces cerevisiae, an industrial workhorse strain for bioethanol production, is known for not having inulinase activity. The inulinase gene from Kluyveromyces marxianus (KmINU), with the ability of converting inulin to fructose, was introduced into S. cerevisiae D452-2. The inulinase gene was fused to three different types of promoter (GPD, PGK1, truncated HXT7) and secretory signal sequence (KmINU, MFα1, SUC2) to generate nine expression cassettes. The inulin fermentation performance of the nine transformants containing different promoter and signal sequence combinations for inulinase production were compared to select an optimized expression system for efficient inulin fermentation. Among the nine inulinase-producing transformants, the S. cerevisiae carrying the PGK1 promoter and MFα1 signal sequence (S. cerevisiae D452-2/p426PM) showed not only the highest specific KmINU activity, but also the best inulin fermentation capability. Finally, a batch fermentation of the selected S. cerevisiae D452-2/p426PM in a bioreactor with 188.2 g/L inulin was performed to produce 80.2 g/L ethanol with 0.43 g ethanol/g inulin of ethanol yield and 1.22 g/L h of ethanol productivity.

  16. Determination of the promoter region of mouse ribosomal RNA gene by an in vitro transcription system.

    PubMed Central

    Yamamoto, O; Takakusa, N; Mishima, Y; Kominami, R; Muramatsu, M

    1984-01-01

    Sequences required for a faithful and efficient transcription of a cloned mouse ribosomal RNA gene (rDNA) are determined by testing a series of deletion mutants in an in vitro transcription system utilizing two kinds of mouse cellular extract. Deletion of sequences upstream of -40 or downstream of +52 causes only slight reduction in promoter activity as compared with the "wild-type" template. For upstream deletion mutants, the removal of a sequence between -40 and -35 causes a significant decrease in the capacity to direct efficient initiation. This decrease becomes more pronounced when the deletion reaches -32 and the sequence A-T-C-T-T-T, conserved among mouse, rat, and human rDNAs, is lost. Residual template activity is further reduced as more upstream sequence is deleted and finally becomes undetectable when the deletion is extended from -22 down to -17, corresponding to the loss of the conserved sequence T-A-T-T-G. As for downstream deletion mutants, the removal of the sequence downstream of +23 causes some (and further deletions up to +11 cause a more) serious decrease in template activity in vitro. These deletions involve other conserved sequences downstream of the transcription start site. However, the removal of the original transcription start site does not abolish the transcription initiation completely, provided that the whole upstream sequence is intact. Images PMID:6320178

  17. Nucleotide sequence of the human N-myc gene

    SciTech Connect

    Stanton, L.W.; Schwab, M.; Bishop, J.M.

    1986-03-01

    Human neuroblastomas frequently display amplification and augmented expression of a gene known as N-myc because of its similarity to the protooncogene c-myc. It has therefore been proposed that N-myc is itself a protooncogene, and subsequent tests have shown that N-myc and c-myc have similar biological activities in cell culture. The authors have now detailed the kinship between N-myc and c-myc by determining the nucleotide sequence of human N-myc and deducing the amino acid sequence of the protein encoded by the gene. The topography of N-myc is strikingly similar to that of c-myc: both genes contain three exons of similar lengths; the coding elements of both genes are located in the second and third exons; and both genes have unusually long 5' untranslated regions in their mRNAs, with features that raise the possibility that expression of the genes may be subject to similar controls of translation. The resemblance between the proteins encoded by N-myc and c-myc sustains previous suspicions that the genes encode related functions.

  18. Repression of the Drosophila proliferating-cell nuclear antigen gene promoter by zerknuellt protein

    SciTech Connect

    Yamaguchi, Masamitsu; Hirose, Fumiko; Nishida, Yasuyoshi; Matsukage, Akio )

    1991-10-01

    A 631-bp fragment containing the 5{prime}-flanking region of the Drosophila melanogaster proliferating-cell nuclear antigen (PCNA) gene was placed upstream of the chloramphenicol acetyltransferase (CAT) gene of a CAT vector. A transient expression assay of CAT activity in Drosophila Kc cells transfected with this plasmid and a set of 5{prime}-deletion derivatives revealed that the promoter function resided within a 192-bp region. Cotransfection with a zerknuellt (zen)-expressing plasmid specifically repressed CAT expression. However, cotransfection with expression plasmids for a nonfunctional zen mutation, even skipped, or bicoid showed no significant effect on CAT expression. RNase protection analysis revealed that the repression by zen was at the transcription step. The target sequence of zen was mapped within the 34-bp region of the PCNA gene promoter, even though it lacked zen protein-binding sites. Transgenic flies carrying the PCNA gene regulatory region fused with lacZ were established. These results indicate that zen indirectly represses PCNA gene expression, probably by regulating the expression of some transcription factor(s) that binds to the PCNA gene promoter.

  19. Searching the expressed sequence tag (EST) databases: panning for genes.

    PubMed

    Jongeneel, C V

    2000-02-01

    The genomes of living organisms contain many elements, including genes coding for proteins. The portions of the genes expressed as mature mRNA, collectively known as the transcriptome, represent only a small part of the genome. The expressed sequence tag (EST) databases contain an increasingly large part of the transcriptome of many species. For this reason, these databases are probably the most abundant source of new coding sequences available today. However, the raw data deposited in the EST databases are to a large extent unorganised, unannotated, redundant and of relatively low quality. This paper reviews some of the characteristics of the EST data, and the methods that can be used to find novel protein sequences within them. It also documents a collection of databases, software and web sites that can be useful to biologists interested in mining the EST databases over the Internet, or in establishing a local environment for such analyses.

  20. Analysis of tissue-specific region in sericin 1 gene promoter of Bombyx mori

    SciTech Connect

    Liu Yan; Yu Lian; Guo Xiuyang; Guo Tingqing; Wang Shengpeng; Lu Changde . E-mail: cdlu@sibs.ac.cn

    2006-03-31

    The gene encoding sericin 1 (Ser1) of silkworm (Bombyx mori) is specifically expressed in the middle silk gland cells. To identify element involved in this transcription-dependent spatial restriction, truncation of the 5' terminal from the sericin 1 (Ser1) promoter is studied in vivo. A 209 bp DNA sequence upstream of the transcriptional start site (-586 to -378) is found to be responsible for promoting tissue-specific transcription. Analysis of this 209 bp region by overlapping deletion studies showed that a 25 bp region (-500 to -476) suppresses the ectopic expression of the Ser1 promoter. An unknown factor abundant in fat body nuclear extracts is shown to bind to this 25 bp fragment. These results suggest that this 25 bp region and the unknown factor are necessary for determining the tissue-specificity of the Ser1 promoter.

  1. Deoxyribonucleic acid sequence of araBAD promoter mutants of Escherichia coli.

    PubMed

    Horwitz, A H; Morandi, C; Wilcox, G

    1980-05-01

    The controlling site region for the araBAD operon is defined, in part, by two classes of cis-acting constitutive mutations. The aralc mutations allow low-level constitutive expression of ara-BAD in the absence of the positive regulatory protein coded for by the araC gene, whereas the araXc mutations allow expression of araBAD in the absence of the cyclic adenosine monophosphate receptor protein. Six independently isolated aralc mutations and three independently isolated araXc mutations were cloned onto the plasmid pBR322 using in vitro recombinant deoxyribonucleic acid techniques and in vivo recombination between plasmid and chromosomal deoxyribonucleic acid. The location of these mutations was determined by deoxyribonucleic acid sequence analysis. All of the aralc mutations occurred at position -35 within the araBAD promoter (+1 = messenger ribonucleic acid start for araBAD) and resulted from an AT leads to GC transition. All of the araXc mutations occurred at position -10 within the araBAD promoter and resulted from a GC leads to AT transition. Models are presented to explain the mode of action of the aralc and araXc mutations.

  2. Cloning and Functional Analysis of the Promoter of an Ascorbate Oxidase Gene from Gossypium hirsutum.

    PubMed

    Xin, Shan; Tao, Chengcheng; Li, Hongbin

    2016-01-01

    Apoplastic ascorbate oxidase (AO) plays significant roles in plant cell growth. However, the mechanism of underlying the transcriptional regulation of AO in Gossypium hirsutum remains unclear. Here, we obtained a 1,920-bp promoter sequence from the Gossypium hirsutum ascorbate oxidase (GhAO1) gene, and this GhAO1 promoter included a number of known cis-elements. Promoter activity analysis in overexpressing pGhAO1::GFP-GUS tobacco (Nicotiana benthamiana) showed that the GhAO1 promoter exhibited high activity, driving strong reporter gene expression in tobacco trichomes, leaves and roots. Promoter 5'-deletion analysis demonstrated that truncated GhAO1 promoters with serial 5'-end deletions had different GUS activities. A 360-bp fragment was sufficient to activate GUS expression. The P-1040 region had less GUS activity than the P-720 region, suggesting that the 320-bp region from nucleotide -720 to -1040 might include a cis-element acting as a silencer. Interestingly, an auxin-responsive cis-acting element (TGA-element) was uncovered in the promoter. To analyze the function of the TGA-element, tobacco leaves transformed with promoters with different 5' truncations were treated with indole-3-acetic acid (IAA). Tobacco leaves transformed with the promoter regions containing the TGA-element showed significantly increased GUS activity after IAA treatment, implying that the fragment spanning nucleotides -1760 to -1600 (which includes the TGA-element) might be a key component for IAA responsiveness. Analyses of the AO promoter region and AO expression pattern in Gossypium arboreum (Ga, diploid cotton with an AA genome), Gossypium raimondii (Gr, diploid cotton with a DD genome) and Gossypium hirsutum (Gh, tetraploid cotton with an AADD genome) indicated that AO promoter activation and AO transcription were detected together only in D genome/sub-genome (Gr and Gh) cotton. Taken together, these results suggest that the 1,920-bp GhAO1 promoter is a functional sequence with a

  3. Cloning and sequence analysis of an actin gene in aloe.

    PubMed

    Wen, S S; He, D W; Liao, C M; Li, J; Wen, G Q; Liu, X H

    2014-07-04

    Aloe (Aloe spp), containing abundant polysaccharides and numerous bioactive ingredients, has remarkable medical, ornamental, calleidic, and edible values. In the present study, the total RNA was extracted from aloe leaf tissue. The isolated high-quality RNA was further used to clone actin gene by using reverse transcription-polymerase chain reaction (RT-PCR). The result of sequence analysis for the amplified fragment revealed that the cloned actin gene was 1012 bp in length (GenBank accession No. KC751541.1) and contained a 924-bp coding region and encoded a protein consisting of 307 amino acids. Homologous alignment showed that it shared over 80 and 96% identity with the nucleotide and amino acid sequences of actin from other plants, respectively. In addition, the cloned gene was used for phylogenetic analyses based on the deduced amino acid sequences, and the results suggested that the actin gene is highly conserved in evolution. The findings of this study will be useful for investigating the expression patterns of other genes in Aloe.

  4. A detailed mutational analysis of the VSG gene expression site promoter.

    PubMed

    Pham, V P; Qi, C C; Gottesdiener, K M

    1996-01-01

    The African trypanosome Trypanosoma brucei is a protozoan parasite that causes the disease African sleeping sickness. The parasite avoids the host's immune response by the process of antigenic variation, or by sequentially expressing antigenically different cell-surface coat proteins. These proteins, called variant surface glycoproteins (VSGs), are expressed from a specific locus, the VSG gene expression site (ES). In an attempt to understand expression of VSG genes, we expanded on earlier investigations of the promoter that controls the large VSG gene expression site transcription unit. We studied VSG ES promoter function both in transient transfection assays, and after stable integration at a chromosomal locus. Analysis of closely spaced deletion mutants showed that the minimum VSG ES promoter fragment that gives full activity is extremely small, and mapped precisely to a fragment that contains no more than -67 bp 5' to the putative transcription initiation site. The promoter lacked an upstream control element, or UCE, an element found at the PARP promoter, and at most eukaryotic Pol I promoters. Furthermore, linker scanning mutagenesis demonstrated that the VSG ES promoter contains at least two essential regulatory elements, including sequences within the region -67/-60 and the region -35/-20, both numbered relative to the initiation site. An altered promoter with mutated nucleotides surrounding the transcription initiation site still directed wild-type levels of expression. In this study, the results were similar for both insect and bloodstream form trypanosomes, suggesting that the same basic machinery for expression from the VSG ES promoter is found in both stages of the parasite.

  5. Phenotype Sequencing: Identifying the Genes That Cause a Phenotype Directly from Pooled Sequencing of Independent Mutants

    PubMed Central

    Harper, Marc A.; Chen, Zugen; Toy, Traci; Machado, Iara M. P.; Nelson, Stanley F.; Liao, James C.; Lee, Christopher J.

    2011-01-01

    Random mutagenesis and phenotype screening provide a powerful method for dissecting microbial functions, but their results can be laborious to analyze experimentally. Each mutant strain may contain 50–100 random mutations, necessitating extensive functional experiments to determine which one causes the selected phenotype. To solve this problem, we propose a “Phenotype Sequencing” approach in which genes causing the phenotype can be identified directly from sequencing of multiple independent mutants. We developed a new computational analysis method showing that 1. causal genes can be identified with high probability from even a modest number of mutant genomes; 2. costs can be cut many-fold compared with a conventional genome sequencing approach via an optimized strategy of library-pooling (multiple strains per library) and tag-pooling (multiple tagged libraries per sequencing lane). We have performed extensive validation experiments on a set of E. coli mutants with increased isobutanol biofuel tolerance. We generated a range of sequencing experiments varying from 3 to 32 mutant strains, with pooling on 1 to 3 sequencing lanes. Our statistical analysis of these data (4099 mutations from 32 mutant genomes) successfully identified 3 genes (acrB, marC, acrA) that have been independently validated as causing this experimental phenotype. It must be emphasized that our approach reduces mutant sequencing costs enormously. Whereas a conventional genome sequencing experiment would have cost $7,200 in reagents alone, our Phenotype Sequencing design yielded the same information value for only $1200. In fact, our smallest experiments reliably identified acrB and marC at a cost of only $110–$340. PMID:21364744

  6. Structural organization, sequence, and expression of the mouse HEXA gene encoding the alpha subunit of hexosaminidase A.

    PubMed

    Wakamatsu, N; Benoit, G; Lamhonwah, A M; Zhang, Z X; Trasler, J M; Triggs-Raine, B L; Gravel, R A

    1994-11-01

    Genomic clones of the mouse HEXA gene encoding the alpha subunit of lysosomal beta-hexosaminidase A have been isolated, analyzed, and sequenced. The HEXA gene spans approximately 26 kb and consists of 14 exons and 13 introns. The 5' flanking region of the gene has three candidate GC boxes and a number of potential promoter and regulatory elements. Promoter analysis using deletion constructs of 5' flanking sequence fused to the bacterial chloramphenicol acetyltransferase (CAT) gene showed that 150 bp of 5' sequence was sufficient for expression in transfected monkey kidney COS cells. Determination of the sequence of the 5' end of the Hex alpha mRNA by an "anchor-ligation PCR" procedure showed that transcription is initiated from a cluster of sites centered -42, -32, and -21 bp from the first in-frame ATG. Northern blot analysis from 11 different tissues showed over five times the steady-state level of Hex alpha mRNA in testis as compared to that found in three different brain regions; the lowest level (about 1/3 of brain) was found in liver. Comparison of the 5' flanking sequence with that of the human HEXA gene revealed 78% identity within the first 100 bp. These data suggest that the mouse HEXA gene is controlled mainly by sequences located within 150 bp of the 5' flanking region, and we speculate that it may have a role, not only in brain and other tissues, but also in reproductive function in the adult male mouse.

  7. Promoter sequences confirm the three different evolutionary lineages described for HLA-G.

    PubMed

    Martinez-Laso, J; Herraiz, M A; Peñaloza, J; Barbolla, M L; Jurado, M L; Macedo, J; Vidart, J; Cervera, I

    2013-03-01

    HLA-G alleles follow a different pattern of polymorphism generation that those of the HLA classical I alleles. However, this polymorphism maintenance could have an evolutionary specific pathways based on non coding regions as introns, 14 bp deletion/insertion (exon 8) or promoter regions. For this reason, a systematic sequencing study of HLA-G promoter region was done in 36 individuals with a total of 15 different alleles. From the 12 sequences obtained, 7 were new sequences and not previously described. Results show that the sequences have three different patterns of evolution confirming the results obtained in the rest of the sequence regions (exons, introns and 3'UTR) where three different lineages were established. Only one of these lineages includes the non-human primate promoter sequences suggesting the possibility of this lineage could come directly from non-human primates while the other two could be generated after the speciation. More non-human primates MHC-G promoter sequences must be obtained to confirm this hypothesis. Expression and functional assays could be done considering the differences obtained in the promoter regions involving the HLA-G function (mRNA expression, isoforms).

  8. Molecular and functional characterization of the promoter of ETS2, the human c-ets-2 gene.

    PubMed Central

    Mavrothalassitis, G J; Watson, D K; Papas, T S

    1990-01-01

    The 5' end of the human c-ets-2 gene, ETS2, was cloned and characterized. The major transcription initiation start sites were identified, and the pertinent sequences surrounding the ETS2 promoter were determined. The promoter region of ETS2 does not possess typical "TATA" and "CAAT" elements. However, this promoter contains several repeat regions, as well as two consensus AP2 binding sites and three putative Sp1 sites. There is also a palindromic region similar to the serum response element of the c-fos gene, located 1400 base pairs (bp) upstream from the first major transcription initiation site. A G + C-rich sequence (GC element) with dyad symmetry can be seen in the ETS2 promoter, immediately following an unusually long (approximately 250-bp) polypurine-polypyrimidine tract. A series of deletion fragments from the putative promoter region were ligated in front of the bacterial chloramphenicol acetyltransferase gene and tested for activity following transfection into HeLa cells. The 5' boundary of the region needed for maximum promoter activity was found to be 159 bp upstream of the major initiation site. This region of 159 bp contains putative binding sites for transcription factors Sp1 and AP2 (one for each), the GC element, one small forward repeat, one inverted repeat, and half of the polypurine-pyrimidine tract. The promoter of ETS2 (within the polypyrimidine tract) serves to illustrate an alternative structure that may be present in genes with "TATA-less" promoters. Images PMID:2405393

  9. Role of an adenovirus E2 promoter binding factor in E1A-mediated coordinate gene control.

    PubMed Central

    Kovesdi, I; Reichel, R; Nevins, J R

    1987-01-01

    A product of the adenovirus gene E1A is responsible for the stimulation of transcription from six viral promoters as well as at least two cellular promoters. We have detected a HeLa cell factor, termed E2 promoter binding factor (E2F), that appears to mediate the transcriptional stimulation of the viral E2 promoter. Competition experiments revealed that E2F did not recognize and bind to the E1B, E3, E4, or major late promoter sequences. Furthermore, three additional promoters stimulated by E1A, heat shock protein 70, beta-globin, and early simian virus 40, do not bind E2F. In contrast, the factor does recognize sequences in the E1A enhancer, and within the E1A enhancer are duplicated binding sites for E2F. Finally, a single E2F binding site from the E1A enhancer can confer increased transcription to a mouse beta-globin promoter, dependent on the action of the E1A gene product. This stimulation requires binding of E2F since methylation of the binding site, which blocks binding in vitro, reduces transcription stimulation in vivo. We, therefore, conclude that E2F is likely to be responsible for the E1A-mediated stimulation of the E1A gene as well as the E2 gene but is not involved in the activation of the other E1A-inducible promoters. Images PMID:2951737

  10. Sequence diversity in 36 candidate genes for cardiovascular disorders.

    PubMed Central

    Cambien, F; Poirier, O; Nicaud, V; Herrmann, S M; Mallet, C; Ricard, S; Behague, I; Hallet, V; Blanc, H; Loukaci, V; Thillet, J; Evans, A; Ruidavets, J B; Arveiler, D; Luc, G; Tiret, L

    1999-01-01

    Two strategies involving whole-genome association studies have been proposed for the identification of genes involved in complex diseases. The first one seeks to characterize all common variants of human genes and to test their association with disease. The second one seeks to develop dense maps of single-nucleotide polymorphisms (SNPs) and to detect susceptibility genes through linkage disequilibrium. We performed a molecular screening of the coding and/or flanking regions of 36 candidate genes for cardiovascular diseases. All polymorphisms identified by this screening were further genotyped in 750 subjects of European descent. In the whole set of genes, the lengths explored spanned 53.8 kb in the 5' regions, 68.4 kb in exonic regions, and 13 kb in the 3' regions. The strength of linkage disequilibrium within candidate regions suggests that genomewide maps of SNPs might be efficient ways to identify new disease-susceptibility genes, provided that the maps are sufficiently dense. However, the relatively large number of polymorphisms within coding and regulatory regions of candidate genes raises the possibility that several of them might be functional and that the pattern of genotype-phenotype association might be more complex than initially envisaged, as actually has been observed in some well-characterized genes. These results argue in favor of both genomewide association studies and detailed studies of the overall sequence variation of candidate genes, as complementary approaches. PMID:10364531

  11. Genome Sequence of Bacillus mycoides B38V, a Growth-Promoting Bacterium of Sunflower

    PubMed Central

    Ambrosini, Adriana; Sant’Anna, Fernando Hayashi; de Souza, Rocheli; Tadra-Sfeir, Michele; Faoro, Helisson; Alvarenga, Samuel M.; Pedrosa, Fabio Oliveira; Souza, Emanuel Maltempi

    2015-01-01

    Bacillus mycoides B38V is a bacterium isolated from the sunflower rhizosphere that is able to promote plant growth and N uptake. The genome of the isolate has approximately 5.80 Mb and presents sequence codifiers for plant growth-promoting characteristics, such as nitrate reduction and ammonification and iron-siderophore uptake. PMID:25838494

  12. Genome Sequence of the Plant Growth-Promoting Bacterium Enterobacter cloacae GS1

    PubMed Central

    Shankar, Manoharan; Ponraj, Paramasivan; Ilakiam, Devaraj; Rajendhran, Jeyaprakash

    2012-01-01

    Here, we present the genome sequence of Enterobacter cloacae GS1. This strain proficiently colonizes rice roots and promotes plant growth by improving plant nutrition. Analyses of the E. cloacae GS1 genome will throw light on the genetic factors involved in root colonization, growth promotion, and ecological success of this rhizobacterium. PMID:22843603

  13. Draft Genome Sequence of Ochrobactrum intermedium Strain SA148, a Plant Growth-Promoting Desert Rhizobacterium

    PubMed Central

    Lafi, Feras F.; Alam, Intikhab; Geurts, Rene; Bisseling, Ton; Bajic, Vladimir B.

    2017-01-01

    ABSTRACT Ochrobactrum intermedium strain SA148 is a plant growth-promoting bacterium isolated from sandy soil in the Jizan area of Saudi Arabia. Here, we report the 4.9-Mb draft genome sequence of this strain, highlighting different pathways characteristic of plant growth promotion activity and environmental adaptation of SA148. PMID:28254977

  14. Strategies for Development of Functionally Equivalent Promoters with Minimum Sequence Homology for Transgene Expression in Plants: cis-Elements in a Novel DNA Context versus Domain Swapping1

    PubMed Central

    Bhullar, Simran; Chakravarthy, Suma; Advani, Sonia; Datta, Sudipta; Pental, Deepak; Burma, Pradeep Kumar

    2003-01-01

    The cauliflower mosaic virus 35S (35S) promoter has been extensively used for the constitutive expression of transgenes in dicotyledonous plants. The repetitive use of the same promoter is known to induce transgene inactivation due to promoter homology. As a way to circumvent this problem, we tested two different strategies for the development of synthetic promoters that are functionally equivalent but have a minimum sequence homology. Such promoters can be generated by (a) introducing known cis-elements in a novel or synthetic stretch of DNA or (b) “domain swapping,” wherein domains of one promoter can be replaced with functionally equivalent domains from other heterologous promoters. We evaluated the two strategies for promoter modifications using domain A (consisting of minimal promoter and subdomain A1) of the 35S promoter as a model. A set of modified 35S promoters were developed whose strength was compared with the 35S promoter per se using β-glucuronidase as the reporter gene. Analysis of the expression of the reporter gene in transient assay system showed that domain swapping led to a significant fall in promoter activity. In contrast, promoters developed by placing cis-elements in a novel DNA context showed levels of expression comparable with that of the 35S. Two promoter constructs Mod2A1T and Mod3A1T were then designed by placing the core sequences of minimal promoter and subdomain A1 in divergent DNA sequences. Transgenics developed in tobacco (Nicotiana tabacum) with the two constructs and with 35S as control were used to assess the promoter activity in different tissues of primary transformants. Mod2A1T and Mod3A1T were found to be active in all of the tissues tested, at levels comparable with that of 35S. Further, the expression of the Mod2A1T promoter in the seedlings of the T1 generation was also similar to that of the 35S promoter. The present strategy opens up the possibility of creating a set of synthetic promoters with minimum sequence

  15. Molecular Diagnostics of Gliomas Using Next Generation Sequencing of a Glioma-Tailored Gene Panel.

    PubMed

    Zacher, Angela; Kaulich, Kerstin; Stepanow, Stefanie; Wolter, Marietta; Köhrer, Karl; Felsberg, Jörg; Malzkorn, Bastian; Reifenberger, Guido

    2017-03-01

    Current classification of gliomas is based on histological criteria according to the World Health Organization (WHO) classification of tumors of the central nervous system. Over the past years, characteristic genetic profiles have been identified in various glioma types. These can refine tumor diagnostics and provide important prognostic and predictive information. We report on the establishment and validation of gene panel next generation sequencing (NGS) for the molecular diagnostics of gliomas. We designed a glioma-tailored gene panel covering 660 amplicons derived from 20 genes frequently aberrant in different glioma types. Sensitivity and specificity of glioma gene panel NGS for detection of DNA sequence variants and copy number changes were validated by single gene analyses. NGS-based mutation detection was optimized for application on formalin-fixed paraffin-embedded tissue specimens including small stereotactic biopsy samples. NGS data obtained in a retrospective analysis of 121 gliomas allowed for their molecular classification into distinct biological groups, including (i) isocitrate dehydrogenase gene (IDH) 1 or 2 mutant astrocytic gliomas with frequent α-thalassemia/mental retardation syndrome X-linked (ATRX) and tumor protein p53 (TP53) gene mutations, (ii) IDH mutant oligodendroglial tumors with 1p/19q codeletion, telomerase reverse transcriptase (TERT) promoter mutation and frequent Drosophila homolog of capicua (CIC) gene mutation, as well as (iii) IDH wildtype glioblastomas with frequent TERT promoter mutation, phosphatase and tensin homolog (PTEN) mutation and/or epidermal growth factor receptor (EGFR) amplification. Oligoastrocytic gliomas were genetically assigned to either of these groups. Our findings implicate gene panel NGS as a promising diagnostic technique that may facilitate integrated histological and molecular glioma classification.

  16. Cultivar-specific gene modulation in Vitis vinifera: analysis of the promoters regulating the expression of WOX transcription factors.

    PubMed

    Boccacci, Paolo; Mela, Anita; Pavez Mina, Catalina; Chitarra, Walter; Perrone, Irene; Gribaudo, Ivana; Gambino, Giorgio

    2017-03-30

    The family of Wuschel-related Homeobox (WOX) genes is a class of transcription factors involved in the early stages of embryogenesis and organ development in plants. Some of these genes have shown different transcription levels in embryogenic tissues and mature organs in two different cultivars of Vitis vinifera: 'Chardonnay' (CH) and 'Cabernet Sauvignon' (CS). Therefore, we investigated the genetic basis responsible for these differences by cloning and sequencing in both the cultivars the promoter regions (~2000 bp) proximal to the transcription start site of five VvWOX genes. We then introduced these promoters into Arabidopsis thaliana for expression pattern characterisation using the GUS reporter gene. In the transgenic Arabidopsis, two promoters isolated from CS (pVvWOX13C_CS and pVvWOX6_CS) induced increased expression compared to the sequence isolated in CH, confirming the data obtained in grapevine tissues. These results were corroborated by transient expression assays using the agroinfiltration approach in grapevine somatic embryos. Truncated versions of pVvWOX13C demonstrated that few nucleotide differences between the sequences isolated from CH and CS are pivotal for the transcriptional regulation of VvWOX13C. Analysis of promoters using heterologous and homologous systems appear to be effective for exploring gene modulation linked with intervarietal sequence variation in grapevine.

  17. Cultivar-specific gene modulation in Vitis vinifera: analysis of the promoters regulating the expression of WOX transcription factors

    PubMed Central

    Boccacci, Paolo; Mela, Anita; Pavez Mina, Catalina; Chitarra, Walter; Perrone, Irene; Gribaudo, Ivana; Gambino, Giorgio

    2017-01-01

    The family of Wuschel-related Homeobox (WOX) genes is a class of transcription factors involved in the early stages of embryogenesis and organ development in plants. Some of these genes have shown different transcription levels in embryogenic tissues and mature organs in two different cultivars of Vitis vinifera: ‘Chardonnay’ (CH) and ‘Cabernet Sauvignon’ (CS). Therefore, we investigated the genetic basis responsible for these differences by cloning and sequencing in both the cultivars the promoter regions (~2000 bp) proximal to the transcription start site of five VvWOX genes. We then introduced these promoters into Arabidopsis thaliana for expression pattern characterisation using the GUS reporter gene. In the transgenic Arabidopsis, two promoters isolated from CS (pVvWOX13C_CS and pVvWOX6_CS) induced increased expression compared to the sequence isolated in CH, confirming the data obtained in grapevine tissues. These results were corroborated by transient expression assays using the agroinfiltration approach in grapevine somatic embryos. Truncated versions of pVvWOX13C demonstrated that few nucleotide differences between the sequences isolated from CH and CS are pivotal for the transcriptional regulation of VvWOX13C. Analysis of promoters using heterologous and homologous systems appear to be effective for exploring gene modulation linked with intervarietal sequence variation in grapevine. PMID:28358354

  18. Mining tissue-specific contigs from peanut (Arachis hypogaea L.) for promoter cloning by deep transcriptome sequencing.

    PubMed

    Geng, Lili; Duan, Xiaohong; Liang, Chun; Shu, Changlong; Song, Fuping; Zhang, Jie

    2014-10-01

    Peanut (Arachis hypogaea L.), one of the most important oil legumes in the world, is heavily damaged by white grubs. Tissue-specific promoters are needed to incorporate insect resistance genes into peanut by genetic transformation to control the subterranean pests. Transcriptome sequencing is the most effective way to analyze differential gene expression in this non-model species and contribute to promoter cloning. The transcriptomes of the roots, seeds and leaves of peanut were sequenced using Illumina technology. A simple digital expression profile was established based on number of transcripts per million clean tags (TPM) from different tissues. Subsequently, 584 root-specific candidate transcript assembly contigs (TACs) and 316 seed-specific candidate TACs were identified. Among these candidate TACs, 55.3% were root-specific and 64.6% were seed-specific by semi-quantitative RT-PCR analysis. Moreover, the consistency of semi-quantitative RT-PCR with the simple digital expression profile was correlated with the length and TPM value of TACs. The results of gene ontology showed that some root-specific TACs are involved in stress resistance and respond to auxin stimulus, whereas, seed-specific candidate TACs are involved in embryo development, lipid storage and long-chain fatty acid biosynthesis. One root-specific promoter was cloned and characterized. We developed a high-yield screening system in peanut by establishing a simple digital expression profile based on Illumina sequencing. The feasible and rapid method presented by this study can be used for other non-model crops to explore tissue-specific or spatially specific promoters.

  19. In vivo generation of highly abundant sequence-specific oligonucleotides for antisense and triplex gene regulation.

    PubMed Central

    Noonberg, S B; Scott, G K; Garovoy, M R; Benz, C C; Hunt, C A

    1994-01-01

    Antisense and triplex oligonucleotides continue to demonstrate potential as mediators of gene-specific repression of protein synthesis. However, inefficient and heterogeneous cellular uptake, intracellular sequestration, and rapid intracellular and extracellular degradation represent obstacles to their eventual clinical utility. Efficient cellular delivery of targeted ribozymes can present similar problems. In this report we describe a system for circumventing these obstacles and producing large quantities of short, sequence-specific RNA oligonucleotides for use in these gene regulation strategies. The oligonucleotides are generated from a vector containing promoter, capping, and termination sequences from the human small nuclear U6 gene, surrounding a synthetic sequence incorporating the oligonucleotide of interest. In vivo, these oligonucleotides are produced constitutively and without cell type specificity in levels up to 5 x 10(6) copies per cell, reach steady-state levels of expression within 9 hours post-transfection, and are still readily detectable 7 days post-transfection. In addition, these oligonucleotides are retained in the nucleus, obtain a 5' gamma-monomethyl phosphate cap, and have an intracellular half-life of approximately one hour. This expression vector provides a novel and efficient method of intracellular delivery of antisense or triplex RNA oligonucleotides (and/or ribozymes) for gene regulation, as well as a cost-effective means of comparing the biological activity arising from a variety of different potential oligonucleotide sequences. Images PMID:8052538

  20. EST sequencing and gene expression profiling of cultivated peanut (Arachis hypogaea L.).

    PubMed

    Bi, Yu-Ping; Liu, Wei; Xia, Han; Su, Lei; Zhao, Chuan-Zhi; Wan, Shu-Bo; Wang, Xing-Jun

    2010-10-01

    Peanut (Arachis hypogaea L.) is one of the most important oil crops in the world. However, biotechnological based improvement of peanut is far behind many other crops. It is critical and urgent to establish the biotechnological platform for peanut germplasm innovation. In this study, a peanut seed cDNA library was constructed to establish the biotechnological platform for peanut germplasm innovation. About 17,000 expressed sequence tags (ESTs) were sequenced and used for further investigation. Among which, 12.5% were annotated as metabolic related and 4.6% encoded transcription or post-transcription factors. ESTs encoding storage protein and enzymes related to protein degradation accounted for 28.8% and formed the largest group of the annotated ESTs. ESTs that encoded stress responsive proteins and pathogen-related proteins accounted for 5.6%. ESTs that encoded unknown proteins or showed no hit in the GenBank nr database accounted for 20.1% and 13.9%, respectively. A total number of 5066 EST sequences were selected to make a cDNA microarray. Expression analysis revealed that these sequences showed diverse expression patterns in peanut seeds, leaves, stems, roots, flowers, and gynophores. We also analyzed the gene expression pattern during seed development. Genes that were upregulated (≥twofold) at 15, 25, 35, and 45 days after pegging (DAP) were found and compared with 70 DAP. The potential value of these genes and their promoters in the peanut gene engineering study is discussed.

  1. The mouse muscle creatine kinase promoter faithfully drives reporter gene expression in transgenic Xenopus laevis.

    PubMed

    Lim, Wayland; Neff, Eric S; Furlow, J David

    2004-06-17

    Developing Xenopus laevis experience two periods of muscle differentiation, once during embryogenesis and again at metamorphosis. During metamorphosis, thyroid hormone induces both muscle growth in the limbs and muscle death in the tail. In mammals, the muscle creatine kinase (MCK) gene is activated during the differentiation from myoblasts to myocytes and has served as both a marker for muscle development and to drive transgene expression in transgenic mice. Transcriptional control elements are generally highly conserved throughout evolution, potentially allowing mouse promoter use in transgenic X. laevis. This paper compares endogenous X. laevis MCK gene expression and the mouse MCK (mMCK) promoter driving a green fluorescent protein reporter in transgenic X. laevis. The mMCK promoter demonstrated strong skeletal muscle-specific transgene expression in both the juvenile tadpole and adult frog. Therefore, our results clearly demonstrate the functional conservation of regulatory sequences in vertebrate muscle gene promoters and illustrate the utility of using X. laevis transgenesis for detailed comparative study of mammalian promoter activity in vivo.

  2. Novel Bifidobacterium promoters selected through microarray analysis lead to constitutive high-level gene expression.

    PubMed

    Wang, Yan; Kim, Jin Yong; Park, Myeong Soo; Ji, Geun Eog

    2012-08-01

    For the development of a food-grade expression system for Bifidobacterium, a strong promoter leading to high-level expression of cloned gene is a prerequisite. For this purpose, a promoter screening host-vector system for Bifidobacterium has been established using β-glucosidase from Bifidobacterium lactis as a reporter and Bifidobacterium bifidum BGN4 as a host, which is β-glucosidase negative strain. Seven putative promoters showing constitutive high-level expression were selected through microarray analysis based on the genome sequence of B. bifidum BGN4. They were cloned into upstream of β-glucosidase gene and transformed into Escherichia coli DH5α and B. bifidum BGN4. Promoter activities were analyzed both in E. coli and B. bifidum BGN4 by measuring β-glucosidase activity. β-Glucosidase activities in all of the transformants showed growth-associated characteristics. Among them, P919 was the strongest in B. bifidum BGN4 and showed maximum activity at 18 h, while P895 was the strongest in E. coli DH5α at 7 h. This study shows that novel strong promoters such as P919 can be used for high-level expression of foreign genes in Bifidobacterium and will be useful for the construction of an efficient food-grade expression system.

  3. Site-specific methylation of the rat prolactin and growth hormone promoters correlates with gene expression.

    PubMed Central

    Ngô, V; Gourdji, D; Laverrière, J N

    1996-01-01

    The methylation patterns of the rat prolactin (rPRL) (positions -440 to -20) and growth hormone (rGH) (positions -360 to -110) promoters were analyzed by bisulfite genomic sequencing. Two normal tissues, the anterior pituitary and the liver, and three rat pituitary GH3 cell lines that differ considerably in their abilities to express both genes were tested. High levels of rPRL gene expression were correlated with hypomethylation of the CpG dinucleotides located at positions -277 and -97, near or within positive cis-acting regulatory elements. For the nine CpG sites analyzed in the rGH promoter, an overall hypomethylation-expression coupling was also observed for the anterior pituitary, the liver, and two of the cell lines. The effect of DNA methylation was tested by measuring the transient expression of the chloramphenicol acetyltransferase reporter gene driven by a regionally methylated rPRL promoter. CpG methylation resulted in a decrease in the activity of the rPRL promoter which was proportional to the number of modified CpG sites. The extent of the inhibition was also found to be dependent on the position of methylated sites. Taken together, these data suggest that site-specific methylation may modulate the action of transcription factors that dictate the tissue-specific expression of the rPRL and rGH genes in vivo. PMID:8668139

  4. Cloning and promoter identification of the iron-regulated cir gene of Escherichia coli.

    PubMed Central

    Griggs, D W; Tharp, B B; Konisky, J

    1987-01-01

    The cir gene, which encodes the colicin I receptor protein and is regulated by both cellular iron content and growth temperature, was cloned into a multicopy-number plasmid. Physical mapping and complementation analysis established the position of cir between mgl and nfo on the Escherichia coli chromosome. A gene encoding a 32,000-dalton polypeptide was located downstream of and adjacent to cir, but did not appear to be part of the same transcriptional unit. A 525-base-pair fragment from the 5' end of the 1.8-kilobase-pair receptor-coding region directed iron-regulated transcription and translation of a hybrid cir-lacZ gene. Two overlapping promoters were identified by determination of the transcriptional start sites and by sequence analysis. A small open reading frame (120 nucleotides) of unknown significance preceded the receptor-coding sequence. Examination of the amino acid sequence of the receptor purified from the outer membrane revealed that the gene product was processed by removal of a signal peptide and that the mature form had an amino acid sequence near its amino terminus which closely resembled that of several other TonB-dependent proteins. Images PMID:3316180

  5. Variation in Rubisco activase (RCAβ) gene promoters and expression in soybean [Glycine max (L.) Merr.

    PubMed Central

    Yu, Deyue

    2014-01-01

    Understanding the genetic basis of Rubisco activase (RCA) gene regulation and altering its expression levels to optimize Rubisco activation may provide an approach to enhance plant productivity. However, the genetic mechanisms and the effect of RCA expression on phenotype are still unknown in soybean. This work analysed the expression of RCA genes and demonstrated that two RCA isoforms presented different expression patterns. Compared with GmRCAα, GmRCAβ was expressed at higher mRNA and protein levels. In addition, GmRCAα and GmRCAβ were positively correlated with chlorophyll fluorescence parameters and seed yield, suggesting that changes in expression of RCA has a potential applicability in breeding for enhanced soybean productivity. To identify the genetic factors that cause expression level variation of GmRCAβ, expression quantitative trait loci (eQTL) mapping was combined with allele mining in a natural population including 219 landraces. The eQTL mapping showed that a combination of both cis- and trans-acting eQTLs might control GmRCAβ expression. As promoters can affect both cis- and trans-acting eQTLs by altering cis-acting regulatory elements or transcription factor binding sites, this work subsequently focused on the promoter region of GmRCAβ. Single-nucleotide polymorphisms in the GmRCAβ promoter were identified and shown to correlate with expression level diversity. These SNPs were classified into two groups, A and B. Further transient expression showed that GUS expression driven by the group A promoter was stronger than that by the group B promoter, suggesting that promoter sequence types could influence gene expression levels. These results would improve understanding how variation within promoters affects gene expression and, ultimately, phenotypic diversity in natural populations. PMID:24170743

  6. Cell-specific activity of cis-acting regulatory elements in the promoter of the mouse multidrug resistance gene mdr1.

    PubMed

    Raymond, M; Gros, P

    1990-11-01

    To define cis-acting elements implicated in transcriptional regulation of the mouse multidrug resistance gene mdr1, we have cloned and characterized the 5' end of the gene. Nucleotide sequence analysis identified TATA, GGGCGG, and CCAAT consensus sequence elements at positions -27, -47, and -83, respectively. The transcriptional activities of 5' deletion fragments from the promoter linked to a reporter gene were tested in mouse cell lines of different tissue origins shown to express different levels of endogenous mdr1 RNA. Sequences located between nucleotides -93 and +84 were able to confer basal promoter activity and cell specificity to the reporter gene. The addition to the basal promoter of sequences upstream of position -141 was found to up or down regulate the basal level of expression of the reporter gene in a cell-specific manner.

  7. Polymorphic core promoter GA-repeats alter gene expression of the early embryonic developmental genes.

    PubMed

    Valipour, E; Kowsari, A; Bayat, H; Banan, M; Kazeminasab, S; Mohammadparast, S; Ohadi, M

    2013-12-01

    Protein complexes that bind to 'GAGA' DNA elements are necessary to replace nucleosomes to create a local chromatin environment that facilitates a variety of site-specific regulatory responses. Three to four elements are required for the disruption of a preassembled nucleosome. We have previously identified human protein-coding gene core promoters that are composed of exceptionally long GA-repeats. The functional implication of those GA-repeats is beginning to emerge in the core promoter of the human SOX5 gene, which is involved in multiple developmental processes. In the current study, we analyze the functional implication of GA-repeats in the core promoter of two additional genes, MECOM and GABRA3, whose expression is largely limited to embryogenesis. We report a significant difference in gene expression as a result of different alleles across those core promoters in the HEK-293 cell line. Across-species homology check for the GABRA3 GA-repeats revealed that those repeats are evolutionary conserved in mouse and primates (p<1 × 10(-8)). The MECOM core promoter GA-repeats are also conserved in numerous species, of which human has the longest repeat and complexity. We propose a novel role for GA-repeat core promoters to regulate gene expression in the genes involved in development and evolution.

  8. GRAIL seeks out genes buried in DNA sequence

    SciTech Connect

    Roberts, L.

    1991-11-08

    When the Human Genome Project achieves its ultimate goal, supposedly around 2005, biologists will have in hand the exact sequence of all 3 billion nucleotides arrayed along the human chromosomes. But they have never been entirely sure how they will read the language of the long string of As, Gs, Ts, and Cs. How will they even be able to pick out the genes, which account for a mere 5% of the genome, from the mass of letters in between Now Edward Ubergacher, a biophysicist-turned-computational-biologist at Oak Ridge National Laboratory, has come one step toward providing an answer: a new artificial intelligence program, called GRAIL, that can pick out the coding regions of genes in a long stretch of sequence data. So far, the Oak Ridge team has analyzed 5 million bases of DNA. One year ago, even 6 months ago, it was virtually impossible to go into human genomic sequence and find genes by computer with any reliability. Now we can go in and find 90% of the genes very quickly. GRAIL can be used on a PC, not a supercomputer, and it provides an answer almost instantly.

  9. Evaluation of the catalase promoter for expressing the alkaline xylanase gene (alx) in Aspergillus niger.

    PubMed

    Sharma, Ruchika; Katoch, Meenu; Govindappa, Nagraj; Srivastava, P S; Sastry, Kedarnath N; Qazi, Ghulam Nabi

    2012-02-01

    Aspergillus niger represents a promising host for the expression of recombinant proteins, but only a few expression systems are available for this organism. In this study, the inducible catalase promoter (PcatR) from A. niger was characterized. For this, constructs were developed and checked for the expression of the alkaline xylanase gene transcriptionally fused under the cat R promoter. Two versions of the catalase (catR) promoter sequence from A. niger (P(cat300,) P(cat924)) were isolated and tested for their ability to drive expression of the alkaline xylanase (alx) gene. P(cat924) showed better efficiency (more than 10-fold increase in AlX activity compared to P(cat300)) under the optimized culture conditions. Induction of the catR promoter with 0.20% H(2)O(2) and 1.5% CaCO(3) in the culture medium, further increased expression of AlX 2.61- and 2.20-fold, respectively, clarifying its inducible nature. Specific induction or repression of the catR promoter provides the possibility for utilization of this promoter in heterologous protein production.

  10. Matrix metalloproteinase-3 gene promoter polymorphisms: A potential risk factor for pelvic organ prolapse

    PubMed Central

    Karachalios, Charalampos; Bakas, Panagiotis; Kaparos, Georgios; Demeridou, Styliani; Liapis, Ilias; Grigoriadis, Charalampos; Liapis, Aggelos

    2016-01-01

    Pelvic organ prolapse (POP) is a common multifactorial condition. Matrix metalloproteinases (MMPs) are enzymes capable of breaking down various connective tissue elements. Single-nucleotide polymorphisms (SNPs) in regulatory areas of MMP-encoding genes can alter their transcription rate, and therefore the possible effect on pelvic floor supporting structures. The insertion of an adenine (A) base in the promoter of the MMP-3 gene at position −1612/−1617 produces a sequence of six adenines (6A), whereas the other allele has five (5A). The aim of the present study was to investigate the possible association of MMP-3 gene promoter SNPs with the risk of POP. The patient group comprised 80 women with clinically significant POP [Stage II, III or IV; POP quantification (POP-Q) system]. The control group consisted of 80 females without any or important pelvic floor support defects (Stages 0 or I; POP-Q system). All the participants underwent the same preoperative evaluation. SNP detection was determined with whole blood sample DNA analysis by quantitative polymerase chain reaction (PCR) in LightCycler® PCR platforms, using the technique of sequence-specific hybridization probe-binding assays and melting temperature curve analysis. The results showed there was no statistically significant difference between 5A/5A, 5A/6A and 6A/6A MMP-3 gene promoter variants in the two study groups (P=0.4758). Therefore, MMP-3 gene promoter SNPs alone is insufficient to increase the genetic susceptibility to POP development. PMID:27588175

  11. Functional identification of the promoter for the gene encoding the alpha subunit of calcium/calmodulin-dependent protein kinase II.

    PubMed Central

    Olson, N J; Massé, T; Suzuki, T; Chen, J; Alam, D; Kelly, P T

    1995-01-01

    To examine the expression of the alpha subunit of calcium/calmodulin-dependent protein kinase II, various 5' flanking genomic sequences were inserted into a chloramphenicol acetyltransferase (CAT) reporter plasmid and CAT enzyme activities were analyzed in transfected NB2a neuroblastoma cells and mRNA transcription was analyzed by nuclease protection assays. A core promoter was identified which contained an essential TATA element located 162 nt 5' to the transcription start site. Sequences 3' to the transcription start site, as well as 5' to the TATA element, increased levels of CAT activity in transfected cells. The alpha-subunit gene promoter displayed higher CAT activities, relative to a simian virus 40 promoter, in transfected neuronal cell lines than in nonneuronal cell lines. Results also suggested that sequence surrounding the natural alpha-gene transcription initiation site may be important for targeting transcription initiation 162 nt downstream of its TATA element. Images Fig. 1 Fig. 3 PMID:7878035

  12. Cloning and sequence analysis of the Chlamydia trachomatis spc ribosomal protein gene cluster.

    PubMed Central

    Kaul, R; Gray, G J; Koehncke, N R; Gu, L J

    1992-01-01

    We identified and sequenced a segment of Chlamydia trachomatis chromosomal DNA that shows homology to the Escherichia coli spc and distal region of the S10 ribosomal protein (r-protein) operons. Its sequence revealed a high degree of nucleotide and operon context conservation with the E. coli r-protein genes. The C. trachomatis spec operon contains the r-protein genes for L14, L24, L5, S8, L6, L18, S5, L15, and Sec Y along with the genes for r-proteins L16, L29, and S17 of the S10 operon. The two operons are separated by a 16-bp intragenic region which contains no transcription signals. However, a putative promoter for the transcription of the spc operon was found 162 nucleotides upstream of the CtrL14e start site; it revealed significant homology to the E. coli consensus promoter sequences. Interestingly, our results indicate the absence of any structure resembling an EcoS8 regulatory target site on C. trachomatis spc mRNA in spite of significant amino acid identity between E. coli and C. trachomatis r-proteins. Also, the intrinsic aminoglycoside resistance in C. trachomatis is unlikely to be mediated by CtrL6e since E. coli expressing CtrL6e remained susceptible to gentamicin (MIC less than 0.5 micrograms/ml). Images PMID:1735714

  13. The artificial zinc finger coding gene 'Jazz' binds the utrophin promoter and activates transcription.

    PubMed

    Corbi, N; Libri, V; Fanciulli, M; Tinsley, J M; Davies, K E; Passananti, C

    2000-06-01

    Up-regulation of utrophin gene expression is recognized as a plausible therapeutic approach in the treatment of Duchenne muscular dystrophy (DMD). We have designed and engineered new zinc finger-based transcription factors capable of binding and activating transcription from the promoter of the dystrophin-related gene, utrophin. Using the recognition 'code' that proposes specific rules between zinc finger primary structure and potential DNA binding sites, we engineered a new gene named 'Jazz' that encodes for a three-zinc finger peptide. Jazz belongs to the Cys2-His2 zinc finger type and was engineered to target the nine base pair DNA sequence: 5'-GCT-GCT-GCG-3', present in the promoter region of both the human and mouse utrophin gene. The entire zinc finger alpha-helix region, containing the amino acid positions that are crucial for DNA binding, was specifically chosen on the basis of the contacts more frequently represented in the available list of the 'code'. Here we demonstrate that Jazz protein binds specifically to the double-stranded DNA target, with a dissociation constant of about 32 nM. Band shift and super-shift experiments confirmed the high affinity and specificity of Jazz protein for its DNA target. Moreover, we show that chimeric proteins, named Gal4-Jazz and Sp1-Jazz, are able to drive the transcription of a test gene from the human utrophin promoter.

  14. Off Target, but Sequence-Specific, shRNA-Associated Trans-Activation of Promoter Reporters in Transient Transfection Assays

    PubMed Central

    Wan, Jun; Yerrabelli, Anitha; Berlinicke, Cindy; Kallman, Alyssa; Qian, Jiang; Zack, Donald J.

    2016-01-01

    Transient transfection promoter reporter assays are commonly used in the study of transcriptional regulation, and can be used to define and characterize both cis-acting regulatory sequences and trans-acting factors. In the process of using a variety of reporter assays designed to study regulation of the rhodopsin (rho) promoter, we discovered that rhodopsin promoter-driven reporter expression could be activated by certain species of shRNA in a gene-target-independent but shRNA sequence-specific manner, suggesting involvement of a specific shRNA associated pathway. Interestingly, the shRNA-mediated increase of rhodopsin promoter activity was synergistically enhanced by the rhodopsin transcriptional regulators CRX and NRL. Additionally, the effect was cell line-dependent, suggesting that this pathway requires the expression of cell-type specific factors. Since microRNA (miRNA) and interferon response-mediated processes have been implicated in RNAi off-target phenomena, we performed miRNA and gene expression profiling on cells transfected with shRNAs that do target a specific gene but have varied effects on rho reporter expression in order to identify transcripts whose expression levels are associated with shRNA induced rhodopsin promoter reporter activity. We identified a total of 50 miRNA species, and by microarray analysis, 320 protein-coding genes, some of which were predicted targets of the identified differentially expressed miRNAs, whose expression was altered in the presence of shRNAs that stimulated rhodopsin-promoter activity in a non-gene-targeting manner. Consistent with earlier studies on shRNA off-target effects, a number of interferon response genes were among those identified to be upregulated. Taken together, our results confirm the importance of considering off-target effects when interpreting data from RNAi experiments and extend prior results by focusing on the importance of including multiple and carefully designed controls in the design and

  15. Informational structure of genetic sequences and nature of gene splicing

    NASA Astrophysics Data System (ADS)

    Trifonov, E. N.

    1991-10-01

    Only about 1/20 of DNA of higher organisms codes for proteins, by means of classical triplet code. The rest of DNA sequences is largely silent, with unclear functions, if any. The triplet code is not the only code (message) carried by the sequences. There are three levels of molecular communication, where the same sequence ``talks'' to various bimolecules, while having, respectively, three different appearances: DNA, RNA and protein. Since the molecular structures and, hence, sequence specific preferences of these are substantially different, the original DNA sequence has to carry simultaneously three types of sequence patterns (codes, messages), thus, being a composite structure in which one had the same letter (nucleotide) is frequently involved in several overlapping codes of different nature. This multiplicity and overlapping of the codes is a unique feature of the Gnomic, language of genetic sequences. The coexisting codes have to be degenerate in various degrees to allow an optimal and concerted performance of all the encoded functions. There is an obvious conflict between the best possible performance of a given function and necessity to compromise the quality of a given sequence pattern in favor of other patterns. It appears that the major role of various changes in the sequences on their ``ontogenetic'' way from DNA to RNA to protein, like RNA editing and splicing, or protein post-translational modifications is to resolve such conflicts. New data are presented strongly indicating that the gene splicing is such a device to resolve the conflict between the code of DNA folding in chromatin and the triplet code for protein synthesis.

  16. Sequence analysis and potentials of the native RbcS promoter in the development of an alternative eukaryotic expression system using green Microalga Ankistrodesmus convolutus.

    PubMed

    Thanh, Tran; Chi, Vu Thi Quynh; Omar, Hishamuddin; Abdullah, Mohd Puad; Napis, Suhaimi

    2012-01-01

    The availability of highly active homologous promoters is critical in the development of a transformation system and improvement of the transformation efficiency. To facilitate transformation of green microalga Ankistrodesmus convolutus which is considered as a potential candidate for many biotechnological applications, a highly-expressed native promoter sequence of ribulose-1,5-bisphosphate carboxylase/oxygenase small subunit (AcRbcS) has been used to drive the expression of β-glucuronidase (gusA) gene in this microalga. Besides the determination of the transcription start site by 5'-RACE, sequence analysis revealed that AcRbcS promoter contained consensus TATA-box and several putative cis-acting elements, including some representative light-regulatory elements (e.g., G-box, Sp1 motif and SORLIP2), which confer light responsiveness in plants, and several potential conserved motifs (e.g., CAGAC-motif, YCCYTGG-motifs and CACCACA-motif), which may be involved in light responsiveness of RbcS gene in green microalgae. Using AcRbcS promoter::gusA translational fusion, it was demonstrated that this promoter could function as a light-regulated promoter in transgenic A. convolutus, which suggested that the isolated AcRbcS promoter was a full and active promoter sequence that contained all cis-elements required for developmental and light-mediated control of gene expression, and this promoter can be used to drive the expression of heterologous genes in A. convolutus. This achievement therefore advances the development of A. convolutus as an alternative expression system for the production of recombinant proteins. This is the first report on development of gene manipulation system for unicellular green alga A. convolutus.

  17. Analyses of promoter-proximal pausing by RNA polymerase II on the hsp70 heat shock gene promoter in a Drosophila nuclear extract.

    PubMed Central

    Li, B; Weber, J A; Chen, Y; Greenleaf, A L; Gilmour, D S

    1996-01-01

    Analyses of Drosophila cells have revealed that RNA polymerase II is paused in a region 20 to 40 nucleotides downstream from the transcription start site of the hsp70 heat shock gene when the gene is not transcriptionally active. We have developed a cell-free system that reconstitutes this promoter-proximal pausing. The paused polymerase has been detected by monitoring the hyperreactivity of thymines in the transcription bubble toward potassium permanganate. The pattern of permanganate reactivity for the hsp70 promoter in the reconstituted system matches the pattern found on the promoter after it has been introduced back into files by P-element-mediated transposition. Matching patterns of permanganate reactivity are also observed for a non-heat shock promoter, the histone H3 promoter. Further analysis of the hsp70 promoter in the reconstituted system reveals that pausing does not depend on sequence-specific interactions located immediately downstream from the pause site. Sequences upstream from the TATA box influence the recruitment of polymerase rather than the efficiency of pausing. Kinetic analysis indicates that the polymerase rapidly enters the paused state and remains stably in this state for at least 25 min. Further analysis shows that the paused polymerase will initially resume elongation when Sarkosyl is added but loses this capacity within minutes of pausing. Using an alpha-amanitin-resistant polymerase, we provide evidence that promoter-proximal pausing does not require the carboxy-terminal domain of the polymerase. PMID:8816456

  18. Next-generation tag sequencing for cancer gene expression profiling.

    PubMed

    Morrissy, A Sorana; Morin, Ryan D; Delaney, Allen; Zeng, Thomas; McDonald, Helen; Jones, Steven; Zhao, Yongjun; Hirst, Martin; Marra, Marco A

    2009-10-01

    We describe a new method, Tag-seq, which employs ultra high-throughput sequencing of 21 base pair cDNA tags for sensitive and cost-effective gene expression profiling. We compared Tag-seq data to LongSAGE data and observed improved representation of several classes of rare transcripts, including transcription factors, antisense transcripts, and intronic sequences, the latter possibly representing novel exons or genes. We observed increases in the diversity, abundance, and dynamic range of such rare transcripts and took advantage of the greater dynamic range of expression to identify, in cancers and normal libraries, altered expression ratios of alternative transcript isoforms. The strand-specific information of Tag-seq reads further allowed us to detect altered expression ratios of sense and antisense (S-AS) transcripts between cancer and normal libraries. S-AS transcripts were enriched in known cancer genes, while transcript isoforms were enriched in miRNA targeting sites. We found that transcript abundance had a stronger GC-bias in LongSAGE than Tag-seq, such that AT-rich tags were less abundant than GC-rich tags in LongSAGE. Tag-seq also performed better in gene discovery, identifying >98% of genes detected by LongSAGE and profiling a distinct subset of the transcriptome characterized by AT-rich genes, which was expressed at levels below those detectable by LongSAGE. Overall, Tag-seq is sensitive to rare transcripts, has less sequence composition bias relative to LongSAGE, and allows differential expression analysis for a greater range of transcripts, including transcripts encoding important regulatory molecules.

  19. BLG-e1 - a novel regulatory element in the distal region of the beta-lactoglobulin gene promoter.

    PubMed

    Reichenstein, Moshe; German, Tania; Barash, Itamar

    2005-04-11

    beta-Lactoglobulin (BLG) is a major ruminant milk protein. A regulatory element, termed BLG-e1, was defined in the distal region of the ovine BLG gene promoter. This 299-bp element lacks the established cis-regulatory sequences that affect milk-protein gene expression. Nevertheless, it alters the binding of downstream BLG sequences to histone H4 and the sensitivity of the histone-DNA complexes to trichostatin A treatment. In mammary cells cultured under favorable lactogenic conditions, BLG-e1 acts as a potent, position-independent silencer of BLG/luciferase expression, and similarly affects the promoter activity of the mouse whey acidic protein gene. Intragenic sequences upstream of BLG exon 2 reverse the silencing effect of BLG-e1 in vitro and in transgenic mice.

  20. The nucleotide sequence of a nematode vitellogenin gene.

    PubMed Central

    Spieth, J; Denison, K; Zucker, E; Blumenthal, T

    1985-01-01

    The nematode, Caenorhabditis elegans, contains a family of six genes that code for vitellogenins. Here we report the complete nucleotide sequence of one of these genes, vit-5. The gene specifies a mRNA of 4869 nucleotides, including untranslated regions of 9 bases at the 5' end and 51 bases at the 3' end. Vit-5 contains four short introns totalling 218 bp. The predicted vitellogenin, yp170A, has a molecular weight of 186,430. At its N terminus it is clearly related to the vitellogenins of vertebrates. However, the vit-5-encoded protein does not contain a serine-rich sequence related to the vertebrate vitellin, phosvitin. In fact, the amino acid composition of the nematode protein is very similar to that of the vertebrate protein without phosvitin. Vit-5 has a highly asymmetric codon choice dictionary. The favored codons are different from those favored in other organisms, but are characteristic of highly expressed C. elegans genes. The strong selection against rare codons is not as great near the 5' end of the gene; rare codons are 15 times more frequent within the first 54 bp than in the next 4.8 kb. PMID:3855245

  1. Nucleotide Sequence of the Protective Antigen Gene of Bacillus Anthracis

    DTIC Science & Technology

    1988-02-02

    transcription and translation of the Bacillus megaterium protein C gene. J. Bacteriol. 158:e09-813. 9. Friedlander, A, M. 1986. Macrophages are sensitive to...of the Protective Antigen Gene of Bacillus anthracis 6. pEaltranalO opl. AMPOA’T B*u~iA S. L. Welkos, J. R. Lowe, F. Eden-McCutchan, M. Vodkin, S. M... Bacillus anthracls and the 5’ and 3’ flanking sequences were determined. Protective antigen ie one of three proteins comprising anthrax toxin. The open

  2. Cloning and sequencing of the gene encoding cytochrome c sub 553 from Desulfovibrio vulgaris Hildenborough

    SciTech Connect

    van Rooijen, G.J.H.; Voordouw, G. ); Bruschi, M. )

    1989-06-01

    The gene encoding cytochrome c{sub 553} from Desulfovibrio vulgaris Hildenborough was cloned by using two synthetic deoxyoligonucleotide probes. The amino acid sequence derived from the sequence of the gene differs from that reported by Bruschi and LeGall. Renewed protein sequencing confirmed the correctness of the DNA-derived sequence. The gene sequence indicates cytochrome c{sub 553} to be synthesized as a precursor protein with an NH{sub 2}-terminal signal sequence of 24 residues.

  3. Isolation and functional analysis of the promoter of the amphioxus Hsp70a gene.

    PubMed

    Li, Dingliang; Li, Guang; Wang, Kunru; Liu, Xin; Li, Weiye; Chen, Xinhua; Wang, Yiquan

    2012-11-15

    Amphioxus is a promising laboratorial model animal for studying the evolutionary and developmental mechanisms that appeared during the invertebrate-chordate to vertebrate transition. However, the main drawback for the use of amphioxus as a model organism is the lack of well-developed technical approaches. Conditional gene expression, as performed with thermal control, is a very useful strategy in gene function studies. To make this method possible in amphioxus studies, here we report the isolation and characterization of an amphioxus Hsp70 gene (Hsp70a) and its promoter in Chinese amphioxus (Branchiostoma belcheri). Hsp70a showed very low expression at normal temperatures but was robustly induced in animals upon heat shock. The basal cis-acting elements (CAAT and TATA), as well as four heat shock elements (HSEs), were found within the regulatory region (-1031 to -11 upstream from the start codon), but surprisingly most of the elements were located in the 5'UTR region (-252 to -10). Reporter constructs, including sequences from both the transcription start site (TSS) and ATG were tested for transient expression in EPC cells and microinjected zebrafish embryos. Results suggested that the 5'UTR region, which includes a TATA box at -92bp, a CAAT box at -152bp, and three HSE elements (-212 to -106), represents the core hsp promoter sequence of the B. belcheri Hsp70a gene. Therefore in this study we identified an effectively thermo-inducible promoter in amphioxus that could be used for the establishment of a conditional gene expression system in which the target gene can be regulated in a temporal- or tissue-specific way in amphioxus.

  4. Genome Sequence of Enterobacter radicincitans DSM16656T, a Plant Growth-Promoting Endophyte

    PubMed Central

    Witzel, Katja; Gwinn-Giglio, Michelle; Nadendla, Suvarna; Shefchek, Kent

    2012-01-01

    Enterobacter radicincitans sp. nov. DSM16656T represents a new species of the genus Enterobacter which is a biological nitrogen-fixing endophytic bacterium with growth-promoting effects on a variety of crop and model plant species. The presence of genes for nitrogen fixation, phosphorous mobilization, and phytohormone production reflects this microbe's potential plant growth-promoting activity. PMID:22965092

  5. Genome sequence of Enterobacter radicincitans DSM16656(T), a plant growth-promoting endophyte.

    PubMed

    Witzel, Katja; Gwinn-Giglio, Michelle; Nadendla, Suvarna; Shefchek, Kent; Ruppel, Silke

    2012-10-01

    Enterobacter radicincitans sp. nov. DSM16656(T) represents a new species of the genus Enterobacter which is a biological nitrogen-fixing endophytic bacterium with growth-promoting effects on a variety of crop and model plant species. The presence of genes for nitrogen fixation, phosphorous mobilization, and phytohormone production reflects this microbe's potential plant growth-promoting activity.

  6. Promoter architecture and transcriptional regulation of Abf1-dependent ribosomal protein genes in Saccharomyces cerevisiae

    PubMed Central

    Fermi, Beatrice; Bosio, Maria Cristina; Dieci, Giorgio

    2016-01-01

    In Saccharomyces cerevisiae, ribosomal protein gene (RPG) promoters display binding sites for either Rap1 or Abf1 transcription factors. Unlike Rap1-associated promoters, the small cohort of Abf1-dependent RPGs (Abf1-RPGs) has not been extensively investigated. We show that RPL3, RPL4B, RPP1A, RPS22B and RPS28A/B share a common promoter architecture, with an Abf1 site upstream of a conserved element matching the sequence recognized by Fhl1, a transcription factor which together with Ifh1 orchestrates Rap1-associated RPG regulation. Abf1 and Fhl1 promoter association was confirmed by ChIP and/or gel retardation assays. Mutational analysis revealed a more severe requirement of Abf1 than Fhl1 binding sites for RPG transcription. In the case of RPS22B an unusual Tbf1 binding site promoted both RPS22B and intron-hosted SNR44 expression. Abf1-RPG down-regulation upon TOR pathway inhibition was much attenuated at defective mutant promoters unable to bind Abf1. TORC1 inactivation caused the expected reduction of Ifh1 occupancy at RPS22B and RPL3 promoters, but unexpectedly it entailed largely increased Abf1 association with Abf1-RPG promoters. We present evidence that Abf1 recruitment upon nutritional stress, also observed for representative ribosome biogenesis genes, favours RPG transcriptional rescue upon nutrient replenishment, thus pointing to nutrient-regulated Abf1 dynamics at promoters as a novel mechanism in ribosome biogenesis control. PMID:27016735

  7. Conservation of position and sequence of a novel, widely expressed gene containing the major human {alpha}-globin regulatory element

    SciTech Connect

    Vyas, P.; Vickers, M.A.; Picketts, D.J.; Higgs, D.R.

    1995-10-10

    We have determined the cDNA and genomic structure of a gene (-14 gene) that lies adjacent to the human {alpha}-globin cluster. Although it is expressed in a wide range of cell lines and tissues, a previously described erythroid-specific regulatory element that controls expression of the {alpha}-globin genes lies within intron 5 of this gene. Analysis of the -14 gene promoter shows that it is GC rich and associated with a constitutively expressed DNase 1 hypersensitive site; unlike the {alpha}-globin promoter, it does not contain a TATA or CCAAT box. These and other differences in promoter structure may explain why the erythroid regulatory element interacts specifically with the {alpha}-globin promoters and not the -14 gene promoter, which lies between the {alpha} promoters and their regulatory element. Interspecies comparisons demonstrate that the sequence and location of the -14 gene adjacent to the a cluster have been maintained since the bird/mammal divergence, 270 million years ago. 38 refs., 6 figs.

  8. Differential interactions of promoter elements in stress responses of the Arabidopsis Adh gene.

    PubMed Central

    Dolferus, R; Jacobs, M; Peacock, W J; Dennis, E S

    1994-01-01

    The Adh (alcohol dehydrogenase, EC 1.1.1.1.) gene from Arabidopsis thaliana (L.) Heynh. can be induced by dehydration and cold, as well as by hypoxia. A 1-kb promoter fragment (CADH: -964 to +53) is sufficient to confer the stress induction and tissue-specific developmental expression characteristics of the Adh gene to a beta-glucuronidase reporter gene. Deletion mapping of the 5' end and site-specific mutagenesis identified four regions of the promoter essential for expression under the three stress conditions. Some sequence elements are important for response to all three stress treatments, whereas others are stress specific. The most critical region essential for expression of the Arabidopsis Adh promoter under all three environmental stresses (region IV: -172 to -141) contains sequences homologous to the GT motif (-160 to -152) and the GC motif (-147 to -144) of the maize Adh1 anaerobic responsive element. Region III (-235 to -172) contains two regions shown by R.J. Ferl and B.H. Laughner ([1989] Plant Mol Biol 12: 357-366) to bind regulatory proteins; mutation of the G-box-1 region (5'-CCACGTGG-3', -216 to -209) does not affect expression under uninduced or hypoxic conditions, but significantly reduces induction by cold stress and, to a lesser extent, by dehydration stress. Mutation of the other G-box-like sequence (G-box-2: 5'-CCAAGTGG-3', -193 to -182) does not change hypoxic response and affects cold and dehydration stress only slightly. G-box-2 mutations also promote high levels of expression under uninduced conditions. Deletion of region I (-964 to -510) results in increased expression under uninduced and all stress conditions, suggesting that this region contains a repressor binding site. Region II (-510 to -384) contains a positive regulatory element and is necessary for high expression levels under all treatments. PMID:7972489

  9. Functional analysis of the human neurofilament light chain gene promoter.

    PubMed Central

    Yazdanbakhsh, K; Fraser, P; Kioussis, D; Vidal, M; Grosveld, F; Lindenbaum, M

    1993-01-01

    We have carried out a structural and functional analysis on the human NF-L (H-NF-L) gene. It contains a methylation-free island, spanning the 5' flanking sequences and the first exon and a number of neuronal-specific DNase I hypersensitive sites have been identified in the upstream region as well as within the body of the gene. Analysis in cell lines and transgenic mice using a combination of these sites has revealed the presence of a conserved element(s) between -300bp and -190bp which is required for neuronal-specific expression. Images PMID:8441658

  10. From expression cloning to gene modeling: the development of Xenopus gene sequence resources.

    PubMed

    Gilchrist, Michael J

    2012-03-01

    The Xenopus community has made concerted efforts over the last 10-12 years systematically to improve the available sequence information for this amphibian model organism ideally suited to the study of early development in vertebrates. Here I review progress in the collection of both sequence data and physical clone reagents for protein coding genes. I conclude that we have cDNA sequences for around 50% and full-length clones for about 35% of the genes in Xenopus tropicalis, and similar numbers but a smaller proportion for Xenopus laevis. In addition, I demonstrate that the gaps in the current genome assembly create problems for the computational elucidation of gene sequences, and suggest some ways to ameliorate the effects of this.

  11. Cloning, sequencing, and overexpression of the Anaerobiospirillum succiniciproducens phosphoenolpyruvate carboxykinase (pckA) gene.

    PubMed Central

    Laivenieks, M; Vieille, C; Zeikus, J G

    1997-01-01

    The phosphoenolpyruvate (PEP) carboxykinase-encoding gene from the anaerobic, CO2-fixing, succinate-producing bacterium Anaerobiospirillum succiniciproducens was cloned, sequenced, and expressed in Escherichia coli. The gene encoded a 532-residue polypeptide with a calculated molecular mass of 58.7 kDa. The sequence of the A. succiniciproducens PEP carboxykinase was similar to those of all known ATP/ADP-dependent PEP carboxykinases. In particular, the A. succiniciproducens enzyme was 67.3% identical and 79.2% similar to the E. coli enzyme. The A. succiniciproducens pckA transcription start site was determined, and putative promoter regions were identified. The recombinant enzyme was overexpressed in E. coli. The purified enzyme was indiscernible from the native enzyme by sodium dodecyl sulfate-polyacrylamide gel electrophoresis and had the same activity as the native enzyme. PMID:9172347

  12. DNA sequence analysis of a mouse pro alpha 1 (I) procollagen gene: evidence for a mouse B1 element within the gene.

    PubMed Central

    Monson, J M; Friedman, J; McCarthy, B J

    1982-01-01

    In a 3.8-kilobase mouse DNA sequence encoding amino acid sequences for the pro alpha 1(I) chain of type I procollagen, 14 coding sequences were identified which specify a sequence 95% homologous to amino acid residues 568 to 963 of the bovine alpha 1(I) chain. All of these coding sequences were flanked by appropriate splice junctions following the GT/AG rule. These observations suggest, but do not prove, that this pro alpha 1(I) gene is transcriptionally active. Of the 14 coding sequences, 7 were 54 base pairs in length, whereas the remainder were higher multiples of 54 base pairs. Nonrandom utilization of codons pertained throughout all of the coding sequences showing a preference (56%) for U in the wobble position. Two of the intervening sequences encoded imperfect vestiges of coding sequences which exhibited a codon preference different from that of the pro alpha 1(I) gene proper and were not flanked by splice junctions. One intervening sequence encoded a member of the mouse B1 family of middle repetitive sequences. It was flanked by 8-base-pair direct repeats and had a truncated A-rich region, suggesting that it may be a mobile element. Within this element were sequences which could function as a RNA polymerase III split promoter. Images PMID:6298597

  13. Chloroplast gene sequences and the study of plant evolution.

    PubMed Central

    Clegg, M T

    1993-01-01

    A large body of sequence data has accumulated for the chloroplast-encoded gene ribulose-1,5-biphosphate carboxylase/oxygenase (rbcL) as the result of a cooperative effort involving many laboratories. The data span all seed plants, including most major lineages from the angiosperms, and as such they provide an unprecedented opportunity to study plant evolutionary history. The full analysis of this large data set poses many problems and opportunities for plant evolutionary biologists and for biostatisticians. PMID:8421667

  14. Pollen- and anther-specific chi promoters from petunia: tandem promoter regulation of the chiA gene.

    PubMed Central

    van Tunen, A J; Mur, L A; Brouns, G S; Rienstra, J D; Koes, R E; Mol, J N

    1990-01-01

    We have analyzed the spatial and temporal activities of chalcone flavanone isomerase (chi) A and B gene promoters from petunia. To study the tandem promoter regulation of chiA, various chiA promoter fragments were fused with the beta-glucuronidase (GUS) reporter gene. Analysis of transgenic plants containing these chimeric genes provided definitive proof that the chiA coding region is regulated by two distinct promoters (designated PA1 and PA2). We also showed that both promoters can function independently and that the chiA PA1 promoter is expressed in limb (epidermal and parenchyma cells), tube (inner epidermal and parenchyma cells), seed (seed coat, endosperm, and embryo), sepal, leaf, and stem. The use of chiA and chiB promoters in the regulation of anther- and pollen-specific gene expression has been studied. By analyzing transgenic plants containing chimeric genes consisting of chiA and B promoter fragments and the GUS reporter gene, we were able to identify a 0.44-kilobase chiA PA2 promoter fragment that drives pollen-specific gene expression and a 1.75-kilobase chiB PB promoter fragment that confers anther-specific (pollen and tapetum cells) expression to the GUS gene. PMID:2152165

  15. Structure of the gene for human. beta. /sub 2/-adrenergic receptor: expression and promoter characterization

    SciTech Connect

    Emorine, L.J.; Marullo, S.; Delavier-Klutchko, C.; Kaveri, S.V.; Durieu-Trautmann, O.; Strosberg, A.D.

    1987-10-01

    The genomic gene coding for the human ..beta../sub 2/-adrenergic receptor (..beta../sub 2/AR) from A431 epidermoid cells has been isolated. Transfection of the gene into eukaryotic cells restores a fully active receptor/GTP-binding protein/adenylate cyclase complex with ..beta../sub 2/AR properties. Southern blot analyses with ..beta../sub 2/AR-specific probes show that a single ..beta../sub 2/AR gene is common to various human tissues and that its flanking sequences are highly conserved among humans and between man and rabbit, mouse, and hamster. Functional significance of these regions is supported by the presence of a promoter region (including mRNA cap sites, two TATA boxes, a CAAT box, and three G + C-rich regions that resemble binding sites for transcription factor Sp1) 200-300 base pairs 5' to the translation initiation codon. In the 3' flanking region, sequences homologous to glucocorticoid-response elements might be responsible for the increased expression of the ..beta../sub 2/AR gene observed after treatment of the transfected cells with hydrocortisone. In addition, 5' to the promoter region, an open reading frame encodes a 251-residue polypeptide that displays striking homologies with protein kinases and other nucleotide-binding proteins.

  16. Cloning and characterization of largemouth bass ( Micropterus salmoides) myostatin encoding gene and its promoter

    NASA Astrophysics Data System (ADS)

    Li, Shengjie; Bai, Junjie; Wang, Lin

    2008-08-01

    Myostatin or GDF-8, a member of the transforming growth factor-β (TGF-β) superfamily, has been demonstrated to be a negative regulator of skeletal muscle mass in mammals. In the present study, we obtained a 5.64 kb sequence of myostatin encoding gene and its promoter from largemouth bass ( Micropterus salmoides). The myostatin encoding gene consisted of three exons (488 bp, 371 bp and 1779 bp, respectively) and two introns (390 bp and 855 bp, respectively). The intron-exon boundaries were conservative in comparison with those of mammalian myostatin encoding genes, whereas the size of introns was smaller than that of mammals. Sequence analysis of 1.569 kb of the largemouth bass myostatin gene promoter region revealed that it contained two TATA boxes, one CAAT box and nine putative E-boxes. Putative muscle growth response elements for myocyte enhancer factor 2 (MEF2), serum response factor (SRF), activator protein 1 (AP1), etc., and muscle-specific Mt binding site (MTBF) were also detected. Some of the transcription factor binding sites were conserved among five teleost species. This information will be useful for studying the transcriptional regulation of myostatin in fish.

  17. Gene expression analysis using strains constructed by NHEJ-mediated one-step promoter cloning in the yeast Kluyveromyces marxianus.

    PubMed

    Suzuki, Ayako; Fujii, Hiroshi; Hoshida, Hisashi; Akada, Rinji

    2015-09-01

    Gene expression analysis provides valuable information to evaluate cellular state. Unlike quantitative mRNA analysis techniques like reverse-transcription PCR and microarray, expression analysis using a reporter gene has not been commonly used for multiple-gene analysis, probably due to the difficulty in preparing multiple reporter-gene constructs. To circumvent this problem, we developed a novel one-step reporter-gene construction system mediated by non-homologous end joining (NHEJ) in the yeast Kluyveromyces marxianus. As a selectable reporter gene, the ScURA3 selection marker was fused in frame with a red fluorescent gene yEmRFP (ScURA3:yEmRFP). The N-terminally truncated ScURA3:yEmRFP fragment was prepared by PCR. Promoter sequences were also prepared by PCR using primers containing the sequence of the deleted ScURA3 N-terminus to attach at their 3(') ends. The two DNA fragments were used for the transformation of a ura3(-) strain of K. marxianus, in which two DNA fragments are randomly joined and integrated into the chromosome through NHEJ. Only the correctly aligned fragments produced transformants on uracil-deficient medium and expressed red fluorescence under the control of the introduced promoters. A total of 36 gene promoters involved in glycolysis and other pathways were analyzed. Fluorescence measurements of these strains allowed real-time gene expression analysis in different culture conditions.

  18. Deciphering Poxvirus Gene Expression by RNA Sequencing and Ribosome Profiling

    PubMed Central

    Cao, Shuai; Martens, Craig A.; Porcella, Stephen F.; Xie, Zhi; Ma, Ming; Shen, Ben

    2015-01-01

    ABSTRACT The more than 200 closely spaced annotated open reading frames, extensive transcriptional read-through, and numerous unpredicted RNA start sites have made the analysis of vaccinia virus gene expression challenging. Genome-wide ribosome profiling provided an unprecedented assessment of poxvirus gene expression. By 4 h after infection, approximately 80% of the ribosome-associated mRNA was viral. Ribosome-associated mRNAs were detected for most annotated early genes at 2 h and for most intermediate and late genes at 4 and 8 h. Cluster analysis identified a subset of early mRNAs that continued to be translated at the later times. At 2 h, there was excellent correlation between the abundance of individual mRNAs and the numbers of associated ribosomes, indicating that expression was primarily transcriptionally regulated. However, extensive transcriptional read-through invalidated similar correlations at later times. The mRNAs with the highest density of ribosomes had host response, DNA replication, and transcription roles at early times and were virion components at late times. Translation inhibitors were used to map initiation sites at single-nucleotide resolution at the start of most annotated open reading frames although in some cases a downstream methionine was used instead. Additional putative translational initiation sites with AUG or alternative codons occurred mostly within open reading frames, and fewer occurred in untranslated leader sequences, antisense strands, and intergenic regions. However, most open reading frames associated with these additional translation initiation sites were short, raising questions regarding their biological roles. The data were used to construct a high-resolution genome-wide map of the vaccinia virus translatome. IMPORTANCE This report contains the first genome-wide, high-resolution analysis of poxvirus gene expression at both transcriptional and translational levels. The study was made possible by recent methodological

  19. GeneQuiz: A workbench for sequence analysis

    SciTech Connect

    Scharf, M.; Schneider, R.; Casari, G.; Bork, P.

    1994-12-31

    We present the prototype of a software system, called GeneQuiz, for large-scale biological sequence analysis. The system was designed to meet the needs that arise in computational sequence analysis and our past experience with the analysis of 171 protein sequences of yeast chromosome III. We explain the cognitive challenges associated with this particular research activity and present our model of the sequence analysis process. The prototype system consists of two parts: (i) the database update and search system (driven by perl programs and rdb, a simple relational database engine also written in perl) and (ii) the visualization and browsing system (developed under C++/ET++). The principal design requirement for the first part was the complete automation of all repetitive actions: database up- dates, efficient sequence similarity searches and sampling of results in a uniform fashion. The user is then presented with {open_quotes}hit-lists{close_quotes} that summarize the results from heterogeneous database searches. The expert`s primary task now simply becomes the further analysis of the candidate entries, where the problem is to extract adequate information about functional characteristics of the query protein rapidly. This second task is tremendously accelerated by a simple combination of the heterogeneous output into uniform relational tables and the provision of browsing mechanisms that give access to database records, sequence entries and alignment views. Indexing of molecular sequence databases provides fast retrieval of individual entries with the use of unique identifiers as well as browsing through databases using pre-existing cross-references. The presentation here covers an overview of the architecture of the system prototype and our experiences on its applicability in sequence analysis.

  20. Full-Length Minor Ampullate Spidroin Gene Sequence

    PubMed Central

    Chen, Gefei; Liu, Xiangqin; Zhang, Yunlong; Lin, Senzhu; Yang, Zijiang; Johansson, Jan; Rising, Anna; Meng, Qing

    2012-01-01

    Spider silk includes seven protein based fibers and glue-like substances produced by glands in the spider's abdomen. Minor ampullate silk is used to make the auxiliary spiral of the orb-web and also for wrapping prey, has a high tensile strength and does not supercontract in water. So far, only partial cDNA sequences have been obtained for minor ampullate spidroins (MiSps). Here we describe the first MiSp full-length gene sequence from the spider species Araneus ventricosus, using a multidimensional PCR approach. Comparative analysis of the sequence reveals regulatory elements, as well as unique spidroin gene and protein architecture including the presence of an unusually large intron. The spliced full-length transcript of MiSp gene is 5440 bp in size and encodes 1766 amino acid residues organized into conserved nonrepetitive N- and C-terminal domains and a central predominantly repetitive region composed of four units that are iterated in a non regular manner. The repeats are more conserved within A. ventricosus MiSp than compared to repeats from homologous proteins, and are interrupted by two nonrepetitive spacer regions, which have 100% identity even at the nucleotide level. PMID:23251707

  1. Sequence elements in the human osteocalcin gene confer basal activation and inducible response to hormonal vitamin D3.

    PubMed

    Kerner, S A; Scott, R A; Pike, J W

    1989-06-01

    Osteoblast-specific expression of the bone protein osteocalcin is controlled at the transcriptional level by the steroid hormone 1 alpha,25-dihydroxyvitamin D3. As this protein may represent a marker for bone activity in human disease, we examined the regulation of its expression at the molecular level by evaluating human osteocalcin gene promoter function. We describe regions within the promoter that contribute to basal expression of the gene in osteoblast-like cells in culture. Further, we define a 21-base-pair DNA element with the sequence 5'-GTGACTCACCGGGTGAACGGG-3', which acts in cis to mediate 1 alpha,25-dihydroxyvitamin D3 inducibility of the osteocalcin gene. This response element bears sequence similarity with other short DNA segments, particularly those for estrogen and thyroid hormone, which act together with their respective trans-acting receptors to modulate gene transcription.

  2. Draft Genome Sequence of the Plant Growth-Promoting Rhizobacterium Pseudomonas fluorescens Strain CREA-C16 Isolated from Pea (Pisum sativum L.) Rhizosphere

    PubMed Central

    Sorrentino, Roberto; Scotti, Riccardo; Salzano, Melania; Aurilia, Vincenzo

    2017-01-01

    ABSTRACT Herein, we report the draft genome sequence of Pseudomonas fluorescens strain CREA-C16, a plant growth-promoting rhizobacterium that was isolated from the rhizosphere of Pisum sativum L. plants. The genome sequence is ~6 Mb in size, with a G+C content of 60.1%, and includes 4,457 candidate protein-encoding genes. PMID:28126933

  3. Comparative Genomic Analysis of the Streptococcus dysgalactiae Species Group: Gene Content, Molecular Adaptation, and Promoter Evolution

    PubMed Central

    Suzuki, Haruo; Lefébure, Tristan; Hubisz, Melissa Jane; Pavinski Bitar, Paulina; Lang, Ping; Siepel, Adam; Stanhope, Michael J.

    2011-01-01

    Comparative genomics of closely related bacterial species with different pathogenesis and host preference can provide a means of identifying the specifics of adaptive differences. Streptococcus dysgalactiae (SD) is comprised of two subspecies: S. dysgalactiae subsp. equisimilis is both a human commensal organism and a human pathogen, and S. dysgalactiae subsp. dysgalactiae is strictly an animal pathogen. Here, we present complete genome sequences for both taxa, with analyses involving other species of Streptococcus but focusing on adaptation in the SD species group. We found little evidence for enrichment in biochemical categories of genes carried by each SD strain, however, differences in the virulence gene repertoire were apparent. Some of the differences could be ascribed to prophage and integrative conjugative elements. We identified approximately 9% of the nonrecombinant core genome to be under positive selection, some of which involved known virulence factors in other bacteria. Analyses of proteomes by pooling data across genes, by biochemical category, clade, or branch, provided evidence for increased rates of evolution in several gene categories, as well as external branches of the tree. Promoters were primarily evolving under purifying selection but with certain categories of genes evolving faster. Many of these fast-evolving categories were the same as those associated with rapid evolution in proteins. Overall, these results suggest that adaptation to changing environments and new hosts in the SD species group has involved the acquisition of key virulence genes along with selection of orthologous protein-coding loci and operon promoters. PMID:21282711

  4. Complete genome sequence of Bacillus amyloliquefaciens strain Co1-6, a plant growth-promoting rhizobacterium of Calendula officinalis

    SciTech Connect

    Köberl, Martina; White, Richard A.; Erschen, Sabine; Spanberger, Nora; El-Arabi, Tarek F.; Jansson, Janet K.; Berg, Gabriele

    2015-08-13

    The genome sequence of Bacillus amyloliquefaciens strain Co1-6, a plant growth-promoting rhizobacterium (PGPR) with broad-spectrum antagonistic activity against plant-pathogenic fungi, bacteria, and nematodes, consists of a single 3.9-Mb circular chromosome. The genome reveals genes putatively responsible for its promising biocontrol and PGP properties.

  5. Human gene encoding prostacyclin synthase (PTGIS): Genomic organization, chromosomal localization, and promoter activity

    SciTech Connect

    Yokoyama, Chieko; Yabuki, Tomoko; Inoue, Hiroyasu

    1996-09-01

    The prostacyclin synthase gene isolated from human genomic libraries (PTGIS) consists of 10 exons spanning approximately 60 kb. All the splice donor and acceptor sites conform to the GT/AG rule. Genomic Southern blot and fluorescence in situ hybridization analyses revealed that the human prostacyclin synthase gene is present as a single copy per haploid genome and is localized on chromosome 20q13.11-q13.13. The 1.5-kb sequence of the 5{prime} of the translational initiation site contained both GC-rich and pyrimidine-rich regions and consensus sequences of the transcription factor recognition sites such as Sp1, AP-2, the interferon-{gamma} response element, GATA, NF-{kappa}B, the CACCC box, and the glucocorticoid response element. The core binding sequence (GAGACC) of the shear stress responsive element was also found in the 5{prime}-flanking region of the gene. The major product of the primer extension analysis suggested that the transcription of the gene started from the positions around 49 bp upstream of the translational initiation codon. Transient transfection experiments using human aortic and bovine arterial endothelial cells demonstrated that the GC-rich region (positions -145 to -10) possessed a significant promoter activity. The 6-kb downstream sequence of the translational termination codon contained multiple polyadenylation signals, Alu repeat sequences, and the consensus sequence of the primate-repetitive DNA element, MER1. Two sizes of the prostacyclin synthase mRNAs (approximately 6 and 3.3 kb) were detected with the human aorta and lung. RNA blot hybridization analysis using the 3{prime}-untranslated region as probe indicated that the sizes of the 3{prime}-flanking regions were different in the major 6-kb and minor 3.3-kb mRNAs. 54 refs., 7 figs.

  6. Isolation and sequence analysis of the gene encoding triose phosphate isomerase from Zygosaccharomyces bailii.

    PubMed

    Merico, A; Rodrigues, F; Côrte-Real, M; Porro, D; Ranzi, B M; Compagno, C

    2001-06-30

    The ZbTPI1 gene encoding triose phosphate isomerase (TIM) was cloned from a Zygosaccharomyces bailii genomic library by complementation of the Saccharomyces cerevisiae tpi1 mutant strain. The nucleotide sequence of a 1.5 kb fragment showed an open reading frame (ORF) of 746 bp, encoding a protein of 248 amino acid residues. The deduced amino acid sequence shares a high degree of homology with TIMs from other yeast species, including some highly conserved regions. The analysis of the promoter sequence of the ZbTPI1 revealed the presence of putative motifs known to have regulatory functions in S. cerevisiae. The GenBank Accession No. of ZbTPI1 is AF325852.

  7. Arabidopsis meiotic crossover hot spots overlap with H2A.Z nucleosomes at gene promoters.

    PubMed

    Choi, Kyuha; Zhao, Xiaohui; Kelly, Krystyna A; Venn, Oliver; Higgins, James D; Yelina, Nataliya E; Hardcastle, Thomas J; Ziolkowski, Piotr A; Copenhaver, Gregory P; Franklin, F Chris H; McVean, Gil; Henderson, Ian R

    2013-11-01

    PRDM9 directs human meiotic crossover hot spots to intergenic sequence motifs, whereas budding yeast hot spots overlap regions of low nucleosome density (LND) in gene promoters. To investigate hot spots in plants, which lack PRDM9, we used coalescent analysis of genetic variation in Arabidopsis thaliana. Crossovers increased toward gene promoters and terminators, and hot spots were associated with active chromatin modifications, including H2A.Z, histone H3 Lys4 trimethylation (H3K4me3), LND and low DNA methylation. Hot spot-enriched A-rich and CTT-repeat DNA motifs occurred upstream and downstream, respectively, of transcriptional start sites. Crossovers were asymmetric around promoters and were most frequent over CTT-repeat motifs and H2A.Z nucleosomes. Pollen typing, segregation and cytogenetic analysis showed decreased numbers of crossovers in the arp6 H2A.Z deposition mutant at multiple scales. During meiosis, H2A.Z forms overlapping chromosomal foci with the DMC1 and RAD51 recombinases. As arp6 reduced the number of DMC1 or RAD51 foci, H2A.Z may promote the formation or processing of meiotic DNA double-strand breaks. We propose that gene chromatin ancestrally designates hot spots within eukaryotes and PRDM9 is a derived state within vertebrates.

  8. Analysis of the promoter region of the gene encoding NAD-dependent methylenetetrahydrofolate dehydrogenase-methenyltetrahydrofolate cyclohydrolase.

    PubMed Central

    Bélanger, C; Peri, K G; MacKenzie, R E

    1991-01-01

    Sequence analysis of the 5'-flanking region of the gene encoding NAD-dependent methylenetetrahydrofolate dehydrogenase-methenyltetrahydrofolate cyclohydrolase (NMDMC) revealed several putative cis-regulatory elements. To delineate the function of these regulatory elements, various deletion mutants of the 5'-flanking region were connected to the reporter gene chloramphenicol acetyltransferase (CAT) and promoter activity was measured in transient transfection assays. Transfection experiments performed with the sequence extending from -508 to +59 produced a high-level transient expression of the CAT gene in BALB/c 3T3-SV-T2 and NIH 3T3 cells. Removal of the sequence from +16 to +59 which includes the second transcription start point at +43, a TATA-like box and 5'-untranslated sequences abolished the promoter activity. Deletion analysis of 5'-upstream sequences revealed that the region from positions -55 to +59 is sufficient to mediate a high CAT activity comparable to the level obtained with the construct -508/+59. Within this region are found a CAAT box, a TATA-like box and two putative GC boxes. A functional analysis of the promoter showed that the sequence from -55 to +59 is sufficient to respond to stimulation by serum. Images PMID:1843253

  9. Cruciform-extruding regulatory element controls cell-specific activity of the tyrosine hydroxylase gene promoter.

    PubMed Central

    Kim, E L; Peng, H; Esparza, F M; Maltchenko, S Z; Stachowiak, M K

    1998-01-01

    Tyrosine hydroxylase (TH) is expressed specifically in catecholaminergic cells. We have identified a novel regulatory sequence in the upstream region of the bovine TH gene promoter formed by a dyad symmetry element (DSE1;-352/-307 bp). DSE1 supports TH promoter activity in TH-expressing bovine adrenal medulla chromaffin (BAMC) cells and inhibits promoter activity in non-expressing TE671 cells. DNase I footprinting of relaxed TH promoter DNA showed weak binding of nuclear BAMC cell proteins to a short sequence in the right DSE1 arm. In BAMC cells, deletion of the right arm markedly reduced the expression of luciferase from the TH promoter. However, deletion of the left DSE1 arm or its reversed orientation (RevL) also inactivated the TH promoter. In supercoiled TH promoter, DSE1 assumes a cruciform-like conformation i.e., it binds cruciform-specific 2D3 antibody, and S1 nuclease-cleavage and OsO4-modification assays have identified an imperfect cruciform extruded by the DSE1. DNase I footprinting of supercoiled plasmid showed that cruciformed DSE1 is targeted by nuclear proteins more efficiently than the linear duplex isomer and that the protected site encompasses the left arm and center of DSE1. Our results suggest that the disruption of intrastrand base-pairing preventing cruciform formation and protein binding to DSE1 is responsible for its inactivation in DSE1 mutants. DSE1 cruciform may act as a target site for activator (BAMC cells) and repressor (TE671) proteins. Its extrusion emerges as a novel mechanism that controls cell-specific promoter activity. PMID:9512554

  10. Detecting gene mutations in Japanese Alzheimer's patients by semiconductor sequencing.

    PubMed

    Yagi, Ryoichi; Miyamoto, Ryosuke; Morino, Hiroyuki; Izumi, Yuishin; Kuramochi, Masahito; Kurashige, Takashi; Maruyama, Hirofumi; Mizuno, Noriyoshi; Kurihara, Hidemi; Kawakami, Hideshi

    2014-07-01

    Alzheimer's disease (AD) is the most common form of dementia. To date, several genes have been identified as the cause of AD, including PSEN1, PSEN2, and APP. The association between APOE and late-onset AD has also been reported. We here used a bench top next-generation sequencer, which uses an integrated semiconductor device, detects hydrogen ions, and operates at a high-speed using nonoptical technology. We examined 45 Japanese AD patients with positive family histories, and 29 sporadic patients with early onset (<60-year-old). Causative mutations were detected in 5 patients in the familial group (11%). Three patients had a known heterozygous missense mutation in the PSEN1 gene (p.H163R). Two patients from 1 family had a novel heterozygous missense mutation in the PSEN1 gene (p.F386L). In the early onset group, 1 patient carrying homozygous APOEε4 had a novel heterozygous missense mutation in the PSEN2 gene (p.T421M). Approximately 43% patients were APOEε4 positive in our study. This new sequencing technology is useful for detecting genetic variations in familial AD.

  11. Identification and characterization of rhizospheric microbial diversity by 16S ribosomal RNA gene sequencing

    PubMed Central

    Naveed, Muhammad; Mubeen, Samavia; khan, SamiUllah; Ahmed, Iftikhar; Khalid, Nauman; Suleria, Hafiz Ansar Rasul; Bano, Asghari; Mumtaz, Abdul Samad

    2014-01-01

    In the present study, samples of rhizosphere and root nodules were collected from different areas of Pakistan to isolate plant growth promoting rhizobacteria. Identification of bacterial isolates was made by 16S rRNA gene sequence analysis and taxonomical confirmation on EzTaxon Server. The identified bacterial strains were belonged to 5 genera i.e. Ensifer, Bacillus, Pseudomona, Leclercia and Rhizobium. Phylogenetic analysis inferred from 16S rRNA gene sequences showed the evolutionary relationship of bacterial strains with the respective genera. Based on phylogenetic analysis, some candidate novel species were also identified. The bacterial strains were also characterized for morphological, physiological, biochemical tests and glucose dehydrogenase (gdh) gene that involved in the phosphate solublization using cofactor pyrroloquinolone quinone (PQQ). Seven rhizoshperic and 3 root nodulating stains are positive for gdh gene. Furthermore, this study confirms a novel association between microbes and their hosts like field grown crops, leguminous and non-leguminous plants. It was concluded that a diverse group of bacterial population exist in the rhizosphere and root nodules that might be useful in evaluating the mechanisms behind plant microbial interactions and strains QAU-63 and QAU-68 have sequence similarity of 97 and 95% which might be declared as novel after further taxonomic characterization. PMID:25477935

  12. Sequence and transcriptional start site of the Pseudomonas aeruginosa outer membrane porin protein F gene.

    PubMed Central

    Duchêne, M; Schweizer, A; Lottspeich, F; Krauss, G; Marget, M; Vogel, K; von Specht, B U; Domdey, H

    1988-01-01

    Porin F is one of the major proteins of the outer membrane of Pseudomonas aeruginosa. It forms water-filled pores of variable size. Porin F is a candidate for a vaccine against P. aeruginosa because it antigenically cross-reacts in all serotype strains of the International Antigenic Typing Scheme. We have isolated the gene for porin F from a lambda EMBL3 bacteriophage library by using oligodeoxynucleotide hybridization probes and have determined its nucleotide sequence. Different peptide sequences obtained from isolated porin F confirmed the deduced protein sequence. The mature protein consists of 326 amino acid residues and has a molecular weight of 35,250. The precursor contains an N-terminal signal peptide of 24 amino acid residues. S1 protection and primer extension experiments, together with Northern (RNA) blots, indicate that the mRNA coding for porin F is monocistronic with short untranslated regions of about 58 bases at the 5' end and about 47 bases at the 3' end. The sequences in the -10 and -35 regions upstream of the transcriptional start site are closely related to the Escherichia coli promoter consensus sequences, which explains why the porin F gene is expressed in E. coli under the control of its own promoter. The amino acid sequence of porin F is not homologous to the different E. coli porins OmpF, OmpC, LamB, and PhoE. On the other hand, a highly homologous region of 30 amino acids between the OmpA proteins of different enteric bacteria and porin F of P. aeruginosa was detected. The core region of the homology to E. coli OmpA had 11 of 12 amino acid residues in common. Images PMID:2447060

  13. Sequences in the HSP90 promoter form G-quadruplex structures with selectivity for disubstituted phenyl bis-oxazole derivatives.

    PubMed

    Ohnmacht, Stephan A; Micco, Marialuisa; Petrucci, Vanessa; Todd, Alan K; Reszka, Anthony P; Gunaratnam, Mekala; Carvalho, Marta A; Zloh, Mire; Neidle, Stephen

    2012-09-15

    The HSP90 protein is an important target in cancer. We report here that stable quadruplex DNAs can be formed from a promoter sequence in the HSP90 gene, on the basis of melting, circular and NMR studies, and show that these can be selectively targeted by non-macrocyclic quadruplex-stabilizing phenyl bis-oxazole derivatives. These do not bind significantly to duplex DNA and show low stabilization of the human telomeric quadruplex. These results suggest an approach to targeting HSP90 at the DNA level.

  14. Identification of novel functional sequence variants in the gene for peptidase inhibitor 3

    PubMed Central

    Chowdhury, Mahboob A; Kuivaniemi, Helena; Romero, Roberto; Edwin, Samuel; Chaiworapongsa, Tinnakorn; Tromp, Gerard

    2006-01-01

    Background Peptidase inhibitor 3 (PI3) inhibits neutrophil elastase and proteinase-3, and has a potential role in skin and lung diseases as well as in cancer. Genome-wide expression profiling of chorioamniotic membranes revealed decreased expression of PI3 in women with preterm premature rupture of membranes. To elucidate the molecular mechanisms contributing to the decreased expression in amniotic membranes, the PI3 gene was searched for sequence variations and the functional significance of the identified promoter variants was studied. Methods Single nucleotide polymorphisms (SNPs) were identified by direct sequencing of PCR products spanning a region from 1,173 bp upstream to 1,266 bp downstream of the translation start site. Fourteen SNPs were genotyped from 112 and nine SNPs from 24 unrelated individuals. Putative transcription factor binding sites as detected by in silico search were verified by electrophoretic mobility shift assay (EMSA) using nuclear extract from Hela and amnion cell nuclear extract. Deviation from Hardy-Weinberg equilibrium (HWE) was tested by χ2 goodness-of-fit test. Haplotypes were estimated using expectation maximization (EM) algorithm. Results Twenty-three sequence variations were identified by direct sequencing of polymerase chain reaction (PCR) products covering 2,439 nt of the PI3 gene (-1,173 nt of promoter sequences and all three exons). Analysis of 112 unrelated individuals showed that 20 variants had minor allele frequencies (MAF) ranging from 0.02 to 0.46 representing "true polymorphisms", while three had MAF ≤ 0.01. Eleven variants were in the promoter region; several putative transcription factor binding sites were found at these sites by database searches. Differential binding of transcription factors was demonstrated at two polymorphic sites by electrophoretic mobility shift assays, both in amniotic and HeLa cell nuclear extracts. Differential binding of the transcription factor GATA1 at -689C>G site was confirmed by a

  15. Identifying putative promoter regions of Hermansky-Pudlak syndrome genes by means of phylogenetic footprinting

    PubMed Central

    Stanescu, H.; Wolfsberg, T.G.; Moreland, R.T.; Ayub, M.H.; Erickson, E.; Westbroek, W.; Huizing, M.; Gahl, W.A.; Helip-Wooley, A.

    2009-01-01

    Summary HPS is an autosomal recessive disorder characterized by oculocutaneous albinism and prolonged bleeding. Eight human genes are described resulting in the HPS subtypes 1–8. Certain HPS proteins combine to form Biogenesis of Lysosome-related Organelles Complexes (BLOCs), thought to function in the formation of intracellular vesicles such as melanosomes, platelet dense bodies, and lytic granules. Specifically, BLOC-2 contains the HPS3, HPS5 and HPS6 proteins. We used phylogenetic footprinting to identify conserved regions in the upstream sequences of HPS3, HPS5 and HPS6. These conserved regions were verified to have in vitro transcription activation activity using luciferase reporter assays. Transcription factor binding site analyses of the regions identified 52 putative sites shared by all three genes. When analysis was limited to the conserved footprints, seven binding sites were found shared among all three genes: Pax-5, AIRE, CACD, ZF5, Zic1, E2F and Churchill. The HPS3 conserved upstream region was sequenced in four patients with decreased fibroblast HPS3 RNA levels and only one HPS3 mutation in the coding exons and surrounding exon/intron boundaries; no mutation was found. These findings illustrate the power of phylogenetic footprinting for identifying potential regulatory regions in non-coding sequences and define the first putative promoter elements for any HPS genes. PMID:19523149

  16. Cloning and sequencing of the gene encoding the cell surface glycoprotein of Haloarcula japonica strain TR-1.

    PubMed

    Wakai, H; Nakamura, S; Kawasaki, H; Takada, K; Mizutani, S; Aono, R; Horikoshi, K

    1997-02-01

    The triangular disk-shaped halophilic archaeon Haloarcula japonica strain TR-1 has a glycoprotein on its cell surface. The complete gene encoding the cell surface glycoprotein (CSG) was cloned and sequenced. The gene has an open reading frame of 2586 bp, and a potential archaeal promoter sequence approximately 150 bp upstream of the ATG initiation codon. The mature CSG is composed of 828 amino acids and is preceded by a signal sequence of 34 amino acid residues. A hydropathy analysis showed a hydrophobic stretch at the C-terminus, that probably serves as a transmembrane domain. The amino acid sequence of the Ha. japonica CSG showed 52.1% and 43.2% identities to those from the Halobacterium halobium and Haloferax volcanii CSGs, respectively. Five potential N-glycosylation sites were found in the mature Ha. japonica CSG, sites that were distinctly different from those in Hb. halobium and Hf. volcanii. The Ha. japonica CSG gene was expressed in Escherichia coli.

  17. Transcriptional response elements in the promoter of CYP6B1, an insect P450 gene regulated by plant chemicals.

    PubMed

    Petersen, Rebecca A; Niamsup, Hataichanoke; Berenbaum, May R; Schuler, Mary A

    2003-02-17

    Papilio polyxenes, a lepidopteran continually exposed to toxic furanocoumarins in its hostplants, owes its tolerance to these compounds to the transcriptional induction of the CYP6B1 gene encoding a P450 capable of metabolizing linear furanocoumarins, such as xanthotoxin, at high rates. Transient expression of various lengths of wild-type and mutant CYP6B1v3 promoter in lepidopteran Sf9 cells defines a positive element (XRE-xan) from -136 to -119 required for both basal and xanthotoxin-inducible transcription and a negative element from -228 to -146 that represses basal transcription. Fusion of the CYP6B1v3 XRE-xan element to the Drosophila melanogaster Eip28/29 core promoter indicates that the XRE-xan functions in conjunction with its own core promoter but not with a heterologous core promoter. Sequence searches of the CYP6B1v3 proximal promoter region revealed a number of putative elements (XRE-AhR, ARE, OCT-1, EcRE, C/EBP, Inr) sharing sequence similarity with those in other regulated vertebrate and insect promoters. Mutation of TGAC nucleotides shared by the overlapping EcRE/ARE/XRE-xan indicates that this sequence is essential for basal and regulated transcription of this gene. Mutagenesis in the non-overlapping region of the EcRE indicates it modulates basal transcription. These findings are incorporated into a working model for regulation of this toxin-inducible promoter.

  18. Technology development for gene discovery and full-length sequencing

    SciTech Connect

    Marcelo Bento Soares

    2004-07-19

    In previous years, with support from the U.S. Department of Energy, we developed methods for construction of normalized and subtracted cDNA libraries, and constructed hundreds of high-quality libraries for production of Expressed Sequence Tags (ESTs). Our clones were made widely available to the scientific community through the IMAGE Consortium, and millions of ESTs were produced from our libraries either by collaborators or by our own sequencing laboratory at the University of Iowa. During this grant period, we focused on (1) the development of a method for preferential cloning of tissue-specific and/or rare transcripts, (2) its utilization to expedite EST-based gene discovery for the NIH Mouse Brain Molecular Anatomy Project, (3) further development and optimization of a method for construction of full-length-enriched cDNA libraries, and (4) modification of a plasmid vector to maximize efficiency of full-length cDNA sequencing by the transposon-mediated approach. It is noteworthy that the technology developed for preferential cloning of rare mRNAs enabled identification of over 2,000 mouse transcripts differentially expressed in the hippocampus. In addition, the method that we optimized for construction of full-length-enriched cDNA libraries was successfully utilized for the production of approximately fifty libraries from the developing mouse nervous system, from which over 2,500 full-ORF-containing cDNAs have been identified and accurately sequenced in their entirety either by our group or by the NIH-Mammalian Gene Collection Program Sequencing Team.

  19. Multiple DNA sequence elements are necessary for the function of an immunoglobulin heavy chain promoter.

    PubMed Central

    Eaton, S; Calame, K

    1987-01-01

    Sequences required for the function of the mouse V1 immunoglobulin heavy chain variable-region (VH) promoter were identified by transient transfection of the normal and mutated promoters into plasmacytoma cells. Our results identify four regions required for normal promoter function: (i) the octamer ATGCAAAT, previously identified by others; (ii) a heptamer, CTAATGA; (iii) a pyrimidine-rich region; and (iv) a region between positions -125 and -251 relative to the transcription start site. Sequence analysis of 19 mouse and human VH 5' flanking regions shows that the heptamer and pyrimidine stretch are strongly conserved. We have also demonstrated that the octamer functions in an orientation independent manner in the VH promoter. Images PMID:3118372

  20. Novel Gene Expression Profile of Women with Intrinsic Skin Youthfulness by Whole Transcriptome Sequencing

    PubMed Central

    Xu, Jin; Spitale, Robert C.; Guan, Linna; Flynn, Ryan A.; Torre, Eduardo A.; Li, Rui; Raber, Inbar; Qu, Kun; Kern, Dale; Knaggs, Helen E.; Chang, Howard Y.; Chang, Anne Lynn S.

    2016-01-01

    While much is known about genes that promote aging, little is known about genes that protect against or prevent aging, particularly in human skin. The main objective of this study was to perform an unbiased, whole transcriptome search for genes that associate with intrinsic skin youthfulness. To accomplish this, healthy women (n = 122) of European descent, ages 18–89 years with Fitzpatrick skin type I/II were examined for facial skin aging parameters and clinical covariates, including smoking and ultraviolet exposure. Skin youthfulness was defined as the top 10% of individuals whose assessed skin aging features were most discrepant with their chronological ages. Skin biopsies from sun-protected inner arm were subjected to 3’-end sequencing for expression quantification, with results verified by quantitative reverse transcriptase-polymerase chain reaction. Unbiased clustering revealed gene expression signatures characteristic of older women with skin youthfulness (n = 12) compared to older women without skin youthfulness (n = 33), after accounting for gene expression changes associated with chronological age alone. Gene set analysis was performed using Genomica open-access software. This study identified a novel set of candidate skin youthfulness genes demonstrating differences between SY and non-SY group, including pleckstrin homology like domain family A member 1 (PHLDA1) (p = 2.4x10-5), a follicle stem cell marker, and hyaluronan synthase 2-anti-sense 1 (HAS2-AS1) (p = 0.00105), a non-coding RNA that is part of the hyaluronan synthesis pathway. We show that immunologic gene sets are the most significantly altered in skin youthfulness (with the most significant gene set p = 2.4x10-5), suggesting the immune system plays an important role in skin youthfulness, a finding that has not previously been recognized. These results are a valuable resource from which multiple future studies may be undertaken to better understand the mechanisms that promote skin

  1. SIRT1 gene expression upon genotoxic damage is regulated by APE1 through nCaRE-promoter elements

    PubMed Central

    Antoniali, Giulia; Lirussi, Lisa; D'Ambrosio, Chiara; Dal Piaz, Fabrizio; Vascotto, Carlo; Casarano, Elena; Marasco, Daniela; Scaloni, Andrea; Fogolari, Federico; Tell, Gianluca

    2014-01-01

    Apurinic/apyrimidinic endonuclease 1 (APE1) is a multifunctional protein contributing to genome stability via repair of DNA lesions via the base excision repair pathway. It also plays a role in gene expression regulation and RNA metabolism. Another, poorly characterized function is its ability to bind to negative calcium responsive elements (nCaRE) of some gene promoters. The presence of many functional nCaRE sequences regulating gene transcription can be envisioned, given their conservation within ALU repeats. To look for functional nCaRE sequences within the human genome, we performed bioinformatic analyses and identified 57 genes potentially regulated by APE1. We focused on sirtuin-1 (SIRT1) deacetylase due to its involvement in cell stress, including senescence, apoptosis, and tumorigenesis, and its role in the deacetylation of APE1 after genotoxic stress. The human SIRT1 promoter presents two nCaRE elements stably bound by APE1 through its N-terminus. We demonstrate that APE1 is part of a multiprotein complex including hOGG1, Ku70, and RNA Pol II, which is recruited on SIRT1 promoter to regulate SIRT1 gene functions during early response to oxidative stress. These findings provide new insights into the role of nCaRE sequences in the transcriptional regulation of mammalian genes. PMID:24356447

  2. Sequence of the WT1 upstream region including the Wit-1 gene

    SciTech Connect

    Gessler, M. ); Bruns, G.A.P. )

    1993-08-01

    The Wilms tumor gene WT1 encodes a Cys[sub 2]His[sub 2]-type zinc finger protein that can bind DNA and function as a transcriptional regulator. The pathological spectrum of tumorigenesis and various developmental defects produced by different WT1 alteration suggests that WT1 controls a number of subsequent effector genes. To define the role of WT1 in these developmental processes it will be important to elucidate mechanisms that govern expression of WT1 itself. To facilitate mapping of the WT1 promoter region and 5[prime] control elements the authors have determined the sequence upstream of the WT1 transcription unit. This includes the Wit-1 gene that is transcribed in the opposite direction. 11 refs., 3 figs.

  3. Escherichia coli σ70 senses sequence and conformation of the promoter spacer region

    PubMed Central

    Singh, Shivani S.; Typas, Athanasios; Hengge, Regine; Grainger, David C.

    2011-01-01

    In bacteria, promoter identification by RNA polymerase is mediated by a dissociable σ factor. The housekeeping σ70 factor of Escherichia coli recognizes two well characterized DNA sequence elements, known as the ‘−10’ and ‘−35’ hexamers. These elements are separated by ‘spacer’ DNA, the sequence of which is generally considered unimportant. Here, we use a combination of bioinformatics, genetics and biochemistry to show that σ70 can sense the sequence and conformation of the promoter spacer region. Our data illustrate how alterations in spacer region sequence can increase promoter activity. This stimulatory effect requires σ70 side chain R451, which is located in close proximity to the non-template strand at promoter position −18. Conversely, R451 is not required to mediate transcriptional stimulation by improvement of the −10 element. Mutation of σ70 residue R451, which is highly conserved, results in reduced growth rate, consistent with a central role in promoter recognition. PMID:21398630

  4. Detection and sequence analysis of accessory gene regulator genes of Staphylococcus pseudintermedius isolates

    PubMed Central

    Chitra, M. Ananda; Jayanthy, C.; Nagarajan, B.

    2015-01-01

    Background: Staphylococcus pseudintermedius (SP) is the major pathogenic species of dogs involved in a wide variety of skin and soft tissue infections. The accessory gene regulator (agr) locus of Staphylococcus aureus has been extensively studied, and it influences the expression of many virulence genes. It encodes a two-component signal transduction system that leads to down-regulation of surface proteins and up-regulation of secreted proteins during in vitro growth of S. aureus. The objective of this study was to detect and sequence analyzing the AgrA, B, and D of SP isolated from canine skin infections. Materials and Methods: In this study, we have isolated and identified SP from canine pyoderma and otitis cases by polymerase chain reaction (PCR) and confirmed by PCR-restriction fragment length polymorphism. Primers for SP agrA and agrBD genes were designed using online primer designing software and BLAST searched for its specificity. Amplification of the agr genes was carried out for 53 isolates of SP by PCR and sequencing of agrA, B, and D were carried out for five isolates and analyzed using DNAstar and Mega5.2 software. Results: A total of 53 (59%) SP isolates were obtained from 90 samples. 15 isolates (28%) were confirmed to be methicillin-resistant SP (MRSP) with the detection of the mecA gene. Accessory gene regulator A, B, and D genes were detected in all the SP isolates. Complete nucleotide sequences of the above three genes for five isolates were submitted to GenBank, and their accession numbers are from KJ133557 to KJ133571. AgrA amino acid sequence analysis showed that it is mainly made of alpha-helices and is hydrophilic in nature. AgrB is a transmembrane protein, and AgrD encodes the precursor of the autoinducing peptide (AIP). Sequencing of the agrD gene revealed that the 5 canine SP strains tested could be divided into three Agr specificity groups (RIPTSTGFF, KIPTSTGFF, and RIPISTGFF) based on the putative AIP produced by each strain. The AIP of

  5. The HIP1 binding site is required for growth regulation of the dihydrofolate reductase gene promoter.

    PubMed Central

    Means, A L; Slansky, J E; McMahon, S L; Knuth, M W; Farnham, P J

    1992-01-01

    The transcription rate of the dihydrofolate reductase (DHFR) gene increases at the G1/S boundary of the proliferative cell cycle. Through analysis of transiently and stably transfected NIH 3T3 cells, we have now demonstrated that DHFR promoter sequences extending from -270 to +20 are sufficient to confer similar regulation on a reporter gene. Mutation of a protein binding site that spans sequences from -16 to +11 in the DHFR promoter resulted in loss of the transcriptional increase at the G1/S boundary. Purification of an activity from HeLa nuclear extract that binds to this region enriched for a 180-kDa polypeptide (HIP1). Using this HIP1 preparation, we have identified specific positions within the binding site that are critical for efficient protein-DNA interactions. An analysis of association and dissociation rates suggests that bound HIP1 protein can exchange rapidly with free protein. This rapid exchange may facilitate the burst of transcriptional activity from the DHFR promoter at the G1/S boundary. Images PMID:1545788

  6. Genetic and functional analysis of the von Hippel-Lindau (VHL) tumour suppressor gene promoter

    PubMed Central

    Zatyka, M; Morrissey, C; Kuzmin, I; Lerman, M; Latif, F; Richards, F; Maher, E

    2002-01-01

    The VHL gatekeeper tumour suppressor gene is inactivated in the familial cancer syndrome von Hippel-Lindau disease and in most sporadic clear cell renal cell carcinomas. Recently the VHL gene product has been identified as a specific component of a SCF-like complex, which regulates proteolytic degradation of the hypoxia inducible transcription factors HIF-1 and HIF-2. pVHL is critical for normal development and mRNA expression studies suggest a role in nephrogenesis. Despite the importance of VHL in oncogenesis and development, little is known about the regulation of VHL expression. To investigate VHL promoter activity, we performed comparative sequence analysis of human, primate, and rodent 5‘ VHL sequences. We then proceeded to deletion analysis of regions showing significant evolutionary conservation between human and rat promoter sequences, and defined two positive and one negative regulatory regions. Analysis of specific putative transcription factor binding sites identified a functional Sp1 site, which was shown to be a regulatory element. Overlapping Sp1/AP2 sites were also identified and candidate E2F1 binding sites evaluated. Three binding sites for as yet unidentified transcription factors were mapped also. These investigations provide a basis for elucidating the regulation of VHL expression in development, the molecular pathology of epigenetic silencing of VHL in tumourigenesis, and suggest a possible link between Sp1, VHL, and nephrogenesis. PMID:12114475

  7. Characterization of type IV pilus genes in plant growth-promoting Pseudomonas putida WCS358.

    PubMed Central

    de Groot, A; Heijnen, I; de Cock, H; Filloux, A; Tommassen, J

    1994-01-01

    In a search for factors that could contribute to the ability of the plant growth-stimulating Pseudomonas putida WCS358 to colonize plant roots, the organism was analyzed for the presence of genes required for pilus biosynthesis. The pilD gene of Pseudomonas aeruginosa, which has also been designated xcpA, is involved in protein secretion and in the biogenesis of type IV pili. It encodes a peptidase that processes the precursors of the pilin subunits and of several components of the secretion apparatus. Prepilin processing activity could be demonstrated in P. putida WCS358, suggesting that this nonpathogenic strain may contain type IV pili as well. A DNA fragment containing the pilD (xcpA) gene of P. putida was cloned and found to complement a pilD (xcpA) mutation in P. aeruginosa. Nucleotide sequencing revealed, next to the pilD (xcpA) gene, the presence of two additional genes, pilA and pilC, that are highly homologous to genes involved in the biogenesis of type IV pili. The pilA gene encodes the pilin subunit, and pilC is an accessory gene, required for the assembly of the subunits into pili. In comparison with the pil gene cluster in P. aeruginosa, a gene homologous to pilB is lacking in the P. putida gene cluster. Pili were not detected on the cell surface of P. putida itself, not even when pilA was expressed from the tac promoter on a plasmid, indicating that not all the genes required for pilus biogenesis were expressed under the conditions tested. Expression of pilA of P. putida in P. aeruginosa resulted in the production of pili containing P. putida PilA subunits. Images PMID:7905475

  8. Nuclear gene sequences from a late pleistocene sloth coprolite.

    PubMed

    Poinar, Hendrik; Kuch, Melanie; McDonald, Gregory; Martin, Paul; Pääbo, Svante

    2003-07-01

    The determination of nuclear DNA sequences from ancient remains would open many novel opportunities such as the resolution of phylogenies, the sexing of hominid and animal remains, and the characterization of genes involved in phenotypic traits. However, to date, single-copy nuclear DNA sequences from fossils have been determined only from bones and teeth of woolly mammoths preserved in the permafrost. Since the best preserved ancient nucleic acids tend to stem from cold environments, this has led to the assumption that nuclear DNA would be retrievable only from frozen remains. We have previously shown that Pleistocene coprolites stemming from the extinct Shasta sloth (Nothrotheriops shastensis, Megatheriidae) contain mitochondrial (mt) DNA from the animal that produced them as well as chloroplast (cp) DNA from the ingested plants. Recent attempts to resolve the phylogeny of two families of extinct sloths by using strictly mitochondrial DNA has been inconclusive. We have prepared DNA extracts from a ground sloth coprolite from Gypsum Cave, Nevada, and quantitated the number of mtDNA copies for three different fragment lengths by using real-time PCR. We amplified one multicopy and three single-copy nuclear gene fragments and used the concatenated sequence to resolve the phylogeny. These results show that ancient single-copy nuclear DNA can be recovered from warm, arid climates. Thus, nuclear DNA preservation is not restricted to cold climates.

  9. Next Generation Sequencing in Predicting Gene Function in Podophyllotoxin Biosynthesis*

    PubMed Central

    Marques, Joaquim V.; Kim, Kye-Won; Lee, Choonseok; Costa, Michael A.; May, Gregory D.; Crow, John A.; Davin, Laurence B.; Lewis, Norman G.

    2013-01-01

    Podophyllum species are sources of (−)-podophyllotoxin, an aryltetralin lignan used for semi-synthesis of various powerful and extensively employed cancer-treating drugs. Its biosynthetic pathway, however, remains largely unknown, with the last unequivocally demonstrated intermediate being (−)-matairesinol. Herein, massively parallel sequencing of Podophyllum hexandrum and Podophyllum peltatum transcriptomes and subsequent bioinformatics analyses of the corresponding assemblies were carried out. Validation of the assembly process was first achieved through confirmation of assembled sequences with those of various genes previously established as involved in podophyllotoxin biosynthesis as well as other candidate biosynthetic pathway genes. This contribution describes characterization of two of the latter, namely the cytochrome P450s, CYP719A23 from P. hexandrum and CYP719A24 from P. peltatum. Both enzymes were capable of converting (−)-matairesinol into (−)-pluviatolide by catalyzing methylenedioxy bridge formation and did not act on other possible substrates tested. Interestingly, the enzymes described herein were highly similar to methylenedioxy bridge-forming enzymes from alkaloid biosynthesis, whereas candidates more similar to lignan biosynthetic enzymes were catalytically inactive with the substrates employed. This overall strategy has thus enabled facile further identification of enzymes putatively involved in (−)-podophyllotoxin biosynthesis and underscores the deductive power of next generation sequencing and bioinformatics to probe and deduce medicinal plant biosynthetic pathways. PMID:23161544

  10. Automated Gene Ontology annotation for anonymous sequence data.

    PubMed

    Hennig, Steffen; Groth, Detlef; Lehrach, Hans

    2003-07-01

    Gene Ontology (GO) is the most widely accepted attempt to construct a unified and structured vocabulary for the description of genes and their products in any organism. Annotation by GO terms is performed in most of the current genome projects, which besides generality has the advantage of being very convenient for computer based classification methods. However, direct use of GO in small sequencing projects is not easy, especially for species not commonly represented in public databases. We present a software package (GOblet), which performs annotation based on GO terms for anonymous cDNA or protein sequences. It uses the species independent GO structure and vocabulary together with a series of protein databases collected from various sites, to perform a detailed GO annotation by sequence similarity searches. The sensitivity and the reference protein sets can be selected by the user. GOblet runs automatically and is available as a public service on our web server. The paper also addresses the reliability of automated GO annotations by using a reference set of more than 6000 human proteins. The GOblet server is accessible at http://goblet.molgen.mpg.de.

  11. Identification of an activator protein-1-like sequence as the glucocorticoid response element in the rat tyrosine hydroxylase gene.

    PubMed

    Rani, C S Sheela; Elango, Narayanasamy; Wang, Shou-Shu; Kobayashi, Kazuto; Strong, Randy

    2009-03-01

    Glucocorticoids (GCs) generally stimulate gene transcription via consensus glucocorticoid response elements (GREs) located in the promoter region. To identify the GRE in the rat tyrosine hydroxylase (TH) gene promoter, we transiently transfected PC12 cells with a 9-kilobase (kb) TH promoter-luciferase (Luc) construct. Dexamethasone (Dex) stimulated Luc activity, which was abolished by mifepristone (RU486). Serial deletion mutations revealed a Dex-responsive 7-base pair (bp) sequence, TGACTAA, located at -5734 to -5728. Deletion of just these seven nucleotides from the 9-kb promoter completely abolished the Dex response and partially reduced the response to phorbol ester but not to forskolin. The Dex response was fully retained in a construct in which most of the 9-kb promoter was deleted, except for 100 bp around the -5.7-kb region, clearly identifying this 7-bp sequence as solely responsible for GC responsiveness. Conversely, deletion of the proximal cAMP-response element (-45/-38) or activator protein-1 (AP-1) (-207/-201) sites in the 9-kb promoter did not affect Dex and phorbol ester responses. A radiolabeled 25-bp promoter fragment bearing the 7-bp TH-GRE/AP-1 showed specific binding to PC12 nuclear proteins. Using antibodies against the glucocorticoid receptors and AP-1 family of proteins and primers for the TH-GRE/AP-1 region, we detected a specific DNA amplicon in a chromatin immunoprecipitation assay. This 7-bp TH-GRE/AP-1 sequence (TGACTAA) does not bear similarity to any known GRE but closely resembles the consensus AP-1 binding site, TGACTCA. Our studies describe for the first time a novel GRE/AP-1 site present in the TH gene promoter that is critical for glucocorticoid regulation of the TH gene.

  12. Characterization of the Human Insulin-induced Gene 2 (INSIG2) Promoter

    PubMed Central

    Fernández-Alvarez, Ana; Soledad Alvarez, María; Cucarella, Carme; Casado, Marta

    2010-01-01

    Insulin-induced gene 2 (INSIG2) and its homolog INSIG1 encode closely related endoplasmic reticulum proteins that regulate the proteolytic activation of sterol regulatory element-binding proteins, transcription factors that activate the synthesis of cholesterol and fatty acids in animal cells. Several studies have been carried out to identify INSIG2 genetic variants associated with metabolic diseases. However, few data have been published regarding the regulation of INSIG2 gene expression. Two Insig2 transcripts have been described in rodents through the use of different promoters that produce different noncoding first exons that splice into a common second exon. Herein we report the cloning and characterization of the human INSIG2 promoter and the detection of an INSIG2-specific transcript homologous to the Insig2b mouse variant in human liver. Deletion analyses on 3 kb of 5′-flanking DNA of the human INSIG2 gene revealed the functional importance of a 350-bp region upstream of the transcription start site. Mutated analyses, chromatin immunoprecipitation assays, and RNA interference analyses unveiled the significance of an Ets-consensus motif in the proximal region and the interaction of the Ets family member SAP1a (serum response factor (SRF) accessory protein-1a) with this region of the human INSIG2 promoter. Moreover, our findings suggest that insulin activated the human INSIG2 promoter in a process mediated by phosphorylated SAP1a. Overall, these results map the functional elements in the human INSIG2 promoter sequence and suggest an unexpected regulation of INSIG2 gene expression in human liver. PMID:20145255

  13. Promoter analysis of intestinal genes induced during iron-deprivation reveals enrichment of conserved SP1-like binding sites

    PubMed Central

    Collins, James F; Hu, Zihua

    2007-01-01

    Background Iron-deficiency leads to the induction of genes related to intestinal iron absorption and homeostasis. By analyzing a large GeneChip® dataset from the rat intestine, we identified a large cluster of 228 genes that was induced by iron-deprivation. Only 2 of these genes contained 3' iron-response elements, suggesting that other regulation including transcriptional may be involved. We therefore utilized computational methods to test the hypothesis that some of the genes within this large up-regulated cluster are co-ordinately regulated by common transcriptional mechanisms. We thus identified promoters from the up-regulated gene cluster from rat, mouse and human, and performed enrichment analyses with the Clover program and the TRANSFAC database. Results Surprisingly, we found a strong statistical enrichment for SP1 binding sites in our experimental promoters as compared to background sequences. As the TRANSFAC database cannot distinguish among SP/KLF family members, many of which bind similar GC-rich DNA sequences, we surmise that SP1 or an SP1-like factor could be involved in this response. In fact, we detected induction of SP6/KLF14 in the GeneChip® studies, and confirmed it by real-time PCR. Additional computational analyses suggested that an SP1-like factor may function synergistically with a FOX TF to regulate a subset of these genes. Furthermore, analysis of promoter sequences identified many genes with multiple, conserved SP1 and FOX binding sites, the relative location of which within orthologous promoters was highly conserved. Conclusion SP1 or a closely related factor may play a primary role in the genetic response to iron-deficiency in the mammalian intestine. PMID:18005439

  14. Organization of gene and non-gene sequences in micronuclear DNA of Oxytricha nova.

    PubMed Central

    Boswell, R E; Jahn, C L; Greslin, A F; Prescott, D M

    1983-01-01

    In order to study the derivation of the macronuclear genome from the micronuclear genome in Oxytricha nova micronuclear DNA was partially digested with EcoRI, size fractionated, and then cloned in the lambda phage Charon 8. Clones were selected a) at random b) by hybridization with macronuclear DNA or c) by hybridization with clones of macronuclear DNA. One group of these clones contains only unique sequence DNA, and all of these had sequences that were homologous to macronuclear sequences. The number of macronuclear genes with sequences homologous to these micronuclear clones indicates that macronuclear sequences are clustered in the micronuclear genome. Many micronuclear clones contain repetitive DNA sequences and hybridize to numerous EcoRI fragments of total micronuclear DNA, yielding similar but non-identical patterns. Some micronuclear clones containing these repetitive sequences also contained unique sequence DNA that hybridized to a macronuclear sequence. These clones define a major interspersed repetitive sequence family in the micronuclear genome that is eliminated during formation of the macronuclear genome. Images PMID:6304639

  15. Learning gene regulatory networks from next generation sequencing data.

    PubMed

    Jia, Bochao; Xu, Suwa; Xiao, Guanghua; Lamba, Vishal; Liang, Faming

    2017-03-10

    In recent years, next generation sequencing (NGS) has gradually replaced microarray as the major platform in measuring gene expressions. Compared to microarray, NGS has many advantages, such as less noise and higher throughput. However, the discreteness of NGS data also challenges the existing statistical methodology. In particular, there still lacks an appropriate statistical method for reconstructing gene regulatory networks using NGS data in the literature. The existing local Poisson graphical model method is not consistent and can only infer certain local structures of the network. In this article, we propose a random effect model-based transformation to continuize NGS data and then we transform the continuized data to Gaussian via a semiparametric transformation and apply an equivalent partial correlation selection method to reconstruct gene regulatory networks. The proposed method is consistent. The numerical results indicate that the proposed method can lead to much more accurate inference of gene regulatory networks than the local Poisson graphical model and other existing methods. The proposed data-continuized transformation fills the theoretical gap for how to transform discrete data to continuous data and facilitates NGS data analysis. The proposed data-continuized transformation also makes it feasible to integrate different types of data, such as microarray and RNA-seq data, in reconstruction of gene regulatory networks.

  16. Deep sequencing reveals 50 novel genes for recessive cognitive disorders.

    PubMed

    Najmabadi, Hossein; Hu, Hao; Garshasbi, Masoud; Zemojtel, Tomasz; Abedini, Seyedeh Sedigheh; Chen, Wei; Hosseini, Masoumeh; Behjati, Farkhondeh; Haas, Stefan; Jamali, Payman; Zecha, Agnes; Mohseni, Marzieh; Püttmann, Lucia; Vahid, Leyla Nouri; Jensen, Corinna; Moheb, Lia Abbasi; Bienek, Melanie; Larti, Farzaneh; Mueller, Ines; Weissmann, Robert; Darvish, Hossein; Wrogemann, Klaus; Hadavi, Valeh; Lipkowitz, Bettina; Esmaeeli-Nieh, Sahar; Wieczorek, Dagmar; Kariminejad, Roxana; Firouzabadi, Saghar Ghasemi; Cohen, Monika; Fattahi, Zohreh; Rost, Imma; Mojahedi, Faezeh; Hertzberg, Christoph; Dehghan, Atefeh; Rajab, Anna; Banavandi, Mohammad Javad Soltani; Hoffer, Julia; Falah, Masoumeh; Musante, Luciana; Kalscheuer, Vera; Ullmann, Reinhard; Kuss, Andreas Walter; Tzschach, Andreas; Kahrizi, Kimia; Ropers, H Hilger

    2011-09-21

    Common diseases are often complex because they are genetically heterogeneous, with many different genetic defects giving rise to clinically indistinguishable phenotypes. This has been amply documented for early-onset cognitive impairment, or intellectual disability, one of the most complex disorders known and a very important health care problem worldwide. More than 90 different gene defects have been identified for X-chromosome-linked intellectual disability alone, but research into the more frequent autosomal forms of intellectual disability is still in its infancy. To expedite the molecular elucidation of autosomal-recessive intellectual disability, we have now performed homozygosity mapping, exon enrichment and next-generation sequencing in 136 consanguineous families with autosomal-recessive intellectual disability from Iran and elsewhere. This study, the largest published so far, has revealed additional mutations in 23 genes previously implicated in intellectual disability or related neurological disorders, as well as single, probably disease-causing variants in 50 novel candidate genes. Proteins encoded by several of these genes interact directly with products of known intellectual disability genes, and many are involved in fundamental cellular processes such as transcription and translation, cell-cycle control, energy metabolism and fatty-acid synthesis, which seem to be pivotal for normal brain development and function.

  17. Sugarcane Loading Stem Gene promoters drive transgene expression preferentially in the stem.

    PubMed

    Moyle, Richard L; Birch, Robert G

    2013-05-01

    Promoter regions of six sugarcane Loading Stem Gene (ScLSG) alleles were analyzed using bioinformatic and transgenic approaches. Stable transgene expression analyses, on multiple independent lines per construct, revealed differences between ScLSG promoters in absolute levels and in tissue-selectivity of luciferase reporter activity. Four promoters drove peak expression in the sucrose-loading zone and maintained substantial expression throughout mature stems. One drove a pattern of gradual increase along the stem maturation profile. In general, stem: root expression ratio increased with plant age. The ScLSG5 promoter had the fewest light-enhanced and root-expression motifs in bioinformatic analysis, and drove the highest level and specificity of transgene expression in stems. This indicates the potential to further improve the stem specificity of ScLSG promoter sequences by eliminating enhancers of expression in other tissues. An intron in the 5'UTR was important for expression strength. The ScLSG promoters will be useful for research and biotechnology in sugarcane, where the tailored expression of transgenes in stems is important for enhanced accumulation of sugar or value-added products, and for development as a bioenergy feedstock.

  18. LuxCDE-luxAB-based promoter reporter system to monitor the Yersinia enterocolitica O:3 gene expression in vivo

    PubMed Central

    Bozcal, Elif; Dagdeviren, Melih; Uzel, Atac

    2017-01-01

    It is crucial to understand the in vitro and in vivo regulation of the virulence factor genes of bacterial pathogens. In this study, we describe the construction of a versatile reporter system for Yersinia enterocolitica serotype O:3 (YeO3) based on the luxCDABE operon. In strain YeO3-luxCDE we integrated the luciferase substrate biosynthetic genes, luxCDE, into the genome of the bacterium so that the substrate is constitutively produced. The luxAB genes that encode the luciferase enzyme were cloned into a suicide vector to allow cloning of any promoter-containing fragment upstream the genes. When the obtained suicide-construct is mobilized into YeO3-luxCDE bacteria, it integrates into the recipient genome via homologous recombination between the cloned promoter fragment and the genomic promoter sequence and thereby generates a single-copy and stable promoter reporter. Lipopolysaccharide (LPS) O-antigen (O-ag) and outer core hexasaccharide (OC) of YeO3 are virulence factors necessary to colonization of the intestine and establishment of infection. To monitor the activities of the OC and O-ag gene cluster promoters we constructed the reporter strains YeO3-Poc::luxAB and YeO3-Pop1::luxAB, respectively. In vitro, at 37°C both promoter activities were highest during logarithmic growth and decreased when the bacteria entered stationary growth phase. At 22°C the OC gene cluster promoter activity increased during the late logarithmic phase. Both promoters were more active in late stationary phase. To monitor the promoter activities in vivo, mice were infected intragastrically and the reporter activities monitored by the IVIS technology. The mouse experiments revealed that both LPS promoters were well expressed in vivo and could be detected by IVIS, mainly from the intestinal region of orally infected mice. PMID:28235077

  19. Polymorphisms in the kappa casein (CSN3) gene in horse and comparative analysis of its promoter and coding region.

    PubMed

    Hobor, S; Kunej, T; Dovc, P

    2008-10-01

    The major parts of the coding region and promoter of the equine kappa casein (CSN3) gene were sequenced and compared among several species. Four SNPs were identified in the CSN3 gene: two in exon 1 and two in exon 4. The SNPs were genotyped in six Slovenian horse breeds using RFLP and two different PCR-based methods. The highest variation in genotype frequencies was found in the Slovenian cold-blood breed. The SNPs in exon 4 may cause a change in the amino acid sequence and may alter chemical/functional properties of the protein. Using horse-specific primers, we obtained 400 bp of exon 4 sequence from zebra and donkey. Two SNPs within the zebra exon 4 sequence were discovered; both presumably caused amino acid substitutions. Within the equine promoter sequence, 15 SNPs were found and 12 of them could be involved in the gain/loss of potential transcription factor (TF) binding sites. Using a comparative genomics approach, we obtained 1482 bp of the promoter sequence from zebra and donkey. Sequence alignment revealed highly conserved blocks of promoter sequence among nine species (sheep, goat, cow, zebra, donkey, horse, chimp, macaque and human) and clustered these species in three distinct groups. Consensus binding sites for TFs STAT5, C/EBP, NF1 and STAT6, previously demonstrated to be associated with expression, were located within conserved regions. Four promoter regions were tested for specific binding of TFs using electrophoretic mobility shift assays. Predicted binding sites for C/EBP and NF1 were confirmed and one conserved region was specifically detected by a yet-uncharacterized TF.

  20. Neural regulation of muscle acetylcholine receptor epsilon- and alpha- subunit gene promoters in transgenic mice

    PubMed Central

    1993-01-01

    The effects of denervation were investigated in mice with transgenes containing promoter elements from the muscle acetylcholine receptor epsilon- and alpha-subunit genes. The promoter sequences were coupled to a nuclear localization signal-beta-galactosidase fusion gene (nlacZ) as a reporter. While many postsynaptic specializations form in the embryo, expression of the epsilon subunit is induced during the first two postnatal weeks. When muscles were denervated at birth, before the onset of epsilon expression, epsilon nlacZ still appeared at the former synaptic sites on schedule. This result suggests that the nerve leaves a localized "trace" in the muscle that can continue to regulate transcription. An additional finding was that epsilon nlacZ expression was much stronger in denervated than in intact muscles. This suggests that the epsilon promoter is similar to the other subunits in containing elements that are activated on cessation of neural activity. However, even after denervation, epsilon nlacZ expression was always confined to the synaptic region whereas alpha nlacZ expression increased in nuclei along the entire length of the fiber. This suggests that while the epsilon gene is similar in its activity dependence to other subunit genes, it is unique in that local nerve-derived signals are essential for its expression. Consequently, inactivity enhances epsilon expression only in synaptic nuclei where such signals are present, but enhances expression throughout the muscle fiber. Truncations and an internal deletion of the epsilon promoter indicate that cis-elements essential for the response to synaptic signals are contained within 280 bp of the transcription start site. In contrast to these results in young animals, denervation in older animals leads to an unexpected reduction in nlacZ activity. However, mRNA measurements indicated that transgene expression was increased in these animals. This discordance between nlacZ mRNA and enzyme activity, demonstrates a

  1. Identification of a sequence-specific DNA binding factor required for transcription of the barley chloroplast blue light-responsive psbD-psbC promoter.

    PubMed Central

    Kim, M; Mullet, J E

    1995-01-01

    The plastid gene psbD encodes the photosystem II reaction center chlorophyll protein D2. psbD is located in a complex operon that includes psbC, psbK, psbl, orf62, and trnG. The operon is transcribed from at least three different promoters. One of the psbD promoters is differentially activated when plants are exposed to blue light. In this study, the psbD blue light-responsive promoter was accurately transcribed in vitro in high-salt extracts of barley plastids. Transcription required supercoiled templates and was inhibited by tagetitoxin, an inhibitor of plastid transcription. Escherichia coli RNA polymerase did not recognize the psbD light-responsive promoter with the same specificity as plastid RNA polymerase. Deletion analyses demonstrated that sequences between -39 and -68, upstream of the transcription initiation site, were required for transcription of the psbD blue light-responsive promoter. This DNA region is highly conserved among plant species and contains multiple AAG sequences. Gel shift assays and DNase I footprinting experiments demonstrated that the AAG-rich DNA sequence interacts with a sequence-specific DNA binding factor termed AGF. Point mutations in the AAG cis element decreased binding of AGF and inhibited transcription from the psbD light-responsive promoter. We concluded that AGF is an essential factor required for transcription of the psbD light-responsive promoter. PMID:8589628

  2. Deduction of upstream sequences of Xanthomonas campestris flagellar genes responding to transcription activation by FleQ

    SciTech Connect

    Hu, R.-M.; Yang, T.-C.; Yang, S.-H.; Tseng, Y.-H. . E-mail: yhtseng@chtai.ctc.edu.tw

    2005-10-07

    Xanthomonas campestris pv. campestris (Xcc), a close relative to Pseudomonas aeruginosa, is the pathogen causing black rot in cruciferous plants. In P. aeruginosa, FleQ serves as a cognate activator of {sigma}{sup 54} in transcription from several {sigma}{sup 54}-dependent promoters of flagellar genes. These P. aeruginosa promoters have been analyzed for FleQ-binding sequences; however, no consensus was deduced. Xcc, although lacks fleSR, has a fleQ homologue residing among over 40 contiguously clustered flagellar genes. A fleQ mutant, Xc17fleQ, constructed by insertional mutation is deficient in FleQ protein, non-flagellated, and immobile. Transcriptional fusion assays on six putative {sigma}{sup 54}-dependent promoters of the flagellar genes, fliE, fliQ, fliL, flgG, flgB, and flhF, indicated that each of them is also FleQ dependent. Each of these promoters has a sequence with weak consensus to 5'-gaaacCCgccgCcgctTt-3', immediately upstream of the predicted {sigma}{sup 54}-binding site, with an imperfect inverted repeat containing a GC-rich center flanked by several A and T at 5'- and 3'-ends, respectively. Replacing this region in fliE promoter with a HindIII recognition sequence abolished the transcription, indicating that this region responds to transcription activation by FleQ.

  3. Promoter Methylation Analysis of IDH Genes in Human Gliomas.

    PubMed

    Flanagan, Simon; Lee, Maggie; Li, Cheryl C Y; Suter, Catherine M; Buckland, Michael E

    2012-01-01

    Mutations in isocitrate dehydrogenase (IDH)-1 or -2 are found in the majority of WHO grade II and III astrocytomas and oligodendrogliomas, and secondary glioblastomas. Almost all described mutations are heterozygous missense mutations affecting a conserved arginine residue in the substrate binding site of IDH1 (R132) or IDH2 (R172). But the exact mechanism of IDH mutations in neoplasia is not understood. It has been proposed that IDH mutations impart a "toxic gain-of-function" to the mutant protein, however a dominant-negative effect of mutant IDH has also been described, implying that IDH may function as a tumor suppressor gene. As most, if not all, tumor suppressor genes are inactivated by epigenetic silencing, in a wide variety of tumors, we asked if IDH1 or IDH2 carry the epigenetic signature of a tumor suppressor by assessing cytosine methylation at their promoters. Methylation was quantified in 68 human brain tumors, including both IDH-mutant and IDH wildtype, by bisulfite pyrosequencing. In all tumors examined, CpG methylation levels were less than 8%. Our data demonstrate that inactivation of IDH function through promoter hypermethylation is not common in human gliomas and other brain tumors. These findings do not support a tumor suppressor role for IDH genes in human gliomas.

  4. Sequence polymorphism and evolution of three cetacean MHC genes.

    PubMed

    Xu, Shi Xia; Ren, Wen Hua; Li, Shu Zhen; Wei, Fu Wen; Zhou, Kai Ya; Yang, Guang

    2009-09-01

    Sequence variability at three major histocompatibility complex (MHC) genes (DQB, DRA, and MHC-I) of cetaceans was investigated in order to get an overall understanding of cetacean MHC evolution. Little sequence variation was detected at the DRA locus, while extensive and considerable variability were found at the MHC-I and DQB loci. Phylogenetic reconstruction and sequence comparison revealed extensive sharing of identical MHC alleles among different species at the three MHC loci examined. Comparisons of phylogenetic trees for these MHC loci with the trees reconstructed only based on non-PBR sites revealed that allelic similarity/identity possibly reflected common ancestry and were not due to adaptive convergence. At the same time, trans-species evolution was also evidenced that the allelic diversity of the three MHC loci clearly pre-dated species divergence events according to the relaxed molecular clock. It may be the forces of balancing selection acting to maintain the high sequence variability and identical alleles in trans-specific manner at the MHC-I and DQB loci.

  5. The Interrelationship between Promoter Strength, Gene Expression, and Growth Rate

    PubMed Central

    Klesmith, Justin R.; Detwiler, Emily E.; Tomek, Kyle J.; Whitehead, Timothy A.

    2014-01-01

    In exponentially growing bacteria, expression of heterologous protein impedes cellular growth rates. Quantitative understanding of the relationship between expression and growth rate will advance our ability to forward engineer bacteria, important for metabolic engineering and synthetic biology applications. Recently, a work described a scaling model based on optimal allocation of ribosomes for protein translation. This model quantitatively predicts a linear relationship between microbial growth rate and heterologous protein expression with no free parameters. With the aim of validating this model, we have rigorously quantified the fitness cost of gene expression by using a library of synthetic constitutive promoters to drive expression of two separate proteins (eGFP and amiE) in E. coli in different strains and growth media. In all cases, we demonstrate that the fitness cost is consistent with the previous findings. We expand upon the previous theory by introducing a simple promoter activity model to quantitatively predict how basal promoter strength relates to growth rate and protein expression. We then estimate the amount of protein expression needed to support high flux through a heterologous metabolic pathway and predict the sizable fitness cost associated with enzyme production. This work has broad implications across applied biological sciences because it allows for prediction of the interplay between promoter strength, protein expression, and the resulting cost to microbial growth rates. PMID:25286161

  6. From genes to markers: exploiting gene sequence information to develop tools for plant breeding.

    PubMed

    Garcia, Melissa; Mather, Diane E

    2014-01-01

    Once the sequence is known for a gene of interest, it is usually possible to design markers to detect polymorphisms within the gene. Such markers can be particularly useful in plant breeding, especially if they detect the causal polymorphism within the gene and are diagnostic of the phenotype. In this chapter, we (1) discuss how gene sequences are obtained and aligned and how polymorphic sites can be identified or predicted; (2) explain the principles of PCR primer design and PCR amplification and provide guidelines for their application in the design and testing of markers; (3) discuss detection methods for presence/absence (dominant) polymorphisms, length polymorphisms and single nucleotide polymorphisms (SNPs); and (4) outline some of the factors that affect the utility of markers in plant breeding and explain how markers can be evaluated (validated) for use in plant breeding.

  7. Cloning, sequencing, and expression of the cold-inducible hutU gene from the antarctic psychrotrophic bacterium Pseudomonas syringae.

    PubMed

    Janiyani, Kamala L; Ray, M K

    2002-01-01

    A promoter-fusion study with a Tn 5-based promoter probe vector had earlier found that the hutU gene which encodes the enzyme urocanase for the histidine utilization pathway is upregulated at a lower temperature (4 degrees C) in the Antarctic psychrotrophic bacterium Pseudomonas syringae. To examine the characteristics of the urocanase gene and its promoter elements from the psychrotroph, the complete hutU and its upstream region from P. syringae were cloned, sequenced, and analyzed in the present study. Northern blot and primer extension analyses suggested that the hutU gene is inducible upon a downshift of temperature (22 to 4 degrees C) and that there is more than one transcription initiation site. One of the initiation sites was specific to the cells grown at 4 degrees C, which was different from the common initiation sites observed at both 4 and 22 degrees C. Although no typical promoter consensus sequences were observed in the flanking region of the transcription initiation sites, there was a characteristic CAAAA sequence at the -10 position of the promoters. Additionally, the location of the transcription and translation initiation sites suggested that the hutU mRNA contains a long 5'-untranslated region, a characteristic feature of many cold-inducible genes of mesophilic bacteria. A comparison of deduced amino acid sequences of urocanase from various bacteria, including the mesophilic and psychrotrophic Pseudomonas spp., suggests that there is a high degree of similarity between the enzymes. The enzyme sequence contains a signature motif (GXGX(2)GX(10)G) of the Rossmann fold for dinucleotide (NAD(+)) binding and two conserved cysteine residues in and around the active site. The psychrotrophic enzyme, however, has an extended N-terminal end.

  8. Rearrangement of mouse immunoglobulin kappa deleting element recombining sequence promotes immune tolerance and lambda B cell production.

    PubMed

    Vela, José Luis; Aït-Azzouzene, Djemel; Duong, Bao Hoa; Ota, Takayuki; Nemazee, David

    2008-02-01

    The recombining sequence (RS) of mouse and its human equivalent, the immunoglobulin (Ig) kappa deleting element (IGKDE), are sequences found at the 3' end of the Ig kappa locus (Igk) that rearrange to inactivate Igk in developing B cells. RS recombination correlates with Ig lambda (Iglambda) light (L) chain expression and likely plays a role in receptor editing by eliminating Igk genes encoding autoantibodies. A mouse strain was generated in which the recombination signal of RS was removed, blocking RS-mediated Igk inactivation. In RS mutant mice, receptor editing and self-tolerance were impaired, in some cases leading to autoantibody formation. Surprisingly, mutant mice also made fewer B cells expressing lambda chain, whereas lambda versus kappa isotype exclusion was only modestly affected. These results provide insight into the mechanism of L chain isotype exclusion and indicate that RS has a physiological role in promoting the formation of lambda L chain-expressing B cells.

  9. Population-genetic analysis of HvABCG31 promoter sequence in wild barley (Hordeum vulgare ssp. spontaneum)

    PubMed Central

    2012-01-01

    Background The cuticle is an important adaptive structure whose origin played a crucial role in the transition of plants from aqueous to terrestrial conditions. HvABCG31/Eibi1 is an ABCG transporter gene, involved in cuticle formation that was recently identified in wild barley (Hordeum vulgare ssp. spontaneum). To study the genetic variation of HvABCG31 in different habitats, its 2 kb promoter region was sequenced from 112 wild barley accessions collected from five natural populations from southern and northern Israel. The sites included three mesic and two xeric habitats, and differed in annual rainfall, soil type, and soil water capacity. Results Phylogenetic analysis of the aligned HvABCG31 promoter sequences clustered the majority of accessions (69 out of 71) from the three northern mesic populations into one cluster, while all 21 accessions from the Dead Sea area, a xeric southern population, and two isolated accessions (one from a xeric population at Mitzpe Ramon and one from the xeric ‘African Slope’ of “Evolution Canyon”) formed the second cluster. The southern arid populations included six haplotypes, but they differed from the consensus sequence at a large number of positions, while the northern mesic populations included 15 haplotypes that were, on average, more similar to the consensus sequence. Most of the haplotypes (20 of 22) were unique to a population. Interestingly, higher genetic variation occurred within populations (54.2%) than among populations (45.8%). Analysis of the promoter region detected a large number of transcription factor binding sites: 121–128 and 121–134 sites in the two southern arid populations, and 123–128,125–128, and 123–125 sites in the three northern mesic populations. Three types of TFBSs were significantly enriched: those related to GA (gibberellin), Dof (DNA binding with one finger), and light. Conclusions Drought stress and adaptive natural selection may have been important determinants in the observed

  10. Analysis of core promoter sequences located downstream from the TATA element in the hsp70 promoter from Drosophila melanogaster.

    PubMed

    Wu, C H; Madabusi, L; Nishioka, H; Emanuel, P; Sypes, M; Arkhipova, I; Gilmour, D S

    2001-03-01

    TFIID recognizes multiple sequence elements in the hsp70 promoter of Drosophila. Here, we investigate the function of sequences downstream from the TATA element. A mutation in the initiator was identified that caused an eightfold reduction in binding of TFIID and a fourfold reduction in transcription in vitro. Another mutation in the +24 to +29 region was somewhat less inhibitory, but a mutation in the +14 to +19 region had essentially no effect. The normal promoter and the mutants in the initiator and the +24 to +29 region were transformed into flies by P element-mediated transformation. The initiator mutation reduced expression an average of twofold in adult flies, whereas the mutation in the +24 to +29 region had essentially no effect. In contrast, a promoter combining the two mutations was expressed an average of sixfold less than the wild type. The results suggest that the initiator and the +24 to +29 region could serve overlapping functions in vivo. Protein-DNA cross-linking was used to identify which subunits of TFIID contact the +24 to +29 region and the initiator. No specific subunits were found to cross-link to the +24 to +29 region. In contrast, the initiator cross-linked exclusively to dTAF230. Remarkably, dTAF230 cross-links approximately 10 times more efficiently to the nontranscribed strand than to the transcribed strand at the initiator.

  11. International interlaboratory study comparing single organism 16S rRNA gene sequencing data: Beyond consensus sequence comparisons

    PubMed Central

    Olson, Nathan D.; Lund, Steven P.; Zook, Justin M.; Rojas-Cornejo, Fabiola; Beck, Brian; Foy, Carole; Huggett, Jim; Whale, Alexandra S.; Sui, Zhiwei; Baoutina, Anna; Dobeson, Michael; Partis, Lina; Morrow, Jayne B.

    2015-01-01

    This study presents the results from an interlaboratory sequencing study for which we developed a novel high-resolution method for comparing data from different sequencing platforms for a multi-copy, paralogous gene. The combination of PCR amplification and 16S ribosomal RNA gene (16S rRNA) sequencing has revolutionized bacteriology by enabling rapid identification, frequently without the need for culture. To assess variability between laboratories in sequencing 16S rRNA, six laboratories sequenced the gene encoding the 16S rRNA from Escherichia coli O157:H7 strain EDL933 and Listeria monocytogenes serovar 4b strain NCTC11994. Participants performed sequencing methods and protocols available in their laboratories: Sanger sequencing, Roche 454 pyrosequencing®, or Ion Torrent PGM®. The sequencing data were evaluated on three levels: (1) identity of biologically conserved position, (2) ratio of 16S rRNA gene copies featuring identified variants, and (3) the collection of variant combinations in a set of 16S rRNA gene copies. The same set of biologically conserved positions was identified for each sequencing method. Analytical methods using Bayesian and maximum likelihood statistics were developed to estimate variant copy ratios, which describe the ratio of nucleotides at each identified biologically variable position, as well as the likely set of variant combinations present in 16S rRNA gene copies. Our results indicate that estimated variant copy ratios at biologically variable positions were only reproducible for high throughput sequencing methods. Furthermore, the likely variant combination set was only reproducible with increased sequencing depth and longer read lengths. We also demonstrate novel methods for evaluating variable positions when comparing multi-copy gene sequence data from multiple laboratories generated using multiple sequencing technologies. PMID:27077030

  12. Increased expression in vivo and in vitro of foreign genes directed by A-type inclusion body hybrid promoters in recombinant vaccinia viruses.

    PubMed Central

    Funahashi, S; Itamura, S; Iinuma, H; Nerome, K; Sugimoto, M; Shida, H

    1991-01-01

    We constructed A-type inclusion body (ATI) hybrid promoters, that is, late ATI promoters followed by tandemly repeated early regions of the promoter for the 7.5-kDa protein (the 7.5-kDa promoter). The repetition of the whole early promoter sequence of the 7.5-kDa gene, including the upstream consensus sequence and initiation region, efficiently increased the early expression of the bacterial chloramphenicol acetyltransferase gene in recombinant vaccinia virus. Recombinant vaccinia virus could express influenza virus hemagglutinin via the hybrid promoter more efficiently, induced higher levels of neutralizing antibody and cytotoxic T lymphocytes, and consequently protected mice more efficiently against challenge with influenza virus than did recombinant vaccinia virus containing the widely used 7.5-kDa promoter. Images PMID:1654453

  13. Sequence analysis of the equine ACTN3 gene in Australian horse breeds.

    PubMed

    Thomas, K C; Hamilton, N A; North, K N; Houweling, P J

    2014-03-15

    The sarcomeric α-actinins, encoded by the genes ACTN2 and ACTN3, are major structural components of the Z-line and have high sequence similarity. α-Actinin-2 is present in all skeletal muscle fibres, while α-actinin-3 has developed specialized expression in only type 2 (fast, glycolytic) fibres. A common single nucleotide polymorphism (SNP) in the human ACTN3 gene (R577X) has been found to influence muscle performance in elite athletes and the normal population. For this reason, equine ACTN3 (eACTN3) is considered to be a possible candidate that may influence horse performance. In this study, the intron/exon boundaries and entire coding region of eACTN3 have been sequenced in five Australian horse breeds (Thoroughbred, Arabian, Standardbred, Clydsdale and Shire) and compared to the eACTN3 GenBank sequence. A total of 34 SNPs were identified, of which 26 were intronic and eight exonic. All exonic SNPs were synonymous; however, five intronic SNPs showed significant differences between breeds. A total of 72 horses were genotyped for a SNP located in the promoter region of the eACTN3 gene (g. 1104 G>A) which differed significantly between breed groups. We hypothesize that this polymorphism influences eACTN3 expression and with further studies may provide a novel marker of horse performance in the future.

  14. Comparative analysis of the pig BAC sequence involved in the regulation of myostatin gene.

    PubMed

    Yu, Zhengquan; Li, Yan; Meng, Qingyong; Yuan, Jing; Zhao, Zhihui; Li, Wei; Hu, Xiaoxiang; Yan, Bingxue; Fan, Baoliang; Yu, Shuyang; Li, Ning

    2005-04-01

    Myostatin (GDF8, MSTN) is a member of the transforming growth factor beta superfamily that is essential for proper regulation of skeletal muscle mass. In order to study its expression and regulatory mechanism deeply, we have presented a comparative analysis of about 170-kb pig BAC sequence containing the myostatin gene among pig, human and mouse. The genomic region is characterized by high interspersed repeats and low G+C content. As for the myostatin gene, a higher sequence similarity is found between human and pig than between these species and the mouse. One striking feature is that the structure of two TATA-boxes in the nearby downstream of CCAAT-box is identified in the promoter. Further analysis reveals that the TATA-box1 is responsible for the transcription in pig and human, but the TATA-box2 acts on the transcription in mouse. The other interesting feature is that two polyadenylation signal sequences (AATAAA) exist in 3'UTR of the pig myostatin gene. Moreover, a large number of potential transcription factor-binding sites are also identified in evolutionary conserved regions (ECRs), which may be associated with the regulation of myostatin. Many putative transcription factors play an important role in the muscle development, and the complex interaction between myostatin and these factors may be required for proper muscle development.

  15. Cap analysis gene expression for high-throughput analysis of transcriptional starting point and identification of promoter usage.

    PubMed

    Shiraki, Toshiyuki; Kondo, Shinji; Katayama, Shintaro; Waki, Kazunori; Kasukawa, Takeya; Kawaji, Hideya; Kodzius, Rimantas; Watahiki, Akira; Nakamura, Mari; Arakawa, Takahiro; Fukuda, Shiro; Sasaki, Daisuke; Podhajska, Anna; Harbers, Matthias; Kawai, Jun; Carninci, Piero; Hayashizaki, Yoshihide

    2003-12-23

    We introduce cap analysis gene expression (CAGE), which is based on preparation and sequencing of concatamers of DNA tags deriving from the initial 20 nucleotides from 5' end mRNAs. CAGE allows high-throughout gene expression analysis and the profiling of transcriptional start points (TSP), including promoter usage analysis. By analyzing four libraries (brain, cortex, hippocampus, and cerebellum), we redefined more accurately the TSPs of 11-27% of the analyzed transcriptional units that were hit. The frequency of CAGE tags correlates well with results from other analyses, such as serial analysis of gene expression, and furthermore maps the TSPs more accurately, including in tissue-specific cases. The high-throughput nature of this technology paves the way for understanding gene networks via correlation of promoter usage and gene transcriptional factor expression.

  16. Sequences of the recA gene and protein.

    PubMed

    Sancar, A; Stachelek, C; Konigsberg, W; Rupp, W D

    1980-05-01

    We have determined the nucleotide sequence of the recA gene of Escherichia coli; this permits the formulation of the primary structure for the recA protein. This structure is consistent with the amino acid composition of the tryptic peptides obtained from the recA protein. The coding region of the recA gene has 1059 base pairs, which specify 352 amino acids. The recA protein has alanine and phenylalanine as its NH2- and COOH-terminal amino acids, respectively, and has the following amino acid composition: Cys3 Asp20 Asn15 Met9 Thr17 Ser20 Glu30 Gln13 Pro10 Gly35 Ala38 Val22 Ile27 Leu31 Tyr7 Phe10 His2Lys27 Trp2 Arg14. Of the three cysteine residues, only two can be alkylated under reducing and denaturing conditions. The molecular weight of the recA polypeptide is 37,842.

  17. Aly/ REF, a factor for mRNA transport, activates RH gene promoter function.

    PubMed

    Suganuma, Hiroshi; Kumada, Maki; Omi, Toshinori; Gotoh, Takaya; Lkhagvasuren, Munkhtulga; Okuda, Hiroshi; Kamesaki, Toyomi; Kajii, Eiji; Iwamoto, Sadahiko

    2005-06-01

    The rhesus (Rh) blood group antigens are of considerable importance in transfusion medicine as well as in newborn or autoimmune hemolytic diseases due to their high antigenicity. We identified a major DNaseI hypersensitive site at the 5' flanking regions of both RHD and RHCE exon 1. A 34 bp fragment located at -191 to -158 from a translation start position, and containing the TCCCCTCCC sequence, was involved in enhancing promoter activity, which was assessed by luciferase reporter gene assay. A biotin-labelled 34 bp probe isolated an mRNA transporter protein, Aly/REF. The specific binding of Aly/REF to RH promoter in erythroid was confirmed by chromatin immunoprecipitation assay. The silencing of Aly/REF by siRNA reduced not only the RH promoter activity of the reporter gene but also transcription from the native genome. These facts provide second proof of Aly/REF as a transcription coactivator, initially identified as a coactivator for the TCRalpha enhancer function. Aly/REF might be a novel transcription cofactor for erythroid-specific genes.

  18. Two closely linked but separable promoters for human neuronal nitric oxide synthase gene transcription.

    PubMed Central

    Xie, J; Roddy, P; Rife, T K; Murad, F; Young, A P

    1995-01-01

    In this report we demonstrate that the human cerebellum contains neuronal nitric oxide synthase (nNOS) mRNAs with two distinct 5'-untranslated regions that are encoded through use of closely linked but separate promoters. nNOS cDNA clones were shown to contain different 5' terminal exons spliced to a common exon 2. Genomic cloning and sequence analysis demonstrate that the unique exons are positioned within 300 bp of each other but separated from exon 2 by an intron that is at least 20 kb in length. A CpG island engulfs the downstream 5'-terminal exon. In contrast, most of the upstream exon resides outside of this CpG island. Interestingly, the upstream exon includes a GT dinucleotide repeat. A fusion gene with a 414-bp nNOS genomic fragment that includes a portion of the upstream 5'-terminal exon and its immediate 5'-flanking DNA is expressed in transfected HeLa cells. Also expressed is a fusion gene that contains the luciferase reporter under transcriptional control by a 308-bp genomic fragment that includes the region separating both 5'-terminal exons. These results indicate that expression of these exons is subject to transcriptional control by separate promoters. However, the proximity of these promoters raise the possibility that complex interactions may be involved in regulating nNOS gene expression at these sites. Images Fig. 1 Fig. 4 PMID:7532307

  19. Gene Expression of Axon Growth Promoting Factors in the Deer Antler

    PubMed Central

    Pita-Thomas, Wolfgang; Fernández-Martos, Carmen; Yunta, Mónica; Maza, Rodrigo M.; Navarro-Ruiz, Rosa; Lopez-Rodríguez, Marcos Javier; Reigada, David; Nieto-Sampedro, Manuel; Nieto-Diaz, Manuel

    2010-01-01

    The annual regeneration cycle of deer (Cervidae, Artiodactyla) antlers represents a unique model of epimorphic regeneration and rapid growth in adult mammals. Regenerating antlers are innervated by trigeminal sensory axons growing through the velvet, the modified form of skin that envelopes the antler, at elongation velocities that reach one centimetre per day in the common deer (Cervus elaphus). Several axon growth promoters like NT-3, NGF or IGF-1 have been described in the antler. To increase the knowledge on the axon growth environment, we have combined different gene-expression techniques to identify and characterize the expression of promoting molecules not previously described in the antler velvet. Cross-species microarray analyses of deer samples on human arrays allowed us to build up a list of 90 extracellular or membrane molecules involved in axon growth that were potentially being expressed in the antler. Fifteen of these genes were analysed using PCR and sequencing techniques to confirm their expression in the velvet and to compare it with the expression in other antler and skin samples. Expression of 8 axon growth promoters was confirmed in the velvet, 5 of them not previously described in the antler. In conclusion, our work shows that antler velvet provides growing axons with a variety of promoters of axon growth, sharing many of them with deer's normal and pedicle skin. PMID:21187928

  20. Draft genome sequence of the plant growth-promoting bacterium Bacillus siamensis KCTC 13613T.

    PubMed

    Jeong, Haeyoung; Jeong, Da-Eun; Kim, Sun Hong; Song, Geun Cheol; Park, Soo-Young; Ryu, Choong-Min; Park, Seung-Hwan; Choi, Soo-Keun

    2012-08-01

    Bacillus siamensis KCTC 13613(T), a novel halophilic Bacillus species isolated from a salted Thai food, produced antimicrobial compounds against plant pathogens and promoted plant growth by volatile emission. We determined the 3.8-Mb genome sequence of B. siamensis KCTC 13613(T) to reveal the plant-beneficial effect at the genomic level.

  1. Positive and negative functional interactions between promoter elements from different classes of RNA polymerase III-transcribed genes.

    PubMed Central

    Parry, H D; Mattaj, I W

    1990-01-01

    Consensus tRNA gene promoter elements, A and B boxes, were introduced into the coding sequence of a Xenopus U6 gene. Combinations in which A and B boxes were coupled to wild-type or mutant U6 promoters were made. In this way information about both the functions of individual promoter elements and functional relationships between different classes of RNA polymerase III promoter element were obtained. Mutants in which the U6 PSE was non-functional were rescued by the presence of a B box, indicating a degree of functional relationship between these two elements. Moreover, the B box acted to increase the transcriptional activity and competitive strength of the wild-type U6 promoter. In contrast, no evidence was obtained to suggest that a tRNA A box can interact productively with U6 promoter elements in the absence of a B box. Data obtained suggest that the U6 PSE functions as an 'adaptor', being necessary to enable the basal U6 promoter to respond to upstream enhancement. Certain combinations of U6 and tRNA promoter elements are shown to be mutually antagonistic by a mechanism which is likely to involve blockage of transcription initiation. In summary, the U6 and tRNA promoters are shown to consist of functionally related, but distinct, promoter elements whose interactions shed new light on their normal roles in transcription. Images Fig. 1. Fig. 2. Fig. 3. Fig. 4. Fig. 5. Fig. 6. Fig. 7. Fig. 8. PMID:2323333

  2. Molecular mechanisms underlying the regulation of the MFG-E8 gene promoter activity in physiological and inflammatory conditions

    PubMed Central

    Wang, Xiao; Bu, Heng-Fu; Liu, Shirley XL; De Plaen, Isabelle G.; Tan, Xiao-Di

    2015-01-01

    Milk fat globule-EGF factor 8 (MFG-E8) is expressed by macrophages and plays an important role in attenuating inflammation and maintaining tissue homeostasis. Previously, we and others found that LPS inhibits MFG-E8 gene expression in macrophages. Here, we characterized the 5′-flanking region of the mouse MFG-E8 gene. To functionally analyze the upstream regulatory region of the MFG-E8 gene, a series of luciferase reporter gene constructs containing deleted or mutated regulatory elements were prepared. Using the luciferase assay, we revealed that Sp1 binding motifs within the proximal promoter region were necessary for full activity of the MFG-E8 promoter, whereas AP-1 like binding sequence at −372 played a role in governing the promoter activity at a homeostatic level. With chromatin immunoprecipitation assay, we showed that Sp1 and c-Jun physically interact with the MFG-E8 promoter region in vivo. In addition, Sp1 was found to regulate the MFG-E8 promoter activity positively and c-Jun negatively. Furthermore, we demonstrated that LPS inhibited MFG-E8 promoter activity via targeting Sp1 and AP-1-like motifs in the 5′-flanking region. Collectively, our data indicate that Sp1 and AP-1-related factors are involved in the regulation of MFG-E8 gene transcription by targeting their binding sites in the 5′-flanking region under physiological and inflammatory states. PMID:25711369

  3. How to analyze gene expression using RNA-sequencing data.

    PubMed

    Ramsköld, Daniel; Kavak, Ersen; Sandberg, Rickard

    2012-01-01

    RNA-Seq is arising as a powerful method for transcriptome analyses that will eventually make microarrays obsolete for gene expression analyses. Improvements in high-throughput sequencing and efficient sample barcoding are now enabling tens of samples to be run in a cost-effective manner, competing with microarrays in price, excelling in performance. Still, most studies use microarrays, partly due to the ease of data analyses using programs and modules that quickly turn raw microarray data into spreadsheets of gene expression values and significant differentially expressed genes. Instead RNA-Seq data analyses are still in its infancy and the researchers are facing new challenges and have to combine different tools to carry out an analysis. In this chapter, we provide a tutorial on RNA-Seq data analysis to enable researchers to quantify gene expression, identify splice junctions, and find novel transcripts using publicly available software. We focus on the analyses performed in organisms where a reference genome is available and discuss issues with current methodology that have to be solved before RNA-Seq data can utilize its full potential.

  4. Discovery of a Family of Genomic Sequences Which Interact Specifically with the c-MYC Promoter to Regulate c-MYC Expression

    PubMed Central

    Thomas, Shelia D.; Rouchka, Eric C.; Miller, Donald M.

    2016-01-01

    G-quadruplex forming sequences are particularly enriched in the promoter regions of eukaryotic genes, especially of oncogenes. One of the most well studied G-quadruplex forming sequences is located in the nuclease hypersensitive element (NHE) III1 of the c-MYC promoter region. The oncoprotein c-MYC regulates a large array of genes which play important roles in growth regulation and metabolism. It is dysregulated in >70% of human cancers. The silencer NHEIII1 located upstream of the P1 promoter regulates up-to 80% of c-MYC transcription and includes a G-quadruplex structure (Pu27) that is required for promoter inhibition. We have identified, for the first time, a family of seventeen G-quadruplex-forming motifs with >90% identity with Pu27, located on different chromosomes throughout the human genome, some found near or within genes involved in stem cell maintenance or neural cell development. Notably, all members of the Pu27 family interact specifically with NHEIII1 sequence, in vitro. Crosslinking studies demonstrate that Pu27 oligonucleotide binds specifically to the C-rich strand of the NHEIII1 resulting in the G-quadruplex structure stabilization. Pu27 homologous sequences (Pu27-HS) significantly inhibit leukemic cell lines proliferation in culture. Exposure of U937 cells to the Pu27-HS induces cell growth inhibition associated with cell cycle arrest that is most likely due to downregulation of c-MYC expression at the RNA and/or protein levels. Expression of SOX2, another gene containing a Pu27-HS, was affected by Pu27-HS treatment as well. Our data suggest that the oligonucleotides encoding the Pu27 family target complementary DNA sequences in the genome, including those of the c-MYC and SOX2 promoters. This effect is most likely cell type and cell growth condition dependent. The presence of genomic G-quadruplex-forming sequences homologous to Pu27 of c-MYC silencer and the fact that they interact specifically with the parent sequence suggest a common

  5. Transcriptional activity of novel ALDH1L1 promoters in the rat brain following AAV vector-mediated gene transfer

    PubMed Central

    Mudannayake, Janitha M; Mouravlev, Alexandre; Fong, Dahna M; Young, Deborah

    2016-01-01

    Aldehyde dehydrogenase family 1, member L1 (ALDH1L1) is a recently characterized pan-astrocytic marker that is more homogenously expressed throughout the brain than the classic astrocytic marker, glial fibrillary acidic protein. We generated putative promoter sequence variants of the rat ALDH1L1 gene for use in adeno-associated viral vector-mediated gene transfer, with an aim to achieve selective regulation of transgene expression in astrocytes in the rat brain. Unexpectedly, ALDH1L1 promoter variants mediated transcriptional activity exclusively in neurons in the substantia nigra pars compacta as assessed by luciferase reporter expression at 3 weeks postvector infusion. This selectivity for neurons in the substantia nigra pars compacta also persisted in the context of adeno-associated viral serotype 5, 8 or 9 vector-mediated gene delivery. An in vivo promoter comparison showed the highest performing ALDH1L1 promoter variant mediated higher transgene expression than the neuronal-specific synapsin 1 and tyrosine hydroxylase promoters. The ALDH1L1 promoter was also transcriptionally active in dentate granule neurons following intrahippocampal adeno-associated viral vector infusion, whereas transgene expression was detected in both striatal neurons and astrocytes following vector infusion into the striatum. Our results demonstrate the potential suitability of the ALDH1L1 promoter as a new tool in the development of gene therapy and disease modelling applications. PMID:27990448

  6. Nucleotide sequence of the hemolysin I gene from Actinobacillus pleuropneumoniae.

    PubMed Central

    Frey, J; Meier, R; Gygi, D; Nicolet, J

    1991-01-01

    The DNA sequence of the gene encoding the structural protein of hemolysin I (HlyI) of Actinobacillus pleuropneumoniae serotype 1 strain 4074 was analyzed. The nucleotide sequence shows a 3,072-bp reading frame encoding a protein of 1,023 amino acids with a calculated molecular size of 110.1 kDa. This corresponds to the HlyI protein, which has an apparent molecular size on sodium dodecyl sulfate gels of 105 kDa. The structure of the protein derived from the DNA sequence shows three hydrophobic regions in the N-terminal part of the protein, 13 glycine-rich domains in the second half of the protein, and a hydrophilic C-terminal area, all of which are typical of the cytotoxins of the RTX (repeats in the structural toxin) toxin family. The derived amino acid sequence of HlyI shows 42% homology with the hemolysin of A. pleuropneumoniae serotype 5, 41% homology with the leukotoxin of Pasteurella haemolytica, and 56% homology with the Escherichia coli alpha-hemolysin. The 13 glycine-rich repeats and three hydrophobic areas of the HlyI sequence show more similarity to the E. coli alpha-hemolysin than to either the A. pleuropneumoniae serotype 5 hemolysin or the leukotoxin (while the last two are more similar to each other). Two types of RTX hemolysins therefore seem to be present in A. pleuropneumoniae, one (HlyI) resembling the alpha-hemolysin and a second more closely related to the leukotoxin. Ca(2+)-binding experiments using HlyI and recombinant A. pleuropneumoniae prohemolysin (HlyIA) that was produced in E. coli shows that HlyI binds 45Ca2+, probably because of the 13 glycine-rich repeated domains. Activation of the prohemolysin is not required for Ca2+ binding. Images PMID:1879928

  7. Ets transcription factors bind and transactivate the core promoter of the von Willebrand factor gene.

    PubMed

    Schwachtgen, J L; Janel, N; Barek, L; Duterque-Coquillaud, M; Ghysdael, J; Meyer, D; Kerbiriou-Nabias, D

    1997-12-18

    von Willebrand factor (vWF) gene expression is restricted to endothelial cells and megakaryocytes. Previous results demonstrated that basal transcription of the human vWF gene is mediated through a promoter located between base pairs -89 and +19 (cap site: +1) which is functional in endothelial and non endothelial cells. Two DNA repeats TTTCCTTT correlating with inverted consensus binding sites for the Ets family of transcription factors are present in the -56/-36 sequence. In order to analyse whether these DNA elements are involved in transcription, human umbilical vein endothelial cells (HUVEC), bovine calf pulmonary endothelial cell line (CPAE), HeLa and COS cells were transfected with constructs containing deletions of the -89/+19 fragment, linked to the chloramphenicol acetyl transferase (CAT) reporter gene. The -60/+19 region exhibits significant promoter activity in HUVEC and CPAE cells only. The -42/+19 fragment is not active. Mutations of the -60/+19 promoter fragment in the 5' (-56/-49) Ets binding site abolish transcription in endothelial cells whereas mutations in the 3' (-43/-36) site does not. The -60/-33 fragment forms three complexes with proteins from HUVEC nuclear extracts in electrophoretic mobility shift assay which are dependent on the presence of the 5' Ets binding site. Binding of recombinant Ets-1 protein to the -60/-33 fragment gives a complex which also depends on the 5' site. The -60/+19 vWF gene core promoter is transactivated in HeLa cells by cotransfecting with Ets-1 or Erg (Ets-related gene) expression plasmids. In contrast to the wild type construct, transcription of the 5' site mutants is not increased by these expressed proteins. The results indicate that the promoter activity of the -60/+19 region of the vWF gene depends on transcription factors of the Ets family of which several members like Ets-1, Ets-2 and Erg are expressed in endothelium. Cotransfection of Ets-1 and Erg expression plasmids is sufficient to induce the -60/+19 v

  8. Core promoter-specific gene regulation: TATA box selectivity and Initiator-dependent bi-directionality of serum response factor-activated transcription.

    PubMed

    Xu, Muyu; Gonzalez-Hurtado, Elsie; Martinez, Ernest

    2016-04-01

    Gene-specific activation by enhancers involves their communication with the basal RNA polymerase II transcription machinery at the core promoter. Core promoters are diverse and may contain a variety of sequence elements such as the TATA box, the Initiator (INR), and the downstream promoter element (DPE) recognized, respectively, by the TATA-binding protein (TBP) and TBP-associated factors of the TFIID complex. Core promoter elements contribute to the gene selectivity of enhancers, and INR/DPE-specific enhancers and activators have been identified. Here, we identify a TATA box-selective activating sequence upstream of the human β-actin (ACTB) gene that mediates serum response factor (SRF)-induced transcription from TATA-dependent but not INR-dependent promoters and requires the TATA-binding/bending activity of TBP, which is otherwise dispensable for transcription from a TATA-less promoter. The SRF-dependent ACTB sequence is stereospecific on TATA promoters but activates in an orientation-independent manner a composite TATA/INR-containing promoter. More generally, we show that SRF-regulated genes of the actin/cytoskeleton/contractile family tend to have a TATA box. These results suggest distinct TATA-dependent and INR-dependent mechanisms of TFIID-mediated transcription in mammalian cells that are compatible with only certain stereospecific combinations of activators, and that a TBP-TATA binding mechanism is important for SRF activation of the actin/cytoskeleton-related gene family.

  9. Identification of a Promoter for the Human C1q-Tumor Necrosis Factor–Related Protein-5 Gene Associated with Late-Onset Retinal Degeneration

    PubMed Central

    Chavali, Venkata R. M.; Sommer, Jeffrey R.; Petters, Robert M.

    2010-01-01

    Purpose. The Complement-1q tumor necrosis factor-related protein 5 (C1QTNF5/CTRP5) gene is located in the 3′ untranslated region of the Membrane Frizzled Related Protein (MFRP) gene, and these two genes are reported to be dicistronic. The authors examined the 5′ upstream sequence of CTRP5 for the presence of a promoter regulating the expression of this gene. Methods. The sequence upstream of the translational start site of human CTRP5 (hCTRP5) was analyzed by Promoter Inspector software. A series of plasmids containing segments of hCTRP5 putative promoter sequence (−29 bp to −3.6 kb) upstream of the luciferase gene were generated. Cells were transiently transfected with these plasmids, and luciferase activity was measured. 5′ RACE analysis was performed to determine the functional transcription start site. V5 tagged-pig CTRP5 (pCTRP5) gene, cloned downstream of the hCTRP5 putative promoter, was expressed in a human retinal cell line (ARPE-19) and a Chinese hamster ovary cell line (CHO-K1) to study the functionality of the putative promoter. Results. Bioinformatic analysis identified a putative promoter region between nt −1322 and +1 sequence of hCTRP5. 5′ RACE analysis revealed the presence of the transcriptional start site (TSS) at 62 bp upstream of the start codon in the CTRP5. The 1.3-kb sequence of the hCTRP5 predicted promoter produced higher levels of luciferase activity, indicating the strength of the cloned CTRP5 promoter. The promoter sequence between nt −1322 bp to −29 bp upstream of the first ATG of CTRP5 was found to be essential for this promoter activity. The predicted hCTRP5 promoter was found to control the expression of V5-tagged pCTRP5 and nuclear GFP, indicating that the promoter was functional. Conclusions. This study revealed the presence of a functional promoter for the CTRP5 gene located 5′ of its start site. Understanding the regulation of CTRP5 gene transcription may provide insights into the possible role of CTRP5 in

  10. Evolution of Hsp70 Gene Expression: A Role for Changes in AT-Richness within Promoters

    PubMed Central

    Ma, Ronghui; Zhang, Bo; Kang, Le

    2011-01-01

    In disparate organisms adaptation to thermal stress has been linked to changes in the expression of genes encoding heat-shock proteins (Hsp). The underlying genetics, however, remain elusive. We show here that two AT-rich sequence elements in the promoter region of the hsp70 gene of the fly Liriomyza sativae that are absent in the congeneric species, Liriomyza huidobrensis, have marked cis-regulatory consequences. We studied the cis-regulatory consequences of these elements (called ATRS1 and ATRS2) by measuring the constitutive and heat-shock-induced luciferase luminescence that they drive in cells transfected with constructs carrying them modified, deleted, or intact, in the hsp70 promoter fused to the luciferase gene. The elements affected expression level markedly and in different ways: Deleting ATRS1 augmented both the constitutive and the heat-shock-induced luminescence, suggesting that this element represses transcription. Interestingly, replacing the element with random sequences of the same length and A+T content delivered the wild-type luminescence pattern, proving that the element's high A+T content is crucial for its effects. Deleting ATRS2 decreased luminescence dramatically and almost abolished heat-shock inducibility and so did replacing the element with random sequences matching the element's length and A+T content, suggesting that ATRS2's effects on transcription and heat-shock inducibility involve a common mechanism requiring at least in part the element's specific primary structure. Finally, constitutive and heat-shock luminescence were reduced strongly when two putative binding sites for the Zeste transcription factor identified within ATRS2 were altered through site-directed mutagenesis, and the heat-shock-induced luminescence increased when Zeste was over-expressed, indicating that Zeste participates in the effects mapped to ATRS2 at least in part. AT-rich sequences are common in promoters and our results suggest that they should play important

  11. Evolution of hsp70 gene expression: a role for changes in AT-richness within promoters.

    PubMed

    Chen, Bing; Jia, Tieliu; Ma, Ronghui; Zhang, Bo; Kang, Le

    2011-01-01

    In disparate organisms adaptation to thermal stress has been linked to changes in the expression of genes encoding heat-shock proteins (Hsp). The underlying genetics, however, remain elusive. We show here that two AT-rich sequence elements in the promoter region of the hsp70 gene of the fly Liriomyza sativae that are absent in the congeneric species, Liriomyza huidobrensis, have marked cis-regulatory consequences. We studied the cis-regulatory consequences of these elements (called ATRS1 and ATRS2) by measuring the constitutive and heat-shock-induced luciferase luminescence that they drive in cells transfected with constructs carrying them modified, deleted, or intact, in the hsp70 promoter fused to the luciferase gene. The elements affected expression level markedly and in different ways: Deleting ATRS1 augmented both the constitutive and the heat-shock-induced luminescence, suggesting that this element represses transcription. Interestingly, replacing the element with random sequences of the same length and A+T content delivered the wild-type luminescence pattern, proving that the element's high A+T content is crucial for its effects. Deleting ATRS2 decreased luminescence dramatically and almost abolished heat-shock inducibility and so did replacing the element with random sequences matching the element's length and A+T content, suggesting that ATRS2's effects on transcription and heat-shock inducibility involve a common mechanism requiring at least in part the element's specific primary structure. Finally, constitutive and heat-shock luminescence were reduced strongly when two putative binding sites for the Zeste transcription factor identified within ATRS2 were altered through site-directed mutagenesis, and the heat-shock-induced luminescence increased when Zeste was over-expressed, indicating that Zeste participates in the effects mapped to ATRS2 at least in part. AT-rich sequences are common in promoters and our results suggest that they should play important

  12. Solving the molecular diagnostic testing conundrum for Mendelian disorders in the era of next-generation sequencing: single-gene, gene panel, or exome/genome sequencing.

    PubMed

    Xue, Yuan; Ankala, Arunkanth; Wilcox, William R; Hegde, Madhuri R

    2015-06-01

    Next-generation sequencing is changing the paradigm of clinical genetic testing. Today there are numerous molecular tests available, including single-gene tests, gene panels, and exome sequencing or genome sequencing. As a result, ordering physicians face the conundrum of selecting the best diagnostic tool for their patients with genetic conditions. Single-gene testing is often most appropriate for conditions with distinctive clinical features and minimal locus heterogeneity. Next-generation sequencing-based gene panel testing, which can be complemented with array comparative genomic hybridization and other ancillary methods, provides a comprehensive and feasible approach for heterogeneous disorders. Exome sequencing and genome sequencing have the advantage of being unbiased regarding what set of genes is analyzed, enabling parallel interrogation of most of the genes in the human genome. However, current limitations of next-generation sequencing technology and our variant interpretation capabilities caution us against offering exome sequencing or genome sequencing as either stand-alone or first-choice diagnostic approaches. A growing interest in personalized medicine calls for the application of genome sequencing in clinical diagnostics, but major challenges must be addressed before its full potential can be realized. Here, we propose a testing algorithm to help clinicians opt for the most appropriate molecular diagnostic tool for each scenario.

  13. Analysis of Hypothetical Promoter Domains of DKFZp564A1164, NPHS1 and HSPOX1 Genes

    SciTech Connect

    Hammond, Sha S.

    2004-03-01

    For this study, a high throughput method for identifying and testing regulatory elements was examined. In addition, the validity of promoters predicted by FirstEF was tested. It was found that by combining computer based promoter and first exon predictions from FirstEF (Davuluri et al., 2001) with PCR-based cloning to generate luciferase reporter constructs, and by testing reporter activity in cultured mammalian cells plated in a 96 well format one could identify promoter activity in a relatively high throughput manner. The data generated in this study suggest that FirstEF predictions are sometimes incorrect. Therefore, having a strategy for defining which FirstEF predicted promoters to test first may accelerate the process. Initially testing promoters that are at a confirmed transcription start site for a gene, at a possible alternate transcription start site or in a region of conserved sequence would be the best candidates, while promoters predicted in gene desert regions may not be as easy to confirm. The luciferase assay lent itself very well to the high throughput search, however the subcloning did not always go smoothly. The numerous steps that this traditional subcloning method requires were time consuming and increased the opportunities for errors. A faster method that skips many of the traditional subcloning steps, such as the Creator{trademark} system by Clontech is currently being investigated by our lab. The development and testing of substantially larger enhancer/silencer regulatory elements may not be possible at this time using these high throughput methods. These regulatory elements are generally GC rich making them more difficult to PCR and subclone. Additionally, confirming upstream untranslated first exons was not possible within this time scale using the SMART RACE protocol. It will be necessary to further explore the limitations within these procedures in order to confirm these and future regulatory elements. Alterations and modifications to

  14. Cloning, sequencing and analysis of dnaK -dnaJ gene cluster of Bacillus megaterium.

    PubMed

    Bao, Fangming; Gong, Lei; Shao, Weilan

    2008-12-01

    The DNA fragment of heat shock genes (hrcA-grpE-dnaK-dnaJ) containing complete hrcA-grpE-dnaK operon and the transcription unit of dnaJ was cloned, sequensed and analyzed from Bacillus megaterium RF5. The sequence of hrcA, grpE and dnaJ were first time reported, and their coding products exibit 60%, 63% and 81% of identities to the homologs of B. subtilis. A sigmaA-type promoter of Gram-positive bacteria (PA1) and a terminator were located upstream of the hrcA and downstream of dnaK, and a Controlling inverted repeat of chaperone expression element (CIRCE) was identified between PA1 and hrcA. Another sigmaA-type promoter (PA2) and a terminator were found upstream and downstream of dnaJ, indicating B. megaterium has a transcription unit containing a single gene dnaJ. The structure of dnaJ transcription unit is more similar to that of Listeria monocytogenes than other species of Bacillus. A partial protein-based phylogenetic tree, derived from Gram-positive bacteria using HrcA sequence, indicated a closer phylogenetic relationship between B. megaterium and Geobacillus species than other two Bacillus species.

  15. Binding motifs in bacterial gene promoters modulate transcriptional effect of global regulators

    SciTech Connect

    Leuze, Michael Rex; Karpinets, Tatiana V; Syed, Mustafa H; Beliaev, Alexander S; Uberbacher, Edward C

    2012-01-01

    Bacterial gene regulation involves transcription factors (TFs) that influence the expression of many genes. Global regulators, including CRP (cAMP Receptor Protein), ArcA, and FNR, can modulate the transcriptional activity of multiple operons. The similarity of a regulatory element s sequence to a TF s consensus binding site (BS) and the position of the regulatory element in an operon promoter are considered the most important determinants of this TF s regulatory influence. In this study we explore the hypothesis that the number of TFBS half-sites (where a half-site is one half of the palindromic BS consensus sequence, which we shall refer to as a binding motif or a BM) of a global regulator in an operon s promoter plays an important role in the operon s transcriptional regulation. We examine empirical data from transcriptional profiling of the CRP regulon in Shewanella oneidenses MR 1 and Escherichia coli, and of the ArcA regulon in S. oneidenses MR 1. We compare the power of CRP BM counts and of full, symmetrical CRP TFBS characteristics, namely similarity to consensus and location, to predict CRP-induced transcriptional activity. We find that CRP BM counts have a nonlinear effect on CRP-dependent transcriptional activity and predict this activity better than full-length TFBS quality or location. Regression analysis indicates that IHF (Integration Host Factor) and ArcA have synergistic effects on CRP-induced gene transcription, positive and negative, respectively. Based on these results, we propose that the fine-tuning of bacterial transcriptional activity by CRP may involves not only the bending of the operon promoter, facilitated by CRP in cooperation with the histone-like protein IHF, but also the cumulative binding affinity of multiple weak BMs.

  16. Long-range correlations of RNA polymerase II promoter sequences across organisms

    NASA Astrophysics Data System (ADS)

    Katsaloulis, P.; Theoharis, T.; Zheng, W. M.; Hao, B. L.; Bountis, A.; Almirantis, Y.; Provata, A.

    2006-07-01

    The statistical properties of the size distribution of DNA segments separating identical oligonucleotides are studied. For representative eukaryotes ( Homo sapiens, Mus musculus, Saccharomyces cereviciae, Oryza sativa, Arabidopsis thaliana) we have demonstrated the existence of long-range correlations for the distances separating oligonucleotides of sizes 4, 5 and 6, which carry a promoter signature. This observation is independent of the consensus sequence used by the organism, as in the case of O. sativa (which mainly uses the CG promoter box) and A. thaliana (which mainly uses the TATA promoter box). If we use two parameters to characterise the size distribution separating oligonucleotides, we observe that oligonucleotides containing promoter signatures cluster together, away from the others.

  17. Transcriptome Sequencing and Positive Selected Genes Analysis of Bombyx mandarina

    PubMed Central

    Wu, Yuqian; Long, Renwen; Liu, Chun; Xia, Qingyou

    2015-01-01

    The wild silkworm Bombyx mandarina is widely believed to be an ancestor of the domesticated silkworm, Bombyx mori. Silkworms are often used as a model for studying the mechanism of species domestication. Here, we performed transcriptome sequencing of the wild silkworm using an Illumina HiSeq2000 platform. We produced 100,004,078 high-quality reads and assembled them into 50,773 contigs with an N50 length of 1764 bp and a mean length of 941.62 bp. A total of 33,759 unigenes were identified, with 12,805 annotated in the Nr database, 8273 in the Pfam database, and 9093 in the Swiss-Prot database. Expression profile analysis found significant differential expression of 1308 unigenes between the middle silk gland (MSG) and posterior silk gland (PSG). Three sericin genes (sericin 1, sericin 2, and sericin 3) were expressed specifically in the MSG and three fibroin genes (fibroin-H, fibroin-L, and fibroin/P25) were expressed specifically in the PSG. In addition, 32,297 Single-nucleotide polymorphisms (SNPs) and 361 insertion-deletions (INDELs) were detected. Comparison with the domesticated silkworm p50/Dazao identified 5,295 orthologous genes, among which 400 might have experienced or to be experiencing positive selection by Ka/Ks analysis. These data and analyses presented here provide insights into silkworm domestication and an invaluable resource for wild silkworm genomics research. PMID:25806526

  18. Identification of novel hereditary cancer genes by whole exome sequencing.

    PubMed

    Sokolenko, Anna P; Suspitsin, Evgeny N; Kuligina, Ekatherina Sh; Bizin, Ilya V; Frishman, Dmitrij; Imyanitov, Evgeny N

    2015-12-28

    Whole exome sequencing (WES) provides a powerful tool for medical genetic research. Several dozens of WES studies involving patients with hereditary cancer syndromes have already been reported. WES led to breakthrough in understanding of the genetic basis of some exceptionally rare syndromes; for example, identification of germ-line SMARCA4 mutations in patients with ovarian hypercalcemic small cell carcinomas indeed explains a noticeable share of familial aggregation of this disease. However, studies on common cancer types turned out to be more difficult. In particular, there is almost a dozen of reports describing WES analysis of breast cancer patients, but none of them yet succeeded to reveal a gene responsible for the significant share of missing heritability. Virtually all components of WES studies require substantial improvement, e.g. technical performance of WES, interpretation of WES results, mode of patient selection, etc. Most of contemporary investigations focus on genes with autosomal dominant mechanism of inheritance; however, recessive and oligogenic models of transmission of cancer susceptibility also need to be considered. It is expected that the list of medically relevant tumor-predisposing genes will be rapidly expanding in the next few years.

  19. Cloning, overexpression and nucleotide sequence of a thermostable DNA ligase-encoding gene.

    PubMed

    Barany, F; Gelfand, D H

    1991-12-20

    Thermostable DNA ligase has been harnessed for the detection of single-base genetic diseases using the ligase chain reaction [Barany, Proc. Natl. Acad. Sci. USA 88 (1991) 189-193]. The Thermus thermophilus (Tth) DNA ligase-encoding gene (ligT) was cloned in Escherichia coli by genetic complementation of a ligts 7 defect in an E. coli host. Nucleotide sequence analysis of the gene revealed a single chain of 676 amino acid residues with 47% identity to the E. coli ligase. Under phoA promoter control, Tth ligase was overproduced to greater than 10% of E. coli cellular proteins. Adenylated and deadenylated forms of the purified enzyme were distinguished by apparent molecular weights of 81 kDa and 78 kDa, respectively, after separation via sodium dodecyl sulfate-polyacrylamide-gel electrophoresis.

  20. Distinct Prion Domain Sequences Ensure Efficient Amyloid Propagation by Promoting Chaperone Binding or Processing In Vivo

    PubMed Central

    Langlois, Christine R.; Serio, Tricia R.

    2016-01-01

    Prions are a group of proteins that can adopt a spectrum of metastable conformations in vivo. These alternative states change protein function and are self-replicating and transmissible, creating protein-based elements of inheritance and infectivity. Prion conformational flexibility is encoded in the amino acid composition and sequence of the protein, which dictate its ability not only to form an ordered aggregate known as amyloid but also to maintain and transmit this structure in vivo. But, while we can effectively predict amyloid propensity in vitro, the mechanism by which sequence elements promote prion propagation in vivo remains unclear. In yeast, propagation of the [PSI+] prion, the amyloid form of the Sup35 protein, has been linked to an oligopeptide repeat region of the protein. Here, we demonstrate that this region is composed of separable functional elements, the repeats themselves and a repeat proximal region, which are both required for efficient prion propagation. Changes in the numbers of these elements do not alter the physical properties of Sup35 amyloid, but their presence promotes amyloid fragmentation, and therefore maintenance, by molecular chaperones. Rather than acting redundantly, our observations suggest that these sequence elements make complementary contributions to prion propagation, with the repeat proximal region promoting chaperone binding to and the repeats promoting chaperone processing of Sup35 amyloid. PMID:27814358

  1. Promoter elements of the PHR1 gene of Saccharomyces cerevisiae and their roles in the response to DNA damage.

    PubMed Central

    Sancar, G B; Ferris, R; Smith, F W; Vandeberg, B

    1995-01-01

    The PHR1 gene of Saccharomyces cerevisiae encodes the apoenzyme for the DNA repair enzyme photolyase. PHR1 transcription is induced in response to 254 nm radiation and a variety of chemical damaging agents. We report here the identification of promoter elements required for PHR1 expression. Transcription is regulated primarily through three sequence elements clustered within a 120 bp region immediately upstream of the translational start site. A 20 bp interrupted palindrome comprises UASPHR1 and is responsible for 80-90% of basal and induced expression. UASPHR1 alone can activate transcription of a CYC1 minimal promoter but does not confer damage responsiveness. In the intact PHR1 promoter UAS function is dependent upon an upstream essential sequence (UES). URSPHR1 contains a binding site for the damage-responsive repressor Prp; consistent with this role, deletion or specific mutations of the URS increase basal level expression and decrease the induction ratio. Deletion of URSPHR1 also eliminates the requirement for UESPHR1 for promoter activation, indicating that the UES attenuates Prp-mediated repression. Sequences within UASPHR1 are similar to regulatory sequences found upstream of both damage responsive and nonresponsive genes involved in DNA repair and metabolism. PMID:7501452

  2. Gene sequence and predicted amino acid sequence of the motA protein, a membrane-associated protein required for flagellar rotation in Escherichia coli.

    PubMed Central

    Dean, G E; Macnab, R M; Stader, J; Matsumura, P; Burks, C

    1984-01-01

    The motA and motB gene products of Escherichia coli are integral membrane proteins necessary for flagellar rotation. We determined the DNA sequence of the region containing the motA gene and its promoter. Within this sequence, there is an open reading frame of 885 nucleotides, which with high probability (98% confidence level) meets criteria for a coding sequence. The 295-residue amino acid translation product had a molecular weight of 31,974, in good agreement with the value determined experimentally by gel electrophoresis. The amino acid sequence, which was quite hydrophobic, was subjected to a theoretical analysis designed to predict membrane-spanning alpha-helical segments of integral membrane proteins; four such hydrophobic helices were predicted by this treatment. Additional amphipathic helices may also be present. A remarkable feature of the sequence is the existence of two segments of high uncompensated charge density, one positive and the other negative. Possible organization of the protein in the membrane is discussed. Asymmetry in the amino acid composition of translated DNA sequences was used to distinguish between two possible initiation codons. The use of this method as a criterion for authentication of coding regions is described briefly in an Appendix. PMID:6090403

  3. Sequential gene promoter methylation during HPV-induced cervical carcinogenesis.

    PubMed

    Henken, F E; Wilting, S M; Overmeer, R M; van Rietschoten, J G I; Nygren, A O H; Errami, A; Schouten, J P; Meijer, C J L M; Snijders, P J F; Steenbergen, R D M

    2007-11-19

    We aimed to link DNA methylation events occurring in cervical carcinomas to distinct stages of HPV-induced transformation. Methylation specific-multiplex ligation-dependent probe amplification (MS-MLPA) analysis of cervical carcinomas revealed promoter methylation of 12 out of 29 tumour suppressor genes analysed, with MGMT being most frequently methylated (92%). Subsequently, consecutive stages of HPV16/18-transfected keratinocytes (n=11), ranging from pre-immortal to anchorage-independent phenotypes, were analysed by MS-MLPA. Whereas no methylation was evident in pre-immortal cells, progression to anchorage independence was associated with an accumulation of frequent methylation events involving five genes, all of which were also methylated in cervical carcinomas. TP73 and ESR1 methylation became manifest in early immortal cells followed by RARbeta and DAPK1 methylation in late immortal passages. Complementary methylation of MGMT was related to anchorage independence. Analysis of nine cervical cancer cell lines, representing the tumorigenic phenotype, revealed in addition to these five genes frequent methylation of CADM1, CDH13 and CHFR. In conclusion, eight recurrent methylation events in cervical carcinomas could be assigned to different stages of HPV-induced transformation. Hence, our in vitro model system provides a valuable tool to further functionally address the epigenetic alterations that are common in cervical carcinomas.

  4. Sequential gene